28

8885d_c28_1081-1119 2/12/04 2:28 PM Page 1081 mac76 mac76:385_reb:
chapter
28
REGULATION OF
GENE EXPRESSION
28.1 Principles of Gene Regulation 1082 proteinhemoglobinin erythrocytes. Given the high
28.2 Regulation of Gene Expression in Prokaryotes 1092 cost of protein synthesis, regulation of gene expression
is essential to making optimal use of available energy.
28.3 Regulation of Gene Expression in Eukaryotes 1102 The cellular concentration of a protein is deter-
mined by a delicate balance of at least seven processes,
each having several potential points of regulation:
The fundamental problem of chemical physiology and of
embryology is to understand why tissue cells do not all 1. Synthesis of the primary RNA transcript
express, all the time, all the potentialities inherent in their (transcription)
genome. 2. Posttranscriptional modification of mRNA
Franois Jacob and Jacques Monod, 3. Messenger RNA degradation
article in Journal of Molecular Biology, 1961
4. Protein synthesis (translation)
5. Posttranslational modification of proteins
f the 4,000 or so genes in the typical bacterial 6. Protein targeting and transport
O genome, or the perhaps 35,000 genes in the human
genome, only a fraction are expressed in a cell at any
7. Protein degradation
given time. Some gene products are present in very large These processes are summarized in Figure 281. We
amounts: the elongation factors required for protein have examined several of these mechanisms in previous
synthesis, for example, are among the most abundant chapters. Posttranscriptional modification of mRNA, by
proteins in bacteria, and ribulose 1,5-bisphosphate processes such as alternative splicing patterns (see
carboxylase/oxygenase (rubisco) of plants and photosyn- Fig. 2619b) or RNA editing (see Box 271), can affect
thetic bacteria is, as far as we know, the most abundant which proteins are produced from an mRNA transcript
enzyme in the biosphere. Other gene products occur in and in what amounts. A variety of nucleotide sequences
much smaller amounts; for instance, a cell may contain in an mRNA can affect the rate of its degradation (p.
only a few molecules of the enzymes that repair rare 1020). Many factors affect the rate at which an mRNA
DNA lesions. Requirements for some gene products is translated into a protein, as well as the posttransla-
change over time. The need for enzymes in certain meta- tional modification, targeting, and eventual degradation
bolic pathways may wax and wane as food sources of that protein (Chapter 27).
change or are depleted. During development of a mul- This chapter focuses primarily on the regulation of
ticellular organism, some proteins that influence cellu- transcription initiation, although aspects of posttran-
lar differentiation are present for just a brief time in only scriptional and translational regulation are also de-
a few cells. Specialization of cellular function can dra- scribed. Of the regulatory processes illustrated in Fig-
matically affect the need for various gene products; an ure 281, those operating at the level of transcription
example is the uniquely high concentration of a single initiation are the best documented and probably the most
1081
1082 Chapter 28 Regulation of Gene Expression
Gene of coordination occurs in the complex regulatory circuits

DNA that guide the development of multicellular eukaryotes,
which can involve many types of regulatory mechanisms.
Transcription We begin by examining the interactions between
proteins and DNA that are the key to transcriptional reg-
Primary ulation. We next discuss the specific proteins that in-
Nucleotides
transcript fluence the expression of specific genes, first in prokary-
otic and then in eukaryotic cells. Information about
Posttranscriptional
processing posttranscriptional and translational regulation is in-
mRNA cluded in the discussion, where relevant, to provide a
degradation
more complete overview of the rich complexity of reg-
Mature mRNA
ulatory mechanisms.
Translation
28.1 Principles of Gene Regulation
Genes for products that are required at all times, such
as those for the enzymes of central metabolic path-
Protein Amino acids
(inactive)
ways, are expressed at a more or less constant level in
virtually every cell of a species or organism. Such genes
are often referred to as housekeeping genes. Un-
varying expression of a gene is called constitutive
Posttranslational
gene expression.
processing Protein For other gene products, cellular levels rise and fall
degradation in response to molecular signals; this is regulated gene
expression. Gene products that increase in concen-
Modified tration under particular molecular circumstances are re-
protein ferred to as inducible; the process of increasing their
(active)
expression is induction. The expression of many of the
genes encoding DNA repair enzymes, for example, is in-
duced by high levels of DNA damage. Conversely, gene
Protein targeting products that decrease in concentration in response to
and transport a molecular signal are referred to as repressible, and
the process is called repression. For example, in bac-
FIGURE 281 Seven processes that affect the steady-state concen- teria, ample supplies of tryptophan lead to repression
tration of a protein. Each process has several potential points of of the genes for the enzymes that catalyze tryptophan
regulation. biosynthesis.
Transcription is mediated and regulated by protein-
DNA interactions, especially those involving the protein
common. As in all biochemical processes, an efficient
components of RNA polymerase (Chapter 26). We first
place for regulation is at the beginning of the pathway.
consider how the activity of RNA polymerase is regu-
Because synthesis of informational macromolecules is
lated, and proceed to a general description of the pro-
so extraordinarily expensive in terms of energy, elabo-
teins participating in this process. We then examine the
rate mechanisms have evolved to regulate the process.
molecular basis for the recognition of specific DNA se-
Researchers continue to discover complex and some-
quences by DNA-binding proteins.
times surprising regulatory mechanisms. Increasingly,
posttranscriptional and translational regulation are
RNA Polymerase Binds to DNA at Promoters
proving to be among the more important of these
processes, especially in eukaryotes. In fact, the regula- RNA polymerases bind to DNA and initiate transcrip-
tory processes themselves can involve a considerable in- tion at promoters (see Fig. 265), sites generally found
vestment of chemical energy. near points at which RNA synthesis begins on the DNA
Control of transcription initiation permits the syn- template. The regulation of transcription initiation of-
chronized regulation of multiple genes encoding prod- ten entails changes in how RNA polymerase interacts
ucts with interdependent activities. For example, when with a promoter.
their DNA is heavily damaged, bacterial cells require a The nucleotide sequences of promoters vary consid-
coordinated increase in the levels of the many DNA re- erably, affecting the binding affinity of RNA polymerases
pair enzymes. And perhaps the most sophisticated form and thus the frequency of transcription initiation. Some
28.1 Principles of Gene Regulation 1083
RNA start site

35 region 10 region
DNA 5 UP element TTGACA N17 TATAAT N59
mRNA
FIGURE 282 Consensus sequence for many E. coli promoters. Most are shown as they exist in the nontemplate strand, with the 5 termi-
base substitutions in the 10 and 35 regions have a negative effect nus on the left. Nucleotides are numbered from the transcription start
on promoter function. Some promoters also include the UP (upstream site, with positive numbers to the right (in the direction of transcrip-
promoter) element (see Fig. 265). By convention, DNA sequences tion) and negative numbers to the left. N indicates any nucleotide.
Escherichia coli genes are transcribed once per second, Transcription Initiation Is Regulated by Proteins That
others less than once per cell generation. Much of this Bind to or near Promoters
variation is due to differences in promoter sequence. In
the absence of regulatory proteins, differences in pro- At least three types of proteins regulate transcription
moter sequences may affect the frequency of transcrip- initiation by RNA polymerase: specificity factors alter
tion initiation by a factor of 1,000 or more. Most E. coli the specificity of RNA polymerase for a given promoter
promoters have a sequence close to a consensus (Fig. or set of promoters; repressors impede access of RNA
282). Mutations that result in a shift away from the con- polymerase to the promoter; and activators enhance
sensus sequence usually decrease promoter function; the RNA polymerasepromoter interaction.
conversely, mutations toward consensus usually enhance We introduced prokaryotic specificity factors in
promoter function. Chapter 26 (see Fig. 265), although we did not refer to
Although housekeeping genes are expressed con- them by that name. The subunit of the E. coli RNA
stitutively, the cellular concentrations of the proteins polymerase holoenzyme is a specificity factor that medi-
they encode vary widely. For these genes, the RNA ates promoter recognition and binding. Most E. coli pro-
polymerasepromoter interaction strongly influences moters are recognized by a single subunit (Mr 70,000),
the rate of transcription initiation; differences in pro- 70. Under some conditions, some of the 70 subunits are
moter sequence allow the cell to synthesize the appro- replaced by another specificity factor. One notable case
priate level of each housekeeping gene product. arises when the bacteria are subjected to heat stress,
The basal rate of transcription initiation at the pro- leading to the replacement of 70 by 32 (Mr 32,000).
moters of nonhousekeeping genes is also determined by When bound to 32, RNA polymerase is directed to a spe-
the promoter sequence, but expression of these genes cialized set of promoters with a different consensus
is further modulated by regulatory proteins. Many of sequence (Fig. 283). These promoters control the ex-
these proteins work by enhancing or interfering with the pression of a set of genes that encode the heat-shock
interaction between RNA polymerase and the promoter. response proteins. Thus, through changes in the binding
The sequences of eukaryotic promoters are more affinity of the polymerase that direct it to different pro-
variable than their prokaryotic counterparts (see moters, a set of genes involved in related processes is co-
Fig. 268). The three eukaryotic RNA polymerases usu- ordinately regulated. In eukaryotic cells, some of the gen-
ally require an array of general transcription factors in eral transcription factors, in particular the TATA-binding
order to bind to a promoter. Yet, as with prokaryotic protein (TBP; see Fig. 268), may be considered speci-
gene expression, the basal level of transcription is de- ficity factors.
termined by the effect of promoter sequences on the Repressors bind to specific sites on the DNA. In
function of RNA polymerase and its associated tran- prokaryotic cells, such binding sites, called operators,
scription factors. are generally near a promoter. RNA polymerase binding,
RNA start site
DNA 5 TNTCNCCCTTGAA N1315 CCCCATTTA N7
mRNA
FIGURE 283 Consensus sequence for promoters that regulate expression of the E. coli heat-
shock genes. This system responds to temperature increases as well as some other environmental
stresses, resulting in the induction of a set of proteins. Binding of RNA polymerase to heat-shock
promoters is mediated by a specialized subunit of the polymerase, 32, which replaces 70 in
the RNA polymerase initiation complex.
or its movement along the DNA after binding, is blocked ing the assembly or activity of a transcription complex
when the repressor is present. Regulation by means of at the promoter.
a repressor protein that blocks transcription is referred Activators provide a molecular counterpoint to re-
to as negative regulation. Repressor binding to DNA pressors; they bind to DNA and enhance the activity of
is regulated by a molecular signal (or effector), usually RNA polymerase at a promoter; this is positive regu-
a small molecule or a protein, that binds to the repres- lation. Activator binding sites are often adjacent to
sor and causes a conformational change. The interaction promoters that are bound weakly or not at all by RNA
between repressor and signal molecule either increases polymerase alone, such that little transcription occurs
or decreases transcription. In some cases, the confor- in the absence of the activator. Some eukaryotic acti-
mational change results in dissociation of a DNA-bound vators bind to DNA sites, called enhancers, that are
repressor from the operator (Fig. 284a). Transcription quite distant from the promoter, affecting the rate of
initiation can then proceed unhindered. In other cases, transcription at a promoter that may be located thou-
interaction between an inactive repressor and the signal sands of base pairs away. Some activators are normally
molecule causes the repressor to bind to the operator bound to DNA, enhancing transcription until dissociation
(Fig. 284b). In eukaryotic cells, the binding site for a of the activator is triggered by the binding of a signal
repressor may be some distance from the promoter; molecule (Fig. 284c). In other cases the activator binds
binding has the same effect as in bacterial cells: inhibit- to DNA only after interaction with a signal molecule
Negative regulation Positive regulation

(bound repressor inhibits transcription) (bound activator facilitates transcription)
(a) (c) RNA polymerase

Operator
DNA
Promoter
Molecular signal
causes dissociation
of regulatory protein 5 3
from DNA mRNA
Signal
molecule 5 3
mRNA
(b) (d)
Molecular signal
causes binding
of regulatory protein 5 3
to DNA mRNA
5 3
mRNA
FIGURE 284 Common patterns of regulation of transcription initi- lecular signal and transcription proceeds; when the signal is added,
ation. Two types of negative regulation are illustrated. (a) Repressor the activator dissociates and transcription is inhibited. (d) Activator
(pink) binds to the operator in the absence of the molecular signal; binds in the presence of the signal; it dissociates only when the sig-
the external signal causes dissociation of the repressor to permit tran- nal is removed. Note that positive and negative regulation refer to
scription. (b) Repressor binds in the presence of the signal; the re- the type of regulatory protein involved: the bound protein either fa-
pressor dissociates and transcription ensues when the signal is re- cilitates or inhibits transcription. In either case, addition of the mo-
moved. Positive regulation is mediated by gene activators. Again, two lecular signal may increase or decrease transcription, depending on
types are shown. (c) Activator (green) binds in the absence of the mo- its effect on the regulatory protein.
(Fig. 284d). Signal molecules can therefore increase or Lactose Galactoside permease
decrease transcription, depending on how they affect Outside
the activator. Positive regulation is particularly common
in eukaryotes, as we shall see.
Inside
Many Prokaryotic Genes Are Clustered and
Regulated in Operons
CH2OH CH2OH
Bacteria have a simple general mechanism for coordi- O O
nating the regulation of genes encoding products that HO H H H OH
participate in a set of related processes: these genes are O
OH H H OH H H
clustered on the chromosome and are transcribed to- H
gether. Many prokaryotic mRNAs are polycistronic
H OH H OH
multiple genes on a single transcriptand the single Lactose
promoter that initiates transcription of the cluster is the
site of regulation for expression of all the genes in the -galactosidase
cluster. The gene cluster and promoter, plus additional
sequences that function together in regulation, are
CH2OH
called an operon (Fig. 285). Operons that include two O
to six genes transcribed as a unit are common; some HO H O CH2
operons contain 20 or more genes. O
Many of the principles of prokaryotic gene expres- OH H H H
H OH
H
sion were first defined by studies of lactose metabolism
in E. coli, which can use lactose as its sole carbon source. H OH OH H H
HO
In 1960, Franois Jacob and Jacques Monod published
a short paper in the Proceedings of the French Acad- H OH
emy of Sciences that described how two adjacent genes Allolactose
involved in lactose metabolism were coordinately regu-
lated by a genetic element located at one end of the CH2OH CH2OH
gene cluster. The genes were those for -galactosidase, O O
which cleaves lactose to galactose and glucose, and HO H OH H H OH
galactoside permease, which transports lactose into the
OH H H HO OH H H
cell (Fig. 286). The terms operon and operator H
were first introduced in this paper. With the operon
H OH H OH
model, gene regulation could, for the first time, be con-
Galactose Glucose
sidered in molecular terms.
The lac Operon Is Subject to Negative Regulation FIGURE 286 Lactose metabolism in E. coli. Uptake and metabolism
The lactose (lac) operon (Fig. 287a) includes the of lactose require the activities of galactoside permease and -
genes for -galactosidase (Z), galactoside permease galactosidase. Conversion of lactose to allolactose by transglycosyla-
(Y ), and thiogalactoside transacetylase (A). The last of tion is a minor reaction also catalyzed by -galactosidase.
these enzymes appears to modify toxic galactosides to
facilitate their removal from the cell. Each of the three
genes is preceded by a ribosome binding site (not shown
in Fig. 287) that independently directs the translation
Repressor
Activator binding site
binding site (operator)
DNA Promoter A B C
Regulatory sequences Genes transcribed as a unit
FIGURE 285 Representative prokaryotic operon. Genes A, B, and

C are transcribed on one polycistronic mRNA. Typical regulatory se-
quences include binding sites for proteins that either activate or re-
press transcription from the promoter. Franois Jacob Jacques Monod, 19101976
Lac repressor
mRNA
(a) DNA PI I O3 P O1 Z O2 Y A Operators

