Proceeding ISVM2015c

SCIENTIFIC VETERINARY INSTITUTE NOVI SAD
INSTITUTE OF VETERINARY MEDICINE OF SERBIA
One Health New Challenges
First International Symposium of

Veterinary Medicine
(ISVM2015)
PROCEEDINGS
Hotel "Premier Aqua" - Vrdnik

May 21 23, 2015
First International Symposium of Veterinary Medicine ISVM2015
Publisher
Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia
For the Publisher

Prof Dr Miroslav irkovi, Principal Research Felow
Editor in Chief
Dr Tama Petrovi, Senior Research Associate
Technical Editor
Printed by
Multidizajn, Novi Sad
250 copies
Novi Sad, 2015
ISBN: 978-86-82871-36-1
ORGANISERS
SCIENTIFIC VETERINARY INSTITUTE NOVI SAD
and
INSTITUTE OF VETERINARY MEDICINE OF SERBIA
CO-ORGANISERS and SUPPORTERS

MINISTRY OF EDUCATION SCIENCE AND TECHNOLOGICAL DEVELOPMENT
PROVINCIAL SECRETARIAT FOR SCIENCE AND TECHNOLOGICAL DEVELOPMENT
MINISTRY OF AGRICULTURE AND ENVIRONMENTAL PROTECTION
GENERAL SPONSOR
FISH Corp.2000 d.o.o.

SPONSORS
GLOBOS Osiguranje a.d.o.
NOACK
ALEA I.A.
SANO
ORGANIZING COMMITTEE
Dr Miroslav irkovi, Principal Research Fellow - President
Dr Dobrila Jaki-Dimi,Principal Research Fellow
Dr Vladimir Polaek, Research Associate
Dr Branka Vidi, Principal Research Fellow
Dr Jadranka uti, Research Associate
Dr Sava Lazi, Principal Research Fellow
Dr Milica ivkov-Balo, Senior Research Associate
Dr Jelena Petrovi, Senior Research Associate
Dr Vladimir Radosavljevi, Research Associate
Dr Dragana Ljubojevi, Research Associate
Dr Sara Savi, Research Associate
Petar Bakmaz, secretary of Organizing Committee
TECHNICAL SECRETARIAT
Jelena Babi, DVM, MSc, Research Assistant
Biljana Boin, DVM, MSc, Research Trainee
Nikola Bakmaz, Secretary
Dobrisav Vukovi, IT engineer
Vera Proki, librarian
SCIENTIFIC COMMITTEE
Dr Tama Petrovi, Senior Research Associate President (Serbia)
Dr Miroslav irkovi, Principal Research Fellow (Serbia)
Dr Dubravka Milanov,Senior Research Associate(Serbia)
Dr Dobrila Jaki-Dimi,Principal Research Fellow (Serbia)
Dr Tania Hubenova, professor (Bulgaria)
Dr Theresa Bernardo, Principal Research Fellow (USA)
Dr Igor Stojanov, Senior Research Associate (Serbia)
Dr Branka Vidi, Principal Research Fellow (Serbia)
Dr Sara Savi, Research Associate (Serbia)
Dr Tama Bakonyi, Principal Research Fellow (Hungary)
Dr Dejan Bugarski, Research Associate (Serbia)
Dr Sava Lazi, Principal Research Fellow (Serbia)
Dr Vladimir Polaek, Research Associate (Serbia)
Dr Duan Orli, Principal Research Fellow (Serbia)
Dr Marjana Todorevi, Postdoc.Research Assistant(UK)
Dr Juan Carlos Saiz, Principal Research Fellow (Spain)
Dr Jadranka uti, Research Associate (Serbia)
Dr Ivan Pavlovi, Principal Research Fellow (Serbia)
Dr Miroslav Uroevi, Research Associate (Serbia)
Dr Vladimir Radosavljevi, Research Associate (Serbia)
Dr Jasna Prodanov Radulovi,ResearchAssociate (Serbia)
Dr Aleksandar Mai, Adjunct professor (Canada)
Dr Petr Kralik, Research Associate (Czech Republic)
Dr Stanko Bobo, professor (Serbia)
Dr Dragana Dimitrijevi , PhD (Serbia)
Dr Maja Velhner, Principal Research Fellow (Serbia)
Dr Bojana Grgi, MSc (Serbia)
Dr Aymeric Hans, Senior Research Associate (France)
Dr Milovan Joviin, Research Associate (Serbia)
Dr Vesna Miloevi, professor (Serbia)
Dr Radomir Ratajac, Research Associate (Serbia)
Dr Duan Laloevi, professor (Serbia)
Dr Dragana Ljubojevi, Research Associate (Serbia)
Dr Ivan Bogut, professor (Croatia)
Dr ivoslav Grgi, Research Associate (Serbia)
Dr Milica ivkov-Balo,Senior ResearchAssociate(Serbia)
Dr Diana Lupulovi, Research Associate (Serbia)
Dr Milo Kapetanov, Principal Research Fellow (Serbia)
Dr Aleksandar Milovanovi, Research Associate (Serbia)
Dr. Corinna Kehrenberg, professor (Germany)
Dr eljko Mihaljev, Research Associate (Serbia)
Dr Slavica Koari,Principal Research Fellow(Serbia)
Dr Danka Masli-Striak, Research Associate (Serbia)
Dr Jelena Petrovi, Senior Research Associate (Serbia)
Dr Dragica Vojinovi, Research Associate (Serbia)
Dr Vladimir Savi, Senior Research Associate(Croatia)
Dr Ksenija Nei, Research Associate (Serbia)
Dr Ivana Hrnjakovi-Cevtkovi, professor (Serbia)
Dr ivka Ili, Research Associate (Serbia)
Dr Sandra Stefan-Miki, professor (Serbia)
Dr Boidar Savi, Research Associate (Serbia)
Dr Sneana Ivanovi, Principal Research Fellow (Serbia)
Dr Branislav Kureljui, Research Associate (Serbia)
Dr Nataa Goli, Principal Research Fellow (Serbia)
Dr Sandra Jaki, Research Assosiate (Serbia)
HONORARY COMMITTEE:
Dr Sran Verbi, prof dr Sneana Bogosavljevi Bokovi, prof dr Zoran Mai, Vladimir Pavlov, Branislav
Bogaroki, prof dr Dragan Glamoi, prof dr Vlada Teodorovi, prof dr Radovan Pejanovi, prof dr Milan
Popovi, prof dr Zora Mijaevi, prof dr Brana Radenkovi Damjanovi, prof dr Nikola Gruji, prim dr
Dragan Ili, doc dr Vladimir Petrovi, prof dr Dine Mitrov, prof dr Nihad Fejzi, doc dr Boris Habrun, prof
dr eljko Cvetni, prof dr Andrej Kirbi, prof dr Tadej Malovrh, prof dr Boris Stegny, prof dr Paul Pirsan,
prof dr Gheorghe Darabus, dr Teodor Dujin, dr Radovan Pavlovi, dr Ivana Kovini, dr Marijana Gali, dr
Ksenija Stevanovi, dr Milan urjanovi, dr Mira Velhner, dr Dragan Milievi, Petar Matijevi, prof dr
Dragan efer, dr Aleksandar Lonarevi, dr Milenko uti, dr Vojin Iveti, dr Sneana Jankovi, dr Vesna
orevi, dr Jovanka Levi.
3
PREFACE
Concept of One Health is a strategy which enrolls several disciplines in all aspects of
human and animal health care and environment protection. This kind of approach to solving
different public health issues proved to be the best practice of preservation of public health on a
global level. For this reason a need for different, unique and multidisciplinary perspective has been
recognized.
In Vrdnik, from 21st to 23rd of May, 2015, First International Symposium of Veterinary
Medicine will be held, named One Health New challenges. At the Symposium, the existence of
One Health initiative in Serbia, our region and also broader international surrounding will be
analyzed and also current topics and different perspectives will be discussed. The main goal of
Symposium is primarily to gather all the people interested in the topic of One Healthconcept.
Also it would be essential to perceive a large number of issues of this platform, the possibilities of
improvement on national, regional and international level and to propose future activities and
recognized challenges which are possible at this moment. It is very important that the participants of
the symposium are researchers and experts of different occupations, because of the broader
initiative proposals and different perspectives for the same issues.
A successful implementation of One Health concept cannot be done without cooperation
and exchange of opinions among doctors, veterinarians, agronomists, technologists, biologists, etc.
It is needed to perceive a particular problem from a perspective of different professions and
expertise, regardless if the topic is a zoonozis, emergent and infectious diseases, food safety,
antimicrobial resistance, etc. Only with a One Health concept and approach there can be an
appropriate response to the challenges that come up with the aim of preservation of public health
and environment. Basically this concept represents a mutual effort of different disciplines which
operate locally on a national level, and also globally, so that optimal health of humans, animals and
ecosystems is achieved. Necessary interdisciplinary requires a continuous cooperation among
epizootiological and epidemiological service, infectologists, veterinary practitioners, doctors, food
safety experts, biologists, environmentalists and other above mentioned disciplines.
At the One Health New challenges Symposium, work of experts, researchers and their
collaborators of different occupations, profiles and research groups will be presented. The
Symposium is supported by the Ministry of education, science and technological development,
Ministry of agriculture and environment protection, Province Secretary of science and technological
development, Province Secretary of agriculture, aquaculture and forestry and our sponsors. I would
like to use this opportunity and express my great gratitude to the companies and institutions which
have sponsored our Symposium One Health New challenges, or helped in any other way.
Special thanks, I owe to the stuff of Scientific Veterinary Institute Novi Sad, as well as the stuff
from Scientific Veterinary Institute of Serbia, for the help with organization and a successful
Symposium!
President of Organizing Committee
Prof. Dr Miroslav irkovi
Director of Scientific Veterinary Institute Novi Sad
.
Content
Page
PROGRAM
10 - 18
Key note speach: One Health Concept role and importance of veterinarians.
Milijan Jovanovi, Miroslav irkovi
19 - 26
27 - 104
Session 1
DISEASES OF FARM ANIMALS
Plenary lecture: EIA and EVA two equine viral diseases present in Europe
Aymeric Hans
28 - 35
Invited presentation: The voluntary programme for control and eradication of bovine viral
diarrhoea virus infections in Slovenia.
Ivan Toplak, Peter Hostnik, Danijela Rihtari, Joe Grom
36 - 41
Invited presentation: Comparison of macroscopic and microscopic lession in mesenterial lymph

nodes in pigs naturally infected with Mycobaterium avim subsp hominissuis.
Vladimir Polaek, Jasna Prodanov-Radulovi, Dejan Vidanovi, Sanja Kovaevi-Aleksi
42 - 49
Immune response and protective effect of vaccine against listeriosis in sheep in Serbia. Dragan
Baci, Blagoje Dimitrijevi, Mila Savi
50 - 56
Oral fluid as a potential sample for viral diseases detection in pigs. Vesna Milicevi, Branislav
Kureljusi, Jelena Maksimovic-Zori, Ljubisa Veljovi, Vladimir Radosavljevi, Nemanja
Jezdimirovi, Bozidar Savi
57 - 63
Mycobacteria in animals in Slovenia: from cattle to aquarium fish. Mateja Pate, Darja Kuar,
Urka Zajc, Vlasta Jeni, Diana ele, Gorazd Vengut, Joe Stari, Joica Jeek, Katarina Logar,
Tina Pir, Petra Bandelj, Brane Krt, Matja Ocepek
64 - 70
Sanitary and quality conditions of imported bulls semen in Serbia analyzed at "NIV-NS"
(retrospective from 2010-2014). Aleksandar Milovanovi, Tomislav Barna, Milovan Joviin, Jelena
Api, Sava Lazi, Igor Stojanov, Miroslav Uroevi
71 - 79
The health status of breeding stallions for natural breeding and artificial insemination,
regulatory compliance in European Union, South America and West Balkan. Miroslav I.
Urosevi, Luis Losinno, Aleksandar Milovanovi, Dragisa Trailovi, Slobodanka Vakanjac, Jelena
Petrovi, Natasa Filipovi
80 - 86
Sperm pathological forms and acrosomal membrane integrity in boar AI dose on pig farms in
AP Vojvodina (Serbia). Jelena Api, Aleksandar Milovanovi, Tomislav Barna, Milovan Joviin
87 - 91
Echinococcus granulosus of domestic pigs: a case control study. Doroteja Mari, Jasna ProdanovRadulovi, Igor Stojanov, Sinia Gruba, Ivan Pui, Vladimir Polaek
92 - 96
The prevalence of aspergillosis in poultry and control measures - our experience. Milo
Kapetanov, Dragana Ljubojevi, Igor Stojanov, Milica ivkov-Balo, Milo Peli, Marko Paji
97 - 104
Session 2 - Main Hall
105 - 188
FOOD AND FEED SAFETY AND QUALITY

Invited presentation: Game meat safety wild boars.
Jelena Petrovi, Milica ivkov Balo, ivoslav Grgi
106 - 114
Invited presentation: The determination of qualities in cereals silages supplemented with pumpkin
and carrot.
Milica ivkov-Balo, Sandra Jaki, Milovan Joviin
115 - 123

Invited presentation: Mycotoxicological assessment of feed in Serbia in 2014 in the light of new
legislation.
Ksenija Nei, Sandra Jaki, Milica ivkov-Balo, Bojana Pruni
124 132
Effects of fed diets with a different n-6/n-3 PUFAs ratio on oxidative stability, and physicochemical properties of chickens meat. Dragan Milievi, Dejana Trbovi, Zoran Petrovi, Breda
Jakovac-Strajn, Ivan Nastasijevi, Nenad Perunovi, Mirjana Luki
133 141
Ecological safe production of smoked common carp meat. Jelena Babi, Brankica Kartalovi,
Jelena Petrovi, ore Okanovi, Biljana Boi, Milo Peli, Miroslav irkovi
142 147
Effect of diet on improving fatty acid composition of pig meat. Radmila Markovi, Milica
Todorovi, Sran Panti, Milan Balti, Jelena Ivanovi, Dobrila Jaki-Dimi, Dragan efer, Branko
Petrujki, Stamen Radulovi
148 156
Effects of some dieatary supplementation with phytonutrients on selected biochemical

parameters and growth performance in broiler chikens. Milanka Jezdimirovi, Blagoje
Dimitrijevi, Saa Ivanovi, Nemanja Jezdimirovi, Mila Savi, Dragan Baci, Slavoljub Jovi
157 165
The influence of climatic factors in Serbia on mycotoxin production. Sandra Jaki, Milica ivkovBalo, Nadeda Prica, Zoran Mai, Ksenija Nei, Igor Jaji, Biljana Abramovi
166 172
Radioactivity of the soil in Vojvodina (northern province of Serbia). eljko Mihaljev, Dragana
Ljubojevi, Miroslav irkovi, Milica ivkov-Balo, Sandra Jaki, Brankica Kartalovi, Nadeda
Prica
173 177
Physicochemical analysis as an indicator of the quality of honey originating from Vojvodina

region. Nadeda Prica, Milica ivkov-Balo, Sandra Jaki, eljko Mihaljev, Dragana Ljubojevi,
Branka Vidi, Sara Savi
178 182
Effects of dietary hot red pepper addition on productive performance and blood lipid profile of
broiler chickens. Nikola Puvaa, Ljiljana Kostadinovi, Dragana Ljubojevi, Dragomir Luka, Sanja
Popovi, Jovanka Levi, Olivera uragi, Rade Jovanovi
183 - 188
Session 3
189 - 241
VECTOR BORNE INFECTIONS

Plenary lecture: Mosquito-borne flaviviruses in Europe: current perspectives.
Juan Carlos Saiz
190 195
Invited presentation: An overview of the recent studies on tick borne pathogens in Serbia.
Sara Savi, Branka Vidi, Aleksandar Potkonjak, eljko onka
196 - 203
Invited presentation: WNV in Serbia: update of current knowledge.

Tama Petrovi, Duan Petri, Diana Lupulovi, Ivana Hrnjakovi Cvetkovi, Vesna Miloevi, Sava
Lazi, Juan Carlos Saiz
204 212
Pathomorphological findings in organs of sheeps died of bluetongue disease. Ivan Dobrosavljevi,

Milena ivojinovi, Slavonka Stoki-Nikoli, Milica Lazi, Dragan Rogoarski
213 219
Species diversity and life stages dominance of hard ticks (acari: ixodidae) at Vojvodina hunting
resorts. Aleksandra Petrovi, Aleksandar Jurii, Ivana Ivanovi, Aleksandar Potkonjak, Vuk Vraar,
Dragana Rajkovi
220 228
Cross-reactions in serological diagnosis of flavivirus infections. Ivana Hrnjakovi Cvjetkovi,

Duan Petri, Tama Petrovi, Gordana Kovaevi, Jelena Radovanov, Aleksandra Jovanovi Galovi,
Dejan Cvjetkovi, Sandra Stefan Miki, Aleksandra Pati, Nataa Nikoli, Vesna Miloevi
229 233
Vector-borne infection (Ehrlichia canis) clinical case. Zlatko Dimeski, Biljana Petrovska, Zivko
Gacovski, Goce Cilev, Elena Buntevska, Bojan Stamadziovski
234 - 236

Leshmaniasis in 12 years old male pekingese-clinical case. Zlatko Dimeski, Biljana Petrovska,
Zivko Gacovski, Goce Cilev, Blagica Trajanoska, Martin Kamceski, Bojan Stamadziovski, Elena
Buntevska
237 241
Session 4
242 311
WILDLIFE DISEASES AND PATHOGENS IN ENVIRONMENT

Plenary lecture: Influenza in Birds and Other Animals.
Vladimir Savi
243 250
Invited presentation: Virus infections of the honeybee (Apis mellifera l.) in central Europe.
Tams Bakonyi, Petra Forgch, Ale Gregorc, Ivana Tlak Gajger, Lszl Bksi, Mikls Rusvai,
Norbert Nowotny
251 259
Invited presentation: The most common health disturbances detected in wild boars in enclosed
hunting grounds in Vojvodina province.
Jasna Prodanov-Radulovi, Radoslav Doen, Igor Stojanov, Tama Petrovi
260 270
Contamination of public places at central Belgrade municipalities with dogs parasites in period
2013-2014. Ivan Pavlovi, Dubravka Jovii, Vladimir Terzin, Dragana Petkovi, Dragana Terzin,
Milo Pavlovi, Zoran Tambur, Sneana Radivojevi, Borivoje Savi, Slobodan Stanojevi
271 274
Risk factors in domestic and wild cycles of Trichinella species. Milena ivojinovi, Ivan
Dobrosavljevi, Ljiljana Sofroni Milosavljevi, Budimir Plavi, Zoran Kulii, Sonja Radojii
275 282
Insight into the present pesticide contamination and copepods status (Crustacea: Copepoda) of
surface water in irrigation canals in Vojvodina. Vojislava Bursi, Gorica Vukovi, Aleksandra
Petrovi, Maja Meseldija, Tijana Zeremski, Aleksandar Jurii, Dragana Rajkovi
283 289
A serological survey on Aujeszky's disease in wild boars in the region of Vojvodina in Serbia.
Sava Lazi, Vesna Milievi, Gospava Lazi, Ljubia Veljovi, Diana Lupulovi, Jasna ProdanovRadulovi, Jelena Maksimovi -Zori, Sinia Gruba, Radoslav Doen, Tama Petrovi
290 294
Viruses in environment: situation in Vojvodina province of Serbia. Gospava Lazi, Sinia Gruba,
Bugarski Dejan, Diana Lupulovi, Sava Lazi, Petar Kneevi, Tama Petrovi
295 300
Development of a multi-residue method for the determination of insecticides in animal fat by

LC-MS/MS. Vojislava Bursi, Gorica Vukovi, Tijana Zeremski, Dejan Beukovi, Milo Beukovi,
Aleksandra Petrovi, Magdalina Cara
301 305
The unusual colony losses in the region of Vojvodina. Jelena Babi, Sara Savi, Miroslav irkovi,
Igor Stojanov, Ivan Pihler, Nada Plava
306 - 311
Session 5
312 389
AQUACULTURE
Plenary lecture: Converting waste landfill in pond areas.
Miroslav irkovi, Brankica Kartalovi, Milo Peli, Nikolina Novakov, Dragana Ljubojevi, Sanja
Jovani, eljko Mihaljev
313 320
Invited presentation: Rapid detection of important carp viruses by loop-mediated isothermal

amplification (LAMP).
Vladimir Radosavljevi, Dragana Ljubojevi, Vesna Milievi, Miroslav irkovi, Dobrila JakiDimi, Jelena Maksimovi-Zori, Jadranka utic
321 326
Invited presentation: Link between lipid quality of cyprinid fish species and human health.
Dragana Ljubojevi, Miroslav irkovi
327 339
Seasonal variations of physico chemical parameters of the pond. Brankica Kartalovi, Miroslav
irkovi, Milo Peli, Sanja Jovani, Nikolina Novakov, Biljana Boi, eljko Mihaljev
340 - 345

Nodular coccidiosis of carp fingerlings caused by Goussia subepithelialis. Nikolina Novakov,
Miroslav irkovi, Dragana Ljubojevi, Milo Peli, Biljana Boi, Jelena Babi, Dalibor Todorovi
346 350
Drum-form fitoreactor in seawater recirculation system. Dmitry Dementyev
351 356
Body traits and chemical composition of carp grown in production systems with different level of
intensification. Liliana Hadzhinikolova, Angelina Ivanova, Tania Hubenova
357 361
Meat lipid quality in carps (yprinus carpio L) grown in production systems with different level
of intensification. Angelina Ivanova, Liliana Hadzhinikolova
362 368
Results of breeding of juveniles of huchen (Hucho hucho) obtained by insemination with fresh
and cryopreserved sperm in artificial conditions. Nataa Radojkovi, Aleksandra Milokovi,
Simona Kovaevi, Tijana Velikovi, Sneana Simi, Miroslav irkovi, kos Horvth, Vladica
Simi
369 373
Distribution and some ecological impacts of fluke Posthodiplostomum cuticola (Digenea,

Trematodes) in the fish assemblage of the Zapadna Morava River (Danube basin, Serbia). Goran
Markovi, Nikolina Novakov
374 378
The effect of OTC and flumequine antibiotic in fresh feed for the control of erythrodermatitis in
common carp (Cyprinus carpio L.). Milo Peli, Brankica Kartalovi, Dragana Ljubojevi, Nikolina
Novakov, Dalibor Todorovi, Biljana Boi, Miroslav irkovi
379 384
Malignant anaemia of the carps. Biljana Boi, Nikolina Novakov, Milo Peli, Dalibor Todorovi,
Miroslav irkovi
385 - 389
Session 6
390 444
EMERGING AND RE-EMERGING ZOONOSES

Invited presentation: Important zoonotic viral diseases of wildlife and their impact on human
health.
Diana Lupulovi, Gospava Lazi, Jasna Prodanov-Radulovi, Tamas Petrovi
391 400
Invited presentation: Influenza and international health regulations.

Dragana Dimitrijevi, Slavica Raki Adrovi, Milunka Milinkovi, Jovanka osi
401 404
Invited presentation: Comparation of Rhodococcus equi of human and animal origin.

Ljiljana Suvajdi, Maja Velhner, Maja Bekut, Gordana Boji, Tamara Krsti, Zoran Suvajdi,
Milenko Lazi
404 413
The role of veterinary medicine in One Health concept. Branka Vidi, Sara Savi, Stanko Bobo,
Nadeda Prica, Miodrag Radinovi
414 419
The concept One World, One Health in the Macedonian state institutions. Misho Hristovski,
Blazho Janevski, Martin Josheski
420 433
More than two years without detection of wild rabies virus in Slovenia. Peter Hostnik, Jedert
Maurer Werning, Breda Hrovatin, Danijela Rihtari, Ivan Toplak
434 438
Epizootiological importance of Salmonella spp. isolated in different poultry farms in Southern

Baka and Srem region. Marko Paji, Dalibor Todorovi, Maja Velhner, Dubravka Milanov,
Vladimir Polaek, Spomenka uri, Igor Stojanov
439 444
Session 7
445 - 484
ANTIBIOTIC RESISTANCE
Invited presentation: Potential spread of antimicrobial resistance via drinking water in livestock
husbandry.
Igor Stojanov, Jasna Prodanov Radulovi, Milo Kapetanov, Jelena Petrovi
446 - 453

Invited presentation: Antimicrobial activity of the essential oils from some aromatic medicinal
plants cultivated in Serbia.
Radomir Ratajac, Marina eki Stoi, Aleksandar Milovanovi, Igor Stojanov
454 461
Antimicrobial activity of blackberry juice from Serbia on animal pathogens. Tamara Krsti,
Ljiljana Suvajdi, Sran Stojanovi, Tama Petrovi, Maja Bekut, Neboja Ili, Zoran Suvajdi
462 467
Antibiotic resistance to fluoroqionoles in Salmonella spp.: Recent findings in Serbia and brief
overview of resistance mechanisms and molecular typing methods. Maja Velhner, Gordana
Kozoderovi, Zora Jelesi
468 472
Antibacterial susceptibility of mastitis pathogens to iodine-lithium complex in vitro. Marina eki

Stoi, Radomir Ratajac, Aleksandar Milovanovi, Jelena Petrovi, Igor Stojanov, Jelena Api
473 478
Random amplified polymorphic DNA analysis RAPD and resistance to antimicrobial agents in
Salmonella spp. isolated from poultry flocks in Southern Baka and Srem region. Dalibor
Todorovi, Maja Velhner, Bojana Pruni, Marko Paji, Dubravka Milanov, Vladimir Polaek, Dejan
Bugarski
479 - 484
Supplement to Session 1: Diseases of farm animals

Detection of infected goats with CAE virus-control measures and prevention. Miodrag Radinovic,
Marija Paji, Stanko Bobo, Branka Vidi, Sara Savi, Annamaria Galfi
485 488
Immunoglobulin G concentration and ultrasonography of the cows udder with subclinical

mastitis. Annamaria Galfi, Miodrag Radinovi, Marija Paji, Stanko Bobo, Branka Vidi, Sara Savi,
Dubravka Milanov
489 - 492
Supplement to Session 2: Food anf feed safety and quality

Remediation of by-products of slaughtered livestock. Djordje Okanovi, Milutin Risti
493 498
PROGRAM
Thursday, May 21, 2015
13:00 15:30
Registration of participants
Main Hall entrance
15:30 17:40
Session 1 Main Hall

Diseases of farm animals
Chairs: Sava Lazi, Ivan Toplak, Vladimir Polaek
15:30 15:50
Plenary lecture: EIA and EVA two equine viral diseases present in Europe. Aymeric Hans
(ANSES - French Agency for Food, Environmental and Occupational Health & Safety)
15:50 16:05
Invited presentation: The voluntary programme for control and eradication of bovine viral
diarrhoea virus infections in Slovenia. Ivan Toplak, Peter Hostnik, Danijela Rihtari, Joe Grom
(National Veterinary Institute, Veterinary Faculty, University of Ljubljana)
16:05 16:20
Invited presentation: Comparison of macroscopic and microscopic lession in mesenterial lymph

nodes in pigs naturally infected with Mycobaterium avim subsp hominissuis. Vladimir Polaek,
Jasna Prodanov-Radulovi, Sanja Kovaevi-Aleksi (Scientific Veterinary Institute Novi Sad, Novi
Sad, Serbia)
16:20 16:30
Immune response and protective effect of vaccine against listeriosis in sheep in Serbia. Dragan
Baci, Blagoje Dimitrijevi, Mila Savi
16:30 16:40
Listeriosis: a continuous challenge in veterinary practice. Majda Golob, Mateja Pate, Darja Kuar,
Matja Ocepek, Irena Zdovc
16:40 16:50
Oral fluid as a potential sample for viral diseases detection in pigs. Vesna Milicevi, Branislav
Kureljusi, Jelena Maksimovic-Zori, Ljubisa Veljovi, Vladimir Radosavljevi, Nemanja
Jezdimirovi, Bozidar Savi
16:50 17:00
Mycobacteria in animals in Slovenia: from cattle to aquarium fish. Mateja Pate, Darja Kuar,
Urka Zajc, Vlasta Jeni, Diana ele, Gorazd Vengut, Joe Stari, Joica Jeek, Katarina Logar,
Tina Pir, Petra Bandelj, Brane Krt, Matja Ocepek
17:00 17:10
Detection of infected goats with CAE virus-control measures and prevention. Miodrag
Radinovic, Marija Paji, Stanko Bobo, Branka Vidi, Sara Savi, Annamaria Galfi
17:10 17:20
Sanitary and quality conditions of imported bulls semen in Serbia analyzed at "NIV-NS"
(retrospective from 2010-2014). Aleksandar Milovanovi, Tomislav Barna, Milovan Joviin, Jelena
Api, Sava Lazi, Igor Stojanov, Miroslav Uroevi
17:20 17:30
Discussion for all presentations and posters in Session 1
10

Posters Hall B (Piva)
1.1 Serological survey for antibodies against morbus Aujeszky virus in pigs originating from
unvaccinated herds. Ivan Pui, Jasna Prodanov-Radulovi, Radoslav Doen, Doroteja
Mari, Miroslav Urosevi, Diana Lupolovi, Igor Stojanov
1.2 Biosafety in laboratories for diagnosis of transboundary diseases. Ljubisa Veljovi, Vesna
Milicevi, Jelena Maksimovic-Zori, Vladimir Radosavljevi, Jadranka uti, Danka Masli
Striak, Boidar Savi
1.3 Some facts of the rdar morphotype of Salmonella spp. and Escherichia coli. Dubravka
Milanov, Bojana Pruni, Marko Paji, Maja Velhner, Ivana abarkapa
1.4 The health status of breeding stallions for natural breeding and artificial insemination,
regulatory compliance in European Union, South America and West Balkan. Miroslav I.
Urosevi, Luis Losinno, Aleksandar Milovanovi, Dragisa Trailovi, Slobodanka Vakanjac,
Jelena Petrovi, Natasa Filipovi
1.5 Sperm pathological forms and acrosomal membrane integrity in boar AI dose on pig
farms in AP Vojvodina (Serbia). Jelena Api, Aleksandar Milovanovi, Tomislav Barna,
Milovan Joviin
1.6 Immunoglobulin G concentration and ultrasonography of the cows udder with subclinical
mastitis. Annamaria Galfi, Miodrag Radinovi, Marija Paji, Stanko Bobo, Branka Vidi, Sara
Savi, Dubravka Milanov
1.7 Echinococcus granulosus of domestic pigs: a case control study. Doroteja Mari, Jasna
Prodanov-Radulovi, Igor Stojanov, Sinia Gruba, Ivan Pui, Vladimir Polaek
1.8 The prevalence of aspergillosis in poultry and control measures - our experience. Milo
Kapetanov, Dragana Ljubojevi, Igor Stojanov, Milica ivkov-Balo, Milo Peli, Marko Paji
1.9 The influence of Aspergillus fumigatus infection on some hematological parameters in
turkeys poults. Nemanja Jezdimirovi, Branislav Kureljui, Boidar Savi, Jasna Kureljui,
ore Cvetojevi, Blagoje Dimitrijevi, Dobrila Jaki-Dimi, Vesna Milievi, Danka MasliStriak, Vojin Iveti, Milijan Jovanovi
1.10 Diseases of digestive system in suckling piglets detected on swine farms in Vojvodina
province. Jasna Prodanov-Radulovi, Radoslav Doen, Igor Stojanov, Ivan Pui, Vladimir
Polaek, Sinia Gruba, Doroteja Mari
17:30 18:00
Coffe break with posters
18:00 20:00
Welcome, Symposium Opening Session

Main hall
Program dedicated for 65th Anniversary of Scientific Veterinary Institute Novi Sad
Symposium opening - welcome addresses:

- Welcome address: Miroslav irkovi (President of the Organizing Committee)
- Welcome address: Tama Petrovi (President of the Scientific Committee)
- Welcome address: Representative of local administration Municipality Irig
- Welcome address: Dejan Bugarski (Director of Veterinary Directorate (CVO), Ministry of
Agriculture and Environmental Protection)
- Welcome address: Representative of Secretariat for Science and Technological Development,
Autonomous Province of Vojvodina
- Welcome address and opening: Representative of Ministry of Education, Science and
Technological Development, Republic of Serbia
Key note speech: One Health Concept role and importance of veterinarians. Milijan
Jovanovi, Miroslav irkovi
2
Welcome Coctail and party
11
Friday, May 22, 2015

Morning Sessions Main Hall
08:30 13:10
Paralel Sessions
08:30 10:30
Session 2 - Main Hall

Food and feed safety and quality
Chairs: Dragan Milievi, Jelena Petrovi, Milica ivkov Balo
08:30 08:45
Invited presentation: Game meat safety wild boars.

Jelena Petrovi, Milica ivkov Balo, ivoslav Grgi (Scientific Veterinary Institute Novi Sad,
Novi Sad, Serbia)
08:45 09:00
Invited presentation: The determination of qualities in cereals silages supplemented with

pumpkin and carrot. Milica ivkov-Balo, Sandra Jaki, Milovan Joviin (Scientific Veterinary
Institute Novi Sad, Novi Sad, Serbia)
09:00 09:15
Invited presentation: Mycotoxicological assessment of feed in Serbia in 2014 in the light of new
legislation. Ksenija Nei, Sandra Jaki, Milica ivkov-Balo, Bojana Pruni (Institute of
Veterinary Medicine of Serbia, Belgrade, Serbia)
09:15 09:25
Development of probiotic cultures for domestic animals. Nataa Goli, Katarina Veljovi,
Miroslav Dini, Nikola Popovi, Marija Miljkovic, Milan Koji, Igor Mrvaljevi, Amarela TerziVidojevi
09:25 09:35
Effects of fed diets with a different n-6/n-3 PUFAs ratio on oxidative stability, and physicochemical properties of chickens meat. Dragan Milievi, Dejana Trbovi, Zoran Petrovi, Breda
Jakovac-Strajn, Ivan Nastasijevi, Nenad Perunovi, Mirjana Luki
09:35 09:45
Remediation of by-products of slaughtered livestock. Djordje Okanovi, Milutin Risti
09:45 09:55
Ecological safe production of smoked common carp meat. Jelena Babi, Brankica Kartalovi,
Jelena Petrovi, ore Okanovi, Biljana Boi, Milo Peli, Miroslav irkovi
09:55 10:05
Development of starter cultures for fermented dairy products based on autochthonous lactic
acid bacteria. Amarela Terzi-Vidojevi, Katarina Veljovi, Duanka Popovi, Ivana Strahini,
Maja Tolinaki, Milica Nikoli, Sanja Mihajlovi, Milan Koji
10:05 10:15
Effect of diet on improving fatty acid composition of pig meat. Radmila Markovi, Milica
Todorovi, Sran Panti, Milan Balti, Jelena Ivanovi, Dobrila Jaki-Dimi, Dragan efer,
Branko Petrujki, Stamen Radulovi
10:15 10:30
12

2.1. Analysis of pesticide residues in vegetables on green markets in Novi Sad (Serbia). Mira
Pucarevi, Nataa Stoji, Biljana Panin
2.2. Effects of some dieatary supplementation with phytonutrients on selected biochemical
parameters and growth performance in broiler chikens. Milanka Jezdimirovi, Blagoje
Dimitrijevi, Saa Ivanovi, Nemanja Jezdimirovi, Mila Savi, Dragan Baci, Slavoljub
Jovi
2.3. The influence of climatic factors in serbia on mycotoxin production. Sandra Jaki,
Milica ivkov-Balo, Nadeda Prica, Zoran Mai, Ksenija Nei, Igor Jaji, Biljana
Abramovi
2.4. Occurrence of selected foodborne pathogens in foods of plant origin. Monika Moravkova,
Petra Vasickova, Michal Slany, Petr Kralik
2.5. Radioactivity of the soil in Vojvodina (northern province of Serbia). eljko Mihaljev,
Dragana Ljubojevi, Miroslav irkovi, Milica ivkov-Balo, Sandra Jaki, Brankica
Kartalovi, Nadeda Prica
2.6. Physicochemical analysis as an indicator of the quality of honey originating from
Vojvodina region. Nadeda Prica, Milica ivkov-Balo, Sandra Jaki, eljko Mihaljev,
Dragana Ljubojevi, Branka Vidi, Sara Savi
2.7. Some quality parameters of industrial kulen from market of Vojvodina. Natalija Dini,
Maja Ivi, Branislav oji, Sneana kaljac, Vladimir Tomovi, Marija Jokanovi, Predrag
Ikoni, Tatjana Tasi, ore Okanovi
2.8. Effects of dietary hot red pepper addition on productive performance and blood lipid
profile of broiler chickens. Nikola Puvaa, Ljiljana Kostadinovi, Dragana Ljubojevi,
Dragomir Luka, Sanja Popovi, Jovanka Levi, Olivera uragi
2.9. Influence of new product fitokokci-sto in broilers nutrition on productive characteristics
and biochemical blood status. Ljiljana Kostadinovi, Nikola Puvaa, Dragomir Luka,
Sanja Popovi, Jovanka Levi, Olivera uragi, Rade Jovanovi
2.10. Fatty acid composition of two skeletal muscles from native Serbian swallow-belly
mangulica pigs reared outdoors. Predrag Ikoni, Duica olovi, Tatjana Tasi, ore
Okanovi, Vladimir Tomovi, Natalija Dini, Jovanka Levi
10:30 11:00
11:00 13:10
Session 4 Main Hall

Wildlife diseases and pathogens in environment
Chairs: Tama Petrovi, Vladimir Savi, Tamas Bakonyi
11:00 11:20
Plenary lecture: Influenza in Birds and Other Animals.

Vladimir Savi (Croatian Veterinary Institute, Zagreb, Croatia)
11:20 11:40
Invited presentation: Virus infections of the honeybee (Apis mellifera l.) in central Europe.
Tams Bakonyi, Petra Forgch, Ale Gregorc, Ivana Tlak Gajger, Lszl Bksi, Mikls Rusvai,
Norbert Nowotny (Faculty of Veterinary Science, Szent Istvn University, Budapest, Hungary)
11:40 12:00
Invited presentation: The most common health disturbances detected in wild boars in enclosed
hunting grounds in Vojvodina province. Jasna Prodanov-Radulovi, Radoslav Doen, Igor
Stojanov, Tama Petrovi (Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
12:00 12:10
Roe deer vs. Red deer papillomavirus an odd pair in delta-papillomavirus evolution and
ecology. Kroly Erdlyi, Alessandra Scagliarini
12:10 12:20
Contamination of public places at central Belgrade municipalities with dogs parasites in

period 2013-2014. Ivan Pavlovi, Dubravka Jovii, Vladimir Terzin, Dragana Petkovi, Dragana
Terzin, Milo Pavlovi, Zoran Tambur, Sneana Radivojevi, Borivoje Savi, Slobodan Stanojevi
12:20 12:30
Bacillus thuringiensis as the model for the development of reliable method for the detection
and quantification of spore of Bacillus anthracis from environmental samples. Vera
Sedlackova, Iva Kubikova, Petr Kralik
13

12:30 12:40
Occurrence of Toxoplasma gondii in domestic pigs and wild boars in the Czech Republic.
Michal Slany, Lea Jakubcova, Nikol Reslova, Alena Lorencova
12:40 12:50
Risk factors in domestic and wild cycles of Trichinella species. Milena ivojinovi, Ivan
Dobrosavljevi, Ljiljana Sofroni Milosavljevi, Budimir Plavi, Zoran Kulii, Sonja Radojii
12:50 13:00
Insight into the present pesticide contamination and copepods status (Crustacea: Copepoda)
of surface water in irrigation canals in Vojvodina. Vojislava Bursi, Gorica Vukovi,
Aleksandra Petrovi, Maja Meseldija, Tijana Zeremski, Aleksandar Jurii, Dragana Rajkovi
13:00 13:10

4.1 Ecto- and endoparasitic burden of apodemus mice (Rodentia: Muridae) at hunting resort
Kamarite (Serbia). Olivera Bjeli abrilo, Aleksandra Petrovi, Aleksandar Jurii, Borislav
abrilo, Dina Tenji, Ivana Ivnovi
4.2 A serological survey on Aujeszky's disease in wild boars in the region of Vojvodina in
Serbia. Sava Lazi, Vesna Milievi, Gospava Lazi, Ljubia Veljovi, Diana Lupulovi,
Jasna Prodanov-Radulovi, Jelena Maksimovi -Zori, Sinia Gruba, Radoslav Doen, Tama
Petrovi
4.3 Dermal fibromatosis of the roe deer- case report. Duan Laloevi, Zoran Risti, Sava Lazi
4.4 Viruses in environment: situation in Vojvodina province of Serbia. Gospava Lazi, Sinia
Gruba, Bugarski Dejan, Diana Lupulovi, Sava Lazi, Petar Kneevi, Tama Petrovi
4.5 Development of a multi-residue method for the determination of insecticides in animal
fat by LC-MS/MS. Vojislava Bursi, Gorica Vukovi, Tijana Zeremski, Dejan Beukovi,
Milo Beukovi, Aleksandra Petrovi, Magdalina Cara
4.6 The unusual colony losses in Vojvodina Province. Jelena Babi, Sara Savi, Miroslav
irkovi, Igor Stojanov, Ivan Pihler, Nada Plava
13:10 14:30
Lunch break and poster viewing
Morning Sessions Hall A (Tara)

08:30 13:00
Paralel Sessions
08:30 10:30
Session 3 Hall A (Tara)

Vector borne infections
Chairs: Tama Petrovi, Juan Carlos Saiz, Sara Savi
08:30 08:50
Plenary lecture: Mosquito-borne flaviviruses in Europe: current perspectives.

Juan Carlos Saiz (INIA, Madrid, Spain)
08:50 09:10
Invited presentation: An overview of the recent studies on tick borne pathogens in Serbia.
Sara Savi, Branka Vidi, Aleksandar Potkonjak, eljko onka (Scientific Veterinary Institute
Novi Sad, Novi Sad, Serbia)
09:10 09:30
Invited presentation: WNV in Serbia: update of current knowledge.

Tama Petrovi, Duan Petri, Diana Lupulovi, Ivana Hrnjakovi Cvetkovi, Vesna Miloevi,
Sava Lazi, Juan Carlos Saiz (Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
09:30 09:40
Pathomorphological findings in organs of sheeps died of bluetongue disease. Ivan

Dobrosavljevi, Milena ivojinovi, Slavonka Stoki-Nikoli, Milica Lazi, Dragan Rogoarski
09:40 09:50
Species diversity and life stages dominance of hard ticks (acari: ixodidae) at Vojvodina
hunting resorts. Aleksandra Petrovi, Aleksandar Jurii, Ivana Ivanovi, Aleksandar Potkonjak,
Vuk Vraar, Dragana Rajkovi
14

09:50 10:00
Babesia spp. in ticks parasitizing wild canids in Serbia. Ratko Sukara, Salem Juwaid,
Dimosthenis Chochlakis, Sanja aki, Darko Mihaljica, Duko irovi, Sneana Tomanovi
10:00 10:10
Diversity and spatial distribution of sandflies (diptera: psychodidae) and possibility of reemergence of leishmaniasis in Serbia. Slavica Vaselek, Gizem Oguz, Nazli Ayhan, Sara Savi,
Trentina Di Muccio, Ozge Erisoz Kasap, Yusuf Ozbel, Vladimir Ivovi, Luigi Gradoni, Bulent
Alten, Duan Petri
10:10 10:30

3.1 Cross-reactions in serological diagnosis of flavivirus infections. Ivana Hrnjakovi
Cvjetkovi, Duan Petri, Tama Petrovi, Gordana Kovaevi, Jelena Radovanov, Aleksandra
Jovanovi Galovi, Dejan Cvjetkovi, Sandra Stefan Miki, Aleksandra Pati, Nataa Nikoli,
Vesna Miloevi
3.2 Epidemiology of Bluetongue disease in Southeastern Europe. Josheski Martin, Hristovski
Mio
3.3 Vector-borne infection (Ehrlichia canis) clinical case. Zlatko Dimeski, Biljana Petrovska,
Zivko Gacovski, Goce Cilev, Elena Buntevska, Bojan Stamadziovski
3.4 Leshmaniasis in 12 years old male pekingese-clinical case. Zlatko Dimeski, Biljana
Petrovska, Zivko Gacovski, Goce Cilev, Blagica Trajanoska, Martin Kamceski, Bojan
Stamadziovski, Elena Buntevska
10:30 11:00
11:00 13:00
Session 5 Hall A (Tara)

Aquaculture
Chairs: Miroslav irkovi, Vesna orevi, Vladimir Radosavljevi
11:00 11:20
Plenary lecture: Converting waste landfill in pond areas. Miroslav irkovi, Brankica
Kartalovi, Milo Peli, Nikolina Novakov, Dragana Ljubojevi, Sanja Jovani, eljko Mihaljev
(Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
11:20 11:35
Invited presentation: Rapid detection of important carp viruses by loop-mediated isothermal

amplification (LAMP). Vladimir Radosavljevi, Dragana Ljubojevi, Vesna Milievi, Miroslav
irkovi, Dobrila Jaki-Dimi, Jelena Maksimovi-Zori, Jadranka utic (Institute of Veterinary
Medicine of Serbia, Belgrade, Serbia)
11:35 11:50
Invited presentation: Link between lipid quality of cyprinid fish species and human health.
Dragana Ljubojevi, Miroslav irkovi (Scientific Veterinary Institute Novi Sad, Novi Sad,
Serbia)
11:50 12:00
Seasonal variations of physico chemical parameters of the pond. Brankica Kartalovi, Miroslav
irkovi, Milo Peli, Sanja Jovani, Nikolina Novakov, Biljana Boi, eljko Mihaljev
12:00 12:10
The impact of benthic and planktonic bacteria on microbiological status of the digestive tract
of carp (Cyprinus carpio). Vesna orevi, Miroslav irkovi, Dragana Ljubojevi, Vesna
Jankovi, Dejana Trbovi, Radivoj Petronijevi, Danka Spiri
12:10 12:20
A closer look at toll-like receptor 4 (TLR4) and toll-like receptor 20 (TLR20) of common carp
(Cyprinus carpio). Danilo Pietretti, Maria Forlenza and Geert Wiegertjes
12:20 12:30
Nodular coccidiosis of carp fingerlings caused by Goussia subepithelialis. Nikolina Novakov,

Miroslav irkovi, Dragana Ljubojevi, Milo Peli, Biljana Boi, Jelena Babi, Dalibor
Todorovi
12:30 12:40
Drum-form fitoreactor in seawater recirculation system. Dmitry Dementyev
15

12:40 12:50
Body traits and chemical composition of carp grown in production systems with different
level of intensification. Liliana Hadzhinikolova, Angelina Ivanova, Tania Hubenova
12:50 13:00
Meat lipid quality in carps (yprinus carpio L) grown in production systems with different
level of intensification. Angelina Ivanova, Liliana Hadzhinikolova
13:00 13:10

5.1 Results of breeding of juveniles of huchen (Hucho hucho) obtained by insemination with
fresh and cryopreserved sperm in artificial conditions. Nataa Radojkovi, Aleksandra
Milokovi, Simona Kovaevi, Tijana Velikovi, Sneana Simi, Miroslav irkovi, kos
Horvth, Vladica Simi
5.2 Distribution of fluke Posthodiplostomum cuticola (Digenea, Trematodes) in the fish
assemblage of the Zapadna Morava River (Danube basin, Serbia). Goran Markovi,
Nikolina Novakov
5.3 The effect of OTC and flumequine antibiotic in fresh feed for the control of
erythrodermatitis in common carp (Cyprinus carpio L.). Milo Peli, Brankica Kartalovi,
Dragana Ljubojevi, Nikolina Novakov, Dalibor Todorovi, Biljana Boi, Miroslav irkovi
5.4 Malignant anaemia of the carps. Biljana Boi, Nikolina Novakov, Milo Peli, Dalibor
Todorovi, Miroslav irkovi
13:10 14:30
Lunch break and poster viewing
Friday, May 22, 2015

Afternoon Sessions Main Hall
14:30 16:35
Session 6 Main Hall

Emerging and re-emerging zoonoses
Chairs: Branka Vidi, Dobrila Jaki Dimi, Sara Savi
14:30 14:45
Invited presentation: Important zoonotic viral diseases of wildlife and their impact on human
health. Diana Lupulovi, Gospava Lazi, Jasna Prodanov-Radulovi, Tamas Petrovi (Scientific
Veterinary Institute Novi Sad, Novi Sad, Serbia)
14:45 15:00
Invited presentation: Influenza and international health regulations. Dragana Dimitrijevi,

Slavica Raki Adrovi, Milunka Milinkovi, Jovanka osi (Institute of Public Health of Serbia
Batut, Serbia)
15:00 15:15
Invited presentation: Comparation of Rhodococcus equi of human and animal origin. Ljiljana
Suvajdi, Maja Velhner, Maja Bekut, Gordana Boji, Tamara Krsti, Zoran Suvajdi, Milenko
Lazi (Faculty of Medicine, Department of Pharmacy, University of Novi Sad, Serbia)
15:15 15:25
The role of veterinary medicine in One Health concept. Branka Vidi, Sara Savi, Stanko
Bobo, Nadeda Prica, Miodrag Radinovi
15:25 15:35
The concept One World, One Health in the Macedonian state institutions. Misho Hristovski,
Blazho Janevski, Martin Josheski
15:35 15:45
More than two years without detection of wild rabies virus in Slovenia. Peter Hostnik, Jedert
Maurer Werning, Breda Hrovatin, Danijela Rihtari, Ivan Toplak.
15:45 15:55
Hepatitis E virus in the Czech Republic. Petra Vasickova, Monika Kubankova, Petr Kralik
16

15:55 16:05
Seroprevalence of hepatitis E virus in commercial pig farms, backyard pigs and slaughtered
pigs in the region of the city Belgrade. Branislav Kureljui, Boidar Savi, Nemanja
Jezdimirovi, ore Cvetojevi, Jasna Kureljui, Dobrila Jaki-Dimi, Oliver Radanovi, Vesna
Milievi, Danka Masli-Striak, Vojin Iveti
16:05 16:15
Epizootiological importance of Salmonella spp. Isolated in different poultry farms in

Southern Baka and Srem region. Marko Paji, Dalibor Todorovi, Maja Velhner, Dubravka
Milanov, Vladimir Polaek, Spomenka uri, Igor Stojanov
16:15 16:25
Sepsis and meningoencephalitis caused by Streptococcus suis bacteria a case report. Vesna
Turkulov, Grozdana anak, Sinia Sevic, Mila Rajkovi, Dajana Lendak, Ljiljana ivanovi
16:25 16:35

6.1 Listeria monocytogenes meningoencephalitis in humans. Grozdana anak, Vesna
Turkulov, Sinia Sevi, Milo Vujanovi, Ljiljana ivanovi, Vedrana Petri
6.2 Hemorhagic fever with renal syndrome in Serbia. Vesna Kovaevi-Jovanovi, Jelena
Proti
6.3 Detection of L. interrogans serovar hardjo in experimentaly sub cutaneus infected rabbits
by diferent diagnostical methods. ivoslav Grgi, Branka Vidi, Sara Savi, Diana
Lupulovi, Ivan Pusic
6.4 Live attenuated swine influenza viruses as vaccine candidates. Aleksandar Mai, Yan
Zhou, Shawn Babiuk, Bojana Pruni, Tama Petrovi
16:35 17:00
17:00 19:00
Session 7 Main Hall

Antibiotic resistance
Chairs: Jelena Petrovi, Maja Velhner, Corinna Kehrenberg
17:00 17:30
Plenary lecture: Mechanisms of multidrug resistance in bacteria of animal origin. Corinna

Kehrenberg (University of Veterinary Medicine, Hannover, Germany)
17:30 17:45
Invited presentation: Potential spread of antimicrobial resistance via drinking water in

livestock husbandry. Igor Stojanov, Jasna Prodanov Radulovi, Milo Kapetanov, Jelena
Petrovic (Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
17:45 18:00
Invited presentation: Antimicrobial activity of the essential oils from some aromatic medicinal
plants cultivated in Serbia. Radomir Ratajac, Marina eki Stoi, Aleksandar Milovanovi,
Igor Stojanov (Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia)
18:00 18:10
Antimicrobial resistance of Enterococcus faecalis strains from pork.

Zdovc
18:10 18:20
Antimicrobial activity of blackberry juice from Serbia on animal pathogens. Tamara Krsti,
Ljiljana Suvajdi, Sran Stojanovi, Tama Petrovi, Maja Bekut, Neboja Ili, Zoran Suvajdi
18:20 18:30
The concept of reserve antibiotic. Maja Bekut, Ljiljana Suvajdi, Tamara Krsti
18:30 18:40
Antibiotic resistance to fluoroqionoles in Salmonella spp.: Recent findings in Serbia and brief
overview of resistance mechanisms and molecular typing methods. Maja Velhner, Gordana
Kozoderovi, Zora Jelesi
18:40 18:50
Research on the antibiotic resistance APEC strains isolated from broilers, in the western part
of Romania. Iancu Ionica, Viorel Herman, Ctan Nicolae
18:50 19:00
17
Majda Golob, Irena

7.1
Growth competition experiments revealed a fitness cost in triclosan tolerant salmonella

enterica mutants of different serovars. Ulrike Rensch, Matthias Greiner, Gnter Klein,
Corinna Kehrenberg
7.2 Bordetella bronchiseptica: proposal for a modification of the broth microdilution
susceptibility testing method. Sandra Prller, Cornelia Frmke, Heike Kaspar, Gnter Klein,
Lothar Kreienbrock, Corinna Kehrenberg
7.3 Quantification of viable campylobacter cells by qPCR after ethidium monoazide and
propidium monoazide treatments of cells. Diana Seinige, Carsten Krischek, Gnter Klein,
Corinna Kehrenberg
7.4 In-vitro susceptibility to eight biocides in extended-spectrum eta-lactamase (ESBL)
producing Escherichia coliisolates of human and avian origin. Daniela Deus, Carsten
Krischek, Yvonne Pfeifer, Gnter Klein, Felix Reich, Corinna Kehrenberg
7.5 Comparison of agar dilution and broth microdilution susceptibility testing of
Haemophilus parasuis isolates from Germany. Sandra Prller, Conny Turni, Patrick J.
Blackall, Katrin Strutzberg-Minder, Heike Kaspar, Diana Meemken, Gnter Klein, Corinna
Kehrenberg
7.6 Susceptibility of methicillin-resistant and susceptible Staphylococcus aureus isolates of
various clonal lineages to eight biocides. Isa Adriana Kernberger-Fischer, Carsten Krischek,
Birgit Strommenger, Gnter Klein, Corinna Kehrenberg
7.7 Surveillance of antimicrobial resistance at the clinic of infection disease in Clinical
Centre of Vojvodina. Vedrana Petric, Sandra Stefan-Miki, Sinia Sevi, Vesna Miloevi,
Ivana Hrnjakovi-Cvjetkovi, Milo Vujanovi
7.8 Antibacterial susceptibility of mastitis pathogens to iodine-lithium complex in vitro.
Marina eki Stoi, Radomir Ratajac, Aleksandar Milovanovi, Jelena Petrovi, Igor
Stojanov, Jelena Api
7.9 Random amplified polymorphic DNA analysis RAPD and resistance to antimicrobial
agents in Salmonella spp. isolated from poultry flocks in Southern Baka and Srem
region. Dalibor Todorovi, Maja Velhner, Bojana Pruni, Marko Paji, Dubravka Milanov,
Vladimir Polaek, Dejan Bugarski
7.10 Resistance of Black-Headed gull (Chroicocephalus ridibundus) and mute swan (Cygnus
olor) Escherichia coli to second and third generation of cephalosporins. Aleksandra
Petrovi, Milivoje Petrui, Verica Aleksi, Petar Kneevi
Dinner and free time
1 9 : 0 0
Saturday, May 23, 2015

09:00 09:40
Main Hall
Symposium Conclusions and Closing Remarks
Chairs: Miroslav irkovi, Tama Petrovi
09:00 09:30
Symposium Conclusions with discussions
09:30 09:40
Closing Remarks
09:40 12:30
Tourst excursion - Visits of cultural and historical places - optional
End of Symposium
18
Key note speech

ONE HEALTH CONCEPT - THE ROLE AND IMPORTANCE OF VETERINARIANS
Milijan Jovanovi1*, Miroslav irkovi2
1.Faculty of Veterinary Medicine, University of Belgrade, Belgrade, Serbia
2. Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia
* Corresponding author: [email protected]
Abstract
The One Health concept is defined as the collaborative efforts of multiple disciplines, working
locally, nationally and globally, to reach optimal health for people, animals and the environment.
One Health is a new phrase, but the concept extends back to ancient times and can be traced as far
back as to the Greek physician Hippocrates.
In the late 19th century, German physician and pathologist Rudolf Virchow (18211902), to
indicate the infectious disease links between animal and human health, coined the term "zoonosis",
and said "...between animal and human medicine there are no dividing lines nor should there be".
The phrase "One Medicine" was developed and promoted by an American veterinary
epidemiologist Calvin W. Schwabe (19272006).
The term One Health is used in many different contexts. However, there appears to be some
confusion as to what the term really means. Some authors consider the terms One Medicine, One
Health and One World-One Health-One Medicine to be entirely synonymous.
Because in the early year of 21st century emerging zoonotic diseases created several international
crises governments and scientists worldwide recognized that greater interdisciplinary collaboration
was required to prevent and control diseases such as bovine spongiform encephalopathy (BSE),
severe acute respiratory syndrome (SARS), highly pathogenic avian influenza (HPAI H5N1) and
etc. It had highlighted the need for professional collaboration and that such collaboration should
include not only physicians and veterinarians, but also wildlife specialists, environmentalists,
anthropologists, economists and sociologists, among others. The One Health concept recognized
that the health and wellbeing of humans, animals and ecosystems are interconnected. The concept
One Health has been adopted with great enthusiasm by the veterinary profession. Veterinarians
have opportunities and responsibilities to protect the health and well being of people, animals and
ecosystems in all the areas in which they work: food security, food safety, antibiotic sensitivity
testing, research on zoonoses, emerging infectious diseases, ecosystem protection, and comparative
medical research. The tripartite group FAO/OIE/ WHO promotes and supports One Health
approach. We see One Health as a concept that would drive new research ideas and greater
collaboration.
Keywords: animals, ecosystem, humans, One Health, zoonoses
Introduction
The One Health Concept is a worldwide strategy for expanding interdisciplinary collaborations and
communications to improve all aspects of the health and welfare of humans, animals and the
environment. It could be defined as the collaborative efforts of multiple disciplines, working
locally, nationally and globally, to reach optimal health for people, animals and the environment
(Gibbs, 2014).
The term One Health is used in many different contexts and by people with varying backgrounds.
However, there appears to be some confusion as to what the term really means, and it is used in a
19
wide range of contexts, often including or bordering concepts such as infection biology, contagious
diseases, zoonotic infections, evolutionary medicine, comparative medicine, and translational
medicine.
Some authors consider the terms One Medicine, One Health and One World, One Health, One
Medicine to be entirely synonymous (Gibbs and Anderson, 2009) while others point out some
differences, which are subtly nuanced (Lerner and Berg, 2015). It is certain that the term One
Health most commonly used today and has the widest and comprehensive meaning, which refers
not only to infectious diseases but also encompasses the general public health, comparative
medicine and ecology.
History
One Health is a new phrase, but the concept extends back to ancient times. The recognition that
environmental factors can impact human health can be traced as far back as to
the Greek physician Hippocrates (c. 460 BCE c. 370 BCE) and his text "On Airs, Waters, and
Places". in which he promoted the concept that public health depended on a clean environment.
(Anon, 2015).
Also, in India on a stone edict, laid down by the roadside, written in the time of King Ashoka
(ca. 304 BC-232 BC), a common concern about the health of humans and animals:
. . . everywhere has Beloved-of-the-Gods, King Piyadasi, made provision for two types of medical
treatment: medical treatment for humans and medical treatment for animals. Wherever medical
herbs suitable for humans or animals are not available, I have had them imported and grown.
Wherever medical roots or fruits are not available I have had them imported and grown. Along
roads I have had wells dug and trees planted for the benefit of humans and animals (Lerner and
Berg 2015).
Figure 1. Rudolf Virchow (18211902)
20
In recent history, the great advocate of a unique approach to medicine was the founder of modern
pathology German pathologist Rudolf Virchow (Rudolf Virchow, 1821-1902) (Figure 1) which is
its position formulated in the following statement: Between animal and human medicine there is
no dividing line-nor should there be. The object is different but the experience obtained constitutes
the basis of all medicine. The son of a butcher, Virchow noted the link between diseases of
humans and animals and coined the term zoonosis to indicate the infectious disease links between
animal and human health. He described the life cycle of Trichinella spiralis in swine and its
zoonotic consequences. Another pathologist, William Osler (1849-1919), a Canadian physician was
also ardent supporter of unique medicine. He briefly studied in Germany with Virchow and after he
got a lectureship in the Medical Faculty of McGill University in Montreal. He lectured to not only
medical students, but also he demonstrated anatomy and pathology on a daily basis to the veterinary
students from the Montreal Veterinary College. As an active participant in comparative pathology,
he became vice president and later president of the Veterinary Medical Association.
In the early 20th century Virchow concept is beginning to fade and lose interest in the medical
and veterinary profession, which develop as an independent discipline. In the middle of the
twentieth century Calvin Schwabe (1927-2006), a veterinary epidemiologist and parasitologist at
the University of California, Davis School of Veterinary Medicine, established a modern approach
to the role of animals in human health which developed and promoted through concept One
Medicine. His concepts of One Medicine were based on the close relationship between humans,
domestic animals and public health. Schwabe proposed a unified human and veterinary approach to
zoonoses in the 1964 edition of his monograph Veterinary Medicine and Human Health which
has reached the third edition that appeared in 1984(Cardiff et al, 2008).
The term One World-One Health was first introduced at the meeting of the Wildlife Conservation
Society (WCS), which was held in New York in 2004. At this meeting were adopted 12
recommendations to embrace and protect both medicine and ecosystem health. This series of
recommendations became known as the Manhattan Principles, in recognition of the fact that the
meeting was hosted by Rockefeller University in New York (Gibbs, 2014).
The idea of greater collaboration between veterinary and medical profession over time more and
more developed in the USA. In 2006, the American Veterinary Medical Association (AVMA)
established the One Health Initiative Task Force, and a year later in 2007, the American Medical
Association unanimously approved a resolution calling for increased collaboration between the
human and veterinary medicine. The term One Health had entered the medical and scientific
lexicon (Cardif et al. 2008; Gibbs, 2014; Kaplan et al.2009).
The World Veterinary Association (WVA) recognizes and supports the Tripartite Concept Note
titled Sharing responsibilities and coordinating global activities to address health risks at the
animal-human-ecosystem interfaces jointly developed and adopted by the World Organization for
Animal Health (OIE), World Health Organization (WHO) and the Food and Agriculture
Organization of the United Nations (FAO) in 2010 (Anon, 2014). The tripartite note clearly
recognizes that addressing health risks at the human-animal-ecosystem interface requires strong
partnerships among all stakeholders.
The goal of the concept

The One Health Concept recognizes that the health and wellbeing of humans, animals and
ecosystems are interconnected. It involves applying a coordinated, collaborative, multidisciplinary
and cross-sectorial approach to address potential or existing risks that originate at animal-humanecosystem interfaces.
21
The importance of One Health concept in the modern world is increasingly gaining in, it is not
difficult to understand because that about two-thirds (60.3 %) of emerging infectious diseases
(EID) result from zoonoses; the majority of these have their origin in wildlife (71.8%) and have
been increasing in recent years. A major finding was that there was a high correlation between EID
origins and socio-economic, environmental and ecological factors, thereby providing a mechanism
by which areas (called emerging disease hotspots) where EIDs are most likely to originate.
Global resources to combat the emergence of infectious disease are not well allocated as most of the
research and surveillance activities are occurring in countries that do not fit the predicted sites from
which new diseases are likely to emerge. Humans serve as a primary reservoir for only 3% of
known zoonotic pathogens (Frank, 2008).
In the early years of the 21st century with the advent of diseases such as highly pathogenic avian
influenza (HPAI H5N1) severe acute respiratory syndrome (SARS), Middle East respiratory
syndrome (MERS), Bovine spongiform encephalopathy (BSE) AIDS, Ebola, West Nile virus,
hantavirus infections and others diseases that had the potential to become pandemic, including
extensive human mortality, created several international crises (Gibbs, 2005). Governments and
scientists worldwide have found themselves facing a great challenge and recognized that greater
interdisciplinary collaboration was required to prevent and control of these diseases. Some believe
that the One Health concept was just created and developed in fear of these diseases (Gibbs,
2014).
With the development of technology, air and water transport, the world has continued to shrink.
Microorganisms can travel by plane across the world in time frames shorter than their incubation
periods. Nowhere is remote and no one is disconnected(Frank, 2008). Special problems are
caused by vectors transmitted diseases. Country borders do not exist for vector-borne diseases
(Vali et al, 2015).
The population of the world is increasing from the current 7 billion, is projected to reach 9 billion
in 2050. The increase in population will require greater need for safe and quality food of animal
origin (Wall, 2014). Food safety, combating microbial resistance to antibiotics, climate change and
wildlife conservation are further mega-concerns where One Health can make contributions.
As a starting point for an explanation of "One Health concept" many authors have taken symbolic
umbrella model (Figure 2), which was developed in Sweden and from which we can see the
complexity of the concept. A number of scientific fields are present under the umbrella of One
Health (see the top row circles): biology, human medicine, veterinary medicine, public health,
environmental chemistry, and health economy, to mention some of the most important ones. The
concept of health could be defined on at least three different levels: the individual level, the group
or population level, or the ecosystem level (Lerner and Berg, 2015).
Health is a state of complete physical, mental and social well-being and not merely the absence of
disease or infirmity. It is the outcome of a complex of several inter-dependent medical, economic,
socio-cultural, environmental and ecological factors. Peoples health and wellbeing, and equally
animal health and welfare are strongly interlinked. Both also influence and are impacted by the
health of the environment. Health is a precondition for wellbeing and respectively welfare.
Wellbeing and welfare reinforce health.
Animals, domesticated and wild, play a key role in the wellbeing of people and the future of our
planet. They provide working power, food, protection, companionship and enjoyment, facilitate the
advancement of biomedical research, and are a crucial part of healthy ecosystems. Keeping animals
healthy is essential for the health and well-being of people and the environment (Mills and Hall,
2014). The man and animals in a broader sense belong to the one multispecies animal world in
22
which in some cases shared a common pathogen, and also they are together exposed to harmful,
toxic agents from the environment.
Figure 2. The One Health concept presented in the form of an umbrella
In the One Health concept, plant health is often perceived as a part of ecosystem health rather than
as a separate entity and has essential impact on human and animal health
Recognizing the basic fact that all humans and animals must eat to survive, it follows that since our
food sources are all derived directly or indirectly from plants we must protect plant life on this earth
to maintain healthy humans and healthy animals. Thus, plant pathogens play a direct and indirect
role in the ecological existence of human and animal species. We need human doctors (physicians)
and animal doctors (veterinarians), as well as plant doctors (plant pathologists) to work together
for the common good of all species. How to plant health can affect the health of animals, animal
products safety and health of people and which problems of that might arise, well you can see
from our example from 2013 regarding the appearance of larger amounts of aflatoxin in corn
grain and corn products.
Besides their role in the preservation of ecosystems and the importance as a source of food plants
will be in the future more and more used in the protection of animal health. Recent advances in
immunology and in biotechnology, demonstrated the feasibility and advantages of plant-based
production platforms for various recombinant proteins with therapeutic use, including, subunit
vaccines, complex antibodies and immunogenic virus-like particles. Plant made therapeutic
products are currently on the cusp of widely entering biotechnology markets. To date, vaccines
been made against chicken infectious bronchitis virus (IBV) and infectious bursal disease virus
(IBDV), enterotoxigenic E. coli (ETEC) and porcine transmissible gastroenteritis coronavirus
23
(TGEV), bovine herpes virus (BHV) and bovine viral diarrhea virus (BVDV) (Kolotilin et al.,
2014).
The role of the veterinarians

Veterinarians, regardless of their field of practice, all play a significant role in human health and
animal health Veterinarians in all areas of the profession have opportunities and responsibilities to
protect the health and well being of people in all the areas in which they work: food security, food
safety, antibiotic sensitivity testing, research on zoonoses, emerging infectious diseases, ecosystem
protection, comparative medical research, and human physical/mental health. The veterinarian is the
only health care professional likely to see both people and their animals, so he/she therefore has an
awareness of the potential threat of zoonotic disease and has the ability and responsibility for
detecting zoonotic/emerging diseases. Fortunately, veterinarians have considerable training in
comparative medicine, zoonoses, and public health. Physicians on the other hand do not receive
extensive training in comparative medicine and zoonoses. Therefore veterinarians are in a better
position to discover public health threats than are physicians. They are also in an ideal position for
establishing a disease surveillance system using pets as sentinels of disease exposure in the home
environment and in the wild (Frank, 2008).
There should be a good relationship and communication between public and private veterinary
sectors as well as between veterinarians and animal owners and keepers. In achieving the One
Health concept veterinary profession has a special responsibility and prominence in the
implementation of the following:
enhancing the health and welfare of animals (e.g., through treatment and prevention of
diseases and promotion of animals physical and mental wellbeing);
improving the health of people (e.g., through detection and prevention of zoonotic diseases);
ensuring safer animal products for human consumption (e.g., through preventing foodborne
diseases and food frauds; and overseeing best practices for use of animal medicines);
ensuring sufficient food (e.g., through technological and management advances);
protecting the environment (e.g., through conservation, prudent use of medicines, and
chemicals, and the careful disposal of waste);
competencies in the use of antimicrobials and thus insuring their effectiveness in both
animal and human medical practice; in the use of antimicrobials and thus preserve their
effectiveness in veterinary and medical practice (Anon, 2014).
Comparative medicine
Comparative medicine is the study of disease processes across species and is based on the study of
naturally occurring diseases of animals that also afflict humans Comparative medicine is, by
definition, based on the idea of comparing humans to one or more chosen animal species, or the
other way around. Hence, it has limitations from a veterinary point of view, as veterinarians are also
often interested in comparing different animal species with each other, that is, making comparisons
that include several different species but not necessarily always including Homo sapiens. Animals
suffer from many of the same chronic diseases such as heart disease, cancer, diabetes, asthma, and
arthritis as humans. Sometimes a disease entity is recognized in animals long before it is recognized
in humans. The concept of comparative medicine is very old. The ancient Greeks understood that
dissecting and studying animals could yield important clues to understanding human diseases. The
24
musculoskeletal system is particularly well-suited to comparative medicine studies since acute and
chronic disorders of bones and joints have the same counterparts in humans and animals.
Information gained from one species can be directly translated to another, thereby advancing the
diagnosis and treatment of musculoskeletal disorders. Some of the solutions in orthopedic surgery,
such as a particular method of fixation in fractures were first applied in veterinary practice (Cook
and Arnoczky, 2009).
In the United Kingdom has been established the Comparative Clinical Science Foundation to fund
comparative studies in cancer, aging and genetic disorders (http://www.onemedicine.org.uk/).
Comparative sequence analyses demonstrate extensive genetic homologies among species.
Furthermore, it has been proven that mutations of one gene in one species cause a similar disease in
other species. For example, the virus discovered to cause sarcomas in chickens by Peyton Rous and
others, 100 years ago harbours the gene associated with cancers in rats, mice and human. As the
genes and diseases are the same, the medicine will be the same: the genetic version of One
Medicine or One Health approach (Cardiff, 2008). Isolation and cloning of a gene associated with
human disease, when inserted into and expressed by the mouse genome, recapitulates the disease in
the mouse. Clearly, one gene can cause the same disease in another species. In modern biological
science is dominated by molecular biology and there is a need to learn more and more about less
and less. To enhance interdisciplinary scientific collaboration, like the existence of "Open access
publishing", there is thinking about creating "Open access bio-banks" where will be kept
biological material (be it tissue, blood, fecal samples, effluent water, or anything else possibly
relevant) that would be available to scientists who perceive certain problems from different
aspects (Lerner, 2015).
One Health in education

Given the importance of One Health to the enhancement of human, animal and environmental
health, it is essential to embed the One Health Concept into the curricula at colleges, schools and
faculties educating animal, human, and environmental health professionals. New communication
technologies provide excellent opportunities to spread information and engage people in
postgraduate education. In some parts of the world today is possible in this field to gain a degree
MSc and PhD at the University (Gibbs, 2014). To familiarize professionals with One Health,
numerous international, regional, and national conferences, symposia, and workshops have been
organized. Two international congresses have specifically addressed One Health, the first in
Australia in 2011 and the second in Thailand in 2013. Each was attended by several hundred
professionals. A third international congress is planned for 2015 in Amsterdam.
Conclusion
The advancement of the health and well-being of people and animals depends on effective and
sustained collaboration between varied professions and disciplines, both in the public and private
sectors. Observation of animal health and welfare, public health, zoonotic and environmental
problems as a separate discipline and entities would have in a long term, limited impact on
solving global problems. For continuous improvement it is necessary a broad interdisciplinary
holistic approach to develop effective action that fully emphasizes One Health philosophy. It is
time to consider whether One Health will prove to be a short-lived response to a spate of emerging
diseases that apparently threatened to the world, or a paradigm shift that will lead to a wider and
deeper commitment to interdisciplinary action addressing the protection and needs of society in the
21st century. We have an optimistic attitude, and we hope that the future will most likely bring
25
more collaborations of veterinarians from all fields with multiple professions such as public health,
human medicine, bio-engineering, animal science, environmental science, and wildlife. Together,
we are stronger to fight disease, and we are, indeed, wiser.
References:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Anon, The Internet Classics Archive. Hippocrates. "On Airs, Waters, and Places". 400 BCE. Translated
by Francis Adams. 2015, http://classics.mit.edu/Hippocrates/airwatpl.html
Anon: World Veterinary Association Position on One Health Concept, 2014, www.worldvet.org.
Cardiff RD, Ward MJ, Barthold SW: One medicine - one pathology: are veterinary and human
pathology prepared? Laboratory Investigation, 88: 18-26, 2008.
Cook JL, Arnoczky SP. "The One Health Concept in Comparative Orthopaedics." One Health
Newsletter Florida
Department
of
Health.
Summer
2009;
vol.
2,
issue
3.
http://www.doh.state.fl.us/environment/medicine/One_Health/OHNLSummer2009.pdf.
Frank D: One world, one health, one medicine - Presidents Message. Canadian Veterinary Journal,
49(11): 1063-1065, 2008.
Gibbs EPJ:The evolution of One Health: a decade of progress and challenges for the future, Veterinary
Record 174: 85-91, 2014.
Gibbs EPJ, Anderson TC: One World-One Health and the global challenge of epidemic diseases of
viral aetiology, Veterinaria Italiana, 45(1): 9-18, 2009.
Kaplan B, Kahn LH, Monath TP: The brewing storm, Veterinaria Italiana, 45(1): 9-18, 2009.
Kolotilin I, Topp E, Cox E, Davriendt B, Conrad U, Joensuu J et al.: Plant-based solutions for veterinary
immunotherapeutics and prophylactics. Veterinary Research 2014, 45: 117.
Lerner H, Berg C: The concept of health in One Health and some practical implications for research and
education: what is One Health? Infection Ecology and Epidemiology 2015, 5: 25300 http://dx.doi.org./10.3402/iee.v5.25300.
Mills D, Hall S: Animal-assisted interventions: making better use of the human-animal bond Veterinary
Record, 174: 269-273, 2014.
Osterholm MT, Moore KA, Kelley S, Brosseau LM, Wong G, Murphy FA et al.: Transmission of Ebola
viruses: what we know and what we do not know. mBio 2015, 6(2): e0013715.doi:10.1128/mBio.00137-15.
Vali M, Radojii S, Obrenovi S, Stevi N, Vasi A: Vektori kao rezervoari I prenosioci infektivnih
bolesti ivotinja, Zbornik predavanja XXXVI Seminara za inovacije znanja veterinara, 2015, 3-18.
Verner-Carlsson J, Lhmus M, Sundstrm K, Strand TM, Verkerk M, Reusken C et al.: First evidence
of Seoul hantavirus in the wild rat population in the Netherlands. Infection Ecology and Epidemiology
2015, 5: 27215 - http://dx.doi.org/10.3402/iee.v5.27215.
Wall P: One Health and the food chain: maintaining safety in a globalised industry, Veterinary Record,
174: 189-192, 2014.
26
________________________________________________________________________
Session 1
DISEASES OF FARM ANIMALS
Full Papers
_______________________________________________________________________
27
Plenary lecture:
EIA AND EVA TWO EQUINE VIRAL DISEASES PRESENT IN EUROPE
Aymeric Hans1
1 ANSES-Dozul Laboratory for Equine Diseases, Virology Unit, France
Abstract
Equine infectious anemia (EIA) and Equine Viral Arteritis (EVA) are two equine diseases of
importance to international trade listed by the World Organization for Animal Heath (OIE). Equine
infectious anemia is caused by a virus (EIAV) belonging to the retroviridae family, genus
Lentivirus as the Human Immunodeficiency Virus (HIV) and has a worldwide distribution. EIAV
causes a persistant infection associated to recurrent febrile episodes. Asymptomatic infected
animals are the viral reservoir and can transmit the virus to others equids. EIAV is bloodborne and
transmitted primarily via biting flies, but also iatrogenically if non-sterile needles or surgical
equipment are used. Insects mainly horseflies and stable flies are mechanical vectors:
although the virus does not replicate within the insect, the infectious virus can remain in its
mouthparts for several hours after biting. Equine arteritis virus (EAV), the causative agent of EVA,
is a member of the Arteriviridae family. EAV infects equidae and may be transmitted through
respiratory and venereal routes. EAV can persist in the reproductive tract of stallions only.
Following the primary infection, up to 70% of stallions can be persistently infected and shed the
virus in their semen sometimes for life. These shedder stallions spread the virus in the horse
population during breeding or when their semen is used for artificial insemination. The financial
consequences of these diseases are potentially huge, since EIAV positive horses are in general
slaughtered and stallions shedding EAV in the semen lose their value. Moreover, EAV infection
may cause abortion in pregnant mares and the death of young foals. Romania and Italy are the most
European countries affected by EIA. The disease is endemic in Romania whereas only sporadic
cases have been notified in others European countries. Also, EVA cases are mainly sporadic in
European countries with very few descriptions of pathogenic strains leading to death or abortion
in pregnant mares. To better understand and prevent the viral spread in equine population
epidemiological surveys as well as molecular characterization of strains isolated in Europe are
investigated.
Keywords: Virus, Equine, notifiable diseases, Phylogeny
Equine Infectious Anemia Virus

Introduction
Equine infectious anaemia (EIA) is a viral disease. It is caused by Equine Infectious Anaemia virus
(EIAV) belonging to the Retroviridae family, genus Lentivirus, which also includes Human
Immunodeficiency Virus (HIV), Bovine and Feline Immunodeficiency Viruses (BIV and FIV) and
the visna-maedi virus. EIAV causes a persistent infection in equids. Clinical signs associated to the
infection appear between one to three weeks after infection and are characterized by fever, anemia,
edemas and various signs of listlessness and depend on the immune status of the host and viral load
upon infection.
28
The disease progresses and can be divided in three distinct phases. In its acute phase, the horse
shows serious clinical signs that can lead to the animal death. The chronic stage is characterized by
a recurrence of clinical phases such as pyrexia and anemia, whereas the final stage is asymptomatic
(Hammond et al., 2000; Leroux et al., 2001) with no overt signs of disease. However, these
unapparent carriers never eliminate the virus and represent an economical threat for the equine
industry. Moreover, they remain a source of infection for other horses (Issel and Adams, 1982).
Virus is transmitted mainly by infected blood through biting flies, but also by contaminated
instruments when non-sterile needles or dental equipment are used (Foil et al., 1983; Hawkins et al.,
1973). Insects, mainly horseflies and stable flies, are mechanical vectors: while the virus does not
replicate within the insect, the infectious virus remains in its mouthparts several hours after biting
(Williams et al., 1981). The virus is disseminated most effectively by this type of mechanical
vector-borne transmission when horses are gathered for equestrian events.
EIA Control is based on identification of unapparent carriers by detection of EIAV antibodies using
serological tests. The Agar Gel Immuno-Diffusion test (AGID) known as a Coggins test (Coggins et
al., 1972) is the most widely used to confirm an EIA case. Recently, some Enzyme Linked-Immuno
Sorbent Assays (ELISA) have been developed as well as immunoblots (Issel et al., 2013). EIA test
is required for horse importation/exportation and for stallions prior semen collection or in hand
breeding. Basically, leisure horses not used for breeding purposes are barely tested for EIA, thus
EIA outbreaks are often detected by a veterinarian following suspicious clinical signs in a horse
farm. Since year 2000, more and more outbreaks of EIA have been reported in Europe and USA.
Review of EIA surveillance in France

Outbreak surveillance
As EIA is a Category 1 health hazard, any clinical suspicion or confirmation by the results of
analysis by an accredited laboratory must be declared to the Directorate General for Food (DGAL)
and sample(s) must be sent to the National Reference Laboratory (NRL) for confirmation. This
clinical surveillance relies on the owners, veterinarians and the network of laboratories accredited to
perform serological analyses to detect EIA. Any equidae testing positive with an agar gel
immunodiffusion test (AGID, also known as Coggins test) is considered to be infected.
When EIA is confirmed, a declaration of infection (APDI) is issued by state veterinary services,
thus initiating health control measures. Control measures mainly consist of movement restrictions
placed on the outbreak site and decontamination by euthanasia of the infected horses, the
disinfection of facilities and materials, and monthly serological testing on the horses remaining at
the outbreak site. The outbreak is considered to have been eliminated and the restrictive measures
are lifted when the remaining horses have tested negative at least twice, three months apart.
At the same time, the horses at risk of infection (i.e. those that had been in contact with the infected
animal and those present within 500 m) are identified and placed under surveillance (restriction of
movements and regular serological testing to ensure there is no seroconversion within 90 days of
the last contact with an infected horse).
Programmed surveillance
Programmed (active) surveillance includes several different measures:
Breeding stallions are monitored systematically:
- All stallions used in artificial insemination are tested on a regular basis. If the semen is to be
sent to another European Union country, a negative Coggins result must be produced in the
two weeks preceding the first collection.
29
Stallions serving naturally in certain breeds must also be tested in accordance with their stud
book recommendations. A negative Coggins result must be produced in the three months
prior to the first service then every three years.
Furhtermore, voluntary surveillance is recommended and a test for EIA should be performed
whenever there is a change of ownership. All exported equidae must be tested in accordance with
the health requirements of the importing country. Imported equidae must also be screened for EIA
according to the exporting country, the type of importation (temporary, definitive or readmission
after temporary export) and the type of use (slaughter or other). Screening is not mandatory for
equids transported within the EU except for those from Romania. This measure was introduced in
2010 (2010/346/EU) following several cases of EIA in the United Kingdom, Belgium and France in
2009 and 2010 among equids imported directly from Romania.
2012 outbreaks
In 2012, the French network of accredited laboratories carried out 15,691 serological analyses of
which 27 tested positive. The 27 positive analyses involved eight equines in two distinct outbreaks
in two counties: Vaucluse and Gard. These two outbreaks were discovered following the
appearance of clinical signs that were suggestive of EIA (listlessness, weight loss, anaemia, nasal
bleeding, etc.).
Vaucluse outbreak
The primary outbreak was declared on January 30th, 2012, after confirmation of the infection in a
16 year-old part-bred Arabian gelding that showed suggestive clinical signs such as fever, nasal
bleeding, swelling of the lower abdomen, hind legs and the penile sheath, and pale mucus
membranes. The APDI order for the outbreak site was issued on February 2nd, 2012, requiring
restriction of movements and testing of all horses on the site. This site held seven other horses, three
of which were also diagnosed with an EIAV infection on February 6th, 2012 and all four infected
horses were euthanised on February 9th, 2012.
The epidemiological surveys covered a six-month period from August 2011 to January 2012 and
identified (1) all horses that had been in contact and at risk for EIA infection and (2) all horses
present within a 1 km radius of the outbreak site.
These surveys revealed that some of the four infected horses had participated in an endurance race
in September 2011 in Vaucluse. As a result, more than 180 horses were identified as being at risk of
EIA infection; no cases of infection were detected among those 180 horses. Despite the high
number of at-risk horses exposed during the endurance race in late September 2011, the virus
transmission was not demonstrated outside of the outbreak site, and there was no secondary
transmission to horses off site.
Gard outbreak
The primary EIA outbreak declared in September 2012 in Gard involved six horses of the
Camargue, Pura Raza Espaola (PRE) Andalusian, Barb and Merens breeds. The index case, which
exhibited fever (40C) and low haematocrit levels (16%), was originally thought to be infected with
babesiosis (for which it tested positive), and was treated for this disease. In the absence of
subsequent improvement, the veterinarian suspected an EIA infection and, noting the poor state of
its health (massive weight loss of about 100 kg), the horse was euthanised.
The epidemiological survey was first carried out on horses present within 500 meters of the primary
outbreak site as well as on all horses that had been in contact with the infected horses during the
four months period preceding the confirmation of the outbreak. The surveys identified 378 at-risk
30
contact horses, among which only 364 could be sampled. Of these 364 horses, 3 were tested
positive for EIA.
Molecular epidemiology
To genotype the EIA strains isolated from various outbreaks, gag gene (1400 nucleotides long) was
sequenced. The 2012 EIA outbreaks led to the identification of eight seropositive horses. Virus
isolates were characterised from five of the eight horses. The phylogenetic analysis, carried out
using the MEGA 5.0 software package, was used to compare and classify the viruses isolated in
2012 with respect to those isolated previously in France and those reported in the literature (Figure
1).
Figure 1: Phylogenetic analysis of 50 EIA isolates using MEGA 5.0. Analysis performed using the full gag
gene sequence (1400bp).
The obtained phylogenetic tree shows that the isolates from the outbreak declared in Vaucluse and
Gard were not only different from each other but also from those identified previously in France, in
particular those isolated in Var in 2009 (Ponon et al., 2011). Although there were indications from
the epidemiological field survey that there was an epidemiological connection between the
Vaucluse and Gard outbreaks via the purchase, sale or trade of horses, this hypothesis was not
confirmed by phylogenetic analysis. In contrast, data of this phylogenetic study show that Vaucluse
and Gard outbreaks had two distinct origins because the sequenced virus isolates were not identical.
Furthermore, the seropositive horses in the Vaucluse outbreak were infected by two different
isolates (Figure 1). The isolate characterised from horse 12D134 shows that it was related to isolates
sampled in 2007 on donkeys in Ardche county (Reme et al., 2009). However, no epidemiological
31
connection could be established from the field surveys between horse 12D134 and the Ardche
donkey euthanised in 2007. Likewise, the viral isolates characterised from horses 12D128 and
12D131 were similar to the virus isolated in 2010 in Dordogne county on a cull trotting horse. Once
again, no epidemiological connection was demonstrated between these two outbreaks. Moreover,
the isolates characterised from horses 12D899 and 12D903, found in Gard county, were similar to
viruses isolated in Italy in the past few years (Hans et al., 2012).
Review of EIA surveillance in Europe 2010-2014

EIA is a notifiable disease in Europe. Each country has to report any EIA cases, even if no clinical
signs are seen. Thus, each AGID positive test has to be declared to the national authority then to the
European authority. The vast majority of outbreaks declared in Europe are sporadic cases without
sanitary and economic consequences for horse industry. Between 2010 and 2014, no EIA outbreaks
have been reported by Baltic and Scandinavian countries (Estonia, Latvia, Lithuania, Finland
Sweden and Denmark). The western European countries (UK, Ireland, Netherlands, Belgium,
France, Spain and Portugal) have reported 16 EIA outbreaks with 35 positives horses during the last
four years. Eighty five outbreaks were reported by central European countries (Germany, Poland,
Czech Republic, Slovakia, Austria and Hungary) with a total of 105 horses tested positive for EIA
during the last four years. Finally, Italy and the Balkans countries (Croatia, Romania, Bulgaria,
Slovenia) have reported more than 7 400 EIA outbreaks between 2010 and 2014 associated to
around 10 000 positive horses for EIA. Officially, EIA outbreaks have been reported from France,
UK, Italy, Romania, Belgium, Netherlands, Germany, Croatia and Hungary during the last four
years, showing that EIA is present all around Europe with different prevalence level.
In Europe, only two countries, Italy and Romania, have implemented a national surveillance
program to test the horse population registered for EIA.
Following the 2006 EIA outbreak, due to the use of contaminated plasma, Italy has decided to
implement a surveillance program as follow: Annual test of all equids over 6 months of age kept in
regions with high prevalence (Latium, Umbria and Abruzzo) and a test every two year for equids
living in area where EIA seroprevalence is lower. Italian authority decided to test also donkeys and
mules. In Italy, around 230 000 horse sera samples, 10 000 donkeys and 1500 mules are tested each
year. Prevalence of the disease is different between horses, donkeys and mules. Indeed, prevalence
in mule is around 10%, whereas prevalence is weak in donkeys and horse around 0.08% and 0.15%,
respectively. These data, from Italy, show that the main reservoir for EIA seems to be the mules.
Since 2007, and the implementation of the surveillance program in Italy, the number of EIA
outbreaks and the number of positive horses detected has steadily decreased over the past few years.
Situation in Romania is totally different compare to Italy, since Romania has very few breeding
farms. The majority (55%) out of 700 000 equids identified in 2010 in Romania are used for work
in the fields and not for sport or leisure activity. Less than 1 %, corresponding to 4 400 equids only,
was kept in stud-farms, whereas the 99% left are owned and kept by private individual who
possessed in general only one equid. The first description of the disease dates back to the 50s in the
Baragan region located in the South East of Romania. It is only after the integration of Romania in
European Union in 2006, that the EIA problem has been seen. Indeed, between 2000 and 2004
Romania has declared 9 953 EIA outbreaks with 30 132 positive equids. Since 2010, Romania has
implemented a surveillance program aimed at testing all equids older than 6 months of age, two
times per year for stallions and sport horses and once a year for others. Incidence is still difficult to
estimate in Romania. Nevertheless, a decrease in the number of outbreaks and of positive horses is
seen since 2010.
32
Equine arteritis Virus

Introduction
Equine arteritis virus (EAV) is one of the major viral pathogens of horses (Rola et al., 2011). It is
the causative agent of equine viral arteritis (EVA), and can infect horses, donkeys, mules, and
zebras (Balasuriya et al., 2013). EAV is an Arterivirus belonging to the Arteriviridae family in the
order Nidovirales (Cavanagh, 1997). EAV was initially isolated from an aborted foetus on a
Standardbred breeding farm near Bucyrus, Ohio, USA, in 1953 (Bryans et al., 1957a; Bryans et al.,
1957b). Based on phylogenetic analysis of a portion of ORF5 encoding viral glycoprotein 5 (GP5),
EAV isolates are classified into two groups: The North American and the European group. The
latter can be further divided into two subgroups: European subgroup 1 (EU-1) and European
subgroup 2 (EU-2) (9, 10). It has been previously reported that North American and European EAV
isolates present 85% of nucleotide identity (Vairo et al., 2012). EVA is a respiratory and
reproductive disease of horses that occurs worldwide (Glaser et al., 1996; Timoney and McCollum,
1993). The vast majority of EAV infections are subclinical, but acutely infected animals may
develop a wide range of clinical signs including pyrexia, depression, anorexia, dependent edema
(scrotum, ventral trunk, and limbs), stiffness of gait, conjunctivitis, lacrimation and swelling around
the eyes (periorbital and supraorbital edema), respiratory distress and leukopenia. The direct
consequences of EVA outbreaks are financial losses mainly due to abortions of pregnant mares and
death of young foals (Vairo et al., 2012). Following primary EAV infection, up to 70% of the
stallions will carry the virus in their reproductive tract sometimes for years (Holyoak et al., 1993a;
Holyoak et al., 1993b). Those stallions will shed the virus in their semen.
Figure 2: Phylogenetic analysis by Maximum Likelihood method. The analysis involved 87 nucleotide
sequences
33
During the summer of 2007, an outbreak of EVA occurred in Normandy, France. Only draught and
saddle horses were affected. This 2007 outbreak occurred following the used of semen
contaminated by EAV for insemination. The objectives of this study were to undertake a thorough
epidemiological investigation to identify shedders stallions following the 2007 EVA outbreak as
well as the molecular characterization of EAV isolates encountered in France.
A total of 35 positive semen samples and 5 tissues samples from aborted foetuses were analyzed in
this study. All of them have been collected between 2007 and 2010. The evolutionary history was
inferred by using the Maximum Likelihood method based on the Data specific model. Evolutionary
analyses were conducted in MEGA5 (Tamura et al., 2011). The phylogenetic tree has been
constructed using 87 sequences (figure 2). 52 of them have retrieved from Genbank database and 35
were from viruses isolated in France between 2007 and 2010. Analysis was performed using the
3kb sequences covering ORF2 to ORF7 of the EAV genome.
The phylogenetic tree constructed shows that EVA viruses circulating in France belong to 3 groups
defined as the American group (AG), the European subgroup 1 (EU1) and European subgroup 2
(EU2). Nevertheless the majority of viruses belong to the European group, since only one virus
from the American group has been isolated in France during these 3 years. Interestingly, virus
responsible of the 2007 outbreak in Normandy belongs to the European subgroup 2 and seems to be
slightly different from viruses that use to be isolated in France before the outbreak. Indeed, all viral
isolates which are related to the 2007 outbreak formed a smaller group inside the European
subgroup 2. This genetic feature might explain the severity of the clinical signs and the
pathogenicity of the virus that caused several deaths in 2007
This work gives a clear and precise view of equine arteritis viruses strains that are circulating in
France. EAV isolates belong to the 3 groups described in the literature AG, EU1 and EU2.
Nevertheless the majority of them are from the European lineage. In addition, EAV viruses isolated
during the 2007 outbreak grouped in the European subgroup 2 and are slightly divergent from the
ones seen in France the past years. This genetic diversity might explain the severity of clinical signs
and the higher mortality rate seen during this outbreak. Investigations are in progress to understand
and decipher the pathogenic features of this isolate.
References
1.
2.
3.
4.
5.
6.
7.
Balasuriya, U.B., Go, Y.Y., Maclachlan, N.J., 2013. Equine arteritis virus. Veterinary microbiology.
Bryans, J.T., Crowe, M.E., Doll, E.R., McCollum, W.H., 1957a. Isolation of a filterable agent causing
arteritis of horses and abortion by mares; its differentiation from the equine abortion (influenza) virus.
The Cornell veterinarian 47, 3-41.
Bryans, J.T., Doll, E.R., Knappenberger, R.E., 1957b. An outbreak of abortion caused by the equine
arteritis virus. The Cornell veterinarian 47, 69-75.
Cavanagh, D., 1997. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Archives of
virology 142, 629-633.
Coggins, L., Norcross, N.L., Nusbaum, S.R., 1972. Diagnosis of equine infectious anemia by
immunodiffusion test. American journal of veterinary research 33, 11-18.
Foil, L.D., Meek, C.L., Adams, W.V., Issel, C.J., 1983. Mechanical transmission of equine infectious
anemia virus by deer flies (Chrysops flavidus) and stable flies (Stomoxys calcitrans). American journal
of veterinary research 44, 155-156.
Glaser, A.L., de Vries, A.A., Rottier, P.J., Horzinek, M.C., Colenbrander, B., 1996. Equine arteritis
virus: a review of clinical features and management aspects. The Veterinary quarterly 18, 95-99.
34

8.
9.
10.
11.
12.
13.
14.
15.
16.
Hammond, S.A., Li, F., McKeon, B.M., Sr., Cook, S.J., Issel, C.J., Montelaro, R.C., 2000. Immune
responses and viral replication in long-term inapparent carrier ponies inoculated with equine infectious
anemia virus. Journal of virology 74, 5968-5981.
Hans, A., Ponon, N., Zientara, S., 2012. Situation pidmiologique de lanmie infectieuse des quids
en France et en Europe de 1994 2011. Bull. Acad. Vt. France 165, 27-34.
Hawkins, J.A., Adams, W.V., Cook, L., Wilson, B.H., Roth, E.E., 1973. Role of horse fly (Tabanus
fuscicostatus Hine) and stable fly (Stomoxys calcitrans L.) in transmission of equine infectious anemia
to ponies in Louisiana. American journal of veterinary research 34, 1583-1586.
Holyoak, G.R., Giles, R.C., McCollum, W.H., Little, T.V., Timoney, P.J., 1993a. Pathological changes
associated with equine arteritis virus infection of the reproductive tract in prepubertal and peripubertal
colts. Journal of comparative pathology 109, 281-293.
Holyoak, G.R., Little, T.V., McCollam, W.H., Timoney, P.J., 1993b. Relationship between onset of
puberty and establishment of persistent infection with equine arteritis virus in the experimentally
infected colt. Journal of comparative pathology 109, 29-46.
Issel, C.J., Adams, W.V., Jr., 1982. Detection of equine infectious anemia virus in a horse with an
equivocal agar gel immunodiffusion test reaction. Journal of the American Veterinary Medical
Association 180, 276-278.
Issel, C.J., Scicluna, M.T., Cook, S.J., Cook, R.F., Caprioli, A., Ricci, I., Rosone, F., Craigo, J.K.,
Montelaro, R.C., Autorino, G.L., 2013. Challenges and proposed solutions for more accurate serological
diagnosis of equine infectious anaemia. The Veterinary record 172, 210.
Leroux, C., Craigo, J.K., Issel, C.J., Montelaro, R.C., 2001. Equine infectious anemia virus genomic
evolution in progressor and nonprogressor ponies. Journal of virology 75, 4570-4583.
Ponon, N., Moutou, F., Gaudaire, D., Napolitan, L., Le Guyader, E., Hans, A., 2011. Bilan de la
surveillance de lAnmie Infectieuse des Equids en France en 2010: gestion de deux pisodes
asymptomatique. Bulletin pidmiologique sant animale-alimentation, 54-55.
17. Reme, A.M., Klotz, S., Guix, E., Hans, A., Ponon, N., Moutou, F., 2009. Anmie infectieuse des
quids: deux foyers rcents en Ardche et dans le var. Bulletin pidmiologie sant animalealimentation BE 33. Rola, J., Larska, M., Rola, J.G., Belak, S., Autorino, G.L., 2011. Epizotiology and
phylogeny of equine arteritis virus in hucul horses. Veterinary microbiology 148, 402-407.
18. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum
parsimony methods. Molecular biology and evolution 28, 2731-2739.
19. Timoney, P.J., McCollum, W.H., 1993. Equine viral arteritis. The Veterinary clinics of North America.
Equine practice 9, 295-309.
20. Vairo, S., Vandekerckhove, A., Steukers, L., Glorieux, S., Van den Broeck, W., Nauwynck, H., 2012.
Clinical and virological outcome of an infection with the Belgian equine arteritis virus strain 08P178.
Veterinary microbiology 157, 333-344.
21. Williams, D.L., Issel, C.J., Steelman, C.D., Adams, W.V., Jr., Benton, C.V., 1981. Studies with equine
infectious anemia virus: transmission attempts by mosquitoes and survival of virus on vector mouthparts
and hypodermic needles, and in mosquito tissue culture. American journal of veterinary research 42,
1469-1473
35
Invited lecture
THE VOLUNTARY PROGRAMME FOR CONTROL AND ERADICATION OF BOVINE
VIRAL DIARRHEA VIRUS INFECTIONS IN SLOVENIA
Ivan Toplak1, Peter Hostnik1, Danijela Rihtari1, Joe Grom1
1. University of Ljubljana, Veterinary Faculty, National Veterinary Institute, Ljubljana, Slovenia
Abstract
In Slovenia the control of bovine viral diarrhea viral (BVDV) infection was started 1994. About
half of the bovine herds were recognized with BVDV antibody positive animals. During last twenty
years only limited progress towards the eradication was achieved. With the beginning of year 2014,
according to new national rules, which prescribes the conditions for recognition, acquisition and
maintenance, a free status of BVDV for an individual herd can be achieved, if specific requirement,
based on laboratory testing, and preventive measurements are implemented in a herd. The basis of
voluntary programme is identification and certification of herds which are free of virus. For the
recognition of officially BVDV free status of herd the breeder should provide two consecutives
laboratory testing at intervals of at least six months in all animals which are during the sample
collection in the age group of 7 to 13 months, with negative results for antibodies. The farmer will
then maintained the status by the implementation of preventive measures and each year renewed
this status with one laboratory testing of all animals in the age group of 7 to 13 months. If herd is
recognized as BVDV positive, it can start with the acquisition programme through the identification
and elimination of persistently infected animals and laboratory testing all newborn calf for BVDV
during one year of period.
At the beginning of year 2015 in Slovenia already 11 bovine herds are officially free of BVDV.
First herds with officially BVDV free status confirming, that this practice is a good and cost
effective solution for our farmers. All herds with recognized BVDV free status are presented on
web site of The administration of the Republic of Slovenia for food safety, veterinary and plant
protection. We hope that voluntary programme is first step towards the eradication of BVDV at
national level.
Keywords: bovine viral diarrhoea virus, diagnostics, eradication, cattle
Introduction
Bovine viral diarrhea (BVD) is a disease of cattle that reduces productivity and may increases death
loss. It is caused by bovine viral diarrhea virus (BVDV), a member of the Pestivirus genus of the
family Flaviviridae (Lindenbach and Rice, 2001). BVDV is distributed throughout the world, with
endemic areas detecting antibodies among 70100 % of herds, while in some European countries
such as Sweden, Norway, Finland and Austria, the disease has already been eradicated
(Obritzhauser et al., 2005; Houe et al., 2006). BVDV is spreading by close contact (nose-to-nose)
between cattle and produce heavy economic losses in infected herds.
Virus is shedding by both acutely and persistently infected (PI) animals, but levels of shedding are
much higher in PI cattle, which are the natural reservoir for the virus. Foetuses that become infected
between 30 and 125 days of gestation and survive the infection may be born as BVDV infected
calves (Brownlie et al., 1989). The BVDV infection will persist for the life of the calf, hence the
term ''persistent infection'', or PI. The incidence of PI animals is estimated between 0.3 and 2.6 %
36
(Baker, 1995). PI animals are the main source of infection in infected herds and tend never to reach
their productive potential and growth because of reduced fertility and increased susceptibility to
other diseases (Loneragan et al., 2005). By removing the source of infection (PI animals) from the
population the disease can be controlled (Houe et al., 2006). Blood tests are the most frequently
used method to identify BVDV in live animals, but also other samples such as skin biopsies (taken
from the ear), milk or even oral swab samples can be collected for detection of virus (Kenedy et al.,
2006; Fulton et al., 2009; Toplak et al., 2015).
The monitoring of herds infected with BVDV in Slovenia started in 1994, but the disease is likely to
be present in breeding farms for centuries (Grom and Barli-Maganja, 1999, Toplak, 2004). Since
1994, all bulls in breeding and artificial insemination centers are under supervision based on the
regular laboratory testing (Hostnik et al., 2002). Since this time, the collection centres are free of
BVDV, which are important preventive measures in a country to prevent spreading of BVDV by the
semen. During the period 1996 and 2003 from 260 to 312 breeding herds BVD were monitored for
the detection of antibodies (Toplak et al, 2002, Toplak, 2004). Young bulls are tested for BVD
antibodies and BVDV genome just before entering the breeding centres and later once per year in
centres. Before 2014 only few reports of successful elimination of BVDV was published for
Slovenia (Toplak et al., 2001; Toplak, 2004; Stari et al., 2010).
Molecular methods are used for molecular epidemiology studies to confirm the transmission of the
BVDV between infected herds. Comparison of the nucleotide sequences of BVDV strains obtained
from different infected herds in the 5'-non-coding or Npro region of the viral genome reviled not
only identical strains in different herds, but also introduction of new strains from abroad (Toplak et
al., 2002, Toplak, 2004). The results of genetic typing of 52 BVDV strains collected between 2004
and 2013 from infected Slovenian herds have shown that the identified strains of BVD virus were
classified into the same subgroup of genotype 1 (1b, 1d, 1f, 1g) as have been detected in years 1998
to 2004 confirming that the same strains have been circulating more than a decade in infected herds
(Toplak, 2004, Toplak et al., 2014). BVDV strains of genotype 2 were not identified in Slovenia.
Although it is difficult to estimate the disease cost because of variable infection many cost-benefit
analysis proved the positive impact of BVDV elimination at herd and eradication at national level
(Houe, 2003, Hsler et al., 2012). With the beginning of 2014, new national rules determining the
conditions for recognition, acquisition and maintenance of a herd status, free of BVDV (Uradni list
Republike Slovenije no. 107/2013) were introduced. This program is modification of the BVDV
eradication programs successfully established at national level in Sweden, Norway, Finland,
Denmark and Austria (Lindberg and Alenius, 1999; Obritzhauser et al., 2005). After one year of
experiences some breeders already achieved significant progress in health status, implement
preventive measures and maintenance of BVDV free status in the herds. In this paper, we would
like to present some experiences with new rules and some preliminary results.
Material and Methods

1. Basic principles of voluntary program for control and eradication of BVDV infections in
Slovenia
The program is running on the voluntary basis and breeders can officially acquire the status of a
herd free of BVD. This new regulation helps Slovenian farmers to take a decision how they want to
regulate the health status of their herds. Recognition, acquisition and maintenance of status are
based on the results of laboratory tests, as well as the farmer who is obliged to implement all
measures to prevent re-introduction of BVDV into herd. Vaccination is not practiced as an option in
the rules by the program running in Slovenia.
37
1.1 Recognition of a herd - free of BVDV

If the farmer decides to apply for recognition of status, it must comply with the following: during
the past 12 months no BVD infection has been confirmed in the herd, no animal shows clinical
signs of disease, animals shall be separated by a physical or natural barriers from herds with a lower
status, only negative animals may be introduced into herd through quarantine, for insemination only
semen obtained from bulls free of BVD is used. In addition to these conditions, the herd owner
should provide two consecutive BVD antibody ELISA testing at intervals of at least six months in
all animals in the age group 7 to 13 months (Scheme 1). Into the second sampling, other groups of
animals, which at the time of samples collection are aged 7 to 13 month, are included. If the
laboratory results of these tests are negative in all animals, the herd owner may submit an
application for recognition of a herd free of BVD. Rules allow the recognition of the status also for
herds that do not have young animals, as in this case, samples are collected in the next age group of
animals, e.g. the age group 14 to 20 months. The holder of the animals submits an application for
recognition to the Regional Office of Administration for Food Safety, Veterinary and Plant
Protection. List of herds free of BVDV is published on the website and it is free available to
farmers.
1.2 Acquisition of a herd - free of BVDV
For BVDV infected herds recognition of BVDV free status is possible on voluntary basis after
removing BVDV positive animals from the herd. The most important measure is to eliminate all
persistently infected animals (PI) from the herd. In the first step, blood samples (serum) should be
collected and tested from all animals in a herd to determine the presence of BVD virus
(identification of PI). PI animals must be immediately slaughtered. In addition, samples of all
newborn calves (blood sample - serum) in the first week of age should be sampled in a herd for a
period of one year and tested for BVD genome. All BVDV positive calves must be removed from
the herd. One year after the elimination of the last PI from the herd all animals in the age group of 7
to 13 months are tested for the presence of BVD antibodies by ELISA. If the results of all animals
are negative, the same herd is tested after six months again to prove the stability of the herd. If all
animals in the age group of 7 to 13 months are negative and farmer implemented preventive
measures, the herd owner may apply for recognition of the status free of BVD (Scheme 1).
1.3 Maintenance of a herd - free of BVDV
Recognition of a herd free of BVD is granted for a period of one year. The farmers successfully
maintain the status by the implementation of preventive measures and status need to be renewed
again after one - year period. To keep the status farmer should ensure the laboratory testing for
BVD antibodies in all animals in the herd, which are at that time aged 7 to 13 months. Sampling in
the herd is repeating at intervals of 12 months, thus confirming the absence of BVDV infection.
1.4 Withdrawal the status - free of BVDV
If is determined that the herd has no longer qualifications for the status, the veterinary
administration made a decision which status is withdrawn. Farm, which has been deprived of the
status, is deleted from the list on the website. If a farmer wants to renew the status, must fulfill the
conditions laid down for the recognition of BVDV free status.
Results
During the period between January 2014 and April 2015 in total 1.138 samples were collected from
99 individual cattle herds and tested for antibody detection. Sera samples were tested by ELISA
38
(Svanovir BVDV Ab, Svanova) for detection of specific antibodies against BVDV and samples
were interpreted according to producer instructions. First herd with BVDV free status was officially
confirmed in July 15, 2014. Until April 2015, official recognition of BVDV free status was
confirmed already for 13 individual herds.
Between January 2014 and April 2015 in total 2.186 individual serum samples from newborn calf
and cattle were collected from 86 different herds and tested for BVDV genome by RT-PCR as
previously described (Toplak et al., 2015). Out of 2.186 tested animals 64 (2.92 %) were detected
BVDV genome positive animals by RT-PCR method.
Scheme 1: The algorithm for recognition, acquisition and maintenance of BVD free status - the basic
principles for voluntary program, which was started in Slovenia in January 2014.
Discussion
The first voluntary program providing officially recognized BVDV free status for individual herds
in Slovenia started in January 2014. Veterinary faculty from Ljubljana together with Administration
for Food Safety, Veterinary and Plant Protection and private practitioners prepared the conditions
for farmers, which want to apply for BVDV free status. The basic principle of first voluntary
program is laboratory testing of young stock together with preventive actions of farmer to prevent
reintroduction of BVDV. Although the BVDV infection is endemic in Slovenia with about 30 % of
infected cattle herds, still more than half of herds are free of BVDV. For this reason, more than
hundred cattle farmers already started with first step for recognition of BVDV free status.
According to herd size, number of animals which need to be tested, is usually between 5 and 10.
This is important information for farmers who covers all costs, including laboratory testing. After
39
first negative results in a herd, the same herd needs to be tested after six month to prove the stability
of herd. First 13 herds which have already been officially recognized with BVDV free status are
promising, that new rules were accepted from farmers and recognition of BVDV free status have
important value to improvement the production on a farm. The initial testing of herds for antibodies
gives also opportunity for farmers to start with the control BVDV in infected herd. The BVDV
positive herds can take the actions through the identification and elimination of persistently infected
animals from a herd. These animals secreted the BVD virus into the environment, especially with
nasal discharge, saliva, feces and urine. In BVDV infected herd newborn calf are constantly
infected within a few months after the birth, expressing clinical symptoms and get sick because of
acute phase of the disease. After two to three weeks, specific antibodies can be detected by ELISA
and those antibodies are present in the blood throughout life. If the mother is positive for BVD
antibodies, calves receive colostral antibodies, by sucking colostrum, which remain in the blood up
to 3 months, in rare cases up to 8 months of age. During the laboratory testing it was recognized
that individual animals from the sampled age group of 7 to 13 months were low antibody positive in
ELISA test, usually with percent positive values between 10 and 20, so we suggest retesting them
after one month. The important preventive measure is also that animals must be separated by
physical or natural barriers from herds with a lower status and only negative animals may be
introduced into herd through quarantine. Farmer needs to be careful about this, not to lose BVDV
negative status. In the infected herd, BVDV is quickly transmitted between animals of all ages and
this feature of BVD virus can be successfully used in laboratory tests. Screening of the age group of
young animals in the herd (aged 7 to 13 months) assures us that based on the results specific
antibodies the current situation regarding BVDV infection in the whole herd is recognized.
BVDV positive animal may not be sold, because those animals are the main source for spreading
BVDV infection into new herd. The identification of PI in infected herds was successful and 64
new PI animals were detected last year. Our system is still without record of slaughtering those
BVDV positive animals and these needs to be corrected as soon as possible. At the moment the
action and responsibility is on farmer. If such BVDV positive animal is send to other herd this will
act like a boomerang, because it will extended the circulation of virus in population and maintain
the BVDV infection in the herds.
Conclusion
New rules which were adopted for the first time in Slovenia define the conditions for recognition,
acquisition, maintenance and withdrawal of BVDV free status. Veterinary Faculty is offering to a
breeder special package of discounts for laboratory testing of samples and reduced the time from
sample reception to the results on one week. For the recognition and maintenance of BVDV free
status, only a small proportion of the entire herd need to be tested, which allows lower costs and the
recognition of the BVDV free status for many breeders. Program is on voluntary basis and gives no
compulsion to breeders which can at any stage of the control decide to deviate from the target. The
common aim for farmers and veterinarian is healthy herd and healthy animals. Breeders who are
selling and buying animals will benefits based on BVDV free status. They can decide what kind of
animals want buy for a fixed price. The new rules based on voluntary program have already been
implemented and widely accepted and we believe that it provides a good solution for our farmers.
Our neighbouring countries such as Austria, Italy and Switzerland were already implemented or
finished similar BVD national program. Thus, the next step will be moving from voluntary to
national program.
Acknowledgments
Special thanks to Breda Hrovatin, Jedrt Maurer Wernig and group from The Administration of the
Republic of Slovenia for Food Safety, Veterinary Sector and Plant Protection, private veterinary
40
practitioners and farmers for collaboration in program. Thanks to Polona Beron for technical
assistance during sample testing. This research was financially partly supported by the Slovenian
Research Agency, program group P4-0092 (Animal Health, Environment and Food Safety).
References
1. Baker JC.: The clinical manifestations of bovine viral diarrhea infection. Vet Clin Nort Am Food Anim
Pract 11: 425445, 1995
2. Brownlie J, Clarke MC, Howard CJ: Experimental infection of cattle in early pregnancy with a
cytopathic strain of bovine virus diarhoea virus. Res. Vet. Sci. 46, 307311, 1989
3. Fulton RW, Hessman BE, Ridpath JF, et al.: Multiple diagnostic tests to identify cattle with bovine viral
diarrhea virus and duration of positive test results in persistently infected cattle. Can J Vet Res 73: 117
124, 2009
4. Hsler B, Howe KS, Presi P, Strk, KDC.: An economic model to evaluate the mitigation programme for
bovine viral diarrhoea in Switzerland. Prev. Vet. Med. 106, 162173, 2012.
5. Hostnik P, Toplak I, Barli-Maganja D, Kosec M, Grom J. Predlog programa kontrole in izkoreninjenja
okub z virusom bovine virusne diareje v osemenjevalnih centrih, v vzrejaliih in rejah bikovskih mater
Vet. nov. 11: 449-456, 2002
6. Houe H, Lindberg A, Moennig V.: Test strategies in bovine viral diarrhea virus control and eradication
campaigns in Europe. J Vet Diag Invest 18: 427436, 2006
7. Houe H.: Economic impact of BVDV infection in dairies. Biologicals 31, 137143, 2003
8. Kennedy JA, Mortimer RG, Powers B.: Reverse transcription-polymerase chain reaction on pooled
samples to detect bovine viral diarrhea virus by using fresh ear-notch-sample supernatants. J Vet Diag
Invest 18: 8993, 2006
9. Lindberg ALE, Alenius S.: Principles for eradication of bovine viral diarrhea virus (BVDV) infections in
cattle populations. Vet Microbiol 64, 197-222, 1999
10. Lindenbach BD, Rice CM.: Flavivirdae: the viruses and their replication. In: Fields virology, ed. Knipe
DM, Howley PM, 4th ed., Lippincott Williams & Wilkins, Philadelphia, PA, 2001, 9911041
11. Loneragan GH, Thomson DU, Montgomery DL, et al.: Prevalence, outcome and health consequences
associated with persistent infection with bovine viral diarrhea virus in feedlot cattle. J Am Vet Med
Assoc 226: 595601, 2005
12. Obritzhauser W, Fuchs K, Kfer J.: BVDV infection risk in the course of the BVDV eradication
program in Styria/Austria. Prevent. Vet. Med. 72, 127132, 2005
13. Stari J, Laiek D, Raspor P, Gaperlin B, Jeek J, Toplak I. Bovina virusna diareja (BVD) in opis
zdravljenja okuene mlene reje. Vestnik Veterinarske zbornice Slovenije. 3: 9-13, 2010
14. Toplak I, Barli-Maganja D, Hostnik P, Grom J. Ugotavljanje perzistentnih izloevalcev virusa bovine
virusne diareje (BVD) v seroloko pozitivnih rejah bikovskih mater v Sloveniji Vet. nov. 3: 97-102,
2001
15. Toplak I, Barli-Maganja D, Hostnik P, Grom J.: Genetic heterogeneity of bovine viral diarrhoea virus
(BVD) strains isolated in Slovenia. Slov. vet. res. 39: 113-123, 2002
16. Toplak I: Molecular epidemiology of bovine viral diarrhoea virus (BVDV) in Slovenian breeding cattle
herds, Doctoral thesis, University of Ljubljana, Veterinary Faculty, 1-142, 2004
17. Toplak I, Rihtari D, Hostnik P, Grom J.: Molekularna epidemiologija virusov bovine virusne diareje
(BVD) ugotovljenih v Sloveniji med leti 1997 in 2014. V: MAJDI, Gregor (ur.). 5. slovenski
veterinarski kongres 2014 = 5th Slovenian Veterinary Congress 2014, Portoro, 14.-15. November 2014,
(Slovenian veterinary research, 2014, suppl. 16). Ljubljana: Veterinarska fakulteta, 2014, 23-24.
18. Toplak I, Rihtari D, Hostnik P, Mrkun J.: The usefulness of two molecular methods for the detection of
persistently infected cattle with bovine viral diarrhea using oral swab samples. Slov Vet Res, 52, 23-30,
2015
41
Invited lecture
COMPARISON OF MACROSCOPIC AND MICROSCOPIC LESSION IN MESENTERIAL
LYMPH NODES IN PIGS NATURALLY INFECTED WITH MYCOBATERIUM AVIM
SUBSP HOMINISSUIS
Vladimir Polaek1*, Jasna Prodanov-Radulovi1, Dejan Vidanovi2 Sanja Kovaevi-Aleksi3
1
2

Veterinary Specialized Institute Kraljevo, Kraljevo, Serbia
3
Faculty of Veterinary Medicine, Belgrade, Serbia
Abstract
Mycobacterium avium, belonging to the Mycobacterium avium complex (MAC), is divided into the
subspecies avium, paratuberculosis and silvaticum. More recently, M. avium subsp avium has been
further divided into M. avium subsp avium and M. avium subsp. hominissuis. M. avium subsp
hominissuis (MAH) is a bacterium which causes mycobacteriosis both in pigs and humans and most
common diseases of children and immune-compromised humans. The most important
morphological characteristic of infections caused by MAH and other mycobacteria is granuloma
formation. Granuloma is a unique structure and within it the growth of mycobacteria is in
accordance with anti-bacterial effector mechanisms of the host.
In our study we compared macroscopic and microscopic lessons in formalin fixed paraffin
embedded (FFPE) samples of mesenterial lymph nodes from tuberculin positive pigs. FFPE lymph
nodes were also examined by real-time PCR for IS1245. Post mortem examination was performed
on 100 pigs. Granulomatous lesions compatible with mycobacterial infection were found in
mesenterial lymph nodes in 88 pigs. Macroscopic lesions were detected in 43 pigs, while 45 pigs
manifested only microscopic lesions. In 12 pigs, no lesions were detected. The granulomas were
composed of focal accumulation of inflammatory cells in which macrophages, epithelioid cells,
multinucleated giant cells and lymphocytes predominated. Caseous necrotic areas were present in
some granuloma. Numerous eosinophils and myofibroblasts were present within the granuloma.
Our results show that routine meat inspections at slaughterhouses may fail to detect microscopic
lessons caused by M. avium subsp hominissuis and in certain cases could pose a threat for consumer
health.
Keywords: Mycobaterium avium subsp hominissuis, mycobacteriosis, granuloma, meat inspections
Introduction
Mycobacterium avium, belonging to the Mycobacterium avium complex (MAC), is divided into the
subspecies avium, paratuberculosis and silvaticum (Inderlied et al., 1993). More recently, M. avium
subsp avium has been further divided into M. avium subsp. avium and M. avium subsp. hominissuis
(Mijs et al, 2002; Turenne et al, 2007). M. avium subsp. hominissuis (MAH) is a ubiquitous
microorganism which lives both in water and soil and causes mycobacteriosis of pigs and human
population, mostly in children and immunocompromised humans (Agdenstein et al., 2014; Alvarez
et al., 2011; Domingos et al., 2009; Falkinham et al 1996; 2001; Johansen et al., 2014; Matlova et
al., 2004, 2004a, 2005; Biet et al., 2005; Hilbor et al., 2008; Yajko, 1995). One of major hallmark of
MAH infections in pigs are localized granulomatous lesions on lymph nodes of digestive tract
or/and on lymph nodes in the head (Thorel et al, 2001; Hybia et al, 2008; Polaek, 2010).
Generalized disease is less common and can affect internal organs such as liver, spleen or kidneys
though not always, are found at the meat inspection in slaughterhouses, without a previous detection
42
of clinical symptoms of the disease (Agdestein et al., 2012; Thoen, 2006). An annual study of a
slaughterhouse in the Netherlands shows that caseous changes have been detected in 0.5% of
examined lymph nodes of slaughtered pigs out of which 50% were infected with Mac (Komijn et
al., 2007). The available data suggests that certain herds of pigs exhibited granulomatous changes
in 30-50% of slaughtered pigs where M. avium was detected (van Ingen et al., 2010). As a routine
tuberculin skin test is not performed on pigs in most countries, the main source of information about
the occurrence of tuberculosis is the data gathered at meat control in slaughterhouses (Cvetni et al.,
2007; Agdestein et al., 2012). On the other hand, a large number of infected animals may fail to
detect by routine meat inspection at slaughterhouses since the changes at some stages of Mac
infections arent macroscopically visible (Komijn et al., 1999; Tirkkonen et al., 2007; Polaek,
2010). This paper will present the results of macroscopic and microscopic changes on mesenteric
lymph nodes of the pigs naturally infected with M. avium subsp. homminissuis.

Examinations have been performed on the samples of mesenteric lymph nodes of 100 pigs
(Norwegian Landrace breed), 5-10 months old. The pigs originating from Lithuania were kept in
quarantine. During the quarantine period, tuberculin skin tests with bovine and avian tuberculin
were carried out. These tests were positive. According to the ruling issued by Veterinary Directorate
of the Ministry of Agriculture, Forestry and Water Management, swine euthanasia was authorized.
Immediately after the euthanasia autopsy and sampling of mesenteric lymph nodes were performed.
Euthanasia was performed by preparation T-61 (Intervet, Holand) as described in previous study
(Agdestain et al., 2011). The samples of mesenteric lymph nodes for pathohistological and
molecular examinations were fixed for 24-48 hours in 10% buffered formalin. After the standard
processing in automatic tissue processor they were embedded into paraffin blocks. Then the 4-5
mn thick sections were stained according to hematoxylin-eosin method (HE). Mesenteric lymph
nodes of 10 healthy pigs were used as a control.
Molecular examination
Real time PCR from FFPE for IS 1245 and lymph nodes has been performed by the Norwegian
Veterinary Institute described in previous study (Agdestain et al., 2011, Polacek, 2010).
Macroscopic examination
The analysis of macroscopic lesions has been performed by indentation of the nodes in several
parallel sections, followed by classification into two groups:
A no macroscopic lesions detected
B macroscopic lesions detected
Microscopic examination
Granulomas were classified into three following histological groups by microscoping. These
included the granulomas with:
1. No necrosis
2. Initial phase of necrosis
3. Distinctive necrosis and calcification.
Results
Macroscopic examination showed that mesenteric lymph nodes were enlarged with or without
bordered areas of caseous necrosis. I.e. calcification. The diameter of the limited areas of caseous
43
necrosis, i.e. calcification was most commonly 1-2 mm, although in some cases it was larger than
10 mm (Image 1.).
The presence of M. avium subsp. hominissuis has been confirmed in a previous study by real time
PCR detecting IS1245 (Agdestein et al. 2011, Polaek 2010).
Picture 1. Macroscopic changes on mesentric lyph nodes infected with M. avium complex A limited area of
caseous necrosis on the cross section of a mesenteric lymph node (A-B). Disseminated areas of caseous
necrosis and dystrophic calcification on the cross section of a mesenteric lymph node (C-F).
The results of pathohysiological examinations

The microscopic examination of lymph node samples stained by the routine hematoxylin-eosin
(HE) method showed the presence of granulomatous lymphadenitis. According to morphological
charactersitics, granulomas were classified into three histological groups.
44
The first group included granulomas dominated by macrophages (epithelioid cells) and
lymphocytes. Caseous necrosis in granuloma centre was not detected in this group. Eosinophil
granulocytes were located between macrophages and lymphocytes, diffusely dispersed in a
granuloma. Epithelioid cells have light cytoplasm and vesicular nucleus with scarce chromatin. In
order to expand phagocytic capacity, several epiteloid cells are merged into polynuclear giant cells.
At this stage, granulomas contain 1-2 giant cells on average. Out of the total of 100 examined
samples of swine mesenteric lymph nodes, 19 belonged to the first histological group- 15 of them
were from macroscopic group A (no visible changes on lymph nodes) and 4 were from the group B
(with visible changes on lymph nodes).
The second group contained granulomas with morphological characteristics of circumscript lesions
with outer layer formed of myofibroblasts. These cells are commonly elongated or oval, located on
the periphery of granulomas, which separates it from the surrounding tissue. Individual
myofibroblasts with different phenotype are located diffusely in a granuloma. The central part of
the granulomas from the second group is modified by the areas of caseous necrosis. In some cases
dystrophic calcification in the form of dark blue deposits of irregular shape and uneven size is
detected. The thickness of connective tissue capsule is more conspicuous in big granulomas in the
areas of central necrosis. The number of polynuclear cells is significantly smaller than in the
granulomas from the first group. Morphological characteristics of granulomas from the second
group were found in 8 samples- 5 of them belonged to the macroscopic group A (with no visible
changes on lymph nodes), while 3 samples were classified into macroscopic group B (with visible
changes on lymph nodes).
Granulomas with distinctive and ever-present caseous necrosis and/or calcification in the centre
were in the third group. Necrotic area in the centre and clearly conspicuous connective tissue layer
on the periphery narrow the zone of epithelioid cells and lymphocytes and form a layer where
eosinophil granulocytes are found. Their distribution is distinctive on the periphery which is why
these cells from the 3rd group are peripherally located, between myofibroblasts, with irregular shape
in the connective tissue outer layer. They can even be found outside the belt. Giant polynuclear cells
were not found in these granulomas. A great majority of mesenteric lymph node samples (61)
belonged to the third histological group. 25 of them were in the macroscopic group A (with no
visible changes on lymph nodes), while 36 were in group B (with visible changes on lymph nodes).
(Table 1)
Morphological characteristics of the above mentioned granuloma types, in different stadiums of the
same tissue samples overlap in some cases. The criterion for classification in such situations was the
presence of dominating changes on a sample. Out of the total number of examined samples there
were 12 pigs that showed neither macroscopic nor microscopic changes typical of tuberculosis.
These lymph nodes were classified into macroscopic group A (Table 1).
Table 1. Overall results of both macrocopic and microscopic examinations of pig mesenteric lymph
nodes
microSCOPIC
changes
No changes
(Group A)
scopic
MACRO
No
changes
With changes
(Group B)
Group 1.
changes
Group 2.
Group 3.
12
15
25
57
(45)
36
43
12
19
61
45
Picture 2. Microscopic changes on mesenteric lymph nodes of the pigs infected with Mycobaterium avium
complex : A-microscopic group 1, B,D-microscopic group 2, C, E- multinucleated giant cells and Fmicroscopic group 3.
Discussion
This paper deals with morphological changes on mesenteric lymph nodes in pigs that were
previously diagnosed with positive tuberculin skin reaction. Molecular method determined the
presence of M. avium subsp hominissuis genome.
Granuloma is a unique structure and within it the growth of mycobacteria is in accordance with
anti-bacterial effector mechanisms of the host (Co et al., 2004). Granulomatous tip of inflammatory
46
reaction is a basic morphological characteristic of immune response of an organism to the infection

caused by mycobacteria. Formation and sustainability of granulomas is a complex process
undergoing several phases of immune response of the host (Hybia et al 2008). Immune reaction
against persistent bacteria is a sensitive and delayed reaction, mediated by T lymphocytes (Th1),
which respond with antigen presenting cells (APC), followed by a transformation of macrophage
proliferation. Mycobacteria found in a granuloma are affected by a low oxygen concentration and
very restricted nutrition. Some researchers suggest that in such conditions mycobacteria activate the
genes that initiate alternative metabolic pathways, one of them being the alternative citric acid cycle
for using lipids found in necrotic centre of a granuloma in great quantities. It is also assumed that
M. tuberculosis which is in a hibernation state changes the structure of cell wall in a granuloma
since it loses the staining feature as an acid resistant bacterium (Co et al., 2004),
Neither macroscopic nor microscopic examinations of the samples detected changes in mesenteric
lymph nodes in 12 pigs (12%) that were infected with tuberculosis. All 12 pigs were positive to
tuberculin, 8 out of which showed a positive reaction to tuberculin B as well. Mesentric lymph
nodes of 7 pigs selected randomly from this group of animals were additionally tested using real
time PCR method and one turned out to be positive to IS1245 (M. avium). This implicates a low
specificity of tuberculin skin test.
Out of 57 (57%) pigs that had a positive reaction to avian turbeculin and which did not have any
changes on mesenteric lymph nodes, 45 (45%) had specific granulomatous lymphadentitis,
according to histological examinations. In a large number of cases (25/45) the specific
granulomatous lymphadenitis had the characteristics in the later stage of chronic granulomatous
process with massive necroses and very conspicuous dystrophic calcification. These results
unequivocally support the fact that tuberculin tests are highly sensitive. The results of examination
of 43 pigs with positive tuberculin reaction and visible macroscopic changes on mesenteric lymph
nodes speak in favour of test sensitivity. Microscopic examination of these animals also detected
the changes typical of tuberculosis.
The analysis of the tuberculin skin test results and morphological examinations raises a question of
the extent to which the test is an indicator of pathological changes in an organism as it certainly
detects the existence of immune response to the presented mycobacteria. The data about occurrence
and extent of tuberculosis are most commonly obtained from the meat control in slaughterhouses or
from a quarantine of imported animals a since tuberculin skin test is often one of the compulsory
diagnostic measures during the quarantine period of most categories of imported pigs in the
Republic of Serbia. Although imperfect, tuberculin test is a significant measure in the control of
micobacterioses in pig production (Cvetnic et al., 2007; Polacek, 2010). The results we have
obtained suggest that the use of tuberculin skin test method is more reliable compared to a routine
examination at the meat inspection in abattoir, particularly in cases when tuberculous changes are
not macroscopically visible and detectable by routine meat control in slaughterhouses, which results
in the failure to spot infected pigs during the control process (Polacek, 2010; Agdestein et al.,
2012). In our opinion, the control on the presence of tuberculosis cause needs to be tightened;
having in mind that the number of positive tuberculin skin tests performed on imported animals in
our country during quarantines is on the increase. The introduction of more reliable measures for
determination of positive reactors and their restriction from food chain will significantly decrease
the occurrence of disease in human population.
Acknowledgements:
This study was supported by Project TR 31084 of Ministry of Education, Science and
Technological Development, Republic of Serbia. Also we would like to express our grateful to
47
Tone Bjordal Johansen and her colleagues from Norwegian Veterinary Institute (Oslo) for help with
molecular examinations and Danka Vukainovi for help with manuscript and translation.
References:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
lvarez J., Castellanos E., Romero B., Aranaz A., Bezos J., Rodrguez S., Mateos A., Domnguez L., de
Juan L. Epidemiological investigation of a Mycobacterium avium subsp. hominissuis outbreak in swine.
Epidemiology and Infection. 2011;139(1):143148
Agdestein A., Johansen T. B., Polaek V., Lium B., Holstad G., Vidanovi D., Aleksi-Kovaevi S.,
Jrgensen A., ultauskas J., Nilsen S. F., Djnne B. Investigation of an outbreak of mycobacteriosis in
pigs. BMC Veterinary Research. 2011; 7, 63.
Agdestein A, Johansen TB, Kolbjrnsen , Jrgensen A, Djnne B, Olsen I. A Comparative study of
Mycobacterium avium subsp. avium and Mycobacterium avium subsp. hominissuis in experimentally
infected pigs. BMC Veterinary Research. 2012; 8: 11. doi:10.1186/1746-6148-8-11.
Agdestein A., Olsen I., Jrgensen A., Djnne B., Johansen T. B. Novel insights into transmission routes
of Mycobacterium avium in pigs and possible implications for human health. Veterinary Research.
2014; 45.
Biet F, Boschiroli ML, Thorel MF, Guilloteau LA. Zoonotic aspects of Mycobacterium bovis and
Mycobacterium avium-intracellulare complex (MAC) Vet Res. 2005;36: 411436.
Co, D.O., Hogan, L.H., Kim, S.I., Sandor, M., 2004. Mycobacterial granulomas: key to a long-lasting
host-pathogen relationship. Clin. Immunol. 113, 130-136.
Cvetni Z, Spicic S, Benic M, Katalinic-Jankovic V, Pate M, Krt B, Ocepek M. Mycobacterial infection
of pigs in Croatia. Acta Vet Hung. 2007; 55:19.
Domingos M., Amado A., Botelho A. IS 1245 RFLP analysis of strains of Mycobacterium avium
subspecies hominissuis isolated from pigs with tuberculosis lymphadenitis in Portugal. Veterinary
Record. 2009; 164(4):116120.
Falkinham JO III. Epidemiology of infection by nontuberculous mycobacteria. Clin Microbiol Rev.
1996; 9:177215.
Falkinham J. O., III, Norton C. D., Lechevallier M. W. Factors influencing numbers of Mycobacterium
avium, Mycobacterium intracellulare, and other mycobacteria in drinking water distribution systems.
Applied and Environmental Microbiology. 2001; 67(3):12251231.
Hilborn E. D., Yakrus M. A., Covert T. C., Harris S. I., Donnelly S. F., Schmitt M. T., Toney S., Bailey
S. A., Stelma G. N., Jr. Molecular comparison of Mycobacterium avium isolates from clinical and
environmental sources. Applied and Environmental Microbiology. 2008;74(15):49664968.
Hibiya, K., Kasumi, Y., Sugawara, I., Fujita, J., 2008. Histopathological classification of systemic
Mycobacterium avium complex infections in slaughtered domestic pigs. Comp Immunol Microbiol
Infect Dis 31, 347-366.
Inderlied CB, Kemper CA, Bermudez LE. The Mycobacterium avium complex. Clin Microbiol Rev.
1993; 6:266310.
Johansen TB, Agdestein A, Lium B, Jrgensen A, Djnne B. Mycobacterium avium subsp. hominissuis
Infection in Swine Associated with Peat Used for Bedding. BioMed Research International. 2014;
2014:189649. doi:10.1155/2014/189649.
Mijs W, de Haas P, Rossau R, Van der Laan T, Rigouts L, Portaels F, Van Soolingen D. Molecular
evidence to support a proposal to reserve the designation Mycobacterium avium subsp. avium for birdtype isolates and M. avium subsp. hominissuis for the human/porcine type of M. avium. Int J Syst Evol
Microbiol. 2002; 52:15051518.
Matlova L., Dvorska L., Palecek K., Maurenc L., Bartos M., Pavlik I. Impact of sawdust and wood
shavings in bedding on pig tuberculous lesions in lymph nodes, and IS1245 RFLP analysis of
Mycobacterium avium subsp. hominissuis of serotypes 6 and 8 isolated from pigs and environment.
Veterinary Microbiology. 2004; 102(3-4):227236.
48

17. Matlova, L., Dvorska, L., Bartos, M., Docekal, J., Trckova, M., Pavlik, I., 2004a, Tuberculous lesions in
pig lymph nodes caused by kaolin fed as a supplement. Vet. Med.-Czech 49, 379-388.
18. Matlova L., Dvorska L., Ayele W. Y., Bartos M., Amemori T., Pavlik I. Distribution of Mycobacterium
avium complex isolates in tissue samples of pigs fed peat naturally contaminated with mycobacteria as a
supplement. Journal of Clinical Microbiology. 2005; 43(3):12611268.
19. Komijn, R.E., de Haas, P.E., Schneider, M.M., Eger, T., Nieuwenhuijs, J.H., van den Hoek, R.J.,
Bakker, D., van Zijd Erveld, F.G., van Soolingen, D., 1999, Prevalence of Mycobacterium avium in
slaughter pigs in The Netherlands and comparison of IS1245 restriction fragment length polymorphism
patterns of porcine and human isolates. J Clin Microbiol 37, 1254-1259.
20. Polacek,V.,Vidanovic, D.,Vaskovic, N., Knezevic,M., Gledic,D., Krnjaic, D., Aleksic-Kovacevic, S.,
2010. Distribution of Myofibroblasts, Transforming Growth Factor- 1 and Transforming Growth
Factor- 1 receptor I in Granuloma Caused by Mycobacterium avium complex in Pigs. In: J. Comp.
Pathol. 143, 326-326.
21. Polacek, V., 2010. Uloga miofibroblasta u morfogenezi granulomatoznog limfadenitisa svinja prirodno
inficiranih uznicima iz kompleksa Mycobacterium avium (in Serbian with English abstract). PhD
thesis, Faculty of Veterinary Medicine, Belgrade.
22. Tirkkonen, T., Pakarinen, J., Moisander, A.M., Makinen, J., Soini, H., Ali-Vehmas, T., 2007, High
genetic relatedness among Mycobacterium avium strains isolated from pigs and humans revealed by
comparative IS1245 RFLP analysis. Vet Microbiol 125, 175-181.
23. Thorel MF, Huchzermeyer HF, Michel AL. Mycobacterium avium and Mycobacterium intracellulare
infection in mammals. Rev Sci Tech. 2001; 20:204218.
24. van Ingen J, Wisselink HJ, van Solt-Smits CB, Boeree MJ, Van Soolingen D. Isolation of mycobacteria
other than Mycobacterium avium from porcine lymph nodes. Vet Microbiol. 2010; 144:250253.
25. Thoen, C.O., 2006, Diseases of swine- Tuberculosis, 9th Edition. Blackwell Publishing Ltd, Oxford.
26. Turenne CY, Wallace R Jr, Behr MA. Mycobacterium avium in the postgenomic era. Clin Microbiol
Rev. 2007; 20:205229.
27. Yajko D. M., Chin D. P., Gonzalez P. C., Nassos P. S., Hopewell P. C., Reingold A. L., Horsburgh C.
R., Jr., Yakrus M. A., Ostroff S. M., Hadley W. K. Mycobacterium avium complex in water, food, and
soil samples collected from the environment of HIV-infected individuals. Journal of Acquired Immune
Deficiency Syndromes and Human Retrovirology. 1995; 9(2):176182.
49
IMMUNE RESPONSE AND PROTECTIVE EFFECT OF VACCINE AGAINST

LISTERIOSIS IN SHEEP IN SERBIA
Dragan Baci1*, Blagoje Dimitrijevi1, Mila Savi1
1. University of Belgrade, Faculty of veterinary medicine, Serbia
Abstract
In this study the protective effects of two bivalent inactivated vaccines were evaluated. Vaccines
were prepared from Listeria monocytogenes, serotypes 1/2a and 4b, as the most frequent in our and
surrounding epidemiological areas. Vaccine A consists of whole L. monocytogenes bacteria cells,
inactivated with 0.4% formaldehyde and aluminium hydroxide as a carrier. Vaccine B contains
0.1% saponin in addition to ingredients of vaccine A. Evaluations of these vaccines were performed
in 60 sheep, divided into four groups (n=10) with a corresponding negative control group (n=5).
After 14 days, boosterisation of all animals was performed. In order to evaluate the immune
response, blood samples were obtained every 14 days during the next 6 months. Antibody titres
were determined by microaglutitation (MAT) and complement fixation tests (CFT).
Comparative analyses of antibody titres, induced by vaccines A and B, show that the later (with
saponine) significantly increased the level of antibody titres (p<0.01). The levels of immune
response were also significantly impacted by the total number of bacteria and vaccine dosages
(p<0.01).
The bivalent vaccine containing 0.1% saponin (vaccine B) in 5.0 ml x 106 cfu/ml (colony-forming
units per milliliter) dosage shows a protective effect after challenge with L. monocytogenes. The
protective levels of antibody were 1/80 and 1/16, determined by MAT and CFT, respectively.
Antibody titres were significantly higher after boosterisation (p<0.01) and protective levels could be
detected in sera of vaccinated animals during the next 6 months.
Therefore, it is strongly recommended to perform boosterisation two weeks after initial vaccination.
Keywords: Listeria monocytogenes, vaccine, immune response, protective effect, saponin, sheep
Introduction
Listeria monocytogenes, a gram-positive, facultative intracytosolic bacteria, is the causative agent
of listeriosis, a severe disease associated with a high mortality rate. Nearly all domestic animals are
susceptible to L. monocytogenes infection, but animal listeriosis most commonly occurs in
ruminants. Listeriosis is also an important food-borne zoonosis (Farber and Peterkin, 1991; Regan
et al., 2005). In ruminants, among which sheep are the more commonly affected, listeriosis is
usually represented by three distinct clinical syndromes; septicemia, encephalitis
(meningoencephalitis), and abortion. Ovine listeriosis has also been associated with mastitis, some
ophthalmic lesions, such as keratoconjunctivitis and gastroenteritis (Wagner et al., 2000; Clark et
al., 2004; Otter et al., 2004; Gasanov et al., 2005).
Listeria is widely distributed in the natural environment and has been isolated from soil surface,
rotten vegetables and pasture herbage. Domesticated ruminants play a key role in the maintenance
of Listeria spp. in the rural environment through a continuous faecaloral enrichment cycle (Picoux,
2008). The main source of infection in ruminants is poorly fermented silage with a pH above 5.0
5.5 and within pockets of aerobic deterioration (microaerophilic microorganisms). In general, the
disease is more frequent in winter and early spring. This risk during the winter season is associated
50
with the fact that Listeria can grow at temperatures where growth of other pathogens is inhibited
due to excessive cold (psychrophilic microorganisms) (Radostits et al., 2007).
L. monocytogenes can be distinguished in 16 serovars on the basis of somatic and flagellar antigens
and there is genetic diversity between serovars (Beumer and Hazeleger, 2002). Two virulent
serovars (l/2a and 4b) are most commonly isolated in farm animal diseases in Serbia (unpublished
data). These strains can multiply in macrophages and monocytes and produce a haemolysin,
listeriolysin O (LLO), which is the virulence determinant of the organism (Bennett and Weaver,
2001; Amagliani et al., 2006).
The recovery rate is higher if treatment is administered early in the course of the disease.
Antibiotics (ampicilline and gentamicin) must be administered for a prolonged period, because
recovery can take as long as one month (Low and Donachie, 1997). Treatment of severely ill or
recumbent animals with listeriosis is rarely successful (George, 2002). Immunoprophylaxis (i.e
vaccination) has proved itself over the past 120 years to be by far the most efficient and costeffective method of controlling infectious diseases. Nevertheless, vaccination is not always an
innocuos procedure, and its use must always be accompanied by a careful assessment of the risks
and benefits of the procedure (Tizard, 2006).
Taking into account all of the above mentioned, the objective of this study was to evaluate the
protective effects of two inactivated, bivalent vaccines prepared from two of the most frequent
serotypes of L. monocytogenes in our and surrounding epidemiological areas.
Material and methods

Isolation and serotypization of isolated L. monocytogenes strains
L. monocytogenes was isolated from samples of aborted fetuses or brains of dead sheep on tryptone
agar (Torlak, Belgrade-Serbia) according to the standard procedure. Serotypization of the isolated
strains was determined by the method of fast agglutination on the microscope slide coated with antiO and anti-H immunoserum of L. monocytogenes (Bioveta, Czech Republic).
Preparation of vaccines
Vaccines were prepared from whole L. monocytogenes bacterial cells, serotypes 1/2a and 4b,
inactivated with 0.4% formalin with the addition of aluminium hydroxide as a carrier (vaccine A).
Vaccine B, beside above mentioned constituents also, contained 0.1% saponin.
Examining the sterility and toxicity of vaccines
The examination of the sterility of prepared vaccines was performed by sowing on nutritive agar,
5% blood agar and tryptone agar. During the five day incubation period (37 oC), the substrates were
inspected on a daily basis, no growth of aerobic and anaerobic microorganisms having been
detected.
The toxicity of vaccines was also examined on laboratory mice. Briefly, after the subcutaneous
application of the examined vaccine, the dose being 0.3 ml, the mice were monitored daily for any
possible changes in the general condition during a period of four weeks. After this period, the mice
were sacrificed and a suspension of parenhimatic organs was sown on tryptone and blood agar.
During this period of monitoring, no deaths of mice were recorded.
Serological reactions
Titre determination of the antibodies after immunization was performed by the method of slow
agglutination (MAT), according to the instructions of the manufacturer (Bioveta, Czech Republic).
51
For performing serological reactions, personally prepared and standardized antigenes of L.

monocytogenes, serotypes 1/2a and 4b were used.
Examination of the prepared vaccines on sheep
The examination of vaccines (A and B) was performed on 60 sheep of the Wrtenberg breed aged
between three and four months, with a average body mass of 30-35 kg. The sheep were divided into
four groups (n=10), each group having its own negative control group (n=5). Before applying the
analysed vaccines, subcutaneously into the knee fold, blood samples from the sheep were obtained
by puncture of v. jugularis with the aim of detecting the possible presence of antibodies of the
studied L. monocytogenes serotypes. The first group of animals was vaccinated with 2.5 ml 106
cfu/ml, the second group with 5.0 ml 106 cfu/ml of vaccine A. The third group was vaccinated
with 2.5 ml 106 cfu/ml, while the fourth group received 5.0 ml 106 cfu/ml of vaccine B,
respectively.
Sheep from the negative control groups received subcutaneous injections of physiological solution
(Hemofarm, Vrac).
Two weeks after immunization, the sheep were revaccinated according to the same protocol.
Determination of the antibody titre in the blood serum after immunization was performed at
fortnightly intervals, commencing from the second week and ending on the 24th week.
All experimental procedures were performed according to our institutional guidelines for animal
research and principles of the European Convention for the Protection of Vertebrate Animals Used
for Experimental and Other (Official Daily N. L 358/1358/6, 18, December 1986).
Statistical analysis
Statistical significance of differences of all examined parameters was determined by means of the
ANOVA, followed by the Tukey test. Data were expressed as means standard error. The level of
significance was set at p < 0.05. Statistical analysis was performed using the Graph Pad Prism 5.0
Software, CA, USA.
Results
Examining the blood serum on day zero, (before commencing with the vaccination), employing the
method of slow agglutination, it was determined that the sheep included in the experiment were
seronegative for 1/2a and 4b L. monocytogenes serotypes.
Results of sheep antibody titres obtained by the method of microagglutination
Titres of agglutinized antibodies in sheep vaccinated with vaccine A ranged within the interval from
1/20 to 1/80, while in sheep which received vaccine B, the titres ranged from 1/40 to 1/320 (results
not shown).
It has been determined by statistical analysis that the average antibody titre was highest in the
animal group IV which received the vaccine B, the dose being 5.0 ml (17.69 1.11), while the
lowest titre was in the animal group I which received the vaccine A, the dose being 2.5 ml (12.96
1.25) (Fig. 1). Comparing the average values of antibody titres, a high statistical difference was
determined between all the studied groups (p<0.01). Comparing antibody titre values between the
groups that received different doses of vaccine B, no statistical differences were detected (p>0.05).
Analyzing the trend of agglutinized antibody titre movement, after applying vaccine A in a dose
range from 2.5 to 5.0 ml during 24 weeks, it has been detected that the titre gradually increases,
reaching maximum values on the sixth and fourth week respectively, followed by a fall (Figure 2).
52
A very similar tendency of movement has the antibody titre after the application of vaccine B with a
dose of 2.5 ml. The titre gradually rises and reaches its peak on the eigth week after vaccination,
followed by a downfall (Figure 2).
Analyzing the tendency of agglutinizing antibody titre movement after application of vaccine B,
with doses of 2.5 and 5.0 ml, during 24 weeks, it has been determined that the titre gradually
increases, reaching its maximum value on the sixth week followed by a gradual fall (Figure 2). A
very similar tendency of movement is shown by the antibody titre after applying the vaccine B with
a dose of 2.5 ml. The titre gradually rises, reaching its highest level on the eight week after
vaccination, followed by a gradual fall (Figure 3).
Figure 1. Average titres of antibody following the application of vaccines A and B in different
dosages, determined by MAT. Group I versus group II, p<0.01; Group II versus group III, p<0.01; Gruop
III versus group IV, p>0.05
Figure 2. The trend of agglutinized antibody titres movement during 24 weeks period following the
application of vaccine A in 2.5 and 5.0 x 106 cfu/ml, determined by MAT. CI Confidential Interval
53
Results of artificial infection

Artificial infection was performed in five sheep from group IV with the antibody titre ranging
within average values (1/80-MAT and 1/16 CFT). Sheep were infected with 5.0 ml x 106 cfu/ml of
fresh bujon, 24 h culture containing 1/2a and 4b strains, applied subcutaneously in the knee fold.
The animals were monitored daily the next 30 days for possible changes in their general health
conditions. In the studied sheep, neither body temperature increase nor changes in the general health
have been recorded. Bacteriological analyses of fecal samples, chemoculture of blood, nasal and
buccal smears were negative for the presence of the studied L. monocytogenes strains.
Figure 3. The trend of agglutinized antibody titres movement during 24 weeks period following the
application of vaccine B in 2.5 and 5.0 x 106 cfu/ml, determined by MAT. CI Confidential Interval
Discussion
Vaccination is a very useful tool in preventing infectious diseases, if there is an elicitation of
effective, protective antibodies. Two major criteria must first be satisfied in determining whether
vaccination should be used to control a specific disease. First, it must be established that the
immune system can protect against the disease in question. Second, before using a vaccine, we must
be sure that the risks of vaccination do not exceed those associated with the chance of contracting
the disease itself (Tizard, 2006; Radostits et al., 2007).
Since the therapy of listeriosis is currently under discussion and does not always offer good results,
listeriosis being a serious zoonosis (Braun et al., 2002), the aim of this study is to evaluate the
efficiency of our experimental inactivated vaccine in contributing to the control and suppression of
listeriosis. On the basis of isolation and serotypization, it has been determined that serotypes 1/2a
and 4b L. monocytogenes dominate on our epizootological region, as well as in the surrounding
countries (unpublished data). This is the reason why in our study we selected the above mentioned
L. monocytogenes strains.
The key factors for the vaccine quality and adequate immune response are: the number of
microorganisms in the vaccine, degree of attenuation or means of inactivation, combination of
bacterial antigens in the vaccine, as well as the type of added adjuvant, time of vaccination and
revaccination (Gudding, 1989).
It has been established that the total number of microorganisms in the vaccine, as well as the vaccine
dose, have an effect on the immune response (Linde et al., 1995). For this reason, the animals in our
54
experiment were vaccinated with various doses of vaccine, 2.5 and 5.0 ml 106 cfu/ml. On the basis
of the fact that we used pathogen L. monocytogenes serotypes, their inactivation was achieved with
formalin with the addition of aluminium hydroxide as the carrier (Szemeredi and Padanyi, 1989).
We determined that the antibody titre is significantly higher if the studied vaccine is applied as a dose of
5.0 ml 106 cfu/ml, in relation to the dose of 2.5 ml 106 cfu/ml (Figs 1 and 3). Comparing antibody
titres in animals immunized with vaccines A and B, it has been determined that the addition of saponin
in vaccine B, at a dose of 0.1%, significantly supports the immune response (Lhopital et al., 1993;
Linde et al., 1995). These results are expected due to the fact that saponin is a nonspecific activator of
the immune system (Tizard, 2006).
Antibody titres obtained by vaccines with saponin differ significantly when compared to titres obtained
by applying vaccines without saponin. Titre levels of agglutinated antibodies applying the vaccine
containing saponin ranged from 1/40 to 1/320, while with vaccines lacking saponin, the values ranged
from 1/20 to 1/80.
The aim of revaccination is the boosterization, i.e. obtaining higher antibody titres (Tizard, 2006). In the
present study, 14 days after vaccination, a revaccination has been performed. It is evident that the
agglutinated antibodies persisted in the serum of animals six months after vaccination, specifically with a
higher titre after the application of vaccine B with a dose of 5.0 ml 106 cfu/ml (Figs 4, 5 and 6). The
vaccinal titre obtained in this way was in the range of 1/80 to 1/320, determined by MAT. Our results
are in agreement with the results of other authors (Ivanov, 1985; Gudding, 1989; Linde, 1995), who
suggested revaccination for a more efficient protection from L. monocytogenes.
With the intention of checking the quality and efficiency of the prepared vaccine, an artificial
infection was initiated (Mencikova et al., 1989). Taking into account that by applying vaccine B,
with a dose of 5.0 ml 106 cfu/ml, the highest antibody titre was obtained. The examination was
performed on five sheep with average titre levels for this group of animals. Monitoring the health
conditions of the studied sheep during the period of 30 days, we determined that the bivalent vaccine
prepared from inactivated listeria serotypes with saponin and dose of 5.0 ml 106 cfu/ml, protected the
studied animals after artificial infection, the protective titre having a value of 1/80 for MAT, i.e. 1/16
applying CFT. These results are in agreement with those previously reported by Nowacki et al. (1987)
and Tzora et al. (1998).
Since the studied vaccine has not shown toxicity and was efficient in the protection of sheep after
artificial infection, such a vaccine with additional research and evaluation on a larger number of
animals could find its application in the control of listeriosis in flocks where listeriosis appears
more frequently resulting in greater economic losses (Ivanov et al., 1977; Mencikova et al., 1989;
Regan et al., 2005).
In conclusion, in this study, we demonstrated that antibody titres were significantly higher after
boosterisation and that protective levels could be detected in sera of vaccinated animals during the
next 6 months. Therefore, it is strongly recommended to perform boosterisation two weeks after
initial vaccination.
Acknowledgements
Financial support for this study was provided by the Ministry of Education Science and
Technological Development, Republic of Serbia (Grant No 31085).
References
1.
2.
Amagliani G.C., Giammarini E., Omiccioli E.G., Merati G., Pezzotti G., Filippini G., et al.: A
combination of diagnostic tools for rapid screening of ovine listeriosis. Res Vet Sci, 81, 185189, 2006
Bennett W.R., Weaver R.E.: Serodiagnosis of Listeria monocytogenes. Bacteriological Analytical
Manual, 58-72, 2001
55

3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Beumer R.R., Hazeleger C.W.: Listeria monocytogenes: diagnostic problems. Immun Med Microbiol,
35, 191197, 2002
Braun U., Stehle C., Ehrensperger F.: Clinical findings and treatment of listeriosis in 67 sheep and
goats. Vet Rec, 150, 38-42, 2002
Brugere-Picoux J.: Ovine listeriosis, Small Rumin Res, 76, 12-20, 2008
Clark R.G., Gill J.M., Swaney S.: Listeria monocytogenes gastroenteritis in sheep. NZ Vet J, 52, 46-47,
2004
Farber J.M., Peterkin P.I.: Listeria monocytogenes, a food-borne pathogen. Microbiol. Rev, 55, 476
511, 1991
Gasanov U.D., Hughes P., Hansbro M.: Methods for the isolation and identification of Listeria spp. and
Listeria monocytogenes. FEMS Microbiol Rev, 229, 851875, 2005
George L.W.: Listeriosis, In Smith, BP, (Ed), Large Animal Internal Medicine, Mosby, St Louis, 946949, 2002
Gudding R., Nesse L.L., Gronstol H.: Immunisation against infections caused by Listeria
monocytogenes in sheep. Vet Rec. 125, 111114, 1989
Ivanov M., Draganov T., Dikova M.: Study on the active immunoprophylaxis of sheep listeriosis. Cent
Vet Res Inst, Sofia, 324329, 1977
Kumar H., Singh B.B., Bal M.S., Kaur K., Singh R., et al: Pathological and epidemiological
investigations into Listeria encephalitis in sheep. Small Rumin Res, 71, 293297, 2007
Lhopital S., Marly J., Pardon P., Berche P.: Kinetics of antibody production against listeriolysin O in
sheep with listeriosis. J Clin Microbiol, 31, 15371540, 1993
Linde K., Fthenakis G.C., Lippmann R., Kinne J., Abraham A.: The efficacy of a live Listeria
monocytogenes combined serotype 1/2a and serotype 4b vaccine. Vaccine, 13, 923926, 1995
Mencikova E., Snirc J., Gubran D., Smola J., Mara M.: Experimental listeriosis in immunized sheep.
Acta Microbiol Hung, 36, 331334, 1989
Nowacki J., Lewandowska S., Konopa M., Przymus J.: Studies on the safety and efficacy of a live
vaccine against Listeria infection in lambs. Medycyna Weterynaryjna, 46, 259261, 1991
Otter A., Houlihan M.G., Daniel R.G., Kirby F.D., Shock A., Higgins R.J.: Ovine gastrointestinal
listeriosis. Vet Rec, 154, 479, 2004
Radostits O.M., Gay C.C., Hinchcliff K.W., Constable P.D.: Veterinary Medicine. A Textbook of the
Disease of Cattle, Horses, Sheep, Pigs and Goats (10th ed.), Saunders, Philadelphia, 2007, 356-402.
Regan E.J., Harrison G.A.J., Butler S., McLauchlin J., Thomas M., Mitchell S.: Primary cutaneous
listeriosis in a veterinarian. Vet Rec, 157, 207, 2005
Szemeredi G., Padanyi M.: A ten years experience with inactivated vaccine against listeriosis of sheep.
Acta Microbiol Hung, 36, 327330, 1989
Tizard I.:, In: Veterinary Immunology, WBC Saunders 7th Ed, 2006, 365-392.
Tzora A., Fthenakis G.C., Linde K.: The effects of inoculation of Listeria monocytogenes into the ovine
mammary gland. Vet Microbiol, 42, 245-253, 1998
Wagner M., Podstatzky-Lichtenstein L., Lehner A., Asperger H., Baumgartner W., et al: Prolonged
excretion of Listeria monocytogenes in a subclinical case of mastitis. Milchwissenschaft, 55, 36, 2000
56
ORAL FLUID AS A POTENTIAL SAMPLE FOR VIRAL DISEASES

DETECTION IN PIGS
Vesna Milicevic1*, Branislav Kureljusic1, Jelena Maksimovic-Zoric1, Ljubisa Veljovic1, Vladimir
Radosavljevic1, Nemanja Jezdimirovic1, Bozidar Savic1
1. Institute of Veterinary Medicine of Serbia, Belgrade, Serbia
Abstract
Diagnosing infectious diseases in pigs is laborious work, as it involves taking blood or swab
samples which is very stressful for pig; it is time consuming, independently whether piglets or
adults are meant to be sampled. Since the most of viruses are excreted orally, and taking into
consideration experiences in human medicine, oral fluid started to be investigated as a potential
sample for diseases detection.
There are many advantages of this kind of sampling. By testing oral fluid more animals can be
screened, than by individual testing of blood or swabs. This method is welfare friendly means of
monitoring disease, working towards better productivity. The results represent the status of the herd
not of the individual animals. Having in mind that most of viruses can be excreted before clinical
signs; this is a very useful tool for early detection of the disease. Oral fluid is collected by giving the
cotton ropes to the animals to chew it. The ropes are afterwards processed in the laboratory in order
to extract oral fluid which then could be tested for the presence of different markers, such as
viruses, bacteria, antibodies etc. On the selected pig farms, we installed the ropes in the pens, to be
easily accessed and attractive for pigs. Collected oral fluid samples have been tested on PRRS,
PCV2 and SIV. Initial results suggest that oral fluid sampling could provide a low-cost, noninvasive method to assess the health status of pigs. Additional work on technique validation is
needed.
Keywords: non invasive sampling, oral fluid, PRRS, PCV2, SIV
Introduction
Accurate and reliable laboratory diagnosis in modern swine production is the request. It is of same
importance for early disease detection, surveillance and monitoring purposes. Although pigs are
intelligent animals which remember rewards, sampling for them is very stressful and affects their
welfare. Traditional sampling methods require skilled personnel and is time consuming since is
individually based. Serum samples are, the most often, used for infectious diseases diagnosis. But
there are many limitations in serology results interpretation that are linked with estimation of time
when infection occurred, presence of maternal antibodies, but also with early stages when
antibodies are not detectable. In particular, the need to handle and bleed animals presents a
significant risk for further spread of diseases (Mur et al., 2013).
Gold standard in infective disease diagnosis is agent detection. Permanent infectious disease
monitoring, molecular epidemiology and tracking disease back, which are of high priority in high
density farms, are possible only by capturing the virus or viral genome. Many causative agents of
infectious diseases are excreted even before onset of clinical symptoms, making it important to
detect them as early as possible.
57
For these purposes, live animals are needed to be sampled; swabbing is the most often used
technique. Taking nasal swabs is not difficult, but needs individual sampling. Oral fluid is an
alternative specimen that could potentially replace nasal swabs.
In human medicine, oral fluid specimens have been used for infective agents detection but also for
hormones, toxins and drugs (Prickett and Zimmerman, 2010). Nowadays, for HIV (Connolly et al.,
2004) and measles (Carr et al., 2009) surveillances, oral fluid samples are preferred because of it
safety, efficiency, cost effectiveness and large number of samples availability.
Porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2),
swine influenza virus (SIV), foot and mouth disease virus (FMDV), classical swine fever virus
(CSFV) and African swine fever virus (ASFV) are shed in oral fluid which has been proved to be
accurate diagnostic specimen (Ramirez et al., 2012). It has been shown that oral fluid can be used
also for antibody detection. There are many advantages of oral fluid collection: requires no catching
or killing of animals and is feasible to get it from farmed pigs (Hoffman et al., 2008) and from wild
boar (Chichkin et al., 2012).
Rope sampling is a non-invasive method of oral fluid collection which allows detection of various
infectious agents and assists with disease surveillance. It is less laborious to perform and causes less
stress to animals. Basically, oral fluid samples are collected from individual pigs or pens of pigs by
allowing them to chew on cotton rope placed in the pen for 2030 min. Oral fluid is extracted
manually from the rope and further processed in the laboratory (Prickett et al., 2008). Once
collected, oral fluid must be cooled immediately and transported to the laboratory as soon as
possible because of very active saliva enzymes which tend to inactivate viruses, in particular if virus
isolation test is going to be performed.
Rope sampling and oral fluid testing is, at some circumstances, even more sensitive than swab
testing. It has been shown that rope sampling was able to detect FMDV 6 days prior to visual
clinical observations in unvaccinated and infected pigs. However, saliva swabs were positive 3 days
before the rope samples (Vosloo et al, 2012).
However, this method has its limitations. The amount of oral fluid sample collected is dependent on
animal behavior. Sick animals show less interest in the ropes. When sampling was performed in
pens, it has been seen that sick animals come to chew on ropes only after healthy pigs got bored
(Vosloo et al, 2013).
How much important control of infective disease, in particular transboundary ones, in big farms is
well known. But, majority of swine population in the world is kept in small size, backyard holdings,
with low biosecurity that, despite almost perfect tools for disease control in developed countries,
heavily can affect the risk of disease spreading (Depner et al., 2013). Wild life plays the same role.
Rope sampling of free ranging pigs and wild boar can possible overcome these limitations for
disease control in this epizootic niche.
New techniques always arise suspicion on their improvement comparing to traditional ones.
Usually, people are distrust when ever new technique requires no contact with animals. Such
reactions were seen when surveyed owners were asked about oral vaccination (Mogner et al., 2015).
Infective disease surveillance in swine sector in Serbia is at very low level. This is possibly due to
the demanding sampling but also to the cost of individual testing. Swine production is a kind of
production where herd level of diseases status should be assessed, so therefore there is no need for
individual testing. In this case, group sampling sensitivity is the most important factor.
In this experiment, we wanted to show that disease detection is possible with alternative sampling
methods which do not require animal catching, in local, field conditions. For this purposes, we
selected 2 farms where respiratory diseases were previously confirmed. The objective of this study
was to conduct a preliminary assessment of the feasibility of detecting PRRSV, PCV2 and SIV in
58
oral-fluid samples. Fine tuning of the method, depending on the disease stage and number of
animals per pen, is still needed.