(b)
(c) (d)
FIGURE 287 The lac operon. (a) The lac operon in the repressed discontinuous segments of DNA (blue). (d) Conformational change in
state. The I gene encodes the Lac repressor. The lac Z, Y, and A genes the Lac repressor caused by binding of the artificial inducer iso-
encode -galactosidase, galactoside permease, and thiogalactoside propylthiogalactoside, IPTG (derived from PDB ID 1LBH and 1LBG).
transacetylase, respectively. P is the promoter for the lac genes, and The structure of the tetrameric repressor is shown without IPTG bound
PI is the promoter for the I gene. O1 is the main operator for the lac (transparent image) and with IPTG bound (overlaid solid image; IPTG
operon; O2 and O3 are secondary operator sites of lesser affinity for not shown). The DNA bound when IPTG is absent (transparent struc-
the Lac repressor. (b) The Lac repressor binds to the main operator ture) is not shown. When IPTG is bound and DNA is not bound, the
and O2 or O3, apparently forming a loop in the DNA that might wrap repressors DNA-binding domains are too disordered to be defined in
around the repressor as shown. (c) Lac repressor bound to DNA (de- the crystal structure.
rived from PDB ID 1LBG). This shows the protein (gray) bound to short,
of that gene (Chapter 27). Regulation of the lac operon called the Lac repressor, a tetramer of identical
by the lac repressor protein (Lac) follows the pattern monomers. The operator to which it binds most tightly
outlined in Figure 284a. (O1) abuts the transcription start site (Fig. 287a). The
The study of lac operon mutants has revealed some I gene is transcribed from its own promoter (PI) inde-
details of the workings of the operons regulatory sys- pendent of the lac operon genes. The lac operon has
tem. In the absence of lactose, the lac operon genes are two secondary binding sites for the Lac repressor. One
repressed. Mutations in the operator or in another gene, (O2) is centered near position 410, within the gene
the I gene, result in constitutive synthesis of the gene encoding -galactosidase (Z); the other (O3) is near po-
products. When the I gene is defective, repression can sition 90, within the I gene. To repress the operon, the
be restored by introducing a functional I gene into the Lac repressor appears to bind to both the main opera-
cell on another DNA molecule, demonstrating that the tor and one of the two secondary sites, with the inter-
I gene encodes a diffusible molecule that causes gene vening DNA looped out (Fig. 287b, c). Either binding
repression. This molecule proved to be a protein, now arrangement blocks transcription initiation.
Despite this elaborate binding complex, repression An inducer that cannot be metabolized allows researchers
is not absolute. Binding of the Lac repressor reduces to explore the physiological function of lactose as a car-
the rate of transcription initiation by a factor of 103. If bon source for growth, separate from its function in the
the O2 and O3 sites are eliminated by deletion or muta- regulation of gene expression.
tion, the binding of repressor to O1 alone reduces tran- In addition to the multitude of operons now known
scription by a factor of about 102. Even in the repressed in bacteria, a few polycistronic operons have been found
state, each cell has a few molecules of -galactosidase in the cells of lower eukaryotes. In the cells of higher
and galactoside permease, presumably synthesized on eukaryotes, however, almost all protein-encoding genes
the rare occasions when the repressor transiently dis- are transcribed separately.
sociates from the operators. This basal level of tran- The mechanisms by which operons are regulated
scription is essential to operon regulation. can vary significantly from the simple model presented
When cells are provided with lactose, the lac operon in Figure 287. Even the lac operon is more complex
is induced. An inducer (signal) molecule binds to a spe- than indicated here, with an activator also contributing
cific site on the Lac repressor, causing a conformational to the overall scheme, as we shall see in Section 28.2.
change (Fig. 287d) that results in dissociation of the Before any further discussion of the layers of regulation
repressor from the operator. The inducer in the lac of gene expression, however, we examine the critical
operon system is not lactose itself but allolactose, an molecular interactions between DNA-binding proteins
isomer of lactose (Fig. 286). After entry into the E. (such as repressors and activators) and the DNA se-
coli cell (via the few existing molecules of permease), quences to which they bind.
lactose is converted to allolactose by one of the few ex-
isting -galactosidase molecules. Release of the opera- Regulatory Proteins Have Discrete
tor by Lac repressor, triggered as the repressor binds to DNA-Binding Domains
allolactose, allows expression of the lac operon genes
and leads to a 103-fold increase in the concentration of Regulatory proteins generally bind to specific DNA se-
-galactosidase. quences. Their affinity for these target sequences is
Several -galactosides structurally related to allo- roughly 104 to 106 times higher than their affinity for
lactose are inducers of the lac operon but are not sub- any other DNA sequences. Most regulatory proteins
strates for -galactosidase; others are substrates but not have discrete DNA-binding domains containing sub-
inducers. One particularly effective and nonmetaboliz- structures that interact closely and specifically with the
able inducer of the lac operon that is often used ex- DNA. These binding domains usually include one or
perimentally is isopropylthiogalactoside (IPTG): more of a relatively small group of recognizable and
characteristic structural motifs.
CH2OH CH3 To bind specifically to DNA sequences, regulatory
OH O proteins must recognize surface features on the DNA.
S C H
H Most of the chemical groups that differ among the four
OH H CH3 bases and thus permit discrimination between base pairs
H H
are hydrogen-bond donor and acceptor groups exposed
H OH in the major groove of DNA (Fig. 288), and most of the
Isopropylthiogalactoside protein-DNA contacts that impart specificity are hydro-
(IPTG) gen bonds. A notable exception is the nonpolar surface
Major groove Major groove Major groove Major groove
H H
H CH3 CH3 O H
H O H N H N H
N O N O
5
N N N N
6 N H N N N
1 N H N N N N H N N H N
N N N N
N O N O O N O N
N H H N
H H
Minor groove Minor groove Minor groove Minor groove
Adenine Thymine Guanine Cytosine Thymine Adenine Cytosine Guanine
FIGURE 288 Groups in DNA available for protein binding. Shown the major and minor grooves of DNA. Groups that can be used for
here are functional groups on all four base pairs that are displayed in base-pair recognition by proteins are shown in red.
H O To interact with bases in the major groove of DNA,

R N C C R a protein requires a relatively small structure that can
H O stably protrude from the protein surface. The DNA-
H CH2
R N C C R Arginine binding domains of regulatory proteins tend to be small
Glutamine CH2
(or asparagine) H CH2 (60 to 90 amino acid residues), and the structural mo-
CH2 tifs within these domains that are actually in contact
CH2
NH with the DNA are smaller still. Many small proteins are
C
O H N C unstable because of their limited capacity to form lay-
N
H H
N H ers of structure to bury hydrophobic groups (p. 118).
CH3 H H H
O H
N N H The DNA-binding motifs provide either a very compact
N H O
N 6 7 N stable structure or a way of allowing a segment of pro-
N H
N N 6 7 tein to protrude from the protein surface.
N H
N N
O N N The DNA-binding sites for regulatory proteins are
O H N
N often inverted repeats of a short DNA sequence (a palin-
H drome) at which multiple (usually two) subunits of a
Thymine Adenine Cytosine Guanine regulatory protein bind cooperatively. The Lac repres-
sor is unusual in that it functions as a tetramer, with two
FIGURE 289 Two examples of specific amino acidbase pair inter- dimers tethered together at the end distant from the
actions that have been observed in DNA-protein binding. DNA-binding sites (Fig. 287b). An E. coli cell normally
contains about 20 tetramers of the Lac repressor. Each
of the tethered dimers separately binds to a palindromic
near C-5 of pyrimidines, where thymine is readily dis- operator sequence, in contact with 17 bp of a 22 bp re-
tinguished from cytosine by its protruding methyl group. gion in the lac operon (Fig. 2810). And each of the
Protein-DNA contacts are also possible in the minor tethered dimers can independently bind to an operator
groove of the DNA, but the hydrogen-bonding patterns sequence, with one generally binding to O1 and the other
here generally do not allow ready discrimination be- to O2 or O3 (as in Fig. 287b). The symmetry of the O1
tween base pairs. operator sequence corresponds to the twofold axis of
Within regulatory proteins, the amino acid side symmetry of two paired Lac repressor subunits. The
chains most often hydrogen-bonding to bases in the tetrameric Lac repressor binds to its operator sequences
DNA are those of Asn, Gln, Glu, Lys, and Arg residues. in vivo with an estimated dissociation constant of about
Is there a simple recognition code in which a particular 1010 M. The repressor discriminates between the op-
amino acid always pairs with a particular base? The two erators and other sequences by a factor of about 106, so
hydrogen bonds that can form between Gln or Asn and binding to these few base pairs among the 4.6 million
the N 6 and N-7 positions of adenine cannot form with or so of the E. coli chromosome is highly specific.
any other base. And an Arg residue can form two hy- Several DNA-binding motifs have been described,
drogen bonds with N-7 and O6 of guanine (Fig. 289). but here we focus on two that play prominent roles in
Examination of the structures of many DNA-binding the binding of DNA by regulatory proteins: the helix-
proteins, however, has shown that a protein can recog- turn-helix and the zinc finger. We also consider a type
nize each base pair in more than one way, leading to the of DNA-binding domainthe homeodomainfound in
conclusion that there is no simple amino acidbase code. some eukaryotic proteins.
For some proteins, the Gln-adenine interaction can
specify AUT base pairs, but in others a van der Waals Helix-Turn-Helix This DNA-binding motif is crucial to the
pocket for the methyl group of thymine can recognize interaction of many prokaryotic regulatory proteins with
AUT base pairs. Researchers cannot yet examine the DNA, and similar motifs occur in some eukaryotic reg-
structure of a DNA-binding protein and infer the DNA ulatory proteins. The helix-turn-helix motif comprises
sequence to which it binds. about 20 amino acids in two short -helical segments,
Promoter
(bound by RNA polymerase) RNA start site
DNA TAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCAC
35 region 10 region
Operator
FIGURE 2810 Relationship between the lac operator sequence O1 (bound by Lac repressor)
and the lac promoter. The bases shaded beige exhibit twofold (palin-
dromic) symmetry about the axis indicated by the dashed vertical line. mRNA
each seven to nine amino acid residues long, separated interact with the DNA in a sequence-specific way. This
by a turn (Fig. 2811). This structure generally is not helix is stacked on other segments of the protein
stable by itself; it is simply the reactive portion of a structure so that it protrudes from the protein surface.
somewhat larger DNA-binding domain. One of the two When bound to DNA, the recognition helix is positioned
-helical segments is called the recognition helix, be- in or nearly in the major groove. The Lac repressor has
cause it usually contains many of the amino acids that this DNA-binding motif (Fig. 2811).
(a) (b)
(c) (d)
FIGURE 2811 Helix-turn-helix. (a) DNA-binding domain of the Lac DNA-binding domain of the Lac repressor (gray) bound to DNA (blue).
repressor (PDB ID 1LCC). The helix-turn-helix motif is shown in red (d) The same DNA-binding domain as in (c), but separated from the
and orange; the DNA recognition helix is red. (b) Entire Lac repres- DNA, with the binding interaction surfaces shown. Some groups on
sor (derived from PDB ID 1LBG). The DNA-binding domains are gray, the protein and DNA that interact through hydrogen-bonding are
and the helices involved in tetramerization are red. The remainder shown in red; some groups that interact through hydrophobic inter-
of the protein (shades of green) has the binding sites for allolactose. actions are in orange. This model shows only a few of the groups in-
The allolactose-binding domains are linked to the DNA-binding do- volved in sequence recognition. The complementary nature of the two
mains through linker helices (yellow). (c) Surface rendering of the surfaces is evident.
Zinc Finger In a zinc finger, about 30 amino acid

residues form an elongated loop held together at the
base by a single Zn2 ion, which is coordinated to four
of the residues (four Cys, or two Cys and two His). The
zinc does not itself interact with DNA; rather, the coor-
dination of zinc with the amino acid residues stabilizes
this small structural motif. Several hydrophobic side
chains in the core of the structure also lend stability.
Figure 2812 shows the interaction between DNA and
three zinc fingers of a single polypeptide from the mouse
regulatory protein Zif268.
Many eukaryotic DNA-binding proteins contain zinc
fingers. The interaction of a single zinc finger with DNA
is typically weak, and many DNA-binding proteins, like
Zif268, have multiple zinc fingers that substantially en-
hance binding by interacting simultaneously with the
DNA. One DNA-binding protein of the frog Xenopus has
37 zinc fingers. There are few known examples of the
zinc finger motif in prokaryotic proteins.
The precise manner in which proteins with zinc fin-
gers bind to DNA differs from one protein to the next.
Some zinc fingers contain the amino acid residues that FIGURE 2813 Homeodomain. Shown here is a homeodomain
are important in sequence discrimination, whereas oth- bound to DNA; one of the helices (red), stacked on two others, can
ers appear to bind DNA nonspecifically (the amino acids be seen protruding into the major groove (PDB ID 1B8I). This is only
required for specificity are located elsewhere in the a small part of the much larger protein Ultrabithorax (Ubx), active in
protein). Zinc fingers can also function as RNA-binding the regulation of development in fruit flies.
motifsfor example, in certain proteins that bind eu-
karyotic mRNAs and act as translational repressors. We
discuss this role later (Section 28.3).
development. This domain of 60 amino acidscalled the
Homeodomain Another type of DNA-binding domain has homeodomain, because it was discovered in homeotic
been identified in a number of proteins that function as genes (genes that regulate the development of body pat-
transcriptional regulators, especially during eukaryotic terns)is highly conserved and has now been identified
in proteins from a wide variety of organisms, including
humans (Fig. 2813). The DNA-binding segment of the
domain is related to the helix-turn-helix motif. The DNA
sequence that encodes this domain is known as the
homeobox.
Regulatory Proteins Also Have Protein-Protein

Interaction Domains
Regulatory proteins contain domains not only for DNA
binding but also for protein-protein interactionswith
RNA polymerase, other regulatory proteins, or other sub-
units of the same regulatory protein. Examples include
many eukaryotic transcription factors that function as
gene activators, which often bind as dimers to the DNA,
using DNA-binding domains that contain zinc fingers.
Some structural domains are devoted to the interactions
required for dimer formation, which is generally a pre-
requisite for DNA binding. Like DNA-binding motifs, the
FIGURE 2812 Zinc fingers. Three zinc fingers (gray) of the regula- structural motifs that mediate protein-protein interac-
tory protein Zif268, complexed with DNA (blue and white) (PDB ID tions tend to fall within one of a few common categories.
1A1L). Each Zn2 (maroon) coordinates with two His and two Cys Two important examples are the leucine zipper and
residues (not shown). the basic helix-loop-helix. Structural motifs such as
these are the basis for classifying some regulatory pro- in the control of gene expression during the develop-
teins into structural families. ment of multicellular organisms. These proteins share a
conserved region of about 50 amino acid residues im-
Leucine Zipper This motif is an amphipathic helix with portant in both DNA binding and protein dimerization.
a series of hydrophobic amino acid residues concen- This region can form two short amphipathic helices
trated on one side (Fig. 2814), with the hydrophobic linked by a loop of variable length, the helix-loop-helix
surface forming the area of contact between the two (distinct from the helix-turn-helix motif associated
polypeptides of a dimer. A striking feature of these with DNA binding). The helix-loop-helix motifs of two
helices is the occurrence of Leu residues at every polypeptides interact to form dimers (Fig. 2815). In
seventh position, forming a straight line along the these proteins, DNA binding is mediated by an adjacent
hydrophobic surface. Although researchers initially short amino acid sequence rich in basic residues, simi-
thought the Leu residues interdigitated (hence the lar to the separate DNA-binding region in proteins con-
name zipper), we now know that they line up side by taining leucine zippers.
side as the interacting helices coil around each other
(forming a coiled coil; Fig. 2814b). Regulatory proteins Subunit Mixing in Eukaryotic Regulatory Proteins Several
with leucine zippers often have a separate DNA-binding families of eukaryotic transcription factors have been
domain with a high concentration of basic (Lys or Arg) defined based on close structural similarities. Within
residues that can interact with the negatively charged each family, dimers can sometimes form between two
phosphates of the DNA backbone. Leucine zippers have identical proteins (a homodimer) or between two dif-
been found in many eukaryotic and a few prokaryotic ferent members of the family (a heterodimer). A hypo-
proteins. thetical family of four different leucine-zipper proteins
could thus form up to ten different dimeric species. In
Basic Helix-Loop-Helix Another common structural motif many cases, the different combinations appear to have
occurs in some eukaryotic regulatory proteins implicated distinct regulatory and functional properties.
Regulatory
Source protein Amino acid sequence
6 Amino acid
DNA-binding region connector Leucine zipper
C/EBP D KN S N E Y R V R R E R NN I A V R K S R D K A K Q R N V E T Q Q K V L E L T S DND R L R K R V E Q L S R E L D T L R G
Mammal Jun S Q E R I K A E R K R M R N R I A A S K C R K R K L E R I A R L E E K V K T L K A Q N S E L A S T A NM L T E Q V A Q L K Q
Fos E E R R R I R R I R R E R N KM A A A K C R N R R R E L T D T L Q A E T D Q L E D K K S A L Q T E I A N L L K E K E K L E F
Yeast GCN4 P E S S D P A A L K R A R N T E A A R R S R A R K L Q R MK Q L E D K V E E L L S K N Y H L E N E V A R L K K L V G E R
Consensus RR R R RR
N R L L L L L
molecule
KK K K KK
(a) Invariant Asn
FIGURE 2814 Leucine zippers. (a) Comparison of

amino acid sequences of several leucine zipper
proteins. Note the Leu (L) residues at every seventh
position in the zipper region, and the number of Lys
(K) and Arg (R) residues in the DNA-binding region.
(b) Leucine zipper from the yeast activator protein
GCN4 (PDB ID 1YSA). Only the zippered helices
(gray and light blue), derived from different subunits of
the dimeric protein, are shown. The two helices wrap
around each other in a gently coiled coil. The inter-
acting Leu residues are shown in red.
Zipper
region
(b)
(negative regulation) or activate transcription

(positive regulation) at specific promoters.
In bacteria, genes that encode products with
interdependent functions are often clustered in
an operon, a single transcriptional unit.
Transcription of the genes is generally blocked
by binding of a specific repressor protein at a
DNA site called an operator. Dissociation of the
repressor from the operator is mediated by a
specific small molecule, an inducer. These
principles were first elucidated in studies of the
lactose (lac) operon. The Lac repressor
dissociates from the lac operator when the
repressor binds to its inducer, allolactose.
Regulatory proteins are DNA-binding proteins
that recognize specific DNA sequences; most
have distinct DNA-binding domains. Within
these domains, common structural motifs that
bind DNA are the helix-turn-helix, zinc finger,
FIGURE 2815 Helix-loop-helix. The human transcription factor Max, and homeodomain.
bound to its DNA target site (PDB ID 1HLO). The protein is dimeric; Regulatory proteins also contain domains for
one subunit is colored. The DNA-binding segment (pink) merges with protein-protein interactions, including the
the first helix of the helix-loop-helix (red). The second helix merges leucine zipper and helix-loop-helix, which are
with the carboxyl-terminal end of the subunit (purple). Interaction of involved in dimerization, and other motifs
the carboxyl-terminal helices of the two subunits describes a coiled
involved in activation of transcription.
coil very similar to that of a leucine zipper (see Fig. 2814b), but with
only one pair of interacting Leu residues (red side chains near the top)
in this particular example. The overall structure is sometimes called a 28.2 Regulation of Gene Expression
helix-loop-helix/leucine zipper motif.
in Prokaryotes
As in many other areas of biochemical investigation, the
study of the regulation of gene expression advanced ear-
In addition to structural domains devoted to DNA lier and faster in bacteria than in other experimental or-
binding and dimerization (or oligomerization), many ganisms. The examples of bacterial gene regulation pre-
regulatory proteins must interact with RNA polymerase, sented here are chosen from among scores of
with unrelated regulatory proteins, or with both. At least well-studied systems, partly for their historical signifi-
three different types of additional domains for protein- cance, but primarily because they provide a good
protein interaction have been characterized (primarily overview of the range of regulatory mechanisms em-
in eukaryotes): glutamine-rich, proline-rich, and acidic ployed in prokaryotes. Many of the principles of prokary-
domains, the names reflecting the amino acid residues otic gene regulation are also relevant to understanding
that are especially abundant. gene expression in eukaryotic cells.
Protein-DNA binding interactions are the basis of We begin by examining the lactose and tryptophan
the intricate regulatory circuits fundamental to gene operons; each system has regulatory proteins, but the
function. We now turn to a closer examination of these overall mechanisms of regulation are very different. This
gene regulatory schemes, first in prokaryotic, then in is followed by a short discussion of the SOS response in
eukaryotic systems. E. coli, illustrating how genes scattered throughout the
genome can be coordinately regulated. We then describe
SUMMARY 28.1 Principles of Gene Regulation two prokaryotic systems of quite different types, illus-
trating the diversity of gene regulatory mechanisms:
The expression of genes is regulated by regulation of ribosomal protein synthesis at the level of
processes that affect the rates at which gene translation, with many of the regulatory proteins bind-
products are synthesized and degraded. Much ing to RNA (rather than DNA), and regulation of a
of this regulation occurs at the level of process called phase variation in Salmonella, which re-
transcription initiation, mediated by regulatory sults from genetic recombination. First, we return to the
proteins that either repress transcription lac operon to examine its features in greater detail.
28.2 Regulation of Gene Expression in Prokaryotes 1093
The lac Operon Undergoes Positive Regulation

The operator-repressor-inducer interactions described
earlier for the lac operon (Fig. 287) provide an intu-
itively satisfying model for an on/off switch in the reg-
ulation of gene expression. In truth, operon regulation
is rarely so simple. A bacteriums environment is too
complex for its genes to be controlled by one signal.
Other factors besides lactose affect the expression of
the lac genes, such as the availability of glucose. Glu-
cose, metabolized directly by glycolysis, is E. colis pre-
ferred energy source. Other sugars can serve as the main
or sole nutrient, but extra steps are required to prepare
them for entry into glycolysis, necessitating the syn-
thesis of additional enzymes. Clearly, expressing the
genes for proteins that metabolize sugars such as lac-
tose or arabinose is wasteful when glucose is abundant.
What happens to the expression of the lac operon
when both glucose and lactose are present? A regula- FIGURE 2816 CRP homodimer. (PDB ID 1RUN) Bound molecules
tory mechanism known as catabolite repression re- of cAMP are shown in red. Note the bending of the DNA around the
stricts expression of the genes required for catabolism protein. The region that interacts with RNA polymerase is shaded
of lactose, arabinose, and other sugars in the presence yellow.
of glucose, even when these secondary sugars are also
present. The effect of glucose is mediated by cAMP, as
a coactivator, and an activator protein known as cAMP
receptor protein, or CRP (the protein is sometimes cert. CRP-cAMP has little effect on the lac operon when
called CAP, for catabolite gene activator protein). CRP the Lac repressor is blocking transcription, and dissoci-
is a homodimer (subunit Mr 22,000) with binding sites ation of the repressor from the lac operator has little
for DNA and cAMP. Binding is mediated by a helix-turn- effect on transcription of the lac operon unless CRP-
helix motif within the proteins DNA-binding domain cAMP is present to facilitate transcription; when CRP is
(Fig. 2816). When glucose is absent, CRP-cAMP binds not bound, the wild-type lac promoter is a relatively
to a site near the lac promoter (Fig. 2817a) and stim- weak promoter (Fig. 2817b). The open complex of
ulates RNA transcription 50-fold. CRP-cAMP is there- RNA polymerase and the promoter (see Fig. 266) does
fore a positive regulatory element responsive to glucose not form readily unless CRP-cAMP is present. CRP inter-
levels, whereas the Lac repressor is a negative regula- acts directly with RNA polymerase (at the region shown
tory element responsive to lactose. The two act in con- in Fig. 2816) through the polymerases subunit.
CRP site Bound by RNA polymerase 5 3 mRNA
DNA 5 ATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACAC
35 region 10 region Operator
(a)
lac promoter TTTACA TATGTT

35 region 10 region
Promoter TTGACA TATAAT

consensus sequence
(b)
FIGURE 2817 Activation of transcription of the lac operon by CRP. the lac promoter compared with the promoter consensus sequence.
(a) The binding site for CRP-cAMP is near the promoter. As in the case The differences mean that RNA polymerase binds relatively weakly to
of the lac operator, the CRP site has twofold symmetry (bases shaded the lac promoter until the polymerase is activated by CRP-cAMP.
beige) about the axis indicated by the dashed line. (b) Sequence of
(a) cAMP Lac RNA polymerase

CRP repressor
bound
Low Lactose
glucose
(high cAMP)
Lac
CRP site Promoter repressor
(b)
High Lactose
glucose
(low cAMP)
Lac
repressor
FIGURE 2818 Combined effects of glucose and lactose on expression of the lac operon. (a) High
levels of transcription take place only when glucose concentrations are low (so cAMP levels are high
and CRP-cAMP is bound) and lactose concentrations are high (so the Lac repressor is not bound).
(b) Without bound activator (CRP-cAMP), the lac promoter is poorly transcribed even when lactose
concentrations are high and the Lac repressor is not bound.
The effect of glucose on CRP is mediated by the thetic enzymes are not needed and the operon is
cAMP interaction (Fig. 2818). CRP binds to DNA most repressed.
avidly when cAMP concentrations are high. In the pres- The E. coli tryptophan (trp) operon (Fig. 2819)
ence of glucose, the synthesis of cAMP is inhibited and includes five genes for the enzymes required to convert
efflux of cAMP from the cell is stimulated. As [cAMP] chorismate to tryptophan. Note that two of the enzymes
declines, CRP binding to DNA declines, thereby de- catalyze more than one step in the pathway. The mRNA
creasing the expression of the lac operon. Strong in- from the trp operon has a half-life of only about 3 min,
duction of the lac operon therefore requires both lac- allowing the cell to respond rapidly to changing needs
tose (to inactivate the lac repressor) and a lowered for this amino acid. The Trp repressor is a homodimer,
concentration of glucose (to trigger an increase in each subunit containing 107 amino acid residues (Fig.
[cAMP] and increased binding of cAMP to CRP). 2820). When tryptophan is abundant it binds to the
CRP and cAMP are involved in the coordinated reg- Trp repressor, causing a conformational change that
ulation of many operons, primarily those that encode permits the repressor to bind to the trp operator and
enzymes for the metabolism of secondary sugars such inhibit expression of the trp operon. The trp operator
as lactose and arabinose. A network of operons with a site overlaps the promoter, so binding of the repressor
common regulator is called a regulon. This arrange- blocks binding of RNA polymerase.
ment, which allows for coordinated shifts in cellular Once again, this simple on/off circuit mediated by a
functions that can require the action of hundreds of repressor is not the entire regulatory story. Different
genes, is a major theme in the regulated expression of cellular concentrations of tryptophan can vary the rate
dispersed networks of genes in eukaryotes. Other bac- of synthesis of the biosynthetic enzymes over a 700-fold
terial regulons include the heat-shock gene system that range. Once repression is lifted and transcription be-
responds to changes in temperature (p. 1083) and the gins, the rate of transcription is fine-tuned by a second
genes induced in E. coli as part of the SOS response to regulatory process, called transcription attenuation,
DNA damage, described later. in which transcription is initiated normally but is
abruptly halted before the operon genes are transcribed.
Many Genes for Amino Acid Biosynthetic Enzymes Are The frequency with which transcription is attenuated is
regulated by the availability of tryptophan and relies on
Regulated by Transcription Attenuation
the very close coupling of transcription and translation
The 20 common amino acids are required in large in bacteria.
amounts for protein synthesis, and E. coli can synthe- The trp operon attenuation mechanism uses signals
size all of them. The genes for the enzymes needed to encoded in four sequences within a 162 nucleotide
synthesize a given amino acid are generally clustered in leader region at the 5 end of the mRNA, preceding the
an operon and are expressed whenever existing supplies initiation codon of the first gene (Fig. 2821a). Within
of that amino acid are inadequate for cellular require- the leader lies a region known as the attenuator, made
ments. When the amino acid is abundant, the biosyn- up of sequences 3 and 4. These sequences base-pair to
Trp
repressor
Trp FIGURE 2819 The trp operon. This operon is regulated by two
mechanisms: when tryptophan levels are high, (1) the repressor
(upper left) binds to its operator and (2) transcription of trp mRNA
is attenuated (see Fig. 2821). The biosynthesis of tryptophan by the
enzymes encoded in the trp operon is diagrammed at the bottom
(see also Fig. 2217).
Attenuator
Leader (trpL)
DNA trpR P O trpE trpD trpC trpB trpA
Regulatory region Regulated genes
trp mRNA
(low tryptophan levels)
Attenuated
mRNA
(high tryptophan levels)
Anthranilate Anthranilate Tryptophan Tryptophan

synthase, synthase, synthase, synthase,
component I component II subunit subunit
Anthranilate N-(5-Phosphoribosyl)- Tryptophan synthase

synthase anthranilate isomerase ( 22)
(I2, II2) Indole-3-glycerol
phosphate synthase
Chorismate Anthranilate N-(5-Phosphoribosyl)- Enol-1-o-carboxy- Indole-3-glycerol L-Tryptophan

anthranilate phenylamino- phosphate
Glutamine Glutamate PRPP PPi 1-deoxyribulose CO2
phosphate Glyceraldehyde L-Serine
Pyruvate H2O 3-phosphate
form a GqC-rich stem-and-loop structure closely fol-

lowed by a series of U residues. The attenuator struc-
ture acts as a transcription terminator (Fig. 2821b).
Sequence 2 is an alternative complement for sequence
3 (Fig. 2821c). If sequences 2 and 3 base-pair, the at-
tenuator structure cannot form and transcription con-
tinues into the trp biosynthetic genes; the loop formed
by the pairing of sequences 2 and 3 does not obstruct
transcription.
Regulatory sequence 1 is crucial for a tryptophan-
sensitive mechanism that determines whether sequence
3 pairs with sequence 2 (allowing transcription to con-
tinue) or with sequence 4 (attenuating transcription).
Formation of the attenuator stem-and-loop structure
depends on events that occur during translation of reg-
ulatory sequence 1, which encodes a leader peptide (so
called because it is encoded by the leader region of the
FIGURE 2820 Trp repressor. The repressor is a dimer, with both sub- mRNA) of 14 amino acids, two of which are Trp residues.
units (gray and light blue) binding the DNA at helix-turn-helix motifs The leader peptide has no other known cellular func-
(PDB ID 1TRO). Bound molecules of tryptophan are in red. tion; its synthesis is simply an operon regulatory device.
8885d_c28_1096 2/19/04 6:13 AM Page 1096 mac76 mac76:385_reb:
Leader peptide
Met Lys Ala Ile Phe Val Le
u
mRNA pppAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACU
GA
Lys
AA
1
G
G
CGAAAUGCGUACCACUUAUGUGACGGGCAAAGUCCUUCACGCGGUGG U U ly
AA 2 (stop) Ser Thr Arg Trp Trp G
ACU
139 162
G
A
U A CCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAACAAUGCAAACA
3 4 Met Gln Thr
TrpE polypeptide
Site of
transcription End of leader
attenuation region (trpL)
(a)
Completed
Attenuator A
leader U
structure A
A
peptide U
Ribosome A UG
M KAIFVLK U
C
C GG
A
G C A
G C
C G
W
3 4 RNA C G
W
G C
polymerase C G
RT
1 2 C G
C G
C G
S
5 UUUU 3 G C
C G
mRNA A U
G CU
C UUUUU
AGAUACC A U
DNA C U UUUUU
AGAUACC
Trp codons 110
110
trpL 3:4 Pair
(attenuator)
3:4 Pair
When tryptophan levels are high, the ribosome quickly translates (attenuator)
sequence 1 (open reading frame encoding leader peptide) and blocks
sequence 2 before sequence 3 is transcribed. Continued transcription
leads to attenuation at the terminator-like attenuator structure
A
formed by sequences 3 and 4.
UA A
G A
U A
GC GA
100
G C 100
C G
U A
G C
A A
Incomplete 90 U A
C U
leader peptide CA AC
90 C U
M CA AC
KA C G
AU AA
IF
2 3 UC G
A U
VL
U A
U U A 110
KG
trp-regulated genes A U
1 U C
G A 110
5 U C
80 GG CC
4 U
A
C
A
80 G
C G
C
trpL DNA AG CA
C G
G C
G C
G C
G
C G C
When tryptophan levels are low, the ribosome pauses at the AG CC
Trp codons in sequence 1. Formation of the paired structure A C G C
A C U
between sequences 2 and 3 prevents attenuation, because A C
sequence 3 is no longer available to form the attenuator U
structure with sequence 4. The 2:3 structure, unlike the 2:3 Pair
3:4 attenuator, does not prevent transcription. 2:3 Pair
(b) (c)
(c)
FIGURE 2821 Transcriptional attenuation in the trp operon. Tran- 3 are complementary, as are sequences 3 and 4. The attenuator struc-
scription is initiated at the beginning of the 162 nucleotide mRNA ture forms by the pairing of sequences 3 and 4 (top). Its structure and
leader encoded by a DNA region called trpL (see Fig. 28-19). A reg- function are similar to those of a transcription terminator (see Fig.
ulatory mechanism determines whether transcription is attenuated at 267). Pairing of sequences 2 and 3 (bottom) prevents the attenuator
the end of the leader or continues into the structural genes. (a) The structure from forming. Note that the leader peptide has no other cel-
trp mRNA leader (trpL). The attenuation mechanism in the trp operon lular function. Translation of its open reading frame has a purely reg-
involves sequences 1 to 4 (highlighted). (b) Sequence 1 encodes a ulatory role that determines which complementary sequences (2 and
small peptide, the leader peptide, containing two Trp residues (W); it 3 or 3 and 4) are paired. (c) Base-pairing schemes for the comple-
is translated immediately after transcription begins. Sequences 2 and mentary regions of the trp mRNA leader.
This peptide is translated immediately after it is tran- 15 amino acid leader peptide produced by the phe
scribed, by a ribosome that follows closely behind RNA operon contains seven Phe residues. The leu operon
polymerase as transcription proceeds. leader peptide has four contiguous Leu residues. The
When tryptophan concentrations are high, concen- leader peptide for the his operon contains seven con-
trations of charged tryptophan tRNA (Trp-tRNATrp) are tiguous His residues. In fact, in the his operon and a
also high. This allows translation to proceed rapidly past number of others, attenuation is sufficiently sensitive to
the two Trp codons of sequence 1 and into sequence 2, be the only regulatory mechanism.
before sequence 3 is synthesized by RNA polymerase.
In this situation, sequence 2 is covered by the ribosome Induction of the SOS Response Requires Destruction
and unavailable for pairing to sequence 3 when se-
of Repressor Proteins
quence 3 is synthesized; the attenuator structure (se-
quences 3 and 4) forms and transcription halts (Fig. Extensive DNA damage in the bacterial chromosome
2821b, top). When tryptophan concentrations are low, triggers the induction of many distantly located genes.
however, the ribosome stalls at the two Trp codons in This response, called the SOS response (p. 976), pro-
sequence 1, because charged tRNATrp is less available. vides another good example of coordinated gene regu-
Sequence 2 remains free while sequence 3 is synthe- lation. Many of the induced genes are involved in DNA
sized, allowing these two sequences to base-pair and repair (see Table 256). The key regulatory proteins are
permitting transcription to proceed (Fig. 2821b, bot- the RecA protein and the LexA repressor.
tom). In this way, the proportion of transcripts that The LexA repressor (Mr 22,700) inhibits transcrip-
are attenuated declines as tryptophan concentration tion of all the SOS genes (Fig. 2822), and induction
declines. of the SOS response requires removal of LexA. This is
Many other amino acid biosynthetic operons use a not a simple dissociation from DNA in response to bind-
similar attenuation strategy to fine-tune biosynthetic en- ing of a small molecule, as in the regulation of the lac
zymes to meet the prevailing cellular requirements. The operon described above. Instead, the LexA repressor is
E. coli chromosome
polB dinB uvrB
uvrA sulA
RecA
LexA protein
repressor 1 Damage to
DNA produces
dinF umuC,D
single-strand gap.
FIGURE 2822 SOS response in E. coli. See Table