To test potential use of oral fluid for virus detection in the field conditions, we selected 2 pig farms
with recently reported respiratory disorders. On the both farms, pigs were kept in pens capacity 510 animals. All animals were clinically examined before oral fluid collection. Two pens with pigs
showing different respiratory symptoms from each farm were chosen for sampling. The ropes that
we used were made of pure cotton, 50 cm length, not treated with any chemicals or dyes, and with
high absorbance capacity. Cotton ropes have been fixed in pens at places easily accessible for pigs
and left for 30 minutes that pigs could chew on it. Pigs were observed during the all collection time
and their reaction on ropes and how attractive ropes were for them were recorded. After exposure
time, ropes were stored in plastic bags, cooled at +4 C and transported to the laboratory.
Oral fluids were extracted manually, squeezing cotton ropes. The fluid was centrifuged for 10
minutes at 1500 g and used in subsequent analyses. Molecular methods, RT-PCR and PCR, were
used for viral genome detection. Total RNA was extracted from 150 l of oral fluid using
commercial kit (Isolate RNA Kit, Bioline, USA) according to the manufacturers instructions. DNA
was isolated using QIAamp DNA Mini (Qiagen, USA).
For PRRSV genome detection one-step RT-PCR (Verso 1 Step RT-PCR Reddymixx Kit, Thermo
Scientific) was performed using primers targeting ORF 7 (Donadeu et al., 1999). The reaction was
carried out in a total volume of 25 l. The RT-PCR program included a reverse transcription stage
at 50 C for 30 min, followed by an initial PCR activation step at 95 C for 15 min. and 40 cycles of
94 C for 30 s, 60 C for 30 s and 72 C for 1 min and a final extension step at 72 C for 10 min.
The RT-PCR products were visualized in 2% agarose gel with 0.5 g/ml ethidium bromide.
A PCR technique for PCV2 detection was performed. The primers and conditions used for PCV2
have been previously described (Sandvik et al., 2001). The amplified products were run in a 2%
agarose gel and visualised by staining with 0.5 g/ml of ethidium bromide.
Partial matrix gene of Influenza A virus was amplified using published primers (WHO, 2009) by
real time RT-PCR (Verso I Step qRT-PCR ROX Kit, Thermo Scientific). Thermal cycling was done
under the following conditions: 15 min at 50 C; 15 min at 95 C; 50 cycles of 15 s at 95 C; and
60 s at 60 C. The specimen was considered positive if Ct value was 38.0.
Results
From each farm, 2 samples were tested. One sample was taken from animals old 12-16 weeks, and
another one from pigs older than16 weeks.
Oral fluid collection on both farms, in the field conditions, using ropes was very easy. Pigs were
very interested in a new object in their pens and chew on ropes continuously for 30 minutes,
replacing one another. All ropes stayed fixed in pens, not damaged. Each rope was quite well
sodden with saliva which volume was enough for performing the laboratory tests. There was no
difference in behaviour and interest in ropes between different age groups.
Clinically, farm I reported respiratory disorders in all age categories 6 weeks ago. Pigs were treated
with antibiotics and on sampling day all pigs had no fever, occasionally coughing was heard and
pigs were in recovery stage.
On second pig farm, respiratory disease was in acute phase. Pigs had fever, anorexia, nasal
discharge, sneezing and labored breathing.
59
Results of molecular tests showed that samples from the farm in recovery stage were negative on
PRRV, PCV2 and SIV. In the farm with acute respiratory disease, PRRS and SIV infections were
confirmed.
In one oral fluid sample, on real time RT-PCR genome of Influenza Virus A was detected, Ct value
28,7. In two samples, genome of PRRSV was confirmed. All samples, from both farms were
negative on PCV2 (Table 1).
Table 1: Results of oral fluid samples tested on SIV, PRRSV and PRV2 presence
Virus
Result (%)
PRRSV
PCV2
SIV
2/4 (50)
0/4 (0)
1/4 (25)
Farm I
Pen 1 12-16 w
negative
negative
negative
Pen 2 >16w
negative
negative
negative
Farm II
Pen 1 12-16 w
positive
negative
negative
Pen 2 >16w
positive
negative
positive
Discussion
Swine Influenza Virus was detectable in porcine oral fluids by real-time RT-PCR. SIV is
transmitted via nasopharyngeal route, in direct contact between animals by droplets and aerosols of
nasal secretions. Virus excretion begins within 24 hours from infection and lasts 7-10 days (OIE,
2009) although Blaskovic et al. (1970) reported a case of a pig which had been shedding SIV over 4
months. Furthermore, swine influenza H1N1 virus has been recovered from pigs with no signs of
disease (Hinshaw et al., 1978). Carrier animals are rarely described but also considered as
responsible for Influenza virus introduction into uninfected herds (Merck Manual, 2008).
Pigs from the pen in which we confirmed SIV showed typical clinical signs of SIV. The infection
was in acute phase when amount of excreted virus is at highest level. Influenza A is present in pig
farms year round, but the outbreaks are most common in cold weather time, mainly in finishing pigs
(OIE, 2009).
Influenza in pigs can be diagnosed confirming presence of virus itself or immune response of the
host. Diagnostic tests that detect virus, viral proteins (antigens), or viral nucleic acid are Fluorescent
antibody (FA) test, AgELISA, RT-PCR and Virus isolation. Detection of circulating antibodies to
SIV can be performed by Hemagglutination inhibition test or Ab ELISA. Preferred samples are
nasal swabs, lung tissue and serum samples (Janke, 2000).
The results of the recent studies indicate that pen-based oral fluids provide an easy, effective, and
safe collection method for the detection of SIV with rapid testing methods such as real-time RTPCR (Detmer et al., 2011).
Oral fluid represents group sample and therefore its sensitivity should be considered. Romagosa et
al (2011) showed that pen-based collection of oral fluids is a sensitive method to detect influenza
even when within pen prevalence is low and when pigs have been vaccinated and highlight the
potential use of oral fluids for influenza surveillance (Romagosa et al., 2011).
Influenza A situation in Serbia is unknown. The virus presence has been rarely reported although
respiratory disorders are common in pig farms. Cost of individual tests and labour to get samples
for virology tests are possible reasons for this.
Another respiratory disease which heavily can affect health status of pigs is PRRS. However, in
some herds, infection can be asymptomatic. The virus is shed via saliva, milk, colostrum, urine,
faeces. Since proven that viral RNA could be detected in oropharingeal region of growing pigs up
to 251 days post infection nasal swabs are the sample of choice (OIE, 2008). Though, detection of
PRRS virus is the most reliable during the early stages of PRRS infection.
60
Viral antigen can be identified in infected fresh tissue, preferably lung, by direct fluorescent
antibody test. PCR or in situ hybridization is used to demonstrate viral RNA. Serology may be
helpful in confirming the presence (seropositivity) and stage (high levels of antibody in recent
infections) of PRRS infection in the herd.
In experimental conditions, PRRSV can be detected in oral fluid for approximately 4 weeks after
exposure ( Opriessnig et al., 2006). Field data showed that this period can be prolonged up to 8
weeks (Prickett et al., 2008a). Since the diagnostic window for PRRS is much larger than for SIV,
we succeeded to detect PRRV in oral fluid samples in both oral fluid samples from one farm. PRRS
surveillance if individually based is very costly. Using oral fluid for surveillance purposes, more
animals can be tested whereas number of samples and tests is less. Making surveillance and disease
control plans, sempling method sensitivity should be considered in order to be replaced with
appropriate number of animals to be samples in order to achieve the aim of the plan.
Porcine circovirus 2 is ubiquitous in domestic pigs. At some circumstances, PCV2 cause
postweaning multisystemic wasting syndrome (PMWS), reproductive failure, enteritis, respiratory
disease, porcine dermatitis and nephropathy syndrome (PDNS) or a combination of these
(Opriessnig et al.,2007). PMWS most commonly affects 2-4 month-old pigs, although the disease
has been also described in younger and older animals (Segals et al., 2005). PCV2 is transmitted
horizontally excreting virus in nasal secretions, saliva, faeces and serum (Shibata et al. 2003) and
vertically (Pensaert et al. 2004).
Limited data on the amount of PCV2 in nasal fluid and saliva following experimental infection is
available. The internationally accepted criteria to diagnose PMWS include the presence of
compatible clinical signs, lesions and moderate to high amount of the virus. Detecting the virus
itself doesnt` mean that it caused the disease but only evidence of virus infection (Caprioli et al.,
2006)
The positive and significant correlation found between amounts of PCV2 detected in lymphoid
tissues, sera and swabs suggests that nasal and rectal swabs are suitable indicators of the level of
PCV2 excretion (Lorenc et al., 2009)
Oral fluid sampling for PCV2 detection has been studied recently; showing that with these samples
PCV2 is detectable longer than 8 weeks. However, we didn`t detect PCV2 in oral fluid samples
probably because of low level of excreted virus in the stage where no other disorders have been
seen which we could linked to PCV2.
Diseases surveillance is fundamental to the control, elimination, or eradication of an infectious
agent and often requires large number of samples. Large number of samples requires labour and
time associated efforts. Due to these restrictions, in many farms, surveillance is abandoned or
inefficient. Having available and accurate alternative sampling methods that are cost and time
effective, simply to be performed, we believe that surveillance and disease control can be improved.
Detecting PRRSV and SIV in oral fluid, we showed that depending on stage, early disease detection
in farm condition is feasible. For precise characterization of method sensitivity, more experiments
are needed to be performed.
References
1.
2.
Blaskovic, D., Rathova, V., Kociskova, D., Kaplan, M.M., Jamrichova, O., Sadecky, E.: Experimental
infection of weanling pigs with A-swine influenza virus. 3. Immunity in piglets farrowed by antibodybearing dams experimentally infected a year earlier. Bull. World Health Organ. 42, 771777, 1970
Caprioli, A., McNeilly, F., McNair, I., Lagan-Tregaski, P., Ellis, J., Krakowka, S., McKillen, J.,
Ostanello, F., Allan, G.: PCR detection of porcine circovirus type 2 (PCV2) DNA in blood, tonsillar and
faecal swabs from experimentally infected pigs. Res Vet Sci, 81, 287-292, 2006
61

3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Carr, M.J., Conway, A., Waters, A., Moran, J., Hassan, J., Hall, W.W., Connell, J.: Molecular
epidemiology of circulating measles virus in Ireland 20022007. J. Med. Virol. 81: 125129, 2009
Chichkin, Y., Gazaev, I. K., Tsybanov, S.Z and Kolbasov, D.V.: Non-invasive method of collecting
saliva from wild boar infected with African swine fever, Veterinaria, 6: 2628, 2012
Connolly, C., Shisana, O., Colvin, M., Stoker, D.: Epidemiology of HIV in South Africa results of a
national, community-based survey. S. Afr. Med. J. 94: 77781, 2004
Depner, Klaus; Milicevic, Vesna; Dietze, Klaas: New Non-Invasive Methods To Control And Eradicate
Transboundary Animal Diseases In The Back Yard And Free Ranging Pig Sector, GRF One Health
Summit 2013, Proceedings, 2nd GRF One Health Summit 2013, 17-20 November 2013, Davos,
Switzerland
Detmer E.Susan,1 Devi P. Patnayak, Yin Jiang, Marie R. Gramer, Sagar M.: Goyal Detection of
Influenza A virus in porcine oral fluid samples, J Vet Diagn Invest 23:241247, 2011
Donadeu, M., Arias, M., Gomez-Tejedor, C., Aguero, M., Romero, L.J., Christianson, W.T., SanchezVizcaino, J.M.: Using polymerase chain reaction to obtain PRRSV-free piglets from epidemically
infected herds. Swine Health Prod. 7: 225261, 1999
Hinshaw VS, Bean WJ , Webster RG, Easterday BC: Prevalence of Influenca viruses in swine and the
antigenic and genetic relatedness of influenca viruses from men and swine, Virology, 84: 51-62, 1978
Hoffman, P., Prickett, J., Zimmerman, J., et al. Implementation and validation of swine oral fluid
collection in a commercial system. Proceedings of the 39th Annual Meeting of the American
Association of Swine Veterinarians , pp. 301-302. San Diego, California, USA, 2008
Lorenc, Grau-Romaa, Charlotte K. Hjulsager, Marina Sibila, Charlotte S. Kristensend,Sergio LopezSoria, Claes Enec, Jordi Casala, Anette Btnere, Miquel Nofrar asa,Vivi Bille-Hansenc, Lorenzo
Frailea, Poul Baekbod, Joaquim Segalsa, Lars E. Larsen: Infection, excretion and seroconversion
dynamics of porcine circovirus type 2 (PCV2) in pigs from post-weaning multisystemic wasting
syndrome (PMWS) affected farms in Spain and Denmark, Veterinary Microbiology 135, 272282, 2009
Janke H. Bruce: Diagnosis of Swine Influenza, Swine Health Prod. 8 (2): 79-84, 2000
Monger VR, Stegman JA, Dukpa K, Gurung RB, Loeffen WL: Evaluation of Oral Bait Vaccine
Efficacy Against Classical Swine Fever in Village Backyard Pig Farms in Bhutan, Transbound Emerg
Dis. 2015 Feb 7. Doi 10.1111/tbed.12333, 2015
Mur, Lina, Gallardo Carmina, Soler Alejandro, Zimmermman Jeffrey, Pelayo Virginia, Nieto Raquel,
Sanchez-Vizcaino Jose Manuel, Arias Marisa: Potential use of oral fluid samples for serological
diagnosis of African swine fever, Veterinary Microbiology 165: 135139, 2013
OIE: PRRS: the disease, its diagnosis, prevention and control, Report of the OIE ad hoc group on
porcine reproductive respiratory syndrome, Paris, 9 - 11 June 2008
OIE
Technical
Disease
Cards.
Last
updated
June
2009,
http://www.oie.int/fileadmin/Home/eng/Animal_Health_in_the_World/docs/pdf/Disease_cards/SWINE
_INFLUENZA.pdf
Opriessnig T, McKeown NE, Harmon KL, Meng XJ, Halbur PG: Porcine circovirus type 2 infection
decreases the efficacy of a modified live porcine reproductive and respiratory syndrome virus vaccine.
Clin Vaccine Immunol.13:923929, 2006
Opriessnig, T., Meng, X.J., Halbur, P.G.: Porcine circovirus type 2 associated disease: update on current
terminology, clinical manifestations, pathogenesis, diagnosis, and intervention strategies. J. Vet.
Diagn.Invest.19, 591-615, 2007
Pensaert, M.B., Sanchez, R.E., Jr., Ladekjaer-Mikkelsen, A.S., Allan, G.M., Nauwynck, H.J.: Viremia
and effect of fetal infection with porcine viruses with special reference to porcine circovirus 2 infection.
Vet Microbiol 98, 175-183, 2004
Prickett, J., Simer, R., Christopher-Hennings, J., Yoon, K.J., Evans, R.B., Zimmerman, J.J.: Detection
of porcine reproductive and respiratory syndrome virus infection in porcine oral fluid samples: a
longitudinal study under experimental conditions. J. Vet. Diagn. Invest. 20: 156163, 2008
62

21. Prickett J.R., Wonil Kim, Robert Simer, Kyoung-Jin Yoon, Jeff Zimmerman: Oral-fluid samples for
surveillance of commercial growing pigs for porcine reproductive and respiratory syndrome virus and
porcine circovirus type 2 infections: J Swine Health Prod. 16(2):8691, 2008a
22. Prickett, J.R., Zimmerman, J.J.: The development of oral fluid-based diagnostics and applications in
veterinary medicine. Anim. Health Res. Rev. 11: 207216, 2010
23. Ramirez Alejandro, Wang Chong, Prickett R. John, Pogranichniy Roman, Kyoung-Jin Yoon, Rodger
Main, Johnsona K. John, Rademacherd Chris, Hoogland Marlin, Hoffmann Patrick, Kurtz Anne, Kurtz
Ernest, Jeffrey Zimmerman: Efficient surveillance of pig populations using oral fluids, Preventive
Veterinary Medicine 104: 292 300, 2012
24. Romagosa Anna, Marie Gramer, Han Soo Joo, Montserrat Torremorell: Sensitivity of oral fluids for
detecting influenza A virus in populations of vaccinated and non-vaccinated pigs, DOI:10.1111/j.17502659.2011.00276.x
25. Sandvik, T., Grierson, S., King, D.P., Spencer, Y., Banks, M., Drew, T.: Detection and genetic typing of
porcine circovirus DNA isolated from archived paraffin ambedded pig tissues. Comp. Virol.,
Proceedings-ssDNA Viruses of plants, birds, pigs and primates, Saint-Malo 2427 Sept. 2001
26. Segals , J., Allan, G.M., Domingo, M.: Porcine circovirus diseases. Anim. Health. Res. Rev. 6, 119142, 2005
27. Shibata, I., Okuda, Y., Yazawa, S., Ono, M., Sasaki, T., Itagaki, M., Nakajima, N., Okabe, Y.,
Hidejima, I.: PCR detection of Porcine circovirus type 2 DNA in whole blood, serum, oropharyngeal
swab, nasal swab, and feces from experimentally infected pigs and field cases. J. Vet. Med. Sci. 65,
405-408, 2003
28. The
Merck
Veterinary
Manual.
Swine
influenza.
2008.
ISBN
1442167424.
http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc /121407.htm. Retrieved April 30, 2009
29. Vosloo et al: Using ropes to detect Foot-and-Mouth Disease Virus infection in pigs, Australian Animal
Health Laboratory, CSIRO, Australia EuFMD 2012, Jerez de la Frontera, Spain, 2012
30. Vosloo W., J. Morris, A. Davis, M. Giles, J. Wang, H. T. T. Nguyen, P. V. Kim, N. V. Quach, P. T. T.
Le, P.H.N. Nguyen, H. Dang, H. X. Tran, P. P. Vu, V. V. Hung, Q. T. Le, T. M. Tran, T. M. T. Mai, Q.
T. V. Le and N. B. Singanallur: Collection of Oral Fluids Using Cotton Ropes as a Sampling Method to
Detect Foot-and-Mouth Disease Virus Infection in Pigs, Transbound Emerg Dis. 2013 Dec 11. DOI:
10.1111/tbed.12196
31. WHO: CDC protocol of realtime RTPCR for swine influenza A(H1N1) 28 April 2009 revision 1 (30
April 2009)
63
MYCOBACTERIA IN ANIMALS IN SLOVENIA: FROM CATTLE TO AQUARIUM FISH

Mateja Pate1*, Darja Kuar1, Urka Zajc1, Vlasta Jeni1, Diana ele1, Gorazd Vengut1, Joe
Stari1, Joica Jeek1, Katarina Logar1, Tina Pir1, Petra Bandelj1, Brane Krt1, Matja Ocepek1
1. University of Ljubljana, Veterinary Faculty, Gerbieva 60, SI-1115 Ljubljana, Slovenia
Abstract
Slovenia was officially declared free of bovine tuberculosis (bTB) in 2009 although the proportion
of tuberculin test positive herds and animals in the past 40 years did not exceed 0.08% and 0.07%,
respectively. In the last two decades, a single case of bTB in cattle of Slovene origin was confirmed
by the culture method. However, bTB was detected recently in cattle imported from an EU member
state with a relatively high prevalence of bTB.
Among nontuberculous mycobacteria (NTM) in farm animals, the majority of isolates identified in
the past 15 years belonged to Mycobacterium (M.) avium which was mostly isolated from pigs.
After 2003, when compulsory slaughterhouse inspection of pigs was abolished, sporadic M. avium
isolates were obtained from cattle, poultry, pet birds, reptiles and zoo animals.
Aquarium fish are also an important reservoir of NTM. Two studies on NTM in ornamental fish in
Slovenia (2001-2004 and 2009-2011), which included 142 fish from several pet shops, revealed that
the majority (~80%) of aquarium fish harbour NTM. The predominant species was M. fortuitum.
The proportion of M. marinum, the most important zoonotic pathogen among NTM in fish, was
relatively high (~10%).
Between 2010 and 2013, the first survey on mycobacterial infections in wildlife in Slovenia was
conducted, including 306 apparently healthy free-range wild animals belonging to 13 species.
Members of M. tuberculosis complex were not detected, but a number of NTM were identified in
11.8% animals, with M. peregrinum being the most prevalent, followed by M. avium and M.
intracellulare. Some of the NTM were most probably reported for the first time in certain wildlife
hosts.
Paratuberculosis has become a common disease of ruminants in Slovenia. After a few
seroprevalence studies showing relatively low prevalence of disease in cattle herds in the past, it
recently became clear that presumably a lot more dairy cattle herds are affected and that up to 89%
of the animals within a herd may be infected with M. avium subsp. paratuberculosis. These facts
call for immediate implementation of measures necessary to control the disease.
Keywords: Mycobacterium, farm animals, wildlife, fish
Introduction
Bacteria of the genus Mycobacterium commonly cause pathologies or mortality in humans and
animals worldwide. Their infections are notoriously difficult to treat due to the unique cell wall of
mycobacteria and their natural resistance against many chemical or physical agents. Three main
groups of mycobacteria can be identified, namely the obligate pathogens from the Mycobacterium
tuberculosis complex (MTBC; e.g. M. tuberculosis, M. bovis, M. caprae) causing tuberculosis, the
obligate pathogens M. leprae and M. lepromatosis causing leprosy, and the nontuberculous
mycobacteria (NTM) causing skin/soft tissue disease, pulmonary disease, lymphadenitis or
disseminated disease. NTM are also called mycobacteria other than tuberculosis (MOTT), atypical,
opportunistic or environmental mycobacteria as being ubiquitous in soil and water (Dawson, 2000).
64
They usually do not cause disease in the immunocompetent humans despite the continuous
exposure to low levels, since the majority of human-mycobacteria interactions are self-curing
colonizations (Primm et al., 2004). Not to be overlooked, however, the release of potent
immunomodulators during the immune system activation may result in downstream effects like
allergies and irritations of the bowel (Primm et al., 2004). Some species of mycobacteria are very
difficult to grow in vitro as they are fastidious and take long periods to develop in culture; species
can be divided into slow and fast growers. They are widespread and typically found in water and
food sources, with the exception of obligate pathogens not found as free-living mycobacteria.
Cultivation and identification of mycobacteria

Cultivation of mycobacteria, performed in our laboratory, follows the sample homogenization,
concentration and decontamination protocol described by Kent and Kubica (1985). The processed
samples are inoculated onto five selective growth media: Lwenstein-Jensen (one slant
supplemented with pyruvate and one slant supplemented with glycerin), Stonebrink, Middlebrook
7H10 and BBL Mycobacteria Growth Indicator Tube (MGIT, Becton Dickinson). The tubes are
incubated for eight weeks at 37C. For the detection of mycobacteria from fish, the media are
incubated also at 30C and at room temperature. In case of suspected paratuberculosis, the samples
are processed as described by Logar et al. (2012). The inoculated Herrolds egg yolk agar slants,
supplemented with mycobactin J, amphotericin B, nalidixic acid, and vancomycin (HEYA, Becton
Dickinson) are then incubated at 37C for over 16 weeks.
Identification of the isolates is based on the colony morphology, PCR-hybridization assays
(GenoType Culture Identification Kits MTBC, CM and AS, Hain Lifescience), PCR assays and 16S
rRNA gene sequencing. PCR tests targeted at mycobacteria-specific insertion sequences (IS), short
DNA fragments which are capable of transposition and are abundant in the mycobacterial genome,
are used for identification of M. avium subsp. avium (IS901; Kunze et al., 1992), M. avium subsp.
paratuberculosis (IS900, Logar et al., 2012) and members of M. tuberculosis complex (IS6110,
Thacker et al., 2011). A real-time PCR assay targeting the erp gene and IS2404 is employed for
differentiation of M. marinum from other members of the M. marinum group (Slany, 2013). To
determine the phylogenetic affiliation of isolates, PCR amplification using the mycobacteriaspecific primer pair 285/264, targeting a 1037-bp segment of the 16S rRNA gene, is performed
(Kirschner et al., 1993). When 285/264 amplicons cannot be obtained or the sequencing generates
poor or ambiguous results, isolates are subjected to PCR amplification of ribosomal genes using the
commonly employed eubacterial primer pair 27F/1492R (Lane, 1991). Ribosomal PCR amplicons
are sequenced in both directions. The retrieved forward and reverse sequence fragments are edited
and assembled employing the SeqMan II v.5.05 program (DNASTAR Inc.) and submitted to
megablast classification accessed through NCBI, EzTaxon and RIDOM websites.
Bovine tuberculosis: Slovenia is officially free of the disease

The first records of bovine tuberculosis (bTB) in Slovenia date back in 1851. Several decades later,
between 1891 and 1900, the disease was reported to be spread among cattle population and the first
tuberculin skin testing (ST), which was performed on some large farms in 1922, revealed 70% of
animals as positive reactors. Nevertheless, the proportion of positive animals in abattoirs did not
exceed 1% in the period between the world wars. After the 2nd world war a planned ST on the
community farms started and a federal eradication program was established in 1954. Systematic
monitoring came into force in 1962 and has been carried out ever since. In 1968, the OIE-generated
animal health code was adopted, providing basic principles of bTB eradication. In addition to
regular ST and examination of carcasses at slaughter, bTB control included ST in quarantine for all
imported cattle. As a result, between 1974 and 1976 the proportion of positive herds fell under
65
0.1%. A decade later it dropped to 0.01%. Slovenia was declared officially free of bTB only in 2009
due to administrative reasons even though a single case of bTB in cattle of Slovene origin has been
culture-confirmed in the last 25 years (Ocepek et al., 2014). However, due to abolished quarantines
in the European Union, the situation can change at any time. Indeed, a case of bTB has already been
detected, caused by M. caprae in a herd consisting of cattle imported from an EU member state
with a relatively high prevalence of bTB (Pate et al., 2012).
Even though M. tuberculosis primarily causes TB in humans, several cases of infections have been
described also in domestic animals, mostly in those living in close contact with diseased humans.
Therefore, humans with active TB are regarded as the main source of infection for animals, which
may sometimes develop classical form of TB. With regard to domestic animals, M. tuberculosis
infection was most frequently reported in cattle. We described such a case ten years ago; our case
was the first human-to-cattle transmission of M. tuberculosis to be proven by a modern genotyping
method (Ocepek et al., 2005).
Mycobacteria in wildlife: evidence of a variety of nontuberculous mycobacteria

One of the greatest threats to any control programme in domestic animals is infection in wildife
maintenance hosts that cannot be controlled and can re-introduce infection in livestock. Until
recently, the only known significant mycobacterial infection in wildlife in Slovenia was an
M. caprae outbreak in a zoo in 2004, affecting bisons and dromedary camels (Pate et al., 2006).
However, as the countries bordering Slovenia have all recorded cases of bTB in free-range wild
animals, particularly in deer and wild boar, a survey on mycobacteria in Slovenian wildlife was
undertaken. The study was conducted on hunting grounds across the entire territory of Slovenia,
using the most important game animals as target species with a particular focus on wild boar and
red deer as potential reservoirs. The survey included a total of 306 apparently healthy free-range
wild animals of 13 species: red deer, roe deer, wild boar, wolf, badger, chamois, red fox, fallow
deer, mouflon, polecat, ibex, stone marten and jackal. Mycobacteria were isolated from 11.8%
animals, namely from red deer, roe deer, wild boar, fallow deer and jackal. The presence of the
causative agents of bTB was not demonstrated in any wildlife species. In contrast, a variety of
potentially pathogenic environmental mycobacteria (NTM) were identified: M. peregrinum,
followed by M. avium subsp. hominissuis, M. intracellulare, M. confluentis, M. fortuitum,
M. terrae, M. avium subsp. avium, M. celatum, M. engbaekii, M. neoaurum, M. nonchromogenicum
and M. vaccae. Despite their omnipresence in the environment, it seems that some of the NTM
found in this study have not been described before in the respective hosts. Nevertheless, the
significance of their presence in wildlife hosts in the absence of evident clinical signs and gross
pathology has yet to be assessed.
Mycobacteria in fish: the presence of potentially pathogenic species for humans

Mycobacterial infections are one of the most common infections of aquarium fish. Since their initial
discovery at the end of 19th century, fish mycobacterial diseases have been reported to occur
worldwide in more than 150 species. The mycobacteria generally accepted as fish pathogens are
M. marinum, M. fortuitum and M. chelonae. Several other species are listed in the literature but
most isolates belong to one of the mentioned species. Fish mycobacteriosis is a typically chronic
progressive disease that may take years to develop into clinically noticeable illness, recognized by
listlessness, lethargy, pigment alternation, sluggish movements, open lesions and ulcerations, skin
inflammation, exophthalmia, and signs of emaciation. Gross or microscopic greyish-white tubercles
may be found scattered or grouped in any parenchymatous tissue, but are usually seen on the liver,
kidney and spleen. Fish mycobacteriosis is also an important zoonosis and poses a significant risk to
all human beings working with the affected fish or the aquaria. Fish mycobacteria are capable of
66
causing both localized and disseminated infections in man. M. fortuitum and M. chelonae usually
cause superficial lesions via skin wounds, but pulmonary disease and cervical lymph node infection
may also occur. Most M. marinum infections are cutaneous, with the hands being commonly
affected (Dolenc-Volj and olnir-Dov, 2010).
The first study on mycobacteria in fish in Slovenia was conducted between 2001 and 2004, when 35
aquarium fish were investigated and 29 were positive for mycobacteria. M. fortuitum, M. marinum
and M. gordonae were most frequently isolated, followed by M. chelonae and M. peregrinum.
Approximately one fifth of fish harboured M. marinum (Pate et al., 2005). The latest study
encompassed 107 apparently healthy ornamental fish belonging to 20 species that were investigated
in the period from 2009 to 2011. Almost 80% of the investigated fish were positive for
mycobacteria, among which the common fish pathogens M. fortuitum, M. marinum and
M. chelonae were discovered, in addition to M. peregrinum/septicum, M. gordonae, M. arupense,
M. kansasii, M. ulcerans and M. setense (Pate et al., 2014).
The results of our studies demonstrate that the vast majority of ornamental fish available in pet
shops in Slovenia harbour mycobacteria, among which the potentially pathogenic species for
humans are predominant. A particularly striking fact is a relatively high percentage of M. marinum,
which is the main causative agent of cutaneous mycobacteriosis in humans. Therefore, it is of great
importance to increase the awareness of workers in fish industry, aquarium hobbyists and medical
staff. The most important step towards decreasing the possibility to acquire mycobacterial
infections from fish is to wear waterproof gloves whenever cleaning the aquarium and handling the
fish, even when preparing them for a meal. With this simple precaution, many could avoid a longlasting therapy with antimicrobials.
Nontuberculous mycobacteria in farm animals: the predominance of M. avium

In the past, M. avium was the most frequently encountered NTM in samples from farm animals
(especially pigs) sent to our laboratory. M. avium is the causative agent of avian tuberculosis, a
chronic contagious disease of poultry and birds with a fatal outcome. Pigs are susceptible to
infection caused by members of the M. tuberculosis and M. avium complex, and by several
opportunistic mycobacterial species. However, infections caused by M. avium complex are the most
common in pigs and have been described worldwide. M. avium-induced disease in pigs usually
manifests in the form of lymphadenitis. Environment (water, soil, sawdust, feed, bedding, birds etc.)
is a risk factor for human and animal infections caused by the M. avium complex, comprising
M. avium and M. intracellulare. During 2000-2011, M. avium was by far most frequently isolated
from pig samples sent to our laboratory; however, most isolates date before 2003 when the
compulsory slaughterhouse inspection of swine lymph nodes was abolished. In other farm and
companion animals (horses, cattle, cats and dogs), a disease due to M. avium is considered to be
very uncommon. However, we described M. avium-related lung tuberculosis in a cow showing
clinical signs and lesions closely resembling those due to M. bovis (Ocepek et al., 2003). Apart from
this case, M. avium has been isolated from cattle in several other cases during 2000-2011, as well as
from poultry and pet birds. In the last few years, sporadic infections in various domestic and wild
animals (goose, snake, elephant, deer, and jackal) were recorded.
Paratuberculosis: a threat to dairy cattle farming

Paratuberculosis (paraTB), a chronic granulomatous enteritis caused by M. avium subsp.
paratuberculosis (Map) which affects many animal species, is a common disease of ruminants in
Slovenia. The first case was detected in 1961 in imported Jersey cows. No other cases were reported
until 1993, when paraTB was found in a sheep flock; since then, several outbreaks of the disease in
cattle, goats and sheep have been documented. Systematic screening of paraTB was carried out
67
between 1995 and 2001, using various serological tests and including different categories and
numbers of cattle (Ocepek et al., 1999, 2002). For the period between 2002 and 2007, no data on
paraTB prevalence are available. In 2008, a seroprevalence study was conducted in which animals
older than two years were screened for Map in randomly selected cattle herds. The study showed
that the true prevalence at the herd level was almost the same as in 1999 and that it was fairly low
(18.49%) compared to many European countries (Kuar et al., 2011).
The results from our previous studies, concerning the comparisons of different diagnostic tests for
paraTB, suggested that the specificity of the ELISA kits used is questionable and showed a need for
highly sensitive and specific method to detect subclinically infected animals which are the main
cause of maintained herd infection and of spread of infections between herds and premises. Lack of
sufficiently sensitive, specific, reliable and fast laboratory tests can lead to underestimation of the
proportions of Map shedders in herds.
Therefore, we then introduced a high-yield DNA extraction method coupled with quantitative realtime PCR (qPCR) to detect Map in cattle faeces. The study, which included faecal culture, milk
ELISA, milk qPCR and faecal qPCR, was performed on the samples of 141 subclinically infected
dairy cattle of all age categories from a farm with a history of paraTB. The results suggested that
the proportion of low-level Map shedders in cattle populations tested in the past was most likely
underestimated. In addition to detecting a surprisingly high proportion of Map shedders within a
herd (89%), we demonstrated a negative influence of Map infection to milk production already in
the first lactation heifers (Logar et al., 2012). Furthermore, later studies indicated that presumably a
lot more dairy cattle herds are infected with Map. In the last study, eight randomly selected big
dairy herds were monitored for the presence of Map-antibodies. These were detected in all herds
while in half of them culture-positive animals were found (Stari et al., 2011).
Vaccination can be used as a measure to control the disease; however, as it hampers diagnostics of
paraTB and interferes with tuberculin skin testing, the opinions on its use vary. Vaccination
prevents the occurrence of clinical signs and reduces the shedding of Map in faeces and milk. The
latter was observed during our vaccination trial performed in two heavily infected dairy herds; in
addition, the vaccination contributed to increased annual milk yield (Ocepek et al., 2014). However,
hygienic measures are of crucial importance for controlling the disease.
As Slovenia has not yet implemented any measures for the prevention and control of the disease, a
significant increase in the prevalence of paraTB in the majority of big dairy herds is expected in the
forthcoming years. Certain EU member states have already implemented strict preventive measures
which request paraTB negative status of the herds providing milk for public consumption.
Economic losses faced by the Slovenian breeders of Black and White cattle due to paraTB are
estimated at 1 to 5 million euro per year. Therefore, it would be reasonable to introduce the control
and eradication program which would encompass systematic screening of the disease and
certification of infection-free herds. This would enable the farmers to buy non-infected animals and
increase the animal value in trading. However, this goal cannot be successfully pursued without
participation of the government, veterinarians, cattle breeding associations and the cattle breeders
themselves.
Acknowledgements
Mycobacteria research was funded by the Slovenian Research Agency (Grant P4-0092). Milojka
etina, Alenka Usenik and Nataa Peterka are thanked for their technical assistance over the years.
References
1.
Dawson D.J.: Mycobacterial terminology. Journal of Clinical Microbiology, 38, 3913, 2000
68

2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Dolenc-Volj M., olnir-Dov M.: Delayed diagnosis of Mycobacterium marinum infection: a case
report and review of the literature. Acta Dermatovenerologica APA, 19, 35-39, 2010
Kent P.T., Kubica G.P.: Public Health Mycobacteriology. A Guide for the Level III Laboratory. Atlanta,
GA, USA, US Department of Health and Human Services, Public Health Service, Centers for Disease
Control, 1985
Kirschner P., Springer B., Vogel U., Meier A., Wrede A., Kiekenbeck M., Bange F.C., Bttger E.C.:
Genotypic identification of mycobacteria by nucleic acid sequence determination: report of a 2-year
experience in a clinical laboratory. Journal of Clinical Microbiology, 31, 2882-2889, 1993
Kunze Z.M., Portaels F., McFadden J.J.: Biologically distinct subtypes of Mycobacterium avium differ
in possession of insertion sequence IS901. Journal of Clinical Microbiology, 30, 2366-2372, 1992
Kuar D., Ocepek M., Logar K., Pate M., Krt B.: Seroprevalence of cattle paratuberculosis in Slovenia
in 2008 and a comparison of data from current and previous studies. Slovenian Veterinary Research, 48,
39-44, 2011
Lane D.J.: 16S/23S rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics. John
Wiley & Sons, New York, NY, USA, pp. 115-147, 1991
Logar K., Kopin R., Bandelj P., Stari J., Lapanje A., Ocepek M.: Evaluation of combined highefficiency DNA extraction and real-time PCR for detection of Mycobacterium avium subsp.
paratuberculosis in subclinically infected dairy cattle: comparison with faecal culture, milk real-time
PCR and milk ELISA. BMC Veterinary Research 8: 1-22, 2012
Ocepek M., Posedi J., Pislak M.: Prevalence of bovine paratuberculosis in Slovenia in 1997 and 1998.
Zbornik Veterinarske Fakultete Univerze v Ljubljani, 36, 111-119, 1999
Ocepek M., Krt B., Pate M., Poganik M.: Seroprevalence of paratuberculosis in Slovenia between 1999
and 2001. Slovenian Veterinary Research, 39, 179-185, 2002
Ocepek M., Pate M., olnir-Dov M., Cvetni .: Tuberculosis in cattle caused by IS901+
Mycobacterium avium subsp. avium: a case report. Veterinrn medicna, 48, 47-50, 2003
Ocepek M., Pate M., Zolnir-Dovc M., Poljak M.: Transmission of Mycobacterium tuberculosis from
human to cattle. Journal of Clinical Microbiology, 43, 3555-3557, 2005
Ocepek M., Pate M., Maurer Wernig J., Pir T.: Eradication of bovine tuberculosis in Slovenia.
Delegates handbook, VI International M. bovis Conference June 16-19, 2014, Cardiff, UK, organized
by British cattle veterinary association, 2014, 73
Ocepek M., Stari J., Jeek J., Logar K., Zajc U., Bandelj P., Pate M.: Effect of vaccination against
paratuberculosis on fecal shedding and productivity of heavily infected cattle herds. Program &
abstracts, 12th International Colloquium on Paratuberculosis, June 22-26, 2014. Parma, Italy, organized
by International Association for Paratuberculosis, 2014, 148
Pate M., Jeni V., olnir-Dov M, Ocepek M.: Detection of mycobacteria in aquarium fish in Slovenia
by culture and molecular methods. Diseases of Aquatic Organisms, 64, 29-35, 2005
Pate M., Svara T., Gombac M., Paller T., Zolnir-Dovc M., Emersic I., Prodinger W.M., Bartos M.,
Zdovc I., Krt B., Pavlik I., Cvetnic Z. Pogacnik M., Ocepek M.: Outbreak of tuberculosis caused by
Mycobacterium caprae in a zoological garden. Journal of Veterinary Medicine Series B, 53, 387-392,
2006
Pate M., olnir-Dov M., Ocepek M.: Tuberculosis as a zoonosis: importance and diagnostics.
Medicinski Razgledi 51 (Suppl. 6), 119-125, 2012
Pate M., Kuar D., olnir-Dov M., Jeni V., Ocepek M.: Akvarijske ribice v lui mikobakterijskih
okub ljudi = Aquarium fish in the light of human mycobacterial infections. Enboz, 11, 4-7, 2014
Primm T.P., Lucero C.A., Falkinham J.O. III: Health impacts of environmental mycobacteria, Clinical
Microbiology Reviews, 17, 98106, 2004
Slany M.: A new cultivation-independent tool for fast and reliable detection of Mycobacterium
marinum. Journal of Fish Diseases, 37, 363-369, 2013
Stari J., Zadnik T., Logar K., Ocepek M.: Diagnostic of paratuberculosis on 8 big dairy farms in central
Slovenia. Veterinarska stanica 42, suppl. 1, 78-81, 2011
69

22. Thacker T.C., Harris B., Palmer M.V., Waters W.R.: Improved specificity for detection of
Mycobacterium bovis in fresh tissues using IS6110 real-time PCR. BMC Veterinary Research, 7, 50,
2011
70
SANITARY AND QUALITY CONDITIONS OF IMPORTED BULLS SEMEN IN SERBIA

ANALYSED AT "NIV-NS" (RETROSPECTIVE FROM 2010-2014)
Aleksandar Milovanovi 1*, Tomislav Barna 1, Milovan Joviin1, Jelena Api1, Sava Lazi1, Igor
Stojanov1, Miroslav Uroevi2
1
Scientific Veterinary Institute "Novi Sad", Novi Sad, Serbia

Scientific institute of reproduction and artificial insemination for domestic animals "Temerin", Temerin,
Serbia
*Corresponding author: [email protected]
Abstract
During the period from 2010 to 2014 Scientific veterinary institute "Novi Sad" (NIV-NS) was
responsible for quality control of 44 quarantines with 344,485 imported doses in 710 batches from
248 bulls, originating from 10 different countries (EU countries, USA and Canada) and 18 different
breeding centers.
Samples were analyzed for bacterial count (expressed as colony forming units - CFU/mL) and
bacterial types, virus gene presence of IBR/IPV, BVD and Schmallenberg virus. Semen quality was
tested by CASA (Computer Assisted Sperm Analyzes), flow citometry and cytology sperm quality
parameters. Complete analyses were performed on 550 semen samples of 248 bulls.
Dominantly, semen traits were in accordance to relevant national and international standards
(Official Journal of R. Serbia 38/2014 and OIE). However, 43 batches (32 bulls from 15
imports), with total of 21.826 straws (6.33% of all imported straws) were rejected/destroyed
because of different and prominent discrepancy, related to improper transportation (liquid nitrogen
leaking), presence of the genome of Bovine viral diarrhea virus, opportunistic pathogen bacteria
(Citrobacter freundii), elevated bacterial count (CFU from 40-780103), but mostly were rejected
because of low semen quality (10 of 15 cases). E.g., recorded sperm total motility ranged between
9.30-56.70% (average 35.709.60%), progressive motility 1.7-28.8% (16.775,20%), total motile
cells per straw 8.11106 (1,70-15,10106), progressive motile cells 0.36-7.0106 (3.761.40106,
CASA) and live sperm cells with intact acrosome (LIA) 4-55% (33.679.75%) and pathologic
forms (5-65%) from cyto-morphological studies. LIA cells by flow cytometry were 15.22 to
64.26% with average of 39.2412.02%.
EU semen trading policy is devoted only to sanitary conditions and semen quality is a matter of
standard operative procedure (SOP) of breeding center. Semen of lower quality (up to dead-non
motile semen) could be expected from imported semen.
Keywords: bull, semen, quarantine, quality and sanitary condition
Introduction
Republic of Serbia has a long tradition of cows farming, bulls semen production and semen import.
First semen production and insemination started in 1951 with fresh semen (Perkovi, 2011) and first
import of frozen semen in 1976 (frozen semen of Simmental bulls for insemination of sires
mothers). Commercial semen imports started from 1989-1990 with Montbliarde frozen semen
from France (Perkovi, unpublished data), and then continued with Simmental breed from West
Germany and Austria, together with Holstein breed from USA.
From that period, semen import, storage, breeding plans and distribution were a privilege and
obligation of breeding centers. After 2011 first distributive centers were registered and semen
import became more intensive and versatile, including many worldwide breeding centers and local
71
companies involved in semen trading and several cattle breeds become available to our market.
Nowadays semen import in Serbia is carried out trough 3 registered breeding centers and 10 semen
distributive companies. Most of significant producers of semen from the globe are presented on our
market now, selling semen of the best genetic value and those with commercial value.
General directives for intra-Community semen trading are regulated by 88/407/EEC directive.
Intercommunity trading between non EU trading is regulated by Commission for implementing
decision 2011/630/EU (bovine species from third countries). Regulations of semen storage centers
(semen distributive centers) are regulated with Directive 88/407/EEC.
None of this directive is regulating minimal hygiene conditions of produced semen (level of
bacterial contamination and bacterial type) or minimal technical guidelines of produced semen (e.g.
minimal number of live motile cells, maximal percentage of pathology forms).
OIE Terrestrial Animal Health Code from 2003 had guidelines related to count of saprophytic
bacteria in semen doses. Thawed semen should not contain more than 5,000 CFU per semen
sample, including saprophytic bacteria, fungi, moulds and yeasts. Regulations in some countries are
even stricter (2), and allows up to 500 CFU/ml of saprophytic microorganisms. Presence of
opportunistic pathogen bacteria is not recommended. Explanation was that presence of
opportunistic pathogen bacteria in the sterile uterus of potentially immunocompromised individuals
or herd cattle may present a risk for the occurrence of reproductive and other health problems in
animals or humans (3, 4, 5). Current OIE Terrestrial Animal Health Code from 2010 is missing
these paragraphs. Reason for this is not stated and it is not known to this the first author of this
article.
Some countries had established their own health criteria for bulls' semen clearing semen quality and
hygiene. Generally, Republic of Serbia is following these positive EU recommendations, but
current status of non-EU country allow to have national regulations that more precisely regulate
semen import, stressing on semen quality traits (minimal producing requirements regarding hygiene
and semen quality; Official Journal of R. Serbia 38/2014).

Before semen import, importers have to acquire positive opinion from Scientific-expert Council and
to fulfil veterinary requirements regarding Veterinary Health certificate of animal that were used to
produce bovine semen as well as for frozen semen. After import semen is held in quarantine during
maximal period of 21 day which is provided for semen sanitary and quality control. Control is
under supervision of Republic veterinary inspectors and samples are submitted to reference
veterinary institutions (Faculty of Veterinary medicine in Belgrade or to regional Veterinary
Institutions). Most batches imported in the province of Vojvodina (north Serbia) were directed by
decision of Veterinary Directorate to be tested in Laboratory of Reproduction at Scientific
Veterinary institute in Novi Sad. Method of sampling (number of batches to be tested and number
of doses per batch) was determined to be in accordance of the criteria of the representing Institutes.
In our case, all bulls from the list and almost all batches were subjected to analyses (exception was
if the bulls had import of several batches and some batches were with small number of straws-e.g.,
less than 50 doses). In most cases 3 straws per analyze were sampled for viral, bacterial and quality
investigations.
Bulls semen quality control consisted of:
1. CASA (Computer Assisted Sperm Analysis, ISAS, Proiser, Spain) for assessing
concentration, total and progressive motility and spermatozoa speed values;
2. flow cytometry analyses (Guava Millipore-IMV, USA) for sperm chromatin structure assay
- SCSA test (acridine orange, Invitrogen), and test of membrane and acrosome integrity
72
(PNA-FITC/PI, Invitrogen, USA) for synthetic extenders, or vitality test-membrane integrity

(Sybr14-PI, Invitrogen, USA) for milk or egg-yolk extenders;
3. Detailed cyto-morphological examination of stained sperm sample with eosine-nigrosinetripan blue staining (Alfapanon, Novi Sad) under oil immersion with phase contrast
objective, 1000x magnification (Olympus BX-40, Japan). The spermatozoa morphology was
assessed according to Barth and Oko (1989) and semen was classified according to quality
criteria by Joviin et al. (1992) in four class (I, II, III and out of class).
Qualitative determination of bacteria was performed by cultivation onto the Columbia agar plates
supplemented with 5% sheep blood (Oxoid, Basingstoke, UK), MacConkey agar (Oxoid,
Basingstoke, UK) and Sabouraud dextrose agar (Torlak, Serbia). For anaerobic and microaerophilic
bacterial determination the thioglycollate broth was used. Tests for total aerobic microorganisms
were carried out in accordance with the international standard (ISO 8607: 2003). Briefly, series of
dilution (101-105) were prepared in buffered peptone water (CM1049, Oxoid, Basingstoke, UK),
and 0.5 mL were inoculated on Petri dish and Tryptone Soya Agar (CM131, Oxoid) supplemented
with 5% of sheep erythrocytes was poured over. The plates were incubated for 48h at 37oC under
aerobic conditions.
Imported semen was also subjected to virological testing for the presence of IBR/IPV (BHV-1),
BVD and Schmallenberg virus. Identification of the virus was carried through susceptible cell
culture (MDBK cell line; OIE Terrestrial Manual, Chapter 2.4.8, 2008) or molecular biological
study PCR technique. For identification of BVDV and Scmallenberg agent in the bulls' semen realtime ART-PCR was used, and PCR molecular method for IBR (Applied Biosystem 7500, Life
Technology, MA, USA).
Semen must be free of virus genome presence, or pathogen bacteria. Before national directives for
semen quality (declared in 2014) bacterial loads was tolerated up to 10.000 of total CFU/ml at NIVNS. Doses also were discarded (scored as out of class) in the following situation: CASA
parameters-total motility spermatozoa 30%, CASA progressive motile under 20%, total motile
cells in a dose less than 4106 sperm cells per doses, progressive motile cells less than 3106. Also,
semen should have at least 40% of live normal sperm cells with intact acrosome and less than 40%
of abnormal forms (cito-morphology after supravital staining).
From April 2014, official guidelines for semen quality were established (Official Journal of
Republic of Serbia" no. 38 from April 4, 2014). Main quality parameters of bull semen extracted
from this regulative are now more demanding and are as follows:
1) progressive sperm motility: at least 50% (for our sperm motility test that was performed
by CASA, we considered progressive motility at least of 30% and total motility at least of
50%);
2) the percentage of morphologically altered sperm up to 30%;
3) the number of (progressively) motile and morphologically normal spermatozoa in a dose
after thawing: at least 10 million;
4) the total number of the bacteria up to 500 CFU/ml (if semen had good quality traits we
tolerate up to 10,000 of saprophytic bacteria).
In cases with very good semen quality and less sperm cells in doses semen could pass analyses
because some elite bulls breeding centers were producing doses not more than with 6-9 106 sperm
cells per doses. There were rare cases of compensation of semen quality with higher number of
spermatozoa. Sexed semen is not covered by this quality regulation but all other regulations
regarding bacterial and viral presence were done as for conventional semen.
In the case that semen is not in accordance to relevant quality or sanitary requirement semen must
be safely destroyed or turned back to producer. Importers and producers accepted semen destroying
in such cases. Semen destroying was carried out by autoclaving at 128C for 1h and10 minutes.
73
Results
During the period from 2010 to 2014 Scientific Veterinary Institute "Novi Sad" (NIV-NS) was
responsible for quality control of 44 quarantines with 344,485 imported doses in 710 batches from
248 bulls. Out of 710 imported batches, 562 were analyzed (79.15%). Complete analyses were
performed on 550 conventional and 22 sexed semen samples of 248 bulls. Sexed semen represented
only 3.85% of all analyzed semen batches.
Semen originated from 10 different countries (Austria, Germany, Denmark, Croatia, Czech
Republic, Slovakia, Netherlands, USA and Canada) and from 18 different breeding centers. Most
often imports were from Croatia (15 times), Netherlands (7), Switzerland and Canada (5).
Table 1. Overview of the basic details of the number of quarantines, imported of conventional semen
batches, total bulls semen doses, performed analyses and rejected semen doses by exporting countries
subjected to analyses at NIV-NS during period 2011-2014.
Imported
Country
Austria
Canada
Croatia
Czech Rep.
Denmark
Germany
Netherlands
Slovakia
Switzerland
USA
TOTAL 10
Analyzed:
of imports
Samples
Batches bulls of doses bulls
(quarantines)
(batches)
3
57
4
28,009
4
24
5
86
54
53,950
54
78
15
225
73
115,464
73
207
1
10
2
4,790
2
10
1
24
5
6,300
5
8
2
82
20
40,100
20
52
7
55
27
22,157
27
52
1
7
1
4,455
1
7
5
114
37
54,350
37
67
4
50
25
14,910
25
45
44
710
248 344,485 248
550
of rejected:
semen
bulls batches
doses
14
23
13,376
1
1
502
8
10
4,070
4
4
1,967
1
1
690
1
1
500
2
3
721
21,826
31
43
Table 2. Imported semen samples/analyses according to bulls breed and imported countries for conventional
semen (N=550).
Breed
Country
Austria
Canada
Croatia
Czech Rep.
Denmark
Germany
Netherlands
Slovakia
Switzerland
USA
TOTAL
Angus Belgian blue Brown Swiss Holstein Limousine Simmental

1
2
3
2
2
6
4
10
74
87
20
10
7
28
34
31
34
251
4
4
24
180
37
7
32
280

Table 3. Imported semen samples/analyses according to bulls breed and imported countries (sexed semen),
N=22.
Breed
Holstein
Simmental
Country
Canada
Denmark
Germany
Netherlands
USA
TOTAL
2
1
3
15
21
1
1
Table 4. Basic details of the rejected bulls semen doses (main reasons for rejection, number of
quarantines/imports, imported batches, bulls and number of doses) that was subjected to analyses at NIV-NS
during the period from 2011 to 2014.
Imported
of imports
doses % of all
batches
bulls
of doses
(quarantines)
rejections
Viral presence (BVD)
1
1
1
502
2.30%
Bacterial unsoundness
3
10
5
2,916
13.36%
Semen quality criteria
10
29
23
16,741
76.70%
Improper transport (N2 leaking)
2
3
3
1,667
7.64%
TOTAL
100%
16*
43
32
21,826
*15 imports were rejected, in one a combination of high bacterial load and low semen quality was noted
Reason for rejection
Reasons for semen rejection were classified as viral presence, bacterial unsoundness, low semen
quality or improper transport (liquid nitrogen leaking).
In 15 cases from 44 imports (quarantines) one of the mentioned reason for rejection were noted,
presenting incidence of 34.09%. One quarantine had combination of low semen quality in 2 batches
and high bacterial presence in 6 batches.
Viral genome presence of BVD by RT-PCR technique was noted in one batch of one imported
bulls' semen.
Bacterial unsoundness represented in 3 imports, on 5 bulls and 10 batches, representing 23.25%
(10/43) of rejected batches and 13.36% of all rejected doses (2,916/21,826; Table 5). From all
semen analyzes this is represented 1.81% of all batches (10/550) and only 0.85% of all imported
semen.
Bacterial contamination with Citrobacter Freundii (an opportunistic microbe that is accountable for
quite a few significant opportunistic infections) isolated in monoculture, in concentration of 1.000
CFU/ml was noted in one case and rejected as a potential risk for uro-genital infections (Milanov
and all., 2012; Joaquin and all., 1992; Badger et all, 1999). Other 9 rejections were because of high
bacterial load of saprophytic and/or opportunistic microorganism (40,000 to 780,000 CFU/ml,
averaging 237,778232,313 CFU/ml). This was several times over technical normative for semen
quality.
Main reason for semen rejecting was improper semen quality (29/43 cases; 67.77%), with total
rejections of 16,741 doses from 21,826 rejected doses (76.70%; Table 4). Low semen quality was
registered in 10 imports, in 29 batches and in 23 bulls. This represented 5.27% of all imported
semen batches (29/550) and 4.86% of all imported semen doses (16,741/344,485).
75

Table 5. Details of rejected bulls semen doses regarding bacterial contamination (number of imports, bulls,
batches, doses, bacterial load and isolated strains) during the period from 2011 to 2014.
Import
Bull
Batches
Import A
Bull A
Batch 1
Batch 2
Batch 3
of
doses
300
375
150
Batch 4
410
Batch 5
325
Batch 6
375
Batch 7
260
Batch 8
Batch 9
Batch 10
10
185
300
236
2.916
Bull B
Import B
Bull C
Bull D
Import C
TOTAL: 3
Bull F
5
Bacterial load
Isolated bacterial strain
(CFU/ml)
1.000 Citrobacter Freundii
350.000 Enterobacter aerogenes and Bacillus sp.
200.000 Corynebacterium sp. and Bacillus sp.
Corynebacterium sp., Bacillus sp., and
160.000
Staphylococcus sp.
Bacillus sp., Staphylococcus sp. and
130.000
Micrococcus sp.
Enterobacter aerogenes, Bacillus sp. and
780.000
Corynebacterium sp.
Bacillus sp., Staphylococcus sp. and
340.000
Micrococcus sp.
80.000 Bacillus sp. and Staphylococcus sp.
60.000 Enterobacter aerogenes
40.000 Enterobacter aerogenes
-
Regarding CASA parameters, average total motility of 29 rejected semen was 35.479.6%
(minimal value 9.30%, maximal 56.70%), progressive motility 16.775.50% (from 1.70% to
28.80%) and fast moving spermatozoa 19.10% (from 2.00-35.70%). Average total motile sperm
cells were 8.11106 (1.70-15.10106).
Table 6. Descriptive statistic of the CASA parameters of rejected deep frozen bulls' semen (29 semen
samples)
Descriptive
statistic
values
Mean
Minimum
Maximum
Std.Dev.
Coef.Var.
St. Error
1. Number of
spermatozoa
million million in
in ml
dose
90.90
22.72
29.10
7.30
133.90
33.50
22.26
5.56
24.48
24.47
3.87
0.97
2. Total motility
after
thawing
35.47%
9.30%
56.70%
9.61%
27.08
0.02
million
in dose
8.11
1.70
15.10
2.95
36.35
0.51
3. Progressive
motility
after
million
thawing
in dose
16.77%
3.76
1.70%
0.36
28.80%
7.00
5.50%
1.40
32.81
37.32
0.01
0.24
4. Percent of
fast moving
spermatozoa
19.10%
2.00%
35.70%
6.83%
35.77
0.01
On cyto-morphological analyses of deep frozen bull semen (29 semen samples) average percentage
of normal live sperm cells was 33.6712.01 (4.00-55.00%) and total abnormalities 42.7612.01%
(5.00-65.00% ).
Sperm chromatin structure assay (SCSA) of rejected deep frozen bulls' semen indicated average
sperm chromatin defects in 9.509.00% of spermatozoa, ranging from 0.40-32.10% (29 semen
samples) detected by flow cytometry. On membrane permeability test (sperm vitality test, livedead), intact sperm membrane was detected in 30.489.67% sperm cells, ranging from 1.60-43.80%
(23 semen samples). On sperm membrane and acrosome integrity assay (24 semen samples) live
spermatozoa with intact acrosome was detected in 39.2412.02% sperm cells, ranging from 1,6043,80% (23 semen samples); booth detected by flow cytometry. Total damaged acrosomes (DA)
in sperm cells were present in 31.5114.30% (ranging from 2.52-65.38%).
76

Table 6. Descriptive statistic of cyto-morphological analyses of deep frozen bull semen (29 semen samples).
Subpopulation of sperm cells (%)
Descriptive statistic
values
Mean
Minimum
Maximum
Std.Dev.
Coef.Var.
St. Error
Normal sperm morphology
Total
Live spermatozoa
LI
LDA
L
Abnormal sperm morphology

Total, live and death
I BN
II BN
PPD
ABN
1.
2.
3.
4.
5.
6.
7.
8.
42.76
5.00
65.00
12.01
28.10
2.09
33.67
4.00
55.00
9.75
28.97
1.70
2.39
0.00
26.00
4.51
188.54
0.79
32.67
13.00
64.00
10.60
32.45
1.85
2.00
0.00
8.00
2.26
113.19
0.39
11.88
2.00
30.00
7.02
59.11
1.22
6.88
0.00
35.00
7.81
113.53
1.36
42.76
5.00
65.00
12.01
28.10
2.09
( L=Total live/unstained spz.; LIA=Live spz. with intact acrosome; LDA=Live spz. with damaged acrosome; DA=Damaged acrosome - total;
PPD=Protoplasmatic droplet-total; I BN=Primary abnormalities; II BN= Secondary abnormalities; ( ABN= Total abnormalities).
Table 7. Descriptive statistic of sperm chromatin structure assay (SCSA) of rejected deep frozen bulls' semen
(29 semen samples) by flow cytometry
1. DNA status
values
(DNA %)
undamaged
damaged
Mean
90.51
9.50
Minimum
67.93
0.40
Maximum
99.60
32.10
Std.Dev.
8.97
9.00
Coef.Var.
9.91
94.68
St. Error
1.61
1.62
Table 8. Descriptive statistic of membrane permeability test (sperm vitality test, live-dead) for rejected deep
frozen bull semen (24 semen samples) by flow cytometry
1. Membrane status (%)
values
Undamaged
Damaged
(live)
(dead)
Mean
30.48
69.52
Minimum
1.60
56.20
Maximum
43.80
98.40
Std.Dev.
9.67
9.67
Coef.Var.
31.72
13.91
St. Error
1.97
1.97
Table 9. Descriptive statistic of sperm membrane and acrosome integrity assay for rejected deep frozen bull
semen (23 semen samples) by flow cytometry
Detection of specific subpopulations of spermatozoa (%)
values
LIA
DI
LDA
DDS
L
DA
1.
2.
3.
4.
5.
6.
Mean
43.33
39.24
16.56
16.88
27.34
31.51
Minimum
22.94
15.22
0.60
0.34
2.02
2.52
Maximum
66.42
64.26
47.42
51.00
56.18
65.38
Std.Dev.
13.06
12.02
15.03
16.05
12.73
14.30
Coef.Var.
30.15
30.64
90.71
95.10
46.56
45.39
St. Error
2.72
2.51
3.13
3.35
2.65
2.98
( L=Total live spermatozoa; LIA=Live spermatozoa with intact acrosome; DIA=dead spermatozoa with intact acrosome; LDA=Live spermatozoa
with damaged acrosome; DDS= dead spermatozoa with damaged acrosome; DA=Damaged acrosome - total).
77
Discussion
Council directive 88/407/EEC is laying down the animal health requirements applicable to intraCommunity trade in and imports of semen of domestic animals of the bovine species. Bulls semen
produced for artificial insemination should fulfil sanitary requirements before the quarantine period
(requirements of the farm, AI station or quarantine), at herd and individual level (diagnostic tests on
the bull).
Intercommunity trading and EU to non EU trading is regulated by Commission for implementing
decision 2011/630/EU on imports into the Union of semen of domestic animals of the bovine
species from third countries. In both cases no strict or any technical guidelines for intra community
trade is mentioned that could serve as a general guideline regarding semen quality requirements or
for bacterial count in extended semen.
Quality of imported semen analyzed at NIV-NS dominantly was in accordance to relevant national
and international standards (Official Journal of R. Serbia 38/2014, Council directive 88/407/EEC
and OIE). However, 43 batches (32 bulls from 15 imports), with total of 21,826 straws (6.33% of all
imported straws) were rejected/destroyed because of different and prominent discrepancy, related to
improper transportation (liquid nitrogen leaking 1,667 straws), presence of the genome of Bovine
Viral Diarrhea Virus, opportunistic pathogen bacteria (Citrobacter freundii - 300 doses), elevated
bacterial count (CFU from 40-780103; 2,616 doses), but mostly were rejected because of low
semen quality (10 of 15 cases 16,741 doses).
France has established automatically generated system of on field data collecting trough coding of
cows and semen straws. Information of cows, used semen, insemination or rebreeding is
automatically sent to main computers by internet on the moment of insemination which allows that
fertility problems are quickly recognized. Serbia without this system is relaying on obligation of
veterinary service to inform breeding or distributing center on pregnancy rate of purchased bulls'
semen. Practically, this system is not working in most regions (lack of data collecting and data
summering). Complains often are coming directly from farmers instead of veterinarian
practitioners. Other way to have better insight of semen quality is to test semen with up to date
laboratory system taking in account that biology traits are not always in accordance with laboratory
results (Milovanovi and Barna, 2011), what was strong argument of importers when semen of low
quality was established, before declaration of national direction for semen quality (Official Journal
of R. Serbia 38/2014. With modern, up-to-date system of semen quality control and strong
argumentation (semen quality tested by several methods, photo and movie documentation, ISO
standardized bacteriology and virology laboratories/tests), semen rejection was accepted as normal
issue, and most domestic importers and foreign breeding centers as sellers are easier accepting
reasons for semen destroying.
Conclusion
EU semen trading policy is devoted only to sanitary conditions and semen quality is a matter of
standard operative procedure (SOP) of breeding center. Semen of lower quality (up to dead-non
motile semen) could be expected from imported semen.
Routine semen testing at the import and national recommendations of semen quality traits can be
comprehended as a good method for reduction of fertility problem generated by male infertility on
cattle farms in Serbia.
Acknowledgements
This work was supported by a grant from scientific project TR 031071 of Ministry of Education and
Science of Republic of Serbia
78
Reference:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Badger LJ, Stins F. Monique, Kim KS; Citrobacter freundii Invades and Replicates in Human Brain
Microvascular Endothelial Cells, Infection and Immunity, 1999, Vol. 67, 8, 4208-15.
Barth AD, Oko RJ, 1989. Abnormal Morphology of Bovine Spermatozoa. Iowa State University Press,
Ames, IA, US.
Collection and processing of Bovine, small ruminant and porcine semen, OIE - Terrestrial Animal
Health Code,Chapter 4. 6, 2010.
Dr Stevan Perkovi, 60 godina rada stoarsko-veterinarskog centra Krnjaa, 1951-2011, onografija,
publisher: Stoarsko veterinarski Centar Krnjaa, print, Nauna KMD, Beograd, 2011.
ISO 8607:2003(E): Artificial insemination of animals -- Frozen semen of breeding bulls -- Enumeration
of living aerobic microorganisms, www.iso.org
Joaquin A, Khan S., Russell N., Al Fayez N: Neonatal Meningitis and Bilateral Cerebellar Abscesses
due to Citrobacter freundii, Pediatr Neurosurg 1991/1992; 17:23-4.
Joviin M, Neme , Boro I, Jakovljevi G, Kai M, Salma J, Glavoni L, 1997. Steonost krava u
zavisnosti od citolokog i mikrobiolokog kvaliteta zamrznutog semena bikova. Zbornik naunih radova
PKB Agroekonomik, 329-39.
Milanov D., Stojanovi D., Barna T., Milovanovi A.: Izolacija Citrobacter freundii iz duboko
zamrznutog semena bika - prikaz sluaja. Nauni simpozijum Reprodukcija domaih ivotinja i bolesti
novoroenadi, Divibare, 4-7. oktobar 2012, urednik Miodrag Lazarevi, Zbornik predavanja, Str. 125129, Beograd, Nauna KMD, 2012 (srp)
Milovanovi A., Barna T.: The modified thermoresistance test is not siutable for fertility prediction of
frozen-thawed bull semen. The 15th Annual Conference of the European Society for Domestic Animal
Reproduction (ESDAR), Antalya, Turkey 15-17 September 2011, Guest Editor Detlef Rath,
Reproduction in Domestic Animals, Str. 130-130, Berlin, Wiley-Blackwell, 2011.
Minimalni
pogoji
za
oploditveno
sposobnost
semena:
http://www.uradnilist.si/1/objava.jsp?urlid=200751&stevilka=2725
OIE Terrestrial Manual 2008, Chapter 2.4.8. Bovine Viral Disease
"IE
Terrestrial
Animal
Health
Code
2003",
http://www.oie.int/eng/normes/mcode/code2003/A_00127.htm
Pravilnik o uslovima u pogledu objekata, opreme, sredstava za rad i strunog kadra koje mora da
ispunjava centar za skladitenje i distribuciju semena za vetako osemenjavanje (Objavleno u
Slubenom glasniku RS, broj 6/11 od 4. februara 2011. godine
79
THE HEALTH STATUS OF BREEDING STALLIONS FOR NATURAL BREEDING AND

ARTIFICIAL INSEMINATION: REGULATORY COMPLIANCE IN EUROPEAN UNION
AND WEST BALKAN
Miroslav I. Urosevi1*, Luis Losinno2, Aleksandar Milovanovi3, Dragia Trailovi4, Slobodanka
Vakanjac4, Jelena Petrovi3, Natasa Filipovi5
1. Scientific institute of reproduction and artificial insemination for domestic animals "Temerin" Temerin, Serbia
2. Fac. Agronomia y Veterinaria, Universidad Nacional de Rio Cuarto, Rio Cuarto, Argentina
4. Faculty of veterinary medicine, University of Belgrade, Belgrade, Serbia
5. Faculty of agriculture, Veterinary medicine Dep., University of Novi Sad, Novi Sad, Serbia
Abstract
Diagnostic and health condition control procedures of breeding stallions in Serbia are in accordance
with Regulation on the establishment of animal health care measures for 2014. Diagnostic tests for
breeding stallions are performed on each breeding animal one time in a year, and those include only
tests for Equine infectious anaemia. Nevertheless, the majority of horse owners and keepers tend to
follow their previous routines and preventive measures. When it comes to stallions, tests which are
conducted on horse-farm prior to breeding season include serum neutralization test for Equine
Herpes Virus -1 (EHV-1) and Equine viral arteritis.
What is the looming problem nowadays is that there is no existing system control whether would
that involve certain institutions or associations (sport or breeding animals). Examination of equine
sperm for arteritis is not a common procedure - however, in justified cases of doubt solely it is. On
the other hand, as an example of regulations in South America, we shall mention compulsory
measures in Argentina about the obligation of examination of Equine Viral Arteritis on stallions.
These are following: Every breeding association must submit a certification of negativity (serum
neutralization test) for Equine Viral Arteritis of all active stallions before the annual breeding
registration or AI. Frozen semen samples imported from foreign countries must be checked by state
laboratories for detection of viral presence by PCR before commercialization and insemination. On
balance, it can be emphasized, that in relation to further development of veterinary profession and
horse industry in Serbia as well, it is not recommended to a priori implement every EU model
currently, and completely, due to the difference in horse breeding between our system and similar in
EU countries. Nevertheless, in relation to mentioned legal framework and de facto situation in horse
breeding in Serbia, we would recommend thoroughly planned control and primarily to make
evidence of stallions used for breeding of mares in sport and rural areas.
Keywords: equine, semen, legislative, Serbia, EU
Introduction
The state of horse breeding and reproduction in Serbia
Horse breeding as an animal husbandry branch has a long and significant tradition in Serbia through
the use of horses in work, sport and nowadays increasingly more as a hobby. According to the
records from the Bureau for statistics of Serbia from 2014 here are 16.000 horses, which include
8.000 of mares and fillies. However, when it comes to the number of stallions there are no official
records. Although, those are the official records we consider them as not viable enough and they are
80
taken with caution owing to the fact that those do not reflect the actual state especially regarding the
breeding animals.
Moreover, the additional records available to us are containing the information about the population
size on the Province Vojvodina territory (Trivunovic, 2014). This report, from main breeding
organisation in the animal husbandry at the Faculty of Agriculture of Novi Sad from 2014, includes
only stallions that are registered, and are under the regular productivity control. The active
population counts 184 animals. Thus, there is an assumption that for breeding is used a larger
number of the breeding animals, however the breeders are not completely adjusted to breeding
programmes from the unknown reason whether they are not keeping records or they do not hand in
breeding reports to basic breeding organisations. In addition to those mentioned facts there have not
been a proper number of scientific publications when it comes to fertility and problems in horse
reproduction due to infectious disease in Serbia. In the continuation of this work we are going to
describe what are the laws that should be obeyed regarding the health conditions of stallions, if they
are compared with the legislation in Serbia (West Balkan) and EU.
Legislation about breeding stallions in Serbia
Diagnostic and health condition control procedures of breeding stallions in Serbia are in accordance
with Regulation on the establishment of animal health care measures for 2014 (Anonymous,
2014A). Diagnostic tests for breeding stallions are performed on each breeding animal one time in a
year, and those include only tests for Equine infectious anaemia (EIA). Nevertheless, the majority
of horse owners and keepers tend to follow their previous routines and preventive measures. When
it comes to stallions, tests which are conducted on horse-farm prior to breeding season include
serum neutralization test in blood sample for Equine Herpes Virus-1 (EHV-1) and Equine viral
arteritis (EVA).
Nevertheless, the present Program of measures states that in order to do establishment, monitoring
and prevention of Leptospirosis specific diagnostic examination (microscopic agglutination testMAT), is biannually conducted in stallions for natural mating and for semen production for
artificial insemination. Furthermore, there are no precise data about the number of breeding mares
and stallions that are under regular serological control for Leptospirosis in the herds in Serbia.
Owing to that, we cannot accurately determine the nature of epizootic situation for this contagious
disease.
What is the looming problem nowadays is that there is no existing system control whether would
that involve certain institutions or associations (sport or breeding animals). Examination of equine
sperm for EVA is not a common procedure - however, in justified cases of doubt solely it is.
In any case, in our country no systematic control of breeding animals for CEM (Contagious equine
metritis) is done which is hardening the insight on the field. However, there is existing risk of CEM
transmission during the import of breeding stallions and mares from the neighbour countries and
EU, as well as the stallions provided and borrowed for breeding.
Compulsory blood examination for EIA with the Coggins test has to be conducted in the following
cases: once in a year in the breeding horse-farms, horse-farms owned by Serbian Military Force,
sports horse-farms, stud sections, forests and other places of work, as well as in every herd
containing more than 10 horses; 90 days prior their arrival to hippodromes, fairies, exhibitions,
reviews, sporting competitions etc. If the owner of an animal sells the animal or alienates it in any
other way, the certificate about the examination of EIA must not be older than 30 days. Diagnostic
examination can also be done with ELISA test, with confirmation Coggins test in addition.
Equine viral arteritis
All newly purchased horses should be kept in quarantine and subjected to serological testing
81
(serum neutralisation test), necessarily paired blood samples.

In relation to the regulations on the health status of breeding stallions in Serbia rules about semen
quality ought to be mentioned (Anonymous, 2014B).
It is necessary to obtain certificate of the official veterinary organization claiming that the samples
are taken from studs with high in quality with well-familiar health status and that the standard
measures are conducted which are in accordance with program of measures of animal health care;
Certificate of the official veterinary organization claiming that standard clinical examination is
conducted and that no symptoms are established responsible for causing diseases which can be
transmitted by the semen of the donor animal.
Such records are kept for each production run of conserved semen, and in a manner when it is
possible at any time to determine the origin of semen and it is kept for at least five years from the
date of placing on the market of the last batch produced.
The semen meets the requirements in terms of quality if: it is produced in a centre for reproduction
and artificial insemination; it meets the health and hygiene conditions in accordance with
recognized international standards; it is taken from an animal that has been clinically examined and
at which no symptoms of diseases which can be transmitted by semen of an animal which the
semen is taken from; it is taken from the high in quality breeding animals with known health status
over which are implemented the measures prescribed by a special regulation governing the program
of measures of animal health care;
European Union legislative
An interesting example of legislation is in Croatia, where the Regulations on traffic equine semen
are in fact the provisions of Directive 92/65/ EEC (Anonymous, 1992) on health requirements for
trade and imports into the European Union (EU) of animals, semen, ova and embryos. Regardless of
its issuing in 2009, the mentioned Regulations came into force on the day of Croatia entering the
EU in 2013.
As in the whole EU veterinary certificate for trade of semen of the equine animal is issued or
authorized by the official veterinarian and above all he specifies the type, race and identity of donor
semen, as well as the time of collection of semen. The official veterinarian confirms that the Centre
for semen collection in which that semen was collected, processed and stored for transport, meets
the following requirements: that is situated on the territory or in the region of the Member State on
the day of collection of semen until the date of dispatch of semen or until the expiry of a period of
30 days mandatory storage of frozen semen that is free of African horse sickness (AHS) in
accordance with special regulations; that during the period commencing 30 days prior to the date of
semen collection until the date of dispatch of fresh / chilled semen or until the expiry of a period of
30 days mandatory storage of frozen semen fulfil the requirements of the Ordinance on the
veterinary conditions for the transfer of the equine animal and imports from third countries. This
Ordinance applies to most contagious animal diseases, in accordance with Council Directive EC. In
the first place, the definition of "third country" means States that are not members of the EU. But in
the narrow sense of "third country" in relation to the status of AHS, means a Member State of the
EU free from AHS, or most precisely where no clinical, serological (in unvaccinated equidae) or
epidemiological evidence of AHS have not been established in the past two years and in which in
the last 12 months has not implemented a vaccination against this disease. The term "official
veterinarian" means that the veterinarian is appointed by the Minister in accordance with the
provisions of the Veterinary Act.
The official veterinarian must during the inspection and on the basis of declarations by the owner or
breeder to establish the absence of any reason to suspect that the equidae have been in contact with
animals suffering from infectious or contagious diseases during the 15 days immediately prior to the
82
examination. This applies to a negative status of the animal from a disease which should be
reported: Dourine, Glanders, Equine encephalomyelitis (all types including Venezuelan
encephalomyelitis), EIA, rabies, anthrax, AHS, Vesicular stomatitis.
The certificate of health in the case of a registered equine must be issued within 48 hours before
loading or no later than the last working day prior to loading, in the language of the country of
export of semen and at least one of the official languages of the EU. The health certificate is valid
for 10 days and consists of a single sheet. Interestingly, the experts of the European Commission, in
cooperation with the Ministry of Agriculture (as the competent body of the exporting country), may
do the examination on the spot, to the extent that is necessary to ensure the implementation of this
Regulation. The competent body shall provide all necessary assistance to the experts referred to in
paragraph in carrying out their work. If it is about the import of equidae from the third countries to
Croatia it is only allowed if those countries are officially enlisted by the European Commission.
This approval relates to the whole territory of a third country or to only a part of its area. We should
not neglect the legislation of the third country which applies in relation to animal health and
welfare.
The conditions to be met by the Centre for artificial insemination in EU are: That during the period
commencing 30 days prior to the date of semen collection until the date of dispatch of fresh / chilled
semen or until the expiry of a period of 30 days of mandatory storage of frozen semen possessed
only equidae which were free of clinical signs of CEM and EVA. That the above described semen
comes from donor stallions, which: on the day of collection of semen have not shown clinical signs
of an infectious or contagious disease; during at least 30 days prior to collection of semen have not
been used for natural mating; during at least 30 days prior to collection of semen have been kept on
farms where no equine animal showed clinical signs of EVA; during at least 60 days prior to
collection of semen have been kept on farms where no equine animal showed clinical signs of
CEM; according to the information / check the official veterinarian of the 15 days immediately
prior to collection of semen have not been in contact with equidae suffering from an infectious or
contagious disease; that they are subjected to the following tests in a laboratory approved by the
competent authority in accordance with a test program: Coggins test for EIA with negative result,
serum neutralisation test with serum dilution of 1 in 4, or with virus isolation test on an aliquot of
the entire semen of the donor stallion, with the negative result; a test for CEM carried out on two
occassions with an interval of seven days by isolation of Taylorella equigenitalis from preejaculatory fluid or a semen sample and from genital swabs taken at least from the penile sheath,
urethra and urethral fossa with negative result in each case.
That the stallions donors undergo one of the following testing programs: that at least 30 days prior
to and during the collection of semen continuously resident in the collection centre of semen and in
that period no equine animal in the centre has not come into direct contact with equidae of lower
health status than the one in the centre. Certainly, the exact date is stated when they carried out
indicated tests on samples of semen or blood.
During the completion of this certificate, parts that are not related to the shipment must be crossed
out. In order to prevent forgery of documents, the colour of the seal and signature of veterinarian
should differ from the colour of the printed text.
Discussion
Unfortunately, for now, in Serbia some kind of diagnostics includes only sport horses or other
categories of horses that are exposed to diagnosis because of bringing them to the event, fairs or
export.
83
The impression is that the most widely implemented serological diagnosis is the one of EIA.
Although the Ordinance on eradication EIA specifies the compulsory serological diagnostic
measures in horses once in five years it is highly dubious that this is fully carried out. This is
indicated by the occasional discovery of seropositive animals in the past 5 years. In contrast, most
sports horses are regularly controlled, sometimes several times a year, and it is partly regulated by
law, and partly by sporting regulations.
Regardless of whether it is possible titre of antibodies against influenza, herpes virus infection, or
EVA result of vaccination or infection it raises the question of what this finding means when we are
aware that a large number of horses are positive to all these diseases, without evidence of
vaccination.
There are some interesting experiences and research on the occurrence of EVA in Croatia in the
period from 2009 to 2012 (Kolakovi, 2013). According to the legislation in Croatia, EVA is
mandatory controlled with serological examinations of all stallions before the breeding season.
Serologically positive animals then are subjected to an overview of at least two semen samples for
the presence of the virus, with the PCR method. Stallions with a positive test for EVA in the sperm
must be excluded from breeding. The author concludes that this reduction in the number of stallions
serologically examined presents a significant risk of uncontrolled spread of EVA in the horse
population in Croatia. It underlines the need to careful approach when it comes to the
implementation of vaccination against this disease, because the mentioned measure cannot
eliminate the cause of the permanently infected stallions. Therefore, it is recommended to provide
vaccination of only seronegative animals under strictly controlled conditions with the required stay
in quarantine after the vaccination. In addition, vaccination, particularly in countries with unreliable
labelling and record-keeping of horses (i.e. Croatia and Serbia), completely loses the ability to
control the disease with serological examination, primarily because of the problems in
differentiating infectious and vaccination titre. Moreover, epizootic situation in Serbia, together
with the manner of keeping, manipulating and breeding animals, is not suitable to disease control
implementing vaccination against EVA.
As an example of regulations in South America (Argentina), we would mention compulsory
measures (National Animal Sanitary Service-SENASA- 434/01) in Argentina about the obligation
of examination of EVA on stallions. These are following: Every breeding association must submit a
certification of negativity (serum neutralization test) for EVA of all active stallions before the
annual breeding registration or artificial insemination. Frozen semen samples imported from foreign
countries must be checked by state laboratories for detection of viral presence by PCR before
commercialization and insemination.
In relation to the occurrence of Dourine, interesting is the situation in Italy (Calistri et al. , 2013),
where the disease was diagnosed in the regions Sicilia and Campagna in 2011. In Italy, the program
of measures requires examination of about 4000 breeding stallions annually to this parasitic
infection. Having established five outbreaks of Dourine in spring 2011, competent institutions have
made a plan to eradicate and above all to provide the determination of the prevalence of this disease
in Italy. Consequently were found two, but later seven outbreaks. It has been discovered that the
infection is created directly from infected individual coitus. Although Italy is considered the country
with developed horse breeding, this prevention of Dourine has been used to detect a number of
deficiencies in recording and registration of horses in the Central Database in relation to the
situation on the field. All this made it difficult to implement measures on eradication Dourine and
identify the source of infection. This refers to an uncontrolled mating mares (without proper
records), non-implementation of the prescribed veterinary measures and on the impossibility of
monitoring the movement of animals. This example confirms that effective control of infectious
diseases that occur occasionally involves primarily the establishment of effective communication
between veterinarians, authorized diagnostic institutes and laboratories, veterinary inspection,
84
government and international institutions which are responsible for recording the occurrence of
certain diseases and regular reporting when that is the case.
Conclusion
It can be concluded that the aforementioned regulations differ significantly only in the control of
CEM and EVA, which are the most actual epizootiological problem in Serbian horse population,
because we have no real information about their presence in horse studs in Serbia.
Actually it is understood the free status of centres for artificial insemination and horse studs of
especially dangerous infectious diseases, such as AHS. We believe that more important would be
consistent implementation of regulations related to the diagnosis of infectious diseases in stallions.
On balance, it can be emphasized, that in relation to further development of veterinary profession
and horse industry in Serbia as well, it is not recommended to a priori implement every EU model
currently, and completely, due to the difference in horse breeding between our system and similar in
EU countries. Nevertheless, in relation to mentioned legal framework and de facto situation in horse
breeding in Serbia, we would recommend thoroughly planned control and primarily to make
evidence of stallions used for breeding of mares in sport and rural areas.
Thus, based on these data, we propose appropriate measures. First of all, audits (as amended)
regulations and their alignment with the current EU directives, bearing in mind the epizootiological
epizootiological situation in the country and the region. As a prerequisite, it should be the training
of certified laboratories for fast and effective diagnosis of infectious diseases of horses, those that
are regularly or occasionally occurs in our country, as well as diseases that can potentially introduce
horses or otherwise from other countries. This mainly refers to identifying EVA in the sperm
(PCR), as well as with evaluation of genital swabs for CEM. However, as far as it is possible we
would not recommend vaccination against EVA. The reason for this is that the disease situation in
Serbia, the way of keeping animals, the use and breeding horses, including the records and marking
of animals, are not appropriate and in accordance with control of the disease by introducing just
these preventive measures.
To ensure effective diagnosis, it is necessary to review and offer laboratory analysis of all
veterinary institutes related to infectious diseases of horses. Constant communication and exchange
of information and experience would ensure effective coordination of all involved in the health care
of horses, and certainly with international organizations such as OIE and the relevant EU bodies.
Because of the introduction of legal solutions for immunoprophylaxis should enable simpler
procedure of import of vaccines for infectious diseases of horses. And last but not least, a crucial
measure for combating infectious diseases, breeding a horse and raising awareness of the
importance of this issue, both for the owner or holder of the animals themselves and veterinarians
who care about their health condition.
Acknowledgements
The presented work is part of the research done in the scientific projects TR-31084 and III-46005
granted by the Serbian Ministry of Education and Science.
Reference:
1. Anonymous: Council Directive 92/65/EEC, of 13 July 1992 laying down animal health requirements
governing trade in and imports into the Community of animals, semen, ova and embryos not subject to
85
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
animal health requirements laid down in specific Community rules referred to in Annex A (I) to
Directive 90/425/EEC. (OJ L 268, 14.9.1992, p.54), 1992.
Anonymous: Veterinary Law ("Off. Gazette of RS" No 91/2005, 30/2010), 2010.
Anonymous: Ordinance on animal health requirements when moving and imports equidae from third
countries ("Official Gazette of Croatia" No. 78/12), 2012.
Anonymous: Regulation on the establishment of animal health care measures for 2014. year ("Off.
Gazette of RS" No. 24/14), 2014A.
Anonymous, Regulation of marking semen, making evidence about producing semen, as well as
requirements when it comes to fulfilment of semen quality (Offizial Gazette of Serbia 38/14 from april
2014), 2014B.
Aurich Ch, Reproduktionsmedizin beim Pferd. Gynkologie Andrologie Geburtshilfe. Stuttgart,
Parey Verlag, 2010.
Bazanow AB, Jackulak, AN, Frcka BA, Staroniewicz MZ: Abortogenic viruses in horses, Equine Vet
Educ, 26, 48-55, 2014.
Calistri P, Narcisi V, Atzeni M: Dourine reemergence in Italy. J Equine Vet Sci, 33, 2, 8389, 2013.
urii B, Petrovi T, Uroevi M, Dimi-Jaki D, , Appearance and spread of Equine Viral Arteritis
(EVA) Republic in Serbia. Proceedings of the 10th International Congress of World Equine Veterinary
Association, Moscow, Russia, February 2008, 624.
Kolakovi J: "Serosurveillance of equine viral arteritis in Croatia and evaluation of control measures
during period 2009. 2012.", Graduate thesis. University of Zagreb, Faculty of veterinary medicine,
Croatia, 2013.
Trivunovic S.: The Main breeding organisation in the animal husbandry of the Faculty of Agriculture,
University of Novi Sad, 2014. https://sites.google.com/a/stocarstvo.edu.rs/glavna-odgajivackaorganizacija/publikacije
Uroevi I.M., Trailovi R.D., Salajpal K., Jaji I., Ili S.: Infectious diseases of equine reproductive
organs: preventive measures and erradication. Proceeding, The Horseville, Science and Profession, third
Regional Symposium Breeding, reproduction and healt care horses. Novi Sad, Serbia, 1-3 October
2012, 711-19
86
SPERM PATHOLOGICAL FORMS AND ACROSOMAL MEMBRANE INTEGRITY IN

BOAR AI DOSE ON PIG FARMS IN AP VOJVODINA (SERBIA)
Jelena Api1*, Aleksandar Milovanovi1, Tomislav Barna1, Milovan Joviin1
1. Scientific Veterinary Institute "Novi Sad", Novi Sad, Serbia.
Abstract
The success of sows artificial insemination (AI) significantly depends on the quality of sperm used.
The presence of morphologically abnormal sperm significantly reduces the boar semen fertilization
potential. Additionally, the presence of such sperms indicates on various diseases and disorders, or
adverse effects of unfavourable environmental factors. Therefore, the aim of this study is to analyze
the presence of sperm morphological abnormalities, detected in the boars used for AI on farms in
AP Vojvodina (Serbia). Extended semen samples, from 111 AI boars, was tested on sperm and
acrosomal membrane integrity by flow cytometry. Supravital staining (eosin-nigrosin) according to
Bloom, was used to determinate the percentage of live, dead and pathological forms of sperm, as
well as sperm with intact or damaged acrosome. In average, live sperm was average 71%, of which
59% was with intact acrosome. Damaged acrosome was found in 13% live and in 17% dead sperm.
Pathological forms (PF) were found in 32.5% of sperm (20.7% primary and 11.5% secondary PF).
It is important to point out that only 19% of AI doses were categorized as a "first class", while 49%
of the AI doses were "outside of class" (not for use in AI). These results indicate a very poor quality
of examined AI doses. In conclusion, factors that can affect AI dose fertilizing capacity, in the on
farm artificial insemination technology, must be determined in detail.
Keywords: sperm, morphological abnormalities, AI, boars.
Introduction
In modern intensive pig production, more than 90% of sows are artificially inseminated (AI), by
using liquid diluted semen (Stani and Dragin, 2011; Lpez Rodrguez, 2012; Kalifa et al., 2014).
Fertilizing capacity of AI dose significantly depends on the quality of used semen. Sperm
concentration, progressive motility, percentage of viable cells and acrosome morphology are the
basic parameters of semen quality evaluation (Knox, 2004; Mircu et al., 2008; Maes et al., 2011).
To selection of the boars with a good reproductive performance, the prediction of sperm fertilizing
ability has a great economic importance, when expensive genetically superior boars is used in sows
artificial insemination (Gadea et al., 2004). For maximal reproductive exploitation of genetic
quality boar, large number of AI doses per one ejaculate, are often produced (Stani, et al., 2012).
This results in excessive semen extension (Johnson, 2000; Stani et al., 2012). However,
overextension of semen is the most common cause of reduced progressive motility and increased
number of abnormal sperm in AI doses (Maxwell et al., 2007; Caballero et al., 2008; Stani et al.,
2012), particularly sperms with acrosome damaged or disintegrated acrosomal membrane (Perez
Marcos et al., 1991; Kommisurd et al., 2002). Therefore, to achieve high fertility rate in artificially
inseminated sows, it is necessary to accurately control the quality of each ejaculate and extended
semen in AI dose.
The aim of this study was to analyze the presence of morphologically abnormal sperm in the
extended boar semen, used for AI on intensive pig production farms in Vojvodina Province
(Republic of Serbia).
87

Quality testing of diluted boar semen was performed in the Laboratory of reproduction in domestic
animals, Scientific Vterinary Institute, Novi Sad (Republic of Serbia). Extended semen samples
were transported from the farm to the Institute in thermo-box, at +17oC. After arrival to the
laboratory, the semen samples were prepared according to the usual protocol for testing by CASA
(computer assisted semen analysis) and for flow cytometry methods. Total of 111 samples of
diluted boar sperm (AI doses) during the year 2014 and 2015 was tested.
Flow cytometry (Guava-IMV Millipore, USA) was used to test the sperm cell membrane integrity
and akrosome membrane integrity (a combination of fluorometric colors PNA-FITC and propidium
iodide). Percentage ratio of live and dead sperm, sperm with intact acrosome, protoplasmic droplet,
as well as pathological forms of spermatozoa was determined by cytomorphological examination of
supravital stained sperm preparation (eosin-nigrosin staining method according to Bloom). Based
on cytomorphological findings (according to Joviin et al., 1997), as well as on internal
classification according to the number of progressively motile sperm cells (determined by CASA
method), AI doses were classified as class I, II, III or "out of class" (Milovanovi et al., 2013).
Table 1. Reference values for classification of diluted boar semen*
Sperm subpopulation in examined semen samples
1. Total live (L)
2. Live with intact acrosome (LIA)
Normal sperm
3. Live with damaged acrosome (LDA)
forms
4. 4. Total with damaged acrosome (DA)
5. Total with protoplasmic droplet (PPD)
6. Primary abnormal (I ABN)
Pathological
7. Secondary abnormal (II ABN)
sperm forms
8. Pathological forms total (PFT)
Class of sperm qality1

I class
II class
III class
51-69%
40-50%
70%
46-59%
40-45%
60%
6-9%
10-15%
5%
11-20%
21-30%
10%
11-20%
21-30%
10%
6-10%
11-15%
5%
6-10%
11-15%
5%
16-30%
31-7.0%
15%
*Laboratory for Reproduction in Domestic Animal, Scientific Veterinary Institute, Novi Sad.
1
Semen samples with parameters above or below of these values are classified as "out of class"
Results
The obtained parameters of tested diluted boar semen samples (AI doses), are shown in Table 2.
From the total of 71% live (unstained) sperm, 59% of them was with intact acrosome. Damaged
acrosome was found in 13% of live and in 17% of dead sperm cells. Various pathological forms
were found in 32.2% of sperm cells (abnormalities of head and/or principal piece of the sperm cell,
primary abnormalities - I ABN, in 20.7% and abnormalities of middle or rear part of the sperm tail,
secondary abnormalities - II ABN, in 11.5%).
From the total number of AI doses (n = 111), 49% of them was categorized as "out of class" (not for
use in AI), while only 19% of AI dose was a "first class", 16% of AI doses was "second class" and
16% of AI doses was "third class" (Fig. 1).
88
Table 2. The parameter values of tested diluted semen samples (AI doses)
Parameter value
Average
Variation
71.413,98
35.6 - 91.9
58.716,00
17.3 - 87.7
11.213,15
1.8 - 46.3
12.713,22
0.2 - 53.7
17.313,40
0.0 - 49.7
30.016,43
0.2 - 68.2
20.717,49
1 - 64
11.516,33
0 - 68
32.219,87
2 - 85
Parameter of sperm subpopulation in

examined semen samples
1. Total live, unstained (L)
2. Live with intact acrosome (LIA)
3. Dead with intact acrosome (DIA)
4. Live with damaged acrosome (LDA)
5. Dead with damaged acrosome (DDA)
6. Total with damaged acrosome (DA)
7. abnormalities (I ABN)
Primar
8.
Secondar
abnormalities (II ABN)
9.
Pathological
forms total (PFT)
Total semen samples / boars tested (n)
111
I ABN - Pathological changes of head and/or uper part of the sperm tail.
II ABN - Pathological changes of midle and/or rear part of the sperm tail.
Semen samples, %
60
49
50
N = 111
40
30
19
20
16
16
Second
Third
10
0
Out of class
First
Semen class
Fig. 1. Classes distribution of tested diluted semen samples
Fig. 1. Classes distribution of tested diluted semen samples
Discussion and Conclusion

The results of our research show a very poor quality of tested AI doses. Based on the presence of
pathological sperm forms (32.2%) and the number of sperm with damaged acrosomal membrane
(30%), up to 49% of AI doses were categorized as "out of class" (not for use in artificial
insemination).
There are many factors that can influence AI dose fertilizing capacity: factors associated with the
boar and factors associated with AI dose (volume, sperm numbers and progressive motility, the
percent of abnormal sperm, contaminants within the dose, and even the amount of sperm cell
agglutinatio) (Knox, 2004; Yeske, 2007). Progressive motility and acrosomal membrane integrity
are the main parameters of AI dose fertilizing capacity, and can be significantly decrease by
overdilution of ejaculate or by impact of inadequate storage and/or transport condition (darkness
and temperature +17oC) (Johnson et al., 2000; Stani et al., 2012). The results which were
obtained by Kommisurd et al. (2002), indicate that the acrosome is more susceptible to damage
during storage than the organelles being the structural basis of motility. Using over diluted AI doses
is frequently demonstrated as a reason for reduced fertility in the artificially inseminated, compared
89
to naturally inseminated sows (Zveki, 2003; Gadea, 2005; Alm et al., 2006). On the other hand, it
has been shown that there is considerable variation among boars concerning the fertilizing capacity
of semen during storage (Waberski et al. 1994; Stani et al., 2003b).
In conclusion: to detected the reasons for large number of poor AI doses, following should be done:
(1) evaluate boar ejaculate quality, (2) check the boars healt status, (3) determine dilution rate of
each AI dose, and (4) check the storage and/or transport conditions of AI doses.
Acknowledgments
Science of Republic of Serbia.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Alm K., Peltoniemi O.A.T., Koskinen E., Andersson M.: Porcine Field Fertility with Two Different
Insemination Doses and the Effect of Sperm Morphology. Reprod. Dom. Anim., 41, 3, 210-213, 2006.
Caballero I., Vazquez M.J., Garca M.E., Parrilla I., Roca J., Calvete J.J., Sanz L., Martnez A.E.: Major
proteins of boar seminal plasma as a tool for biotechnological preservation of spermatozoa.
Theriogenology, 70, 13521355, 2008.
Gadea J., Selles E., Marco A.M.: The Predictive Value of Porcine Seminal Parameters on Fertility
Outcome U nder Commercial Conditions. Reprod. Dom. Anim., 39,303308, 2004.
Gadea J.: Sperm factors related to in vitro and in vivo porcine fertility. Theriogenology, 63:431444,
2005.
Johnson L.A., Weitze K.F., Fise, P., Maxwell W.M.C.: Storage of boar semen. Anim. Reprod. Sci., 62,
143-172, 2000.
Joviin M., Neme ., Boro I., Jakovljevi G., Kai M., Salma J., Glavoni L.: Steonost krava u
zavisnosti od citolokog i mikrobiolokog kvaliteta zamrznutog semena bikova. Zbornik naunih
radova PKB Agroekonomik, 329-39, 1997.
Khalifa T., Rekkas C., Samartzi F., Lymberopoulos A., Kousenidis K., Dovenski T.: Highlights on
artificial insemination (AI) technology in the pigs. Mac. Vet. Rev., 37, 1, 5-34, 2014.
Knox V.R.: Practicalities and Pitfalls of Semen Evaluation. Advances in Pork Production, 15, 315-322,
2004.
Kommisrud E., Paulenz H., Sehested E., Grevle I.S.: Influence of Boar and Semen Parameters on
Motility and Acrosome Integrity in Liquid Boar Semen Stored for Five Days. Acta Vet. Scand., 43, 4955, 2002.
Lpez Rodrguez, A.: Fresh boar semen: quality control and production (PhD Thesis). Faculty of
Veterinary Medicine, Ghent University, 2012.
Maes D., Lopez Rodriguez A., Rijsselaere T., Vyt P., Van Soom A.: Artificial Insemination in Pigs. In:
Artificial Insemination in Farm Animals (Dr. Milad Manafi, Ed.), 2011, 80-94.
Maxwell W.M.C., de Graaf S.P., Ghaoui R.E.-H., Evans G.: Seminal plasma effects on sperm handling
and female fertility. Soc. Reprod. Fertil., Suppl 64, 1338, 2007.
Milovanovi A., Barna T., Milanov D., Lazarevi M.: Model for cooperation between boarstuds and
laboratories for reproduction in boars semen quality control. Arhiv veterinarske medicine, 6, 1, 57-70,
2013.
Mircu C., Cernescu H., Knop I.Violeta, Frunz Ilinca, Ardelean V., Bonca G.H., Otava G., Zarcula
Simona, Gabriela Korodi Renate, Ardelean A.: Boar semen evaluation using casa and its relation to
fertility. Lucrri stiinifice medicin veterinar (Timisoara), 41, 203-212, 2008.
Perez Marcos C., Sanchez R., Palacio M., Pursel V.G., Perez Garcia T., Martin Rillo S.: Effects of
dilution rate on the motility and acrosome morphology of boar spermatozoa stored at 15C. Reprod.
Dom. Anim., 26, 112-116, 1991.
90

16. Stani I., Dragin S.: Modern technology of artificial insemination in domestic animals. Contemporary
Agriculture, 60, 1-2, 204-214, 2011.
17. Stani B., Gagrin M., Radovi I.: Uticaj godinje sezone, rase i starosti nerastova na kvalitet sperme.
Biotechnology in Animal Husbandry, 19, 3-4, 25-29, 2003.
18. Stani B., Zveki D., Radovi I,. Boi A., Erdeljan M.: Increasing reproductive exploitation of AI
boars (a review). Proc. 23rd Internat. Symp. New Technologies in Contemporary Animal Production,
Novi Sad (Serbia), 19. 21. Jun, 2013, 141-143.
19. Stani I., Dragin S., Stani B., Harvey R., Boi A., Anderson R.: Effects of breed, spermatozoa
concentration, and storage on progressive motility of extended boar semen. Journal of Microbiology,
Biotechnology and Food Sciences, 1, 3, 287-295, 2012.
20. Stani I., Dragin S., Stankovi B., Jotanovi S.: ffect of protein contents in seminal plasma on sperm
motility in diluted boar semen. Proc. 1st International Symposium on Animal Science, November 8 10,
2012., Belgrade, Serbia, 149-154.
21. Waberski D., Meding S., Dirksen G., Weitze K.F., Leiding E.C., Hahn R.: Fertility of long term-stored
boar semen: Influence of extender (Androhep and Kiev), storage time and plasma droplets in the semen.
Anim. Reprod. Sci., 36, 145-151, 1994.
22. Yeske P.: Health Problems That Affect Fertility. Nat. Hog Farmer, 15, 21-32, 2007.
23. Zveki D.: Fertilitet prirodno ili vetaki osemenjenih krmaa u proizvodnim uslovima (Magistarska
teza). Univerzitet u Novom Sadu, Poljoprivredni fakultet, 2003
91
ECHINOCOCCUS GRANULOSUS OF DOMESTIC PIGS: A CASE CONTROL STUDY

Doroteja Mari*1, Jasna Prodanov-Radulovi1, Igor Stojanov1, Sinia Gruba1,
Ivan Pui1, Vladimir Polaek1
1 Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia
Abstract
Internal parasites of swine are very common in swine worldwide, sometimes compromising
production and occasionally the cause of clinical disease. One of the most important zoonotic
parasites that can be found in swine is a larval stage of Echinococcus granulosus. Adult
Echinococcus spp. cestodes occur in carnivores, and their larval cysts (hydatids) occur in various
herbivores and omnivores, including humans and swine. In carnivores, egg-laden proglottids pass
with the faeces, contaminating the environment. When ingested by a pig, the larva (oncosphere)
hatches in the small intestine, penetrates the intestinal wall, and enters the circulation. The liver
stops about 70% of the oncospheres, where they nidate and develop into hydatids. Hydatic disease
in pigs is not common finding on large swine farms, because biosecurity measuers are taken to
prevent the contact of swine with carnivores. However, this is not a case with the backyards and
free-range pigs, and they present the most frequent way of pig production in villages. The aim of
the paper is to present a finding of intensive parasitic infection (hydatic disease) in backyards pigs.
The material for this research included pigs from one backyard, where certain disorders and health
problems in weaned pigs were detected. The applied research methods included: anamnestical and
clinical evaluation, pathomorphological examination, parasitological laboratory testing for detection
and determination the presence of parasites in the organs and tissue samples (liver, lung) derived
from died pigs. Since in the evaluated backayard a sudden death in 10 weaners occurred, with
unspecific clinical signs, the gross pathology examination of 2 dead weaners was performed. The
nacropsy findings revealed the presence of enormous number of hydatid cysts on and in the liver
tissue. Also, a large number of free parasitic cysts were found in the abdominal cavity. By
parasitological examination of the liver and abdominal content, the presence of small parasitic cyst
of Echinococcus granulosus (2-5 mm) was detected. Based on the achieved results, it can be
concluded that Echinococcus granulosus infection is present in the backyards and free-roaming
pigs, where husbandry methods allow direct contact with domestic and wild carnivores.
Keywords: backyards, domestic pigs, Echinococcus granulosus
Introduction
Hydatidosis in pigs is caused by larval form of Echinococcus granulosus.
Echinococcosis/hydatidosis is a zoontic parasitic disease that poses a major health as well as
economic threat all around the world. In the etiology of the disease, two stages can be discerned: 1)
hydatid stage (cystic echinococcosis), which occurs in intermediate hosts (domestic and wild
omnivores, herbivores and humans); and 2) echinococcosis stage, which occurs in the dead-end
(definitive) hosts (animals from the families Canidae and Felidae), caused by the adult
Echinococcus spp. (Brunetti and Filice, 2008).
In Serbia, the highest percentage of infected pigs can be found in backyard and free-range pig
production systems (up to 75%). The percentage of infected pigs found on large swine farms (with
biosecurity measures) is also not negligible and adds up to 10% (Pavlovi et al., 1997).
92
A certain number of wild boars in our country are reared in controlled and enclosed hunting
grounds, while a number of free-ranging populations are mainly unknown. One of the
characteristics of outdoor swine production in some regions is raising free-roaming domestic pigs,
where they share forest habitat with wild boars. Contacts between wild boars and domestic pigs
kept in outdoor farms may occur occasionally. Since both animals have the same susceptibility to
various infections including hydatidosis, there is a major concern to monitor the epidemiological
situation of wild boars especially when control measures in domestic pigs are implemented
(Prodanov-Radulovi et al., 2014).
Uncharacteristically for tapeworms, the adult tapeworm is very small, only 5 mm in length. The
eggs produced by the parasite are very light and resilient (Laaksonen and Paulsen, 2015). The
infection of intermediate hosts occurs exclusively through the use of the contaminated water and
food. The source of the Echinococcus eggs contamination is to be found in the faeces of dead-end
(definitive) hosts, which is continuously being released into the external environment and ultimately
consumed by the pigs (Pavlovi and Ivanovi, 2006).
The development process of the hydatic cysts is the same in all intermediate hosts, including
humans. Once the digestive tract is reached, oncospheres (hexacanths) are released from the eggs,
penetrating through the intestinal mucosa and reaching the capillaries, from where, through vena
porta, the primary implantation site is reached - the liver (up to 70% share). Certain number of
oncospheres that mash the liver, arrive at the right heart via vena cava, proceeding towards the
lungs, the second most frequent implantation organ for hydatic cysts. The remaining hexacanths are
transferred, through the left heart, towards the other parts of the organism implanting kidneys,
eyes and seldom brain and bones. When oncospheres (hexacanths) are fixed to the mucous
membrane, the development of the cysts can begin. The cysts are continuously growing throughout
the whole life of the intermediate host (Pavlovi et al., 2011). Their size varies, depending on the
duration of the infection, from barely noticeable to cysts of 150 mm in diameter. The cysts are often
pearly grey colour and contain clear liquid with thousands of small, infectious larval forms of the
parasite (Laaksonen and Paulsen, 2015). They are under considerable pressure and in the case of
their rupture, the outcome is fatal.
In most of the cases the disease in pigs is asymptomatic and the losses primarily occur due to organ
failures caused by the implanted cysts. There are three main factors contributing to the spreading of
this infection in pigs: 1) the lack of pig breeders and dog owners knowledge concerning the life
cycle of the parasite and concerning its epidemic potential; 2) the percentage (share) of the infected
dogs as dead-end (definitive) hosts; and 3) hygienic circumstances, especially in pig breeding
practices.
The aim of this paper is to widen the awareness of the possibility of Echinococcus granulosus
epidemic mostly among the pigs bred in backyard and free-range pig production systems.

The material for the investigation included one small family owned backyards swine farm (capacity
of 5 sows), where the free-range was also practiced.
The Veterinary Inspection had informed the Scientific Veterinary Institute Novi Sad about the
suspicion of the possible outbreak of classical swine fever in the family owned swine farm engaged
in extensive swine breeding in the Srem region. Since in the evaluated backayard a sudden death in
10 weaners occurred, with unspecific clinical signs, the gross pathology examination of 2 dead
weaners was performed. The samples from dead weaners were tested by RT-PCR method, in order
to exclude the possibility of infection with classical swine fever virus.
93
Since gross pathology findings had indicated the presence of significant pathomorphological
changes, an additional parasitological testing was performed.
Results
During the external gross pathological pathomorphological examination of dead pigs, carried out in
the backyard of the pig owner, a dirty slimy discharge of the nostrils was discovered at both pigs, as
well as a strong cyanosis of the skin in the area of proboscis and earlobe base with visible yellow
discoloration of the skin and mucous membranes. Mild palpebral oedema was also detected at one
of the dead pigs. The internal gross pathological pathomorphological examination, on the other
hand, revealed an amber coloured, free liquid, with fibrin strands in the chest cavity (Picture 1).
Picture 1. Chest and abdominal cavity: free liquid with fibrin strands
The examined tissues were also remarkable for mucosal and serosal yellow discolouration.
Individual bleeding on the side parts of the diaphragmatic lobes were present in the lungs, as well as
the hepatisation of apical and cardiac lobes. A few examples of Metastrongylus spp. were found in
the lumens of bronchi and bronchioles. The mediastinal lymph nodes were unchanged. Tonsils,
epiglottis, pharynx and larynx were also unchanged. The mandibular lymph nodes were unchanged.
Extremely yellow discolouration of endocardium was discovered. In the abdominal cavity, the free
liquid mixed with large amount of fibrin strands and free whitish, almost translucent, cystic
formations, like drops, the size of grain of wheat or rice, also was found (Picture 2a and Picture
2b).
Picture 2a. Abdominal cavity: free liquid with fibrin

strands and cystic formations
Picture 2b. Abdominal cavity: free liquid with fibrin

strands and cystic formations
94
The liver was significantly enlarged with rounded edges and with a small but very numerous cystic
formations protruding and dropping out of the liver tissue after cutting (Picture 3a). Hepatic
hemorrhage with considerable structural defects was present (Picture 3b).
Picture 3a. Liver: hemorrhage and cystic formations

dropping out of the liver tissue after cutting
Picture 3b. Liver: hemorrhage and cystic formations
The stomach was nearly empty, with expressed folds of mucous membranes and without changes in
the mucosa. The small and large intestines were almost empty, with only a small amount of content
and without changes in the mucous membrane. There was yellow discolouration of the kidneys with
no changes either under the capsule or on the transverse section. The bladder was full of dense,
distinctly yellow liquid content and without changes in the mucosa (Picture 4).
Picture 4. Slit bladder: dense, distinctly yellow liquid content
Discussion and conclusions

In Serbia, there are no official datasets of infection rates available for all the farms applying the
backyard and free-range pig production systems, i. e. the slaughter is often carried out nonsupervised by inspection service and without being reported. According to some recent
investigations, infection rates vary widely across country between 4.6 and 57.6% (Ivanovi and
Pavlovi, 1999). It has been established that around 75% of the infected pigs come from mini farms,
applying the backyard and free-range pig production systems, mostly not maintaining strict
biosecurity measures. Socio-economic factors as well as the lack of breeders and dog owners
knowledge concerning the epidemiological features of the infection and the lack of adequate
cemeteries for disposal of the deceased animals all contribute to the spread of this zoontic disease.
95
Considering the fact that echinococcosis/hydatidosis poses a major global threat, infection
monitoring must be carried out with care and perseverance all over the world. For example, on the
occasion of a pig slaughter in Lithuania, the examination of 684 pig livers revealed that
significantly more infected animals came from mini farms (applying the backyard and free-range
pig production systems and thus not maintaining strict biosecurity measures) then from large-scale
farms (Bruzinskaite et al., 2009).
In order to make progress in the fight against echinococcosis/hydatidosis, it is necessary to cut off
every rout of transmission of the infection. To this end, it should be made mandatory, that livestock
slaughter process is always carried out in slaughterhouses, and under constant supervision of
veterinary inspection services. It is also of paramount importance to report every case of the
infection to the veterinary inspection service from where animal originate and to document it. The
hygiene of the pig production practices and methods also affects the spread of the infection, which
makes it extremely important to maintain strict biosecurity measures, which also means control on
livestock movement, so that, in this particular case, the contact between the pigs and the
intermediate and definitive hosts (dogs, i. e. their faeces) would be made impossible. The
importance of widening of the global awareness of the problem as well as widening the access to
the knowledge of infection should also be emphasised. Through education, which should start from
school and also encompass instructing livestock breeders, butchers and dog owners on how to
prevent the infection, everyone should be familiar with the basic facts concerning this infection.
This education also means making wider public familiar with measures that should be undertaken,
in order to combat this zoonosis more successfully. The measures also include the dog
dehelmintisation, the control of dog movement and secure disposal of the organs contaminated with
hydatic cysts (by boiling, burning or handling in animal shelters).
Acknowledgements
This paper is a result of the research within the project TR 31084, financed by the Ministry of
Education, Science and Technological Development, Republic of Serbia.
References
1. Brunetti E., Filice C.: Echinococcus Hydatid Cyste Medicine Specialities Infectious Diseases Parasitic
Infections, http://emedicine.medscape.com/article/216432 - overview, 2008
2. Bruzinskaite R., Sarkunas M., Torgerson P. R., Mathis A., Deplazes P.: Echinococcosis in pigs and
intestinal infection with Echinococcus spp. in dogs in southwestern Lithuania. Vet Parasitol., 160, 3-4,
237-241, 2009
3. Ivanovi S., Pavlovi I.: Rairenost ehinokokoze kod svinja u ekstenzivnom dranju na podruju srednjebanatskog okruga. Tehnologija mesa, 40 (6), 302-303, 1999. Beograd, Srbija
4. Laaksonen S. and Paulsen P.: Hunting hygiene, Wageningen Academic Publishers, 2015
5. Pavlovi I., Iveti V., Valter D., Lonarevi A., Kulii Z., Dimitri A.: Ehinokokoza svinjaepizootioloki, epidemioloki i ekonomski znaaj. Zbornik radova 4. savetovanja veterinara Republike
Srpske sa meunarodnim ueem, 116, 1997. Tesli, Republika Srpska
6. Pavlovi I., Ivanovi S.: Ehinokokoza/hidatidoza, bolest ivotinja i ljudi, izd. Nauni institut za
veterinarstvo Srbije i Ministarstvo poljoprivrede, umarstva i vodoprivrede, 1-32, 2006. Beograd, Srbija
7. Pavlovi I.,Hadi I., ugi G., Aneli-Buzadi G., Vai D., Jovevski S.: Hidatidoza aktuelan problem
stoarske proizvodnje. Zbornik naunih radova sa XXV savetovanja agronoma, veterinara i tehnologa,
Institut PKB Agroekonomik, Vol.17, 3-4, 133-139, 2011. Beograd, Srbija
8. Prodanov-Radulovi J., Doen R., Petrovi T., Polaek V., Lupulovi D., Stojanov I., Gruba S.:
Antibodies to selected viral disease agents in hunted wild boars in Vovodina region, 3rd International
symposium on hunting, Modern aspects of sustainable management of game population, 149-153, 2014.
Zemun-Beograd, Srbija
96
THE PREVALENCE OF ASPERGILLOSIS IN POULTRY AND CONTROL MEASURES OUR EXPERIENCE

Milo Kapetanov*, Dragana Ljubojevi, Igor Stojanov, Milica ivkov-Balo1, Milo Peli,
Marko Paji
Abstract
The fungi of the genus Aspegillus are ubiquitous saprophytic microorganisms which are, in certain
circumstances, responsible for clinical infections of respiratory tract in all poultry, particularly in
young birds. Aspergillus fumigatus, A. niger and A. glaucus are the most common isolated fungi in
the cases of pulmonary aspergillosis in poultry. Poultry is constantly exposed to these fungi in its
environment, and predisposing factors, such as long exposition, highly contaminated environment
and litter, high humidity in poultry houses, poor ventilation, as well as malnutrition and stress
contribute to the development of clinical manifestations of aspergillosis. The aim of the present
paper was to examine the effects of some factors on the incidence and prevalence of the clinical
form of aspergillosis in poultry. The possibility to control the disease by introduction of
prophylactic measures was also considered. The presence of Aspergillus sp. in poultry was analyzed
based on the results of clinical and laboratory tests carried out during 2000, 2010 and 2014. The
prevalence of aspergillosis was noted in poultry of different age, such as hatched eggs, young and
adult birds. Aspergillus sp. was isolated in the range of 3.85% to 36.14% from unhatched eggs, litter
and environmental and hatchery swabs. An increased trend in number of infected poultry flocks was
observed, especially in young birds. During the years 2000, 2010 and 2014, acute aspergillosis was
detected in 12, 16 and 21 commercial flocks of chickens and turkeys, respectively. Application of
proper sanitary-hygiene measures on poultry farms and hatcheries, as well as microbiological
control of feed are considered essential for an efficient control of spreading of infection.
Keywords: aspergillosis in poultry, humidity, temperature, feed
Introduction
Aspergillosis is a fungal disease of all poultry species, particularly of young birds. Most frequently
it occurs in turkey poults, chicks, ducklings and goslings (Kunkle, 2003; Beytut et al., 2004).
Aspergillus fumigatus is considered to be the most pathogenic and is the most frequent isolate from
pathologic lesions, while others like A. niger, A. flavus, A. terreus and A. glaucus can induce the
disease, too. The fungal spores are ubiquitous in nature. Exposure of poultry to fungi or spores
occurs after the introduction of contaminated litter and feed. Early infection is possible in hatcheries
if fungal contamination occurs.
Certain infectious diseases may contribute to aspergillosis, e.g. infectious bronchitis, coryza,
chronic respiratory disease, laryngotracheitis, Newcastle disease and fowlpox. It has been
speculated that extremely dry air and dust can cause the infection with Aspergillus because they dry
out the respiratory mucosa and protective effect of mucus is absent (Kristensen and Wathes, 2000).
Some geographic and seasonal regularity are observed in relation to the distribution of aspergillosis
outbreaks. Incidence of the disease decreases on poultry farms with stringent hygiene and good
nutrition management.
97
Influence of certain factors on the outbreak and spreading, as well as clinical features of
aspergillosis, were investigated in this paper. The possibility to control the disease by introduction
of prophylactic and intervention measures was discussed.

The presence of Aspergillus spp. on poultry farms was analyzed from data collected after the
clinical and laboratory investigations performed during the three selected years, 2000, 2010 and
2014.
Poultry flocks were clinically observed and postmortem examination of chickens and turkeys of
different age was carried out. If aspergillosis was detected in the findings, the attacked tissues were
taken for microbiological investigations. Having been processed first, tissue samples were cultured
on solid media using standard methods. Mycological investigations were done in laboratory at the
Veterinary Institute Novi Sad.
Litter taken directly from different surfaces in poultry houses and swabs was cultured on solid
media. Unhatched eggs, hatchery waste and environmental swabs taken from different surfaces in
hatcheries were sampled in order to determine the presence of fungi and its frequency, as well as for
the comparison of mycological contamination with the environmental conditions.
The influence of different factors on the occurrence, spreading and source of aspergillosis was
investigated using data from the official report of the Republic Hydro meteorological Service of
Serbia, regarding the outer temperature and rainfalls in 2000, 2010 and 2014, for the purpose of
comparison with the control period from 1961 to 1990.
Results and Discussion

The spread out of aspergillosis was noted in poultry of different age, from very young birds to adult
ones. It is well known that the disease can occur in other young and adult poultry species, including
poults, goslings, ducklings, swans, wild and pet birds, particularly if kept in intensive manner.
While resistant and healthy poultry can overcome the infection with high number of Aspergillus,
week and young birds generally become ill easily. It is experimentally demonstrated that chickens
up to three days of age are the most susceptible to the infection, while older are more resistant.
Islam et al. (2009) found significant differences in morbidity (up to 70%) and mortality rate
depending on age and category; aspergillosis was most frequently detected in cockerels (9.03%),
then in broiler chickens (5.48%) and in laying hens (1.92%). The disease was clinically present in
broilers at the earliest age (13 days) and in layers and cockerels at the oldest age (76 weeks). In
epizootiological investigation Sajid et al. (2006) found the majority of sick flocks at the age of 14
days. Aspergillosis appears in two clinical forms: 1) acute form with high morbidity and mortality
rates, the disease persists from only few days to two weeks, and 2) subacute and chronic form in
adult poultry, disease being persistent several weeks or rarely several months.
During the years 2000, 2010 and 2014, acute aspergillosis was detected in 12, 16 and 21
commercial flocks of chickens and turkeys, respectively. In 2010 and 2014 the disease was acute
with high morbidity and mortality within only few days. Numerous flocks suffered detrimental
losses in a short period of time and were destroyed because their further raise was economically
unjustified. Clinical symptoms during the acute source of infection are described in literature,
including depression, inapetence, thirst and hyperventilation with dyspnoe (Akan et al., 2001; Islam
et al., 2009; Stoute et al., 2009). Chickens have ruffled feathers; they drowse, get weaker and, in
complicated cases of dyspnoe, pathologic wheese is observed, which differs from other respiratory
diseases. Besides the symptoms previously mentioned, the investigation of mass pneumomycoses
98
discovered one distinctive finding which was grouping of the chickens toward the source of fresh
air ("hunger for oxygen"; Figures 1 and 2).
Besides respiratory form, infection of eyes can also occur (Akan et al., 2001). In that case
protruding eye lids are observed because of formation of yellowish-cheesy small pellets around the
membrane nicticans with central ulceration (Figures 3 and 4). In our investigations, ocular infection
with Aspergillus was determined in two broiler flocks, at the age from 7 to 10 days. In subacute and
chronic infection, only one or several individuals in flock became ill. Clinical signs of depression,
inapetence, ruffled feathers and emaciation are common, sometimes chronic bronchopneumonia,
too (Martin et al., 2007; Islam et al., 2009) during the year 2010 and 2014 subacute and chronic
aspergillosis was not detected.
In the investigated period, acute aspergillosis was clinically noted. Postmortem findings included
nodules - aspergillus granuloma, oval or round shaped, single or in conglomerate, size of a pin head
to pea, located on air sacs, lungs and on visceral serosae of abdominal cavity, liver and intestines
(Figures 5 and 6). Granulomas, oval or round, single or in group of conglomerate, are typical
section finding in Aspergillus infected birds. They are located in thoracic and abdominal cavity and
on the liver surface. Their appearance resembles the one found in avian tubercullosis, but with
radial hyphae nets surrounded by reactive zone like granulation tissue. Generally, nodules are
present in almost all tissues, even in eyes and brain (Throne Steinlage et al., 2002; Mukaratirwa,
2006; Martin et al., 2007; Cacciuttolo et al., 2009; Islam et al., 2009; Stoute et al., 2009).
Figures 1 and 2. The infected chickens from aspergillosis prominent dyspnea.
Figures 3 and 4. Ocular form of aspergillosis - yellowish cheesy pellets around the membrane nicticans.
99
Clinical signs and pathologic findings are not sufficient for diagnose, so laboratory confirmation by
isolation of Aspergillus sp. is necessary. The spores germinate well in laboratory conditions, on
standard media and at room temperature, producing green to green-blue colour colonies that become darker, even black over time (Figures 7 and 8). In order for the disease to be diagnosed other
respiratory agents need to be excluded, such as infectious bronchitis, coryza, chronic respiratory
disease and Newcastle disease, infectious laryngitis, tuberculosis and fowlpox.
In intensive poultry keeping, there are numerous sources of this important fungal infection. Feed,
particularly mashed, can be contaminated with high number of fungi and moulds (Akanetal., 2001;
Nei et al., 2005; krinjar et al., 2009; Kapetanov et al., 2012; Kapetanov et al., 2013).
Figures 5 and 6. The infected turkeys from aspergillosis; post-mortem finding: disseminated nodulesaspergillus granulomas in the lungs and serosal surfaces of organs in the abdominal cavity.
Figures 7 i 8. The growth of Aspergillus flavus colonies on Sabouraud agar.
The infection in poultry may occur if litter, environment or hatcheries are contaminated. Fertile
eggs and embryos can be contaminated before or during the incubation, and Aspergillus sp. is found
in tissues of unhatched eggs and hatchery waste (Jacobsen et al., 2010). Warm and humid air in
hatchery provides ideal conditions for the survival of Aspergillus. Infected embryos die between
15th and 18th incubation day, which may cause a decrease in hatch-ability of up to 30%. Dust
containing more than 800 colonies per gram leads to prospective embryo infection (Kozi, 1967).
100
Eggshell can be contaminated in case of inadequate collection and storage of eggs. The spores are
most frequently isolated from alanto-chorion liquid, producing green colonies up to 2 cm in size.
During the years 2000, 2010 and 2014, Aspergillus sp. colonies were often detected in unhatched
eggs and swabs taken from the hatchery (Table 1). In order to prevent the contamination of embryos
and chickens at hatch, different sanitation programs are applied (Ivanov, 2008). The sanitation
programs are designed in such manner that the number of fungi and other potential pathogens is
maintained at an acceptable level. However, their total elimination is not realistic. Lately, some
reports have brought the attention to possible infection of reproductive tissues of hens and
concomitant disease (Egg Borne Aspergillosis or congenital aspergillosis). It is demonstrated that
intravenous and inhalation infection is possible (Femenia et al., 2007). Still, under natural
conditions, infection is predominantly induced by air and orally.
Using inadequate litter increases the possibility of infection at early age. Higher number of fungi,
longer exposition, particularly in combination with stressing procedures, like vaccination, beek
trimming etc., all contributes to aspergillosis. Different types of litter may be contaminated
unequally. Sajid et al. (2006) found significantly higher rate of infected eggs in flocks kept on
sawdust (67.74%) in comparison to rice hulls (32.26%). On the other hand, Islam et al. (2009) could
not clearly relate the incidence of aspergillosis to the type of litter used. In our investigations,
mycological control of litter and swabs taken from surfaces in poultry houses points to oversights
during sanitation and disinfection (Table 1). With respect to year 2000, the total number of samples
and the number of mycologically inadequate samples was nominally higher in 2010 and 2014.
Raising poultry under higher fungal contamination increases the risk of aspergillosis, especially in
immune compromised or sick birds. The influence of particular outer and environmental factors to
fungal survival are numerous (De Bey et al., 1995; GigIi et al., 2005; Karwowska, 2005; Nichita
and Tirziu , 2008). The spores of Aspergillus germinate better when the air is dry. Aspergillus sp. is
often isolated from dust, and since the largest proportion of dust particles is inhalable, dust is
considered to be the predisposing factor for aspergillosis outbreak (De Bey et al., 1995). The type of
ventilation and air humidity are also relevant (De Bey et al.. 1995; Gigli et al., 2005; Sajid et al.,
2006) as they can impact the concentration of Aspergillus in the poultry house (Nichita and Tirziu,
2008).
By using available data on meteorological conditions in the region, this paper aims at establishing
the connection between clinical aspergillosis and overall laboratory findings, as well as the climatic
factors. The official report of Hydrometeorological Service of the Republic Serbia, for the year
2010, shows extremely warm percentile distribution. During the summer of 2010 maximal daily
temperatures were often above 30 C, and the total number of tropical days was higher than the usual
in most parts of Serbia, except in mountain regions. However for 2014 besides the very hot days,
abundant precipitations were also characterized, leading to flooding of the rivers from their banks
and further to (some sort of) natural disasters.
Table 1 - Contamination of unhatched eggs, litter, swabs taken from the poultry houses and
hatcheries by Aspergillus sp.
Sample type
Year 2000
Number and
Total number
%of positive
of samples
samples
Year 2010
Number and
Total number
% of positive
of samples
samples
Year 2014
Number and
Total number
% of positive
of samples
samples
Unhatched eggs
481
33 - 6.86
617
62 - 10.05
746
74 9.91
Litter
39
9 - 23.07
42
15-35.71
112
32-28.57
Swabs from houses
94
34 - 36 17
111
39-36.14
171
31-18.13
Hatchery swabs
182
7-3.85
268
15 - 5.60
311
101
11 - 3.53
The Hydro-meteorological reports also show rainfalls of totally 110 to 150% of the average values
(taken from the period between 1961 and 1990) in most parts of Serbia, and the percentile
distribution was rainy, very rainy and extremely rainy. The rainfalls were extremely rainy in all
regions. During the selected years (2000, 2010 and 2014) average outer temperatures were high
throughout the whole year. The rainfalls, watery alluvium and relative humidity of air, were
significantly higher than usual. In order to survive and reproduce, fungi need certain humidity and
temperature level which is around and higher than 37C (De Bey etal., 1995; Karwowska, 2005;
Gigli et al., 2005; Sajid et al., 2006; Chate and Bhivgade, 2010).
The distribution of the aspergillosis outbreaks is influenced by some geographic and seasonal
differences, so it is more frequent in areas with high outer temperature and rainfalls (De Bey et al.,
1995; Karwowska, 2005; Madscn , 2006; Sajid et al., 2006). On the other hand, during winter, due
to inadequate environmental conditions and the fact that sometimes it is impossible to provide
optimal ambient for poultry, aspergillosis incidence increases. Some daily aberrance in the number
of Aspergillus in poultry houses was determined by Nayak et al. (1998). In our country, aspegillosis
outbreaks are more frequent in areas northern from the rivers Sava and Danube.
Microflora in poultry houses and farms in general, in our case the "population" of Aspergillus sp.,
contributes to the emission of biosol into atmosphere, especially during the warmer months
(Karwowska, 2005). The concentration of unwanted and potentially harmful gasses, dust, bacteria
and fungi in poultry house are changes depending on the age of poultry, particularly in broiler
chickens (Vuemilo et al., 2007). The air pollution impacts the health and productivity of poultry
(Nei et al., 2005). Also, certain species of fungi have toxinogenic and allergenic features so they
can disturb the health of people, either directly, in case of farmers, or in case of the rest of the population, indirectly, after emission into atmosphere (krinjar et al., 2009; Chate and Bhivgade , 2010).
It seems to be necessary to create and implement standards for adequate hygiene, epizootiological
and epidemiological conditions on farms and their environment.
Conclusions
The global warming and high relative humidity induced increase of incidence of some diseases,
including aspergillosis.
Poultry is constantly exposed to Aspergillus sp. in its environment, so high contamination and long
exposal contributes to clinical aspergillosis.
The success of therapy basically depends on the source of disease and degree of dissemination of
process. In acute cases, particularly in very young chickens, it would be wrong to rely on antifungal
therapy solely. Implementation of sanitary-hygiene measures in poultry houses and hatcheries, as
well as microbiological control of feed, is essential for prevention of significant losses.
Acknowledgement
Education, Science and Technological Development, Republic of Serbia
References
1.
2.
Akan M., Hazrolu R., Ihan Z., Sareyypolu B., Tunca R.: A case of Aspergillosis in a broiler breeder
flock. Avian Diseases, 46, (2): 497-501, 2001
Beytut E., Ozean K., Erginsoy S.: Immunohistochemical detection of fungal elements in the tissues of
102
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
goslings with pulmonary and systemic Aspergillosis. Acta Vetcrinaria Hungarica, 52, (1): 71-84, 2004
Cacciuttolo E., Rossi G., Nardoni S., Legrottag1ie R., Mani P.: Anatomopathological aspects of avian
aspergillosis. Veterinary Research Communications, 33: 521-527, 2009
Chate D. B., Bhivgade S. W.: Fungaldisease incidence inside poultry farm at ALISA. International
Referred Research Journal II, (15): 10-11, 2010
De Bey M. C., Trampel D. W., Richard J. L., Bundy D. S., Hoffman L. J., Meyer V. M., Cox D. F.:
Effect of environmental variables in turkey confinement houses on airborne Aspergillus and mycoflora
composition. Poultry Science, 74, 463-471, 1995
Femenia F., Fontaine J. J., Lair-Fulleringer S., Berkova N., Huet D., Towanou N., Rakotovao F., Granet
O. I., Le Loc'h G., Arne P., Guillot J.: Clinical, mycological and pathological findings in turkeys
experimentally infected by Aspergillus fumigatus. Avian Pathology, 36, (3): 213-219, 2007
Gigli A. C., Baracho M. S., Ns I. A., Silva R. A., Zago R., Dall'Anese F. P.: Diagnosis and evaluation
offungi presence in the air of two different ventilation systems for broiler houses. Revista Brasileira de
Ciencia Avicola, 7, (4): 205-208, 2005
Islam M. N., Rashid S. M., Juli M. S., Rima U. K., Khatun M.: Pneumomycosis in chickens: Clinical,
pathological and therapeutical investigation. International Journal of Sustainable Crop Production, 4,
(3): 16-21, 2009
Ivanov I.: Disinfection of eggs contaminated with some fungi and moulds. Trakia Journal of Sciences,
6, 98-101, 2008
Jacobsen I. D., Grosse K., Slesiona S., Hube B., Berndt A., Brock M.: Embryonated eggs as an
alternative infection model to investigate Aspergillus fumigatus virulence. Infection and Immunity, 78,
(7): 2995-3006, 2010
Kapetanov M., Potkonjak D., Stojanov I., ivkov-Balo M., Jaki S.: Importance of clinical and
pathological diagnostics of mycotoxicosis in fattening turkeys caused by T-2 trichothecene.
Proceedings, XV International Symposium Feed Technology, Feed to Food Cost Feed for Health Joint
Workshop Novi Sad, October 03-05, 2012, Novi Sad, Serbia, organized by Institute of Food
Technology, 2012, 304-309
Kapetanov M., Potkonjak D., Stojanov I., ivkov-Balo M., Jaki S.: Clinical and pathomorphological
diagnostics of mycotoxicosis in parent poultry flock caused by T-2 trychotecene. Matica Srpska Journal
for Natural Sciences, 124,137-143, 2013
Karwowska E.: Microbiological air contamination in farming environment. Polish Journal of
Environmental Studies, 14, (4): 445-449, 2005
Kozi L. I., Puha I. Eds.: Gajenje i zdravstvena zatita ivine. Odbor za izdavaku delatnost Saveza
veterinara i veterinarskih tehniara SFRJ, Beograd, 1967, 329-331.
Kristensen H. H., Wathes C. M.: Ammonia and poultry welfare: a review. World's Poultry Science
Journal, 56: 235-245, 2000
Kunkle R. A.: Fungal injections. In: Saif YM Ed., Diseases of poultry Ed. 11, Iowa State University
Press, Ames, 2003, 883-902.
Madsen A. M.: Exposure to airborne microbial components in autumn and spring during work at Danish
biofuelplants. The Annals of Occupational Hygiene 50, (8): 821-831, 2006
Martin M. P., Bouck K. P., Helm J., Dykstra M. J., Wages D. P., Barnes H. J.: Disseminated Aspergillus
flavus infection in broiler breeder pullets. Avian Diseases, 51, (2): 626-631, 2007
Mukaratirwa S.: Outbreak of disseminated zygomycosis and concomitant pulmonary aspergillosis in
breeder layer cockerels. Journal of Veterinary Medicine, 53: 51-53, 2006
Nayakv B. K., Nanda A., Behera N.: Airborne fungal spores in an industrial area; seasonal and diurnal
periodicity. Aerobiologia, 14: 59-67, 1998
Nei K., Mai Z., Sinovec Z.: Trovanja ivotinja izazvana sekundarnim metabolitima plesni.
Veterinarski glasnik, 59, (1-2): 41-57, 2005
Nichita I., Tirziu E.: Investigations on airborne fungi in poultry houses. Lucrari stiintifice Medicina
veterinara, XLI: 932-935, 2008
Regulations on the quality of animal feed: Official Gazette of the Republic of Serbia, 2010
103

24. Sajid M. A., Khan I. A., Rauf U.: Aspergillus fumigatus in commercial poultry flocks, a serious threat to
poultry industry in Pakistan. J. Anim. Pl. Sci., 16, 3/4, 79-81, 2006
25. krinjar M. M., Kenjve,T. L., A M. .: Frequency of Aspergillus fumigates fres.: A toxigenic and
allergenic fungal species in milking cows feeds throughout one research year. Matica Srpska Journal
for Natural Sciences, 116, 101-112, 2009
26. Stoute S. T., Bickford A. A., Walker R. L., Charlton B. R.: Mycotic pododer mat it is and mycotic
pneumonia in commercial turkey poults in northernCalifornia. Journal of Veterinary Diagnostic
Investigation, 21, 554-557, 2009
27. The Republic Hydrometeorological Service of Serbia (2010): www.hidmet.gov.rs
28. Throne Steinlage S. J., Sander J. E., Brown T. P., Lobsinger C. M., Thayer S. G., Martinez A.:
Disseminated mycosis in layer cockerels and pullets. Avian Diseases, 47, (1): 229-233, 2003
29. Vuemilo M., Matkovi K., Vinkovi B., Jaksi S., Grani K., Mas N.: The effect of animal age on air
pollutant concentration in a broiler house. Czech Journal Of Animal Science., 52, (6): 170-174, 2007
104
________________________________________________________________________
Session 2
FOOD AND FEED SAFETY AND QUALITY

Full papers
_______________________________________________________________________
105
Invited lecture
GAME MEAT SAFETY WILD BOARS
Jelena Petrovi*, Milica ivkov Balo, ivoslav Grgi
1
Scientific Veterinary Institute Novi Sad, Rumenacki put 20, Novi Sad, Serbia
Abstract
Wild animal meat harvesting and processing is significantly different from classical livestock meat
production and represents a challenge by itself. Implementation of the concept "from forest to fork"
encompasses epidemiological difference between wild animals and livestock, influence of hunting
ground ecology, type of hunting, field evisceration of hunted game, meat inspection after shooting
or transport etc. The objective of this paper was to identify biological and chemical hazards
important for wild boar meat safety. Several hazards were analysed: Mycobacterium spp.,
Salmonella spp., Trichinella spp.,Toxoplasma spp., Alaria alata, microelements, and heavy metals.
Two criteria were established for hazards identification: evidence of shared pathogens presence in
wild boar population in specific geografical region and evidence of hazardeous pathogens spread
during handling, processing and consumption of wild boars meat. The research on the presence of
food borne pathogens in wild boars meat is still scarce, while the Trichinella spp. life cycle is
distinctly described and there are relevant data about epidemiology and natural reservoirs of the
parasite in this part of the Europe, however little is known about other food borne pathogens in wild
boar population. The presence of Salmonella spp., Toxoplasma gondii, Alaria alata is identified in
wild boar population in our region. The analysis of the results of the microelements and heavy
metals in wild boar meat has shown that no samples exceeded legally set limits, but our results
suggest that pollution of the biosphere with chemical contaminants should be systematically
monitored to identify potential increasing contamination tendencies. Programme for monitoring and
control of game meat safety should include control measures for live animals, control measures
during hunting and after shooting, guidelines for official meat inspection, control measures for
carcass processing and surveillance of chemical residues.
Keywords: meat, wild boar, food borne pathogens, microelements, heavy metals
Introduction
Wild boar (Sus scrofa) distribution covers the entire continental Europe; it is missing in British
Isles, Scandinavia and northern part of the European Russia. Wild boars in Serbia are native and
very abundant big game species. Excessive and irresponsible hunting resulted in demographic
decline in early 20th century. However, thanks to substantial changes of agricultural practice,
reduced number of natural enemies as well as game feeding policies in last four decades the game
population has recovered and is still increasing, not only in Serbia but also around Europe (Rippa et
al., 2012).
Game meat production chain is substantially different from the conventional production of meat
from domestic animals, thus presenting an unique challenge. The concept from forest to fork
encompasses the effects of hunting ground ecosystems, type of hunting/shooting, evisceration in the
field, meat inspection after slaughtering, transportation etc. The risk assessment regarding
alimentary pathogens in wild boars implies elucidation of some basic issues, i.e., identifying the
epidemiological difference between domestic and wild animals and determining the criteria for
evaluating the safety of wild game meat.
106
When speaking of wild animals, the disease control measures encompass the control of the diseases
that are transmissible from wild to domestic animals or directly to humans. Potential negative
environmental impact of measures and actions taken to the purpose of disease control is a specific
issue within the program of wildlife disease control.The opinion that complete eradication of
infectious and zoonotic diseases among wild animal population is virtually impossible is nowadays
widely accepted.
Domestic animals are raised for food and food production in controlled conditions, thus undergoing
the range of measures for health status control and ante and post mortem examinations at slaughter.
Contrary to that, game undergoes only a post mortem examination. In that respect, information on
certain diseases or mortality rates is lacking as well as the veterinary treatment, specific laboratory
testing, etc., thus restricting the proper evaluation of animals health status and prevention of their
entrance into the food chain.
The food safety criteria for assessing the safety of wild game meat are still lacking. They represent a
complex food-safety issue, since the majority of criteria relies on the average daily food intake,
which is highly specific in wild animals. The majority of the population consumes minor amounts
of game meat, but small population consumes pretty large quantities of game meat. The average
consumption of game meat among hunters families is estimated to be some 4kg meat per person,
i.e., family member (Ramanzin i sar., 2010).
The objective of this paper was to identify biological and chemical hazards of importance for wild
boar meat safety. Moreover, control measures for particular hazards are described, too.
Hazard identification and control options

Our identification of hazards of importance for wild boar meat relied on two main criteria. Is there
evidence for hazard transmission during handling, preparing and consuming of wild boar meat and
is there evidence of the presence of the pathogen among the game population in our region? The
following hazards were categorized:
High-priority hazards: Mycobacterium spp., Salmonella spp., Trichinella spp. Toxoplasma
gondii
Low-priority hazards: chemical hazards, Alaria alata
Hazards of undefined priority, i.e. hazards that still lack sufficient data Campylobacter spp.
Y. enterocolitica, pathogenic verotoxic E. coli
The guidelines of Codex Alimentarius Commission (CAC, 2005) put the emphasis on hygiene and
inspection surveillance of hunted game at the primary stage of meat production chain (including
transport) as the critical points for game meat control. The recommendations are implemented
through Directive Regulations (EC) 853/2004 and 854/2004.
The measures are basically distributed into two groups:
identification of the diseases and all major changes by visual inspection ( in case of apparent
pathological changes, severe contamination from the environment or suspected specific
biohazard, additional laboratory testing is recommended)
application of practical skills and knowledge aimed at preventing the spread or increase of
biohazards (such as Salmonella spp.) on/in edible tissues
Mycobacterium bovis
M. tuberculosis is considered the most important biological hazard in large game. Among the
wildlife population of Europe, three animals are considered major hosts of tuberculosis: badger,
wild boar and deer from the subfamily Cervinae. Wild boar can act as a direct source of human
107
tuberculosis infection, as well as the reservoir of infection in domestic animals (Gortazari i sar,
2008). Transmission of tuberculosis to humans occurs mainly by inhaling infectious aerosols,
consuming raw milk and, though somewhat less frequently, by consuming meat products
originating from infected animals. Some literature reports described potential infection routes from
wild boars to humans, including contact via the raw meat (Ashford et al., 2001).
Some 90% of known-infected wild boars with tuberculosis manifest calcified granulomatous lesions
in the mandibular lymph nodes. Moreover, 60% of these animals have generalized tuberculosis, i.e.,
lesions in multiple organs, predominantly in the head, thorax and abdomen. However, even
generalised tuberculosis in wild boar rarely causes visible loss of body condition (Martn-Hernando
et al., 2007). Hence, tuberculosis in wild boars is not manifested by specific clinical picture and
only the pathoanatomical examination can reveal suspect disease.
Wild boar tuberculosis has been reported in the last decades in at least 10 European countries:
Bulgaria, Croatia, France, Germany, Hungary, Poland, Portugal, Slovakia, Spain and the UK
(Gortzar et al., 2012). Wild boar experience much higher levels of exposure than deer (Vicente et
al., 2006). M. bovis prevalence in wild boar ranged from 46 to 52 % in three different surveys in
the Iberian Peninsula (Gortzar et al., 2008), where this host is considered the main carrier of
wildlife tuberculosis and a key factor in cattle tuberculosis eradication (Naranjo et al., 2008). In the
region of South Baka, three endemic foci of tuberculosis were recorded located in municipalities
of abalj, Novi Sad and Titel. The percentage of infected animals in individual herds ranged
between 11.10% and 59.18% (Pui et al., 2007; Pui et al., 2009; Pui et al., 2013). So far,
relevant data on the presence of tuberculosis in wild boars in this region are not available and the
research is ongoing. The occurrence of tuberculosis in cattle was recorded in the village of Kovilj
(the territory of Novi Sad municipality), which suggests potential contacts between wild and
domestic animals and thus presence of tuberculosis in wild game.
Eradication programmes in domestic animals rely on annual diagnostic examination of cattle using
the method of intradermal tuberculinization reaction, computed records and animal tracking, testing
positive herds and those who were in close contact with them at short intervals, and mandatory
slaughter of positive animals (Pui et al., 2008; Pui et al., 2009a,b,c). When speaking of wild
animals, the surveillance is practically impossible, so meat inspection is the only potential current
source of information and measure for control of tuberculosis.
Trichinella spp
Trichinellosis is endemic in almost all European countries, affecting also the regions of Srem and
river valeys of Danube, Drina and Kolubara in Serbia (Petrovi et al.,2012a). The analysis of
recorded trichinellosis epidemics in Vojvodina in the period 2001-2011 identified domestic pig as
the main reservoire of Trichinella. The infection is commonly acquired by consuming raw or
undercooked meat infected with living Trichinella larvae. Documented cases of human infections
after consuming wild boar meat were reported in Serbia (Uroevi et al., 2013). In Europe, wild
animals are considered the main reservoir of Trichinella, which makes the eradication of the
infection impossible in spite of its pretty low prevalence in wild game (Rafter et al., 2005).
According to Petrovi et al. (2012 a, b, c), high incidence of trichinellosis was established in the
territory of Vojvodina among several animal species such as jackals (7.89%), foxes (4.76%) and
wild boars (0.53%). In countries in which trichinellosis of domestic animals has been fully
eradicated, such as Danemark, the prevalence of sylvatic trichinellosis is extremely low (0.001%)
(Enemark et al., 2000). Moreover, an average infection rate in carnivores in Vojvodina (3
larvae/10g) is significantly higher than that recorded in Danemark (1 larva/10g). In some cases,
extremely high infection rates has been established in wild boars in Vojvodina region, ranging even
up to 1100 larvae/g (Petrovic et al., 2013a, b). High incidence of sylvatic trichinellosis in some
108
geographic regions poses substantial risk of infection spreading to domestic pigs grazed in sylvatic
habitats. The potential transmission routes of Trichinella spp. in pigs include canibalism, ingestion
of synanthropic and sylvatic animals as well as of the faeces of pigs that have been infected some 12 days earlier (Petrovi et al., 2014).
According to Petrovic et al. (2014), life cycle of T. spiralis in Vojvodina region includes circulation
from domestic pigs to wild boars and vice versa, which is assotiated with specific behaviour of this
animal species. Wild boars are very tolerant to the presence of humans, often commingling with
domestic pigs on common pastures and have access to laystall and food waste. Improper disposal of
pig carcasses and offals in the field, is the greatest risk factor for trichinellosis maintenance and
spread within pig population.
The diaphragms of all killed wild boars must be examined by artificial digestion method, for
estimating the presence of Trihinela spp larvae. This is the most effective measure for the control of
meat safety when speaking of this pathogen. However, it should be emphasized that appropriate
disposal of meat originating from infected animals represents an important step in preventing
further spreading of trichinellosis.
Salmonella spp.
Salmonella has long been recognised as an important zoonotic pathogen of economic significance
in animals and humans. Human salmonellosis is usually characterised by the acute onset of fever,
abdominal pain, nausea and sometimes vomiting. Symptoms are often mild and most infections are
self-limiting, lasting a few days. The common reservoir of Salmonella is the intestinal tract of a
wide range of domestic and wild animals, which may result in a variety of foodstuffs of both animal
and plant origin becoming contaminated with faecal organisms either directly or indirectly (EFSA,
2013).
Finding of Salmonella spp in wild boars has traditionally been associated with S. Typhimurium;
however, in the past few decades, the spectrum of serotypes isolated from carcasses, tonsils, faeces
and lymph nodes is much more diverse. Great differences in the prevalence of Salmonella spp. in
game were reported between individual species (e.g., the rates are higher in wild boars than in
ruminants) as well as between particular regions (e.g., higher prevalence rates were recorded in
southern countries of the EU) (Table 1). According to data reported by EU MSs in the framework
of the Zoonoses Directive (2003/99/EC) in 20042011, 1.1 % of deer, 11.1 % of reindeer, 18.3 % of
wild boar, 1.8 % of ostrich and 2 % of rabbit faecal samples were positive for this organism.
Salmonella was therefore shortlisted for risk ranking (EFSA, 2013)
Investigation of wild game pathogens in our country were mainly aimed at wild birds and other
enteropathogens (Stojanov et al., 2012; Velhner et al., 2012). The prevalence of salmonellas on wild
boar carcasses is relatively low, i.e. below 10% (unpublished data). Wild boars are more frequently
the carriers of Salmonella spp. than wild ruminants. Thus, an inadequate evisceration and/or bad
shot (e.g. shooting wound in abdominal region) increases the risk of meat contamination with
Salmonella spp. (Wisniewski, 2001).
Table 1. Prevalence of Salmonella spp. in wild boars in some European countries (Paulsen et al., 2012)
Animal species and sample
Wild boars, faeces
Country
Number of samples
Number of positive
samples
Italy
2365
441 (18.7%)
Portugal
Switzerland
77
73
17 (22.1%)
4 (5.5%)
109
There are few practical options for eradication of Salmonella and other zoonotic diseases in
wildlife, with the possible exception of vaccination or culling in geographically isolated areas.
Regulating animal density (to avoid crowding and overabundance), can contribute to disease
control; also, when game is eviscerated on the spot, the offal should be removed from wildlife
(Gortazar et al., 2006). However, there are no records indicating that such measures would have
successfully eradicated Salmonella in the wild.
In actual scientiffic literature there are no published recommendations (at least to our knowledge)
on Salmonella spp., control measures in live wild boars. Therefore it is important to control hygiene
during hunting, evisceration, bleeding and cleaning of carcasses, cooling and transportation,
coupled with sampling of processed carcasses for Salmonella spp. presence.
Toxoplasma gondii
T. gondii infection is common in animals and humans. T. gondii is an obligate intracellular
protozoan parasite. Nearly all warm-blooded animals can act as intermediate hosts, and almost all
animals may be carriers of tissue cysts of this parasite. However, the parasite matures only in
domestic and wild cats, which are the definitive hosts (EFSA, 2013). In pregnant women, the
parasite can cause congenital infections resulting in abortion, stillbirth, mortality and hydrocephalus
in newborns. The parasite can also cause severe disease in immune compromised individuals such
as organ graft recipients and individuals with AIDS or cancer (EFSA, 2013). In immune-competent
individuals, 8090 % of cases of T. gondii infection are asymptomatic and the majority of the
remainder result in only mild, self-limiting symptoms.
Common infection routes for wild boars include ingestion of oocysts from the environment,
ingestion of infected rodents and birds or cannibalism (Tenter et al., 2000). An interesting
observation was reported by Dubey et al (1992) suggesting significantly higher seroprevalence of
Toxoplasma among pigs raised outdoor than in those reared in conventional settings. The natural
production system is conducive for exposure of the pigs to various known risk factors for
Toxoplasma infestations such as cats (the definitive host) and other species that can be harbouring
cysts in their musculature as compared to the indoor conventional production system. In addition,
the outdoor environment with open access to soil, vegetation, and moisture allows viable
environments for Toxoplasma oocysts. The similar trend of higher seroprevalence of Toxoplasma
and Trichinella in outdoor-reared swine was reported in the Netherlands (van der Giessen et al.,
2007). The frequency distribution of Toxoplasma seroprevalence reported in Dubey et al (1992)
study ranged from 0.38% in intensive production to 5.62% in outdoor-reared system.
T. gondii is common in hunted wild boars in EU, where the seroprevalence has been reported to
vary between 8% and 38% (Lutz, 1997; Gauss et al., 2005; Antolova et al., 2007). The
seroprevalence in farmed wild boar has been reported to be 33 % (EFSA, 2007). Given the high
incidence in wild boar, this organism is significant hazard for wild boar meat safety.
Toxoplasmosis in animal commonly takes an asymptomatic course, which makes the diagnostics in
living animals impossible. To detect T. gondii infection in livestock, serologic assays can be
applied. With the exception of cattle, the presence of antibodies and tissue cysts is assumed to
correlate well. Meat or tissue samples can be tested by bioassay or PCR. T. gondii oocysts cannot be
differentiated from Hammondia or Neospora oocysts morphologically, thus molecular techniques
need to be applied. If infected meat is consumed without prior freezing or proper heating (core
temperature over 67 C) T. gondii can be transmitted. Salting, fermenting, drying, and smoking also
reduce tissue cyst viability, but the exact conditions needed to inactivate T. gondii are less wellestablished (Opsteegh et al., 2013).
110
Alaria alata
Alaria alata is a trematode parasite, and the transmission of this parasite occurs when humans eat
undercooked game or frog meat infected with the mesocercarial stage of this parasite. The
epidemiology of Alaria infection is not well-understood (Moehl et al., 2009a). The reported cases of
human larval alariosis are most likely due to mesocercariae from Alaria species other than A.
americana, but primates can be infested by A. americana (Moehl et al., 2009b). A study in
Germany (Riehn et al., 2012) found a high prevalence of A. alata in wild boar (11.5%). Although
specific methods for targeted detection of A. alata are available, its diagnosis is feasible during the
official Trichinella inspection in the competent veterinary inspection offices. Recent studies
conducted in the eastern parts of Austria indicated an overall prevalence of A. alata mesocercariae
in wild boar of 2%, when lean muscle (M. masseter) tissue was tested (Sailer et al., 2012) or 6.7%,
when a muscle fat tissue mixed sample was tested (Paulsen et al., 2012).
Jaki et al. (2002) and Grosse and Wste (2006) pointed out that the parasite represents a potential
source of infection for both humans and animals, and that consumption of wild boar meat can be an
important factor in the epidemiology of this zoonosis (Moehl et al., 2009b). However, to date, there
has been no report on human alariosis cases due to consumption of wild boar meat and thus Aaria
alata was ranked as hazard with low priority.
Chemical hazards
EFSA (2013) ranked chemical residues and contaminants on the basis of bioaccumulation,
toxicological profile and likelihood of occurrence, and they took into account the findings from the
NRCPs for the period 20052010. The ranking results were as following:
- No substances were classified in the high potential concern category for game.
- Within the category of medium potential concern for farmed game is cadmium.
- All other substances listed in Council Directive 96/23/EC was ranked as being of low or
negligible potential concern
- Potentially higher exposure of consumers to these substances from game meat takes place
only incidentally, as a result of mistakes or non-compliance with known and regulated
procedures.
The analysis of the results of the microelements and heavy metals in wild boar meat in Serbia (non
published data), has shown that no samples exceeded legal limits, but our results suggest that
pollution of the biosphere with chemical contaminants should be systematically monitored to
identify potential increasing contamination tendencies.
Conclusion
The absence of characteristic clinical picture is common to all aforementioned hazards, thus a
thorough post mortem examination for the presence of tuberculosis and artificial digestion to
confirm the presence of Trichinella but also Alarai alata is of outmost importance. However, some
hazards are not detectable by these procedures (Salmonella, Toxoplasma, chemical hazards) and
designing and implementation of appropriate hazard control programs is necessary.
The presence of alimentary pathogens and contamination of boar meat with chemical hazards in
Serbia has not yet been fully elucidated. While relevant data on Trichinella spp are available and
the mechanisms of the maintenance of its life cycle in our region are well known, the data on other
hazards are still unclear. A number of ongoing research-scientific projects in our country address
the prevalence of selected hazards among wildlife population with an aim of obtaining
111
scientifically-based risk analysis as a corner-stone for implementing appropriate programmes and

measures for the control of alimentary hazards. The programme for control and monitoring of wild
boar meat should encompass control measures for live animals, control measures during and after
hunting, guidelines for veterinary inspection of meat, control measures for carcass processing and
monitoring over chemical residues.
Acknowledgement
This work was supported by the Ministry of Science and Technological Development of the
Republic of Serbia, grants TR 31084.
References
1. Antolova D., Reiterova K., Dubinsky P.:Seroprevalence of Toxoplasma gondii in wild boars (Sus scrofa)
in the Slovak Republic. Annals of Agricultural and Environmental Medicine, 14, 7173, 2007
2. Ashford D., Whitney E., Raghunathan P., Cosivi O.: Epidemiology of selected mycobacteria that infect
humans and other animals. Rev Sci Tech. 20,1,325-337, 2001
3. CAC Codex alimentarius CAC/RCP58-2005. Code of hygienic practice for meat
4. Council Directive 96/23/EC
5. Dubey J., Gamble H., Rodrigues A., Thulliez Ph.: Prevalence of antibodies
to Toxoplasma gondii and Trichinella spiralis in 509 pigs from 31 farms in Oahu, Hawaii. Veterinary
Parasitology, 43,12, 57-63, 1992
6. EFSA: Scientific Opinion of the Panel on Biological Hazards on a request from EFSA on Surveillance
and monitoring of Toxoplasma in humans, foods and animals. The EFSA Journal 583,164, 2007
7. EFSA: Scientific Opinion on the public health hazards to be covered by inspection of meat from farmed
game. The EFSA Journal 11,6,3264,2013
8. Enemark H., Bjorn H., Henriksen S., Nielsen B:. Screening for infection of Trichinella in red fox
(Vulpes vulpes) in Denmark Vet Parasitology 88, 3-4, 229-37,2000
9. Gauss C., Dubey J., Vidal D., Cabezon O., Ruiz-Fons F., Vicente J., Marco I., Lavin S., Gortazar C.,
Almeria S.: Prevalence of Toxoplasma gondii antibodies in red deer (Cervus elaphus) and other wild
ruminants from Spain. Veterinary Parasitology, 136, 193200, 2006
10. Gortazar C., Acevedo P., Ruiz-Fons F., Vicente J.: Disease risks and overabundance of game species
European Journal of Wildlife Research 52,8187,2006
11. Gortazar C., Torres J., Vicente J., Acevedo P., Reglero M., de la Fuente J., Negro J., Aznar-Martin J.:
Bovine tuberculosis in Doana Biosphere Reserve: the role of wild ungulates as disease reservoirs in the
last Iberian lynx strongholds. PLoS One,23,3,7:e2776. 2008 . doi: 10.1371/journal.pone.0002776.
12. Gortzar C., Delahay R., McDonald R.:The status of tuberculosis in European wild mammals. Mammal
Review, 42, 193206, 2012
13. Grosse K.,Wuste T.:Mesocercaria from Alaria alatadiscoveries at examination for trichinosis.
Fleischwirtschaft, 86, 106108, 2006
14. Jaksic S., Uhitil S.,Vucemilo M.:Mesocercariae of fluke Alaria alata determined in wild boar meat.
Zeitschrift Fur Jagdwissenschaft, 48, 203207, 2002
15. Lutz W.: Serological evidence of antibodies against Toxoplasma and Leptospira in wild boar. Zeitschrift
Fr Jagdwissenschaft, 43, 283287, 1997
16. Moehl K., Grosse K., Hamedy A., Wueste T., Kabelitz T., Luecker E.: Alaria alatainvestigations on
detection, prevalence and biology of a re-emerging parasite. International Journal of Medical
Microbiology, 299, 103103, 2009a.
17. Moehl K., Grosse K., Hamedy A., Wueste T., Kabelitz P.,Luecker E.: Biology of Alaria spp. and human
exposition risk to Alaria mesocercariaea review. Parasitology Research, 105, 115Naranjo V,
112
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
Gortzar C, Vicente J and de la Fuente J, 2008. Evidence of the role of European wild boar as a reservoir
of Mycobacterium tuberculosis complex. Veterinary Microbiology, 127, 19, 2009b.
Opsteegh M., Teunis P., Zuchner L., Koets A., Langelaar M.,van der Giessen J.: Low predictive value of
seroprevalence of Toxoplasma gondii in cattle for detection of parasite DNA. International Journal of
Parasitology, 41, 343354, 2010
Paz M., Hofle U., Vicente J., Ruiz-Fons F., Vidal D., Barral M., Garrido J., Funte J, Gortazar C.: Lesions
associated with Mycobacterium tuberculosis complex infection in the European wild boar. Tuberculosis
87, 4, 360-367,2007
Paulsen P., Smulders, F., Hilbert, F.: Salmonella in meat from hunted game: A Central European
perspective. Food Research International, 45, 609616, 2012a
Paulsen P., Ehebruster J., Irschik I., Luecker E., Riehn K., Winkelmayer R.,Smulders F:Findings of
Alaria alata mesocercariae in wild boars (Sus scrofa) in eastern Austria. European Journal of Wildlife
Research, 58, 991995, 2012b
Petrovi J., Pui I., Api J., Milanov D., Grgi ., orevi V., Matekalo-Sverak V. Silvatina
trihineloza - uloga divljih ivotinja u ciklusu irenja trihineloze u Srbiji. Veterinarski glasnik 66,3-4,175183,2012a
Petrovi J., Grgi ., ivkov-Balo M.: Molecular diagnostics of trichinella species: new data on
trichinella life cycle in Vojvodina region.Proceedings, Conference Meat and Meat Products Perspectives of Sustainable Production, Belgrade, 10th-12th June, 153-158, 2013a
Petrovi J., Doen R., Grgi ., Stojanov I., Milanov D.Zbornik radova u 11.Simpozijuma sa
meunarodnim ueem 'Zdravstvena zatita, selekcija i reprodukcija svinja'.98-98, 2013b
Petrovi J., Grgic Z., Pusic I., Urosevic M.: Sylvatic trichinosis in the Vojvodina region (Serbia). Trends
in game meat hygiene From forest to fork. Wageningen Academic Publishers, AE Wageningen, The
Netherlands, 175-181, 2014
Pui I., urii B., Bugarski D., Prodanov J., Santra V.: Epizootioloke karakteristike tuberkuloze
goveda u koviljskom ritu. IX epizootioloki dani sa meunarodnim ueem, Poarevac 28-31.03.2007
Zbornik radova i kratkih sadraja,135-137, 2007a.
Pui I., urii B., Savi-Jeveni S., Prodanov J., Bugarski D., Grgi ., Milievi V.: Vrednovanje i
primena mycobacterium bovis gama interferon testa u dijagnostici tuberkuloze goveda. X epizootioloki
dani sa meunarodnim ueem, Tara 2-5. 04 2008. Zbornik radova i kratkih sadraja, 207-208,2008
Pui I., urii B., Milievi V., Grgi ., Prodanov J., Bugarski D.: Metode dijagnostike tuberkuloze
na ivim govedima. 8. kongres veterinara Srbije, Beograd, sa meunarodnim ueem, 15-19.09.2009.
Zbornik kratkih sadraja, Veterinarska medicina, ivot i zdravlje, 101-102, 2009a
Pui I., Laloevi D., Bugarski D., Prodanov J., Grgi ., Uroevi M., Lupulovi D.: Epizootioloke
karakteristike tuberkuloze goveda u Junobakom okrugu. Arhiv veterinarske medicine, ISSN 18209955, 55-63, 2009b
Pui I., Milievi V., Savi S., Prodanov J., Grgi ., Bugarski D., Stojanov I.: A preliminary trial to
evaluate the gamma-interferon assay for the detection of tuberculosis in cattle under local conditions in
Serbia. Lucrari stiintifice, ISSN 1221-5295, 125-130, 2009c .
Pui I., Prodanov-Radulovi J., Ratajac R., Stojanov I., Uroevi M., Mari D.: The use of different
diagnostic techniques in cattle tuberculosis eradication. II International Symposium and XVIII Scientific
Conference of Agronomists of Republic of Srpskam March 26-29, 2013, 372-373, 2013 .
Rafter P., Marucci G., Brangan P., Pozzio E. 2005. Rediscovery of Trhichinella spiralis in red foxes
(Vulpes vulpes) in Ireland after thirty years of oblivion. J. Infect., 50, 61-5,2005
Ramanzin M, Amici A, Casoli C et al. Meat from wild ungulates: ensuring quality and hygiene of an
increasing resource. Italian Journal of Animal Science 2010; 9:e61doi:10.4081/ijas.2010.e61
Regulations (EC) 853/2004 i 854/2004
Rippa, D., Maselli, V., Di Donato, S., Salvioli, L.,Liguori, A.,Ligrone, R., Fulgione, D.: Efekti razliitog
lovnog gazdovanja na genetsku strukturu populacije divlje svinje u junoj Italiji. Meunarodni
simpozijum o lovstvu, Savremeni aspekti odrivog gazdovanja populacijama divljai Zemun-Beograd,
Srbija, 22. 24. jun, 2012. UDK:351.823.1:65.012.32
113

36. Sailer A., Glawischnig W., Irschik I., Luecker E., Riehn K.,Paulsen P.: Findings of Alaria alata
mesocercariae in wild boar in Austria: current knowledge, identification of risk factors and discussion of
risk management options. Wiener Tierarztliche Monatsschrift, 99, 346352, 2012
37. Stojanov I., Kapetanov M., ivkov-Balo M., Petrovi J., Potkonjak , Ecological role of bacterial isolates
in protected wild birds Proseedings.International symposium on hunting, 22-24.06.2012, 107-109, 2012
38. Tenter A., Heckeroth A., Weiss L. Erratum to Toxoplasma gondii: from animals to humans Int. J.
Parasitol 31, 2, 217-220, 2001
39. Uroevi M., Petrovi J., Mirilovi M., Risati Z., Jaji I.: Karakteristike trihineloze kod ljudi na
teritoriji Vojvodine u periodu 2002-2011., 6, 1, 45-55, 2013
40. Van der Giessen J., Fonville M., Bouwknegt M., Langelaar M., Vollema A.:Seroprevalence
of Trichinella spiralis and Toxoplasma gondii in pigs from different housing systems in The
NetherlandsVeterinary Parasitology, 148, 34, 371-374, 2007
41. Vicente J., Hofle U., Garrido J., Fernandez-de-Mera I., Juste R., Barral M., Gortazar C.: Wild boar and
red deer display high prevalences of tuberculosis-like lesions in Spain.Veterinary Research 37,107119,
2006
42. Velhner M., Suvajdi L., Petrovi J., eperanda M. Antimicrobial resistance of escherichia coli in wild
animals. Arhiv veterinarske medicine 35-44, 2012.
43. Wisniewski J. The incidence of Salmonella spp. in wild boars in Poland. Medycyna Weterynaryjna, 57,
399401, 2001.
114
Invited lecture
THE DETERMINATION OF THE QUALITY IN CEREAL SILAGES SUPPLEMENTED
WITH PUMPKIN AND CARROT
Milica Zivkov-Balos1, Sandra Jaki1, Milovan Jovicin1
1
Scientific Vetereinary Institute Novi Sad, Novi Sad Republic of Serbia

Abstract
The aim of this work was to evaluate the nutritional composition of silages based on the cereals
supplemented with carrot as well as pumpkin. For the ensilage, the following combinations of raw
materials were used: whole corn plant and carrot, oat grits and carrot and corn grits and pumpkin.
Determination of moisture, fat, crude fiber, ash, calcium and phosphorus in the samples was
performed by standard methods, while the protein was analyzed by measuring total nitrogen by total
combustion (according to Dumas). Content of mineral matters was measured applying the atomic
absorption spectrometry. The results obtained from this research reveal that cereals silages
supplemented with pumpkin and carrot can be considered a good source of nutrients.
Key words: silages, cereals, pumpkin, carrot, dairy cows
Introduction
Plant species that are suitable for silage have a higher dry matter yield in the field and higher
digestibility, low buffer capacity and a higher amount of water-soluble carbohydrates. Whole plant
maize silage is used worldwide in the rations for cattle. However, -carotene content in maize
silage, which is a popular main feed for dairy cows, is very low. The majority of feeds for dairy
cows contain low levels of -carotene (Nozire et al. 2006). The contents of -carotene in grass
vary depending on the plant species and growth stage. The highest levels of -carotene in pasture
grass, maize, alfalfa, etc. are found in young plants and their content decreases with plant ageing.
Plant carotenoids are transferred to the products of animal origin with the different absorption rates.
Thus, egg yolk demonstrates high absorption rate, whereas carotenoids transfer is somewhat less
pronounced in ruminants and affects the colour of milk and dairy products and body fat as well.
Consumers mostly assess the initial quality of animal products according to its colour, though their
preferences regarding the colour and thus the acceptability of milk and dairy products differ
between the countries and even between the regions in one country. Yellow colour of milk and
dairy products is often associated with grass-feeding systems, which are considered natural in
most countries. Thus, the carotenoids content in milk can be considered an indicator of pasturebased farming (Nozire et al., 2006).
The only natural source of vitamin A for ruminants is that occurring by -carotene cleavage and
its absorption by enterocytes and, to some lesser extent, as the product of liver metabolism. To that
end, adequate -carotene content in the colostrum is a prerequisite for providing adequate levels of
vitamin A (-carotene). Furthermore, its absorption by the enterocytes is of vital importance for calf
development (Kaelawmun et al., 2011). Peripartal period in dairy cows is highly stressful period
associated with intensive physiological changes and metabolic adaptation during pregnancy period
and lactation. The energy requirements increase because of accelerated foetal growth and milk
production. This period is characterized by increased immunosuppression and thus higher
susceptibility to disease. Metabolic changes are associated with rapid foetal growth, parturition and
115
inducing of lactation, which results in increased generation of free radicals. When the production of
free radicals exceeds the antioxidant defence mechanisms of the body, the cow is in oxidative stress
(Kaelawmun et al., 2011). Oxidative stress is an important factor contributing to disease
susceptibility. -carotene as an antioxidant can affect the functionality of hosts immune system
through its positive effects on membrane fluidity (Chew and Park, (2004); Tjoelker et al., (1988,
1990)). Chawla and Kaur (2004) reported that -carotene supplementation to cows in drying off
period is required to improve the antioxidative plasma status and overall health status post partum,
to improve the milk production and quality, and to reduce the incidence of mammary infections.
Kawashima et al. (2010) reported that -carotene supply improved embryo production and quality
in super ovulated cows. Among the role of retinol in ruminants, as in other mammals, its influence
on reproduction has been extensively studied. Retinol deficiency may reduce reproductive
efficiency in dairy cows, especially through impaired ovarian function and increased incidence of
abortion (Hurley and Done, 1989). Retinol is also involved in various functions, such as vision,
growth and male fertility. In addition, the conversion rate of -carotene to vitamin A in granulose
cells has been enhanced by follicular growth, and intrafollicular concentrations of vitamin A
correlated positively with those of estradiol and follicle diameter (Schweigert et al., 1987).
Some crops, which are used as feed alternative for domestic animals, are rich sources of this
vitamin precursor. In our region, carrot and pumpkin can be considered alternative cultures and
good sources of vitamin A and -carotene for cattle. The use of agricultural residues and surplus
products as well as alternative crops is often a useful way of overcoming the shortage of animal
feedstuffs and has been intensively addressed by some recent researches and projects worldwide.
Agricultural surplus, low purchase price of agricultural products and inability of selling the products
on the market result in the disposal and loss of substantial amounts of agricultural products.
Carrot is good source of carotene, but it conteins also xanthophyll, though in some lesser amounts.
At the food market, the carrots of poor quality (some 22% of total production) are returned to the
producers mainly because of undersize, deformity, breakage or root diseases/infection. The rejected
crops that are returned to the supplier are considered goods of poor economic value and are used
rather as animal feed than the source of carotenoids. Potential way of using the health-nutritional
components of rejected crops and thus increasing their economic value is their application in
organic egg production (Hammershj et al., 2010). Carrots have become a common animal feed in
egg production in Danemark. In the U.S., carrot root has been used in cattle breeding as the winter
feed for dairy cows, in the production of yellow-colour butter and cream (Watson, 1994). Some
novel researches indicated that carrot supplementation to the diet of dairy cows increases the
content of vitamin A and lactic acids in milk (Nalecz-Tarwacka et al., 2003).
Beside for human consumption, pumpkin (especially some particular varieties) is used as animal
feed. Flashy and cellulose portions of pumpkin are one of the most important edible agricultural
residues (Razzaghzadeh et al., 2007). In the U.S., pumpkin varieties are grown as decorative plants
as well as for human nutrition. Pumpkins with spots or blemish as well as those broken or damaged
during harvesting are discarded as inacceptable for the market. Moreover, after October 31
(Halloween), the demand for decorative pumpkins decreases, thus substantial amount of the crops is
left in the fields. Some farmers use pumpkin fields for grazing (in combination with maize-stalk),
but in general, very little information is available on the nutritive value of pumpkin in cattle
nutrition. Some researches pointed out that pumpkin is good source of energy with adequate protein
content for the cattle (Jenkins, 2010).
It is to be emphasized that including of these alternative crops into the diet for dairy cows could
contribute to the increase of organic milk production in line with the basic principles of organic
production. Organic milk production is based on organic principles and objectives including
naturalness and recycling of nutrients. According to current regulations, the feed used in organic
milk production must be 100% organic-grown (EC, 1999). However, the integrity of organic
116
production could be further enhanced if frequent use of vitamin supplementation with artificial fatsoluble vitamins is substituted by vitamins from natural sources (Mogensen et al., 2012).
Preservation of alternative crops
Carrot and pumpkin are highly moist materials. Although these materials have nutritive value, they
are difficult to incorporate into a commercial feeding program because of preservation problems.
This means that these need to be treated for storage if they are to be made available as a feed
resource during lean season. Ensiling can be considered as a method for making use of wet raw
materials more effectively. Prior to silage making, drying and chopping are also required, which
makes the method somewhat expensive and cumbersome for farmers.
Silage making involves harvesting crops by mechanical harvester, usually with considerable
reduction of the size of particles, which accelerates the release of plant cell contents. The harvested
materials are placed in a silo, which is sealed to produce anaerobic conditions. The silo is opened
after several weeks or months and the silage is removed for use as feed. Preservation of ensiled
materials is achieved by the conversion of plant water-soluble carbohydrates glucose, fructose,
fructans and sucrose to organic acids, principally lactic acid. There is also a variable degree of
degradation of proteins to amino acids and other nitrogenous compounds (Wilkinson, 1999).
The advantages of ensiling alternative crops and root crops include (Moran, 2005):
feeding is possible when such by-products are not being produced

increasing feed resources and an insurance for high nutrient demands, such as milking cows
reducing demands on home-grown forages
if low cost, reducing total feed costs
can improve their palatability
can reduce toxicity to safe levels (in vegetables)
can destroy harmful bacteria (in food by-products)
can constitute a major proportion of diets
Another aspect of using carrot and pumpkin in cattle nutrition that is to be emphasized is the fact
that using agricultural surplus products for animal feed is a specific recycling process, since such
surplus, when accumulated, can cause environment pollution and increased costs of waste disposal.
The basic aim of these researches was finding new options for balanced livestock diet avoiding the
competition with human nutrition, and thus changing the perception of economic value of food.
Using alternative crops as animal feed can provide competitive alternatives to traditional feed
sources and potentially reduce the expenses and impact on the environment. At the same time,
agricultural surplus products should be used with an aim of increasing the self-sufficiency and
stability of food supply. Such raw materials can be used not only as the source of nutrients for
ruminants but also as the substitute for commercial and imported feeds, which leads to further
savings in energy and transportation. Moreover, potential harmful environmental effects of waste
incineration, i.e., landfills for plant material surplus are greatly reduced.
The aforementioned strongly suggests the soundness and necessity of our research that was aimed at
alternative crops and agricultural surplus products from our region, which could be used as feed for
dairy cows and an alternative to synthetic vitamin A and -carotene in organic milk production.
Materials and Methods
Material:
For ensilaging, the following combinations of raw materials were used:
117
1. Vitaminized silage of whole maize plant and carrot

Silage maize mass was 72 000 kg and carrot mass (whole root) was 3500 kg. The ensilaging was
performed in a trench silo using an inoculant (Start supplement for silage, Natura point, Novi Sad).
2. Vitaminized silage of carrot and oat grits
Carrots (14 kg) were chopped in small particles (2 cm), and then 12.5 kg of oat-grits were added
along with 1.5 l water. The ensiling was performed in a PVC barrel.
3. Vitaminized silage of maize grits and pumpkin, variety Ishicu Kuru (used for seed production)
was prepared in a trench silo. Pumpkins pulp (720 kg) was pulverized using a tractor chips and
mixed with 480 kg of maize grits. Silage was carried out in six plastic barrels of 200 L
Sampling procedure:
Silage samples were taken from the top, centre and bottom parts of the trench silo, i.e. the barrel.
The samples were collected into sterilized bags, kept in iceboxes and transported to the laboratory
for analysis.
Animal experiment:
Four cows in late pregnancy and four recently calved cows originating from the same dairy farm
were fed vitaminized silage of whole maize plant and carrot. Blood samples were collected before
and after silage supplementation to the diet.
Methods of chemical analysis:
Determination of moisture, crude fat, crude fibre, crude ash, calcium and phosphorus in the
samples was performed by standard methods (ISO 6496; 6492; 6865; 5984; 6490-2; 6491), while
crude protein was determined by measuring total nitrogen using total combustion according to
Dumas (EN ISO 16634-1) and applying Elementar Rapid N Analyzer. Content of -carotene was
determined by spectrophometric method. Content of mineral matters (manganese, zinc, copper,
iron, magnesium, sodium) were determined using atomic absorption spectrophotometry applying
Varian SpectrAA-10. The serum content of carotene was determined using colorimetry.