lexA recA
Replication 256 for the functions of many of these proteins.
The LexA protein is the repressor in this system,
which has an operator site (red) near each gene.
Because the recA gene is not entirely repressed by
polB dinB uvrB the LexA repressor, the normal cell contains about
1,000 RecA monomers. 1 When DNA is exten-
sively damaged (e.g., by UV light), DNA replication
uvrA sulA is halted and the number of single-strand gaps in
3 LexA repressor is inactivated the DNA increases. 2 RecA protein binds to this
activated damaged, single-stranded DNA, activating the
proteolysis proteins coprotease activity. 3 While bound to
2 RecA binds to DNA, the RecA protein facilitates cleavage and
dinF single-stranded DNA. umuC,D inactivation of the LexA repressor. When the
repressor is inactivated, the SOS genes, including
recA, are induced; RecA levels increase 50- to
lexA recA 100-fold.
inactivated when it catalyzes its own cleavage at a spe- transcribed from that operon and blocks translation of
cific AlaGly peptide bond, producing two roughly all the genes the messenger encodes (Fig. 2823). In
equal protein fragments. At physiological pH, this au- general, the r-protein that plays the role of repressor
tocleavage reaction requires the RecA protein. RecA is also binds directly to an rRNA. Each translational re-
not a protease in the classical sense, but its interaction pressor r-protein binds with higher affinity to the ap-
with LexA facilitates the repressors self-cleavage reac- propriate rRNA than to its mRNA, so the mRNA is bound
tion. This function of RecA is sometimes called a co- and translation repressed only when the level of the
protease activity. r-protein exceeds that of the rRNA. This ensures that
The RecA protein provides the functional link be- translation of the mRNAs encoding r-proteins is re-
tween the biological signal (DNA damage) and induc- pressed only when synthesis of these r-proteins exceeds
tion of the SOS genes. Heavy DNA damage leads to nu- that needed to make functional ribosomes. In this way,
merous single-strand gaps in the DNA, and only RecA the rate of r-protein synthesis is kept in balance with
that is bound to single-stranded DNA can facilitate rRNA availability.
cleavage of the LexA repressor (Fig. 2822, bottom). The mRNA binding site for the translational re-
Binding of RecA at the gaps eventually activates its co- pressor is near the translational start site of one of the
protease activity, leading to cleavage of the LexA re- genes in the operon, usually the first gene (Fig. 2823).
pressor and SOS induction. In other operons this would affect only that one gene,
During induction of the SOS response in a severely because in bacterial polycistronic mRNAs most genes
damaged cell, RecA also cleaves and thus inactivates the have independent translation signals. In the r-protein
repressors that otherwise allow propagation of certain operons, however, the translation of one gene depends
viruses in a dormant lysogenic state within the bacter- on the translation of all the others. The mechanism of
ial host. This provides a remarkable illustration of evo- this translational coupling is not yet understood in de-
lutionary adaptation. These repressors, like LexA, also tail. However, in some cases the translation of multiple
undergo self-cleavage at a specific AlaGly peptide genes appears to be blocked by folding of the mRNA
bond, so induction of the SOS response permits repli- into an elaborate three-dimensional structure that is sta-
cation of the virus and lysis of the cell, releasing new bilized both by internal base-pairing (as in Fig. 826)
viral particles. Thus the bacteriophage can make a hasty and by binding of the translational repressor protein.
exit from a compromised bacterial host cell. When the translational repressor is absent, ribosome
binding and translation of one or more of the genes dis-
Synthesis of Ribosomal Proteins Is Coordinated rupts the folded structure of the mRNA and allows all
the genes to be translated.
with rRNA Synthesis
Because the synthesis of r-proteins is coordinated
In bacteria, an increased cellular demand for protein with the available rRNA, the regulation of ribosome pro-
synthesis is met by increasing the number of ribosomes duction reflects the regulation of rRNA synthesis. In E.
rather than altering the activity of individual ribosomes. coli, rRNA synthesis from the seven rRNA operons re-
In general, the number of ribosomes increases as the sponds to cellular growth rate and to changes in the
cellular growth rate increases. At high growth rates, ri- availability of crucial nutrients, particularly amino acids.
bosomes make up approximately 45% of the cells dry The regulation coordinated with amino acid concentra-
weight. The proportion of cellular resources devoted to tions is known as the stringent response (Fig. 2824).
making ribosomes is so large, and the function of ribo- When amino acid concentrations are low, rRNA synthe-
somes so important, that cells must coordinate the syn- sis is halted. Amino acid starvation leads to the binding
thesis of the ribosomal components: the ribosomal pro- of uncharged tRNAs to the ribosomal A site; this trig-
teins (r-proteins) and RNAs (rRNAs). This regulation is gers a sequence of events that begins with the binding
distinct from the mechanisms described so far, because of an enzyme called stringent factor (RelA protein)
it occurs largely at the level of translation. to the ribosome. When bound to the ribosome, stringent
The 52 genes that encode the r-proteins occur in at factor catalyzes formation of the unusual nucleotide
least 20 operons, each with 1 to 11 genes. Some of these guanosine tetraphosphate (ppGpp; see Fig. 842); it
operons also contain the genes for the subunits of adds pyrophosphate to the 3 position of GTP, in the
DNA primase (see Fig. 2513), RNA polymerase (see reaction
Fig. 264), and protein synthesis elongation factors (see
GTP ATP 88n pppGpp AMP
Fig. 2723)revealing the close coupling of replication,
transcription, and protein synthesis during cell growth. then a phosphohydrolase cleaves off one phosphate to
The r-protein operons are regulated primarily form ppGpp. The abrupt rise in ppGpp level in response
through a translational feedback mechanism. One to amino acid starvation results in a great reduction in
r-protein encoded by each operon also functions as a rRNA synthesis, mediated at least in part by the bind-
translational repressor, which binds to the mRNA ing of ppGpp to RNA polymerase.
L10
operon 5 L10 L7/L12 3
S7
str operon 5 S12 S7 EF-G EF-Tu 3

FIGURE 2823 Translational feedback in some ribosomal
protein operons. The r-proteins that act as translational
S4 repressors are shaded pink. Each translational repressor
blocks the translation of all genes in that operon by binding
to the indicated site on the mRNA. Genes that encode
subunits of RNA polymerase are shaded yellow; genes that
operon 5 S13 S11 S4 L17 3
encode elongation factors are blue. The r-proteins of the
large (50S) ribosomal subunit are designated L1 to L34;
L4 those of the small (30S) subunit, S1 to S21.
S10 operon 5 S10 L3 L4 L23 L2 (L22, S19) S3 L16 L29 S17 3
S8
spc operon 5 L14 L24 L5 S14 S8 L6 L18 S5 L30 L15 3
+
NH3
Growing
polypeptide
OH
E
mRNA
5 3
P A
FIGURE 2824 Stringent response in E. coli. This response Stringent
to amino acid starvation is triggered by binding of an factor (RelA
uncharged tRNA in the ribosomal A site. A protein called protein)
stringent factor binds to the ribosome and catalyzes the (p)ppGpp AMP
GTP ATP
synthesis of pppGpp, which is converted by a phosphohy-
drolase to ppGpp. The signal ppGpp reduces transcription
of some genes and increases that of others, in part by RNA
binding to the subunit of RNA polymerase and altering polymerase
the enzymes promoter specificity. Synthesis of rRNA is
reduced when ppGpp levels increase.
The nucleotide ppGpp, along with cAMP, belongs to

a class of modified nucleotides that act as cellular sec-
ond messengers (p. 302). In E. coli, these two nu-
cleotides serve as starvation signals; they cause large
changes in cellular metabolism by increasing or de-
creasing the transcription of hundreds of genes. In eu-
karyotic cells, similar nucleotide second messengers
also have multiple regulatory functions. The coordina-
tion of cellular metabolism with cell growth is highly
complex, and further regulatory mechanisms undoubt-
edly remain to be discovered.
Some Genes Are Regulated

FIGURE 2825 Salmonella typhimurium, with flagella evident.
by Genetic Recombination
Salmonella typhimurium, which inhabits the mam- at either end of the DNA segment. When the DNA seg-
malian intestine, moves by rotating the flagella on its ment is in one orientation, the gene for FljB flagellin and
cell surface (Fig. 2825). The many copies of the pro- the gene encoding a repressor (FljA) are expressed
tein flagellin (Mr 53,000) that make up the flagella are (Fig. 2826a); the repressor shuts down expression of
prominent targets of mammalian immune systems. But the gene for FliC flagellin. When the DNA segment is
Salmonella cells have a mechanism that evades the im- inverted (Fig. 2826b), the fljA and fljB genes are no
mune response: they switch between two distinct fla- longer transcribed, and the fliC gene is induced as the
gellin proteins (FljB and FliC) roughly once every 1,000 repressor becomes depleted. The Hin recombinase, en-
generations, using a process called phase variation. coded by the hin gene in the DNA segment that un-
The switch is accomplished by periodic inversion of dergoes inversion, is expressed when the DNA segment
a segment of DNA containing the promoter for a fla- is in either orientation, so the cell can always switch
gellin gene. The inversion is a site-specific recombina- from one state to the other.
tion reaction (see Fig. 2539) mediated by the Hin re- This type of regulatory mechanism has the advan-
combinase at specific 14 bp sequences (hix sequences) tage of being absolute: gene expression is impossible
Inverted repeat (hix)

Promoter for FljB Promoter
and repressor for FliC
DNA hin fljB fljA fliC
hin mRNA fljB and fljA mRNA
FIGURE 2826 Regulation of flagellin genes

in Salmonella: phase variation. The products
Hin recombinase FljB FljA of genes fliC and fljB are different flagellins.
f lagellin protein The hin gene encodes the recombinase that
(repressor)
catalyzes inversion of the DNA segment
Transposed (a) containing the fljB promoter and the hin gene.
segment The recombination sites (inverted repeats) are
called hix (yellow). (a) In one orientation, fljB
hin fljB fljA fliC is expressed along with a repressor protein
(product of the fljA gene) that represses tran-
scription of the fliC gene. (b) In the opposite
fliC mRNA
orientation only the fliC gene is expressed; the
hin mRNA fljA and fljB genes cannot be transcribed. The
interconversion between these two states,
known as phase variation, also requires two
other nonspecific DNA-binding proteins (not
FliC f lagellin shown), HU (histonelike protein from U13, a
Hin recombinase
strain of E. coli) and FIS (factor for inversion
(b) stimulation).
TABLE 281 Examples of Gene Regulation by Recombination

Recombinase/ Type of
System recombination site recombination Function
Phase variation (Salmonella) Hin/hix Site-specific Alternative expression of two
flagellin genes allows evasion
of host immune response.
Host range (bacteriophage ) Gin/gix Site-specific Alternative expression of two
sets of tail fiber genes affects
host range.
Mating-type switch (yeast) HO endonuclease, Nonreciprocal Alternative expression of two
RAD52 protein, other gene conversion* mating types of yeast,
proteins/MAT a and , creates cells of
different mating types that can
mate and undergo meiosis.
Antigenic variation (trypanosomes) Varies Nonreciprocal gene Successive expression of
conversion* different genes encoding the
variable surface glycoproteins
(VSGs) allows evasion of host
immune response.
*
In nonreciprocal gene conversion (a class of recombination events not discussed in Chapter 25), genetic information is moved from one part of
the genome (where it is silent) to another (where it is expressed). The reaction is similar to replicative transposition (see Fig. 2543).

Trypanosomes cause African sleeping sickness and other diseases (see Box 222). The outer surface of a trypanosome is made up of multiple
copies of a single VSG, the major surface antigen. A cell can change surface antigens to more than 100 different forms, precluding an effective
defense by the host immune system.
when the gene is physically separated from its promoter genes involved in metabolism of secondary
(note the position of the fljB promoter in Fig. 2826b). sugars. A group of coordinately regulated
An absolute on/off switch may be important in this sys- operons is referred to as a regulon.
tem (even though it affects only one of the two flagellin Operons that produce the enzymes of amino
genes), because a flagellum with just one copy of the acid synthesis have a regulatory circuit called
wrong flagellin might be vulnerable to host antibodies attenuation, which uses a transcription
against that protein. The Salmonella system is by no termination site (the attenuator) in the mRNA.
means unique. Similar regulatory systems occur in a num- Formation of the attenuator is modulated by a
ber of other bacteria and in some bacteriophages, and mechanism that couples transcription and
recombination systems with similar functions have been translation while responding to small changes
found in eukaryotes (Table 281). Gene regulation by in amino acid concentration.
DNA rearrangements that move genes and/or promot-
In the SOS system, multiple unlinked genes
ers is particularly common in pathogens that benefit by
repressed by a single repressor are induced
changing their host range or by changing their surface
simultaneously when DNA damage triggers
proteins, thereby staying ahead of host immune systems.
RecA proteinfacilitated autocatalytic
proteolysis of the repressor.
SUMMARY 28.2 Regulation of Gene Expression In the synthesis of ribosomal proteins, one
in Prokaryotes protein in each r-protein operon acts as a
translational repressor. The mRNA is bound by
In addition to repression by the Lac repressor, the repressor, and translation is blocked only
the E. coli lac operon undergoes positive when the r-protein is present in excess of
regulation by the cAMP receptor protein available rRNA. Some genes are regulated by
(CRP). When [glucose] is low, [cAMP] is high genetic recombination processes that move
and CRP-cAMP binds to a specific site on the promoters relative to the genes being
DNA, stimulating transcription of the lac regulated. Regulation can also take place at the
operon and production of lactose-metabolizing level of translation. These diverse mechanisms
enzymes. The presence of glucose depresses permit very sensitive cellular responses to
[cAMP], decreasing expression of lac and other environmental change.
28.3 Regulation of Gene Expression with particular chromosome structuresthe cen-

tromeres, for example. The remaining, less condensed
in Eukaryotes chromatin is called euchromatin.
Initiation of transcription is a crucial regulation point for Transcription of a eukaryotic gene is strongly re-
both prokaryotic and eukaryotic gene expression. Al- pressed when its DNA is condensed within heterochro-
though some of the same regulatory mechanisms are matin. Some, but not all, of the euchromatin is
used in both systems, there is a fundamental difference transcriptionally active. Transcriptionally active chro-
in the regulation of transcription in eukaryotes and mosomal regions can be detected based on their in-
bacteria. creased sensitivity to nuclease-mediated degradation.
We can define a transcriptional ground state as the Nucleases such as DNase I tend to cleave the DNA of
inherent activity of promoters and transcriptional ma- carefully isolated chromatin into fragments of multiples
chinery in vivo in the absence of regulatory sequences. of about 200 bp, reflecting the regular repeating struc-
In bacteria, RNA polymerase generally has access to ture of the nucleosome (see Fig. 2426). In actively tran-
every promoter and can bind and initiate transcription scribed regions, the fragments produced by nuclease ac-
at some level of efficiency in the absence of activators tivity are smaller and more heterogeneous in size. These
or repressors; the transcriptional ground state is there- regions contain hypersensitive sites, sequences es-
fore nonrestrictive. In eukaryotes, however, strong pro- pecially sensitive to DNase I, which consist of about 100
moters are generally inactive in vivo in the absence of to 200 bp within the 1,000 bp flanking the 5 ends of
regulatory proteins; that is, the transcriptional ground transcribed genes. In some genes, hypersensitive sites
state is restrictive. This fundamental difference gives are found farther from the 5 end, near the 3 end, or
rise to at least four important features that distinguish even within the gene itself.
the regulation of gene expression in eukaryotes from Many hypersensitive sites correspond to binding
that in bacteria. sites for known regulatory proteins, and the relative ab-
First, access to eukaryotic promoters is restricted sence of nucleosomes in these regions may allow the
by the structure of chromatin, and activation of tran- binding of these proteins. Nucleosomes are entirely ab-
scription is associated with many changes in chromatin sent in some regions that are very active in transcrip-
structure in the transcribed region. Second, although tion, such as the rRNA genes. Transcriptionally active
eukaryotic cells have both positive and negative regula- chromatin tends to be deficient in histone H1, which
tory mechanisms, positive mechanisms predominate in binds to the linker DNA between nucleosome particles.
all systems characterized so far. Thus, given that the Histones within transcriptionally active chromatin
transcriptional ground state is restrictive, virtually every and heterochromatin also differ in their patterns of co-
eukaryotic gene requires activation to be transcribed. valent modification. The core histones of nucleosome
Third, eukaryotic cells have larger, more complex mul- particles (H2A, H2B, H3, H4; see Fig. 2427) are mod-
timeric regulatory proteins than do bacteria. Finally, ified by irreversible methylation of Lys residues, phos-
transcription in the eukaryotic nucleus is separated phorylation of Ser or Thr residues, acetylation (see be-
from translation in the cytoplasm in both space and low), or attachment of ubiquitin (see Fig. 2741). Each
time. of the core histones has two distinct structural domains.
The complexity of regulatory circuits in eukaryotic A central domain is involved in histone-histone interac-
cells is extraordinary, as the following discussion shows. tion and the wrapping of DNA around the nucleosome.
We conclude the section with an illustrated description A second, lysine-rich amino-terminal domain is gener-
of one of the most elaborate circuits: the regulatory cas- ally positioned near the exterior of the assembled nu-
cade that controls development in fruit flies. cleosome particle; the covalent modifications occur at
specific residues concentrated in this amino-terminal
Transcriptionally Active Chromatin Is Structurally domain. The patterns of modification have led some re-
searchers to propose the existence of a histone code, in
Distinct from Inactive Chromatin
which modification patterns are recognized by enzymes
The effects of chromosome structure on gene regula- that alter the structure of chromatin. Modifications as-
tion in eukaryotes have no clear parallel in prokaryotes. sociated with transcriptional activation would be recog-
In the eukaryotic cell cycle, interphase chromosomes nized by enzymes that make the chromatin more ac-
appear, at first viewing, to be dispersed and amorphous cessible to the transcription machinery.
(see Figs 1241, 2425). Nevertheless, several forms of 5-Methylation of cytosine residues of CpG se-
chromatin can be found along these chromosomes. quences is common in eukaryotic DNA (p. 296), but
About 10% of the chromatin in a typical eukaryotic cell DNA in transcriptionally active chromatin tends to be
is in a more condensed form than the rest of the chro- undermethylated. Furthermore, CpG sites in particular
matin. This form, heterochromatin, is transcription- genes are more often undermethylated in cells from tis-
ally inactive. Heterochromatin is generally associated sues where the genes are expressed than in those where
28.3 Regulation of Gene Expression in Eukaryotes 1103
the genes are not expressed. The overall pattern sug- longer required, the acetylation of nucleosomes in that
gests that active chromatin is prepared for transcription vicinity is reduced by the activity of histone deacety-
by the removal of potential structural barriers. lases, as part of a general gene-silencing process that
restores the chromatin to a transcriptionally inactive
Chromatin Is Remodeled by Acetylation and state. In addition to the removal of certain acetyl groups,
Nucleosomal Displacements new covalent modification of histones marks chromatin
as transcriptionally inactive. As an example, the Lys
The detailed mechanisms for transcription-associated residue at position 9 in histone H3 is often methylated
structural changes in chromatin, called chromatin re- in heterochromatin.
modeling, are now coming to light, including identifi- Chromatin remodeling also requires protein com-
cation of a variety of enzymes directly implicated in the plexes that actively move or displace nucleosomes, hy-
process. These include enzymes that covalently modify drolyzing ATP in the process (Table 282). The enzyme
the core histones of the nucleosome and others that use complex SWI/SNF found in all eukaryotic cells, contains
the chemical energy of ATP to remodel nucleosomes on 11 polypeptides (total Mr 2 106) that together create
the DNA (Table 282).
hypersensitive sites in the chromatin and stimulate the
The acetylation and deacetylation of histones figure
binding of transcription factors. SWI/SNF is not required
prominently in the processes that activate chromatin
for the transcription of every gene. NURF is another
for transcription. As noted above, the amino-terminal
ATP-dependent enzyme complex that remodels chro-
domains of the core histones are generally rich in Lys
matin in ways that complement and overlap the activ-
residues. Particular Lys residues are acetylated by
ity of SWI/SNF. These enzyme complexes play an im-
histone acetyltransferases (HATs). Cytosolic (type B)
portant role in preparing a region of chromatin for active
HATs acetylate newly synthesized histones before the
transcription.
histones are imported into the nucleus. The subsequent
assembly of the histones into chromatin is facilitated by
Many Eukaryotic Promoters Are Positively Regulated
additional proteins: CAF1 for H3 and H4, and NAP1 for
H2A and H2B. (See Table 282 for an explanation of As already noted, eukaryotic RNA polymerases have lit-
some of these abbreviated names.) tle or no intrinsic affinity for their promoters; initiation
Where chromatin is being activated for transcrip- of transcription is almost always dependent on the
tion, the nucleosomal histones are further acetylated by action of multiple activator proteins. One important
nuclear (type A) HATs. The acetylation of multiple Lys reason for the apparent predominance of positive regu-
residues in the amino-terminal domains of histones H3 lation seems obvious: the storage of DNA within chro-
and H4 can reduce the affinity of the entire nucleosome matin effectively renders most promoters inaccessible,
for DNA. Acetylation may also prevent or promote in- so genes are normally silent in the absence of other reg-
teractions with other proteins involved in transcription ulation. The structure of chromatin affects access to
or its regulation. When transcription of a gene is no some promoters more than others, but repressors that
TABLE 282 Some Enzyme Complexes Catalyzing Chromatin Structural Changes Associated with Transcription
Oligomeric structure
Enzyme complex* (number of polypeptides) Source Activities
GCN5-ADA2-ADA3 3 Yeast GCN5 has type A HAT activity
SAGA/PCAF 20 Eukaryotes Includes GCN5-ADA2-ADA3
SWI/SNF 11; total Mr 2 106 Eukaryotes ATP-dependent nucleosome remodeling
NURF 4; total Mr 500,000 Drosophila ATP-dependent nucleosome remodeling
CAFI 2 Humans; Drosophila Responsible for binding histones H3
and H4 to DNA
NAP1 1; Mr 125,000 Widely distributed in Responsible for binding histones H2A
eukaryotes and H2B to DNA
*
The abbreviations for eukaryotic genes and proteins are often more confusing or obscure than those used for bacteria. The complex of GCN5
(general control nonderepressible) and ADA (alteration/deficiency activation) proteins was discovered during investigation of the regulation of
nitrogen metabolism genes in yeast. These proteins can be part of the larger SAGA complex (SPF, ADA2,3, GCN5, acetyltransferase) in yeasts.
The equivalent of SAGA in humans is PCAF (p300/CBP-associated factor). SWI (switching) was discovered as a protein required for expression
of certain genes involved in mating-type switching in yeast, and SNF (sucrose nonfermenting) as a factor for expression of the yeast gene for
sucrase. Subsequent studies revealed multiple SWI and SNF proteins that acted in a complex. The SWI/SNF complex has a role in the
expression of a wide range of genes and has been found in many eukaryotes, including humans. NURF is nuclear remodeling factor; CAF1,
chromatin assembly factor; and NAP1, nucleosome assembly protein.
bind to DNA so as to preclude access of RNA polymerase upstream from the transcription start site, or may even
(negative regulation) would often be simply redundant. be downstream, within the gene itself. When bound by
Other factors are at play in the use of positive regula- the appropriate regulatory proteins, an enhancer in-
tion, and speculation generally centers around two: the creases transcription at nearby promoters regardless of
large size of eukaryotic genomes and the greater effi- its orientation in the DNA. The UASs of yeast function
ciency of positive regulation. in a similar way, although generally they must be posi-
First, nonspecific DNA binding of regulatory pro- tioned upstream and within a few hundred base pairs of
teins becomes a more important problem in the much the transcription start site. An average Pol II promoter
larger genomes of higher eukaryotes. And the chance may be affected by a half-dozen regulatory sequences
that a single specific binding sequence will occur ran- of this type, and even more complex promoters are quite
domly at an inappropriate site also increases with common.
genome size. Specificity for transcriptional activation Successful binding of active RNA polymerase II
can be improved if each of several positive-regulatory holoenzyme at one of its promoters usually requires
proteins must bind specific DNA sequences and then the action of other proteins (Fig. 2827), of three types:
form a complex in order to become active. The average (1) basal transcription factors (see Fig. 269, Table
number of regulatory sites for a gene in a multicellular 261), required at every Pol II promoter; (2) DNA-
organism is probably at least five. The requirement for binding transactivators, which bind to enhancers or
binding of several positive-regulatory proteins to spe- UASs and facilitate transcription; and (3) coactivators.
cific DNA sequences vastly reduces the probability of The latter group act indirectlynot by binding to the
the random occurrence of a functional juxtaposition of DNAand are required for essential communication be-
all the necessary binding sites. In principle, a similar tween the DNA-binding transactivators and the complex
strategy could be used by multiple negative-regulatory composed of Pol II and the general transcription factors.
elements, but this brings us to the second reason for the Furthermore, a variety of repressor proteins can inter-
use of positive regulation: it is simply more efficient. If fere with communication between the RNA polymerase
the 30,000 to 35,000 genes in the human genome were and the DNA-binding transactivators, resulting in re-
negatively regulated, each cell would have to synthe- pression of transcription (Fig. 2827b). Here we focus
size, at all times, this same number of different repres- on the protein complexes shown in Figure 2827 and
sors (or many times this number if multiple regulatory on how they interact to activate transcription.
elements were used at each promoter) in concentra-
tions sufficient to permit specific binding to each un- TATA-Binding Protein The first component to bind in the
wanted gene. In positive regulation, most of the genes assembly of a preinitiation complex at the TATA box of
are normally inactive (that is, RNA polymerases do not a typical Pol II promoter is the TATA-binding protein
bind to the promoters) and the cell synthesizes only the (TBP). The complete complex includes the basal
activator proteins needed to promote transcription of (or general) transcription factors TFIIB, TFIIE, TFIIF,
the subset of genes required in the cell at that time. TFIIH; Pol II; and perhaps TFIIA (not all of the factors
These arguments notwithstanding, there are examples are shown in Fig. 2827). This minimal preinitiation
of negative regulation in eukaryotes, from yeast to hu- complex, however, is often insufficient for the initiation
mans, as we shall see. of transcription and generally does not form at all if the
promoter is obscured within chromatin. Positive regu-
DNA-Binding Transactivators and Coactivators lation leading to transcription is imposed by the trans-
Facilitate Assembly of the General activators and coactivators.
Transcription Factors
DNA-Binding Transactivators The requirements for trans-
To continue our exploration of the regulation of gene activators vary greatly from one promoter to another. A
expression in eukaryotes, we return to the interactions few transactivators are known to facilitate transcription
between promoters and RNA polymerase II (Pol II), the at hundreds of promoters, whereas others are specific
enzyme responsible for the synthesis of eukaryotic for a few promoters. Many transactivators are sensitive
mRNAs. Although most (but not all) Pol II promoters to the binding of signal molecules, providing the capac-
include the TATA box and Inr (initiator) sequences, with ity to activate or deactivate transcription in response to
their standard spacing (see Fig. 268), they vary greatly a changing cellular environment. Some enhancers bound
in both the number and the location of additional se- by DNA-binding transactivators are quite distant from
quences required for the regulation of transcription. the promoters TATA box. How do the transactivators
These additional regulatory sequences are usually called function at a distance? The answer in most cases seems
enhancers in higher eukaryotes and upstream acti- to be that, as indicated earlier, the intervening DNA is
vator sequences (UASs) in yeast. A typical enhancer looped so that the various protein complexes can inter-
may be found hundreds or even thousands of base pairs act directly. The looping is promoted by certain non-
HMG proteins Transcription Coactivator Protein Complexes Most transcription re-

quires the presence of additional protein complexes.
UAS TATA Inr
Some major regulatory protein complexes that interact
TBP with Pol II have been defined both genetically and bio-
chemically. These coactivator complexes act as inter-
mediaries between the DNA-binding transactivators and
TFIID CTD RNA the Pol II complex.
polymerase II
co- Mediator complex The best-characterized coactivator is the transcrip-
activators
tion factor TFIID (Fig. 2827). In eukaryotes, TFIID is
a large complex that includes TBP and ten or more TBP-
associated factors (TAFs). Some TAFs resemble his-
DNA tones and may play a role in displacing nucleosomes dur-
ing the activation of transcription. Many DNA-binding
Enhancers DNA-binding transactivators aid in transcription initiation by inter-
transactivators acting with one or more TAFs. The requirement for
(a) TAFs to initiate transcription can vary greatly from one
gene to another. Some promoters require TFIID, some
do not, and some require only subsets of the TFIID TAF
UAS TATA Inr subunits.
TBP
Another important coactivator consists of 20 or
more polypeptides in a protein complex called media-
tor (Fig. 2827); the 20 core polypeptides are highly
conserved from fungi to humans. Mediator binds tightly
Repressor
TFIID
to the carboxyl-terminal domain (CTD) of the largest
Mediator
subunit of Pol II. The mediator complex is required for
both basal and regulated transcription at promoters
used by Pol II, and it also stimulates the phosphoryla-
tion of the CTD by TFIIH. Both mediator and TFIID are
required at some promoters. As with TFIID, some DNA-
Enhancers
(b) binding transactivators interact with one or more com-
ponents of the mediator complex. Coactivator com-
FIGURE 2827 Eukaryotic promoters and regulatory proteins. RNA plexes function at or near the promoters TATA box.
polymerase II and its associated general transcription factors form a
preinitiation complex at the TATA box and Inr site of the cognate pro- Choreography of Transcriptional Activation We can now be-
moters, a process facilitated by DNA-binding transactivators, acting gin to piece together the sequence of transcriptional ac-
through TFIID and/or mediator. (a) A composite promoter with typi- tivation events at a typical Pol II promoter. First, cru-
cal sequence elements and protein complexes found in both yeast and cial remodeling of the chromatin takes place in stages.
higher eukaryotes. The carboxyl-terminal domain (CTD) of Pol II (see Some DNA-binding transactivators have significant
Fig. 269) is an important point of interaction with mediator and other
affinity for their binding sites even when the sites are
protein complexes. Not shown are the protein complexes required for
within condensed chromatin. Binding of one transacti-
histone acetylation and chromatin remodeling. For the DNA-binding
vator may facilitate the binding of others, gradually dis-
transactivators, DNA-binding domains are shown in green, activation
placing some nucleosomes.
domains in pink. The interactions symbolized by blue arrows are dis-
The bound transactivators can then interact di-
cussed in the text. (b) A wide variety of eukaryotic transcriptional re-
pressors function by a range of mechanisms. Some bind directly to
rectly with HATs or enzyme complexes such as
DNA, displacing a protein complex required for activation; others in-
SWI/SNF (or both), accelerating the remodeling of the
teract with various parts of the transcription or activation complexes surrounding chromatin. In this way a bound transac-
to prevent activation. Possible points of interaction are indicated with tivator can draw in other components necessary for
red arrows. further chromatin remodeling to permit transcription
of specific genes. The bound transactivators, gener-
ally acting through complexes such as TFIID or me-
histone proteins that are abundant in chromatin and diator (or both), stabilize the binding of Pol II and its
bind nonspecifically to DNA. These high mobility group associated transcription factors and greatly facilitate
(HMG) proteins (Fig. 2827; high mobility refers to formation of the preinitiation transcription complex.
their electrophoretic mobility in polyacrylamide gels) Complexity in these regulatory circuits is the rule
play an important structural role in chromatin remod- rather than the exception, with multiple DNA-bound
eling and transcriptional activation. transactivators promoting transcription.
The script can change from one promoter to an- Intermediary complex RNA
(TFIID or mediator) polymerase II
other, but most promoters seem to require a precisely complex
ordered assembly of components to initiate transcrip-
tion. The assembly process is not always fast. At some
TATA Inr
genes it may take minutes; at certain genes in higher TBP
eukaryotes the process can take days. HMG
proteins
Reversible Transcriptional Activation Although rarer, some Gal80p
eukaryotic regulatory proteins that bind to Pol II pro- Gal4p
moters can act as repressors, inhibiting the formation UASG
of active preinitiation complexes (Fig. 2827b). Some
transactivators can adopt different conformations, en-
abling them to serve as transcriptional activators or re- Gal3p
+
pressors. For example, some steroid hormone receptors galactose
(described later) function in the nucleus as DNA-
binding transactivators, stimulating the transcription of
certain genes when a particular steroid hormone signal
is present. When the hormone is absent, the receptor Intermediary complex
proteins revert to a repressor conformation, prevent-
ing the formation of preinitiation complexes. In some
TATA Inr
cases this repression involves interaction with histone
TBP
deacetylases and other proteins that help restore the Gal3p
surrounding chromatin to its transcriptionally inactive
state. UAS G
The Genes of Galactose Metabolism in Yeast Are