Data on average chemical composition of the examined silage samples are displayed in Table 1.
According to the research of Horrocks and Vallentine (1999), the desirable content of dry matter
(DM) of maize plant for ensiling is 35%. This percentage provides an optimal proportion of starch,
which is the carrier of energy value and soluble sugars essential in production of adequate
amounts of lactic acid. Moisture content in the examined samples ranged from 45.33% to 76.92%.
Reduced fermentation in carrot/oat grit silage is most probably due to the high content of dry
matter, which inhibits the microbial activity (ivkov-Balo et al., 2013, 2014).
Table 1. Chemical composition of vitaminized silages (on dry matter basis, %) (ivkov-Balo et al.,
2014)
Sample
Dry matter
Organic matter
Crude Protein
Crude fat
Crude fiber
Crude ash
(DM)
(OM)
(CP)
(EE)
(CF)
(CA)
1
27.58 4.50
95.29 4.44
9.32 0.36
1.20 0.23 23.86 1.73 4.71 0.06
2
53.02 5.59
96.72 5.12
13.45 0.59
0.79 0.30 10.49 1.02 3.28 0.65
3
55.13 1.79
89.70 3.60
8.11 0.28
0.54 0.02 8.98 0.13 10.30 1.82
Sample No: 1. whole corn plant and carrot; 2. oat grits and carrot; 3. corn grits and pumpkin; Results are
presented as meansSD.
118
The CP content was 2.29-2.84% on fresh matter basis (average 9.32% in DM) in silage of whole
maize plant and carrot, 7.13-7.52% (average 13.45% in DM) in silage of carrot and oat grits and
4.19-4.75% (average 8.11% in DM) in silage of maize grits and pumpkin (Table 1). Our results of
silage CP were in between the results of other authors. Demirel et al. (2011) noted that silages of 12
maize hybrids have CP content from 4.07-6.91% in DM. Kamalak et al. (2002) findings revealed
the content of CP from 8.5 to 9.6% for control and transgenic maize varieties. The effect of stage of
maturity on the ensiling properties of whole crop maize was studied under laboratory conditions.
The CP content decreased from 80 to 58 g/kg DM (Filya, 2004). Vranic et al. (2008) reported that
the CP content in samples of maize silage for dairy cows nutrition, was 61.6 g CP / kg DM. Similar
findings (68.72 g/kg DM) were reported by orevi et al. (2009). Carrots have 85-90% moisture
content and about 10% crude protein in dry matter (Rust and Buskirk, 2008). Carrot silage has 27.1
% of DM and 13.8% of CP (Laflamme, 1992). Content of proteins in pumpkins (carving and pie
pumpkins) is 14.3-14.4% in DM (Jenkins, 2010) and 16% (Davis et al., 2012).
The CF content in silages changed from 4.82 to 8.45% on fresh matter basis (8.98-23.86% in DM).
The highest content of CF has been established in vitaminized silage of whole maize plant and
carrot, and the lowest in vitaminized silage of maize grits and pumpkin. Our results are in
compliance with the results of other authors. Demirel et al. (2011) established CF content in maize
silages ranging between 17.96 and 27.28% DM. orevi et al. (2009) reported that the content of
CF in DM of whole plant maize silage is 17.65%, whereas Galila et al. (2012) reported the content
of CF in maize stalks, after the process of fermentation (that lasted 28 day), ranging between 24.54
and 27.20%. Carrot root contains 8.1-12.1% crude fibre in DM (Nonaka et al., 1994). The carrot
roots and carrot heads contain 9.1% and 18.1% of CF, respectively (Davis et al., 2012). Fresh
pumpkin (Cucurbita sp.) contains averagely 13.2% CF in DM (Enishi et al., 2004).
Ether extract (EE) ranged between 0.54% and 1.20% DM. Our silage results were lower than the
results of other authors. The maize silages EE content changed from 2.68% to 4.40% in DM
(Demirel et al., 2011). Djordjevi et al. (2009) reported that EE content in dry matter of maize
silages is 8.76%. EE content in carrot is on average 1.0% (0.2-1.9%) in DM (Nonaka et al., 1994).
Fresh pumpkin contains about 2.8% of crude fat in DM (Enishi et al., 2004).
The CA content in silages changed from 3.28 to 10.30 % in DM. Highest ash content was measured
in the silage of whole maize plant and pumpkin as a consequence of higher proportion of maize
stalks in the silage. Fresh pumpkin contains about 2.8% of crude fat in DM (Enishi et al., 2004). CA
in whole plant maize silages changed from 4.64 to 7.94% in DM (Demirel et al., 2011). According
to the report of Djordjevi et al. (2009), CA content in dry matter of maize silages is 5.04%. Filya
(2004) reported CA contents in maize silages in different stages of fermentation ranging 4.0213.57% in DM. The average CA content in carrot is 7.4% (3.1-10.4%) in DM (Nonaka et al., 1994).
Enishi et al. (2004) reported that fresh pumpkin contains about 7.9% CA in DM.
Calcium (Ca) and phosphorus (P) content in investigated silages is displayed in Table 2. The
chemical analysis revealed abundant amounts of these essential macro elements for animal nutrition
on DM basis ranging between 900-4300 mg/kg (Ca) and 1600-2200 mg/kg (P). The highest content
of Ca was measured in vitaminized silage made of whole maize plant and carrot. Calcium content
in whole maize plant is 800 mg Ca/kg DM (Galila et al., 2012). The average calcium and
phosphorus contents in fresh carrot roots are 3800 mg/kg and 2900 mg/kg DM, respectively
(Nonaka et al., 1994). Idi et al. (2005) reported Ca and P contents in dry matter of carrot of 0.36%
and 0.26%, respectively. The pumpkin Ca and P contents are averagely 3900 mg/kg and 2600
mg/kg in DM, respectively (Enishi et al., 2004). Hashemi and Razzaghzadeh (2007) reported Ca
and P contents in dry matter of silages from Cucurbit residues of 0.94% and 0.09%, respectively.
The DM mineral content of our silages was within the range of average values reported by other
authors. The variability in the contents of mineral elements in plants results from a number of
119
factors, such as plant species, soil properties and application of agro technical measures (ivkovBalo et al., 1999). Macro- and microelements analyses of soils, feed (alfalfa and maize) and food
(wheat) indicated a high variability in the contents of these elements between some locations in
Vojvodina Province (ivkov-Balo et al., 2000, 2011).
Table2. Mineral content of vitaminized silages (on dry matter basis)
Mineral,
unit of measure
Type of vitaminized silage

2
Calcium, %
0.36-0.43
0.09-0.13
0.13-0.16
Phosphorus, %
0.18-0.22
0.21-0.26
0.14-0.18
Manganese, mg/kg
47.1-61.3
2.1-10.3
7.6-8.9
Zinc, mg/kg
22.8-24.3
18.7-20.4
15.4-19.8
Coper, mg/kg
30.8-31.2
7.2-7.9
4.5-21.6
Iron, mg/kg
126.9-147.6
70.5-95.1
99.8-111.2
Magnesium, mg/kg
2175-3912
754.-802
805-898
Natrium, mg/kg
798-1131
660-753
3283-17187
Type of vitaminized silage: 1. whole corn plant and carrot; 2. oat grits and carrot; 3. corn grits and pumpkin;
Results are presented as interval of variation
The highest manganese (Mn) levels were measured in the samples of maize silage (whole plant) and
carrot, being averagely 54.2 mg/kg of DM. This is significantly higher value as compared to that
reported by other authors. Thus, Demirel et al. (2011) reported Mn contents in samples of diverse
maize hybrids silage ranging from 4.09 to 6.16 mg/kg of DM. Blackwood (2007) stated that silage
made of whole plant maize contained 34.0 mg/kg Mn in DM. The content of Mn in carrot ranges
between 34.4 mg/kg DM in the root and 198 mg/kg in leaves (Intawongse and Dean, 2006). The
results of their investigation showed that uptake of some microelements by plants corresponded to
the increasing level of soil contamination, and that soil-to-plant transfer factor values decreased
from Mn>>Zn>Cd>Cu>Pb. Higher manganese contents in our samples are most probably due to
the high soil Mn levels. The highest zinc (Zn) levels were determined also in silages based on whole
maize plant and carrot. Our results on zinc levels correspond with the results of other authors
(Demirel et al., 2011; Intawongse and Dean, 2006). Iron contents in the examined samples of
vitaminized silages were within the range of available literature data. Vitaminized silages,
particularly those based on pumpkin pulp and maize grout, are very rich in sodium and magnesium.
The most important attribute of these silages is their richness in vitamins and -carotene. The
average content of this provitamin in maize and carrot based silages was about 386.60 mg/kg.
According to the data from the literature, the level of -carotene in maize ranges from 24 to 35
mg/kg, whereas average -carotene contents in green grass, dry forages, silages and hay are 196,
159, 81 and 36 mg/kg, respectively (Noziere et al., 2006).
Total 8 sera of cows from two production groups, i.e., cows in late pregnancy and recently calved,
were tested before and during feeding vitaminized silage made of maize (whole plant) and carrot
(Table 3.).
120
Elevated contents of -carotene were measured in the blood of all cows fed vitaminized silage
based on maize and carrot. Such high levels of -carotene in vitaminized silage, that is, blood sera
of the cows, contributed to improved production results and significantly reduced administration of
veterinary drugs.
Table 3. The content of -carotene in blood serum before and during feeding vitaminized silage
Characteristic
Reference value
Sample No.
1.
2.
3.
4.
n=4
SD=
SD=
Sample No.
1.
2.
3.
4.
n=4
Content of -carotene
winter 2.79-9.30; summer 9.30-27.90
The values in samples before feeding
vitaminized silage
7.22
8.23
7.59
7.98
7.76 0.44
The values in samples during feeding
vitaminized silage
36.83
28.64
42.59
36.07
36.03 7.01
Conclusions
Vitaminized silages based on grains, carrot and pumpkin that were used in the present experiment
were assessed to be of good quality. With regard to their nutritional composition, the investigated
vitaminized silages are potential resource to be used in bovine diets. Vitaminized silages based on
grains, carrot and pumpkin ensure good results in cattle reproduction and better milk yield. The
entire technological process is designed to provide highest level of preserving the quality and
nutritive properties of feed. The selected alternative crops are widely grown in the territory of
Serbia and do not require any substantial economic investments, which guarantees a sustainable
production of safe organic food of animal origin and satisfactory production outcomes without
significantly affecting the farming technology.
Acknowledgments
The research was financially supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia (Project No TR31071)
References
1.
2.
3.
Blackwood, I.: Mineral content of common ruminant stockfeeds, crops and pastures. Primefact 522,
September Livestock Officer, Extensive Industries Development, Paterson, 2007.
Chawla R., Kaur H.: Plasma antioxidant vitamin status of periparturient cows supplemented with tocopherol and -carotene. Anim. Feed Sci. Tech., 114, 279-285, 2004.
Chew B.P., Park J.S.: Carotenoid action on the immune response. J. Nutr., 134, 257-261.
121

4.
Demirel R., Akdemir F., Saruhan V., Sentrk Demirel D., Akinci C., Aydan F.: The determination of
qualities in different whole-plant silages among hybrid maize cultivars. African Journal of Agricultural
Research, 624, 5469-5474, 2011.
5. Davis C., Wiggins L., Hersom M.: Utilization of Cull Vegetables as Feedstuffs for Cattle.
http://edis.ifas.ufl.edu/pdffiles/AN/AN28000.pdf
6. Djordjevi N., Grubi G., Levi J., Sredanovi S., Stojanovi B., Boikovi A.: The quality of silages
from lucerne, whole maize plant and maize cobs prepared with various additives. Proceedings of XIII
International Symposium Feed Technology Symposium FEDD-TO-FOOD/1st Workshop FP/REGPOT3, Novi Sad, Serbia, 2009, 146-152.
7. EC: Regulation No 1804/1999 from European Commission, supplementing regulation No 2092/91,
1999.
8. Enishi O., Yoshioka T., Nakashima K.., Saeki M., Kawashima T.: Analysis of in situ ruminal digestive
characteristics and nutritive value of pumpkin and carrot juice residue for ruminant feeds. Grassland
Sci., 50, 4, 360-365, 2004.
9. Filya I.: Nutritive value and aerobic stability of whole crop maize silage harvested at four stages of
maturity. Animal Feed Science and Technology, 116, 141150, 2004.
10. Galila A.M.A. Darwish, Bakr A.A., Abdallah M.M.F.: Nutritional value upgrading of maize stalk by
using Pleurotus ostreatus and Saccharomyces cerevisiae in solid state fermentation. Annals of
Agricultural Science, 57 (1) 47-51, 2012.
11. Hammershj M., Kidmose U., Steenfeldt S.: Deposition of carotenoids in egg yolk by short-term
supplement of coloured carrot (Daucus carota) varieties as forage material for egg-laying hens. J Sci
Food Agric, 90: 11631171, 2010.
12. Hashemi R., Razzaghzadeh S.: Investigation on the Possibility of Ensiling Cucurbit (Cucurbita pepo)
Residues and Determination of Best Silage Formula. Journal of Animal and Veterinary Advances, 6
(12), 1450-1452, 2007.
13. Horrocks R.D., Vallentine J.F.: Harvested Forages. Academic Press, San Diego, 426, 1999.
14. Hurley W.L., Doane R.M.: Recent developments in the roles of vitamins and minerals in reproduction.
J.Dairy Sci. 72, 784804, 1989.
15. Idi A., Permin A., Christensen J.P., Steenfeldt S., Engberg R.M., Fink M.: Effect of carrots and maize
silage on colinization of hens by Ascaridia galli and Salmonella enterica servoar Enteritidis.
Helminthologia, 42 (3) 121-131, 2005.
16. Intawongse M., Dean R. J : Uptake of heavy metals by vegetable plants grown on contaminated soil and
their bioavailability in the human gastrointenstinal tract. Food Additives and Contaminats, 23 (1), 3648, 2006.
17. Jenkins H. K.: Feed Value of Alternative Crops for Beef Cattle. NebGuide, Index: Beef Feeding and
Nutrition, G2036, University of Nebraska-Lincoln Extension, Institute of agriculture and Natural
Resources, 2010.
18. Kaewlamun W., Okouyi M., Humblot P., Remy D., Techakumphu M., C. Duvaux-Ponter C., Ponter
A.A.: The influence of a supplement of -carotene given during the dry period to dairy cows on
colostrums quality, and -carotene status, metabolites and hormones in newborn calves. Animal Food
Science and Technology, 165, 31-37, 2011.
19. Kaewlamun W., Okouyi M., Humblot P., Remy D., Techakumphu M., C. Duvaux-Ponter C., Ponter
A.A.: Effects of a dietary supplement of -carotene given during the dry period on milk production
and.circulating hormones and metabolites in dairy cows. Revue Md. Vt., 163, 5, 235-241, 2012.
20. Kamalak A., Grbz, Y., Finiaayson, H.J. (2002). Comparison of in vitro DM degradation of four maize
silagesusing the Menke Gas Production method. Turk. J. Vet. Anim.Sci., 26, 1003-1008, 2002.
21. Kawashima C., Nagashima S., Sawada K., Schweigert F.J., Miyamoto A., Kida K.: Effect of -carotene
supply during close-up dry period on the onset of first postpartum luteal activity in dairy cows.
Reprod.dom. Anim., 45, 282-287, 2010.
22. Laflamme L. F.: Carrot/grass silage as cattle feed. Can. J. Anim. Sci, 72,441-443, 1992.
122

23. Mogensen L., Kristensen T., Segaard K., Jensen S.K., Sehested J.: Alpha-tocopherol and beta-carotene
in roughages and milk in organic dairy herds. Livestock Science, 145, 44-54, 2012.
24. Moran J.: Tropical dairy farming : feeding management for small holder dairy farmers in the humid
tropics, (2005) , 312 pp., Landlinks Press
25. Nalecz-Tarwacka T.A., Karaszewska T.A., Zdziarski K.: The influence of carrot addition to cows ration
on the level of vitamins and fatty acids in cow milk. Polish Journal of Food and Nutrition Sciences, 12,
53 (2), 53-56, 2003.
26. Nonaka K., Nakui T., Shinoda M.: Conservative and nutritive values of carrot silage. Research Bulletin
of the Hokkaido Agricultural Experiment Station, 159: 73-85, 1994.
27. Nozire P., Graulet B., Lucas A., Martin B., Grolier P., Doreau M.: Carotenoids for ruminants: From
forages to dairy products. Animal Feed Science and Technology, 131, 418450, 2006.
28. Razzaghzadeh S., Amini-Jabakandi J., Hashemi A.: Effects of different levels of Pumpkin (Cucurbita
Pepo) residue silage replacement with forage part of ration on male buffalo calves fattening
performance. Ital.J.Anim.Sci., 6, (2), 575-577, 2007.
29. Rust S., Buskrik D.: Feeding Carrots or Sugar Beets to Cattle. In Cattle Call, Michigan State University
Extension Newsletter 13 (4), 2008, http;//beef.msu.edu/Link-Click.aspx?fileticket =KjL6uucd9Mg%
3d&tabid=537.
30. Schweigert F.J., Rambech W.A., Zucker H.: Transport of -carotene by the serum lipoproteins in cattle.
J. Anim. Physiol. Anim. Nutr. 57, 162167, 1987.
31. Tjoelker L.W., Chew B.P., Tanaka T.S., Daniel L.R.: Bovine vitamin A and -carotene intake and
lactational status. 1. Responsiveness of peripheral blood polymorpho -nuclear leukocytes to vitamin A
and -carotene challenge in vitro. J. Dairy Sci., 71, 3112-3119, 1998.
32. Tjoelker L.W., Chew B.P., Tanaka T.S., Daniel L.R (1990). Effect of dietary vitamin A and -carotene
on polymorphonuclear leukocytes and lymphocytes function in dairy cow during the early dry period. J.
Dairy Sci., 73, 1017-1022.
33. Vrani M., Kneevi M., Mati I., Turin D.: Utjecaj dodatka kukuruzne silae travnoj silai razliitih
rokova konje na ad libitum konzumaciju obroka. Mljekarstvo 58,1, 69-84, 2008.
34. Watson S.J.: Feeding of Livestock. New York: T. Nelson and Sons, 1994.
35. Wilkinson J.M.: Silage and animal health. Natural Toxins, 7, 221-232, 1999.
36. ivkov-Balo M., Mihaljev ., Mai Z.: Koliine makro i mikroelemenata sa podruja Vojvodine.
Savremena poljoprivreda, 48, 12, 285288, 1999.
37. Zivkov-Balos M., aric M., Mihaljev Z., Djilas S.: Level of toxic elements and other mineral matters in
wheat. Eco-Conference 27-30 September. Safe Food, Proceedings II, 2000, 267.
38. ivkov Balo M., Mihaljev ., upi .: Contnet Of Trace Elements And Some Radionuclides In
Lucerne (Medicago Sativa). Biotechnology in Animal Husbandry, 27 (3), 591-98, 2011.
39. ivkov-Balo M., Joviin M., Api J., Mihaljev ., Prica N., Obradovi S.: Potentials and benefits of
vitaminized silages in the diet of dairy cows. Proceedings of 23rd International Symposium New
Technologies in Contemporary Animal Production, 19-21.06.2013., Poljoprivredni fakultet Novi Sad,
2013, 85-87.
40. ivkov-Balo M., Jaki S., Mihaljev ., Obradovi S., Ljubojevi D., Stojanov I., Joviin M.: Nutritive
value of vitaminized silages. XVI International Symposium Feed technology Novi Sad (Serbia), 28.
30.10.2014., 187-192, University of Novi Sad, Institute of food technology, ISBN 978-86-7994-044-5.
123
Invited lecture
MYCOTOXICOLOGICAL ASSESSMENT OF FEED IN SERBIA IN 2014 IN THE LIGHT
OF NEW LEGISLATION
Ksenija Nei1*, Sandra Jaki2, Milica ivkov-Balo2, Bojana Pruni2
1
2
Institute of Veterinary Medicine of Serbia, Belgrade, Serbia

Abstract
Under favorable environmental conditions, when temperature and moisture are suitable, fungi
proliferate and may produce secondary metabolites well known as mycotoxins. They commonly
enter the food chain through contaminated food and feed crops, mainly cereals, which get infested
prior to and during harvest, or during (improper) storage. But neither all molds are toxigenic, nor all
secondary metabolites are toxic. Therefore, although more than 300 mycotoxins have been isolated
and chemically characterized, worldwide research has focused on those forms causing significant
injuries to humans and animals. There is a small number of toxins that are of practical relevance, as
well as small number that has been officially regulated. European Union and Serbian regulations
treat only several mycotoxins by giving maximal permitted limits in feed and food. Regarding feed,
recently revised directive was published in Serbia in March 2014.
The aim of this paper was to present the mycotoxicological assessment of feed in Serbia in 2014 in
the light of this newly established regulation. Here shown results indicate that mycotoxins are
present more than they used to be, so more attention has to be paid to this problem, especially
keeping on mind their global impact on food safety, with possible serious effects on animal and
human health. So there is strong need for preventive measures, as well as regular and
comprehensive monitoring of feed as important step for struggle and control of these natural
contaminants.
Keywords: feed safety, monitoring, mycotoxins, regulations
Introduction
Mycotoxins have globally significant human and animal health, economic and international trade
implications (Bryden, 2012). The supply of meat, milk and eggs, the human food of animal origin,
can be adversely affected by mycotoxins. This is followed by the impact on animal health and
production (Shier et al, 2005).
Fungi are ubiquitous and all feedstuffs can be contaminated with mycotoxins. Formation of
mycotoxins is not restricted to any component of the animal feed supply chain, but the level of
contamination varies with location and reects different agronomic practices and climatic
conditions, which dictate the fungi that are present in a farming system (Bryden, 2009).
The fungal species most often encountered with intoxications belong primarily to genera
Aspergillus, Fusarium and Penicillium. These moulds produce many different toxic compounds but
not all isolates of the same species produce toxins (Cole et al, 2003; Brase et al, 2009). The major
toxins produced by these three genera include: aatoxins, ochratoxins, trichothecenes, fumonisins
and zearalenone.
Fungi are a normal part of the microora of standing crops and stored feeds, but the production of
mycotoxins depends upon the fungi present, agronomic practices, the composition of the
commodity and the conditions of harvesting, handling and storage (Bryden, 2009). The amount of
124
toxin produced will depend on physical factors (moisture, relative humidity, temperature and
mechanical damage), chemical factors (carbon dioxide, oxygen, composition of substrate, pesticide
and fungicides), and biological factors (plant variety, stress, insects, spore load).
The accumulation of mycotoxins, both before and after harvest, largely reflects climatic conditions.
Fusarium toxins are produced in cereal grains during high moisture conditions around harvest
(Nesic et al, 2014), whereas pre-harvest aatoxin contamination of crops is associated with high
temperatures, insect damage and prolonged drought conditions. Moreover, because Aspergillus can
tolerate lower water activity than Fusarium, it is more likely to contaminate commodities both preand post-harvest, whereas Fusarium is more likely to be found as a contaminant pre-harvest
(Bryden, 2009). These examples demonstrate that although it may be convenient to describe fungi
as either pre- and post-harvest organisms, the actual colonisation and proliferation of fungi is not
clear cut but depends on the environmental and ecological circumstances and the resulting toxins
will differ accordingly.
Stored grain is not static as well. It is in a dynamic state and may become infested with fungi and
insects. These interrelationships are affected by climatic factors such as temperature and humidity,
by geographical location, by the type of storage container and by grain handling and transport.
Moisture depends mostly on water content at harvest, the amount of drying, aerating, and turning of
the grain before or during storage as well as the respiration of insects and microorganisms in the
stored grain. If provided grain is dry when placed in storage, moisture content can only rise from
leaks or condensation. Grain may go into storage at a uniform temperature but over a period the
grain mass will cool at a different rate in the centre than at the periphery. As a result of temperature
differentials moisture migrates through the storage bin, resulting in condensation and the provision
of ideal conditions for mould growth or the development of hot spots in localised areas. Microbial
and insect growth in stored grain also results in moisture condensation and the potential
development of hot spots. The minimum critical levels for the growth of fungi are 70150 g/kg
moisture (depending on commodity) and 8085% relative humidity. Temperatures at which toxin
production can take place vary from 0 C to 35 C, depending on fungal species. Most mycotoxins
are very stable chemically and once formed in a feedstuff will continue to contaminate that
commodity and feeds manufactured from it (Bryden, 2012).
However, the major problem associated with mycotoxin contamination of the animal feed supply
chain is not acute disease episodes but reduced animal productivity. Low level toxin ingestion may
cause an array of metabolic disturbances which may or may not be accompanied by pathological
change (Haschek et al, 2002). One of the rst indications of a chronic mycotoxicosis is growth
depression, which may result from reduced feed intake, impaired nutrient utilisation, changes in
feed quality or toxicity per se. Many studies have demonstrated that mycotoxin ingestion reduced
feed conversion efficiency and may reflect impaired nutrient utilisation. The perturbations of
metabolism that occur following mycotoxin ingestion may affect reproductive efficiency of both
males and females (Nesic et al, 2008) and in the pregnant animal, mycotoxins may disturb
embryonic and foetal development. Mycotoxins are immunomodulators, mostly
immunosuppressive and it has been shown they increase the susceptibility of animals to infectious
disease (CAST, 2003).
It is important to know the fate of mycotoxins after ingestion, as contamination of animal products
with mycotoxins or their metabolic products has signicant public health implications. In this
regard, transfer of aatoxin into milk and ochratoxin A into meat have been the issues of most
concern. Available evidence suggests that tissue accumulation of aatoxin or its metabolites is very
low and that residues are excreted in a few days. Animals are effective toxin eliminators with milk,
the animal product most likely to contain aatoxin residues. The hydroxylated metabolite of
aatoxins B1, aatoxins M1 is excreted into milk from 1 to 6% of dietary intake (Fink-Gremmels,
2008).
125
Ochratoxin A has been detected in blood, kidneys, liver and muscle tissue from slaughtered pigs in
several European countries. There are significant differences among pig and poultry tissue
deposition studies and this is presumably due to differences in absorption and metabolism of the
toxin. It has been shown that the half-life of ochratoxin A in pigs and chickens is 180140 h and
approximately 4 h, respectively (Petterrson, 2004).
Residues of other mycotoxins including zearalenone, trichothecenes and fumonisins are not
considered to be of public health importance as only very low levels of the toxins have been found
in the tissues of animals that had been fed very high levels of the toxins in experimental situations
(Petterrson, 2004). However, caution should be exercised when extrapolating or predicting tissue
residues as there is presently insufficient data on which to anticipate the outcome of any field
toxicosis. There are some reports of synergistic effects of different mycotoxins which suggest that
contamination of e.g. dairy rations with other mycotoxins, in particular ochratoxin, may decrease
the excretion of aatoxin B1 by dairy cattle (Bryden, 2012).
Keeping on mind worldwide impact of these natural contaminants on feed and food safety, with
possible serious effects on animal and human health, the aim of this paper was to present the
mycotoxicological assessment of feed in Serbia in 2014 in the light of actual legislation and to
highlight the need for greater attention focused on the prevention.
Meterial and Methods

Monitoring of the presence of mycotoxins was done performing 1315 analysis of feedstuffs and
complete feed for different animal species produced in Serbia during 2014. The contents of
aflatoxin B1, ochratoxin A, zearalenone, deoxynivalenol and T2 toxin in feed samples were
determined in the Institute of Veterinary Medicine of Serbia in Belgrade and in the Scientific
Veterinary Institute Novi Sad. Both institutions perform ISO17025 accredited methods, using
commercial ELISA tests produced by Neogen, USA (Veratox HS for Aflatoxin B1, product
8031B; Veratox for Ochratoxin, product 8610; Veratox for Zearalenone, product 8110; Veratox for
DON, product 8331NE; Veratox for T-2/HT-2 toxin, product 8230, with detection limits: 1.0 g/kg,
2 g/kg, 25 g/kg, 250 g/kg and 25 g/kg, respectively) and R-Biopharm, Germany (Ridascreen
AflatoxinB1 30/15, Art. No. R1211; Ridascreen FAST Ochatoxin A, Art.No. R5402; Ridascreen
FAST Zearalenon, Art. No. R5502; Ridascreen FAST DON SC Art. No. 5905 and Ridascreen
FAST T-2 toxin, Art.No. R5302, with detection limits: 1.0 g/kg, 5 g/kg, 60 g/kg, 74 g/kg and
33 g/kg, respectively). Results were compared and interpreted according to new Serbian regulation
(Sl.glasnik RS, 27/2014).
Results
Results of mycotoxicological examination of feed samples during the year 2014 showed low
presence of ochratoxin A (Table 1), as well as T-2/HT-2 toxin (Table 2).
While 25.4 % of 138 analysed samples were slightly positive, detected concentrations of ochratoxin
A were far below maximum permitted levels given in Serbian directive (Sl.glasnik RS, 27/2014),
which is more strict compared with the previous one (Sl.glasnik RS, 4/2010). Most of the values
were below the detection limits of the used ELISA protocols. The highest concentration of
ochratoxin was detected in the mixture for poultry and it was 0.0275 mg/kg.
Regarding T-2/HT-2 detection no comment could be given in respect of new regulation (Sl.glasnik
RS, 27/2014), as no limits are proposed here. But directive from 2010 (Sl.glasnik RS, 4/2010), that
is not valid since March 2014, prescribed levels of 1.0 mg/kg for adult pigs and poultry and 0.5
126
mg/kg for young animals. Both were high above determined concentrations. Maximal content of
0.143 mg/kg among 169 samples was discovered in feed for pigs.
With regard to aflatoxin crisis in 2013, special attention was paid to the presence of this group of
toxins. Therefore, the largest number of samples were examined, a total of 668. Overall results
(Table 3) indicated that aflatoxin was still there in 59.1 % of performed analysis with 5.1 % of
samples that exceeded limits permitted by now actual legislation (Sl.glasnik RS, 27/2014). The
largest content was quantified in the corn sample (0.0322 mg/kg) which was above regulated limit
of 0.03 mg/kg, but which would be tolerable according to previous permitted limit of 0.05 mg/kg
(Sl.glasnik RS, 4/2010). Generally, by the adoption of new Directive more stringent criteria for
allowable levels of aflatoxin were introduced, thereby specifying limits for B1 from group of
aflatoxins. During the whole year, decreasing trend of recorded concentrations of aflatoxin B1 was
noted, with very few positives at the end of the year.
Table 1. Ochratoxin A in feed samples
Type of feed
Number of
samples
Positives
[%]
Poultry
Pigs
Cattle
Corn
Silage
Sunflower meal
Wheat
OVERALL
27
62
4
39
3
1
2
138
29.6
30.7
0
20.5
0
0
0
25.4
Range of
concentrations
[mg/kg]
0.0037 0.0275
0.003 0.0182
< 0.002
0.0052 0.0153
< 0.002
< 0.002
< 0.002
0.003 0.0275
Mean value
[mg/kg]
0.0084
0.0096
< 0.002
0.0082
< 0.002
< 0.002
< 0.002
0.0087
Above
permitted
limits [%]
0
0
0
0
0
0
0
0
Maximum
permitted
level [mg/kg]
0.2
0.1
0.25
0.25
0.25
0.25
-
Table 2. T-2/HT-2 toxin in feed samples

T 2 toksin
Number of
samples
Positives
[%]
Poultry
Pigs
Cattle
Corn
Wheat
OVERALL
38
77
5
48
1
169
39.5
26.0
20.0
18.8
0
26.6
Range of
concentrations
[mg/kg]
0.029 0.095
0.026 0.143
0.060
0.039 0.098
< 0.025
0.026 0.143
Mean value
[mg/kg]
0.0514
0.0546
0.060
0.0681
< 0.025
0.0585
Above
permitted
limits [%]
-
Maximum
permitted
level [mg/kg]
-
But, examining feed throughout 2014, while the situation with aflatoxin B1 turned down, the results
related to Fusarium toxins, zearalenone and DON, were changing and becoming more complex.
Over time more positive samples were found.
Results of zearalenone analysis are presented in Table 4. Among 165 samples in 51.5 % of them
certain concentrations were detected. The highest level of 2.389 mg/kg was found in corn, but there
were 4.8 % of samples with contamination above permitted level and all of them were for feeding
pigs.
Deoxynivalenol (Table 5.) was found in the highest percentage of analysed samples (64 %) and
11.4 % of them were highly contaminated, more than it was allowed by regulation (Sl. glasnik RS,
27/2014). As the most sensitive species, pigs were strongly affected and the largest mean value was
determined in feed for those animals (1.159 mg/kg), as well as the biggest number of inadequate
samples (27.3 %). Maximal detected concentration was found in the corn sample (12.242 mg/kg)
and 76 % of them were found positive, while all samples of wheat were also contaminated.
127
Table 3. Aflatoxin B1 in feed samples

Type of feed
Number of
samples
Positives
[%]
Range of
concentrations
[mg/kg]
Mean value
[mg/kg]
Above
permitted
limits [%]
Poultry
189
73.0
0.0011 0.030
0.0037
7.9
Pigs
190
58.4
0.0011 0.024
0.0060
6.8
Cattle
103
59.2
0.0010 0.0082 0.0034
1.9
Lambs
23
30.4
0.0011 0.0072 0.0046
8.7
Premix and
39
71.8
0.0011 0.013
0.0038
0
additional mix
Corn
100
37.0
0.0010 0.0322 0.0065
2
Silage
14
71.4
0.0011 0.0013 0.0040
0
Sunflower
8
15.0
0.0020 0.0016 0.0063
0
meal
Wheat
2
50.0
0.0050
0.0050
0
OVERALL
668
59.1
0.0010 0.0322 0.0048
5.1
*Double permitted level: for young animals (lower level) and adult animals (higher level)
Maximum
permitted
level
[mg/kg]
0.005-0.02*
0.005-0.02*
0.005-0.02*
0.005
0.01
0.03
0.03
0.03
0.03
-
Table 4. Zearalenone in feed samples

Type of feed
Number of
samples
Positives
[%]
Range of
concentrations
[mg/kg]
Mean value
[mg/kg]
Above
permitted
limits [%]
Poultry
14
28.6
0.046 0.249
0.145
Pigs
77
48.1
0.031 0.574
0.168
10.4
Cattle
9
77.8
0.067 0.593
0.258
0
Corn
52
53.9
0.063 2.389
0.309
0
Silage
8
100.0
0.062 1.542
0.494
0
Sunflower
2
0
< 0.025
< 0.025
0
meal
Wheat
3
33.3
0.083
0.083
0
OVERALL
165
51.5
0.031 2.389
0.243
4.8
Maximum
permitted
level
[mg/kg]
0.2-0.5*
1
6
6
4
4
-
Table 5. Deoxynivalenol (DON) in feed samples

Type of feed
Number of
samples
Positives
[%]
Range of
concentrations
[mg/kg]
Mean value
[mg/kg]
Above
permitted
limits [%]
Poultry
32
53.1
0.079 1.770
0.931
0
Pigs
66
63.6
0.079 5.852
1.159
27.3
Cattle
5
40.0
0.290 1.47
0.88
0
Corn
50
76.0
0.091 12.242
1.792
2
Silage
12
66.7
0.170 10.377
3.980
8.3
Sunflower
5
0
< 0.074
< 0.074
0
meal
Wheat
5
100.0
0.370 3.612
1.9
0
OVERALL
175
64.0
0.079 12.242
1.774
11.4
128
Maximum
permitted
level
[mg/kg]
5
0.9
2-5*
12
12
8
8
-
Discussion
Taking into consideration all these collected data, one fact cannot be neglected: mycotoxins are
more present than they used to be. In Serbia during previous years rare or strictly experimental
reports were given regarding this topic, which stayed captured in professional circles until the
attention of broad public was drawn to the case of aflatoxin in 2013, solely because of its presence
in milk (Kos et al, 2014). Also, in terms of aflatoxin presence in feed, situation was quite different
and very unlike years ago (Jakic-Dimic et al, 2010; Jakic-Dimic and Nesic, 2011). Most of the
analyses presented by Nesic and Pavlovic in early 2013, showed in 75 % of them significant
contamination, while as many as 35 % exceeded the maximum permitted levels, so did not
correspond to the Serbian regulation (Sl.glasnik RS, 4/2010). The highest percentage of
contaminated samples (100%) and also the maximal concentration (0.263 mg/kg) was detected in
feed for piglets, while 70 % of dairy mixtures were positive and 47.5 % over regulated level.
Extremely hot and dry conditions followed by drought were noted during maize growing season
2012 (Republic Hydrometeorological Service of Serbia, 2012), so aflatoxins occurrence in 68.5% of
samples harvested in 2012 could be contributed to weather conditions favourable for mould growth
and mycotoxins production (Kos et al, 2013). Comparing the results shown in Table 3 it can be
noted that the percentage of positive samples decreased in 2014, as well as detected aflatoxin
concentrations (the largest content was 0.0322 mg/kg quantified in the corn sample). Although
greater number of examinations done, only 5.1 % were above limits permitted by new legislation
(Sl.glasnik RS, 27/2014), which prescribed more strict criteria for aflatoxin. Approaching the end of
the year downward trend for this toxin had been increasingly apparent.
As aflatoxin crisis began to subside, the public interest in the problem of mycotoxins declined, but
not the problem itself. It has only modified in accordance with the new conditions of climate and
environment with lot of rain and moisture (Republic Hydrometeorological Service of Serbia, 2014).
Therefore, testing of maize and wheat during 2014, showed a large percentage of positives on
presence of new group, Fusarium mycotoxins: zearalenone and deoxynivalenol. Although these
moulds and their secondary metabolites are typical for our region, however, the frequency of their
presence and level of contamination exceeded previous data (Nesic and Pavlovic, 2013). Residues
of those mycotoxins are not considered to be of public health importance as only very low levels of
the toxins have been found in the tissues of animals that had been fed very high levels of the toxins
in experimental situations (Petterrson, 2004). But, from animal health and production point of view
their presence should not be neglected. The economic consequences can be very serious, especially
in pigs as the most sensitive species. Common clinical signs of zearalenonetoxicoses are vaginal
and vulvar swelling, enlargement of mammary glands and testicular atrophy, as well as other
reproductive effects, such as decreased fertility, increased number of resorptions and reduced litter
size (EFSA 2011; Nesic et al, 2008). Recent studies have demonstrated the potential for ZEA to
stimulate growth of human breast cancer cells (Yu et al, 2005). Intoxication with deoxynivalenol
(vomitoxin) is manifested by a decrease in food intake or its refusal, vomiting and digestive
disorders with subsequent losses of weight gain (Nesic et al, 2014). The gastrointestinal system is
the target organ of this toxin. In practice, the co-occurrence of DON and ZEA, or even additional
mycotoxins in contaminated cereals exacerbates the management of affected animals (Dll and
Dnicke, 2011).
Due to synergistic interactions co-contaminated samples might elicit adverse effects even the
concentrations of the individual mycotoxins do not surpass legal guidance values. However, in their
present state regulations do not address co-contamination and associated risks. For example, there is
data that a 5% growth depression is to be expected in pigs fed naturally deoxynivalenol (DON)contaminated diets containing 0.6 mg kg1 DON, whereas 1.8 mg kg1 DON is required to obtain
a similar effect if pure toxin is used. Serbian Directive as well as the European Unions guidance for
DON in complete feed for pigs is 0.9 mg/kg (Streit et al, 2013).
129
Based on the discussion above it is also important to emphasize the process of detection of
mycotoxins. Mycotoxins are a major analytical challenge because of the range of chemical
compounds they represent, and the array of feed matrices in which they are found. Analysis is
essential for determining the extent of mycotoxin contamination, for risk analysis, for confirming
the diagnosis of a mycotoxicosis and for monitoring mycotoxin mitigation strategies. Quantifying
these compounds requires sophisticated laboratory equipment and trained people (Krska et al, 2008;
Rahmani et al, 2009). The development of immunological methods for mycotoxin detection,
especially enzyme-linked immunosorbent assays (ELISA), although screening test, was a major
step toward developing rapid, repeatable and sensitive assays. But there are other influences that
can disturb the validity of the results. Sampling is the greatest source of error when quantifying
mycotoxin contamination. It is difficult to obtain feed samples representative of what may have
caused a mycotoxicosis incident or to represent large grain consignments. These difficulties arise
because of the uneven distribution of toxin within a commodity, in which mycotoxins occur (CAST,
2003; Whitaker, 2003, 2006). Also, it has recently become apparent that there is a connection
between masked, hidden, bound and/or conjugated mycotoxins in feedstuffs and the potential
for animals to perform poorly. Mycotoxin conjugates may be formed as a result of plant metabolism
(Berthiller et al, 2007), but are not detected by using conventional analytical procedures. These
conjugates will be hydrolyzed following ingestion, thereby increasing exposure to the precursor
toxin.
As the latest laboratory results showed permanent presence of some mycotoxins and the cooccurance of few of them, it is important to establish better prevention (Nesic et al, 2013), as well
as the predictive models in regard to meteorological forecasts. However, special attention has to be
paid to the control system and regular monitoring of cereals, feed and food has to be organized.
Since managing impact of these contaminants is still great practical challenge, only timely and
adequate reaction is the right solution. There are a number of approaches that can be taken to
minimize mycotoxin contamination in the food chain: prevention of fungal growth and therefore
mycotoxin formation, strategies to reduce or eliminate mycotoxins from contaminated feedstuffs or
diverting contaminated products to low risk uses. A field to table combating program against
mycotoxins should involve Good Agricultural Practice, Good Manufacturing Practice, Good
Storage Practice and applying the seven HACCP (Hazard Analysis Critical Control Points)
principles within the framework of the quality systems, as well as Good Laboratory Practice and the
methods for mycotoxin detection which must meet the highest standards.
Acknowledgments
This paper is published as part of the projects of the Ministry of Education, Science and
Technological Development of Republic of Serbia No. III46009 and 031071.
References
1.
2.
3.
4.
Berthiller F., Sulyok M., Krska R., Schuhmacher R.: Chromatographic methods for the simultaneous
determination of mycotoxins and their conjugates in cereals. Int. J. Food Microbiol., 119, 3337, 2007
Brase S., Encinas A., Keck J., Nising C.F.: Chemistry and biology of mycotoxins and related fungal
metabolites. Chem. Rev., 109, 39034399, 2009
Bryden W.L.: Mycotoxin contamination of the feed supply chain: Implications for animal productivity
and feed security. Animal Feed Science and Technology, 173, 134 158, 2012
Bryden W.L.: Mycotoxins and mycotoxicoses: significance, occurrence and mitigation in the food
chain. In: Ballantyne B, Marrs T, Syversen T (Eds.), General and Applied Toxicology. Third ed. John
Wiley & Sons Ltd, Chichester, UK, 2009, 35293553.
130

5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
CAST: Mycotoxins risk in plant, animal and human systems, Task Force Report, No. 139. Council for
Agricultural Science and Technology, Ames, Iowa, 2003, 1-191.
Cole R.J., Scheweikert M.A., Jarvis B.B.: Handbook of Secondary Fungal Metabolites, Vols. IIII.
Academic Press, CA, USA, 2003.
Dll S., Dnicke S.: The Fusarium toxins deoxynivalenol (DON) and zearalenone (ZON) in animal
feeding. Preventive Veterinary Medicine, 102, 132 145, 2011
EFSA: Scientific Opinion on the risks for public health related to the presence of zearalenone in food.
EFSA Journal, 9 (6), 2197, 2011
Fink-Gremmels J.: Mycotoxins in cattle feeds and carry-over to dairy milk: a review. Food Addit.
Contam., 25, 172180, 2008
Haschek W.M., Voss K.A., Beasley V.R.: Selected mycotoxins affecting animal and human health. In:
Haschek, W.M., Rousseaux, E.C.G., Wallig, M.A. (Eds.), Handbook of Toxicological Pathology, vol. 1,
second ed. Academic Press, New York, 2002, 645699.
Jakic-Dimic D., Nesic K., Savic B., Keckes J., Pisinov B.: Presence of fungi in poultry feed and effects
of contaminants on health status. Proceedings of the XIV International Symposium Feed Technology,
Novi Sad, Serbia, 248-253, 2010
Jakic-Dimic D., Nesic K.: Mycotoxins in feed for poultry. Proceedings of the 4th International Congress
on Food and Nutrition and MycoRed 2nd Mediterranean Workshop on Mycotoxins and Toxigenic
Fungi, October 12-14, 2011, Istanbul, Turkey, 2011, 229.
Kos J., Levi J., uragi O., Koki B., Miladinovi I.: Occurrence and estimation of aatoxin M1
exposure in milk in Serbia, Food Control, 38, 41-46, 2014
Kos J., Mastilovi J., Jani Hajnal E., ari B.: Natural occurrence of aflatoxins in maize harvested in
Serbia during 20092012, Food control, 34, 31-34, 2013
Krska R., Schubert-Ulrich P., Molinelli A., Sulyok M., McDonald S., Crews C.: Mycotoxin analysis: an
update. Food Addit. Contam. 25, 152163, 2008
Nesic K., Ivanovic S., Nesic V.: Fusarial Toxins - Secondary Metabolites of Fusarium Fungi. Rev.
Environ. Contam. T., 228, 101-120, 2014
Nesic K., Jaki S., Kapetanov M.: Prevention, control and detection of Fusarial toxins. Matica srpska
J. Natural sciences, 124, 91-99, 2013
Nesic K., Pavlovi N.: Current mycotoxicological profile of Serbian feed. Proceedings of the
International 57th Meat Industry Conference, June 10-12, 2013, Belgrade, Serbia, 2013, 320-323.
Nesic K., Resanovic R., Nesic V., Sinovec Z.: Efficacy of mineral and organic adsorbent in alleviating
harmful effects of zearalenone on pigs performance and health. Acta Veterinaria 58, 2-3, 211-219, 2008
Petterrson H.: Controlling mycotoxins in animal feeds. In: Magan, N., Olsen, M. (Eds.), Mycotoxins in
Food. Woodhead Publishing, Cambridge, 2004, 262304.
Rahmani A., Jinap S., Soleimany F.: Qualitative and quantitative analysis of mycotoxins. Compr. Rev.
Food Sci. Food, 202-251, 2009
Republic Hydrometeorological Service of Serbia. Agrometeoroloski uslovi u proizvodnoj 2011/2012
godini na teritoriji Republike Srbije, 2012.
Republic Hydrometeorological Service of Serbia. Agrometeoroloski uslovi u proizvodnoj 2013/2014
godini na teritoriji Republike Srbije, 2014.
Shier W.T., Abbas H.K., Wearer M.A., Horn B.W.: The case for monitoring Aspergillus avus
aatoxigenicity for food safety assessment in developing countries. In: Abbas, H.K. (Ed.), Aatoxin and
Food Safety. CRC Press, Boca Raton, 2005, 291311.
Slubeni glasnik Republike Srbije, Pravilnik o izmeni pravilnika o kvalitetu hrane za ivotinje 27, 2014
Slubeni glasnik Republike Srbije, Pravilnik o kvalitetu hrane za ivotinje 4, 2010
Streit E., Naehrer K., Rodrigues I., Schatzmayr G.: Mycotoxin occurrence in feed and feed raw
materials worldwide: Long-term analysis with special focus on Europe and Asia. J. Sci. Food Agric. 93,
28922899, 2013.
Whitaker T.B.: Detecting mycotoxins in agricultural commodities. Mol. Biotech. 23, 6171, 2003
131

29. Whitaker T.B.: Sampling foods for mycotoxins. Food Addit. Contam. 23, 5061, 2006
30. Yu Z., Zhang L., Wu D., Liu F.: Anti-apoptotic action of zearalenone in MCF-7 cells. Ecotoxicol.
Environ. Saf., 62, 441446, 2005
132
EFFECTS OF FED DIETS WITH A DIFFERENT N-6/N-3 PUFAS RATIO ON OXIDATIVE

STABILITY, AND PHYSICO-CHEMICAL PROPERTIES OF CHICKENS MEAT
Dragan Milievi1*, Dejana Trbovi1, Zoran Petrovi1, Breda Jakovac-Strajn2, Ivan Nastasijevi1,
Nenad Parunovi1, Mirjana Luki1
1
Institute of Meat Hygiene and Technology, Belgrade, Republic of Serbia

Faculty of Veterinary Medicine University of Ljubljana, Ljubljana, Republic of Slovenia
*
Abstract
The objective of this study was to determine the fatty acid (FA) profile, oxidative stability of lipids,
measured by the thiobarbituric acid (TBA) and physicochemical properties of raw and heatprocessed meat of chickens fed with a different n-6/n-3 PUFAs ratio (14.38, 12.91, 13.40 and
12.85, respectively), resulting from the different dietary ingredient (particularly soybean meal and
sunflower oil). Samples of breast and thigh muscles of broilers equal to 48 from two farms (Farm
I and Farm II) were taken during 2012. The chickens were fed ad libitum on commercial diets for
growing broilers which contained different feed ingredients. Generally, all parameters measured
were influenced by the interaction of growth performances, the quality characteristics of the
chicken meat, and treatment group (farms and diets) by at most 5%. The farm treatments modify
significantly growth performance and feed intake of the broilers between farms. The
physicochemical properties, including cooking loss, color, pH, lipids and thiobarbituric acid (TBA)
in raw and heat-processed breast and drumstick meat samples, differed significantly. Content of
total iron (Fe) did not differ significantly between meat samples. Comparing FAs composition in
diet with drumstick and breast muscle, the diet was comprised mainly of polyunsaturated FA
(PUFA) then monounsaturated FA (MUFA) and saturated FA (SFA) (100:47:27%) versus
drumstick and breast muscle, where the predominant FAs was MUFA, in comparison to SFA and
PUFA (100:78:55%), although the proportion of FAs with four or more double bonds was
metabolized specific. It may be concluded that, higher n-6/n-3 PUFAs ratio in the diets improved
the FAs ratio in the meat samples, however, the higher n-6/n-3 PUFAs ratio in meat adversely
affected the oxidative stability as manifested by the significantly higher TBA concentrations in
heat-processed breast and drumstick meat (4.69 0.93 to 5.52 1.44 and 5.87 1.27 to 8.63
0.88 MAL/kg, respectively), compared with those of the group where are low n-6/n-3 PUFAs ratio
in meat samples (2.49 1.08 to 5.46 0.19 and 3.06 0.99 to 4.53 0.10 MAL/kg, respectively).
Therefore, our results suggest that poultry meat quality is a complex and multivariate property,
which is affected by multiple interacting factors.
Keywords: chicken meat, physicochemical properties and oxidative stability.
Introduction
Effect of diet on human health is a major problem not only in developing countries but also in
highly industrialized countries, where consumers are becoming more demanding in relation to food
products. Chicken meat is the fastest growing component of global meat demand. In Serbia the
consumption of chicken meat is higher compared to other meats, as it is preferred over other meat
for its health appeal because of its nutritional value, but also its taste and appearance
(Bogosavljevic-Boskovic et al., 2010). Compared to other meats, chicken lipids are characterised
by relatively high levels of unsaturated fatty acids, especially polyunsaturated fatty acids (PUFA),
which are considered as a positive and healthy aspect by consumers (Bonoli et al., 2007).
However, commercial chicken meat is known to be deficient in n-3 FA and rich in n-6 FA. From
133
the human health point of view, it is important to have low saturated fat and adequate amount of
PUFA preferably less n-6 FA, balancing n-3 FA. The modern human diet is deficient in n-3 FAs,
which has been linked to the increase in several degenerative diseases such as cardiovascular
disease, diabetes, arthritis, cancer and mental illness (Nichols et al., 2010). Therefore it is important
to enrich chicken meat with n-3 FA and lower the saturated and n-6 FA content. Decreasing the n6/n-3 FA ratio in chickens is important in order to make chicken meat a functional food (Rondelli et
al., 2004). Of all the meat constituents, the lipid fraction has the highest susceptibility to
modification, in contrast to protein with aminoacidic composition determined by the genetic code.
As a result, feeding strategies have been adopted to alter lipid composition of broilers meat (Kouba
and Mourot, 2011). However, the increasing amount of PUFA content in poultry diets could
increase the degree of broilers fat unsaturation and probably the rate of tissue lipid peroxidation,
which reflects the so-called thiobarbituric acid reactive substance (TBA) value of broilers tissue
(Cherian et al., 1996). Lipid oxidation is responsible for the production of undesirable compounds
(from both a toxic and sensory point of view) which is of significant importance in consumer
purchase decisions for fresh meat (Risvik, 1994), and in general causes shelf-life quality
deterioration in meat (Bou et al., 2009). Therefore, the present study was conducted to determine
the fatty acid (FA) profile, oxidative stability of lipids, measured by the thiobarbituric acid (TBA)
and physicochemical properties of raw and heat-processed meat of chickens fed with a different n6/n-3 PUFAs ratio and a possible interaction between these factors.

Animals and diets
A total number of 48 samples of breast and thigh meat were taken from chilled broiler carcasses
collected during 2012. Two homogeneous groups of male and female (50%:50%) Ross 508 and
Hubbard broilers were reared under commercial conditions on two farms in Vojvodina in the
northern part of Serbia, and fed ad libitum commercial diets for growing broilers with different
ingredients (Table 2). All diets were formulated to meet the minimum requirements for broilers
and were proved as mash feed.
Sample preparation
At the age of 39 day, 12 birds selected on the basis of live weight within as wide range as
possible, were slaughtered at a commercial abattoir. Feed gain and body weight (b.w.) had been
recorded at weekly intervals. Feed conversion ratio corrected for mortality was then calculated
(Table 1). After slaughtering and dressing, the hot carcasses were chilled for 2 h at 4C . The
carcasses were weighed and refrigerated for 24 h.The breast with skin (Mm. pectoralis major) and
thigh meat with skin (Mm. of regio tibio-femoralis) were cut, separated and weighed (Table 1).
Analyses
Meat color was evaluated immediately after deboning using colorimeter (Minolta Chroma Meter
RC-400, Japan). The CIE system color profile of lightness (L*), redness (a*) and yellowness (b*)
was measured by reflectance colorimeter using illuminant source D. The colorimeter was calibrated
throughout the experiment using a standard white ceramic tile. Color was measured on skin side
surface of each left breast in area free of obvious color defect, bruises and blood spots, while pH
value was measured 24 h postmortem, by inserting a portable pH meter (Testo 205, AG, Germany)
along with a temperature probe into the cranial part of each left breast sample. For determine
cooking loss whole samples of both muscles (about 20 g) were placed in open aluminium pans
and roasted in an electric oven pre-heated to 220C for 30 min. Then the samples were
equilibrated to room temperature and reweighed. Cooking loss determined as percentage of weight
134
lost during cooking. Total lipid was determined in raw and roasted breast and thigh meat with
skin. Total lipid content was determined by extraction of fat by petroleum ether and Soxhlet
extractor after acid hydrolysis of the samples (SRPS ISO, 1992). Total lipids were extracted from
the diet, thigh and breast muscle samples and further converted to fatty acid methyl esters (FAMEs)
(0.25 M trimethylsulfonium hydroxide - TMSH in methanol as the methylating agent). FAMEs
were determined by capillary gas chromatography on GC Shimadzu 2010 (Kyoto, Japan) equipped
with flame ionization detector and capillary HP-88 column (100 m 0.25 mm 0.20m, J&W
Scientific, USA). Thiobarbituric acid (TBA) was determined according to the method proposed by
Tarladgis et al. (1964) and Holland (1971). TBA content was expressed as mg of malondialdehyde
per kg of meat (mg MAL/kg). Determinations of Fe in meat samples were performed by flame
atomic absorption spectrophotometry (Analyst 300, Perkin Elmer, USA) following the methods
described by Jorhem (2000).
Data from the experiment was analysed by descriptive statistics (mean, standard deviation, and
range). ANOVA with Tukey's test was performed, in order to determine statistical differences
among examined parameters between farms (P < 0.05).
Results
Growth performance of the broilers
The Growth performances of broilers fed various dietary and composition of the commercial
broiler diets which were used for feeding chicks, are shown in Tables 1 and 2. Average live
weight, daily gain, carcass, breast, and drumstick weights were different among the groups of
broilers. At the same age, the highest average daily body gains (57 g), average daily feed intake
(103.9 g) and carcass (1764.87 227.83 g), breast (647.95 78.70 g), and drumstick weights
(536.40 88.41 g) were in chickens from Farm I in the autumn. Despite the different diet
compositions, nutritive values were similar during the investigation (Table 2). In regard to fatty
acids content, n-6/n-3 PUFAs ratio were different (14.38, 12.91, 13.40 and 12.85, respectively),
resulting from the different dietary ingredient, particularly soybean meal and sunflower oil.
Physicochemical properties, FAs rations and TBA values in broiler meat
Physicochemical properties, FAs rations and oxidative status of raw broiler meat are shown in
Table 3 and Figs 1 and 2. The physicochemical properties, including cooking loss, color, pH, lipids
and thiobarbituric acid (TBA) in raw and heat-processed breast and drumstick meat samples,
differed significantly between treatment group. Content of total Fe did not differ significantly
between samples. Comparing FAs composition in diet with drumstick and breast muscle, the diet
was comprised mainly of PUFA then MUFA or SFA (100:47:27 %) versus drumstick and breast
muscle, where the predominant FAs was MUFA, in comparison to SFA and PUFA (100:66-77:5670 %), except in the treatment group were is sunflower oil added in diets in 4.45 % (100:71-96:3751 %). Although the proportion of FAs with four or more double bonds was metabolized specific,
the n-6/n-3 PUFAs ratio in breast and drumstick muscle samples was higher in broilers fed with
higher level of the sunflower oil and the soybean meal (29.01:1 and 20.84:1 respectively). These
results indicated that n-6/n-3 PUFAs ratio in broiler meat large in magnitude, was significantly
different (P<0.001). The average TBA values in drumstick and breast muscle (0.04 and 0.02 mg
MAL/kg, respectively) in treatment group Ib was significantly (P<0.001) lower than those from the
other treatment group. The average TBA values in drumstick and breast muscle in other group
varied between 0.067 to 0.09 MAL/kg, both in breast and drumstick muscle.
135
Table 1. Growth performances of broilers fed various dietary ( X Sd, Range)

Farm
Parameter
(range)
Age at slaughter (d)

Average daily body gain (g)
Average daily feed intake (g)
Feed gain (g:g)
Carcass weight (g)
Breast weight (g)
Thigh weight (g)
I (n = 12)
38
57
103.9
1.82
1279.45174.02
(1021.7- 1681.2)
452.5 80.17
(339 - 628)
389.89 51.19
(316.8 - 494)
II (n = 12)
38
39
84.33
2.16
1223.3 116.38
(1055 - 1486.4)
427.70 53.44
(337.1 - 547.2)
392.9 39.20
(354 - 472.7)
Ib (n = 12)
39
57
100.51
1.76
1764.87 227.83
(1498.8 - 2226.7)
647.95 78.70
(510 - 775.1)
536.40 88.41
(443.2 - 703)
IIb (n = 12)
38
52
106.1
2.04
1400.70 130.01
(1186 - 1712.7)
470.62 61.15
(393.4 - 614.1)
476.78 48.20
(398.6 - 572.4)
I, II - farms, n - number of samples, a - summer, b - autumn/winter
Table 2. Composition and main characteristics of the commercial broiler diet

Ingredients/
Amount (%)
Corn
Starter (0 - 15 d)
Ia
55.2
IIa
55.12
Ib
50.06
IIb
49.45
Grover (16 - 32 d)
Farm
a
a
I
II
Ib
IIb
56.03
56.03 39.08
49.6
Finisher (33 - 38 d)
Ia
61.1
IIa
55.8
Ib
55.8
IIb
52.75
SbM
34.8
34.8
18
30.9
30.9
25.4
29.8
(46% CP)
SbM
15
33.60
31.60
29.4
23.5
24.5
(44% CP)
Wg
3.0
3.0
6.0
6.0
6.0
6.0
20.0
10.0
6.0
6.0
10
10
SfM
3.0
(33% CP)
Yeasts
1.5
CG
2.0
2.0
2.0
SfO
1.65
1.65
2.5
2.62
2.4
2.4
4.42
3.45
3.05
3.45 3.45
4.45
L-Lysine
0.27
0.27
0.29
0.36
0.02
0.02
0.08
0.11
0.16
0.05 0.24
0.11
DL-Meth.
0.28
0.28
0.30
0.28
0.15
0.15
0.17
0.15
0.15
0.11 0.14
0.15
Treonine
0.12
0.12
0.13
0.14
0.03
0.03
0.05
0.07
0.06
Ch. 60%
0.13
0.13
0.13
0.14
0.10
0.10
0.10
0.10
0.10
0.10 0.10
0.10
VMP 0.5%
0.60
0.60
0.60
0.60
0.60
0.60
0.50
0.50
0.50
0.50 0.50
0.50
Chemical composition (%)
Crude protein 22.32 22.82 22.46 22.25
19.24
20.39 20.1
20.62 18.71 18.83 19.12 19.82
Water
11.07 10.23 11.50 13.19
10.69
10.73 11.40 12.79 10.30 11.46 11.11 11.57
Crude fibre
1.15 1.68
1.57
1.88
1.73
1.50
1.66
1.75
1.34
1.55
1.63
2.68
Fat
4.75 4.48
4.56
4.60
4.69
4.30
4.92
4.90
6.32
5.95
6.10
6.20
Ash
5.48 5.80
5.63
5.61
5.32
6.04
5.52
5.21
4.62
4.88
4.98
5.44
Ca
0.82 0.95
0.86
0.88
0.74
1.03
0.86
0.81
0.81
0.74
0.78
0.81
Available P
0.71 0.70
0.68
0.65
1.73
0.69
1.05
0.73
0.58
0.70
0.64
0.63
Sums of fatty acids
SFA
15.3 16.05 16.0 16.62
15.7
16.83 16.83 16.95
15.6
16.06
15.8
15.8
MUFA
27.6 26.83 28.09 29.85
27.9
27.79 28.40 29.53
27.2
25.95
27.0 27.88
PUFA
57.1 57.12 55.92 53.53
56.4
55.4 55.77 55.53
57.2
58.01
57.2 56.38
n-3
3.49 3.65
3.58
3.61
3.53
4.14
3.67
3.36
3.72
4.17
3.98
4.07
n-6
53.6 53.47 52.33 49.92
52.87
51.25 51.45 50.17 53.48
53.84
53.21 52.31
n-6/n-3
15.3 14.65 14.61 13.83
14.98
12.38 14.10 14.93 14.38
12.91
13.40 12.85
PUFA/SFA
3.73 3.56
3.49
3.22
3.60
3.29
3.38
3.27
3.66
3.61
3.62
3.58
MUFA/
1.65 1.67
1.75
1.79
1.77
1.65
1.72
1.72
1.74
1.61
1.71
1.77
SFA
ME (MJ/kg)
12.65 12.65 12.65 12.65
13.00 13.00 13.00 13.00 13.45 13.45
13.45 13.45
I, II - farms, a - summer, b - autumn/winter, SbM - soybean meal, Wg - wheat grain, SfM - sunflower meal, CG - corn
gluten, SfO - sunflower oil, DL MethDL - methionine, Ch - choline, VMP - vitamin + mineral premix, SFA - saturated
FA, MUFA - monounsaturated FA , PUFA - polyunsaturated FA
136
Table 3. Chemical composition and physicochemical properties of raw and heat-processed breast
and drumstick meat
Treatment group
Parametar
Breast
Ia
Ib
IIa
IIb
36.11 1.70 ***

(33.58-39.71)
58.08 3.71 *
(52.30-66.08)
1.40 0.67,***
(0.14-2.54)
4.31 1.77 ***
(1.20-6.99)
5.40 0.20 ***
(5.11-5.71)
4.06 1.37
(2.26-7.74)
5.53 0.61 ***
(5.01-6.78)
6,08 0.34 ***
(5.50-6.55)
0.08 0.036 ***
(0.04-0.16)
29.06 2.80 ***

(24.04-32.86)
53.96 3.70 **
(48.70-60.78)
-0.172 0.76 ***
(-1.41-1.47)
3.40 1.51 **
(0.59-5.55)
5.90 0.18 ***
(5.57-6.15)
3.94 0.42 *
(3.44-4.76)
4.19 1.15 ***
(2.30-5.62)
6.25 0.78***
(5.00-7.00)
0.018 0.012 ***
(0.000-0.03)
35.67 3.18 ***

(30.32-40.12)
56.72 2.90 **
(51.94-63.64)
0.47 0.37 **
(0.01-1.11)
2.00 0.70 ***
(0.76-2.86)
5.89 0.11 ***
(5.70-6.10)
4.34 0.55
(3.62-5.14)
3.05 1.11 ***
(1.80-5.79)
3.57 0.155***
(3.42-4.00)
0.086 0.05 ***
(0.03-0.17)
31.70 2.73 ***

(25.60-34.83)
58.26 3.20 **
(53.94-62.82)
0.46 0.92 *
(-0.64-2.36)
4.93 1.47 ***
(2.78-8.91)
5.84 0.14 ***
(5.62-6.15)
4.30 0.31 *
(3.90-4.90)
2.61 0.77 ***
(1.32-3.92)
3.72 0.61***
(3.04-4.90)
0.067 0.012 ***
(0.05-0.09)
32.60 2.10 **
(29.96-36.10)
57.20 1.87 ***
L*
(54.66-60.05)
2.83 1.67 *
a*
(1.10-7.48)
4.71 1.95 **
b*
(2.44-7.63)
5.71 0.29 ***
pH 24
(5.21-6.10)
7.88 1.41
Fe total (mg/kg)
(6.03-10.34)
9.63 0.64 ***
raw
Lipids
(8.18-10.81)
(%)
heat14.73 0.55 ***
processed
(14.00-15.50)
TBA (mg MAL/kg)
0.07 0.02 **
raw
(0.05-0.12)
* P < 0.05; ** P < 0.01; *** p 0.001
29.69 3.48 *
(23.73-36.25)
52.93 2.58 ***
(49.01-56.36)
2.02 0.57
(1.18-3.39)
5.91 1.22 ***
(4.36-8.20)
6.45 0.25 ***
(6.02-6.77)
8.42 1.46
(6.08-11.18)
9.85 1.98 ***
(8.12-15.29)
13.37 0.95 ***
(12.00-15.00)
0.04 0.014 ***
(0.004-0.06)
33.34 4.58 **
(24.78-41.34)
58.82 2.21 ***
(54.91-62.33)
1.26 0.79 ***
(0.25-3.11)
2.86 1.10 ***
(1.10-4.60)
6.44 0.17 ***
(6.15-6.74)
7.45 0.98
(6.07-9.24)
5.20 0.45 ***
(4.33-5.70)
10.54 0.22***
(10.00-11.00)
0.087 0.064 *
(0.03-0.24)
29.60 2.37
(25.06-33.36)
58.10 3.22 ***
(49.54-61.84)
3.10 1.07 ***
(1.30-4.65)
7.67 2.77 ***
(1.47-11.55)
6.51 0.09 ***
(6.38-6.68)
8.12 0.69
(7.00-9.10)
8.16 2.26 ***
(5.27-11.26)
11.07 2.04 ***
(8.11-14.11)
0.09 0.01 ***
(0.07-0.12)
Cooking loss (%)

L*
a*
b*
pH 24
Fe total (mg/kg)
Lipids
(%)
raw
heatprocessed
TBA (mg MAL/kg)
raw
Drumstick
Cooking loss (%)
The concentrations of total lipid and TBA values in heat-processed broiler meat are shown in
Table 3 and Figure 3. Heat-processed broiler meat (Table 3) belonging to chickens from Farm II
contained lower quantities of total lipids in breast (3.57 to 3.72%) and drumstick (10.54 to 11.07
%) than samples from Farm I in breast (6.08 to 6.25 %) and drumstick (13.37 to 14.73%). These
differences were significant (P < 0.001). TBA values as a measure of lipid oxidation in heatprocessed breast and drumstick chicken meat are shown in Figure 3. A higher (P 0.001) TBA
values was found in the muscle from the Farm II. The average TBA values in samples of heatprocessed drumstick muscle of chickens from Farm II ranged from 5.87 1.28 (mg MAL/kg) in
summer to 8.63 0.88 (mg MAL/kg) in autumn, compared to those from the Farm Ib, where the
average TBA values in samples of heat-processed breast muscle was 2.49 1.08 (mg MAL/kg)
and 3.06 0.99 (mg MAL/kg) in drumstick muscle. These differences (p < 0.001) could be
137
attributed to initial higher level of TBA values in samples from farm II, as well as high n-6/n-3
PUFAs ratio in breast and drumstick muscle.
100%
PUFA
90%
MUFA
80%
SFA
70%
60%
50%
40%
30%
20%
10%
0%
B (Ia)
D (Ia)
B (Ib)
D (Ib)
B (IIa)
D (IIa)
B (IIb)
D (IIb)
Fig. 1. The fatty acid (FAs) rations (% of total fatty acids) in raw breast (B) and raw drumstick (D) meat
from farms I and II during summer (a) and autumn (b) fed dissimilar diets
40
12
35
(mg MAL/kg)
n-6/n-3
30
25
20
12
10
10
15
10
B (I a)
D (I a)
B (I b)
D (I b)
B (II a)
D (II a)
B (II b)
D (II b)
B (Ia)
D (Ia)
B (Ib)
D (Ib)
B (IIa)
D (IIa)
B (IIb)
D (IIb)
Fig. 2.(A) n-6/n-3 PUFA ratio in raw breast (B) and raw drumstick (D) meat from farms I and II during
summer (a) and autumn (b) fed dissimilar diets (B) Malondialdehyde (mg MAL/kg) content in heatprocessed breast (B) and drumstick (D) meat with skin from farms I and II during summer (a) and autumn
(b)
Discussion
In the present study, we analyzed the effect of diets with a different n-6/n-3 PUFAs ratio resulting
from the different dietary ingredient (particularly soybean meal and sunflower oil), on the fatty acid
(FA) profile, physicochemical properties and oxidative status of raw and heat-processed breast and
drumstick meat. The results of the study indicate that all parameters measured were influenced by
the interaction of growth performances, the quality characteristics of the chicken meat, and
treatment group (farms and diets). Because of inclusion of grain, corn, plant seeds or oils, which
138
are rich in C18:2, poultry meat of different kinds generally has as high n-6/n-3 ratio as pork and
higher than beef and lamb, whereas the P/S ratio is closer to 1.0 (Li et al., 1998). These results are
in contrast to those observed in our study where P/S ratio was below of 1.0 (0.39 to 0.97 in breast
and 0.76 to 1.04 in drumstick). However, P/S ratio is better in samples originating from farm I then
from farm II. A lower dietary n-6/n-3 PUFA ratio provides health benefits to consumers. In typical
Western diets, the n-6/n-3 PUFA ratio is high, ranging between 10:1 and 30:1 (Hibbeln et al.,
2006), while it should remain in the 1:11:4 range (Lands, 2005). The ideal dietary n-6/n-3 PUFA
ratio, recommended by an international panel of lipids experts, is approximately 2:1 (Simopoulos et
al., 1999). In the present experiment, the ideal n-6/n-3 PUFA ratio was not achieved and was far
from recommended, ranged from 14.1:1 to 29.01:1 in breast meat, versus 18.08:1 to 20.84:1 in
drumstick meat. High n-6/n-3 PUFA ratio corresponded to low P/S ratio in samples originating
grom farm II.
Concerning results in the present studies, this result suggests that dietary lipid source or n-6/n-3
PUFA ratio did not influence its color characterized in scale L*,a*, and b* (data not presented). For
example, Bianchi et al., (2009) reported that dietary use of vegetable oils produced darker and a
higher yellowness of breast meat than animal fats. In regarding to diferences between FAs
composition in diet with thigh and breast muscle, the results in this study supported the hypothesis
that chicks can better assimilate FAs from fat sources that are rich in UFA than from fats that are
rich in SFA (Smits et al., 2000). Friedman and Nylund (1980), reported that the absorption of long
chain SFA is limited by their incorporation rate into micelles. Saturated FA are less rapidly
incorporated into micelles than polyunsaturated FA because of their non- polarity, which makes
them rely on an adequate presence of bile salts for efficient emulsification (Polin et al. 1980,
Dnicke, 2001).
The TBA test is a sensitive and useful method for monitoring lipid oxidation in many systems and
under a wide variety of conditions. The increase in the TBA content in heat-processed breast and
drumstick meat noted in the present study, was accompanied by a higher proportion n-6/n -3 PUFA
ratio in the total FA pool. Several studies have reported, an increase in n-6/n -3 PUFA ratio in meat
was followed by an increase in the concentrations of lipid oxidation products (measured as TBA
content) or cholesterol oxidation products, both in raw meat (Zanini et al., 2006: Cortinas et al.,
2004) and heat-processed meat (Eder et. al., 2005). Also, the results (Fig. 2B) revealed that the
initial MAL levels in meat, which strongly depend on fat content, composition, and fatty acid
composition, determine the absolute MAL levels after cooking. Similar results have been reported
by Vasavada et al. (2006).
It is important to point out the role that haemoglobin can perform in the beginning of
lipoperoxidative process. In the case of meat, it has been found that the haeme group (contains iron,
Fe) present in some proteins would have an important catalytic effect in the oxidative
decomposition of PUFA. In addition, Kranen et al. (1999) suggested that poultry leg and breast
contain significant concentrations of haemoglobin, 0.67 mg/g and 0.24 mg/g, respectively and in
consequence, when the animals are slaughtered, the biochemical processes that turn the muscle into
meat allow haemoproteins to control the lipoperoxidative processes that definitively accelerate the
deterioration of the meat (Alayash et al., 2001). Concerning the differences in the MAL levels in
meat between farms and season it is important to emphasise that this differences can be attributed to
the differences in the type of ingredient added to feeds, particularly corn, soybean meal and
sunflower oil, the main source of dietary fat.
In fact, it was noted that production parameters for broilers from the farms were very different. The
performance of the birds was not within the expected range of the breed standard (Aviagen, 2007),
and so the study did not reflect commercial performance. These data show much worse production
parameters for broilers at Farm II compared with Farm I, probably due to the problems induced by
microbiological factors (high mortality rate 28.37%, data not presented), which consequently
139
might alter the chemical composition, and physicochemical properties of the meat. In addition, to
explain some discrepancy in obtained results with other authors, linked to possible microbiological
factor which could induce worst production results, cells involved in the inflammatory response are
typically rich in the n-6 fatty acid. PUFA are important constituents of the phospholipids of the
membranes of inflammatory cells. Typically these contain a relatively high proportion of the n-6
PUFA (Calder, 2012).
Conclusion
This study contributes an update to the literature data about fatty acid (FA) profile, oxidative
stability of lipids, measured by the thiobarbituric acid (TBA) in the meat cuts obtained from
chickens from the conventional commercial rearing system. From the results of the present study, it
can be concluded that, higher n-6/n-3 PUFAs ratio in the diets improved the FAs ratio in the meat
samples. However, the higher n-6/n-3 PUFAs ratio in meat adversely affected the oxidative stability
as manifested by the significantly higher TBA concentrations in heat-processed breast and
drumstick meat. Results from the current study can be used as a feeding strategy in order to improve
poultry production. Therefore, further studies should be encouraged to evaluate the nutritive value
of chicken meat produced through new and alternative rearing systems, the utilisation of animal
feed fortified in some nutrients, and better slaughtering practices, which currently also contribute to
the variability of the nutrient composition of meat.
Acknowledgements
This study was supported by the projects no. TR 31008, funded by the Ministry of Education,
Science and Technological Development of the Republic of Serbia.
References
1. Alayash A.I., Patel R.P. and Cashon R.E.: Redox reactions of hemoglobin and myoglobin: Biological
and toxicological implications. Antioxidants & Redox Signalling, 3, 313-327, 2001
2. Aviagen.:
Ross
308
Broiler
Performance
Objectives
June
2007.
http://aviagen.com/ss/assets/Tech_Center/Ross_Broiler/Ross_308_Broiler_Performance_Objectives.pdf
. 2007
3. Bianchi M., Ferioli F., Petracci M., Caboni M.F., Cavani C.: The influence of dietary lipid source on
quality characteristics of raw and processed chicken meat. European Food Research and Technology,
229, 23392348, 2009
4. Bogosavljevic-Boskovic S., Mitrovic S., Djokovic R., Doskovic V., Djermanovic V.: Chemical
composition of chicken meat produced in extensive indoor and free range rearing systems.
African Journal of Biotechnology, 53, 90699075, 2010
5. Bonoli M., Caboni M.F., Rodriguez-Estrada M.T., Lercker G.: Effect of feeding fat sources on the
quality and composition of lipids of precooked ready-to-eat fried chicken patties. Food Chemistry, 101,
13271337, 2007
6. Bou R., Codony R., Tres A., Decker E.A., Guardiola F.: Dietary strategies to improve nutritional value,
oxidative stability, and sensory properties of poultry products. Critical Reviews in Food
Science and Nutritio, 49, 800822, 2009
7. Calder C. Philip.: Fatty acids Long-chain fatty acids and inflammation. The 5th International
Immunonutrition Workshop was held at Puerto Vallarta, Mexico on 68 April 2011. Proceedings of the
Nutrition Society, 71 , 284289, 2012
8. Cherian G., Wolfe F. W., Sim J. S.: Dietary oils and added tocopherols: effects on egg or tissue
tocopherols, fatty acids, and oxidative stability. Poultry Science, 75, 423431, 1996
140

9.
Cortinas L., Villaverde C., Galobart J., Baucells M. D.et al., Fatty acid content in chicken thigh and
breast as affected by dietary polyunsaturated level. Poultry Science, 83, 11551164, 2004
10. Dnicke S.: Interaction between cereal identity and fat quality and content in response to feed enzymes
in broilers. In: Bedford, M.R., Partridge, G.G. (Eds.), Enzymes in Farm Animal Nutrition. CABI Pub,
Wallingford, UK, 2001, pp. 199236.
11. Eder K., Gru"thal G., Kluge H., Hirche, F. et al.,Concentration of cholesterol oxidation products in
raw,heated processed and frozen meat of broiler chickens fed diets differing in the type of fat and
vitamin E concentration. British Journal of Nutrition, 93, 633643, 2005
12. Hibbeln J. R., Nieminen L. R. G., Blasbalg T. L., Riggs J. A., Lands W. E. M.: Healthy intakes of n-3
and n-6 fatty acids: Estimations considering worldwide diversity. American Journal of Clinical
Nutrition, 83, 14831493, 2006
13. Holland C. D.: Determination of malonaldehyde as an index of randicity of nut meats. Journal of
AOAC, 54, 5, 10241026, 1971
14. Nichols P.D., Petrie J., Singh S.: Long-chain omega-3 oils-an update on sustainable sources. Nutrients
2, 572585, 2010
15. Jorhem L: Determination of metals in foods by atomic absorption spectrometry after dry ashing: NMKL
collaborative study. Journal of AOAC International, 83, 1204-1211, 2000
16. Kouba M., Mourot J.: A review of nutritional effects on fat composition of animal products with special
emphasis on n-3 polyunsaturated fatty acids. Biochimie, 93, 1317, 2011
17. Kranen R.W., Van Kuppevelt T.H., Goedhart H.A., Veerkamp, C.H., Lambooy, E. and Veekamp H.:
Hemoglobin and myoglobin content in muscles of broiler chickens. Poultry Science, 78, 467-476, 1999
18. Lands W. E. M.: Dietary fat and health: The evidence and the politics of prevention: Careful use of
dietary fats can improve life and prevent disease. Annals of the New York Academy of Sciences, 1055,
179192, 2005
19. Li D. A. Ng., Mann N. J., and Sinclair A. J.: Contribution of meat fat to dietary arachidonic acid, Lipids,
33, 437440, 1998
20. Polin D., Wing T., Ki P., Pell K.E.: The effect of bile acids and lipase on absorption of tallow in young
chicks. Poultry Science, 59, 27382743, 1980
21. Risvik E., Sensory properties and preferences. Meat Science, 36, 6777, 1994
22. Rondelli S.G., Martinez O., and Garcia P.T.: Effects of different dietary lipids on the fatty acid
composition of broiler abdominal fat. Brazilian Journal of Poultry Science 6, 171-175, 2004
23. Simopoulos A. P., Leaf A., Salem N., Jr.: Workshop on the essentiality of an recommended dietary
intakes for omega-6 and omega-3 fatty acids. Journal of the American College of Nutrition, 18, 487
489, 1999
24. Smits C.H.M., Moughan P.J., Beynen A.C.: The inhibitory effect of a highly viscous
carboxymethylcellulose on dietary fat digestibility in the growing chicken is dependent on the type of
fat. Journal of Animal Physiology and Animal Nutrition, 83, 231238, 2000
25. SRPS ISO 1443/1992. Meso i proizvodi od mesaOdreivanje sadraja ukupne masti.
26. Tarladgis B. C., Pearson A. M, Dugan L.R.: Chemistry of the 2-thiobarbituric acid test for
determination of oxidative rancidity in foods. II Formation of the TBA malonaldehyde complex without
acid heat treatment. Journal of the Science of Food and Agriculture, 15, 9, 602607, 1964
27. Vasavada M.N., and Cornforth D.P.: Evaluation of Antioxidant Effects of Raisin Paste in Cooked
Ground Beef, Pork, and Chicken. Journal of Food Science, 71, 4, 242246, 2006
28. Zanini S. F., Colnago G. L., Pessotti B. M. S., Bastos M. R. et al., Oxidative stability and total lipids on
thing and breast meat of broiler fed diets with two fat sources and supplemented with conjugated
linoleic acid. LWT - Food Science and Technology, 39, 717723, 2006
141
ECOLOGICALLY SAFE PRODUCTION OF SMOKED COMMON CARP MEAT

Jelena Babi1*, Brankica Kartalovi1, Jelena Petrovi1, Okanovi ore2, Biljana Boi1, Milo
Peli1, Miroslav irkovi1
1

2
Institute of Food Technology in Novi Sad, Serbia
Abstract
Recently, the production of smoked common carp meat has suffered some changes in the production
process that include changing production conditions, as well as adapting recipes and quality to
industrial production conditions. The product obtained in this way has not all those sensory
characteristics of the products which consumers are given by craft production. The aim of this work
was to prove quality, safety and the lower PAHs content of a product obtained in ecological safe
production of smoked common carp meat.
The sensory, chemical and microbiological analyses of the ecologically produced smoked common
carp meat which were done at the Scientific veterinary institute "Novi Sad" confirm quality and
safety of the product and prove that the application of gravel filter gets smoked product without the
presence of carcinogenic polycyclic aromatic hydrocarbons (PAH).
Keywords: ecological, smoking, common carp, gravel filter, safety
Introduction
Production of smoked meat is common in Serbia and the region, which makes smoked products
very popular and consumed quite often. In this region, smoked fish is mostly eaten during the
Christmas fastening period. The consumption of smoked fish in our country is lower compared to
other countries in the EU, but it shows the tendency for the significant growth. The taste of smoked
carp meat resembles the taste of other traditional smoked products and therefore affects the increase
of the fish consumption in our market.
The main technological problem when it comes to the fish meat is that it goes bad very quickly
(FAO, 1995; Adelaja et al, 2013; Rzepka et al, 2013; Cirkovic et al, 2015). This characteristic is
mainly due to the lack of activity of the milk acid, that is, the pH value being close to the neutral
value and high activity of water (aw) being higher than 0,95 (Milijasevic et al, 2010).
In order to make the fish meat more durable (better preserved) as the product, we have to take
knowing and professional care of the fish from the moment they are caught until the moment they
are sold to the consumer. Processing of the fish meat creates adverse conditions for survival of
microorganisms, the main cause of fish meat going bad, and they act in a bacteriostatic,
bactericidical and the combined way (Cirkovic et al, 2002). The fish processing enables selling it on
a much bigger market, that is, it makes it more available for the consumers. The fish processing
industry is not well developed in our country because for many years the amount of fish was just
not enough and also because of the consumers' habits. This led to selling all the fish raw (Cirkovic
et al, 2002; Cirkovi et al, 2015). The main purpose of the smoking process is to preserve the
product. This is partially done by drying it out and partially through the transfer of antimicrobiological compositions, such are the phenols in smoke. Smoked fish is considered to be a
ready to- eat meal (Ready-To-Eat, RTE), and lately, its consumption has increased significantly in
many European countries (Gallart-Jornet et al, 2007). Approximately 15% of the fish for human
consumption is available in either cold or hot variant (Stolyhwo and Sikorski, 2005). In contrast to
142
the times when the smoked fish meat was considered to be an item of luxury, today this is a
common product, available to the great number of people. Within this type of the fish products, the
smoked carp, silver carp and trout meat is available in our country (Pavlicevic et al, 2013).
Recently, the production of smoked common carp meat has suffered some changes in the
production process that include changing production conditions, as well as adapting recipes and
quality to industrial production conditions. The product obtained in this way has not all those
sensory characteristics of the products which consumers are given by craft production. The standard
quality of the hot smoked fish meat is not easily sustainable. It depends on the number of factors
related to the fish farming, fishing, transport, raw material, stunning, slaughtering, cutting off the
head and gills, descaling, exentration, washing, halving, brining, washing under pressure and
draining, drying, hot smoking, cooling, packaging and storing.
The acceptance of smoked fish in developed countries is based primarily on the sensory
characteristics (Yanar et al, 2006), while group of authors Akintola et al. (2013) confirmed the
nutritional qualities and adequacies.
It is known that the smoke, consisting of hundreds of components, also contains at least 100
polycyclic aromatic hydrocarbons (Polycyclic Aromatic Hydrocarbons, PAH) and their alkylated
derivatives. Some of them are proven to have carcinogenic characteristics (Stolyhwo and Sikorski,
2005). According to the latest classification of the carcinogenic PAH compounds, benzo[a]pyrene
(BaP) is a definite carcinogenic (group 1), dibenz[a,h]anthracene is probably carcinogenic (group
2A), but naphthalene, benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene,
benzo[j]fluoranthene and indenol[1,2,3-c,d]pyrene are classified as possible human carcinogens
(group 2B) (International Agency for Research on Cancer, 2012). Wood smoke has also been
classified as definite carcinogenic (group 1) (International Agency for Research on Cancer, 2012;
Essumang et al, 2014).
PAH compounds reach their maximum levels during burning of materials, wood or cigarettes at
500-700 C (Wenzl et al, 2006). This carcinogenic effect needs to be minimized by technological
procedures in the production of the smoked carp meat. These procedures imply construction of craft
smokehouses and chambers that serve the same purpose, choosing the materials with limited fat
content, choosing the most adequate type of wood, the height of the kiln in relation to the fish,
temperature of pyrolysis, the duration of drying and smoking, the temperature in the central part of
the fish and finally, using the different types of filters (Yurchenko and Mlder, 2005; Anggraini and
Yuniningsih, 2013).
The carp fish was farmed on the fish farm Eka in Lukino Selo. The feed with 30% protein was
used for farming. The fish meat contained 6% fat. The fishing was done in autumn period, and the
fish was stored at the temperature of 4 C before it was processed.
Brining was done with a dry method with 2 % NaCl for 12 hours at room temperature. After that we
did washing under pressure and draining, then drying in the smoke generator with the gravel filter
for 1 h at 55 C, followed by hot smoking using beech sawdust until the temperature in the centre
of the product, which was continuously monitored, reached 65 C. This value was kept for 1h.
After that we continued with cooling down to the temperature of 10 C or less within 3 hours after
smoking, and then down to the temperature of 3 C or less within 12 hours. The analyses of the
smoked carp meat were done at the Scientific Veterinary Institute "Novi Sad". 20 samples of the
smoked carp meat were tested in total. The quality of the product was tested with the sensory,
chemical and microbiological methods.
Chemical analyses included determining of the PAH levels. The identification of PAHs was done
with an analytical method gas chromatographymass spectrometry (GC-MS) (Agilent
143
7890B/5977A MSD), based on comparison of the retention times of the peaks and target ions with
those obtained from standard mixture of PAHs (standards supplied by instrument manufacturer).
Quantification was based on external calibration curves prepared from the standard solution of each
of the PAHs. The coefficients of determination (r2) for the PAH standard calibration plots were
pyrene (0.99975), benzo[b]fluoranthene (0.99945), benzo[k]fluoranthene (0.99950), acenaphthylene
(0.99982), indenol[1,2,3-c,d]pyrene (0.99999), benzo[a]anthracene (0.99926), acenaphthylene
(0.99928) and flourene (0.99963).
Microbiological analyses were done according to the current Regulation (Regulation on General
and Special Conditions of Hygiene of Food at any Stage of Production, Processing and Transport,
the Official Gazette SRJ 72/2010) by determining/detecting Listeria monocytogenes (SRPS EN
ISO 11290-1/2010) in the final product.
Sensory characteristics of the final product, the smoked carp meat, were determined in a
quantitative-descriptive test (SRPS EN ISO 6658/2002), at the interval scale ranging from 1 to 5.
Five sensory evaluators, who had passed the sensory evaluation training in detecting and
recognizing smells (SRPS ISO 5496/2002) and whose senses had previously been tested using the
test for determining the sense of taste (SRPS ISO 3972/2002), were giving marks in sensory
characteristics.
Results
The total PAHs concentration in ecological smoked common carp meat was 279.60 g/kg. Maximal
concentrations of PAHs detected in the final product are: fluoranthen (63.93g/kg), naphtalene
(61.18 g/kg), acenaphthylene (60.97 g/kg), fluorene (50.58 g/kg), anthracene (21.56 g/kg),
acenaphtene (8.13 g/kg), fluoranthene (7.66g/kg ), pyrene (3.33 g/kg). The most important
thing is that PAHs from the groups 1, 2A i 2B (International Agency for Research on Cancer, 2012)
were not detected in the samples.
The reference method for determining the presence of Listeria monocytogenes (SRPS EN ISO
11290-1/2010) did not reveal any of its presence in all the samples. The results of the sensory
characteristics of the smoked carp meat are shown in Figure 1. The obtained results of chemical,
microbiological and sensory tests confirm the quality and safety of the smoked carp meat processed
in this ecological way.
Figure 1. The results of the sensory marks of the ecologically smoked carp meat
Sensory
characteristics
Appearance
Colour
Smell
Colour at the
intersection
Texture
Taste
Sd
CV%
4,51
4,67
4,83
4,67
0,60
0,52
0,49
0,66
13,30
11,13
10,14
14,13
4,83
4,76
0,86
0,42
17,81
8,82

Many studies done on animals have shown that dietary intake of BaP causes increased levels of
tumors, especially in the upper gastrointestinal tract (Kazerouni et al, 2001).
144
In order to determine PAH compounds in food, various methods are used. They are:
fluorometricand spectrofotometric, high performance liquid chromatography, gas chromatography
mass spectrometry (GC-MS) or gas chromatography with flame ionization detector (Yurchenko and
Mlder, 2005). Gas chromatography is widely used to determine PAH compounds in food (Simko,
2002).
Non-processed fish can have small or undetectable amounts of different PAHs absorbed from the
environment, most commonly from the contaminated water because fish rapidly metabolizes PAHs
(Stolyhwo and Sikorski, 2005; Yurchenko and Mlder, 2005).
The levels of PAH in smoked fishery products from modern smoking kilns with external smoke
generation are higher than the levels in smoked fishery products from traditional smoking kilns
(Karl and Leinemann, 1996).
Temperature of smoke plays an important part in the amount of carciogenic PAHs that are created
during pyrolysis. The amount increases linearly with the smoking temperature within the interval of
400- 1000C (Simko, 2002). Direct exposure to smoke leads to a product with higher
concentrations of PAHs, whereas non-direct exposure to smoke leads to a product with lower
concentrations of PAHs (Simko, 2002; Duedahl-Olesen et al, 2010). Many studies have been
investigating the influence of different combustion woods and smoking duration on smoked food
PAH content and confirmed that soft resinous woods and longer smoking durations resulted in food
with higher PAH content (Stumpe-Viksna et al, 2008; Duedahl-Olesen et al, 2010; Forsberg et al,
2012)
The sum of PAH in smoked fish products in Denmark ranged from 22 g/kg in smoked mackerel
prepared in an electric oven to 1387 g/kg in herring smoked by direct smoking (Duedahl-Olesen et
al, 2006).
Traditional sauna smoked products are marketed as special delicacies, but during an official control
programme of BaP levels in Swedish smoked meat and fish, six samples of smoked fish which were
produced by traditional sauna smoking, had high BaP levels ranging from 8,4 to 14,4 g/kg.
Samples of meat and fish smoked by indirect technique all had BaP levels below limit of
quantification. Regional initiatives of Sweden support further development of the traditional sauna
smoking process and improvement of the quality of the smoked products (Wretling et al, 2010).
Forsberg et al. (2012) reported that traditional smoking of fish is still practiced, and is still a
significant component of the CTUIRs cultural and spiritual identity in the USA, but smoking
processes can introduce potentially harmful combustion by-products into the smoked fillets. That
was confirmed by their study in which the carcinogenic and non-carcinogenic PAHs in traditionally
smoked salmon were 40430 times higher than those measured in commercial products.
Investigation of potential carcinogenic PAH in two different smoked fish in Turkey showed a
significant correlation between the fish fat and the total PAHs level. Also, the content of PAH in
smoked fish depends on the concentration of these compounds in the wood smoke, smoking
temperature and smoking time. The concentration of total PAHs varied between 23.83- 79.74 g/kg
(Basak et al, 2010).
The results of Essumang and the group of authors (2014) have shown the statistically significant
difference in PAH levels between smoking with no charcoal as a filter and smoking with charcoal
as a filter.
Yusuf et al. (2015) investigated the effect of fish smoking methods on dietary exposure to PAHs
and potential risks to human health. They proved that traditional method of smoking had 7
genotoxic PAHs.
Data reported in the literature on PAHs in smoked fish are highly variable and that can be attributed
to the differences in the procedures used for smoking. Some of variables are: the type and
145
composition of wood, type of generator, oxygen accessibility, temperature of smoke generation,

smoking time, fat content, preparation of fish etc (Basak et al, 2010; Yusuf et al, 2015).
We proved the quality, safety and the lower PAHs content of product obtained in ecologically safe
production of smoked common carp meat. By producing the smoked carp meat in this way, we
obtain a product that has all the sensory characteristics provided by the traditional craft industry,
while at the same time, we obtain a safer product because it contains lower levels of PAHs which
minimizes the carcinogenic effect if consumed. This method of smoking can be applied to other
smoked products in craft industry.
Food safety is one of the most important policies of the EU, especially when it comes to the policy
of protecting the consumers. Beside this, the EU pays a lot of attention to the production of
traditional-craft products because it enables the development of villages, rural tourism and higher
profit for the producers. Considering that the traditional-craft production of the smoked meat is
typical for our country, it is necessary to continue our work on improving and securing the quality
and safety of smoked products and also, protecting the geographical origin.
Acknowledgments
This paper is a result of the research within the project TR 31011 The influence of the quality of
the food components for cyprinid fish species on the quality of meat, losses and the profitability of
production, financed by the Ministry of Science and Technological Development, Republic of
Serbia.
References
1.
Akintola S.L., Brown A., Abdullahi B., Osowo O.D., Bello B.O.: Effects of Hot Smoking and Sun
Drying Processes on Nutritional Composition of Giant Tiger Shrimp, Pol. J. Food and Nutr. Sci., 63, 4,
227-237, 2013
2. Anggraini S.P.A., Yuniningsih S.: Liquid Smoke Purification Process for Benzo (A) Pyrene Levels
Lowering on Food Safety, J.Agric.Food.Tech., 3, 12, 1-4, 2013
3. ATSDR: Case Studies on Enviromental Medicine: Toxicity of Polycyclic Aromatic Hydrocarbons
(PAHs), WB 1519, 2012
4. Basak S., Sengor G.F., Karakoc F.T.: The Detection of Potential Carcinogenic PAH Using HPLC
Procedure in Two Different Smoked Fish, Case Study: Istanbul/Turkey, Turkish Journal of Fisheries
and Aquatic Sciences 10, 351-355, 2010
5. Cirkovic M., Jovanovic B., Maletin S.: Ribarstvo, Poljoprivredni fakultet, Novi Sad, 2002
6. Cirkovic M., Ljubojevic D., Novakov N., Djordjevic V.: Gajenje i kvalitet mesa aranskih riba,
monografija,Nauni institut za veterinarstvo Novi Sad, Novi Sad, 2015
7. Duedahl-Olesen L., Christensen J.H., Hojgard A., Granby K., Timm-Heinrich M.: Influence of smoking
parameters on the concentration of polycyclic aromatic hydrocarbons (PAHs) in Danish smoked fish.
Food additives & contaminants, 27, 12941305, 2010
8. Duedahl-Olesen L., White S., Binderup M.L.: Polycyclic aromatic hydrocarbons (PAH) in Danish
smoked fish and meat products. Polycyclic Aromatic Hydrocarbons 26, 163184, 2006
9. Essumang D.K, Dodoo D.K., Adjei J.K.: Effective reduction of PAH contamination in smoke cured fish
products using charcoal filters in a modified traditional kiln, Food Control, 35, 1, 85-93, 2014
10. Essumang D.K, Dodoo D.K., Adjei J.K.: Polycyclic aromatic hydrocarbon (PAH) contamination in
smoke-cured fish products, Journal of Food Composition and Analysis, 27, 2, 128-138, 2012
11. FAO: Quality and quality changes in fresh fish, FAO fisheries technical paper- 348 food and
Agriculture organization of the United Nations, 1995
146

12. Forsberg N.D., Stone D., Harding A., Harper B., Harris S., Matzke M.M., Cardenas A., Waters K.M.,
Anderson K.A.: Effect of Native American Fish Smoking Methods on Dietary Exposure to Polycyclic
Aromatic Hydrocarbons and Possible Risks to Human Health, J.Agric.Food Chem., 60,27, 6899-6906,
2012
13. Gallart-Jornet L., Barat J.M., Rustad T., Erikson U., Escriche I., Fito P.: Influence of brine
concentration on Atlantic salmon fillet salting. Journal of Food Engineering, 80, 26727, 2007
14. International Agency for Research on Cancer- IARC: IARC Monographs on the Evaluation of
Carcinogenic Risks to Humans, volumes 1 e103, 2012
15. Karl H., Leinemann M.: Determination of polycyclic sromatic hydrocarbons in smoked fishery products
from different smoking kilns, Z Lebensm Unters Forsch 202, 6, 458-464, 1996
16. Kazerouni N., Sinha R., Che-Han H., Greenberg A., Rothman N.: Analysis of 200 food items for
benzo(a)pyrene and estimation of its intake in an epidemiologic study, Food and Chemical Toxicology
39, 423-436, 2001
17. Milijasevi M., Babic J., Baltic M., Spiric A., Velebit B., Borovic B., Spiric D.: Uticaj razliitih smea
gasova na promene nekih mikrobiolokih i heijskih parametara u odrescima (Cyprinus carpio)
upakovanih u modifikovanu atmosferu. Tehnologija mesa 51, 1, 66-70, 2010
18. Pavlicevic N., Djordjevic V., Dimitrijevic M., Karabasil N., Baltic M., Boskovic M., Petrovic J.: Effect
of pre-processing of trout by freezing on the characteristics of smoked trout fillets, Tehnologija mesa
54,1, 5768, 2013
19. Rzepka M., zogul F., Surwka K., Michalczyk M.: Freshness and quality attributes of cold stored
Atlantic bonito (Sarda sarda) gravad, International Journal of Food Science and Technology, 48, 6,
13181326, 2013
20. Simko P.: Determination of polycyclic aromatic hydrocarbons in smoked meat products and smoke
flavouring food additives, Journal of Chromatography B, 770, 1-2, 3-18, 2002
21. Stolyhwo A., Sikorski Z. E.: Polycyclic aromatic hydrocarbons in smoked fish- a critical review, Food
Chemistry, 91, 2, 303-311, 2005
22. Stumpe-Viksna I., Bartkevics V., Kukare A., Morozovs A.: Polycyclic aromatic hydrocarbons in meat
smoked with different types of wood, Food Chem, 110, 794797, 2008
23. Wenzl T., Simon R., Anklam E., Kleiner J.: Analytical methods for polycyclic aromatic hydrocarbons
(PAHs) in food and the environment needed for new food legislation in the European Union, TrAC
Trends in Analytical Chemistry, 25, 7, 716-725, 2006
24. Wretling S., Eriksson A., Eskhult G.A., Larsson B.: Polycyclic aromatic hydrocarbons (PAHs) in
Swedish smoked meat and fish, Journal of Food Composition and Analysis 23, 264-272, 2010
25. Yanar Y., Celik M., Akamca E.: Effects of brine concentration on shelf-life of hot-smoked tilapia stored
at 4 C, Food. Chem., 97, 244-247, 2006
26. Yurchenko S., Mlder U.: The determination of polycyclic aromatic hydrocarbons in smoked fish by
gas chromatography mass spectrometry with positive-ion chemical ionization, Journal od Food
Composition and Analysis 18, 857-869, 2005.
27. Yusuf K.A., Ezechukwu L.N., Fakoya K.A., Akintola S.L., Agboola J.I., Omoleye T.O.: Effects of brine
concentration on shelf-life, African Journal of Food Science, 9,3,126-135, 2015
147
EFFECT OF THE DIET ON IMPROVEMENT OF THE FATTY ACID COMPOSITION OF

PIG MEAT
Radmila Markovi1*, Milica Todorovi1, Sran Panti3, Milan Balti1, Jelena Ivanovi1, Dobrila
Jaki-Dimi2, Dragan efer1, Branko Petrujki1, Stamen Radulovi1
1
Faculty of Veterinary Medicine, University of Belgrade, Serbia

2
Veterinary Scientific Institute, Belgrade, Serbia
3
DOO Nutritio, Bijeljina, BiH
Abstract
Numerous studies have confirmed the correlation between the prevalence of chronic disease and
human nutrition. In these studies, special emphasis is placed on the use of fats in human nutrition,
especially n-3 and n-6 fatty acids and their relation. The importance of conjugated linoleic acid
(CLA) for human health is also highlighted. Furthermore, the content and a ratio of fatty acids in
pig meat may be affected by choice of feeds for pigs. The aim of our research was to investigate the
impact of commercial preparations linseed, or of commercial preparations of CLA supplementation
in diets for pigs on fatty acid composition of pig meat. Fatty acid composition of feed for pigs and
pig meat was determined by gas chromatography.The use of linseed or CLA in the diet of pigs
significantly influenced the content of saturated, monounsaturated and polyunsaturated fatty acids
in pig meat. The meat of pigs fed with these supplements had significantly better ratio of n-6/n-3
fatty acids, compared to the meat of pigs fed without the addition of linseed preparation, or CLA.
The meat of pigs fed with the addition of CLA preparations revealed the presence of both isomers
of this preparation. The presence of these isomers has not been proven in the meat of pigs fed
without the addition of CLA.Adding linseed preparation, or preparation of CLA in food for pigs
improves the nutritional value of pigs meat.
Keywords: pigs nutrition, linseed, fatty acids, meat quality
Introduction
Numerous medical findings show that a significant role in the development of cardiovascular and
other chronic diseases in humans has a relationship between the two groups of polyunsaturated fatty
acids in the diet: n-6 acids, whose main representative is linoleic acid (C18: 2 n-6) and n-3 fatty
acids, whose main representative is alpha linolenic acid (C18:3 n-3).
Unsaturated fatty acids have mutually differences in chain length, number and position of double
bonds in molecules. The abbreviation "n-6" (or n-6) indicates that the first double bond in the
molecule of fatty acid is at the sixth carbon atom, as for "-3 '(or n-3) indicates that the first double
bond in the molecule of fatty acid is at the third carbon atom, counting from the methyl group. In
the natural resources most often reported unsaturated fatty acids belong to the n-6, n-3 and n-9
series.
The human body cannot synthesize essential fatty acids, but retains the ability to translate basic
essential fatty acid ingested with food (linoleic and -linolenic) in the so-called long-chain
polyunsaturated fatty acids with specific roles in the body. In these biotransformation are involved
enzymes desaturase and elongase and throughout their activities, as well as the amount of substrate,
depends the intensity and efficiency of these reactions (obaji, 2002).
148
Numerous studies confirm that increased intake of n-3 fatty acids can affect on decreasing the risk
of heart disease and vascular disorders, but also alleviating symptoms and improving the clinical
picture in some autoimmune and inflammatory disorders.
Interest in the role of polyunsaturated fatty acids has been launched by investigations in 70 th of the
last century, which have revealed a very low occurrence of vascular disease in the population of
Greenland Eskimos, despite their diet rich in fat and based on marine mammals and fish whose food
chain is based on algae and plankton rich in n-3 polyunsaturated fatty acids. Similar observations
were later confirmed by epidemiological studies in other populations with a similar diet, for
example, in coastal areas of Japan (Karolyi, 2007).
The ability of producing n-3 enriched meat products of pigs is very interesting for many producers
and consumers, as noted above. In monogastric animals such as pigs, fatty acids are absorbed from
the gastrointestinal tract with small changes. In fact, the fatty acid profile of tissue directly reflects
the profile of fatty acids in animal nutrition. In ruminants, however, the fatty acids from food in the
digestive tract are changed, under the influence of the process of microbial fermentation and
biohydrogenation, prior to absorption from the gastrointestinal tract (Baltic et al., 2011b; Markovic
et al., 2011b).
In modern human nutrition the ratio of n-6/n-3 polyunsaturated fatty acids is relatively wide (1015:1), so that today in human diet efforts is made in order to enrich food with n-3 fatty acids, so that
this relationship could be approximate to optimal (4:1).
In the pig nutrition soybean, sunflower and other oilseeds that contain fatty acids of n-3 series and
fatty acids of n-6 series are used (Baltic et al., 2011; Markovic et al., 2011).
Linseed contains about 35 to 45% oil compared to the mass of dry material (Karleskind, 1996).
More than 70% of this oil contains polyunsaturated fatty acids, primarily alpha-linolenic acid
(ALA), an essential -3 fatty acids and linoleic acid (LA), essential n-6 fatty acids.
It should be noted that linseed meal contains the fatty acid profile that is similar, if not identical, as
linseed, considering that the total oil content of the meal is variable depending on the method used
for extraction of oil, which affects the energy value of this nutrient.
The CLAs are a mixture of positional and geometric isomers of linoleic acid (9c,12c C18:2), which
were first identified in rumen fluid as an intermediate in the biohydrogenation process (Bartlett and
Chapman, 1961). In synthetic CLA preparations the 9c,11t and 10t,12c isomers are predominant
(often in a 1:1 ratio). It appears that the 9c,11t isomer has positive effects on some types of cancer
by inhibiting tumorogenesis, while 10t,12c isomer could be responsible for changes in whole-body
fat deposition (Pariza et al., 2001).
In addition, dietary CLA seems to be highly deposited in body tissues of monogastric animals and
as a result, in pork and meat products (Corino et al., 2005; Jiang et al., 2010).
The aim of this study was that in two experiments on pigs choice of ingredients, meal examination
to influence the fatty acid composition and meat quality of pigs.
Materials and methods

The aim of the research in the Experiment 1 was to investigate the effect of different sources of fat
in the diet on fatty acid composition and meat quality of fattening pigs.
The trial was conducted on 30 crossbreeds pigs (Yorkshire Landrace), with an initial body
weight of 60 kg. The pigs were divided into three groups of ten animals and the experiment lasted
46 days until a mean weight of about 100 kg. They were fed with standard mixture for pigs in the
final stage of fattening, provided that the groups differed only in the fact that the first experimental
149
group (E-I) had a grain sunflower, second experimental group (E-II) preparation of linseed
(Vitalan, Vitalac, France) in the recommended inclusion rate of 2.5% in the mixture, and the third
experimental group (E-III) full-fat soybean meal included in the diet (Table 1). The fatty acid
composition of feed and meat content of n-3 and n-6 fatty acids, as well as their relationship with
feed and meat were investigated.
In the Experiment 2 the aim of the research was to investigate if the addition of CLA in the diet of
fattening pigs, affects the fatty acid composition of meat. Sixty crossbreed pigs (Yorkshire
Landrace), with an initial body weight of 60 kg were used in this study. The pigs were divided
into two groups (Control-C and Experimental-E) of 30 pigs in each and fed with a standard mixture
(NRC, 1998), from 60 to 110 kg (fattening period of 60 days). The diet between groups differed
only in the fact that the experimental group had commercially prepared conjugated linoleic acid
60% CLA (Lutalin, BASF, Germany), added in the feed, at the recommended rate of 2.0% of the
mixture. The mixtures were balanced and completely satisfied the needs of the animals in this
production stage. The nutrient composition of the diets is detailed in Table 1.
Table 1. Raw material of the final feed for pigs fattening (%)
Feed
Corn, grain
Wheat, grain
Barley, grain
Full-fat soybean meal
Soybean meal
Sunflower, grain
Wheat bran
Vitalan
Lutalin
Dicalcium phosphate
Chalk
Salt
Vitamin mineral premix
E-I
Experiment 1
E-II
E-III
46.7
15.0
11.5
7.5
16.2
-
50.80
14.0
13.0
16.50
2.5
51.0
14.0
14.60
1.0
16.20
-
0.50
1.20
0.40
1
100
0.60
1.20
0.40
1
100
0.60
1.20
0.40
1
100
Experiment 2
C
E
48
28
16
5
3
100
46
28
16
5
2
3
100
The total lipids, for fatty acid determination, were extracted from pig muscle tissue with
hexane/isopropanol mixture by accelerated solvent extraction (ASE 200, Dionex, Germany). After
the evaporation of solvent to dryness under the stream of nitrogen, total lipids were converted to
fatty acid methyl esters (FAME) by trimethylsulfonium hydroxide. FAMEs were determined by
Shimadzu 2010 gas chromatograph equipped with flame ionization detector (FID) and cianopropyl
HP-88 capillary column (100m 0.25 mm 0.20m) (Trbovi et al., 2011).
Meat samples (M. longissimus dorsi) from each pig in all groups for analysis of fatty acid
composition analysis were taken at the end of the both experiments, after slaughtering, processing
and chilling of the carcasses.
Results
In these studies, we have investigated the quantities and proportions of fatty acids in pork meat
when fed diets with variable fatty acid content. In the examined total fatty acid content of pig feed,
(Table 2) it was noticed that there was a statistically significant (p<0.01) difference between groups
(Experiment 1). The complete feed mixture of E-II group, which contained the preparation of
150
extruded linseed, had a significantly lower content of SFA and significantly higher PUFA content
(p<0.01), compared to the other two groups.
Since the fatty acid content was significantly different, that resulted in different ratios of n-6/n-3. In
the Experiment 1, the most beneficial ratio of n-6/n-3 was observed in E-II group (5.57) (a group
that was fed linseed preparation), compared to E-I group (52.65) and E-III group (11.00) (p <0.01)
(Table 2).
Table 2. The fatty acid composition of feed (%), and the ratio n-6/n-3
FA
SFA
MUFA
PUFA
n-6
n-3
n-6/n-3
c9t11CLA
t10c12CLA
c9t11CLA+
t10c12CLA
E-I ( X SD)
20.60B 0.46
35.29A,B0.56
43.54AB0.76
42.73AC0.76
0.81AC 0.1
52.65AC1.10
-
Experiment 1
E-II ( X SD)
18.38AB0.60
25.46B0.26
55.99A0.70
47.46AB0.60
8.53AB0.22
5.57AB0.14
-
E-III ( X SD)
20.17A0.32
25.51A0.32
54.33B0.48
49.79BC0.41
4.54BC0.22
11.00BC0.54
-
Experiment 2
C ( X SD)
E ( X SD)
22.21A0.40 17.93A0.27
38.31A0.20 25.71A0.24
39.48A0.60 56.36A0.32
37.98A0.55 53.94A0.18
1.47A0.07
2.38A0.22
25.78a1.11 22.80a2.21
ND
2.570.02
ND
2.550.01
ND
5.120.03
Legend: A, B, C the same letter indicates significant difference of p<0.01; a the same letter indicates significant difference
of p<0.05
In the Experiment 2, significant differences between the contents of fatty acid in the feed of control
and experimental groups were observed. SFA and MUFA in the feed of the control group were
significantly higher (p<0.01) than in feed of the experimental group. The content of n-3 and n-6
fatty acids, was significantly higher (p<0.01) in the feed of the experimental group. Similarly the
most beneficial ratio of n-6/n-3 was observed in the feed of the experimental group (p<0.05) (Table
2). CLA isomers c9t11CLA and t10c12CLA were detected in the feed supplemented with CLA
(experimental group) and were below the detection limit in the control group (Table 2).
The average content of SFA and MUFA in the meat (Experiment 1) was higher in the group of pigs
fed with linseed preparation (E-II), but on the other hand the average content of PUFA in this group
was lower as well as the n-6/ n-3 ratio compared to the other two groups of pigs (p<0.01) (Table 3).
In the Experiment 1, meat from the group which was fed with linseed preparation, E-II group, had
the highest percentage of SFA (37.910.75%), which was significantly higher (p<0.01) compared to
the E-I group, while between E-II and E-III groups no significance was observed (Table 3).
Table 3. Fatty acid composition in meat (%), and ratio
Experiment 1
FA
SFA
MUFA
PUFA
n-6
n-3
n-6/n-3
c9t11CLA
t10c12CLA
c9t11CLA+
t10c12CLA
Legend: A the same
p<0.05
Experiment 2
E-I ( X SD)
36.98A0.25
39.59AC0.12
23.17AC0.28
22.53AC0.28
0.69AC0.01
32.40AC0.51
-
E-II ( X SD)
37.91A0.75
43.71AB0.28
17.99AB0.44
16.98AB0.56
1.23AB0.03
13.67AB0.08
-
E-III ( X SD)
37.540.05
41.42BC0.05
20.87BC0.08
19.76BC0.07
1.12BC0.02
17.84BC0.55
-
C ( X SD)
43.33A1.38
46.72A1.88
9.95a0.60
9.510.57
0.320.04
29.72a3.60
ND
ND
E ( X SD)
53.48A1.07
37.53A0.28
8.99a0.92
8.560.90
0.360.03
24.58a2.97
2.370.01
1.190.01
ND
3.560.71
letter indicates significant difference of p<0.01; a the same letter indicates significant difference of
151
Meat from E-II group (Experiment 1) of pigs contained 43.710.28% of MUFA, which was
significantly higher (p<0.01) and 17.990.44% of PUFA, which was significantly lower (p<0.01)
compared to E-I and E-III group. The meat of pigs that were fed with soy (E-III group) was
41.420.05% of MUFA and 20.870.08% of PUFA, which was significantly higher (p<0.01)
compared to the E-I group that was fed with sunflower grain, as a source of fatty acids (Table 3).
It was found that the average content of saturated fatty acids in the meat of the experimental group
of pigs (53.481.07%) was significantly higher (p<0.01) than the average content of saturated fatty
acids in the meat of pigs of the control group (43.33 1.38%). The average content of
monounsaturated or polyunsaturated fatty acids (37.530.28%, 8.990.92%, respectively) in the
experimental group pig meat was significantly lower (p<0.01, p<0.05, respectively) than the
average content of monounsaturated or polyunsaturated fatty acids in the meat of pigs of the control
group (46.721.88%, 9.95 0.60, respectively). There was no statistically significant difference
between the average content of n-3 and n-6 fatty acids in meat sample (0.360.03%, 8.560.90%,
respectively) and a control group of pigs (0.320.04%, 9.510.57%, respectively).
The average ratio of n-6/n-3 fatty acids in meat pigs experimental group (24.582.97) were
significantly lower (p<0.05) than the same ratio in the meat of the control group pigs (29.72 3.60)
as shown in Table 3.
The average content of conjugated linoleic acid c9t11, t10c12 and total CLA content in the meat of
pigs of the experimental group was 2.370.01%, 1.190.01% and 3.560.71% (respectively). In the
meat of the control group of pigs the CLA was not detected (Table 3).
Discussion
A negative attitude towards the consumption of meat has many different causes. One of the most
common is the health concern. Today, virtually everyone knows that there is a connection between
diet and health. Scientific discoveries and better informed consumers have contributed to the
understanding of these connections. Among the risk factors of numerous chronic noncommunicable diseases (cardiovascular and cerebral diseases, hypertension, malignant neoplasms,
diabetes, obesity, nephrolithiasis, bile duct diseases, osteoporosis, dental caries), which are
numerous (more than 200), nutrition is of the great importance.
The fatty acid profile of the meat directly reflects the fatty acid profile in feed (Eastwood, 2008).
Since linseed has a desirable fatty acid composition, many producers are interested to include
linseed in swine finisher in order to improve the fatty acid composition of meat.
In this study (Experiment 1) results indicate that by changing sources of fat and fatty acid
composition of feeds, the fatty acid composition of meat can be affected. The average content of
saturated (SFA), monounsaturated (MUFA) and polyunsaturated (PUFA) fatty acids, as well as the
average contents of n-6 and n-3 fatty acids in the feed, between groups, were statistically
significantly different.
It has been found that the average content of saturated fatty acids in pork meat of pigs fed with the
addition of linseed was significantly higher compared to the SFA content of the meat from pigs fed
with the addition of sunflower. The average content of polyunsaturated fatty acids in pork from pigs
fed with the addition of linseed was significantly lower compared to average content of these acids
in pork from pigs in the other two groups (p <0.01) (Todorovic, 2014).
The average content of n-6 fatty acids in meat was significantly lower, and content of n-3 fatty acids
significantly higher in pork meat of pigs fed with the addition of linseed (p<0.01). Pork from pigs
fed with additions of linseed had a statistically significantly better ratio of n-6/n-3 fatty acids.
152
Apart from the optimal quantity of essential fatty acids in nutrition, their ration is also very
important. The ratio of n-3/n-6 fatty acids is optimal if it is in a range 1:4 to 1:5. It is recommended
that polyunsaturated fatty acids present 10 to 20% of total daily intake of lipids. Fatty acids n-3
have a protective effect on the cardiovascular system and the decrease of frequency of deaths
caused by cardiovascular diseases. These acids decrease triglycerides in blood, and blood pressure,
regulate the activity of protein kinase C that have a role in angiogenesis and slow down the growth
of tumor metastases. An important source of n-3 fatty acids is the fish meat of northern sea fish
(mackerel, herring, sardines, salmon) (Losso, 2002; Pariza, 1997).
One of the first studies about the effects of linseed on meat lipid profile was performed by Cunnane
et al. (1990). In this experiment, from the age of two till the tenth week of age feed was
supplemented with 5% of linseed. Piglets had significantly higher levels of ALA in the liver,
kidney, heart, skin, subcutaneous adipose and muscle tissue.
Later, other researches performed trials in order to determine the optimal level and the length of
supplementation of linseed in feed, in order to ensure that the enrichment of n-3 fatty acids does not
negatively affects meat quality. Romans et al. (1995a) studied the influence of different
concentrations of linseed in feed (5, 10 and 15%) 25 days before the slaughter. These authors
concluded that linseed should not be used in the feed of finisher pigs at the level higher than 15% in
order to maintain the meat sensory properties. In the other study, Romans et al. (1995b) studied the
different length of linseed use in feed (15% linseed) 7, 14, 21 and 28 days before the slaughter. The
ALA content of back fat adipose tissue significantly linearly increased with the increase in the
length of feed supplementation with linseed. A large number of experiments were performed in
final pig fattening stage (Raj et al., 2010; Matthews et al., 2000; Vclavkova and Bekova, 2007;
Enser et al., 2000 and Thacker et al. 2004).
Okanovi et al. (2010) investigated the impact of feed enriched with linseed on the content of n-3
fatty acids in pork, from pigs with an average weight of 110 kg. Feed containing linseed resulted in
higher concentrations of n-3 fatty acids (> 7 mg/100 g), which decreased ratio of n-6 and n-3 fatty
acids in meat (<3) making it better for human health.
The CLA concentration in muscle tissue may be further enhanced when CLA supplementation is
combined with additional dietary fat (Gatlin et al., 2002). Adding CLA in the mixture for pigs
(Experiment 2) has significantly influenced the fatty acid composition of the mixture. It was found
that the experimental group of pigs had significantly increased the content of polyunsaturated fatty
acids (PUFA), while the amount of saturated and monounsaturated fatty acids was reduced in the
same group. Adding a CLA mixture to the feed of experimental groups of pigs increased content of
n-6 fatty acids, as well as the void content of n-3 fatty acids. The swine feed by adding CLA to
change the attitude of n-6/n-3 fatty acids, which is caused by the content of these acids in mixtures.
Results of n-6/ n-3 fatty acid ratio in the diets of the control and experimental groups of pigs are
shown in Table 2. The average content of isomers c9t11CLA and t10c12CLA in feed for the pigs of
the experimental group were nearly identical, which is understandable, given the fact that the
Lutalin preparation, according to the producer statement contains 50% and 50% c9t11CLA
t10c12CLA (Table 2).
As a part of these investigations have been two isomers of CLA, c9t11CLA and t10c12CLA, as a
supplement mixture for pigs. Both of these acids were found in the meat of pigs, provided that the
content c9t11CLA was almost twice the content t10c12CLA (Table 3).
It is notable that it is not the same degree of adoption and incorporation of both isomers of
conjugated linoleic acid were observed in the feed. Isomer c9t11 is more suitable for installation in
intramuscular fat depots (Panti, 2014).
A number of the current research is directed at manipulating the fatty acid content of meat animals
in order to increase n-3 and CLA content (Enser et al., 1998). The cereal-based diet commonly
153
offered to poultry and pig supplies mainly n-6 PUFA and a small amount of n-3 PUFA. This is
reflected in the fatty acid composition of the animal product. Dietary modification of poultry meat,
eggs or pork meat in order to increase the content of n-3 PUFA requires a supply of n-3 PUFA from
the diet (Nieto and Ros, 2012). Many studies in order to manipulate the fatty acid composition of
the meat using whole oilseeds have been conducted.
Several reports indicate that CLA supplementation increases the amount of saturated fatty acids
(C14:0, C16:0, and C18:0) and decreases the amount of MUFA fraction (mainly C18:1) in pig the
tissues by down-regulating the D9-desaturase activity (Eggert et al., 2001; Gatlin et al., 2002; Joo et
al., 2002; Lauridsen et al., 2005; Smith et al., 2002; Thiel-Cooper et al., 2001).
Conclusion
A diet enriched with extruded linseed had a beneficial impact on the content of n-3, n-6 acids and
the ratio of n-6/n-3, which is important for the health of consumers. Chemical analysis of the fatty
acid composition of complete mixtures found that the feed which was included preparation of
linseed had significantly lower SFA content, and content is significantly higher PUFA mixture of
full fat soybean meal. Also, the ratio of n-6/n-3 fatty acids in feeds linseed group was lower (5.567)
in comparison to a composition for a full fat soybean meal group (11.00) (p<0.01). By adding a
mixture of linseed to the mixture for finishing pigs the meat with favorable fatty acid composition
and favorable ratio of n-6/n-3 fatty acids compared to pigs which had no linseed in the diet was
obtained.
The inclusion of high dose of dietary CLA in pigs of conventional genotype (Yorkshire
Landrace) increased the CLA content in pig meat. Also, the addition of CLA in the diet of pigs
increases the content of the SFA and reduces the content of MUFA and PUFA in the pig meat.
The results from this study show that the pig products can be modified to in order to provide a
significant increase the functional lipids, which can have a positive influence on the human health.
Acknowledgment
The study was conducted within the project "The selected biological threat to the safety/quality of
food of animal origin and control measures from the farm to the consumer", TR 031034 financed by
the Ministry of Education, Science and technological development of the Republic of Serbia.
References
1.
2.
3.
4.
5.
6.
Balti .M., Markovi Radmila, orevi Vesna: Nutrition and meat quality. Tehnologija mesa, 52, 1,
154-159, 2011b
Balti .M., Markovi Radmila, Dokmanovi Marija, efer D., Karabasil N., Todorovi Milica: Ishrana
i kvalitet mesa svinja. Zbornik radova 9.Simpozijuma-Zdravstvena zatita selekcija i reprodukcija
svinja. Veterinarski Institut Poarevac, Srebrno jezero, 2011,139-146
Bartlet, J.C. and D.G. Chapman: Detection of hydrogenated fats in butter fat by measurement of cistrans conjugated unsaturation. J. Agric. Food Chem. 9: 1961, 50-53
Corino Carlo, Alessia Di Giancamillo, Raffaella Rossi, Cinzia Domeneghini, , Dietary Conjugated
Linoleic Acid Affects Morphofunctional and Chemical Aspects of Subcutaneous Adipose Tissue in
Heavy Pigs, J. Nutr., 135, 6, 1444-1450, 2005
Cunnane S.C., Stitt P.A., Ganguli S., Armstrong J.K.: Raised omega-3 fatty acid levels in pigs fed flax.
Can. J. Anim. Sci.,70, 251-254, 1990
Eastwood Laura: The nutritional value of flax seed meal for swine. PhD Thesis. Departmant of Animal
and Poultry Science. University of Saskatchewan. Canada. 2008
154

7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Enser M., K.G. Hallett, B. Hewett, G.A.J.Fursey, J.D. Wood,. and G. Harrington: Fatty acid content and
composition of UK beef and lamb muscle in relation to production system and implications for human
nutrition. Meat Science, 49:329341, 1998
Enser M., Richardson R.I., Wood J.D., Gill B.P., Sheard P.R.: Feeding linseed to increase the n-3 PUFA
of pork: fatty acid composition of muscle, adipose tissue, liver and sausages. Meat Sci., 55: 201-212,
2000
Eggert J.M., M.A. Belury, A. Kempa-Steczko, S.E. Mills and A.P. Schinckel: Effects of conjugated
linoleic acid on the belly firmness and fatty acid composition of genetically lean pigs. Journal of Animal
Science. 79:28662872, 2001
Gatlin LA, See MT, Larick DK, Lin X, Odle J.: Conjugated linoleic acid combination with
supplemental dietary fat alters pork fat quality. J Anim Sci., 132:310512, 2002
Jiang Z.Y., Yang L., Jiang S.Q., Lin Y C., Zhong W.J., & Zheng C. T.: Conjugated linoleic acid
differentially regulates fat deposition in backfat and longissimus muscle of finishing pigs. J Anim Sci,
88, 1694-1705, 2010 http://dx.doi.org/10.2527/jas.2008-1551
Joo S.T., J.I Lee, Y L. Ha and G.B. Park: Effects of dietary conjugated linoleic acid on fatty acid
composition, lipid oxidation, color, and water-holding capacity of pork loin. Journal of Animal Science,
80:108112, 2002
Karleskind A.: Oils and Fats Manual, Vol.1, Intercept Ltd, Andover, Hampshire, UK, 1996
Karolyi D.: Polinezasiene masne kiseline u ishrani ljudi. Meso, IX,.3, 151 158, 2007
Lauridsen C., H.Mu and P. Henckel: Influence of dietary conjugated linoleic acid (CLA) and age at
slaughtering on performance, slaughter- and meat quality, lipoproteins, and tissue deposition of CLA in
barrows. Meat Science, 69:393399, 2005
Losso N.J, Preventing degenarative diseases by anti-angiogenic funtional foods. Food Technology, 56,
6: 78-87, 2002
Markovi Radmila, Todorovi Milica, efer D., Karabasil N., Radulovi S., Drljai A., Balti .M.:
Znaaj izbora hraniva za masnokiselinski sastav mesa. Zbornik referata i kratkih sadraja 22.
Savetovanja veterinara Srbije, Zlatibor, 95-111, 2011b
Markovi Radmila, Balti .M., Marija Dokmanovi, Radulovi S., Jelena uri, Milica Todorovi,
Drljai A.: Ishrana i kvalitet mesa svinja- pogled u budunost. Veterinarski urnal Republike Srpske,
XI, 1, 30-36, 2011
Matthews K.R., Homer D.B., Thies F., Calder P.C.: Effect of whole linseed (Linum usitatissimum) in
the diet of finishing pigs on growth performance and on the quality and fatty acid composition of
various tissues. Br. J. Nutr., 83: 637-643, 2000
Nieto, G. and G. Ros: Modification of Fatty Acid Composition in Meat Through Diet: Effect on Lipid
Peroxidation and Relationship to Nutritional Quality A Review. Chapter 12, 2012
http://dx.doi.org/10.5772/51114
NRC: Nutritional requirements of swine. 10th Ed. NRC., Washington, DC, 1998
Okanovi ., Ili N., Ivanov Duica, Pali D., Drobnjakovi R., Vukevi ., Ikoni P.: Influence of
linseed enriched diet on omega-3 fatty acids content in pork. Krmiva, 52, 189-194, 2010
Panti Sran: Uticaj konjugovane linolne kiseline na proizvodne rezultate, kvalitet mesa i proizvoda od
mesa svinja u tovu, Doktorska disertacija, Fakultet veterinarske medicine Univerziteta u Beogradu,
2014
Pariza M.W.:Conjugated linoleic acid, a newly recognized nutrient. Chemistry and Industry, 16: 464469, 1997
Pariza M.W., Park Y., Cook M.E.: The biologically active isomers of conjugatedlinoleic acid. Progress
in Lipid Research, 40, 283298, 2001
Raj Stanislawa, Polawska Ewa, Skiba Grzegorz, Weremko Dagmara, Fandrejewski H., Skomial J.: The
influence of dietary source of fatty acids on chemical composition of the body and utilization of linoleic
and linolenic acids by pigs. Animal Science Papers and Reports, 28, 4, 355-362, 2010
155

27. Romans J., Johnson R., Wulf D., Libal G., Costello W.: Effects of ground flaxseed in swine diets on pig
performance and on physical and sensory characteristics and omega-3 fatty acid content of pork. I.
Dietary level of flaxseed. J. Anim. Sci., 73: 1982-1986, 1995a
28. Romans J., Wulf D., Johnson R., Libal G., Costello W.: Effects of ground flaxseed in swine diets on pig
performance and on physical and sensory characteristics and omega-3 fatty acid content of pork. II.
Duration of 15% dietary flaxseed. J. Anim. Sci., 73: 1987-1999, 1995b
29. Smith S.B., T.S. Hively, G.M Cortese, J.J Han, K.Y. Chung, P Casteada.:. Conjugated linoleic acid
depresses the 9 desaturase index and stearoyl coenzyme A desaturase enzyme activity in porcine
subcutaneous adipose tissue. Journal of Animal Science, 80: 21102115, 2002
30. obaji Slaana S., Uloga, zdravstveni znaaj i dijetarni izvori -3 masnih kiselina. Hrana i ishrana,
43, 3-6, 102-107, 2002
31. Todorovi Milica: Uticaj razliitih izvora masti na proizvodne rezultate i kvalitet mesa tovnih svinja,
Doktorska disertacija, Fakultet veterinarske medicine Univerziteta u Beogradu, 2014
32. Thacker P., Racz V., Soita H.: Performance and carcass characteristics of growing finishing pigs fed
barley-based diets supplemented with Linpro (extruded whole flaxseed and peas) or soybean meal. Can.
J. Anim. Sci., 84: 681688, 2004
33. Thiel-Cooper, R.L., F.C Parrish, J.C Sparks, B.R Wiegand, and R.C. Ewan: Conjugated linoleic acid
changes swine performance and carcass composition. Journal of Animal Science, 79: 18211828, 2001
34. Trbovi Dejana, Vrani Danijela, inovi-Stojanovi Jasna, Petronijevi R., Milijaevi M., MatekaloSverak Vesna, Spiri Aurelija: Fatty acid profile of carp fish species from two aquaculture systems. V
International Conference Aquaculture &fishery, Conference proceedings, 80-84, 2011.
35. Vaclavkova Eva, Bekova Ruena: Effect of linseed in pig diet on meat quality and fatty acid content.
Arch. Tierz. Dummerstorf, 50, Special Issue, 144-151, 2007
156
EFFECTS OF SOME DIEATARY SUPPLEMENTATION WITH PHYTONUTRIENTS ON

SELECTED BIOCHEMICAL PARAMETERS AND GROWTH PERFORMANCE IN
BROILER CHIKENS
Milanka Jezdimirovi1*, Blagoje Dimitrijevi1, Saa Ivanovi1, Nemanja Jezdimirovi2, Mila
Savi1, Dragan Baci1, Slavoljub Jovi1
1
University of Belgrade, Faculty of veterinary medicine, Serbia

2
Abstract
Maintaining bird health, regarding diseases or agents acting on the gastrointestinal tract, is crucial in
broiler production, since this is the entry route of nutrients for bird development. Also, it is well
known that broiler production is impossible without antibiotics, which are used as growth promoters
and in order to suppress overgrowth of pathogenic microflora in the gastrointestinal tract. Taking
into account this, we investigated the growth promoting and beneficial effects of three
phytoadditives (Ocimum basilicum, Thymus vulgaris and Pimpinella anisum) on growth
performances (body weight, total feed intake, feed conversion ratio and carcass yield),
concentrations of glucose, total proteins, albumin, total bilirubin, triglycerides and activity of
creatine kinase enzyme, in broiler chicks at 56 days of age. On the day of hatching 150 broiler
chicks, were divided into five equally groups (n=30). The control group (1st group) of broilers
received a basal diet (BD) without any feed additive. The second, third and fourth groups of chicks
were fed BD enriched with 1% of Ocimum basilicum pulverised herba, 0.5% of Ocimum basilicum
and 0.5% of Thymus vulgaris pulverised herba and 0.5% of Thymus vulgaris herba and 2% of
Pimpinella anisum pulverised fructus, respectively. The fifth group was fed with BD mixed with
Salinomycin (60 ppm). The results indicated that feeding the diets enriched with selected herbal
supplement failed to affect the growth performance of chickens at 56 days of age. In addition, this
supplementation had no influence on glucose metabolism, but we observed beneficial effects on
some parameters of protein metabolism. The concentration of total proteins was significantly higher
in chicks fed with phytoadditives; 41.711.08 vs 35.881.04 g/L; p<0.01. Albumin concentration
was also significantly higher in experimental groups (28.291.32 vs 19.730.51 g/L; p<0.001).
Creatine kinase activity and total bilirubin concentration were significantly reduced in broilers fed
with phytoadditives; p<0.05. Ocimim basilicum in combination with Thymus vulgaris decreased the
concentration of tryglicerides (0.890.02 vs 1.230.05 mmol/L; p<0.001), but this was not the case
with other phytoadditives.
It could be concluded that supplementation of the diet with phytoadditives has a potential to
improve health status in broilers. Further examinations are needed in order to elucidate the exact
mechanism of action.
Key words: phytonutrients, growth performance, blood chemistry, broiler chickens
Introduction
Expansion of the poultry industry holds the greatest promise for bridging the animal protein gap in
the world. This is mainly due to the short generation interval of poultry, particularly of broilers.
However, the rising cost of poultry feed, problems of drugs residues, microbial resistance and
diseases have become major problems militating against the industry (Puvaa et al., 2013).
Maintaining bird health, regarding diseases or agents acting on the gastrointestinal tract, is crucial in
157
broiler production, since this is the entry route of nutrients for bird development. Also, it is well
known that broiler production is impossible without antibiotics and coccidiostats, which are used as
growth promoters and in order to suppress overgrowth of pathogenic organisms in the
gastrointestinal tract.
The prophylactic use of antibiotics in poultry nutrition in order to cause improvements in growth,
feed consumption, feed utilization and decreased mortality from clinical diseases is well
documented. But, the growing concern over the transmission and the proliferation of resistant
bacteria via the food chain has led to a ban of the feed use of antibiotic growth promoters in
livestock within the European Union since 2006 (Brenes and Roura, 2010). As a result, new
commercial additives derived from plants including aromatic plant extracts and their purified
constituents have been examined as a part of alternative feed strategies for the future. Such products
have several advantages over commonly used commercial antibiotics since they are residue free and
they are also, generally recognized as safe and commonly used items in the food industry (Lv et al.,
2011). These botanicals have received increased attention as possible growth performance
enhancers for animals in the last decade. Also, natural methods are likely to play an increasing
role in the control of the disease since they are well accepted by consumers. Plant products are
residue-free, and function by mechanisms other than those of chemotherapeutics, involving new
therapeutic molecules to which resistance has not yet developed (Orengo et al., 2011).
Plants and their extracts have been used for many centuries as treatments for ailment of many
pathological conditions, yet only in the past 20-30 years have scientists seriously begun to
determine whether plant-derived traditional remedies are effective, and, if so, their mode of action.
Less than 10% of approximately 250000 of the worlds flowering plant species have been
investigated scientifically for their pharmacological properties but almost 25% of active medical
compounds currently prescribed in the USA and UK were isolated from higher plants. Plants are an
important source for drug discovery particularly for parasites because of the long association
between the coexistence of parasites, humans and herbal remedies (Anthony et al., 2005). Recently,
a number of plants and their extracts have been used in poultry nutrition. Their functional
substances (such as flavonoids, polyphenols and terpenoids) are mainly secondary metabolites
synthesized by plants to deter herbivorous predators, repel competitors and attract pollinators
(Petrovi et al., 2011).
Taking into account this, we investigated the growth promoting and beneficial effects of three
phytoadditives (Ocimum basilicum, Thymus vulgaris and Pimpinella anisum) grown and harvested
in Serbia, on growth performances, concentration of glucose, total proteins, albumin, total bilirubin,
triglycerides and activity of creatine kinase enzyme, in broiler chicks at 56 days of age.

Plant materials
The herba of basil (Ocimum basilicum) and thyme (Thymus vulgaris) and fructus of Pimpinella
anisum were collected in Vojvodina (North Province of Serbia), dried at room temperature away
from sunlight. The dried leaves and fructus were pulverised and kept at 8 oC before mixing with
broiler diets.
Experimental animals and diets
On the day of hatching 150 broiler chicks, were randomly divided into five equally groups (n=30).
The broilers were kept in large pens on wood shavings. On the day of hatching, the room
temperature was kept at 32 oC and then was gradually decreased by 3 oC per week to a final
temperature of 23 oC on the day 21, which was then maintained constantly. Continuous lighting
158
regimen (24 h of light per day) was kept throughout the fattening period. Relative humidity in the
room was maintained at 70%.
All birds were fed ad libitum with the commercial standard diets for broilers (Veterinarski ZavodZemun, Serbia): Starter from day 1 to 14; Grower from day 15 to 35 and Finisher from day
36 to 56. The control group (1st group) of broilers received a basal diet (BD) without any feed
additive. The second, third and fourth groups of chicks were fed BD enriched with 1% of Ocimum
basilicum pulverised herba, 0.5% of Ocimum basilicum and 0.5% of Thymus vulgaris pulverised
herba and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum pulverised fructus,
respectively. The fifth group was fed with BD mixed with Salinomycin (60 ppm). The broilers had
free access to feed and water.
All experiments were performed according to our institutional guidelines for animal research and
principles of the European Convention for the Protection of Vertebrate Animals Used for
Experimental and Other (Official Daily N. L 358/1358/6, 18, December 1986).
Sample collection
None of broiler chickens in any group died during the trial. The body weight of broilers, feed
conversion ratio and carcass yield were among the growth parameters studied and recorded on the
day 56 of life. On day 56 of age all broilers were slaughtered by decapitation. Blood was taken
without anticoagulants presence, enabling the separation of blood serum. Sera were obtained after
a spontaneous blood coagulation attained by centrifugation lasting 10 min at 3000 rpm. Thus
obtained blood sera were frozen at -20 oC until further analysis.
Biochemical assaying
The kinetic method was used to determine creatine kinase (CK) enzyme activity, while triglycerides
concentration was determined after enzymatic hydrolysis with lipases and quinoneimine as
indicator. The biuret method was used to determine total protein concentration, while bromocresol
green was used to determine albumin concentration. Total bilirubin (the sum of conjugated and
unconjugated bilirubin) was determined in the reaction with diazonium ion of sulphanilic acid. All
of the above mentioned biochemical parameters were determined using commercial kits (Bayer
Diagnostics, Germany). Spectrophotometric measurements were performed with Cecil CE
2021UV/VIS spectrophotometer. Blood glucose concentration was determined by using PrecisionXtra plus test strips.
Statistical significance of differences of all examined parameters were determined by means of the
ANOVA, followed by the Tukey test. Data were expressed as means standard error. Significance
level was set at p < 0.05. Statistical analysis was performed using the Graph Pad Prism 5.0
Software, CA, USA.
Results
The effect of diet supplementation with 1% of Ocimum basilicum, 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum, in
experimental groups, as well as in control groups (C1 fed with BD; and C2 fed BD plus
Salinomycin) on the body weight, total feed intake, feed conversion ratio and carcass yield are
shown in Table 1.
159
Our results showed no statistically significant differences (p > 0.05) in the growth performance
indices (such as body weight, total feed intake, feed conversion ratio and carcass yield), between
groups of chicken.
Table 1. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum
basilicum and 0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella
anisum (III group); Control groups (C1 fed with BD and C2 BD plus Salinomycin) on growth
performance of broilers at the age of 56 days
C1
I group
II group
III group
C2
260264.99
265470.48
257375.04
237555.25
269491.49
Total feed intake (g)
8405
7214
6985
7365
8210
Feed conversion ratio
2.15
1.99
1.87
1.89
2.05
Carcass yield
1605
1794
1768
1601
1715
Body weight
Concentrations of total proteins (Fig. 1) were statistically significant higher in groups of chickens
supplemented with phytoadditives; the higher concentrations were recorded in I (41.020.76 g/L; p
< 0.01) and III groups (41.711.08 g/L; p < 0.001) compared to C2 group (35.261.06 g/L).
The albumin concentrations (Fig. 2) were also statistically significant higher in broilers fed with
phytoadditives. Also, in this case the higher albumin concentrations were determined in I
(28.291.32 g/L; p < 0.001) and III groups (26.500.89 g/L; p < 0.001) compared to C1
(19.730.51 g/L) and C2 (19.310.53 g/L) groups. But it is also worth to mention that we
determined higher values of albumin in I group (fed BD plus 0.5% basil) compared to II group
(24.390.85 g/L; p < 0.05).
Total proteins g/L
50
**
+
***
++
40
30
20
10
gr
ou
p
III
ro
up
II
g
Ig
ro
up
Fig. 1. The effects of diet supplementation with 1% of Ocimum basilicum (I group), 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (II group) and 0.5% of Thymus vulgaris herba and 2% of Pimpinella anisum (III group); C1
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of total proteins in
broilers at the age of 56 days; + p<0.05; ++ p<0.01 vs. C1 control group; ** p<0.01; *** p<0.001 vs. C2 control group
Creatine kinase activity (Fig. 3) is another biomarker which can be used for evaluation, not only of
functional status of hepatocytes, but also for skeletal muscle integrity. In this experimental design
we determined the lowest activity in group of broilers fed BD with 0.5% of Ocimum basilicum and
0.5% of Thymus vulgaris (403.430.55 U/L; p < 0.01) and broilers fed BD with 0.5% of Thymus
vulgaris herba and 2% of Pimpinella anisum (470.141.06 U/L; p < 0.05), compared to C2 group
(695.874.5 U/L). There were no differences between C1 group (BD only) and I group of broilers
(BD plus basil), p > 0.05.
160
40
#
***
+++
Albumin g/L
30
***
+++
**
++
20
10
III
gr
ou
p
ro
up
II
g
Ig
ro
up
control group fed with BD; C2 control group fed with BD plus Salinomycin) on albumin concentration in broilers at
the age of 56 days; ++ p<0.01; +++ p<0.001 vs. C1 control group; ** p<0.01; *** p<0.001 vs. C2 control group; # p<0.05 I
group vs. II group
Creatine kinase U/L
1000
800
600
**
400
200
III
gr
ou
p
ro
up
II
g
Ig
ro
up
control group fed with BD; C2 control group fed with BD plus Salinomycin) on creatine kinase activity in broilers at
the age of 56 days; * p<0.05; ** p<0.01 vs. C2 control group
Total bilirubin mol/L
15
10
**
+
gr
ou
p
III
ro
up
II
g
Ig
ro
up
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of total bilirubin in
broilers at the age of 56 days; * p<0.05; ** p<0.01 vs. C2 control group
161
Concentrations of total bilirubin (Fig. 4) were the lowest in III group of broilers (8.110.16 mol/L;
p < 0.01) and in II group (8.270.31 mol/L; p < 0.05) compared to C2 group. It is of interest to
note that we did not find statistically significant difference between C1 (BD only) and C2 groups
(BD plus Salinomycin); p > 0.05.
Triglycerides concentration (Fig. 5) was the lowest in II group of broilers fed with addition of 0.5%
of Ocimum basilicum and 0.5% of Thymus vulgaris (0.890.02 mmol/L; p < 0.001), compared to C1
(1.230.05 mmol/L) and C2 (1.140.03 mmol/L). The same statistical differences (p < 0.001) were
noticed between I (1.200.02 mmol/L) and II group (1.250.06 mmol/L) of broilers.
We did not find any significant differences (p > 0.05) between broiler groups regarding
concentration of glucose (Fig. 6)
Triglycerides mmol/L
1.5
###
***
+++
1.0
0.5
III
gr
ou
p
ro
up
II
g
Ig
ro
up
0.0
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of triglycerides in
broilers at the age of 56 days; +++ p<0.001 vs. C1 control group; *** p<0.01 vs. C2 control group; ### p<0.001 I group vs.
II group
Glucose mmol/L
15
10
gr
ou
p
III
up
ro
II
g
Ig
ro
up
control group fed with BD; C2 control group fed with BD plus Salinomycin) on concentration of glucose in broilers at
the age of 56 days
Discussion & Conclusion

The practice of feeding livestock with subtherapeutic levels of antibiotics has been in use for over
fifty years. But, usage of antibiotics has negative effects on animals health and production
162
(Markovi et al., 2009). Furthermore, now days consumers request poultry products that are free
from residual chemotherapeutics. The use of natural products as an alternative to drugs may be the
best solution to this consumer demand (Harper and Makatouni, 2002).
The herbal products are complex mixtures of ingredients, where the relative concentrations of each
phytomolecule may vary considerably (Orengo et al., 2012). Instead of testing each and every one,
our study focuses on three plants used alone or in combination. The aim of this research was to find
what plant and effective doses of herbal additives could have a beneficial impact on the growth
performance and health status of broilers.
Plants and their extracts (called essential oils) possess antibacterial, antifungal and antiviral
properties and have been screened worldwide as potential sources of novel antimicrobial
compounds, alternatives to treat infectious diseases and agents promoting food preservation
(Solorzano-Santos and Miranda-Novales, 2011). Weight gain is one of the most sensitive and
informative measure of efficacy of certain additives (Conway et al., 1999). From productive point
of view, it is of interest to mention that our results showed that phytoadditives can improve growth
performance in broilers, although there were no statistically significant differences between control
and experimental groups (Table 1). But, it is obvious from results showed in Table 1, that broilers
received BD with 0.5% of Ocimum basilicum and 0.5% of Thymus vulgaris had a better feed
conversion ratio and carcass yield compared to other groups of broilers. Our trial was performed
under highly hygienic conditions, which could have alleviated the animals response.
Environmental conditions, such as density and stress status of the animals, are important for
detecting performance responses to plants used as feed additives (Catala-Gregori et al., 2008).
According to Ertas et al. (2005), the combination of some plants extracts could present better effect
on the growth performance in poultry in comparison with their individual supplementation.
Synergism among some herbal constituents was highlighted in the in vitro studies performed by
Montes-Belmont and Carvajal (1998). Moreover, Burt (2004) reported that an antagonistic effect
has been expected as well. We presumed that potential synergistic effects between basil and thyme
could result in beneficial effect on both the growth performance of broilers and their
hepatoprotective effects.
Although total protein concentrations were also affected by phytoadditives in BD (Fig. 1), the most
remarkable are results in albumin concentrations (Fig. 2). Our results showed that 1% of basil had
the best stimulatory effect on hepatocytes to synthesized albumin, since the liver is the only site for
its synthesis. It is possible that eugenol and carvacrol, two major ingredients of basil (Lv et al.,
2011), are responsible for such liver response. Total proteins, also were much higher in herbal
supplemented broilers; the most higher values were recorded in group supplemented with mixture
of 0.5% basil and 0.5% of thyme (Fig. 1). If one takes into account that globulins are the second
protein fraction, very important as a part of defensive systems of an organism (and that they are
elevated in this case), the contribution of this herbal combination should not be neglected in
stimulation of broilers immune system.
Dietary supplementation of our plants combination to chickens for 8 weeks did not cause a
significantly lower blood plasma glucose concentration, and in this respect our results are
contradictory. Namely, a number of spices and herbs have a long history of traditional use in
treating elevated blood sugar levels. For example Jarvill-Taylor et al. (2001) reported that cinnamon
stimulated glucose uptake, glycogen synthesis, and activated glycogen synthase in 3T3-L1
adipocytes. Later studies of Bakirel et al. (2008) showed that ethanolic extracts of rosemary leaves
lowered blood glucose in normoglycemic and glucose-hyperglycemic rabbits.
In the present experiment, there was a significant decrease in total bilirubin concentration in birds
fed diets supplemented with 0.5% basil and 0.5% thyme (II group) and 0.5% basil and 2% anis (III
group). A decrease in total bilirubin level in the blood sera in the current study could be explained
by stimulation of uridine diphosphate glucuronyltransferase enzyme (UDP-glucuronyltransferase),
163
or by protective effects of essential oils presents in our combination of plants on wall of liver cells
(Figs. 3 and 4). There are several reports concerning an inhibition or activation of hepatic UDP
glucuronyltransferase by certain plant constituents. Siraki et al. (2005) found out that borneol
inhibited glucuronidation of non steroidal antiinflammatory drugs in isolated rat hepatocytes. This
could be also applied to activity of creatine kinase activity. Namely, we found significantly decrease
of its activity in the blood sera of broilers fed with combinations of basil and thyme (II group) and
basil and anis (III group). Undoubtedly, these findings coupled with total bilirubin concentration,
suggest that wall of liver cells was strengthened in some way (Bakkali et al., 2008).
Little is known about the effects of herbs on lipid metabolism of broilers. The effect of some
functional herb substances (cyclic terpenes) on serum cholesterol and total lipids in poultry were
reported by Faxova et al. (2009). On the other hand, no changes in serum cholesterol and plasma
lipids because of dietary supplementation of herb extracts (some monoterpens and essential oils) to
broilers were observed. Najafi and Torki (2010) found that total cholesterol, triglycerides and highdensity lipoproteins in the blood of broilers did not respond to the dietary supplementation of clove
extract. Our results are in line with these findings, except for the combination of 0.5% basil and
0.5% thyme (Fig. 5), where this combination of phytoadditives significantly decreased the
concentration of triglycerides in the blood of broilers.
It could be concluded that supplementation of the diet with phytoadditives has a potential to
improve health status in broilers. Further examinations are needed in order to elucidate the exact
mechanism of action.
Acknowledgment
This work was granted by Ministry of education, science and technological development, Republic
of Serbia; Grant No III 46009.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Anthony JP., Fyfe L., Smith H.: Plant active components a resource for antiparasitic agents? Trends in
Parasitology, 21, 10, 2005
Bakirel T., Bakirel U., Kels O.U., Ulgen S.G., Yaroibi H.: In vitro assessment of antidiabetic and
antioxidant activities of rosemary (Rosmarinus officinalis) in alloxan-diabetic rabbits. Journal of
Ethnopharmacology, 116, 64-73, 2008
Bakkali F., Averbeck S., Averbeck D., Idaomar M.: Biological effects of essential oils - A review. Food
and Chemical Toxicology, 46, 446-475, 2008
Brenes A., Roura E.: Essential oils in poultry nutrition: Main effects and modes of action. Animal Feed
Science and Technology, 158, 1-14, 2010
Burt S.: Essential oils: their antibacterial properties and potential application in foods a review.
International Journal of Food Microbiology, 94, 223-253, 2004
Catala-Gregori P., Mallet S., Travel A., Orengo J., Lessire M.: Efficiency of a prebiotic and a plant
extract alone or in combination on broiler performance and intestinal physiology. Canadian Journal of
Animal Science, 88, 623-629, 2008
Conway D.P., Dayton A.D., McKenzie M.E.: Comparative testing of anticoccidials in broiler chickens:
the role of coccidial lesion scores. Poultry Science, 78, 529-535, 1999
Ertas O.N., Guler T., Ciftci M., Dalkilic B., Sinsek U.G.: The effect of an essential oil mix derived from
oregano, clove and anis on broiler performance. International Journal of Poultry Science, 4, 879-884,
2005
Faixova Z., Piesova E., Makova Z., Takacova J., Cobanova K., Leng L., Faix S.: Effects of borneol on
blood chemistry changes in chickens. Acta veterinaria (Beograd), 59, 177-184, 2009
164

10. Harper C.G., Makatouni A.: Consumer perception of organic food production and farm animal welfare.
British Food Journal, 104, 287-299, 2002
11. Jarvill-Taylor K.J., Anderson R.A., Graves D.J.: A hydroxychalcone derived from cinnamon functions
as a mimetic for insulin in 3T3-L1adipocytes. Journal of American College of Nutrition, 20, 327-336,
2001
12. Lv F., Liang H., Yuan Q., Li C.: In vitro antimicrobial effects and mechanism of action of selected plant
essential oil combinations against four food-related microorganism. Food Research International, 44,
3057-3064, 2011
13. Markovi R., efer D., Krsti M., Petrujki B.: Effect of different growth promoters on broiler
performance and gut morphology. Archivos de Medicina Veterinaria, 41, 163-169, 2009
14. Montes-Belmont R., Carvajal M.: Control of Aspergillus flavus in maize with plant essential oil and
their components. Journal of Food Protection, 61, 616-619, 1998
15. Najafi P., Torki M.: Performance, blood metabolites and immunocompetence of broiler chicks fed diets
included essential oils of medicinal herbs. Journal of Animal and Veterinary Advances, 9, 1164-1168,
2010
16. Orengo J., Buendia A.J., Ruiz-Ibanez M.R., Madrid J., Del Rio L., Catala-Gregori P., Garcia V.,
Hernandez F.: Evaluating the efficacy of cinnamaldehyde and Echinacea purpurea plant extract in
broilers against Eimeria acervulina. Veterinary Parasitology, 185, 158-163, 2012
17. Petrovic V., Marcincak S., Popelka P., Simkova J., Martonova M., Buleca J., Marcincakova D.,
Tuckova M., Molnar L., Kovac G.: The effect of supplementation of clove and agrimony or clove and
lemon balm on growth performance, antioxidant status and selected indices of lipid profile or broiler
chickens. Journal of Animal Physiology and Animal Nutrition, 1-8, 2011
18. Puvaa N., Stanaev V., Glamoi D., Levi J., Peri L., Stanaev V., Mili D.: Beneficial effect of
phytoadditives in broiler nutrition. Worlds Polutry Science Association, 69, 27-37, 2013
19. Siraki A.G., Chevaldina T., OBrien P.J.: Application of quantitative structure-toxicity relationships for
acute NSAID cytotoxicity in rat hepatocytes. Chemico-Biological Interactions, 151, 174-91, 2005.
20. Solorzano-Santos F., Miranda-Novales M.G.: Essential oils from aromatic herbs as antimicrobial agents.
Current Opinion in Biotechnology, 23, 1-6, 2011
165
THE INFLUENCE OF CLIMATIC FACTORS IN SERBIA ON MYCOTOXIN

PRODUCTION
Sandra Jaki1*, Milica ivkov-Balo1, Nadeda Prica1, Zoran Mai1, Ksenija Nei2, Igor Jaji3,
Biljana Abramovi4
1

3
Faculty of Agriculture, University of Novi Sad, Serbia
4
Faculty of Sciences, University of Novi Sad, Novi Sad, Serbia
2
Abstract
Marked climate changes led to frequent droughts and high temperatures that favor the growth of
molds, occurrence of plant diseases and pests and consequently, the toxin production. Having in
mind characteristic climatic conditions in Serbia in 2011/12 and 2013/14 production years, our
research was aimed at investigating their influence on contamination of animal feed and potential
consequent poisoning of milk by specific mycotoxins. The available results on crops contamination
for each year were correlated with the climatic conditions characteristic for the relevant year.
Extremely warm and dry 2011/12 production year (according to the report of Republic
Hydrometeorological Service of Serbia) was characterized also by high aflatoxin levels in maize.
Out of 67 examined maize samples, 61.2% were contaminated with aflatoxins, whereas 24% of
examined 75 milk samples contained aflatoxin M1 at concentrations above 0.5 g/kg. Contrary to
that, extremely humid climate conditions in 2013/14 production year resulted in particularly high
concentration of Fusarium toxins. Thus, 100% of 21 examined maize samples were contaminated
with deoxynivalenol and fumonisins, and 90% with zearalenone. Consequently, high percentage of
16 examined samples of complete feed mixtures for pigs were declared unsafe, that is, contaminated
with deoxynivalenol (75%) and zearalenone (44%). Comparison of the data on climatic conditions
with the levels and incidence of samples contaminated with aflatoxins and Fusarium toxins
revealed negative effects of climatic deviations (precipitation rate and temperature) in the territory
of Serbia on mycotoxicological safety of maize, and consequently animal feed and milk.
Keywords: mycotoxins, climate, feed, milk
Introduction
Mycotoxins are toxic compounds produced by filamentous fungi, which often contaminate cereal
food and feeds. Mycotoxins may possess carcinogenic, cytotoxic, immunosuppressive, neurotoxic,
estrogenic or teratogenic activity (Nei et al., 2014). The mycotoxins of greatest concern in Serbia
usually were Fusarium toxins such deoxynivalenol (DON, Jaji et al., 2008) and zearalenone (Jaji
et al., 2013), but also ochratoxin A as Aspergillus toxin (Jaki et al., 2011). In warm and humid
subtropical and tropical conditions, maize ears are ideal conditions for colonization and dominance
of Aspergillus flavus/parasiticus species, resulting in the formation of aflatoxins (Sanchis and
Magan, 2004). Until now, aflatoxins were not identified as common contaminant of cereals in the
territory of Serbia (Jaki et al., 2011; Kos et al., 2013). Moreover, high concentrations of
fumonisins were not recorded either (Jaki et al., 2012), thus, they were not addressed in legal
regulations pertaining to animal feed (Official Gazette RS, 2014). Mycotoxins cause individual
toxic effects to human and animal health; however, cumulative effect of low mycotoxin
166
concentration and potential synergistic effects of low levels of multiple mycotoxins are issues that
are receiving growing attention (Stojanov et al., 2013).
Production of mycotoxins on crops depends on climatic factors such as temperature and relative
humidity, thus, changing climate has a direct impact on mycotoxin production (Paterson and Lima,
2011). Accurate information is therefore needed on the impact of and relationship between key
factors related to climate conditions (water availability and temperature), and which are marginal
and which are optimum for germination, growth and toxin production (Sanchis and Magan, 2004).
Table 1 shows the optimal temperatures and water activity (aw) for mycotoxins production and
growth in vitro for some important plant pathogenic fungi.
Table 1. Optimal temperature (C) and water activity (aw) for mycotoxin production and growth on
different substrates (Sanchis and Magan, 2004).
Fungus species
Aspergillus flavus
Aflatoxins
33
(0.99 aw)
Mycotoxins production
Ochratoxin
Zearalenone DON
1530
(0.93 aw)
Fusarium
verticillioides,
F. proliferatum
25
(>0.98 aw)
F. graminearum
A. ochraceus
Penicillium
verrucosum
Fumonisins
2530
(0.98 aw)
25
(0.900.95 aw)
30
(0.99 aw)
Growth
35
(0.95 aw)
30
(0.90 aw)
2022
(0.98-0.995 aw)
30
(0.960.98 aw)
25
(0.95 aw)
Conditions adverse to the plant (drought stress, temperature stress, stress induced by pest attack,
poor nutrient status, etc.) encourages the fungal partner to develop more than under conditions
favourable to the plant with the expectation of greater production of mycotoxins. On the other side,
factors influenced by climate such as insect and other pest attack, soil condition and nutrient status
and agro-industrial methodology are potential and indirect triggers of fungal colonization and
mycotoxins production (Tirado et al., 2010). Temperature and rainfall are the climatic factors that
are most likely to be affected widely by future global change, and alterations in these are expected
to have a wide range of impacts on plants and on mycotoxins concentrations in plants (Miraglia et
al., 2009).
Maize can support different mycotoxin-producing molds, such as F. graminearum, F.
verticillioides, and A. flavus, and the dominant species is determined by meteorological conditions.
F. verticillioides, a producer of the fumonisin toxins, is the most common species on maize in
Southern Europe. Fumonisins have been associated with dry weather during grain fill and late
season rains. Therefore, the production of the toxins will be favored by the foreseen climate change.
While drought years may take most of crop value in the case of aflatoxin problems, mild
temperature and rain during maize plant growth is conducive to plant infection by F. graminearum
and DON levels (Miraglia at al., 2009). Therefore, changes in global temperature would directly
affect their growth and mycotoxins production capacity.
According to Paterson and Lima (2010) the biggest risk with respect to mycotoxins from climate
change will be found in developed countries with temperate climates (e.g. parts of Europe and the
United States of America, etc.) and the anticipated climate changes will present numerous
challenges for those involved in mycotoxins research and crop production in the near future.
167
A high priority over the next decade is the collation of accurate contamination and weather data,
together with the development of models to forecast the effects of climate change on mycotoxins,
with a view to providing the necessary foresight for strategic adaptation to climate change (Miraglia
et al., 2009; Paterson and Lima, 2010). Modelling studies provide increasingly realistic scenarios
for the influence of changes in the magnitude and variability of precipitation, temperature, etc. on
mycotoxins contamination.
Having in mind characteristic climatic changes that resulted in specific extreme conditions in Serbia
in 2011/12 and 2013/14 production years, our research was aimed at investigating their influence on
contamination of maize, feed and potential consequent poisoning of milk by specific mycotoxins.

The results of determining the contents of total aflatoxins in 67 maize samples, harvest 2012 are
presented in this article. The level of aflatoxin M1 was examined in 75 milk samples. The contents
of Fusarium toxins: deoxynivalenol, zearalenone and total fumonisins were examined in 21 maize
samples (harvest 2014) as well as 16 samples of complete pig mixtures and 7 complete poultry
mixtures. The samples originated from different localities of Serbia. The investigated samples were
a part of animal feeds that were submitted to our laboratory for regular control, yet suspect because
of evident health problems on related pig and poultry farms. Milk samples were collected from milk
collecting points or dairy plants, directly on the production line.
The presence of total aflatoxins, aflatoxin M1, deoxynivalenol, fumonisins (FB) and zearalenone in
corn, feed, and milk were analyzed by enzyme-linked immunosorbent assay methods, using
RidascreenFAST Aflatoxin (Art. No. R5202), RidascreenAflatoxin M1 (Art. No. R1121),
RidascreenFAST DON (Art. No. R5901), RidascreenFumonisin (Art. No. R3401) and
RidascreenFAST Zearalenon (Art. No. R5502) test kits (R-Biopharm, Germany). The color
intensity is measured photometrically at 450 nm (Multiskan FC, Thermo Scientific, China) and is
inversely proportional to the mycotoxin concentration in the sample. According to the
manufacturers description, the detection limits (DL) were 1.75 g/kg (ppb) for aflatoxins, 5 ng/kg
(ppt) for aflatoxin M1, 0.2 mg/kg (ppm) for DON, and 25 g/kg for fumonisins. Laboratory
detection limit for zearalenone was 60 g/kg. The analytical quality of the ELISA method was
assured by the use of certified reference materials: TR-A100, lot #A-S-267, TR-F100, lot #F-C-439,
TR-D100, lot #DW-174 and R-Z100, lot #Z-C-320 (Trilogy Analytical Laboratory, Washington,
USA), as well as by participation in proficiency testing scheme (milk powder sample FAPAS
04224). Recovery was 101% for aflatoxins, 105% for aflatoxin M1, 103% for DON, 99% for
fumonisins, and 90% for zearalenone. Special software, the RidaSoft Win (Art. No. Z9999, RBiopharm, Germany), was used for the evaluation of enzyme immunoassays.
Results and discussion

Contamination of maize and milk by aflatoxins in 2012
Having in mind characteristic climatic conditions in Serbia during 2012, which particularly affected
maize production, aflatoxin concentration has been examined in selected maize samples (Table 2).
Table 2. Aflatoxin content in maize samples in Serbia, harvest 2012.
DL
Min
Mean value
Positive/
Positive samples
Toxin
Max (g/kg)
(g/kg)
(g/kg)
(g/kg)
total no. of samples
(%)
Aflatoxins
1.75
2.11
156
37.36
168
41/67
61.2
As obvious from Table 2, 61.2% of samples revealed aflatoxin levels above DL. Out of 67
examined samples, 14 (21%) were unacceptable for animal feed, i.e., the level of total aflatoxins
exceeded 50 g/kg, which was maximum permitted level in animal feed according to the relevant
Regulation in Serbia of that time (Official Gazette RS, 2010). Namely, pursuant to new Regulation
(Official Gazette RS, 2014), maximum permitted content of aflatoxin B1 in animal feed is 30 g/kg,
thus in that case 22.4% of examined samples would have been declared unacceptable. Researches
on aflatoxin in maize (harvest 2012) in Serbia of other authors revealed similar results: 56%
positive samples out of which 5.4% with concentration above 50 g/kg and with a maximum
concentration reaching even 145.8 g/kg (krinjar et al., 2013); 68.5% positive samples with 29.5%
revealing toxin content >50 g/kg (Kos et al., 2013).
Maize contamination with high levels of aflatoxins has lead to consequent milk contamination with
M1, a metabolic product of aflatoxin B1. The results of the examination of milk samples are
displayed in Table 3. Eighteen (24%) examined samples contained more than 0.5 g/kg aflatoxin
M1, thus not complying with the legislative regulations in Serbia of that time (Official Gazette RS,
2013). When analyzing the obtained results in relation to EU regulations (EC, 2010), 73.3% of the
samples would have been declared unacceptable for human consumption because of aflatoxin
concentration above 0.05 g/kg
Table 3. Contents of aflatoxin M1 in milk samples in Serbia in 2013.
No. of samples
Toxin
Aflatoxin M1
DL*
(g/kg)
Positive/
total no. of
samples
Positive
samples
(%)
0.050.50
(g/kg)
0.500.80
(g/kg)
> 0.80
(g/kg)
0.05
55/75
73.3
37
10
* Because of high toxin concentration and max permitted level of 0.5 g/kg, the samples were diluted, thus
determination range encompassed concentrations from 0.05 to 0.80 g/kg
According to the report of the Republic Hydrometeorological Service of Serbia, 2012-production

year was characterized by pronounced climatic changes, i.e., hydro-meteorological extremes
ranging from heat and cold waves to severe and prolonged drought. Three heat waves were
recorded in Serbia in the period from June to August 2012. Positive deviation of maximum daily
temperature as compared to the annual range of average daily temperatures was even up to 13C.
Prolonged periods of extremely high air temperatures during June, July and August 2012 as well as
precipitation deficit resulted in severe and extreme draughts in many regions of Serbia.
Consequently, dramatically accelerated ripening of the majority of crops has occurred. Poorer
qualitative and quantitative crop yield can be attributed to both unfavourable combination of
temperature and humidity conditions in the periods of the year coinciding with the most critical
stages of plant development and inadequate implementation of appropriate agro-technical measures.
Such conditions favored the occurrence of Fusarium infection and increase in pest population.
Weather conditions negatively affected the tasseling, silk production and fertilization of corn. Such
conditions were, however, ideal for the development and activity of plant pests. During this period,
the worst situation was recorded in Vojvodina region, with an average precipitation rate of only
25%. Maize was the most endangered crop of all, and was ready for harvesting as early as end
August (RHMZS, 2012).
According to the aforementioned report of the RHMZS, one can conclude that summer 2012 was
the hottest one in Serbia since record began, and with very little precipitation. The hottest and driest
period (30 June-25 July) in the major part of the territory coincided with the most important
generation phases of spring crops, thus causing substantial damage and losses in agricultural crops
production manifested by high concentration of aflatoxins in maize and consequently in milk.
169
Contamination of maize and animal feed with Fusarium toxins in 2014

The results on the contents of some Fusarium toxins in maize (harvest 2014) and animal feed are
presented in Table 4.
Table 4. Concentration of Fusarium toxins in samples of animal feed and maize (harvest 2014), in Serbia
Corn
DON
Zearalenone
Fumonisins
(mg/kg)
(g/kg)
(mg/kg)
21
21
21
Total number of samples
21
19
21
Number of positive samples
Number of inappropriate
0
0
0
samples
7.6
2389
10.2
max content
0.207
83
0.449
min content
Average

samples
max content
min content
Average

samples
max content
min content
Average
2.12
433.4
3.28
Complete swine mixtures
DON
Zearalenone
Fumonisins
(mg/kg)
(g/kg)
(mg/kg)
16
16
16
16
16
16
12
7
0
5.82
0.47
574
144
2.15
0.901
2.82
337.6
1.42
Complete poultry mixtures
DON
Zearalenone
Fumonisins
(mg/kg)
(g/kg)
(mg/kg)
7
Not
7
legislated
6
7
0
0
3.17
0.311
4.24
0.837
1.82
1.83
According to the results presented in Table 4, high incidence of samples positive to Fusarium toxins
was recorded in maize samples. DON and fumonisin contamination was confirmed in 100% of
examined maize samples, whereas 90.5% of samples were contaminated with zearalenone.
Although the concentrations of the examined mycotoxins in maize did not exceed the maximum
permitted levels (8 mg/kg for DON, 4000 g/kg for zearalenone and 60 mg/kg for fumonisins
(Official Gazette RS, 2014; EC, 2006)), maize contamination with these mycotoxins consequently
resulted in large number of contaminated samples of complete pig mixtures (100% samples
contaminated with all three toxins) and complete poultry mixtures (DON and fumonisin
contamination of 85.7% and 100% samples, respectively). As complete feed mixtures contain large
proportion of maize, high percentage of pig mixtures were declared inappropriate according to the
Regulation because of increased contents of DON (75.0%) and zearalenone (43.7%). Fumonisin
concentration in examined samples did not exceed the maximum permitted values according to EU
170
regulations (EC, 2006); however, their presence should not be neglected because of their potential
cumulative and synergistic toxic effects with DON and zearalenone.
According to the report of RHMZS, weather conditions in the territory of Serbia in 2014 revealed
several extreme deviations as compared to the annual range of average values for this climatic
region. By mid May, the territory of Serbia was characterized by abundant rainfall, which has never
been recorded so far. The summer 2014, (June-August) was characterized by moderately warm and
extremely rainy and humid season. During the vegetative period (April-September) 2014, the
average rainfall recorded in Serbia was 700 mm, which is the highest rate of rainfall during
vegetation period recorded in the last 45 years. In the major part of the country, the precipitation
rate was 2-3 times higher as compared to the multi-year annual average. Such extremely humid and
rainy weather brought about a number of plant diseases such as blight and decaying fungi as well as
intensive activity of the European corn borer (Ostrinia nubilalis). Frequent rains and increased air
humidity contributed to significantly slower ripening of maize, thus resulting in delayed harvesting.
Even though this rainy year contributed to record maize yields, increased grain moisture content as
well as grain damage caused by mouldy corn agents such as Fusarium and Penicillium was
recorded (RHMZS, 2014).
The presented results indicated that humid climatic conditions in 2014 significantly contributed to
the development of Fusarium moulds and consequent mycotoxin production in maize.
Conclusion
Based on the analysis of the content of examined mycotoxins and agrometeorological factors we
can conclude that temperate climate is the determining factor for mycotoxicological safety of
cereals in the region of Serbia. The deviation from annual average precipitation and temperature
values, that is, precipitation surplus or droughts as well as prolonged periods with extremely high
temperatures, impose the necessity of applying all available agro technical measures to prevent
development of fungi, maize diseases and insects and thus reduce the risk of mycotoxin
contamination. The obtained data on the level of mycotoxins and correlation of their contents are
useful instrument for developing a model to improve prediction of risks for mycotoxin
contamination in Serbia.
Acknowledgments
The work was financially supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia (Project No 172042).
References
1.
2.
3.
4.
EC (European Commission): Commission Recommendation of 17 August 2006 on the presence of

deoxynivalenol, zearalenone, ochratoxin A, T-2 and HT-2 and fumonisins in products intended for animal
feeding. 2006/576/EC, O. J., L 229: 79, 2006
EC (European Commission): Commission Regulation 165/2010 of 26 February 2010 amending
Regulation (EC) No 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards
aflatoxins, O. J., L 50: 812, 2010
Jaji I., Juri V., Glamoi D., Abramovi B.: Occurrence of Deoxynivalenol in Maize and Wheat in
Serbia. International Journal of Molecular Sciences, 9, 11, 21142126, 2008
Jaji I., Krstovi S., Perii B., Jaki S., Bursi V., Abramovi B.: Presence of zearalenone in the most
commonly grown wheat cultivars in Serbia, Proceedings for Natural Sciences, Matica Srpska Novi Sad,
124, 101-109, 2013
171

5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Jaki S., Pruni B., Milanov D., Jaji I., Bjelica L., Abramovi B.: Fumonisins and co-occurring
mycotoxins in north Serbian corn, Proceedings for Natural Sciences, Matica Srpska Novi Sad, 120,
4959, 2011
Jaki S., Abramovi B., Jaji I., ivkov-Balo M., Mihaljev ., Despotovi V., oji D.: Co-occurrence
of Fumonisins and Deoxynivalenol in Wheat and Maize Harvested in Serbia. Bulletin of Environmental
Contamination and Toxicology, 89, 3, 615-619, 2012
Kos J., Mastilovi J., Jani Hajnal E., Sari B.: Natural occurrence of aflatoxins in maize harvested in
Serbia during 20092012. Food Control, 34, 1, 3134, 2013
Miraglia M., Marvin H. J. P., Kleter G. A., Battilani P., Brera C., Coni E., Cubadda F., L. Croci, De
Santis B., Dekkers S., Filippi L., Hutjes R.W.A., Noordam M.Y., Pisante M., Piva G., Prandini A., Toti
L., van den Born G.J., Vespermann A.: Climate change and food safety: An emerging issue with special
focus on Europe. Food and Chemical Toxicology, 47, 5, 1009-1021, 2009
Nei K., Ivanovi S., Nei V.: Fusarial Toxins: Secondary Metabolites of Fusarium Fungi. Reviews of
Environmental Contamination and Toxicology, 228, 101-120, 2014
Official Gazette RS, No. 4 : Pravilnik o kvalitetu hrane za ivotinje, l. 99 i 101, 2010
Official Gazette RS, No. 20: Pravilnik o maksimalno dozvoljenim koliinama ostataka sredstava za
zatitu bilja u hrani i hrani za ivotinje i o hrani i hrani za ivotinje za koju se utvruju maksimalno
dozvoljene koliine ostataka sredstava za zatitu bilja, 2013
Official Gazette RS, No. 27: Pravilnik o izmeni pravilnika o kvalitetu hrane za ivotinje, 2014
Paterson R.R.M., Lima N.: How will climate change affect mycotoxins in food? Food Research
International, 43, 7, 1902-1914, 2010
Paterson R.R.M., Lima N.: Further mycotoxin effects from climate change. Food Research International,
44, 9, 2555-2566, 2011
R-biopharm,
Mycotoxins,
http://www.r-biopharm.com/products/food-feed-analysis/mycotoxins,
Pristupljeno 05.04.2015.
RHMZS (Republiki hidrometeoroloki zavod Srbije): Agrometeoroloki uslovi u proizvodnim
2011/2012; 2013/2014. godinama na teritoriji Republike Srbije.
http://www.hidmet.gov.rs/ciril/meteorologija/agrometeorologija.php, Pristupljeno 05.04.2015.
Sanchis V., Magan N.: Environmental conditions affecting mycotoxins. In, Mycotoxins in food:
Detection and control, Eds. N. Magan and M. Olsen, Boca Raton, FL: CRC Press, 2004, 174-189.
Stojanov I.M., Kapetanov M.C., Potkonjak D.V., ivkov-Balo M.M., Jaki S.M., Radulovi Prodanov
J.Z.: Correlation between the limit values of laboratory and clinical mycotoxicosis. Journal for Natural
Sciences, Matica Srpska Novi Sad, 124, 325-332, 2013
krinjar M., Jockovi ., Matijevi Z., Koci-Tanackov S.: Aflatoksini u itaricama i proizvodima na
bazi itarica - pojava, uticaj na ljudsko zdravlje, zakonska regulative. Zbornik referata 47. Savetovanje
agronoma Srbije, 39.02.2013, Zlatibor, Srbija, 2013, 27-32.
Tirado M.C., Clarke R., Jaykus L.A., McQuatters-Gollop A., Frank J.M.: Climate change and food safety:
A review. Food Research International, 43, 7, 1745-1765, 2010
172
RADIOACTIVITY OF THE SOIL IN VOJVODINA

(NORTHERN PROVINCE OF SERBIA)
eljko Mihaljev1*, Dragana Ljubojevi1, Miroslav irkovi1, Milica ivkov-Balo1, Sandra
Jaki1, Brankica Kartalovi1, Nadeda Prica1
Abstract
Peaceful uses of nuclear energy (nuclear weapons testing, nuclear reactor accidents, industrial and
medical use of radioactive compounds) and application of phosphate mineral fertilizers in
agricultural production lead to substantial environmental contamination. Land contaminated with
radionuclides represents the first link in the food chain and hence the radioactive contamination of
crop and livestock production. To determine the soil levels of natural radionuclides the samples
were collected from 11 localities in the territory of Vojvodina. The measurements were performed
applying inductively coupled plasma with mass spectrometry. The values for concentration of
radionuclide activity measured in the examined samples do not significantly diverge from standard
values for agricultural soils.
Key words: natural radionuclides, soil, ICP-MS
Introduction
Natural radioactivity implicates presence of radioactive elements that have been present in nature
since the formation of Earth and the very beginning of formation of its entire living world
(biosphere). Abundant researches revealed substantial differences in the levels of natural
radionuclides between particular localities at Earths surface, and their amounts vary according to
the locality (Mitrovi et al., 1996). The largest source of radiation activity of the soil is a natural
radionuclide potassium-40 (Delalija, 2006). Some other natural radionuclides, which have always
been present on Earth, include also uranium-235, uranium-238, thorium-232, radium-226 and
radon-222 (Levant, 1996). The exposure to low-level radiation originating from these natural
elements has been always affecting all living beings on Earth, and it is considered background
radiation or natural phon.
The basic component of the biosphere is lithosphere (Earths crust), which represents the first link
of the ecology chain: soil-vegetation-animals-man. The soil plays a crucial role in the process of
radionuclide distribution and transfer, thus, knowing of radioactive contamination of the soil is of
great importance for radiation safety issues in biotechnology (Petrovi et al., 1994). Radioactive
contamination of the soil is either natural (formed without mans activity) or human produced
(nuclear testing, reactor accidents, radioactive waste) (Dobri et al., 2006).
The technologically enhanced naturally occurring radioactivity is attributed to uranium, which is
brought to the environment through diverse technological procedures and agro technical measures
(Rajkovi, 2001). Technological development resulted in substantial increase of natural soil
radioactivity, predominantly through intensive application of agro-technical measures based on the
use of artificial phosphate fertilizers that contain substantial amounts of natural uranium. Moreover,
mining of ore containing heavy metals (zinc, copper, led) from deep layers of lithosphere and
processing thereof, as well as the thermal power stations producing huge amounts of solid waste
(ash, cinder) that contain natural radionuclides such as uranium, thorium and their prodigy (Kisi et
al., 2013) increase the levels of soil radioactivity. Uncontrolled application of phosphate fertilizers
173
implicates substantial potential for undermining of ecological balance as they represent the most
powerful source of 238U and 232Th content in the soil, and hence in plants and other links within the
food chain. In a superphosphate, uranium is deposited as highly water-soluble uranyl sulphate UO2(SO4) and urano-sulphate - U(SO4) (Mitrovi et al., 2011). Contrary to other radioisotopes,
radioactive decay of 238U and 232Th results in formation of the series of unstable nuclei, 226Ra and
222
Rn being the most dangerous members of uranium chain. 226Ra is a long half-life -emitter,
manifesting affinity for accumulating in bones, while gaseous 222Rn is responsible for internal
irradiation of lung tissues. Emissions of those radionuclides into the environment represent potential
significant risk factors for the exposure of local inhabitants to ionizing radiation, as well as for
increased levels of natural radiation in particular regions.
Involvement of particular radionuclides into biological cycle is associated with plants ability to
absorb radioactive elements from the soil via their root systems. The amount of radioactive material
from the soil absorbed by plants is directly proportional to the pollution emission density at
particular territory (Simi M., 2001). The transfer of radionuclides from the soil into the plants is
substantially dependant on the soil type, that is, its physico-chemical properties that significantly
affect the resorption rate of radioactive material. The most important physico-chemical properties
include chemical composition (concentration of minerals and content of organic matter), structure
(mechanical composition), pH, moisture content and crop density.

Soil samples were collected from 11 localities in the territory of Vojvodina (Table 1) during 2014.
All samplings (at each of 11 localities) were performed by collecting soil samples from 10-15
different points at the total surface of 100m2. The samples were collected only from flattened soil
surface at the depth of 10-20 cm. The majority of soil samples were of chernozem-type (ivkovi
et al., 1972). The samples were dried at 1050C until reaching the constant mass (IAEA, 1989).
Subsequently, removal of mechanical impurities (mainly stones and plant particles) has been
performed. Dried soil samples were mechanically crushed (ground) to obtain fine powder. The
amount of 1g of homogenized sample was weighed and decomposed in HNO3 and H2O2 mixture
using the wet digestion method and the system Ethos, Microwave Labstation, Milestone. Uranium
content was determined using Agilent 7700x Series ICP-MS, and data analysis was performed by
MassHunter Workstation software.
Figure 1. Geographical view of sampling locations

174
The activity levels of uranium-235 and uranium-238 in soil samples were determined according to
total uranium concentration using mass activity values 0.570 Bq/mg U for 235U and 11.10 Bq/mg U
for 238U (Eisenbud, 1973). Potassium content was determined using the method of emission
spectrophotometry on Spectr AA10, manufactured by Varian, at wavelength 766.5 nm and using
cesium as the ionization-suppressor. The soil levels of potassium-40 activity were calculated from
total potassium, using the mass activity value for potassium being 31.561 Bq/g K (Eisenbud, 1973).
Results
The soil in Vojvodina region undergoes radioactive contamination from diverse sources. Above all,
emissions from nuclear plant reactors in neighboring regions cause contamination of the air and
water in a wide area. Intensive application of phosphate fertilizers with high uranium content
potentially causes gradual increase in the activity level of uranium chain in the soil. Moreover,
potential contamination of the soil in Vojvodina with depleted uranium caused by NATO bombing
in 1999 is widely accepted public opinion. All aforementioned factors strongly suggest the
importance of comprehensive assessment of the soil radioactivity status in Vojvodina (Bikit et al.,
2010). Table 1 displays the results on potassium and uranium concentrations, as well as the activity
levels of natural radionuclides 40K, 235U and 238U.
Table 1. Contents of potassium and uranium and concentration of potassium-40, uranium-235 and
uranium-238 activity in soil samples
No.
Locality
1.
Ba
2.
Zmajevo
3.
Despotovo
4.
Temerin
5.
enej
6.
Lovenac
7.
urug
8.
Kisa
9.
Baki Brestovac
10.
Baki Jarak
11.
Rumenka
Average value SD
K content
[g/kg]
16.37 0.54
15.08 0.24
10.91 0.06
15.92 0.30
11.40 0.29
12.84 0.17
17.72 0.58
21.88 0.35
17.57 0.33
22.03 0.42
23.49 0.45
16.84 4.28
40
K activity
[Bq/kg]
516.6 17.0
476.1 17.6
344.3 12.1
502.4 19.6
359.8 19.4
405.4 15.3
559.3 18.6
690.6 11.0
554.5 10.5
695.3 13.2
741.4 14.1
531.4 134.9
U content
[mg/kg]
4.76 0.24
3.55 0.18
3.36 0.17
2.65 0.13
3.12 0.16
3.89 0.19
3.06 0.15
2.87 0.14
2.80 0.14
2.76 0.14
3.24 0.16
3.28 0.62
235
U activity
[Bq/kg]
2.71 0.14
2.02 0.10
1.91 0.10
1.51 0.08
1.78 0.09
2.22 0.11
1.74 0.09
1.63 0.08
1.60 0.08
1.57 0.08
1.85 0.09
1.87 0.35
238
U activity
[Bq/kg]
52.84 2.64
39.40 1.97
37.30 1.86
29.42 1.47
34.63 1.73
43.18 2.16
33.97 1.70
31.86 1.59
31.08 1.55
30.64 1.53
35.96 1.80
36.39 6.83

The results displayed in Table 1 revealed potassium contents in the examined soil samples ranging
from 10.91 to 23.49 g/kg with an average value for all localities being 16.844.28 g/kg. These
values correspond with the potassium-40 activity concentration in a range 344.3 741.4 Bq/kg,
with an average activity level for all localities being 531.4 134.9 Bq/kg. The obtained levels of Kconcentration and 40K activity are considered common values for the soil and are in full accordance
with the results of other authors (Bikit et al., 1990). One can also conclude that potassium-40 is
predominant natural radionuclide in the soil as compared to other radionuclides. Obvious variations
in potassium content in soil lead to the conclusion that incorporation of radionuclides from the soil
into the plants largely depend on pedological properties, soil exploitation, agrotechnical treatments
as well as on the type of plants, what is in accordance with the results of our previous researches
(upi et al., 2005; Mihaljev et al., 2011).
175
Uranium contents in soil samples were uniform, ranging within an interval 2.65-4.76 mg/kg with an
average value for all localities being 3.28 mg/kg (Table 1). Based on these values, the following
activity concentrations for uranium were calculated: 235U = 1.51-2.71 Bq/kg, average value 1.87
0.35 Bq/kg and 238U = 29.42-52.84 Bq/kg, average value 36.39 6.83 Bq/kg. Similar results on
uranium concentration in the soil and the activity concentration for radioactive uranium-238 were
reported by other authors (Skipperud et al., 2011).
The importance of natural radionuclides as potential pollutants in agricultural and livestock
production is addressed in the latest addendum to the Ordinance on the limits of radionuclides in
drinking water, food, animal feed, drugs, general use items, building materials and other goods that
are placed on the market (Official Gazette of RS, No. 97/13). This addendum introduced the new
article, 11a, establishing limits for the contents of natural radionuclides (238U, 226Ra, 40K) in mineral
and phosphate fertilizers as potential sources of radioactive contamination of soil.
We also may conclude that ICP-MS (inductively coupled plasma mass spectrometry) proved very
sensitive method for quantitative determination of uranium concentration in soil samples (Sahoo et
al., 2011). It is therefore an attractive alternative for monitoring uranium because can detect the
normal environmentally caused concentrations (Schramel et al., 1997).
Systematic monitoring of radioactivity level of agricultural soil is of paramount importance in
Vojvodina, as the region with extremely high potential for production of safe food. Soil
contamination with wet or dry atmospheric precipitation and materials characterized by
technologically increased level of natural radioactivity can represent a permanent reservoir of
radionuclides that significantly contribute to the overall radiation exposure and total population
radiation dose.
Acknowledgments
The work was financially supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia, project No TR 31084.
References
1.
2.
3.
4.
5.
6.
7.
8.
Bikit I., Todorovi N., Mra D., Forkapi S., Jovanevi N., Nikolov J., Hansman J.: Merenje
radioaktivnosti zemljita na teritoriji AP Vojvodine. Univerzitet u Novom Sadu, Prirodno-matematiki
fakultet, Departman za fiziku, Novi Sad, 2010
Bikit I., Slivka J., Veskovi M., onki Lj., Krmar M., Mihaljev .: Contamination of Soil and Food
with Radionuclides from Chernobyl. Proceedings of the International Symposium on Post-Chernobyl
Environmental Radioactivity Studies in East European Countries, Kazimierz -1990, Maria CurieSklodowska University, Lublin, Poland, 1990, 34-37
upi ., Mihaljev ., Kljaji R., ivkov-Balo M., Ivanev A.: Total beta activity, potassium-40 and
residual beta activity in alfalfa samples in Vojvodina region. Proceedings of XI international feed
technology simposium-Quality Assurance, Vrnjaka Banja, 2005, 245-248
Dobri S., urovi B.:Nuklearni akcidenti u svetu od 1950 do 2005. Godine. Vojnosanitetski pregled,
63, 5, 465-469, 2006
Delalija M.: Ionizirajue zraenje u biosferi. Sveuilite u Splitu, Kemijsko-tehnoloki fakultet, Split,
2006
Eisenbud M.: Environmental Radioactivity. Academic Press, New York, 1973
International Atomic Energy Agency-IAEA: Measurement of Radionuclides in Food and the
Environment. Vienna, 1989
Kisi D., Mileti S., Radonji V., Radanovi S., Filipovi J.:Prirodna radioaktivnost uglja i leteeg
pepela u termoelektrani Nikola Tesla B. Hemijska Industrija, 67, 5, 729-738, 2013
176

9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Levant I.: Izloenost prirodnom zraenju na Zemlji. Posebno izdanje Agencije za posebni otpad-APO,
Zagreb, 1996
Mihaljev ., upi ., ivkov-Balo M., Jaki S.: Total beta activity, Potassium-40 activity and
residual beta activity in different Tea Samples. Proceedings of XV International Eco-Conference,
Environmental Protection of Urban and Suburban settlements II, Novi Sad, 2011, 281-287
Mitrovi B., Vitorovi G., Stojanovi M., Vitorovi D.: Radiaktivnost fosfatnih mineralnih proizvoda.
Veterinarski Glasnik 65, 1-2, 123-140, 2011
Mitrovi R., Kljaji R., Petrovi B.: Sistem radijacione kontrole u biotehnologiji. Nauni institut za
veterinarstvo Novi Sad, Novi Sad, 1996
Petrovi B., Mitrovi R.: Radijaciona zatita u biotehnologiji. DP Institut za mlekarstvo, Beograd, 1994
Rajkovi M.: Osiromaeni uranijum Uranijum, radioaktivnost i zakonska regulative. Hemijska
Industrija, 55, 4, 167-182, 2001
Sahoo S.K., Hosoda M., Kamagata S., Sorimachi A., Ishikawa T., Tokonami S., Uchida S.: Thorium,
Uranium and rare Elements Concentration in Weathered Japanese Soil Samples. Progress in Nuclear
Science and Technology, 1, 416-419, 2011
Schramel P., Wendler I., Roth Werner E.: Method for the Determination of Thorium and Uranium in
Urin by ICP-MS. Mikrochimica Acta, 126, 263-266, 1997
Simi M., Kovaevi J., Radoevi B., Jovi V.: Prirodni kontaminanti ivotne sredine. Tehnologija
mesa, 42, 1-2, 45-57, 2001
Skipperud L., Popi J., Roos P., Salminen S., Nygren U., Sigmarsson O., Palsson S.E.: Methods-MS,
final report. Nordic nuclear safety research, nks-243, 30-32, 2011
Sl. glasnik RS, br 97/2013. Pravilnik o dopuni Pravilnika o granicama sadraja radionuklida u vodi za
pie, ivotnim namirnicama, stonoj hrani, lekovima, predmetima opte upotrebe, graevinskom
materijalu i drugoj robi koja se stavlja u promet
Veri A., etojevi D., Mijatovi D., Tramoljika Lj.:Uticaj radioaktivnog zraenja na ljudski
organizam. Book of Abstracts, 1st International Conference Ecological Safety in post-modern
environment, Banja Luka, Bosna I Hercegovina, 2009.
ivkovi B., Nejgebauer V., Tanasijevi ., Miljkovi N., Stojkovi L., Drezgi P.: Soils of Vojvodina.
Institute for agricultural research, Novi Sad, 1972
177
PHYSICOCHEMICAL ANALYSIS AS AN INDICATOR OF THE QUALITY OF HONEY

ORIGINATING FROM VOJVODINA REGION
Nadeda Prica1*, Milica ivkov-Balo1, Sandra Jaki1, eljko Mihaljev1, Dragana Ljubojevi1,
Branka Vidi 1, Sara Savi1
1

Abstract
Physicochemical analysis of honey plays an important role in determining the overall characteristic
of honey and final assessment of its quality. This study was aimed at investigating the
physicochemical properties of local honeys collected from different flora from Vojvodina. The
physicochemical parameters such as moisture content, titratable acidity, HMF determination and
ash content were analyzed. The physicochemical characteristics of 35 out of 40 honey samples
(87.5%) analyzed in this study completely correspond with the national Regulation No. 45/2003 and
Codex Alimentarius, indicating adequate processing, good maturity and freshness. Five samples
(12.5%) did not meet standards established in the Regulation No. 45/2003 and Codex standards. In
40 samples analyzed, the HMF content was elevated in one sample (2.5%) exceeding the limit of 40
mg/kg, and 29 samples (72.5%) revealed values lower than 10 mg/kg, which is typical for fresh
unheated honeys, according to the current quality criteria. The moisture content exceeded the
maximum level permitted by the Regulation in only one of 40 analyzed honey samples (2.5%).
Moreover, in only three samples (7.5%), ash content exceeded the maximum level permitted by the
Regulation. The titratable acidity of all samples was lower than the limit of 40 mmol of acid per
1000 g of sample. Research findings pointed out that the physicochemical properties of local honey
from Vojvodina were in accordance with the Codex standard and the products meet significant
quality criteria for a high-quality honey.
Key words: honey, quality, moisture content, titratable acidity, HMF content, ash content
Introduction
Honey is a sweet liquid produced by honeybees using nectar from flowers through a process of
regurgitation and evaporation. The possible health benefits of consuming honey have been
documented in early Greek, Roman, Vedic, and Islamic texts and the healing qualities of honey
were referred to by philosophers and scientists all the way back to ancient times, such as Aristotle
(384 - 322 BC) and Aristoxenus (320 BC). Modern science is finding that many of the historical
claims that honey can be used in medicine may indeed be true. In the Bible (Old Testament), King
Solomon said, "My son, eat thou honey, for it is good", and there are a number of reasons why it
may be good ( Nordqvist, 2014).
Honey also possesses antiseptic and antibacterial properties. In modern science, we have managed
to find useful applications of honey in chronic wound management. However, it should be noted
that many of honey's health claims still require further rigorous scientific studies to confirm them
(Nordqvist, 2014).
According to the Regulation ("Official Gazette of SCG", No. 45/2003), honey is defined as sweet,
dense, crystallized, viscous product produced by honeybees from the nectar of honey plant flowers
or from secretions of living parts (conifer or hardwood species), which the bees collect, transform
by combining with specific substances of their own, and deposit in honeycombs to mature. In
178
Codex standard (2001), honey is defined as natural sweet substance produced by honey bees from
the nectar of plants or from secretions of living parts of plants or excretions of plant sucking insects
on the living parts of plants, which the bees collect, transform by combining with specific
substances of their own, deposit, dehydrate, store, and leave in the honey comb to ripen and
mature. Chemical composition of honey implicates highly complex mixture of more than 200
different substances (Ferreira et al., 2009). Some of these substances are produced by honeybees,
and some originate from honey plants, whereas some are produced during the maturation process in
the honeycomb (Krell, 1996).
Serbia has a very long tradition of beekeeping. Its favourable climate, good geographical condition
and a variety of botanical species provide great potential for the development of apiculture
(Maukanovi-Joci, 2008).
Serbian honey could potentially be very interesting for the EU market, so it is very important to
verify its compliance with the quality specifications of the European Union (European Economic
Community, 2002).

To the purpose of determining the moisture content, ash content, hydroxyl methyl furfural (HMF)
content and total acidity, 40 samples of different honeys originating from Vojvodina region were
collected. All samples were in their original packages and were transferred to the laboratory and
stored in a cold and dark place. The investigated samples included 12 samples of meadow honey, 14
samples of acacia honey, 14 samples of linden honey, 4 samples of multiflower honey, 5 samples of
sunflower honey and 1 sample of forest honey.
Moisture content was determined by the refractometric method (Off.Gazette of SFRJ, 1985), using
an Abbe refractometer (Model RMT, Optech, Italy). All measurements were performed at 200C
after equilibrium, and obtaining the corresponding % of moisture from the refractive index of the
honey sample was calculated by consulting a standard table for this purpose.
The acidity of honey was determined by volumetric method (Off. Gazette of SFRJ, 1985). Ten
grams of honey were dissolved in 75 ml of distilled water and alcoholic solution of phenolphthalein
was added. The solution was titrated with 0.1 mol/dm3 NaOH. Acidity (milimol of formic acid per
kg of honey) was determined as 10 times the volume of NaOH used in titration.
For determination of ash content, the method Off. Gazette of SFRJ, 1985, was followed. According
to the method, 5 g of each sample was weighed in a ceramic plate. The plate was heated in a muffle
furnace for about 3 to 5 h at 600C. It was cooled in desiccators and weighed. The weight of ash
gave the ash content and was calculated by the following formula:
Ash (%) = Weight of sample after ashing 100 /Weight of fresh sample taken
For the HMF determination use was made of an HPLC Dionex UltiMate 3000 Series system with a
diode array detector (DAD-3000, Thermo Scientific, Germany), consisting of an autosampler WPS3000, degasser, quaternary pump, and Hypersil GOLD column (1503 mm, particle size 3 m). The
system was controlled by Chromeleon 7 software (Thermo Scientific). The mobile phase was
MeOHwater (10+90, v/v) filtered through 0.22-m membrane filter, at a flow rate of 1.0 ml/min.

The obtained results on moisture content, total acidity, HMF content and ash content in the
examined honey samples are displayed in Table 1.
179
Moisture content is one of the most important compositions to be considered as a quality parameter
of honey. The maximum moisture content was found to be 34.00 mmol of acid/1000 g in linden
samples, whereas 2.2 mmol of acid/1000 g moisture content was observed in multiflower variety.
Table 1. Results of determining moisture content, HMF, ash content and total acidity in diverse
honey samples
TYPE OF
HONEY
No. of
samples
Meadow
Moisture content
(%)
Acidity
(mmol of acid/1000 g)
Ash content
(%)
HMF content
(mg/kg)
Range
Average
SD
Range
Average
SD
Range
Average
SD
Range
Average
SD
12
14.6 18.6
17.33 1.13
13.75 26
20.34 3.79
0.07 2.96
0.48 0.81
3.84 34.75
10.81 8.20
Acacia
10
14.2 18.4
16.2 1.42
9.5 18.75
13.17 3.07
0.0 0.41
0.09 0.13
6.78 43.78
15.87 12.64
Linden
15 18.6
16.67 1.36
10.5 34.0
15.9 7.44
0.04 1.27
0.38 0.40
4.69 16.13
8.40 3.54
Multi
flower
15.821.4
17.661.93
2.2 27.7
18.98 9.10
0.07 -0.36
0.22 0.10
5.69 10.7
7.48 1.75
Sunflower
16 16.8
16.33 0.42
10 15.00
12.42 2.50
0.02 0.275
0.11 0.15
5.23 7.45
6.47 1.13
Average values obtained in our research (Table 1.) are in agreement with the findings of Cantarelli
et al. (2008), who reported that the moisture content in honey was in the range of 14 to 18%;
however, it depends upon the season and geographic condition. Furthermore, these results are also
in agreement with those of Nuru (2002) and Downey et al. (2005), who reported that the range of
moisture content of pure honey is 16.10 to 23.36%. Fredes and Montenegro (2006) reported that
honey with lower moisture content would have a longer shelf life. The maximum ash content
(2.96%) was found in one sample of meadow honey, another sample of meadow honey revealed ash
contents of 0.86%, which exceeds the maximum permitted level of 0.50%. Total ash contents
measured in other honey samples were in accordance with the limits prescribed by relevant
Regulation. , These findings are in agreement with those of Ihtisham-ul-haq (1997), who analyzed
different varieties of honey and determined the ash content range of 0.008 to 0.49% in honey
samples. These results are also in agreement with those of White (1975a), who worked on different
varieties of honey and obtained ash content in the range of 0.020 to 1.028%. The variation may be
due to many factors such as soil conditions, atmospheric conditions and physiology of each plant.
The composition of organic acids in honey has not yet been adequately investigated; however, some
evidence (Rogulja et al., 2009) suggest that acacia, chestnut and meadow honeys are characterized
by particularly low contents of organic acids, whilst darker honeys in general appear to be higher in
acidity.
The research of Prica et al. (2014.) also demonstrated low acidity of acacia honey as compared with
other examined honey types. The results obtained for meadow honey do not correspond with the
aforementioned evidence, yet the acidity was within the proper range. Our results correspond with
these reports. HMF represents the freshness of honey and depends on adequate beehives and harvest
practice. The majority of honey samples had HMF contents in line with the maximum permitted
levels prescribed by the Regulation ("Official Gazette of SCG", No. 45/2003); maximum HMF
content in honey put in the market is fixed to 40 mg/kg. According to the obtained results, HMF in
honey content exceeded maximum permitted value in only one sample of acacia honey.
180
Conclusion
The physicochemical characteristics of 35 out of 40 honey samples (87.5%) analyzed in this study
completely correspond with the national Regulation No. 45/2003 and Codex Alimentarius,
indicating adequate processing, good maturity and freshness. Five samples (12.5%) did not meet
characteristics established in the Regulation No. 45/2003 and Codex standards. In 40 samples
analyzed, the HMF content was elevated in one sample (2.5%) exceeding the limit of 40 mg/kg, and
29 samples (72.5%) revealed values lower than 10 mg/kg, which is typical of fresh unheated
honeys, according to the current quality criteria.
The moisture content exceeded the maximum level permitted by the Regulation in only one of 40
analyzed honey samples (2.5%). Moreover, in only three samples (7.5%), ash content exceeded the
maximum level permitted by the Regulation. The titratable acidity of all samples was lower than the
limit of 40 mmol of acid per 1000 g of sample.
Research findings pointed out that the physicochemical properties of local honey from Vojvodina
were in accordance with the Codex standard and it meets significant quality criteria for a highquality honey.
Acknowledgments
This work is supported by a grant from the Ministry of Education, Science and Technological
Development, Republic of Serbia, Project number TR 31084
References
1. Cantarelli M.A., Pellerano R.G., Marchevsky E.J., Camia J.M.: Quality of honey from Argentina: Studi
of chemical composition and trace elements. The Journal of the Argentine Chemical Society, 96, 1/2, 3341, 2008
2. Codex Alimentarius Commission: Revised Codex Standard for Honey, Codex STAN 12-1981, 2001.
3. Downey G., Hussey K., Jelly J.D., Walshe T.F., Martn P.G.: Preliminary contribution to the
characterization of artisanal honey produced on the island of Ireland by palynological and
physicochemical data. Food Chemistry, 91: 347-354. 2005
4. European Economic Community: EEC Council Directive of 20 December 2001 relating to honey.
Official Journal of the European Communities, 110, 47-50, 2002
5. Ferreira I.C.F.R., Aires E., Barreira J.C.M., Estevinho L.M.: Antioxidant activity of Portuguese honey
samples: Different contributions of the entire honey and phenolic extract. Food Chemistry, 114, 14381443, 2009
6. Fredes C., Montenegro G.: Heavy metal and other trace elements contents in honey bee in Chile. Cien.
Inv. Agric., 33, 50-58, 2006
7. Ihtisham-ul-haq: Effect of floral type, geographical locations and honey bee species on the water activity
and other physico-chemical parameters of honey. M.Sc. Thesis. Deptt. Food Sci. Technol., Faculty of
Nutrition Sciences, NWFP Agricultural University, Peshawer, Pakistan, 1997
8. Krell R.: Value-added products from beekeeping, FAO Agricultural Services Bulletin No. 124, Food and
Agriculture
Organization
of
the
United
Nations
Rome
1996,
Dostupno
na
www.fao.org/docrep/w0076e/w0076e00.htm. Pristupljeno 12.11.2014.
9. Maukanovi-Joci M.: The biology of melliferous plants with an atlas of Serbian apiflora. Faculty of
Agriculture (on Serbian), Beograd, Serbia, 2008
10. Nordqvist J., Reviewed by Megan Ware, RDN, LD, registered dietitian and nutritionist, What are the
health benefits of honey?; 26.09.2014. Dostupno na:
http://www.medicalnewstoday.com/articles/264667.php
181

11. Nuru A.: Geographical races of the Honeybees (Apis mellifera L.) of the Northern Regions of Ethiopia.
Ph.D. dissertation. Rhodes University, South Africa. 2002
12. Prica N., ivkov-Balo M., Jaki S., Mihaljev ., Kartalovi B., Babi J., Savi S.: Water content and
acidity as an indicator of the quality of honey originating from Vojvodina region, Archives of Veterinary
Medicine, 2, vol 7, 99-110, 2014
13. Rogulja D., Vahi N., Matkovi D.: Kemijske, fizikalne i senzorske znaajke meda, 2009, Dostupno na
www.pcelinjak.hr/OLD/index.php/Prehrana-i-biotehnologija/kemijske-fizikalne-i-senzorske-znaajkemed.html. Pristupljeno 12.11.2014.
14. Sl. list SCG, br. 45/2003, Pravilnik o kvalitetu i drugim zahtevima za med, druge pelinje proizvode,
preparate na bazi meda i drugih pelinjih proizvoda.
15. White JW : Composition of Honey in: Honey A Comprehensive Survey (Ed. Crane E); Heinemann,
London, pp. 157-206,1975a
182
EFFECTS OF DIETARY HOT RED PEPPER ADDITION ON PRODUCTIVE

PERFORMANCE AND BLOOD LIPID PROFILE OF BROILER CHICKENS
Nikola Puvaa1*, Ljiljana Kostadinovi2, Dragana Ljubojevi3, Dragomir Luka1, Sanja Popovi2,
Jovanka Levi2, Olivera uragi2, Rade Jovanovi4
1
University of Novi Sad, Faculty of Agriculture, Novi Sad, Serbia

University of Novi Sad, Institute of Food Technology, Novi Sad, Serbia
3
4
Institute for Science Application in Agriculture, Belgrade, Serbia
Abstract
Experiment was conducted to investigate the effect of hot red pepper in broiler nutrition on
productive performances and blood lipid profile. For biological research three treatments with the
total of 450 broilers were formed, within four replicates. Control treatment (CON) of chickens were
fed with mixture based on corn flour and soybean meal of standard composition and quality, while
the experimental treatments were fed with the same mixture only with addition of two levels of hot
red pepper 0.5 (HRP-0.5) and 1.0 g/100g (HRP-1.0). Addition of hot red pepper in the amount of
0.5 g/100g has led to the highest final body weight of chickens (2460.6 g), followed by the addition
of 1.0 g/100g (2442.4 g) with significant differences (p<0.05) compared to a control treatment
(2075.8 g). The lowest amounts of triglycerides, total cholesterol, low density lipoprotein (LDL)
and non-high density lipoprotein (non HDL) was recorded in broilers in treatments with hot red
pepper with statistically significant (p<0.05) differences compared to a control treatment. The
highest share of high density lipoprotein (HDL) with statistical significance (p<0.05) was
determined also in hot red pepper treatments. Based on the obtained results, it can be concluded that
the addition of hot red pepper in broiler chicken nutrition has positive effects on production
performances and in improvement of chicken blood lipid profile.
Key words: Hot red pepper, cholesterol, nutrition, chickens, food
Introduction
Beside of an important role of hot red pepper in daily human nutrition for enhancement of taste,
aroma and colour of food, this spice have also been efficiently used in animal nutrition for
improvement of animal health and production of healthier meat and eggs. With the ban of
antibiotics use in animal nutrition due to the emergence of microbe resistance, alternative growth
promoters must be found (Steiner, 2009). Removal of antibiotics as growth promoters has led to
animal performance problems, increase of feed conversion ratio, and a rise in the incidence of
certain animal diseases (Wierup, 2001). The alternatives to antibiotics as growth stimulators are
numerous (Steiner, 2009; Puvaa et al., 2013). Hot red pepper (Capsicum annuum L.) plays an
important role in decreasing the deposition of cholesterol and fat in the body, contributes to
decreased levels of triglycerides and supports the vascular system in the body. Efficient hot red
pepper compounds consist of capsaicin, capsicin and capsanthin. Hencken, (1991) explained that
hot red pepper is rich in vitamin C, which have a considerable impact in improving production
through contributes the reduction of heat stress (Yoshioka et al., 2001). A recent studies involved in
chicken performance have shown that blends of active compounds for hot red pepper have
chemopreventive and chemotherapeutic effects. In research of Al-Kassie et al. (2012) addition of
hot red pepper had significant effect on the heterophil/lymphocytes (H/L) ratio, which reflects the
183
role of hot red pepper, especially its active compound capisicine, which is involved in stress
hormones, and which supports the immune system of birds and enhances its resistance against
disease through decreasing (H/L) ratio.
The aim of this study was to investigate the effect of hot red pepper in broiler nutrition on blood
lipid profile and productive performances.

Determination of bioactive components in hot red pepper
Content of capsanthin or colored matter in a sample of hot red pepper powder is determined by the
reference method SRPS EN ISO 7540 (2012). The method is based on extraction of colored
substances from a sample of hot red pepper with benzene and then spectrophotometric measurement
of maximum absorbance at a wavelength of 477nm. Content of capsanthin in samples of ground
pepper is expressed in g/kg of dry matter of the sample. The content of capsaicin in a sample of
pepper is determined according to the method described in the manual for quality control of fresh
and processed fruits, vegetables and mushrooms and non-alcoholic beverages (Vraar, 2001). The
method is based on extraction of capsaicin from a sample of hot red pepper, separation of colouring
matters and the development of colour characteristic of capsaicin, followed by spectrophotometric
measurement of maximum absorbance at a wavelength of 433nm. The colour intensity of the
solution is proportional to the concentration of capsaicin. The content of capsaicin in samples of hot
red pepper powder is expressed in g/100g dry matter of the sample. Concentration of capsanthin and
capsaicin is given in Table 1.
Table 1. Concentration of capsanthin and capsaicin in experimental hot red pepper
Hot red pepper powder samples
(n=3)
LSM
SELSM
Bioactive compounds
Capsanthin, g/kg
Capsaicin, g/kg
a
3.31
0.96b
0.58
0.04
Treatments with different letter indexes in the same row are statistically significantly different (p<0.05)
Animal trials
Biological tests were carried out under production conditions at the experimental farm "Pustara" in
property of the Faculty of Agriculture from Novi Sad. At the beginning of the experiment, a total of
450 one-day old Hubbard broilers were distributed into three dietary treatments with four replicates
each. Every dietary treatment included 150 chickens, which were divided in four pens with 37-38
chicken per each pen. Chickens were reared on floor holding system with the chopped straw as litter
material. Chickens were provided with the light regime of 23h of day per entire experimental period
of 42 days with incandescent light source. For nutrition of chicks three mixtures were used, starter,
grower and finisher through pan feeders. For the first 14 days, during the preparatory period, chicks
were fed with starter mixtures. Following the preparation period, chicks were fed with grower
mixtures for the next 21 days, and then for the last 7 days of fattening period with finisher mixtures
according the experimental design given in Table 2 and dietary chemical composition of used
starter, grower and finisher mixtures which is given in Table 3.
During the experiment chicks were fed and watered ad libitum. Chickens were watered throught the
nipple water system. Microclimate conditions were regularly monitored. Body weight was
monitored at an individual level during the entire experimental period every seven days, while the
feed consumption and feed conversion ratio were monitored at the pen level also every seven days.
184
Table 2. Experimental design with chickens

Experimental
treatmens
CON
HRP-0.5
HRP-1.0
Concetration of additives in chicken diets

In starter,
In grower,
In finisher, g/100g
g/100g
g/100g
Additive
1 14 days
15 35 days
36 42 days
Control treatment
0.0
0.0
0.0
Hot red pepper
0.0
0.5
0.5
Hot red pepper
0.0
1.0
1.0
Table 3. Chemical composition of dietary mixtures, g/100g

Nutrients
Dry matter
Moisture
Crude protein
Crude fat
Crude fibre
Crude ash
Ca
P
Metabolic Energy, MJ/kg
*Hot red pepper is added on top on the basic diet
Starter
89.4
10.5
21.1
3.9
3.5
5.0
0.8
0.6
12.5
Diet mixtures
Grower
89.3
10.7
20.7
3.9
3.5
4.8
0.9
0.6
12.8
Finisher
89.4
10.5
17.3
4.7
3.6
5.6
1.1
0.5
13.3
Blood lipids
At the end of 6th week, twelve birds were randomly chosen from each treatment and bled via wing
vein puncture to obtain blood samples. Serum samples from blood were separated by centrifugation
(4000 rpm for 5 min at 20C). Commercially available kits (Randox Laboratories Limited - United
KIngdom) were used to analyse the serum for triglycerides, total cholesterol, HDL and LDL on an
biochemical autoanalyzer Cobas Mira Plus (Roche Diagnostics). Values were expressed as mg/dl.
Statistical analyses
Statistical analyses were conducted within statistical software program Statistica 12 for Windows,
to determine if variables differed between treatments. Significant effects were further explored
using analysis of variance (ANOVA) with repeated measurements, least square means (LSM) and
standard errors of least square means (SELSM), as well as Fisher's LSD post-hoc multiple range test
with Bonferroni corrections to ascertain differences among treatment means. A significance level of
p<0.05 was used.

Capsanthin and capsaicin content
From the results given in Table 1 it can be seen the concentration of capsanthin (3.31 g/kg) and
capsaicin (0.96 g/kg) as the main bioactive components in hot red pepper. According the Serbian
regulation (Off. Gazette of SFRY, No. 1/79), hot red pepper on 1 kg of dry matter should comprise
at least 2 g of capsanthin and capsaicin between 0.5 to 0.7 g. As it can be seen from the results
shown in Table 1, samples of hot red pepper correspond to quality parameters requirements of
Serbian regulations, except for the content of capsaicin, which in the tested samples was higher for
185
0.26 g of dry mater. Taking into account that the capsaicin is alkaloid responsible for the hot taste of
pepper, this result was expected because the hot red pepper is recognizable its pungent quality.
Similar result was obtained by Dang et al. (2014) in their study of three-liquid-phase extraction and
separation of capsanthin and capsaicin from Capsicum annum L. The highest content of capsaicin
was found in the placenta, as well as dihydrocapsaicin, 10.48 and 6.43 g/kg, respectively, while the
highest ratio of 3.71 estimated from the quantity of capsaicin and dihydrocapsaicin was calculated
in the pericarp. The determined pungency level in placenta of 272 211 SHU was almost five times
and two times higher than the pungency level in the seed and pericarp, respectively (Simonovska et
al., 2014).
Productive performance of broilers
Based on the obtained results it can be concluded that the addition of hot red pepper in the diet of
broiler chickens led to a statistically significant (p<0.05) differences in body weight (Table 4).
Chickens have finished the preparatory period with uniform body weight with no statistical
significant differences (p>0.05). At the end of the second fattening period, addition of hot red
pepper exerted the stimulating effect and led to statistically significant differences (p<0.05) in body
weight in relation to the control treatment. After the completion of the experimental period, the
highest achieved body weight of chicken was in treatment HRP-0.5 (2460.6 g) which was followed
by treatment HRP-1.0 (2442.4 g) with statistically significant differences (p<0.05) compared to
control treatment.
Table 4. Body weight of chickens in experiment, g
Experimental
treatments
CON
LSM
HRP-0.5
LSM
HRP-1.0
LSM
Pooled SELSM
1 day
42.8a
42.5a
42a
0.47
7 days
162.7a
162.5a
161.6a
1.6
Age of chickens
14 days
21 days
28 days
388.6a
785.6a
1162.4a
a
a
385.3
770.5
1193.6a
a
a
385.1
762.4
1183.6a
3.87
8.38
11.84
35 days
1643.8b
1815.1a
1812.1a
12.2
42 days
2075.8b
2460.6a
2442.4a
24.33
Treatments with different letter indexes in the same column are statistically significantly different (p<0.05)
Our study has shown that the addition of hot red pepper has positive effect on production results of
chickens, which is also in agreement with previous findings of Alaa (2010), Al-Kassie et al. (2012)
and Puvaa et al. (2014c) with the use of hot red pepper in broiler chicken nutrition. Research of AlKassie et al. (2011) revealed that the inclusion of hot red pepper at levels of 0.5%, 0.75% and 1% in
the diets of broiler chicken of hybrid line Ross 308 improved body weight gain and feed conversion
ratio. Investigation of Thiamhirunsopit et al. (2014) with the different forms of hot red peppers
showed better growth performance results of chickens on experimental hot red pepper treatments in
comparison to control treatments.
Lipid profile in broiler chickens
Addition of hot red pepper as feed additives to broiler chicken nutrition in this experiment led to
high improvement of lipid profile of chickens. From the results given in Table 5 it can be noticed
that the highest amounts of triglycerides (65.9 mg/dl), total cholesterol (97.2 mg/dl) and LDL (36.7
mg/dl) were in control treatment with statistically significant (p<0.05) differences in comparison to
treatments with the dietary addition of hot red pepper.
This effect can be explained by the possible inhibition of the Acetyl CoA syntheses enzyme that is
necessary for the biosynthesis of fatty acids. Afzal et al. (1985) reported that polyunsaturated fatty
acids prevent atherosclerosis through the formation of cholesterol esters. Both levels of hot red
pepper in our study decreased LDL levels compared to the levels in chickens of the control
186
treatment. This effect can be explained by the possible mechanism of antioxidant and antiperoxide
lowering action on LDL or the decrease in hepatic production of very low density lipoprotein
(VLDL) which serves as the precursor of LDL in the blood circulation (Kim et al., 2009).
Table 5. Biochemical blood parameters and lipid profile, mg/dl
Experimental
treatments
CON
LSM
HRP-0.5
LSM
HRP-1.0
LSM
Pooled SELSM
Triglycerides
a
65.9
16.7b
17.7b
0.8
Total
cholesterol
97.2a
52.4b
54.3b
0.9
HDL
LDL
19.2
35.5a
35.7a
1.16
36.7
9.4b
10.3b
1.01
non HDL
a
78.0
16.9b
18.6b
1.03
HDL/LDL
0.5b
3.8a
3.6a
2.33
Treatments with different letter indexes in the same column are statistically significantly different (p<0.05)
Addition of hot red pepper to the broiler diet in different amounts from 0.25 to 1% had influence on
decreased concentration of blood cholesterol, and other blood biochemical parameters (Alaa, 2010;
Al-Kassie et al., 2012). Furthermore, addition of spice herbs and medicinal plants can facilitate
activity of enzymes which are involved in the conversion of cholesterol to bilious acids and
subsequently will result in lower cholesterol concentration in the carcass. Similar results with the
lowering effects of total cholesterol in red and white meat and skin of chickens fed with dietary
garlic powder was obtained by Stanaev et al. (2012). Spice herbs in human nutrition had a very
large influence in health promotion and lowering concentration of blood cholesterol and lipid
oxidation (Ahuja and Ball, 2006). Beside the hot red pepper, garlic (Puvaa et al., 2014a) and black
pepper (Puvaa et al., 2014b) had a high impact on alteration of blood lipid profile of chickens.
Capsinoids present in red peppers causes pungent, hot tasting sensations when consumed as a part
of the diet in addition to sensory properties of chicken meat that may be affects human health,
because capsinoids includes antimicrobial activities against disease caused by bacteria. Meat
obtained by chickens fed with hot red pepper poses better lipid profile and can be successfully used
in daily human nutrition as a dietetic food.
Conclusions
Based on the obtained results, it can be concluded that the addition of hot red pepper in broiler
chicken nutrition has positive effect on production performances. Addition of hot red pepper in the
amount of 0.5 g/100g has led to the highest final body weights of chickens. Also it can be
concluded that significant lowering of plasma cholesterol, triglycerides, LDL and increase of HDL
by this spice herb supplementation in broiler diet could indicates effective in regulation of lipid
metabolism in a favourable manner for prevention of atherosclerosis or coronary heart diseases in
humans who use this kind of chicken products in their daily nutrition.
Acknowledgments
This paper is a part of the project III 46012 which is financed by Ministry for Science and
Technological development of the Republic of Serbia. Also the realization of one part of this
experiment was supported by the Perutnina Ptuj Topiko a.d., Petefi brigade 2, 24300 Baka
Topola, Serbia.
References
1.
Afzal M., Hassan R.A.H., El-Kazini A.A., Fattah R.M.A.: Allium sativum in the control of
atherosclerosis. Agricultural and Biological Chemistry, 49, 1187-1188, 1985.
187

2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Ahuja K.D., Ball M.J.: Effects of daily ingestion of chilli on serum lipoprotein oxidation in adult men
and women. British Journal of Nutrition, 96, 239-42, 2006.
Alaa A.A.: The effect of the Capsicum annuum in the diet of broilers on the isolation and shedding rate
of Salmonella paratyphoid. Kufa Journal for Veterinary Medical Sciences, 1, 28-38, 2010.
Al-Kassie G.A.M., Al-Nasrawi M.A.M., Ajeena S.J.: The effects of using hot red pepper as a diet
supplement on some performance traits in broiler. Pakistan Journal of Nutrition, 10, 842-845, 2011.
Al-Kassie G.A.M., Butris G.Y., Ajeena S.J.: The potency of feed supplemented mixture of hot red
pepper and black pepper on the performance and some hematological blood traits in broiler diet.
International Journal of Advanced Biological Research, 2, 53-57, 2012.
Dang Y.Y., Zhang H., Xiu Z.L.: Three-liquid-phase extraction and separation of capsanthin and
capsaicin from Capsicum annum L. Czech Journal of Food Science, 32, 109114, 2014.
Hencken H.: Cooling the burn from hot peppers. Journal of the American Medical Association, 266,
2766-2770, 1991.
Kim Y.J., Jin S.K., Yang H.S.: Effect of dietary garlic bulb and husk on the physicochemical proper-ties
of chicken meat. Poultry Science, 88, 398-405, 2009.
Puvaa N., Kostadinovi Lj., Ljubojevi D., Luka D., Popovi S.: Influence of black pepper (Piper
nigrum L.) on productive performances and blood lipid profile of broiler chickens. Annals of Biological
Research, 5: 29-33, 2014b.
Puvaa N., Kostadinovi Lj., Ljubojevi D., Luka D., Popovi S., Dokmanov B., Stanaev V.S.:
Effects of dietary garlic addition on productive performance and blood lipid profile of broiler chickens.
Biotechnology in Animal Husbandry, 30, 669-677, 2014a.
Puvaa N., Ljubojevi D., Luka D., Kostadinovi Lj., Stanaev V., Popovi S., ivkov Balo M.,
Nikolova N. (2014c): Digestibility of fat in broiler chickens influenced by dietary addition of spice
herbs. Macedonian Journal of Animal Science, 4, 6167, 2014c.
Puvaa N., Stanaev V., Glamoi D., Levi J., Peri L., Stanaev V., Mili D.: Beneficial effects of
phytoadditives in broiler nutrition. World's Poultry Science Journal, 69, 27-34, 2013.
Simonovska J., Rafajlovska V., Kavrakovski Z., Srbinoska M.: Nutritional and bioactive compounds in
hot fruits of Capsicum annuum L. from Macedonia. Macedonian Journal of Chemistry and Chemical
Engineering, 33, 97104, 2014.
SRPS EN ISO 7540.: Ground paprika (Capsicum annuum L.). Requirements for ground paprika, 2012.
Stanaev V., Glamoi D., Miloevi N., Peri L., Puvaa N., Stanaev V., Mili D., Plava N.:
Influence of garlic (Allium sativum L.) and copper as phytoadditives in the feed on the content of
cholesterol in the tissues of the chickens. Journal of Medicinal Plants Research, 6, 2816-2819, 2012.
Steiner T.: Phytogenics in animal nutrition Natural concepts to optimise gut health and performance.
Nottingham University Press: 1-169, 2009.
Thiamhirunsopit K., Phisalaphong C., Boonkird S., Kijparkorn S.: Effect of chili meal (Capsicum
frutescens LINN.) on growth performance, stress index, lipid peroxidation and ileal nutrient digestibility
in broilers reared under high stocking density condition. Animal Feed Science and Technology, 192, 90100, 2014.
Vraar Lj.: Manual for quality control of fresh and processed fruits, vegetables and mushrooms and
non-alcoholic beverages (In Serbian). Faculty of Technology, Novi Sad, 2001.
Wierup M.: The Swedish experience of the 1986 ban of antimicrobial growth promoters, with special
reference to animal health, disease prevention, productivity, and usage of antimicrobials. Microbial
Drug Resistance, 7, 183190, 2001.
Yoshioka M., Doucet E., Drapeau V., Dionne I., Tremblay A. (2001): Combined effects of red pepper
and caffeine consumption on energy balance in subjects given free access to foods. British Journal of
Nutrition, 85, 203-211, 2001.
188
________________________________________________________________________
Session 3
VECTOR BORNE INFECTIONS

Full papers
_______________________________________________________________________
189
Plenary lecture:
MOSQUITO-BORNE FLAVIVIRUSES IN EUROPE: CURRENT PERSPECTIVES
Juan Carlos Saiz
Departamento de Biotecnologa, Instituto Nacional de Investigacin y Tecnologa Agraria y
Alimentaria (INIA). Carretera de la Corua Km 7.5, 28040, Madrid (Spain)
Corresponding author: [email protected]
Abstract
Flaviviruses (Flaviviridae family) constitute a genus of viruses that contains more than 50 different
species, many of which are important human and animal pathogens. Flavivirus genome is
constituted by a single-stranded RNA molecule of positive polarity ( 11,000 nt) that encodes a
polyprotein in a single open reading frame. Flaviviruses are maintained in nature in an infectious
cycle between wild animals, which act as their natural host, and insects (mosquitoes and ticks) that
act as their vectors. These vectors can transmit the virus to other animals or to humans, causing
zoonoses. Flaviviruses can infect the host nervous system, thus inducing severe neurological
diseases that can lead to death. Global climate warming together with changes in land use are
helping to change the distribution patterns of flaviviruses. Nowadays, 3 mosquito-borne flaviviruses
have been detected in Europe: West Nile virus (WNV), Usutu virus (USUV) and Bagaza virus
(BAGV), being WNV the most clinically relevant. WNV lineage 1 has been circulating in Europe
since 1960s, but from the 1990s the number, frequency and severity of the outbreaks increased
greatly. Earlier in this century, lineage 2 strains entered the continent, being already responsible for
hundreds of human cases and dozens of deaths. Lineage 2 strains are currently circulating in central
and south-eastern Europe, including Serbia. Usutu virus (USUV), was reported for the first time in
Austria in 2001 and quickly spread across Europe, causing a considerable number of bird deaths
and neurological disorders in a few immunocompromised patients, and it is now considered a
European resident pathogen. BAGV was reported for the first time in Europe when caused a deadly
outbreak among partridges and pheasants in Spain in 2010. Here, different aspects of mosquitoborne flaviviruses pathogenesis and clinical consequences, distribution, epidemiology, diagnosis,
and prophylaxis (vaccine and antivirals) will be discussed.
Keywords: Flavivirus, mosquitoes, Europe, West Nile virus, Usutu virus, Bagaza virus
Introduction
Flaviviruses (Flaviviridae family) constitute a genus of viruses that contains more than 50 different
species, many of which are important human and animal pathogens, such as Dengue virus (DENV),
West Nile virus (WNV), Japanese encephalitis virus (JEV), Yellow fever virus (YFV), Usutu virus
(USUV), or Tick-borne encephalitis virus (TBEV), among others (Weaver and Reisen, 2010). Most
flaviviruses are maintained in nature in an infectious cycle that includes transmission between wild
animals, which act as their natural host, and insects (mosquitoes and ticks) that act as their vectors,
being thus arboviruses (arthropod-borne viruses). These vectors can transmit the virus to other
animals or to humans, causing zoonoses. A characteristic shared by a wide variety of flaviviruses is
that they can infect cells from the host nervous system, thus inducing severe neurological diseases,
which often include encephalitis (Sips et al., 2012). Global climate warming together with changes
in land use are helping to change the distribution patterns of some flaviviruses, so that, they are
190
currently being detected in new geographical zones, where they cause infectious outbreaks that
affect both human and animals (Gould and Higgs, 2009).
Genomic organization and structure

Flavivirus genome is constituted by a single-stranded RNA molecule of positive polarity of about
11,000 nucleotides in length that encodes a polyprotein in a single open reading frame flanked by
two non-coding regions (NCRs) located at the 5 and 3 ends of the genome (Martn-Acebes and
Saiz, 2012). The RNA presents a cap structure at 5 end, but lack a 3 poly (A) tract, and a single
open reading frame that encodes for a polyprotein that is proteolytically processed by viral and
cellular proteases rendering ten major viral proteins: three structural (C, prM and E) and seven nonstructural, NS (NS1, 2A, 2B, 3, 4A, 4B y 5) involved in different aspect of the viral cycle (MartnAcebes and Saiz, 2012).
The genomic RNA is enclosed within a nucleocapsid formed by the capsid (C) protein that
constitutes the core of the virion and is enveloped by a lipid bilayer derived from the host cell
(Martn-Acebes and Saiz, 2012). Mature virions display a smooth outer surface with no projections
or spikes constituted by the membrane (M) protein and the E glycoprotein, resulting in a particle of
icosahedral symmetry. The E glycoprotein is exposed on the surface of the virion and is the main
responsible for the induction of neutralizing antibodies.
Ecology
Flaviviruses are grouped according to their vectors, mosquitoes, ticks, or those for which the vector
is still unknown. Those transmitted by mosquitoes are subdivided into 2 clades depending on the
vector genus (Culex or Aedes) (Beck et al., 2013). Culex-clade viruses usually have birds as natural
reservoirs, are neurotropic, and may cause encephalitis. Aedes-clade viruses have primates as main
reservoir and are not used to be neurotropic, but frequently cause hemorrhagic diseases. Tick-borne
flaviviruses are also grouped into 2 clades, those that circulate among seabirds and those that
produce encephalitis and which main natural reservoir are rodents, being the most clinically
relevant the TBEV (Beck et al., 2013).
Within a mosquito genus, different species show diverse competence for transmission of the
different flaviviruses (Martn-Acebes and Saiz, 2012). For instances, more than 11 species have
been described as WNV competent vectors in U.S., being the most efficient ones those of the Culex
species, although other species (such as Aedes or Ochlerotatus) may also play a role on viral
transmission as bridging vectors that can transmit the virus to mammals. In Europe, the virus has
been isolated from more than 40 different species, being again those of the Culex species the main
vectors. Several other species have been also described as competent vectors in other geographical
areas.
Climate (temperature, humidity, rainfall rate, etc.) and landscape conditions (altitude, latitude, water
sources, forestation, etc.) directly affect arthropod populations, density and stability, thus playing a
pivotal role in arboviral dissemination and evolution (Gould and Higgs, 2009; Beck et al., 2013;
Weaver and Barret, 2004). Climate change affects the geographical and seasonal distribution of
arthropod vectors, a fact that has many consequences. Expansion of mosquito species to more
extreme latitudes and elevations allows them to reach new host populations to feed on, and to share
new ecological niches with other vector species. Heavy rainfall and warm temperatures benefit the
increase of mosquitoes populations, and has been positively correlated with arbovirus transmission
(Martn-Acebes and Saiz, 2012; Weaver and Barret, 2004). Likewise, overabundance of birds that
share urban and rural areas with ubiquitous fastidious mosquitoes that feed on birds and mammals
plays an important role in flavivirus transmission. In fact, in two of the major urban WNV
191
outbreaks reported in Europe, which took place in Bucharest (Romania), and Volgograd and
Volzhskiy (Russia), the regions were heavily infested by potential mosquito vectors. Thus, arboviral
epidemics are probably more related to the concomitant profusion of hosts and vector populations in
the same area, generally wastelands and mashes where migratory birds are abundant, than to other
factors (Brault, 2009).
An important factor in arboviral evolution is socio-economic development since it has led to
increased and faster travelling, urbanization, deforestation, irrigation, and migratory activities
leading to overpopulation. For instance, and because JEV outbreaks were mainly restricted to Japan
before the second world war, the conflict seems to have favoured virus spread (Gould and Higgs,
2009). Hence, new human and animal behaviours and climate changes are facilitating contact
between vectors and hosts that, together with viral genetic mechanisms, may lead to the emergence
or re-emergence of new arbovirus with expanded tropism and host-range and, thus, represents an
important threat for human and animal health.
Flavivirus circulation in Europe

In Europe, only a few flaviviruses are considered endemic (WNV, USUV and TBE), although
imported infections by other members of the family (DENV, YFV, etc.) are occasionally reported
(Beck et al., 2013). Among tick-borne flaviviruses, TBVE is the most clinically relevant in Europe
(Amicizia et al., 2013). The virus is transmitted by Ixodes ricinus and I. persulcatus and infects
more than 10.000 humans every year around the world. In Europe, hundreds of cases are reported
every year, even though it is estimated that between 70%-95% of them are asymptomatic. Most
cases occur in Finland, central Europe, and the European regions of Russia. Besides TBVE,
Looping ill virus (LIV), which infects mainly sheep and it is transmitted by I. ricinus ticks, has been
reported in several countries (Spain, Norway, Ireland, Turkey and Bulgaria), but where it is more
common is in the British Islands (Amicizia et al., 2013).
Regarding mosquito borne flavivirus circulating in Europe, West Nile virus is the more clinically
important, being now considered endemic in the continent (Martn-Acebes and Saiz, 2012).
Recently USUV seems to have also colonized the continent, and the Bagaza virus (BAGV) was
recently detected in Spain (Beck et al., 2013). Presence of WNV in Europe is known since the
1960s, but it was in the 1990s when lineage 1 strains colonized south Europe and the
Mediterranean basin, originating a very significant increase in the number, frequency and severity
of the outbreaks (Martn-Acebes and Saiz, 2012). At the beginning of this century, lineage 2 strains
entered the continent and, since then, they have been isolated in birds, mosquitoes, sentinel
chickens, and humans in several countries, being already responsible for hundreds of human cases
and dozens of deaths (Lani et al., 2014). Lineage 2 strains have already been detected in central and
south-eastern Europe. Nowadays, viruses from the two lineages are currently circulating in Italy. In
Serbia, the first outbreak of WNV clinical infection in humans was reported in 2012 with a total of
70 West Nile fever cases, 41 clinically and laboratory confirmed of which 9 resulted fatal (Dauphin
and Zientara, 2007). One year later over 300 new human cases were reported in the country, in what
was the largest human WNV outbreak in Europe during that year (http://ecdc.europa.eu/). Before
that, anti-WNV antibodies had been detected in humans, horses and birds, and WNV-RNA was
amplified from mosquito and bird tissue pools, from which the first WNV strain was isolated in the
country (Lani et al., 2014).
As mentioned early, only other two mosquito borne flaviviruses have been detected in Europe
(Beck et al., 2013). BAGV was reported to cause a deadly outbreak among partridges and pheasants
in Spain in 2010, but it has not been detected again since then. In contrast, USUV, which was
reported for the first time in Austria in 2001, has quickly spread across the continent, causing a
considerable number of bird deaths. The virus has been detected in mosquitoes, birds, bats, and
192
equids, and it has been recently associated with a few cases of neurological disorders in
immunocompromised patients in Italy and Croatia (Beck et al., 2013).
Clinical manifestations and pathogenesis

Most of WNV infections in humans are asymptomatic, but an estimated 20% of the infected people
develop clinical symptoms, although severe neurological diseases are observed in less than 1% of
them (Sips et al., 2012; (Martn-Acebes and Saiz, 2012). West Nile fever (WNF) is characterized by
several non-specific flu-like symptoms, which usually develop between 2 to 15 days after infection
and last for 2 to 5 days. Severe West Nile disease (WND) is associated with neurological disorders,
with an estimated 10% of the neuroinvasive cases resulting fatal. A fully functional immune (innate
and adaptive) response (humoral and cellular) is essential to fight WNV infection, although, overall,
humoral immune response is capable of control viral load and dissemination; Nevertheless, WNV is
capable to directly infect neurons, brain stem and spinal cord. The pathogenesis of WNV infection
is similar to that of other Flaviviruses. After primary inoculation, WNV is believed to replicate in
resident skin Langerhans dendritic cells before it traffics to the lymph nodes and blood stream from
where it reaches the spleen and kidneys and, finally penetrates the CNS resulting in inflammation of
the medulla, brain stem and spinal cord (Martn-Acebes and Saiz, 2012).
As in humans, the majority of WNV infections in horses are usually not accompanied by
presentation of clinical signs, which are only observed in around 10% of the animals and are
characterized by fever and, sometimes, by ataxia and muscular weakness, which usually last for 3
weeks (Martn-Acebes and Saiz, 2012). Even though outbreaks resulted in 25 to 45% of mortality
rates among affected horse, implementation of vaccination campaigns has strongly reduced these
mortality rates. However, contrary to other Flavivirus infections, clinical cases of WND in horses
do not precede that in humans, discarding their use as sentinels.
Typical clinical signs in birds are neurological, such as ataxia and paralysis, as well as nonneurological, such as depression, lethargy, ruffled feathers, weight loss and myocarditis (MartnAcebes and Saiz, 2012). When birds die from WND, they use to do it in the first 24 h after the onset
of clinical signs. WNV infection causes damage in multiple bird organs. Monitoring of crow
mortality has been successfully adopted as an epidemiological indicator for tracking WNV activity
in the USA, predicting an increase of the risk for human infections (Martn-Acebes and Saiz, 2012).
Diagnosis
Flavivirus laboratory diagnosis relays on isolation of virus, detection of viral antigens or RNA in
blood or tissues, or detection of virus-specific IgM antibody that should be further confirmed by
detection of IgG antibody in the same or a subsequent sample.
Virus isolation in susceptible cell culture is the gold standard for virus detection, but it is usually
hampered by the typical short duration and low levels of viremia and by the need of BSL-3
facilities. In this regard, several methods for detection of viral RNA have been applied for
Flavivirus surveillance and diagnosis, mainly reverse transcription (RT) polymerase chain reaction
(PCR) assays and quantitative real-time RT-PCR (Martn-Acebes and Saiz, 2012; Dauphin and
Zientara, 2007).
Cross-reactivity between Flavivirus antigens is the greatest drawback for proper serological
diagnosis and epidemiological studies and, thus, sera have to be tested against different related
viruses and results have to be subsequently confirmed by different assays, namely hemagglutination
inhibition (HI), immunoflourescence (IF) or plaque reduction neutralization test (PRNT),
considered as the gold-standard (Martn-Acebes and Saiz, 2012; Dauphin and Zientara, 2007). A 4193
fold increase in PRNT titers between 2 sequential serum samples collected 2-3 weeks apart usually
confirms an acute Flavivirus infection, and viral neutralizing titers 4-fold higher than titers to other
related-flavivirus is usually taken as a probe of the specificity of the infection. Different ELISA
formats, both commercial and in-house, are currently applied for serological testing using
inactivated whole virus as antigen; however, its production implies risks for laboratory personnel
and needs highly sophisticated biosafety level 3 (BSL-3) containment facilities to grow the virus,
and then, several ELISAs have been developed using recombinant viral proteins expressed in a
variety of systems (bacteria, mammalian cells, insect cells, and larvae) (Martn-Acebes and Saiz,
2012; Dauphin and Zientara, 2007).
Prophylaxis
Until now, no WNV or USUV vaccine or specific therapy has been approved for humans, and
clinical treatment is only supportive; however, promising approaches are being developed (MartnAcebes and Saiz, 2012; Dauphin and Zientara, 2007). In this regard, and even though there are
effective, licensed WNV vaccines for horses, no approved vaccines exist for human use, although
some have undergone clinical trial. These candidates are based on the use of either live attenuated
or chemically inactivated virus, or recombinant viral proteins (or fragments of them) synthesized in
diverse systems (from bacteria to insect cells and larvae) (Dauphin and Zientara, 2007).
The search for antiviral compounds active against Flavivirus infection includes the identification of
those targeting distinct aspects of the viral replication cycle (Martn-Acebes and Saiz, 2012;
Dauphin and Zientara, 2007). The candidate may be targeted against the viral particle itself,
impairing its entry and/or infection, or it may block multiplication of the virus within infected cells.
This search has leaded to the identification of multiple promising compounds interfering with these
processes, including the repositioning of drugs approved for other purposes that have also shown
antiviral activities against Flavivirus (Martn-Acebes and Saiz, 2012; Dauphin and Zientara, 2007).
Recently a new approach in antiviral search has focused on cellular factors (proteins and lipids)
implicated in the viral life cycle, which may constitute potential targets for antiviral activity. In any
case, progress in Flavivirus therapies should pass through a combination of drug strategies that
targets viral replication, boosts protective immune responses, minimizes neuronal injury, and limits
the development of resistant variants. However, long way remains to be completed before these
novel compounds could to be administered to humans or animals, as they should be first tested for
antiviral activity in animal models and adverse effects should be ruled out.
Conclusions
Although our knowledge about Flavivirus infections has greatly increased during recent years, some
aspects of WNV activity still need to be further addressed: the ways WNV colonizes new ecological
niches and the role that climate and anthropogenic factors play; the differences in WNV disease
manifestations between different regions of the world; the better understanding of WNV immunity,
pathogenicity, and the molecular basis of virulence; the development of national and international
surveillance programs to monitor WNV spread and to take appropriate measures to control it; the
search for more efficient, rapid, and specific diagnostic assays; and the search for cost-effective
human vaccines and antiviral targets for therapeutic usage.
Acknowledgments
Supported by grants RTA-2011-0036 and E_RTA2013-00013-C04-2014 (INIA), and PLATESAP2013/ABI-2906 (Comunidad Autnoma de Madrid).
194
References
1.
Amicizia D et al. (2013). Epidemiology of tick-borne encephalitis (TBE) in Europe and its prevention
by available vaccines. Human Vacc & Immunotherp 9(5):1163-1171. Doi:10.4161/hv.23802.
2. Beck C, et al. (2013). Flavivrus in Europe: complex circulation patterns and their consequences for the
diagnosis and control of West Nile disease. Int J Environ Res Public Health 10:6049-6083.
Doi:10.3390/ijerph10116049.
3. Brault AC (2009). Changing patterns of West Nile virus transmission: altered vector competence and
host susceptibility. Vet Res 40:43. Doi:10.1051/vetres/2009026.
4. Dauphin G, Zientara S. (2007). West Nile virus: recent trends in diagnosis and vaccine development.
Vaccine 25:5563-5576. Doi: 10.1016/j.vaccine.2006.12.005.
5. Gould EA and Higgs S (2009). Impact of climate change and other factors on emerging arboviruses
diseases. Trans R Soc Trop Med Hyg 103(2):109-121. Doi:10.1016/j.trstmh.2008.07.025.
6. Lani R, et al. (2014). Tick-borne viruses: a review from the perspective of therapeutic approaches. Ticks
Tick Borne Diseases 5(5):457-465. Doi:10.1016/j.ttbdis.2014.04.001.
7. Martn-Acebes MA and Saiz JC (2012). West Nile virus: a re-emerging pathogen revisited. World
Journal of Virology 1(2):51-70. Doi:10.5501/wjv.v1.i2.51.
8. Sips. G.J, et al. (2012). Neuroinvasive flavivirus infections. Rev Med Virol 22(2):69-87.
Doi:10.1002/rmv.712.
9. Weaver SC and Barret ADT (2004). Transmission cycles, host range, evolution and emergence of
arboviral diseases. Nature Rev Microbiol 2:789-801. Doi:10.1038/nrmcrol1006.
10. Weaver SC and Reisen WK (2010). Present and future arboviral threats. Antiviral Research 85(2):328.
Doi:0.1016/j.antiviral.2009.10.008.
195
Invited lecture
AN OVERVIEW OF THE RECENT STUDIES ON TICK BORNE PATHOGENS IN
SERBIA
Sara Savi1, Branka Vidi1, Aleksandar Potkonjak2, eljko onka3
1 Scientific Veterinary Institute Novi Sad
2 Department of veterinary medicine, Faculty of agriculture, University of Novi Sad,
2 Zito Dunav Agroveterina DOO, Voganj
Abstract
Tick borne diseases are one of the key issues within a One Health concept. A triangle between
humans, animals and ticks has been a challenge for researchers for some time now. In Serbia,
research on ticks as vectors, tick borne pathogens and tick borne diseases has started approximately
a decade ago. The first studies were on the presence of Borrelia burgdorferi sensu lato starins in
ticks, followed by research on Babesia spp. During the last few years a lot of work has been done,
not only in Serbia, but in the whole region on the topic of the presence of Anaplasma
phagocytophilum, Coxiella burnetii and Francisella tularensis in ticks.
Tick species found in different regions of Serbia so far are the following: Ixodes ricinus,
Dermacentor marginatus, Dermacentor reticulatus, Rhipicephalus sanguineus, Hemaphysalis
punctata, Haemaphysalis concinna
For B.burgdorferi s.l. more genospecies were found in ticks during the last few years: B. afzelii,
B,burgdorferi s.s, B. lusitaniae, B. garinii and B. valaisiana. Monitoring of the prevalenece of
B.burgdorferi s.l. in ticks is constant, but it differs among different regions in Serbia (Vojvodina,
Belgrade region and middle Serbia). The prevalence for B.burgdorferi in ticks varies from 23% to
42.5%.
Babesia spp is found to be present in ticks with two different methods, in different tick species with
different prevalence varies from 10.61% to 46.40% in different regions. In another study,
Anaplasma phagocitophylum has recently been found in 13.9% ticks in Serbia. Coxiella burnetii
was found in less than 7% in ticks in different regions of Serbia. The prevalence for Francisella
tularensis microorganisms has also been found as 3.8% in ticks.
All of the monitored pathogens are causative agents for more or less dangerous zoonozes, which
can be found in the region of Serbia and almost all of them have already been reported in humans.
Key words: tick borne pathogens, zoonozes, borreliosis, anaplasmosis, ricketiosis, babesiosis
Introduction
Arthropods as vectors of pathogens are causing vector-borne diseases, an important threat to public
health. The pathogen carried by the arthropod vector is transferred during blood feeding, the closest
interaction between the arthropod vector and the vertebrate host. Whether or not the transferred
pathogen is actually causing a disease, depends on a complex interaction of many factors, most
important the pathogen, the host and the hosts immune system (Mencke, 2013).
A research on vector borne infections and pathogens has started two decades ago. Vector borne
pathogens are often known as emerging pathogens. Emerging pathogens include infectious agents
that were previously un recognized and have been identified and associated with a new disease or
an illness with a previously unknown aetiology; organisms that have been described in other regions
196
and imported into areas where they were previously unknown, or agents that were constantly
present in the affected area at a low level or in a different host and due to some change have become
more widely spread in the population under concern (Harrus and Baneth, 2005). Important tickborne zoonoses such as Lyme disease, human granulocytic anaplasmosis (HGA) caused by A.
phagocytophilum, human monocytic ehrlichiosis (HME) caused by Ehrlichia chaffeensis, and
human babesiosis caused by B. microti were all described in the US during the second half of the
20th century and later in other countries and continents. Candidates Neoehrlichia mikurensis is an
intracellular bacterium member of the Anaplasmataceae family which causes severe disease with
fever and septicaemia in humans. It is an example of an emerging tick borne infection that has
been known only for a decade and appears to be dispersed in multiple regions. It has been identified
throughout Europe, in patients in Sweden, Switzerland, Germany, Czech Republic, China (Foldvari,
2014). Similarly to other tick borne infections agents, it is likely to have been circulating among
wildlife animals and ticks long before it emerged as a recognised clinical cause of human disease.
Tick borne diseases are one of the key issues within a One Health concept. A triangle between
humans, animals and ticks within the environmental conditions, has been a challenge for
researchers for some time now.
Figure 1 Overlaping of tick borne infections among different species (Baneth, 2014)
Ticks as vectors
Approximately 900 species of ticks have been described to date, of which more than 700 belong to
the Ixodidae (hard ticks); approximately 200 belong to the Argasidae (soft ticks). The lifestyle of
ticks which includes uptake of blood from hosts, secretion of saliva into the host tissues, movement
between different hosts and production of eggs from which a new generation of ticks develops,
inevitably makes them suitable to host other organisms. A wide variety of pathogens is transmitted
from ticks to vertebrates including viruses, bacteria such as rickettsiae and spirochetes, fungi,
protozoa and helminths, of which most have a life cycle which requires passage through the
vertebrate host (Dantas-Torres et al., 2012).
Several factors contribute to the change in geographic ranges of tick borne infections. Ticks cannot
fly or move long distances by themselves and, therefore, their transfer from one location to another
depends mostly on movement of hosts including birds which can fly long distances (Mathers et al.,
2011 and Hasle, 2013), migrating wild animal species such as jackals, animals introduced into new
areas by humans such as farm animals imported into areas where they were not present before,
197
rodents travelling accidently with ships or trucks, or imported pet animals. Climate change may also
facilitate migration of vertebrate tick hosts, allowing dispersal of ticks and pathogens into new
territories (Estrada-Pea et al., 2012). Transmission of tick borne infections can also occur by
contaminated blood transfusions and needles. Babesia of different species have been shown to be
transmitted by blood transfusion in both humans and dogs (Stegeman et al., 2003). Such artificial
transmission may result in spread of tick borne infections to new areas, if competent tick vectors
and reservoir hosts are found in those areas. Although the majority of tick borne infections are
transmitted via the tick saliva during the course of the blood meal, there are some pathogens of
veterinary importance which are transmitted naturally by other mechanisms. For example,
Hepatozoon spp. is protozoa that belongs to the Apicomplexa and infect vertebrates by oral
ingestion of an arthropod host containing infective sporozoites. Hepatozoon spp. infect dogs that
orally uptake and ingest ticks harbouring mature sporozoites.
Ixodes ticks are abundant throughout Europe, but I.ricinus nortward shift has been noted, all the
way up to Norway and Sweden (Jaenson and Lindgren, 2011). I. ricinus has also been recorded at
1200-1300m above sea level in Check Republic and Austria (Daniel et al., 2003; Stuenzner et al.,
2006).
Factors that influence the distribution of I. ricinus in Europe have been identified as the following:
(1) factors directly related to climatic change (affecting the tick, host or habitat), (2) factors related
to changes in the distribution of tick hosts (which may be directly or indirectly a consequence of
human interventions) and (3) other ecological changes. Considering the large size of the global
human population, the high density of humans in some areas, and the surface size of the adult
human body, humans would be expected to be one of the most common blood sources for
ticks. Certainly most tick borne infections circulate between wildlife animals and ticks, and may
affect humans or domestic animals, but do not rely on infecting people for their persistence. For
example, Lyme disease circulates mostly among rodents, and humans or domestic dogs are just
incidental hosts that could suffer from clinical disease but do not play an important role in the
enzootic transmission and epidemiology of this infection (Radolf et al., 2012). Despite the global
abundance of humans and their presence in a variety of climates and ecological conditions, they are
not major reservoirs for tick borne infections. Tick borne infections of humans, farm animals and
companion animals such as dogs and cats, may overlap, and some agents such as B.
burgdorferi and Anaplasma phagocytophilum are able to infect hosts belonging to more than one of
these categories, however all of these zoonotic agents are associated with wildlife reservoirs
Tick borreliosis
One of the most prevalent vector borne disease in humans in Europe is borreliosis. In Europe
several Borrelia species have been described, which are considered to cause human borreliosis with
clinical symptoms. These species are referred to collectively as Borrelia burgdorferi sensu lato, and
B.afzelii, B.garinii and B.valesiana. It is proposed to use term borreliosis or tick borreliosis for
Borrelia infection in Europe with B.burgdorferi s.l. instead of Lyme borreliosis which is used in
North America.
The risk of tick bite during outdoor activities for humans and dogs was studied in hunters and
compared to humans without association to hunting. The study indicated a higher prevalence of
borreliosis in owners of hunting dogs (15%) compared to non hunters (9%), but in more than 90%
of hunters, there was no evidence of clinical symptoms. There is an association between
occupations such as forestry workers, military personnel, rangers and borreliosis (Nohlmans et al.,
1991).
Information on the role of dogs in tick borreliosis, as infected patient or as a sentinel for tick
borreliosis in Europe is rather limited. The data for seroprevalence of borreliosis in dogs in Europe
198
vary from only several percentages in Czech Republic, Poland and Romania, to 50% in Slovakia
(Pelchalova et al., 2006; Scotarczak and Wodecka, 2003; Kiss et al., 2011; Stefancikova et al.,
1998)
Tick-borne rickettsiales
Rickettsiales transmitted by ticks in Europe and causing clinical signs in dogs are Anaplasma
phagocytophilum and Anaplasma platys. There is also Erlichia canis, belonging to the
Anaplasmataceae family. Anaplasma phagocytophilum has been found all over Europe in the
following countries: Austria, Belgium, Czech Republic, Finland, France, Germany, Hungary, Italy,
Luxembourg, Netherlands, Norway, Poland, Russia, Slovakia, Slovenia, Spain, Sweden,
Switzerland and United Kingdom (Jahfari et al., 2014)
Rickettsia conorii is the most important tick borne rickettiosis with public health impact in Europe.
It is the pathogen of Mediterranean spotted fever. The main vector for Rikettsia conorii is
Rhipicephalus sanguineus, but also Ixodes ricinus and Dermacentor spp have been described
(Benianti et al., 2002). Dogs have been identified as reservoirs of Rickettsia conorii (Levin et al.,
2012)
Tick borne babesiosis

In temperate areas of Europe, Dermacentor reticulatus is a quite common tick species affecting
dogs and is the primary vector of canine babesiosis due to Babesia canis
Canine babesiosis is a tick-borne disease caused by intraerythrocytic protozoa of the genus
Babesia which can cause severe clinical illness. In recent years, the geographic distribution of
babesiosis has expanded from western and central Europe toward northern Europe, probably due
both to changes in the climate which has increased tick survival and due to an increase in
companion animal travels.
Human babesiosis is caused by the intraerythrocytic parasite of the genus Babesia (phylum
Apicomplexa). Humans are commonly infected by the bite of Ixodid ticks. Rarely, transmission does
occur perinatal or via contaminated blood transfusion. Human babesiosis is a zoonotic disease with
a worldwide increasing importance according to the increasing number of immunocompromised
patients. Clinical symptoms have a wide range from asymptomatic to severe and letal cases. So far,
the detection of the parasites in ticks and seroepidemiological data in Europe identified 3
humanpathogenic species: B. microti, B. divergens und B. venatorum (EU1-3). The relative small
number of approximately 50 documented human cases is probably due to the lack of knowledge of
the disease and the availability of diagnostic tools. Comprehensive systematic investigations of the
prevalence in ticks, seroepidemiological data and improved diagnostic tests are urgently needed to
evaluate the importance of the parasite.
Review of current situation in Serbia

The development of molecular diagnostic tools such as conventional PCR, real-time PCR, DNA
sequencing and other methods have not only enhanced the capacity of diagnostic laboratories to
detect the presence of infection, but have also expanded the capability of detecting new, previously
unknown, pathogens and distinguishing between species and strains of microorganisms, which was
difficult and sometimes impossible prior to the advent of molecular biological techniques.
Furthermore, these molecular capabilities have become accessible and affordable to diagnostic
laboratories in the last decade, and not merely restricted to research facilities.
199
In Serbia, research on ticks as vectors, tick borne pathogens and tick borne diseases has started
approximately a decade ago. The first studies were on the presence of Borrelia burgdorferi sensu
lato strains in ticks, followed by research on Babesia spp. During the last few years a lot of work
has been done, not only in Serbia, but in the whole region on the topic of the presence of
Anaplsma phagocytophilum, Coxiella burnetii and Francisella tularensis in ticks.
Tick species found in different regions of Serbia so far are the following: Ixodes ricinus,
Dermacentor marginatus, Dermacentor reticulatus, Rhipicephalus sanguineus, Hemaphysalis
punctata, Haemaphysalis concinna (Tomanovi, 2013).
For B.burgdorferi s.l. more genospecies were found in ticks during the last few years: B. afzelii,
B,burgdorferi s.s, B. lusitaniae, B. garinii and B. valaisiana (Tomanovi et al., 2014; Potkonjak et
al., 2014. Monitoring of the prevalenece of B.burgdorferi s.l. in ticks is constant, but it differs
among different regions in Serbia (Vojvodina, Belgrade region and middle Serbia). The prevalence
for B.burgdorferi in ticks varies from 23% to 42.5% in different regions (Milutinovi et al., 2008;
Savi et al., 2010). Babesia spp is found to be present in ticks with two different methods, in
different tick species. It was found in Dermacentor reticulatus (21.57%) and Haemophysalis
concinna (8.57%) with one group of authors, by molecular detection in ticks collected from the field
(Mihaljica et al., 2012). The other group of authors searched for Babesia by microscopic analysis of
the midgut content of ticks in R. sanguineus, D. marginatus and D. reticulatus ticks, collected from
dogs with clinical sighs of babesiosis. The prevalence in ticks in the second study was quite higher
46.40% (Pavlovi et al., 2002). Both studies were done in the same region. In another study,
Anaplasma phagocitophylum has recently been found in 13.9% ticks in Serbia, including strains
with proven pathogenicity for humans (Tomanovi et al., 2010; Potkonjak et al., 2013). Coxiella
burnetii was found in less than 7% in ticks in different regions of Serbia (Tomanovi et al., 2013).
The prevalence for Francisella tularensis microorganisms has also been found as 3.8% in ticks
(Milutinoviet al., 2008).
All of the monitored pathogens are causative agents for more or less dangerous zoonozes, which
can be found in the region of Serbia and some of them have already been reported in humans (Savi
et al., 2012).
Table 1 Zoonotic tick borne diseases and hosts found in Serbia
Disease
Borreliosis
Bartonellosis
Ehrlichiosis
Rickettsiosis
Anaplasmosis
Tularaemia
Coxiellosis
Tick-borne encephalitis
Louping ill
*unpublished data, research still going on
Vector
Tick
Flea, Tick
Tick
Tick, Flea
Tick
Tick
Tick
Tick
Tick
Detection in Serbia
Ticks, dogs, humans
Cats
*
Ticks
Ticks, dogs
Ticks
Ticks, sheep, humans
*
No
Conclusion
Vector-borne diseases are important infectious disease of human and veterinary medicine across
Europe. From all the published data recently, it is concluded that further research is needed and
field studies on vector borne diseases in Serbia. The epidemiology of ticks, the dynamics of ticks
spreading into new habitats due to climate changes and land use is not enough known.
200
Veterinary medicine in general, needs to be included in any action of European bodies regarding
tick borreliosis and also this disease is an important canine vector borne disease. Infections with
Rickettsiales, like Anaplasma phagocytophilum or Rickettsia conorii are emerging and re-emerging
vector borne diseases in Europe.
Vector borne diseases shared between humans and dogs, point clearly towards the necessity for a
joint effort under the One health concept in all aspects, from epidemiology, clinic, diagnostic,
therapy and prevention. From a veterinary medicinal perspective the importance of a One health
concept was recently addressed by the World Small Animal Veterinary Association (WSAVA) by
initiating the One Health Committee ( Day, 2010). It is the aim of this committee to position small
animal veterinary medicine as an integral part of the One health concept in terms of zoonotic and
vector-borne diseases (Day, 2011).
The question at the moment is weather is the global prevalence of tick borne infections increasing
or are improvements in the ability to detect infection using sensitive and specific new techniques,
and an increased awareness, responsible for more detection of disease? It is most likely that both an increase in the spread of tick borne infections and an improved capability of detection are the
answer for the global rise in reporting of tick borne infections. Human tick borne infections cannot
be described without studying and understanding their relationship to animal hosts and reservoirs.
Unlike some of the major human vector-borne diseases associated with flying insect vectors, where
infection could be independent of association with animals, tick borne infections are zoonoses and
control efforts must consider this when programs are developed to limit or eradicate them.
Integration of veterinary and human reporting systems, surveillance in wildlife and tick populations,
and combined teams of experts from several scientific disciplines such as entomology,
epidemiology, medicine, public health and veterinary medicine are needed for the formulation of
regulations and guidelines for the prevention of tick borne infections (Baneth, 2014).
Acknowledgments
This work was supported by the grant TR31084 of the Ministry of Education, Science and
Technological Development of the Republic of Serbia.
References:
1.
2.
3.
4.
5.
6.
7.
Baneth G, Tick-borne infections of animals and humans: a common ground, Int J Parasitol. 2014
Aug;44(9):591-6. doi: 10.1016/j.ijpara.2014.03.011. Epub 2014 May 15, 2014
Beninati T., N. Lo, H. Noda, F. Esposito, A. Rizzoli, G. Favia, C. Genchi, First detection of spotted
fever group rickettsiae in Ixodes ricinus from Italy Emerg. Infect. Dis., 8 (9), pp. 983986, 2002.
Daniel M., V. Danielova, B. Kriz, A. Jirsa, J. Nozicka, Shift of the tick Ixodes ricinus and tick-borne
encephalitis to higher altitudes in Central Europe, Eur. J. Clin. Microbiol. Infect. Dis., 22, pp. 327328,
2003.
Dantas-Torres F., B.B. Chomel, D. Otranto, Ticks and tick-borne diseases: a One Health perspective
Trends Parasitol., 28, pp. 437446, 2012.
Day M.J. One health: the importance of companion animal vector-borne diseases Parasit. Vectors, 4, p.
49, 2011.
Day M.J. One health: the small companion animal dimension Vet. Rec., 167, pp. 847849, 2010.
Dumont P, Fourie JJ, Soll M, Beugnet F, Repellency, prevention of attachment and acaricidal efficacy
of a new combination of fipronil and permethrin against the main vector of canine babesiosis in Europe,
Dermacentor reticulatus ticks, Parasit Vectors. 2015 Jan 27;8:50. doi: 10.1186/s13071-015-0682-z.,
2015.
201

8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Estrada-Pea A, N. Snchez, A. Estrada-Snchez, An assessment of the distribution and spread of the

tick Hyalomma marginatum in the western Palearctic under different climate scenarios, Vector Borne
Zoonotic Dis., 12, pp. 758768, 2012.
Fldvri G, Jahfari S, Rig K, Jablonszky M, Szekeres S, Majoros G, Tth M, Molnr V, Coipan
EC, Sprong H, Candidatus Neoehrlichia mikurensis and Anaplasma phagocytophilum in urban
hedgehogs, Emerg Infect Dis. 2014 Mar;20(3):496-8. doi: 10.3201/eid2003.130935, 2014.
Harrus S., G. Baneth, Drivers for the emergence and re-emergence of vector-borne protozoal and
bacterial diseases, Int. J. Parasitol., 35, pp. 13091318, 2005.
Hasle G., Transport of ixodid ticks and tick-borne pathogens by migratory birds, Front. Cell. Infect.
Microbiol., 10, p. 48, 2013.
Hildebrandt A, Hunfeld KP, Human babesiosis - a rare but potentially dangerous zoonosis, Dtsch Med
Wochenschr. 2014 May;139 (18):957-62. doi: 10.1055/s-0034-1369936. Epub Apr 23, 2014.
Jaenson T.G, E. Lindgren, The range of Ixodes ricinus and the risk of contracting Lyme borreliosis will
increase northwards when the vegetation period becomes longer Ticks Tick Borne Dis., 2 (1), pp. 44
49, 2011.
Jahfari S, Coipan EC, Fonville M, van Leeuwen AD, Hengeveld P, Heylen D, Heyman P, van Maanen
C, Butler CM, Fldvri G, Szekeres S, van Duijvendijk G, Tack W, Rijks JM, van der Giessen
J, Takken W, van Wieren SE, Takumi K, Sprong H, Circulation of four Anaplasma phagocytophilum
ecotypes in Europe, Parasit Vectors. 2014 Aug 15;7:365. doi: 10.1186/1756-3305-7-365. 2014.
Levin M.L., L.F. Killmaster, G.E. Temtsova, Domestic dogs (Canis familiaris) as reservoir hosts
for Rickettsia conorii Vector-borne Zoonotic Dis., 12 (1) , pp. 2833, 2012.
Medlock J.M., K.M. Hansford, A. Bormane, M. Derdakova, A. Estrada-Pea, J.C. George, I.
Golovljova, T.G.T. Jaenson, J.K. Jensen, P.M. Jensen, M. Kazimirova, J.A. Oteo, A. Papa, K. Pfister,
O. Plantard, S.E. Randolph, A. Rizzoli, M.M. Santos-Silva, H. Sprong, L. Vial, G. Hendrickx, H. Zeller,
H. Van Bortel, Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe,
Parasit. Vectors, 6, p. 1, 2003.
Mencke N, Future challenges for parasitology: vector control and 'One health' in Europe: the veterinary
medicinal view on CVBDs such as tick borreliosis, rickettsiosis and canine leishmaniosis, Vet
Parasitol. 2013 Aug 1;195(3-4):256-71. doi: 10.1016/j.vetpar.2013.04.007. Epub Apr 6, 2013.
Mihaljica D, Radulovi , Tomanovi S, aki S, Penezi A, Milutinovi M, Molecular detection of
Babesia spp in ticks in Northert Serbia, Arch.Biol.Sci, Belgrade, 64 (4), 1951-1958, 2012.
Milutinovi M, Masuzawa T, Tomanovi S, Radulovi Z, Fukui T, Okamoto Y., Borrelia burgdorferi
sensu lato, Anaplasma phagocytophilum, Francisella tularensis and their co-infections in host-seeking
Ixodes ricinus ticks collected in Serbia, Exp Appl Acarol. 2008 Aug;45(3-4):171-83. doi:
10.1007/s10493-008-9166-6. Epub Jun 13, 2008.
Nohlmans M.K., A.E. van den Bogaard, A.A. Blaauw, C.P. van Boven, Prevalence of Lyme borreliosis
in The Netherlands Ned. Tijdschr. Geneeskd., 135 (48) , pp. 22882292, 1991.
Pavlovi I, Milutinovi M, Petkovi D, Terzin D, Terzin V, Epizootiological research of canine
babesiosis in the Belgrade district, J.Protozool. Res, 12, 10-15, 2002.
Pejchalov K., A. Zkovsk, K. Fuck, P. Schnilec, Serological confirmation of Borrelia
burgdorferi infection in dogs in the Czech Republic, Vet. Res. Commun., 30 (3), pp. 231238, 2006.
Potkonjak A, S Savi, E Ruzi-Sablji, V Vraar, B Lako, A Jurii, A Petrovi, D Rajkovi,
Molelecular characterization of Borrelia strains isolated from ticks in Vojvodina, Parasites &
Vectors , 7(Suppl 1):P18, 2014.
Radolf J.D., M.J. Caimano, B. Stevenson, L.T. Hu , Of ticks, mice and men: understanding the dualhost lifestyle of Lyme disease spirochaetes, Nat. Rev. Microbiol., 10, pp. 8799, 2012.
Savi S., B. Vidi, S. Lazi, B. Lako, A. Potkonjak, Z. Lepsanovi, Borrelia burgdorferi in ticks and
dogs in the province of Vojvodina, Serbia, Parasite, 17 (4) , pp. 357361, 2010.
Savi S, Vidi B, Grgi , Jurii A, uri V, Ruzi M, Loli Z, Vektorske zoonoze PASA u
Vojvodini, Arhiv veterinarske medicine, vol. 5, br. 1, 77-87, 2012.
202

27. Skotarczak B., B. Wodecka, Molecular evidence of the presence of Borrelia burgdorferi sensu lato in
blood samples taken from dogs in Poland Ann. Agric. Environ. Med., 10 (1), pp. 113115, 2003.
28. Stefankov A, G. Tresov, B. Petko, I. Skardov, E. Sesztkov, Elisa comparison of three whole-cell
antigens of Borrelia burgdorferi sensu lato in serological study of dogs from area of Kosice, eastern
Slovakia Ann. Agric. Environ. Med., 5 (1) , pp. 2530, 1998.
29. Stegeman J.R., A.J. Birkenheuer, J.M. Kruger, E.B. Breitschwerdt, Transfusion-associated Babesia
gibsoni infection in a dog, J. Am. Vet. Med. Assoc., 222, pp. 959963, 2003.
30. Stuenzner D., Z. Hubalek, J. Halouzka, I. Wendelin, W. Sixl, E. Marth, Prevalence of Borrelia
burgdorferi sensu lato in the tick Ixodes ricinus in the Styrian mountains of Austria, Wien. Klin.
Wochenschr., 118, pp. 682685, 2006.
31. T. Kiss, D. Cadar, A.F. Krupaci, A. Bordeanu, G.F. Brudac, A.D. Mihalca, V. Mircean, L. Gliga,
M.O. Dumitrache, M. Spnu, Serological reactivity to Borrelia burgdorferi sensu lato in dogs and
horses from distinct areas in Romania Vector Borne Zoonotic Dis., 11 (9) , pp. 12591262, 2011.
32. Tomanovi S , S aki, Radulovi, D Mihaljica, R Sukara, M Milutinovi, E Rui-Sablji, Strain
diversity of Borrelia burgdorferi sensu lato in Serbia, Parasites & Vectors , 7(Suppl 1):O25, 2014.
33. Tomanovi S, Chochlakis D, Radulovi Z, Milutinovi M, Caki S, Mihaljica D, Tselentis
Y, Psaroulaki A., Analysis of pathogen co-occurrence in host-seeking adult hard ticks from Serbia, Exp
Appl Acarol. 2013 Mar;59(3):367-76. doi: 10.1007/s10493-012-9597-y. Epub 2012 Jul 7, 2013.
203
Invited lecture
WNV IN SERBIA: UPDATE OF CURRENT KNOWLEDGE
Tama Petrovi1, Duan Petri2, Diana Lupulovi1, Ivana Hrnjakovic Cvetkovic3, Vesna
Milosevic3, Sava Lazi1, Juan Carlos Saiz 4
2. Laboratory for medical and veterinary entomology, Faculty of Agriculture, University of Novi Sad, Novi Sad,
Serbia
3. Institute of Public Health of Vojvodina, Medical Faculty, University of Novi Sad, Novi Sad, Serbia
4. Department of Biotechnology, Instituto Nacional de Investigacin y Tecnologa Agraria y Alimentaria (INIA),
Madrid, Spain
Abstract
West Nile virus (WNV) is a neurovirulent mosquito-borne Flavivirus with zoonotic potential.
Recently, the number, frequency and severity of outbreaks of infections caused by WNV, with
neurological consequences for birds, humans and horses have increased dramatically throughout
central and south Europe, including Serbia, constituting a serious veterinary and public health
problem.
The emergency of WNV infections in Serbia is described through the current epidemiology
situation based on recent data on the presence, prevalence and incidence of WNV infection among
virus natural hosts and vectors; sentinel (horses) and other animal species, and in human population.
The short overview of the WNV serology studies conducted on horse blood samples collected in
different occasions during the last six years, and the results of the serology studies conducted
among other animal species like pigs, wild boars, and roe deer in Serbia are presented and
discussed. The results of the first studies on WNV presence in mosquito vectors, and in wild birds
as virus natural hosts in Serbia are presented and analyzed. Also, the data on the WNV serology
studies conducted in human population in Serbia in the last few years, and the existing data of
WNV outbreaks in 2012, 2013 and 2014 are included.
In addition, the national program for WNV monitoring launched by the veterinary service in Serbia
in April 2014 is presented. The program was funded by the Veterinary Directorate, and it was
implemented on the field by veterinary service in collaboration with entomologists and
ornithologists. The main objective of the monitoring program was early detection of WNV presence
in nature, and consequently timely alerting of human health services and local governments in order
to control the mosquito population and to inform the local communities. The monitoring program
was based on the direct and indirect monitoring of WNV presence in nature. Indirect monitoring of
virus presence was performed by serological testing of WNV seronegative - sentinel horses and
backyard chickens hatched during 2014, and direct monitoring was done by molecular testing of
WNV presence in pooled mosquitos samples and in wild birds. Number of tested samples is
defined at the level of each district of the Republic of Serbia in relation to the risks of WNV
infection.
Keywords: West Nile virus, antibody and virus detection, domestic and wild animals, human
population, mosquitoes, surveillance program, Serbia
Introduction
West Nile virus (WNV) is a neurovirulent mosquito-borne Flavivirus with zoonotic potential,
which is maintained in nature in an enzootic transmission cycle between avian hosts and
204
ornithophilic mosquito vectors. The virus occasionally infects other vertebrates, including humans
and horses, in which it may cause sporadic disease outbreaks that may result fatal. West Nile virus
(WNV) was first isolated from a febrile woman in the West Nile district of Uganda in 1937
(Smithburn et al., 1940) and today is considered as the most widespread flavivirus in the world,
endemic in Africa, Asia, Europe, Middle East, Australia and Americas (Trevejo and Eidson, 2008;
Calistri et al., 2010; Weissenbck et al., 2010; Papa et al., 2011).
WNV infections have been described in a wide variety of vertebrates (Komar et al., 2003). The
virus is maintained in an enzootic cycle between ornithophilic mosquitoes, mainly of the Culex
genus (Hayes et al., 2005; Ziegler et al., 2012), but also Aedes and Ochlerotatus genus, and certain
wild bird species (Savini et al., 2012; Ziegler et al., 2012). WNV was found in more than 150
species of wild and domestic birds (van der Meulen et al., 2005). Wild birds are important to public
health because birds migrating across national and intercontinental borders and becoming a longrange virus vectors (Linke et al., 2007). Following infection, many bird species produce levels of
viraemia that are sufficient for transmitting the virus to mosquitoes (Komar et al., 2003). Human
and mammals, especially horses, are occasional, dead end hosts and play limited roles in the natural
cycle because viraemia is generally too low to infect mosquitoes (Dauphin et al., 2004; Valiakos et
al., 2011), however severe neuroinvasive disease and occasionally with fatal outcomes can occur.
In Europe, until the 1990s WNV had caused sporadic outbreaks with rare reports of encephalitis
but its epidemiological behaviour changed when it re-emerged in Romania, Russia and the
Mediterranean basin causing dozens of humans and horses deaths (Castillo-Olivares and Wood,
2004; Blitvich, 2008; Calistri et al., 2010). Also, only recently the strains of WNV lineage 2 were
identified in Europe: in 2004 and 2005 in goshawks and birds of prey in Hungary, in 2007 in
Volgograd, Russia, and in 2008 and 2009 in goshawks and a falcon in Austria (Bakonyi et al., 2006;
Erdlyi et al., 2007; Platonov et al., 2008; Wodak et al., 2011). Since 2008, WNV has been heavily
spreading throughout central and southeastern Europe, constituting a serious veterinary and public
health problem for Europe (Barbi et al., 2012; Ziegler et al., 2012).
The history of West Nile fever in Serbia is largely unknown. Due to absence of routine diagnose
praxis and limited resources in hospitals of Serbia the human cases of meningoencephalitis of
unknown origin, that should be submitted to laboratory testing for WNV presence, had been
neglected up until 2012. In addition, with the exception for research purpose, the regular, program
based WNV surveillance in sentinel chickens, horses or mosquitoes did not exist before 2013. Only
scarce historical data exists about the presence of WNV in human population and indicate
seroprevalence of WNV in republics of former Yugoslavia of 1-3% in Croatia, 1% in Bosnia and
Herzegovina and Kosovo, 1% in Montenegro and 1-8% in Serbia (Vesenjak-Hirjan et al., 1991).
WNV epidemiology in human population in Serbia

First serological investigation was conducted in 1972 and antibodies against West Nile virus
(WNV) were found in 2.6% - 4.7% of human sera (Bordjoki et al., 1072). After almost a 30 years
gap, ELISA IgG testing revealed the seroprevalence of WNV in 6.67% of human sera of the 45
patients who were hospitalized for encephalitis or meningoencephalitis in the period 2001-2005 and
3.69% of 406 samples taken from healthy persons. Average seroprevalence of WNV in samples
taken from 2001-2010 was 3.99% (18 out of 451). A total of 337 persons tested in 2010 were
exposed to at least one mosquito exposure related risk factor. Among them, 5.04% were
seropositive to WNV. Most of the probably infected people did not screen windows and doors in
their houses, while in the group using window screens only 0.88% were seropositive to WNV
(Petri et al., 2012). The obtained seroprevalence in this study still didnt suggest more intensive
circulation of WNV in Serbia. Except this data, as to our knowledge, no clinical manifestation of
disease was ever reported in Serbia until 2012.
205
In August 2012, an outbreak of WNV infection in humans, was reported for the first time ever in
Serbia (EpiSouth Weekly Epi Bulletin - N232, - N240; ECDC, 2012; Obrenovi et al., 2013;
Popovi et al., 2013), being the first time that WNV infections in the country have been associated
with clinical symptoms. As of November 30, 2012, a total of 71 West Nile fever cases were
reported, among which 42 were clinically and laboratory confirmed, and in 9 cases resulted fatal
(lethality of 12.7%). All the cases were detected in central and northern part of the country, 72% of
them in the Beograd district (ECDC, 2012; Obrenovic et al., 2013; Popovic et al., 2013). This
epidemic continued, and became even more severe during 2013. As of November 2nd, 2013, a total
of 303 West Nile fever cases were reported, among which 202 were clinically and laboratory
confirmed, and 103 were classified as probable cases. Infection in 35 cases resulted fatal (lethality
of 11.6%). Almost all of the cases were also detected in central and northern part of the country
(Institute of Public Health of Serbia, 2014).
The epidemic also continued during 2014. The outbreak characteristic was similar as those from
2012. In total 76 clinical cases were reported and 9 cases resulted fatal. Almost all the cases were
detected in central and northern part of the country, and 65 out of 76 (86%) of them in four counties
(Belgrade, South Banat, South Backa and Srem county) (ECDC, 2014). In Europe during 2014 in
total 163 human cases were reported, so 47% of cases were from Serbia. It can be concluded that
WNV infection in Serbia become endemic and can be assumed that it will be public health problem
in the coming years also.
WNV epidemiology situation in horses

Serological analysis by ELISA based on WNV recombinant envelope E (rE) protein and PRNT
showed for the first time in Serbia that 12% of 349 tested horses from northern part of country,
sampled during 2009-2010, presented specific neutralizing WNV antibodies (average PRNT90 =
120, range: 42650), which in one case also cross-neutralized Usutu virus. This was the first time
that anti-USUV high neutralizing antibody titers have been reported in horses. Positive horses were
found in 14 of the 28 municipalities studied, which are up to 200km distant (Lupulovi et al., 2011).
In our another previous study (Medi et al., 2014), the presence of WNV specific antibodies was
examined in 252 horse sera samples collected from 7 different stables and locations in Vojvodina
province and Belgrade area, during 2007-2011. WNV antibodies were found in 72 (28.6%) sera
samples. The higher level of 28.6% anti-WNV antibody positive horses obtained in that study
comparing to 12% reported in our first investigation could be explained by the fact that in the first
study the horse sera were collected randomly from the whole territory of Vojvodina province, often
individually reared, and in the second study the blood sera were taken from horses situated in the
stables, with high number of horses in the same location. Also, most of the examined horse sera in
this study were sampled during 2010 and 2011 that could imply on possible more intensive WNV
circulation during year 2011. WNV seroprevalence ranged per stable from 13.3% up to 40%
seropositive animals. The highest prevalence of anti-WNV antibody positive animals was found in
stable near Romanian border (40%) and near Belgrade (35.5%). The high WNV prevalence was
assumed to be the results of intensive WNV circulation that was confirmed in Romania during 2008
- 2010 and the close proximity of river Danube with a high circulation of migratory wild birds
(Medi et al., 2014).
In addition, to asses WNV presence in the environment immediately after the human WNV
outbreak in 2012, during November and December of 2012, presence of anti-WNV IgG antibodies
were examined by commercial ELISA test in blood sera samples of 130 horses from 6 stables and 1
settlement in Vojvodina province, northern Serbia (Petrovi et al., 2014). Positive results were
obtained in 49.23% (64/130) samples. Per stable, percent of seropositive animals was from 35% to
64%. This prevalence (49.23%) obtained in horses during 2012 was much higher than that found in
horses during 2009 and 2010 (12%), including the confirmed seroconversion in at least 8 horses that
206
tested negative in 2010, thus confirming an intensive WNV circulation in 2012 on the territory of
Serbia. Very recent WNV infection theory is also supported by findings that among young, up to 3
years old animals, almost 57% tested positive on anti-WNV antibodies (Petrovi et al., 2014).
Similarly, 96 horses from 5 tested stables during 2012 were tested again during 2013 with the same
methodology. High prevalence of 46.88% (ranged between stables from 23.53-75.0%) with new
cases of seroconversion were detected also indicating an intensive WNV circulation in 2013
(unpublished data). The very recent data suggests that more than 50% of horses from Northern and
central part of Serbia, the areas around the rivers Danube, Sava and Tisza, are seropositive
(unpublished data).
Presence of WNV in natural host species and vectors in Serbia

Presence of WNV was also studied in susceptible wild birds species and mosquitoes as virus
natural hosts and vectors in the last few years in Serbia. WNV circulation was examined by ELISA
and PRNT in 92 blood sera and 81 pooled tissues from 133 wild resident and migratory birds from
45 species within 27 families collected from January until September 2012 in Vojvodina Province northern part of Serbia (Petrovi et al., 2013). WNV antibodies were detected in 7 (7.6%) blood
sera of: 4 Mute swans (Cygnus olor), 2 White-tailed eagles (Haliaeetus albicilla), and 1 Common
pheasant (Phasianus colchicus). Three of the seropositive birds found here were resident birds (two
White-tailed Eagles and one Common Pheasant), while the other four (Mute Swans) are considered
both migratory and resident birds in Serbia. Viral RNA was detected, for the first time in Serbia, by
RT-qPCR in 9 birds: 3 Northern goshawks (Accipiter gentilis), 2 White-tailed eagles, 1 Legged gull
(Larus michahellis), 1 Hooded crow (Corvus cornix), 1 Bearded parrot-bill (Panurus biarmicus),
and 1 Common pheasant. Seven of these birds died during the summer of 2012 while two (a
pheasant and one goshawk) died during winter-early spring. Eight of the nine WNV RNA positive
birds were strictly resident, suggesting that they became infected in the country. Moreover, isolation
of WNV-RNA from dead predators (5 of the 9 WNV positive birds) provides more evidence that
birds of prey play a key role in virus transmission (Petrovi et al., 2013).
All the isolates were classified by phylogenetic analysis of partial E region sequences as lineage 2
WNV strains and they were closely related to those responsible of recent outbreaks in Greece, Italy,
and Hungary. Further on, West Nile virus from one Northern goshawk (SRB-Novi Sad/12) was
isolated on Vero cell culture and its full genome sequenced. Phylogenetic analysis of this complete
genomic sequence showed a lineage 2 strain that clusters with the viruses responsible for the most
recent human and animal outbreaks reported in neighbouring countries, however, SRB-Novi Sad/12
isolate was unique, as it showed a total of 29 distinctive nucleotides when compared to those
circulating in Europe. Comparison of partial sequences of the E region from five additional WNV
sequences recovered from respective birds in this study shows that at least two different groups of
lineage 2 strains, which simultaneously circulated during summer of 2012, can be distinguished
(Petrovi et al., 2013). These results suggest that WNV has reached the country in, at least, two
different events and suggest that the virus not only has become endemic in Serbia and surrounding
countries, but that it is also evolving while circulating in the area. According to these findings, it
seems logically to think that since its original detection in Hungary, WNV lineage 2 has expanded
southwards and reached Serbia recently, but it cannot be ruled out that there had been prior sporadic
human and animal cases that have gone unnoticed.
Mosquitoes were sampled on the spots where possible circulation, based on serological testing of
humans and horses, was detected in order to optimally utilize available number of test kits and
minimize the number of pools for mosquito surveillance. Data obtained from human serological
surveillance in 2009 had indicated seven hot spots of possible WNV transmission in the
municipality of Novi Sad (capital of Vojvodina Province). In 2010 mosquito trapping was focused
207
on these hot spots revealing WNV RNA in three out of 50 pools of Cx. pipiens pipiens, the first
finding of WNV in mosquitoes in Serbia (Petri et al., 2012). During this experiment, a total of
56757 mosquitoes (841 pools of 50 individual insects) originating from 66 localities in 29
settlements in Vojvodina were examined. The presence of WNV genome was established in only
three pooled-samples of mosquitoes collected during 2010 in the territory of Detelinara (part of the
city of Novi Sad). The isolate was typed as lineage 2 WNV (Petri et al., 2012). During the year
2012 WNV outbreak in Serbia, mosquitoes were collected at 62 sites in 31 municipalities in Serbia.
West Nile virus RNA was detected in 9.55% of 314 mosquito pools (11113 specimens) from 9
municipalities in Cx. pipiens pipiens, Aedimorphus vexans and Culiseta annulata (Petri et al., in
press). In addition, presence of WNV genome was confirmed in 28 (9.2%) out of 306 mosquito
pools collected and tested from 20 localities in Vojvodina Province of Serbia during 2013
(unpublished data). The very recent testing of WNV presence in mosquito vectors (Cx. pipiens
pipiens) was done during the first WNV surveillance program during 2014 in Serbia. The Cx.
pipiens pipiens mosquitoes were collected from the whole territory of Serbia and out of 995 tested
mousquito pools WNV were found present in 22 (2.21%) samples (unpublished data). These data
point on slightly less intensive WNV circulation during 2014 in Serbia, but still the virus circulation
in vectors is endemically present for the least four last years.
WNV seroprevalence in different domestic and wild animal species

Presence of anti-WNV antibodies in blood sera of different animal species detected recently also
represents the evidence of intensive circulation of WNV in the last few years in Serbia. Out of
tested blood sera of 66 donkeys, 1076 dogs, 318 poultry, 102 sheep, 6 goats, 30 cattle, and 5 deer,
collected between 2008 and 2012, presence of anti-WNV antibodies was found in 0.93% dogs and
0.31% poultry (urii et al., 2013). To assess WNV circulation among mammals in the country,
688 samples obtained from 279 farm pigs, 318 wild boars, and 91 roe deer were investigated for the
presence of antibodies to WNV by ELISA and viral neutralization test. ELISA-reactive sera were
identified in 43 (15.4%) pigs, 56 (17.6%) wild boars, and 17 (18.7%) roe deer. Of these, 6 (14%),
33 (59%), and 4 (23.5%) respectively, neutralized WNV. One out of the 45 ELISA negative sera
tested, from a roe deer, neutralized WNV (Escribano-Romero et al., 2015).
Methodology of WNV surveillance program in Serbia

Veterinary Directorate of the Ministry of Agriculture and Environmental Protection infront the
Veterinary Service launched and funded the national WNV surveillance program starting from
April 2014. The surveillance program encompassed sentinel species (poultry and horses),
mosquitoes (particularly species Culex pipiens, which were confirmed as most prevalent WNV
vectors in our region) and wild bird species, which are natural virus reservoirs and populate the
natural habitats in Serbia, either temporarily or permanently.
The surveillance program was conducted throughout the year according to the provided guidelines.
Active surveillance was performed by serological examination (by ELISA) of sentinel poultry and
horses and by testing of virus presence in samples of mosquito vectors (sampled by dry-ice baited
traps in the period of most prominent vector activity using special traps), as well as in the samples
of all collected dead wild birds belonging to the species susceptible to WNV (tested throughout the
year). The detection of virus presence in birds and mosquitoes was done by molecular diagnostic
(RT-PCR or real-time RT-PCR). Passive surveillance encompassed serological (testing of paired
serum samples) and virological examination of clinically ill horses manifesting signs of CNS
dysfunction.
208
The active and passive surveillance encompassed all municipalities in the Republic of Serbia. The
selection and distribution of sampling localities in each county-region is defined by epizootiological
services of Scientific and Specialized Veterinary Institutes according to the assessment of the risk of
exposure to WNV (according to the human cases in the last 2 years, and previous studies performed
in horses). The whole Program was described in details by Petrovi et al. (2014a). The basic
methodology of WNV surveillance program in Serbia in 2014 is described in the Table 1.
Table 1. WNV surveillance program (sampling /testing) in Serbia in 2014 (Petrovi et al., 2014a)
High-risk regions/Counties
Lower-risk regions/Counties
1. Testing of sentinel animals (domestic poultry and horses) aimed at early detection of WNV
circulation
Surveillance of
sentinel poultry on
rural households
poultry hatched in
current year
(backyard poultry)
Surveillance of
sentinel horses
Serological testing at the authorized

institute in the period May-September
from 10 settlements / County; 5 samples /
settlement from et least one household
according to described schedule.
6 samplings (1 in May; 1 in June; 2 in
July; 1 in August by middle; 1 in
September (until 15 Sept)
Serological testing of 50 sentinel horses in
the authorized institute, sampling from
minimum 3 localities per County.
Sampling and blood testing of same
horses to be performed three times (in
three occasions) (June-July-August)
Serological testing at the authorized

institute in the period June-September
from 6 settlements / County; 5 samples /
settlement from et least one household
according to described schedule.
4 samplings (1 in June; 1 in July; 1 in
August by middle; 1 in September
(until 15 Sept)
Serological testing of 30 sentinel horses
in the authorized institute, sampling
from min 3 localities per County.
Sampling and blood testing of same
horses to be performed three times (in
three occasions) (June-July-August)
2. Testing aimed at early detection of WNV in natural reservoirs and vectors
Virus surveillance
in wild birds
Virus surveillance
in vectors mosquitoes
(Culex pipiens)
Application of RT-PCR or real time RTPCR methodology for testing samples of

dead susceptible bird species throughout
the year, or up to 100 samples of
purposely hunted birds or live captured
susceptible bird species per County during
the period May - October
Collecting mosquitoes at 2-week intervals
in the period May-September at 10
localities within the County and testing
the virus presence by RT-PCR or real time
RT-PCR methodology (7 samplings in the
period from end May to the first half of
September)
RT-PCR or real time RT-PCR

methodology for samples of up to 50
dead birds (WNV-susceptible species)
per County during the period May October
Collecting mosquitoes at monthly
intervals in the period May-September at
5 localities per County and testing the
virus presence by RT-PCR or real time
RT-PCR methodology (5 samplings
once a month in the period from second
half May to the first half of September)
Future steps and expectations

The aforementioned serological and virological examinations confirmed active circulation and
endemic presence of WNV in the territory of the Republic of Serbia. Based on the obtained results
and anticipated intense circulation of WNV that poses substantial risks for both public and animal
209
health in Serbia, there is a need for further studies and continuous monitoring and surveillance of
WNV infection and virus epidemiology in Serbia in the coming years.
Acknowledgments
This work is conducted within the project TR31084 funded by the Serbian Ministry of Education,
Science and Technological development
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Bakonyi, T., Ivanics, E., Erdelyi, K., Ursu, K., Ferenczi, E., Weissenbock H. and N. Nowotny: Lineage
1 and 2 strains of encephalitic West Nile virus, central Europe. Emerg Infect Dis. 12(4), 618-623, 2006.
Barbi, Lj., Liste, E., Kati, S., Stevanovi, V., Madi, J., Stareina, V., Labrovi, A., Di Gennaro, A.
and G. Savini: Spreading of West Nile virus infection in Croatia. Veterinary Microbiology 159, No 3-4,
504508, 2012.
Blitvich, B.J.: Transmission dynamics and changing epidemiology of West Nile virus. Anim. Health
Res. Rev. 9(1), 71-86, 2008.
Bordjoski M, Gligic A, Boskovic R.: Arbovirusne infekcije u SR Srbiji. Vojnosanit Pregl, 29(4):173175, 1972.
urii B, Vasi A, Rogoarski D, Vojinovi D, Elezovi Radovanovi M, Mani M, Mari J, Proki N,
Ili , Novotny N, Gligi A.: Seroepizootiological-epidemiological investigation and mapping of West
Nile infection in the Republic of Serbia. Acta Veterinaria (Beograd), Vol. 63, No. 5-6, 569-579, 2013.
DOI: 10.2298/AVB 1306569D
Calistri, P., Giovannini, A., Hubalek, Z., Ionescu, A., Monaco, F., Savini, G., Lelli R.: Epidemiology of
West Nile in Europe and the Mediterranean basin. The Open Virol. J. 4, 29-37, 2010.
Castillo-Olivares, J. and J. Wood: West Nile infection in horses. Vet. Res. 35, 467-483, 2004.
Dauphin, G., Zientara, S., Zeller, H. and B. Murgue (2004). West Nile: worldwide current situation in
animals and humans. Comp Immunol Microbiol Infect Dis. 27 No5, 343-355.
ECDC (European Centre for Disease Prevention and Control). Reported cases of West Nile fever for the
EU and neighbouring countries. Situations update 30. November 2012. [Accessed 16 Dec 2012].
Available
from:
http://ecdc.europa.eu/en/healthtopics/west_nile_fever/West-Nile-fevermaps/Pages/index.aspx
ECDC (European Centre for Disease Prevention and Control). Reported cases of West Nile fever for the
EU and neighbouring countries. Situations update 20. November 2014. Available from:
http://ecdc.europa.eu/en/healthtopics/west_nile_fever/West-Nile-fever-maps/pages/index.aspx
.
[Accessed 10 March 2015].
EpiSouth Weekly Epi Bulletin - N232, 22nd August 28th August 2012 (e-WEB) available at:
http://www.episouthnetwork.org/sites/default/files/bulletin_file/eweb_232_30_08_12.pdf
EpiSouth Weekly Epi Bulletin - N240, 17 October 23 October 2012 (e-WEB) available at:
http://www.episouthnetwork.org/content/episouth-weekly-epi-bulletin-e-web
Erdlyi, K., Ursu, K., Ferenczi, E., Szeeredi, L., Ratz, F., Skare, J., Bakonyi T.: Clinical and
pathological features of linage 2 West Nile virus: Infections in birds of prey in Hungary. Vector Borne
Zoonotic Dis. 7, No 2, 181-188, 2007
Escribano-Romero E, Lupulovi D, Merino T, Blzquez A-B, Lazi G, Lazi S, Saiz JC, Petrovi T.
West Nile virus serosurveillance in wild and domestic mammals from Serbia. Veterinary Microbiology
176, 365369, 2015.
Hayes, E., Komar, N., Nasci, R., Montgomery, S., OLeary, D., Campbell G.: Epidemiology and
transmission dynamics of West Nile virus disease. Emerg Infect Dis. 11, No 8, 1167-1173, 2005.
Institut za javno zdravlje Srbije. Infrmci tuln pidmil situcii grznic
Zpdng Nil n tritrii Rpubli Srbi u 2014. gdini - 25.07.2014. (www.batut.org.rs;
http://www.batut.org.rs/index.php?content=940 )
210