Subject to Both Positive and Negative Regulation
0FIGURE 2828 Regulation of transcription at genes of galactose
Some of the general principles described above can be
metabolism in yeast. Galactose is imported into the cell and converted
illustrated by one well-studied eukaryotic regulatory
to galactose 6-phosphate by a pathway involving six enzymes whose
circuit (Fig. 2828). The enzymes required for the im-
genes are scattered over three chromosomes (see Table 283). Tran-
portation and metabolism of galactose in yeast are en-
scription of these genes is regulated by the combined actions of the
coded by genes scattered over several chromosomes proteins Gal4p, Gal80p, and Gal3p, with Gal4p playing the central
(Table 283). Each of the GAL genes is transcribed sep- role of DNA-binding transactivator. The Gal4p-Gal80p complex is in-
arately, and yeast cells have no operons like those in active in gene activation. Binding of galactose to Gal3p and its inter-
bacteria. However, all the GAL genes have similar pro- action with Gal80p produce a conformational change in Gal80p that
moters and are regulated coordinately by a common set allows Gal4p to function in transcription activation.
of proteins. The promoters for the GAL genes consist
of the TATA box and Inr sequences, as well as an up- Glucose is the preferred carbon source for yeast, as
stream activator sequence (UASG) recognized by a it is for bacteria. When glucose is present, most of the
DNA-binding transcriptional activator known as Gal4 GAL genes are repressedwhether galactose is present
protein (Gal4p). Regulation of gene expression by galac- or not. The GAL regulatory system described above is
tose entails an interplay between Gal4p and two other effectively overridden by a complex catabolite repres-
proteins, Gal80p and Gal3p (Fig. 2828). Gal80p forms sion system that includes several proteins (not depicted
a complex with Gal4p, preventing Gal4p from function- in Fig. 2829).
ing as an activator of the GAL promoters. When galac-
tose is present, it binds Gal3p, which then interacts with DNA-Binding Transactivators Have a
Gal80p, allowing Gal4p to function as an activator at the
Modular Structure
various GAL promoters.
Other protein complexes also have a role in acti- DNA-binding transactivators typically have a distinct
vating transcription of the GAL genes. These may in- structural domain for specific DNA binding and one or
clude the SAGA complex for histone acetylation, the more additional domains for transcriptional activation
SWI/SNF complex for nucleosome remodeling, and the or for interaction with other regulatory proteins. Inter-
mediator complex. Figure 2829 provides an idea of the action of two regulatory proteins is often mediated by
complexity of protein interactions in the overall process domains containing leucine zippers (Fig. 2814) or helix-
of transcriptional activation in eukaryotic cells. loop-helix motifs (Fig. 2815). We consider here three
TABLE 283 Genes of Galactose Metabolism in Yeast

Relative protein expression
in different carbon sources
Chromosomal Protein size
Protein function location (number of residues) Glucose Glycerol Galactose
Regulated genes
GAL1 Galactokinase II 528
GAL2 Galactose permease XII 574
PGM2 Phosphoglucomutase XIII 569
GAL7 Galactose 1-phosphate
uridylyltransferase II 365
GAL10 UDP-glucose 4-epimerase II 699
MEL1 -Galactosidase II 453
Regulatory genes
GAL3 Inducer IV 520
GAL4 Transcriptional activator XVI 881 /
GAL80 Transcriptional inhibitor XIII 435
Source: Adapted from Reece, R. & Platt, A. (1997) Signaling activation and repression of RNA polymerase II transcription in yeast. Bioessays
19, 10011010.
HMG proteins
TATA FIGURE 2829 Protein complexes involved in transcription activa-
tion of a group of related eukaryotic genes. The GAL system illustrates
the complexity of this process, but not all these protein complexes are
GCN5-ADA2-ADA3 yet known to affect GAL gene transcription. Note that many of the
complexes (such as SWI/SNF, GCN5-ADA2-ADA3, and mediator) af-
Gal4p fect the transcription of many genes. The complexes assemble step-
UASG wise. First the DNA-binding transactivators bind, then the additional
protein complexes needed to remodel the chromatin and allow tran-
scription to begin.
TFIIA , TBP
TATA distinct types of structural domains used in activation

TFIIA TBP
by DNA-binding transactivators (Fig. 2830a): Gal4p,
Sp1, and CTF1.
UAS G Gal4p contains a zinc fingerlike structure in its
DNA-binding domain, near the amino terminus; this do-
main has six Cys residues that coordinate two Zn2. The
RNA protein functions as a homodimer (with dimerization
polymerase II
complex mediated by interactions between two coiled coils) and
binds to UASG, a palindromic DNA sequence about 17 bp
SWI/
long. Gal4p has a separate activation domain with many
Mediator
SNF acidic amino acid residues. Experiments that substitute
TFIIF
a variety of different peptide sequences for the acidic
TFIIB
TFIIA TBP TFIIE activation domain of Gal4p suggest that the acidic na-
TFIIH ture of this domain is critical to its function, although
its precise amino acid sequence can vary considerably.
UAS G Sp1 (Mr 80,000) is a DNA-binding transactivator
for a large number of genes in higher eukaryotes. Its
DNA binding site, the GC box (consensus sequence
HMG proteins
turn-helix nor a zinc finger motif; its DNA-binding mech-
TFIID anism is not yet clear. CTF1 has a proline-rich acti-
TATA INR
vation domain, with Pro accounting for more than 20%
TBP
of the amino acid residues.
TFIIH The discrete activation and DNA-binding domains
of regulatory proteins often act completely independ-
ently, as has been demonstrated in domain-swapping
experiments. Genetic engineering techniques (Chap-
P ter 9) can join the proline-rich activation domain of
P QQQ CTF1 to the DNA-binding domain of Sp1 to create a pro-
CT AT
P
CC

FI
Sp1 tein that, like normal Sp1, binds to GC boxes on the DNA
A
UASG GC DNA and activates transcription at a nearby promoter (as in

Gal4p Fig. 2830b). The DNA-binding domain of Gal4p has
(a) similarly been replaced experimentally with the DNA-
binding domain of the prokaryotic LexA repressor (of
the SOS response; Fig. 2822). This chimeric protein
neither binds at UASG nor activates the yeast GAL genes
TFIID (as would normal Gal4p) unless the UASG sequence in
TATA INR the DNA is replaced by the LexA recognition site.
TBP
TFIIH Eukaryotic Gene Expression Can Be Regulated
by Intercellular and Intracellular Signals
The effects of steroid hormones (and of thyroid and
retinoid hormones, which have the same mode of ac-
PPP
CTFI
tion) provide additional well-studied examples of the
Sp1 modulation of eukaryotic regulatory proteins by direct
GC DNA interaction with molecular signals (see Fig. 1240). Un-
like other types of hormones, steroid hormones do not
(b) have to bind to plasma membrane receptors. Instead,
FIGURE 2830 DNA-binding transactivators. (a) Typical DNA-bind-
they can interact with intracellular receptors that are
ing transactivators such as CTF1, Gal4p, and Sp1 have a DNA-bind-
themselves transcriptional transactivators. Steroid hor-
ing domain and an activation domain. The nature of the activation do- mones too hydrophobic to dissolve readily in the blood
main is indicated by symbols: , acidic; Q Q Q, glutamine-rich; (estrogen, progesterone, and cortisol, for example)
P P P, proline-rich. Some or all of these proteins may activate tran- travel on specific carrier proteins from their point of re-
scription by interacting with intermediary complexes such as TFIID or lease to their target tissues. In the target tissue, the hor-
mediator. Note that the binding sites illustrated here are not generally mone passes through the plasma membrane by simple
found together near a single gene. (b) A chimeric protein containing diffusion and binds to its specific receptor protein in the
the DNA-binding domain of Sp1 and the activation domain of CTF1 nucleus. The hormone-receptor complex acts by bind-
activates transcription if a GC box is present. ing to highly specific DNA sequences called hormone
response elements (HREs), thereby altering gene ex-
pression. Hormone binding triggers changes in the con-
GGGCGG), is usually quite near the TATA box. The formation of the receptor proteins so that they become
DNA-binding domain of the Sp1 protein is near its car- capable of interacting with additional transcription fac-
boxyl terminus and contains three zinc fingers. Two tors. The bound hormone-receptor complex can either
other domains in Sp1 function in activation, and are no- enhance or suppress the expression of adjacent genes.
table in that 25% of their amino acid residues are Gln. The DNA sequences (HREs) to which hormone-
A wide variety of other activator proteins also have these receptor complexes bind are similar in length and
glutamine-rich domains. arrangement, but differ in sequence, for the various
CCAAT-binding transcription factor 1 (CTF1) be- steroid hormones. Each receptor has a consensus HRE
longs to a family of DNA-binding transactivators that sequence (Table 284) to which the hormone-receptor
bind a sequence called the CCAAT site (its consensus complex binds well, with each consensus consisting of
sequence is TGGN6GCCAA, where N is any nucleotide). two six-nucleotide sequences, either contiguous or sep-
The DNA-binding domain of CTF1 contains many basic arated by three nucleotides, in tandem or in a palindromic
amino acid residues, and the binding region is probably arrangement. The hormone receptors have a highly
arranged as an helix. This protein has neither a helix- conserved DNA-binding domain with two zinc fingers
Some humans unable to respond to cortisol, testos-

TABLE 284 Hormone Response Elements (HREs) terone, vitamin D, or thyroxine have mutations of this
Bound by Steroid-Type Hormone Receptors type.
Receptor Consensus sequence bound*
Regulation Can Result from Phosphorylation
Androgen GG(A/T)ACAN2TGTTCT of Nuclear Transcription Factors
Glucocorticoid GGTACAN3TGTTCT
Retinoic acid (some) AGGTCAN5AGGTCA We noted in Chapter 12 that the effects of insulin on
Vitamin D AGGTCAN3AGGTCA gene expression are mediated by a series of steps lead-
Thyroid hormone AGGTCAN3AGGTCA ing ultimately to the activation of a protein kinase in the
RX AGGTCANAGGTCANAGGTCANAGGTCA nucleus that phosphorylates specific DNA-binding pro-
teins and thereby alters their ability to act as tran-
*
N represents any nucleotide. scription factors (see Fig. 126). This general mecha-

Forms a dimer with the retinoic acid receptor or vitamin D receptor. nism mediates the effects of many nonsteroid hormones.
For example, the -adrenergic pathway that leads to el-
evated levels of cytosolic cAMP, which acts as a second
(Fig. 2831). The hormone-receptor complex binds to messenger in eukaryotes as well as in prokaryotes (see
the DNA as a dimer, with the zinc finger domains of each Figs 1212, 2818), also affects the transcription of a
monomer recognizing one of the six-nucleotide se- set of genes, each of which is located near a specific
quences. The ability of a given hormone to act through DNA sequence called a cAMP response element (CRE).
the hormone-receptor complex to alter the expression The catalytic subunit of protein kinase A, released when
of a specific gene depends on the exact sequence of the cAMP levels rise (see Fig. 1215), enters the nucleus
HRE, its position relative to the gene, and the number and phosphorylates a nuclear protein, the CRE-binding
of HREs associated with the gene. protein (CREB). When phosphorylated, CREB binds to
Unlike the DNA-binding domain, the ligand-binding CREs near certain genes and acts as a transcription fac-
region of the receptor proteinalways at the carboxyl tor, turning on the expression of these genes.
terminusis quite specific to the particular receptor. In
the ligand-binding region, the glucocorticoid receptor is Many Eukaryotic mRNAs Are Subject
only 30% similar to the estrogen receptor and 17% sim-
to Translational Repression
ilar to the thyroid hormone receptor. The size of the lig-
and-binding region varies dramatically; in the vitamin D Regulation at the level of translation assumes a much
receptor it has only 25 amino acid residues, whereas in more prominent role in eukaryotes than in bacteria and
the mineralocorticoid receptor it has 603 residues. Mu- is observed in a range of cellular situations. In contrast to
tations that change one amino acid in these regions can the tight coupling of transcription and translation in bac-
result in loss of responsiveness to a specific hormone. teria, the transcripts generated in a eukaryotic nucleus
Y
G H
S Y N FIGURE 2831 Typical steroid hormone receptors.
K R
A G 20 These receptor proteins have a binding site for the
D R
Y V hormone, a DNA-binding domain, and a region that
I K
D W
50 T S activates transcription of the regulated gene. The highly
N S
conserved DNA-binding domain has two zinc fingers.
C C
10 C C The sequence shown here is that for the estrogen
Q
V E N Q 60 receptor, but the residues in bold type are common to
Zn T Zn
A A all steroid hormone receptors.
A G
P
C C C C
30 40 70 80
MKETRY KAFFKRSIQGHNDYM RLRKCYEVGMMKGGIRKDRRGG

H 3N COO
Transcription DNA binding Hormone binding
activation (6668 residues, (variable sequence
(variable sequence highly and length)
and length) conserved)
must be processed and transported to the cytoplasm be-