17. Komar, N., Langevin, S., Hinten, S., Nemeth, N., Edwards, E., Hettler, D., Davis, B., Bowen, R.,
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Bunning M.: Experimental infection of North American birds with the New York 1999 Strain of West
Nile virus. Emerg Infect Dis. 9, No 3, 311-322, 2003.
Linke, S., Niedrig, M., Kaiser, A., Ellerbrok, H., Muller, K., Muller, T., Conraths, F.J., Muhle, R.U.,
Schmidt, D., Koppen, U., Bairlein, F., Berthold, P., Pauli G.: Serologic evidence of West Nile virus
infections in wild birds captured in Germany. Am. J. Trop. Med. Hyg. 77, 358364, 2007.
Lupulovi D, Martn-Acebes M, Lazi S, Alonso-Padilla J, Blquez A-B, Escribano-Romero E, Petrovi
T, Saiz JC. First Serological Evidence of West Nile Virus Activity in Horses in Serbia. Vector-Borne
and Zoonotic Diseases, Vol. 11, No9, 1303-05, 2011.
Medi S, van den Hoven R, Petrovi T, Lupulovi D, Nowotny N.: Serological evidence of West Nile
virus infection in the horse population of northern Serbia. J Infect Dev Ctries, 8(7):914-918, 2014.
Obrenovi Jelena, Grgi Bojana, Lonarevi Goranka, Dimitrijevi Dragana, Ili-Vlatkovi Verica,
Simi Danijela, Kanazit Milena, Seke Kristina, Milinkovi Milunka, Mutavdi Tanja. Izvetaj o
zaraznim bolestima u 2012.godini na teritoriji Republike Srbije. Institut za javno zdravlje Srbije dr
Jovan
Jovanovi
Batut,
2013,
ISSN2217-9607.
http://www.batut.org.rs/download/izvestaji/Godisnji%20izvestaj%20o%20zaraznim%20bolstima%202
012.pdf
Papa, A., Bakonyi, T., Xanthopoulou, K., Vazquez, A., Tenorio, A., Nowotny N.: Genetic
characterization of West Nile virus lineage 2, Greece, 2010. Emerg. Infect. Dis. 17, 920922, 2011.
Popovi N, Miloevi B, Uroevi A, Poluga J, Lavadinovi L, Nedelijkovi J, Jevtovi D, Dulovi O.
Outbreak of West Nile virus infection among humans in Serbia, August to October 2012 . Euro Surveill.
2013;18(43):pii=20613
Petri D, Hrnjakovi Cvjetkovi I, Radovanov J, Cvjetkovi D, Jerant Pati V, Miloevi V, Kovaevi
G, Zgomba M, Ignjatovi upina A, Konjevi A, Marinkovi, D, Paz Snchez-Seco M.: West nile virus
surveillance in humans and mosquitoes and detection of cell fusing agent virus in Vojvodina province
(Serbia). HealthMED, Vol. 6, No 2, 462-468, 2012.
Petri D., Zgomba M., Ignjatovi upina A., Bellini R., Hrnjakovi Cvjetkovi I., Miloevi V., Jerant
Pati V., Lazi S., Petrovi T. West Nile virus presence in mosquitoes in Serbia during 2012. In press
Petrovi T, Blazquez A, Lupulovi D, Lazi G, Escribano-Romero E, Fabijan D, Kapetanov M, Lazi S,
Saiz JC.: Monitoring West Nile virus (WNV) infection in wild birds in Serbia during 2012: first
isolation and characterisation of WNV strains from Serbia. Eurosurveillance, Vol 18, 44, 1-8, 2013.
Petrovi T, Lazi S, Lupulovi D, Lazi G, Bugarski D, Vidanovi D, Stefan-Miki S, Miloevi V,
Hrnjakovi-Cvetkovi I, Petri D.: Serological study on WNV presence in horses in Vojvodina after the
human outbreak in Serbia in 2012. Arch Biol Sci Belgrade, 66 (2), 473-481, 2014.
Petrovi T., ekler M., Petri D., Lazi S., Lupulovi D., Lazi G., Debeljak Z., Bugarski D., Plavi B.:
West Nile virus surveillance program in Serbia. Arhiv veterinarske medicine, 7, 2, p29-45, 2014a.
Platonov, A.E., Fedorova, M.V., Karan, L.S., Shopenskaya, T.A., Platonova, O.V. and V.I. Zhuravlev
(2008). Epidemiology of West Nile infection in Volgograd, Russia, in relation to climate change and
mosquito (Diptera: Culicidae) bionomics. Parasitol Res. 103, Suppl 1, 45-53
Savini, G., Capelli, G., Monaco, F., Polci, A., Russo, F., Di Gennaro, A., Marini, V., Teodori, L.,
Montarsi, F., Pinoni, C., Pisciella, M., Terregino, C., Marangon, S., Capua I., Lelli R.: Evidence of West
Nile virus lineage 2 circulation in Northern Italy. Vet Microbiol. 158 No 3-4, 267-273, 2012.
Smithburn, K.C., Hughes, T.P., Burke, A.W., Paul J.H.: A neurotropic virus isolated from the blood of
a native of Uganda. Am J Trop Med Hyg 20, 471-492, 1940.
Trevejo, R.T., and M. Eidson: Zoonosis update: West Nile virus. J. Am. Vet. Med. Assoc. 232, 1302
1309, 2008.
Valiakos, G., Touloudi, A., Iacovakis, C., Athanasiou, L., Birtsas, P., Spyrou, V., Billinis C.: Molecular
detection and phylogenetic analysis of West Nile virus lineage 2 in sedentary wild birds (Eurasian
magpie), Greece, 2010. Euro Surveill. 16(18):pii=19862, 2011. [Accessed 30 May 2013]. Available
online: http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19862
van der Meulen, K.M., Pensaert, M.B., Nauwynck H.J.: West Nile virus in the vertebrate world. Arch.
Virol. 150, 637657, 2005.
211

35. Vesenjak-Hirjan J., Punda-Poli V., Dobec M.: Geographical distribution of arboviruses in Yugoslavia.
Journal of Hygiene, Epidemiology, Microbiology and Immunology (Prague) 35, 129-40, 1991.
36. Weissenbck, H., Hublek, Z. Bakonyi, T., Nowotny N.: Zoonotic mosquito-borne flaviviruses:
worldwide presence of agents with proven pathogenicity and potential candidates of future emerging
diseases. Vet. Microbiol. 140, 271280, 2010.
37. Wodak, E., Richter, S., Bag, Z., Revilla-Fernndez, S., Weissenbck, H., Nowotny, N., Winter P.:
Detection and molecular analysis of West Nile virus infections in birds of prey in the eastern part of
Austria in 2008 and 2009. Vet Microbiol. 149, No 3-4, 358-366, 2011
38. Ziegler, U., Seidowski, D., Angenvoort, J., Eiden, M., Mller, K., Nowotny, N., Groschup M.H.:
Monitoring of West Nile Virus Infections in Germany. Zoonoses and Public Health, Vol. 59, 95-101,
2012
212
PATHOMORPHOLOGICAL FINDINGS IN ORGANS OF SHEEPS DIED OF

BLUETONGUE DISEASE
Ivan Dobrosavljevic1*, Milena Zivojinovic1, Slavonka Stokic-Nikolic1, Milica Lazic1, Dragan
Rogozarski1
1
Vetrinary specialistic institute Pozarevac, Pozarevac, Serbia

Abstract
Bluetongue is an infectious arthropod-borne viral disease primarily of domestic and wild ruminants.
Infection with bluetongue virus (BTV) is common in a broad band across the world. Since the
1990s, BTV has extended considerably north of the 40th and even the 50th parallel in some parts of
the world (eg, Europe).
The etiological agent of the disease is Orbivirus, family Reoviridae. There are at least 24 serotypes
worldwide. Although not all serotypes exist in any one geographic area, virus has high capacity to
quickly spread across the area.
During the late summer and early fall 2014, emerging of the disease was observed in the eastern and
southeastern part of Serbia. It was confirmed as BTV Serotype 4. The first cases in sheep in
Branicevo district were recorded in September. The sheeps have had fever, lameness and
depression. Edema of lips, nose, face, submandibular area and eyelids were seen in most of the
cases. Edema of the head was followed by plentiful salivation. On the tongue and gums there could
be seen erosions and in one sheep it was found edematous tongue with mild cyanosis (blue tongue).
The first autopsy findings of dead sheeps did not clearly indicate blue thongue disease: several
erosions on the tongue and gums with plenty of saliva, slightly swollen subcutaneous tissue in the
chest region. The most pronounced lesions were in the thoracic cavity: hyperemia and pulmonary
edema, massive subpleural hemorrhages. The lesions of the proximal part of the pulmonary artery
were slightly pronounced (hardly visible changes).
Subsequent autopsy cases were revealed pathognomonic lesions on the proximal part of the
pulmonary artery (ring bleeding under the adventitia of the pulmonary artery), edema and
hemorrhages of the papillary muscle of the left heart ventricle. These gross lesions are nearly
certain sign of the disease. The severity of lesions depends on the virulence of the virus, the period
of time of it presents on some area and the immune status of the host. Laboratory confirmation is
essential for final diagnose.
Key words: Orbivirus, sheep, gross lesions.
Introduction
Bluetongue (BT) or ovine catarrhal fever is an arthropod-borne viral disease of domestic and wild
ruminants, particularly sheep. It is characterised by inflammation, haemorrhage, excoriations,
erosion and cyanosis of the mucous membranes of the oronasal cavity, coronitis, laminitis, oedema
of the head and neck, and torticollis. The name of the disease derives from cyanosis of the tongue.
Bluetongue is most prevalent in tropical and subtropical climate area. It was first described in South
Africa (in the late eighteenth century) in Merino sheep (Verwoerd and Erasmus, 2004). During the
twentieth century, the disease have been reported in Cyprus, Israel, USA, Portugal, Spain, Pakistan,
India, Middle East, China, Malaysia, Indonesia, Australia and in now days in Southeast Europe.
The etiological agent of the disease is a virus which is composed of a segmented, double-stranded
RNA enclosed in a double-layered capsid. It was classified in genus Orbivirus, family Reoviridae.
There are at least 24 serotypes worldwide. In blood and tissue specimens it is very stable at 20 C, 4
C and -70 C, but not at -20 C. The virus is unstable below pH 6,5 (Owen, 1964).
213
Bluetongue virus (BTV) first multiplies in the regional lymph nodes after virus inoculation by the
bite of a midge before spreading to the rest of the body. Viral replication occurs primarily in
endothelial cells and pericytes of capillaries and small blood vessels. Pathological changes in these
cells leads to hyperplasia of the endothelium and consequently vascular occlusion, stasis and
exudation, which eventually gives rise to hypoxia, oedema and haemorrhage as well as to secondary
lesions in the overlying epithelium (Verwoerd and Erasmus, 2004). The most sever lesions occur in
areas where the temperature is lower than that of circulating blood (Verwoerd and Erasmus, 2004).
There is also evidence for a highly selective involvement of endothelial cells in certain blood
vessels, such as the pulmonary artery and those where the most severe lesions are found. The
mechanism of these lesions is not understood.
The aim of this paper was not to elucidate the new facts about BT, but to remind and emphasizes
the importance of gross lesions in the diagnosis of this disease.
Photos used in this paper were taken during necropsies of sheep, in Veterinary institute
Poarevac, in September 2014. In all cases BTV was confirmed in full blood samples by ReverseTranscription Polymerase Chain Reaction (RT-PCR).
Results
During the late summer and early fall 2014, emerging of BT was observed in the eastern and southeastern part of Serbia. It was confirmed BTV, serotype 4. The first cases in sheep in Branicevo
district were recorded in September. The sheep have had fever, lameness and depression. Oedema
of lips, nose, face, submandibular area and eyelids were seen in most of the cases. Oedema of the
head was followed by plentiful salivation. On the tongue and gums there could be seen erosions and
in one sheep it was found oedematous tongue with mild cyanosis (blue tongue).
The first autopsy findings of dead sheep did not clearly indicate Blue tongue disease: several
erosions on the tongue and gums with plenty of saliva (Fig. 1, 2 and 3), slightly swollen
subcutaneous tissue and few ecchymoses of the intermuscular connective tissues in the chest region
(Fig. 4 and 5). The most pronounced lesions were in the thoracic cavity: hyperaemia and pulmonary
oedema, massive subpleural haemorrhages. The lesions of the proximal part of the pulmonary artery
were slightly pronounced (hardly visible haemorrhages) (Fig. 6, 7, 8 and 9).
Figure 1. Erosion and haemorrhage

on the mucosa of lower lip.
Figure 2. Erosive glositis and hyperemia of corner of the

lips.
214
Figure 3. Erosions and haemorrhages on

dental pad.
Figure 4. Slightly swollen subcutaneous tissue in

the chest region.
Figure 6. Hyperemia and pulmonary edema with

lot of foamy exudate in bronchus
Figure 5. Ecchymoses of the intermuscular

connective tissues in the chest region.
Figure 8. Hardly visible subepicardial

petechiae and petechiae at the proximal part
of pulmonary artery
Figure 7. Massive subpleural hemorrhages
215
Figure 9. Hardly visible petechiae in tunica

media of proximal part of pulmonary artery
(inner side).
Figure 10. Erosions on dental pad covered with

diphtheritic deposits.
Figure 14. Disseminated subepicardial ecchymoses
216
Figure 12. Gelatinous oedema of connective

tissue in the surroundings of the esophagus
Figure 11. Oedema of subcutaneous tissue

in the submandibular area.
Figure 13. Hydrothorax
Figure 15. Ring bleeding in the tunica

media of proximal part of pulmonary
artery.
Figure 16. Edema and hemorrhages of the papillary muscle

of the left heart ventricle. Disseminated subendocardial
ecchymoses.
Figure 17. Subcapsular haemorrhages of the spleen
Subsequent autopsy cases were revealed more pronounced and characteristic lesions: erosions on
dental pad covered with diphtheritic deposits Fig.10; oedema of subcutaneous tissue in the
submandibular area Fig. 11; gelatinous oedema of connective tissue in the surroundings of of the
esophagus Fig. 12; hydrothorax - Fig. 13; sprayed subepicardial bleeding which cover a large area
of the heart - Fig. 14; pronounced ring bleeding in the tunica media of proximal part of pulmonary
artery - Fig. 15; edema and hemorrhages of the papillary muscle of the left heart ventricle - Fig. 16;
subcapsular petechial hemorrhages of the spleen Fig. 17.
Discussion
Previously described gross lesions correspond largely with the clinical signs (Moulton, 1961).
Ecchymoses and larger haemorrhages in the tunica media of the pulmonary artery near its base are
characteristic of BT (Fig. 8, 9 and 15). These lesions are sometimes described as being
pathognomonic for BT, but they have also been seen on rare occasions in other infections such as
217
Rift Valley fever, heart-water and pulpy kidney disease in sheep. These haemorrhages may be
difficult do see and it may be necessary to stretch the pulmonary artery and to hold it against the
light (Fig. 9). Sometimes epicardial and endocardial haemorrhages as well as focal necrosis of the
papillary muscle can be seen in the left ventricle (Fig. 16). Bleedings in the wall of the base of the
pulmonary artery and lesions of the papillary muscle of the left ventricle are highly characteristic
for BT and they are usually obvious in severe clinical infections but as shown in Figures 8 and 9,
they may be barely visible in mild or convalescent cases (Lear and Callan, 2014).
Lymph nodes are commonly swollen and oedematous and at the spleen can be seen subcapsular
haemorrhages (Fig. 17).
Oral lesions which have been seen in the initial stage of the disease consist of slightly expressed
hyperemia, erosions and haemorrhages of the mucous membrane (Fig. 1, 2 and 3). The mucous
membrane was covered with a large amount of saliva. Destruction of epithelial cells lead to
excoriation and erosions (especially in areas of most friction: inside of the lips, dental pad, cheeks
and tongue, particularly adjacent to molars). Secondary bacterial infecton is often responsible for
the diphteric necrosis of the erosions (Martens et al., 1989), which have been observed in latter
clinical cases and necropsies (Fig. 10).
Hyperaemia, petechiation and erosions of the mucosa of the forestomachs, particularly of the
papillae, rumenal pillars, reticular folds and oesophageal groove also can be seen in gastrointestinal
tract (Erasmus, 1990).
The most severe pathology changes occur in the lungs. Severe hyperaemia and oedema of the lungs
accompanied by copious amounts of froth in bronchi and trachea, as well as hydrothorax, occur
especially in acute fatal cases (Fig. 6). Aspiration pneumonia may occasionally be found (Luedke et
al., 1964).
The muscle lesions comprise ecchymoses (Fig. 5) and gelatinous oedema of the intermuscular
connective tissue, particularly in the neck and the dorsal thoracic region.
Each of described lesions for himself are not sufficient for diagnosis of BT, but all together in
correlation with clinical signs and epizootic anamnesis are certain milestone in the right direction.
First cases of the disease should be differentiated from early signs of hepatogenous photosensitivity
caused by a variety of plant and mycotoxin poisonings (Kellerman et al., 1988), vesicular diseases
such as foot-and-mouth disease and contagious ecthyma. In sheep that die after typical oral lesions
of BT have regressed, it may be difficult to differentiate BT from disease such as heartwater and
pulpy kidney disease (Verwoerd and Erasmus, 2004).
A presumptive diagnosis of BT can be made from previously described lesions in affected sheep,
especially in those areas where the disease is endemic. In nonendemic areas and in other ruminant
species laboratory conformation by either virus isolation, conformation of the virus genome or
serology is necessary. Laboratory conformation is also necessary to identify the serotype involved
in order to establish specific control measures.
References:
1. Erasmus B.J.: Bluetongue. In: Virus infections of Ruminants, Vol. 3, ed. Dinter Z and Morein B.,
Amsterdam: Elsevier Science Publishers, 1990.
2. Kellerman T.S., Coetzer J.A.W. and Naud T.W.: Plant Poisonings and Mycotoxicoses of Livestocks in
Soutern Africa. Cape Town, Oxford University Press Soutern Africa, 1988.
3. Lear A.S. and Callan R.J.: Overview of Bluetongue. In: The Merck Veterinary Manual, ed. Aiello S.E.
and Moses M.A., Merck Sharp & Dohme Corp., a subsidiary of Merck & Co., Inc., Whitehouse Station,
N.J., U.S.A., 2014,
http://www.merckmanuals.com/vet/generalized_conditions/bluetongue/overview_of_bluetongue.html
218

4. Luedke A.J, Bowne J.G., Jochim M.M. and Doyle C.: Clinical and pathologic features of bluetongue in
sheep. American Journal of Veterinary Research, 25, 963-970, 1964.
5. Martens P.P.C., Pedley S., Cowley J., Burroughs J.N., Corteyn A.H., Jeggo M.H., Jennings D.M. and
Gorman B.M.: Analysis of the roles of bluetongue virus outer capsid protein VP2 and VP5 in
determination of virus serotype. Virology, 170, 561-565, 1989.
6. Moulton J.E.: Pathology of bluetongue of sheepin California. Journal of the american Veterinary Medical
Association, 138, 493-498, 1961.
7. Owen N.C.: Investrigation into the pH stability of bluetongue virus and its survival in mutton and beef.
Onderstepoort Journal of Veterinary Research, 31, 109-118, 1964.
8. Verwoerd D.W. and Erasmus B.J.: Bluetongue. In: Infectious diseases of livestock, 2 nd edition, ed.
Coetzer J.A.W. and Tustin R.C., Cape Town, Oxford University Press Soutern Africa, 2004, 1201-1220.
219
SPECIES DIVERSITY AND LIFE STAGES DOMINANCE OF HARD TICKS

(Acari: Ixodidae) AT VOJVODINA HUNTING RESORTS
Aleksandra Petrovi1*, Aleksandar Jurii1, Ivana Ivanovi1, Aleksandar Potkonjak2, Vuk Vraar2,
Dragana Rajkovi1
1 Department of Environmental and Plant Protection, Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia
2 Department of Veterinary Medicine, Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia
Abstract
All hard ticks species are obligatory parasites, often host nonspecific, and therefore capable of
parasitizing a numerous species of vertebrates. Their relatively slow feeding process on the hosts,
the absence of digestive enzymes and relatively adaptable life cycles enable acquisition,
maintenance and transmission of a variety of the pathogens and thus cause severe diseases in
humans and animals. The aim of the study is to determine the hard tick species diversity and the
dominance of the certain life stages on the hosts and on the vegetation cover at the hunting resorts
of Vojvodina. Two methods were used for tick sampling: from the vegetation and from the body of
the hunted roe deer (Capreolus capreolus Linnaeus, 1758) and wild boars (Sus scrofa Linnaeus,
1758). The study was conducted from 2011 to 2014 at 20 hunting resorts in Vojvodina, all
agroecosystems with wide belts of deciduous forests and sporadic shrub vegetation. Eight tick
species from four genera were identified on the hosts: Ixodes ricinus Linnaeus 1758,
Haemaphysalis concinna Koch 1844, H. punctata Canestrini & Fanzago 1878, H. sulcata
Canestrini & Fanzago 1878, Dermacentor marginatus Sulzer 1776, D. reticulatus Fabricius 1794,
Rhipicephalus bursa Canestrini & Fanzago 1878 and R. sanguineus Latreille 1806, but only five
species from three genera on the vegetation: I. ricinus, H. concinna, H. punctata, D. marginatus and
D. reticulatus. Depending on the season, locality and the sampling methods, the dominance of the
certain life stages was significantly different. The adult stages of all tick species were found on the
hosts, nymphae of I. ricinus, H. concinna and H. punctata and larvae only of I. ricinus and H.
punctata. However, on the vegetation cover, adults were found for five tick species, but nymphal
and larval stages only of I. ricinus and H. concinna. Due to its wide home ranges, seasonal
migrations and population fluctuations most of the vertebrate species found at hunting resorts
represent an "epidemiological bridge" among hosts, parasites and pathogens, responsible for the
maintenance of the high tick density populations in certain habitats and therefore seasonal, spatial,
transstadial and transovarial transmission of important pathogens for human and animal health.
Key words: ticks, Ixodidae, diversity, life stages, hunting resorts, Vojvodina
Introduction
All hard ticks species are obligatory parasites, often host nonspecific, and therefore capable of
parasitizing a numerous species of vertebrates. Their relatively slow feeding process on the hosts,
the absence of digestive enzymes and relatively adaptable life cycles enable acquisition,
maintenance and transmission of a variety of the pathogens and thus cause severe diseases in
humans and animals (Sonenshine, 1991). High tick infestation could cause the death of the host due
to blood loss (Balashov, 1968; loc. cit. Evans, 1992), but more important is the role of ticks as
vectors of numerous pathogens, viruses, bacteria and protozoa, transmitted to the host during the
feeding phase. During the last two decades, cases of zoonoses transmitted by ticks, such as Lyme
borreliosis, Tick-borne encephalitis, anaplasmosis, babesiosis and others, are on the rise, and
220
represent the leading health problem in many parts of Europe and North America (Paulauskas,
2009). Additionally, the further increase of tick-borne disease incidences could be expected as a
result of global climate change, as well as the expansion of vectors and pathogens in the new areas.
Due to their vector role, ticks are the subjects of many studies. To understand the complex
interactions among ticks, their hosts and pathogens, and to determine the potential risk of the
contact between humans and animals with infected ticks, a good knowledge of all biotic and abiotic
factors that affect the population of these arthropods is needed. Furthermore, continuous and
systematic monitoring of species abundance, seasonal and spatial dynamics of ticks and their hosts
is crucial.
Acarological studies in our country are mainly focused on urban and suburban habitats, although a
few numbers of studies were conducted at the natural habitats of ticks, such as hunting and natural
resorts (Jurii et al., 2011, Jurii et al., 2012). The rural habitats have low anthropogenic
influence, so floristic and faunistic communities are rich and diverse and provide favourable
conditions for maintaining the tick populations. The main host for the adult stages of Ixodes ricinus
in Central Europe is roe deer (Capreolus capreolus Linnaeus, 1758) (Pintur et al., 2012), followed
by the wild boar (Sus scrofa Linnaeus, 1758). Several studies have confirmed the high infestation of
roe deer and wild boars in Europe (Fuente et al., 2004; Ruiz-Fons et al., 2006; Kiffner et al., 2010;
Vor et al., 2010; Pintur et al., 2012; Carpi et al., 2008), stating that its abundance can affect the
population dynamics of I. ricinus ticks. Although the role of roe deer and wild boars in maintaining
the agents of some diseases in natural habitats (such as Lyme borreliosis and Tick-borne
encephalitis) is still unclear, there are numerous evidences of a positive correlation between the
number of roe deer and ticks (Carpi et al., 2008), which confirms the importance of understanding
the complex mechanisms of transmission of these potentially serious diseases. The role of wild boar
as a reservoir of Anaplasma phagocytophilum is confirmed by Michalik et al. (2009). Due to its
wide home ranges, seasonal migrations and population fluctuations most of the vertebrate species
found at hunting resorts represent an "epidemiological bridge" among hosts, parasites and
pathogens, responsible for the maintenance of the high tick density populations in certain habitats
and therefore seasonal, spatial, transstadial and transovarial transmission of important pathogens for
human and animal health.
In order to obtain the most accurate data on tick species diversity and density in practice, it is
necessary to use different methods of tick sampling. Due to different host seeking strategies, the
estimated relative abundance of tick populations is in most cases the direct result of the applied
sampling methods and as such do not represent a real tick species diversity at a certain locality. To
avoid the bias and to obtain the actual state of tick species diversity and their spatial dispersion, two
different methods of tick sampling were applied in this study. The aim of the study is to determine
the hard tick species diversity and the dominance of the certain life stages found on the hosts and on
the vegetation cover at the hunting resorts of Vojvodina.

Tick sampling and identification
Ticks were collected during the four year study (2011-2014) using two methods: from the nature
and from the hunted carcasses of roe deer (Capreolus capreolus Linnaeus, 1758) and wild boars
(Sus scrofa Linnaeus 1758). Frome nature, ticks were sampled according to Flag-hour method
(Maupin et al., 1991), i.e. by dragging the white flannel cloths (1 x 1.6 m) through the vegetation
and the soil surface in total length of 100 m for an hour (Sonenshine, 1993). Both sides of the cloth
were carefully examined every 20 m. The sampling was conducted at five chosen transects of each
hunting resort. Ticks were sampled monthly, from 10 am till 6 pm, if weather conditions were
suitable. This method was not used if the average daily temperature values were under 5C. The
221
collection of ticks from the carcasses of roe deer and wild boars was performed immediately after
the hunt. Each carcass was systematically and thoroughly inspected using palpatory technique by
three observers using latex gloves. All tick specimens were collected using acarological tweezers
and placed into plastic tubes (5 ml) with a small cotton ball soaked in water to maintain the
humidity and closed with perforated plastic stopper for sufficient ventilation. The collected
specimens were properly labeled and transported to the laboratory and maintained in induced
diapause at 5C till examination and identification. Tick species were identified up to species level
according to identification keys: Nosek & Sixl (1972), Estrada-Pea et al. (2004) and Walker et al.
(2007).
Localities
The study was performed at 20 localities on the territory of Autonomous Province of Vojvodina, 15
in Baka: Ada (13.277 ha, N4546`522`` E2009`230``), Apatin (28.812 ha, N4541`593``
E1855`340``), Ba (30.149 ha, N4520`447`` E1913`108``), Baka Palanka (52.204 ha,
N4514`198`` E1920`239``), Bako Gradite (6.548 ha, N4533`336` E2005`512``), Bako
Petrovo Selo (11.304 ha, N4541`144`` E2005`283``), Beej (30.147 ha, N4536`536``
E2004`419``), Futog (14.413 ha, N4514`005`` E1941`093``), Kanjia (39.856 ha, N4603`271``
E2004`422``), Mol (9.429 ha, N 4544`103`` E2009`462``), Nadalj (3.646 ha, N4532`005``
E1954`542``), Senta (25.500 ha, N4558`399`` E2005`316``), Srbobran (19.441 ha, N4533`331`
E1946`052``), Titel (26.070 ha, N4512`338`` E2019`075``), Turija (5.343 ha, N4532`509``
E1951`239``); four in Banat: oka (23.139 ha, N4557`301`` E2005`469``), Novi Beej (60.745
ha, N4535`509`` E2007`219``), Panevo (69.565 ha, N4451`530`` E2037`453``), Novi
Kneevac (30.539 ha, N4601`456`` E2004`598``); and one in Srem: Ruma (50.560 ha,
N4501`570`` E1949`189`` (area according to Antoni & Beukovi, 2007). All studied localities
were described as agroecosystems with wide belts of mixed deciduous forests and sporadic shrub
and bush vegetation.
Statistical analyses
The obtained values were tested using software Statistica 12 (StatSoft, licensed to University of
Novi Sad, Faculty of Agriculture). In order to statistically analyze the data, distribution fitting tests
(2 and Kolmogorov-Smirnov tests), one-way ANOVA (tested by Fishers LSD test for significance
level of p<0.05 as statistically significant and p<0.01 as highly statistically significant) were
applied.
Results
The qualitative and quantitative studies of tick species and life stages collected from vegetation and
from the carcasses of the hosts have shown the differences in relative abundance of identified tick
genera and species (Tab 1.).
Table 1. Differences in abundance of identified tick species, life stages and localities depending on sampling
method
Ticks collected
from the
vegetation
Ticks collected
from the hosts
Total
number
Number
of tick
species
The mean of
collected
ticks
Minimum
collected
ticks
Maximum
collected
ticks
Variance
Standard
deviation
Standard
error
20035
50.0875
569
8641.057
92.957
4.648
7267
11.3547
256
1084.236
32.928
1.302
222
Ticks collected from the vegetation

The totals of 20035 ticks were sampled from the vegetation (Tab 2.). Five tick species from three
genera were identified: Ixodes ricinus Linnaeus 1758 (82.98%), Dermacentor marginatus Sulzer
1776 (9.99%) and D. reticulatus Fabricius 1794 (1.20%), Haemaphysalis punctata Canestrini and
Fanzago 1878 (5.43%) and H. concinna Koch 1844 (0.39%). The most abundant were the larvae of
I. ricinus (32.5%). The larval stages of other four species as well as the nymphal stages of D.
marginatus and D. reticulatus have not been found using this method. The highest number of
collected tick specimens was obtained at locality Panevo (6.42%) and the lowest at hunting resort
Bako Gradite (4.07%).
Table 2. The number of ticks collected from the vegetation
Locality
l
273
245
321
I. ricinus
n
152 217
73
145 154
89
169 269
85
715
633
844
D. marginatus
n
0
0
48 27
0
0
55 23
0
0
59 25
75
78
84
D. reticulatus
n

0
0 11
8 19
0
0
0
0
0
0
0
0
0
0
H. punctata
n

11 32 10
13 35 11
15 21
8
53
59
44
H. concinna
Total
n

0
0
2
1
3
865
0
0
1
0
1
771
0
0
2
0
2
974
Ada
0
4.32
Apatin
0
3.85
Ba
0
4.86
Baka
256 189 198
96
739
0
0
72 26
98
0
0
0
0
0
0 12 34
9
55
0
1
0
0
1
893
4.46
Palanka
Bako
259 175 178
59
671
0
0
56 35
91
0
0
0
0
0
0 12 29
8
49
0
0
3
1
4
815
4.07
Gradite
Bako
Petrovo
358 211 159
63
791
0
0
65 24
89
0
0 12
9 21
0 11 26
7
44
0
0
1
0
1
946
4.72
selo
Beej
211 148 265
84
708
0
0
69 29
98
0
0 18
7 25
0 12 32
9
53
0
2
1
0
3
887
4.43
Futog
345 201 245 102
893
0
0
78 38 116
0
0 12
5 17
0 11 31
8
50
0
0
5
1
6 1082
5.40
Kanjia
326
36 240
68
670
0
0
71 21
92
0
0 21 11 32
0 18 30 12
60
0
0
0
0
0
854
4.26
Mol
211 184 211
75
681
0
0
84 33 117
0
0 13
5 18
0 13 25
2
40
0
1
2
1
4
860
4.29
Nadalj
198 196 256
79
729
0
0
92 22 114
0
0 10
6 16
0 19 27 24
70
0
0
1
0
1
930
4.64
Senta
371 258 242
96
967
0
0
69 28
97
0
0
0
0
0
0 19 24 21
64
0
0
0
0
0 1128
5.63
Srbobran
386 234 214
96
930
0
0
67 31
98
0
0 14
5 19
0 18 29
8
55
0
2
3
2
7 1109
5.54
Titel
345 265 198
93
901
0
0
99 34 133
0
0
5
3
8
0 21 34
9
64
0
0
4
2
6 1112
5.55
Turija
245 233 206
85
769
0
0
48 39
87
0
0
6
1
7
0 19 36 15
70
0
0
5
2
7
940
4.69
Ruma
425 245 254
86 1010
0
0
87 29 116
0
0
2
0
2
0 15 29 16
60
0
1
1
0
2 1190
5.94
oka
398 257 214
82
951
0
0
84 26 110
0
0
8
1
9
0 21 24 28
73
0
2
5
2
9 1152
5.75
Novi Beej 387 311 236
76 1010
0
0
76 34 110
0
0 14
8 22
0 20 21 22
63
0
1
7
4 12 1217
6.07
Panevo
569 254 197
58 1078
0
0
88 26 114
0
0 19
7 26
0 11 30 21
62
0
0
5
2
7 1287
6.42
Novi
387 224 226
99
936
0
0
59 25
84
0
0
0
0
0
0
0
0
0
0
0
2
1
0
3 1023
5.11
Kneevac
Total
6516 4087 4379 1644 16626
0
0 1426 575 2001
0
0 165 76 241
0 291 549 248 1088
0 12 49 18 79 20035 100.00
%
32.52 20.40 21.86 8.21 82.98 0.00 0.00 7.12 2.87 9.99 0.00 0.00 0.82 0.38 1.20 0.00 1.45 2.74 1.24 5.43 0.00 0.06 0.24 0.09 0.39 100.00
Obtained data had normal distribution, and ANOVA did not emphasize any statistical significances
regarding the different localities as independent variables on the number of collected ticks as a
dependent variable (pl=0.99999 for p0.05). However, ANOVA proved high statistical significance
between the total number of collected ticks and their species and life stages (psp=0.00000 and
pst=0.00475 for p<0.01) (Graph 1. and 2.). The Fisher's LSD test demonstrated high statistical
differences (for p<0.01) between the number of collected I. ricinus and all other species and D.
marginatus comparing to D. reticulatus and H. concinna. Furthermore, the number of sampled
males had high statistical differences (for p<0.01) comparing to collected larvae and females.
Ticks collected from the hosts
The total number 7267 specimens of ticks were sampled from the roe deer (64 carcasses) and wild
boars (29 carcasses) (Table 3.). Eight tick species from four genera were identified: I. ricinus
(69.00%), D. marginatus (13.76%), D. reticulates (4.06%), H. punctata (2.11%), H. concinna
(1.22%), as well as Haemaphysalis sulcata Canestrini & Fanzago 1878 (2.53%), Rhipicephalus
sanguineus Latreille 1806 (6.47%) and R. bursa Canestrini & Fanzago 1878 (0.85%). The most
abundant were the females of I. ricinus (49.33%). The larval stages of all identified species, as well
223
as the nymphs of D. marginatus, D. reticulatus, H. punctata, H. sulcata and R. bursa have not been
found on the hosts. The highest number of sampled ticks was at hunting resort Novi Kneevac
(6.12%) and the lowest at locality Mol (3.59%).
Table 3. The number of ticks collected from the hosts

Locality
I. ricinus
l
D. marginatus
D. reticulatus
H. punctata
H. concinna
H. sulcata
R. sanguineus
R. bursa
Total
Ada
22
125
58
205
24
18
42
11
11
277
3.81
Apatin
24
129
54
207
28
16
44
10
20
287
3.95
Ba
Baka
Palanka
Bako
Gradite
Bako
Petrovo
selo
19
256
62
337
35
24
59
15
11
23
434
5.97
25
247
51
323
36
21
57
11
16
21
421
5.79
23
211
25
259
29
18
47
19
24
11
19
349
4.80
35
241
32
308
41
31
72
10
13
16
26
429
5.90
Beej
26
158
57
241
27
15
42
10
18
10
12
11
28
345
4.75
Futog
58
132
48
238
39
15
54
19
23
11
25
347
4.78
Kanjia
24
154
34
212
34
14
48
24
18
42
10
15
332
4.57
Mol
26
126
25
177
29
13
42
13
15
261
3.59
Nadalj
35
191
11
237
31
36
14
22
11
307
4.22
Senta
45
174
24
243
40
18
58
15
20
13
17
353
4.86
Srbobran
47
152
37
236
25
13
38
15
11
17
11
33
343
4.72
Titel
39
147
36
222
29
34
10
18
15
10
32
309
4.25
Turija
50
205
41
296
36
17
53
11
15
11
16
22
405
5.57
Ruma
25
185
21
231
41
16
57
16
14
22
12
16
22
14
15
38
406
5.59
oka
26
164
26
216
48
54
17
26
24
33
15
29
359
4.94
Novi Beej
38
184
34
256
50
25
75
12
16
21
11
32
10
11
29
10
427
5.88
Panevo
Novi
Kneevac
34
182
45
261
23
11
34
13
17
26
15
19
18
37
18
35
10
431
5.93
31
222
56
309
36
18
54
14
22
11
17
21
13
445
6.12
777 5014
0 681 319 1000
0 199
96 295
0 100
53 153
10
57
22
89
0 124
89 470
39
23
62
Total
%
0 652 3585
60 184
0 202 179
7267 100.00
0.00 8.97 49.33 10.69 69.00 0.00 0.00 9.37 4.39 13.76 0.00 0.00 2.74 1.32 4.06 0.00 0.00 1.38 0.73 2.11 0.00 0.14 0.78 0.30 1.22 0.00 0.00 1.71 0.83 2.53 0.00 2.78 2.46 1.22 6.47 0.00 0.00 0.54 0.32 0.85 100.00
Tested values had normal distribution, and there were no significant differences among collected
ticks concerning different localities (pl=1.00000 for p<0.05). Nevertheless, ANOVA emphasized
high statistical associations between the number of collected ticks and species and life stages
(psp=0.00000 and pst=0.00000 for p<0.01) (Graph 3. and 4.). The Fisher's LSD test proved high
statistical differences (for p<0.01) between the number of collected I. ricinus ticks and all other
species, as well as D. marginatus with H. concinna and R. bursa. The statistical significances (for
p<0.05) were obtained for comparing the numbers of D. marginatus with D. reticulatus, H.
punctata and H. sulcata. No statistical significances were found in the number of D. marginatus and
R. sanguineus. Moreover, the high statistical differences (for p<0.01) were found in the number of
sampled larvae comparing to females and males, and females compared to nymphs and males.
224
90
45
80
40
70
35
60
30
50
Number of ticks
Number of ticks
40
30
20
25
20
15
10
10
5
0
0
-10
I. ricinus
D. reticulatus
H. concinna
R. sanguineus
D. marginatus
H. punctata
H. sulcata
R. bursa
Mean
Mean0.95 Conf. Interval
-5
Larvae
Species
Mean
Graph 3. The number of different ticks species

collected from the hosts
Mean0.95 Conf. Interval
Nymphs
Females
Males
Stage
Graph 4. The number of different ticks stages

collected from the hosts
Discussion & Conclusion

The obtained differences in relative abundance of identified tick species collected from the
vegetation and from the hosts were the direct results of applied sampling methods, as the various
tick species demonstrate a different host seeking strategies. According to Crooks & Randolph
(2006) ixodid ticks could achieve contact with a host by active hunting (Hyalomma, Amblyomma),
by waiting in nests or lairs (I. hexagonus), or by ambushing a passing animal from a vantage point
on the vegetation cover (I. ricinus). Furthermore, they emphasize that active host questing
behaviour increase desiccation, so these ticks have to return periodically to the moist litter layer in
order to reabsorb needed water to maintain a certain level of humidity. Three species were collected
only from the hosts: H. sulcata (females and males), R. sanguineus (nymphs, females and males)
and R. bursa (females and males). R. sanguineus demonstrates an active host seeking behavior,
although it could also find an appropriate host by ambush strategy questing behaviour (DantasTorres, 2010).
The most abundant species collected by both methods at each prospected locality was I. ricinus.
The same results were published by Barandika et al. (2008) and by Mihalca et al. (2012). According
to these authors, I. ricinus is the predominant tick species in Europe found by both methods,
flagging the vegetation or on the hosts. The determining factors for its abundance are microclimate
characteristics and host densities. Barandika et al. (2008) proved that although the flagging method
is suitable for sampling several tick species like I. ricinus and other exophilic ticks, the efficiency of
this technique varies substantially with different tick species and life stages. Higher adult tick
species diversity found on the studied hosts could be explained by the fact that the immature tick
stages are capable of feeding on almost any vertebrate, but adults require the blood meals of more
than 1 ml, especially from the animals that could provide it better, such as ungulates (Donz et al.,
2004).
The adults of D. marginatus and D. reticulates were collected from the vegetation and from the
hosts. D. marginatus follows the distribution pattern of I. ricinus in Vojvodina as the second most
abundant tick species. Its presence is registered at all prospected localities, as well as in deciduous
forests, pastures, meadows, all kinds of shrub vegetation along the river banks, even in the urban
areas (Jurii et al., 2010). D. reticulatus, on the other hand, is sporadically found on the vegetation,
but more often on the hosts. This species has been registered on the vegetation cover at 14
localities. The results of this study demonstrate that the habitats of this species are restricted to river
basins, wet/flooded forests, grassland and meadows, rich in bush and shrub vegetation, which is
confirmed by similar conclusions of Mihalca et al. (2012).
225
The nymphs and adults of H. punctata were obtained from the vegetation, but only adults were
found on the host. This species is confirmed at 19 localities as a host-seeking tick, and only at 7 as
parasiting on the hosts. More frequent, but less abundant was H. concinna, which nymphal stages
and adults were found both on the vegetation and the hosts. H. concinna was identified at all
prospected localities when sampled the vegetation and at 14 localities when sampled from the hosts.
These two species have preferences to open, warm and mild humid areas, with overlapping niches
with I. ricinus, and according to Nosek (1971, loc. cit. Mihalca et al. 2012), these species prefer
pastures, forest margins and forest-steppes. H. sulcata was the most abundant species of
Haemaphysalis genus, found as adults only on the hosts. Its presence is confirmed at 9 localities.
Similarly to findings of Mihalca et al. (2012), this species prefers warm and humid areas in
Vojvodina.
The species of genus Rhipicephalus were found only on the hosts. The nymphs and adults of R.
sanguineus were obtained from all studied localities. However, only adults of R. bursa were
collected at 13 localities. Although R. sanguineus is an endophilic, monotropic and three-host tick
species, it is also able to survive and maintain its population in the outdoor environments (DantasTorres, 2010) and therefore parasite on cattle or wild ungulates (Estrada-Pea et al., 2004). R.
bursa, on the other hand is a typical representative of tick fauna commonly found on ungulates,
with preferences to areas well covered with bush and steppe vegetation (Fuente et al., 2004).
Statistical differences obtained from studying the appearance of species on the vegetation and on
the hosts are mainly caused by ticks preferences to suitable habitats and hosts, their adaptability and
different host seeking strategies. Furthermore, the absence of D. marginatus and D. reticulatus
larval stages on the vegetation cover could be explained by their induced endophilic behaviour, as
they are found in the vicinity or in the lairs of rodent and insectivore species. In addition, the larval
stages of all collected tick species from the hosts are absent too, as they parasite only on rodents and
other small mammals, reptiles and birds, although Vor et al. (2010) have reported their presence on
the heads of the roe deer in Germany.
The most abundant tick stages obtained from the vegetation were larvae and females. Statistical
significance calculated for the male could be explained by their low abundance and specific sex
ratio characteristics typical for the ambush host-seeking behaviour confirmed by Hornok (2009).
However, statistical differences obtained for females comparing to nymphs and males from the
hosts proves the fact that females are obligated to take the blood meal in order to oviposit.
The presence and abundance of certain tick species at studied localities have not emphasized any
statistical significance in both types of sampling. The total number of collected ticks was evenly
distributed. The number of ticks collected from the vegetation varied from 4.07% at Bako Gradite
to 6.42% at Panevo and from the hosts from 3.59% at Mol to 6.12% at Novi Kneevac.
In order to obtain the most accurate data on tick species diversity and density in practice, to avoid
the bias and to obtain the actual tick population densities and their spatial dispersion it is necessary
to use different methods of tick sampling and to include a wider range of tick hosts such as other
ungulate species, carnivores, rodents, reptiles, birds, bats. Due to consistent population densities,
wide home ranges and seasonal migrations, most of the vertebrate species found at hunting resorts
are responsible for the maintenance of the high tick density populations in certain habitats and
therefore seasonal, spatial, transstadial and transovarial transmission of pathogens important for
human and animal health.
Acknowledgments
The presented work is part of the research done in the project TR31084 granted by the Serbian
Ministry of Education and Science and project No: 114-451-1293/2014-03 granted by the
Provincial secretary for science and technological development of AP Vojvodina
226
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Antoni D., Beukovi M.: Lovaka organizacija Vojvodine: 1922-2007. Monografija Lovakog Saveza
Vojvodine, Novi Sad, 2007
Barandika J.F., Hurtado A., Garca-Sanmartin J., Juste R.A., Anda P., Garca-Prez A.L.: Prevalence of
Tick-Borne Zoonotic Bacteria in Questing Adult Ticks from Northern Spain. Vector-Borne and
Zoonotic Diseases, 8, 6, 829-835, 2008
Carpi G., Cagnacci F., Neteler M., Rizzoli A.: Tick infestation on roe deer in relation to geographic and
remotely sensed climatic variables in a tick-borne encephalitis endemic area. Epidemiol. Infect., 136,
14161424, 2008
Crooks E., Randolph S.E.: Walking by Ixodes ricinus ticks: intrinsic factors determine the attraction of
moisture or host odour. The Journal of Experimental Biology, 209, 2138-2142, 2006
Dantas-Torres F.: Biology and ecology of the brown dog tick, Rhipicephalus sanguineus. Parasites &
Vectors, 3, 26, 1-11, 2010
Donz G., Mcmahon C., Guerin M.: Rumen metabolites serve ticks to exploit large mammals. The
Journal of Experimental Biology, 207, 4283-4289, 2004
Estrada-Pea A., Bouattour A., Camicas J., Walker A.: Ticks of domestic animals in the Mediterranean
Region. A guide to identification of species. University of Zagaroza, Spain., 2004
Evans G.: Principles of Acarology. Cambridge Univesity press, Cambridge, 1992
Fuente de la J., Naranjo V., Ruiz-Fons F., Vicente J., Estrada-Pea A., Almazn C., Kocan K.M.,
Martin P.M., Gortzar C.: Prevalence of tick-borne pathogens in ixodid ticks (Acari: Ixodidae) collected
from European wild boar (Sus scrofa) and Iberian red deer (Cervus elaphus hispanicus) in central Spain.
Eur J Wildl Res, 50, 187-196, 2004
Hornok S.: Allochronic seasonal peak activities of Dermacentor and Haemaphysalis spp. under
continental climate in Hungary. Veterinary Parasitology, 163, 366-369, 2009
Jurii A:, Petrovi A., Rajkovi D., Niin S.: The application of lambda-cyhalothrin in tick control. Exp
Appl Acarol, 52, 201-109, 2010
Jurii A., Petrovi A., Rajkovi D., Beukovi M.: Attachment site and abundance estimation of ixodid
ticks (Acari: Ixodidae) on male roe deer (Capreolus capreolus Linnaeus 1758). Proceedings of 22nd
International symposium Food safety production,June19-25,Trebinje, Bosnia and Herzegovina, 2011,
146-148
Jurii A., Petrovi A., Rajkovi D., Beukovi M.: Monitoring of tick species (Acari: Ixodidae) in
Vojvodina hunting resorts. Proceedings of International symposium on hunting Modern aspects of
sustainable management of game population,June22-24, Zemun-Belgrade, Serbia, 2012, 122-125
Kiffner C., Ldige C., Alings M., Vor T., Rhe F.: Abundance estimation of Ixodes ticks (Acari:
Ixodidae) on roe deer (Capreolus capreolus). Exp. Appl. Acarol, 52, 7384, 2010
Maupin G.O., Fish D., Zoltowsky J., Campos E.G., Piesman J.: Landscape ecology of Lyme disease in a
residential area of Westchestcr County. Am. J. Epiderniol, 133, 1105-1113, 1991
Michalik J., Staczak J., Cieniuch S., Racewicz M., Sikora B., Dabert M. (2009): Surveillance of wild
boar (Sus scrofa) and feeding Ixodes ricinus ticks for Anaplasma phagocytophilum and Borrelia
burgdorferi s.l. using molecular methods. Book of Apstracts, 10th International Jena Symposium on
Tick-borne Diseases (IJSTD),March 19-21, Weimar, Germany, 2009, 178
Mihalca A.D., Gherman C.M., Magda C., Dumitrache M.O., Gyrke A., Sndor A.D., Doma C.,
Oltean M., Mircean V., Mrcuan D.I., D'Amico G., Pduraru A.O., Cozma V.: Ixodes ricinus is the
dominant questing tick in forest habitats in Romania: the results from a countrywide dragging
campaign. Exp Appl Acarol, 58, 175-182, 2012
Nosek J., Sixl W.: Central European Ticks (Ixodoidea) Key for determination. In collaboration with
Kvicala P. & Waltinger H. Mitt. Abt. Zool. Landesmus. Joanneum Jg. 1H2S, Graz, 1972
Pintur K., Beck R., Babi I., Popovi N., Florijani T., Krapinec K., Bokovi I.: Krpeljivost srnee
divljai na podruju Gorskog Kotora. Book of Abstracts, 47th Croatian and 7th International
Symposium on Agriculture, February 13-17, Opatija, Croatia, 2012, 619623
227

20. Ruiz-Fons F., Fernndez-de-Mera I.G., Acevedo P., Hfle U., Vicente J., Fuente de la J., Gortazr C.:
Ixodid ticks parasitizing Iberian red deer (Cervus elaphus hispanicus) and European wild boar (Sus
scrofa) from Spain: Geographical and temporal distribution. Veterinary Parasitology, 140, 1/2,133142,
2006
21. Sonenshine D.E.: Biology of ticks. Vol. 1., Oxford University Press, Oxford, 1991
22. Sonenshine D.E.: Biology of Ticks. Vol. II. Oxford University Press, Oxford, 1993
23. Vor T., Kiffner C., Hagedorn P.,Niedrig M., Rhe F.: Tick burden on European roe deer (Capreolus
capreolus). Exp. Appl. Acarol, 51, 405417, 2010
24. Walker A.R., Bouattour A., Camicas J.L. Estrada-Pea A., Horak I.G., Latif A.A., Pegram R.G., Preston
P.M.: Ticks of Domestic Animals in Africa: A Guide to Identification of Species. Bioscience reports,
Edinburgh., 2007
228
CROSS-REACTIONS IN SEROLOGICAL DIAGNOSIS OF FLAVIVIRUS INFECTIONS

Ivana Hrnjakovic Cvjetkovic1a.1b*, Dusan Petric2, Tamas Petrovic3, Gordana Kovacevic1a, Jelena
Radovanov1a, Aleksandra Jovanovic Galovic1a, Dejan Cvjetkovic4, Sandra Stefan Mikic4,
Aleksandra Patic1a.1b, Natasa Nikolic1a.1b, Vesna Milosevic1a.1b
1a Institute of Public Health of Vojvodina, Novi Sad, Serbia
1b Faculty of Medicine, University of Novi Sad, Novi Sad, Serbia
2. Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia
4. Clinic for Infectious Diseases, Clinical Centre of Vojvodina, Faculty of Medicine, University of Novi Sad, Novi Sad,
Serbia
Abstract
The most important flaviviruses are mosquito-borne viruses responsible for severe encephalitis in
humans: Japan encephalitis virus (JEV), Saint Louis encephalitis virus, West Nile virus (WNV) and
Dengue viruses (DV-1 through 4). The most important mammalian tick-borne flavivirus is tickborne encephalitis virus (TBEV). Nowadays, in early illness phase, diagnosis is based on detection
of viral RNA by PCR/real time PCR. In the late phase of infection serologic diagnosis is a method
of choice to establish the diagnosis of flavivirus infection. Significant problems in serological
diagnosis are cross-reactions between members of Flavivirus genus due to antigenic similarity. The
aim of the study was to demonstrate the extent to which the use of multiple serological testing is
able to contribute solving the cross-reaction issues between some members of genus Flavivirus.
Eighteen ELISA IgG-positive sera on WNV were tested on Dengue virus by ELISA as well as on 8
flaviviruses (TBEV, WNV, JEV, YFV, DV 1-4) by indirect immunofluorescent test (IIFT)
Flavivirus Profile 2 (Euroimmun, Germany).
All of 18 ELISA IgG- positive sera on WNV were simultaneously ELISA IgG- positive on Dengue
virus. Considering the fact that WNV circulates in Serbia among mosquitoes, birds, horses and
humans unlike Denga virus, it was assumed that there were cross-reactions and sera from 18
patients were tested on eight flaviviruses by IIFT. In 12 sera specific IgG antibodies to WNV were
confirmed by determination of antibody titres. Among those 12 sera, 5 sera were only positive to
WNV by IIFT (but not to other flaviviruses), whereas the testing of the other 7 sera showed the
presence of both the antibodies against WNV and antibodies against Dengue viruses 1-4 (although
the latter in lower titers). Six (33.3%) patients need to be additionally tested for setting the final
diagnose. Cross-reaction issues between WNV and Dengue virus can be solved in some cases by
IIFT.
Keywords: flaviviruses, cross-reaction, serological diagnosis
Introduction
Flavivirus genus consists of more than 70 viruses. More than thirty of them are pathogens
significant for human medicine. Flaviviruses are 40 - 60 nm in diameter and have a single-stranded,
positive-sense RNA of 11 kb. There is glycoprotein E inserted in the viral lipid envelope (Jawetz,
Melnick & Adelberg's, 2013). The antigenic determinants of glicoprotein E are responsible for
production of neutralisation antibodies in the host. On the basis of antigenic characteristics
flaviviruses can be divided into eight antigenic groups. The most important antigenic group is the
complex of Japan encephalitis (JE) whose members are mosquito - borne viruses that can cause
229
severe cases of encephalitis in humans: Japan encephalitis virus (JEV), Saint Louis encephalitis
virus (SLEV), West Nile virus (WNV), Murray Valley virus and the complex of Denga viruses
whose members are DV-1 through 4.
Four denga viruses are widely distributed in the tropics (between 35 north and 35 south latitude)
where principal vector Aedes aegypti is present. WNV is the only mosquito borne flavivirus which
activity in humans and animals is detected in Serbia (Petrovi et al., 2014; Petric et al ., 2012). The
vast majority of WNV infections in humans are asymptomatic. Approximately 20% of infected
humans suffer from WNV fever and less than 1% develops neuroinvasive disease resulting in
encephalitis and meningitis. Myocarditis, pancreatitis and fulminant hepatitis have been described
in some symptomatic persons infected with WNV (Petersen and Marfin, 2002). Human clinical
cases associated with WNV infections have been reported from many countries in Africa, southern
Europe, south-western and south-central Asia and Australia (Hublek and Holouzka, 1999). Cases
of yellow fever virus (YFV) infection have been recorded in subtropical areas of Africa and South
America (Jerant Pati, 2007). Since 2000, circulation of YFV has been increased significantly in
Africa. Epidemics of YFW infection occurred in unimmunized population of Africa in 20th century;
morbidity rate was very high, ranging from 51 - 89% (WER, 2005). The most remarkable clinical
feature is haemorrhagic syndrome. Neurological disorders, meningitis, kidney and liver failure may
also occur.
Among mammalian tick-borne flaviviruses, the most important is tick-borne encephalitis virus
(TBEV). TBEV infections are endemic in large parts of Europe (Southern Germany, Austria,
Switzerland, Czech Republic, Slovakia, Hungary, Slovenia, Baltic countries, Poland, parts of
Scandinavia, European Russia (Heinz et al., 2013). Neighbouring countries like Bosnia, Croatia,
Bulgaria, and Romania are at high risk due to high prevalence of the virus in ticks (WHO, 2011.).
Japanese encephalitis is zoonosis widely distributed in Asia caused by Japanese encephalitis virus
(JEV). Most JEV infections are asymptomatic, but in some cases the virus can cause systemic
febrile illness with the central nervous system involvement and possible fatal outcome.
Surprisingly, Ravanini reported detection of JEV RNA in mosquitoes collected in northern Italy.
Further investigations are needed for confirmation of spreading JEV in Europe (Ravanini et al.,
2012).
Nowadays, in early illness phase, diagnosis is based on detection of viral RNA by PCR or real time
PCR or serologic tests. However, serologic tests appear to be the method of choice for establishing
the diagnosis in the late phase of virus infection. Significant problems in serological diagnosis are
cross reactions between members of Flavivirus genus because of antigenic similarity. Viral isolation
from blood or cerebrospinal fluid is usually unsuccessful even in the early stage of infection
because of low viral loud in humans.
The aim of the study was to examine the value of multiple serological testing in solving the crossreaction issues between flaviviruses.

Eighteen sera ELISA IgG-positive on WNV were tested on Dengue virus by ELISA. The same sera
were tested on 8 flaviviruses (TBEV, WNV, JEV, YFV, DV, 1-4) by indirect immunofluorescent
test (IIFT) Flavivirus Profile 2 (Euroimmun, Germany).
For purpose of WNV IgG antibodies detection, commercially available ELISA was used (produced
by Euroimmun, Lbeck, Germany). Testing, calculation and interpretation of results were
performed strictly on the automatic device Euroimmun Analyzer I-2P following manufacturer
instructions. Results were evaluated semiquantitatively by calculating a ratio of the extinction value
of patient sample over the extinction value of the calibrator 2 which was included into the test.
230
Results were considered as positive if ratio was equal to or greater than 1.1, intermediate if ratio
was between 0.8 and 1.1 and negative if ratio was less than 0.8. All samples were tested in the
Institute of Public Health of Vojvodina and all were positive on WNV IgG antibodies.
Eighteen ELISA WNV IgG-positive sera were tested by commercially available ELISA IgG for
denga (Euroimmun, Germany) and IIFT Flavivirus Mosaic 1 (Euroimmun, Germany) against
TBEV, WNV, JEV, YFV, DV 1-4. For IIFT, serum samples were diluted 1:10 and applied on the
slides coated with TBEV, WNV, JEV, YFV, DV 1-4 antigens. The results were read under a
fluorescent microscope (Olympus BH2), objective 40X.
Results
All of 18 ELISA WNV IgG-positive sera were simultaneously ELISA IgG- positive on Dengue
virus (table 1). Considering the fact that WNV circulates in Serbia among mosquitoes, birds, horses
and humans unlike Dengue virus, it was assumed that there were cross-reactions.
Table 1.Results of ELISA IgG on Denga virus in IgG WNV positive serum samples
Serum
samples
116
159
8
14
91
31
11132
5291
11582
11553
11542
5409
11796
688
626
667
11528
11561
Origin of
samples
ND
ND
MBD
MBD
MBD
MBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
SBD
History of
WNV
infection
recent
past
past
past
past
past
past
past
recent
past
past
past
past
past
past
past
recent
recent
ELISA
WNV
IgG
4,46 IgM +
5,56
2,98
5,73
IgG+
1,96
3,25
2,60
5,13 IgM+
5,97
5,04
3,79
4,60
1,28
5,83
5,85
I1,53 IgM+
4,69 IgM+
ELISA
Denga
IgG
1.28
3.28
1,16
3,43
3,17
2,89
0,88
1.70
2,29
4,52
3,23
4,62
3,18
1,94
2,97
2,16
3,15
3,35
Legend: ND - Nisava district, MBD - Middle Banat District, SBD - South Backa District
Between WNV and Denga virus by ELISA IgG test independent whether it is recent or past WNV
infection. Serum sample No 116, 11582, 11528 and 11561 were positive on WNV IgM antibodies
that indicated recent infections. In the other serum samples past WNV infection were detected.
Cross reactivity of the WNV positive sera observed in ELISA against DV was 100%.
All 18 sera positive against WNV were tested on eight flaviviruses by IIFT. In 6 (33.3%) sera
specific WNV IgG antibodies were confirmed and there were no cross-reactivity with other
flaviviruses. In 12 serum samples cross reactivity was observed (table 2). The highest crossreactivity was observed with DV, in 11/18 (61.11%)
231
Table 2.Cross-reactivity between flaviviruses

lavivirus
Percentage (number of cross reactive

samples/number of total tested)
DV
11/18 (61,11)
YFV
4/18 (22,22)
TBEV
3/18 (16,67)
JEV
1/18 (5,55)
Legend: DV- Denga virus, YFV - Yellow fever virus,
TBEV - tick-borne encephalitis virus, JEV - Japanese encephalitis virus
Cross-reactivity was observed for all denga virus serotypes (table 3). The highest cross-reactivity
(33.33%) was observed with DV4. Among those 12 sera, where cross-reactivity was observed in,
11 sera showed the presence of both the antibodies against WNV and antibodies against Dengue
viruses 1-4 (although the latter in lower titers).
Table 3. Cross-reactivity between denga virus (1-4) by IgG IIFT in serum samples positive on
WNV by ELISA IgG
Flavivirus
Percentage (number of cross reactive

samples/number of total samples tested)
DV1
DV2
DV3
DV4
5/18 (27,77)
5/18 (27,77)
3/18 (16,67)
6/18 (33,33)
Legend: DV1-4 Denga virus, serotype 1-4
Discussion and conclusion

Flaviviruses are important human pathogens distributed worldwide. Laboratory diagnosis of
flavivirus infection can be made by isolation from CSF or blood on cell culture in BSL 4 in
reference laboratories. Neutralisation test, IFT, ELISA as well as PCR test can be applied for
identification of isolates. Molecular techniques are the tests of choice to detect viremia in all
flavivirus infections. Molecular tests are important because of their sensitivity and specificity but in
the late phase of infection they are negative. For this reason, detection of specific antibodies to
flaviviruses in late phases of infection by serologic tests is widely used for routine diagnosis of
flavivirus infection. The serum and/or CSF (in case of neuroinvasive infections) can be tested by
ELISA, IIFT, complement fixation test or hemagglutination inhibition test. ELISA and IIFT are
commercially available. The cross-reactivity within the flavivirus group must be considered in
setting up the diagnosis (Jawetz, Melnick & Adelberg's, 2013). In areas where many ARBO viruses
are present simultaneously, cross-reactivity is important problem in establishing accurate diagnosis.
In this study, cross-reactivity among the Flaviviridae family members was observed using ELISA
and IIFT. The study results reported from Makino indicated that the cross-reactivity among
flaviviruses has been observed quite often (Makino et al., 1994).
In our study, IIFT showed a better discrimination between specific IgG antibodies to DV and
specific IgG antibodies to WNV than did ELISA IgG specific for these viruses. Cross-reactivity
among DV and WNV was 100% by ELISA and 66.6% by IIFT. Such results are in agreement with
the study results provided by Koraka in which DV antigen was responsible for lower rate of crossreactions by IIFT than by ELISA (Koraka et al., 2002).
232
Applying IIFT in our study, WNV, JEV, YFV and TBEV antigens gave lower rate of crossreactions than DV antigens by the same test. DV4 antigen gave the highest rate of cross-reactivity.
Acknowledgments
The presented work is part of the research done in the project TR31084 and TR43007 granted by
the Serbian Ministry of Science and Technological Development and 114-451-2142/2011-01 (20112014) by Provincial Secretariat for Science and Technological Development.
References
1.
Heinz F., Stiasny K., Holzmann H., Grgic-Vitek M., Kriz B., Essl A., and Kundi M.: Vaccination and
tick-borne encephalitis, Central Europe. Emerg Infect Dis,19,1,69-76,2013.
2. Hublek Z., Holouzka J.: West Nile fever a re-emerging mosquito-borne viral disease in Europe.
Emerg Infect Dis , 5, 5, 643-650, 1999
3. Jawetz, Melnick & Adelberg's.: Medical Microbiology.26th Edition. New York, McGraw Hill Lange,
2013
4. Jerant Pati V. Medicinska virusologija..Novi Sad, Ortomedics, 2007.
5. Koraka P., Zeller H., Niedrig M., Osterhaus A., Groen J. Reactivity of serum samples from patients with
a flavivirus infection measured by immunofluorescence assay and ELISA.Microbes and Infection,
4,1209-1215,2002
6. Makino Y., Tadano M., Saito M., Maneekarn N. , Sittisombut N.,Sirisanthana V., et al. Studies on
serological cross-reaction in sequential flavivirus ections, Microbiol. Immunol, 38, 951955, 1994.
7. Petersen LR., Marfin AA. West Nile virus: A primer for clinician. Ann Inter Med, 137, 3, 173 179,
2002
8. Petric D., Hrnjakovic Cvjetkovic I., Radovanov J., Cvjetkovic D., Jerant Patic V., Milosevic V., et
all.West Nile virus surveillance in humans and mosquitoes and detection of cell fusing agent virus in
Vojvodina province (Serbia). HealthMed 6, 2, 462-468, 2012;
9. Petrovi T., Lupulovi D., Petri D., Vasi A., Hrnjakovi Cvjetkovi I., Miloevi V. i ost. Groznica
zapadnog Nila - znaajna vektorska virusna infekcija u Srbiji:aktuelna situacija. Veterinarski glasnik,
69,1-2, 2015 (prihvaeno za tampu)
10. Ravanini P., Huhtamo E., Ilaria V., Crobu MG., Nicosia AM., Servino L., et all. Japanese encephalitis
virus RNA detected in Culex pipiens mosquitoes in Italy. Euro Surveill,17,28,2012,:pii=20221
Available on line: http://www.eurosurveillance.org/ViewArticle.
11. WHO.Vaccines against tick-borne encephalitis:WHO position paper.Wkly WHOEpidemiol Rec, 86, 24,
241-56, 2011.
12. WER...The yellow fever situation in Africa and South America in 2004. Weekly epidemiological
record. 80, 29, 249-256, 2005 Available on line:http://www.who.int/wer
233
VECTOR BORNE INFECTION (EHRLICHIA CANIS) CLINICAL CASE

Zlatko Dimeski1*, Biljana Petrovska1, Zivko Gacovski1, Goce Cilev1,
Elena Buntevska2, Bojan Stamadziovski2
1
Univesity St. Kliment Ohridski - Faculty of Veterinary Medicine, 7000 Bitola, R. Macedonia
2
Pet Land Veterinary Hospital, 7500 Prilep, R. Macedonia
*Corresponding author/ e-mail: [email protected]
Abstract
Vector borne infection with Ehrlichia canis is a systemic disorder that manifests with fever,
bleeding tendencies, with thrombocytopenia and platelet dysfunction and non-regenerative anaemia.
The disease is transmitted through the saliva of brown tick, Rhipicephalus sanguineus, which is
widespread in the world. The etiologic agent of canine monocytic ehrlichiosis (CME) is rickettsia
Ehrlichia canis (E. canis). It is a small gram negative coccoide bacteria that parasitizes in
circulating monocytes as a group of organisms called morulae. The clinical manifestation of the
disease is known as ehrlichiosis in dogs (CME). This disease is known in the world, also under the
following names dogs rickettsioses, canine hemorrhagic fever, canine typhoid, tropical
pancytopenia.
Diagnostic and treatment of canine ehrlichiosis is described in a male dog, of Labrador breed, about
2.5 years old. Clinical symptoms in this dog were depression, reduced limb function after long
inactivity, disbalance in the movement of the rear limbs, nervous symptoms, loss of weight.
After performing the complete blood count, blood examination showed reduced number of
granulocytes (41.7 - %), increased number of lymphocytes (49.6 + %) and monocytosis (8.7 + %).
Diagnosis was not based on blood tests, rapid tests were also done for diagnostics of giardiasis,
distemper, parvovirosis, leishmaniasis and ehrlichiosis, after which it was concluded that the dog
had a positive finding only for ehrlichiosis.
Keywords: Ehrlichia canis, Labrador, Vector borne infection, Ehrlichiosis
Introduction
In our case, it is the treatment of Ehrlichiosis, male breed dog Labrador, about 2.5 years old, with
signs of depression, reduced limb function in long inactivity, imbalance in the movement of the rear
limbs, nervous signs, reduced body weight.
Ehrlichiosis in dogs is usually caused by Ehrlichia canis, E. chaffeensis, E. ewingii, and possibly E.
ruminantium. There are several types of Ehrlichia, which affect various species of animals. Some
affect humans. Some organisms that were formerly classified as Ehrlichia now reclassified as
Anaplasma. Ehrlichia organisms are called rickettsia that the evolutionary scale between bacteria
and viruses (Tuna and Ulutas, 2009). Canine ehrlichiosis is a disease of dogs and wild canids (e.g.,
wolves) and located around the world. Canine ehrlichiosis is also known by other names such as
"tracker dog disease", "tropical canine pancytopenia, ''canine hemorrhagic fever, 'and' dog typhoid."
Ehrlichia are transmitted by ticks including Brown dog tick, Rhipicephalus sanguineus. When the
mature form of a tick feeds on another animal, Ehrlichia are transmitted to the animal.
Ehrlichiosis can have three stages. Signs of the acute phase of the disease usually develop 1-3
weeks after being bitten by triggers. The acute phase of the illness usually lasts 2-4 weeks. Platelets
small cell fragments that help blood clotting, often destroyed. As a result of infection, lymph nodes,
liver and spleen are often enlarged. Anemia, fever, depression, lethargy, loss of appetite, shortness
234
of breath, joint pain and stiffness and bruising are common symptoms. Many dogs will be able to
fight off the infection. If not, enter the subclinical stage.
In subclinical stage of the animal may appear normal or mild anemia. At this stage of Ehrlichia is
inside the spleen. This stage can last for months or years. The dog will either eliminate Ehrlichia
body or infection can progress to chronic phase.
Chronic phase may have moderate or severe symptoms. Weight loss, anemia, neurological signs,
hemorrhage, eye inflammation, edema (fluid accumulation) of the hind limbs, and cant be seen,
and fever. Blood tests show that one or all types of blood cells are reduced. One type cells,
lymphocytes can be increased and abnormal. This can sometimes interfere with some types of
leukemia. If the dog became chronically infected, the disease can be restored, especially during
periods of stress. In some cases, arthritis or kidney disease called "glomerluonephritis" which can
develop (Yci et al., 2010).
Reducing the number of platelets (platelets that assist in blood clotting) is the most common
laboratory finding in all stages of disease. Changes in the level of proteins in blood are different.
The most common protein albumin is reduced, and globulin increased (Bulla et al., 2004).
Since one tick can infect more than one disease (e.g., haemobartonellosis or babesiosis), dogs
infected with more than one of these diseases at a time, which generally causes serious symptoms
(Mylonakis et al., 2010).

The diagnosis is based on results of special blood tests. One is known as ELISA test, and the other
is a quick test, which we did when the dog was brought to the veterinary clinic, he was positive on
E. canis. The antibodies can be detected at an early stage of the disease, because it takes a while for
the body to make. A positive result indicates that the dog is affected by Ehrlichia. In the acute phase
of disease, antibody levels increased significantly. A dog with an active infection showed a
significant increase in antibodies present.
For treatment we used tetracycline or doxycycline, for 3-4 weeks, even though the dog's symptoms
generally improve after several days of therapy. We gave supportive therapy, including intravenous
infusion and vitamins (B complex and C vitamin).

The rapid test that we did was positive (Figure 1) and in addition we show the results of blood
(Table 1)
Table 1. Blood results-clinical case-patient dog ID 3197 (date of analysis 18.02.2015)
Parameter
Leucocites
Eritrocites
Hemoglobine
Hematokrit
MCV
MCH
MCHC
PLT
Result
9
11.3x10 /L
5.30x109/L
11.9
36.7
69.2
22.5
32.4
220
235
Reference
4-9x10^9/L
4.2-5.5x10^12/L
14-18g/dl
37.0-54.0%
76.0-96.0um^3
27.0-32.0pg
30.0-35.0x10^6/L
140-340x10^6/L
Blood results were small increase in leucocytes, while the remaining parameters were within the
normal reference values.
Figure1. Rapid test
Conclusion
Ehrlichia canis is the cause of classical Ehrlichiosis in dogs. This Ehrlichia targets moncytes and is
transmitted by Rhipicephalus sanguineus, the "brown dog tick." The therapy that was given to the
dog, his general condition improved, neurological symptoms and also improved weight gain.
Diagnosis is usually made on the basis of a combination of clinical signs, hematologic
abnormalities and serologic findings.
References
1. Tuna E. G. and Ulutas B. (2009). Prevalence of Ehrlichia canis infection in trombocytopenic dogs.
Lucrri Stinifice Medicin Veterinar Vol. XLII, 2009, Timisoara.
2. Yci B. Ba. et al. (2010) The spread of canine monocytic ehrlichiosis in Turkey to Central Anadolia.
Israel Journal of Veterinary Medicine Volume 65 (1).
3. Bulla C. et al. (2004). The relationship between the degree of thrombocytopenia and infection with
Ehrlichia canis in an endemic area. Vet. Res. 35 (2004).
4. Mylonakis M., Siarkou V. and Koutinas A. (2010) Myelosupressive caninemonogytic ehrlichiosis
(Ehrlichia canis): An update on the pathogenesis, diagnosis and management. Israel Journal of the
veterinary medicine; Volume 65 (4) 2010.
236
LESHMANIASIS IN 12 YEARS OLD MALE PEKINGESE-CLINICAL CASE

Zlatko Dimeski1*, Biljana Petrovska1, Zivko Gacovski1, Goce Cilev1,
Blagica Trajanoska2, Martin Kamceski2, Bojan Stamadziovski2, Elena Buntevska2
1
Univesity St. Kliment Ohridski - Faculty of Veterinary Medicine, 7000 Bitola, R. Macedonia
2
Pet Land Veterinary Hospital, 7500 Prilep, R. Macedonia
Abstract
Leishmaniasis is a protozoan disease transmitted among domestic and wild animals, as well as
humans. It is widespread in tropical, subtropical regions, but is prevalent in temperate regions.
Leishmaniasis is a transmissible disease caused by protozoa of Leishmania genus, and it is primarly
spread with a bite of female sand fly - Phlebotomine (Phlebotomus). The disease occurs in many
forms of which the most common are two following forms: visceral (caused with Leishmania
donovani) and cutaneus form (caused by Leischmania tropica).
In this report we will present the diagnosis of leishmaniosis and treatment in a dog of Pekingese
breed, male, about twelve years old. The only distinctive symptom in the dog, observed by the
owners and according to the anamnesis - was sharply aging, during a week and was mostly visible
on the head of the dog. There were no characteristic signs as alopecia or skin changes, lethargy and
hyperthermia. Due to the wide spreading of leishmaniasis in our region, a rapid immunological test
for leishmaniosis was conducted and the result was positive finding. Also, laboratory tests were
made such as haematological analysis (WBC 31.27x109/L, Lymph 21.04x109/L, Gran.8.60x109/L,
Lymph 67.3% Mon 5,5%, Gran. 74,9%, RBC 5,04x1012/L, HGB 100g/L, HCT 30,04%, MCV
65,5fL, MCHC 333 g/L, RDW 15,7%, PLT 154x109/L, MPV 8,9 fL, PDW 39,6, PCT 0.079%) and
blood biochemistry test (creatinine 168,6 mol/L, urea 10.8 mmol/L, S 124 U/L, ALT 62 U/L,
ALP 23,55 U/L) in the blood. Despite these trials a fast test for leishmaniasis was further made.
According to the test, the dog was positive to leishmaniasis. We chose therapy with allopurinol
(20mg/kg, P/O in period of 9-12 months), Rubenal 300, Ipaktin phosphate reducer and Milteforan
(2mg/kg body weight, for 28 days).
Keywords: Leishmaniasis, Pekingese dog, haematological and biochemical profile, fast
immunological test, Allopurinol, Milteforan
Introduction
Canine leishmaniasis (CanL), cause Leishmania infantum is the largest global zoonosis potentially
fatal for humans and dogs, which is the main reservoir of infection in humans. CanL is endemic in
more than 70 countries worldwide (Shaw et al., 2009). CanL manifest a wide range of clinical signs
and degrees of severity, and although there is an insufficient number of research contracts for the
management of this disease. CanL is systemic disease that may potentially relate to any organ or
tissue, presents with nonspecific clinical signs.
Some dogs show clinical signs, while others remain asymptomatic carriers and are infectious for
sand fly. Infected animals are usually affected with lymphadenopathy, anemia, desquamated and
ulcerative lesions of the skin and glomerulonephritis with proteinuria (Zatelli et al., 2003). Ocular
lesions as blepharitis, uveitis, corneal edema or chorioretinitis, can also be present. Unspecific
symptoms may occur frequently, making it difficult to diagnose the disease. Renal lesions are most
commonly affected organs present in dogs with leishmaniasis (Baneth et al., 2008). Proliferation of
glomeruli appears, because circulating immune complexes deposited, which leads to proteinuria.
237
These lesions may progress to chronic renal failure or nephritic syndrome. Renal failure is one of
the classic general symptoms that appear in leishmaniasis, but rarely only manifestation of the
disease.

Complete blood count was performed in blood samples in EDTA tubes, using automated blood
analyzer which is calibrated specifically for dog blood. Although we did biochemical profile and a
rapid test for leishmaniasis (rapid test kit), the test results were positive. The test for leishmaniasis
was made for high prevalence of this disease in our region.
Treatment was initiated with Allopurinol. Allopurinol belongs to a class of drugs called xanthine
oxidase inhibitors which prevent the accumulation of uric acid. If uric acid accumulates in the body,
crystals form in the urine which may congregate to produce kidney or bladder stones. It is used in
dogs alone or in combination with pentavalentantimonials, for its limited toxicity, efficiency and
low cost. The most common dosage is 5-20 mg per day, divided into two doses every 12 hours, over
a long period of time. Side effects are very rare. Allopurinol therapy for Pekingese is (25 mg, 8-11
months, of the tablet 100mg) was selected, with a recommendation for controls every 3 months
(http://www.1800petmeds.com/Allopurinol-prod10042.html). Also the patient was given a dietary
supplement to support renal function - Rubenal 300. Rubenal 300 is a new aid to maintaining
normal kidney structure which is important in kidney function and is an issue for dogs and cats with
kidney problems. Rubenal 300 helps by maintaining the normal fibrous architecture of the kidneys
(Dosage: Dog 3 - 6kg 1 x Rubenal tablet twice daily). Epakitine phosphate reducer that helps
kidney function in support of renal function in case of chronic renal failure in dogs 5 g twice daily,
mixed with food for up to 6 months from the beginning. Epakitin should be recommended at the
first signs of hyper-phosphatemia in cases of CanL. For best results, it is suggested to use Epakitin
in combination with a low phosphorous diet. However, Epakitins highly palatable formulation can
be used with their regular food in animals that refuse to change their diet.
Table 1.Acknowledged forms of currently available treatment
The dog was treated with Milteforan analkylphosphochorine, it is currently the standard treatment
of leishmaniasis Dog. The drug was administered orally for 28 days. The drug is in the form of
liquid, administered orally. The most common contraindication is vomiting, which is transient.
238
Also, the drug showed no adverse effects on the liver and kidneys, and it can be attributed to dogs
with renal failure and avoiding danger, if the dogs do not have renal insufficiency treatment. This
drug is an orally bio-available chemical that was originally studied as an antitumor agent.
Subsequent to the serendipitous laboratory finding that Milteforan was active against Leishmania, it
was tested in dogs in vivo and found to be an effective agent at eliminating parasitemia. The
advantage of this drug is that its direct anti-parasitic activity is not dependent on a functional
immune system.

The haematological and biochemical results after the first clinical examination are given in the
Table 2 and 3.
Table 2. Hematological finding in the 12 year old Pekingese, on the day of receiving in the clinic
Parameter
WBC
Lymph.
MCH
Gran.
Lymph.%
Mon. %
Gran. %
WBC
RBC
HGB
HCT
MCV
MCH
MCHC
PLT
MPV
PCT
Result
9
Ref.values
4.1 x10 /L
0.7 x109/L
0.2 x109/L
3.2 x109/L
16.40%
3.80%
69.90%
3.08x109/L
4.1 x109/L
71g/l
15.7%
89.5fL
29.3
358g/L
103x109/L
8.3 fL
0.079%
6.0-17.0
0.8-5.1
0.0-1.8
4.0-12.6
12.0-30.0
2.0-9.0
60.0-93.0
5.50-8.50
6.0-17.0
110-190
39.0-56.0
62.0-72.0
20.0-25.0
300-380
117-460
7.0-12.0
Parameter
Result
Ref.values
Creatinin
ALP
Urea
AST
ALT
315.9mol/L
72.64 U/L
45.0mmol/L
54.1 U/L
35.7 U/L
44-138
<136
3.1-9.2
9-49
8-57
Table 3. Biochemical analysis
From the tables we conclude that the dog was severally affected. The dog had overall leukopenia
with low number of leucocytes, and also got severally anaemia because of eritropenia and
hypohaemoglobulinemia, wich probably results from reduced synthesis of erythropoietin in
damaged kidneys and reduced intake of food. The kidneys are severally affected and they cant
normally clear the creatinine and urea from the body. AST (asparat aminotransferase) showed
increased acctivity, probably because of kidney tissue inflammation. In the specific treatment, we
have included also some maintenance therapy for kidneys (Rubenal 300 and Epakitin).
239
After 28 days of therapy has been shown to improve the general condition of the dog and improved
renal function and liver function. The leukocytes count has normalized, the finding of anemia has
also improved, with normal number of erythrocytes, hemoglobin concentration and hematocrit
value. Platelet count is also near normal value. AST level is normal. Creatinine is in normal values,
wich means that kidneys are working well in respect of clearence. Urea in the serum show normal
levels.
Table 4: Blood results 28 days of therapy with Milteforan and other supportive therapy results
after blood analysis and biochemistry
Parameter
WBC
Lymph.
MCH
Gran.
Lymph.%
Mon. %
Gran. %
RBC
HGB
HCT
MCV
MCH
MCH
PLT
MPV
PCT
Result
9
Reference
8.5 x10 /L
1.1 x109/L
0.9 x109/L
6.3 x109/L
21.10%
4.30%
77.40%
6.06x1012/L
137g/L
41.6%
68.3fL
27.3
315g/L
239x109/L
8.9fL
0.071%
6.0-17.0
0.8-5.1
0.0-1.8
4.0-12.6
12.0-30.0
2.0-9.0
60.0-93.0
5.50-8.50
110-190
39.0-56.0
62.0-72.0
20.0-25.0
117-460
117-460
7.0-12.0
Result
57mol/L
64.52 U/L
8.2mmol/L
30.1 U/L
32.4 U/L
Ref.values
44-138
<136
3.1-9.2
9-49
8-57
Table 5: Biochemical analysis
Parameter
Creatinin
ALP
Urea
AST
ALT
Conclusion
In this case report, we have concluded that: Allopurinol together with Milteforan is acceptable
specific therapy for canine Leishmaniasis. Supportive therapy for kidney is also important,
especially in cases in wich there is kidney damage. Maybe we should also include some other
reasonable drugs (namely to support kidney function) like diuretics (furosemide and
spironolactone), but also synthetic erythropoietin and antimonials.
References
1. Shaw SE, Langton DA, Hillman TJ (2009) Canine leishmaniosis in the United Kingdom: a zoonotic
disease waiting for a vector? Vet Parasitol 2009.
2. Zatelli A, Borgarelli M, Santilli R, Bonfanti U, Nigrisoli E, Zanatta R, Tarducci A, Guarraci A (2003)
Glomerular lesions in dogs infected with Leishmania organisms. Am J Vet Res 2003.
240

3. Baneth G, Koutinas AF, Solano-Gallego L, Bourdeau P, Ferrer L (2008) Canine leishmaniosis-new
concepts and insights on an expanding zoonosis: part I. Trends Parasitol 2008.
4. http://www.1800petmeds.com/Allopurinol-prod10042.html
241
________________________________________________________________________
Session 4
WILDLIFE DISEASES AND PATHOGENS IN ENVIRONMENT

Oral presentations
_______________________________________________________________________
242
Plenary lecture:
INFLUENZA IN BIRDS AND OTHER ANIMALS
Vladimir Savi
Croatian Veterinary Institute, Poultry Centre, Zagreb, Croatia
Abstract
There are three types of influenza viruses: A, B, and C; and the latter two are primarily of a human
health importance. In contrast, influenza A viruses have been isolated from a variety of birds and
mammals, nevertheless the natural hosts of the virus are wild waterfowls, gulls and related birds.
Other species that are infected with influenza A viruses, particularly chickens, turkeys, swine,
horses, and humans, are considered aberrant hosts. Majority of influenza A viruses are fully adapted
to the natural hosts in which they multiply mainly in intestines and the infection causes no
symptoms. Influenza A viruses in their natural hosts are in evolutionary stasis. On the other hand,
the infection in aberrant hosts usually results in rapid evolution due to selection pressure driven by
the virus adaptation to a new host. Such rapid evolution can result in high virulence for the new
host, and sometimes even for other species. Emergence of highly virulent influenza A viruses is of a
particular concern for the poultry industry because such viruses cause up to 100% mortality in
chickens and turkeys. Few influenza viruses are well adapted and established in mammalian hosts,
causing primarily respiratory disease like swine influenza, equine influenza and human influenza.
Swine, as an aberrant host, plays an important role in ecology and epidemiology of influenza A
viruses because this species is prone to infection with viruses originating from wild birds, domestic
poultry and mammalian hosts. Such a universal host can serve as a vessel for mixing of the genetic
material of different viruses which can result in new influenza A viruses with unpredictable
features.
Keywords: Influenza A, virus, birds, mammals
Introduction
Influenza viruses are classified into types A, B and C, according to the antigenic properties of
matrix proteins or nucleoproteins. The majority of human influenza virus epidemics, including all
pandemics, are caused by influenza virus type A, which is also the type associated with influenza of
avian, equine and swine species (Webster et al. 1978.). Influenza B and C viruses are isolated
mainly from humans and are less pathogenic than influenza A viruses (McCauley and Mahy, 1983).
Influenza A viruses can be further divided into sub-types on the basis of the antigenic reactivity of
the surface glycoproteins, the haemagglutinin and neuraminidase molecules. So far there are 16
haemagglutinin (H) and nine neuraminidase (N) subtypes (Fouchier et al., 2005) and each virus
possesses one H and one N subtype, apparently in any of 144 possible combinations from H1N1 to
H16N9. Recently, two influenza-like virus genomes designated H17N10 and H18N11 were
identified in South American bats, but attempts to propagate this virus in cell cultures and chicken
embryos were unsuccessful (Wu et al. 2014).
According to numerous authors, influenza A virus was first isolated from chickens at the beginning
of the 20th century (A/Brescia/1902 [H7N7]). Although there is some dispute on a later year of the
isolation of the virus, another isolate of the same subtype (A/FPV/Dutch/27 [H7N7]) dates back in
1920s (Alexander, 2009). This was followed by isolation of influenza virus from pigs (Shope, 1931)
and humans (Smith et al., 1933) in 1930s and two decades later from horses (Sovinova et al., 1958).
243
Influenza virus isolates from chicken were initially called fowl plague virus because until 1955 it
was not known that they were actually influenza viruses (Schfer, 1955). Subsequent extensive
research revealed more or less barriers to frequent interspecies transmissions of influenza A viruses.
They are influenced by the virus composition and the host specific receptors (Ito eta al., 2000;
Suarez, 2000; Matrosovich et al., 2009). Despite these barriers, influenza A viruses occasionally
transmit from its natural host to other species in which usually cause short-term spread and soon
vanish. In extremely rare cases these viruses adapt to the new host, and such adaptation usually has
far-reaching consequences.
Natural and aberrant hosts of influenza A viruses

Influenza A viruses infect numerous avian and mammalian species, but the natural hosts of the virus
are aquatic birds from orders Anseriformes (ducks, geese and swans) and Charadriiformes (gulls,
shorebirds and terns), particularly ducks. Other species that are infected with influenza A viruses
are considered as aberrant hosts. The most common aberrant hosts are domestic poultry (chicken
and turkey), domestic mammals (pig and horse) and man (Figure 1). The distinction between the
natural and aberrant host is essential for understanding the ecology of these viruses. The vast
majority of influenza A virus is fully adapted to aquatic birds in which infection does not cause
virtually any disease and such viruses in these hosts are in the evolutionary stasis. In contrast, very
intense evolution in aberrant hosts is attributed to selection pressures for adaptation of these viruses
the new host. This adaptation may result in very high virulence for the new host, and sometimes for
other species. It is important to emphasize that influenza viruses multiply in natural hosts, i.e.
aquatic birds primarily in the intestines being excreted via feces. In contrast, influenza viruses in
aberrant hosts usually multiply in the respiratory system (Suarez, 2000; Capua and Alexander,
2007).
Figure 1. The most important hosts and transmission of influenza A viruses. Solid line shows usual
transmission. Dotted line shows transmission which occurs rarely or only presumed transmission.
244
Wild birds as natural hosts of influenza A viruses

While only few H and N subtypes are found in aberrant hosts, all 16 H and 9 N subtypes in the
majority of possible combinations are isolated from waterfowls. Wild ducks are the primary natural
reservoir for influenza A viruses in which most of the H subtypes are found (Capua and Alexander,
2007) while H13 and H16 subtypes are isolated almost exclusively from gulls and related birds
(Kawaoka et al., 1988). Influenza A virus excretion from infected duck lasts for just two to four
weeks, but the virus is excreted in high concentration, even in hundreds of millions of infectious
particles per gram of faeces (Webster et al., 1978). Avian influenza viruses have been isolated from
freshly deposited faecal material and from unconcentrated lake water, thus waterfowl, as gregarious
species, have a very efficient way to transmit viruses; i.e., via fecal material in the water supply
(Webster et al., 1992). The successful spread of the influenza A virus among waterfowl is
contributed by their seasonal migrations when they can transmit viruses over long distances (Gilbert
et al., 2006). Migratory bird flyways can be roughly divided into two groups as a result of
geographic ecozones: flyways of the Eastern Hemisphere (Eurasia, Africa, and Australasia and the
flyways of the Western Hemisphere (Americas). In most cases, there is no or very limited overlap
between these two groups of flyways. Consequently there is no or very limited virus exchange
between waterfowl populations the Eastern and Western Hemisphere. This resulted in separate
influenza A virus evolutions in waterfowl in these two hemispheres. With addition of unique
influenza A viruses from gulls (H13 and H16 subtypes), nucleotide sequence analysis of viruses
from the natural host reservoir shows three distinct categories of avian viruses: North American,
Eurasian and gull lineages (Suarez, 2000). Separate evolution and ecology of avian influenza
viruses in the Eastern and Western Hemisphere is further emphasizes by complete absence of H14
and H15 subtypes in America (Krauss et al., 2007). However, infrequent incursions occur and
mainly incursions of avian influenza viruses of Eurasian lineage into North America are
documented (Pearce et al., 2010) including recent incursions of Asian H5 viruses of high
pathogenicity into Canada and USA. Beside genetic differences (Figure 2) there are also significant
antigenic differences between same H subtypes from different hemispheres.
Influenza A viruses in poultry

Domestic poultry species such as chicken and turkey are susceptible to only a limited range of
circulating influenza virus subtypes (Brown et al., 2006). These two avian species are aberrant hosts
and influenza A viruses in chickens and turkeys are under continuous selection pressure (Suarez,
2000). According to pathogenicity in these two hosts, influenza A viruses can be divided into two
clearly distinct groups. Highly virulent viruses replicates in virtually all organ systems and cause
mortality to 100%. This form of the disease is termed highly pathogenic avian influenza (HPAI).
These viruses are of either H5 or H7 subtype, but not all viruses of these groups cause HPAI.
Another group is comprised of viruses causing mild, primarily respiratory disease, termed low
pathogenic avian influenza (LPAI). It may not be neglected that LPAI viruses, if exacerbated by
other infections or environmental conditions, may cause serious disease. More important is that
LPAI viruses of H5 and H7 subtype are potential precursors for HPAI viruses whereas some of
them need only a slight mutation to turn them into very virulent viruses. These mutations occur
after a number of passages in the chicken or turkey (Capua and Alexander, 2007). HPAI virus of
H5N1 subtype that emerged in mid 1990s in the Far East has undergone additional passages trough
domestic poultry and became pathogenic for ducks which were considered until 2002 to be
unsusceptible to HPAI (Sturm-Ramirez et al., 2004). It became pathogenic even to carnivore
mammals, particularly cats, tigers and leopards, which normally do not contract the disease
(Alexander and Capua, 2008). The virus also caused serious fatally in infected humans (Li et al.,
2008). The situation with the H5N1 HPAI was even more worsening by virus spill-over from
245
domestic poultry into the ecosystem which resulted in migratory waterfowl infection. Seasonal
migration during 2005 and 2006 resulted in spread of the virus from China to the rest of Asia,
Europe and Africa (Salzberg et al., 2007). This virus still circulates among migrating wild birds in
Asia, Europe and Africa. Similar scenario happened with a HPAI virus of H5N8 subtype, which is a
reassortant of H5N1 and therefore also poultry origin influenza virus. The novel reassortant virus
occurred in 2014 among poultry and wild birds in South Korea (Lee et al., 2014) and afterwards in
Japan and China. This H5N8 virus probably spread by wild birds further into Europe and North
America and consequently infected the local poultry. So far there is no evidence of infection of
mammals including humans with this virus.
Figure 2. Phylogenetic tree from the NS gene of different subtypes of influenza A viruses. Thirty-three
isolates from the most important host of influenza A virus with different geographic origin in the period from
1956 to 2011 were compared. Groups of viruses with respect to the host, geographical origin and
evolutionary features are marked on the right side of the image. Viruses from different host within the
respective groups are underlined. The tree was made using Maximum Composite Likelihood and Neighbour
Joining algorithm with 1000 repetitions, and the tree is midpoint rooted.
Swine influenza
Commonly circulating subtypes in pigs are H1N1, H1N2, and H3N2 influenza A viruses which are
adapted to this species. Nevertheless, pigs have receptors for avian and human influenza viruses.
Therefore, if the waterfowl is considered a natural host of influenza A viruses, the pig can be
246
considered as a universal host of this virus (Figure 1). Hence the same subtype of swine influenza
virus can be of a different origin, genetic makeup and antigenic reactivity. Swine influenza virus of
H1N1 subtype which is swine entity and evolutionarily has a common origin with the Spanish flu
virus prevails in the North American pig population. In contrast, avian origin swine adapted H1N1
virus prevails in the pig populations in Europe and Asia which is also referred as avian-like H1N1
(Figure 2). The North American and Eurasian swine H1N1 viruses, although of the same subtype,
can be easily distinguished by serology. Beside these two H1N1 viruses, human H1N1 viruses (both
seasonal and pandemic) can be found in pigs which is usually result of a direct transmission from
humans. Similarly to H1N1 subtype, viruses of H3N2 subtype create a very complex
epizootiological situation in pigs (Figure 2) including human-like and avian-like H3N2
variants. Swine H1N2 viruses are various reassortants from mentioned H1N1 and H3N2 viruses.
Occasionally, true avian and even equine influenza viruses could be found in pigs, but they usually
did not establish in this species and soon disappear from the swine populations (Brown et al., 2000).
Other subtypes, like H2N1, H2N3 and H3N1 were also found in pigs.
Swine influenza is generally mild and short-lasting illness manifested similarly to a mild clinical
picture of human influenza. More important is the role of pig as an intermediate host for avian and
human influenza viruses (Figure 1). Simultaneous infection of pigs with two or more different
influenza viruses may result in reassortment of the gene segments between viruses of different
origin. This can result in a new progeny virus with genetic makeup of both (or all) parental viruses.
The new progeny virus may have possibility to cross host species barrier and even to cause
pandemic (Ito et al., 2000; Matrosovich et al., 2009).
Influenza in horses and other equids

Equine influenza is a common acute respiratory disease of horses, donkeys and mules with
symptoms resembling human influenza. In fully susceptible animals, clinical signs include pyrexia
and a harsh dry cough followed by a mucopurulent nasal discharge (Gerber, 1970). There is also a
report on equine influenza with neurological signs due to viral-type non-suppurative encephalitis
(Daly et al., 2006). As influenza in other species, equine influenza spreads rapidly in a susceptible
population. Vaccination provides protection against clinical disease given that the appropriate
vaccinal strain is used (Daly et al., 2011) yet vaccinated infected horses can still shed the virus.
Before the virologic era, equine epizootics highly suggestive of influenza were documented
repeatedly, beginning in 13th century (Morens and Taubenberger, 2010), but the virus was first
isolated in 1956 (Sovinova et al., 1958) during the epizootic equine influenza of H7N7 subtype,
formerly known as equi-1 or Prague type. This subtype in equine population is now likely
extinct. Another subtype formerly known as equi-2 or Miami type emerged in early 1960s in
equine population in North America (Waddell et al., 1963). This H3N8 subtype still circulates in
equine populations worldwide and it is currently present in Croatia (unpublished). Both subtypes
are at the antigenic and genetic level specific for horses (or equids in general), and differ
significantly from H3N8 and H7N7 viruses isolated from other hosts i.e. birds. In addition to this,
great difference between these two equine influenza subtypes (Figure 2) implicates two long-term
separate evolutions with no reassortment events between these two subtypes as well as with other
influenza A viruses. Therefore, horses were considered as a dead-end host, but infection of dogs in
2004 with influenza A virus of H3N8 subtype genetically closely related to contemporary strains of
equine influenza virus (Crawford et al., 2005) related racing greyhounds with infected horses at
hippodromes in Florida. The virus was later found in nongreyhound dogs indicating horizontal dogto-dog transmission (Payungporn et al., 2008). Similarly to interspecies transmission of equine
influenza virus in Florida, cohabitation of horses and camels in Mongolia resulted in isolation of
equine influenza virus (H3N8) from one healthy Bactrian camel out of 460 tested (Yondon et al.,
2014).
247
Influenza A in other animals

Besides already mentioned mammals, influenza A viruses have been sporadically isolated from
other species such as whales, seals and minks i.e. water related mammals. Isolation of H13 subtype
from stranded whales can be associated with direct transmission of the virus from seagulls, but it is
not known whether the infection stranding was related (Hinshaw et al., 1986). Influenza A viruses
of H7N7 and H4N5 subtypes have been isolated from seals (Geraci et al., 1982) and the virus of
H10N4 from minks (Klingebron et al., 1985) caused severe and fatal disease in the these species.
These viruses were phylogenetically closely related to avian influenza A viruses. Such findings
indicate a relatively frequent transmission of influenza A virus among different species, mostly
from birds to mammals, but such infections are restricted and the virus is not maintained in the new
species for a longer period (Webster et al., 1992). A range of carnivorous mammals that were
infected with the Asian H5N1 HPAI virus was fed by infected poultry or wild birds. Transmission
of the H5N1 virus from mammal to mammal was not yet indisputably documented.
Primates are sensitive to human influenza virus. Like other human respiratory viruses, human
influenza virus has repeatedly caused outbreaks of flu-like disease with high morbidity and even
deaths amongst chimpanzees and gorillas (Ryan et al., 2011). Non human primates that have
contact with humans can be naturally infected with seasonal endemic human influenza viruses and
with emerging pandemic-risk avian influenza viruses (Karlsson et al., 2012). Like humans,
macaques infected with influenza virus exhibit fever, malaise, nasal discharge, and nonproductive
cough (Berendt, 1974). It remains unknown whether non human primates are infected with
influenza viruses in nature (Karlsson et al., 2012).
References
1.
Alexander D.J., Brown I.H.: History of highly pathogenic avian influenza. Revue scientifique et
technique, 28, 1, 19-38, 2009
2. Alexander D.J., Capua I.: Avian influenza in poultry. World's Poultry Science Journal, 64, 4, 513-532,
2008
3. Berendt R.F.: Simian model for the evaluation of immunity to influenza. Infection and Immunity, 9, 1,
101-105, 1974
4. Brown I.H.: The epidemiology and evolution of influenza viruses in pigs. Veterinary Microbiology, 74,
1/2, 29-46, 2000
5. Brown I.H., Banks J., Manvell R.J., Essen S.C., Shell W., Slomka M., Londt B., Alexander D.J.: Recent
epidemiology and ecology of influenza A viruses in avian species in Europe and the Middle East.
Developments in biological, 124, 4550, 2006
6. Capua I., Alexander D.J.: Avian influenza infections in birds a moving target. Influenza and Other
Respiratory Viruses, 2007; 1, 1. 11-18, 2007
7. Crawford, P.C., Dubovi, E.J., Castleman, W.L., Stephenson, I., Gibbs, E.P., Chen, L., Smith, C., Hill,
R.C., Ferro, P., Pompey, J., Bright, R.A., Medina, M.J., Johnson, C.M., Olsen, C.W., Cox, N.J., Klimov,
A.I., Katz, J.M., Donis, R.O.: Transmission of equine influenza virus to dogs. Science, 310, 5747, 482485, 2005
8. Daly J.M., MacRae S., Newton J.R., Wattrang E., Elton D.M.: Equine influenza: a review of an
unpredictable virus. Veterinary Journal, 189, 1, 7-14, 2011
9. Daly J.M., Whitwell K.E., Miller J., Dowd G., Cardwell J.M., Smith K.C.: Investigation of equine
influenza cases exhibiting neurological disease: co-incidence or association? Journal of Comparative
Pathology, 134, 2/3, 231235, 2006
10. Fouchier R.A., Munster V., Wallensten A., Bestebroer T.M., Herfst S., Smith D., Rimmelzwaan G.F.,
Olsen B., Osterhaus A.D.: Characterization of a novel influenza A virus hemagglutinin subtype (H16)
obtained from black-headed gulls. Journal of Virology, 79, 5, 2814-2822, 2005
248

11. Geraci J.R., St Aubin D.J., Barker I.K., Webster R.G., Hinshaw V.S., Bean W.J,. Ruhnke H.L., Prescott
J.H., Early G., Baker A.S., Madoff S., Schooley R.T.: Mass mortality of harbor seals: pneumonia
associated with influenza A virus. Science, 215, 4536, 1129-1131, 1982
12. Gerber H.: Clinical features, sequelae and epidemiology of equine influenza. In: Equine Infectious
Diseases II, eds. Bryans J.T., Gerber H., Basel: S. Karger, 1970, 6380.
13. Gilbert M., Xiao X., Domenech J., Lubroth J., Martin V., Slingenbergh J.: Anatidae migration in the
western Palearctic and spread of highly pathogenic avian influenza H5N1 virus. Emerging Infectious
Diseases, 12, 11, 1650-1656, 2006
14. Hinshaw V.S., Bean W.J., Geraci J., Fiorelli P., Early G., Webster R.G.: Characterization of two
influenza A viruses from a pilot whale. Journal of Virology, 58, 2, 655-656, 1986
15. Ito T., Kawaoka Y.: Host-range barrier of influenza A viruses. Veterinary Microbiology, 74, 1/2, 71-75,
2000
16. Karlsson E.A., Engel G.A., Feeroz M.M., San S., Rompis A., Lee B.P., Shaw E., Oh G., Schillaci M.A.,
Grant R., Heidrich J., Schultz-Cherry S., Jones-Engel L.: Influenza virus infection in nonhuman
primates. Emerging Infectious Diseases, 18, 10, 1672-1675, 2012
17. Kawaoka Y., Chambers T.M., Sladen W.L., Webster R.G.: Is the gene pool of influenza viruses in
shorebirds and gulls different from that in wild ducks? Virology, 63, 1, 247-250, 1988
18. Klingeborn B., Englund L., Rott R., Juntti N., Rockborn G.: An avian influenza A virus killing a
mammalian species-the mink. Archives of Virology, 86, 3/4, 347-351, 1985
19. Krauss S., Obert C.A., Franks J., Walker D., Jones K., Seiler P., Niles L., Pryor S.P., Obenauer J.C.,
Naeve C.W., Widjaja L., Webby R.J., Webster RG.: Influenza in migratory birds and evidence of
limited intercontinental virus exchange. PLoS Pathogens, 3, 11, 1684-1693, 2007
20. Lee Y.J., Kang H.M., Lee E.K., Song B.M., Jeong J.S., Kwon Y.K.: Novel reassortant influenza
A(H5N8) viruses, South Korea, 2014. Emerging Infectious Diseases, 20, 6, 10871089, 2014
21. Li F.C., Choi B.C., Sly T., Pak A.W.: Finding the real case-fatality rate of H5N1 avian influenza.
Journal of Epidemiology & Community Health, 62, 6, 555-559, 2008
22. Matrosovich M., Stech J., Klenk H.D.: Influenza receptors, polymerase and host range. Revue
scientifique et technique, 28, 1, 203-217, 2009
23. McCauley J.W., Mahy B.W.: Structure and function of the influenza virus genome. Biochemical
Journal, 211, 281294, 1983
24. Morens D.M., Taubenberger J.K. Historical thoughts on influenza viral ecosystems, or behold a pale
horse, dead dogs, failing fowl, and sick swine. Influenza and Other Respiratory Viruses, 4, 6, 327-337,
2010
25. Payungporn S., Crawford P.C., Kouo T.S., Chen L.M., Pompey J., Castleman W.L., Dubovi E.J., Katz
J.M., Donis R.O.: Influenza A virus (H3N8) in dogs with respiratory disease, Florida. Emerging
Infectious Diseases, 2008; 14, 6, 902-908, 2008
26. Pearce J.M., Ramey A.M., Ip H.S., Gill R.E. Jr.(2010) Limited evidence of trans-hemispheric
movement of avian influenza viruses among contemporary North American shorebird isolates. Virus
Research, 148, 1/2, 44-50, 2010
27. Ryan S.J., Walsh, P.D.: Consequences of non-intervention for infectious disease in African great apes.
PLoS One, 6, 12, 1-9, 2011
28. Salzberg S.L., Kingsford C., Cattoli G., Spiro D.J., Janies D.A., Aly M.M., Brown I.H., CouacyHymann E., De Mia G.M., Dung do H., Guercio A., Joannis T., Maken Ali A.S., Osmani A., Padalino
I., Saad M.D., Savi V., Sengamalay N.A., Yingst S., Zaborsky J., Zorman-Rojs O., Ghedin E., Capua I.
Genome analysis linking recent European and African influenza (H5N1) viruses. Emerging Infectious
Diseases, 13, 5, 713-718, 2007
29. Schfer W. Vergleichende sero-immunologische Untersuchungen uber die Viren der Influenza und der
klassischen Geflugelpest. Verlag der Zeitschrift fr Naturforschung., 10b, 81-91, 1955
30. Shope R.E.: Swine influenza: III. Filtration experiments and etiology. Journal of Experimental
Medicine, 54, 3, 349-360, 1931
249

31. Smith W., Andrewes C.H., Laidlaw P.P.: A virus obtained from influenza patients. Lancet, 2, 5732, 6668, 1933
32. Sovinova O., Tumova B., Pouska F., Nemec J.: Isolation of a virus causing respiratory disease in horses.
Acta Virologica, 2, 1, 52-61, 1958
33. Sturm-Ramirez K.M., Ellis T., Bousfield B., Bissett L., Dyrting K., Rehg J.E.: Reemerging H5N1
influenza viruses in Hong Kong in 2002 are highly pathogenic to ducks. Journal of Virology, 78, 9,
4892-4901, 2004
34. Suarez D.L.: Evolution of avian influenza viruses. Veterinary Microbiology, 74, 1/2, 15-27, 2000
35. Waddell G.H., Teigland M.B., Sigel M.M.: A new influenza virus associated with equine respiratory
disease. Journal of the American Veterinary Medical Association, 143, 587590, 1963
36. Webster R.G., Bean W.J., Gorman O.T., Chambers T.M., Kawaoka Y.: Evolution and ecology of
influenza A viruses. Microbiological Reviews, 56, 1, 152-179, 1992
37. Webster RG, Yakhno M, Hinshaw VS, Bean WJ, Murti KG. Intestinal influenza: replication and
characterization of influenza viruses in ducks. Virology, 84, 2, 268-78, 1978
38. Wu Y., Wu Y., Tefsen B., Shi Y., Gao G.F. Bat-derived influenza-like viruses H17N10 and H18N11.
Trends in Microbiology, 22, 4, 183-191, 2014.
39. Yondon M., Zayat B., Nelson M.I., Heil G.L., Anderson B.D., Lin X., Halpin R.A., McKenzie P.P.,
White S.K., Wentworth D.E., Gray G.C.: Equine influenza A(H3N8) virus isolated from Bactrian
camel, Mongolia. Emerging Infectious Diseases, 12, 2144-2147, 2014
250
Invited lecture
VIRUS INFECTIONS OF THE HONEYBEE (APIS MELLIFERA L.) IN CENTRAL
EUROPE
Tams Bakonyi1,2*, Petra Forgch1, Ale Gregorc3, Ivana Tlak Gajger4, Lszl Bksi5, Mikls
Rusvai1, Norbert Nowotny2,6
1
Faculty of Veterinary Science, Szent Istvn University, Budapest, Hungary

2
University of Veterinary Medicine, Vienna, Austria
3
Agricultural Institute of Slovenia, Ljubljana, Slovenia
4
Faculty of Veterinary Medicine, University of Zagreb, Zagreb, Croatia
5
Institute of Apiculture and Bee Biology, Research Centre for Farm Animal Gene Conservation, Gdll, Hungary
6
College of Medicine and Health Sciences, Sultan Qaboos University, Muscat, Oman
Abstract
Viral infections of the honeybee (Apis mellifera L.) became into the scope of the veterinary interest
in the last two decades due to their pathogenic role and the increasing importance of the host
species. Since 2004 extensive losses of honeybee colonies have been observed in North America
and Europe, but its aetiology remained unclear. The phenomenon was named to Colony Collapse
Disorder, and viruses were also considered as causative agents. Moreover, winter losses of
honeybees seemed to be increasing everywhere, and resulted in decline of managed honeybee
population. The presence of bee viruses has been reported from several countries worldwide. Many
of them can be detected in apparently health colonies. Subclinical infection, however, might be
activated by predisposing- and weakening factors, which lead to depopulation or sudden collapse of
the colonies. The most important predisposing factor is the parasitic mite Varroa destructor, which
is a vector of several honeybee viruses, and also weakens the pupae and adult bees by its feeding.
The presence of other pathogens, parasites (i.e. Nosema apis), intoxications and environmental
pollution may also act as an activator of viral infections. The conventional diagnostic methods have
limited value in the case of bee virus infections and diseases; therefore, molecular methods,
predominantly reverse-transcription polymerase chain reaction (RT-PCR) assays are used to detect
viral RNA in honeybee samples.
Our research groups are investigating honeybee virus infections in central-European countries since
1997. We have been detecting the presence of Acute bee paralysis virus, Black queen cell virus,
Chronic bee paralysis virus, Deformed wing virus, and Sacbrood virus in Hungary, Austria,
Slovenia and Croatia. The frequencies of the viruses in different countries varied significantly.
Phylogenetic comparisons revealed closer genetic relationships between bee viruses collected in the
Carpathian basin. Although the prevalence of bee viruses in central-European countries was lower
than those reported in Western Europe, a steady increase has been observed in Hungary between
2004 and 2007. Besides increasing bee colony density and problems with varroa-control, the
domestic and international trade of bees and bee products may also contribute to the aggravation of
virus-associated problems in beekeeping in the region.
Key words: honeybee, virus infections, Varroa destructor, RT-PCR
Introduction
Approximately 25,000 species of bees have been identified worldwide. Nevertheless, only ten
species can be regarded as honeybees. Since bees are highly adaptable insects, they are able to
251
adjust to a wide variety of climates and geographic regions. The habitat of the western honeybee or
European honeybee (Apis mellifera L.) ranges from the tip of southern Africa to southern
Scandinavia, and from Americas, through Europe to western Asia (Whitfield et al., 2009).
Beekeeping is deeply rooted in human society. The apiculture provides full or additional family
income with a considerable market for bee products used as food, pharmaceutics and medical
products. Bee products (i.e. honey, wax, propolis, royal jelly and bee venom) have been used since
the prehistoric times for consumption and for therapeutic purposes. In 2012 the total world honey
production exceeded 1,500,000 tonnes (FAO, 2013). The two leading producers of honey are China
and the European Union (Word Trade Daily, 2012). The direct value of the produced honey is about
140 million EUR, but the total added crops due to pollination services has estimated 14,2 billion
EUR in 2005 in the EU (Gallai et al., 2008).
Honeybees are key pollinators native to Europe and have great impact for many agricultural crops
and conservation of natural plant diversity. In light of the decline of wild insect pollinators the
importance of managed beekeeping is greater today than ever. In the last decade extensive losses of
honeybee colonies have been observed in North America and Europe (Communication from the
Commission on honeybee health, 2010), but the aetiology of the losses remain unclear (Le Conte et
al., 2010; Neumann and Carreck, 2010; Moritz et al., 2010). The phenomenon was named to
Colony Collapse Disorder (CCD) with defined signs and was characterized by disappeared
colonies, which were not typically found later in many parts of the world. However, winter losses of
honeybees seemed to be increasing everywhere, and resulted in decline of managed honeybee
population. Honeybee experts in the USA and Europe formed networks to collect more exact data to
identify factors that seem to be not only multifactorial, but interact with individual situations by
countries. The European concerted action was designed in 2008 as a COST action FAO803 by the
name of Prevention of honeybee COlony LOSses (COLOSS).
The Working Group 1 (WG1) of the COLOSS epidemiological unit developed a detailed selfadministrated questionnaire to collect exact data on losses. The first results were published recently
(van der Zee et al., 2012) with the analysed information from 12 countries in 2009 and 24 countries
in 2010. According to the survey the mean losses varied between 7-22 % in 2009 and 7-30 % in
2010 winter. An important finding was that for all countries which participated in 2009, winter
losses were found to be substantially higher in 2010. Beekeepers in the majority of the countries
who reported disappeared colonies experienced higher winter losses compared with beekeepers that
experienced winter losses but not reported disappeared colonies. The same was noticed in the USA
where survey responders had lost an average 38.4 % of their colonies in 2011 (van Engelsdorp et
al., 2012). Studies focusing on infectious agents in the background of CDD identified viruses,
microsporidia and parasites as most important factors.
Although more than 20 different viruses were detected from bees, only a few of them are
considered to be able to cause severe diseases in honeybees, and hence are relevant in beekeeping.
The most important beeviruses in Europe are Acute bee paralysis virus (ABPV), Black queen cell
virus (BQCV), Chronic bee paralysis virus (CBPV), Deformed wing virus (DWV), Israeli acute
paralysis virus (IAPV), Kashmir bee virus (KBV), and Sacbrood virus (SBV).
ABPV is commonly present in apparently healthy bees; however, this virus may play a role in cases
of sudden collapse of honeybee colonies infested with the parasitic mite Varroa destructor. Due to
the world-wide spread of the varroa mite in the last decades, also ABPV gained more and more
importance (Ball, 1997). On one hand, the mite is a possible vector for the virus; on the other hand
it weakens the bees and activates viral infections (Nordstom et al., 1999).
BQCV causes frequent subclinical infections in adult bees; however it affects clinically prepupae or
pupae of the queen especially in spring and early summer (Laidlaw, 1979). Infected queen pupae
252
die and darken, and the cell walls get black. Nosema apis infestation is a suspected predisposing
factor for disease manifestation (Allen and Ball, 1996).
Two manifestations of CBPV infection have been noted: I. the bees are unable to fly, they are
trembling and crawling and the wings are asymmetric outspread. They often suffer from dysentery
and die within a few days; II. the bees look black because of hair loss. The guard bees do not
recognize them and dismiss them because of their altered look. Although in some cases up to 30%
of worker bees are affected, CBPV infection remains sometimes undetected, and the colonies
usually recover spontaneously from the disease (Bailey, 1967).
DWV is mostly detected in varroa-infected bees (Bowen-Walker et al., 1999). The virus propagates
slowly, and pupae infected at the white-eyed stage of development may have malformed wings and
shortened life span. Adult bees carry the virus without apparent signs.
IAPV was discovered in Israel, but its presence was also demonstrated in other countries. Because
IAPV infections were diagnosed more frequently in CCD-affected honeybee colonies, compared to
healthy colonies in the USA, the role of this virus was hypothesized in the background of CCD
(Cox-Foster et al., 2007; Chen et al., 2014). IAPV is genetically closely related to ABPV and KBV.
KBV is closely related to ABPV and IAPV, however it has been rarely reported in Europe so far
(Allen and Ball, 1996; Siede and Buchler, 2004.). It affects brood and adult bees. Adult bees usually
die within a few days after infection, but larvae may survive following ingestion of the virus, and
some of them become inapparently infected adults.
SBV affects primarily the brood of the honeybee and results in larval death (Ritter, 1996). Infected
larvae fail to pupate and the ecdysial fluid aggregates around the integument, forming the "sac" for
which the disease is named. Larvae change in colour from pearly white to pale yellow and after
death they dry out and change to a dark brown ship-shaped scab. Infection of adult bees is possible,
the viruses are able to propagate in them, but the bees remain apparently healthy. Sacbrood appears
mainly in spring, when the brood-season begins and large numbers of infected young adults are
present (Ritter, 1996).
The virological diagnostic methods have limited value in the case of bee viruses. Because bees are
colonial animals, investigations of individuals are usually less informative. Possibilities for
observation of clinical signs are often complicated, and signs of different virus infections may be
similar. Due to the size of bees, gross pathology is rarely informative. Histopathology is
complicated by the presence of chitin, causing poor penetration of tissue fixation substances, and
causing problems with sectioning of embedded tissues. Identification of beeviruses on
morphological basis, using electron microscopy is on one hand expensive and time-consuming, on
the other hand poorly selective, because of similarities in size and virion morphology. Virus
isolation based on serial passages of viruses in cell cultures is not applicable due to the lack of beespecific and beevirus-susceptible cell cultures. The only possibility for beevirus isolation is
experimental infection of larvae, pupae or newly emerged bees. This technique is, however,
laborious and time consuming. Additionally, the availability of brood is seasonal, and because
viruses frequently cause inapparent infections in honeybee colonies, finding virus-free brood for
experimental virus isolation is rarely possible. Serological methods using virus-specific antibodies,
raised in experimental mammals have been developed in specific laboratories. Viral antigens were
detected and characterized with these methods using agar-gel immunodiffusion (AGID) or enzymelinked immunosorbent assay (ELISA) platforms (Bailey, 1967; Bksi et al., 1999). However, the
availability of such sera is limited, and their specificity due to virus mixtures used for
immunization might be impaired. Because the immune system of invertebrates is mainly based on
non-specific, innate immunity; classical serological methods are not applicable for indirect virusdiagnostic approaches, due to the lack of adaptive immunity, specific anti-viral antibodies and
immune memory in bees (Azzami et al., 2012). The advances of developments of molecular
diagnostic techniques had a revolutionary effect on honeybee virology diagnostics. As more and
253
more beeviruses were genetically characterized, specific, sensitive and rapid diagnostic assays were
developed on the basis of the polymerase chain reaction (PCR) technology. These techniques are
widely used in the last decade for the diagnosis, surveillance and molecular epizootiology of virus
infections in honeybees. In this paper, our studies on certain honeybee viruses in Europe are
summarized.

Sample collection
The collection methodology was depending on the aim of the investigations. In the case of diseased
colonies (i.e. winter losses, colony collapses), usually dead bees were collected in the hives or from
their surroundings. Sometimes bees with neurological signs (altered behaviour, crawling, inability
of flying), deformed wings, changed colour, or altered brood were collected. For the surveillance
studies usually healthy bees were collected from the hives, and if it was available 10 10 cm
covered brood was also collected. Bee samples usually contained at least 50 individuals from each
colony. Samples were stored and transported at 4C, however, sometimes -20C storage was applied
for longer periods (few weeks) at the beekeepers.
Sample processing
Bees were observed at the laboratory, and if they were infested with V. destructor, mites were
collected from the samples. Approximately 25 to 50 bees were pooled from the same colonies and
were crashed in ceramic mortars using sterile quartz sand, and were homogenised in 10 volume
phosphate buffered saline (PBS). After centrifugation (~1,500 g, 10 minutes) viral RNA were
extracted from the supernatants using the QIAamp viral RNA Mini Kit (Qiagen, Hilden, Germany)
according to the manufacturer's instructions. Viral RNA was reverse-transcribed and amplified in
continuous reverse transcription PCR (RT-PCR) method by using the One Step RT-PCR kit
(Qiagen, Hilden, Germany) following the manufacturer's recommendations. Virus-specific primers
are listed in Table 1.
The reverse transcription at 50C for 30 min was followed by a denaturation and polymerase
activation step at 95C for 15 min and by 40 cycles of PCR with 30 s at 94C, 50 s at 55C, and 1
min at 72C. Reactions were completed by a final elongation step for 7 min at 72C. The PCR
products were electrophoresed in a 1.2% TAE-agarose gel, stained with ethidium bromide, and
were photographed under UV light. Fragment sizes were determined with reference to molecular
size markers.
Genetic comparisons
Selected amplification products were subjected to fluorescence-based direct sequencing (Sangers
method) in both directions. Nucleotide sequences were identified by the Basic Local Alignment
Search Tool (BLAST, 2), and aligned using the Align Plus program (Scientific and Educational
Software, version 4.1).
Multiple alignments for phylogenetic analyses were created with the help of the ClustalX program
(Thompson et al., 1997). Phylogenetic analyses were conducted by the PAUP*4.0 beta 10 version
(Swofford, 2002), PHYLIP package 3.6 beta version (Felsenstein, 2004), and Mega 5 (Tamura et
al., 2011) software using maximum parsimony, distance (neighbor-joining) and maximum
likelihood criteria. Bootstrap analyses were performed on 1000 replicates. Trees were drawn with
the help of the TreeView 1.6.6. software.
254
Table 1: Oligonucleotide primer pairs used in RT-PCR assays.

Primer name
ABPV 23fa
ABPV 24ra
BQCV 3fb
BQCV 4rb
CBPV 111fc
CBPV 426rc
DWV 2345fd
DWV 2779rd
IAPV 3042fe
IAPV 3799re
KBV 5406ff
KBV 5800rf
SBV 1fg
SBV 2rg
Primer sequence (5to 3)
Primer position
on the genome
GTGCTATCTTGGAATACTAC
AAGGYTTAGGTTCTACTACT
AGTAGTTGCGATGTACTTCC
CTTAGTCTTACTCGCCACTT
TGTCGAACTGAGGATCTTAC
GACCTGATTAACGACGTTAG
ATTGTGCCAGATTGGACTAC
AGATGCAATGGAGGATACAG
ATTGAGAGTTGCCAAGGAGT
GTCTGTGCTTCGATCACAAT
GATGAACGTCGACCTATTGA
TGTGGGTTGGCTATGAGTCA
ACCAACCGATTCCTCAGTAG
CCTTGGAACTCTGCTGTGTA
7928-7947
8527-8546
252-277
710-729
111-130
407-426
2345-2364
2760-2997
3042-3061
3780-3799
5406-5425
5781-5800
221-240
689-708
Length of the
amplified
product (bp)
618
472
315
434
758
395
487
Nucleotide positions refer to the published sequences of aABPV (GenBank accession number AF150629), bBQCV
(accession number AF125252), cCBPV (accession number AF375659), dDWV (accession number AJ489744), eIAPV
(accession number EF219380), fKBV (accession number AY275710) and gSBV (accession number AF092924). f:
forward primer; r: reverse primer
Results
Occurrence of honeybee viruses in Central European countries
Between 1999 and 2010 we have been investigating the occurrence of the most important honeybee
viruses in four central European countries: Austria, Hungary, Slovenia and Croatia (Bernyi et al.,
2006, Forgch et al., 2008, Gregorc and Bakonyi, 2012, Tlak Gajer et al, 2014). Four honeybee
viruses, ABPV, BQCV, DWV and SBV were detected in all four countries. The occurrence of
CBPV was tested and detected in Austria, Hungary and Croatia. The presence of KBV and IAPV
were tested in Austria, Hungary and Croatia, but were not found in any of the investigated samples.
The detection frequencies are summarised in Table 2.
Table 2: Occurrence of honeybee viruses in four central European countries
Country
n*
year
ABPV
2003Austria
131
68%
2004
199952
37%
Hungary
2004
72
2007
71%
81
2006
12%
Slovenia**
72
2008
10%
Croatia
82
2010
11%
*n= number of samples; NT= not tested
**Newly mated queens were investigated
BQCV
CBPV
DWV
IAPV
KBV
SBV
30%
9%
91%
0%
0%
49%
54%
0%
72%
NT
0%
2%
40%
0%
24%
29%
6%
NT
NT
10%
49%
7%
58%
95%
0%
NT
NT
0%
0%
NT
NT
0%
61%
1%
11%
40%
255
Genetic relationships between central European honeybee viruses

Our phylogenetic studies with ABPVs from Austria, Hungary and Poland revealed that the central
European viruses are genetically distinct from ABPVs detected in the USA, in the United Kingdom
and in South Africa. Hungarian ABPVs formed a monophyletic group, closely related to Polish
ABPVs, while Austrian and further Polish viruses clustered together (Bakonyi et al., 2002). In the
case of BQCV, the South African reference sequence was genetically distant from the central
European viruses. Hungarian Austrian and Polish viruses formed common groups, while some
BQCVs from Poland formed a separate group. Some Polish BQCVs, however clustered differently
depending on the investigated genome region. This finding indicates genetic recombination between
the viruses (Tapaszti et al., 2009). Phylogenetic analysis of CBPVs revealed that Austrian,
Hungarian and Polish viruses formed a common genetic lineage with German, Swiss, and French
viruses, but were distinct from other three genetic lineages containing CBPVs from France, Spain,
Belgium and Uruguay (Blanchard et al., 2009). The genetic relationships between DWVs collected
in Austria, Canada, Germany, Hungary, Japan (Kakugo virus), Nepal, New Zealand, Poland,
Slovenia, Sri Lanka, and the United Arab Emirates were investigated. Despite the great diversity of
collection origin, the sequences has shown high level of genetic conservation, therefore
phylogenetic analysis could not reveal statistically supported clustering of the sequences. The
DWVs, however were genetically distinct from Varroa destructor virus 1 (Bernyi et al., 2007). The
phylogenetic relationship of one Austrian SBV was investigated. It was found closely related to
SBVs from Germany, but more distantly related to SBVs from the United Kingdom, India, Nepal
and South Africa (Grabensteiner et al., 2001).
Discussion
Our studies described the presence of five different honeybee viruses (Acute bee paralysis virus
ABPV, Black queen cell virus BQCV, Chronic bee paralysis virus CBPV, Deformed wing virus
DWV, and Sacbrood virus SBV) in four central European countries (Bernyi et al., 2006,
Forgch et al., 2008, Gregorc and Bakonyi, 2012, Tlak Gajer et al, 2014). Simultaneous infections
with different virus species in colony level have been frequently diagnosed. The investigations
revealed that the infection rate of the Hungarian honeybee colonies have been increasing within the
last years (Tapaszti et al., 2010). Usually, honeybee virus infections are not apparent as they remain
in a latent state within individuals and spread among bee populations at a low level. This means that
clinical signs appear only when virus replication is initiated and infection becomes systemic. When
cells of honeybees are infected with virus particles, they cannot work efficiently; this inevitably
causes vital organs to dysfunction (Bksi et al., 1999). This can lead to outbreaks of disease and
induce significant losses. Infestation with the parasitic mite Varroa destructor is a major
predisposing factor which has a weakening effect on the honeybee (Yang and Cox Foster, 2005)
and viruses may directly spread through the lesions induced by the mite (Ball, 1989). Also, it has
been experimentally proven that these mites carry ABPV (Bksi et al., 1999), DWV (Tentcheva et
al., 2004) as well as KBV (Chen et al., 2004). Other predisposing factors include, for example
nosema infestation, intoxications, environmental pollution, cold weather, dysentery, overcrowding
and further infectious agents such as bacteria, fungi, and parasites. With the spread of Varroa
destructor almost worldwide, attention has been focused on viruses of bees because of the role of
the mite in transmission of a number of these infections and their connection with colony mortality
(Ball and Allen, 1988). This has led to use of the term bee parasitic mite syndrome (Hung et al.,
1996). Therefore, the control of honeybee virus infections must be based on optimal keeping and
breeding conditions (avoiding the above-mentioned predisposing factors) with a particular attention
to varroa-control. Additionally, the possibility for specific treatment or prevention for certain
honeybee virus infections (IAPV and DWV) were reported by using RNA silencing technologies
256
(Maori et al., 2009; Desai et al., 2012; Chen et al., 2014). Because the dominance of innate
immunity and lack of immune memory in bees, active immunisations (vaccinations) are not
applicable for the prevention of bee colonies from virus infection or from the development of virusassociated disease manifestations. The results of our studies indicate that movement and
importation of non-apparent infected stocks of bees may introduce viruses into areas where they are
not endemic. It is therefore important to identify bee virus infections and take this aspect into
consideration in domestic and international transport and trade of honeybees and bee products.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Allen M., Ball B.V.: The incidence and world distribution of honey bee viruses. Bee World, 77, 141162, 1996
Azzami K., Ritter W., Tautz J., Beier H.: Infection of honey bees with acute bee paralysis virus does not
trigger humoral or cellular immune responses. Arch Virol., 157, 4, 689-702, 2012
Bailey L.: The incidence of virus diseases in the honey bee. Ann. Appl. Biol., 60, 43-48, 1967
Bakonyi T., Farkas R., Szendroi A., Dobos-Kovacs M., Rusvai M.: Detection of acute bee paralysis
virus by RT-PCR in honey bee and Varroa destructor field samples: screening of representative
Hungarian apiaries. Apidologie, 33, 63-74, 2002
Ball B.V., Allen M.F.: The prevalence of pathogens in honey bee (Apis mellifera) colonies infested with
the parasitic mite Varroa jacobsoni. Ann. Appl. Biol, 113, 237-244, 1988
Ball B.V.: Varroa and viruses. In: P. Varroa! Fight the mite, ed. Munn and R. Jones, Cardiff:
International Bee Research Association, 1997. 11-15.
Ball B.V.: Varroa jacobsoni as a virus vector. In: Proceedings of a Meeting of the EC- Experts Group,
Udine, ed. R. Cavallaro, vol. EUR 11932 EN, Commission of the European Communities, Brussels,
Belgium. 1989, 241-244.
Bksi L., Ball B., Dobos-Kovcs M., Bakonyi T., Rusvai M.: Occurrence of acute paralysis virus of the
honeybee (Apis mellifera) in a Hungarian apiary infested with the parasitic mite Varroa jacobsoni. Acta
Vet. Hung., 47, 319-324, 1999
Bernyi O., Bakonyi T., Derakhshifar I., Kglberger H., Nowotny N.: Occurrence of six honeybee
viruses in diseased Austrian apiaries. Appl Environ Microbiol,. 72, 4, 2414-2420, 2006
Bernyi O., Bakonyi T., Derakhshifar I., Kglberger H., Topolska G., Ritter W., Pechhacker H.,
Nowotny N.: Phylogenetic analysis of deformed wing virus genotypes from diverse geographic origins
indicates recent global distribution of the virus. Appl. Environ. Microbiol. 73, 11, 3605-3611, 2007
Blanchard P., Schurr F., Olivier V., Celle O., Antnez K., Bakonyi T., Berthoud H., Haubruge E., Higes
M., Kasprzak S., Koeglberger H., Kryger P., Thiry R., Ribire M.: Phylogenetic analysis of the RNAdependent RNA polymerase (RdRp) and a predicted structural protein (pSP) of the Chronic bee
paralysis virus (CBPV) isolated from various geographic regions. Virus Res., 144, 1-2, 334-338, 2009
Bowen-Walker P.L., Martin S.J., Gunn A.: The transmission of deformed wing virus between
honeybees (Apis mellifera L.) by the ectoparasitic mite Varroa jacobsoni Oud.. J. Invert. Pathol., 73,
101-106, 1999
Chen Y.P., Pettis J.S., Corona M., Chen W.P., Li C.J., Spivak M., Visscher P.K., DeGrandi-Hoffman
G., Boncristiani H., Zhao Y., van Engelsdorp D., Delaplane K., Solter L., Drummond F., Kramer M.,
Lipkin W.I., Palacios G., Hamilton M.C., Smith B., Huang S.K., Zheng H.Q., Li J.L., Zhang X., Zhou
A.F., Wu L.Y., Zhou J.Z., Lee M.L., Teixeira E.W., Li Z.G., Evans J.D.: Israeli acute paralysis virus:
epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, 7, :e1004261,
2014
Chen Y.P., Pettis J.S., Evans J.D., Kramer M., Feldlaufer M.F.: Molecular evidence for transmission of
Kashmir bee virus in honey bee colonies by ectoparasitic mite, Varroa destructor. Apidologie, 35, 441448, 2004
Communication
from
the
Commission
on
honeybee
health,
(2010):
http://ec.europa.eu/food/animal/liveanimals/bees/docs/honeybee_health_communication_en.pdf
257

16. Cox-Foster D.L., Conlan S., Holmes E.C., Palacios G., Evans J.D., Moran N.A., Quan P.L., Briese T.,
Hornig M., Geiser D.M., Martinson V., van Engelsdorp D., Kalkstein A.L., Drysdale A., Hui J., Zhai J.,
Cui L., Hutchison S.K., Simons J.F., Egholm M., Pettis J.S., Lipkin W.I.: A metagenomic survey of
microbes in honey bee colony collapse disorder. Science, 318, 5848, 283-287, 2007
17. Desai S.D., Eu Y.J., Whyard S., Currie R.W.: Reduction in deformed wing virus infection in larval and
adult honey bees (Apis mellifera L.) by double-stranded RNA ingestion. Insect Mol Biol. 21, 4, 446455, 2012
18. FAO 2013: http://faostat.fao.org/site/569/DesktopDefault.aspx?PageID=569#ancor
19. Felsenstein J.: PHYLIP Phylogeny Inference Package, Version 3.6b. Department of Genome Sciences
University of Washington Box 357730 Seattle, WA 98195-7730 USA, 2004
20. Forgch P., Bakonyi T., Tapaszti Z., Nowotny N., Rusvai M.: Prevalence of pathogenic bee viruses in
Hungarian apiaries: situation before joining the European Union. J Invertebr Pathol., 98, 2, 235-238,
2008
21. Gallai N., Salles J.-M., Settele J., Vaissire B.E.: Economic valuation of the vulnerability of world
agriculture confronted with pollinator decline. Ecological Economics, 68, 810-821. 2009.
22. Grabensteiner E., Ritter W., Carter M.J., Davison S., Pechhacker H., Kolodziejek J., Boecking O.,
Derakshifar I., Moosbeckhofer R., Licek E., Nowotny N.: Sacbrood virus of the honeybee (Apis
mellifera): rapid identification and phylogenetic analysis using reverse transcription-PCR. Clin. Diagn.
Lab. Immunol., 8, 93-104, 2001
23. Gregorc A., Bakonyi T.: Viral infections in queen bees (Apis mellifera carnica) from rearing apiaries.
Acta Vet. Brno, 81, 15-19, 2012
24. Hung A.C.F., Shimanuki H., Knox D.A.: The role of viruses in bee parasitic mite syndrome, Am. Bee.
J., 136, 731-732, 1996
25. Laidlaw H.H.: Contemporary Queen Rearing. Hamilton, Illinois, Dadant and Sons, 1979
26. Le Conte Y., Ellis M., Ritter W.: Varroa mites and honey bee health: can Varroa explane part of the
colony losses? Apidology, 41, 353-363, 2010.
27. Maori E., Paldi N., Shafir S., Kalev H., Tsur E., Glick E., Sela I.: IAPV, a bee-affecting virus associated
with Colony Collapse Disorder can be silenced by dsRNA ingestion. Insect Mol Biol., 18, 1, 55-60,
2009
28. Moritz R.F.A., de Miranda J., Fries I., Le Conte Y., Neumann P., Paxton R.J.: Research strategies to
improve honeybee health in Europe. Apidologie, 41, 227-242, 2010.
29. Neumann P., Carreck N.L.: Honey bee colony losses, J. Apic. Res., 49, 1-6, 2010.
30. Nordstom S., Fries I., Aarhus A., Hansen H., Korpela S.: Virus infection in Nordic honey bee colonies
with no, low or severe Varroa jacobsoni infestations. Apidologie, 30, 475-484, 1999
31. Ritter W.: Diagnostik und Bekmpfung von Bienenkrankheiten, Stuttgart, Gustav Fischer Verlag Jena,
1996, 104-114.
32. Siede R., Buchler R.: First detection of Kashmir bee virus in Hesse, Germany. Berl. Munch. Tierarztl.
Wochenschr., 117, 12-15, 2004
33. Swofford D.L.: PAUP*, Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4.
Sunderland, Massachusetts, Sinauer Associates, 2002
34. Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S.: MEGA5: Molecular evolutionary
genetics analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony
methods. Mol. Biol. Evol., 28, 2731-2739, 2011
35. Tapaszti Z., Forgch P., Bakonyi T., Rusvai M.: A mzel mh (Apis mellifera L.) vrusos fertzseinek
elfordulsa magyarorszgi mhszetekben. Magyar llatorvosok Lapja, 132, 119-125, 2010
36. Tapaszti Z., Forgch P., Kovg C., Topolska G., Nowotny N., Rusvai M., Bakonyi T.: Genetic analysis
and phylogenetic comparison of Black queen cell virus genotypes. Vet Microbiol., 139, 3-4, 227-234,
2009
37. Tentcheva D., Gauthier L., Zappulla N., Dainat B., Cousserans F., Colin M.E., Bergoin M.: Prevalence
and seasonal variations of six bee viruses in Apis mellifera L. and Varroa destructor mite populations in
France, Appl. Envir. Microbiol., 70, 7185-7191, 2004
258

38. Thompson J.D., Gibson T.J., Plewniak F., Jeanmougin F., Higgins D.G.: The CLUSTAL_X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic
Acids Res., 25, 4876-4882, 1997
39. Tlak Gajger I., Kolodziejek J., Bakonyi T., Nowotny N.: Prevalence and distribution patterns of seven
different honeybee viruses in diseased colonies: a case study from Croatia. Apidologie, 45, 6, 701-706,
2014
40. van der Zee R., Pisa L., Andonov, S. Brodschneider R, Charrire J-D., Chlebo R., Coffey M.F.,
Crailsheim K., Dahle B., Gajda A., Gray A., Drazic M.M., Higes M., Kauko L., Kence A., Kence M.,
Kezic N., Kiprijanovska H., Kralj J., Kristiansen P., Martin Hernandez R, Mutinelli F., Nguyen B.K.,
Otten C., zk r m A., F Pernal S.F., Peterson M., Ramsay G., Santrac V., Soroker V., Topolska G.,
Uzunov A., Vejsns F., Wei S., Selwyn Wilkins S.: Managed honey bee colony losses in Canada, China,
Europe, Israel and Turkey, for the winters of 2008-9 and 2009-10. J. Apic. Res.,. 51, 1, 100-114, 2012.
41. van Engelsdorp D., Caron D., Hayes J., Underwood R., Henson M., Rennich K., Spleen A., Andree M.,
Snyder R., Lee K., Roccasecca K., Wilson M., Wilkes J., Lengerich E., Pettis J., the Bee Informed
Partnership: A national survey of managed honey bee 2010-11 winter losses in the USA: results from
the Bee Informed Partnership. J. Apic. Res, 51, 1, 115-124, 2012.
42. Whitfield C.W., Behura S.K., Berlocher S.H., Clark A.G., Johnston J.S., Sheppard W.S., Smith D.R.,
Suarez A.V., Weaver D., Tsutsui N.D.: Thrice out of Africa: ancient and recent expansions of the honey
bee, Apis mellifera, Science, 314, 5799, 642-645, 2006
43. Word Trade Daily, 2012: http://worldtradedaily.com/2012/07/28/honey-world-production-topexporters-top-importers-and-untied-states-imports-by-country/).
44. Yang X., Cox-Foster D.L.: Impact of an ecto parasite on the immunity and pathology of an invertebrate:
evidence for host immunesuppression and viral amplification. Proc. Nat. Acad. Sci. USA, 102, 74707475, 2005
259
Invited lecture
THE MOST COMMON HEALTH DISTURBANCES DETECTED IN WILD BOARS IN
ENCLOSED HUNTING GROUNDS IN VOJVODINA PROVINCE
Jasna Prodanov-Radulovi1*, Radoslav Doen1, Igor Stojanov1, Tama Petrovi1
1 Scientific veterinary Institute Novi Sad, Novi Sad, Serbia
Abstract
The control of health status of wild boar population is quite demanding and it is not easy to achieve.
Also, often is not possible entirely to perform a complete diagnostic examination in wild boars in
each evaluated case. The aim of this research was to evaluate the most common health disturbances
detected in wild boars in enclosed hunting grounds in Vojvodina Province. The material for this
research included enclosed hunting grounds, where clinical signs of health disorders and dead of
different categories of wild boars were recorded. The following research methods were applied:
epidemiological investigation, clinical examination of live and gross pathological examination of
dead and/or shot diseased wild boars. The clinical examination was performed from the safe
distance at the feeding place. In the laboratory, the applied research methods included:
bacteriological testing, virusological testing (ELISA test, HI test and RT-PCR) and parasitological
examination. On the basis of the achieved results it may be concluded that wild boars could be
source of different endoparasites species. By gross pathological examination it was discovered that
in the largest number of animals the health problems were mainly connected to the parasitic
infestations and bacterial infections of digestive and respiratory organs.
Keywords: wild boars, enclosed hunting grounds, Vojvodina Province
Introduction
Wild boar (Sus scrofa scrofa) numbers have dramatically increased over the past 60 years and the
species also shows a more widespread distribution (Artois et al., 2001; Sedlak et al., 2008; Wu et
al., 2011), which not only means a larger number of hosts available for the transmission of disease,
but also a higher contact rate between hosts (Ruiz-Fons et al., 2008). The population of wild boar in
15 member states of European Union (EU) has been roughly estimated between 800,000 and 1
milion heads, but its density varies from country to country (Laddomada, 2000). Increasing food
availability and climatic change provide optimal conditions for a rapid wild boar multiplication and
expansion (Wu et al., 2011). According to available data of the Veterinary directorate of the
Ministry of Agriculture and Environmental protection, in the Republic of Serbia, the population of
wild boars was aproximatelly estimated on 30.000,00 heads and the density of the wild boar
population ranges from a minimum of 0.2/km2 to over 20/km2. In Serbia, there are about 300
hunting grounds with wild boars. Hunting grounds are managed by two public enterprises, also two
hunting association, four National parks in wich hunting is allowed and 5 hunting grounds are
managed by Ministry of Defence. In Vojvodina Province, there is one public enterprise
Vojvodinaume with 17 hunting grounds, one National park Fruka gora, one private hunting
ground and 86 hunting associations.
Wild boar pathogens are highly relevant not only for the livestock industry but also for wildlife
conservation and for the hunting industry (Doen et al., 2013; Laaksonene and Paulsen, 2015;
Prodanov-Radulovi et al., 2014a). Knowledge of diseases circulating in wildlife populations can be
260
important not only for conservation and livestock production but also for public health (Boadella et
al., 2012; Meng et al., 2009). Because several million wild boars are harvested and consumed yearly
in Europe, wild boar meat and derivates are a likely source of human infections (Boadella et al.,
2012).
Wildlife is a reservoir for several economically important diseases and epizootiologic surveys are
needed, especially in large wild boar populations (Garcia-Gonzlez et al., 2013). Many diseases
may cause external symptoms and abnormal behaviour in game animals. They can also diminish the
value of the end products obtained from game. In the most of the cases, the assessment of game
animal health is based on medical history of the game and, after shoting, observations made of the
carcass and viscera (Laaaksonen and Paulsen, 2015; Prodanov et al., 2009a; Prodanov-Radulovi et
al., 2013a). Migrating and roaming animals can carry pathogens over long distances (Laaaksonen
and Paulsen, 2015). The parallel increase of outdoor piggeries has led to a higher risk of contacts,
and thus of disease transmission, between wild boars and domestic pigs. Because pigs and wild
boars belong to the same species, they share the same pathogens (Prodanov et al., 2009a; Prodanov
et al., 2009b; Wu et al., 2011). The overabundance of wildlife, recognized as a relevant risk factor
for disease transmission between wildlife and domestic animals, compromises the health
surveillance programs carried out both populations (Frlich et al., 2002; Ruiz-Fons et al., 2008).
Hunting and consumption of wild boar meat enables direct contact of humans and wild pigs,
providing ideal conditions for pathogen transmission from wild to domestic pigs and humans. It
should be taken into consideration that domestic animals and humans usually have never been
exposed to pathogens common for wild pigs, and thus are highly susceptible to infection (Ruiz-Fons
et al., 2008). Hunters have a greater than average risk of encountering various pathogens
communicable from animals to people. The ways of handling the carcass, meat, offal and hides
have an effect on this risk (Laaaksonen and Paulsen, 2015).
Animal health surveillance is routinely applied to domestic animals, but limited data exist on the
prevalence and distribution of infectious agents of wild boars in Vojvodina Province. Also, often is
not possible entirely to perform a complete diagnostic examination in wild boars in each evaluated
case (Petrovi et al., 2012, Prodanov-Radulovi et al., 2013a; Prodanov-Radulovi et al., 2013b). In
Vojvodina Province a certain number of wild boars is controlled and reared in an enclosed hunting
ground while the number of free-ranging population is mainly unknown (Prodanov et al., 2009b).
One of the characteristics of outdoor swine production in some regions of Vojvodina is raising freeroaming domestic pigs, where they share forest habitat with wild boar population. It can be assumed
that direct contacts between wild boars and domestic pigs kept in outdoor farms occur occasionally
(Doen et al., 2013; Prodanov-Radulovi et al., 2011; Prodanov-Radulovi et al., 2014a).
In some regions, especially near the river banks, domestic pigs are kept outdoors on the pasture,
which provides favourable conditions for infection transmission. Domestic pigs move freely in the
woods, thus getting in contact with wild boars. However, after summer pasture, domestic pigs are
returning into the pens. It is especially important that owners of the free-roaming animals in the
same time have backyard pigs (Prodanov et al., 2009b). In areas in which traditionally raising freeroaming domestic pigs has been introduced in the woods, hybridization with the wild boars has led
to crossbreeding, production which is often referred to as a feral pig or feral hog (Ruiz-Fons et al.,
2008). In our research during the epizootiological and clinical examination, we discovered the
existence of this type of animal hybrids in the backyards of the owners who practice extensive
grazing (Prodanov et al., 2009b).
The objective of our study was to evaluate the most common health disturbances detected in wild
boars in enclosed hunting grounds in Vojvodina Province, focusing on detected diseases that are
epidemiologically and economically important to the health of both wild boar and domestic swine
populations.
261

The material for this research comprises two different sources with the aim to perform health
control wild boars population in enclosed hunting grounds in Vojvodina Province. As a part of
health control program of wild boars, regularly shot by hunters, the examination of the trunci and
internal organs deriving from wild boars was carried out. The detailed gross pathological
examination, according to the specially adopted protocol, with an aim to not interfere with regular
hunting procedure, and taking the samples for laboratory examination, was done. In order to check
the wild boars in which the hunters noticed some signs of abnormal behaviour and/or signs of
diseases, the gross pathological examination of carcasses of dead or diseased animals shot by
hunters and laboratory testing of their organs and tissue samples was performed. The following
research methods were applied: epidemiological evaluation, clinical examination of live and gross
pathological examination of dead wild boars, standard laboratory testing for detection the presence
of aerobic and anaerobic bacteria in tissue samples (mediastinal and mesenterial lympho nodes,
lungs, heart, liver, spleen, kidney) deriving from dead wild boars, patohistological examination
(lungs) and serology testing (sera samples).
Isolation of bacteria from tissue samples deriving from dead pigs was performed by standard
aerobic and microaerophilic cultivation. Microscopic examination determined whether the isolated
bacteria were Gram positive or not and whether it is a coccoid or rod-like organisms. The
determination was carried out by determining the biochemical characteristics of the isolated
bacteria. Beside this, each animal carcass was thoroughly analysed by gross pathology examination
for the presence of helminths. Lung, digestive tract, liver, gall-bladder and renal pelvis were
examined with routine techniques for the detection of helminth parasites. A parasitological
examination was carried out with fecal material extracted from the rectum of each animal after
necropsy (zinc sulphate flotation, sedimentation and McMasters method). In cooperation with the
hunting societies and local veterinary service gathering of sera samples of hunted wild boars was
organized. The serology testing included classical swine fever (indirect immunoenzyme test kit:
HerdChek CSFVAb, IDEXX Laboratories, USA) and porcine parvovirus (haemagglutination
inhibition test).

Wild boars diseases caused by bacteria
On the several examined hunting grounds, the case history data revealed the problem in piglets
category with clinical signs of growth retardation. The piglets were reluctant to move, fatigued,
easy to catch and a large number of dead piglets were discovered. As a part of health control
program, clinically diseased wild boars (animals showing staggering gait, with long bristling hair
and arched back) were shot by hunters. The gross pathological examination revealed changes
dominantly in the respiratory tract: severe necrotizing pleuropneumonia and the presence of
multiple abscesses in the lung tissue (Pneumonia apostemosa disseminata). In few animals, purple
to gray areas of consolidation of lung tissue were detected (Pneumonia fibrinosa in statu
hepatisatiois rubrae et griseae). Macroscopically, the lung lobes were very similar to the hepato or
pancreatic tissues. In addition, the trachea and bronchi were filled with a foamy exsudate mixed
with small number of lung worms in the respiratory pathways. By standard bacteriological testing
on tissue samples (lungs, mediastinal lymph nodes) Pasteurella haemolytica, Streptoccocus alfa
haemolyticus, Streptococcus beta haemolyticus and Actinobacillus pleuropneumoniae were
detected.
262
In various game animal species, the bacteria from the genus Pasteurella can cause epidemics with
high mortality rate (Laaaksonen and Paulsen, 2015). The bacteria from the genus Pasteurella is
probably the most frequent and damaging invader in the lung i.e. tipically secondary invader and
was never isolated in the bronchial tree of healthy pigs. Even the most pathogenic strains are not
capable of infecting a healthy lung, unlike A. pleuropneumoniae (Le Potier et al., 2006). It is
consider that the outbreak of the disease in wild boars requires stressful and predisposing factors,
such as poor state of nutrition, overexertion, overdensity of population, unfavourable weather
conditions and great number of parasites. Common clinical symptoms in wild boars include hanging
of head and severe functional disorder of respiratory organs (Laaaksonen and Paulsen, 2015;
Prodanov-Radulovi et al., 2013b).
Actinobacillus pleuropneumoniae is considered an obligate parasite of the porcine respiratory tract
and there are no other natural hosts. Transmission occurs via aerosols or direct contact between
pigs. The clinical and pathologic outcome of infection depends on serovar and virulence factors, but
also on age, immunity, hygiene, infectious pressure, breed, and stress factors (Reiner et al., 2010).
Pleuropneumonia caused by A. pleuropneumoniae is one of the important bacterial diseases of the
respiratory tract of the pig and occurs in most pig-keeping countries (Boadella et al., 2012).
Subclinically and chronically infected pigs may enter a permanent carrier state, harbouring A.
pleuropneumoniae in sequestra or well-encapsulated abscesses in the lung and in tonsillar crypts
(Le Potier et al., 2006). Survivors of acute infections become carriers, and the infectious agent is
located mainly in nerotic lung lesions and/or in the tonsils, less frequently in the nasal cavity
(Boadella et al., 2012). Reiner et al. (2010) discovered that the overall prevalence of wild boars that
were PCR-positive for A. pleuropneumoniae DNA was 35.8%. Actinobacillus pleuropneumoniae
DNA was amplified from tonsils of 34.8% and from lungs of 6.4% of wild boars. The discrepancy
between A. pleuropneumoniae loads in lungs and tonsils likely demonstrates the higher colonization
of tonsil tissue with A. pleuropneumoniae in wild boars, although it cannot be excluded that lungs
were categorized as false negatives. Prevalence of A. pleuropneumoniae increased with age and
body weight. Higher prevalences in tonsils without gross pathologic signs of pleuropneumoniae
suggest colonization of most of these animals by non-pathogenic or low-pathogenicity serotypes
(Reiner et al., 2010).
In Europe, most attention has been devoted to diseases that are under official surveillance and
control in either pigs, wild boar or both, while other infections have received comparatively less
effort. Monitoring wildlife diseases faces a number of wildlife-specific constaints, including
sampling difficulties regarding proper sample and site stratification, consistent sampling of the
same sites, and limitations of the diagnostic test available for wildlife (Boadella et al., 2012). It
should be stressed that overdense regional game populations are a predisposing factor for the
disease (Laaaksonen and Paulsen, 2015).
In only few examined enclosed hunting grounds, by clinical examination of wild boars during the
feeding, the clinical signs (greyish to brownish diarrhea) of the enteric infection were observed.
Applying bacteriological testing on tissue samples (kidney, liver, spleen, mesenterial lympho nodes)
derived from diseased shot and dead wild boars the presence of Escherichia coli and Escherichia
coli haemolytica was detected. Most common gross pathology findings included moderate signs of
gastric and intestinal infection and enlarged mesenterial lymph nodes.
Escherichia coli bacteria cause a group of enteric diseases mostly found in young wild boars
(Laaaksonen and Paulsen, 2015). Disease outbreak usually requires predisposing factors, depending
on the virulence of bacterium. Starvation and poor condition of mothers/dams set the scene for an
outbreak of the disease. Infection pressure is also increased when the number of diseased animals is
high and the population is dense (Laaaksonen and Paulsen, 2015; Prodanov-Radulovi et al.,
2013a). In the treatment, usually the same antibiotics are used in the treatment of bacterial diseases
of domestic pigs and wild boars. Bacteria have a genetic ability to mutate and develop strains that
263
are resistant to antibiotics. This, together with poorly planned treatment or mass uncontrolled use of
antibiotics, may cause great problems in the health care of humans and animals (Doen et al., 2014).
In the control, important precautions include game animal feeding ground hygiene and prevention
of contacts between game and production animals (Laaaksonen and Paulsen, 2015).
Wild boar diseases caused by parasites
By gross pathology examination, the adult forms of several gastrointestinal parasites were
discovered: Ascaris suum, Macracanthorhinhus hirudinaceus, Trichuris suis. However, no gross
pathology lesions were detected in the gastrointestinal tract of examined wild boars. Applying
parasitological control of the intestinal content and/or faecal material extracted from the rectum, the
presence of eggs from several parasites was discovered: Trichuris suis, Oesophagostomum sp. and
Hyostrongylus sp. Also, in most of the examined cases, the presence of Protozoa of genus Eimeria
(Coccidia) was detected. Parasites, and changes caused by them, are the most common findings that
a hunter confronts in game handling. It is important to distinguish between a parasitic infection,
which practically all animals have, and a disease caused by parasites. The manifestation of disease
is often directly comparable to the severity of parasitic infection (Laaaksonen and Paulsen, 2015;
Prodanov-Radulovi et al., 2011).
The parasite from genus Coccidia reproduces in the intestines and damages the intestinal lining,
causing diarrhea and intestinal dysfunction of host animals and produce egg-like oocysts to their
feces. The infection is transmitted to another animal via feces-contaminated food or water. In dense
populations, the transmission of the parasite increases and infection pressure grows. Consequently,
coccidian may become a significant cause of mortality in young animals. In the prevention, correct
location and hygiene of game feeding grounds is important (Laaaksonen and Paulsen, 2015).
Roundworms (Trichostrongylidae, Trichuroidea, Strongylidae and Ascaroidea) that parasitize in
the gastrointestinal tract are frequently found in wild boars (Prodanov-Radulovi et al., 2013a). An
adult parasite inhabiting the stomach or intestines of a host animal produces eggs that are passed to
the environment in feces. In general, parasites of the gastrointestinal tract do not cause problems
under normal conditions, and their spread is self-limiting. However, these parasites are significant
in dense animal populations, as well as when starvation occurs. In that case, diseases may be caused
especially by large roundworms (Ascaroidea), they can cause weakening of the animal and
significant mortalities. In addition, animals with a parasitic infection can present a weight loss,
wasting, swollen abdomen, dry and dull hair and diarrhea (Laaaksonen and Paulsen, 2015).
In most of the shot healthy, diseased or dead found wild boars originated from different enclosed
hunting areas the presence of lung worms was established. Clinically, the case history data revealed
the problem in piglets category (signs of growth retardation). The piglets were described as
reluctant to move, fatigued, easy to catch. In several examined hunting grounds, by clinical
examination clinical signs of respiratory infection in young wild boars were detected: dispnoea and
intensive coughing (thumping). The wild boars were emaciated and slow gait, with shrunken eyes
and tough dry hair, and lagging behind the pack were noticed. As part of health control program of
clinically diseased wild boars shot by hunters, gross pathological examination of trunci and internal
organs deriving from shot wild boars was performed. In all examined cases, the gross pathology
examination revealed changes dominantly in the respiratory tract: purulent nasal discharge,
effervescent content in bronchi and bronchioles, mixed with a large number of lung worms, which
were like mucoid plugs filling the respiratory pathways (Metastrongylosis pulmonum summ). All
lobes of the lungs were diffusely swollen, edematous and reddened with marginal emphysema and
consolidation. A large amount of clear, foamy fluid and numerous slender, white nematodes 4-7 cm
long were visible in the trachea and bronchial trees. In several cases, pathomorphologically the
presence of numerous abscesses (Pneumonia apostematosa disseminata) in lung tissue were
detected. In the cases when macroscopically changes on the lung tissue were noticed, the
pathohystological examination were performed and in two examined shot wild boars Pneumonia
264
interstitiais was diagnosed. By parasitological examination the presence of lung worms

(Metastrongylus spp.) in the trachea, bronchi and in posteroventral parts of the diaphragmatic lung
lobes were detected (Pneumonia verminosa).
Lungworms are often encountered as highly prevalent helminthes in wild boars (ProdanovRadulovi et al., 2011; Senlik et al., 2011). In Europe, these parasites have a high prevalence,
affecting more than 80% of pigs created in extensive system and considered one of the main causes
of respiratory changes of these animals (Da Silva et al., 2013). This result might be explained by the
wide geographical distribution of different earthworm species, which form part of the diet of wild
boars and act as intermediate hosts for these parasites (Senlik et al., 2011). An adult parasite dwells
in the bronchial tubes of wild boars, where it produces eggs. The eggs are coughed up to the throat
and travel via the pharynx to the intestines. In the intestines, the eggs develop into larvae and are
passed in feces to the ground. New animals are infected after ingestion of food that contain larvae.
Inside the new host, the larvae penetrate the intestinal wall and migrate via lymphatic vessels to the
lungs, thus completing the parasitic life cycle (Laaaksonen and Paulsen, 2015; Prodanov-Radulovi
et al., 2011). Mild infections are often asymptomatic. Severe infections cause caught and
inflammation of the lungs, the symptoms of which may include deterioration of general condition,
slow growth, weight loss and mortalities. By gross pathological examination, adult parasites can be
seen in the bronchial tubes. The scars left by them are greenish areas of 0.5 to 2 cm in size in the
lungs (Laaaksonen and Paulsen, 2015). The verminous processes are mainly located dorsocaudally
in the lung (Prodanov-Radulovi et al., 2013b).
Lung parasites of the genus Metastrongylus are considered one of the most important selective
factors acting on wild boar population, increasing the mortality of weaker young and adult animals
because they may cause dyspnea, bronchopneumonia, and permanent weight loss in addition to
inflicting tissue damages which allow opportunistic infections of viruses and bacteria (Da Silva and
Muller, 2013). Young wild boars are thought to ingest a higher number of earthworms than adults
and therefore may have a higher level of parasitism (Garcia-Gonzlez et al., 2013; Jrvis et al.,
2007). In Europe, these parasites have high prevalence, affecting more than 80% of pigs created in
extensive system and considered one of the main causes of respiratory changes of these animals (Da
Silva and Muller, 2013; Yoon et al., 2010). Despite the limited number of wild boars examined, our
study suggests these species are common and enzootic in wild boars in Vojvodina region
(Prodanov-Radulovi et al., 2013a; Prodanov-Radulovi et al., 2013b). The reason for the high
prevalence of lungworms may be the density of game population, which often is the natural
explanation of the spread of a parasite transmitted from animal to animal (Laaaksonen and Paulsen,
2015; Jrvis et al., 2007). In control, infection pressure can be diminished by preventing the
development of dense game populations and maintaining good game feeding ground hygiene
(Laaaksonen and Paulsen, 2015). The uncontrolled use of anthihelmintics can lead to an excessive
selection of resistant parasites, which may cause an increase in the infection intensity (Da Silva and
Muller, 2013).
Sporadically, by gross patology examination of shot wild boars, the presence of parasitic cysts in
the abdominal cavity were detected. Tapeworms (Taenia hydatigena) is a ubiquitous parasite, the
definitive hosts of the adult parasite are carnivores such as wolf, dog, lynx and fox. The parasites
intermediate hosts are herbivores and wild boars, which get the parasites eggs to their intestines
through food. The larvae burrow through the intestinal wall and form cysts in the body of
intermediate host (Cysticercus tenuicollis). Each cysts contains one infectious larva. When the cystbearing animal is eaten by a carnivore, the parasites life cycle is completed. The pearly gray, liquidfilled cysts of the T. hydatigena tapeworm, 1.5 to 10 cm in diameter, are most commonly found in
the omentum, liver or peritoneum of wild boars. Single, smaller cysts go easily unnoticed, since the
parasite cysts, as far as is known, do not cause symptoms to the intermediate host. In order to break
a cycle, an infected animals raw meat or organs should not be given to dogs or wild animals
(Laaaksonen and Paulsen, 2015)
265
The other detected parasitic agent in examined wild boars is cysts of a tapeworm, Echinococcus
granulosus. The definitive hosts of E. granulosus are canines, often wolves, whose intestines are
inhabited by adult parasites. The eggs produced by the parasite are spread to the environment
through the host animals feces, and further via food to the intermediate host. Inside the intermediate
host, the parasite forms cysts that contain a large number of infectious larvae. When the animal and
cysts are ingested by carnivores, the parasites life cycle is completed (Rojo-Vazquez et al., 2011).
Typical cysts (hydatid cyst) are commonly found in the liver of the wild boars. Their size varies,
depending on the duration of the infection. The cysts are often pearly grey colour and contain clear
liquid with thousands of small, infectious larval forms of the parasite. The number of cysts may
vary from a single one to over a hundred cysts. An animal suffering from severe infection and large
cysts in abdominal cavity or lungs is more easily killed by carnivores. This assists in the completion
of the parasites cycle. E.granulosus infection can be contracted by humans, who ten act as
intermediate hosts and the infection causes a so called hydatid disease (hydatidosis) (Laaaksonen
and Paulsen, 2015).
Mycotoxicoses in wild boars
In two examined enclosed hunting areas, the problem of diarrhoea, slow growth and mortality in
piglets was discovered. The clinical examination was performed from the safe distance at the
feeding place. The signs of weakness and growth retardation, staggering gait, trace of fecal content
on the hind body parts and on the ground were found. In the feed control a significant quantity of
moldy corn was discovered. Having in mind all the facts, the potential problem of mycotoxicosis
was suggested.
Different fungal species (Fusarium, Aspergillus, Penicillium genera) produce mycotoxins in food
and cause intoxication to those animals that eat the contaminated food. On entering the body, the
toxins possibly produced by fungi may cause a group of different symptoms that are often difficult
to recognize (Prodanov-Radulovi et al., 2014b). Mycotoxins can get to wild animal food from
grass of fodder made from grass, from silage and grain feed (Laaaksonen and Paulsen, 2015).
Symptoms caused by mycotoxins in animals depend on the toxin and the ingested dosage. Clinical
symptoms vary from organ-destroying acute intoxications to chronic states of intoxication that may
include reduced appetite, diarhoea, weight loss and reproductive disturbances. Diagnosis is difficult
to make as the mycotoxin content is very small and several toxins can be found in the same sample
(Prodanov-Radulovi et al., 2014b). Fungal intoxication has rarely been reported in game animals,
perhaps due to difficulty of reaching a diagnosis. In nature, the occurrence of mycotoxins cannot be
controlled. However, the entrance of mycotoxins into the nourishment of game animals can be
avoided with careful hygiene of game animal feeding grounds, using only feed that would be
acceptable for production animals, do not offer feed from the ground but from a feeding device that
prevents the feed from getting wet (Laaaksonen and Paulsen, 2015).
Wild boar diseases caused by viruses
In cooperation with the hunting societies and local veterinary service gathering of sera samples of
hunted wild boars was organized. Serological examination in year 2009 on the presence of specific
antibodies against CSFV (ELISA test) comprised only 259 blood samples obtained from wild boars
in the hunting area of Vojvodina region and it revealed negative result. In year 2010 the serological
control of CSFV antibodies in wild boars population included significantly larger number of
animals i.e. in total 471 tissue samples and 455 blood samples were examined. From examined
blood samples, in 36 positive results i.e. the presence of specific antibodies against CSFV was
detected. However, applying reverse transcription-polymerase chain reaction (RT-PCR) analysis the
presence of viral genome was not established in tissue samples deriving from shot wild boars. The
serological control of the CSFV presence in wild boars population in Vojvodina region was even
more intensified during years 2011-2012. In total 2038 samples were examined: 996 sera samples
266
and 1042 tissue samples (spleen, lymph node, and kidney). Once again, in 33 sera samples the
presence of CSFV specific antibodies was detected. Clinically, no abnormal mortality has been
reported in the analyzed districts of Vojvodina region (Prodanov-Radulovi et al., 2013a; ProdanovRadulovi et al., 2014a). By additional epidemiological evaluation, it was discovered that some of
the examined sera samples from certain hunting grounds that tested positive were a consequence of
previous vaccination against CSFV in the past, with modified live (China strain) vaccine. Although
prohibited from 1983 in Serbia, CSFV vaccination of wild boars may have been applied for a while
after vaccine ban (Prodanov et al., 2009b). Therefore, we cannot exclude the possibility that
vaccinated wild boars may have been sampled and detected as positive in the survey. This could
explain the presence of antibodies against CSFV in some of examined sera samples. In research
conducted in 2013, applying RT-PCR analysis the presence of CSFV genome was not established in
tissues samples deriving from shot wild boars in Vojvodina (Prodanov-Radulovi et al., 2014a).
However, the results of the epizootiological questionnaire indicated that CSFV may be present in
hunting grounds in the region of Danube River, implying that the wild boars population represents
also a source of infection with CSFV (Prodanov et al., 2009b).
Classical swine fever (CSF) is a viral disease caused by a member of Flaviviridae family, genus
Pestivirus and of great economic concern for the pig farming industry (Artois et al., 2002; Rossi et
al., 2005). The disease in the wild boar population was diagnosed and/or serologically confirmed in
several Central and Eastern European countries (Artois et al., 2002; Montagnaro et al., 2010;
Prodanov et al., 2009b; Roic et al., 2012; Rossi et al., 2005; Vengust et al., 2006). In some
European countries, CSFV has been reintroduced periodically into domestic pigs via contact with
infected wild boars (Le Potier et al. 2006; Rossi et al., 2005). Moreover, epidemiological links
between CSFV infections in wild boars and domestic pigs have been repeatedly reported, mainly in
Germany (Ruiz-Fons et al., 2008). At present, CSF monitoring program in Serbia is primarily
focused on the serological investigations of blood samples and control of tissue samples by RTPCR from hunted wild boar. Sampling is performed randomly based on the density of the wild boar
population in different regions (Prodanov Radulovi et al., 2014a). The inveterate tradition to
keep domestic pigs at free range and the consequent contacts with the wild boars are considered the
major cause of outbreaks of CSF, which seems to facilitate disease persistence (Laddomada, 2000;
Rossi et al., 2005).
In one enclosed hunting ground, according to the history data and clinical signs detected in wild
boars (a small number of newborn piglets, stillborn and mummified piglets in the litters), the
problem of PPV infection was suggested. However, the clinical examination was feasible only in a
certain number of wild boars located in specially separated, fenced area. During the visit of hunting
area it was noticed that the fence was not entirely surrounding the area and there were parts without
fence. Having in mind migratory characteristics of population, this could facilitate contact with
domestic pigs located in forest habitat. Applying serological examination (HI test) of blood
samples, antibodies against PPV were widely distributed among the wild boar population in
Vojvodina province: 148 (49.33%) of the 300 examined samples tested PPV positive. The highest
prevalence of seropositive animals was associated with the hunting areas in Baka and Srem
districts. We believe that this is connected with the tradition of keeping domestic pigs in woods
(especially in Srem district), thus increasing possible contact and transmission of diseases between
wild boars and domestic swine (Prodanov et al., 2009b; Prodanov-Radulovi et al., 2014a). The
high prevalence of PPV antibody suggests this virus is endemic in our wild boar populations. In
Europe, PPV is highly prevalent in wild boars, with an incidence ranging from 14 to 57 % (RuizFons et al. 2008; Vengust et al., 2006), except Italy, where low prevalence of antibody to PPV was
reported (Montagnaro et al., 2010).
267
Conclusion
On the basis of the achieved results we can conclude that wild boars could be source of different
endoparasites species. The gross pathological examination discovered that in the largest number of
animals the health problems were mainly connected to the parasitic infestations and bacterial
infections of digestive and respiratory organs. Discovered parasitic infestations in the evaluated
wild boars are economically significant because of retardation in the growth and weigh gain. The
obtained serological results suggest that wild boars have direct or indirect contact with domestic
pigs, which facilitate transmission of pathogens. Avoiding close contact between wild boars and
domestic animals is of logical importance in disease control and eradication programmes. Having in
mind this fact, the special attention should be given to active surveillance of wild boars population
in the areas where close contact with domestic swine is possible. The measures should include the
serological monitoring of wild boars and free-roaming domestic swine, even the prohibition of
extensive grazing, pathological examination of the trunci deriving from shot wild boars. The study
underlines the importance of improving surveillance strategies for pathogens shared between
wildlife and domestic animals and the need to increase disease awareness of hunters, farmers and
veterinary practitioners. In the future, a better connection between veterinary service and experts
from hunting area is needed in order to solve to problems comprehensive way.
Acknowledgements
Education, Science and Technological Development, Republic of Serbia
References
1.
Artois M., Delahay R., Guberti V. and Cheeseman C.: Control of Infectious Diseases of Wildlife in
Europe. The Veterinary Journal, 162, 141-152, 2001
2. Boadella M., Ruiz-Fons J.F.,Vicente J., Mart n J., Segales J. and Gortazar, C.: Seroprevalence Evolution
of Selected Pathogens in Iberian Wild Boar. Transboundary and Emerging Diseases,59, 395404, 2012
3. Da Silva D., Mller G.: Parasites of the respiratory tract of Sus scrofa scrofa (wild boar) from
commercial breeder in southern Brazil and its relationship with Ascaris suum. Parasitol Res 112:13531356, 2013
4. Doen R., Prodanov-Radulovi J., Pui I., Stojanov I., Petrovi T.: Man, wild and domestic pigs :
Major risk points in disease transmission and perspective. Book of Abstracts, 2nd International
symposium on hunting 'Modern aspects of sustainable menagement of game population', 17-20 October,
2013, Novi Sad, Serbia organized by Faculty of Agriculture, Novi Sad, 2013, 97
5. Doen R., Prodanov-Radulovi J., Pui I., Ratajac R., Stojanov I., Gruba S.: The uncontrolled use of
antibiotics in pig production - a threat to public health. XVI International congress Feed technology,
October 28-30, 2014, Novi Sad, organized by Institute of food technology, 2014, 20-24
6. Frlich K., Thiede S., Kozikowski T., Jakov, W.: A Review of Mutual Transmission of Important
Infectious Diseases between Livestock and Wildlife in Europe. Ann. N.Y. Acad. Sci., 969, 4-13, 2002
7. Garcia-Gonzlez A., Prez-Martin J.E., Gamito-Santos J. A., Calero-Bernal R., Alcaide Alfonso M.,
Frontera Carrin E. M.: Epidemiologic Study of Lung Parasites (Metastrongylus spp.) in Wild Boar
(Sus scrofa) in Southwestern Spain. Journal of Wildlife Diseases, 49,1, 157-162, 2013
8. Jrvis T., Kapel Ch., Moks E., Talvik H., Mgi E.: Helminths of wild boar in the isolated population
close to the northern border of its habitat area. Veterinary Parasitology, 150, 366-369, 2007
9. Laddomada A.: Incidence and control of CSF in wild boar in Europe. Vet Microbiol, 73, 121-130, 2000
10. Laaaksonen S. and Paulsen P.: Hunting hygiene, Wageningen Academic Publishers, 2015
268

11. Le Potier M.F., Mesplede A., Vannier, P.: Classical swine fever and other pestiviruses. In: Diseases of
swine, ed. Straw B. E., Zimmerman, J. J., DAllaire, S., Taylor D. J., 9th edn. Oxford: Blackwell
Publishing, 2006, 309-322
12. Meng X. J., Lindsay D. S. and Sriranganathan N.: Wild boars as sources for infectious diseases in
livestock and humans. Phil. Trans. R. Soc., B 364, 2697-2707, 2009
13. Montagnaro S., Sasso S., De Martino L., Longo M., Iovane V., Ghiurmino G., Pisanelli G., Nava D.,
Baldi L., Pagnini U.: Prevalence of Antibodies to Selected Viral and Bacterial Pathogens in Wild Boar
(Sus scrofa) in Campania Region, Italy. Journal of Wildlife Diseases, 46,1, 316319, 2010
14. Petrovi T., Lupulovi D., Lazi G., Prodanov-Radulovi J., Doen R., Lazi S.: A serological survey
on porcine reproductive and respiratory syndrome (PRRS) virus infection in Serbian wild boars
population. Proceedings, EuroPRRS2012 Symposium Understanding and combating PRRS in Europe,
COST Action FA902, 10th - 12th October 2012, Budapest, Hungary, organized by Faculty of
Veterinary Science, Roslin Institute, 2012, 87-88
15. Prodanov J., Doen R., Orli D., Maljkovi M., Pui I., Stojanov I., Radulovi G.: Clinical and
pathomorphological diagnostics in control of health status of wild boars. Proceedings The 9th Regional
Symposium in Animal Clinical Pathology and Therapy Clinica veterinaria, Jun 19-21 Jun, Subotica,
Serbia, 2009a,133-134
16. Prodanov J., Doen R., Pui I., Petrovi T., Orli D., Maljkovi M., Lupulovi D.: The control of
classical swine fever virus presence in wild boars population. Biotechnol. Anim. Husb. 25, 5-6, 879885, 2009b
17. Prodanov-Radulovi J., Doen R., Pui I., Orli D., Stojanov I., Radulovi G.: Verinozna pneumonija
divljih svinja. Arh.vet. med., 3, 2, 19-25, 2011
18. Prodanov-Radulovi J., Doen R., Pui I., Petrovi T., Stojanov I.: Health status control of wild boars
in the hunting area of Vojvodina region. Proceedings, 10th International Symposium Modern Trends in
Livestock Production, 2 - 4 October, Belgrade, organized by Institute for Animal Husbandry, Belgrade,
2013a,1182-1188
19. Prodanov-Radulovi J., Doen R., Pui I., Stojanov I., Petrovi T., Uroevi M.: The bacterial
infections of respiratory tract of wild boars. 2nd International symposium on hunting Modern aspects of
sustainable management of game population, 17-20 October, Novi Sad, Serbia, organized by Faculty of
Agriculture, Novi Sad, 2013b, 220-224
20. Prodanov-Radulovi J., Doen R., Petrovi T., Polaek V., Lupulovi D., Stojanov I., Gruba S.:
Antibodies to selected viral disease agents in hunted wild boars in Vovodina region. 3rd International
symposium on hunting Modern aspects of sustainable management of game population, 26-28
September, Zemun - Beograd, Serbia, organized by Balkan Wildlife Scientific Society, Novi Sad, 149153, 2014a
21. Prodanov-Radulovi J., Doen R., Stojanov I., Polaek V., ivkov-Balo M., Mari D., Pui I.: The
interaction between the swine infectious diseases agents and low levels of mycotoxins in swine feed.
Biotechnol. Anim. Husb., 30,3,433-444, 2014b
22. Reiner G., Fresen C., Bronnert S., Haak I., Willems H.: Prevalence of Haemophilus parasuis infection
in hunted wild boars (Sus scrofa) in Germany. Journal of Wildlife Diseases, 46,2, 551-555, 2010
23. Roi B., Jemersi L., Terzi S., Keros T., Balatinec J.,Florijancic T.: Prevalence of antibodies to
selected viral pathogens in wild boars (sus scrofa) in Croatia in 200506 and 200910. Journal of
Wildlife Diseases, 48, 1,131137, 2012
24. Rojo-Vazquez F.A., Pardo-Liedias J., Francos-Von Hunefeld M., Cordero-Sanchez M., Alamo-Sanz R.,
Hernendez-Gonzalez A., Brunetti E., Siles-Lucas M.: Cystic Echinococcosis in Spain: Current Situation
and Relevance for Other Endemic Areas in Europe. PLoS Negl Trop Dis, 5, 1, e893.doi: 10.1371
/journal.pntd. 0000893, 2011
25. Rossi S., Fromont E., Pontier D., Crucire C., Hars J., Barrat J., Pacholek X., Artois M.: Incidence and
persistence of classical swine fever in free-ranging wild-boar (Sus scrofa). Epidemiol. Infect.,133, 559568, 2005
26. Ruiz-Fons F., Segals J., Gortzar C.: A review of viral diseases of the European wild boar: Effects of
population dynamics and reservoir role. Vet J., 176, 158-169, 2008
269

27. Sedlak K., Bartova E., Machova J.: Antibodies to Selected Viral Disease Agents in Wild Boars from the
Czech Republic. Journal of Wildlife Diseases, 44,3,777780, 2008
28. Senlik B., Cirak V.Y., Girisgin O. Akyol C.V.: Helminth infections of wild boars (Sus scrofa) in the
bursa province of Turkey. Journal of Helminthology, 85, 404-408, 2011
29. Vengust G., Grom J., Bidovec J. A. Kramer M.: Monitoring of Classical Swine Fever in Wild Boar (Sus
scrofa) in Slovenia. J. Vet. Med. B, 53, 247249, 2006
30. Wu N., Abril C., Hini V., Brodard I., Thr B., Fattebert J., Hssy D., Ryser-Degiorgis M-P.: Free
ranging wild boar: a disease threat to domestic pigs in Switzerland? Journal of Wildlife Diseases, 47, 4,
868-879, 2011.
31. Yoon B., Kim H.-C., Kim J.-T.: Lung Worm (Metastrongylus elongatus) Infection in Wild Boars (Sus
scrofa) of the Demilitarized Zone, Korea. Journal of Wildlife Diseases, 46(3), 1052-1054, 2010
270
CONTAMINATION OF PUBLIC PLACES AT CENTRAL BELGRADE

MUNICIPALITIES WITH DOGS PARASITES IN PERIOD 2013-2014
Ivan Pavlovi 1, Dubravka Jovii2, Vladimir Terzin3, Dragana Petkovi4, Dragana Terzin3, Milo
Pavlovi5, Zoran Tambur6, Sneana Radivojevi7, Borivoje Savi8, Slobodan Stanojevi1
1. Scientific Veterinary Institute of Serbia, Belgrade, Serbia
2. Faculty Futura, University Singidunum, Belgrade, Serbia
3. Veterinary Ambulance Pet&Vet, Belgrade, Serbia
4. Veterinary Ambulance Petweellnes Eva, New Belgrade, Serbia
5. Faculty of Veterinary Medicine, University in Belgrade, Serbia
6. Military Medicine Academy, Belgrade, Serbia
7. City Institute of Public Health, Belgrade, Serbia
8. Clinical Center of Serbia, Belgrade, Serbia
Abstract
A steady increase in the number of dogs is a serious sanitary-epidemiological problem of urban
areas. Those animals permanent contaminated those areas with faeces which present a significant
health problem from human. From these reason at Belgrade we had parasitological research of that
places continuously since 1993. Here we presented results of our examination performed at central
Belgrade municipalities in period 2013-2014. Parasites contamination were detected at 45.91%
(45/98) soil samples and 72.5% (58/80) dog faeces. Toxocara canis were found at 31.63% soil
samples and 72.5% dog faeces, Dipyllidium caninum at 19.9% and 25.6%, Ancylostomidae spp. at
18,36% and 22,5%, Trichuris vulpis at 16.32% and 21.25%, Toxacaris leonina at 14.28% and
18.75%, and Taenia-type helminths at 5.1% and 6.6%, Giardia intestinalis at 16.32% and 22.5%,
Amoebae spp at 6.6% and 7.5%, Eimeria canis 7.14% and 12.5% and and Isospora canis 10.28%
and 15.0%.
Keywords: dogs, parasites, zoonoses, environmental contamination
Introduction
The presence of a large number of dogs, pets and stray, whose droppings dirty sidewalks and green
areas, is the current epidemiological problem in urban areas. In close cohabitation stray animals and
pets oriented on the same surface movement in the immediate environment of people and
contamination of public areas eggs zoonotic parasite species leads to constantly attend on the
possibilities of human infection (Mangaval and Pavlovi, 2005; Pavlovi, 2006; Laloevi and
Laoevi, 2008; Elaine et al., 2011). Commenting on the results of parasitological examination of
green areas in in cities around the world, we will see that those polution in Madrid is 9%, London
15-17 % , Michigan 19 % , Kansas 20.6% , Utrecht 23% , Belgrade, Paris and Prague 28 %, Dublin,
32 %, Tokoshima 63 % and etc (Gothe and Reichler, 1990; Jansen et al., 1993; Cielecka et al.,
2005; Demirci et al., 2010; Tylkowska et al., 2010). If it is known that more than 5% of the
contaminated urban areas pose a serious threat to people's health is our opinion that this is not to
comment (Woodroff, 1976).
In order to monitor the contamination in the Belgrade area since 1993 continuously monitors the
contamination of public areas for the presence of parasites originating from dogs (Pavlovi et al.,
1997, 2009; Pavlovi and Surla, 2003). In our paper we presented results of our examination
performed at central Belgrade municipalities in period 2013-2014.
271

Samples of grass and soil with green areas in our climate condition were collected from March to
October. Material for examination was taken on the basis of indicators of bioclimatic conditions
prevailing in the same area leading to the method of bioclimatograme by Uvarov. Samples of dogs
faeces are raised with the same location in the same intervals as samples of soil, grass and sand.
The examination is carried using native preparation, with sedimentation method, the flotation
method, and the sedimentation - flotation method (Euzeby, 1981; Pavlovi and Stevanovi, 2005;
Pavlovi et al., 2007). Assessment of the infection will be performed by the methodology described
by McMaster and Stoll and determination of eggs and oocysts based on morphological
characteristics (Beugnet et al., 2008).
Results
Parasites contaminations were detected at 45.91% (45/98) soil samples and 72.5% (58/80) dog
faeces. Toxocara canis were found at 31.63% soil samples and 72.5% dog faeces, Dipyllidium
caninum at 19.9% and 25.6%, Ancylostomidae spp. at 18,36% and 22,5%, Trichuris vulpis at
16.32% and 21.25%, Toxacaris leonina at 14.28% and 18.75%, and Taenia -type helminths at 5.1%
and 6.6%, Giardia intestinalis at 16.32% and 22.5%, Amoebae spp at 6.6% and 7.5%, Eimeria
canis 7.14% and 12.5% and and Isospora canis 10.28% and 15.0%.
Discusion
Epidemiological study of parasites contamination in the area of Belgrade is the research carried out
continuously since 1993. Throughout this period, this study was performed for scientific purposes
and were unprofitable (which is sometimes caused misunderstanding in the institute), exception of
three occasions when the city government paid for this study (in 2002, 2011 and 2012).
On the basis of the control of parasitic contamination of land from parks and other green areas
between 1993 and 2002 (Pavlovi et al., 1997, 2000), the presence of the locations parasite eggs
was found 65.90% of the examined samples. This was followed by the first reactive in terms of
cleaning the playgrounds so that in the period 2003-2007. The contamination has been established
at 45.90% of the area (Pavlovi et al., 2007).
The following progress has been made by introducing during 2008-2009 in central city districts has
taken root system of baskets with plastic bags from dog feces (Dogi-pot system). During 2011 in
some parks are form of eco zones or parks for dogs (Pavlovi and Terzin, 2012)
A special segment of solving this problem in Belgrade has been the adoption of problem-solving
strategies non-owner of dogs and cats in the city of Belgrade, which was adopted at the Belgrade
City Assembly held 21.9.2011. The city of Belgrade has become one of the few cities that have a
strategy to solve the problem of non-proprietary dogs and it is a document that defines the
principles, objectives and measures to solve the problem in terms of non-owner dogs carry out
administration of local government. In developing this strategy for the City of Belgrade and its
implementation was guided by the principle of humanity, combining the method of euthanasia
without (no kill strategy) and CNR method "catch - treat - let " ( CNR - catch - neuter -release),
with special emphasis on the protection of human and animal health. At the same time more shelters
for dogs has been built and a regular parasitological examination of parks and green areas in the city
was introduced (Pavlovi and Terzin, 2012; Terzin et al., 2012).
On the basis of parasitic control of soil contamination from the parks during the 2012 presence of
parasite eggs was found in over 40% less than in the period 2008-2009.
272
At last two years (2013-2014), activities related to the parasitological control of green areas will
terminate and implementation of Strategies for addressing non-owner of dogs in the City of
Belgrade will partially apply. Those result with increase of number of non-owner dogs, dogs fecal
and parasites contamination of public places (parks, green areas and etc.) for more than 30%
compared to the previous period and high possibility to human infection. To solve that problem we
must to back to permanent parasitological control of public places.
Reference
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Beugnet F.,Polack B., Dang H.: Atlas of Coproscopy. Paris, Kalianxis,2008

Demirci M., Kaya S., etin E.S., Ar doan B.C., nal S., Korkmaz M.: Seroepidemiological
Investigation of Toxocariasis in the Isparta Region of Turkey. Iranian Journal of Parasitology, 5, 2, 5259, 2010
Elaine A., Carvalho A., Regina L., Rocha T.: Toxocariasis: visceral larva migrans in children. Jornal de
Pediatria, 87, 2, 100-110, 2011
Euzeby J.: Diagnostic Experimental des Helminthoses Animales. Paris, ITVS, 1981
Gothe R., Reichler I.: Toxocara canis: Nachweishaufigkeit und Befallsextensitet bei Muterhundien und
ihre wurfen unterschiedlicher Rassen und Halting. Suddeutchlande Tierrtzlitche Praxis 18, 293-300,
1990
Jansen J., van Knapen F., Schreurs M., van Wijngarden T.: Toxocara ova in praks and send boxes in
the city of Utrecht. Tijdschr Dieregneeskund, 11, ,4,, 118-119, 1993
Laloevi D, Laloevi V.: Toxocariasa larva migrans in humans and animals. Beograd, Zadubina
Andrejevi, 2008
Mangaval J.F., Pavlovi I.: Intestinal Parasites (Helminths) Cestoides Order: Cyclophyllidea
Dipyllidium caninum. In: Atlas of Medical Parasitology, ed.P.Karamelo, Turin, Carlo Denegri
Fondation & Infectious Disease, Unit A, Tropical and Parasitology Service Amedeo di Savoia
Hospital Turin, 2005, CD rom
Pavlovi I., Kulii Z., Milutinovi M.: Rezultati parazitolokog ispitivanja peanih igralita za decu u
uem centru Beograda. Veterinarski glasnik, 51,1-2,61-65,1997
Pavlovi I., Milutinovi M., Radenkovi B.,Jankovi Lji., Vuini M., Kulii Z.: Higijenski aspekt
gradskih parkova - rezultati parazitolokog ispitivanja centralnih parkova Beograda. Zbornik radova XI
savetovanja dezinfekcija, dezisekcija i deratizacija u zatiti ivotne sredine sa meunarodnim ueem,
Tara,200, 233-237
Pavlovi I., Surlan N.: Rezultati parazitolokog pregleda zelenih povrina optine Stari grad tokom
2002. godine 143-150. Zbornik radova Strunog skupa kontrola tetnih organizama u urbanoj sredini,
VI beogradska konferencija sa meunarodnim ueem, Beograd, 2003, 143-150
Pavlovi I., Stevanovi S.: Metode parazitoloke kontrole kontaminiranosti zelenih povrina u urbanim
sredinama. Knjiga apstrakata konferencije ivotna sredina i ljudsko zdravlje sa meunarodnim
ueem, Beograd, 2005, 133-134
Pavlovi I.: Geohelminths emerging zoonotic disease in urban areas. Proceedings of the VIII
International Symposium In Animal Clinical Pathology And Therapy Clinica Veterinaria, Neum, Bosna
i Hercegovina, 2006, 1-4, CD rom
Pavlovi I., Kulii Z., Momilovi J., Mii Z., Krsti D.: Basic measure to control and sanation of
parasitic contamination of green areas in urban environmental condition. Abstracts of International
Conference on Environment and Sustainable Development, Beograd, 2007, 78-79
Pavlovi I., Kulii Z., Petkovi D., Terzin V., urin Lj., Terzin D., urin K.: Parasites contamination
of grasy areas of Belgrade in period 2003 - 2007. Abstracts book of International Scientific Conference
on Globalization and Environment, Beograd, 2009, 155-156
Pavlovi I., Terzin V.: The influence of the new strategy to resolve the problem of ownerless dogs and
cats in Belgrade on the preservation of environmental conditions. Book of Abstracts for the
273

International Scientific Conference on Innovative Strategies and Technologies in Environment
Protection, Beograd, 2012,44-46
17. Terzin, V., uki B., Vukievi-Radi O., Proki B.,Radenkovi- Damnjanovi B., Pavlovi I.,
Dimitrijevi S., Markovi M., Tufegdi N.: Strategija grada Beograda o zbrinjavanju naputenih pasa i
maaka. Zbornik predavanja XXXIII seminar za inovacije znanja veterinara, 2012, 69-74
18. Tylkowska A., Pilarczyk B., Gregorczyk A., Templin E.: Gastrointestinal helminths of dogs in Western
Pomerania, Poland. Wiadomooeci Parazytologiczne, 56, 3, 2010, 269276.
19. Woodruff A.W.: Toxocariasis as a public health problem. Environent and Health, 84, 29-31, 1976
274
RISK FACTORS IN DOMESTIC AND WILD CYCLES OF TRICHINELLA SPECIES

Milena Zivojinovi1*, Ivan Dobrosavljevic1, Ljiljana Sofronic Milosavljevi2, Budimir
Plavsic3 Zoran Kulisic4, Sonja Radojicic4
1
Veterinary Specialistic Institute Pozarevac, Dunavska 89, 12000 Pozarevac, Serbia

Institute for the Application of Nuclear Energy INEP, University of Belgrade, Belgrade, Serbia
3
Veterinary Directorate, Ministry of Agriculture and Environmental protection, Serbia
4
Faculty of Veterinary medicine, University of Belgrade, Belgrade, Serbia
Abstract
In the Balkan region of Europe, Trichinella spp. infections are endemic. These zoonotic parasites
are a serious problem for the human health and animal husbandry in Serbia. The aims of the present
study were to define risk factors in transmission of Trichinella spp. in domestic animals and
synanthropic and wild animals.
Through the surveillance and monitoring of Trichinella spp. in wild boars (Sus scrofa), red foxes
(Vulpes vulpes), golden jackals (Canis aureus), wolves (Canis lupus), stray dogs (Canis familiaris)
and domestic pigs (Sus scrofa domestica) we investigated presents and possible pathways for
transmission of Trichinella species. After examination of muscle samples from wild and domestic
animals for presents of Trichinella larvae, genotyping was performed by multiplex PCR. GIS
(Geografical Information System) was used for mapping the spatial distribution of Trichinella spp.
infected animals and all defined point of interest (pig farms, hunting section, slaughterhouses, and
dumps).
Trichinella spp. infection was detected in domestic and wild animals. Trichinella spiralis and
Trichinella britovi were the only two species identified in the isolates as single or mixed infections.
The identification of Trichinella spp. positive animals allowed to identify the foci of transmission
and to inform the veterinary services, the owners of pig farms and slaughterhouses and hunters
associations about the risk of transmission of these zoonotic agents.
The results point out the circulating of Trichinella species by a domestic or a sylvatic cycle, the
transmission between these two cycles and the role of some host species as reservoirs of T. spiralis
or T. britovi or of both species in Serbia.
Key words: Trichinella spp., zoonotic, domestic, wild, transmission
Introduction
In the Balkan region of Europe, Trichinella spp. infections are endemic. These zoonotic parasites
are a serious problem for the human health and animal husbandry in Serbia (Cuperlovic et al.,
2005). Human health problem is mainly the consequence of high prevalence of infection in
domestic animals, especially swine. According to the most important risk factors for trichinellosis
in the domestic and sylvatic cycles (Pozio, 2007), many are present in the endemic district of
Branicevo and Podunavlje, and include intentional feeding of food waste containing pork scraps,
scavenging on garbage dumps by pigs and dogs, and disposing of animal carcasses in the field
which allows sylvatic animals to scavenge on carcasses of infected domestic swine and increases
the probability of transmission to new hosts. The aims of the present study were to define risk
factors in transmission of Trichinella spp. in domestic pigs and synanthropic and wild animals
through surveillance and monitoring of Trichinella spp. among wild and domestic animals in this
region.
275

Through the surveillance and monitoring of Trichinella spp. we investigated presents and possible
pathways for transmission of Trichinella species in domestic and wild animals. During the period
2010, muscle samples were collected from 192.707 domestic pigs, 30 stray dogs and from 338 wild
animals including 174 wild boars (Sus scrofa), 118 red foxes (Vulpes vulpes), 42 golden jackals
(Canis aureus), and 4 wolves (Canis lupus). Muscle samples from wild animals provided by hunters
were analyzed by artificial digestion at the VSI of Pozarevac, according to Regulation (EC) No.
2075/2005 (European Community) and the Manual of Standards for diagnostic tests and vaccines
for terrestrial animals of the World Health Organization for Animal Health (OIE, 2008). Pig meat
samples were examined by trichinoscopy and/or artificial digestion at veterinary stations, veterinary
ambulances and slaughterhouses. When the sample size or types of muscle were inadequate, the pig
owner supplied a new sample. In the case of a positive finding, information was submitted to
veterinary inspectors. The worm burdens were expressed as the number of larvae per gram of
muscle tissue (LPG).
Trichinella larvae recovered after artificial digestion were washed three to five times in cold water,
counted in triplicate and fixed in absolute ethyl alcohol for molecular typing. Larvae were identified
at the species level by multiplex PCR at the International Trichinella Reference Center (ISS, Rome,
Italy) and at the INEP, according to the protocol accredited at the European Union Reference
Laboratory for Parasites (http://www.iss.it/crlp).
The epizootiological surveillance of swine trichinellosis was performed using data from the Animal
Notification System, veterinary services, laboratory results, geographical and epizootiological
surveillance data.
GIS (Geographical Information System) was used for mapping the spatial distribution of Trichinella
spp. infected animals and all defined point of interest (pig farms, hunting section, slaughterhouses,
and dumps).

Trichinellosis is the one of most important zoonosis in the regions Branicevo and Podunavlje. The
re-emergence of trichinellosis was officially recognized in 1999 and in 2003, government declared
parishes Pozarevac, V.Gradiste, Golubac, Kucevo, M. Crnice and Zabari as endemic Trichinella
districts and established measures for control (Zivojinovic et al., 2009).
Figure 1 Trichinella prevalence in the region of Branicevo and Podunavlje in period 1995-2012.
276
Results from meat inspection at Branicevo and Podunavlje regions over an 18-year period (1995
2012) indicated that the level of Trichinella prevalence in slaughter domestic swine was relatively
steady from 1995 to 1998 (Figure 1).
A significant increase (0.839%) was observed from 1999 to 2004 followed by a significant decrease
in 2005 (0.27%) (Zivojinovic et al., 2009). Thereafter, the incidence declined from 2006 to 2010
with low increase in 2011 (0.15%) (Fig. 1). The decrease in prevalence can be explained by the
continued application of the control program organized at the VSI which is based on: the
identification of all the pig farms; systematic rodent control and improvement of biosafety measures
at pig production facilities; antihelminthic treatment of pigs with mebendazole; and the traceability
of infected animals (Zivojinovic et al., 2010). The education of farmers, hunters and consumers was
also included in the control program.
During the period 2010, from 192.707 muscle samples Trichinella infections were detected in 136
(0.07%) pigs. At slaughterhouses from 116.966 samples, 13 samples (0.01%) were positive, while
from 75.741 households, Trichinella infection has been detected in 123 (0.16%) pigs. Swine that
have been examined at slaughterhouses are mainly from big farms with high level of biosecurity
measures which is in accordance with determined t value (t=10,118) and statistically significant
difference (p<0.01) in percent of positive findings at slaughterhouses and slaughtering at
households (Table 1).
Table 1 Results of examinations domestic pigs in slaughterhouses and households in districts of Branicevo
and Podunavlje in 2010
Location of examination
Slaughterhouses
Households
In total
No of examinated pigs
116.966
75.741
192.707
No of Trichinella infected
13
123
136
%
0,01
0,16
0,07
We isolated 211 samples of domestic pigs which originated from households where Trichinella
infection was found in 2010 and 150 samples of pigs from big industrial farms. Trichinella infection
was detected in 25 (11.85%) samples, while 186 (88.15%) samples were negative. In fact, from the
total number of pigs from households, 40.98% were with Trichinella infection, while at industrial
farms that percent was 0%. The larvae isolated from 25 pigs were identified as T. spiralis. The
worm burdens were expressed as the number of larvae per gram of muscle tissue (LPG) and it was
from 0.03 to 20.
In the last 100 years, the increase in forests and fallow land, concomitant with a decrease in farms,
in Europe over the past 100 years has facilitated a great expansion of wild boar (Sus scrofa)
populations in some regions and increased transmission of Trichinella to animals and humans. The
common habit of hunters is leaving animal carcasses in the field after skinning or removing and
discarding the entrails, which increases the probability of transmission to new hosts (Pozio and
Murrell, 2006).
In total of 30 dogs from Branicevo and Podunavlje districts Trichinella infection were found in 7
(23.33%). All of them were stray dogs from municipality Pozarevac. T. spiralis was the only specie
found in dog population. The LPG was from 0.04 to 3.2.
During the same period, Trichinella infections were detected in 27 wild animals (7.99%), which
included 7 (4.02%) wild boars, 8 (6.78%) red foxes, 8 (19.05%) golden jackals and 4 wolves (Table
2).
T. spiralis was detected in 5 red foxes and 3 wild boars; T. britovi was detected only in population
of wild animals: 1 wild boar, 1 golden jackal, 1 red fox and 4 wolves; mix infection with T. spiralis
277
and T. britovi was detected in 2 red foxes and 1 golden jackal. T. spiralis and T. britovi are the two
main species circulating in Europe (Pozio et al., 2009) and in particular in the Romanian counties
bordering Serbia (Blaga et al., 2009).
Table 2. Results of examinations wild animals by artificial digestion in districts of Branicevo and Podunavlje
in 2010.
Animal species
No of examinated samples
No of Trichinella infected animals (%)
Wild boars (Sus scrofa)

Red foxes (Vulpes vulpes)
Golden jackals (Canis aureus)
Wolves (Canis lupus)
In total:
174
118
42
4
338
7 (5,93%)
8 (6,78%)
8 (19,05%)
4 (100%)
27 (7,99%)
The larval burdens related to T. spiralis ranged from 0.12 to 8.12, T. britovi from 0.11 to 19.45 and
mixed infections with both T. spiralis and T. britovi from 0.97 to 7.2. The lowest and the highest
worm burdens were detected in a wild boar and in a golden jackal, respectively.
According to Pozio and Murrell, 2006, the most important risk factors for domestic cycle are:
1) the intentional feeding of food waste containing pork scraps (Gamble et al., 2000) or intentional
or unintentional exposure to carcasses of dead swine or wildlife; these risks are usually
encountered in free-range pasturing
2) pigs allowed to scavenge on garbage dumps
3) feeding of wild game carcasses or scraps from hunting
4) horses fed with pork scraps or with carcasses of fur animals
5) sled dogs fed with carcasses of other dogs or of game in the arctic
6) the use of carcasses of slaughtered fur animals as food for other fur animals present at the farm
7) the use of meat of slaughtered crocodiles to feed other farmed crocodiles as observed in
Zimbabwe
8) the use of pork scraps to feed young crocodiles as demonstrated in Papua New Guinea.
In our work, epizootiological data were obtained by a questionnaire which included data on the type
of farm, number and species of all animals on farm, swine age category, type of production
(fattening or reproduction), breeding conditions, presence of stagnant water, water currents in the
backyard and near the backyard, contact with swine from other husbandries or with wild animals,
whether breeding of swine was the only occupation of the owner, feeding practices (whether swine
are fed with scraps or whether they have access to free ranging), former parasitological
examinations of slaughtered swine from the same farm, existence of Trichinella infected swine in
the yard, anti-helminthic treatment of swine. Introduced to the Animal Notification System (ANS)
and approached only by licensed users, data collected contributed to a better knowledge on endemic
foci and traceability. Since 2006, the spatial and temporal patterns of Trichinella infections in
domestic pigs have been recorded for Branicevo and Podunavlje area (Zivojinovic et al., 2010). We
identified risk factors such as the behavior to raise pigs near rivers (e.g., Danube, Morava, Mlava,
Pek, Jasenica, Kubursnica, Veliki Lug), small waterways and ponds where they can be in touch
with wildlife, which explained the finding of T. spiralis in domestic pigs as well as wild animals
hunted near human settlements. Also, the husbandry conditions on 90% of these backyard farms are
very poor due to the intentional feeding of food waste containing pork scraps, scavenging of pigs in
garbage dumps and the improper disposing of pig carcasses in the field. Furthermore for 10
settlements of this region, the Danube River forms a natural border between Serbia and Romania
where T. spiralis and T. britovi circulate among wild and domestic animals (Blaga et al., 2009). Our
results, as well as those from other authors (Cvetkovic et al., 2011), support the role of wolves as
278
the main reservoir of T. britovi in Serbia. In Serbia, it is mandatory to report Trichinella findings in
pigs to the veterinary services (Plavsic et al., 2009) because of their zoonotic potential.
Application of tools for epizootiological investigations in veterinary medicine, such as
Geographical Information Systems (GIS), offered a new approach and possibilities for the
eradication or control of infectious diseases. GIS is particularly useful for research conducted in
small areas strongly impacted by man. The first report of GIS application in Serbia was for
surveillance and monitoring of Trichinella spp. (Zivojinovic et al., 2010) at district Branicevo. We
used geographical data included location (latitude, longitude) of farm/ premises where Trichinella
infection has been detected, object relationship (proximity of piggeries to stagnant water, water
currents, garbage dumps), points of interest proximity of main roads, hunting sections, forests
with wild animals, industrial farms and slaughterhouses (Figure 1, and 2) all collected by
application of GARMIN Map Source (Garmin, Taiwan) that contains maps, waypoints, routes and
track.
Figure 1 Geographical location of big industrial swine farms (n = 5) in Branicevo and Podunavlje region
Figure 2 Geographical location of hunting sections (26) in Branicevo and Podunavlje region
279
Spatial and temporal patterns of Trichinella infection were made for the Branicevo and Podunavlje,
all settlements were recognized for the presence of Trichinella infection. According to geographical
distribution at Branicevo district, we identified presence of T.spiralis and T.britovi, but at
Podunavlje district only T. spiralis was present. From 11 investigated municipalities, at territory of
nine (Pozarevac, Kucevo, Veliko Gradiste, Malo Crnice, Golubac, Zabari, Smederevo, Velika Plana
and Smederevska Palanka) which present 81.82% of investigated territory we confirmed presents of
Trichinella species (Figure 3).
Figure 3 Geographical location of Trichinella infected domestic pigs in Branicevo and Podunavlje region
Figure 4 Geographical location of Trichinella species in Branicevo and Podunavlje region (

T. britovi,
Mix infection with T. spiralis and T.britovi)
280
T.spiralis,
Trichinella infection hasnt been confirmed in two municipalities Petrovac and Zagubica. Five big
industrial farms were recognized as Trichinella free (Figure 1). We also marked all 26 hunting
sections at this territory in aim to investigate Trichinella infection in wild animals, necessary for
monitoring parasite flow between the domestic and sylvatic cycles (Figure 2). In population of wild
boars, red foxes, golden jackals and wolves Trichinella infection has been confirmed in seven
municipalities (Pozarevac, Veliko Gradiste, Kucevo, Malo Crnice, Golubac, Petrovac and
Zagubica). Trichinella infection only in population of wild animals at territory of those two
municipalities Petrovac and Zagubica indicated high risk for domestic pigs, especially for free range
pigs which are common in this area.
Trichinella spiralis and Trichinella britovi were the only two species identified in the isolates as
single or mixed infections (Figure 4).
The identification of Trichinella spp. positive animals allowed to identify the foci of transmission
and to inform the veterinary services, the owners of pig farms and slaughterhouses and hunters
associations about the risk of transmission of these zoonotic agents.
Conclusion
According to our results, we concluded that risk factors for circulating Trichinella species between
domestic and wild species are numerously at Branicevo and Podunavlje district. The finding of T.
spiralis in domestic pigs as well as wild animals hunted near human settlements can be explained by
the behaviour to raise pigs near rivers (e.g., Danube, Morava, Mlava, Pek, Jasenica, Kubursnica,
Veliki Lug) small waterways and ponds where they can be in touch with wildlife (Zivojinovic et al.,
2013). Pigs and dogs allowed scavenging on garbage dumps (Zivojinovic et al., 2010). The
husbandry conditions on 90% of backyard farms with Trichinella infection are very poor. There is
intentional feeding of food waste containing pork scraps, scavenging of pigs in garbage dumps and
the improper disposing of pig carcasses in the field (Zivojinovic et al., 2013). Possibility of sylvatic
animals fed with carcasses of infected swine is present. There is a influence of human action such as
the habit of living animal caracasses in the field, which increase the probability of transmission to
new hosts. For 10 out of 256 settlements of this region, the Danube River forms a natural border
between Serbia and Romania where T. spiralis and T. britovi circulate among wild and domestic
animals (Blaga et al., 2009).
References
1.
2.
3.
4.
5.
Blaga, R., Gherman, C., Cozma, V., Zocevic, A., Pozio, E., Boireau, P.: Trichinella species circulating
among wild and domestic animals in 174 Romania. Vet. Parasitol. 159, 218221, 2009
Cuperlovic, K., Djordjevic, M., Pavlovic, S.: Re-emergence of trichinellosis in southeastern Europe due
to political and economic changes. Vet. Parasitol. 132, 159166, 2005
Cvetkovic, J., Teodorovic, V., Marucci, G., Vasilev, D., Vasilev, S., Cirovic, D., SofronicMilosavljevic, Lj.: First report of Trichinella britovi 177 in Serbia. Acta Parasitol. 56, 232235, 2011
European Community (2005) - Regulation (EC) No 2075/2005 of the European Parliament and of the
Council of 5 December 2005 laying down specific rules on official controls for Trichinella in meat. Off.
J. EC, L 338, 60-82.
Gamble H.R., Bessonov A.S., Cuperlovic K., Gajadhar A.A., van Knapen F., Nockler K., Schenone H.,
Zhu X.: International Commission on Trichinellosis: recommendations on methods for the control of
Trichinella in domestic and wild animals intended for human consumption. Vet Parasitol., 93,393-408,
2000
281

6.
The Manual of Standards for diagnostic tests and vaccines for terrestrial animals of the World Health
Organization for Animal Health (OIE, 2008), 305-313
7. Plavsic, B., Nedic, D., Micovic, Z., Stanojevic, S., Asanin, R., Krnjajic, D., 189 Tajdic, N., Milanovic,
S.: Veterinary information management system (VIMS) in the process of notification and management
of animal diseases. Acta Vet. (Beogr.) 59, 99108, 2009
8. Pozio E., Murrell K.D.: Systematics and epidemiology of Trichinella. Adv. Parasitol., 63, 368-439,
2006Pozio, E., Rinaldi, L., Marucci, G., Musella, V., Galati, F., Cringoli, G., Boireau, 195 P., La Rosa,
G.: Hosts and habitats of Trichinella spiralis and 196 Trichinella britovi in Europe. Int. J. Parasitol. 39,
7179, 2009
9. Pozio E. Taxonomy, biology and epidemiology of Trichinella parasites. Guidelines for the surveillance,
management, prevention and control of trichinellosis. FAO/WHO/OIE, 31-35, 2007.
10. Zivojinovic M., Dimitrijevic G., Lazic M., Petrovic M., Sofronic-Milosavljevic Lj.: Trichinella
prevalence in swine in an endemic district in Serbia: Epidemiology and control. Vet. Parasitol., 159,
358-360, 2009
11. Zivojinovic, M., Sofronic-Milosavljevic, Lj., Radojicic, S., Kulisic, Z.:Application of GIS in
epizootiological surveillance of swine trichinellosis in one endemic district in Serbia. Parasite, 17, 369373, 2010
12. Zivojinovic M., Sofronic-Milosavljevic Lj., Cvetkovic J., Pozio E., Interisano M., Plavsic B., Radojicic
S., Kulisic Z.: Trichinella infections in different host species of an endemic district of Serbia. Vet.
Parasitol., 194, 136-138, 2013
282
INSIGHT INTO THE PRESENT PESTICIDE CONTAMINATION AND COPEPODS

STATUS (Crustacea: Copepoda) OF SURFACE WATER IN IRRIGATION CANALS IN
VOJVODINA
Vojislava Bursi1*, Gorica Vukovi2, Aleksandra Petrovi1, Maja Meseldija1, Tijana Zeremski3,
Aleksandar Jurii1, Dragana Rajkovi1
1
Department of Environmental and Plant Protection, Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia
2
Institute of Public Health of Belgrade, Serbia
3
Institute of Field and Vegetable Crops, Novi Sad, Serbia
Abstract
The concern about environmental and health issue related to pesticides makes it important to
understand the possible hazards associated with their use and how to minimize risks. The use of
agrichemicals has been steadily increasing in the country during the last three decades and has
continued to grow in recent years. The fate of pesticides in the environment depends, above all, on
their persistence, but also on the characteristics of soil and water. In order to avoid harmful effects
on health and the environment due to the exposure to pesticides and to obtain more data which
would be the basis for the list-legislation setting the maximum residue levels of pesticides in surface
waters, the work on it needs to be ongoing and thorough. In order to gain the insight into the present
pesticide contamination of surface water, two main irrigation canals in Vojvodina (Serbia) elarevo
and Vrbas were examined for the pesticide residue content and presence of copepods as
bioindicators by sampling water monthly from December 2013 to November 2014. The aim of this
work was to determine the trace levels of twenty-one pesticides and the products of their
transformation in irrigation canals, from triazine and urea herbicides and their influence on
copepods species diversity and abundance in canal water. A simple multiresidue method was used
for the determination of herbicides in surface water using LC-MS/MS with ESI. The water analyses
pointed at the detection of the pesticides whose detected values are above the maximum available
concentrations MACs in the period from May to October. Species identification and zooplankton
abundance calculation were conducted by the filtration of the water samples and examination of the
residues using a stereo camera BTC TCA-3.0C with the maximum magnification of 160x. The
water samples obtained from the locality elarevo had high abundance of copepods from two
genera (Diaptomus and Cyclops) in summer. However, in the water samples from the locality Vrbas
no copepod species were found due to the pesticide residues presence.
Keywords: pesticide residues, copepods, fresh water, canals
Introduction
Among all anthropogenic chemicals, the pesticides may cause the most serious problems in the
environment as they are chemicals specifically designed to kill organisms (both the pest target and
other non-target organisms) and they are released into the natural environment intentionally
(Hanazato, 2001). The pesticides used in agriculture, forestry and water management demonstrate
multiple effects on molecules, cells, tissues, organs, individuals, populations and communities.
The presence of zooplankton is crucial in aquatic ecosystems because of their leading role in
maintenance of freshwater food chains as a necessary link between the primary producers, primary
and secondary consumers and decomposers. They provide food for the predator species, especially
283
amphibians and fish, and due to their fast and strong metabolic activity they also recycle certain
nutrients, and therefore feed on living material or detritus dissolving it. In aquaculture, copepods
have a multiple role: food for small fish, micropredators of fish and other organisms, fish parasites,
intermediate hosts of fish parasites and as hosts and vectors of human and animal diseases (Piasecki
et al., 2004).
According to Hanazato (2001), zooplanktons are one of the most sensitive animal groups to the
toxic effects of the chemicals. However, Braginskiiet al. (1979) have concluded that depending on
concentration, the pesticides may either suppress or stimulate the plankton organisms, although,
regarding the zooplankton, pesticides almost always lead to their elimination in freshwater
biocenoses. The abundance, species diversity and seasonal population dynamics of zooplankton
represent very sensitive and accurate bioindicators of freshwater ecosystems conditions, such as
water quality, eutrophication, pollution levels and presence of contaminants. Zooplanktons as well
as other aquatic organisms prefer habitats which have stabile and constant physical, chemical and
biological features. Variations in one or more of these abiotic and biotic factors could lead to stress,
migrations or even death of zooplankton individuals. Balakrishna et al. (2013) emphasize that
zooplankton has been widely used in assessment of aquatic pollution, because of their sensitivity to
small changes in the environment, short generation time and possible parthenogenesis. According to
Day (1990), zooplankton are known to accumulate persistent lipophilic chemicals, particularly the
organochlorine pesticides to concentrations greater than those found in their environment, and
therefore contribute the pesticide residues increase and maintenance in the higher trophic levels.
A lot of studies worldwide have confirmed the negative effect of pesticide residues on the
zooplankton in freshwater bodies worldwide (DeLorenzo et al., 2002; Mukherjee et al., 2010;
Stampfli et al., 2011; Dhembare, 2011), as well as on the freshwater copepods (Day, 1990;
Hanazato, 2001; Piasecki et al., 2004; Yiit, 2006).
The intensive use of pesticides during recent decades has led to the accumulation of their residues in
the environment which especially endangers water quality in the canals in Serbia. Since the water of
rivers and canals are used for drinking and irrigation purposes not only in Serbia but in the whole
world as well, it has become imperative to study the extent and magnitude of pesticides in these
water bodies (Bursi et al., 2013). Data on pesticide residue effects on zooplankton in smaller water
bodies in Serbia are rare, so this study was aimed in obtaining preliminary insight into the present
pesticide contamination of two irrigation canals in Vojvodina and its effect on copepod species and
populations.

In order to gain the insight into the present pesticide contamination of surface water and copepod
status, two main irrigation canals in Vojvodina, elarevo and Vrbas were examined by sampling
water monthly from December 2012 to October 2013, away from the zone of the direct influence of
waste water and tributaries influx. The water samples for analytical analysis (500 ml) were taken
according to the guidelines for taking samples of surface water from rivers and streams SRPS ISO
567-6. This water samples were stored in amber bottles in the dark, at 4 C, during transport to the
laboratory until further analyses. The trace levels of twenty-one pesticides and the products of their
transformation in irrigation canals, from triazine and urea herbicides were determined. The water
samples (1000 ml) for qualitative and quantitative analysis of copepod status were taken using
Standard Ruttner Water Samplers (1000 ml volume). In order to increase positive sampling results
plankton nets were used for qualitative determination of species diversity. All samples were stored
in plastic bottles, properly labelled and transported to the laboratory for the further analysis.
284
Analytical method
The sample preparation was performed by OASIS HLB cartridges (200 mg). They were conditioned
with 2 ml of methanol and 2 ml of HPLC - grade water. After conditioning step, 250 ml volume of
water was enriched on OASIS HLB cartridge with the flow rate settled between 3 and 10 ml/min.
The cartridge was flushed with 10 ml of HPLC - grade water. Pesticides were eluted from the
sorbent with 5 ml dichloromethane and collected in the 12 ml amber glass vial. The solvent was
evaporated in the stream of nitrogen in the Techne - Dry block and the residue was dissolved in the
0.25 ml of initial mobile phase. An amount of 10 l was injected into LC-MS-MS system.
Stock standard solutions for each of the analyses were prepared in acetonitrile at 100 g/ml and
stored in the dark at 4 C. Standard solutions of the mixtures of all compounds at concentrations
ranging between 10 ng/ml and 200 ng/ml were prepared by appropriate dilution of the stock
solutions in acetonitrile. High purity standards (mixture of pesticides) were purchased from LGC
Standards.
The analytical conditions for the determination of pesticides are shown in Table 1. In LC-MS-MS,
data acquisition was performed in multiple reaction monitoring (MRM) modes.
Table 1. LC-MS/MS l conditions
HPLC
Column
Column temperature
Mobile phase
Flow rate
Injection
MS
Ionisation
Nebulizer gas
Dry gas
Vaporiser
Charging Voltage
Capillary
Agilent 1200
XBridge C18, 150 x 3.0 mm, 3.5 m, Waters
40 C
A = 0.1 % HCOOH in methanol
B = 0.1 % HCOOH in water
A: B = 70 : 30
0.5 ml/min
10 l
Agilent 6410
ESI
50 psi
5 L/min at 350 C
250 C
2000 V
3500 V
Copepode sampling
The sampling of copepod species was conducted by the filtration of the water samples (1000 ml)
and examination of the residues, using a stereo camera BTC TCA-3.0C with the maximum
magnification of 160x. The copepod species were identified up to genera level according to Dussart
(1969) identification keys.
Results
Analytical method
MRM conditions for QQQ and coefficients of correlation with validation parameters are presented
in Table 2.The obtained limits of quantification - LOQs for all twenty-one investigated pesticides
were 0.020 g/l (Fig. 1).
285
In the samples obtained from the canal Vrbas twelve pesticides were detected during the whole
research period. The highest concentrations have had terbuthylazine-desethyl in May and prometryn
in July 2013 (Graph. 1.).
Fig. 1. TIC MRM chromatogram from NE7500 0.1 g/mL
Table 2. MRM conditions for QQQ and coefficients of correlation with validation parameters
Pesticide
MRM transition
(m/z)
MW
Atrazine
215
Carbetamide
237
Chloridazon
221
Chlorotoluron
212
Cyanazine
240
Desethylatrazine
187
Desisopropyl-atrazine
173
Dimefuron
338
Diuron
232
Ethidimuron
464
Isoproturon
206
Linuron
248
Metabromuron
258
Metamitron
202
Metazachlor
277
Methabenzthiazuron
221
Metolachlor
283
Propazine
229
Simazine
201
Terbuthylazine
229
Terbuthylazine-desethyl
201
216174
216 96
238 72
238 192
222 104
222 92
213 46
213 72
241 214
241 104
188 146
188 104
174 104
174 68
339 256
339 140
233 72
233 160
265 208
265 162
207 72
207 165
249 160
249 182
259 170
259 148
203 104
203 175
278 134
278 210
222 165
222 150
284 252
284 176
230 146
230 188
202 132
202 96
230 174
230 104
202 146
202 110
286
tR (min)
R2
RecoveryRSD
(%)
16.724
1.000
82.935.77
10.464
0.9998
91.105.17
4.959
0.9998
91.205.10
16.209
0.9998
85.834.90
10.912
0.9998
82.306.17
6.165
0.9997
88.635.93
3.036
0.9999
76.436.73
22.103
0.9981
76.276.97
18.474
0.9999
76.573.97
3.628
0.9987
107.776.93
18.056
1.000
68.878.93
22.163
0.9998
74.376.57
16.469
0.9997
73.336.00
4.401
0.9998
72.004.63
18.067
1.000
81.635.50
16.830
1.000
83.834.97
24.409
0.9996
74.475.80
22.054
0.9993
73.536.77
11.658
0.9999
83.935.23
22.499
0.9996
70.707.60
13.948
0.9997
85.638.62
The water samples from the canal elarevo have had eight detected pesticides, only from May till
October 2013, when the concentration of prometryn was the highest (10.57g/l). High
concentrations were obtained also for terbuthylazine-desethyl in May (Graph. 2.)
Graph. 1. Detected pesticides in the samples from canal Vrbas (detected concentration g/l)
Graph. 2. Detected pesticides in the samples from canal elarevo (detected

concentration g/L)
Copepode samplings
During one year research period, no copepod species were found in the water samples obtained
from the canal Vrbas. Only two genera, Cyclops and Diaptomus were detected in the canal
elarevo, with very low population densities (Tab. 3.).The highest abundance for Cyclops sp. was
detected during September and for Diaptomus sp. during August 2013.
287
elarevo
Vrbas
Tab. 3. The copepods population densities (ind/l)

dec. 12
jan. 13
feb. 13
mar. 13
apr. 13
maj. 13
jun. 13
jul. 13
avg. 13
sep. 13
okt. 13
nov. 13
Cyclops sp.
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
Diaptomus sp.
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
0.00000
Cyclops sp.
1.33333
0.66667
1.33333
2.00000
3.33333
3.33333
6.66667 14.00000 16.66667 17.33333 12.00000 10.00000
Diaptomus sp.
0.00000
0.66667
0.66667
1.33333
2.66667
4.00000
5.33333
9.33333 13.33333 12.66667
9.33333
6.66667

Based on the results of the pesticide residues analyses in the canal water and in accordance with
Directive 2008/105/EC, which by Annex X defines the list of priority substances in water
management policy comprising 33 pollutants out of which 14 are pesticides. Our research work
pointed at the detection of the pesticides which are not on that list but whose detected values are
above the maximum available concentrations MACs.
Twelve herbicides were registered in the water samples from the canal Vrbas and eight from the
canal elarevo. Although water samples obtained from the canal elarevo have had lower number
of detected pesticides, their concentrations were higher (over 10 g/L) comparing to results
acquired from the canal Vrbas.
The small values for population densities of copepod species in spring could be explained by the
fact that neonates are most sensitive to pesticides (Hanazato, 2001). Therefore, populations
composed of a large proportion of neonates are more sensitive to pesticides, which are frequently
happened in a growing phase, when the production of the neonates is intensive. Low population
densities and species diversity of copepods could be also conditioned by their annual fluctuations.
Normally, zooplankton abundance is higher in spring and autumn and lower in summer and winter,
as their abundance is limited by nutrient availability (Yigit, 2006).
The pesticides that have had the highest concentration at both localities were terbuthylazinedesethyl and prometryn. According to Kegley et al. (2014) there are no valid data for aquatic
ecotoxicity ground water contamination of terbuthylazine-desethyl, although terbuthylazine itself is
highly toxic for zooplankton and moderately toxic for fish. The same authors emphasize that this
pesticide demonstrates multiple effects on zooplankton, such as accumulation, intoxication and
mortality. Prometryn is slightly too moderately toxic for zooplankton, causing intoxication and
mortality and potential ground water contaminant (Kegley et al., 2014).
However, all pesticides have had low concentrations at both localities, so apparently they are not
the main reason for none (Vrbas) or small copepod population densities (elarevo). According to
Day (1990), organophosphate insecticides, the synthetic pyrethroids, many herbicides and their
residues may not be detectable in the organisms (not bioaccumulated to any extent) and have no
observable biological effects, but the organism may experience a toxic effect. Furthermore, such
chemicals present a problem in the assessment of environmental damage from pesticide
contamination and techniques to detect the effects of very low concentrations of these nonlipophilic pesticides in natural waters on biota need further development (Day, 1990). Braginskii et
al. (1979) state that low concentrations of pesticides could have a stimulating effect on the
functional activity of bacterial plankton and changes coupled with this in biogeochemical cycles of
nitrogen and phosphorus, as well as the elimination of the water fleas from the zooplankton
promotes the development of the secondary eutrophication and increase the biomass of the
phytoplankton.
288
The main environmental hazard resulting from accumulated residues of pesticides in zooplankton is
their transfer to higher trophic levels (Day, 1990). In conclusion, pesticides along with the abiotic
and biotic factors play a crucial role in copepods species diversity and population dynamics.
Consequently, analysis of pesticides and their residues in the water, as well as their interaction with
zooplankton are important issues in ecotoxicologial and environmental studies.
Acknowledgement
The authors acknowledge the financial support of the Ministry of Education and Science, Republic
of Serbia, Project Ref. III43005 and TR31072.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Balakrishna D., Mahesh T., Samatha D., Ravinder R.T.: Zooplankton Diversity Indices of Dharmasagar
Lake, Warangal District (A.P.). International Journal of Research in Biological Sciences, 3/3, 109-111,
2013
Braginskii L.P., Breskaravainaya V.D., Shcherban' E.P.: Reaction of freshwater phyto- and zooplankton
to pesticides. Biol Bull Acad Sci USSR, 6/4, 487-493, 1979
Bursi V., Gvozdenac S., Vukovi G., Cara M., Pucarevi M., Lazi S., Vukovi S., Zeremski T., Ini
D. (2013): Comparative study of pesticide residue levels in water from irrigation canal with LC-MS/MS
and biological methods, Proceeding bookof 3rd International Conference of Ecology Essays on
Ecosystem and Environmental Research, May 31- June 5., 2013. Tirana, Albania, 870-874
Day K.E.: Pesticide residues in Freshwater and Marine Zooplankton: A Review. Environmental
Pollution, 67, 205-222, 1990.
DeLorenzo M.E., Taylor L.A., Lund S.A., Pennington P.L., Strozier E.D., Fulton M.H.: Toxicity and
Bioconcentration Potential of the Agricultural Pesticide Endosulfan in Phytoplankton and Zooplankton.
Arch. Environ. Contam. Toxicol., 42, 173-181, 2002
Dhembare A.J.: Diversity and its Indices in Zooplankton with Physico-Chemical Properties of Mula
Dam Water Ahmednagar, Maharashtra, India. European Journal of Experimental Biology, 1/4, 98-103,
2011
Dussart B.: Les Coppodes des eaux continentales. (D'europe Occidentale), Tome II: Cyclopodes et
Biologie. Paris, 1969.
Hanazato T.: Pesticide effects on freshwater zooplankton: an ecological perspective. Environmental
Pollution, 112, 1-10, 2001.
Kegley S.E., Hill B.R., Orme S., Choi A.H.: PAN Pesticide Database, Pesticide Action Network, North
America (Oakland, CA, 2014), http:www.pesticideinfo.org
Mukherjee B., Nivedita M., Mukherjee D.: Plankton diversity and dynamics in a polluted eutophic lake,
Ranchi. Journal of Environmental Biology, 31/5, 827-839, 2010
Piasecki, W., Goodwin A.E., Eiras J.C., Nowak B.F.: Importance of Copepoda in Freshwater
Aquaculture. Zoological Studies, 43/2, 193-205, 2004
Stampfli N.C., Knillmann S., Liess M., Beketov M.A.: Environmental context determines community
sensitivity of freshwater zooplankton to a pesticide. Aquatic Toxicology, 104, 116-124, 2011.
Yiit S.: Analysis of the Zooplankton Community by the Shannon-Weaver Index in Kesikkpr Dam
Lake, Turkey. Tarim Bilimleri Dergisi, 12/2, 216-220, 2006.
289
A SEROLOGICAL SURVEY ON AUJESZKY'S DISEASE IN WILD BOARS IN THE

REGION OF VOJVODINA IN SERBIA
Sava Lazi1*, Vesna Milievi2, Gospava Lazi1, Ljubia Veljovi2, Diana Lupulovi1, Jasna
Prodanov-Radulovi1, Jelena Maksimovi-Zori2, Sinia Gruba1, Radoslav Doen1,
Tama Petrovi1
1
2

Abstract
The article presents the results on the presence of specific antibodies against Aujeszky's disease
(AD) virus in blood samples of wild boars hunted in the territory of the Autonomous Province of
Vojvodina in R. Serbia during hunting season 2013-2014. Blood samples were collected during the
evisceration of internal organs in hunted wild boars, from the abdominal vein or heart chamber.
Examination for the presence of specific antibodies against AD was carried out in two virology
laboratories: Scientific Veterinary Institute of Serbia (Belgrade) and Scientific Veterinary Institute
"Novi Sad" (Novi Sad), using commercial ELISA kits for the detection of antibodies against AD.
The study included 434 blood samples of wild boars, originating from 6 locations, that is, epizootic
units in Vojvodina. According to the evaluation of the hunting organizations for the aforementioned
hunting season, the total population of wild boars in the 6 epizootic units included 7,065 animals.
Thus, this examination encompassed 6.14% of the total number of wild boars in the area of
Vojvodina Province.
Antibodies against AD were detected in 179 samples, making 41.24% of the total number of blood
samples. The greatest number of seropositive wild boars was established in epizootic unit of Srem,
where specific IgG anti-AD antibodies were detected in 68 (51.52%) of 132 tested samples. Also,
high percentage of seropositive samples was determined in the epizootic unit of West Baka. In
total, 118 samples were analyzed, and 49.15% thereof reacted positive. The lowest rate of
seropositive samples was detected in the unit of Severna Baka. In this epizootic unit, 24 blood
samples were tested, and antibodies against AD were found in 6 samples, which are still considered
high seropositivity percentage with 25% of positive animals.
The results of this examination indicated that Aujeszky's disease virus infection is widespread in the
population of wild boars in the territory of Vojvodina.
Keywords: Wild boar, Seroprevalence, Aujeszkys disease, ELISA
Introduction
Wild boar (Sus scrofa) populations are found in many regions worldwide. The role of wild boar as a
reservoir of some viruses, and thus a possible source of infection for domestic swine and other
animals is still unclear (Mller et al., 2011; Ruiz-Fons et al., 2008). Aujeszkys disease (AD,
pseudorabies) is a notifiable disease caused by Suid herpesvirus 1 (SuHV), syn. Aujeszkys disease
virus (ADV), which belongs to the family Herpesviridae, subfamily Alphaherpesvirinae, genus
Varicellovirus (Mettenleiter, 2000). The Aujeszkys disease virus (ADV) is an important pathogen
of pigs and infects almost all mammalian species except man (Keros et al., 2014; Pannwitz et al.,
2012). However, pigs are the only animal species that can survive the infection with ADV, which
accounts for its ability to be subclinically (latently) infected (Martinez-Lpez et al., 2009) while
infected individuals of all other animal species succumb to the disease without shedding the virus
(Komromi and Szab, 2005). Because of the substantial economic losses AD causes to the pig
industry, it represents one of the most dangerous diseases in domestic pigs (Pannwitz et al., 2012).
290
In Europe, ADV has been eliminated from domestic pig populations in many countries (Mller et
al., 2011). However, despite the tremendous progress made to control and eliminate the disease in
domestic pigs, ADV infections appear to be widespread in populations of non-domestic swine,
including feral pigs, wild boar and hybrids, across the world (Pannwitz et al., 2012). First evidence
for the occurrence of ADV in wild boars was reported from the USA, Italy, and the Netherlands in
the mid-1980s (Mller et al., 2000). In recent years, ADV infections in wild boar populations have
also been reported from many European countries, including the Czech Republic, France, Slovenia,
Croatia, Poland, Russia, Switzerland and Spain (Albina et al., 2000; Sedlak et al., 2008; upancic et
al., 2002; Vengust et al., 2006). Direct impact of AD in wild boar population dynamics is
considered to be low, but AD outbreaks with associated wild boar mortality have been reported and
restrictions to wild boar movements may also have an impact on wild boar production for hunting
(Ruiz-Fons et al., 2008).
There are no recently published data concerning detection the ADV in wild boars population in
Vojvodina province. However, Mller et al. (2011) have reported an ADV infection in border
regions between Hungary and Serbia, and Keros et al. (2014) suggested the possibility of virus
spread, especially among wild boars, between the borders of Croatia and Serbia. It should be
stressed that domestic pig population in Vojvodina is enzootically infected with ADV (Pui et al.,
2011). One of the characteristics of outdoor swine production in some regions in Vojvodina
Province is raising free-roaming domestic pigs, where they share forest habitat with wild boars
(extensive grazing) (Prodanov-Radulovi et al., 2011). In such conditions, the contacts between
wild boars and domestic pigs kept in woods (free range) may occur occasionally (Albina et al.,
2000). Since wild boars and domestic pigs have the same susceptibility to various infections,
including Morbus Aujeszky virus, there is a major concern to monitor the epidemiological situation
of wild boars especially when control measures in domestic pigs are implemented. The aim of the
current study was to investigate the presence of ADV antibodies in hunted wild boars of Vojvodina
region.

Blood samples and sampling procedure
Blood sampling was performed within the framework of monitoring of classical swine fever in wild
boar population pursuant to the Instruction for monitoring of classical swine fever in wild boars in
2013 and 2014 (Veterinary directorate, No. 323-02-8407/2013-05, dated 28/10/2013). During
evisceration of internal organs of hunted wild boars, determination of animals age and blood
sampling was performed. The age was determined according to the number of molar teeth in the
lower jaw. All hunted animals were distributed into 4 age categories: 0-6 months, 6-18 months, 1.52.5 years and older than 2.5 years. Blood sampling was performed by puncture of abdominal vein
and/or heart chamber using disposable sterile plastic syringes and injection needles. The samples
were transferred into sterile 5 mL tubes and transported to the laboratories. Each sample was
accompanied by a Form containing relevant data on the hunting ground, shooting date,
identification number of hunted boar, material sample and animals age. Separation of blood serum
was performed by the method of spontaneous coagulation and/or centrifugation. Separated blood
serum was poured into the 2mL eppendorf cuvettes and frozen at -20C until testing. In this
manner, 434 wild boar blood serum samples were collected for the purpose of this research.
Localities for blood sampling
The territory of Vojvodina is divided into 6 epizootiological units that correspond with the
administrative regions, except for Banat epizootiological unit composed of two administrative
regions (North Banat and Middle Banat). The number of collected samples according to
291
epizootiological units was as following: Srem -132; West Baka 118; South Baka 117; North
Baka 24; Banat - 22 and South Banat 21.
Blood sample examination
Detection of antibodies against Aujeszkys disease virus was performed in the laboratories of the
Institute of Veterinary Medicine of Serbia, Belgrade and Scientific Veterinary Institute Novi Sad
in Novi Sad using commercial ELISA kits Ingezim ADV TOTAL and IDEXX PRV/ADV gB Ab
test.
Results
The obtained results were displayed in Tables. Data on the presence of ADV-specific antibodies in
the examined samples in relation to the number of examine samples and number of wild boars in
epizootiological units in Vojvodina, are presented in Table 1.
Table 1. Number of wild boars, number of examined blood sera and findings according to epizootiological
units in Vojvodina
No.
Epizootiological
unit
Srem
1
West Baka
2
South Baka
3
North Baka
4
Banat
5
South Banat
6
Total
No. of wild
boars
No. of examined
blood sera
2,080
1,445
1,670
130
540
1,200
7,065
132
118
117
24
22
21
434
% of examined
samples compared
with the total number
of wild boars
6.35
8.17
7.00
18.46
4.07
1.75
6.14%
Finding: Number (%)

Positive
Negative
68 (51.52)
58 (49.15)
34 (29.06)
6 (25.00)
6 (27.27)
7 (33.33)
179(41.24)
64 (48.48)
60 (50.85)
83 (70.94)
18 (75.00)
16 (72.73)
14 (66.66)
288(58.76)
According to the data in Table 1, the greatest number of examined wild boar blood samples
originated from the epizootiological unit of Srem, which is characterized by the largest wild boar
population in the territory of Vojvodina. The number of samples examined in this epizootiological
unit was 132, and ADV-specific antibodies were detected in 68 samples indicating a seroprevalence
rate of 51.52%. High ADV seroprevalence of 49.15% was established in wild boars from West
Baka epizootiological unit. However, in other epizootiological units, the ADV seroprevalence
ranged between 25% and 33%, indicating that more than a quarter of wild boar population in
Vojvodina is infected with Aujeszkys disease.
The finding of antibodies against Aujeszkys disease was presented according to the age of
examined wild boars. The data on the total number of examined blood samples and antibody finding
according to epizootiological units and animals age are displayed in Table 2.
Table 2: The finding of antibodies against Aujeszkys disease according to the age of examined wild boars
from epizootiological units of Vojvodina
Epizootiological
unit
Srem
West Baka
South Baka
North Baka
Banat
South Banat
Total
0-6 months
Exam Pos. (%)
14
6 (42.9)
4
0
8
2 (25)
4
0
3
1 (33)
0
33
9 (27.3)
Neg.
8
4
6
4
2
24
6-18 months
Exam. Pos.(%)
40
16 (40)
40
20 (50)
53
11(20.8)
14
2 (14.3)
9
1 (11)
10
2 (20)
166
52(31.3)
Neg.
24
20
42
12
8
8
114
292
1.5-2.5 years
Exam Pos.(%)
32
17 (53.1)
26
10 (38.5)
22
8 (36.4)
1
1
3
0
7
3 (42.6)
91
39(42.9)
Neg.
15
16
14
0
3
4
52
> 2.5 years

Exam Pos.(%)
46
29 (63)
48
28(58.3)
34
13(38.2)
5
3 (60)
7
4 (57)
4
2 (50)
144 79(54.9)
Neg.
17
20
21
2
3
2
65
As obvious from Table 2, antibodies against Aujeszkys disease were detected in all age categories
of wild boars in the epizootiological units of Srem and South Baka. In Srem epizootiological unit,
the highest percentage of seropositive wild boars, 63%, was recorded in the age category above 2.5
years. However, the percentage of seropositive animals of all age categories was quite high in this
region, ranging from 40% to 53%. In South Baka, the highest prevalence of seropositive animals
was established in the age category > 2.5 years, being 38.2%, whereas seropositivity rate among
other age categories ranged between 20% and 36%. In the unit of West Baka, high percentage of
seropositive animals was detected in age categories > 2.5 years and 6-18 months, being 58.3% and
50%, respectively. As regards the age category, the majority of examined wild boars were from the
age category 6-18 months (166) and > 2.5 years (144), whereas only 33 examined animals were
piglets from age category below 6 months. The percentage of seropositive wild boars gradually
increases with increase of animals age. The lowest and highest seroprevalence rates were
established in piglets below 6 months and boars > 2.5 years old being 27.3% and 54.9%,
respectively.
Discussion
The presented results indicate the presence of ADV infection in the population of wild boars in the
territory of Vojvodina, Republic of Serbia. The occurrence of the disease in wild boars was
confirmed and reported by several authors from neighbouring countries such as Croatia and
Hungary (Keros et al. 2014; upancic et al., 2002; Komromi et al., 2005) as well as from
numerous countries in Europe and America (Mller et al., 2011). The infection has commonly been
confirmed by serological examination; however, virus identification in hunted wild boars using
molecular methods has been increasingly reported during the past few years. The seroprevalence of
Aujeszkys disease in hunted wild boars in several countries and regions in Europe is variable, yet
generally high. Thus, the following seroprevalence rates were reported in some countries: 51% in
central Italy (Lari et al., 2006); 54.54% in Maslovaka Gora in Croatia (upani et al., 2002); 26%
in Slovenia (Vengust et al., 2006), and 30% in Slovakia (Sedlak et al., 2008). The analysis of the
results on seroprevalence of Aujeszkys disease in Germany, which was monitored throughout 24
years in 66 regions, ranges between 0.4 and 15.9%. However, in some regions, the seroprevalence
rate reached even more than 30% during 2006 and 2007 (Pannwitz et al., 2012). The results on
seroprevalence of Aujeszkys disease among the wild boar population in Vojvodina region,
Republic of Serbia, presented in this article are similar to the results reported in the majority of
European countries.
Analysis of presented data on seroprevalence of Aujeszkys disease according to age category of
examined wild boars indicates close correlation of our results with those reported in the literature.
The results of several authors suggested the highest seroprevalence rates in oldest age categories of
wild boars (Mller et al., 2012; Lari et al., 2006; Vengust et al., 2006). According to our results, the
seroprevalence of Aujeszkys disease in hunted wild boars older than 2.5 was 54.9%, whereas
lowest rates were recorded in piglets below 6 months, being 27.3%
Further research of Aujeszkys disease in wild boars is necessary, especially in the aspect of the
spread and persistence of the virus among the wild boar population. Wild boars are potential
infection reservoir for domestic pigs but also for other animals such as hunt dogs, wild carnivores,
etc. Molecular characterization of isolates of ADV in wild and domestic pigs as well as of virus
isolates in other animal species could contribute to better understanding and elucidation of
numerous epidemiological aspects of persistence and spread of Aujeszkys disease in the
environment.
293
Acknowledgments
The research was carried out in the framework of the Project No TR 31084, which was financially
supported by the Ministry of Education, Science and Technological Development of the Republic of
Serbia.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Albina E., Mesplede A., Chenut G., Le Potier M.F., Bourbao G., Le Gal S., Leforban Y.: A serological
survey on classical swine fever (CSF), Aujeszkys disease (AD) and porcine reproductive and
respiratory syndrome (PRRS) virus infections in French wild boars from 1991 to 1998. Veterinary
Microbiology, 77, 43-57, 2000
Keros T., Brni D., Prpi J., Deak D., Jemeri L., Roi B., Bedekovi T.: Characterisation of
pseudorabies virus in domestic pigs and wild boars in Croatis. Acta Veterinariy Hungarica, 62, 4, 512519, 2014
Komromi M., Szab I.: Eradication of Aujeszkys disease from a large-scale pig farm. Acta
Veterinaria Hungarica, 53 (4), 515524, 2005
Lari A., Lorenzi D., Nigrelli D., Brocchi E., Faccini S., Poli A.: Pseudorabies virus in European wild
boar from central Italy. Journal of Wildlife Diseases, 42 (2), 319-324, 2006
Martinez-Lopez B., Carpenter TE., Sanchez-Vizcaino JM.: Risk assessment and cost-effectiveness
analysis of Aujeszkys disease virus introduction through breeding and fattening pig movements into
Spain. Prev. Vet. Med., 90, 1016, 2009
Mettenleiter TC.: Aujeszkys disease (pseudorabies) virus: the virus and molecular pathogenesis.
Veterinary Research, 31, 99-115, 2000
Mller T., Conraths FJ., Hahn EC.: Pseudorabies virus infection (Aujeszkys disease) in wild swine.
Infectious Disease Review, 2, 27-34, 2000
Mller T., Hahn EC., Tottewitz F., Kramer M., Klupp BG., Mettenleiter TC., Freuling C.: Pseudorabies
virus in wild swine: a global perspective. Archiv Virology, 156, 1691-1705, 2011
Pannwitz G., Freuling C., Denzin N., Schaarschmidt U., Nieper H., Hlinak A., Burkhardt S., Klopries
M., dedek J., Hoffmann L., Kramer M., Selhorst T., Conraths F.J., Mettenleiter T. and Mller T.: A
long-term serological survey on Aujeszkys disease virus infections in wild boar in east Germany.
Epidemiol. Infect., 140, 348-358, 2012
Prodanov-Radulovi J., Doen R., Pui I., Stojanov I., Lupulovi D., Ratajac R.: The transmission and
spreading routes of Aujeszkys disease in swine population. Biotechnol.Anim.Husb., 27, 3,867-874,
2011
Pui I., Prodanov-Radulovi J., Doen R., Stojanov I., Stojanovi D., Petrovi T.: Epizootical
characteristics of Aujeszky's disease in Vojvodina region and biosecurity concerns. Biotechnol. Anim.
Husb., 27(3), 875-882, 2011
Ruiz-Fons F., Segales J. & Gortazar C.: A review of viral diseases of the European wild boar: effects of
population dynamics and reservoirs role. Vetrinary Journal, 176, 158169, 2008
Sedlak K., Bartova E., Machova J.: Antibodies to selected viral diseas agents in wild boars from the
Czech Republic. Journal of wildlife diseases, 44, 777-780, 2008
Vengust G., Valencak Z., Bidovec A.: A serological survey of selected pathogens in wild boar in
Slovenia. Journal of Veterinary Medicine, Series B: Infectious Diseasess and Veterinary Public Health,
53, 24-27, 2006
upancic ., Juki B., Lojki M., a ., Jemeri L., Stareina V.: Prevalence of antibodies to classical
swine fever, Aujeszkys disease, porcine reproductive and respiratory syndrome, and bovine viral
diarrhoea viruses in wild boars in Croatia. Journal of Veterinary Medicine, Series B: Infectious
Diseasess and Veterinary Public H
294
VIRUSES IN ENVIRONMENT: SITUATION IN VOJVODINA PROVINCE OF SERBIA

Gospava Lazi1*, Sinia Gruba1, Dejan Bugarski 1, Diana Lupulovi1, Sava Lazi1, Petar
Kneevi2, Tama Petrovi1
1

University of Novi Sad, Faculty of sciences, Department of Biology and Ecology, Novi Sad, Serbia
Abstract
The environment receives, maintains and transports etiological agents to susceptible hosts. The
presence of animal and human, especially zoonotic viruses in environment is intensively studied
and monitored in a lot of countries worldwide. Viruses are shed in extremely high numbers in the
faeces of infected individuals. Surface water is subject to faecal contamination from a variety of
sources. Water could be contaminated through direct inflow of untreated sewage. There is also more
direct faecal contamination of the environment from humans and animals, for example by bathers or
by defecation of farm animals and free-range or wild animals onto surface waters or soil. After the
enteric viruses are discharged into water, they can survive for prolonged periods in the aquatic
environment. Some of the human, animal and zoonotic viruses were chosen to estimate the possible
existence of route of human and animal faecal contamination, as well as indicate whether the
examined surface waters could present a possible hazard for animal and public health.
In Vojvodina Province in Serbia, in total 60 surface water, and 6 untreated sewage samples were
collected at 33 locations during two sampling periods: summer (July-October), and autumn
(November-December). The presence of seven ((human (HAdV, NoV GI, NoV GII and HAV),
animal (PAdV and BPyV) and zoonotic (HEV)) viruses in surface water and sewage samples was
tested by real-time PCR (qPCR) and reverse transcription real-time PCR (RT-qPCR) assays. The
results show that the potential risk for public and animal health exists if the examined surface
waters are used in agricultural and recreational purposes and present the need for assessing water
sources for viral contamination to help protect public health.
Keywords: environment; human, animal and zoonotic viruses; Vojvodina; Serbia
Introduction
The environment receives, maintains and transports etiological agents to susceptible hosts. Viruses
can be transmitted through various environments (water, sewage, soil, air, or surfaces) and persist
enough in these vehicles to represent a health threat. Pathogenic viruses are routinely introduced
into the environment through the discharge of treated and untreated wastes, as current treatment
practices are unable to provide virus-free wastewater effluents (Bosh et al., 2006). The animal,
human and especially zoonotic viruses in environment is intensively studied and monitored in a lot
of countries worldwide. They are shed in extremely high numbers from infected individuals and
they are stable in the environment for extended periods of time. Human exposure to even low levels
of some pathogenic viruses in the environment, such as norovirus, adenovirus, hepatitis E and A
viruses, can cause infection and disease. Some of these viruses have been suggested as a parameter
for evaluating viral pollution of environmental waters (La Rosa et al., 2012). The viruses
transmitted by the respiratory and faecal-oral routes, transport and persistence in environment is
directly related to the potential for and risk of transmission, host exposure, infection and disease
(Sobsey and Meschke, 2003). Enteritic viruses can survive the water disinfection processes that
eliminate bacteria (Carratala et al., 2013). Several waterborne outbreaks of viral gastrointestinal
295
illness have been documented. Besides gastrointestinal illnesses, enteric viruses have been linked to
more acute conditions, including meningitis and paralysis (Spinner and di Giovani, 2001). Many of
the viruses are important pathogens of their human and animal hosts, although some of them do not
always cause severe illness or high mortality rates (Sobsey and Meschke, 2003).
Faecal Contamination of the Environment

The presence of viruses in water is evidence of faecal contamination because they are excreted by
infected individuals and do not belong to natural microbial population (Faccin-Galhardi et al.,
2013). Especially important are a variety of non-enveloped enteric and respiratory viruses. These
include adenoviruses, astroviruses, caliciviruses, papovaviruses, parvoviruses, picornaviruses
(enteroviruses and hepatitis A virus), and other nonenveloped viruses that can be shed in faeces
(and in some cases urine) from infected individuals and can be present in faecal wastes and faecally
contaminated environmental samples (Sobsey and Meschke, 2003). Sewage, especially from
slaughterhouses, may contain animal adenoviruses, sapoviruses, and HEV, which may also be
zoonotic (Wyn-Jones et al., 2011; Petrovi, 2013). The prevalence and distribution of animalspecific viruses in environmental waters must be determined in order to validate the use of these
viruses for source tracking purposes (Fong and Lipp, 2005).
The treatment of waste water and sewage, especially from small towns and villages, as well as from
some large cities in Serbia, is seldom implemented, or works only with partial function. Rivers,
lakes, streams, and coastal waters are regularly contaminated by septic tanks, storm water runoff,
agricultural run-off or run-off of the animal manure used in agriculture and effluents from
inefficiently operated sewage treatment plants. Additionally, water could be also contaminated from
overflows of treatment plants impacted by flooding events, or through direct inflow of untreated
sewage (Lazi et al., 2015).
Viral pathogens transmitted through water

Water is an important vehicle for the transmission of enteric viruses. These agents are adapted to
the hostile environment of the gut and in most cases, can persist for a very long time in water.
Adenovirus
Adenoviruses are members of the family Adenoviridae and the genus Mastadenovirus (Sinclair et
al., 2009). Human adenoviruses (HAdV) have been proposed as indicators of the presence of human
viral pathogens in the environment, because they are prevalent in environmental waters and
successfully detected in different environmental samples, such as waters in lakes and rivers, sewage
systems, treated waters and swimming pools (Bofill-Mas et al., 2010; Silva, 2011). HAdV has also
shown to be very stable in the environment and resistant to water treatments (Rodr guez-Lazaro et
al., 2011). In spite of the existence of reported cases of pneumoenteritis or encephalitis, porcine
adenoviruses (PAdV) do not normally produce clinically severe pathologies (Maluquer de Motes et
al., 2004). PAdV have been often isolated from apparently healthy pigs (Fong and Lipp 2005).
PAdV have been proposed as porcine faecal contamination indicators (Maluquer de Motes et al.,
2004; Girones and Bofill-Mas, 2013).
Norovirus
Noroviruses belongs to the family Caliciviridae and has its own genus Norovirus. Since less than
10 virus particles can lead to infection and disease, noroviruses (NoV) are very common cause of
both endemic and epidemic gastroenteritis (Teunis et al., 2008; Atmar, 2010). These viruses are
extremely contagious. The burden of calicivirus (including NoV) has been clearly documented in
296
numerous geographical areas worldwide (Rodr guez-Lazaro et al., 2012) In US, noroviruses
causes an estimated 23 million cases per year (Sinclair et al., 2009). In Europe NoV epidemics
have been reported to increase in both incidence and severity, probably as a result of an increased
pathogenicity and/or transmissibility of new strains (La Rosa et al., 2012).
Hepatitis E virus
Hepatitis E viruses (HEV) excreted in faeces and urine constitutes a signicant proportion of
pathogens present in sewage (Sinclair et al., 2009). The four major genotypes (GI to GIV)
belonging to a single serotype. While GI and GII are restricted to humans, GIII and GIV are
zoonotic and may infect animals (La Rosa et al., 2012). HEV has been detected in different water
environments, including urban sewages, in Spain, Italy, France and the United States (La Rosa et
al., 2012). Moreover, infectious HEV particles have been reported to occur in sewage, indicating
the existence of a potential public health risk from the contamination of surface water with HEV
(La Rosa et al., 2012).
Hepatitis A virus
Hepatitis A virus belongs to the family Picornaviridae and has its own genus Hepatovirus (Sinclair
et al., 2009). HAV infections result in numerous symptoms, including fever, malaise, anorexia,
nausea and abdominal discomfort, followed by jaundice; the infection can also cause liver damage.
HAVs have been detected in different water environments: wastewaters, treated effluents, surface
waters and drinking waters (La Rosa et al., 2012). Water is considered to be the most important
source of infectious virus because it can survive for long periods in this environment. For example,
the virus can survive over 6 weeks in river water (Rodr guez-Lazaro et al., 2012).
Polyomaviruse
Bovine polyomaviruses (BPyVs) are members of the family Poliomaviridae and the genus
Poliomavirus. BPyV do not lead to clinically severe diseases in cattle (Girones and Bofill-Mas,
2013). These viruses have been suggested as potential bovine markers (Hundesa et al., 2006;
Girones et al., 2010; Girones and Bofill-Mas, 2013).
Situation in Vojvodina Province comparing to the situation in Europe

A number of studies have been carried out with the aim of estimating the risks from viral
contamination related to the release of wastewater into surface waters. In Serbia, untreated urban
sewage and wastewater inflow directly into the different surface waters. The sewage treatment
plants usually do not exist, or there are only mechanical and partial- treatment sewage systems on
place. The surface water samples were collected at 30 locations during two sampling periods:
summer (July-October), and autumn (November-December). The sampling locations for surface
waters were chosen near all larger towns and as close as possible to a few intensive animal
production farms. Among these water samples, 10 samples were collected from 5 urban beaches
and 5 locations in protected natural areas. In total, 60 samples of untreated surface water and 6
samples of untreated urban sewage samples were tested by qPCR and RT-qPCR. The most
prevalent virus found was HAdV which was detected in 43.33% (26/60) samples in Danube, Sava,
Begej and Krivaja Rivers, and DTD, Great Backa, KCIII canals and Palic Lake. HAdV has been
proposed as an indicator of the presence of human viral pathogens in the environment (Bofill Mas et
al., 2006; Silva et al., 2011). Results of our study confirm this observation, and are in line with the
results of many other studies conducted around the world (Rusiol et al., 2014; Kern et al., 2013;
Silva et al., 2011; Pina et al., 1998). In Poland, 60 water samples were collected in 2007 from four
sampling sites situated along the river Wieprz. Human pathogenic viruses were detected in 35% of
297
samples. HAdVs were detected in 28.3% of samples, and were present throughout the whole year
(Kozyra et al., 2011). In Spain, 23 river water samples from two sites with different levels of faecal
pollution were tested, and the human virus most often detected was HAdV, being present in 15 of
the 23 samples (65%) (Pina et al., 1998).
NoV GII was found in 40% (24/60) samples in Danube, Sava, Begej and Krivaja Rivers, and DTD,
Great Backa, KCIII canals, Palic Lake, and Rakovac stream. NoV GI was found in 10% (6/60)
samples in Danube and Sava Rivers, and Great Backa Canal. Our results are in accordance with the
results of the studies conducted in Hungary, where noroviruses were detected in 30% examined
surface water samples (Kern et al. 2013) and in the region of North-Eastern Greece where NoV GII
strains were found in 34% samples (Parasidis et al., 2013b).
PAdV, BPyV and HEV were detected in 5 (8.33%), 4 (6.67%) and 2 (3.33%) samples in Krivaja,
Sava, Danube and Begej Rivers, DTD and KCIII canals. In our study we found PAdV and BPyV
presence in tested surface waters in Serbia in much lower extent than it is published in some other
studies in Europe. One of the possible reasons for these results is because the animal production in
Serbia has been quite low in recent years due to the economic crisis (Lazi et al., 2015). As HEV is
highly prevalent in pig population in Serbia (Lupulovi et al., 2010; Petrovi et al., 2014); the
source of the HEV detected in the samples could be infected humans and / or pigs.
HAV was not found in any of analyzed surface waters or urban sewage samples. Viruses were not
detected in 25% (3/12) of the examined surface waters (Tisa and Jegricka Rivers, and the Special
Nature Reserve Obedska bara - wetland).
Among 6 analyzed sewage samples, 5 (83.33%) were found positive for the target viruses. On both
sampling occasions in two urban sewage systems HAdV and NoV GII and in one occasion NoV GI
were detected, and in the third urban sewage system only NoV GII was found in one of two
sampling occasions. Viruses such as norovirus and adenovirus may be highly prevalent in sewagepolluted recreational waters (Wyn-Jones et al., 2011). Autochthonous strains of HEV have been
reported in urban sewage in several highly developed countries, as well as related cases of sporadic
acute hepatitis caused by these non-imported strains (Pina et al., 2000).
Conclusion and recommendations

The surface water samples tested positive for human, animal and zoonotic viruses indicating that
the contamination must have originated from a variety of sources. The results show that the
potential risk for public and animal health exist if the examined surface waters are used in
agricultural and recreational purposes, and suggest the necessity for further and more extensive
studies. Methods related to virus purification and detection of viral particles should be improved
such that survival of human pathogenic viruses in the environment can be followed reliably.
Legislation on handling and treatment of water and sewage should be adapted as needed to reduce
the risk of environmental virus contamination.
Acknowledgements
This work is conducted within the project TR31084 funded by the Serbian Ministry of Education,
Science and Technological development.
References
1. Atmar, R.L.: Noroviruses: State of the Art. Food and Environmental Virology, 2, 117126, 2010.
298

2. Boll-Mas S., Albinana-Gimenez N., Clemente-Casares P., Hundesa A., Rodriguez-Manzano J., Allard
A., Calvo M., Girones R.: Quantication and Stability of Human Adenoviruses and Polyomavirus
JCPyV in Wastewater Matrices. Applied and Environmental Microbiology, 72, 12, 78947896, 2006.
3. Bofill-Mas S., Calgua B., Clemente-Casares P., La Rosa G., Iaconelli M., Muscillo M., Rutjes S., de
Roda Husman A.M., Grunert A., Graber I., Verani M., Carducci A., Calvo M., Wyn-Jones P., Girones R.:
Quantification of Human Adenoviruses in European Recreational Waters. Food and Environmental
Virology, 2, 101109, 2010.
4. Bosch A., Pint R.M., Abad F.X.: Survival and transport of enteric viruses in the environment. In:
Viruses in Food, ed. S. M. Goyal. Food Microbiology and Food Safety Series. Springer, New York, NY,
2006, 151-187.
5. Carratala A., Rusiol M., Rodriguez-Manzano J., Guerrero-Latorre L., Sommer R., Girones, R.:
Environmental Effectors on the Inactivation of Human Adenoviruses in Water. Food and Environmental
Virology, 5, 203214, 2013.
6. Faccin-Galhardi L.C., Lopes N., Espada S.F., Linhares R.E.C., Pelayo J.S., Nozawa C.: Waterborne viral
pathogens: detection, control and monitoring of water quality for human consumption. Virus Reviews and
Research, Published ahead of print in June 10, 2013.
7. Fong T.T., Lipp E.K.: Enteric Viruses of Humans and Animals in Aquatic Environments: Health Risks,
Detection, and Potential Water Quality Assessment Tools. Microbiology and Molecular Biology Reviews,
69, 2, 357371, 2005.
8. Girones R., Bofill-Mas S.: Virus indicators for food and water. In: Viruses in food and water. Risks,
surveillance and control, ed. N. Cook, Woodhead Publishing Limited, Cambridge, 2013, 483-509.
9. Girons R., Ferrs M.A., Alonso J.L., Rodriguez-Manzano J., Calgua, B., Corra Ade A., Hundesa A.,
Carratala A., Bofill-Mas S.: Molecular detection of pathogens in water--the pros and cons of molecular
techniques. Water Research, 44(15), 4325-4339, 2010.
10. Hundesa A., Maluquer De Motes C., Bofill-Mas S., Albinana-Gimenez N., Girones, R.: Identification of
human and animal adenoviruses and polyomaviruses for determination of sources of faecal contamination
in the environment. Applied and environmental microbiology, 72 (12), 7886 93, 2006.
11. Kern A., Kadar M., Szomor K., Berencsi G., Kapusinszky B., Vargha M.: Detection of enteric viruses in
Hungarian surface waters: first steps towards environmental surveillance. Journal of Water and Health,
11, 4, 772782, 2013.
12. Kozyra I., Kaupke A., Rzezutka A.: Seasonal Occurrence of Human Enteric Viruses in River Water
Samples Col lected from Rural Areas of South-East Poland. Food and Environmental Virology, 3, 115
120, 2011.
13. La Rosa G., Fratini M., della Libera S., Iaconelli M., Muscillo M.: Emerging and potentially emerging
viruses in water environments. Ann Ist Super Sanit, 48, 4, 397-406, 2012.
14. Lazi G., Gruba S., Lupulovi D., Bugarski D., Lazi S., Kneevi P., Petrovi T.: Presence of human
and animal viruses in surface waters in Vojvodina Province of Serbia. Food and Environmental Virology,
DOI 10.1007/s12560-015-9187-3; Accepted: 11 February 2015.
15. Lupulovi D., Lazi S., Prodanov-Radulovi J., Jimnez de Oya N., Escribano-Romero E., Saiz J.C.,
Petrovi T.: First serological study of Hepatitis E virus infection in backyard pigs from Serbia. Food and
Environmental Virology, 2, 110113, 2010.
16. Maluquer de Motes C., Clemente-Casares P., Hundesa A., Martn M., Girones R.: Detection of Bovine
and Porcine Adenoviruses for tracing the source of faecal contamination. Applied and environmental
microbiology, 70, 3, 14481454, 2004.
17. Petrovi T.: Prevalence of viruses in food and the environment. In: Viruses in food and water. Risks,
surveillance and control, ed. N. Cook, Woodhead Publishing Limited, Cambridge, 2013, 19-46.
18. Petrovi T., Lupulovi D., Lazi G., Lazi S., Saiz, H.J.: HEV in Serbia: results of recent studies. Book
of Abstract, 4th International Conference on Food and Environmental Virology, 2 5 September 2014,
Corfu, Greece, organized by UPA and ISFEV, Maroussi, Ionian Academy, 2014, pp 45-47.
19. Pina S., Buti M., Cotrina M., Piella J., Girones, R.: HEV identified in serum from humans with acute
hepatitis and in sewage of animal origin in Spain. Journal of Hepatology, 33 (5), 826-833, 2010.
299

20. Pina S., Puig M., Lucena F., Jofre J., Girones, R.: Viral Pollution in the Environment and in Shellfish:
Human Adenovirus Detection by PCR as an Index of Human Viruses. Applied and Environmental
Microbiology, 64 (9), 33763382, 1998.
21. Rodr guez-Lazaro D., Cook N., Ruggeri F.M., Sellwood J., Nasser A., Sao Jose Nascimento M.,
DAgostino M., Santos R., Saiz J.C., Rzezutka A., Bosch A., Girones R., Carducci A., Muscillo M.,
Kovac K., Diez-Valcarce M., Vantarakis A., Bonsdorff C.-H., de Roda Husman A.M., Hernandez M., van
der Poel W.H.M.: Virus hazards from food, water and other contaminated environments. FEMS
Microbiology Reviews, 786814, 2012.
22. Rusiol M., Fernandez-Cassi X., Hundesa A., Vieira C., Kern A., Eriksson I., Ziros P., Kay D.,
Miagostovich M., Vargha M., Allard A., Vantarakis A., Wyn-Jones P., Bofill-Mas S., Girones, R.:
Application of human and animal viral microbial source tracking tools in fresh and marine waters from
five different geographical areas. Water Research, 59, 119129, 2014.
23. Silva H.D., Garc a-Zapata M.T.A., Anunciacao C.E.: Why the Use of Adenoviruses as Water Quality
Virologic Marker? Food and Environmental Virology, 3, 138140, 2011.
24. Sinclair R.G., Jones E.L., Gerba C.P.: Viruses in recreational water-borne disease outbreaks: A review,
Journal of Applied Microbiology, 107, 17691780, 2009.
25. Sobsey M.D., Meschke J.S.: Virus survival in the environment with special attention to survival in
sewage droplets and other environmental media of faecal or respiratory origin.2003.
http://www.unc.edu/courses/2008spring/envr/421/001/WHO_VirusSurvivalReport_21Aug2003.pdf
26. Spinner M.L., Giovanni G.G.D.: Detection and identification of mammalian reoviruses in surface water
by combined cell culture and reverse transcription-PCR. Applied and environmental microbiology, 67, 7,
3016-3020, 2001.
27. Teunis P.F., Moe C.L., Liu P., Miller S.E., Lindesmith L., Baric R.S., Le Pendu J., Calderon, R.L.:
Norwalk virus: how infectious is it? Journal of Medical Virology, (80), 146814, 2008.
28. Wyn-Jones A., Carducci A., Cook N., D'Agostino M., Divizia M., Fleischer J., Gantzer C., Gawler A.,
Girones R., Hller C., de Roda Husman A.M., Kay D., Kozyra I., Lpez-Pila J., Muscillo M., So Jos
Nascimento M., Papageorgiou G., Rutjes S., Sellwood J., Szewzyk R., Wyer M.: Surveillance of
adenoviruses and noroviruses in European recreational waters. Water Research, 45 (3), 1025 1038,
2011.
300
DEVELOPMENT OF A MULTI-RESIDUE METHOD FOR THE DETERMINATION OF

INSECTICIDES IN ANIMAL FAT BY LC-MS/MS
Vojislava Bursi1, Gorica Vukovi2, Tijana Zeremski3, Dejan Beukovi1, Milo Beukovi1,
Aleksandra Petrovi1, Magdalena Cara4
1
Faculty of Agriculture, University of Novi Sad, Serbia

2
Institute of Public Health, Belgrade, Serbia
3
Institute of Field and Vegetable Crops, Novi Sad, Serbia
4
Faculty of Agriculture and Environment, Agricultural University of Tirana, Albania
Abstract
Agricultural intensification has resulted in the increased mechanization and use of chemical
compounds, and in dramatic changes of landscape characteristics such as the decrease in permanent
vegetation cover, the increase in field size and the reduction of habitat diversity. The occurrence of
pesticide poisoning in wildlife is a matter of species susceptibility (hazard of a compound) and
likelihood of exposure. The most common pesticides in animal origin food are compounds that tend
to concentrate and remain in fatty food. The aim of this work was to develop a liquid
chromatography tandem mass spectrometry method (LC-MS/MS) for the simultaneous
identification and quantification of 18 insecticides in adipose tissue of brown hare, in a single run.
Insecticides were detected by triple quadrupole mass spectrometer (Agilent 6410B Triple Quad
Mass Spectrometer, USA) in positive electrospray ionization using multiple reactions monitoring
mode (MRM). The method was validated for accuracy, precision, linearity, LODs and LOQs. The
calibration was performed as matrix calibration, by means of spiking the calibration samples before
extractions and preparing them in the same way as the test samples. The calibration range was from
0.01 to 0.5 g/ml. The obtained R2 was higher than 0.99 for all the studied pesticides. The LODs
were below 0.005 mg/kg and the LOQs were set on 0.01 mg/kg. For the recovery, the samples were
spiked with the analytes at three concentration levels (0.05, 0.1 and 0.2 mg/kg). The average
recoveries for all analytes were in the range from 67.0 to 101.3% (RSDs 6.73-10.98%). The
obtained mean values of the responds were with RSD<20%. An efficient, sensitive and reliable LCMS/MS method has been developed which can be applied in the analysis of real samples to 20
insecticide residues in brown hare fatty tissue.
Keywords: insecticide residues, LC-MS/MS, validation, brown hare, fat
Introduction
A brown hare (Lepus europaeus Pallas 1778) is one of the most wide-spread and hunted game in
Europe (Beukovi et al., 2011). The most numerous brown hare populations are in agricultural
regions on small agricultural plots with various crops situated among woods meadows and
shrubberies (elmi & Gai, 2011). By drastic increase in areas under crops where the pesticides
are intensively used along with the decrease in areas under fodder crops, the possibility for proper
brown hare nutrition is reduced while its typical habitats have been changed (Beukovi & Popovi,
2014).
It is considered that the excessive use of pesticides is responsible for 18-68% cases of animal
poisoning (Berny, 2007). Berny (2007) also stated that highly toxic and rapid-acting substances
such as organophosphoric insecticides and carbomates cause the kill-off.
The paper will validate the QuEChERS multi-residue method for the determination of insecticide
residues in fatty tissue by liquid chromatography tandem mass spectrometry (LC-MS/MS)
according to SANCO/12571/2013.
301
Within the validation the recoveries of extraction, detection limits (LOD), quantification limits
(LOQ) and linearity with carbofuran-D3 addition as an internal standard (IS) will be determined.
Since 2014 in the European Union the validation of analytical methods is performed according to
directives of SANCO/12571/2013 document. Based on the document for the analysis of pesticide
residues in various matrices and for the improvement of selectivity and sensibility it is necessary to
apply gas (GC) or liquid (LC) chromatography with mass spectrometry (MS) or tandem mass
spectrometry (MS/MS). QuEChERS (Quick Easy Cheap Effective Rugged and Safe) is the
abbreviation of: quick, easy, cheap, effective, rugged and safe method of extraction which has been
developed aimed at the determination of pesticide residues in agricultural products. This method has
become the official AOAC method No. 2007.01 and BSEN 15662:2008 for the determination of
pesticide residua in food (Bursi et al., 2012).

Chemicals
The analitical insecticide standards were manufactured by Dr. Ehrenstorfer GmbH, Germany. As an
internal standard, carbofuran-D3 (99.7%) was purchased from Pestanal, Fluka (Germany), and was
used in the concentration of 1 mg/ml of the basic standard in acetonitrile with the dilution up to 1.0
g/mL. The stock standard solutions were prepared by dissolving an analytical standard in
acetonitrile while the working solution i.e. the mixture of the studied pesticides was obtained by
mixing and diluting the stock standards with acetonitrile resulting in the final mass concentration of
10 g/mL.
Instruments
For LC analysis, an Agilent 1200 (Agilent Technologies, USA) HPLC system with a binary pump
was used. This was equipped with a reversed-phase C8 analytical column of 1504.6 mm and 5 m
particle size (Agilent Zorbax Eclipse XDB). The mobile phase was methanol and Milli-Q water
with 0.1% formic acid in gradient mode, with the flow rate 0.6 ml/min. For the mass spectrometric
analysis, an Agilent 6410 Triple-Quad LC/MS system was applied. Agilent Mass Hunter Data
Acquisition, Qualitative Analysis and Quantitative Analysis software were used for method
development and data acquisition.
10 g sample + 10ml MeCN + 100l ISTD (10 g/ml Carbofuran-D3)
Shake vigorously for 1 min
Add 4 g MgSO4, 1 g NaCl, 1 g Na3Citrate dihydrate, 0.5 g Na2HCitrat sesquihydrate
Shake tube immediately for 1 min
Centrifuge for 5 min at 3000 g
Transfer 5 ml of the extract into a PP tube contained MgSO4, PSA, C18
Shake for 30 s
Centrifuge for 5 min at 3000 g
Transfer 200 l into a vial, evaporate to dryness
Reconstitute in 200 l of mobile phase
LC-MS/MS
Graph. 1. QuEChERS extraction
Validation
The limit of detection - LOD was determined as the lowest concentration giving a response of three
times the average baseline. The ratio signal/noise in the obtained chromatograms for the LOD was
302
calculated by MassHunter Qualitative Software. The linearity was checked using matrix matched
standards (MMS) at the concentrations of 5.0, 10.0, 25.0, 50.0 and 100.0 ng/ml. The recovery was
checked by enriching 10 g of a blank sample with the mixture of pesticide standard of 10 g/ml in
the amount of 100 and 50 l (final mass concentration 0.10 and 0.05 mg/kg) and with the mixture of
pesticide standard of 1 g/ml in the amount of 100 l (final mass concentration 0.01 mg/kg) with
the addition of the internal standard carbofuran-D3 (Graph. 1.).
Results
Before the calibration and quantification of pesticides it was necessary to set an acquisition method.
The determination of the acquisition method comprises: setting chromatographic conditions,
determining the precursor and product ion so called monitoring mode of ion transfer (MRM or
SRM), determining the fragmentation energy (Frag.) and the energy of collision cell (CE). For
setting the SRM MassHunter Optimizer Softvere Version B03.01 (Agilent Technologies 2010) and
Agilent G1733AA MassHunter Pesticide Dynamic MRM Database were used (Tab. 1.).
Table 1. Retention times, MRM and collision cell energy of studied pesticides
Pesticide
Acetamiprid
Carbofuran
Clothianidin
Fenpropathrin
Chlorpyrifos
Tefluthrin
Thiodicarb
Carbosulfan
Cyromazine
Diazinon
Fenoxycarb
Malathion
Tefluthrin
Imidacloprid
Indoxacarb
Phoxim
Pirimiphos methyl
Pyriproxifen
Thiamethoxam
Endosulphan alpha
MRM
Transitions
(m/z)
192.1
192.1
222.1
250.0
250.0
350.2
350.2
349.9
349.9
419.1
419.1
355.1
355.1
381.2
381.2
167.1
167.1
305.0
305.0
302.1
302.1
331.1
331.1
419.1
419.1
256.0
256.0
528.1
528.1
299.1
299.1
306.2
306.2
322.1
322.1
292.0
292.0
404.8
Produkt jon
m/z
Frag.
(V)
160.1
132.0
165.1
169.1
132.1
125.1
55.2
197.9
97.0
193.0
419.0
88.0
108.0
160.1
118.1
125.1
85.0
169.0
153.0
116.1
88.0
127.0
99.0
419.0
193.0
208.7
174.6
203.0
150.0
129.0
77.0
164.2
108.2
227.1
185.1
211.0
181.0
373.1
104
104
90
90
90
100
90
120
120
100
90
130
120
130
130
80
80
100
100
110
110
90
90
1100
130
100
100
120
120
80
80
150
150
120
120
150
150
120
303
CE
(V)
18
34
20
10
15
20
15
15
20
25
15
21
25
21
50
10
25
5
20
12
20
15
15
20
17
15
20
36
16
10
35
20
20
10
10
20
20
10
Rt
(min)
R2
Average
recovery
RSD (%)
8.05
0.9995
98.88.9
14.00
10.50
0.9989
0.9994
86.243.1
103.212.2
20.05
0.9576
59.63.4
20.05
0.9989
55.438.9
18.77
0.9811
78.915.4
14.85
0.9918
97.021.0
17.34
0.9965
93.052.4
17.27
0.9947
75.355.8
17.45
0.9987
82.645.9
17.30
0.9998
92.252.9
15.18
0.9992
83.193.1
18.07
0.9966
73.035.5
10.30
0.9988
95.994.3
18.12
0.9990
73.552.9
17.95
0.9997
74.273.2
18.08
0.9918
86.724.3
19.46
0.9996
59.169.0
9.13
0.9923
64.025.7
16.33
0.9986
99.3311.2
100
80
60
40
20
0
-20
-40
Chlorpyrifos
Fenpropathrin
Endosulphan
alpha
Thiamethoxam
Thiocarb
Tefluthrin
Pyriproxifen
Pirimiphos
methyl
Phoxim
Malathion
Indoxacarb
Imidacloprid
Fenoxycarb
Diazinon
Carbosulfan
Cyromazine
Clothianidin
Carbofuran
-80
-100
Acetamiprid
-60
Graph. 2. Matrix effects (%)
For all the studied pesticides the LOQ of 0.01 mg/kg, was reached while mathematically calculated
LOD was 0.005 mg/kg.

Based on the graphic of matrix influences (%) (Graph. 2.), it can be concluded that the fatty tissue
of a brown hare as a matrix manifests the greatest influence on the carbofuran analysis (86.92%). In
case of carbofuran, imidacloprid, thiocarb, thiametoxam, endosulphan alpha, fenproparthrin and
chlorpyrifos matrix brings about the increase in signal, whereas in case of all the other analysed
insecticides the matrix is the cause of the decrease in the signal. The influence of a brown hare
matrix on most insecticides overcoming 15%, which indicates, that for the determination of these
pesticides a matrix match calibration is necessary.
The evident public concern regarding food safety is manifested through a growing number of
literary available data dealing with this issue. Moller (2014) and Inthavong et al. (2014) used
QuEChERS method for the extraction of pesticides at validation LC-MS/MS and GC-MS/MS
method for the determination of pesticide residues in fatty tissue of animals.
In order to insure the food safety and human health and taking into consideraton the fact that
pesticides can be transferred from animals in a direct way or through food chain a regulation on
maximum amounts of pesticide residues in food was passed (Gazette 29/2014, EC Regulation
396/2005).
A validated LC-MS/MS multiresidual method was obtained which can be used as a routine method
for the determination of insecticide residues in fatty tissue of a brown hare:
For all the studied pesticides the LOQs were set on 0.01 mg/kg, whereas the mathematically
calculated LODs were 0.005 mg/kg.
Extraction recoveries for spiking levels of 0.05, 0.1 and 0.2 mg/kg were 55.4 - 103.21.0 11.2%.
The linearity for the concentrations of 0.1, 0.2, 0.5, 1.0, 2.0 and 5.0 g/mL, were with
R2>0.99 in organic solvent, while in the matrix R2 were lower but over 0.99.
304
Acknowledgement
The authors acknowledge the financial support of the Provincial Secretariat for Agriculture, Water
Management and Forestry, Project Ref. 104-401-3840/2014-07-262.
References
1.
Berny P.: Pesticides and the intoxication of wild animals. Journal of Veterznary Pharmacology and
Therapeutics, 30, 93-110, 2007
2. Beukovi M., orevi Z., Popovi N., Beukovi D., urevi M.: Nutrition specificity of brown hare
(Lepus europaeus) as a cause of the decreased number of population. Savremena poljoprivreda, 60, 3/4,
403-412, 2011
3. Beukovi M., Popovi Z.: Lovstvo, Univerzitet u Novom Sadu, Poljoprivredni fakultet Novi Sad, 2014
4. Bursi V., Vukovi G., pirovi B., Lazi S., urovi R., Zeremski-kori T.: Analiza pesticida u
trenjama QuEChERS ekstrakcijom: Poreenje uticaja sorbenta na prinos ekstrakcije. Zbornik rezimea
radova XIV Simpozijuma o zatiti bilja i IX Kongresa o korovima, Zlatibor 26-30. Novembar, 2012.,
79-80
5. Inthavong C., Doret-Aubertot M., Dragacci S., Hommet F.: A Multiresidues Metod for the Analysis of
100 Pesticides and Their Metabolites by QuEChERS Approach in Poultry Muscle and Liver:
Preliminary Data of Validation Process. Programme and Book of abstracts of the 10th European
Pesticide Residue Workshop Dablin, Ireland, 2014, 118
6. Mller A.: Interlaboratory Validation of the Determination of Pesticides in Animal Products by means
of the QuEChERS Approach. Programme and Book of abstracts of the 10th European Pesticide Residue
Workshop Dablin, Ireland, 2014, 140
7. Pravilnik o maksimalno dozvoljenim koliinama ostataka sredstava za zatitu bilja u hrani i hrani za
ivotinje za koju se utvruju maksimalno dozvoljene koliine ostataka sredstava za zatitu bilja (2014).
Slubeni glasnik RS broj 29/2014.
8. Regulation (EC) No 396/2005 of the European Parliament and of the Council (2005) on maximum
residue levels of pesticides in or on food and feed of plant and animal origin and amending Council
Directive 91/414/EEC.
9. SANCO/12571/2013, Method validation and quality control procedures for pesticide residues analysis
in food and feed.
10. elmi V., Gai D.: Lovstvo sa zatitom lovne faune-praktikum. Univerzitet u Beogradu, umarski
fakultet, Beograd, 2011
305
THE UNUSUAL COLONY LOSSES IN VOJVODINA PROVINCE

Jelena Babi1*, Sara Savi1, Miroslav irkovi1, Igor Stojanov1, Ivan Pihler2, Nada Plava3
1

University of Novi Sad, Faculty of Agriculture, Department of animal science, Novi Sad, Serbia
3
University of Novi Sad, Faculty of Agriculture, Department of veterinary medicine, Novi Sad, Serbia
2
Abstract
The apiculture has been in decline in Serbia as well as in Europe and the USA over recent decades,
as is shown by the decreasing numbers of managed honey bee (Apis mellifera) colonies. Over the
past 10 years, beekeepers have been reporting unusual weakening of bee numbers and colony
losses. According to the European Food and Safety Authority (EFSA) no single cause of declining
bee numbers has been identified.
During a two-year study (December, 2012 December, 2014) 210 bee hives were examined from
63 apiaries in Vojvodina province. All samples were examined in laboratories of Scientific
Veterinary Institute Novi Sad. Examination included detection of Varroa destructor, Aethina
tumida, Tropilaelaps spp, Nosema spp, Paenibacillus larvae. Nosema spp. were detected in 42.48%
of the samples, Varroa destructor in 21.43%, Paenibacillus larvae in 2 examined samples. There
were no evidence of Aethina tumida and Tropilaelaps spp from examined samples from Vojvodina
province. According to the results of our study, major detected problems at Vojvodinas apiaries are
still Nosema spp. and Varroa destructor. Our further study will try to determinate others possible
causes of colony losses in this part of Serbia.
Key words: apiculture, colony losses, Vojvodina, Varroa destructor, Nosema spp
Introduction
The importance of bees and beekeeping is demonstrated directly through the production of honey
and other food and feed supplies (EFSA, 2014). Furthermore, honey bees Apis mellifera are
critically important in sustaining biodiversity by providing essential pollination for a wide range of
plants (Bradbear, 2009) as the most economically valuable pollinators of crop monocultures
worldwide. FAO (The Food and Agriculture Organization of the United Nations) estimates that of
the 100 crop species that provide 90% of food worldwide, 71 are pollinated by bees (EFSA, 2014).
According to FAO and the European Union the value of that indirectly importance of bees is 20-30
times higher than value of honey production (Petrovi et al, 2013). Also, 35% of the human diet is
thought to benefit from pollination (Stindl and Stindl, 2010).
The apiculture has been in decline in Serbia as well as in Europe and the USA over recent decades,
as is shown by the decreasing numbers of managed honey bee (Apis mellifera) colonies (Van
Engelsdorp et al, 2009; VanEngelsdorp and Meixner, 2010; Vejsnaes et al, 2010; Neumann and
Carreck, 2010; Nazzi et al, 2012; Meixner et al, 2014). Over the past 10 years, beekeepers have
been reporting unusual decreasing of bee numbers and colony losses. Mortality is the highest at the
end of winter and beginning of spring (UNEP, 2010; Genersch and Aubert, 2010).
Group of authors Potts et al. (2010) compiled data from 18 European countries to assess trends in
the number of honey bee colonies and beekeepers between 1965 and 2005. They found consistent
declines in honey bee colony numbers in central European countries, but some increases in
Mediterranean countries. Furthermore, beekeeper numbers have declined in all European countries
306
examined. In Canada, the average level of winter loss of honey bee colonies over the winter of
2013/14 was 25.0% (CAPA, 2014). According to the annual survey conducted by the Bee Informed
Partnership and the U.S. Department of Agriculture (USDA) the total loss of honey bee colonies
over the winter 2013/14 was 23.2 %, which is slightly less than in previous years when bee losses
over the winter had an average of 29.6 % (USDA, 2014). Beekeepers from apiaries in Chile in early
spring 2010 reported the massive death of bees (Rodriguez et al, 2012). The total colony losses that
occurred in South Africa in 2010-2011 were 46.2 % (Pirk et al., 2014). The average percentage of
winter losses in Germany was from 3.8% (2004/05) to 15.2% (2005/06), but regionally higher
losses were reported (Genersch et al, 2010). The recorded losses in the Republic of Serbia in the last
decade varied from 30 to 70% (Plava et al, 2013). The decreasing numbers of managed honey bee
colonies in some parts of the world is caused by different pathogens, improper pesticide and
herbicide use, weather conditions, beekeeping technology, antimicrobial resistance due to
uncontrolled use of antibiotics, malnutrition, the environment, the failure by public administrations
to control cross-border trade in breeding stock, socio-economic factors, ageing of the beekeeper
population and lower market prices for their products and services (van Engelsdorp and Meixner,
2010; CAPA, 2014; Rose et al, 2014; OIE, 2014; Chen et al, 2014). According to the European
Food and Safety Authority (EFSA) no single cause of declining bee numbers has been identified.
Many studies have indicated that the losses were usually the result of a combination of different
causes (Riviere et al, 2013; Chen et al, 2014). Honey bees succumb to a variety of pathogens such
as Nosema spp, Ascarapis woodi, Paenibacillus larvae, Melissococcus plutonius, Aethina tumida,
Tropilaelaps spp, Varroa spp and viruses (Genersch et al, 2010; Antnez et al, 2012). Ability of
honey bees to resist those infections is compromised if they are malnourished or exposed to
pesticides (Antunez et al, 2015). COLOSS (Prevention of Honeybee Colony Losses) and the US
Department of Agriculture's Area wide and Managed Pollinator CAP (Coordinated Agricultural
Project) made the first step in understanding and mitigating honey bees losses and objectively
discriminated among types of colony mortality occurring worldwide. This will enable a more
informed and appropriate allocation of research efforts into CCD and other causes of mortality in
general (Williams et al, 2010).
Vojvodina province has excellent natural conditions for beekeeping. However, unusual colony
losses that the beekeepers have encountered represent an important problem whose etiology hasn't
been sufficiently examined.
The aim of the present study was examination of the presence of different honey bees pathogens as
potential causes of unusual colony losses in Vojvodina province.

During a two-year study (December, 2012 December, 2014) 210 bee hives were examined. The
samples of bees which were used as material for this study have been collected in 63 apiaries in the
area of Vojvodina province, Republic of Serbia. All apiaries were clinically examined in detail,
whereupon the brood sample size 10 x 10 cm (Regulations about establishment of Programme of
animal health protection measures, 2009) were taken, together with approximately 100 adults bees
from the back frames, approximately 200250 bees removed from unsealed brood combs and
finally,samples from bottom board were taken for laboratory analysis.
All samples were examined in laboratories of Scientific Veterinary Institute Novi Sad.
Examination included detection of Varroa destructor, Aethina tumida, Tropilaelaps spp, Nosema
spp, Paenibacillus larvae.
Detections of Varroa destructor, Aethina tumida, and Tropilaelaps spp were done in according to
OIE Terrestrial Manual 2008 (OIE, 2008). Microscopic method of counting Nosema spores using
hemacytometer was done on the basis of the instructions Testing for Nosema Spores using
307
Hemacytometer, Instructional Poster # 167 (Reuter et al, 2010). Diagnosis of American foulbrood
(AFB) was based on the presence of clinical signs and identification of the pathogenic agentPaenibacillus larvae in according to OIE Terrestrial Manual 2008 (OIE, 2008; OIE, 2014).
Results
Varroa destructor was present in 21.43% of the samples, while the microscopy analysis of
macerated bee abdomens showed the presence of the spores Nosema spp. in 42.48% of the samples.
During clinical trial a characteristic AFB image was identified (Picture1), whereupon the brood
samples size 10 x 10 cm were taken to identification of Paenibacillus larvae. Microbiological
characterization confirmed the presence of Paenibacillus larvae in both samples, one of them being
from the area of Novi Sad, and the other from Sremska Mitrovica. All colonies of the whole two
apiaries were eliminated and all beekeeping material was destroyed. Also, in areas of those two
apiaries all bee colonies were checked for visual symptoms of AFB. There were no evidence of
Aethina tumida and Tropilaelaps spp from examined samples from Vojvodina province.
Picture 1. Clinical AFB image in samples taken from/in the area of Novi Sad

The ANSES laboratory in France designated by the European Commission as the EU Reference
Laboratory and OIE Reference Laboratory for bee diseases has implemented an active
epidemiological surveillance programme on honey bee colony mortality in 17 EU Member States
during 2012 and 2013. Results of that surveillance programme confirmed that the major honey bee
diseases are varroosis, American foulbrood, European foulbrood, nosemosis and chronic paralysis
(Chauzat et al, 2014). The main focus of most recent studies about colony mortality has been on the
pathogens (Meixner et al, 2014).
The most serious of all pathogens is the parasitic mite, Varroa destructor, which contributes
significant losses to honeybee (Dietemann et al. 2012; Martin et al. 2012).
Many studies have confirmed substantial contribution of Varroa destructor to honey bee losses
across the Northern hemisphere (Dietemann et al, 2012).This ubiquitous parasite act as a vector for
viruses by facilitating their transfer between hosts (Nazzi et al, 2012; Chen et al, 2014). Also, the
308
mites have been reported to activate inapparent virus infections in honey bees probably by down
regulation of honey bee immune genes (Meixner et al, 2014).
Nosema spp has been reported to cause collapse of colonies in both spring and winter (Meixner et
al, 2014). Nosema ceranae as the new parasite has rapidly spread all over the world and the transfer
of this parasite is nearly impossible to avoid (Ritter, 2014). It was present in European Apis
mellifera from 1998 and perhaps from the mid-1990s in the USA and possibly elsewhere (Paxton,
2010).
American foulbrood is considered one of the most contagious and destructive infectious diseases
affecting the larval and pupal stages of honey bees that have been spread nearly all over the world
(Ritter, 2014; OIE, 2014).
During the US national survey of honey-bee pests and diseases, Varroa mites were detected in
approximately 90% of all sampled apiaries in the period from 2010 to 2012. In the same survey,
Nosema spores were found in 47 to 57 %.
The German bee monitoring project has shown the prevalence of Nosema infection 31% in 2005
and less than 14% in 2007. That project also demonstrated a statistically highly significant
difference between the Varroa infestation rate of surviving colonies and of colonies which
collapsed over winter (Genersch et al, 2010).
The results show that in our region there is still no evidence of Aethina tumida and Tropilaelaps,
although they do represent a threat. Aethina tumida was detected for the first time in Reggio
Calabria, South West Italy on 5th September 2014. Until March 2015, more than a thousand
apiaries have been inspected in Calabria and Sicily. Aethina tumida has been confirmed in 61
apiaries in Calabria region and in one apiary in Sicily. Because of that, in those regions
approximately 3,500 honeybee colonies have been destroyed (Chauzat et al, 2015).
During 2006 and 2007 in Spain 73 % of the samples had viral presence, but most (80%) had one
virus and only 20% had two different viruses which was lower than expected (Antunez et al, 2012).
According to the results of our study, major detected problems at Vojvodinas apiaries are still
Nosema spp. and Varroa destructor. Our further study will try to determinate other possible causes
of colony losses in this part of Serbia. In the preserved samples of the adult bees, as well as in the
ones of Varroa mites, the analysis on the most important viruses that affect honeybees such as
Black Queen Cell Virus (BQCV), Deformed Wing Virus (DWV), Sacbrood Virus (SBV), Chronic
Bee Paralysis Virus (CBPV), Acute Bee Paralysis Virus (ABPV), Kashmir Bee Virus (KBV), and
Israeli Acute Paralysis Virus (IAPV) will primarily be done (Antunez et al, 2012).
By regularly controlling the bees we get the real insight into this problem of unusual colony losses,
and based on this insight we can aim at the source of the problem and by doing so, preserve the
health of bees. A preserving the health of bees is an integral part of good environmental
management, food security, enhanced global agriculture and global economy.
Acknowledgments
This study was supported by Project TR 31084 of Ministry of Education, Science and
Technological Development, Republic of Serbia.
References
1.
Antunez K., Anido M., Branchiccela B., Harriet J., Campa J., Invernizzi C., Santos E., Higes M.,
Martin-Hernandez R., Zunino P.: Seasonal Variation of Honeybee Pathogens and its Association with
Pollen Diversity in Uruguay, Microbial Ecology, Invertebrate microbiology, 2015
309

2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Antunez K., Anido M., Garrido-Bailon E., Botias C., Zunino P., Martinez-Salvador A., MartinHernandez R., Higes M.: Low prevalence of honeybee viruses in Spain during 2006 and 2007, Research
in Veterinary Science, 93,3, 1441-1445, 2012
Blacquiere T., van der Steen J.: Diagnosis and control of American foulbrood disease of honey bees in
the Netherlands, Proc. Neth. Entomol. Soc. Meet, 17, 119-123, 2006
Bradbear N.: Bees and their role in forest livelihoods, A guide to the services provided by bees and the
sustainable harvesting, processing and marketing of their products, Food and Agriculture Organization
of the United Nations, 2009
CAPA (Canadian Association of Professional Apiculturists): CAPA Statement on Honey Bee Losses in
Canada, 2014
Chauzat M. P., Laurent M., Riviere M. P., Saugeon C., Hendrix P., Ribiere-Chabert M.: A panEuropean surveillance programme on honey-bee colony mortalities, EPILOBEE, When epidemiology
meets apidology, the OIE and their partners, 2014
Chauzat M.P. Laurent M., Brown M., Kryger P., Mutinelli F., Roelandt S., Roels S., van der Stede Y.,
Schaffer M., Franco S., Duquesne V., Riviere M.P., Ribiere-Chabert M., Hendrikx P. : Guidelines for
the surveillance of the small hive beetle (Aethina tumida) infestation, European Union Reference
Laboratory for honeybee health (EURL), ANSES,
Chen Y.P., Pettis J.S., Corona M., Chen W.P., Li C.L., Spivak M., Visscher P.K., DeGrandi-Hoffman
G., Boncristiani H., Zhao Y., vanEngelsdorp D., Delaplane K., Solter L., Drummond F., Kramer M.,
Lipkin W.I., Palacios G., Hamilton M.C., Smith B., Huang S.K., Zheng H.Q., Li J.L., Zhang X., Zhou
A.F., Wu L.Y., Zhou J.Z. , Lee M.L., Teixeira E.W., Li Z.G., Evans J.D.: Israeli Acute Paralysis Virus:
Epidemiology, Pathogenesis and Implications for Honey Bee Health, PLOS Pathogens, 2014
Dietemann V.P.J., Anderson D., Charriere J.D., Chejanovsky N., Dainat B., de Miranda J., Delaplane
K., Dillier F-X, Fuch S., Gallmann P., Gauthier L., Imdorf A., Koeniger N., Kralj J., Meikle W., Pettis
J., Rosenkranz P., Sammataro D., Smith D., Yanez O., Neumann P.: Varroa destructor: research
avenues towards sustainable control. J Api Res 51, 125132, 2012
EFSA: Bee health, 2014 http://www.efsa.europa.eu
European Commission: Honeybee Health, 2010 http://ec.europa.eu
Food and Agriculture Organisation of the U.N. at www.fao.org/ag/magazine/0512sp1.htm
Genersch E., Aubert M.: Emerging and re-emerging viruses of the honey bee (Apis mellifera L.), Vet.
Res.,41, 54, 2010
Genersch E., von der Ohe W., Kaatz H., Schroeder A., Otten C., Buchler R., Berg S., Ritter W., Muhlen
W., Gisder S., Meixner M., Liebig G., Rosenkranz P.: The German bee monitoring project: a long term
study to understand periodically high winter losses of honey bee colonies, Apidologie 41,332-352, 2010
http://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1002735#ppat-1002735-g007
Johnson R, Corn M L: Bee Health: Background and Issues for Congress, CRS Report Prepared for
Members and Committees of Congress
Klein A.-M., Vaissiere B.E., Cane J.H., Steffan-Dewenter I., Cunningham S.A., Kremen C., Tscharntke
T.: Importance of pollinators in changing landscapes for world crops
Meixner M. D., Francis R. M., Gajda A., Kryger P., Andonov S., Uzunov A., Topolska G., Costa C.,
Amiri E., Berg S., Bienkowska M., Bouga M., Bchler R., Dyrba W., Gurgulova K., Hatjina F., Ivanova
E., Janes M., Kezic N., Korpela S., Le Conte Y., Panasiuk B., Pechhacker H., Tsoktouridis G., Vaccari
G., Wilde J.: Occurrence of parasites and pathogens in honey bee colonies used in a European genotypeenvironment interactions experiment, Journal of Apicultural Research 53, 2, 215-229, 2014
Naug D. : Infected honeybee foragers incur a higher loss in efficiency than in the rate of energetic gain,
Biology Letters, The Royal Society publishing, 10,11, 2014
Nazzi F., Brown S., Annoscia D., Del Piccolo F., Di Prisco G., Varricchio P., Vedova G. D., Cattonaro
F., Caprio E., Pennacchio F.: Synergistic Parasite-Pathogen Interactions Mediated by Host Immunity
Can Drive the Collapse of Honeybee Colonies, PLoS Pathogens 8(6): e1002735, 2012
Neumann P., Carreck N.L.: Honey bee colony losses. Journal of Apicultural Research 49, 1-6, 2010
OIE: OIE Terrestrial Manual, 2013
310

22. OIE: OIE Terrestrial Manuel, 2008
23. OIE: OIE Terrestrial Manuel, 2014
24. OIE: Protecting bees, preserving our future, Bulletin 2014-2, Protecting animals, preserving our future,
World Organisation for Animal Health, 2014
25. Paxton R.: Does infection by Nosema ceranae cause Colony Collapse Disorder in honey bees (Apis
mellifera)?, Journal of Apicultural Research 49, 1, 80-84, 2010
26. Petrovic T., Vidanovi D., Stojanov I., Lupulovi D., Lazi G., Plava N., Lazi S.: First molecular
detection of six honeybee viruses in Serbian apiaries, Proceedings of the 10th International Symposium
Modern Trends in Livestock Production, 627-639, 2013
27. Pirk C., Human H., Crewe R., van Engelsdorp D.: A survey of managed honey bee colony losses in the
Republic of South Africa- 2009 to 2011, Journal of Apicultural Research 53, 1, 35-42, 2014
28. Plava N., Nedi N., Petrovi T., Puvaa N., Stanivuk J., Stanaev V., Vukovi V.: Reasons of
weakening and losses of honey bee colonies, Book of Proceedings 23rd International symposium New
Technologies in Contemporary Animal Production, Novi Sad, 216-219, 2013
29. Potts S., Roberts S., Dean R., Marris G., Brown M., Jones R., Neumann P., Settele J.: Declines of
managed honey bees and beekeepers in Europe, Journal of Apicultural Research 49, 1, 15-22, 2010
30. Reuter G.S., Lee K., Spivak M.: Testing for Nosemas pores using Hemacytometer, University of
Minnesota Instructional Poster #167, 2010
31. Riviere M. P, Ribiere M., Chauzat M. P.: Recent molecular biology methods for foulbrood and
nosemosis diagnosis, Rev.sci.tech.Off.int.Epiz. 32, 3, 885-892, 2013
32. Rodriguez M., Vargas M., Gerding M., Navarro H., Antunez K.: Viral infection and Nosema ceranae in
honey bees (Apis mellifera) in Chile, Journal of Apicultural Research 51, 3, 285-287, 2012
33. Rose R., Pettis J. S., Rennich K., and van Engelsdorp D.: A US national survey of honey bee pests and
diseases. OIE Bulletin, 71-74, 2014
34. Stevanovic J., Stanimirovic Z., Genersch E., Kovacevic S. R., Ljubenkovic J., Radakovic M., Aleksic N.
: Dominance of Nosema ceranae in honey bees in the Balkan countries in the absence of symptoms of
colony collapse disorder, Apidologie, 2010 www.apidologie.org
35. Stindl R., Stindl W.: Vanishing honey bees: Is the dying of adult worker bees a consequence of short
telomeres and premature aging?, Medical Hypotheses, 75, 4, 387-390, 2010
36. UNEP (United Nations Environment Programme): Global Honey Bee Colony Disorder and Other
Threats to Insect Pollinators, UNEP Emerging Issues, 2010 http://www.unep.org/
37. USDA (United States Department of Agriculture, Agricultural Research Service): Survey Reports
Fewer Winter Honey Bee Losses, 2014
38. van Engelsdorp D., Evans J., Saegerman C., Mullin C., Haubruge E., Nguyen B., Frazier M., Frazier J.,
Cox-Foster D., Chen Y., Underwood R., Tarpy D., Pettis J.: Colony Collapse Disorder: A descriptive
Study, PloS One., 4, 8, e6481, 2009
39. VanEngelsdorp D., Meixner M.D.: A historical review of managed honey bee populations in Europe
and the United States and the factors that may affect them. Journal of Invertebrate Pathology 103, S80
S95, 2010
40. Vejsnaes F., Nielsen S. L., Kryger P.: Factors involved in the recent increase in colony losses in
Denmark. Journal of Apicultural Research 49, 1,109-110, 2010
41. Williams G., Tarpy D., van Engelsdorp D., Chauzat M.-P., Cox-Foster D., Delaplane S., Neumann P.,
Pettis J., Rogers R., Shutler D.: Colony Collapse Disorder in context, Bioessays. 32, 10, 845846, 2010
311
________________________________________________________________________
Session 5
AQUACULTURE
Full papers
_______________________________________________________________________
312
Plenary lecture:
CONVERTING WASTE LANDFILL IN POND AREAS
Miroslav irkovi*1, Brankica Kartalovi1, Milo Peli1, Nikolina Novakov1, Dragana Ljubojevi1,
Sanja Jovani2, eljko Mihaljev1
1
Scientific Veterinary Institute "Novi Sad", Novi Sad, Serbia

Institute of Chemistry, Technology and Metallurgy, Belgrade, Serbia
3
Faculty of agriculture Novi Sad, Novi Sad, Serbia
Abstract
Fertile soil is a resource that is in the progress of civilization is increasingly reduced. The amount of
fertile soil can be successfully increased with remediation of landfills. The basis of remediation
makes the removal of contaminated soil layer in sufficient quantity. A real system represents a
construction of ponds area where one part of soil is removed out of pond area and the other part is
exploited for making embankments. Each embankment is covered with a layer of "healthy"
excavated of deeper layers of the soil. In order to neutralize the organic components and to achieve
buffering environment, we used hydrated and slaked lime in an amount of 2000 kg / ha. In further
production, we also use hydrated lime in quantities of 3,000 kg by the end of the growing season.
Thus prepared pond we were filling with water during thirty days before hatching with fish. We
used the polyculture of common carp and bighead. Successful production we were provided by
using different types of aerators and with addition of well water from the first aquifer capacity of
1000 L / ha per minute. For feeding the fish we used the complete nutrients and achieve production
of 2000 kg / ha.
Keywords: soil, remediation, aeration, hydrated lime
Introduction
In the literature until now there has not been a lot of data relating to the construction of a pond on
the land which served as a landfill and where remediation was performed. This is one of the first
papers dealing with this issue. One of the first things that must be done is to remove the surface
layer of soil to reduce the amount of organic matter (Peli, 2014). Location for fish pond
construction is a very important and sometimes has crucial importance for the financial success of
companies (irkovi et al., 2002). It is particularly important that the water used for the pond has
optimal physical and chemical characteristics for fish breeding and that there is enough water
during the whole growing season (irkovi et al., 2002). Zooplankton and phytoplankton are also
very valuable indicators of water quality (Attayde and Bozelli, 1998; Hakkari, 1972; Pontin and
Langley, 1993; Zakaria et al., 2007; Wu, 1984; Weber and Weber 1998). For successful carp
production it is necessary to provide adequate environmental conditions, density of population,
balanced diet and adequate handling with fish (irkovi et al., 2012). Serbia is a country with
traditional production of common carp, and as such occupies third place in the production of carp
per capita in the world, behind the Czech Republic and China, with a production of 1.3 kg per
capita (Ljubojevi et al., 2014). Adequate health care and appropriate intervention aims to preserve
and improve fish production (irkovi and Novakov, 2013).
The aim of this paper is to show that it is possible to produce fish on land where remediation has
been done, which is a significant contribution to environmental protection and rural development.
313

The experiment was conducted within the meat industry. The land where pond was built was used
as a village landfill. Construction of the fish pond started by removing a soil layer with a thickness
of 1 m. 12000 m3 of excavated land was transported and disposed of, 12000 m3 was dug up and
used, and 6000 m3 was brought from the site outside of the landfill. Production took place in an
area under the water of 5 ha.
Before starting the fish production, agricultural limestone was applied to the bottom of empty pond
in an amount of 2000 kg/ha. Filling of the fish pond with water was completed from two wells with
a depth range of 75 to 95 meters, using a pumps capacity of 1000 l / min for each well. Aeration
was conducted using aerators (mud pumps) with a capacity of 2000 l/min spraying the water with
wentury aerator. The flow of the water was 12 sec L/ha.
Production of carp was carried out during 2014 growing season from 15 of April to 20 of October.
One-and two-year old common carp were stocked in the fish pond and the total stocking density
was 500 kg/ha, with a ratio of 300 kg/ha for two-year old and 200 kg/ha for one-year old carp. The
average weight of an one year old carp was 80 g and a two-year old carp was 800 g.
During the production, commercial extruded and pelleted fish feed, with 32% of proteins and 10%
of fat, were given to fish. Feeding was carried out twice a day in 8 am, and the 3 pm.
The flow of the water was 12 sec L/ha. During the production season continuous monitoring of the
basic environmental conditions was undertaken twice a week, particularly the amount of dissolved
oxygen, biological oxygen demand, chemical oxygen demand, quantification of consumption of
permanganate, amount of nitrite, nitrate, chloride, total phosphorus, ammonium ions and ammonia
and pH.
The use of hydrated lime was 1000kg/ha in April, May and June, while in July, August, September
and October was 2000 kg/ha.
During the growing season the health status and condition of the carp was regularly controlled at
least twice a month.
Quality control of the pond water was tested with standard methods (SRPS, SRPS EN ISO, EPA).
The pH of a solution is measured as negative logarithm of hydrogen ion concentration. At a given
temperature, the intensity of the acidic or basic character of a solution is indicated by pH or
hydrogen ion concentration.
The Chemical Oxygen Demand (COD) test determines the oxygen requirements equivalent of
organic matter that is susceptible to oxidation with the help of a strong chemical oxidant. COD is
determinate by titration method by using dichromate.
The Biochemical Oxygen Demand (BOD) is an empirical standardized laboratory test which
measures oxygen requirements for aerobic oxidation of decomposable organic matter and certain
inorganic materials in water, polluted waters and wastewater under controlled conditions of
temperature and incubation period. The quantity of oxygen required for the above oxidation
processes is a measure of the test.
KMnO4 indicates organic pollution. It is determinate by titration in the acid medium.
Dissolved Oxygen- All living organisms are dependent upon oxygen in one form or another to
maintain the metabolic processes that produce energy for growth and reproduction. Dissolved
oxygen was measured by portable meter WTW OXY 300.
314
Ammonia is produced by the microbiological degradation of organic nitrogenous matter. Ammonia

produces a yellow coloured compound when it reacts with alkaline Nessler reagent, provided the
sample is clarified properly. Ammonia is determined by measuring absorbance with UV/VIS
spectrophotometer.
Nitrogen (Nitrate) (NO3-) Nitrate is the most highly oxidised form of nitrogen compounds
commonly present in natural waters. Significant sources of nitrate are chemical fertilizers, decayed
vegetable and animal matter, domestic effluents, sewage sludge disposal to land, industrial
discharge, leachates from refuse dumps and atmospheric washout. Nitrates are determined by
measuring absorbance with UV/VIS spectrophotometer.
Nitrogen (Nitrite) (NO2-) Nitrite in water is either due to oxidation of ammonium compounds or
due to reduction of nitrate. As an intermediate stage in the nitrogen cycle, it is unstable. Nitrite was
determined by measuring absorbance with UV/VIS spectrophotometer.
Chloride (Cl-) The presence of chloride in natural waters can be attributed to dissolution of salt
deposits or discharges of effluents from chemical industries. They are determined by titration.
Phosphate and orthophosphate are determined by spectrophotometric measurement.
Metals all metals are determined by AAS.
Chemical analysis: Water content of fish fillets was determined after drying the samples at 105 C
to a constant weight for 24 hours (SRPS ISO 1442:1997). Crude protein content was determined by
Kjeldahl and ash was determined after burning. Crude lipid in fish tissue was also analyzed using
the Soxhlet System with ether as a solvent (SRPS ISO 1443:1997).
Extraction of lipids was done using Spiri et al. (2010) method for extraction of lipids from fish
muscle by ASE. Fatty acid Methyl esters are determined by Gas Chromatography.
Results
At the end of the growing season, the average weight of the two-year old carp was 1000 g, and 2.5
kg for a three-year old carp. Harvesting density was about 3000 kg/ha. Conversion was 1.6 for
formulated feed in the dry matter. Mortality ranged from 5% in two-year old carps, and 10% in oneyear old carps.
Table 1 shows the range of the maximum and minimum concentration of tested parameters in well
water and the water from the fish pond before and after the addition of lime. The Results of the
analysis of the well water indicate that it has a very good quality which corresponds to the quality of
drinking water. In the pond water the highest values reach level of ammonia, which decreases after
using lime and descends into the acceptable values as shown in Graph 1.
Table 2 summarizes the chemical content and fatty acid composition of the sampled carps. It should
be noted that 12 specimens were taken for analysis. The amount of protein was 16.21 % and fat
content 4.42%. A lipid analysis enabled the classification and quantitative determination of fatty
acids and besides that the sum of saturated fatty acids (SFA), monounsaturated fatty acids (MUFA),
polyunsaturated fatty acids (PUFA), n-3 acids, n-6 acids, n-3/n-6 ratio, n-6/n-3 ratio and ratio of
PUFA/SFA, as well as the ratio of USFA/ SFA which represent the indicators of lipid quality. The
Total amount of SFA was (27%), the amount of MUFA was (28%) and PUFA (44%) content was
the highest. The ratio of n-3/n-6 was 0.92, while the ratio PUFA/SFA was 1.62.
During the health status of fish monitoring erythrodermatitis was diagnosed. The disease appeared
from the middle of August with prevalence of 25%. After treatment with flumequin in pelleted feed,
the symptoms of disease disappeared.
315
Table1. Quality of well water and pond water before and after addition of lime, the range of
maximum and minimum concentration of tested parameters
The
tested parameter
pH
Chemical Oxygen
Demand (COD)
Biochemical Oxygen
Demand (BOD)
Unit
Method
mgO2/L
SRPS H.Z1.111: 1987

SRPS ISO
6060:1994*
mg O2/L
H1.002*
KMnO4
mg/L
Dissolved Oxygen
mg/L
Total N
mgN/L
Ammonia
mgN/L
Nitrate
mgN/L
Nitrite
mgN/L
Chloride
mg/L
Phosphate
mgP/L
Ortophosphate
mgP/L
Metals
Iron
Zink
Arsenic
mg/L
mg/L
g/L
SRPS EN ISO
8467:2007*
SRPS ISO
5814:1994
Computing
SRPS ISO
H.Z1.184:1974*
SRPS ISO 78903:1994*
SRPS EN
26777:2009*
SRPS ISO 9297:1997
SRPS ISO 92971:2007
SRPS EN ISO
6878:2008*
SRPS EN ISO
6878:2008*
EPA 7000b*
EPA 7000b*
EPA 7010*
The measured
value (before
addition of
lime)
7.4-7.8
The measured
value
(after addition
of lime)
7.8-8.5
The
measured
value
(well water)
7.5-7.7
20-26
5-11
2.83-3.82
6-9
<4
<4
30.8-35.8
21-25
1.53-1.81
5.8-6.1
7.56-7.95
5.0-5.67
2.24-2.94
1.25-1.75
2.07-2.721
0.6-1.51
0.41-0.524
<0.02
0.37-0.42
0.43-0.46
1.60-1.83
0.04-0.050
0.03-0.054
0.003
21-24
17-23
8-10
0.031-0.040
0.012-0.015
0.026-0.032
0.025-0.027
0.006-0.013
0.015-0.022
<0.068
<0.011
2.04-2.65
<0.067
<0.011
<1.37
<0.068
0.021-0.026
<1.37
Ammonia -NH3
before addition of lime

after addition of lime
well water
Graph 1. Level of ammonia in well water and in the pond water before and after addition of lime
316
Table2. Chemical and fatty acid composition of produced carp

Parameter
Water content (%)
Protein content (%)
Fat content (%)
Ash content (%)
Fatty acid, %
C12:0
C14:0
C15:0
C16:0
C17:0
C18:0
C20:0
SFA
C16:1, n-9
C18:1cis-9, n-9
C18:1cis-11, n-7
C20:1, n-9
MUFA
C18:2, n-6
C18:3, n-6
C18:3, n-3
C20:2, n-6
C20:3, n-6
C20:3, n-3
C20:4, n-6
C20:5, n-3
C22:5, n-3
C22:6, n-3
PUFA
n-6
n-3
n-3/n-6
n-6/n-3
PUFA/SFA
USFA/SFA
PUFA/MUFA
Carp
78.36 0.24
16.21 0.12
4.42 0.17
1.02 0.02
0.06 0.01
1.53 0.25
1.11 0.08
18.35 0.28
1.32 0.09
4.51 0.12
0.26 0.03
27.15 0.38
5.73 0.28
19.39 0.21
2.33 0.27
1.35 0.12
28.79 0.48
10.29 0.11
5.22 0.06
5.96 0.14
0.33 0.07
0.91 0.06
0.89 0.05
6.21 0.11
4.05 0.08
4.47 0.24
5.75 0.48
44.08 0.55
22.96 0.20
21.12 0.48
0.92 0.02
1.09 0.02
1.62 0.04
2.68 0.05
1.53 0.04
Discussion
The results of the growth indicate that it is possible to breed carps in ponds where remediation has
been performed and where there is a lot of organic material, which could not be completely
eliminate by removing the surface layers of soil. The favourable weight of the carp at harvesting is
the result of good environmental conditions that were based on the use of well water, adequate flow,
aeration, use of hydrated lime, quality of complete feed.
317
The accumulation of contaminants in the fish tissues depends on their concentration in the water,
the lifetime of the fish, the age and the amount of body fat of fish (Bordajandi et al., 2006). Direct
transfer of pollutants is most common from the environment in the sediment and from the sediment
into the aquatic environment and aquatic organisms. State of the ecosystem, water and sediment
directly affects the quality and safety of fish meat (Zoumis et al., 2001). There is a possibility of
mobilization of pollutants in meat and organs of fish (Balter and Lecuyer, 2010), which in the pond
can reach as a result of pollution of the immediate surroundings. The degree of contamination of
water and harvested fish from an ecosystem can indirectly serve as a bioindicator of the degree of
contamination of the ecosystem (Jankovic et al., 2011). Despite the removed soil, organic
production was high as well as the amount of ammonium, which was balanced with the constantly
adding of hydrated lime (the amount which is higher than usual). This helped to keep environmental
conditions in the optimum level for the cultivation of fish, so we had no problem with the smaller
intake of food, lack of oxygen level and higher mortality of fish. The results of the analysis of the
water from fish pond explain the reasons for it being built on remediated soil.
In recent years, increased attention has been paid to the fact that the ponds create a large amount of
nitrogen, phosphorus and organic matter in the water. Nutrients which may cause eutrophication of
the water, coming either directly from the food, or coming from fish excrement (Watanabe et al.
1999). The easiest way to reduce the intake of these substances in the water, is usage of sufficiently
stable food in the water which contains nutritional components that fish can use maximum (Cho and
Bureau, 2001). All these facts are taken into account during the breeding of fish, so the diet was
carried out using a complete feed for carp. The results indicate that this type of diet achieved more
than good production results and the amount of pollutants in the analyzed water was minimal. By
analyzing the economic parameters it can be seen that they are favourable due to good conversion.
The meat quality of carp fish is very variable and changes under the influence of age, breeding
systems and nutrition. The fat content in the carp generally ranges from 2.3 to 16.8%, while the
protein content is less variable and generally is in the range of 14 to 18% (Vladau et al., 2008;
Trbovi et al., 2009; irkovic et al., 2011). Protein and fat content (16.2; 4.4) of analyzed carp
move within the following limits and is very favourable. The results of SFA and USFA obtained in
this study are comparable with the results of other authors. The ratio of n-3/n-6 ranged from 0.8 to
2.4 according to Steffens and Wirth (2007). The ratio of PUFA/SFA which is an indicator of the
quality of lipids was also beneficial (1.62). As the favourable fatty acid composition of carp
affected the entire mixture and mix of grains and liver, spleen and lung, It has been found that the
complete mixture has a very favourable effect on the quality of the fish meat (Ljubojevi et al.,
2013).
Conclusions
It is possible to produce fish on land where remediation has been conducted.
Continuously monitoring of the environmental conditions during the entire process of production is
necessary.
Using well water has an advantage over the water from open water courses, due to its favorable
chemical composition. Water flow and aeration are required in a system with a higher organic load
of water. The use of hydrated lime is a limiting factor in fishery production in organic loaded water.
High production is the result of good nutrition and good environmental conditions. Favorable
conversion per kg was the result of quality balanced meals.
The results of chemical composition of carp meat shows that a very high-quality food is produced.
318
In monitoring the fishs health status and adequate therapeutic measures, implementation is very
important in intensive production, especially in the ponds where a high level of organic matter is
expected.
Remediation contributes to environmental protection and rational usage of land area.
Acknowledgments
This work was supported by grants from the Ministry of Education, Science, and Technological
Development of the Republic of Serbia (project no. TR31011).
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Attayde, J. L. and R. L. Bozelli, 1998. Assessing the indicator properties of zooplankton assemblage to
disturbance gradients by canonical correspondence analysis. Can. J. Fish. Aquat. Sci., 55: 178997.
Balter V. and C. Lecuyer, 2010. Determination of Sr and Ba partition coefficients between apatite from
fish (Sparus aurata) and seawater: The influence of temperature. Geochimica et Cosmochimica Acta,
74: 34493458.
Bordajandi, L. R., Martin, I., Abad, E., Rivera, J. And M.J. Gonzlez, 2006. Organochlorine compounds
(PCBs, PCDDs and PCDFs) in seafish and seafood from the Spanish Atlantic Southwest Coast.
Chemosphere, 64 (9): 1450-1457.
Buchtov, H., Svobodov, Z., Kocour, M. And J. Velek, 2010. Chemical Composition of Fillets of
Mirror Crossbreds Common Carp (Cyprinus carpio L.). Acta Veterinaria Brno, 79: 551557.
Cho, C.Y. and D.P. Bureau, 2001. A review of diet formulationstrategies and feeding systems to reduce
excretory andfeed wastes in aquaculture. Aquaculture Research, 3: 349-360.
irkovi, M. and N. Novakov, 2013. Parasitic diseases of cyprinid fishes. Scientific Veterinary Institute
Novi Sad, Novi Sad, 229 pp.
irkovi, M., Jovanovi. B. and S. Maletin, 2002. Ribarstvo, University of Novi Sad, Faculty of
Agriculture, Novi Sad, 359 pp. (Sr).
irkovi, M., Ljubojevi, D., orevi, V., Novakov, N., Petronijevi, R., Matekalo-Sverak, V. And D.
Trbovi, 2012. The Breed Effect on Productivity and Meat Nutrient Compsition of Fish. Kafkas Univ
Vet Fak Derg, 18 (5): 775-780.
irkovi, M., Trbovi, D. and D. LJubojevi, 2011. Meat quality of fish farmed in polyculture in carp
ponds in Republic of Serbia. Tehnologija mesa, 52: 106-121. (Sr).
Hakkari, L., 1972. Zooplankton species as indicators of environment. Aqua. Fennica, P: 4654.
Jankovi, S., uri, M., Radievi, T., Stefanovi, S., Lenhardt, M., Durgo, K. and B. Antonijevi,
2011. Non-dioxin-like PCBs in ten different fish speciesfrom the Danube river in Serbia. Environmental
Monitoring and Assessment, 181: 153-163.
Ljubojevi, D., irkovi, M., Novakov, N., Puvaa, N., Aleksi, N., Luji, J., and R. Jovanovi, 2014.
Comparison of meat quality of tench, Tinca tinca, reared in extensive and semiintensive culture
systems. Journal of Applied Ichthyology, 30: 50-57.
Ljubojevi, D., irkovi, M., Novakov, N., Trikovi, J. And V. Radosavljevi, 2012. Organic
production of native freshwater fish species as a sustainable solution for developing poor rural regions.
6th World Fisheries Congress (Sustainable Fisheries in a Changing World), Edinburgh, Scotland, 7th 11th May 2012; Book of Abstracts pp. 107.
Ljubojevi, D., Trbovi, D., Luji, J., Bjeli-abrilo, O., Kosti, D., Novakov, N. And M. irkovi,
2013. Fatty Acid Composition of Fishes from Inland Waters. Bulgarian Journal of Agricultural Science,
Supplements, 19 (1): 62-71.
Peli, M., 2014. The use of fishing technologies in sustainable development of slaughterhouse systems,
University of Novi Sad, Novi Sad, Master thesis, 102 pp. (Sr).
319

16. Pontin R. M. and J. M. Langley, 1993. The use of rotifer communities to provide a preliminary national
classification of small water bodies in England. Hydrobiology, 255/256: 4119.
17. Spiri, A., Trbovi, D., Vrani, D., inovi, J., Petronijevi, R. and V. Matekalo-Sverak, 2010.
Statistical evaluation of fatty acid profi le and cholesterol content in fi sh (common carp) lipids obtained
by different sample preparation procedures. Analytica Chimica Acta, 672 (12): 6671
18. Steffens, W. and M. Wirth, 2007. Infl uence of nutrition on the lipid quality of pond fish: common carp
(Cyprinus Fatty Acid Composition of Fishes from Inland Waters 71 carpio) and tench (Tinca tinca).
Aquaculture International, 15: 313319.
19. Trbovi, D., Vrani, D., inovi, J., Borovi, B., Spiri, D., Babi, J. and A. Spiri, 2009.
Masnokiselinski sastav i sadraj holesterola u miinom tkivu jednogodinjeg arana (Cyprinus carpio)
u fazi uzgoja. Tehnologija mesa, 50 (56): 276286 (Sr).
20. Vladau, V.V., Bud, I. and R. Stefan, 2008. Nutritive value of fish meat comparative to some animals
meat. Bulletin of University of Agricultural Sciences and Veterinary Medicine. Animal Sciences and
Biotechnologies, 65 (12): 301305.
21. Watanabe, T., Jahan, P., Satoh, S. and V. Kiron, 1999. Total phosphorus loading onto the water
environment from common carp fed commercial diets. Fisheries Science, 65: 712-716.
22. Webber, D. F. and M. K. Webber, 1998. The water quality of Kingston Harbour: evaluating the use of
the planktonic community and traditional water quality indices. Chemistry and Ecology, 14: 357374.
23. Wu, J - T., 1984. Phytoplankton as bioindicator for water quality in Taipei. Bot. Bull. Acad. Sin., 25:
205-214.
24. Zakaria, H. Y., M. H. Ahemed and R. Flower, 2007. Environmental assessment of spatial distribution of
zooplankton community in Lake Manzalah Egypt. Acta Adriat., 48: 16172.
25. Zoumis, T., Schmidt, A., Grigorova, l. AND W. Calmano, 2001. Contaminants in sediments:
remobilization and demobilization. Science of the Total Environment, 266: 195202.
320
Invited lecture
RAPID DETECTION OF IMPORTANT CARP VIRUSES BY LOOP-MEDIATED
ISOTHERMAL AMPLIFICATION (LAMP)
Vladimir Radosavljevic1*, Dragana Ljubojevic2, Vesna Milicevic1, Miroslav Cirkovic2, Dobrila
Jaki-Dimi1, Jelena Maksimovic-Zoric1, Jadranka Zutic1
1. Institute of Veterinary Medicine of Serbia, Belgrade, Serbia
2. Scientific Veterinary Institute, Novi Sad, Novi Sad, Serbia
Abstract
Nucleic acid amplification is a valuable tool for the diagnosis of fish diseases. Several amplification
methods are available. Among these, PCR is the most widely used in various forms such as reverse
transcription PCR (RT-PCR), nested PCR and multiplex PCR. These PCR-based methods require
either high precision instruments for amplification or elaborate methods for detection of the
amplified products. Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid
diagnostic method that can rapidly amplify a target region under isothermal conditions. The LAMP
reaction employs a Bst DNA polymerase and a set of four specific primers that recognize a total of
six distinct sequences on the target DNA. The most significant advantage of LAMP is the ability to
amplify specific sequences under isothermal conditions between 63C to 65C, thereby obviating
the need for a thermal cycler. Therefore, there is no time loss in thermal changes, and the
amplification efficiency of the LAMP method is extremely high. In this study, we used a LAMP
method for the detection of koi herpesvirus and spring viremia of carp virus, and evaluated its
sensitivity, specificity, and convenience. For the detection of koi herpesvirus we used a LAMP
method published by Gunimaladevi et al., and RT-LAMP protocol targeting the G-protein of the
virus for detection SVCV developed by Shivappa et al. was used. LAMP was carried out and the
reaction products are observed directly, after the addition of SYBR Green I. LAMP protocol is
rapid, sensitive, specific and convenient for detection of KHV DNA. The test requires only a heat
source and is completed in one hour. Considerably less time is required to obtain a result using
SYBR Green I stain, compared with traditional gel electrophoresis.
Keywords: LAMP, carp, virus detection
Introduction
Fish diseases are a constant threat to the sustainability and economic viability of aquaculture. Early
diagnosis plays a vital role in management of sh diseases. Traditionally, various biochemical and
serological tests have been used for sh disease diagnosis. However, the time and expertise required
for such diagnoses makes it difficult to easily adopt under production conditions. Traditional
methods for identifying pathogens are mainly based on phenotypic characteristics. Nucleic acidbased detection assays have also been used for the detection of pathogens. Various techniques,
including restriction digestion of nucleic acid, nucleic acid hybridization and DNA amplication
technology are currently being used. Polymerase chain reaction (PCR) and real-time PCR have
gained a wide popularity as a diagnostic tool. The advantage of PCR over other nucleic acid
techniques is the ease of development of the detection system, its high sensitivity and rapidity.
The recently designated cyprinid herpesvirus 3 (CyHV-3) is an emerging agent that causes fatal
disease in common and koi carp. This highly contagious pathogen has caused severe financial
losses in common and koi carp culture industries worldwide (Gilad et al. 2002; Perelberg et al.2003,
Hedrick et al. 2000). CyHV-3 has the largest genome among viruses in the order Herpesvirales and
321
serves as a model for mutagenesis of large DNA viruses. Spring viraemia of carp (SVC) is a
rhabdovirus infection capable of inducing an acute haemorrhagic and contagious viraemia in several
carp species and of some other cyprinid and ictalurid fish species. The aetiological agent of SVC is
spring viraemia of carp virus (SVCV), a member of the virus family Rhabdoviridae, and tentatively
placed in the genus Vesiculovirus (Fauquet et al. 2005). A variety of assays have been developed to
detect the presence of SVCV. The World Organization for Animal Health (OIE) recommended
diagnostic tests for SVCV include virus culture, reverse transcriptase (RT) PCR, enzyme-linked
immunosorbent assay (ELISA), immunouorescent antibody technique (IFAT) and in situ
hybridization. However, detection of SVCV by PCR or serological detection must be conrmed by
virus culture.
Loop-mediated isothermal amplification (LAMP) amplifies nucleic acid with high sensitivity,
specificity and rapidity under isothermal conditions (Mori et al. 2001). The LAMP reaction
employs a Bst DNA polymerase and a set of four specific primers that recognize a total of six
distinct sequences on the target DNA. The most significant advantage of LAMP is the ability to
amplify specific sequences under isothermal conditions between 63C to 65C, thereby obviating
the need for a thermal cycler (Mori et al. 2001). Therefore, there is no time loss in thermal changes,
and the amplification efficiency of the LAMP method is extremely high (Pillai et al. 2006). Several
reports on LAMP-mediated diagnostic methods have been developed for viral pathogens in
aquaculture. In this study, we used a LAMP method for the detection of koi herpesvirus and spring
viremia of carp virus, and evaluated its sensitivity, specificity, and convenience.