40S Ribosomal subunit
fore translation. This can impose a significant delay on
the appearance of a protein. When a rapid increase in
protein production is needed, a translationally repressed eIF3 3 poly(A)
5 cap binding
mRNA already in the cytoplasm can be activated for
protein
translation without delay. Translational regulation may A
AA A
play an especially important role in regulating certain (A)n
very long eukaryotic genes (a few are measured in the eIF4E
millions of base pairs), for which transcription and eIF4G
mRNA processing can require many hours. Some genes AUG
are regulated at both the transcriptional and transla-
tional stages, with the latter playing a role in the fine- Translational repressors
tuning of cellular protein levels. In some anucleate cells,
such as reticulocytes (immature erythrocytes), tran-
3 Untranslated
scriptional control is entirely unavailable and transla- region (3UTR)
tional control of stored mRNAs becomes essential. As
described below, translational controls can also have FIGURE 2832 Translational regulation of eukaryotic mRNA. One of
spatial significance during development, when the reg- the most important mechanisms for translational regulation in eu-
ulated translation of prepositioned mRNAs creates a karyotes involves the binding of translational repressors (RNA-binding
local gradient of the protein product. proteins) to specific sites in the 3 untranslated region (3UTR) of the
Eukaryotes have at least three main mechanisms of mRNA. These proteins interact with eukaryotic initiation factors or with
translational regulation. the ribosome (see Fig. 2722) to prevent or slow translation.
1. Initiation factors are subject to phosphorylation by binds to eIF2, recycling it with the aid of GTP binding
a number of protein kinases. The phosphorylated and hydrolysis. The maturation of reticulocytes includes
forms are often less active and cause a general destruction of the cell nucleus, leaving behind a plasma
depression of translation in the cell. membrane packed with hemoglobin. Messenger RNAs
2. Some proteins bind directly to mRNA and act as deposited in the cytoplasm before the loss of the nu-
translational repressors, many of them binding at cleus allow for the replacement of hemoglobin. When
specific sites in the 3 untranslated region reticulocytes become deficient in iron or heme, the
(3UTR). So positioned, these proteins interact translation of globin mRNAs is repressed. A protein ki-
with other translation initiation factors bound to nase called HCR (hemin-controlled repressor) is acti-
the mRNA or with the 40S ribosomal subunit to vated, catalyzing the phosphorylation of eIF2. In its
prevent translation initiation (Fig. 2832; compare phosphorylated form, eIF2 forms a stable complex with
this with Fig. 2722). eIF2B that sequesters the eIF2, making it unavailable
for participation in translation. In this way, the reticu-
3. Binding proteins, present in eukaryotes from yeast locyte coordinates the synthesis of globin with the avail-
to mammals, disrupt the interaction between ability of heme.
eIF4E and eIF4G (see Fig. 2722). The mammalian Many additional examples of translational regula-
versions are known as 4E-BPs (eIF4E binding tion have been found in studies of the development of
proteins). When cell growth is slow, these proteins multicellular organisms, as discussed in more detail
limit translation by binding to the site on eIF4E below.
that normally interacts with eIF4G. When cell
growth resumes or increases in response to Posttranscriptional Gene Silencing Is Mediated
growth factors or other stimuli, the binding
by RNA Interference
proteins are inactivated by protein kinase
dependent phosphorylation. In higher eukaryotes, including nematodes, fruit flies,
plants, and mammals, a class of small RNAs has been
The variety of translational regulation mechanisms pro- discovered that mediates the silencing of particular
vides flexibility, allowing focused repression of a few genes. The RNAs function by interacting with mRNAs,
mRNAs or global regulation of all cellular translation. often in the 3UTR, resulting in either mRNA degrada-
Translational regulation has been particularly well tion or translation inhibition. In either case, the mRNA,
studied in reticulocytes. One such mechanism in these and thus the gene that produces it, is silenced. This form
cells involves eIF2, the initiation factor that binds to the of gene regulation controls developmental timing in at
initiator tRNA and conveys it to the ribosome; when least some organisms. It is also used as a mechanism
Met-tRNA has bound to the P site, the factor eIF2B to protect against invading RNA viruses (particularly
important in plants, which lack an immune system) and called small interfering RNAs (siRNAs). These bind to
to control the activity of transposons. In addition, small the mRNA and silence it (Fig. 2833b). The process is
RNA molecules may play a critical (but still undefined) known as RNA interference (RNAi). In plants, virtu-
role in the formation of heterochromatin. ally any gene can be effectively shut down in this way.
The small RNAs are sometimes called micro-RNAs In nematodes, simply introducing the duplex RNA into
(miRNAs). Many are present only transiently during the worms diet produces very effective suppression of
development, and these are sometimes referred to as the target gene. The technique has rapidly become an
small temporal RNAs (stRNAs). Hundreds of different important tool in the ongoing efforts to study gene func-
miRNAs have been identified in higher eukaryotes. They tion, because it can disrupt gene function without cre-
are transcribed as precursor RNAs about 70 nucleotides ating a mutant organism. The procedure can be applied
long, with internally complementary sequences that to humans as well. Laboratory-produced siRNAs have
form hairpinlike structures (Fig. 2833). The precursors already been used to block HIV and poliovirus infections
are cleaved by endonucleases to form short duplexes in cultured human cells for a week or so at a time. Al-
about 20 to 25 nucleotides long. The best-characterized though this work is in its infancy, the rapid progress
nuclease goes by the delightfully suggestive name Dicer; makes RNA interference a field to watch for future med-
endonucleases in the Dicer family are widely distributed ical advances.
in higher eukaryotes. One strand of the processed
miRNA is transferred to the target mRNA (or to a viral Development Is Controlled by Cascades
or transposon RNA), leading to inhibition of translation of Regulatory Proteins
or degradation of the RNA (Fig. 2833a).
This gene regulation mechanism has an interesting For sheer complexity and intricacy of coordination, the
and very useful practical side. If an investigator intro- patterns of gene regulation that bring about develop-
duces into an organism a duplex RNA molecule corre- ment of a zygote into a multicellular animal or plant have
sponding in sequence to virtually any mRNA, the Dicer no peer. Development requires transitions in morphol-
endonuclease cleaves the duplex into short segments, ogy and protein composition that depend on tightly co-
ordinated changes in expression of the genome. More
genes are expressed during early development than in
(a) (b) any other part of the life cycle. For example, in the sea
urchin, an oocyte has about 18,500 different mRNAs,
compared with about 6,000 different mRNAs in the cells
of a typical differentiated tissue. The mRNAs in the
Precursor Duplex RNA
Dicer Dicer oocyte give rise to a cascade of events that regulate the
expression of many genes across both space and time.
Several animals have emerged as important model
stRNA siRNA systems for the study of development, because they are
easy to maintain in a laboratory and have relatively short
generation times. These include nematodes, fruit flies,
zebra fish, mice, and the plant Arabidopsis. This dis-
cussion focuses on the development of fruit flies. Our
understanding of the molecular events during develop-
ment of Drosophila melanogaster is particularly well
advanced and can be used to illustrate patterns and
principles of general significance.
Silenced mRNA AAA(A)n
The life cycle of the fruit fly includes complete
metamorphosis during its progression from an embryo
to an adult (Fig. 2834). Among the most important
Degradation Translation characteristics of the embryo are its polarity (the an-
inhibition terior and posterior parts of the animal are readily dis-
FIGURE 2833 Gene silencing by RNA interference. (a) Small tem- tinguished, as are its dorsal and ventral parts) and its
poral RNAs (stRNAs) are generated by Dicer-mediated cleavage of metamerism (the embryo body is made up of serially
longer precursors that fold to create duplex regions. The stRNAs then repeating segments, each with characteristic features).
bind to mRNAs, leading to degradation of mRNA or inhibition of trans- During development, these segments become organized
lation. (b) Double-stranded RNAs can be constructed and introduced into a head, thorax, and abdomen. Each segment of the
into a cell. Dicer processes the duplex RNAs into small interfering adult thorax has a different set of appendages. Devel-
RNAs (siRNAs), which interact with the target mRNA. Again, the mRNA opment of this complex pattern is under genetic con-
is either degraded or its translation inhibited. trol, and a variety of pattern-regulating genes have been
Late embryosegmented
Day 1
Early embryo hatching
three larval stages,
no segments separated by molts
embryonic
development Larva
T1 T2 T3 A1 A2 A3 A4 A5 A6 A7
Day 0 Egg
Day 5
fertilization pupation
Oocyte
Head Thorax Abdomen
Pupa
FIGURE 2834 Life cycle of the fruit fly Drosophila
melanogaster. Drosophila undergoes a complete metamorphosis
metamorphosis, which means that the adult insect is
radically different in form from its immature stages, a
transformation that requires extensive alterations
during development. By the late embryonic stage, Adult
Day 9
segments have formed, each containing specialized
structures from which the various appendages and 1 mm
other features of the adult fly will develop.
discovered that dramatically affect the organization of tures of the Drosophila embryos body. Maternal
the body. genes are expressed in the unfertilized egg, and the
The Drosophila egg, along with 15 nurse cells, is resulting maternal mRNAs remain dormant until fer-
surrounded by a layer of follicle cells (Fig. 2835). As tilization. These provide most of the proteins needed in
the egg cell forms (before fertilization), mRNAs and pro- very early development, until the cellular blastoderm is
teins originating in the nurse and follicle cells are de- formed. Some of the proteins encoded by maternal
posited in the egg cell, where some play a critical role mRNAs direct the spatial organization of the develop-
in development. Once a fertilized egg is laid, its nucleus ing embryo at early stages, establishing its polarity.
divides and the nuclear descendants continue to divide Segmentation genes, transcribed after fertilization,
in synchrony every 6 to 10 min. Plasma membranes are direct the formation of the proper number of body seg-
not formed around the nuclei, which are distributed ments. At least three subclasses of segmentation genes
within the egg cytoplasm (or syncytium). Between the act at successive stages: gap genes divide the devel-
eighth and eleventh rounds of nuclear division, the nu- oping embryo into several broad regions, and pair-rule
clei migrate to the outer layer of the egg, forming a genes together with segment polarity genes define
monolayer of nuclei surrounding the common yolk-rich 14 stripes that become the 14 segments of a normal em-
cytoplasm; this is the syncytial blastoderm. After a few bryo. Homeotic genes are expressed still later; they
additional divisions, membrane invaginations surround specify which organs and appendages will develop in
the nuclei to create a layer of cells that form the cellu- particular body segments.
lar blastoderm. At this stage, the mitotic cycles in the The many regulatory genes in these three classes
various cells lose their synchrony. The developmental direct the development of an adult fly, with a head, tho-
fate of the cells is determined by the mRNAs and pro- rax, and abdomen, with the proper number of segments,
teins originally deposited in the egg by the nurse and and with the correct appendages on each segment. Al-
follicle cells. though embryogenesis takes about a day to complete,
Proteins that, through changes in local concentra- all these genes are activated during the first four hours.
tion or activity, cause the surrounding tissue to take up Some mRNAs and proteins are present for only a few
a particular shape or structure are sometimes referred minutes at specific points during this period. Some of
to as morphogens; they are the products of pattern- the genes code for transcription factors that affect the
regulating genes. As defined by Christiane Nsslein- expression of other genes in a kind of developmental
Volhard, Edward B. Lewis, and Eric F. Wieschaus, three cascade. Regulation at the level of translation also oc-
major classes of pattern-regulating genesmaternal, curs, and many of the regulatory genes encode transla-
segmentation, and homeotic genesfunction in suc- tional repressors, most of which bind to the 3UTR of
cessive stages of development to specify the basic fea- the mRNA (Fig. 2832). Because many mRNAs are
Nurse cells
Oocyte deposited in the egg long before their translation is
required, translational repression provides an especially
Follicle cells Egg chamber important avenue for regulation in developmental
pathways.
Maternal Genes Some maternal genes are expressed

Oocyte within the nurse and follicle cells, and some in the egg
itself. Within the unfertilized Drosophila egg, the mater-
Nurse nanos
cells mRNA
nal gene products establish two axesanterior-posterior
and dorsal-ventraland thus define which regions of the
bicoid mRNA radially symmetric egg will develop into the head and ab-
domen and the top and bottom of the adult fly. A key
event in very early development is establishment of
Follicle cells
mRNA and protein gradients along the body axes. Some
maternal mRNAs have protein products that diffuse
Oocyte
through the cytoplasm to create an asymmetric distribu-
tion in the egg. Different cells in the cellular blastoderm
therefore inherit different amounts of these proteins,
setting the cells on different developmental paths. The
products of the maternal mRNAs include transcriptional
activators or repressors as well as translational rep-
Egg ressors, all regulating the expression of other pattern-
regulating genes. The resulting specific patterns and
sequences of gene expression therefore differ between
cell lineages, ultimately orchestrating the development of
fertilization each adult structure.
The anterior-posterior axis in Drosophila is defined
at least in part by the products of the bicoid and nanos
Fertilized genes. The bicoid gene product is a major anterior
egg morphogen, and the nanos gene product is a major
posterior morphogen. The mRNA from the bicoid gene
is synthesized by nurse cells
nuclear and deposited in the unfertil-
divisions ized egg near its anterior pole.
Nsslein-Volhard found that
this mRNA is translated soon
Syncytium
after fertilization, and the Bi-
coid protein diffuses through
nuclear
migration
Christiane Nsslein-Volhard
Syncytial
blastoderm
Pole cells FIGURE 2835 Early development in Drosophila. During develop-
ment of the egg, maternal mRNAs (including the bicoid and nanos
membrane
invagination gene transcripts, discussed in the text) and proteins are deposited in
the developing oocyte (unfertilized egg cell) by nurse cells and folli-
cle cells. After fertilization, the two nuclei of the fertilized egg divide
in synchrony within the common cytoplasm (syncytium), then migrate
Cellular
to the periphery. Membrane invaginations surround the nuclei to cre-
blastoderm
ate a monolayer of cells at the periphery; this is the cellular blasto-
derm stage. During the early nuclear divisions, several nuclei at the
far posterior become pole cells, which later become the germ-line
Anterior Posterior cells.
(a) (b)
Normal egg bcd/bcd egg
100 100
Relative concentration
Relative concentration
of Bicoid (Bcd) protein

of Bicoid (Bcd) protein
Normal bcd/ bcd mutant
0 0
0 50 100 0 50 100
Distance from anterior end Distance from anterior end
(% of egg length) (% of egg length)
Normal larva Double-posterior larva
FIGURE 2836 Distribution of a maternal gene product in a ment of the anterior structures of the animal. (b) If the bcd gene is not
Drosophila egg. (a) Micrograph of an immunologically stained egg, expressed by the mother (bcd/bcd mutant) and thus no bicoid
showing distribution of the bicoid (bcd) gene product. The graph meas- mRNA is deposited in the egg, the resulting embryo has two posteri-
ures stain intensity. This distribution is essential for normal develop- ors (and soon dies).
the cell to create, by the seventh nuclear division, a A broader look at the effects of maternal genes re-
concentration gradient radiating out from the anterior veals the outline of a developmental circuit. In addition
pole (Fig. 2836a). The Bicoid protein is a transcription to the bicoid and nanos mRNAs, which are deposited
factor that activates the expression of a number of seg- in the egg asymmetrically, a number of other maternal
mentation genes; the protein contains a homeodomain mRNAs are deposited uniformly throughout the egg cy-
(p. 1090). Bicoid is also a translational repressor that in- toplasm. Three of these mRNAs encode the Pumilio,
activates certain mRNAs. The amounts of Bicoid protein Hunchback, and Caudal proteins, all affected by nanos
in various parts of the embryo affect the subsequent ex- and bicoid (Fig. 2837). Caudal and Pumilio are in-
pression of a number of other genes in a threshold- volved in development of the posterior end of the fly.
dependent manner. Genes are transcriptionally activated Caudal is a transcriptional activator with a home-
or translationally repressed only where the Bicoid protein odomain; Pumilio is a translational repressor. Hunch-
concentration exceeds the threshold. Changes in the back protein plays an important role in the development
shape of the Bicoid concentration gradient have dramatic of the anterior end and is also a transcriptional regula-
effects on the body pattern. Lack of Bicoid protein results tor of a variety of genes, in some cases a positive regu-
in development of an embryo with two abdomens but nei- lator, in other cases negative. Bicoid suppresses trans-
ther head nor thorax (Fig. 2836b); however, embryos lation of caudal in the anterior and also acts as a
without Bicoid will develop normally if an adequate transcriptional activator of hunchback in the cellular
amount of bicoid mRNA is injected into the egg at the ap- blastoderm. Because hunchback is expressed both from
propriate end. The nanos gene has an analogous role, but maternal mRNAs and from genes in the developing egg,
its mRNA is deposited at the posterior end of the egg and it is considered both a maternal and a segmentation
the anterior-posterior protein gradient peaks at the pos- gene. The result of the activities of Bicoid is an increased
terior pole. The Nanos protein is a translational repressor. concentration of Hunchback at the anterior end of the
stages of embryonic development. Expression of the gap

Localized Localized genes is generally regulated by the products of one or
bicoid nanos
mRNA mRNA more maternal genes. At least some of the gap genes
encode transcription factors that affect the expression
translation of mRNA and
diffusion of product creates
of other segmentation or (later) homeotic genes.
concentration gradients One well-characterized segmentation gene is fushi
Bicoid tarazu ( ftz), of the pair-rule subclass. When ftz is
protein Nanos
protein deleted, the embryo develops 7 segments instead of the
normal 14, each segment twice the normal width. The
translation suppression/activation Fushi-tarazu protein (Ftz) is a transcriptional activator
of uniformly distributed mRNAs
reflects gradient of regulator with a homeodomain. The mRNAs and proteins derived
from the normal ftz gene accumulate in a striking pat-
caudal mRNA
tern of seven stripes that encircle the posterior two-
thirds of the embryo (Fig. 2838). The stripes demar-
Posterior
Anterior
cate the positions of segments that develop later; these

Caudal protein segments are eliminated if ftz function is lost. The Ftz
protein and a few similar regulatory proteins directly or
hunchback mRNA indirectly regulate the expression of vast numbers of
genes in the continuing developmental cascade.
Hunchback protein
pumilio mRNA
Pumilio protein
Egg cytoplasm
(a)
FIGURE 2837 Regulatory circuits of the anterior-posterior axis in
a Drosophila egg. The bicoid and nanos mRNAs are localized near
the anterior and posterior poles, respectively. The caudal, hunchback,
and pumilio mRNAs are distributed throughout the egg cytoplasm. The
gradients of Bicoid (Bcd) and Nanos proteins lead to accumulation of
Hunchback protein in the anterior and Caudal protein in the poste-
rior of the egg. Because Pumilio protein requires Nanos protein for its
activity as a translational repressor of hunchback, it functions only at
the posterior end.
(b) 100 m
egg. The Nanos and Pumilio proteins act as translational

repressors of hunchback, suppressing synthesis of its
protein near the posterior end of the egg. Pumilio does
not function in the absence of the Nanos protein, and
the gradient of Nanos expression confines the activity
of both proteins to the posterior region. Translational
repression of the hunchback gene leads to degradation
of hunchback mRNA near the posterior end. However, (c)
lack of Bicoid protein in the posterior leads to expres- FIGURE 2838 Distribution of the fushi tarazu (ftz) gene product in
sion of caudal. In this way, the Hunchback and Caudal early Drosophila embryos. (a) In the normal embryo, the gene prod-
proteins become asymmetrically distributed in the egg. uct can be detected in seven bands around the circumference of the
embryo (shown schematically). These bands (b) appear as dark spots
Segmentation Genes Gap genes, pair-rule genes, and (generated by a radioactive label) in a cross-sectional autoradiograph
segment polarity genes, three subclasses of segmenta- and (c) demarcate the anterior margins of the segments in the late em-
tion genes in Drosophila, are activated at successive bryo (marked in red).
(c)
(b)
(a)
FIGURE 2839 Effects of mutations in homeotic genes in Drosophila. (a) Normal head.
(b) Homeotic mutant (antennapedia) in which antennae are replaced by legs. (c) Normal (d)
body structure. (d) Homeotic mutant (bithorax) in which a segment has developed incor-
rectly to produce an extra set of wings.
Homeotic Genes Loss of homeotic genes by mutation or SUMMARY 28.3 Regulation of Gene Expression
deletion causes the appearance of a normal appendage in Eukaryotes
or body structure at an inappropriate body position. An
important example is the ultrabithorax (ubx) gene. In eukaryotes, positive regulation is more
When Ubx function is lost, the first abdominal segment common than negative regulation, and
develops incorrectly, having the structure of the third transcription is accompanied by large changes
thoracic segment. Other known homeotic mutations in chromatin structure. Promoters for Pol II
cause the formation of an extra set of wings, or two legs typically have a TATA box and Inr sequence, as
at the position in the head where the antennae are nor- well as multiple binding sites for DNA-binding
mally found (Fig. 2839). transactivators. The latter sites, sometimes
The homeotic genes often span long regions of DNA. located hundreds or thousands of base pairs
The ubx gene, for example, is 77,000 bp long. More than away from the TATA box, are called upstream
73,000 bp of this gene are in introns, one of which is activator sequences in yeast and enhancers in
more than 50,000 bp long. Transcription of the ubx gene higher eukaryotes.
takes nearly an hour. The delay this imposes on ubx
gene expression is believed to be a timing mechanism Large complexes of proteins are generally
involved in the temporal regulation of subsequent steps required to regulate transcriptional activity.
in development. The Ubx protein is yet another tran- The effects of DNA-binding transactivators on
scriptional activator with a homeodomain (Fig. 2813). Pol II are mediated by coactivator protein
Many of the principles of development outlined complexes such as TFIID or mediator. The
above apply to eukaryotes from nematodes to humans. modular structures of the transactivators have
Some of the regulatory proteins themselves are con- distinct activation and DNA-binding domains.
served. For example, the products of the homeobox- Other protein complexes, including histone
containing genes HOX 1.1 in mouse and antennapedia acetyltransferases such as GCN5-ADA2-ADA3
in fruit fly differ in only one amino acid residue. Of and ATP-dependent complexes such as
course, although the molecular regulatory mechanisms SWI/SNF and NURF, reversibly remodel
may be similar, many of the ultimate developmental chromatin structure.
events are not conserved (humans do not have wings Hormones affect the regulation of gene
or antennae). The discovery of structural determinants expression in one of two ways. Steroid
with identifiable molecular functions is the first step in hormones interact directly with intracellular
understanding the molecular events underlying devel- receptors that are DNA-binding regulatory
opment. As more genes and their protein products are proteins; binding of the hormone has either
discovered, the biochemical side of this vast puzzle will positive or negative effects on the transcription
be elucidated in increasingly rich detail. of genes targeted by the hormone. Nonsteroid
Chapter 28 Further Reading 1117
hormones bind to cell-surface receptors, of proteins that act as transcriptional

triggering a signaling pathway that can lead to transactivators or translational repressors,
phosphorylation of a regulatory protein, regulating the genes required for the
affecting its activity. development of structures appropriate to a
Development of a multicellular organism particular part of the organism. Sets of
presents the most complex regulatory regulatory genes operate in temporal and
challenge. The fate of cells in the early embryo spatial succession, transforming given areas of
is determined by establishment of an egg cell into predictable structures in the
anterior-posterior and dorsal-ventral gradients adult organism.
Key Terms
Terms in bold are defined in the glossary.
housekeeping genes 1082 leucine zipper 1090 chromatin remodeling ments (HREs) 1108
induction 1082 basic helix-loop-helix 1090 1103 RNA interference (RNAi)
repression 1082 catabolite repression enhancers 1104 1111
specificity factor 1083 1093 upstream activator se- polarity 1111
repressor 1083 cAMP receptor protein quences (UASs) 1104 metamerism 1111
activator 1083 (CRP) 1093 basal transcription morphogens 1112
operator 1083 regulon 1094 factors 1104 maternal genes 1112
negative regulation 1084 transcription attenuation DNA-binding maternal mRNAs 1112
positive regulation 1084 1094 transactivators 1104 segmentation genes 1112
operon 1085 translational coactivators 1104 gap genes 1112
helix-turn-helix 1088 repressor 1098 TATA-binding protein pair-rule genes 1112
zinc finger 1088 stringent response 1098 (TBP) 1104 segment polarity genes
homeodomain 1090 phase variation 1100 mediator 1105 1112
homeobox 1090 hypersensitive sites 1102 hormone response ele- homeotic genes 1112
Further Reading
General Regulation of Gene Expression in Prokaryotes
Hershey, J.W.B., Mathews, M.B., & Sonenberg, N. (1996) Condon, C., Squires, C., & Squires, C.L. (1995) Control of rRNA
Translational Control, Cold Spring Harbor Laboratory Press, Cold transcription in Escherichia coli. Microbiol. Rev. 59, 623645.
Spring Harbor, NY.
Gourse, R.L., Gaal, T., Bartlett, M.S., Appleman, J.A., &
Many detailed reviews cover all aspects of this topic.
Ross, W. (1996) rRNA transcription and growth ratedependent
Mller-Hill, B. (1996) The lac Operon: A Short History of a regulation of ribosome synthesis in Escherichia coli. Annu. Rev.
Genetic Paradigm, Walter de Gruyter, New York. Microbiol. 50, 645677.
An excellent detailed account of the investigation of this
Jacob, F. & Monod, J. (1961) Genetic regulatory mechanisms in
important system.
the synthesis of proteins. J. Mol. Biol. 3, 318356.
Neidhardt, F.C. (ed.) (1996) Escherichia coli and Salmonella The operon model and the concept of messenger RNA, first
typhimurium, 2nd edn, Vol. 1: Cellular and Molecular Biology proposed in the Proceedings of the French Academy of
(Curtiss, R., Ingraham, J.L., Lin, E.C.C., Magasanik, B., Low, K.B., Sciences in 1960, are presented in this historic paper.
Reznikoff, W.S., Riley, M., Schaechter, M., & Umbarger, H.E., vol.
Johnson, R.C. (1991) Mechanism of site-specific DNA inversion
eds), American Society for Microbiology, Washington, DC.
in bacteria. Curr. Opin. Genet. Dev. 1, 404411.
An excellent source for reviews of many bacterial operons. The
Web-based version, EcoSal, is updated regularly. Kolb, A., Busby, S., Buc, H., Garges, S., & Adhya, S. (1993)
Transcriptional regulation by cAMP and its receptor protein.
Pabo, C.O. & Sauer, R.T. (1992) Transcription factors: structural
Annu. Rev. Biochem. 62, 749795.
factors and principles of DNA recognition. Annu. Rev. Biochem.
61, 10531095. Romby, P. & Springer, M. (2003) Bacterial translational control
at atomic resolution. Trends Genet. 19, 155161.
Schleif, R. (1993) Genetics and Molecular Biology, 2nd edn,
The Johns Hopkins University Press, Baltimore. Yanofsky, C., Konan, K.V., & Sarsero, J.P. (1996) Some novel
Provides an excellent account of the experimental basis of transcription attenuation mechanisms used by bacteria. Biochimie
important concepts of prokaryotic gene regulation. 78, 10171024.
Regulation of Gene Expression in Eukaryotes Hannon, G.J. (2002) RNA interference. Nature 418, 244251.
Agami, R. (2002) RNAi and related mechanisms and their Luger, K. (2003) Structure and dynamic behavior of nucleosomes.
potential use for therapy. Curr. Opin. Chem. Biol. 6, 829834. Curr. Opin. Genet. Dev. 13, 127135.
Bashirullah, A., Cooperstock, R.L., & Lipshitz, H.D. (1998) Mannervik, M., Nibu, Y., Zhang, H., & Levine, M. (1999)
RNA localization in development. Annu. Rev. Biochem. 67, Transcriptional coregulators in development. Science 284,
335394. 606609.
Becker, P.B. & Horz W. (2002) ATP-dependent nucleosome Martens, J.A. & Winston, F. (2003) Recent advances in
remodeling. Annu. Rev. Biochem. 71, 247273. understanding chromatin remodeling by Swi/Snf complexes. Curr.
Boube, M., Joulia, L., Cribbs, D.L., & Bourbon, H.M. (2002) Opin. Genet. Dev. 13, 136142.
Evidence for a mediator of RNA polymerase II transcriptional McKnight, S.L. (1991) Molecular zippers in gene regulation. Sci.
regulation conserved from yeast to man. Cell 110, 143151. Am. 264 (April), 5464.
Cerutti, H. (2003) RNA interference: traveling in the cell and A good description of leucine zippers.
gaining functions? Trends Genet. 19, 946. Melton, D.A. (1991) Pattern formation during animal
Conaway, R.C., Brower, C.S., & Conaway, J.W. (2002) Gene development. Science 252, 234241.
expressionemerging roles of ubiquitin in transcription regulation. Muller, W.A. (1997) Developmental Biology, Springer, New York.
Science 296, 12541258. A good elementary text.
Cosma, M.P. (2002) Ordered recruitment: gene-specific Myers, L.C. & Kornberg, R.D. (2000) Mediator of transcriptional
mechanism of transcription activation. Mol. Cell 10, 227236. regulation. Annu. Rev. Biochem. 69, 729749.
Dean, K.A., Aggarwal, A.K., & Wharton, R.P. (2002) Reese, J.C. (2003) Basal transcription factors. Curr. Opin.
Translational repressors in Drosophila. Trends Genet. 18, Genet. Dev. 13, 114118.
572577.
Rivera-Pomar, R. & Jackle, H. (1996) From gradients to stripes
DeRobertis, E.M., Oliver, G., & Wright, C.V.E. (1990) in Drosophila embryogenesis: filling in the gaps. Trends Genet.
Homeobox genes and the vertebrate body plan. Sci. Am. 263 12, 478483.
(July), 4652.
Struhl, K. (1999) Fundamentally different logic of gene regulation
Edmondson, D.G. & Roth, S.Y. (1996) Chromatin and in eukaryotes and prokaryotes. Cell 98, 14.
transcription. FASEB J. 10, 11731182.
Waterhouse, P.M. & Helliwell, C.A. (2003) Exploring plant
Gingras, A.-C., Raught, B., & Sonenberg, N. (1999) eIF4 genomes by RNA-induced gene silencing. Nat. Rev. Genet. 4,
initiation factors: effectors of mRNA recruitment to ribosomes and 2938.
regulators of translation. Annu. Rev. Biochem. 68, 913963.
Gray, N.K. & Wickens, M. (1998) Control of translation initiation
in animals. Annu. Rev. Cell Dev. Biol. 14, 399458.
Problems
1. Effect of mRNA and Protein Stability on Regula- 3. Specific DNA Binding by Regulatory Proteins A
tion E. coli cells are growing in a medium with glucose as typical prokaryotic repressor protein discriminates between
the sole carbon source. Tryptophan is suddenly added. The its specific DNA binding site (operator) and nonspecific DNA
cells continue to grow, and divide every 30 min. Describe by a factor of 104 to 106. About 10 molecules of repressor per
(qualitatively) how the amount of tryptophan synthase cell are sufficient to ensure a high level of repression. Assume
activity in the cells changes with time under the following that a very similar repressor existed in a human cell, with a
conditions: similar specificity for its binding site. How many copies of the
(a) The trp mRNA is stable (degraded slowly over many repressor would be required to elicit a level of repression sim-
hours). ilar to that in the prokaryotic cell? (Hint: The E. coli genome
(b) The trp mRNA is degraded rapidly, but tryptophan contains about 4.6 million bp; the human haploid genome has
synthase is stable. about 3.2 billion bp.)
(c) The trp mRNA and tryptophan synthase are both
4. Repressor Concentration in E. coli The dissociation
degraded rapidly.
constant for a particular repressor-operator complex is very
2. Negative Regulation Describe the probable effects on low, about 1013 M. An E. coli cell (volume 2 1012 mL)
gene expression in the lac operon of a mutation in (a) the contains 10 copies of the repressor. Calculate the cellular con-
lac operator that deletes most of O1; (b) the lacI gene that centration of the repressor protein. How does this value com-
inactivates the repressor; and (c) the promoter that alters pare with the dissociation constant of the repressor-operator
the region around position 10. complex? What is the significance of this result?
Chapter 28 Problems 1119
5. Catabolite Repression E. coli cells are growing in a 10. Functional Domains in Regulatory Proteins A bio-
medium containing lactose but no glucose. Indicate whether chemist replaces the DNA-binding domain of the yeast Gal4
each of the following changes or conditions would increase, protein with the DNA-binding domain from the Lac repres-
decrease, or not change the expression of the lac operon. It sor, and finds that the engineered protein no longer regulates
may be helpful to draw a model depicting what is happening transcription of the GAL genes in yeast. Draw a diagram of
in each situation. the different functional domains you would expect to find in
(a) Addition of a high concentration of glucose the Gal4 protein and in the engineered protein. Why does the
(b) A mutation that prevents dissociation of the Lac re- engineered protein no longer regulate transcription of the
pressor from the operator GAL genes? What might be done to the DNA-binding site rec-
(c) A mutation that completely inactivates -galactosi- ognized by this chimeric protein to make it functional in ac-
dase tivating transcription of GAL genes?
(d) A mutation that completely inactivates galactoside
11. Inheritance Mechanisms in Development A
permease
Drosophila egg that is bcd/bcd may develop normally but
(e) A mutation that prevents binding of CRP to its bind-
as an adult will not be able to produce viable offspring.
ing site near the lac promoter
Explain.
6. Transcription Attenuation How would transcription
of the E. coli trp operon be affected by the following manip- Biochemistry on the Internet
ulations of the leader region of the trp mRNA? 12. TATA Binding Protein and the TATA Box To ex-
(a) Increasing the distance (number of bases) between amine the interactions between transcription factors and
the leader peptide gene and sequence 2 DNA, go to the Protein Data Bank (www.rcsb.org/pdb) and
(b) Increasing the distance between sequences 2 and 3 download the PDB file 1TGH. This file models the interac-
(c) Removing sequence 4 tions between a human TATA-binding protein and a segment
(d) Changing the two Trp codons in the leader peptide of double-stranded DNA. Use the Noncovalent Bond Finder
gene to His codons at the Chime Resources website (www.umass.edu/microbio/
(e) Eliminating the ribosome-binding site for the gene chime) to examine the roles of hydrogen bonds and hydro-
that encodes the leader peptide phobic interactions involved in the binding of this transcrip-
(f) Changing several nucleotides in sequence 3 so that tion factor to the TATA box.
it can base-pair with sequence 4 but not with sequence 2 Within the Noncovalent Bond Finder program, load the
7. Repressors and Repression How would the SOS re- PDB file and display the protein in Spacefill mode and the
sponse in E. coli be affected by a mutation in the lexA gene DNA in Wireframe mode.
that prevented autocatalytic cleavage of the LexA protein? (a) Which of the base pairs in the DNA form hydrogen
bonds with the protein? Which of these contribute to the spe-
8. Regulation by Recombination In the phase variation cific recognition of the TATA box by this protein? (Hydrogen-
system of Salmonella, what would happen to the cell if the bond length between hydrogen donor and hydrogen accep-
Hin recombinase became more active and promoted re- tor ranges from 2.5 to 3.3 .)
combination (DNA inversion) several times in each cell (b) Which amino acid residues in the protein interact
generation? with these base pairs? On what basis did you make this de-
termination? Do these observations agree with the informa-
9. Initiation of Transcription in Eukaryotes A new
tion presented in the text?
RNA polymerase activity is discovered in crude extracts of
(c) What is the sequence of the DNA in this model and
cells derived from an exotic fungus. The RNA polymerase ini-
which portions of the sequence are recognized by the TATA-
tiates transcription only from a single, highly specialized pro-
binding protein?
moter. As the polymerase is purified its activity declines, and
(d) Can you identify any hydrophobic interactions in
the purified enzyme is completely inactive unless crude ex-
this complex? (Hydrophobic interactions usually occur with
tract is added to the reaction mixture. Suggest an explana-
interatomic distances of 3.3 to 4.0 .)
tion for these observations.

28

Uploaded by

Copyright:

Available Formats

28

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

28

Uploaded by

Copyright:

Available Formats

8885d_c28_1081-1119 2/12/04 2:28 PM Page 1081 mac76 mac76:385_reb:

1082 Chapter 28 Regulation of Gene Expression

Gene of coordination occurs in the complex regulatory circuits

28.1 Principles of Gene Regulation 1083

RNA start site

RNA start site

DNA 5 TNTCNCCCTTGAA N1315 CCCCATTTA N7

1084 Chapter 28 Regulation of Gene Expression

Negative regulation Positive regulation

(a) (c) RNA polymerase

28.1 Principles of Gene Regulation 1085

Regulatory sequences Genes transcribed as a unit

FIGURE 285 Representative prokaryotic operon. Genes A, B, and

1086 Chapter 28 Regulation of Gene Expression

(a) DNA PI I O3 P O1 Z O2 Y A Operators

28.1 Principles of Gene Regulation 1087

Major groove Major groove Major groove Major groove

Adenine Thymine Guanine Cytosine Thymine Adenine Cytosine Guanine

1088 Chapter 28 Regulation of Gene Expression

H O To interact with bases in the major groove of DNA,

28.1 Principles of Gene Regulation 1089

1090 Chapter 28 Regulation of Gene Expression

Zinc Finger In a zinc finger, about 30 amino acid

Regulatory Proteins Also Have Protein-Protein

28.1 Principles of Gene Regulation 1091

(a) Invariant Asn

FIGURE 2814 Leucine zippers. (a) Comparison of

1092 Chapter 28 Regulation of Gene Expression

(negative regulation) or activate transcription

28.2 Regulation of Gene Expression in Prokaryotes 1093

The lac Operon Undergoes Positive Regulation

CRP site Bound by RNA polymerase 5 3 mRNA

lac promoter TTTACA TATGTT

Promoter TTGACA TATAAT

1094 Chapter 28 Regulation of Gene Expression

(a) cAMP Lac RNA polymerase

28.2 Regulation of Gene Expression in Prokaryotes 1095

DNA trpR P O trpE trpD trpC trpB trpA

Regulatory region Regulated genes

Anthranilate Anthranilate Tryptophan Tryptophan

Anthranilate N-(5-Phosphoribosyl)- Tryptophan synthase

Chorismate Anthranilate N-(5-Phosphoribosyl)- Enol-1-o-carboxy- Indole-3-glycerol L-Tryptophan

form a GqC-rich stem-and-loop structure closely fol-

28.2 Regulation of Gene Expression in Prokaryotes 1097

polB dinB uvrB

FIGURE 2822 SOS response in E. coli. See Table

1098 Chapter 28 Regulation of Gene Expression

28.2 Regulation of Gene Expression in Prokaryotes 1099

operon 5 L10 L7/L12 3

str operon 5 S12 S7 EF-G EF-Tu 3

S10 operon 5 S10 L3 L4 L23 L2 (L22, S19) S3 L16 L29 S17 3

spc operon 5 L14 L24 L5 S14 S8 L6 L18 S5 L30 L15 3

1100 Chapter 28 Regulation of Gene Expression

The nucleotide ppGpp, along with cAMP, belongs to

Some Genes Are Regulated

Inverted repeat (hix)

hin mRNA fljB and fljA mRNA

FIGURE 2826 Regulation of flagellin genes

28.2 Regulation of Gene Expression in Prokaryotes 1101