Virus strains and cell lines
SVCV reference strain, infectious haematopoietic necrosis virus (IHNV), viral haemorrhagic
septicemia virus (VHSV), PFRV and infectious pancreatic necrosis virus (IPNV) were obtained
from EURL for Fish Diseases, Copenhagen, Denmark. Other SVCV strains were isolated and
preserved in our laboratory. The koi herpes virus was isolated from a koi carp by Hedrick et al.
(2000), generously provided by Dr S. M. Bergmann (Friedrich Loeffler Institute, Germany). The
CCB (Common carp brain) and EPC (Epithelioma papulosum cyprini) cell lines were used to
propagate the aforementioned viruses.
DNA/RNA extraction from cell culture
Viral RNA was extracted from cell cultures infected with different viruses using QIAamp RNA
Mini Kit according to the manufacturers recommendation. The viral DNA was isolated by QIAamp
DNA Mini Kit according to the manufacturers recommendation.
SVCV RT-LAMP reaction conditions
The RT-LAMP assay was carried out in a total mixture volume of 25 L, using primers by
Shivappa et al. (2008). The reaction mixture contained 40 nmol l-1 each of inner primers SVCVFIP and SVCV BIP, 5 nmol l-1 each of outer primers SVCV-F3 and SVCV-B3, 35 L of 20 mol
l-1 dNTP mix, 5 l of 5 mol l-1 betaine (Sigma-Aldrich, St Louis, MO, USA), 0,6 l of 20 mol l-1
MgSO4, 5 l of 8 U Bst (Bacillus stearothermophilus) DNA polymerase (large fragment; New
England Biolabs Inc., Beverly, MA, USA), 25 L of 10 x PCR buffer, 1 L of 40 U of AMV
Reverse transcriptase (Promega, Madison, WI, USA) and 25 L template RNA.The mixture was
incubated at 64C for 60 min, and then the reaction was terminated by heating at 80C for 2 min.
2l LAMP products were electrophoresed on 2.0% agarose gel.
Aliquots of 6 L LAMP reaction products were subjected to electrophoresis with 2% agarose gel
and analysed under a gel ultraviolet bioimage analyser after the gel was stained by ethidium
322
bromide. Alternatively, the reaction products were analysed by the colour change upon treatment
with a SYBR Green I (Invitrogen, CA, USA).
KHV LAMP reaction conditions
The LAMP was carried out in a 25 L reaction volume, using primers by Gunimaladevi et al.
(2004). The reaction mixture contained 2 L (40 pmol) of each KHV- FIP and -BIP, 1.0 L (5
pmol) of KHV-F3 and -B3, 12.5 L of 2X reaction mixture (40 mm Tris-HCl, 20 mm KCl, 16 mm
MgSO4, 20mm (NH4)2SO4, 0.2% Tween-20, 1.6 m betaine and 2.8 mm dNTPs each), 1.0 L of
target DNA and 3.5 L of distilled water. The mixture was heated at 95oC for 5 min, then chilled on
ice and 1.0 L (8 U) of Bst (Bacillus stearothermophilus) DNA polymerase (large fragment; New
England Biolabs Inc., Beverly, MA, USA), was added. The mixture was incubated at 65C for 60
min, and then the reaction was terminated by heating at 80C for 2 min. Aliquots of 6 L LAMP
reaction products were subjected to electrophoresis with 2% agarose gel and analysed under a gel
ultraviolet bioimage analyser after the gel was stained by ethidium bromide. Alternatively, the
reaction products were analysed by the colour change upon treatment with a SYBR Green I
(Invitrogen, CA, USA).
Specificity test of SVCV RT-LAMP
Total RNA was extracted from different virus infected and mock infected cells (SVCV, IHNV,
VHSV, IPNV and PFRV). These samples were used to evaluate specificity of the RT-LAMP assay.
Specificity test of KHV LAMP
Total RNA was extracted from different virus infected and mock infected cells (CyHV-1, CyHV-2,
CyHV-3). These samples were used to evaluate specificity of the RT-LAMP assay.
Sensitivity test of SVCV RT-LAMP
Ten-fold serial dilutions (10-1 to 10-7 diluted) of RNA extracted from SVCV-infected EPC cells
were used as templates for RT-LAMP following optimized conditions. The same diluted RNA
samples were also detected using nested RT-PCR as a control method to evaluate the sensitivity
compared with the RT-LAMP assay. The first step PCR was performed using an outer primer set
5-TCT-TGG-AGC-CAA-ATA-GCT-CAR*-R*TC-3 (SVCV F1) and 5-AGA-TGG-TAT-GGACCC-CAA-TAC-ATH*-ACN*-CAY*-3 SVCV R2), yielding a PCR product with 714 bp. The
second step PCR was carried out with an inner primer set (5-TCT-TGG-AGC-CAA-ATA-GCTCAR*-R*TC-3 (SVCV F1) and 5-CTG-GGG-TTT-CCN*-CCTCAA-AGY*-TGY*-3 (SVC R4),
yielding a PCR product with 606 bp.
Sensitivity test of KHV LAMP
Ten-fold serial dilutions (10-1 to 10-7 diluted) of DNA extracted from KHV-infected CCB cells were
used as templates for LAMP following optimized conditions. The same diluted DNA samples were
also detected using PCR as a control method to evaluate the sensitivity compared with the LAMP
assay. The PCR was performed using an primer set 5-GGG-TTA-CCT-GTA-CGA-G-3 (KHV
TKf) and 5-CAC-CCA-GTA-GAT-TAT-GC-3 KHV TKr), yielding a PCR product with 409 bp.
Results
Specificity of SVCV RT-LAMP assay
To confirm the specific amplification, the RT-LAMP was first used to check the five different
SVCV strains. A characteristic of ladder pattern was detected from the amplified products of both
323
SVCV reference strain and virus strains isolated in Serbia. The cross-amplification of 200 ng each
of RNA of other fish disease viruses (IHNV, VHSV, IPNV and PFRV) was also evaluated to
determine the specificity of RT-LAMP method. It is shown that neither of these RNA extracted
from corresponding virus infected cells was positive by this method. This result indicates that RTLAMP assay is excellently specific to SVCV.
Specificity of KHV LAMP assay
To confirm the specific amplification, the RT-LAMP was first used to check the three different
KHV strains. A characteristic of ladder pattern was detected from the amplified products of both
KHV reference strain and virus strains isolated in Germany. The cross-amplification of 200 ng each
of DNA of other fish disease viruses (CyHV-1, and CyHV-2) was also evaluated to determine the
specificity of LAMP method. It is shown that neither of these DNA extracted from corresponding
virus infected cells was positive by this method. This result indicates that LAMP assay is
excellently specific to KHV.
Sensitivity of SVCV RT-LAMP assay
To compare the sensitivity of detection limit, we carried out RT-LAMP and semi-nested RT-PCR
using the same 10-fold serial dilutions of SVCV RNA. RT-LAMP was able to detect template at
10-6 dilution, same as the semi-nested RT-PCR. Therefore, the detection sensitivity of RT-LAMP
was equal to the semi-nested RT-PCR.
Sensitivity of KHV LAMP assay
To compare the sensitivity of detection limit, we carried out LAMP and PCR using the same 10fold serial dilutions of KHV DNA. LAMP was able to detect template at 10-7 dilution, while PCR
could only detect the presence of the virus up to the 10-5 dilution. Therefore, the detection
sensitivity of RT-LAMP was 100-fold higher than the PCR.
(a)
(b)
Figure 1. Sensitivity test for loop-mediated isothermal amplification (LAMP) and PCR using the same
tenfold series dilutions of koi herpes virus (KHV) DNA as templates. (a) Result of agarose gel
electrophoresis of LAMP products. (b) Result of SYBR green I dye of LAMP products. M: molecular
marker; lane 1: nondiluted DNA extracted from KHV-infected cells; lanes 28: 10-1 to 10-7 dilutions of DNA
extract from KHV-infected cells.
324

Spring viremia of carp and koi herpesvirus disease are the most important epidemic diseases for the
carp industry. At present, the various diagnostic techniques used for the detection of SVCV and
KHV include sell isolation on cell culture, histopathology, viral isolation, in situ hybridization,
electron microscopy, ELISA, nested PCR and real-time PCR. The PCR approach has been found to
be a useful technique for SVCV and KHV diagnosis. LAMP is a novel method that facilitates rapid
nucleic acid amplification using only simple equipment. LAMP is also a sensitive method which
can amplify a few DNA copies in less than 1 hour under isothermal condition (Shivappa et al 2008).
The amplification efficiency of the LAMP method is high because there is no time loss for thermal
change due to its isothermal reaction. The LAMP reaction has been successfully established in
diagnosing viral infection in several species of mammals, plants, fish and shellfish (Soliman and ElMatbouli, 2006). In this study, the LAMP diagnostic protocols were carried out for the detection of
SVCV and KHV. The LAMP reaction conditions were optimized by incubation of the target DNA
with the specific four primers at 65C for 60 min. The amplified products appeared as a ladder-like
pattern on the gel due to the cauliflower-like structures (Notomi et al. 2000).
In conclusion, the LAMP protocols are rapid, sensitive, specific and convenient for detection of two
important carp viruses, SVCV and KHV. The test requires only a heat source reactor and is
completed in 1 h compared with 3-4 h for PCR. Considerably less time is required to obtain a result
using SYBR Green I stain, compared with traditional gel electrophoresis.
Acknowledgments
This research was funded within the project, TR 31011, TR 31075 by the Ministry of Education,
Science and Technological Development, Republic of Serbia.
References
1.
2.
3.
4.
5.
6.
7.
8.
Fauquet C.M., Mayo M.A., Maniloff J., Desselberger U. & Ball L.A.: Virus Taxonomy. Eighth Report
of the International Committee on Taxonomy of Viruses Academic Press, London, UK, 2005.
Gilad O., Yun S., Andree K.B., Adkison M.A., Zlotkin A., Bercovier H., Eldar A., Hedrick R.P.: Initial
characteristics of koi herpesvirus and development of a polymerase chain reaction assay to detect the
virus in koi, Cyprinus carpio koi. Diseases of Aquatic Organisms, 48, 101108, 2002
Gunimaladevi I., Kono T., Venugopal M.N., Sakai M.: Detection of koi herpesvirus in common carp,
Cyprinus carpio L., by loop-mediated isothermal amplification. Journal of Fish Diseases, 27, 583589,
2004
Hedrick R.P., Gilad O., Yun S., Spangenberg J.V., Marty G.D., Nordhausen R.W., Kebus M.J.,
Bercovier H., Eldar A.: A herpesvirus associated with mass mortality of juvenile and adult koi, a strain
of common carp. Journal of Aquatic Animal Health, 12, 4457, 2000
Mori, Y., Nagamine, K., Tomita, N., and Notomi, T.: Detection of loop-mediated isothermal
amplification reaction by turbidity derived from magnesium pyrophosphate formation Biochemical and
Biophysical Research Communications, 289, 150-154, 2001
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T. Loopmediated isothermal amplification of DNANucleic Acids Research, 28, 63, 2000
Perelberg A., Smirnov M., Hutoran M., Diamant A., Bejerano Y., Kotler M.: Epidemiological description of a new viral disease afflicting cultured Cyprinus carpio in Israel. Israeli Journal of AquacultureBamidgeh, 55, 512, 2003
Pillai, D., Bonami, J. R., and Sri, Widada, J.: Rapid detection of Macrobrachium rosenbergii nodavirus
(MrNV) and extra small virus (XSV), the pathogenic agents of white tail disease of Macrobrachium
325

rosenbergii (De Man), by loop-mediated isothermal amplification: Journal of Fish Diseases, 29, 275283, 2006
9. Shivappa RB, Savan R, Kono T, et al.: Detection of spring viraemia of carp virus (SVCV) by loopmediated isothermal amplification (LAMP) in koi carp, Cyprinus carpio L. Journal of Fish Diseases,
31:249258, 2008
10. Soliman, H. and El-Matbouli, M. An inexpensive and rapid diagnostic method of Koi Herpesvirus
(KHV) infection by loop-mediated isothermal amplification, Veterinary Microbiology, 114, 205-213,
2006
326
Invited lecture
LINK BETWEEN LIPID QUALITY OF CYPRINID FISH SPECIES AND HUMAN
HEALTH
Dragana Ljubojevi1*, Miroslav irkovi1
1 Scientific Veterinary Institute Novi Sad, Novi Sad, Republic of Serbia
Abstract
The aim of the study was to analyze the importance of regular cyprinid fish meat consumption in
order to prevent heart and other diseases and preserve the public health of the population. Common
carp is the most important fish species in the Republic of Serbia and together with other cyprinid
species represents an important nutritional source of unsaturated fatty acids. N-3 highly unsaturated
fatty acids have been shown to play an important role in human health. This paper examined the
link between meat quality of cyprinid fish species including chemical and fatty acid compositions
and human health. It was found that the fat content and fatty acid composition significantly differs
in different fish species, even when they belong to the same family. In addition, the same
parameters were found to be influenced by different environmental factors, especially by diet. We
also established a significant role of good production technology and appropriate structure of
planktonic and benthic organisms, which play a significant role in carp nutrition, meet quality and
desirable chemical and fatty acid composition; as well as in the meet quality of other cyprinid
species that are grown in polyculture with carp. Using formulated feed mixtures had a positive
effect on fish health, production parameters and meat quality. Both animals and vegetable
components were used in formulated carp feed in order to study their effects on production
performance and meet quality. Our results showed similar performance with using both types of
feed, but there were moderate changes in fatty acid composition. Fish meat contains low amount of
saturated fatty acids and cholesterol and because of that it presents a healthier alternative compared
to other types of meat. Unsaturated fatty acids are prevalent in cyprinid fish meat and diet rich in
unsaturated fatty acids is correlated with a reduced risk of stroke and coronary heart disease, which
indicates important role of cyprinids fish meat in human diet. The importance of regular
consumption of cyprinid fish species meat is highlighted and analyzed through a wider theoretical
framework that includes guidelines and recommendations of the World Health Organization and
other international competent institutions.
Keywords: cyprinid fish species, lipids, fatty acids, food, human health, recommendations
Introduction
Meat of common carp, the most abudant fish species in fish ponds in the Republic of Serbia, and
other cyprinid species, represent an important nutritional source of unsaturated fatty acids (USFA),
which play many important roles in human health. Therefore, knowledge about the factors that
affect the chemical and fatty acid composition of common carp and other cyprinid species that are
grown in Serbia is very important. It was found that the fat content and fatty acid composition
significantly vary between different fish species, even when they belong to the same family
(irkovi et al., 2012ab; Ljubojevi et al., 2013ab). Environmental factors, rearing system and
especialy nutrition also affect the above mentioned parameters (Ljubojevi et al., 2013cd; 2014;
2015).
327
We also established a significant role of good production technology nd appropriate structure of

planktonic and benthic organisms, which play a significant role in carp nutrition, meet quality and
desirable chemical and fatty acid composition; as well as in the meet quality of other cyprinid
species that are grown in polyculture with carp (irkovi et al., 2012a; Ljubojevi et al., 2014).
Using formulated feed mixtures had a positive effect on fish health, production parameters and meat
quality (Ljubojevi et al., 2013ac). Both animal and vegetable origin components were used in
formulated carp feed in order to study their effects on production performance and meet quality
(Ljubojevi et al., 2015).
Our results showed similar performance with using both types of feed, but there were moderate
changes in fatty acid composition. The elementary prerequisite for the sustainable carp and other
fresh water fishes production, with favourable chemical and fatty acid compositions, should be seen
in the development of better feeding procedures. Completed formulated feed mixtures are necessary
in modern fish farming because they improve the growth performance and chemical and fatty acid
compositions in fish (Ljubojevi et al., 2013a). The importance of regular cyprinid fish meat
consumption in order to prevent heart and other diseases and preserve the public health of the
population is also highlighted in the present paper.
The importance of cyprinid fishery

More than a decade aquaculture has been globally one of the fastest growing sectors of animal
source foods production. Most of it takes place in fresh water fish farms which are becoming a more
important factor in fish production. The common carp is one of the most frequently farmed fishes in
the world as well as in Central and Eastern Europe (irkovi et al., 2012b). Serbia is a country with
a traditional production of carps, and as such holds an important place in Europe. Production takes
place most often in polyculture with silver carp, bighead carp, grass carp and predatory species:
catfish, perch and pike (irkovi et al., 2011). All of these fish species are characterized by
favourable protein, mineral and vitamin contents. The complex of Chinese carps, that is the grass
carp, the silver carp and the bighead carp, was introduced into the open waters of Europe in the
1960s to expand the fish production and enhance the use of plankton (Lenhardt et al., 2011). In
ponds with cyprinid fish species reared in polyculture it makes as much as 20-30% of total fish
population (irkovi et al., 2011). These additional fish species are reared in cyprinid fish ponds
in order to increase the harvest per hectare (irkovi et al., 2012a). In addition, fish rearing in
polyculture enables better utilisation of the resources of natural feed, decreases the use of complete
mixtures for fish feeding and enables the use of cheaper feed such as grains. Besides, it results in
the improvement of the environment in ponds, conditions of fish feeding and the control of invasive
fish species and oxygen concentrations in fish ponds. The demand for fish from aquaculture is on
increase because fish farms are, in most cases, distant from large industrial pollutants, which results
in minimum possible contamination of fishes with anthropogenic pollutants from the environment.
In addition to this, consumers consider fish from fish farms to be more healthy food than that from
free water (Pinto et al., 2008; orevi et al., 2009).
In Serbia today the production of cyprinid fish species takes place in about 85 fish farms in semiintensive systems. In each case of intensifying the production it is necessary to provide adequate
ambient conditions, corresponding stock density, balanced feed and manipulation with fish
(Ljubojevi et al., 2012). Carp rearing is becoming more and more important and is oriented at the
improvement of the characteristics of the fish and increase the efficacy of production (Kocour et al.,
2007; Ljubojevi et al., 2013b). The efficacy of production of various genetic categories of the
common carp (types, lines, intraspecific crossbreeds) has been regularly investigated regarding
production parameters and market value (Buchtova et al., 2006) as well as regarding the chemical
composition of its eatable parts and their nutritional values (Buchtova et al., 2010; irkovi et al.,
2012a; Ljubojevi et al., 2013a). Experimental research concerning the common carp have been
328
widened to the specific fields of the safety of food, that is the content of pollutants in the meat of
this prevalent fresh water fish in the Serbian market (orevi et al., 2013).
Cyprinids culture systems

Traditional method of common carp breeding is extensive production system in which only natural
resources are exploited, ie. natural food available in the fish pond or semi-intensive culture system,
where, in addition to natural food cereals, mainly maize, are added as supplementary feed which
often leads to increased accumulation of fat in the meat of carp and around the internal organs
(Ljubojevi et al., 2013c; Trbovi et al., 2013) and creating pre-judice that carp is fatty fish.
Analyses of carp meat from different growing systems showed that it is really prejudice and that the
amount of fat in the meat of this species mostly depends on the method of its breeding and nutrition
(Ljubojevi et al., 2013c; 2015). Recently, the use of combinations of industrially produced feed
mixture with the exploitation of natural foods is becoming more common on the ponds in the
Republic of Serbia, is and in this way a much better quality fish meat is achieved, especially in
terms of less fat and more favorable fatty acid composition compared to cultivation in semiintensive system with addition of cereals (Ljubojevi et al., 2013bc; Trbovi et al., 2013).
Appropriate preparing of the fish pond in these systems of breeding has a special role in order to
enhance the production of natural food and achieve the appropriate structure of plankton and
benthic organisms (irkovi et al., 2012a) which represent a significant source of protein for carp
and a good source of essential fatty acid (Ljubojevi et al., 2014). Plankton and benthos contain
high levels of n-3 polyunsaturated fatty acids (n-3 PUFA), including EPA and DHA (Domaizon et
al., 2000; Ljubojevi et al., 2014). Therefore, good preparation of fish ponds, and appropriate
technology during the growing cycle are necessary for the proper quantities, as well as favorable
structure of natural food, which is of great importance regarding improving the fatty acid
composition of common carp carp and other cyprinid species. Analysis of the natural food disclosed
that it was rich in EPA and DHA, with a high n-3/n-6 ratio which was higher than 3 (Ljubojevi et
al., 2014). In the total lipid of natural food samples the proportion of SFA, MUFA and PUFA
ranged from 27.6 to 28.4%, 26.127.4, and 45.346.8% of total identified fatty acids (FA),
respectively. Among n-6 PUFA, the most prevalent was arachidonic acid (AA), and relatively high
percentages of LA and ALA were also detected.
Meat quality of cyprinid fish species

The chemical composition and fatty acid composition of cyprinid fish species are influenced by age,
season, various environmental factors, culture system, especially nutrition and those factors that
affecting meat quality parameters of cyprinids were analysed which is very useful information for
producers of these fish species. The common carp is in Serbia the most important and a highly
esteemed fish species. Because of numerous desirable traits, such as high fecundity, good
conversion of both natural and additional feed, fast growth rate, and resistance to poor
environmental conditions and diseases, this fish species is valuable. Common carp meat is highly
appreciated due to the specific flavors, savory flavors, a short time needed for the preparation of
food and its high digestibility. Gastronomic quality of this fish species is confirmed and about 3,000
specialties could be prepared that are well known in the culinary world (irkovi et al., 2002).
Muscles are the main part of the body of the fish that are used in human nutrition. Muscle tissue and
edible organs of carp contain highly valuable protein and other nutritive substances. Common carp
is a medium fatty fish and most of its fat stored as adipose tissue in the abdominal wall (Mrz and
Pickova, 2009). The grass carps meat is of good quality (irkovi et al., 2012ab; Ljubojevi et al.,
2013a) and is esteemed by anglers. Although silver carp is still less esteemed in the market in
Serbia, considering the most important characteristics (protein and fat quantities) its meat is similar
329
to that of other highly esteemed fish species (irkovi et al., 2012a; Ljubojevi et al., 2013a).The
meat of the bighead carp is of good quality since it feeds primarily on natural food (irkovi,
2012ab; Ljubojevi, 2013a).
Fats and fatty acids in cyprinid fish

The main role of fats in fish is that they are sources of metabolic energy needed for growth and
migration. In addition to this, their presence is inevitable for reproduction and the composition of
cell membranes. Triacilglycerols can deposit twice as much energy as carbohydrates and proteins.
Phospholipids are basic structural components of cell membranes. Besides, the fish fats are rich in
long-chained fatty acids, highly unsaturated fatty acids (HUFA), which have important roles in
animals, including fish species, and humans. The fish are the most important source of human food
which contains these nutrients, n-3 fatty acids (n-3 HUFA). Great interest in the research on the fats
in fish species is a result of their important role in the physiological processes in these animals. The
n-3/n-6 ratio of cyprinid fish species meat varies between 0.8 and 2.4 (Steffens et al., 2005). There
are reports indicating this ratio is about 0.5 (Kopicova and Vavreinova, 2007; irkovi et al., 2011),
even less, about 0.2 (Trbovi et al., 2009; Ljubojevi et al., 2011). Ackman (2000) reported EPA
and DHA acid concentrations in farmed carp as low as 0.35. Alongside with proteins, fats and their
components, fatty acids, are the main organic ingredients in fish feed. The lipid content in the fish
body may sometimes exceed the proteins (irkovi et al., 2012c). Excessive amounts of fats in feed
negatively influences the common carps meat quality since this species deposits fat mainly in
deposits surrounding the organs, more than into the muscular tissue (Mraz and Pickova, 2009). Fish
lipids are particularly rich of polyunsaturated fatty acids (PUFA) that are only slowly synthesized in
humans which is the major difference between meat of fish and meat of farmed terrestrial animals
(Vladau et al., 2008). The n-3/n-6 ratio was found generally lower in cultivated than in wild fish
(Ljubojevi et al., 2014d). That is mainly due to nutrition and lowered level of fish meal as protein
source and its completly or partial replacement with cheaper protein sources. Excessive fat content
(> 10%) has a negative influence on the sensory properties of carp meat, which becomes soapily,
and it often happens if the production is carried out in earthen ponds where the amount of natural
food is insufficient, and grains represent additional feed (irkovi et al., 2012c). On the other hand,
too low fat content in muscle tissue (<5%) has a negative effect on the sensory properties, and in
addition reduces the intake of fatty acids from so lean fish in human nutrition. The fat content in
fish tissue contributes to its organoleptic properties, texture and flavour. Tissue which is rich in fat
is juicy, while lean tissue is dry and perceived as thickly fibrous (mijewski et al., 2006). On the
other hand, there are certain groups of people who require meat with minimal fat and cholesterol
content.
Nutrition of common carp

The common carp is an omnivorous species which most frequently feeds on lower animal species
which inhabit the bottom. In addition to this, it consumes some vegetation and the seeds of higher
plants. Because of this treat, in fish farming the carp easily gets used to extruded feed and uses it
with high conversion. From the time they start feeding to the age of fifteen days, the carp larvae
feed on infusoria, small zooplankton (Rotatoria) and crustaceans (Cyclops spp.). Having reached
the length of 18 mm, they begin feeding on the fauna of the benthos. The adult common carp most
often eats water helminths, Hyronomidae larvae, small crustaceans and molluscs (irkovi et al.,
2002). Various feed is given to the carp in aquaculture. Simple mixtures of agricultural by-products
which are easily accessible and cheap are usually used. These are rice, wheat, barley and maize
bran, peas, defatted meals of oil-producing plant such as soya bean, sunflower, cotton or rapeseed
(Ljubojevi., 2014). The quantity of feed that is given as well as the percentage of each component
330
in the mixture varies considerably (de Silva, 2003). Due to the expansion and intensification of carp
rearing, traditional feed consisting of locally accessible components has been replaced by industrial
mixtures which contain protein components of animal or plant origin.
Effect of fish nutrition on meat fatty acid composition

Fatty-acid composition of fish tissues corresponds to that of the feed which is ingested (Sargent et
al., 2002). Ljubojevi et al. (2013c) found that the ratio of n-3/n-6 in common carps varied by feed
and/or rearing system. Using adequately processed plant meals as replacement protein sources can
further improve productivity and nutritive value of carp. Ljubojevi et al. (2014) have found that
breeding system (extensive or semi-intensive) and consequently nutrition significantly affect the
meat quality including chemical composition of tench. Furthermore, they found that tench that fed
on naturally available pond foods had a poor growth parameters and low yields, and that this
method of production is not economically justifiable. The implementation of plant oils in the fish
feed results in decrease of EPA, DHA and in the n-3/n-6 ratio, in comparison to the feed which
contains fish oil, and has direct consequences on the nutritive quality of the final product (Bell et
al., 2001). This is important from the consumers viewpoint since the high contents of EPA, DHA
and the n-3/n-6 ratio are connected with numerous favourable effects on human health and their
decrease is considered to be unwanted (Simopoulos, 2002). The fall in EPA and DHA, and also
20:1 n-9 and 22:1 n-11 in muscle fats of fish may lead to retention of oil in adipocytes and,
consequently, influence the physical and chemical characteristics of meat while it is stored or
processed (Sargent et al., 2002). In supplementation with plant oils it is important that it does not
influence negatively the fish growth rate or the efficacy of feed utilisation, plus that the results
following the replacement are comparable to those obtained with feeding with mixtures containing
fish oil. Requirements for n-6 fatty acids can be satisfied with linoleic acid, which is widely present
in almost all components which are used in the preparation of fish feed. Ljubojevi et al. (2013c)
reported that lipid content of common carp fillet shows high variance (6.315%) in commercially
sized fish depending mainly on previous nutrition. High average values of the fat content observed
by Ljubojevi et al. (2013a) in the fillets of Cyprinids, especially in those of common carp, showed
that the energy-protein ratio was not balanced in the diet of these fishes in a number of ponds.
Fauconneau et al. (1995) and Romvri et al. (2002) also reported that lipid content of common carp
fillets show high variance (113%) in commercial size of fish depending mainly on previous
nutrition. The reason for the least desirable composition of fatty acid profile in the lipids of
common carp reported by Ljubojevi et al. (2013a) can be accounted for by the diet. The feed rich
in saccharides leads to an increase in the percentage of body lipids in fish. At the same time, there is
a decrease in the percentage of protein. Furthermore, supplementary feeding with grains leads to
reduced amounts of essential fatty acids in fish meat and this is due to the lower proportion of
natural food in the diet of the carp which received additional grains. According to the research
conducted by Buchtov et al. (2010) and irkovi et al. (2012), the carp grown on natural food had
a high content of both n-6 and n-3 fatty acids. Ljubojevi et al. (2013c) observed that PUFA/SFA
ratio was the most favourable in the carp fed completed feed mixtures and the least in that fed with
maize and wheat. According to Vasha et al. (2007) the flesh of common carp fed only natural food
from contained 1.76% of fat only, while flesh of fish on supplementary maize feeding contained the
highest amount 13.26% of fat; flesh of fish on supplementary wheat feeding contained 11.22% of
fat; the flesh of fish on supplementary triticale feeding contained 9.72% of fat. A 200 g of edible
portion of fillets of common carp, silver carp, bighead carp, grass carp, Wels catfish, and zander
accorindg to results of Ljubojevi et al. (2013a) contained 436, 1320, 1774, 412, 612, 420 mg of
EPA+DHA, respectively; and 1198, 2160, 2780, 1076, 954, 524 mg of n-3 PUFA, respectively. The
two fatty acids 18:2n-6 and 18:3n-3 are precusors for synthesis of n-6 and n-3 PUFAs, recpectively
(Sargent et al., 2002). According to Ljubojevi et al. (2013c) carp that received extruded formula
331
showed high values of n-6 fatty acids in their muscle, based on the high content of linoleic acid in
the diets. However, although grain mixture contained slightly higher amount of linoleic acid than
formulated feed, percentage of this fatty acid was lower than in carp fed formulated feed, as well as
than in carp which ingested only natural food, but the absolute content of linoleic acid was 2-3 folds
greater in muscle of carp fed grains compared with muscle of carp fed only natural food. Diets
containing soybean or corn were characterized by high linoleic acid content. High contents of n-6
fatty acids in the grain based and extruded formulated (soybean meal, sunflower cernel, wheat
flower and corn) diet resulted in high levels of these fatty acids in the carp meat. The elementary
prerequisite for sustainable carp and other fresh water fish production, with favourable chemical
and fatty acid compositions should be seen in the development of better feeding procedures.
Completed formulated feed mixtures are necessary in modern fish farming because they improve
growth performance and chemical and fatty acid composition in fish (Ljubojevi et al., 2013ac).
Cholesterol content in cyprinid fish meat

Cholesterol content in female and male carp fillets was in range 69.4 mg/100g - 77.6 mg/100g
(Komprda et al., 2003). Trbovi et al. (2009) reported that the amount of total cholesterol was 48.9
mg/100 g in one-year old carp in April and 54.3 mg/100 g in the same age samples harvested in
June. In the study implemented by irkovi et al. (2012), cholesterol level was 55.8 mg/100g in 2year old carp. In agreement literature, cholesterol content in carp muscle tissue varied considerably
from 38 to 120 mg/100 g, depending on fish breed and age, husbandry system, and harvest season
(Bieniarz et al., 2001; irkovi et al., 2011). Kopicova and Vavreinova (2007) detected the content
of total cholesterol in common carp, sterlet, northern pike and asp and it amounted 47, 61, 86 and
45 mg/100g, respectively. irkovi et al. (2012) found out that the difference between six
freshwater fishes with respect to the amount of cholesterol detected in muscle tissue was significant
and detected the level of total cholesterol in range from 34.34 mg/100g in catfish to 62.32 mg/100g
in silver carp. All examined freshwater fish in the study conducted by Ljubojevi et al. (2013b) are
well-favoured sources of cholesterol. Research conducted by Moreira et al. (2001) on the
cholesterol content of many freshwater fish species showed that the values ranged between 40.99
and 52.79 mg/100g. According to Luzia et al. (2003) the amount of total cholesterol in freshwater
fish is lower in comparison with marine fish. The daily intake of cholesterol is currently
recommended not to exceed 300 mg (James and Ralph, 2000).
The importance of fish meat in the human nutrition

At the end of the 1980s more attention was paid to fact that the consuming of polyunsaturated n-3
fatty acids from fish meat has positive effects on human health, especially in the prevention of heart
attack, cerebrovascular insult, atherosclerosis and high blood pressure. The positive effects on the
circulatory system, the process of remembering and learning, reproductive system and
photoreceptors are well known (Simopoulos, 2002). Proteins, fats, vitamins, micro- and
macroelements, and especially essential fatty acids (n-3) are present in optimum quantities for
human needs (irkovi et al., 2011; irkovi et al., 2012b; Ljubojevi et al., 2013acd). There is
strong evidence that dietary DHA lowers the cholesterol level in serum, and other n-3 PUFAs lower
triglycerides in the serum, but do not affect serum cholesterol (Ryan et al., 2009). PUFA may be
important in the prevention of cardiovascular diseases, and also in reduction of mortality in patients
with heart diseases (Kris-Ethertonet al., 2002). In addition, n-3 PUFAs decrease the content of lowdensity lipoproteins (LDL) in human serum, have antiarrhythmic effect (Hu et al., 2002), inhibit
lipogenesis in the liver and platelet aggregation and also damage of blood vessels and they are very
important in the prenatal development of the nervous system (Allen and Harris, 2001). Also, the
PUFA from n-6 series, and in particular from n-3 series participate in the prevention of diseases of
332
the nervous system, improve learning ability, play an important role in the ontogenesis (Arts et al.,
2001) and also have anti-inflammatory effect (Dorea, 2008). Arachidonic acid and DHA are
essential for the development and function of brain and retina (Lauritzen et al., 2001). According to
Sargent et al. (2002) arachidonic acid is a precursor of prostaglandins and thromboxanes, which has
an impact on the blood clots formation and also fix them to the endothelial tissue during the healing
process, and also has a role in the growth. Kmnkov et al. (2001) reported that content of
arachidonic acid in common carp was 1.3%, and according to Guler et al. (2008) up to 5.6%, which
is in accordinance to results of Ljubojevi et al. (2013ac). The shortage of -linolenic acid (18:3 n3, ALA) is responsible for neurological disorders and poor growth (Cundiff etal., 2007). Essential
polyunsaturated fatty acids such as ALA, EPA and DHA are not synthesized in the human body and
effectively synthesized only by aquatic organisms (Simopoulos, 2002); therefore, humans can
receive these essential fatty acids by marine and freshwater fishes. Results od analysis of the most
common meat products of terrestrial domestic animals and poultry have shown that the ratio of n-6 /
n-3 fatty acids was in the range of from 6.5 to 43.2 (Sampels et al., 2009). Increased intake of n-6
fatty acids is associated with a global increase in the number of obese people (Strandvik et al.,
2008) and inflammatory processes (Calder, 2008). Conversely, the intake of n-3 fatty acids decline
and numerous scientific publications indicate that this phenomenon is closely related to several
health problems (Calder, 2008). Fish is a food that is traditionally considered a good source of n-3
fatty acids and measures to improve fat quality of fish are necessary as well as improving the
technologies of fish production. Generally, fish fats contain relatively low percentage of SFA
(<30%), with the exception of a few species (Guler et al., 2008), which corresponds to the results
presented by Ljubojevi et al. (2015). According to Guler et al. (2008) and Yeganeh et al. (2012)
oleic acid was the dominant MUFA in common carp, which is consistent with the results presented
by Ljubojevi et al. (2013abcd). According to the literature data, this fatty acid also plays an
important role in the prevention of cardiovascular diseases (Peterson et al., 1994). High levels of
oleic acid, arachidonic acid and palmitooleic acid are characteristic for fat of freshwater fish (Guler
et al., 2008; Yeganeh et al., 2012). The unfavorable n-6/n-3 ratio has a negative impact on human
health, so some ideas have been developed (Simopoulos, 2002) that the amount of n-6 fatty acids
should be reduced in fish feed in order to maximize the ratio of n-3/n-6 until at least the
recommended levels, which represents a huge challenge, bearing in mind that vegetable ingredients
which are an alternative feedstuffs for animal origin feedstuffs contain relatively high proportion of
n-6 PUFA. Epidemiological and experimental studies have shown a link between nutrition and the
incidence of heart disease (Simopoulos, 2002). Therefore, therapy in the form of proper nutrition is
considered to be important as medicinal treatment of cardiovascular disorders. Beneficial effects of
fatty acids from fish for human health is highlighted in the text, but it is impossible to explain the
beneficial effects of fish meat on the human health only in terms of EPA and DHA, because fish do
not only include fats and fatty acids, but also muscle tissue, which provides a many other nutritional
ingredients, such as proteins. Previous investigations have shown that, in relation to casein, fish
protein in the feed reduces the level of blood cholesterol levels in laboratory animals (Oishi and
Dohmoto, 2009). In addition, fish proteins have other beneficial effects such as anti-hypertensive
properties. They also lowering low-density lipoprotein (LDL-C, also known as "bad cholesterol")
while increasing high density lipoprotein (HDL-C, also known as "good cholesterol"), and also
have a favorable effect against obesity (Boukortt et al., 2004; Oishi and Dohmoto, 2009). Many
epidemiological and clinical studies have shown that an increase in LDL-C levels, and decrease in
HDL-C levels are important risk factors for the occurrence of cardiovascular diseases (Jacobson et
al., 2007). Results of Oishi and Dohmoto (2009) indicate that the fish proteins lower the cholesterol
content in the liver and the serum by increasing the excretion of cholesterol and bile acid in the
faeces as a result of low micellar solubility of cholesterol, and high capacity for binding bile acids.
Share of essential amino acids in fish meat is very high, especially for example tryptophan, an
amino acid which is precursor of serotonin, which is responsible for the good mood in humans
(Gadoth, 2008).
333
The effect of cholesterol content in fish meat on human health

Cholesterol is very important in the human organism as an essential component of cell membranes
and brain tissue. The results of researches related to the relationship of cholesterol ingested by food
and arteriosclerosis are contradictory. The correlation between serum cholesterol levels and
mortality rates caused by cardiovascular diseases in humans has been demonstrated in many studies
(Kris-Eherton et al., 2002). On the other hand, the endogenous cholesterol synthesis in the liver was
three times higher compared to the normal amount of ingested cholesterol via food, which leads to a
reduction of the importance of cholesterol levels in the diet and increasing interest on the total
energy intake through food as well as intake of SFA, MUFA, PUFA and n-6/n-3 ratio in food.
However, the levels of cholesterol in the blood plasma significantly depend on cholesterol levels
ingested by food. There are studies that suggested a connection between cholesterol level ingested
by food and cholesterol level in the blood plasma and atherosclerosis (Orban et al., 2006). The level
of cholesterol in the blood is also affected by other factors, such as excessive energy intake,
increased intake of SFA and transisomer of certain unsaturated fatty acids (Kris-Eherton et al.,
2002). The knowledge about content of cholesterol in fish meat is important, as consumption of fish
meat is increasing on the basis of recommendations that this type of meat should be an essential
component in the diet of people who have high level of cholesterol in blood. The daily intake of
cholesterol is currently recommended not to exceed 300 mg (James and Ralph, 2000). According to
the results of experiments to date, the cholesterol content in animal tissues can be affected by diet
(Komprda et al., 2003), despite regulatory mechanisms in terms of synthesis and absorption of
cholesterol, which maintain a constant concentration of cholesterol in the tissues.
The guidelines and recommendations related to fish consumption

Fish meat should be included in diets for at least three reasons: as a general source of nutritional
components; as low fat, high protein food; and as source of polyunsaturated fatty acids.
Consumption of fish meat is increasing worldwide, primarily due to the fact that fish is
recommended as an important ingredient in healthy nutrition. According to the latest data from
FAO (2012), the Republic of Serbia is a country where the average consumption of fish 5-10 kg per
capita per year, which is significantly below the European and global consumption. As reasons for
low fish consumption Balti et al. (2009) blame low standard of the population, but also weak and
undiversified offer of fish and fish meat products in the local market as well as consumers habits.
There are recommendations of various world organizations related to fish consumption and intake
of n-3 fatty acids, as well as of appropriate ratios of different groups of fatty acids. The n-6/n-3 ratio
in the most of examined cyprinid fishes (irkovi et al., 2011; 2012ab; Ljubojevi et al., 2013d)
was in the optimal range of 2/14/1 for human health which are the prescribed values recommended
from WHO/FAO organization (Simopoulos, 2002). At the same time, the recommended ratio of
polyunsaturated fatty acids (PUFA) to saturated fatty acids (PUFA/SFA), which is an important
indicator of the quality of fat of fish, should be above 0.4 (Wood et al., 2008). Since some meats of
terrestrial farmed animals naturally have a PUFA/SFA ratio of around 0.1 (Wood et al., 2008), meat
has been implicated in causing the imbalanced fatty acid intake of todays consumers. As already
mentioned, the recommended ratio of n-6/n-3 should be less than 4 (Scollan et al., 2006) and this
ratio in some meats of terrestrial animals is higher than this (Wood et al., 2008). USFA/SFA ratio is
also of great importance for assessing the quality of fats. It was assumed that the favorable ratio was
above 0.35 (Kmnkov et al., 2001). Furthermore, the European Food Safety Authority recommends
the intake values: 2 g of n-3 PUFA ALA per day and 250 mg of EPA and DHA per day (EFSA,
2009). The recommended daily intake for healthy adults is 0.65 g DHA and EPA together, with the
minimum amount of each 0.22g, while a recommended daily intake is higher for pregnant and
breastfeeding women (Simopoulos, 2002). In the case of people who suffer from some form of
334
heart disease and have elevated triglyceride levels recommends a daily intake of EPA and DHA
over 1 and 2 to 4 g, respectively (Kris-Etherton et al., 2002). N-6 fatty acids are also essential, but
they are present in most feedstuffs. From the nutrition viewpoint it should be considered the content
of fat in fish meat, because when the values of PUFAs expressed per 100 g of fish meat, intake of n3 PUFAs is larger when human consume fishes that contain higher amounts of fat than lean fish
(Cahu et al., 2004). However, it is very difficult to determine what is the recommended intake of
fish meat in order to satisfy the recommended intake of all mentioned fatty acids if takes into
account the diversity of fatty acid composition between different species of fish, even if they belong
to related species (irkovi et al., 2012a; Ljubojevi et al., 2013cd), especially if takes into account
how the fatty acid composition of fish, including carp vary depending on the nutrition (Mrz and
Pickova, 2009; Ljubojevi et al., 2013a; 2014). When all of the above mentioned considered, it can
be said that the ability to produce quality fish with predictable and known content of n-3 HUFA
could be very important for producers.
Conclusion
The significance of the results regarding chemical and fatty acid compositions of cyprinid fish meat
lies in the fact that the obtained results of the analysis can be valuable information for ecologists,
nutritionists and producers, as well as the broader scientific community. Our previous researches
covered different culture systems of growing cyprinid fish species and different aspects of nutrition
and the results indicate both the positive and negative sides of each production system, from
extensive to the most intensive growing systems in cages, and in addition encompasses the quality
of meat of wild carp, ie. carp overfished from our largest river Danube, which certainly contributes
to the predictability of the quality of fish meat as the final product from aquaculture. Carp meat is
an important source of nutrients in the human nutrition. It was found that the chemical and fatty
acid composition highly varied in cyprinid fish meat, which is due to different nutrition and
environmental factors. The potential for increasing production of carp as a high-value food exist
and therefore there is a need for reliable analytical data. Future research in aquaculture, especially
regarding growing of carp and other cyprinid fish species in cage systems should be directed
towards the study of energy components in feed, finding the optimal ratio of protein and energy in
feed mixtures, as well as an optimal fatty acid composition of the feed mixture, which will
contribute to achieving optimal production results, the preferred fatty acid composition, as well as
cost-effective production.
Acknowledgments
References
1.
2.
3.
4.
Ackman R.G.: Nutritional composition of fats in seafoods. Progress in food & nutrition science, 13,
161-241, 2000
Allen K. G. D., Harris M. A.: The Role of n-3 Fatty Acids in Gestation and Parturition. Experimental
Biology and Medicine, 226, 498-506, 2001
Arts M. T., Ackman R. G., Holub B. J.: Essential fatty acids in aquatic ecosystems: a crucial link
between diet and human health and evolution. Canadian Journal of Fisheries and Aquatic Sciences, 58,
1, 122137, 2001
Balti . M., Kilibarda N., Dimitrijevi M.: Factors significant for the shelf-life of fish and selected fish
products in retail. Tehnologija mesa, 50, 1-2, 166-176, 2009
335

5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Bell J.G., McEvoy J., Tocher D.R., McGhee F., Campbell P.J., Sargent J.R.: Replacement of fish oil
with rapeseed oil in diets of Atlantic salmon (Salmo salar) affects tissue lipid compositions and
hepatocyte fatty acid metabolism. Journal of Nutrition, 131, 15351543, 2001
Bieniarz K., Koldras M., Kaminski J., Mejza T.: Fatty acids. fat and cholesterol in some lines of carp
(Cyprinus carpio) in Poland. Archives of Polish Fisheries, 9, 5-24. 2001
Boukortt F. O., Girard A., Prost J. L., Ait-Yahia D., Bouchenak M., Belleville J.: Fish protein improves
the total antioxidant status of streptozotocin-induced diabetes in spontaneously hypertensive rat.
Medical science monitor: international medical journal of experimental and clinical research, 10, 11,
BR397-404, 2004
Buchtov H., Svobodov Z., Kocour M., Velek J.: Evaluation of growth and dressing out parameters
of experimental scaly crossbreds in three-year-old common carp (Cyprinus carpio, Linnaeus 1758).
Aquaculture Research, 37, 466-471. 2006
Buchtov H., Svobodov Z., Kocour M., Velek J.: Chemical Composition of Fillets of Mirror
Crossbreds Common Carp (Cyprinus carpio L.). Acta Veterinaria Brno, 79, 551557, 2010
Cahu C., Salen P., de Lorgeril M.: Farmed and wild sh in the prevention of cardiovasular diseases:
Assessing possible differences in lipid nutritional values. Nutrition Metabolism and Cardiovascular
Diseases, 14, 3441, 2004
Calder P.C.: Polyunsaturated fatty acids, inflammatory processes andinflammatory bowel diseases.
Molecular Nutrition & Food Research, 52, 8, 885-897, 2008
Cundiff D. K., Lanou A. J., Nigg C. R.: Relation of omega-3 fatty acid intake to other dietary factors
known to reduce coronary heart disease risk. American Journal of Cardiology, 99, 12301233, 2007
irkovi M., Jovanovi B., Maletin S.: Ribarstvo. Univerzitet u Novom Sadu. Poljoprivredni fakultet,
2002
irkovi M., Trbovi D., Ljubojevi D.: Meat quality of fish farmed in polyculture in carp ponds in
Republic of Serbia. Tehnologija mesa, 52, 106-121, 2011
irkovi M., Ljubojevi D., orevi V., Novakov N., Petronijevi R., Matekalo-Sverak V., Trbovi
D.. The Breed Effect on Productivity and Meat Nutrient Compsition of Fish. Kafkas Universitesi
Veteriner Fakultesi Dergisi, 18, 775-780, 2012a
irkovi M., Ljubojevi D., orevi V., Novakov N., Petronijevi R.: Chemical composition of body
including fatty acids of four cyprinids fish species cultured at the same conditions. Archiva Zootechnica,
15, 2, 37-51, 2012b
irkovi M., Ljubojevi D., Jovanovi R., Jankovi S., orevi,V., Novakov N., Trbovi D., Luji J.:
Influence of improper pond management on high fat content in meat of common carp, Cyprinus carpio,
L. Proceedings, The International Conference Biological Food Safety and Quality BFSQ October 4-5,
2012, Belgrade, Serbia, 2012c, 177-179
De Silvia S.S.: Aquaculture, Farming Aquatic Animals and Plants, Lucas, J.S., and Southgate, P.C.
(Eds.). Fishing News Books, Blackwell Publicaton, 276-294, 2003
Domaizon I., Desvilettes C., Debroas D., Bourdier G.: Influence of zooplankton and phytoplankton on
the fatty acid composition of digesta and tissue lipids of silver carp: mesocosm experiment. Journal of
Fish Biology, 57, 417432, 2000
Dorea J.G.: Persistent, bioaccumulative and toxic substances in fish: human health considerations.
Science of the Total Environment, 400, 93114, 2008
orevi V., Balti M., irkovi M., Kilibarda N., Glamolija N., Stefanovi S., Mievi M.:
Quantitative and qualitative determination ofenrofloxacin residues in fish tissues. Acta Veterinaria
Belgrade, 59, 5-6, 579-589, 2009
orevi V., irkovi, M., Ljubojevi D.: Contamination of the Ecosystem with Organic Pollutants and
its Impact on the Protection of Less Valuable Fish Species in Sava and Danube Rivers. Proceedings,
International 57th meat industry conference and meat products-perspectives of sustainable production;
June 10-12, 2013, Belgrade, Serbia
336

23. EFSA: Scientific opinion of the panel on dietetic products, nutrition and allergies on a request from
European Commission related to labelling reference intake values for n-3 and n-6 polyunsaturated fatty
acids. The EFSA Journal, 1176, 111, 2009
24. FAO: Demand and supply of aquafeed and feed ingredients for farmed fish and crustaceans: trends and
future prospects. The State of World Fisheries and Aquaculture, 172-181, 2012
25. Fauconneau B., Alami-Durante H., Laroche-Marcel J., Vallot D.: Growth and meat quality relations in
carp. Aquaculture, 129, 265297, 1995
26. Gadoth N.: On fish oil and omega-3 supplementation in children: The role of such supplementation on
attention and cognitive dysfunction. Brain and Development, 30, 5, 309-312, 2008
27. Guler G.O., Kiztanir B., Aktumsek A., Citil O.B., Ozparlak H.: Determination of the seasonal changes
on total fatty acid composition and 3/6 ratios of carp (Cyprinus carpio L.) muscle lipids in Beysehir
Lake (Turkey). Food Chemistry, 108, 689694, 2008
28. Hu F. B., Bronner L., Willett W. C., Stampfer M. J., Rexrode K. M., Albert C. M., Manson J. E.: Fish
and omega-3 fatty acid intake and risk of coronary heart disease in women. JAMA: the journal of the
American Medical Association, 287, 14, 1815-1821, 2002
29. Jacobson T. A.: Beyond lipids: the role of omega-3 fatty acids from fish oil in the prevention of
coronary heart disease. Current atherosclerosis reports, 9, 2, 145-153, 2007
30. James W. P. T., Ralph A.: Policy and a prudent diet. Garrow, J. S.; James, W. T. P. and A. Ralph
(Editors). Human Nutrition and Dietetics, 10th edition. Churchill Livingstone, Edinburgh, 2000
31. Kmnkov M., Winterov R., Kuera J.: Fatty acids in lipids of carp (Cyprinus carpio) tissues. Czech
Journal of Food Sciences, 19, 177181, 2001
32. Kocour M., Mauger S., Rodina M., Gela D., Linhart O., Vandeputte M.: Heritability estimates for
processing and quality traits in common carp (Cyprinus carpio L.) using a molecular pedigree.
Aquaculture, 270, 43-50, 2007
33. Komprda T., Zelenka J., Fajmonov E., Bakaj P., Pechov P.: Cholesterol Content in Meat of Some
Poultry and Fish Species As Influenced by Live Weight and Total Lipid Content. Journal of
Agricultural and Food Chemistry, 51, 7692-7697, 2003
34. Kopicova Z., Vavreinova S.: Occurrence of squalene and cholesterol invarious species of Czech
freshwater fish. Czech Journal of Food Sciences, 25, 195-201, 2007
35. Kris-Etherton P. M., Harris W. S., Appel L.J.: For the nutrition committee. AHA scientific statement.
Fish consumption, fish oil, omega-3 fatty acids, and cardiovascular disease. Circulation, 106, 2747
2757, 2002
36. Lauritzen L., Hansen H. S., Jorgensen M. H., Michaelsen K. F.: The essentially of long chain n-3 fatty
acids in relation to development and function and brain and retina. Progress in Lipid Research, 40, 1
94, 2001
37. Lenhardt M., Markovi G., Hegedi A., Maletin S., irkovi M., Markovi Z.: Non-native and
translocated fish species in Serbia and their impact on the native ichthyofauna. Reviews in Fish Biology
and Fisheries, 21, 3, 407-421, 2011
38. Luzia A. L., Sampaio G. R., Castellucci C. M. N., Torres E. A. F. S.: The influence of season on the
lipid profiles of five commercially important species of Brazilian fish. Food Chemistry, 83, 9397, 2003
39. Ljubojevi D., irkovi M., orevi V., Trbovi D., Novakov N., Vrani D., Babi J.: Lipids and total
cholesterol content in meat of common carp of various ages. Proceedings, 22nd International
Symposium Food safety production, June 19-25, 2011, Trebinje, Bosna i Hercegovina, 46-49, 2011
40. Ljubojevi D., irkovi M., Novakov N., Jovanovi R., Jankovi S., orevi V., Trbovi D.: The
impact of diet on meat quality of common carp. Archiva Zootechnica, 15, 3, 69-78, 2012
41. Ljubojevi D., irkovi M., orevi V., Puvaa N., Trbovi D., Vukadinov J., Plava N.: Fat quality
of marketable fresh water fish species in the Republic of Serbia. Czech Journal of food sciences, 31,
445-450, 2013a
42. Ljubojevi D., Trbovi D., Luji J., Bjeli-abrilo O., Kosti D., Novakov N., irkovi M.: Fatty Acid
Composition of Fishes from Inland Waters. Bulgarian Journal of Agricultural Science, Supplements,
19, 1, 62-71, 2013b
337

43. Ljubojevi D., irkovi M., Novakov N., Jovanovi R., Jankovi S., orevi V., Mai Z.:
Productivity and Meat Nutrient in Fish: The Diet Effect. Kafkas Universitesi Veteriner Fakultesi
Dergisi, 19, 43-49, 2013c.
44. Ljubojevi D., irkovi M., orevi V., Trbovi D., Vrani D., Novakov N., Mai Z.: Hemijski
sastav, sadraj holesterola i sastav masnih kiselina arana (Cyprinus carpio) iz slobodnog izlova,
poluintenzivnog i kaveznog sistema gajenja. Tehnologija mesa, 54, 1, 4856, 2013d
45. Ljubojevi D., irkovi M., Novakov N., Puvaa N., Aleksi N., Luji J., Jovanovi R.: Comparison of
meat quality of tench, Tinca tinca, reared in extensive and semiintensive culture systems. Journal of
Applied Ichthyology, 30, 50-57, 2014
46. Ljubojevi D.: Korienje repiinog ulja u ishrani arana i linjaka kao faktora promene kvaliteta mesa.
Doktorska disertacija, 2014
47. Ljubojevi D., Radosavljevi V., Puvaa N., ivkov Balo M., orevi V., Jovanovi R., irkovi M.:
Interactive effects of dietary protein level and oil source on proximate composition and fatty acid
composition in common carp (Cyprinus carpio L.). Journal of Food Composition and Analysis, 37, 4450, 2015.
48. Moreira A. B., Visentainer J. V., de Souza N. E., Matsushita M.: Fatty acids profile and cholesterol
contents of three Brazilian Brycon freshwater fishes. Journal of Food Composition and Analysis, 14,
565574, 2001
49. Mrz J., Pickova J.: Differences between lipid content andcomposition of different parts of fillets from
crossbred farmed carp (Cyprinus carpio). Fish Physiology and Biochemistry, 35, 4, 615-623, 2009
50. Oishi Y., Dohmoto N.: Alaska pollack protein prevents the accumulation of visceral fat in rats fed a
high fat diet. Journal of nutritional science and vitaminology, 55, 2, 156-161, 2009
51. Orban E., Masci M., Nevigato T., Di Lena G., Casini I., Caproni R., Rampacci M.: Nutritional quality
and safety of whitefish (Coregonus lavaretus) from Italian lakes. Journal of Food Composition and
Analysis, 19, 6, 737-746, 2006
52. Peterson D.B., Fisher K., Carter R.D., Mann J.: Fatty acid composition of erythrocytes and plasma
triglyceride and cardiovascular risk in Asian diabetic patient. Lancet, 343, 15281530, 1994
53. Pinto B., Garritano S. L., Cristofani R., Ortaggi G., Giuliano A., Amodio-Cocchierri R., Reali D.:
Monitoring of polychlorinated biphenyl contamination and estrogenic activity in water, commercial feed
and farmed seafood. Environmental Monitoring and Assessment, 144, 445453, 2008
54. RomvrI R., Hancz C.S., Petrsi Z.S., Molnr T., Horn P.: Non-invasive measurement of fillet
composition of four freshwater fish species by computer tomography. Aquaculture International, 10,
231240, 2002
55. Ryan A. S., Keske M. A., Hoffman J. P., Nelson E. B.: Clinical overview of algal-docosahexaenoic
acid: effects on triglyceride levels and other cardiovascular risk factors. American journal of
therapeutics, 16, 2, 183-192, 2009
56. Sampels S., Strandvik B., Pickova J.: Processed animal productswith emphasis on polyunsaturated fatty
acid content. European Journal of Lipid Sciences and Technology, 111, 5, 481488, 2009
57. Sargent J.R., Tocher R., Bell J.G.: The lipids. Fish Nutrition (Halver, J.E. & Hardy, R.W. eds), London,
181257, 2002
58. Scollan N.D., Hocquette J.F., Nuernberg K., Dannenberger D., Richardson R.I., Maloney A.:
Innovations in beef production systems that enhance the nutritional and health value of beef lipids and
their relationship with meat quality. Meat Science, 74, 17-33, 2006
59. Simopoulos A.P.: The importance of the ratio of omega-6/omega-3essential fatty acids. Biomedicine &
Pharmacotherapy, 56, 365 379, 2002
60. Steffens W, Wirth M, Fllner G.: Freshwater fishan important source of n3 polyunsaturated fatty acids:
A review. Archives of Polish Fisheries, 13, 15-16, 2005
61. Strandvik B., Eriksson S., Garemo M., Palsdottir V., Sampels S., Pickova J.: Is the relatively low intake
of omega-3 fatty acids in Western diet contributing to the obesity epidemics? Lipid Technology, 20, 5759, 2008
338

62. Trbovi D, Vrani D, inovi J, Borovi B, Spiri D, Babi J, Spiri A.: Fatty acid profile and
cholesterol content in muscle tissue of one year old common carp (Cyprinus carpio) during growth.
Tehnologija mesa, 50, 5-6, 276-286, 2009
63. Trbovi D., Markovi Z., Milojkovi-Opsenica D., Petronijevi R., Spiri D., jinovi-Stojanovi J.,
Spiri A.: Influence of diet on proximate composition and fatty acid profile in common carp (Cyprinus
carpio). Journal of Food Composition and Analysis, 31, 7581, 2013
64. Vacha F., Vejsada P., Huda J., Hartvich P.: Influence of supplemental cereal feeding on the content and
structure of fatty acids during long-lasting storage of common carp (Cyprinus carpio L.). Aquaculture
International, 15, 3-4, 321-329, 2007
65. Vladau V.V., Bud I., Stefan R.: Nutritive value of fish meat comparative to some animals meat. Bulletin
of University of Agricultural Sciences and Veterinary Medicine. Animal Sciences and Biotechnologies,
65, 12, 301305, 2008
66. Wood J.D., Enser M., Fisher A.V., Nute G.R., Sheard P.R., Richardson R.I., Huges S.I., Whittington
F.M.: Fat deposition, fatty acid composition and meat quality: A review. Meat Science, 78, 343358,
2008
67. Yeganeh S., Shabanpour B., Hosseini H., Imanpour M.R., Shabani A.: Comparison of farmed and wild
common carp (Cyprinus carpio): Seasonal variations in chemical composition and fatty acidnprofile.
Czech Journal of Food Sciences, 30, 503511, 2012
68. mijewski T., Kujawa R., Jankowska B., Kwiatkowska A., Mamcarz A.: Slaughter yield, proximate and
fatty acid composition and sensory properties of rapfen (Aspius aspius L) with tissue of bream (Abramis
brama L) and pike (Esox lucius L). Journal of Food Composition and Analysis, 19, 176181, 2006
339
SEASONAL VARIATIONS OF PHYSICO CHEMICAL PARAMETERS OF THE POND

Brankica Kartalovi*1, Miroslav irkovi1, Milo Peli1, Sanja Jovani2, Nikolina Novakov3,
Biljana Boi1, eljko Mihaljev1
1
Scientific Veterinary Institute "Novi Sad", Rumenacki put20, Novi Sad, Serbia
2
Institute of Chemistry, Technology and Metallurgy, Belgrade, Serbia
3
Faculty of agriculture Novi Sad, Novi Sad, Serbia
Abstract
The most variable physic chemical factors in pond water are temperature, pH, dissolved oxygen,
organic production denominated as biochemical oxygen demand (BOD), chemical oxygen demand
(COD), quantification of consumption of permanganate, concentration of ammonia ion, ammonia,
nitrate, nitrite, phosphate. The most variable factor was dissolved oxygen, ammonia and pH in the
experimental ponds. Values of those parameters are limiting factor for successful manufacture and
safe hibernation of fishes. The formation of snow cover on ice, affect on low production of
dissolved oxygen because darkness in fish environment. There is no photosynthesis
and
production of oxygen, but process of degradation is still performed in darkness environmental.
During these process fish are disturbed and consumed more oxygen.
Keywords: water, physic chemical factors, dissolved oxygen
Introduction
Water quality in ponds tested in three directions - physical, chemical and biological quality status.
The physical properties of water has a direct impact on the pace and intensity of the growth of the
fish in the pond, or directly influence the production of the pond. Basic measurements are related to
the water temperature, depth and transparency. The water depth in the carp fish ponds ranges
usually from 1 to 2 m. Due to the low depth of the chemical and biological processes has a
significant role in water temperature. The optimal water temperature ranges from 20 to 27C.
Increase and decrease the water temperature have detrimental effect on the development of natural
fish food, which results in growth failure fish. The high water temperature with the presence of
large amounts of organic matter and ammonia influences the development of various fish diseases.
340
The chemical composition of water is an important amount of dissolved oxygen and pH water
reaction, their amount in the water is constantly measured while measuring the amount of other
chemical elements is performed in cycles, periodically. It is believed that for the life of fish and
other organisms that live in water ponds necessary 10 important and 7 less important chemical
elements. The basic elements are: oxygen, hydrogen, carbon, nitrogen, sulphur, phosphorus,
potassium, calcium, magnesium and iron, and less important are: sodium, chlorine, fluorine, silicon,
manganese, iodine and arsenic. The lack of some of these elements in water can lead to negative
consequences, either on fish, either to other organisms, but it may disrupt the balance of life within
the pond.
Oxygen
Oxygen, without which life is impossible for aquatic animal is in water in dissolved form and on its
volume and the possibility of recovery fishing experts must always be taken into account. Part of
the oxygen is provided from the atmosphere over the water surface of the pond, and the part is
created or released by photosynthesis of aquatic plants. If the insured balance, supplement oxygen
in the water is continuous and sufficient for the needs of organisms that use it. If the balance is
disturbed, there is a shortage of oxygen that can be caused by rotting organic matter, shortage of
light, the increase in water temperature or water pollution. Long-term shortage of oxygen causes for
all fish, including carp, reduction in activity and utilization of food. This depletes fish and decreases
its overall resistance to other unfavourable environmental factors and pathogens. To prevent lack of
oxygen should be immediately accessed supplement oxygen and find the causes of the shortage of
oxygen. Oxygen is an essential element without which the fish cannot live. Entries in the water
from atmospheric air and photosynthesis of plants and plant plankton. The content of dissolved
oxygen allows the fish to breathe, development, reproduction and good health. The content of
dissolved oxygen in water varies with water temperature (Antalfi Antal,Tlg Istvan, 1974) to the
upper limit, as specified in Table 1.
Table1. The dependence of the temperature and the oxygen
Water temperature C
0
2
4
8
10
12
15
17
20
25
27
30
Oxygen mg/l
14,5
13,5
13,0
11,5
11,0
10,5
10,0
9,5
9,0
8,5
8,0
7,5
In the colder water dissolution of oxygen is higher. The solubility of gases in water depends on the
partial pressure of air and reduced pressure drops and increasing temperature. The need for oxygen
depends on the type of fish. Perch need 2 to 3 mg of oxygen / carp and tench can be submitted 0.7
mg / L. During the winter all vital functions are reduced to a minimum, and may be submitted and
the amount of oxygen of 0.5 mg / L.
During the summer months in the carp ponds with additional food intake increases the amount of
organic matter in the water due to which the intensively developing plant and animal plankton. In
June, July and August in the early morning hours (4 to 7 am in the morning) we mainly noticed by a
341
shortage of oxygen. It was the eve of a simple observation of fish, namely fish swims slowly, losing
balance, yawning, breathing hard, pushing her mouth out of the water, and you hear the sound as it
was raining the water. Fish is trying in this way compensate for a lack of oxygen and if the
condition persists for a long time, there is a massive fish kill. Therefore it is necessary to ensure the
flow of fresh water into the pond, turn aerators, measured oxygen content, and observe the
behaviour of fish. To make up for the lack of oxygen when the fish pulls on the bottom, on the
surface of the lime throws. Lime is not toss if the fish are at the surface, as this may cause damage
to mucous membranes and gills of fish, and therefore death. For this behaviour of fish, say that fish,
"smoke" and is associated with the decomposition of the excessive number of blue-green algae. The
water is green and indicates that the water "flower" (Matonikin and Pavleti, 1972; Adamek et al.,
1995; Asaj, 2004).
During the winter months can also occur from lack of oxygen if the pond when is pond too frozen.
Carbon dioxide, hydrogen sulfide, ammonia and other gases accumulate in the water under the ice.
On the surface of ice is necessary to make a "window" 2m long and a meter wide, long side facing
in the direction of the wind, to the surface naturally expanded. The snow on the ice prevents the
entry of sunlight and photosynthesis is reduced (irkovi, 2009). In the winter months, when people
can move around on the ice "windows" are held every day and for the safety of the movement of
people, they need to be mark with branches. The content of dissolved oxygen can be measured by
chemical analysis with portable appliances.
pH
For the cultivation of carp and animals in the water at all, the most convenient is water with a pH of
7.5 to 8. The active reaction pH value changes with the seasons: in the winter and autumn is largely
stable, while in the summer are subjected to large daily fluctuations. Daily changes in pH are related
most to the development fitoplankona, that is consumption of CO2 in photosynthesis process and
release CO2 in the process of breathing.
The water that supplying the pond, may contain toxic substances as chlorine, phenol, ammonia and
others that acting adversely on wildlife in the pond. These substances can get into the pond in a
natural way, as a by-product of flora and fauna, as well as waste water industry, so that on their
concentration must be taken into account.
Carbon dioxide
Carbon dioxide in water is formed as the product of respiration of fish, bacteria, plankton and the
first part of the atmospheric air. In the process of photosynthesis the plants used them. During the
winter months the fish can be displayed on the windows, which can mean lack of oxygen or
excess carbonate and acid, which is formed by binding of carbon dioxide with water.
The content of organic matter
The content of organic matter, or KMnO4 consumption, shows the status of organic matter in the
water. In the spring when the water is heated, it reinforces the development of plankton. The
content of organic substances is in the range of 10 to 20 mg/L. Water containing more than 100
mg/L considered as wastewater. The quality of water for fish farms and determines the content of
ammonia, nitrite content of lime, iron, ammonium and phosphorus.
Successful fish farming while achieving good growth and lossless requires constant monitoring of
chemical water quality and record keeping. Small fish farmers can in case of abnormal behaviour of
fish and water quality change fetch water for analysis.
342

The water temperature is very important factor in facilitating of chemical and biological processes
in the water of the pond. It is measured by portable apparatuses. The optimum water temperature for
the carp growth is between 23 C and 32 C; while on the other aforementioned temperature;
growth slows down (Cirkovic et al., 2002). Increasing the temperature above the optimal range, can
result insignificant reduction in oxygen content, which in the presence of increased organic load,
then a high pH and ammonia accumulation, is leading to reduction of the vital body functions
(Cirkovic, 1986). Increasing water temperature accelerates the process of decomposition of organic
matter in water, and therefore the consumption of available oxygen. Ammonia toxicity (increase of
share non-ionized ammonia fraction of the total amount of ammonia) increases with increasing
temperature (Markovic et al., 2011).
The pH value is a measure of activity of hydrogen ions (H +) in solution and thus determines
whether a given solution acidic or basic character. The pH value is dimensionless, and is used to
compare the pH scale, which includes a value from 0 to 14. For acidic solutions the pH is less than
7 (pH <7.0), and the base is greater than 7 (pH> 7, 0). To a solution of neutral pH is 7. The measure
of this analogue for the concentration of hydroxyl ions in the solution is pOH. pH meter with a glass
probe pH meter with a glass probe, is used to measure the pH values in water and various liquid
solutions so that high and low viscosity.
The amount of dissolved oxygen in the water is another crucial factor in fish breeding. The carp has
low requirements regarding the amount of oxygen dissolved in the water, with the required
minimum of 2 mg / L, and the optimal amount of 3-5 mg/L (Mazurkiewicz, 2009) .The need for
oxygen of carp fish varies depending on age, so request of a two year old carp are 50-70% lower
compared to the one year old, and for consumption carps they are 30-40% smaller compared to the
two year old, all of this, if we consider the three year production cycle of these fish (Mazurkiewicz,
2009).
The total organic matter in the water is determined by means of KMnO4 oxidation in strongly acidic
media. The total content of organic matter is defined as mg of KMnO4 which are spent for their
oxidation, present in one litter of water. Titration is used as method for determination.
Tester Drop checker measured concentration of CO2 in water.

In winter setback becomes dangerous when it approaches around 0C. Basically it can be said that
the temperature of 0.5 C, almost harmless for carp. Cirkovic (2009) considered that the
temperature of 0.5-1 C, suitable for winter, because then life process to a minimum, and the fish
stops moving and take food. Temperature fishery water to some extent can regulate the inflow of
fresh water in winter and in summer period.
In most of the cases studied, concentrations of O2 were suitable for the cultivation of warm-water
fish. During July, August and September O2 concentrations were variable, and they ranged from 3.8
mg/L to 15.7 mg/L, depending on the amount of daily meals and water temperature.
Many authors have proved (Hansell and Boud, 1980; Stevic, 1982; Hamakova et al., 1993; Stevic
et al., 1993), and our research has confirmed that the CO2 concentrations are high, when
concentration of oxygen in water is at lower limit. The value of biological and chemical oxygen
demand, which are indicators of water pollution also varied within the limits suitable for growing
cyprinid species. Table 2 shows water quality in the pond.
343
able 2. - water quality, mg/L (Wdemayer, 1997.)

Alkalinity (like CaC3)
10-400
Aluminum (l)
<0.01
Ammonia (NH3)
<0.02
Arsenic(s)
<0.05
Barium (B)
Barium ()
50-80
Carbon dioxide (C2)
0-10
Chlorine (Cl)
<0,003
Chrome (Cr)
0,03
Alkalinity100 ppm
0,006
Dissolved Oxygen
Hydrogen Sulfide (H2S)
<0,003
Iron (Fe)
<0,1
Led (Pb)
<0,02
Magnesium (Mg)
<15
Manganese (n)
<0,01
Mercury (Hg)
<0,02
Nitrates (N3)
0-3
Nitrites (N3)
<0,1
Nickel (Ni)
0,1
pH
6,5-8
Phosphorus (P)
<5
Sodium (N)
75
Sulfur(S)
<0,1
Zinc (Zn)
<0.05
Conclusion
Height temperatures most important influence on the physical and chemical changes in the factors
during the vegetation period. At temperatures below 12C consumption carp in hibernation while
hatchlings active at lower temperatures, especially on sunny days. When the cubs are also metabolic
processes slow or decomposition of organic matter when properly water flow has toxic effects and
fish tends to go toward the surface, slow swimming and this type of stress affects the occurrence of
diseases.
344
Diseases that cause the greatest wasting and predisposed the poor environmental conditions are koi
herpes virus and spring viremia.
The amount of oxygen in the winter is not the optimal amount when it freezes the water surface and
it snows and disables photosynthetic processes. Then the fish moves and consumes energy depot,
skinny and becomes susceptible to different pathogens. When dissolved oxygen reduces the amount
below 1 mg / mL, the fish are moving to the icy surface and leads to mass deaths.
The emergence of larger quantities of ammonia is typical for the summer period when degradation
processes are quickest but it can happen also in winter when we have a large concentration of fish.
Acknowledgments
References
Antalfi Antal, Tolg Istvan, Izdava: ABC ribnjaarstva, Glas Slavonije, Osijek 1974.
irkovi M., Jovanovi B., Maletin S.:Ribarstvo. Univerzitet u Novom Sadu. Poljoprivredni fakultet
IRKOVI M., 1986. Myxosporldiosis of the common carp fingerlings. Doctoral thesis, Veterinary
Faculty, Beograd, (in Serbian).
3. irkovi M., Markovi G., Simi V., Maletin S., Nikolina M., Momirov D.: Reintrodukcija i
repopulacija linjaka (Tinca tinca) u ribnjake sisteme i otvorene vode, IV Meunarodna konferencija
Ribarstvo, 2009, 27-29 05. Beograd, Conference proceedings, 131-137.
4. Hamakova J., Kouril J., Vachta . Odchov raneho pludku sumce velkeho. Vyzkumn ustav rybarsky a
hydrobiologicky, Edice metodik, Vodnany, 40: 1-1.
5. Hansell and Boud : Effects of Hydrated Lime on Water Quality in Fish Ponds. Thesis, Master of
Science, Auburn University, Alabama, 1980, 23 pp.
6. Markovi Z., Stankovi M., Duli Z., ivi I., Rakovi B.,Spasi M., Poleksi V.: Aquaculture and
fishery in Serbia status and potentials. International Conference Aquaculture& Fishery
Conference proceedings, 2011, 36-40.
7. Matonikin Kepija, R.: Utjecaj brzine strujanja vode na naseljavanje perifitonskih zajednica sedrenih
barijera. 2006. Doktorska disertacija. Sveuilite u Zagrebu
8. Mazurkiewicz, J.: Utilization of domestic plant components in diets for common carp Cyprinus carpio
L. Arch. Pol. Fish. 2009, (17), 5-39.
9. Stevic I: Uzgoj soma (Silurus glanis L.) peletiranom hranom u ribnjakim uvjetima, Zagreb disertacija
1982.
10. Stevi I., Bogut I., Opaak A., 1993. Petogodinji rezultati kaveznog uzgoja soma (Silurus glanis) u
jezeru Modrac. Ribarstvo 48 (2): 67-76.
11. Wedemeyer GA (1997) Effects of rearing conditions on the health and physiological quality of fish in
intensive culture.In: Iwama GW, Pickering AD, Sumpter JP, Schreck CB (eds) Fish Stress and Health in
Aquaculture, pp. 3572. Cambridge University Press, New York
1.
2.
345
NODULAR COCCIDIOSIS OF CARP FINGERLINGS CAUSED BY GOUSSIA

SUBEPITHELIALIS
Nikolina Novakov1*, Miroslav irkovi2, Dragana Ljubojevi2, Milo Peli2, Biljana Boi2, Jelena
Babi2, Dalibor Todorovi2
1

2
Abstract
Goussia subepithelialis is coccidian parasites of common carp Cyprinus carpio L. which have been
reported to cause nodular coccidiosis. The pathogens may lead to necrosis of the intestinal
epithelium and enteritis. The disease is transmitted directly when an uninfected carp comes into
contact with the waste of infected specimens, but may also be transmitted indirectly, through
tubificid oligochaetae, which are paratenic hosts of the coccidian. The most common source of
infection is the sediment of the bottom of the fishpond, which contains large numbers of infective
oocysts. The parasitological survey was carried out in March and April 2014. Carp fingerlings
originating from 12 fish ponds in Serbia were examined for the presence of Goussia subepithelialis.
Disease was confirmed in one-year-old carp fingerlings at two fish ponds. In the mucous membrane
of the last part of the intestine, whitish spots, several millimeters in diameter were observed. In
direct smears made from the sites of pathological changes in the intestines assessed with light
microscopy Goussia subepithelialis sporocysts were detected. Pathological changes presented in the
intestine of carp fingerlings resulted in weakening of the condition in fish and milder mortalities. In
order to prevent this disease, the disinfection of the fish pond bottom it the most important
prophylactic measure.
Keywords: Goussia subepithelialis, nodular coccidiosis, carp fingerlings
Introduction
Piscine coccidia are intracellular organisms of the epithelium (of the gut, the gall bladder, the
swimbladder and the kidney tubules) and tissues (liver) of epithelial origin. Coccisians belongs to
apixomlexan parasites that are common in freshwater and marine fishes that have been describe in
Europe, America, Asia, Africa and Australia (Dycova and Lom, 1981). Goussia carpelli (Leger and
Stankovitch, 1921) and Goussia subepithelialis (Moroff and Fiebiger, 1905) are gut-dwelling
coccidian parasites of common carp Cyprinus carpio L. which have often been reported to cause
serious disease in hatchery populations of carp which manifests as enteritis coccidiosis (G. carpelli)
and nodular coccidiosis (G. subepithelialis). The life cycles of these parasites were studied by
Marincek (1973), who successfully infected carp in the laboratory with G. subepithelialis by oral
inoculation of oocysts, and by Steinhagen and Korting (1988), who laboratory infected carp with G.
carpelli. Transmission of G. carpelli occurred directly by oral ingestion of oocysts but also by
feeding carp on infected tubificids which were able to act as paratenic hosts. The most common
source of infection is the sediment of the bottom of the fishpond, which contains large numbers of
infective oocysts.
In the epithelial cell, parasites undergo successive asexual (merogonous) divisions and a sexual
process by which microgametes, differentiated from a microgamont, fuse with a macrogamont
(macrogamete). The zygote thus formed becomes liberated from the host cell, while being encased
346
in a wall. Through subsequent divisions the zygote divides into four, hard walled sporocysts, each
of which further divides into two motile sporozoites. Oocysts of digestive tract evacuated with the
faeces (Paperna, 1990). Sporulation of most gut coccidia is completed before evacuation in the
faeces (endogenous sporulation). Oocysts of G. subepithelialis, formed in the epithelium are
displaced by the regenerating epithelium into the sub-mucosal layer (Marincek, 1973; Molnar,
1984).
Disease appears in early spring monts as a result of a yearly developmental cycle (Molnar, 1989;
irkovi and Novakov, 2013). The majority of fish coccidians have relatively low pathogenicity.
Lethal infections occurs primary in farm ponds, but sever cases have been reported from natural
waters as well (Bauer et al., 1981). Disease mostly occurs in one-year-old carp fingerlings. In the
mucous membrane of the last part of the intestine, whitish spots, several millimeters in diameter are
present (irkovi and Novakov, 2013). In nodular coccidiosis, caused in carp by G. subepithelialis,
the accumulation of oocysts in the lamina propria induces inflammation with intense leucocyte
infiltration (enteritis) (Marincek, 1973; Molnar, 1984). Nonspecific defence response parameters
(leucocytosis, eosinophylia, activation of phagocytes and elevation of natural antibody titer and of
coeruloplasmin) were detected in carp infected with G. subepithelialis (Studnicka and Swicki,
1990).
Developing intracellular (endogenous) stages may be detected within their host tissues by
microscopic examination of fresh tissue and stained impressions and smears Giemsa, after being air
dried and fixed in absolute methanol). Oocysts of digestive tract-coccidia may be detected in faeces.
The oocyst wall of piscine coccidian is soft and fragile and is often lost by the end of sporulation.
Therefore, if sporulation occurs prior to defecation, only the smaller naked sporocysts may be found
in faeces. Coccidia are identified by the morphometry of their oocysts and sporocysts, the site of
endogenous development and their position in the host cell (Dykova and Lom, 1981). Oocysts are
relatively easy to detect using histological methods. Mallorys stain is particulary suitable.Mature
oocysts stain yellow and stand out in sharp contrast to fish tissue. Flotation is rarely used for fish
coccidia. The only data have been published by Berland and Hojgaard (1981) who used IKI stock
solution and destilated water for the flotation of Goussia. Dawies and Stewart (2000) recommended
an easy ad effective method for detecting low-level infection with coccidians. These authors
utilizided autflorescence of the oocysts. Using florescence microscopy they could detect oocysts in
unstained sqashe preparations, where sporocysts showed a blu autoflorescence.
The economic damage done by coccidiosis to warm water pisciculture has apparently been grossly
underestimated. Since coccidiosis in fish usually manifests itself as a chronic infection, mortality is
gradual and is overlooked in most farms. Losses only become evident when yields are checked at
the end of the growth period. In order to prevent this disease, the disinfection of the fish pond
bottom is one of the most important prophylactic measures.
This paper describes a survey of coccidian infections caused by Goussia subepithelialis in common
carp from fish ponds in Serbia, which resulted in finding infected fish.

Present studies were conducted during March and April 2014. Systematic studies were performed
only in the spring months when disease usually occures. However, samples were occasionally taken
at other times of the year. Over a 1-yr period, a total of 365common carp fish were examined for the
presence of nodular coccidiosis. The examined fishes originated from 12 common carp fish ponds
in Serbia. Fish were collected with a net and transported alive to the laboratory where they were
processed. The intestinal contents of fish kept in the laboratory had been excreted, proved the most
suitable for reliable diagnosis of coccidial infection. The gut of these fish was slit open
longitudinally and examined under a microscope. The mucus and scrapings taken from different
347
segments of the gut were studied with a light microscope. Oocysts were easiest to demonstrate in
the glassy mucus lining the gut but could also be found in the intestinal scrapings. In positive and
doubtful cases smaller places of unaffected intestinal segments or of nodules seen on the intestinal
wall were fixed in 10% buffered formalin.
Results
In the end of March and early April nodules containing of Goussia subepithelialis unsporulated
oocysts were found in the gut in one-year-old carp fingerlings. The total of 16 fish which originate
from two fish ponds were infected. Infection was demonstrable exclusively in the early spring and
disappeared almost completely by the end of April. The oocysts ranged 6x13 m (Figure 1),
developing in nodules where expelled into the intestinal lumen unsporulated.
Figure 1. Goussia subepithelialis oocysts from one-year-old carp fry

In the mucous membrane of the last part of the intestine, whitish spots, several millimeters in
diameter were observed (Figure 2). Pathological changes presented in the intestine of carp
fingerlings resulted in weakening of the condition in affected fish and milder mortalities of fry in
fish ponds where infection was confirmed.
Figure 2. Nodular coccidiosis of carp fingerling intestine
348

This survey of fish cocidiosis revealed the presence of nodular coccidiosis caused by Goussia
subepithelialis in two fish ponds in Serbia. Since the most investigations of this disease were
conducted during the eighties of the last century it is very important to get the latest information
about the presence and prevalence of the diseases. Other similar studies (Dycova and Lom, 1981;
Molnar, 1989; Molnar and Ogawa, 2000) also revealed the presence of nodules in carp fingerlings
containing similar unsporulated oocysts in the gut of fish samples that were taken in the early spring
months. The genus Goussia was regarded for a long time as a synonym of Eimeria, but it was
reinstated by Dykov and Lom (1981), who assigned Goussia to the Eimeriidae. Overstreet et al.
(1984) included it in the family Calyptosporidae, while Levine (1988) regarde Goussia as a member
of the family Barrouxiidae. Lom and Dykov (1992) claimed that Goussia should remain in the
family Eimeriidae. The detection of unsporulated oocysts in the gut of fish deserves special
attention, as according to Molnr (1976), Dykov and Lom (1981) and Davies and Ball (1993), the
majority of fish coccidia sporulate endogenously.
Since little is known about the prevention of losses caused by fish coccidia an established protocol
for therapy and preventive management has not yet been formulated. Only a few of the drugs
developed for controling coccidiosis in warm-blooded animals have been tried on this fish parasites.
Naumova and Kanaev (1962) recommanded osarzol as a therapeutic agent against Goussia sp.
infection of the common carp. Musselius et al. (1965) suggested furazolidon and amprolium
chloride as effective therapeutics, as well as furanace. irkovi and Novakov (2013) indicate that
furan compounds provide the best effect in the treatment of coccidiosis.
Beside classical diagnostic procedures there is an urgent need to apply molecular biological
methods for fish coccidians. This methods are fairly advanced in warm-blooded animals, while for
the fish coccidians only the first such trials are in progress (Jirku et al., 2002).
In order to prevent this disease, freezing, drying out and the disinfection of the fish pond bottom
with lime are still the most important prophylactic measures.
Acknowledgments
This research was supported by the Ministry of Education, Science and Technological Development
of the Republic of Serbia (TR 31011).
References
1.
2.
3.
4.
5.
6.
7.
8.
Bauer N., Musselius A., Strelkov A.: Diseases of pond fishes. Moscow, 1981
Berland B., Hojgaard P.: IKI solution used for flotation of coccidia (Eimeria sp.) and precipitation of oil
from fish liver. Journal of Parasitology, 67, 598-599, 1981
irkovi M., Novakov N.: Parasitic diseases of cyprinid fishes, Novi Sad, 2013
Davies J., Ball J.: The biology of fish coccidia. Advances in Parasitology, 32, 294366 1993
Dawies A., Stewart B.: Autoflorescence in the oocysts of freshwater and marine coccidian. Folia
Parasitologica, 47, 157-158, 2000
Dycova I., Lom J.:Fish coccidia: critical notes of life cycle,classification and pathogenicity. Journal of
Fish Diseases, 4, 487-505, 1981
Jirku M., Modry D., Lapeta R., Koudela B., Lukes, J..: The phylogeny of Goussia and Choleoeimeria
(Apicomplexa; Eimeriorina) and the evolution of excystation structures in coccidia. Protist, 153, 379
390, 2002
Levine D.: The protozoan phylum Apicomplexa. Boca Raton, Florida, CRC Press, 1988
349

9. Lom, J., Dykov I.: Protozoan parasites of fishes. Amsterdam: Elsevier, 1992
10. Marincek, M.: Development d'Eimeria subepithelialis (Sporozoa, Coccidia) -parasite de la carpe. Acta
Protozoologica, 12, 166174, 1973
11. Molnar K., Ogawa K.: A survey on coccidian infection of Lake Biwa fishes in Japan, with the
description of four new species of Goussia Labbe, 1896 (Apicomplexa). Systematic Parasitology, 47,
215222, 2000
12. Molnar K.: Histological study of coccidiosis caused in the silver carp and the bighead by Eimeria
sinensis Chen, 1956. Acta Vet. Acad. Scien. Hung., 26, 303312, 1976
13. Molnar K.: Nodular and epicellular coccdiosis in the intestine of cyprinid fishes. Dis. Aquat. Org., 7, 112, 1989
14. Molnar K.: Some peculiarities of oocyst rejection of fish coccidia. Symposia Biologica Hungarica
(Akademiai Kiado, Budapest), 23, 8797, 1984
15. Musselius A., Laptev I., Ivanova S,: On the coccidiosis of common carp. Trudi VNIPRH, 13, 69-78,
1965
16. Naumova M., Kanaev J.: An ewperiment for treating common carp diseased in coccidiosis. Vopsory
Iktiologii Akademii Nauk, 749-751, 1962
17. Overstreet M., Hawkins E., Fournie, W.: The coccidian genus Calyptospora n. g. and family
Calyptosporidae n. fam. (Apicomplexa) with members infecting primarily fishes. Journal of
Protozoology , 3, 332339, 1984
18. Paperna I.: Fine structure of the gamonts of Eimeria (s.l.) vanasi, a coccidium from the intestine of
cichlid fishes. Dis. Aquat. Org., 9, 163170, 1990
19. Steinhagen D., Korting W.: Experimental transmission of Goussia carpelli (Leger & Stankovitch, 1921;
Protista: Apicomplexa) to common carp, Cyprinus carpio L. Bull. Eur. Ass. Fish Pathol., 8, 112113,
1988
20. Studnicka M., Siwicki A.: The nonspecific immunological response in carp (Cyprinus carpio L.) during
natural infection with Eimeria subepithelialis. Israel J. Aquacult. - Bamidgeh, 42, 1821, 1990
350
DRUM-FORM PHYTOREACTOR IN SEAWATER RECIRCULATION SYSTEM

Dmitry Dementyev
RSAU-MTAA, Moscow, Russia
Abstract
This article is about a new type of phytofiltration in a seawater recirculation system. Here is a
description of a new kind of phytoreactor for marine macroalgaes cultivation in the system for
tilapia breading. This construction allows us to make hydrochemical conditions, such as pH, oxygen
concentration, nitrate-concentration and so on better, that before. Besides, here is information about
acclimatize tilapia for high salinity condition up to 31.
Keywords: phytofiltration, tilapia, macroalgae, seawater, recirculation systems
Introduction
In a freshwater aquaculture co-cultivation of fishes and plants has been well known for a long time.
There is even a special kind of aquaculture and plant growing Aquaponics. But there are not
many investigations about co-cultivation of marine hydrobionts and marine plants. We conducted
the experiment to test some assumptions about perspective of utilization of marine macroalgae for
water preparation in recirculation aquatic system (RAS).
The largest problem of algae-filter engineering is large square requirement, because it works stably
only in a good light conditions for all population of algae. We can plant our plant only at the
bottom. Original decision of this problem is to use rotation drum. Surface of the drum is planted by
macroalgae. On the top of a drum (or several drums) the lamp installed. That scheme provides
several advantages at the same time:
-
stable alternation of dark/light periods, which is necessary for photosynthetic

lightning of more area of algae
good conditions of hydrodynamics
The reason of an advantage in area by using of cylindrical growth surface is the following: surface
of cylinder is S=2rh, where =3.14, r- radius of the cylinder, h height (length in our case).
Applying this formula to the example of a cube aquarium with the side of 50 cm we can see
advantage of cylindrical growth surface because we have effective area of 2500 cm 2 for bottom
planting and about 5900cm2 for planting on the cylindrical structure (with radius of 20 cm and
length 47 cm). This stuff really increases productivity of phytofilter more than twice.

The work has been done in the conditions of aquarium complex in Aquarium RIO, Moscow.
The aim of the experiment was a concrete estimate of productivity of the proposed algafilter
scheme, a check of the luminiars of a certain range, and a research of a principal possibility of
recirculation system creation using only algae filtration in the seawater salinity.
Widespread tropical algae Caulerpa prolifera was selected as an object of research.
351
Other objects of research are aquatic organisms for creation of biological load Tilapia nilotica, 15
instances in experimental and 15 instances in control systems.
Scheme of used recirculation system

Experimental recirculation system is depicted in the scheme 1. Aquatic animals (Tilapia nilotica in
our case) are in the living aquarium (1) with volume equal to 80L, which is located 3 cm higher (2),
than aquarium-phytofilter (3) the same volume (80L). The pump is pumping water from aquariumphytofilter (3) to the living aquarium (1) by feed pipe (4). Water flows by gravity through the return
tube (5) from the living aquarium (1) to the phytofilter (3).
Structure of phytofilter
The main part of aquarium for phytofilter (3) is occupied by rotating mesh drum (6). Experimental
systems drum is planted by macroalgae (Caulerpa prolifera), control systems drum is empty, but
parameters of rotation and lightning are similar.
There remains enough space for algae growth between the edges of the drum, water surface and
vessel wall. Rotation of the drum is provided by two opposite pumps (7), directing the flow on the
hydrodynamic blades (8). Lighting of the phytofilter drum is provided by LED luminary (9).
Parameters of drums are demonstrated on the Table 1:
Table.1 Measurements of drums
Experimental drum
Control drum
Length,
49
49
Radius,
11
11
352
Surface area, 2
3384,92
3384,92
Rotation speed of experimental drum 5 rpm, control drum 9rpm. Lighting of the phytofilter
drum is provided by LED of red spectra (465 nm, 21 pcs.) and blue spectra (660 nm, 21 pcs.),
(Figure 1 and 2)
Figure 1 Experimental system
Figure 2 Control system
In total, 15 specimens of Tilapia sp. with the several weights of 1.4 grams were placed in each
aquarium. Before this fishes were acclimatized for high salinity conditions (about 30), a
prerequisite for algae growing. Acclimatization process of fishes for high salinity took 14 days that
is probably a minimum period. Earlier we tried to do that in 12 days, but about 20% of animals
died.
A month later, at the end of experiment, several weight of tilapia was 7,6 grams in the experimental
group, and 7,19 grams in the control group. Total mass increased from 21 to 110 grams both in the
experimental and control groups. Feeding was carried out by 4 types of feed (artemia and 3 kinds of
dry food), and for calculations of alga-filter productivity we used protein content of foods. In
general, during the month of experiment, 43,416 grams of protein were carried in both experimental
and control systems.
The results of phytofilter utilization

Due to algafilter utilization, hydrochemical regime of experimental system was supported at a high
level during all period of the experiment. Concentrations of ammonia, nitrite and nitrate nitrogen
remained at a very low level, whereas there were acute fluctuations in concentrations of ammonia
(up to 0,4ppm) and nitrite (up to 0,5ppm) nitrogen in the control system. Moreover, there was slow
but constant increase of nitrate concentration in the control system, up to 80ppm at the end of
experiment.
It should be noted as a positive effect of drum algafilter on significant pH (in experimental system
is above approximately 0.42 then in the control system) and oxygen content (in experimental
system is above approximately 1.13ppm then in the control system).
Growth of algae
Next pictures demonstrate the view of experimental drum at the beginning of experiment (Figure 3)
and at the end (Figure 4).
Once a week we weighed algae. As a rule, once a week clipping was doing too, because large
quantities of caulerpa inhibit, and later hold up the rotation of drum. It was noted, that algae was
353
actively growing not only at the surface, but also inside, so there appears another problem rhizoids
of an inside population attached the axis prevents rotation.
Figure 3 Experimental drum 18.01.15
850
Figure 4 Experimental drum 15.01.15
800
806, Clipping
739, Clipping
750
686
700
650
616, Clipping
606
600
550
500
450
449
409
371
400
350
Graph 1. Algae growth
Table 2. Algae growth
M
m
Min
Max
Cv, %
Growth per a week,

avg.
Mass on drum,
avg.
168,6
22,69
50,73
120
237
30,1
615,9
54,98
145,47
409
806
23,6
During the time of experiment from 18.01.15 to 16.02.15, pure growth of algae amounted to 697
grams of wet mass. Determination of dry mass was done, and it equaled 9,84% of wet mass
354
(samples, were washed by distillate water, and dried about 5,5 hours with temperature 100-120 to
the constant weight).
In this way, we can calculate, that 615,8 grams of algae wet mass (Caulerpa prolifera) (60,6 grams
of dry weight), in the system of a drum phytofilter, without any additional filtration systems, can
provide sufficiently high quality of seawater in the closed system with total volume of 160 liters,
total fish weight equal 69,5 grams and daily feeding equivalent of 2,7 grams of protein.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
..
// . . .-. .
: , / , 18-20
. 2008.- : , 2010.- . 37-39.
.. . .: - - . .. ,
2011. 664 .
.. , 02F 3/00.
/ (), 2014126112/05(042412). . 27.06.14.
07.11.2014.
.. // -.
.: , . . / : , 1992.- . 3.- . 2327.
.. //
. . . . . .- .: .- 2002.- 3.- . 15-16.
., . // -.- 1989.- 11.- . 47-49.
..
// .-. . : .
. . ., 16-20 1990.- , 1989.- . 59-60.
Darren L. US A01K63/04 Page. Compact and efficient photosynthetic water filters /
(USA), 5799612 A. - 1998; US 08/826,745.
Janssen M. Cultivation of microalgae: effect of light/dark cycles on biomass yield 2002 Thesis
Wageningen University, Wageningen, The Netherlands, 194 p.
Kim P.K., Kim Y., Jeon J.K. Nitrification and denitrification efficiency of seaweed, Glacilaria
verrusisa with temperature and and nutrientconcentration / International Conference: Lessons from the
Past to Optimise the Future, Trondheim, 5-9 Aug., 2005 // Eur. Aquacult. Soc. Spec. Publ. - 2005.-
35.- P. 274-275.
Kube N., Boschoff A.A., Wecker B. et all. The feasibility of a photobioreactor (microalgae) for
removal of dissolved nutrients in a closed recirculating system / International Conference: Lessons
from the Past to Optimise the Future, Trondheim, 5-9 Aug. 2005 // Eur. Aquacult. Soc. Spec.
Hubl. - 2005.- 35.- P. 289-290.
Larned S.T. Nitrogen- versus phosphorus-limited growth and sources of nutrients for coral reef
macroalgae // Marine Biology, 1998.- 132.- . 409-421.
Martello A., Buono S., Calazzo M. et all. Preiliminary tests on microalgae growth and their use as
food supply in Mytilus galloprovincialis in a recirculating aquaculture system / International
Conference: Lessons from the Past to Optimise the Future, Trondheim, 5-9 Aug., 2005 // Eur.
Aquacult. Sec. Spec. Publ.- 2005.- 35.- P. 315-316.644.
Niu Hua-Xin, Ma SHen, Tian Xiang-Le et all.
Gracilaria lichenoides // Zhoangguo haiyang daxue xuebao Ziran kexue ban = Period. Ocean
Univ. China.- 2006.- 36, 3.- P. 41-48.
Schuenhoff A., Shpigel M., Lupatsch I. et all. A semirecirculating, integrated system for the culture of
fish and seaweed // Aquaculture.- 2003.- 221, 1-4.- S. 167-181.
355

16. Steinbauer M., Kadlecov E. Design of special light source for biological application // Brno University
of Technology, Dept. of Theoretical and Experimental Electrical Engineering, Kolejn 2906/4,612 00
Brno, Czech Republic, (2006) Materials of conference Electro 2006
17. Yue Wei-Zhong, Huang Xiao-ping, Tan Ye-hui, Yin Jian-giang
// Haiyang huanjing Kexue
= Mar. Environ. Sei.- 2004.- 23, 1.- P. 13-15.
18. Yuuki Kitadai and Shusaku Kadowaki. Growth, nitrogen and phosphorus uptake rates and O2
production rate of seaweeds cultured on coastal fish farms // Bull. Fish. Res. Agency.- 2007.- 19.- .
149-154.
19. Zhang-Ji-ping, Guo Zhao-ling
Litopenaeus vannamei // Shuichan kexue = Fish. Sci.- 2006.- 25,
10.- P. 517-519
356
BODY TRAITS AND CHEMICAL COMPOSITION OF CARP GROWN IN PRODUCTION

SYSTEMS WITH DIFFERENT LEVEL OF INTENSIFICATION
Liliana Hadzhinikolova1*, Angelina Ivanova1, Tania Hubenova1
1. Institute of fishery and aquaculture, 248 V. Levski str, Plovdiv 4003, Bulgaria
Abstract
The interest to investigations on carp is substantiated by the fact that the species is among the
primary fish species of economic significance for Bulgarian freshwater aquaculture. That is why the
purpose of the present study was to evaluate body traits and chemical composition of meat from
carps farmed in production systems with different level of intensification. Specific differences in the
analyzed body traits, meat chemical composition and energy value in carps farmed in production
systems with various intensification levels were established. Groups of fish reared in the extensive
system had rather lower body measurements as compared to fish farmed in semi-intensive and
intensive production systems. Statistically significant differences between studied groups of carps
were found out with regard to water and fat contents of meat. According to their fat content, studied
fish were classified in three categories: lean (ES-1 and SemiIS-2), medium-oily (IS-1 and IS-2) and
oily fish (SemiIS-1).
The type and ratio of used feeds had a greater influence on the deposition of fat in fish meat. When
carps were farmed under semi-intensive system conditions and fed grain feeds only, the meat
protein content was the lowest and meat fat content the highest.
Keywords: production systems, carp, body traits, meat, chemical composition
Introduction
The interest to investigations on carp is substantiated by the fact that the species is among the
primary fish species of economic significance for Bulgarian freshwater aquaculture. In the relevant
literature, data about the influence of production systems and the type of feed on meat quality and
meat fatty acid profile are reported (Cirkovic et al., 2011; Trbovic, 2012). Slaughter analysis of
carps from different morphological type and different species origin have been performed by
Ivancheva and Tododrov (1989) and Hadjinikolova and Grozev (1996). In the opinion of Kyosev
(1985) the edible parts as a primary element of fish slaughter analysis constitute 55-80% of fish
body weight depending on the species, age and season.
The quality and nutritional value of fish meat is especially important with respect to healthy human
nutrition. The flavour, nutritional qualities, environmental conditions of fish production systems
gain an increasing importance for consumer preferences in the purchase of fish and retail trade
(Pieniak et al., 2007; Bauer and Schlott, 2009). Repnikov (2007) believes that the rational use of
fish resources could be attained through achievement of high consumer value which includes the
following elements: good quality, organoleptic parameters (presentation, flavour, odour),
nutritional, biological and physiological properties. That is why the purpose of the present study
was to evaluate body traits and chemical composition of meat from carps farmed in production
systems with different level of intensification.
In this study, carp (Cyprinus carpio L.) production systems for human consumption, differing by
their geographical location, types of farming system (earthen ponds, dam lakes, net cages), level of
357
intensification (extensive, semi-intensive, intensive) were used. The extensive system was the
Plovdiv Experimental base (ES-1), the semi-intensive systems (SemiIS) were Budak dere dam lake
(SemiIS-1) and Tri Voditsi/10 Experimental base (SemiIS-2), while the intensive systems were the
Tundzha 73/4 fish farm (IS-1), the Tundzha 73/5 fish farm (IS-2). Carps from semi-intensive and
intensive systems were fed feeds of various composition and structure: grain feeds, high-protein
meals, specialised pelleted and extruded feeds. Fish in the extensive system was not fed (Table 1).
Table 1.Characteristics of the studied production systems
Production systems
Type of feed
Ratio of feed, %
Area, dka
tensive
*S-1
70
Semi-intensive
Semi-IS-1
Semi-IS-2
grain
grain/sunflower meal
100
50:50
250
45
Intensive
IS-1
IS-2
CPF**
CEF
100
100
750
200
*(S 1) - Plovdiv Experimental base; (SemiIS-1) Budak dere Dam Lake; (SemiIS-2) - Tri Voditsi Experimental
base; (IS-1) - Tundzha 73/4 fish farm; (IS-2) - Tundzha 73/5 fish farm; **CEF-combined extruded feed; CPFcombined pelleted feed
During the experiments, in the period from May to October 20122014, physico-chemical
parameters of water were monitored on a monthly basis. The water temperature and pH, the
dissolved oxygen content were compliant with technological norms for cyprinids and provided
normal conditions for the farmed fish species.
For investigation of body measurements, 10 fish were randomly collected from each production
system. Carps were individually weighed to determine body weight (W, g), total body length (TL,
g), standard length of the body (SL, cm). The proportion and ratio between edible and non-edible
body parts were estimated from the individual slaughter analysis with respect to 7 traits through
determination of absolute (g) and relative (% of body weight) values of the following body parts:
head (without gills), carcass, viscera (total), gills, fins and scales.
For meat chemical analysis, part of the fillet containing white muscle, red muscle and adipose tissue
without the skin was sampled from the same body region. The general chemical composition of
meat (n=5) was individually analysed to determine: water content, % (through drying at 105 o,
24h; BSS SR ISO 5984); protein content, % (by the method of Kjeldahl, BSS SR ISO 5983,
using a semi-automated DK 6 digester unit and UDK 132 distillation system, Velp Scientifica); fat
content, % (by the method of Smidt-Boudzynski Ratzlaff); mineral content, % (by burning in a
muffle furnace at 550 o, BSS SR ISO 6496). The energy content of carp meat was estimated on
the basis of the chemical composition using the following coefficients: 17 kJ.g-1 for proteins and
carbohydrates, and 37.0 kJ.g-1 for fat (Ordinance 23 /2001, Ministry of Health).
Data were submitted to statistical analysis for calculation of average value (x), standard error of the
mean (Sx) and coefficient of variation (Cv, %) by means of MSOffice 2010. The statistical
significance of differences between two samples was determined by the Students t-test at a level of
significance P<0.05.

The average body weight of carps from the different production systems varied from 752.0 g to
1404.7 g, total body length ranged between 34.29 cm and 41.12 cm, and small body length: from
29.48 cm to 34.57 cm (ble 2). Lower absolute values of studied exterior traits were established in
carps from the extensive system, and the highest in carps from SemiIS-1. There were differences
between fish from the extensive and the other production systems with respect to body weight
(between 31.5-86.8%), total body length (7.8-19.9 %) and small body length (6.04-17.3%).
358
The average absolute (g) and relative (%) weights of edible and non-edible body parts in studied
groups of carp (scale type) are presented in Table 2. Data indicated that the relative weight of the
head varied from 10.26 % (S-1) to 18.32 % (SemiIS-2), and relative carcass weight from 29.38
% (S-1) to 60.39 % (IS-2). The relative weight of viscera was from 7.83 % (S-1) to 21.45 %
(SemiIS-1), and those of gills and fins from 1.44 to 3.55 %. The proportions of scales varied
within 2.11-4.40 %. Relative weights of edible parts (head and carcass) of fish farmed in the
extensive system were significantly lower compared to those obtained in the other production
systems, with differences in relative head weight between 59.3-78.36 % and from 71.65 % to 2
times for the carcass. Data for the relative carcass weight were similar to those reported by
Hadjinikolova (2004) of 56-59.3 % in carps with average live weight of 900 g.
Table 2.Abssolute and relative values of the body traits of carp (g/% of the body weight *)
Production systems
n=10
tensive
S 1
Semi-intensive
Intensive
Semi-IS-1*
Semi-IS-2
IS-1
IS-2
Exterior features, absolute values
Body weight, g
752.0
1404.7
1159.0
989.0
1205.5
Body length, cm
34.291.08
41.121.09
39.700.84
36.973.37
38.502.69
Small length, cm
29.481.05
34.570.88
33.860.85
31.262.57
33.012.29
Carcass indexes, absolute and relative values, g/%* of the body weight
Head (no gills)
148.42
229.46
212.10
177.37
206.87
10.26*
16.34
18.30
17.93
17.16
Carcass
430.80
708.46
586.00
584.50
728.00
29.38
50.43
50.56
59.10
60.39
Intestines (total)
113.12
301.27
180.80
146.36
174.33
7.83
21.45
15.60
14.80
14.46
Gills
20.80
28.31
27.10
27.21
29.66
1.44
2.02
2.34
2.75
2.46
Fins
24.12
22.55
41.20
26.84
30.43
1.67
1.61
3.55
2.71
2.52
Scales
30.94
44.93
51.00
41.93
44.02
2.11
3.20
4.40
4.24
3.65
The average water, protein, fat and mineral content of carp meat from studied groups is presented in
Table 3. The water amount varied from 73.81 % (S-1) to 80.86 % (SemiIS-2). The muscle water
content of fish reared in extensive (without feeding) and semi-intensive systems (fed grain and
sunflower meal) was higher compared to that of groups reared in intensive systems and fed
compound feed (IS-1, IS-2) or grain feed only (SemiIS-1). The differences among values are of
various statistical significance (P<0.05; P<0.01; P<0.001). The data demonstrated that water was
the main chemical constituent of meat for all groups of carps. The investigation of this parameter is
important as it is involved in the formation of organoleptic properties of meat.
Carp meat protein content varied from 15.90 % to 18.16 % with differences of 9.0-12.4 % among
studied groups of fish, which were not statistically significant (P>0.05). A higher relative
proportion of meat protein was established in carps reared in extensive and semi-intensive systems
(SemiIS-2, fed meal and grain). The meat protein percentage in groups framed in both intensive
systems was 73.5-75.77%. For SemiIS-1, where fish was fed only grain feeds, meat protein content
was markedly lower (60.71 %).
The carp meat fat in studied production systems varied within a rather large range from 0.74%
(SemiIS-2) to 9.48 % (SemiIS-1). Higher absolute values of meat fat were found out in carps from
SemiIS-1 (fed uniformly with grain feed only) and both intensive systems (fed compound feeds
with dietary crude fat to protein ratios 7:1 for IS-1 and 4.2:1 for IS-2). The statistically significance
359
of differences among studied groups of fish was variable (P<0.001; P<0.01), except for the
difference between ES-1 and SemiIS-2 which was insignificant (P>0.05).
Table 3. Chemical composition (% of wet matter) and energy value (kJ.100 g-1) of carp meat from
different production systems
Production systems
Water
Proteins
Fats
Ash
Energy (total), kJ.100 g-1
Energy, % from proteins
Sx
Sx
Sx
Sx
tensive
S-1
79.84
0.07
18.16
0.27
1.02
0.30
0.98
0.020
346.46
89.11
Semi - intensive
Semi-IS-1
Semi-IS-2
73.81
80.86
0.81
0.14
15.90
17.48
0.27
0.17
9.48
0.74
0.90
0.17
0.81
0.92
0.11
0.01
621.06
447.20
43.52
93.40
Intensive
IS-1
IS-2
76.64
76.00
0.18
0.12
17.70
17.64
0.18
0.16
4.63
5.41
0.01
0.03
1.03
0.95
0.179
0.17
607.07
636.65
69.68
66.22
A substantial variation in meat fat content in marketable carps from various fish farms was reported
by Ljubojevi et al. (2013) and Romvri et al. (2002). Some authors (Mahboob, 1992) attributed the
low meat fat level in extensive farming systems not only to the available natural food in ponds, but
also to active efforts for seeking food and aquatic organisms for food, the energy for which is
supplied by fat. The differentiation in fish meat fat proportions was higher in production systems
with feeding in strong relation to the type and ratios of used feeds.
On the basis of obtained results and the classification of Kyosev and Dragoev (2009), the fish
groups are classified in three categories in relation to their meat fat content:
- lean fish (meat fat content up to 2 %) carp groups from SemiIS-2 and ES-1.
- medium-oily fish (meat fat content from 2 % to 8 %) - groups of fish from IS-1 and IS-2
- oily fish (meat fat content from 8 % to 15 %) fish from SemiIS-1.
The mineral content of carp meat ranged between 0.81 and 1.03%, despite the type of the
production system. The differences were not statistically significant (P>0.05). The relative
proportion of mineral substances in dry matter was from 3.09 to 4.86%, comparable to data reported
by Hadjinikolova (2004).
The meat energy content in carps from studied production systems (ble 3) varied from 346.46
kJ.100 g-1 (ES-1) to 636.65 kJ.100 g-1 (IS-2). The changes in carp meat protein to fat ratio reflected
directly its energy value. The analysis showed that the energy value was associated at a greater
extent to meat proteins in fish from ES-1 and SemiIS-2 (89.11-93.4 %) and at a lesser extent in
intensive production systems (66.22 69.68 %), whereas in SemiIS-1, the major part of the energy
came from meat fat (56.48 %). Data indicated that meat energy value followed the same tendency
as meat fat content. In the semi-intensive system with uniform-type carbohydrate feeding, as well as
in intensive systems where meat fat content of carps was higher, average meat energy value was
also higher.
The analysed chemical parameters and meat energy were related to the dynamics of building and
energy substances in carp meat and could serve as traits of quality of meat as nutrient in the
detection of the specificity of farming production system.
360
Conclusions
Specific differences in the analysed body traits, meat chemical composition and energy value in
carps farmed in production systems with various intensification levels were established.
Groups of fish reared in the extensive system had rather lower body measurements as compared to
fish farmed in semi-intensive and intensive production systems.
Statistically significant differences between studied groups of carps were found out with regard to
water and fat contents of meat. According to their fat content, studied fish were classified in three
categories: lean (ES-1 and SemiIS-2), medium-oily (IS-1 and IS-2) and oily fish (SemiIS-1).
The type and ratio of used feeds had a greater influence on the deposition of fat in fish meat. When
carps were farmed under semi-intensive system conditions and fed grain feeds only, the meat
protein content was the lowest and meat fat content the highest.
References
1. Bauer C., Schlott G.: Filet field and fat content in common carp (Cyprinus carpio L.), produced in three
Austrian carp farms with different culture methodologies. J. Appl. Ichthyol, 25, 591-594, 2009
2. irkovi M., Trbovi D., Ljubojevi D., orevi V.: Kvalitet mesa ribagajenih u polikulturi u
ribnjacima u Republici Srbiji. Tehnologija mesa, 52, 1, 106-121, 2011
3. Hadjinikolova L.: Comparative studies on nutritive value of some cultured fish specias. Journal of
animals science, XLI, 3, 69-72, 2004
4. Hadjinikolova L., Grosev Gr.: Characteristics of carcass features and chemical composition of industrial
Hybrid-94 and Plovdivski carp. Bulg. J. Agric. Sci., 2, 753-760, 1996
5. Ivancheva E., Todorov M.: Slaughter analysis of mirror carp of various morphological types. Animal
Sciences, V, 3, 58-64, 1989
6. Kyosev, D.: Technology of Fish and Fish Products. Sofia, Zemizdat, 1985
7. Kyosev D., Dragoev S.: Technology on Fish and Fish Products. Bg ISBN 978-954-90533-6-4 , 2009
8. Ljubojevi D., irkovi M., Novakov N., Jovanovi R., Jankovi S., orevi V., Mai Z.: Productivity
and Meat Nutrient in Fish: The Diet Effect. Kafkas Univ Vet Fak Derg, 19, 1, 43-49, 2013
9. Mahboob S.: Influence of fertilizwer and articial feed on the growth performance in composite culture of
major common and some Chinese carps. Ph.D. Theis (Deptt. of Zoology and Fisheries), Univ. Of Agril.,
Faisalabad, 1992
10. Ordinance 23/2001 of the Ministry of Health
11. Pieniak Z., Verbeke W., Scholderer J., Brunar K., Olsen S. O.: European consumers' use of and trust in
information sources about fish. Food Quality Preference, 18, 1050-1063, 2007
12. Repnikov B. T.: Merchandizing and biochemistry of fish products, publishing house Dashkov and K, Ru,
Moscow, 2007
13. Romvri R., Hancz C. S., Petrsi Z. S., Molnr T., Horn P.: Non-invasive measurement of fillet
composition of four freshwater fish species by computer tomography. Aquaculture International, 10,
231240, 2002
14. Trbovic` D.: The impact of diet on meat quality of common carp. Archiva Zootechnica, 15, 3, 69-78,
2012
361
MEAT LIPID QUALITY IN CARPS (YPRINUS CARPIO L.) GROWN IN PRODUCTION

SYSTEMS WITH DIFFERENT LEVEL OF INTENSIFICATION
Angelina Ivanova1*, Liliana Hadzhinikolova1
1. Institute of fishery and aquaculture, 248 V. Levski str, Plovdiv 4003, Bulgaria
Abstract
The purpose of the present study was to determine the quality of the lipids in carp meat on the basis
of fatty acid profiles, lipids groups and fatty acid ratios. The experiments were carried out with
common carp (Cyprinus carpio L.), reared in production systems with different level of
intensification (extensive, semi-intensive and intensive) in ponds and dam lakes. The highest level
of polyunsaturated EPA, 20:5 -3 (4.93-5.90 g.100g-1) and DHA, 22:6 -3 (4.40-6.23 g.100g-1)
was observed in meat lipids of carp, reared in extensive (S 1) and semi-intensive (Semi-IS-2, fed
with grain/sunflower meal) production systems. The determined ratios of polyunsaturated to
saturated fatty acids in carp lipids were between 0.33 (Semi-IS-1) and 1.31 (IS-1). Biologically
important -6:-3 fatty acid ratio was the most favourable in meat lipids of carp fed with
grain/sunflower meal (Semi-IS-2), extruded feed (IS-2) and in carp reared in extensive production
systems. The feeding of carp with grain influenced the increase in quantities of MUFA (70.6
g.100g-1) and the -6:-3 fatty acid ratio to 6.05.
Keywords: carp, Cyprinus carpio L., fatty acids, fatty acid ratios, lipids groups
Introduction
The composition and quality of lipids in fish tissues has been discussed from different points of
view, as it is influenced by a number of abiotic and biotic factors. The reported variations are
attributed to the integral interaction of the species, gender, age, reproduction period, season,
temperature, feeding etc. Fatty acids are primary structural components of lipids that determine
their physical properties, stability to oxidation, nutritional and biological value. They are essential
for men because of their influence on different physiological processes and involvement in the
production of important biologically active metabolites (Nawar, 1996; Tocher, 2003).
Investigations on the fatty acid profile and fatty acid groups in freshwater fish have been performed
by Andrade et al. (1995), Ljubojevi et al. (2013), Merdzhanova (2014), Visentainer et al. (2000)
and others. The effects of the production system and feed type on meat quality and meat lipid fatty
acid profile in carps are reported by Cirkovic et al. (2011) and Trbovic et al. (2009).
In previous studies, we have investigated the effect of various dietary lipid sources on carp meat
lipid content and fatty acid profile of meat (Hadzhinikolova, 2008). The main lipid indices of carp
meat reared in different production systems are also reported (Ivanova and Hadzhinikolova, 2015).
It was found out that the lipids of studied carp groups possessed very good anti-atherogenic and
anti-thrombogenic properties as studied indices were < 1.0 (atherogenic index - 0.24-0.51 and
thrombogenic index - 0.39-0.61).
The differences were specific with respect to the level of intensification of the production systems.
The present study was designed to study the quality of carp (Cyprinus carpio L.) meat lipids in
relation to environmental conditions, production systems and fish nutrition as carps are among the
aquaculture species in Bulgaria of primary economic importance. The specific goals were to
362
evaluate the quality of carp meat lipids on the basis of the main groups of fatty acids, fatty-acid
profile and fatty acid ratios.

In this study, carp (Cyprinus carpio L.) production systems for human consumption, differing by
their geographical location, types of farming system (earthen ponds, dam lakes, net cages), level of
intensification (extensive, semi-intensive, intensive) were used. The extensive system was the
Plovdiv Experimental base (ExS-1), the semi-intensive were Budak dere dam lake (SemiIS-1) and
Tri Voditsi/ 10 Experimental base (SemiIS-2), while the intensive systems were the Tundzha 73/4
fish farm (IS-1), the Tundzha 73/5 fish farm (IS-2). Carps from semi-intensive and intensive
systems were fed feeds of various composition and structure: grain feeds, high-protein meals,
specialised pelleted and extruded feeds. Fish in the extensive system was not fed (Table 1).
Table 1. Characteristics of the studied production systems
Production
systems
Type of feed
Ratio offeed, %
Area, dka
tensive
S 1
70
Semi-intensive
Semi-IS-1*
grain
100
250
Semi-IS-2
grain /sunflower meal
50:50
45
Intensive
IS-1
CPF**
100
750
IS-2
CEF
100
200
*(S 1) - Plovdiv Experimental base; (Semi-IS-1) Budak dere dam lake; (Semi-IS-2) - Tri Voditsi Experimental base; (IS-1) Tundzha 73/4 fish farm; (IS-2) - Tundzha 73/5 fish farm; **CEF-combined extruded feed; CPF- combined pelleted feed
During the experiments, in the period from May to October 20122014, physico-chemical
parameters of water were monitored on a monthly basis. The water temperature and pH, the
dissolved oxygen content were compliant with technological norms for cyprinids and provided
normal conditions for the farmed fish species.
The fatty acid composition of meat triglycerides was analysed by gas chromatography using a
5890 gas chromatograph with flame ionisation detector, 60 m DB-23 capillary column, column
temperature 130 C (1 min), 6.5 C/min increments up to 170 C, 3.0 C/min increments up to 215
C (12 min); 40.0 C/min up to 230 C (1 min); detector temperature 280 C; injector temperature
270 C, carrier gas hydrogen (2), split 1:50 and software Data Apex Clarity TM 2.4.1.93/2005.
The individual fatty acid content was identified with standards and through retention times. The
results are expressed as g.100 g-1 fat.
Fatty acid groups, fatty acid ratios, as well as group ratios were calculated. Data were submitted to
statistical analysis for calculation of average value (x), standard error of the mean (Sx) and
coefficient of variation (Cv, %) by means of MSOffice 2010. The statistical significance of
differences between two samples was determined by the Students t-test at a level of significance
P<0.05.
Data about the main groups fatty acids (FA) and the fatty acid profile of carp lipids with respect to
the studied production systems are presented in Tables 2 and 3. According to results, the total
amount of saturated fatty acids (SFA) in carp lipids varied from 22.14 (Semi IS-1) to 41.10 g.100 g1
(xS-1). For intensive systems, where fish are given specialised extruded and pelleted feeds, meat
SFA ranges between 26.60 27.77 g.100 g-1. These values are comparable to data reported by
Hadzhinikolova (2008) about SFA levels of 22.0-34.3 g.100 g-1 in the lipids of carps fed pelleted
feed.
363
From the SFA group, the highest proportions were those of the palmitic acid (16:0), stearic acid
(18:0) and behenic acid (22:0). In commercial size carps, Ljubojevi et al. (2013) reported
similar data. Our results were also in agreement with the findings that palmitic acid was the main
FA in carp lipids and that it was not influenced by the type of used feed (Gulsun and Abdurrahman
(2006). The highest levels of the predominant palmitic acid (16:0) was established in the meat of
carps from the extensive system (25.50 g.100 g-1).
Unsaturated fatty acids (UFA) varied within 58.90- 77.86 g.100 g-1 and in general, had levels higher
than those of SFA. In the meat lipids of carps from the intensive systems (fed pelleted and extruded
feeds), UFA were 72.23-73.40 g.100 g-1, with a certain specificity for each studied system. In the
extensive system where fish was not fed, and in Semi IS-2 (combined feeding with grain and
sunflower meal), the UFA amount in meat lipids was lower and between 58.90 and 62.27 g.100 g-1.
The highest level of UFA was detected in Semi IS-1 (77.86 g.100 g-1), and its profile was mostly
associated with the high UFA level (70.60 g.100 g-1).
Table 2. Main fatty acid groups in carp meat lipids in relation to the production system type
Production systems
Groups of
FAs
/g.100 g-1
SFA
UFA
MUFA
PUFA
-6
-3
-6/-3
PUFA/SFA
tensive
S 1
Semi-intensive
Semi-IS-1
Semi-IS-2
41.106.81
58.906.81
28.302.11
30.604.90
18.704.65
11.900.55
1.570.36
0.74
22.141.57
77.861.57
70.61.90
7.260.33
6.230.35
1.030.04
6.050.47
0.33
37.331.74
62.671.74
33.973.05
28.701.34
15.871.06
12.132.45
1.400.35
0.77
Intensive
IS-1
IS-2
26.601.62
73.401.62
38.673.61
34.733.82
29.033.56
5.700.56
5.090.62
1.31
27.773.23
72.233.23
37.865.06
34.373.39
23.701.65
10.673.01
2.220.67
1.23
Monounsaturated fatty acids (UFA) varied within a very broad range from 28.30 to 70.60 g.100
g-1, with highest share of the oleic acid (18:1 -9) - from 21.6 to 60.59 g.100 g-1, followed by
palmitoleic acid (16:1) with 3.46-7.47 g.100 g-1. Comparable results have been reported by other
research teams as well (Hadjinikolova, 2004; Viola and Rappaport, 1979; Viola et al., 1988). Oleic
acid (18:1) is the predominant monounsaturated fatty acid and its level determines the total
MUFA amount. The obtained results are in agreement with oleic acid values reported in the
literature for freshwater fish (Reichwald, 1976). According to Andrade et al. (1995) higher oleic
(18:1) and palmitoleic (16:1) fatty acid levels are indices of good quality of freshwater fish
lipids.
The analysis of data detected a specific differentiation of oleic acid levels in carp meat lipids
according to the production system. The oleic acid level for the group from intensive systems was
30.50-31.24 g.100 g-1, whereas for the groups from ExS and SemiIS-2 - 21.6 and 27.73 g.100 g-1
respectively. The highest oleic acid content was demonstrated in SemiIS-1 (60.59 g.100 g-1), where
fish were fed grain feeds only. For meat lipids of this group, the oleic acid was limiting with a
relative proportion of 85.8% from total MUFA amount and within the UFA group too.
Polyunsaturated fatty acids (UFA) values ranged from 7.26 to 34.73 g.100 g-1. The UFA group
comprises essential omega- and omega-3 fatty acids. The omega-6 fatty acids were determined at a
higher extent by linoleic acid (18:2 -6), which is the predominant in this group, followed by linolenic (18:3 -6) and arachidonic (20:4 -6) acids. Higher linoleic acid concentrations
(18:2 -6) were found out in carp meat lipids from intensive systems (fed specialised feeds),
followed by the extensive system and Semi IS-2 (feeding with grain and sunflower meal). The
lowest values were observed in Semi IS-1 where feeding with grain feeds only was applied.
364
The other omega-6 fatty acids from the content of lipids represented by -linolenic (18:3 -6),
eicosadienonic (20:2 -6) and arachidonic (20:4 -6) acids ranged between 0.1-1.60 g.100 g-1 in
all studied production systems. Carp lipids had different omega-3 PUFA content with respect to the
production system. Higher values of 11.90-12.13 g.100 g-1 were established in S-1 and Semi IS-2
production systems. These groups of carps had two main sources of food natural food (S-1) and
natural food plus feed (combination of sunflower meal and grain for Semi IS-2). According to a
number of researchers (Adamek et al., 2004; Kirbia et al., 1997; Prikril, 1984) the natural food in
basins was most probably an important source of proteins, amino acids, fats and fatty acids, and
vitamins, which are essential for the growth and development of fish. The high content of omega-3
FA in fish from S-1 and Semi IS-2 was mostly dependent on the considerably higher amount of
docosahexaenoic acid (22:6 -3) from 4.40 to 6.23 g.100 g-1, followed by eicosapentaenoic acid
(20:5 -3): 4.93-5.90 g.100 g-1. In Semi IS-2, the zooplankton biomass during the vegetation
period was 3.36 g.m-3 mostly represented by Rotatoria, Cladocera and crustaceans, whereas the
zoobenthos from chironomid larvae and Oligochaeta. Probably, the combination of higher levels
of zooplankton biomass and the lower carp biomass (70 fish per dka, with initial weight of 60 g at
stocking) resulted in better expression of eicosapentaenoic and docosahexaenoic acids in carp
lipids.
Table 3. Fatty acid profile of carp meat lipids in relation to the production system type
Production systems
FAs/g.100g-1
tensive
S 1
Semi - intensive
Semi-IS-1
Semi-IS-2
8:0
10:0
11:0
12:0
14:0
15:0
16:0
17:0
18:0
20:0
22:0
23:0
24:0
14:1
16:1
17:1
18:1(-9)
18:1(-7)
18:2 (-6)
18:3 (-6)
18:3 (-3)
20:1
20:2 (-6)
20:3 (-3)
20:4 (-6)
20:5 (-3)
22:1
22:6 (-3)
0.200.06
0.100.00
0.200.06
0.200.06
1.200.32
0.700.15
25.504.01
0.900.17
7.701.45
0.300.10
3.600.66
0.200.00
0.600.10
0.200.00
3.700.68
0.500.00
21.603.04
1.700.49
17.204.84
0.300.12
0.900.12
0.600.06
0.400.00
0.700.15
0.900.20
5.900.26
4.400.40
1.000.00
17.671.61
3.370.20
0.100.00
7.470.82
60.592.52
5.630.35
0.470.04
2.430.04
0.500.00
0.100.00
0.500.07
0.100.07
0.070.04
365
0.130.04
0.130.04
1.400.32
0.570.04
22.971.15
0.330.08
7.370.43
0.10.00
3.730.35
0.100.00
0.570.08
0.200.00
4.230.64
0.470.04
27.732.63
13.61.10
0.230.04
1.600.26
1.230.08
1.000.00
0.100.00
1.030.04
4.930.82
0.30.00
6.231.82
Intensive
IS-1
IS-2
0.100.00
0.100.00
0.700.14
0.300.04
19.331.14
0.430.04
3.670.41
0.130.04
0.770.11
1.070.08
0.100.00
3.901.20
0.210.04
31.242.61
0.810.07
26.263.21
0.400.03
0.100.00
2.300.46
1.100.21
1.270.27
3.200.19
0.110.04
2.400.39
0.100.00
1.060.23
0.360.04
19.701.13
0.390.00
3.491.80
0.140.07
1.560.29
0.970.57
0.100.00
3.460.67
0.230.08
30.524.12
1.030.08
22.181.68
0.200.12
0.700.21
2.420.36
0.100.00
1.100.19
1.230.35
3.831.50
0.100.00
5.041.53
According to Visentainer et al. (2000) freshwater fish are able to convert polyunsaturated fatty acids
like linoleic (18:2 -6) to the longer arachidonic acid (20:4 -6) and the -linolenic acid (18:3
-3) to longer-chained omega-3 fatty acids eicosapentaenoic (20:5 -3) and docosahexaenoic
(22:6 -3).
It is acknowledged that men could not practically produce these two essential fatty acids from the linolenic acid (18:3 -3), therefore it is more efficient to procure them from the food. This fatty
acid is a precursor for the synthesis of eicosapentaenoic (20:5 -3) and docosahexaenoic (22:6
-3) fatty acids (Crawford et al., 1999). Sargent (1995) affirms that omega-3 fatty acids, especially
docosahexaenoic acid (22:6 -3), are able to maintain the functional integrity and structure of fish
cells. It is believed that fish fat is a rich source of essential fatty acids when it contains
eicosapentaenoic (20:5 -3) and docosahexaenoic (22:6 -3) acids at a level of and over 6 g.100
g-1. Such fats are of high nutritional and biological value (Mieth et al., 1989; Olh et al., 1987).
The analysis of data about the fatty acid quantity and quality of carp lipids allowed affirming that
with respect to the presence of the different fatty acids, the meat lipids of 2-year-old carps are
mainly of the oleic acid type. Saturated fatty acids are mainly represented by the palmitic acid,
while the unsaturated by oleic and linoleic acids. The UFA proportion was higher than that of
SFA.
On the basis of values for the fatty acid groups, the calculated UFA/SFA ratio (Table 2), varied
within the range from 0.33 to 1.32. The minimum allowance of this ratio as per the British
Department of Health (1994) was 0.45. Other auhtors and sources (Kang and Leaf, 2000; AHA,
2005; EFSA, 2009; WHO, 2003; WHO, 2010; FAO/WHO, 2008) specify the value of 1.0 0.2 as
optimum for the ratio; hence, the recommended interval for UFA/SFA ratio was from 0.45 to
1.0. According to our data, the groups from xS-1 and Semi IS-2 were within this range (0.77).
Values under 1.0 in the view of Simopolous (2013) indicate a balanced distribution of fatty acid
groups in these two production systems. The UFA/SFA in Semi IS-2 was 0.33, i.e. under the
minimum value of 0.45 (Department of Health, 1994). Carps from intensive systems were
characterised with ratios higher than the optimum and varied from 1.26 to 1.32. UFA/SFA ratios
obtained in this study correlated with the range reported for freshwater fish (0.71-1.26;
Merdzhanova, 2014).
The present study has shown that in studied production systems the omega-6 fatty acid group
predominated over the omega-3 FA. The -6:-3 ratio varied from 1.40 to 6.05 according to the
production system and regardless of its level of intensification. Values under 5.0, falling within the
reference range approved by the World Health Organisation for foodstuffs and natural products
posing low risk for human health, were detected in fish from xS-1, Semi IS-2 and IS-2. For fish
from IS-1 the ratio was near to the limit (5.09), and the highest -6:-3 ratio of 6.05 was
established in Semi IS-1.
Conclusions
It was demonstrated that with respect to the fatty acid proportions, the meat lipids of 2-year-old
carps were of the oleic acid type. Saturated fatty acids were represented at a highest extent by the
palmitic acid, while the unsaturated 0 by oleic and linoleic acids with a specific differentiation of
their levels with regard to the specific production system.
It was found out that the UFA/SFA ratio in carp meat lipids varied from 0.33 to 1.32 with more
balanced distribution of fatty acid groups in xS-1 and Semi IS-2 (0.77).
The most favourable values of the biologically important -6:-3 ratio was found in carp meat
lipids from SemiIS-2, IS-2 and xS-1 (1.40-2.22), which were in line with the WHO reference
value posing low risk for human health (< 5.0).
366
Feeding carps with grain feeds only resulted in increased UFA concentrations in lipids (70.6
g.100 g-1), unbalanced distribution of fatty acid groups (UFA/SFA = 0.33) and high -6:-3 ratio
(6.05).
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Adamek Z., Musil J., Sukop I.: Diet composition and selectivity in 0+perch (Perca fluviatilis L.) and
its competition with adult fish and carp (Cyprinus carpio L.) stock in pond culture. Agriculturae
Conspectus Scientificus, 69, 1, 21-27, 2004
AHA/ACC: Practice Guidelines: Hunt M., Abraham W., Marshal S., Feldman T., Francis A. Update
for the Diagnosis and Management of Chronic Heart Failure in the Adults, DOI:
10.1161/CIRCULATIONAHA.105.167586, 2005
Andrade A. D., Rubira A. F., Matsushia M., Souza N. E.: Omega3 fatty acids in fresh water fish from
South Brazil. American Oil Chemists Society, 72, 10, 12071210, 1995
irkovi M., Trbovi D., Ljubojevi D., orevi V.: Kvalitet mesa ribagajenih u polikulturi u
ribnjacima u RepubliciSrbiji. Tehnologija mesa, 52, 1, 106-121, 2011
Crawford M. A., Bloom M., Broadhurst C., Schmidt W. F., Cunnane S. C., Galli C.and Parkington J.:
Evidence for the unique function of docosahaenoic acids during the evolution of the modern hominid
brain, Lipids, http://dx.doi.org/10.1007/BF02562227, 34, 39-47, 1999
EFSA: Panel on Dietetic Products, Nutrition, and Allergies (NDA); Scientific Opinion on Dietary
Reference Values for fats, including saturated fatty acids, polyunsaturated fatty acids,
monounsaturated fatty acids, trans fatty acids, and cholesterol. EFSA Journal, 3, 107, 2009
FAO/WHO: Fats and fatty acids in human nutrition Report of an expert consultation, FAO Food and
nutrition, Geneva 91, 2008
Gulsun O., Abdurrahman P.: Amino acid and fatty acid composition of wild sea bass (Dicentrarchus
labrax): a seasonal differentiation, European Food Research and Technology, 222: 316320. 2006
Hadjinikolova L.: Comparative studies on nutritive value of some cultured fish specias. Journal of
animals science, XLI, 3, 69-72, 2004
Hadzhinikolova L.: Investigation on production and biochemical traits in freshwater fish aquaculture
species, National Centre for Agrarian Sciences, Sofia. DSc thesis, 2008
Ivanova A., Hadzhinikolova L.: Evaluation of nutritional quality of common carp (Cyprinus carpio L.)
lipids through fatty acid ratios and lipid indices. Bulg. J. Agric. Sci., Supplement 1, 21, 180185, 2015
Kang J. X., Leaf A.: Prevention of fatal cardiac arrhythmias by polyunsaturated fatty acids. Am. J.
Clin. Nutr., 71, 202-207, 2000
Kibria G., Nugegoda D., Fairclough R., Lam P., Bradly A.: Zooplankton: itsbiochemistry and
significance in aquaculture. NAGA, The ICLARM quarterly 20, 2, 8-14, 1997.
Ljubojevi D., irkovi M., orevi V., Puvaa N., Trbovi D., Vukadinov J., Plava N.: Fat Quality
of Marketable Fresh Water Fish Speciesin the Republic of Serbia. Czech J. Food Sci. 31, 5, 445450,
2013
Merdzhanova .: Fatty acid content of Black Sea and freshwater fish. PhD thesis, Medical University,
Varna, Bg, 147, 2014
Mieth G., Wirth M., Friedrich M., Steffens W., Lieder U.: Cyprinida Lipid Content, 1st Report, Lipid
Content and Fatty Acids Composition of Silver Carp (Hypophthalmichthys molitrix Val.). Die
Nahrung, 33, 91-93, 1989
Nawar W.W.: Lipids, in Food Chemistry, O. R. Fennema (Ed.), 225-320. Third edition. Marcel Decker
Inc, New York, USA, 1996
Olh J., Farkas T., Csengeri I.: Fish Consumption and Health, Halszlat XXXIII: 161163, 1987
Prikryl I.: Abundance and biomass of some important components of zooplankton community as a
function of fish stock weight in ponds with prevalence of stocking and marketable carp. Papers of
RIFCH Vodnany, 13, 3-20, 1984
Reichwald I.: Fish Lipid Chemistry. Fette Seifen Anstrichm., 78, 328334, 1976
367

21.
22.
23.
24.
25.
26.
27.
28.
29.
Sargent J. R.: (n3) polyunsaturated fatty acids and farmed fish. In Fish Oil: Technology, Nutrition and
Marketing (Hamilton, R. J. & Rice, R. D., eds), London: Society of Chemical Industry, 6794, 1995
Simopoulos A.: Dietary Omega-3 Fatty Acid Deficiency and High Fructose Intake in the Development
of Metabolic Syndrome, Brain Metabolic Abnormalities, and Non-Alcoholic Fatty Liver Disease,
Review. Nutrients, 5, 2901-2923, 2013
Tocher D. R.: Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci., 11, 2,
107-184, 2003
Trbovi D., Vrani D., inovi J., Borovi B., Spiri D., Babi J., Spiri A.: Fatty acid profile and
cholesterol content in muscle tissue of one year old common carp (Cyprinus carpio) during growth.
Tehnologija Mesa, 50, 5-6, 276-286, 2009. http://www.inmesbgd.com/
Viola S., Arieli Y., Mokady S.: Effects of longterm feeding of fish oil coated pellets on tilapia and carp
growth body fat composition and tolerance to cold. Bamidgeh, 40, 2, 64-68, 1988
Viola S., Rappaport U.: he "Extra-calorie effect of oil the nutrition of carp", Bamidgeh, 31, 3, 51,
1979
Visentainer J. V., Carvalho P. O., Ikegaki M., Park Y. K.: Concentrao de cido eicosapentaenico
(EPA) e cido docosahexaenico (DHA) em peixes marinhos da costa brasileira. Ciencia e
Tecnolologia de Alimentos, http://dx.doi.org/10.1590/S0101-20612000000100017, 20, 90-93, 2000
WHO: Diet, nutrition and the prevention of chronic diseases. - Tech.Report Ser. 916. Geneva, 2003
WHO: Fat and fatty acids in Human nutritions. Report of a Joint WHO/FAO Expert Consultation.
WHO Technical Report Series 91, WHO, Geneva, 2010
368
RESULTS OF BREEDING OF JUVENILES OF HUCHEN (Hucho hucho) OBTAINED BY

INSEMINATION WITH FRESH AND CRYOPRESERVED SPERM IN ARTIFICIAL
CONDITIONS
Nataa Radojkovi1*, Aleksandra Milokovi1, Simona Kovaevi1, Tijana Velikovi1, Sneana
Simi1, Miroslav irkovi2, kos Horvth3, Vladica Simi1
1. Faculty of Science, Kragujevac, Serbia
3. Szent Istvn University, Department of Fish Culture H-2103, Gdll, Hungary
Abstract
The huchen is the largest indigenous salmonid species in Serbian fresh waters. Obvious
anthropogenic influence has led to pollution, habitat fragmentation and degradation, which effected
the populations of this species by reducing the number. Therefore, there is a growing need for
artificial spawning and breeding of the huchen, both for the reintroduction into the native habitat
and potential commercial breeding. This paper presents the results of insemination with fresh and
cryopreserved sperm. It was followed ontogenetic development, growth and condition of the huchen
juveniles in the first six months of life. Because of the great potential, application of the
cryopreservation method can be very helpful in efforts to preserve these species in aquaculture.
Keywords: huchen, cryopreservation, artificial breeding, insemination, Serbia
Introduction
Huchen Hucho hucho (Linnaeus, 1758) also known as Danube salmon is one of the most
endangered members of the family Salmonidae (Holik et al., 1988). Its native dispersal area
determines it an endemics of the Danube River drainage area, where it inhabits streams and rivers in
highlands (200-600 m of altitude) with fast water current, moderate maximal water temperature
(usually up to 15 C) and sufficient amount of dissolved oxygen (8-9 mg L-1), although it can
sustain more harsh conditions (Simonovi et al., 2011). Its one of the largest salmonids with a
maximum total length of up to 183 cm and a weight of up to 60 kg (Freyhof et al, 2015). This
species is highly predatory, economically valuable, and a prized trophy fish and unfortunately its
current status in Europe is critical, with populations continuously decreasing. Excessive
anthropogenic impacts like habitat destruction, irresponsible deforestation, pollution, poaching and
dam construction, have led to significant reductions in populations abundances. Today this species
is found in smaller and isolated areas, with negative consequences for both demographic and
genetic stability (Ihut et al., 2014). According to IUCN criteria, it is classified as endangered
species. For that reason, there is a need for artificial spawning and breeding of this species.
Semen cryopreservation is recognized as a tool with great potential for the preservation of genetic
variability of depleted stocks and to be used actively in supportive breeding. Only a few reports
about cryopreservation of semen of huchen have been published (Lahnsteiner et al., 1996,
Glogowski et al., 1997, Nynca et al., 2015). Improvement of the efficacy of the cryopreservation
method for huchen semen seems to be a prerequisite for the implementation of this method into
hatchery practice (Nynca et al., 2015). The objective of this study was to test the effects of
cryopreservation on motility parameters and fertilization rates of huchen semen and breeding
juveniles in artificial condition.
369

The work described here was conducted in hatchery Panjica (Ivanjica, Serbia) in april 2014. Fish
were not stimulated hormonally for spermiation or ovulation and male and female individuals were
stocked separately in different pools. 5 males weight between 2, 7 and 5, 6 kg and maximum length
between 60 and 87cm were selected for the experiment. Fish were anesthetized on the location of
capture using 2-phenoxyethanol at a dose of 0.8 ml l1. Anesthetized fish were laid on a towel, their
urogenital openings were wiped dry and sperm were stripped into test tubes.
The motility parameters of the fresh sperm and frozenthawed sperm were examined with
Computer Assisted Sperm Analysis (CASA) (Sperm VisionTM v.3.7.4., Minitube of America,
Venture Court Verona, USA). Sperm were cryopreserved using Grayling extender (200 mM
glucose, 40 mM KCl, 30 mM Tris) and 10% methanol. The mixture of sperm with extender and
cryoprotectant was loaded into 0.5 mL straws (Minitube GmbH, Tiefenbach, Germany). Semen
samples were diluted in ratio 1:4.
Straws were placed on a 3 cm high polystyrene frame floating on the surface of liquid nitrogen and
allowed to cool for 3 min. After cooling straws were plunged into liquid nitrogen. Frozen sperm
samples were stored in a Statebourne BIO 10 storage dewar (Statebourne Cryogenics, Washington
Tyne & Wear, UK). Sperm samples were used for fertilization after 20 days of storage. Samples
were thawed in a 40 C water bath for 13 s.
Fertility trials were performed with fresh and cryopreserved sperm on 26 April 2014. For the
experiment were used eggs of five different females, and for each specimen was performed
fertilization both with cryopreserved and fresh sperm. Amount of 60 grams (approximately 900
eggs) was fertilized with 400 l of sperm. Water from the pond in which specimens were kept was
used as fertilisation solution. Fertilization rate was determined from the percentage of eyed stage
embryos in relation to the total number of eggs.
After fertilisation development of five experimental and five control samples was followed. The
specimens were grown in optimal artificial conditions. In stadium of fingerlings was measured total
length TL (cm) and weight W (g) of specimens, monthly approximately.
Results
Motility values were ranged from 32% to 78%. Samples which motility values were below than
50% were not used for the cryopreservation experiments. The mean motility value of fresh sperm
samples were 56, 252, 48%. Cryopreservation caused a decrease by about 90% (Fig.1)
Fig. 1. Motility parameters of the fresh and cryopreserved sperm
370
Fertilization of eggs with cryopreserved sperm was 35,65% and with fresh sperm was 38,30%.(Fig.
2). One experimental and one control sample from the same female failed probably due to low
quality of oocytes
Fig. 2. Percentage of fertilized eggs with fresh and cryopreserved sperm

Parameters of the total length (L) and weight (W) were measured on a sample of 20 specimens and
in paper presented with their average value (Table 1).
Table 1. The ratio of the length and weight of specimens obtained by fertilisation with fresh and
cryopreserved sperm
Date
17. 06. 2014.
05. 07. 2014.
13. 08. 2014
18. 09. 2014.
Fresh sperm
L
22,95
26,875
37,65
55,85
W
0,115
0,145
0,397
1,03
Cryopreserved sperm
L
W
24,25
0,12
28,65
0,168
36,15
0,353
57,55
1,135
Discussion
Application of sperm cryopresevation to hatchery practice of managing natural aquatic resources
carries a great potential. (Horvat et al., 2012). Successful cryopreservation of fish spermatozoa
depends on a range of factors including the collection of high quality sperm, equilibration
conditions, choice of cryoprotectant medium, cooling/thawing regimes and conditions for
fertilization.(Cabrita et al.,)
The present paper describes the first attempt in Serbia to preserve the semen of huchen for long
periods of time and show that cryopeserved sperm can reliably be used for the fertilization in
hatchery. Lahnsteiner et al. (1996) and Lahnsteiner (2000) recorder low (20-30%) absolute
fertilization rates for cryopreserved semen of huchen. Far better results were obtained by Nynca et
al. (2015) 75-80%, used cryopreservation method based on the employment of methanol-glucose
extender. This cryopreservation procedure has successfully been applied in other salmonid species,
rainbow trout (Ciereszko et al., 2014), brown trout (Nynca et al., 2014) and grayling (Nynca et al.,
2015).
In this experiment, the results showed that despite the low percentage values of sperm motility,
fertilization was successful. In contrast to previous studies, there was no significant difference
371
between the percentage of fertilization with fresh sperm and frozen sperm, even a certain samples
with frozen sperm provided better results. The success of fertilization depends largely on the quality
of oocytes, as well as the quality and concentration of sperm.
Juvenile huchen obtained by artificial spawning with frozen sperm in their growth and condition did
not lag behind the control groups to whose fertilisation was used fresh sperm. In some stages of
development they showed even greater progress.
Huchen has great potential for breeding in aquaculture, since it is highly appreciated salmonid
species. The use of cryopreservation techniques would encourage and facilitate the cultivation of
huchen in artificial conditions as for the needs of the reintroduction in native habitats and
conservation as well as aquaculture.
This method can be a very useful tool for ongoing efforts for conservation of huchen in Central
Europe, for aquaculture of this species, as well as this procedure can be implemented in hatchery
conditions.
Acknowledgments
This investigation was supported by the Ministry of Science and Technological Development of the
Republic of Serbia as part of the project number 31011
References
1.
Cabrita, E., Sarasquete, C., Martnez-Pramo, S., Robles, V., Beiro, J., Prez-Cerezales, S.:
Cryopreservation of fish sperm: applications and perspectives. Journal of Applied Icthyology 26, 623
635, 2010
2. Ciereszko, A., Dietrich,G.J.,Nynca, J., Dobosz, S., Zalewski, T.: Cryopreservation of rainbow trout
semen using a glucosemethanol extender. Aquaculture 420421, 275281, 2014
3. Freyhof, J., S. Weiss, A. Adrovi, M. aleta, A. Dupli, B. Hraovec, B. Kalamuji, Z. Mari, D.
Miloevi, M. Mrakovi, D. Mrdak, M. Piria, U. Schwarz, P. Simonovi, S. ljuka, T. Tomljanovi, &
D. Zabric.: The Huchen Hucho hucho in the Balkan region: Distribution and future impacts by
hydropower development. RiverWatch & EuroNatur, 30 pp, 2015
4. Glogowski, J., Babiak, I., Goryczko, K., Dobosz, S., Kumiski, H.: Properties and cryopreservation of
Danube salmon (Hucho hucho) milt. Arch. Pol. Fish. 5, 235239, 1997
5. Holk J.: Threatened fishes of the world: Hucho hucho (Linnaeus 1758) (Salmonidae). Env. Biol. Fish.
43: 105106, 1995
6. Holik, J.: Conservation of the huchen, Hucho hucho (L.), (Salmonidae) with special reference to
Slovakian rivers. Journal of Fish Bioogy. 37 (sA), 113121, 1990
7. Horvth, A., Jesenek, D., Csorbai, B., Bokor, Z., Raboczki, E.,Kaczk, D., Bernth,G., Hoitsy,G.,
Urbnyi, B., Sunik Bajec, S., Snoj, A.: Application of sperm cryopreservation to hatchery practice and
species conservation: a case of the Adriatic grayling (Thymallus thymallus). Aquaculture 358359,
213215, 2012
8. Ihut, A., Zitek, Andreas., Weiss, S., Ratschan, C., Holzer, G., Kaufmann, T., Cocan, D., Constantinescu,
Miresan, V.: Danube Salmon (Hucho hucho) in Central and South Eastern Europe: AReview for the
Development of an International Program for the Rehabilitation and Conservation of Danube Salmon
Populations. Bulletin UASVM Animal Science and Biotechnologies 71(2), 2014
9. Lahnsteiner, F.,Weismann, T., Patzner, R.,: Cryopreservation of semen of the grayling (Thymallus
thymallus) and the Danube salmon (Hucho hucho). Aquaculture 144, 265274, 1996
10. Lahnsteiner, F.: Semen cryopreservation in the Salmonidae and in the Northern pike. Aquaculture
Research. 31, 245258, 2000
372

11. Nynca, J., Dietrich, G. J., Grudniewska, J., Dobosz, S., Liszewska, E., Krzys, M., Rozynsky, R.,
Ciereszko A.: Efficient method for cryopreservation of European huchen (Hucho hucho L.) and grazling
(Thymallus thymallus L.) semen. Aquaculture, 435, 146-151, 2015
12. Nynca, J., Dietrich, G.J., Dobosz, S., Grudniewska, J., Ciereszko, A.: Efficient method for
cryopreservation of brown trout semen. Aquaculture 433, 6265, 2014
13. Simonovi, P., Nikolic, V., Toi, A., Maric, S.: Length-weight relationship in adult huchen Hucho
hucho (L., 1758) from Drina River, Serbia. Biologia 66/1, 156-159, 2011
373
DISTRIBUTION AND SOME ECOLOGICAL IMPACTS OF FLUKE

POSTHODIPLOSTOMUM CUTICOLA (DIGENEA, TREMATODES) ON THE
ICHTHYOFAUNA OF THE ZAPADNA MORAVA RIVER
(DANUBE BASIN, SERBIA)
Goran Markovi1*, Nikolina Novakov2
1
2
University of Kragujevac, Faculty of Agronomy, aak, Serbia

Abstract
Posthodiplostomum cuticola (Nordmann, 1832) is a very common parasite of the class fluke
(Trematodes, Digenea) recorded in 12 species of the Serbian ichthyofauna. The life cycle of this
fluke includes two intermediate hosts - a mollusc (usually a snail) and a fish. Larval stages of fluke
overwinter in molluscs and infest fish fry during spring. The definitive hosts are waterfowl birds,
usually the grey heron (Ardea cinerea). The metacercariae (fluke larva) lives in fish and causes
posthodiplostomatosis (black spot disease). The specific dark stains on the skin and fins are the
reaction of the hosts body to the presence of the parasite and result from the decomposition of
chromatophore and haemoglobin accumulated around the metacercaria. Disease symptoms include
necrosis of the skin and deeper tissues, body deformation, liver and kidney dystrophy, locomotion
difficulty, etc.
The Zapadna Morava River (298 km long) is a central component of the Serbian hydrosystem.
Ichthyological research conducted during 2002-2012 recorded the presence of 29 species belonging
to 9 families. The family Cyprinidae was dominant in the number of species (19) and in individual
number and biomass. The occurrence of the fluke P. cuticola was observed in 6 cyprinid species.
The parasite was particularly abundant in the fish assemblage of the Meuvrje Reservoir. The
highest infestation was detected in the nase Chondrostoma nasus (65.40% of total catch) and the
chub Squalius cephalus (55.84%). The Meuvrje Reservoir has quite favourable conditions for the
development cycle of the fluke P.cuticola viz. abundant macrophyte vegetation, favourable
temperature regime and a large population of the grey heron (the definitive host). The ecological
balance of this eutrophic ecosystem was disturbed by the presence and abundance of the fluke
P.cuticola.
Keywords: ichthyofauna, posthodiplostomatosis, the Zapadna Morava River
Introduction
A total of 170 fish parasite species have been registered in Serbian watercourses, with
representatives of the class fluke (Trematodes) consisting of 86 species (61 species of the subclass
Monogenea and 25 of the subclass Digenea) predominating (Djikanovic et al., 2012). One of the
most common species of this parasite group is Posthodiplostomum cuticola (Nordmann, 1832). The
presence of this fluke has been recorded in representatives of fish assemblages in many water
bodies, including Balkan watercourses (Markovic and Krsmanovic, 2008; Zrni et al., 2009;
Adrovi et al., 2011). In the Serbian ichthyofauna, P.cuticola larval stages have been detected in 10
species of the family Cyprinidae, 1 of Acipenseridae and 1 of Percidae (Caki et al., 2004a, 2004b;
Djikanovic et al., 2012; Markovi et al., 2012).
The life cycle of P.cuticola includes two intermediate hosts - a mollusc and a fish. The first
intermediate host is usually the snail (Anisus sp. or Planorbis sp.). Larval stages of the fluke
374
overwinter in molluscs and infest fish fry (more susceptible to parasite infestation) during spring.
The optimal temperature for fluke development is about 240C. The definitive hosts are waterfowl
birds, usually the grey heron (Ardea cinerea). The metacercariae (fluke larva) lives in fish and
causes posthodiplostomatosis (black spot disease). The specific dark stains on the skin and fins are
the reaction of the hosts body to the presence of the parasite and result from the decomposition of
chromatophore and haemoglobin accumulated around the metacercaria. Disease symptoms include
necrosis of the skin and deeper tissues, body deformation, haematological changes, liver and kidney
dystrophy, locomotion difficulty (Williams and Jones, 1994; irkovi and Novakov, 2013).
Figure 1. Location map of the Zapadna Morava River profiles:

1 Kratovska Stena 2 Meuvrje Reservoir 3 aak 4 - Kraljevo
The Zapadna Morava River (298km) is a central component of the Serbian hydrosystem located in
western and central parts of the country. The riverbed is rocky and pebbly in the upper and middle
courses and predominantly muddy in both the lower course and the reservoirs (Meuvrje and
Ovar Banja). The river flows through populated areas characterised by intensive urban, rural and
industrial activities. Environmental conditions have an effect on hydrobiont community diversity.
The ichthyofaunal structure in the upper course of the river takes attributes of the barbel/cyprinid
type waterbody, whereas that in the middle and lower courses suggests a cyprinid character
(Markovi and Veljovi, 2005).

Periodical ichthyological investigations were conducted in the upper and middle courses of the
Zapadna Morava River during 2002-2012. Samples were collected from the river profiles Kratovska
Stena (206 rkm), aak (171 rkm) and Kraljevo (104 rkm), and from the profile on the Meuvrje
Reservoir (the dam of the hydroelectric power plant is on 182 rkm) (Figure 1.). Specimens were
caught using standard fishing gear hooks, nets (with mesh sizes ranging from 10mm to 75mm)
and electrofishing equipment - and identified by standard methods (Wheeler, 1983; Simonovi,
2006). Fluke P.cuticola distribution in the fish assemblage of the Zapadna Morava River was
studied. Signs of metacercariae (fluke larva) presence included distinctive dark stains on fish bodies
375
(on the skin, head and fins) and in deeper tissues. The study also dealt with the effect of fluke
presence on some ecological properties (growth rate) of the chub (Squalius cephalus), a dominant
predator fish in the ichthyofauna of the river section analysed.
Results
During the research period, the fish fauna of the Zapadna Morava River included 29 species
belonging to 9 families (Table 1). The family Cyprinidae predominated in terms of the number of
species (19), followed by Percidae (3 species), whereas the other families were monotypes.
Cyprinid species dominated in both numbers of individuals and biomass, accounting for 93.28% of
individuals and 89.17% of the total sample, respectively. Hydroenvironmental conditions were
diverse and they affected fish assemblage structure. The ichthyofaunal structure of the river sector
was unfavourable. The bleak (Alburnus alburnus) was the dominant member of the ichthyofauna,
followed by the chub (Squalius cephalus), the common nase (Chondrostoma nasus) and the roach
Rutilus rutilus. Obligate predators the wells catfish (Silurus glanis) the northern pike (Esox lucius)
and the asp (Leuciscus aspius) were reduced in numbers (only 2.5% of the total fish population).
The increase in the numbers of alien species such as the Prussian carp (Carassius gibelio) caused
competition with the common carp (Cyprinus carpio) and other valuable native species (Markovi
et al., 2013).
The occurrence of P.cuticola metacercariae was detected only in 6 cyprinid species (Table 1.). The
highest infestation was observed in the common nase (65.40% of all specimens caught), chub
(55.84%) and the bleak (25.75%). The fish assemblage of the Meuvje Reservoir showed the
highest infestation level. Fluke occurrence was recorded mostly in fish that were active in schools
(large groups). Parasite presence was found in all age groups of the specimens analysed.
Table 1. Ichthyofauna composition of the Zapadna Morava River
TAXON
Fam. Cyprinidae
Alburnus alburnus *
Alburnoides bipunctatus *
Abramis brama
Ballerus sapa
Barbus balcanicus
Barbus barbus
Carassius gibelio
Chondrostoma nasus *
Cyprinus carpio *
Ctenopharyngodon idella
Hypophthalmichthys molitrix
Leuciscus aspius
Gobio gobio
Squalius cephalus *
Pseudorasbora parva
Rhodeus sericeus
Rutilus rutilus *
Tinca tinca
Vimba vimba
TAXON
Fam. Esocidae
Esox lucius
Fam. Siluridae
Silurus glanis
Fam. Percidae
Gymnocephalus cernua
Perca fluviatilis
Zingel zingel
Fam. Cobitidae
Cobitis taenia
Fam. Nemacheilidae
Barbatula barbatula
Fam. Gobiidae
Neogobius fluviatilis
Fam. Centrarchidae
Lepomis gibbosus
Fam. Ictaluridae
Ameiurus nebulosus
* infested by Posthodiplostomum cuticola
376

Diverse environmental conditions in some profiles of the ecosystem under study have an effect on
the structure of their fish communities. The Meuvrje Reservoir (surface area 1.5 km2) is the
central fishing area. The reservoir was formed in 1953 by the construction of a 31 m high concrete
dam. The initial reservoir volume was 15.4 x 106m3, but river sediment deposition led to a 70% loss
of initial volume. The ecosystem is characterised by a low flow rate, muddy/sandy bottom,
intensive eutrophication and diversified plankton, macrozoobenthos and macrophyte communities.
These conditions cause a high production of lentic species (Lenhardt et al., 2009).
The distribution of P.cuticola was affected by parasite as well as by host behaviour and habitat
characteristics (Ondrakov et al., 2002). The parasites life cycle requires abundant macrophyte
vegetation in the littoral zone, presence of intermediate hosts (snails and fish) and definitive hosts
(Ondrackova et al., 2004). In the Meuvrje Reservoir, conditions were favourable for complete
parasite development: a favourable temperature regime, abundant macrophyte vegetation, presence
of intermediate hosts and a huge population of the definitive host the grey heron (Ardea cinerea).
Fluke P.cuticola has been reported as pathogenic for many fish hosts. The infection may be lethal,
especially during the first months of fish life. The negative influence of parasite presence and life
activity on fish host survival and growth has been observed both in natural and aquaculture
populations (Sinderman, 1987; Ondrackova et al., 2004).
The objective of this study was to evaluate the effect of P.cuticola on the growth of chub (Squalius
cephalus), a common cyprinid species. Comparisons were made between non-infested and flukeinfested specimens (Table 2.).
Table 2. Growth of total body length (in mm) of chub Squalius cephalus in the Meuvrje Reservoir
(Markovic and Krsmanovic, 2008)
age
1+
2+
3+
4+
5+
6+
7+
8+
9+
n
6
12
12
14
16
16
7
4
1
age years
Non-infested (n = 87)
range
s
x
89 116
131 162
160 235
207 255
237 303
275 330
285 380
362 413
430
101
146
203
234
267
306
341
393
430
s standard deviation
12.28
11.72
21.62
14.96
17.64
15.91
30.96
21.82
Infested by P.cuticola (n = 60)

range
s
t
x
n
2
7
9
7
20
9
5
1
91 103
118 157
147 205
210 251
237 280
265 280
315 362
375
t Students t-test
97
136
180
221
264
290
329
375
8.49
18.52
21.71
14.48
15.15
17.46
18.83
df degrees of freedom
0.55
1.41
2.50*
1.97
0.68
2.25*
0.82
df
6
17
19
19
34
23
10
3
* p < 0.05
Absolute length increment showed a growth tendency in both parts of the sample (non-infested and
infested by P.cuticola). Growth in non-infested chub populations was higher than that of infested
populations at all ages (years). Statistically significant differences in growth rate were observed in
individual fish 3+ and 5+ years of age.
The results confirm the negative effect of fluke infestation on the growth rate of the chub. These
findings, coupled with the qualitative and quantitative analysis of the ichthyofauna structure,
suggest deteriorating hydroecological conditions in the ecosystem analysed.
377
Acknowledgements
This study was financially supported by the Ministry of Education, Science and Technological
Development of the Republic of Serbia (Project No. 31011)
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Adrovi A., ujo D., Skenederovi I., Markovi G., Bajri A.: Distribution of Posthodiplostomum
cuticola (Digenea) metacercariae in cyprinids of the Modrac reservoir. V International Conference
Aquaculture & Fishery, June 1-3, Belgrade, Faculty of Agriculture, Belgrade-Zemun, Serbia, 2011,
319-324.
Caki P., Lenhardt M., Kolarevi J., Nedeva I., Radev V., Karaivanova E., Atanasov G.: The first data
on chub (Leuciscus cephalus L.) parasites in the Serbian part of the Danube River. 35. IAD Conference,
Novi Sad, Serbia, 2004a, 549-553.
Caki P., Djikanovi V., Kulii Z., Paunovi M., Jakovev Todorovi D., Miloevi S.: The fauna of
endoparasites in Acipenser ruthenus Linnaeus, 1758 from the Serbian part of the Danube river. Archives
of Biological Sciences, 60, 1, 103-107, 2004b.
irkovi M., Novakov N.: Parazitske bolesti ciprinidnih riba. Nauni institut za veterinarstvo, Novi Sad,
2013.
Djikanovic V., Paunovic M., Nikolic V., Simonovic P., Cakic P.: Parasitofauna of freshwater fishes in
the Serbian open waters: a checklist of parasites of freshwater fishes in Serbian open waters. Reviews in
Fish Biology and Fisheries, 22, 1, 297-324, 2012.
Lenhardt M., Markovic G., Gacic Z.: Decline in the Index of Biotic Integrity of the Fish Assemblage as
a Response to Reservoir Aging. Water Resources Management, 23, 1713-1723, 2009.
Markovi G., Veljovi P.: Biotic indices to be used for assessment of ichthyofauna structure of the
Zapadna Morava river (West Serbia, the Danube basin). Matica Srpska Proceedings for Natural
Sciences, 109, 29-37, 2005.
Markovic G., Krsmanovic M.: The Influence of Posthodiplostomum cuticola (Digenea, Trematodes)
Metacercariae Infestation on the Growth Rate of Leuciscus cephalus L. (Cyprinidae, PISCES). Acta
Agriculturae Serbica, 26, 73-76, 2008.
Markovi G., ikanovi V., Skori S., Luji J., Marinovi Z.: New members of the Zapadna
Morava river ichthyofauna (Serbia). Natura Montenegrina, 12, 2, 295-303, 2013.
Markovi M., irkovi M., Aleksi N., Miloevi N., Bjeli-abrilo O., Ljubojevi D., Aksentijevi K.,
Radojii M.: Posthodiplostomatosis in fish ponds. Acta Veterinaria (Beograd), 62,1, 101-109., 2012.
Ondrakov M., Jurajda P., Gelnar M.: The distribution of Posthodiplostomum cuticola metacercariae in
young-of-the-year cyprinid fish. Journal of Fish Biology, 60, 1355-1357, 2002.
Ondrackova M., Bartosova S., Valova Z., Jurajda P., Gelnar M.: Occurrence of black-spot disease
caused by metacercariae of Posthodiplostomum cuticola among juvenile fishes in water bodies in the
Morava River basin. Acta Parasitologica, 49, 3, 222-227, 2004.
Sinderman C.J.: Effects of parasites on fish population: practical consideration. International Journal
for Parasitology, 17, 371-381, 1987.
Simonovi P.: Ribe Srbije. NNK International, Bioloki fakultet, Beograd, 2006.
Williams H., Jones A.: Parasitic worms of fish. Taylor and Francais, London, 1994.
Wheeler A.: Key to Fishes of Northern Europa (Russ. translation). a ea ,
, 1983.
Zrni S., Orai D., Mihaljei ., aleta M., Zanella D., Jeli D., Jeli M.: First obseration of
Posthodiplostomum cuticola (Nordmann, 1832) metacercariae in cypriniformes from Croatia.
Helminthologia, 46, 2, 112-116
378
THE EFFECT OF OTC AND FLUMEQUINE ANTIBIOTIC IN FRESH FEED FOR THE
CONTROL OF ERYTHRODERMATITIS IN COMMON CARP (CYPRINUS CARPIO L.)
Milo Peli1*, Brankica Kartalovi1, Dragana Ljubojevi1, Nikolina Novakov2, Dalibor Todorovi1,
Biljana Boi1, Miroslav irkovi1
2. University of Novi Sad, Faculty of Agriculture, Novi Sad, Serbia
Abstract
Erythrodermatitis is a disease which affects carp of any age and it occurs during the growing
season. The clinical symptoms of this disease include the appearance of the wounds on skin surface
and muscle tissue and the depth of the wounds is a few millimetres. Aeromonas salmonicida is the
causative aetiological agent of this bacteriological disease. The environmental conditions and
imbalanced nutrition are the most common assumed predisposing factors which underlying the
occurrence of this disease. In our experiments, good results were obtained by the treatment of this
disease by combined usage of OTC and flumequine in fresh feed that was prepared from edible
offal (liver, spleen, and lungs), soy products and cereals. The healing of the wounds was observed at
the end of the first week of therapy, and during the second week we noticed only scar tissue on
places where the wounds previously had been observed. The disease was repaired in October, which
is very important because it could be inconvenient for fish to overwinter with changes characteristic
of erythrodermatitis.
Keywords: erythrodermatytis, Aeromonas salmonicida, OTC, flumequine, common carp
Introduction
Aquaculture in Republic of Serbia is based on the production of cyprinid fishes. First of all the
common carp (Cyprinus carpio) is cultured, but Chinese carps, European catfish, tench and zender
are also reared in large ponds in a semi-intensive culture systems (Ljubojevi et al., 2014). Carp
erythrodermatitis is a contagious bacterial disease of carp and other cyprinid fishes that can occur in
acute or chronic form. It is present on most of the fishponds in Europe, and also occurs in open
waters. Until recently the disease has made considerable damages to carp fish production. Today is
the most present in ponds where ichtiosanitary measures are not implemented and work with the
fish is inattentive. The causative agent of disease belongs to the group of atypical Aeromonas
salmonicida strains, achromogenic variant of A. salmonicida (Bootsma et al., 1977; Jeremi and
Radosavljevi., 2011). The disease was first diagnosed in the former Yugoslavia in 1977 (Bootsma
et al., 1977; Jeremi and Radosavljevi, 2011). The disease is transmitted by water in which
diseased fish are present. It was observed that the disease particularly occurs and spreads when an
irresponsible and harsh working with fish exist. A. salmonicida penetrate through the injured fish
skin and then comes to the appearance of the disease. The incubation period lasts 2-30 days.
Carp erythrodermatitis occurs most frequently in sub-acute and chronic form at temperatures from 4
to 30C (Pol et al., 1980) and represents skin disease. Red sores on the skin are characteristic
clinical signs of disease. Inflammation is expanding circularly, with the middle of circle where skin
decays. Necrotic tissue often become inhabit with secondary bacteria, what results in creation of
ulcers and wounds that affect the muscles. In the case of severe forms of infection, general hydrops
develops before mortalities. Chronic form of the disease is manifested by the presence of open sores
379
on the skin and ribs. The illness lasts for 1.5 to 2.5 months (Jeremi and Radosavljevi, 2011).
Besides of clinical signs, diagnosis of carp erythrodermatitis can be set by isolation of Aeromonas
salmonicida which do not produce pigment and causes the typical changes in biological assay on
carp. A. salmonicida is a microorganism widely distributed in nature: in water, in food and it is a
part of the normal bacterial flora of many animals. It is a facultative anaerobic, oxidase-positive
motile bacterium that lives in aquatic environments and in gastrointestinal tracts of healthy fish
(Rey et al., 2009). It causes diverse pathologic changes such as septicaemia, dermal ulceration, fin
haemorrhagic, rotting of the tails, red sores, exophthalmia, erythrodermatitis especially for common
carp (Jeremi et al., 2005).
As fish affected by erythrodermatitis do not stop taking feed, the disease is successfully treated with
antibiotics, chosen according to efficiency on the basis of susceptibility testing. Oxytetracycline
(OTC) and Flumequine mixed in fish feed is the most commonly used, but increasing antibiotic
resistance is observed and sensitivity should be tested. Tetracycline antibiotics are certainly on of
the most frequently used antibiotics in aquaculture (Dobkov et al., 2013). OTC represents a
broad-spectrum antibiotic produced by Streptomyces rimosus. According to Haug and Hals (2000)
OTC is widely used for the therapy of bacterial infections in fish. Furthermore, it is cost effective
and legally available. This antibiotic is the first choice for the antibiotic treatment of the most
bacterial fish diseases, such as flavobacteriosis, vibriosis, furunculosis and other (Yonar, 2012), and
also represents the first choice for the treatment of erythrodermatitis in carp (Jeney and Jeney,
1995).
The aim of the present study was to evaluate the effect of one week long treatment of
erythrodermatitis in carp with antibiotic OTC and flumequine administered in combination in fish
feed on the healing of the wounds in one- to two-year-old common carp (Cyprinus carpio L.).

The treatment was performed within the meat industry Agropapuk in Kukujevci. The land where
pond was built was used as a village landfill. Construction of the fish pond started by removing a
soil layer with a thickness of 1 m. 12000 m3 of excavated land was transported and disposed of,
12000 m3 was dug up and used, and 6000 m3 was brought from the site outside of the landfill.
Production took place in an area under the water of 3.5 ha. Before starting the fish production,
agricultural limestone was applied to the bottom of empty pond in an amount of 2000 kg/ha. Filling
of the fish pond with water was completed from two wells with a depth range of 75 to 95 meters,
using a pumps capacity of 1000 l/min for each well. Aeration was conducted using aerators (mud
pumps) with a capacity of 2000 l/min spraying the water 5m above the surface. The flow of the
water was 10 sec L/ha. Production of carp was carried out during 2014 growing season and 2100 kg
of one-and two-year old common carp were stocked in the fish pond (Table 1).
The average weight of a one year old carp was 60 g and two-year old carp was 600 g. During the
production, commercial extruded fish feed, with 32% of proteins and 10% of fat, were given to fish.
Besides that, feed in form of dough prepared as mixture of by-products obtained in a slaughterhouse
with the addition of cereals was added (Figure 2). Fresh porcine and bovine spleen, lung, liver and
stomach were obtained from the slaughterhouse Agropapuk, Kukujevci, Republic of Serbia.
Feeding was carried out twice a day in 8 am, and the 3 pm.
During the production season continuous monitoring of the health status and condition of the carp
was done. During the monitoring of health status of fish erythrodermatitis was diagnosed.
Combined usage of tetracycline antibiotic OTC and flumequine in recommended doses of 0.5 kg/t
of feed in form of dough prepared as mixture of by-products obtained in a slaughterhouse with the
addition of cereals was performed.
380
Figure 2. Feed in form of dough prepared as mixture of by-products obtained in a slaughterhouse

with the addition of cereals
Results
The disease appeared from the middle of August with prevalence of 25%. The clinical symptoms of
this disease include the appearance of the wounds on skin surface and muscle tissue and the depth
of the wounds is a few millimetres (Figure 1). The large ulcers on the skin surrounded by a red
border make the fish unsuitable for the market. After treatment with OTC and flumequin in fish
feed, the symptoms of disease disappeared (Figure 3). The healing of the wounds was observed at
the end of the first week of therapy, and during the next week only scar tissue on places where the
wounds previously had been observed. The disease was repaired in October, which is very
important because it could be inconvenient for fish to overwinter with changes characteristic of
erythrodermatitis.
Figure 1. The clinical symptoms of erythrodermatitis

It should be noted that at the end of the growing season, the average weight of the two-year old carp
was 900 g, respectively 3.8 kg for a three-year old carp. Harvesting weight was 7500 kg. FCR was
0.9 for commercial feed and 0.8 for additional dough feed prepared as mixture of by-products
381
obtained in a slaughterhouse with the addition of cereals (Table 1). Mortality ranged 5% in two-year
old carps, and 10% in one-year old carps.
Figure 3. The healing of the wounds at the end of the first week of therapy
Table 1. Production parameters of common carp

Total stocking density
600 kg/ha
Stocking density of one year carp
200 kg/ha
Stocking density of two-year carp
400 kg/ha
Harvesting density
2150 kg/ha
FCR for commercial feed
0.9
FCR for dough
0.8

Of the diseases caused by bacterial pathogens erythrodermatitis (ulcer disease) of the common carp
is the most important and most frequent on the fishponds in Republic of Serbia (Jeremi et al.,
2005). It is caused by Aeromonas subsp. achromogenes. Although the agent is closely related to A.
salmonicida subsp. salmonicida, no general symptoms occur, and after treatment with antibiotics
the chances of recovery are good (Molnr and Csaba, 2005). Prevention against erythrodermatitis is
built in the pond technology, and feeding antibiotics (OTC, neomycin, flumequine) successfully
controls damage done by the disease. For preventive and curative purposes, OTC and flumequine
fed to the fish have been used in Hungary (Molnar et al., 2005) ever since against ulcer skin disease
of the common carp, ascites caused by facultative pathogenic Aeromonas salmonicida, Aeromonas
hydrophila and diseases caused by Flavobacterium strains. As noted by (Dobkov et al., 2013)
OTC have various effects on the fish immune system, depending on the species and size of fish,
water temperature and the method of drug administration. Negative effects, such as the presence of
antibiotic residues in fish, water, and fishpond sediments, growth retardation, the immunesuppression have been observed (Inglis et al., 1996). Despite the mentioned negative effects, OTC
remains one of the most frequently used antibiotics in aquaculture (Tafalla et al., 1999). In the study
382
conducted by Dobkov et al. (2013), no effect of the long-term dietary administration of OTC on
any biometrical parameter (total length, standard length, body weight, hepatosomatic and spleen
somatic index, and condition factor) was found in experimental fish. Also, in the above mentioned
study, no direct effect of OTC which was assumed to be an immunosuppressive substance, on the
spleen somatic index was found, while a significant increase in haemoglobin concentration was
found in the experimental groups fed with a feed containing OTC. In the study by Svobodov et al.
(2006), a decrease in haematocrit was found in experimental carp administered with OTC and
significant increase in haemoglobin concentration was also found in two- to three-year-old carp. It
is well known that leukocytes are involved in the regulation of immunological function and the
protective response to stress in fish. An increase in leukocyte count can result from immune
response to bacteria, while a decrease in leukocyte count can be detected through the altered release
of lymphocytes from lymphoid tissues (Das et al., 2009). Immunosuppressive effects of OTC, as
significant decreases in leukocyte and lymphocyte counts, were found in the study by Svobodov et
al. (2006) on common carp. OTC administration led to an increase in the plasma concentrations of
total proteins in at the end of the test conducted by Dobkov et al., 2013.
Continuous monitoring of the fishs health status and implementation of adequate therapeutic
measures are very important in intensive production, especially in the ponds where a high level of
organic matter is expected. The improvement of hygiene and the use of strict fishpond technology
are the most important for preventing all fish diseases and avoiding heavy losses on fishponds. The
veterinary service responsible for fish diseases exists for long time in Republic of Serbia and
veterinary institutes have specialists for diagnosing viral, bacterial and parasitic diseases.
Acknowledgments
This research was funded within the project, TR 31011 by the Ministry of Education, Science and
Technological Development, Republic of Serbia.
References
1. Bootsma R., Fijan N., J. Blommaert J.: Isolation and preliminary identification of the causative agent
of carp erythrodermatitis. Veterinarski Arhiv, 47(6):291-302, 1977
2. Das B.K., Debnath C., Patnaik P., Swain D.K., Kumar K., Misrhra B.K.: Effect of -glucan on
immunity and survival of early stage of Anabas testudineus (Bloch). Fish and Shellfish Immunology,
27(6), 678-683, 2009
3. Dobkov R., Blahov J., Mikulkov I., Modr H., Prkov E., Svobodov Z., SiwickiA. K.: The
effect of oyster mushroom -1.3/1.6-D-glucan and oxytetracycline antibiotic on biometrical,
haematological, biochemical, and immunological indices, and histopathological changes in common
carp (Cyprinus carpio L.). Fish and Shellfish Immunology, 35(6), 1813-1823, 2013
4. Haug T., Hals P.A.: Pharmacokinetics of oxytetracyline in Arctic charr (Salvelinus alpinus L.) in
freshwater at low temperature. Aquaculture, 186, 175-191, 2000
5. Inglis V., Robertson D., Miller K., Thompson K.D., Richards R.H. Antibiotic protection against
recrudescence of latent Aeromonas salmonicida during furunculosis vaccination. Journal of Fish
Diseases, 19, 341-348, 1996
6. Jeremi S., Radosavljevi V., Jaki-Dimi D.: Aktuelna bakterijska oboljenja slatkovodnih riba:
Biotechnology in Animal Husbandry, 21(3-4), 141-151, 2005
7. Jeremi S., Radosavljevi V.: Presense of bacterial diseases of fish in the Serbia during the period
2005-2010. Conference proceeding of V International conference Aquaculture & Fishery June 1-3,
2011, Belgrade, Serbia, organized by Faculty of Agriculture, University of Belgrade, 2011, 152-158
8. Jeney Z., Jeney G.: Recent achievements in studies on diseases of common carp (Cyprinus carpio
L.). Aquaculture, 129, 397-420, 1995
383

9. Ljubojevi D., irkovi M., Novakov N., Puvaa N., Aleksi N., Luji J., Jovanovi R.: Comparison
of meat quality of tench, Tinca tinca, reared in extensive and semiintensive culture systems. Journal
of Applied Ichthyology, 30, 50-57, 2014
10. Molnr K., Csaba G.: Sanitary management in Hungarian aquaculture. Veterinary Research
Communications, 29, 143-146, 2005
11. Pol J.M.A., Bootsma R., Berg-Blommaert J.M.: Pathogenesis of carp erythrodermatitis (CE): role of
bacterial endo- and exotoxin. pp. 120 - 125. Ahne, ed. Fish diseases. Third COPRAQ-Session.
Springer-Verlag, Berlin, Heidelberg, New York, 1980
12. Rey G, Fouillet A, Bessemoulin P, Frayssinet P, Dufour A.: Heat Exposure and Socio-Economic
Vulnerability as Synergistic Factors in Heat- Wave-Related Mortality. European Journal of
Epidemiology, 24: 495- 502, 2009
13. Svobodov Z., Sudova E., Nepejchalova L., ervinka S., Vykusov B., Modra, H., Kolov J.:
Effects of oxytetracycline containing feed on pond ecosystem and health of carp (Cyprinus carpio
L.). Acta Veterinaria Brno, 75(4), 571-577, 2006
14. Tafalla C., Novoa B., Alvarez J.M., Figueras A.: In vivo and in vitro effect of oxytetracycline
treatment on the immune response of turbot, Scophthalmus maximus (L.). Journal of Fish Diseases,
22(4), 271-276, 1999
15. Yonar M.E.: The effect of lycopene on oxytetracycline-induced oxidative stress and
immunosuppression in rainbow trout (Oncorhynchus mykiss, W.). Fish and Shellfish Immunology,
32(6), 994-1001, 2012
384
MALIGNANT ANAEMIA OF THE CARPS

Biljana Boi1, Nikolina Novakov2, Milo Peli1, Dalibor Todorovi1, Miroslav irkovi1
2. University of Novi Sad, Faculty of Agriculture, Novi Sad, Serbia
Abstract
Malignant anaemia is disease of the carp fingerlings manifested by anaemia, decreased number of
erythrocyte and low level of haemoglobin. Disease is caused by myxosporidia - Myxobolus cyprini.
During wintertime, we examined one-year-old carp fingerlings on five fish ponds, where on two of
them we determined disease (occurrence of clinical symptoms, low number of erythoricyte, low
level of haemoglobin, weakening of the condition). At one pond we had mortality of 60 %, which
we believe to be a consequence of the disease. Carp fingerlings were placed in ponds where
consume fish overwinter, which is one of the main causes for the occurrence of diseases.
Keywords: malignant anemia, carp fingerlings, Myxobolus cyprini
Introduction
Malignant anemia is disease cused by parasite Myxobolus cyprini which is one of the first
discovered protozoans of common carps. The history of this widely distributed species has been full
of controversial issue. After the first description of myxobolus, numerous authors reported on its
presence in carp fish ponds, considering that this parasite can develop in various organs. Plehn
(1924), Shulman (1966) and (Bauer et all. 1981a) found spores in diffusely located plasmodiums in
various tissues, while Kocylowski et Myastynski (1963) and Schaperclaus (1954) detected large
cysts in different locations, including the muscles. Spiczakow (1935) supposed that the massive
invasion of carp by Myxobolus cyprinid results in malignant anaemia, which was accepted by
Shulman (1966) and Bauer et al., (1981a). Due to these claims, the name of disease has been
accepted in former Yugoslavia.
This parasite also can infect Leuciscuc cephalus, Rutilus rutilus and many other cyprinid hosts.
Parasite M. cyprini produces spores in various organs in small plasmodia and possible in cysts. The
present observations of naturally infected common carp fry and two year old carp reveal that M.
cyprini is specific muscle parasite, developing intracellularly in the muscle fibres of the skeletal
muscle (Molnar et al.,2002). The sarcoplasm of the infected muscle fibres is filled with
developmental stages, which are held together in a 11.5 mm long pseudocyst. After maturation of
the spores and disintegration of the pseudocysts, the spores are transported in the bloodstream to
different parts of the body where they are retained in the capillaries (Molnar and Kovcs-Gayer,
1985), free or engulfed in macrophages (Dykova and Lom, 1988). Mature spores typically
accumulate in the kidney, spleen and liver melanomacrophages where they are gradually destroyed.
The data suggest that due to an early date of infection M. Cyprini is the only species from genus
Myxobolus which is closely associated with macrophage aggregation (Holze and Schachner, 2001).
Spores vary greatly in shape, and their dimensions are 7.6-9.7 10-13.5 m (Lom J. and Dykov,
2006), length 12-12.5 m, width 8.5-9 m, the lenght of the spore with mucus envelope is 14 m
(irkovi 1986).
385
They are characterized by slightly to strikingly unequal, elongate pyriform polar capsule, in which
the polar filament is coiled in loose turns situated very obliquely, sometimes almost parallel to the
longitudinal axis of the polar capsule. The posterior end of the spore is in most populations covered
by a mucous layer (Dykova and Lom, 1988).
There is a great variability in the shape of spores between different M. cyprini populations from
carp; the extremes of the variation range could be mistaken for different species. Morphologically
identical spores can be found in plasmodia developed in muscles of many other cyprinid fish
(Leuciscus cephalus, Rutilus rutilus, Barbus barbus) (Dykova and Lom, 1988).
The throphozoites develop in the axial parts of the muscle fibres where they gradually replace the
sarcoplasm. In late stages of parasite growth, when it is covered by nothing more than the
sarcolema, the muscle fibres may be split longitudinally into several muscle bundles (Molnar and
Szekely, 2014). After the disruption of muscle cells the spores of M. cyprini become scattered all
over the body and are often excreted through the gut. At such times large masses of spores can be
detected from the intestinal mucus, embedded in so-called yellow bodies (Molnar, 2002).
The tissue reaction sets in only after the infected segment of the muscle fiber has fallen apart and
the mature spores were released into the endomysium. The ensuing inflammatory reaction in the
musculature is characterized by presence of large number of histiocytes and fibroblasts. There
appeared even signs of myophagy. Inflammation resulting from infection with M. cyprini most
frequently is of proliferative type. It is the main defence mechanism and develops usually when
plasmodia contain mature spores. In the reparation of lesions left after the destruction of large
plasmodia or massive necrosis granular tissue is involved. The incapsulation of plasmodia or
aggregation of spores is also the result of proliferative inflammation (Dycova 1984).
Clinical symptoms are characterized by swelling of the abdomen due to ascites, exophthalmia,
significant cachexia (irkovi and Novakov 2013).
The life cycle is thought to be direct and infection is by ingestion of one of the myriadspores
produced by rupture of a lesion on an infected fish. The static ponds with heavy mud sediment are
an ideal environment for this parasite which tends to build up over a long period of time. It is
essential to remove carcasses of dead fish to keep down the incidence of Myxosporida but there is
no satisfactory drug treatment.
Myxobolus cyprini spores are present in one-year old carps in the majority of fish ponds in
Vojvodina. They are most often found in late autumn, in winter and early spring (irkovi and
Novakov, 2013). The aim of our study was examination of the presence of M. cyprini in fish ponds
in Vojvodina province.

During our study in spring and the autumn (2014), 152 common carp were examined. The samples
of fish which were used as material for this study have been collected from nine fish ponds in the
area of Vojvodina province, Republic of Serbia. A total of 152 two-year-old common carp and carp
fingerlings were examined.
Fresh tissue mounts of liver, spleen, guts and kidneys were examined as native histological
preparation. All samples were clinically examined in detail, where upon spores of M.cyprini was
confirmed in histological section of native preparations.
The shape and measurements of the spores in every fish agreed with the original descriptions and
we used the most widely accepted terminology and systematics. Based on original descriptions and
typical host, spores from the common carp were tentatively identified as M. cyprini.
386
Haematological parameters were done using routine haematological methods which are in common
use for diagnostic in human medicine. Tests used for the presence of anaemia included
haemoglobin estimation and erythrocyte counts (using haemocytometer).
Results
Malignant anaemia of the carps which is caused by parasite M. cyprini was found in all nine fish
ponds in Vojvodina province. Sixty - four out of the one thousand and fifty - two common carp
examined from fish ponds in Vojvodina proved to be infected. In cases of disease the young carps
were very cachectic, with sunken eyes; they gathered at the entrance of the fresh water or burrowed
into the mud and died.
In all carps, independent of size and origin, Myxobolus cyprini occurred predominantly in the
macrophage centres (MCs) of the haematopoietic organs, spleen and guts. In histological sections,
the spores of M. cyprini were found in the lamina propria of the gut, in spherical, relatively small
plasmodia 0.3-1.5 mm in diameter. The plasmodia were usually located at the tip of the mucosal
folds of the intestine, closely adhering to the basement membrane of the epithelium. The samples
contained different numbers of spores. Spores found in common carp were about the same size (10
13 m) and showed a very similar morphology. Spores were ellipsoidal in frontal view and lemon
shaped in lateral view. Spore valves were relatively thick, symmetrical and smooth. Sutural line
distinct, sutural edge protruding, forming a longer process in the posterior and a shorter protrusion
on the anterior end in lateral view. Deformed spores were found in encysted plasmodia and in
spores engulfed by macrophages in different organs. In some cases, free spores from disrupted
plasmodia were detected in the extracellular space between muscle cells. Some spores were found
in blood vessels, caused occlusion of capillaries and local necrosis. Congestion of skin capillaries
caused skin haemorrhages. Histopathological examination also showed that numerous phagocytosed
spores caused local occlusion and destruction of capillaries and exfoliation of gill epithelium,
suggesting blood loss from the damaged blood vessels.
Haematological parameters in diseased fish were 3-4 times lower than in healthy fish, and the
results of haematological parameters are shown in table 1. During a high level period of spore
discharge, haematological indices (haemoglobin and erythrocyte count) in diseased fish
significantly decreased, and the percentage of immature erythrocytes increased.
Table 1. Haematologycal parameters of common carp
Number of erytrocite
Amount of haemoglobyn
Number of fish
pond
Healty x
Unhealthy x
Healty x
Unhealthy x
1.
2.
3.
4.
5.
6.
7.
8.
9.
1.75
1.65
1,60
1,95
1,80
2,00
1,90
1,80
1,80
0.80
0,95
0,90
0,80
0,70
0,75
0,90
0,60
0,90
9,5
9,5
8,5
10,0
10,5
10,0
10,5
11,0
12,5
4,5
5,0
4,0
3,5
4,0
4,5
4,5
3,0
5,0
387

According to the results of our study, M.cyprini is still one of the major detected problems at
Vojvodinas fish ponds. The disease is very severe when young fish is kept with older, or in ponds
where consume fish overwinter. Spores among older diseased fish are very infected for carp
fingerlings.
irkovi et all (1986) confirmed that spores of M. ciprini are most often found in late autumn, in
winter and early spring in almost all organs and tissues. The loses in severe cases were reached
95%. Molnar and Kovach-Gajer (1985) examined in Hungary severe infections with M.cyprini in
carp fry (prevalence up to 57%), and two- summer stocks (prevalence up to 95%).
More than 500 Myxobolus species are known at present. (Molnar, 2000) suggests that the
description and identification of Myxobolus species should not be based exclusively on spore
morphology. Up to this time, identification of myxosporeans has been based on morphological
variations in the spores. However, molecular biological methods, such as DNA techniques
including PCR might serve as an excellent tool for differentiation of morphologically similar
species and they offer great scope for the correct identification of species.
There is no specific therapy of malignant anaemia, but it was noticed that drying out fish ponds in
winter, mechanical treatment of the soil, disinfection with calcium oxide, hydroxide or hypochlorite
are beneficial. It is also very important to control health status of carp fingerlings during spring and
autumn.
Acknowledgments
This paper is a result of the research within the project TR 31011 The influence of the quality of
the food components for cyprinid fish species on the quality of meat, losses and the profitability of
production, financed by the Ministry of Science and Technological Development, Republic of
Serbia
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Bauer O.N., Egusa S., Hoffman G: Parasitic infections of economic importance in fishes. Polish
Acadmy of Science 1981.
irkovi M.: Myxosporidiosis of the common carp fingerlings. Doctoral thesis, Veterinary faculty,
Beograd, 1986.
irkovi M., Novakov N.: Parasitic diseases of cyprinid fishes, Scientific Veterinary Institute Novi Sad,
2013.
Dykova I.: The role of melanomacrofage cenres in the tissue reaction to myxosporean infections of
fishes. Bull. Eur. Ass. Fish. Pathol., 4: 65-67 1984.
Dykova I., Lom J.: Review of pathogenic myxosporeans in intensive culture of carp (Cyprinus carpio)
in Europe. Folia Parasitol. 36: 289307, 1988.
Holzer A.S., Schachner O.: Myxosporidia and macrophage centres in chub (Leuciscus cephalus)
quantitative interactions focus on Myxobolus cyprini, Parasitology ,Vol 122, pp 55-62 , 2001.
Kocylowski B., Myaczynski T.: Fish Disease, Budapest: Publishing House Mezogazdasagi 1963.
Lom J., Dykov I.: Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and
pathogenic species, Folia Parasitologica 53: 136, 2006.
Molnar K.: Redescription and Histopathology of Myxobolus cyprinicola Reuss, 1906, an Intestinal
Parasite of the Common Carp (Cyprinus carpio L.), Acta Protozool. 41: 279 283, 2002.
388

10. Molnar K.: Myxobolus intrachondrealis sp. n. (Myxosporea: Myxobolidae), a parasite of the gill
cartilage of the common carp, Cyprinus carpio, Folia Parasitologica 47: 167-171, 2000.
11. Molnar K., Eszterbauer E.,Szekely C.,Dan A.,Harrach B.: Morphological and molecular biological
studies on intramuscular Myxobolus spp. Of cyprinid fish, Journal of Fish Disease, 25, 643-652, 2002.
12. Molnar K., Kovcs-Gayer E.: The pathogenicity and development within the host fish of Myxobolus
cyprini Doflein, 1898. Parasitology, 90, pp 549-555, 1985.
13. Molnr K., Szkely C.: Tissue preference of some myxobolids (Myxozoa: Myxosporea) from the
musculature of European freshwater fishes, Dis Aquat Org, Vol. 107: 191198, 2014.
14. Plehn M.: Praktikum der Fischkrankheiten. In Handbuch der Binnensischerei Mittteleuropas. Pp. 301407, Stuugard: Publishing House Academie 1924.
15. Schaperclaus W.: Fishkrankheiten. Berlin, Akademia Verlag 1954.
16. Shulman S.: Myxosporidia of fish fauna of the USSR. Publ. House Nauka, Leningrad p 508, 1966.
17. Spiczakov T.: On some common sporozoan disease of the carp, Memories de I'Institut d'Ichyobiologie
et Pisciculture de I'Universite Jagellonienne a Crocovie, 25, 1-39. 1935.
389
________________________________________________________________________
Session 6
EMERGING AND RE-EMERGING ZOONOSES

Full papers
_______________________________________________________________________
390
Invited lecture
IMPORTANT ZOONOTIC VIRAL DISEASES OF WILDLIFE AND THEIR IMPACT ON
HUMAN HEALTH
Diana Lupulovic*1, Gospava Lazic1, Jasna Prodanov-Radulovic1, Tamas Petrovic1
1

Abstract:
Zoonoses are infectious diseases which can be transmitted from animals to humans and, in rare
cases vice versa, from humans to animals. It is estimated that the majority of causative agents are
viruses and approximately 75% of all known zoonoses involve wild animals. Wildlife is important
for epidemiology of most zoonoses as reservoir for the maintenance and spreading of infection.
Many mammalian species, such as wild boar, roe deer, wild carnivores, wild rodents, bats and also
fish or reptiles are recognised as wildlife reservoirs. Wild birds are equally very important, as they
have a significant role in disseminating of various pathogens over long distances.
This paper presents the overview of some literature data and results of testing conducted in Serbia
of several important emerging viral zoonoses that occurred in wildlife: West Nile disease, Usutu
virus, hepatitis E virus, avian and swine influenza and rabies. In addition, the results of zoonotic
disease investigation in humans in Serbia and their impact on human health are also provided.
Introduction of new pathogens, especially into the industrialized countries, increased the global
threat to public health and intensified the efforts to establish control for prevention emerging
zoonoses.
Keywords: zoonoses, viral diseases, wildlife
Introduction:
Many well-known human viruses have been recognised for a long time ago and persist in human
population in balance with their host. Most of these viruses almost never or very rarely cause largescale health problems. But, when pathogens cross the species barriers, the consequences can be
disastrous with a high morbidity and mortality rate (Haagmans et al., 2009).
Wildlife represents free-roaming animals, such as: mammals, birds, fish, reptiles and amphibians.
Throughout the history wild carnivores, roe deer, wild boars, wild rodents or birds had an
important role in the chain of pathogen spreading, whether they serve as a reservoir for many viral
agents or are involved in viral dissemination over long distances (Daszak et al., 2001).
Definition of zoonoses
Zoonoses are defined as infectious diseases that can be transmitted from animals to humans, or vice
versa, from humans to animals (Messenger et al., 2014; Venkatesan et al., 2010). The total number
of zoonoses is unknown, but according to Taylor et al. (2001), 1415 infectious agents are
pathogenic for humans. It is estimated that about 61% of these pathogens are zoonotic, and
approximately 75% originate in wildlife (Jones et al., 2008). The WHO/FAO/OIE joint consultation
on emerging zoonotic diseases held in Geneva in 2004 defined emerging and re-emerging zonoses.
Emerging zoonoses are infections that are recognised in humans for the first time, while reemerging zoonoses are described as diseases that have already infected humans previously, but
appear in new locations, show an increase in incidence or expand geographic, host or vector range
391
(WHO, 2004). Many emerging zoonoses represent a threat to human health and have large
economic impacts.
There are rare reports on the transmission of viruses from humans to animals, named: reverse
zoonoses. We will mention just a few: Rotavirus, Human Adenovirus A-F, Hepatitis E, Influenza
A (H1N1), etc. (Messenger et al., 2014).
History of zoonoses
The history of zoonotic diseases is long for centuries. The most fatal of all so far was Black Death
pandemia (bubonic plague) in the 14th century, which caused 25-40 million deaths. The first known
report on rabies dated from 2300 years BC in Mesopotamia, in hunting dogs (Kruse et al., 2004).
Some modern hypotheses suggest that even Aleksandar the Great died with the symptoms of
encephalitis in Babylon in 323 BC, probably infected with West Nile virus acquired from the dead
ravens. The 1918 influenza pandemia, known as Spanish flu, has taken about 50 million lives. In
the modern history the deadliest is the HIV/AIDS pandemia, which was reported in early 80 and
caused 35 million deaths so far (Morens and Fauci, 2013). In 2014, Ebola caused 11007 deaths in
Sierra Leone, Liberia and Guinea, according to CDC (2015) report, and was the largest Ebola
outbreak known so far.
Transmission modes
The wildlife is considered to be the main reservoir of emerging infections and zoonotic agents can
be transferred in many ways from animals to humans. Some viruses can be transmitted directly, by
bite (rabies). Rodents constitute reservoir for Hantaviruses, which are transferred to humans by
aerosol and excretes in direct contact (Kruse et al., 2004). In 2003, in the USA occurred epidemia of
monkeypox with 37 confirmed human cases. It is considered that probably African squirrel is the
natural host of the disease. Laboratory infections as a consequence of handling with infected
material from animal tissue have also been recorded (Venkatesan et al., 2010).
The majority of viruses is transmitted indirectly and for their transmission is necessary the presence
of different kind of vectors (vector-borne diseases). Arthropod-borne viruses or arboviruses involve
blood-sucking arthropods. The virus is replicating in the insect and transferred to the animal by bite.
Another insect suck the blood of a viremic animal or human and cycles of replication is repeating.
In the nature are recognized different insect vectors which are responsible for spreading of many
viral zoonotic diseases: mosquitoes (West Nile disease, Rift Valley fever, Equine encephalitis,
Dengue fever, Yellow fever, Chikungunya virus), ticks (Tick-borne encephalitis -Eastern and
Western, and Cremen-Congo hemorrhagic fever), sand flies (Vesicular stomatitis) and midges (Blue
tongue disease) (Venkatesan et al., 2010).
In the last few years, viral zoonoses with bat origin attract the attention of scientific society. Bats
counts over 1200 species and are spread in almost every part of the world. They live in the large
colonies and can disseminate viruses over the long distances. The most significant are: Hendra and
Nipha virus and Coronaviruses (SARS and MERS). Recent data revealed that fruit bats are also
reservoir for Ebola and Marburg viruses in Africa (Wang and Crameri, 2014).
Wild birds are important for public health and have a major role in spreading of many viruses
(Haagmans et al., 2009). Wild ducks played a role in the emergency of highly pathogen H1N1
influenza A virus in 2004 in Asia, which causes 28 deaths. The virus is maintained in nature
between the waterfowls and domestic poultry, which can result in reassortment of viruses with the
new antigenic characteristics for which humans are immunologically naive (Kruse et al., 2004).
Some viruses showed a remarkable ability that after replication in their animal host transfer to
human, and with correct circumstances can result in human-to-human transmission. This scenario is
typical for Ebola fever, influenza A and SARS (Cutler et al., 2010).
392
Factors influencing the emergency of zoonotic diseases

The frequency of many zoonotic diseases outbreak is on rise (Wang and Crameri, 2014). There are
recognized many factors that can influence the emergency of different viruses (Graph 1). Climate
and environmental changes and global worming lead to the expansion of vector distribution.
Vectors are moved from their limited geographical area, expended the habitat and introduced the
zoonotic agents into naive animal and human population. Epidemiologist suspect that appropriate
weather with lots of rain and increased mosquito population are the main reasons for emergency of
West Nile virus. Agricultural development, modernisation of agricultural practise and deforestation
pushed together wildlife and livestock and overlapped their natural surroundings. Zoonotic diseases
are lately closely linked to hunting and consuming meat from wild animals, especially non-human
primates. Bush meat is considered delicacy and exportation and trading increased the risk of
cross-species transmission. For example, Ebola and Marburg virus are among the most deadly
viruses for human kind and is believed that these emergent zoonoses are transferred through bush
meat activities (Wang and Crameri, 2014). Microbial changes are responsible for the occurrence of
potentially new emerging pathogens. These changes include mutations (genetic drift) or genetic
recombination (genetic shift). Typical example is influenza A virus. Natural infection with
influenza A is reported in many animal species (birds, pigs, horses, sea mammals) and humans. So
far, four major antigenic shifts resulted with influenza pandemics causing many human fatalities
(Haagmans et al., 2009). Movement of the people, livestock and food provides rapid spread of
pathogens and appearance of the viruses in new locations and continents. In this way rabies is
established in red foxes and spread from Russia to the rest of Europe in early 1940` (Cutler et al.,
2010). The role of companion animals and exotic pets is also important in dissemination of some
virus infections; such as rabies, Chlamydia psittaci, etc.
Graph 1: Factors influencing new and re-emerging zoonoses (source: Cutler et al., 2010)
Manifestations of Viral Zoonoses

The majority of viral zoonoses can be classified according to predominant clinical signs into: 1)
diseases causing no illness, 2) non-specific viral syndrome and 3) severe illness. The third group is
further classified into: 1) hemorrhagic fever, 2) encephalitis and /or rash arthralgia, 3) emerging and
re-emerging and 4) rare zoonotic infections.
393
Most of zoonotic diseases that cause encephalitis are transmitted trough mosquito or tick bites
(West Nile virus, Tick-borne encephalitis, Kunjin virus) or through a bite of infected host (rabies).
Viruses that belong to the group of diseases with clinical signs of hemorrhagic fever causing
internal bleeding from various openings of the body and internal organs (Ebola, Marburg,
Dengue fever, Cremen-Congo hemorrhagic fever, Yellow fever). Rashes and arthralgia are typical
clinical signs for some viruses from Togaviridae family and most of them are transmitted through
mosquito bites (Chikingunya virus). Emerging and re-emerging diseases appear suddenly, with a
wide range of symptoms: flu-like signs and respiratory infections (influenza A, SARS),
hemorrhagic fevers (Ebola, Marburg), hepatitis (Hepatitis E), fever and abdominal pain (Hanta),
fever and encephalitis (Handra and Nipah) etc. Several viral infections cause nonspecific illness
with febrile conditions and occur rare. In these cases humans can acquire the disease mostly by
contact with infected animals (FMD, Newcastle disease, Bluetongue) (Venkatesan et al., 2010).
Selected Viral Zoonoses with a Wildlife Origin in Serbia

Rabies
Rabies is one of the oldest known zoonoses, but still neglected in some parts of the world. Rabies is
neurotropic disease with the clinical signs of encephalomyelitis and with almost 100% mortality
rate. The disease takes every year, according to WHO (2013), more than 60 000 human lives,
mostly in developing countries of Asia and Africa. The victims are usually children younger than 15
years. Many European countries obtained rabies-free status, but for these countries the main threat
represents importation of rabid animals, mainly through the trading activities of pets or livestock. In
infected countries, where Serbia belongs, rabies is maintained in the foxes and other wildlife (Fooks
et al., 2014).
The causative agent of rabies is negative-strained RNA virus that belongs to the genus Lyssavirus,
family Rhabdoviridae. Rabies is transmitted through the bite of infected animals, but there are also
reports of other ways of transmission, through the transplantation of cornea and solid organs (Maier
et al., 2010).
After the World War II, rabies existed in former Yugoslavia in both urban and sylvatic form.
Extensive veterinary measures and massive vaccination of cats and dogs, eradicated urban rabies
and consequently, human exposure. In 1977, rabies entered Serbia from the north, during the large
enzootic emergency in red foxes in Europe and established in wildlife (Petrovi, 1987).
The first trial of the oral vaccination of foxes (ORV) was carried out in Switzerland in 1978. After
that, many European countries followed this example and implemented ORV of foxes. In 2010,
Veterinary Directorate started multi-annual program of oral vaccination of foxes in Serbia,
supported by European Commission and funded by IPA projects (Instrument for Pre-Accession
assistance). Monitoring of the effectiveness of oral vaccination campaigns has been conducted from
2011 and is based on: a) post mortem laboratory examination of brain tissue of target animals
(foxes, jackals and other carnivores) by fluorescent antibody test (FAT), b) detection of antibodies
against rabies virus in serum samples by ELISA and c) detection of tetracycline biomarker in the
mandibles for the evaluation of vaccine bait uptake. From September 2011 to May 2014, the total
number of 4943 brain tissue samples, 4241 sera and 4971 mandibles were analyzed. Confirmed
rabies-positive brains decreased from 10 in 2011/2012 to 6 in 2012/2013 and finally to 1 positive
case in 2013/2014. The seroconversion rate increased from 10.48% in 2011/2012 to 20.11% in
2012/2013 and 42.23% in 2013/2014. Along with the seroconversion, the number of detected
tetracycline positive mandibles raised from: 49.67% in 2011/2012 to 62.60% in 2012/2013 and
eventually to 90.33% in 2013/2014 (Lupulovi et al., 2015).
394
In Graph 2 is presented rabies situation in Serbia from 2006 to 2014. The highest prevalence of
rabies was recorded in the population of foxes and just sporadically in other wildlife or in domestic
animals. Foxes made 84.66% (795/939) of all positive samples. From 20110, when started the first
campaign of vaccine distribution, the number of confirmed positive rabies cases constantly
decreased confirming that ORV of foxes and other wildlife in Serbia was successful.
Graph 2: Prevalence of rabies in different animal species between 2006 and 2014 (Lupulovic et al., 2015)
West Nile Fever

West Nile virus (WNV) is a mosquito-borne arbovirus that belongs to the genus Flavivirus. In
nature, WNV is maintained in the cycle between mosquitoes and birds. Humans and horses can be
infected, but they do not spread the disease (so called dead-end hosts). Approximately, 80% of
infections are subclinical and less than 1% of people can develop clinical signs of the disease. The
disease in horses is also unapparent, but about 10 % of animals got ill and 50% of them die with the
signs of neurological disorder (Martin-Acebes and Saiz, 2012).
The first isolation of WNV was in Uganda in 1937. The disease has been occurred sporadically in
Africa, Asia and Middle East, but the situation dramatically changed when WNV infection outbreak
was reported in 1999 in New York, with over 1100 human fatalities. Since then, the virus spread
and new human cases were reported in the USA, Canada and Mexico. In Europe, the
epidemiological situation changed in 1990, when several countries of Mediterranean basin,
Romania and Russia have faced with humans and horse deaths (Calistri et al., 2010).
In 2012, Greece reported re-emergency of WNV with 18 human deaths. Italy and Hungary also
announced the outbreak of WNV infection. At the same time, in 2012, West Nile virus infection
was reported for the first time in Serbia with 9 human victims (Popovi et al., 2013) and in 2013
with 35 fatalities. Before that, WNV fever in Serbia was neglected disease with the limited data of
virus dissemination. First serological testing of horses was conducted during 2009-2010 in
Vojvodina province and 12% of 349 tested horses reacted seropositive (Lupulovi et al., 2011). In
addition, further examination was carried out and the established seroprevalence was 28.6% (Medi
et al., 2014). After the human outbreak in 2012, 130 horses were examined. The detected anti-WNV
antibodies were much higher comparing to previous surveys, with 49.23% seropositivity rate
(Petrovi et al., 2014).
According to presented data, it was assumed that WNV is circulating among wild birds too. In total,
192 blood sera and 88 pooled tissue samples from 133 different wild resident and migratory birds
were analyzed for the presence of WNV during 2012. Anti-WNV antibodies were detected in 8%
(7/92) of tested blood sera and the presence of WNV RNA was confirmed in 10% (8/81) of pooled
395
tissue samples. Philogenetic analyzes showed that identified WNV RNA belongs to lineage 2 strain,
that is circulating in this part of Europe (Petrovi et al., 2013). Based on the obtained data, WNV
surveillance program has been launched in Serbia since April 2014. The program encompassed
serological testing of seronegative horses and poultry and RT-PCR analyzes of pooled mosquitoes
samples (Petrovi et al., 2014)
The recent investigation showed that WNV is present in the population of wild boars and roe deer,
as well as in the population of domestic pigs in Serbia. For this purpose, 279 swine sera, 318 wild
boars and 91 roe deer were tested by enzyme-linked immunosorbent assay (ELISA) and viral
neutralisation test (VNT). Antibodies against WNV were detected in 43 (15.4%) pigs, 56 (17.6%)
wild boars and 17 (18.7%) roe deer sera (Escribano-Romero et al., 2015)
There is evidence that another mosquito-borne flavivirus, Usutu virus (USUV), is circulating in
Serbia. Anti-USUV neutralizing antibody titre is detected for the first time in one horse sera, during
the examination of WNV activity in horses (Lupulovic et al., 2011). Furthermore, 4.5% (4/88) of
tested patients in South Baka has anti-USUV IgG antibodies (Hrnjakovi Cvetkovi i sar., 2014)
and four wild boar sera showed USUV specifity (Escribano-Romero et al., 2015).
Hepatitis E
Wild boars are the reservoir of a various number of viruses with the potential for transmission of
many diseases to domestic animals and humans. There are reports of serological examination for a
couple of zoonotic agents, including Hepatitis E, swine influenza virus and Japanese encephalitis
virus (Meng et al., 2009).
Hepatitis E (HEV) belongs to one of the five so far described types of viral hepatitis in humans
(hepatitis A, B, C, D and E). The clinical signs of the disease are typical for acute hepatitis with
abdominal pain, nausea, vomiting, anorexia, fever, dark urine and jaundice. The disease is spread
mainly through contaminated water and caused serious epidemics in developing countries of Asia
and Africa. HEV (family Hepeviridae, genus Hepevirus) is non-enveloped whose genome is a
single-stranded RNA molecule (Pinto and Saiz, 2007). First isolation of HEV in pigs was reported
in 1997 (Meng et al., 1997). Since then, the presence of HEV infection in pigs was confirmed in
many countries, such as Spain, the Netherlands, New Zealand, France, Japan, Canada, Portugal,
Germany, etc. Zoonotic potential of HEV is proved after infection of people who consumed
inadequately cooked meat and liver of deer and wild boar (Tei et al., 2003; Masuda et al., 2005).
The first investigations on HEV infection in domestic and wild boars in Serbia was carried out in
2008. HEV RNA was detected in 30% of faecal samples and 45% of the tissue samples from
farming pigs, while no HEV RNA was detected in pooled faecal samples from feral pigs (Petrovic
et al., 2008). In another investigation, 315 swine sera from 3 to 4 months-old backyard pigs were
collected during years 2006-2007 and tested for the presence of anti-HEV antibodies. Out of this
number, 34.6% (109/315) of sera resulted positive by in-house ELISA (Lupulovic et al., 2010;
Jimenez de Oya et al., 2009).
With the aim to determine the presence of HEV in wild boars in Serbia, 92 blood serum samples
were analyzed by in-house ELISA. In 32 (34.78%) animals was detected the presence of specific
antibodies against HEV genotype 3. The blood samples were collected during 2009, 2010 and 2011
from 15 hunting sites in Serbia (Lupulovi i sar., 2011). The obtained results showed that hepatitis
E virus is present in wild boar population in Vojvodina (Graph 3). These results are of remarkable
importance because several studies suggested that HEV is food-borne pathogen with zoonotic
potential.
Further examinations were undertaken and HEV RNA was detected in faeces, liver and bile
samples in slaughterhouses in Serbia (Petrovic et al., 2013) as well as the presence of anti-HEV
396
antibodies in blood and meat juice samples in slaughtered pigs (Lupulovic et al., 2013). In order to
provide more data on the potential risk for public health, 200 volunteer blood donors were tested for
the presence of anti-HEV IgG antibodies by in-house ELISA. In total, 15% of blood samples were
seropositive. No HEV RNA was detected in any of the analyzed blood samples (Petrovi et al.,
2014).
Graph 3: HEV infection in wild boars in Serbia (source: Lupulovi i sar., 2011). All coloured fields - hunting
areas in Vojvodina, where wild boar blood samples were collected; dark coloured fields - hunting areas with
HEV IgG positive wild boars
Avian influenza
Avian influenza (AI) is a viral infection of birds (especially wild water fowl such as ducks and
geese), often without clinical signs of the disease. AI viruses can sometimes transfer to domestic
poultry and cause large-scale outbreaks of infection. Avian influenza is zoonoses with a great
potential to cross the species barrier and cause high mortality in humans.
Avian influenza viruses are divided into 2 groups based on their ability to cause disease in poultry:
highly pathogenic and law pathogenic viruses. Highly pathogenic viruses can cause mortality up to
100% within 48 hours, while low pathogenic viruses are not generally associated with severe
disease in poultry. Influenza A type viruses can be also subtype according to their two surface
glycoproteins: hemagglutinin (HA) and neuraminidase (NA). Until now, 18 types of hemagglutinin
and 11 types of neuraminidase have been identified. Human infections are usually induced with
subtypes H5 and H7. Influenza A viruses are susceptible to mutations which can be minor ("drift")
or major ("shift"). The special threat represents the possibility of virus to spread and replicate in the
new host causing reassortment of viruses. Most cases of infection in humans were caused by direct
contact with sick live or dead poultry. Until now there is no evidence that virus can be transmitted
by direct contact from person to person (WHO, 2014).
397
A couple of pandemic outbreaks of AI have been recorded in the past. The best known is Spanish
flu in 1918, when avian influenza subtype H1N1 has been transmitted to humans and killed about
50 million people. Highly pathogenic avian influenza H5N1 caused infection in poultry in Hong
Kong in 1997, resulting in millions of dead chickens and several human deaths. Another emergency
of AI H1N1 was reported in 2003 and 2004, and the disease spread from Asia to Europe and Africa.
Influenza A subtype H7N9 infected humans in Asia in 2013, but there were no reports of human
cases out of China.
Serbia announced first case of highly pathogenic AI H5N1 in March 2006 in wild birds (swans).
ekler et al. (2009) tested AI seroprevalence in 30 blood samples of 46 species of wild birds,
collected from 2006 to 2008 in Serbia. Specific antibodies against AI were established in 9 (30%)
samples using cELISA. In addition, the same sera were tested by hemmaglutination inhibition test
(HI test) to distinguish H subtypes. Among the tested samples, antibodies against AI virus subtype
H5 were detected in 4 samples, and against subtype H7 in 3 samples (ekler et al., 2009)
Influenza pandemics are unpredictable. It is of great importance to carry out further surveys to
analyze the prevalence of avian influenza, especially in wild birds in Serbia.
Conclusions
Different viral zoonotic agents have been detected in wildlife in Serbia (rabies, WNV, hepatitis E,
USUV, avian influenza). Additional investigations on important viral zoonoses should be conducted
with the aim to prevent outbreak of emergency diseases with the serious consequences for human
health.
Acknowledgments
This work is supported by project TR31084, funded by the Ministry of Education, Science and
Technological Development of the Republic of Serbia.
References
1.
2.
3.
4.
5.
6.
7.
8.
Calistri P., Giovannini A., Hubalek Z., Ionescu A., Monaco F., Savini G., Lelli R.: Epidemiology of
West Nile in Europe and in the Mediterranean Basin.Open Virol J., 4, 2937, 2010
CDC-Centers for Disease Control and Prevention: 2014 Ebola Outbreak in West Africa - Case Counts
(www.cdc.gov), accessed on: 11 May 2015
Cutler S., Fooks A., van der Poel W.: Public Health Threat of New, Reemerging, and Neglected
Zoonoses in the Industrialized World. Emerging Infectious Diseases, 16(1), 1-7, 2010
Daszak P, Cunningham A, Hyatt A: Anthropogenic environmental change and the emergence of
infectious diseases in wildlife. Acta Trop., 78(2), 103-16, 2001
Escribano-Romeroa E., Lupulovi D., Merino-Ramos T., Blazquez A., Lazi G., Lazi S., Saiz J.C.,
Petrovi T.: West Nile virus serosurveillance in pigs, wild boars, and roe deer in Serbia. Veterinary
microbiology, 176, 365-369, 2015
Fooks A., Banyard A., Horton D., Johnson N., McElhinney L., Jackson A.: Current status of rabies and
prospects for elimination. The Lancet, 384(9951), 1389-99, 2014
Haagmans B., Andeweg A., Osterhaus A: The application of genomics to emerging zoonotic viral
diseases. Plos Pathog, 5 (10), 2009
Hrnjakovi-Cvjetkovi I., Petri D., Petrovi T., Pati A., Nikoli N., Jovanovi-Galovi A., Kovaevi
G., Radovanov J., Miloevi V.: Ispitivanje seroprevalence na Usutu virus u stanovnika Junobakog
okruga, Vojvodina, Srbija. Simpozijum XVI epizootioloski dani Srbije, 6-7 novembar 2014, Zrenjanin,
Zbornik kratkih sadraja, 96-97, 2014
398

9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Jimenez de Oya N., Galindo I., Girones O., Duizer E., Escribano J.M., Saiz, J. C.: Serological
immunoassay fordetection of hepatitis E virus on the basis of genotype 3 openreading frame 2
recombinant proteins produced in Trichoplusia ni larvae. Journal of Clinical Microbiology, 47(10),
32763282, 2009.
Jones K., Patel N., Levy M., Storeygard A., Balk D., Gittleman J., Daszak P.: Global trends in emerging
infectious diseases. Nature 451, 990-993, 2008.
Kruse H., Kirkemo A., Handeland K.: Wildlife as source of zoonotic infections. Emerg Infect
Dis,10(12), 2067-72, 2004
Lupulovi D., Grgi ., Lazi G., Prodanov-Radulovi J., Potkonjak A., Lazi S., Petrovi T.: Detection
of Hepatitis E Virus Antibodies in Blood and Meat Juice Samples in Slaughtered Pigs in Serbia. 16th
International Symposium of the World Association of Veterianary Laboratory Diagnosticians WAVLD,
Book of Abstracts, 273-273, Berlin, German, 2013
Lupulovi D., Lazi S., Prodanov-Radulovi J., Jimenez de Oya N., Escribano-Romero E., Saiz J.,
Petrovi T.: First Serological Study of Hepatitis E Virus Infection in Backyard Pigs from Serbia. Food
Environment Virology, (2), 110-113, 2010
Lupulovic D., Maksimovic Zoric J., Vaskovic N., Bugarski D., Plavsic B., Ivanovic N., Petrovic T.,
Pusic I., Marcic D., Grgic Z., Lazic S.: First Report on the Efficiency of Oral Vaccination of Foxes
against Rabies in Serbia. Zoonoses Public Health, 2015 [Epub ahead of print]
Lupulovi D., Martin-Acebes M., Lazi S., Alonso-Padilla J., Blazquez A., Escribano-Romero E.,
Petrovi T., Saiz J.: First Serological Evidence of West Nile Virus Activity in Horses in Serbia. VectorBorne and Zoonotic Diseases, 11(9), 1303-1305, 2011
Lupulovi D., Petrovi T., Prodanov-Radulovi J., Doen R., Pui I.: Seroprevalenca hepatitis E
virusne infekcije kod divljih svinja u Srbiji. Arhiv veterinarske medicine, ISSN 1820-9955, Str. 19-29,
2011
Maier T., Schwarting A., Mauer D., Ross R., Martens A., Kliem V.: Management and outcomes after
multiple corneal and solid organ transplantations from a donor infected with rabies virus. Clin Infect
Dis. 50, 11121119, 2010
Martin-Acebes A. and Saiz J.C.: West Nile virus: a re-emerging pathogen revisited. World J Virol 1:
5170, 2012
Masuda J., Yano K., Tamada Y., Takii Y., Ito M., Omagari K., Kohno S.: Acute hepatitis E of a man
who consumed wildboar meat prior to the onset of illness in Nagasaki, Japan. Hepatol Res, 31, 178
183, 2005
Medi S., Hoven R., Petrovi T., Lupulovi D., Nowotny N.: Serological evidence of West Nile virus
infection in the horse population of northern Serbia. Journal of Infection in Developing Countries, 8 (7),
914-918, 2014
Meng X. J., Purcell R. H., Halbur P. G., Lehman J. R., Webb D. M., Tsareva T. S.: A novel virus in
swine isclosely related to the human hepatitis E virus. Proceedings of theNational Academy of Sciences
USA, 94(18), 98609865, 1997
Meng X., Lindsay D., Sriranganathan N.:Wild boars as sources for infectious diseases in livestock and
humans. Philos Trans R Soc Lond B Biol Sci., 364(1530), 2697-2707, 2009
Messenger A, Barnes A, Gray G: Reverse Zoonotic Disease Transmission (Zooanthroponosis): A
Systematic Review of Seldom-Documented Human Biological Threats to Animals. PLoS ONE, 9(2),
2014
Morens D. and Fauci A.: Emerging Infectious Diseases: Threats to Human Health and Global Stability.
PLoS Pathog., 9(7), 2013
Petrovi M.: Urban and Sylvatic Rabies in Yugoslavia. Rabies Bulletin Europe, Vol. 11/No 4/1987.
(www.who-rabies-bulletin.org/journal/Bulletin_1987_4.pdf), accessed on 26 September 2014
Petrovic T, Prodanov J, Lazic S: First Preliminary Results on the Presence of Hepatitis E virus in Swine
Population in Serbia. International Symposium Current Developments in Food and Environmental
Virology; Proceedings, Pisa, Italy, 52-53, 2008.
399

27. Petrovi T., Blazquez A., Lupulovi D., Lazi G., Escribano-Romero E., Fabijan D., Kapetanov M.,
Lazi S., Saiz J.: Monitoring West Nile virus (WNV) infection in wild birds in Serbia during 2012: first
isolation and characterisation of WNV strains from Serbia. Eurosurveillance, 18 (44), 2013
28. Petrovi T., Lazi S., Lupulovi D., Lazi G., Bugarski D., Vidanovi D., Stefan-Miki S., Miloevi
V., Hrnjakovi-Cvetkovi I., Petri D.: Serological study on WNV presence in horses in Vojvodina after
the human outbreak in Serbia in 2012. Archives of Biological Sciences, 66 (2), 473-481, 2014
29. Petrovi T., Lupulovi D., Grgi ., Lazi G., Vidanovi D., Lazi S.: The preliminary survey of HEV
presence in samples of pigs - pork products in slaughterhouses in Serbia. 16th International Symposium
of the World Association of Veterianary Laboratory Diagnosticians WAVLD, Book of Abstracts, 273273, Berlin, German, 2013
30. Petrovi T., Lupulovi D., Jimenez de Oya N., Vojvodi S., Blazquez A., Escribano-Romero E., MartinAcebes M., Potkonjak A., Miloevi V., Lazi S., Saiz J.: Prevalence of hepatitis E virus (HEV)
antibodies in Serbian blood donors. Journal of Infection in Developing Countries, 8 (10), 1322-1327,
2014
31. Petrovi T., ekler M., Petri D., Lazi S., Lupulovi D., Lazi G., Debeljak Z., Bugarski D., Plavi B.:
West Nile virus surveillance program in Serbia. Arhiv veterinarske medicine, 7 (2), 29-45, 2014
32. Pinto R. and Saiz J. C.: Human viruses in water. In: Perspectives in medical virology, ed. A. Bosch,
Amsterdam, The Netherlands: Elsevier, Vol. 17, 3967, 2007
33. Popovi N., Miloevi B., Uroevi A., Poluga J., Lavadinovi L., Nedelijkovi J., Jevtovi Dj.,
Dulovi O.: Outbreak of West Nile virus infection among humans in Serbia, August to October 2012.
Eurosurveillance, 18 (43), 2013
34. ekler M., Aanin R., Krnjaji D., Pali T., Mili N., Jovanovi T., Kovaevi D., plavi b.,
Stojanovi D., Vidanovi D., Aanin N.: Examination of presence of specific antibodies against avian
influenza virus in some species of wild birds. Acta Veterinaria (Beograd), 59 (4), 381-403, 2009
35. Taylor L., Latham S., Woolhouse M.: Risk factors for human disease emergence. Philos Trans R Soc
Lond B Biol Sci., 356 (1411), 983989, 2001.
36. Tei S., Kitajima N., Takahashi K., Mishiro S.: Zoonotic transmission of hepatitis E virus from deer to
human beings. Lancet, 362, 371373, 2003
37. Venkatesan G., V. Balamurugan V., Gandhale P.N., Singh R.K, Bhanuprakash V.: Viral Zoonosis: A
Comprehensive Review. Asian Journal of animal and Veterinary Advances, 5 (2), 77-92, 2010.
38. Wang L.-F. and Crameri G.: Emerging zoonotic viral diseases. Rev. sci. tech. Off. int. Epiz., 33 (2),
569-581, 2014
39. WHO-World
Health
Organization:
Avian
influenza
(http://www.who.int/mediacentre/factsheets/avian_influenza/en/), accessed on: 11 May 2015
40. WHO-World Health Organization: Emerging Zoonoses (www.who.int/zoonoses/emerging_zoonoses),
accessed on: 11 May 2015
41. WHO-World Health Organization: WHO Consultation on rabies, second report, Technical Report
Series, No. 982, 2013. (http://apps.who.int/iris/bitstream/10665/85346/1/9789240690943), accessed on:
26 September 2014
400
Invited lecture
INFLUENZA AND INTERNATIONAL HEALTH REGULATIONS
Dragana Dimitrijevi1, Slavica Raki Adrovi2, Milunka Milinkovi1, Jovanka osi1
1. Institute of Public Health of Serbia Dr Milan Jovanovi Batut, Belgrade, Serbia
2. Institute of Virology, Vaccines and Sera "Torlak"
* Corresponding author: [email protected];
Abstract
Influenza virus is a virus with the greatest pandemic potential. Surveillance of influenza, both
epidemiological and virological is crucial. The existence of a surveillance system that has the
capacity to recognize, support and identify influenza caused by a new subtype of the virus is an
imperative for every country. Risk assessment for cases of human infection with avian influenza or
animal influenza virus as A (H7N9), A (H5N6) has become a routine procedure.
The International Health Regulations (IHR 2005) are a legally binding agreement that was adopted
by all WHO Member States and which entered into force in June 2007. While taking the challenges
of a globalized world into consideration, the purpose of the IHR (2005) is to provide a framework
for international efforts to contain or reduce the risk from public health threats that may spread
between countries. To this end, the IHR (2005) contain rights and obligations for the States and for
WHO concerning national and international surveillance, assessment and public health response.
With respect to surveillance, States are required to notify WHO of all events "that may constitute a
public health emergency of international concern" according to agreed criteria. Public Health
Emergency of International Concern (PHEIC) is an extraordinary event which is determined, by the
International Health Regulations (2005), as well as unusual and / or unexpected events that have a
serious impact on health, with a significant risk of international spread or significant risk of
restricting international travel and trade. The criteria for risk assessment i.e. decision instruments
are based on the following issues: there is a serious public health impact, whether the event is
unusual or unexpected, whether there is a risk of international spread and Interference with
international travel or trade. Improving surveillance of influenza both in human and veterinary
medicine is the constant challenge of each country.
Keywords: influenza, International health regulations, Serbia
In the globalised world, diseases can spread far and wide via international travel and trade. A health
crisis in one country can impact livelihoods and economies in many parts of the world (Katz, 2009).
Since entering into force in 2007, the IHR have provided a legally binding global framework to
support national and international programs and activities aimed at preventing, protecting against,
controlling, and providing a public health response to the international spread of disease (WHO,
2008). In 2005, the World Health Assembly adopted revised International Health Regulations (IHR)
in ways that are commensurate with and restricted to public health risks, and which avoid
unnecessary interference with traffic and trade (WHO, 2008).
The resurgence of infectious diseases noted in the first half of the 1990s showed IHR 1969s
limitations. IHR 2005 expands the scope of the regulations application, contains more demanding
surveillance and response obligations, and applies human rights principles to public health
interventions.
Surveillance has been defined as the systematic ongoing collection, collation and analysis of data
for public health purposes and the timely dissemination of public health information for assessment
and public health response as necessary (WHO, 2008).
401
A surveillance system requires structures and processes to support these ongoing functions. IHR
2005 identifies health-related events that each country that agrees to be bound by the regulations (a
state party) must report to WHO. In terms of health-related events that occur in its territory, a
state party must notify WHO of all events which may constitute a public health emergency of
international concern (article 6.1). IHR 2005 also requires state parties, as far as is practicable, to
inform WHO of public health risks identified outside their territories that may cause international
disease spread, as manifested by exported or imported human cases, vectors that may carry
infection or contamination, or contaminated goods (article 9.2). Public Health Emergency of
International Concern (PHEIC) is an extraordinary event which is determined, by the International
Health Regulations (2005), as well as unusual and / or unexpected events that have a serious impact
on health, with a significant risk of international spread or significant risk of restricting international
travel and trade (WHO, 2008). Only WHOs Director General has the authority to determine
whether an event constitutes a PHEIC. IHR 2005 includes a list of diseases for which a single case
may constitute a PHEIC and must be reported to WHO immediately. This list consists of smallpox,
poliomyelitis, human influenza caused by new subtypes, and severe acute respiratory syndrome
(SARS).
A second list of diseases exists for which a single case requires the decision instrument to be used to
assess the event, but notification is determined by the assessment and is not automatic. Finally, IHR
2005 also encourages state parties to consult with WHO over events that do not meet the criteria for
formal notification but may still be of public health relevance (article 8/IHR).
IHR 2005s purpose is to prevent, protect against, control, and facilitate public health responses to
the international spread of disease (article 2), and IHR 2005 makes surveillance central to guiding
effective public health action against cross-border disease threats. Surveillance is central to IHR
2005s public health objectives, which explains why IHR 2005 requires all state parties to develop,
strengthen, and maintain core surveillance capacities (article 5.1). It also raised awareness that
global disease threats can go undetected and unreported to the point that control efforts are
extremely difficult because major spread has often already occurred (Kohl et al., 2012).
Achievement of core capacities in detection, assessment and response at national and subnational
levels; includes eight technical areas: national legislation, policy and financing, coordination and
National IHR Focal Point (NFP) communications, surveillance, response, preparedness, risk
communication, human resources, laboratory States Parties to collaborate with each other and with
international organizations to ensure capacities (WHA, 2009).
Influenza virus is a virus with the greatest pandemic potential. Worldwide, seasonal influenza is
responsible for an estimated 3.5 million cases of severe illness and 250 000500 000 deaths each
year (WHO, 2008). Seasonal influenza can cause serious public-health and economic problems. In
developed countries, epidemics can cause significant worker absenteeism and loss of productivity.
Health facilities can become overburdened at periods of peak illness. Little is known about the
effects of influenza epidemics in developing countries owing to a lack of data (Gessner et al., 2011).
Surveillance of influenza, both epidemiological and virological is crucial. The existence of a
surveillance system that has the capacity to recognize, support and identify influenza caused by a
new subtype of the virus is a imperative for every country, as well as for Serbia.
The terms emerging and re-emerging infections were coined to describe newly recognized,
clinically distinct infectious diseases and known infectious diseases with increasing incidence in a
given place or population. Influenza viruses circulating in animals pose threats to human health.
Humans can become ill when infected with viruses from animal sources, such as avian influenza
virus subtypes H5N1, H5N6 and H9N2 and swine is influenza virus subtypes H1N1 and H3N2.
The emergence of two new human infections avian influenza A (H5N1) and Severe Acute
Respiratory Syndrome (SARS) had profound effects on the international health community. The
402
response to these global public-health events helped accelerate efforts to revise the IHR and to plan
for a future pandemic. The first human outbreak of avian influenza A (H5N1) was detected in 1997
in Hong Kong Special Administrative Region (Mounts et al., 1997). This was the first recognized
instance in which a highly pathogenic avian influenza virus had been directly transmitted to humans
and resulted in serious illness. H5N1 subsequently spread among millions of wild and domestic
birds from late 2003 onwards, aided in part by migratory waterfowl (Peiris et al., 2007; Webster et
al., 2006; Kalthoff et al., 2010). Although the virus proved difficult to transmit to humans, case
fatality was high. The ongoing geographic spread and evolution of avian influenza A (H5N1) was
worrisome.
Avian influenza A(H7N9) is a subtype of influenza viruses that have been detected in birds in the
past. This particular A(H7N9) virus had not previously been seen in either animals or people until it
was found in March 2013 in China. Infections in both humans and birds have been observed. The
disease is of concern because most patients have become severely ill. This virus does not appear to
transmit easily from person to person, and sustained human-to-human transmission has not been
reported.
The emergence of another influenza viruses, gave the global health community a preview of the
demands that a pandemic or other worldwide public-health emergency would make. In the absence
of medicines, at the beginning, control of the global epidemic fell to more traditional public-health
measures, including hand and respiratory hygiene, strict adherence to infection-control measures for
hospitalized patients, isolation of ill persons and quarantine of close contacts (Olsen et al., 2003).
The potential to learn lessons from the 20092010 pandemic influenza experience and the need to
address public concerns regarding the WHO response led to the establishment of the first IHR
Review Committee. The best way to prevent international spread of diseases is to detect public
health threats early and implement effective measures when the problem is small and at local level.
The existence of a surveillance system that has the capacity to recognize, support and identify
influenza caused by a new subtype of the virus is a imperative for every country. Risk assessment
for cases of human infection with avian influenza or animal influenza virus as A (H7N9), A (H5N6)
has become a routine procedure.
The criteria for risk assessment i.e. decision instruments are based on the following issues there is a
serious public health impact, whether the event is unusual or unexpected, whether there is a risk of
international spread and Interference with international travel or trade.
At the beginning of 2015, World Health Organization underlined warning signals from the volatile
world of influenza viruses. The current global influenza situation is characterized by a number of an
increase in the variety of animal influenza viruses co-circulating and exchanging genetic material,
giving rise to novel strains. Changes in the H3N2 seasonal influenza viruses, which have affected
the protection conferred by the current vaccine for season 2014/2015, are also of particular concern.
Regarding H7N9, there is no change in the epidemiology of human infections. As far as H5 viruses,
they are currently the most obvious threat to health. Crucial is be prepared for surprises. Improving
surveillance of influenza both in human and veterinary medicine is the constant challenge of each
country.
References:
1. Gessner BD, Shindo N, Briand S. Seasonal influenza epidemiology in sub-Saharan Africa: a
systematic review. Lancet Infec Dis, 2011, 11:223235.
2. Kalthoff D, Globig A, Beer M. (Highly pathogenic) avian influenza as a zoonotic agent. Vet
Microbiol, 2010, 140:237245.
403

3. Katz R. Use of Revised International Health Regulations during Influenza A (H1N1) Epidemic,
2009. Emerg Infect Dis. 2009;15(8):1165-1170.
4. Kohl KS, Arthur RR, OConnor R, et al. Assessment of Public Health Events through International
Health Regulations, United States, 20072011.Emerg Infec Dis. 2012;18(7):1047-1053.
5. Mounts AW, Kwong H, Izurieta HS, et al. Case-control study of risk factors for avian influenza A
(H5N1) disease, Hong Kong, 1997. J Infect Dis, 1999, 180:505508.
6. Olsen SJ, Chang HL, Cheung TY,et al. Transmission of the severe acute respiratory syndrome on
aircraft. N Engl J Med, 2003, 349:24162422.
7. Peiris JS, de Jong MD, Guan Y. Avian influenza virus (H5N1): a threat to human health. Clin
Microbiol Rev, 2007, 20:243267.
8. Webster RG, Peiris M, Chen H, et al. H5N1 outbreaks and enzootic influenza. Emerg Infect Dis,
2006, 12:38.
9. World Health Assembly. Implementation of the International Health Regulations (2005): report of
the Review Committee on the functioning of the International Health Regulations (2005) in relation
to pandemic (H1N1) 2009. WHA64.10. 2011 May 5 [cited 2012 May 1].
http://apps.who.int/gb/ebwha/pdf_fi les/WHA64/ A64_10-en.pdf
10. World
Health
Organization.
Influenza.
25
January
2008.
http://www.who.int/immunization/topics/influenza/en/index.html
11. World Health Organization. International Health Regulations 2005, 2nd ed. Geneva: The
Organization; 2008. http://whqlibdoc.who.int/publications/2008/9789241580410_eng.pdf). [cited
2012 Apr 9]
404
Invited lecture
COMPARISON OF RHODOCOCCUS EQUI OF HUMAN AND ANIMAL ORIGIN
Ljiljana Suvajdi1*, Maja Velhner2, Maja Bekut3, Gordana Boji4, Tamara Krsti3,5, Zoran
Suvajdi6, Milenko Lazi3
1. Medical Faculty, Department for Pharmacy, University of Novi Sad, Serbia
2. Scientific Veterinary Institute Novi Sad, Serbia
3. Medical Faculty, University of Novi Sad, Serbia
4. Institute of Public Health of Vojvodina, Novi Sad, Serbia
5. Faculty of Pharmacy, European University, Novi Sad, Serbia
6. Veterinary ambulance, STRIKS, erevi, Serbia
Abstract
Different diagnostic criteria and even different nomenclature of bacteria can cause confusion in
monitoring the presence and transmission of infectious agents within human and animal
populations. In order to have valid epidemiological-epizootic surveillance, we should apply the
same or at least comparable diagnostic algorithms of causative agents. We compared Rhodococcus
equi isolates of human and animal origin using the same methodology.
The strain isolated from the lungs of foals was compared to isolates from the eye of patient with
conjunctivitis and from altered lung part of women with pulmonary malakoplakia. Morphological,
cultural and tinctorial properties were investigated. Also, tests of catalase, oxidase, plasma
coagulation and double CAMP were done. Final diagnosis was performed by using commercial API
CORYNE sets ("Bio Merieux"). All of the examined strains formed visible colonies after 18 hours
of incubation. Colonies were shiny, whitish, porcelain-like, and slightly larger than 1 mm in
diameter. Throughout the subsequent 24 hours of incubation, colonies became mucous, confluent,
reaching few millimeters in diameter and growing better in aerobic than in microaerophilic
conditions. After seven days at room temperature colonies turned salmon pink in color.
In the Gram-stained smears, regular cycle bacterial morphology revealed appearance
transformation: coccoidbacilluscoccus in every 24 hours. In a double CAMP test isolates
revealed synergistic haemolysis with S.aureus, with the characteristic spade-shape and with sides
converging to the top. The isolate showed markedly catalase positive, and negative in a cytochrome
C oxidase test. It coagulated rabbit plasma diluted 1:4 and human plasma diluted 1:9. All
investigated isolates corresponded with the BioMerieux identification table in all parameters.
Diagnosis was evaluated using a software program from the same manufacturer, confirming the
identity probability of 99.9%, T=1, thus qualifying the identification as excellent.
The results can be compared only if the same or comparable methodologies were applied. In this
case, strains originating from humans were identical in all investigated parameters with a strain of
animal origin. Regardless of the fact that some microorganisms are considered animal and some
human pathogens, the vast majority of them can cause diseases in humans and in animals.
Key word: Rhodococcus equi, human and animal origin, comparison
Introduction
Rhodococcus equi (R. equi) belongs to the subgroup 1 of nocardioform microorganisms, along with
Gordon, Nocardia and Tsukamurella, because all four genera contain mycolic acid. Genus
Rhodococcus contains 29 species, of which only three types are pathogenic (Holt et al., 1994)
Rhodococcus equi is pathogenic to humans and animals, Rhodococcus fascians is pathogenic to
405
plants, especially tobacco, and Rhodococcus rhodnii is pathogenic to insects. Rhodococcus equi was
first isolated and identified from the lungs of foals by Magnuson in Sweden in 1923 and nominated
for a new species (Magnusson, 1923). Since then, many researchers have found Rhodococcus equi
in many mammals, such as horses, cattle, goats, sheep, pigs, dogs, cats, deer and bears. It was
isolated from poikilothermic animals such as crocodiles, wild birds and arthropods. It survives in
freshwater and marine habitats. The microorganism is present in the soil, on all continents except
Antarctic (Prescott, 1991).
The organism properties
Size of the microorganism varies from 1 to 5 micrometers (Barton and Hughes, 1980; Biberstein
and Zee, 1990). Within 24 hours, the cycle of coccus form passes to rod form, which gave the
whole genus its name, Rhodococcus (Krech and Hollis, 1991). It contains a capsule of
polysaccharide nature (Barton and Hughes, 1980). In respect to capsular antigens 27 serological
capsular types are described, whose prevalence varies geographically (Biberstein and Zee, 1990).
They are Gram positive, but they can be Gram-labile (Barton and Hughes, 1980). Some strains are
weakly acid resistant (Krech and Hollis, 1991; Quinn et al., 1998). At usual feedings, they grow
mainly in the form of mucous colonies that initially look porcelain-like and later receive a salmon
pink pigmentation (Krech and Hollis, 1991; Claridge and Spiegel, 1995; Quinn et al., 1998). They
are strict aerobes, broadly tolerant to temperature range starting from 10C (Barton and Hughes,
1980; Biberstein and Zee, 1990). The microorganism is catalase positive, hydrolyzes urea, reduces
nitrates and it is inactive toward substrates for fermentation commonly used in routine work (Barton
and Hughes, 1980; Biberstein and Zee, 1990; Holt et al., 1994; Quinn et al., 1998). R. equi produces
equi factor that, with microorganisms Trueperella pyogenes (Quinn et al., 1998; Suvajdi, 2000),
Corynebacterium pseudotuberculosis (Claridge and Spiegel, 1995; Suvajdi et al., 2014; Suvajdi
and Suvajdi, 2014), Corynebacterium ulcerans (Claridge and Spiegel, 1995; Suvajdi et al.,
2012a; Suvajdi and Suvajdi, 2014), Arcanobacterium haemolyticum (Claridge and Spiegel,
1995; Suvajdi et al., 2002; Suvajdi and Suvajdi, 2014), Staphylococcus aureus (Quinn et al.,
1998; Suvajdi et al., 2006), Listeria ivanovii and some strains of Listeria monocytogenes (Bille
and Doyle, 1991; Krech and Hollis, 1991; Suvajdi, 2000; Suvajdi et al., 2002; Suvajdi et al.,
2012b; Suvajdi and Suvajdi, 2014) leads to complete hemolysis of sheep and bovine
erythrocytes.
R. equi is a facultative intracellular parasite that survives the phagocytosis inside macrophage and
consequently causes granulomatous inflammation. With the eventual destruction of macrophages,
granulomas may become purulent. Capsule and diffusible factors of R. equi, phospholipase C and
the cholesterol oxidase have a role in causing the disease (Quinn et al., 1998, Barton and Hughes,
1980).
Ecology
In the environment, R. equi is mainly located in the upper soil layer and in the dust, especially in
localities where domestic animals are raised, primarily horses and pigs (Prescott, 1991). It is known
that R. equi can be found in the soil of 50-95% households in which horses are bred, as R. equi is
present in horses' feces in very high concentrations.
In the feces of mares, R. equi is present in concentration from 102 to 103 colony forming units
(CFU) per gram. It is isolated from the feces of foals, starting from the first week of life. In the
feces of four weeks old foals it is present in the amount from 104 to 105 CFU. Such high
concentration stays up to 8 and 10 weeks of age, when it starts to decrease and, as foals are
maturing, settles to the concentration characteristic for mares. The highest excretion by feces, 10 6 to
108 CFU per gram, appears in the period until 8 weeks of life, precisely at the time when the foals
are most receptive to infections (Takai, 1997).
406
Epidemiology and pathology

Inhalation and ingestion are considered to be the most common ways of infection (Gigure and
Prescott, 1997). The disease can be transmitted also vertically (Biberstein and Zee, 1990) through
the umbilical cord and transpartal through mucous membranes. The disease is widespread
throughout the world, but occurs sporadically, although it may become endemic. The lungs are the
most often affected by R. equi infection. Three clinical forms are dominant: acute purulent
pneumonia, chronic pneumonia with piogranulomatouses abscesses and intestinal mesenteric
lymphadenitis (Quinn et al., 1998). Immune immature foals that are weakly or no longer passively
protected by antibodies from colostrum are particularly sensitive. The most vulnerable are foals at
the age of 1-6 months. Mortality in foals up to 2 months of age is up to 50% (Biberstein and Zee,
1990). Extrapulmonary infections of horses such as arthritis (Firth et al., 1980) and subcutaneous
abscesses (Wilson, 1955) are rarely described. Suppurative processes in a variety of mammals, pigs,
and rarely sheep, goats and cattle have also been described (Barton and Hughes, 1980). The
microorganism can infect wounds, and can be spread from a major focus of infection. For example,
infection of the lungs can cause abscesses of the whole body and internal organs (Miki et al.,
2014).
The first case of infection among humans in the form of lung abscess was described by Golub et al.
in 1967 (Golub et al., 1967), in a 29 years old man who was diagnosed for plasma cell hepatitis and
treated with prednisone. In human population, infections by R. equi are often affecting
immunocompromised patients. Ten percent of infected patients are treated with immunosuppressive
drugs which is an integral part of the therapy during organ transplantation and in autoimmune
diseases (La Rocca et al., 1998). It is believed that about two-thirds of patients infected with R. equi
suffer from HIV. In other reports the most common infection is pneumonia in immunosuppresed
patients. However, brain abscess (Corne et al., 2002) and endophthalmitis of a 9 year old boy, were
also found although patients were not immunocompromised (Ebersole and Paturzo, 1988). Since
then, more than 20 endophthalmites in humans with different immune statuses were found (Van
Etta et al., 1983). In 1991, Prescott JF pointed out that R. equi is pathogenic for animals and for
humans (Prescott, 1991).
In Serbia, reports of the isolation of R. equi were extremely sporadic. Since 2000, three human and
three veterinary reports were published: isolations from the lungs of pigs and calves in 2000
(Suvajdi, 2000), from the lungs of a colt 2001 (Suvajdi et al., 2001), from a dogs eye 2004
(Mii et al., 2004), from a humans eye 2004 (Suvajdi, 2004), from pulmonary malakoplakia
2006 (Suvajdi and Povaan, 2006) and from blood and sputum cultures and lung empyema 2014
(Miki et al., 2014). These rare isolations of this species suggest its misidentifications in human and
in veterinary microbiology laboratories.

Study object
1. Biopsy specimen from pulmonary malakoplakia in 43 years old immune suppressed patient
undergoing chemotherapy for Hodgkin's lymphoma. During the application of chemotherapy,
development of R. equi pneumonia has occurred. The patient fully recovered after 12 months of
therapy by combination of parenteral and oral antibiotics, with the drainage of purulent collections.
2. Conjunctival swab of a veterinary technician, of excellent general health status, with acute
inflammation of conjunctiva. Rhodococcus equi was isolated from conjunctiva as the only potential
407
pathogenic causative agent. Patient fully recovered after one week of treatment with 0.5%
erythromycin eye drops.
3. Specimen of specifically altered lung tissue of a two months old foal with signs of
suppurative bronchopneumonia. At pathological examination, large pulmonary abscesses were
found with cheesy necrosis as the dominant lesion. Foal fell ill in August, and suffered for a week.
Specimens collections
The specimen from the female immune compromised patient was collected by transthoracic needle
punction from pulmonary malakoplakia, during necropsy from foals lungs and by conjunctival
swab from the eye of patient with acute conjunctivitis. The swab was immersed in saline just before
sampling.
Specimens transport
Conjunctival swab and transthoracic punctate were transported in thioglycollate medium, while the
modified part of the lungs obtained by autopsy was submitted to the laboratory in a sterile Petri
dish.
Primary processing of samples
All three specimens were processed immediately upon arrival at the laboratory. Samples were
seeded on two blood agar plates with 10% of sheep blood, endo agar and Sabourou substrate. Blood
agar plates were seeded simultaneously, with the line of growth of Staphylococcus aureus and
without it. One of two blood agar seeded plates was incubated microaerophilically, and the other, as
well as other primary mediums, aerobically at 37C.
Secondary investigation: preliminary diagnosis
Secondary diagnostic was done according to the methodology of Suvajdi (thesis). Tests of
catalase, oxidase, plasma coagulation and CAMP phenomena with Staphylococcus aureus, Listeria
ivanovii and Arcanobacterium haemolyticum were conducted. Isolates were examined in classical
biochemical series: Triple Sugar Iron agar (TSI slant), Sacharose, Lactose, Glucose, Simmons'
Citrate Agar, Clark Lubs medium, Adonitol and Inositol broth, Christensen's Urea agar slant i
Sulfide, Indole, Motility (SIM) medium.
Tertiary investigation: confirmation, definitive diagnosis
Verification of the identity of isolated strains was done by using commercial API CORYNE sets
("BioMrieux"). Kits were read by a software program from the same manufacturer.
Results
Appearance of colonies
After incubation for 18 hours (aerobic and micro-aerophylic conditions) shiny white colonies that
seemed porcelain, slightly larger than 1mm in diameter were formed (Figure 1). After the
subsequent 24 hours of incubation, colonies became mucous, confluent, reaching few millimetres in
diameter and growing better in aerobic than in microaerophilic conditions (Figure 2). After seven
days at room temperature colonies are turned salmon pink in colour.
408
Figure 1 Colonies of Rhodococcus equi on 5% bovine blood agar after 18

h incubation at 37oC aerobically. Note the porcelain-like appearance of
colonies.
Figure 1 18 h old culture
Figure 2 Colonies of Rhodococcus equi on 5% bovine blood agar after 42

h incubation at 37oC aerobically. Note the creamish appearance of colonies
and confluent growth.
Figure 2 42 h old culture
Morphological and tinctorial characteristics

In the Gram-stained smears, regular cycle bacterial morphology revealed an appearance
transformation: coccoidbacilluscoccus every 24 hours (Figures 3 and 4). Bacterial organism is
positive in Gram staining but with presence of Gram variability.
Figure 3 - R. equi 18 h old culture, presence of

coccus shapes
Figure 4 - R. equi 36 h old culture, presence of rode

shapes
Synergistic hemolysis
Isolates have developed synergistic hemolysis with S. aureus, in characteristic spade shape, with
sides converging to the top (Figure 5). In a double CAMP test, the same pattern is repeated in the
upper middle. However, when S. aureus is vertically drawn to R. equi, synergistic hemolysis gains
the shape of a crescent, left and right vertical line on bottom (Figure 6). Isolates also developed
synergistic hemolysis with L. ivanovii and A. haemolyticum, that resembles a closed and an open
umbrella, respectively (Figure 7).
409
Figure 5 S. aureus CAMP
Figure 6 Double CAMP
Figure 7 R. equi CAMP
Figure 5.: Triangle Staphylococcus aureus; perpendicular to the sides of a triangle Rhodococcus equi strains. Note the
synergistic hemolysis with the characteristic spade shapes.
Figure 6.: Double CAMP test. The upper horizontal line Staphylococcus aureus, the lower horizontal line Rhodococcus
equi, in the middle vertical R. equi, left and right vertical S. aureus. Note the repeated spade shape pattern in the upper
middle, and crescent shaped synergistic hemolysis on the bottom left and right.
Figure 7.: Circular Rhodococcus equi line, from the center of the plate to the circular line Listeria ivanovii, from the rim
of the plate to the circular line one by one Arcanobacterium haemolyticum and Staphylococcus aureus. Note the
synergistic hemolysis with shape of an open umbrella for A. haemolyticum and closed umbrella for Listeria ivanovii.
Table 1 Biochemical characteristics* of strains of Rhodococcus equi isolated from eye of human and lungs
of foal and human
ISOLATE REACTION
INVESTIGATED
IDENTIFICATION
TEST
REACTION
STRAIN
TABLE
1
2
NIT
NITrate reduction
3/3
85
PYZ
PYraZinamidase
0/3
30
PyrA
Pyrolydonil Arylamidase
0/3
15
PAL
ALkaline Phosphatase
3/3
95
-GUR
beta GlucURonidase
0/3
0
-GAL
beta GALactosidase
0/3
0
-GLU
alpha GLUscosidase
3/3
95
-NAG
N-Acetyl--Glucosaminidase
0/3
0
ESC
ESCulin (-glucosidase)
0/3
15
URE
UREase
0/3
15
GELatine (hydrolysis)
0/3
0
GEL
O
Oxidase
0/3
0
GLU
GLUcose (fermentation)
0/3
0
RIB
RIBose (fermentation)
0/3
0
XYL
XYLose (fermentation)
0/3
0
MAN
MANitol (fermentation)
0/3
0
MAL
MALtose (fermentation)
0/3
0
LAC
LACtose (fermentation)
0/3
0
SAC
SACharose (fermentation)
0/3
0
GLYG
GLYcoGen (fermentation)
0/3
0
CAT
CATalase
3/3
100
*API Coryne V 2.0 and software program-BioMrieux.
Biochemical characteristics
All three isolates showed markedly catalase positive, and negative in a cytochrome C oxidase test.
They coagulated rabbit plasma diluted 1:4 for which we did not find comparable information in
accessible literature. Isolates produced free and bound coagulase, which was manifested by positive
410
plasma tube and Cadnes Graves test. In examined biochemical series all substrates remained
unchanged. Thus, the organism is non-reactive in each tested parameter.
In further study of biochemical properties, all examined isolates were exactly the same as
approximate strain ("BioMrieux"). The result, which was read by a software program
("BioMrieux"), confirmed the probability of identity of 99.9% with the degree of probability T = 1
and the number of tests against 0, and the identifications were evaluated as excellent.

In all tested parameters, cultural, morphological and tinctorial traits completely correspond with
literature sources (Barton and Hughes, 1980; Krech and Hollis, 1991; Claridge and Spiegel, 1995;
Quinn et al., 1998) and our previous experience (Suvajdi, 2000; Suvajdi et al., 2001; Suvajdi,
2004; Suvajdi and Povaan, 2006). The fact that the isolates possessed free and bounded
coagulase corresponded only to our previous experience (Suvajdi, 2000; Suvajdi et al., 2001;
Suvajdi, 2004; Suvajdi and Povaan, 2006), but we havent found comparable data in available
literature.
Isolates developed synergistic hemolysis with A. haemolyticum (Claridge and Spiegel, 1995;
Suvajdi, 2000; Suvajdi et al., 2002; Suvajdi et al., 2006; Suvajdi et al., 2012b; Suvajdi
and Suvajdi, 2014), L. ivanovii (Bille and Doyle, 1991; Suvajdi, 2000; Suvajdi et al., 2002;
Suvajdi et al., 2012b; Suvajdi and Suvajdi, 2014) and S. aureus (Quinn et al., 1998;
Suvajdi et al., 2006.), which is a characteristic of species.
Etalon strain of BioMrieux reduces nitrates, shows positive reaction on the Alkaline Phosphatase
and alpha Gluscosidase in 95% of cases, while is negative to other tests. All three strains looked
exactly the same, regardless of origin. The probability of R. equi decomposing Esculin and
hydrolyzing Urea, as well as for the Pyrolydonil Arylamidase test to come out positive is 15% at
best. Thirty of 100 tested strains could be positive in the test of Pyrazinamidase. Our investigated
strains uniformly and completely corresponded to the etalon strain. Thus, the identity rate was
99.9%, accuracy rate T = 1, test count = 0. The identification rate was evaluated as excellent.
Since 2000, in our country only few isolates of R. equi were found in human and animal
specimens. In our opinion, it is due to misidentifying R. equi during routine laboratory procedures.
This could be avoided if every suspect colony was investigated in the common CAMP test with
Staphylococcus aureus.
Different diagnostic criteria and even different nomenclature of bacteria can cause confusion in
monitoring the presence and transmission of infectious agents within human and animal
populations. In order to have valid epidemiological-epizootic surveillance, we should apply the
same or at least comparable diagnostic algorithms of causative agents. We compared Rhodococcus
equi isolates of human and animal origin using the same methodology.
Strains originating from humans were identical in all investigated parameters with a strain of animal
origin. Regardless of the fact that some microorganisms are considered animal and some human
pathogens, the vast majority of them can cause diseases in both humans and animals.
Humans and animals live together in the same ecosystems and they exchange their microfloras.
Thus, we must conclude that the health of humans is impossible without healthy animals. One
health is always full of new challenges!
Acknowledgements
This work was supported by the Ministry of Education, Science and Technological Development,
Republic of Serbia, Project number 46012 and 41012.
411
References
1. Barton MD., Hughes KL.: Corynebacterium equi: review. The Veterinary Bulletin, 50, 65-80, 1980
2. Biberstein EL., Zee YC.: Review of Veterinary Microbiology. Cambridge Massachusets: Blackwell
Science Inc., 1990
3. Bille J., Doyle MP.: Listeria and Erysipelothrix. In: Manual of Clinical Microbiology (5th edition), eds.
Balows A., Hausler Jr. WJ., Herrmann KL., Isenberg HD., Shadomy HJ., Washington D.C.: American
Society for Microbiology, 1991, 287295.
4. Claridge JE., Spiegel CA.: Corynebacterium and Miscellaneous Irregular Gram- Positive Rods,
Erysipelothrix and Gardnerella. In: Manual of Clinical Micribiology, 6th edition, eds. Murray PR., Baron
EJ., Pfaller MA., Tenover FC., Yolken RH, Washington D.C.: AMS Press, 1995, 357378.
5. Corne P., Rajeebally I., Jonquet O.: Rhodococcus equi brain abscess in an immunocompetent patient.
Scandinavian Journal of Infectious Diseases, 34, 4, 300-302, 2002
6. Ebersole LL., Paturzo JL.: Endophthalmitis caused by Rhodococcus equi Prescott serotype 4. Journal of
Clinical Microbiology, 26, 6, 1221-1222, 1988
7. Firth EC., Dik KJ., Goedegebuure SA., Hagens FM., Verberne LRM., Merkens HW., Kersjes AW.:
Polyarthritis and bone infection in foal. Zentralblatt fr Veterinrmedizin Reihe B, 27, 2, 102-124, 1980
8. Gigure S., Prescott JF.: Clinical manifestations, diagnosis, treatment and prevention of Rhodococcus
equi infections in foals. Veterinary Microbiology, 56, 3/4, 313-334, 1997
9. Golub B., Falk G., Spink WW.: Lung abscess due to Corynebacterium equi: report of first human
infection. Annals of Internal Medicine, 66, 6, 1174-1177, 1967
10. Holt J., Krieg N., Sneath P., Staley J., Williams S.: Bergeys Manual of Determinative bacteriology, 9 th
ed. Washington, Williams & Wilkins, 1994
11. Krech T., Hollis DG.: Corynebacterium and related organisms. In: Manual of Clinical Microbiology (5th
edition), eds. Balows A., Hausler Jr. WJ., Herrmann KL., Isenberg HD., Shadomy HJ., WashingtonDC:
American Society for Microbiology, 1991, 277286.
12. La Rocca E., Gesu G., Caldara R., Maffi P., Del Maschio A., Vanzulli A., Castoldi R., Di Carlo V.,
Pozza G., Secchi A.: Pulmonary infection caused by Rhodococcus equi in a kidney and pancreas
transplant recipient: a case report. Transplantation, 65, 11, 1524-1525, 1998
13. Magnusson H.: Spezifische infektise pneumonie beim fohlen: ein neuer eitererreger beim pferd. Archiv
fr Wisseenschaftliche und Praktische Tierheilkunde, 50, 22-38, 1923
14. Miki D., orevi Z., Sekulovi L., Koji M., Tomanovi B.: Disseminated Rhodococcus equi
infection in a patient with Hodgkin lymphoma. Vojnosanitetski Pregled, 71, 3, 317-324, 2014
15. Mii D., Hadi Mili M., Aanin R.: Infekcija oiju psa izazvana bakterijom Rhodococcus equi.
Veterinarski glasnik, 58, 56, S. 669676, 2004
16. Prescott JF.: Rhodococcus equi: an animal and human pathogen. Clinical Microbiology Reviews, 4,1,2034, 1991
17. Quinn PJ., Carter ME., Markey BK., Carter GR.: Clinical Veterinary Microbiology. London, Mosby,
1998
18. Suvajdi Lj., Aanin J., Lako B., Potkonjak A., Saka V., abarkapa I., Stojakovi N.: Isolation of
Arcanobacterium haemolyticum from calves with pneumonia and proposal of a diagnostic protocol.
Veterinarski Glasnik, 66, 3/4, 165-174, 2012(b)
19. Suvajdi Lj., Aanin R., Kneevi N., Koari S.: Characterisation of Arcanobacterium haemolyticum
isolates originating from pneumonic piglets (the first isolation from piglet lungs in Yugoslavia). Acta
veterinaria, 52, 4, 223-34, 2002
20. Suvajdi Lj., Levi J., Velhner M., Milanov D., abarkapa I., Bekut M., Suvajdi Z.: Identification of
Corynebacterium pseudotuberculosis isolated from milk samples from cows with mastitis. Book of
Proceedings, XVI International Symposium Feed Technology Oct 28-30, 2014, Novi Sad, Serbia,
organized by Institute of Food Technology, University of Novi Sad, 2014, 157-163
412

21. Suvajdi Lj., Mra E., Bogavac M., Dambas Lj.: Urtica caused by Arcanobacterium haemolyticum.
Diagnostic and therapeutic failures. Matica Srpska Journal for Natural Sciences, 111, 35-43, 2006
22. Suvajdi Lj., Petej Z., Milanov D., Trailovi D.: Rhodocuccus equi izolovan iz plua drebeta - prikaz
sluaja. Book of proceedings, Clinica Veterinaria- Third Symposium in Animal Clinical Pathology and
Therapy, Jun 11-15, 2001, Budva, Montenegro, organized by Faculty of veterinary medicine, University
of Belgrade, Faculty of veterinary medicine, University of Skopje and Veterinary Association of
Montenegro, 323-324
23. Suvajdi Lj., Potkonjak A., Milanov D., Lako B., Koci B., Mili N., abarkapa I.: A Proposal of a
Diagnostic Protocol for Isolation of Corynebacterium ulcerans from Cow's Milk. Acta Scientiae
Veterinariae, 40, 2, 1039, 2012(a)
24. Suvajdi Lj., Povaan .: Identification on Rhodococcus equi from pulmonary malakoplakia. Book of
proceedings, Infections and lung diseases, Jun 8-9, 2006, Paris , France, organized by Institute Pasteur,
Euroconferences, 45/15
25. Suvajdi Lj., Suvajdi Z.: Pathogens of animals and humans Phospholipase D producers and their
diagnostic and therapeutic failures. Book of Proceedings, XVI International Symposium Feed
Technology Oct 28-30, 2014, Novi Sad, Serbia, organized by Institute of Food Technology, University
of Novi Sad, 2014, 164- 171
26. Suvajdi Lj.: Izuavanje karakteristika Actinomyces pyogenesa i slinih mikroorganizama izolovanih iz
plua teladi i prasadi sa pneumonijom [dissertation]. Beograd: Univezitet u Beogradu, 2000
27. Suvajdi Lj.: Rhodococcus equi. Isolation from the eye of patient-frst human isolate in Serbia and
Montenegro. Book of proceedings, 3rd Congress of the ESEI Oct 17-20, 2004; Paris, France, organized
by ESEI- European Society for Emerging Infections,111
28. Takai S.: Epidemiology of Rhodococcus equi infections: a review. Veterinary Microbiology, 56, 3/4,
167-176, 1997
29. Van Etta LL., Filice GA., Ferguson RM., Gerding DN.: Corynebacterium equi: A Review of 12 Cases of
human infection. Review of infectious diseases, 5, 6, 1012-1018, 1983
30. Wilson MM.: A study of Corynebacterium equi infection in a study of thoroughbred horses in Victoria.
Australian Veterinary Journal, 31, 7, 175-181, 1955
413
THE ROLE OF VETERINARY MEDICINE IN THE ONE-HEALTH CONCEPT

Branka Vidi1, Sara Savi1, S.Bobo2, Nadeda Prica1, M.Radinovi2
2. Department of veterinary medicine, Faculty of Agriculture, University of Novi Sad, Serbia
Abstract
Lately, a great number of challenges have been introduced to human community, which has a great
impact to human and animal health and environment. During the last few decades, there has been
an increase of the number of new, unknown infectious diseases, but also diseases of humans and
animals which were considered eradicated or under control. These diseases have a negative
influence to human and animal health worldwide and they can cause great economical damage. The
consequences are always greatest in the poorest countries! After the analysis of collected data it has
been proved that 64% out of 1.400 pathogens are the ones which can threaten human health and
73% of emerging human pathogens are directly or indirectly zoonotic in nature.
Globalisation and climate changes have a huge impact in the world on the occurrence and
development of infectious diseases in humans and animals. Furthermore, changes in demography,
peoples behavior, technology progress, international transportation and trade, but also changes and
adaptation of microorganisms, are all important factors for the occurrence of infectious diseases.
These diseases are a consequence of emerging new pathogens or changed ones that have already
existed before. Good health is a basic right of every human on Earth. Term or concept One Health
is a strategy which covers several disciplines in all aspects of health protection of humans and
animals and environmental protection. Cooperation and communication of experts from different
disciplines such as human medicine, veterinary medicine, public services, environmental studies,
wildlife protection and surveillance, ecology and food safety all have one aim - One Health.
In the future, veterinary medicine should have a great role in One Health concept. Veterinary
experts have to monitor global trends which influence public health and occurrence of the diseases.
They should also acquire necessary knowledge and expertise, to be efficient when diseases occur.
Worlds need for food of animal origin is higher and higher every year. That is why attention of
veterinary experts has to be adequate and constantly improved. Breeding and health protection of
domestic animals necessarily has to be under monitoring and control of educated staff, who have a
holistic concept of One Health, which integrates a unique approach to human and animal health
and also environment protection.
Keywords: Animal health, emerging diseases, zoonoses, one health
Introduction
Globalization and climatic changes have a wide range of impacts on the occurrence and
development of infectious diseases, both human and animal ones. Moreover, the changes in human
interactions and demography, technology advancement, international transport and trade as well as
changes and adaptability of microorganisms are important factors for the occurrence of infectious
diseases resulting from the emergence of new pathogens, alterations of known pathogens as well as
changes in the distribution and prevalence of known pathogens among new host population or
territories.
Infectious diseases profoundly influence the health status of a population and economy in every
country, affecting both humans and animals; however, the poorest (developing) countries
414
commonly suffer the most severe consequences. The rate of disease emergence and spread is
difficult to predict, having in mind a wide range of important factors implicated in the mechanism
of the disease. In that respect, records and analyses of previous epidemics as well as monitoring and
updating of control and disease surveillance programmes using advanced technologies (satellite
measurements) and new scientific accomplishments are highly relevant, as well as preparing of
some potential intervention strategies in case of disease emergence. Human and veterinary service
institutions should take effective steps and adequate measures for the prevention and control of
infectious diseases and the development of new methods for early, rapid and accurate diagnosing
(nanotechnologies, biosensors, etc.)
According to the World Health Organization (WHO), "Health is a state of complete physical,
mental and social well-being and not merely an absence of disease or infirmity. Good health is the
fundamental right of all people on Earth.
One Health has been defined as "the collaborative effort of multiple disciplines working
locally, nationally, and globally to attain optimal health for people, animals and the
environment". One Health is an interdisciplinary model integrating diverse disciplines such as
medicine, veterinary medicine, public health, environment protection, wildlife protection, ecology,
and food safety aimed at forming unified solutions applicable for the improvement of the health of
humans, animals and the environment. Such an approach proved the best policy for health
protection at global level.
Emerging infectious diseases

The emergence of new infectious diseases in the 20th is linked to increasing contact between
humans and animals, intensification and integration of food production, and the expansion of
international travel (Atlas 2003), as well as intensive climatic changes. Animals are the dominant
factor implicated in the occurrence of infection and development of the diseases, thus, of the 1,415
microbes that are known to infect humans, 61 percent come from animals (Taylor et al, 2001).
Consequently, and in light of some previous incidents a group of health professionals at Rockefeller
University in New York developed the slogan "One World - One Health" with an aim of promoting
and recognizing the association of animals and environmental factors and their effects on human
health.
The avian influenza (HPAI H5N1) epidemic that began in Hong Kong in 1997, forced the global
community to recognize that animal health and human health are closely linked. The HPAI H5N1
virus resurfaced in isolated outbreaks, and in late 2003, severe epidemic of highly pathogenic avian
influenza was registered in South Korea. Delays in international reporting and poor public reaction
in the region resulted in extensive virus spread across the region of Southeast Asia. As a response to
the global threat posed by this pathogen, the Food and Agriculture Organization (FAO), World
Health Organization (WHO), and World Organization for Animal Health (OIE) developed a
strategy and tripartite agreement on mutual activities aimed at preventing infections related with the
animal-human-ecosystem interface (FAO 2013). One Health is therefore an ideal model of joining
health practitioners, veterinarians, ecologist and other profiles. Improvement of epidemiology
centres and services as well as application of modern molecular methods will contribute to the
development of effective measures and strategies for successful implementation of health protection
programs worldwide (Atlas 2003).
Emerging diseases and zoonoses

Discovery and wide application of antibiotics and vaccination programs have long been considered
to fully eradicate the infectious diseases, thus putting the emphasis on health protection programs
415
aimed at cardiovascular and non-infectious diseases. On the contrary, during the past few years we
have been witnessing the emergence of new infectious diseases in both humans and animals, as well
as the diseases that were considered eradicated or under control. The most important diseases,
which represent a global health problem, include Human Immunodeficiency Virus (HIV), Severe
Acute Respiratory Syndrome (SARS), West Nile virus, highly pathogenic avian virus H5N1, and
recently identified influenza virus H1N1. The underlying cause of this phenomenon is complex and
multifold (Brown 2004, Morse 2004) including close contacts between wild and domestic animals
and humans, intensive livestock husbandry, inadequate biosafety measures in livestock production
practice, emerging resistance of bacteria towards antibiotics, intensive people mobility and
interactions, international trade, transport, changes of the eco-systems, etc.
Communication/mobility
Current air traffic enables reaching almost every place on Earth within 36 hours, which is much less
than the incubation period for many of viral and bacterial diseases, suggesting the possibility of
rapid global distribution of the infection even before the manifestation of a single clinical symptom.
Consequently, the disease outbreaks can occur in the regions in which they have never been
recorded before. Thus, West Nile virus was not known in North America before 1999, but it is
widely known at almost all continents. This strongly suggests that health professionals and
veterinarians should be acquainted with the epidemiological and clinical aspects of the diseases,
which are still uncommon in their countries, and be able to recognize them. Such diseases
encompass some highly contagious diseases such as foot and mouth disease, rinderpest (cattle
plague), African swine fever, atypical avian pest, highly pathogenic avian influenza virus, etc
(Jones 2008).
Modern communication and OIE health information system enabled fast flow of information of
outbreak and spreading of infections, enabling identification of disease reservoirs and
implementation of rapid and effective control measures by the veterinary service. Moreover,
relevant information on the spread of the infection and measures (aimed at prevention and
elimination of consequences) taken by the responsible authorities will be available to the public. In
that respect, veterinary service must prepare effective and adequate plans and control strategies
including adequately trained staff and communication resources to minimize potential hazards for
human and animal health. Lack of proper coordination within the entire system for health protection
can result in severe impact on the safety of foods of animal origin and the consumers, as well as
substantial financial losses to the producers.
International trade
Dramatic increase in goods turnover on international market during the past few decades resulted
from the efforts to remove the barriers and enable the access to world markets to all participants in
the international trade. The global trade of animals and products of animal origin has enormously
expanded as the result of reduction or elimination of import taxes as well as the advancements in
the technology of storage and preservation of food. It is also linked with an increase in global
consumption associated with the improved living standards, especially in economically developed
countries.
Since the 1960, global meat production has tripled, milk production doubled and production of eggs
is almost four times higher (Speedy, 2003). Intensive turnover and movement of animals and foods
is associated with increased risk of the transmission of infectious diseases, above all food borne
zoonozes. Considering the increased risk, WTO (World Trade Organization) has taken an active
role in the development of regulations and policies aimed at protecting animal health and ensuring
416
food safety as the key elements of international trade. OIE provides scientific support on animal
turnover regulation to WTO, whereas FAO and WHO (via Codex Alimentarius) provide the
guidelines to the regulations pertaining to food products, including foods of animal origin.
Wars and terrorism

War is a restraining factor that influences animal health in many aspects. It may lead to failure of
specific programs for disease control as well as total collapse of veterinary service and
infrastructure. War conflicts cause serious problems related to food production, movement of
refugees together with their animals to other regions. Bioterrorism added new and worrisome
dimension in the process of disease control. The majority of potential agents used so far are of
zoonotic nature, thus, both humans and animals would be endangered in case of biological warfare
(Davis 2004).
Changes of the climate and other environmental factors

The relationship between the animal husbandry and environment and health is a bi-directional
interaction. On one hand, animals may have negative effects on the environment, while on the other
hand, animal health and productivity are greatly affected by the same ecological burden (Sherman
2010). Ruminants are an important source of gaseous emission, contributing to global warming.
Livestock production has become an important factor in environmental degradation through
deforestation, particularly in Latin America. In regions with intensive livestock production, excess
animal waste (manure and slurry) may cause pollution of water streams. Overgrazing results in soil
degradation, especially in semi-arid regions. At the same time, human and animal diseases can
result from environmental impact or climatic changes. Global warming is associated with spread of
Bluetongue disease in Europe (Purse et al. 2005), Hantavirus infection in North America, malaria
epidemics in Africa and South America, Dengue fever in Asia and cholera in South Asia (Anyamba
et al 2006).
The role of a veterinarian in the One Health concept

There are several phrases and terms associated with One Health such as united health, integrated
health, one medicine, one world-one medicine; however, disregarding the definition, this concept
should represent a global strategy of multidisciplinary collaboration in all aspects of human and
animal health protection, and environment protection (Gibbs 2013). Such a multidisciplinary
approach should be accomplished at local, national and global levels to provide adequate protection
of human and animal health. Global trends and numerous technological advancements from the past
few decades have contributed to increased development and worldwide spread of zoonotic diseases.
In spite of substantial social advantages associated with globalization, it also posed a range of
challenging issues in view of domestic animals, human health and environment protection.
Veterinary medicine should play crucial role in the future of the One Health concept. The
professionals and expert in this field must follow global trends affecting animal health and diseases
and improve their knowledge and expertise to effectively address future challenges (FAO 2013).
Veterinarians are the only health professionals whose formal training is based in comparative
medicine, with in-depth studies of the health and diseases of multiple species (Chaddock 2012, Pal
2014) Veterinarians are also trained in public health as it pertains to livestock production and
environmental assessments associated with animal health problems and diagnosis (water, feed, and
air quality, etc...). Veterinarians are active in public health by working closely with physicians and
other health professionals on disease investigation, surveillance and effective response to potential
417
disease outbreaks (Hoblet 2002, Pal 2014). Veterinarians in the zoo and wildlife sectors are
acquainted with wild animal diseases, thus able to be a part of interdisciplinary teams composed of
wildlife biologists, ecologists and other specialists (FAO 2013, Gibbs 2013).
Consequently, the veterinary medical profession needs to be actively involved in the One Health
approach with an aim of human, animal and environmental well-being. Potential barrier for
veterinarians and students of veterinary medicine might be the identification of career pathways and
employment opportunities for working on One Health issues in a global context (Chaddock 2012).
In addition to technical competence, other important attributes are strong leadership abilities,
teamwork, foreign language proficiency, improved communication skills, cross-cultural experience,
adaptability and flexibility and even advanced training in the other medical specialty areas such as
epidemiology, toxicology or virology.
Conclusion
Veterinary medicine should play crucial role in the future of the One Health concept. The
professionals and expert in this field must follow global trends affecting animal health and diseases
and improve their knowledge and expertise to effectively address future challenges. As a
consequence of modern technologies, some local changes or incidents may result in effects of
global importance. This is particularly significant in case of disease outbreaks, since current
globalization era is associated with increased number and incidence of infectious diseases,
especially zoonoses. Intensive communication and trade with animals and agricultural products
provided conditions for rapid transmission of the disease throughout the world. Infectious diseases
arise as a consequence of mutual contact between humans and domestic and wild animals, as well
as of environmental changes. To the purpose of preventing disease transmission and potential
negative outcomes, comprehensive research and adequate actions are of vital importance.
Multidisciplinary approach and mutual acting of veterinarians, physicians, biologists, agronomists
and ecologists, is the prerequisite for successful addressing this issue.
Acknowledgments
The presented work is a part of the research done in the projects TR31071 and 31084, granted by
the Serbian Ministry of Education and Science.
References
1.
2.
3.
4.
5.
6.
7.
8.
Anyamba A., Chreutien JP., Small J., Tucker CJ, Linthicum KJ: Developing global climate anomalies
suggest potential disease tisks for 2000 -2007. Internat J Hilth Geogr., 5, 60-68, 2006.
Atlas R.: One Health: its origins and futire: Curr. Trop. Microb. Immunol., 365, 1-13, 2013.
Brown C.: Emerging zoonoses and pathogens of pablic health significance: Rev. Sci. Tech. Off. Int.
Epiz. 23, 435-442, 2004.
Chaddock M.: Academic Veterinary Medicine and One health Education; It is more than clinical
applications. J.Vet.med.Edu. 39, 241-246, 2012.
Davis RG. The ABCs of bioterrorism for veterinarians, focusing on Category B and C agents.JAVMA
224,1096-1104, 2004.
FAO.The State of Food and Agriculture 2009: Livestock in the balance.Rome FAO p.75-93, 2009.
Gibbs S.,Gibbs E.: The historical, present, and futire role of veterinarians in One Health. Current Top.
Microbiol. Immunol..365, 31-47, 2013.
Hoblet KH., Maccabe AT., Heider LE: Veterinarians in population health and public practice. J Vet.
Med. Educ. 30, 232-239, 2002.
418

9.
10.
11.
12.
13.
14.
15.
Jones KE, Patel NG.,Levy MA., Storeygard A., Balk D., Gittleman JL., Daszaik P.: Global trends in
emerging infectious disease. Nature 451, 990-993, 2008.
Morse SS. Factors and determinants of disease emergence. Rev.Sci. Tech. Off. Ont Epoz. 23, 443- 451,
2004.
Pal M., gebrezabiher W., Rahman T.: The roles of veterinary, medical and environmental professionals
to achieve One health. J.Adv. Vet.Anim.res., 1 (4) 148-155, 2014.
Purse BV., Mellor PS., Rogers DJ., Samuel AR., Mertens PPC., Baylis M.: Climate change and the
recent emergence of bluetongue in Europe. Nat.Rev.Microbiol. 3, 171-181, 2005.
Sherman D.: A Global veterinary Medical Perspective on the Concept of One health: Focus on
Livestock. 51, 281-287. 2010.
Speedy AW. Global production and consumption of animal source foods. J.Nutr. 133, 4048-4053, 2003.
Taylor L., Latham S., Woolhouse M.: Risk factors for human disease emergence. Biol.Sci. 356, 983989, 2001.
419
THE CONCEPT ONE WORLD, ONE HEALTH IN THE MACEDONIAN STATE

INSTITUTIONS
Misho Hristovski1*, Blazho Janevski2, Martin Josheski2
1
Faculty of veterinary medicine, Skopje, Macedonia

Food and Veterinary Agency, Skopje, Macedonia
2
Abstract
One World, One Health concept is a unique and significant important opportunity for veterinary
medicine to collaborate with human medicine and public, wildlife and environmental health for the
good of all. Nearly 60% of infectious diseases in people have animal origin. The prevalence of
infectious diseases in the last 40 years increased and more than 75% of the emerging infectious
diseases in humans have animal origin. The concept One World, One Health need to establish
closer professional interactions, collaborations and educational opportunities between veterinary
and medical professions allied together in the improvement of the public health and animal health at
local, national and global level in search of better health for all: people, animals and the ecosystem.
It need to minimize the risk of global impact of epidemics and pandemics as a consequence of
emerging infectious diseases, food-borne pathogens with enhancing the state institutions, creating
well prepared emergency response and surveillance systems.
Doctors of veterinary medicine have obligations and responsibilities to protect people`s health and
wellbeing in all the areas in which they work and are incorporated: food security, food safety,
emerging infectious diseases through the Food and Veterinary Agency and the Faculty of veterinary
medicine. Doctor of medicine have obligations and responsibilities to protect people`s health and
wellbeing through the State Sanitary and Health Inspectorate and Institute of Public Health as a part
of the Ministry of Health.
Demographic changes including global population growth, uncontrolled urbanization, socioeconomic changes, agricultural changes, changes in pathogens adaptation and climate change
leading to increased epidemic potential and changes in public health are the main factors that lead to
the necessary of creation a new network. Within the One World, One Health strategic framework,
there need to be build new network which will be nimble enough to be able to predict, adapt and
respond rapidly to any new health emergencies.
The aim of this article is to show the strengths and weaknesses of state institutions in the concept
One World, One Health, to provide guidance to improve the situation and to show a clear picture of
the current situation in Macedonia.
Keywords: Concept One World-One Health, Infectious diseases, State Institutions
Introduction
One health is a modern term and global strategy that describes and expands the cooperation and
communication between various scientific disciplines at local, national and global level in search of
better health for all: people, animals and the ecosystem. The concept implies that people do not
exist in isolation, but are part of a living ecosystem in which the actions of one member affect
overall activity of all other members. The One World One Health concept proposes an international,
interdisciplinary, cross-sectorial approach to surveillance, monitoring, prevention, control and
mitigation of emerging diseases, as well as to environmental conservation. It recognizes the
linkages between animal, human and ecosystem health domains. The significance of the One World
420
One Health concept is to diminish the risk and minimize the global impact of epidemics and
pandemics due to emerging infectious diseases by enhancing livestock and wildlife disease
intelligence, surveillance and emergency response systems at national, regional and international
levels, and by supporting them through strong and stable public and animal health services and
effective national communication strategies. 1
The mission of One Health is the establishment of closer professional interactions, collaborations,
and educational opportunities across the veterinary and medical professions, together with their
allied sciences, in order to improve public health and animal health. Principal drivers for One
Health are the increasing threats posed by emerging zoonotic diseases, foodand water - borne
diseases and environmental changes, which demand a fundamentally new, integrated effort by
multi-disciplinary health professions. In addition, One Health is built on the foundation that the
health of people, animals and our environment represents a continuum where improvements in
health in one domain often produces positive health affects in the others; thus, plans and actions to
improve health demand collaborative efforts across disciplines, organizations and communities. 9
Although the concept of One Health is a modern and growing field of research, its roots date back
at least two centuries. In the XIX century, Dr. Rudolf Virchow (1821-1902), a German physician
and pathologist, formally admitted the connection between the health of humans and animals and
said: between medicine of animals and humans there is no dividing line-nor it should be. The
subject is different, but gained experience constitutes the basis of all medicine. His followers
continued to promote the concept, but for practical purposes, despite the ongoing revelations about
commonalities of physiological and pathological characteristics of humans and animals, the concept
loses its value, and human and veterinary medicine developed as separate professions. 7
In the 1960s, the veterinary epidemiologist and parasitologist Dr. Calvin Schwabe coined the phrase
"one medicine" and called for a unified approach between veterinary and human medicine to
combat zoonotic diseases. His concept is based on common knowledge of anatomy, physiology,
pathology and etiology in all species and results in a "value added knowledge" which cannot be
acquired by one-sided approach. The term One Medicine is highly exploited by Dr. Schwabe in his
1984 book Veterinary medicine and human health" to describe the synergies that will arise from
the cooperation of human and veterinary practitioners and scientists. 7
Within the One World, One Health strategic framework, there was consensus to build on the
existing approaches and mandates of international institutions and other partners to form a flexible
network a network that is expected to be nimble enough to be able to adapt, form new coalitions
and respond rapidly to any new health emergencies. Internationally, this network would be built on
a number of structures and mechanisms that have been already established by agencies such as FAO
(Food and Agriculture Organization), OIE (World Organization for Animal Health), WHO (World
Health Organization) and UNICEF (The United Nations Children's Fund). Building on these
structures does not mean the integration or fusion of roles among different specialized international
agencies; the goal is rather to improve communication, coordination and collaboration. 10
FAO explained that the thrust of the One World, One Health concept is to diminish the risk and
minimize the global impact of epidemics and pandemics due to emerging infectious diseases by
enhancing livestock and wildlife disease intelligence, surveillance and emergency response systems
at national, regional and international levels, and by supporting them through strong and stable
public and animal health services and effective national communication strategies. 11
Nearly 875 of the 1,461 infectious diseases of people are of animal origin. In the last 30 years the
prevalence of infectious disease has increased such that 75% of the emerging infectious diseases in
humans are of animal origin. The increasing occurrence of emerging infectious diseases indicates
that bridging animal, human and environmental health through the One Health concept is becoming
even more critical. Veterinarians can be, and often are, the first line of defence for zoonotic diseases
421
as well as for various toxicants that occur naturally or by intentional terrorist attack. Veterinarians
are in contact with a wide variety of domestic and free-ranging animals, effective and efficient
diagnostic systems, and local and national regulatory systems for animal health, food safety, and
public health. One Health represents a unique and significant opportunity for veterinary medicine to
collaborate with human medicine and public, wildlife and environmental health for the greater
good. An integrated approach is the key to promoting One Health, and this approach is best
developed by ensuring that veterinarians are extensively involved in collaborative teams,
particularly in leadership roles. 12
Doctors of veterinary medicine (DVM), through everyday activities have an obligation and
responsibility to protect the health and welfare of people. 7The veterinarian is the only health care
professional likely to see both people and their animals, so he/she therefore has an awareness of the
potential threat of zoonotic disease and has the ability and responsibility for detecting
zoonotic/emerging diseases. Fortunately, veterinarians have considerable training in comparative
medicine, zoonoses, and public health. Physicians on the other hand do not receive extensive
training in comparative medicine and zoonoses. Therefore veterinarians are in a better position to
discover public health threats than physicians. They are also in an ideal position for establishing a
disease surveillance system using pets as sentinels of disease exposure in the home environment and
in the wild. In addition, veterinarians in companion animal practice could work together with family
physicians by using common tools such as family genogram with pets; this tool is being presented
to family physicians and introduced to veterinarians as well. Veterinarians, regardless of their field
of practice, all play a significant role in human health and animal health. The future will most likely
bring more collaborations of veterinarians from all fields with multiple professions such as public
health, human medicine, bio-engineering, animal science, environmental science, and wildlife.
Together, we are stronger to fight disease, and we are, indeed, wiser. 2
Veterinarians in all areas of the profession have opportunities and responsibilities to protect the
health and wellbeing of people in all the areas in which they work: food security, food safety,
antibiotic sensitivity testing, and research on zoonoses, emerging infectious diseases, ecosystem
protection, comparative medical research, and human physical/mental health. The veterinarian is the
only health care professional likely to see both people and their animals, so he/she therefore has an
awareness of the potential threat of zoonotic disease and has the ability and responsibility for
detecting zoonotic/emerging diseases. Fortunately, veterinarians have considerable training in
comparative medicine, zoonoses, and public health. The future will most likely bring more
collaborations of veterinarians from all fields with multiple professions such as public health,
human medicine, bio-engineering, animal science, environmental science, and wildlife. 2
Increases in the emergence or re-emergence of animal and human infectious diseases have been
evident in many parts of the world for several years. Over 1600 human pathogens are now
described, an average of three new diseases is reported approximately every 2 years, and a new
infecting organism is published every week. It is estimated that approximately 75 per cent of new
human pathogens reported in the past 25 years have originated in animals and the risk of zoonoses
is predicted to continue to increase. 16
Taylor et al. constructed a database including 1415 identified species of infectious organisms
known to be pathogenic to humans. They derived the data from several sources and included very
recently described human pathogens, with 217 viruses and prions, 538 bacteria and rickettsia, 307
fungi, 66 protozoa, and 287 helminthes in total. Of these 1415 human pathogens, 868 (61%) were
considered zoonotic and 175 pathogenic species were associated with emerging diseases. This
analysis showed that zoonotic pathogens are more likely to be associated with emerging than nonemerging diseases. 4
422

The main objective of this research is to show the real structure of state institutions in terms of the
concept One world, one health, one medicine for all and the position of the veterinarians,
physicians and other medical personal. Therefore, with a broader explanation, it is given a clear,
concise and factual support of the official state institutions in terms of their responsibilities, tasks
and targets as government institutions. In this research it is given the position on institutional level
in the terms of the concept One world, one health, one medicine for all. The organization of the
state service in terms of the concept One world, one health, one medicine for all is clearly shown
by various enacted laws that govern their tasks, objectives and responsibilities. In this study we
used all laws that are currently in force in the Republic of Macedonia in terms of the position of
state institutions, with one main purpose, to explain the position and the real situation of the state
institution, with their responsibilities and tasks and to explain the position of the veterinarians and
physicians within the concept One World, One health, One medicine.
Results
The concept One World, One Health describes and expands the cooperation and communication
between various scientific disciplines at local, national and global level in search of better health for
all: people, animals and the ecosystem. The significance of the One World One Health concept is to
diminish the risk and minimize the global impact of epidemics and pandemics due to emerging
infectious diseases by enhancing livestock and wildlife disease intelligence, surveillance and
emergency response systems at national, regional and international levels.
Governments and scientists worldwide recognized that greater interdisciplinary collaboration was
required to prevent and control zoonoses, and that such collaboration should include not only
physicians and veterinarians, but also wildlife specialists, environmentalists, anthropologists,
economists and sociologists, among others. The expression One Health was proposed as a concept
to foster such interdisciplinary collaboration. 14
According to the One Health Commission, One Health is the collaborative effort of multiple health
science professions, together with their related disciplines and institutions working locally,
nationally, and globally to attain optimal health for people, domestic animals, wildlife, plants, and
our environment. Besides that, The World Organization for Animal Health not specifically defines
the concept One Health as a collaborative and all-encompassing way to address, when relevant,
animal and public health globally. This collaboration should not be limited to only the international
level, but must be translated as a new and fundamental paradigm at national levels. The One
Health Global Network considers that the aim of One Health is to improve health and wellbeing
through the prevention of risks and the mitigation of effects of crises that originate at the interface
between humans, animals and their various environments. 14
The organization of the human health sector in Macedonia is organized by the Ministry of Health,
Faculties of Medicine, State Sanitary and Health Inspection and Institute of Public Health of the
Republic of Macedonia. The organization of the animal health sector in Macedonia is organized by
the Food and Veterinary Agency and the Faculty of veterinary medicine-Skopje. The control of the
work of health professionals, physicians, dentists and pharmacists is performed by three chambers,
while control of the work of official veterinarians and other graduates doctors of veterinary
medicine is performed by the Veterinary Chamber of Republic of Macedonia. The Physicians
Chamber of the Republic of Macedonia, Pharmaceutical Chamber of Republic of Macedonia and
the Dentist Chamber of Republic of Macedonia are responsible, under the supervision of the Health
Insurance Fund, for the licensing and conduct of doctors, dentists and pharmacists respectively. In
addition to these supervisory bodies, there are the Macedonian Medical Association and the
423
Macedonian Nursing Association. Veterinary Chamber of Macedonia is independent and legal

entity responsible to protect and promote the professional and scientific interests of doctors of
veterinary medicine. All individuals who work as doctors of veterinary medicine in the country
must be members of the Veterinary Chamber. The Chamber is responsible to create and keep a
register of members of the Chamber, to give or revoke licenses for work, to control and monitor the
operation of doctors of veterinary medicine, determine code of professional ethical obligations and
rights and supervise their implementation by its members, to establish a Court of Honor, to plan and
organize courses for improving professional skills, scientific knowledge and expertise on current
and important issues of veterinary interest etc. (Figure 1).
Figure 1. Organization of the human and veterinary health care in Macedonia
The Health Care Law regulates issues related to the system and organization of health care and the
provision of health activity, guaranteed rights and the needs and interests of the state in the
provision of health care, health facilities, employment, rights and duties, responsibilities,
evaluation, termination of employment, protection and decision-making rights and obligations of
health care workers and associates, quality and safety in the health industry, chambers and
professional associations, advertising and advertising of health activity, the health care activity in
extraordinary conditions and supervision over health work. Health care, in terms of this Law,
includes a system of social and individual measures, activities and procedures like preservation and
improvement of health, prevention, early detection and eradication of diseases, injuries and other
disorders health caused by the impact of working and living environment, timely and effective
treatment and health care and rehabilitation.5
424
Public Health Law regulates the implementation of the main functions and tasks of the public health
system of public health, public health emergencies and the funding of public health. The purpose of
Public Health Law is to preserve and promote the health of the population, to allow the
implementation of the main functions and tasks of public health through organized activities and
measures to be taken by the authorities, local government units and other legal entities and
individuals in cooperation with medical institutions, to promote and strengthen inter-agency
cooperation in the implementation of the core functions of public health, to promote and strengthen
cooperation between relevant ministries and local government and public and private sector and
citizens in the preservation and promotion of health, to provide an adequate response in the event of
a public health need and urgency and the emergence of public health emergency, to ensure the
implementation of international health regulations and to regulate specific public health issues that
are not regulated by other laws. Public health is a system of knowledge and skills for preventing
disease, prolonging life and promoting health through the organized efforts of society. Through the
system of public health monitor and analyze the health status of the population in order for it to be
improved by impact factors of health risk factors such as the environment, germs, lifestyle and
socio-economic factors. The public health is based on the principles of responsibility for health and
the leading role of the state in preserving and improving the health of the population, wide-ranging
measures and activities aimed at the whole population, and on the socio-economic determinants of
health and the most significant risk factors, multidisciplinary basis and inter-sectorial cooperation,
collection of data through quantitative and qualitative methods and partnership with the population.
Basic functions of public health are monitoring and evaluation of health and wellbeing of the
population, identification, investigation and mitigation of health problems and health hazards in the
community, protection of health needs assessment and activities necessary to ensure the protection
of health, preventing the disease through steps of primary and secondary prevention, health
promotion and health education, proposing the adoption and enforcement of laws and regulations
that ensure the protection of health, particularly through food safety, water, air, and land the job,
providing competent multidisciplinary public health staff, supporting and conducting research for
health, development and planning of public health policies, preparation and management of public
health emergencies, including prevention, response and mitigation and providing a cross-sectorial
partnerships and community participation to promote health and reduce inequalities. 13
According to the Veterinary Health Law, Veterinary Public Health is done as primary, secondary
and tertiary veterinary public health. Primary veterinary public health covers the activities of the
application of good hygiene practice, good manufacturing practice, HACCP and other procedures in
the buildings and farms. The secondary veterinary public health is the sum of certain activities of
public interest. Veterinary public health is performed by the competent authority, in order to
achieve a high level of food safety, consumer protection through official control of facilities for
production and processing of food of animal origin, as well as protection the environment from
animal by-products, contaminants and pathogens. Secondary veterinary public health includes
certification of veterinary public health, the official controls, supervision and monitoring of the
activities of veterinary public health facilities and holdings, including markets, slaughterhouses,
dairies, other facilities for processing and packing, transport, storage, facilities for sale of food of
animal origin to retail and wholesale including their approval, control, supervision and inspection of
their work, the application of good hygiene practice, risk analysis and record keeping, systematic
preparation and training of official and authorized veterinarians and associations of producers of
good hygiene practices, GMP and HACCP and the implementation of measures in the annual order
for veterinary public health. Secondary veterinary public health is conducted from the national
reference laboratories in the name of the competent authority to ensure compliance with
microbiological criteria and regulations for the control of residues, radionuclides, and other
biologically active substances, products and raw materials of animal origin, water for watering the
animals, food contaminants and other banned substances through laboratory testing. Tertiary
425
veterinary public health is performed by the higher education and scientific research institutions in
the field of veterinary medicine and includes expert advice, cooperation with the competent
authority, expertise and education, biochemical, hystochemical, cytological, parasitological,
microbiological, immunological, radiological and radiochemical analysis of products and raw
materials of animal origin, food, water and air disinfection, decontamination, sanitation,
deodoration and eradication of pests and the introduction of new and improved methods for
laboratory analysis of contaminants and residues in products, raw feed and professional and
educational activities for the competent authority. 18
The Faculty of Veterinary Medicine Skopje (FVM-S) has teaching, research and applicative
activity in field of veterinary medicine and veterinary public health. The Mission of FVM-S is
realized via organizing study, transfer of knowledge, development and promotion of the education
and science in veterinary health in Republic of Macedonia, development of creative abilities,
preparing students for profession of doctor of veterinary medicine which needs professional
knowledge and ability for scientific approach in the work, promoting of the technological
development of the veterinary profession and building positions for the future. Besides the care for
the animal health, veterinary medicine has important role in the public health via obtaining healthy
and quality food from animal and plant origin. Veterinarians, with their undisputable role in the
production and trade of food are promoting confidence of the consumers and successfulness of the
livestock production. 19
For educational and research activities, the FVM-S is organized in scientific and educational unit institutes. There are three teaching-scientific organization units in FVM-S: Veterinary Institute,
Institute for Food Safety and Institute for Reproduction and Biomedicine. All Institutes of the
Faculty are constituted by different departments, laboratories and clinics where the processes of
education, research and application are effecting. The Veterinary Institute incorporates laboratories
for diagnosis of infectious diseases affecting farm animals and humans, being included and
regulated by the state policies. Another unit of the Veterinary Institute is the University Veterinary
Clinic which offers a wide range of diagnostic, surgical and therapeutically prospects. The Food
Institute includes departments focusing on food safety, food quality and veterinary public health
issues. The laboratories are specialized in testing food safety and quality for human consumption,
using different microbiological, chemical and nutritive analysis methods. They also offer an
opportunity for animal food and water analysis. The Institute for Reproduction and Biomedicine
incorporates departments and laboratories which focus on issues regarding animal breeding,
reproduction and animal welfare.20
The Food and Veterinary Agency of Republic of Macedonia (FVA) is an independent body of the
of the state administration with a legal entity, with its adoption of the Law on Food Safety (Official
Gazette No. 157/10) was formed on 01.01.2011 by merging the Office Veterinary Directorate of the
Ministry of Agriculture and Forestry and Food Inspectorate from the Ministry of Health. By
integrating the responsibilities of these two bodies in the composition and formation of the Agency
as an independent institution for Food Safety and Veterinary overcome the overlapping
responsibilities the Veterinary and Food and achieve optimal utilization of available funds and
resources in terms of staffing, equipment and facilities. It is responsible for activities in the area of
food safety and animal feed, implementation, control, supervision and monitoring of veterinary
activities in the field of animal health, welfare, veterinary public health and control of national
reference laboratories and authorized providing adequate support for the Agency. FVA is
responsible for the coordination of legislation and control systems for issues of food security and
food for animals between the competent institutions in the country, as well as communication with
the institutions of the European Union. FVA is a contact point for EFSA, RASFF and Codex
Alimentarius. In their work, FVA aims to provide constant care to protect human health from
diseases transmitted through food, consumer protection against fraud and their open, honest and
timely information about possible dangers of food, protection of animal health and their well-being
426
and protection of the environment from pollution by waste of animal origin, through the control of
the implementation of regulations harmonized with EU standards as well as international standards
ratified by the Republic of Macedonia. The vision of FVA is that FVA need to be recognized as an
institution that is synonymous with food security by providing the protection of public health and
protect the health and welfare of animals, and protecting the interests of consumers, through the
application of modern scientific and technical solutions in the field of food safety and animal feed.
FVA leads constant concern for the protection of human health from diseases transmitted through
food and through animals, protecting consumers from being misled and their transparent and timely
information on the potential dangers of food, protect the health of animals and their welfare as well
as protection of the environment from pollution by waste of animal origin, through the control of
the implementation of regulations harmonized with EU standards and international standards
ratified by the Republic of Macedonia. 21
FVA in accordance with European principles for traceability of food from farm - to fork takes the
function as the sole competent authority to control the safety of food and feed, implementation,
control, supervision and monitoring of veterinary activities in the field of animal health, welfare,
veterinary public health and control of laboratories that provide support for FVA. The main goal of
the Food and Veterinary is providing a high level of protection of health and consumer interests
when it comes to food safety. 21
The Institute of Public Health of the Republic of Macedonia provides technical assistance to the
Ministry of Health of the Republic of Macedonia in the development of medium and long-term
plans for public health, including public health programs in the field of health protection, health
promotion, population screening and monitoring and control of communicable and noncommunicable diseases, builds and implements professional doctrinal positions in the area of public
health, prepare annual national reports on relevant aspects of public health for the Ministry of
Health and propose measures for overcoming public health problems, prepare standards for activity
and coordinate, monitor and evaluate the operation of the Centres, collect, prepare and analyze
results and data files pursuant to the record in the field of health, develop and provide programs for
continuous professional development in the field of public health for employees of the Institute and
in the centres, and other target groups, in cooperation with the centres and other educational
institutions, coordinate and monitor the implementation of public health activities arising from
national public health with centres, conducts and coordinates public health measures in case of
epidemics and other emergencies on the territory of the Republic of Macedonia, in cooperation with
other institutions, organize and conduct research in the field of public health, monitoring and
assessment of the risks caused by physical, chemical, biological and radiological agents in the
environment, with particular reference to ionizing and non-ionizing radiation and act as a reference
laboratory in human medicine. The Centres for Public Health perform different tasks, like
identification and preparation of medium and long-term work plans for the implementation of
public health activities, including health promotion, population screening, monitoring and control of
communicable and non-communicable diseases in the area covered by the centre, preparation of
annual reports to evaluate the health of the population, and propose measures for overcoming public
health problems in the area covered by the centre, collection, processing and analysis of records and
data stipulated by law, monitoring, analysis and evaluation of environmental health and sanitary
conditions with risk assessment, and to propose measures for overcoming public health problems,
study and monitoring of hygiene and environmental health conditions in terms of air protection,
food safety and the general use items, drinking water, surface water, wastewater and solid waste,
and others, monitoring the nutrition of the population, and the diseases and conditions that are the
result of improper diet and recommend measures for their removal, microbiological and physicalchemical laboratory services, analysis and evaluation of laboratory data, and propose measures for
overcoming public health problems, monitoring, analysis, implementation and evaluation of
measures to protect the population against infectious and other diseases, epidemics and other
427
emergencies and carry out active and passive immunization, implementation of preventive measures
of disinfection, fumigation and pest control of public health concern and preparation of operational
plans for their area within the national strategy to protect the population in case of public health
emergencies. 13
Sanitary and Health Inspection Law regulates the competence and organization of sanitary and
health inspection, the appointment of sanitary and health inspectors, powers and procedures for
inspection. Sanitary and health inspection includes inspection over the implementation of laws and
regulations enacted laws relating to sanitary - hygienic, epidemiological and health of the
population, health insurance records in the healthcare field. Inspection includes the space, facilities,
premises and equipment, activities and persons performing medical practice, as well as persons who
in any way have a negative impact on human health. In the area of sanitary-hygienic and
epidemiological protection, the inspectorate supervises the implementation of general and specific
measures to prevent the occurrence, early detection, prevention of spread and eradication of
infectious diseases and infections, safety of items for general use in the production and marketing
as: toys, tools for maintaining cleanliness, beauty products, substances for the production and
packaging of these products and certain items for use come in direct contact with the skin and
mucous membranes, meeting the requirements for the activity in accordance with special
regulations in facilities under the authority of the sanitary and health inspection, sanitary and
hygienic conditions in the facilities, space, facilities and equipment in which the medical activity
and activities in the fields of education, culture, social welfare, sport and recreation, public
transportation, hospitality, tourism, trade and other industries, persons, goods and vehicles at border
crossings, and in relation to the protection of human health from the entry and spread of infectious
diseases etc.17
Veterinary Health Law regulates the organization and responsibility in performing veterinary
activities, principles and procedures for implementation of activities related to the protection of
animals and people from diseases transmitted by animals, products, animal by-products and items,
action against infectious animal diseases, including zoonoses, the work of the Veterinary Chamber
and other issues of importance to veterinary services. This Law regulates the control and eradication
of animal diseases, the general requirements for marketing of animals and products, import, transit
of animals, products and items, the financing of health care, animal and veterinary public health and
other issues in relation to the performance of the veterinary health.18
Veterinary activities of public interest in the Republic of Macedonia implements the Food and
Veterinary Agency in cooperation with other bodies and institutions, through the competent
authority, the Director of the Food and Veterinary Agency of Republic of Macedonia and the
national reference laboratory when working for the Agency on a contract basis. The main
responsibilities and activities of the Food and Veterinary Agency are surveillance, diagnosis,
prevention and eradication of infectious animal diseases and zoonoses and meeting national and
international reporting obligations, official controls for issuing certificates for animal health and
veterinary public health, keeping records and identification and registration of animals for animal
health protection, maintaining a high level of health protection in animal productivity and welfare
and protection of people and the environment from harmful agents that are transmitted by animals,
raw materials, products, animal by-products and items, planning and proposing measures for
disinfection, decontamination, sanitation, deodoration and extermination of pests, control the
production, sale and use of veterinary medicinal products and other products intended for use in
veterinary, control of production, sales and use of the feed, monitoring, analysis and assessment of
environmental impact on nature and animal health, establishing and controlling hygiene and
technological processes and facilities and holdings and training and professional development of
doctors of veterinary medicine, raising awareness and informing growers, manufacturers and the
public regarding the objectives, methods and procedures.18
428
The official veterinarian has the rights and duty to implement measures for animal health
protection, prevention, control and eradication of animal diseases, surveillance and monitoring of
animal diseases and implementation of veterinary controls for storage, production and transport of
animals, assesses the market value of slaughtered or killed animals, products, by-products of animal
origin and animal feed, control of compliance with legislation on veterinary centres for reproduction
and artificial insemination of semen for artificial insemination, eggs and embryos, as well as
holdings of animals for breeding, farms for livestock, poultry and fish apiaries, animal reserves and
zoos, perform or taking control of sampling, monitoring the performance of laboratory tests on live
animals, products, animal by-products and raw materials, including sampling of water and feed,
implementing measures for the supervision of the side effects of biological and chemical
contaminants that are subject to veterinary control, reported immediately to the Director that must
be reported, perform official control, supervision and monitoring of the activities of veterinary
public health, slaughterhouses, dairies, other facilities for processing and packing, transport, storage
facilities for wholesale and retail of food of animal origin, including their approval and compliance
with the conditions of work, inspection and review of ongoing and appropriate application of good
hygiene practices and risk analysis, management and storage of records, compliance with
microbiological criteria and regulations for residues, contaminants and prohibited substances
through laboratory analysis of samples, control the production, sale and use of food and water for
animals, controls on products of animal origin that could pollute the environment, inspect and
control the implementation of regulations for the protection and welfare of animals, supervise the
implementation of the system for the identification and registration of animals, control the sale and
use of veterinary medicinal products and other products, issuing certificates and other documents in
accordance with the regulations of the veterinary health and conducts border veterinary controls for
the import and transit shipments of animal products and animal by-products. The Official
veterinarian is a doctor of veterinary medicine, employed by the competent authority under the
provisions of the Law on civil servants, to have undergone formal professional and administrative
training in a certain period following the program and passed the exam for official veterinarian,
organized by the competent authority and continually update their knowledge, in accordance with
the program of the competent authority. 18
From the other site, responsible for control and inspection of the food safety are food inspectors,
official veterinarian, the state inspector of agriculture and the state phytosanitary inspector. Based
on Food safety Law and regulations adopted under this law as a state official veterinarian inspector,
the official veterinarian based on contract, have the rights and duty to seek information and original
documents pertaining to the production and distribution of controlled, for establishing own
supervision file and copy documents, exercise control in all stages of production, processing and
distribution in the food operators, control the products and materials that come into contact with
food at all stages of production, processing and distribution, exercise control and approve the import
of food of animal origin and animal feed, take samples for laboratory analysis and testing and to
give further measures to remove the shortcomings identified, prohibit the manufacture and trade of
food that is a risk to human health, to order destruction or destroy food is not safe, to order removal
of persons in the production and trade of food that is found to be carriers of infectious diseases
transmitted by food and take other measures to protect human health from the risk of unsafe food, to
take samples from live animals, and in case it is necessary to kill animals for sampling, and to take
samples of products, animal by-products and food for animals for laboratory tests and to prohibit
movement of animal products, animal by-products and animal feed to get the final results of
samples taken, to perform tests on animals, examine on products, animal feed, objects and water
used for cattle under the provisions of this Law and other laws in the field of veterinary, to performs
health control of animals, products and animal by-products, veterinary products, animal feed, water
and items that are used for cattle, take and send samples for laboratory tests in a reference
laboratory, organize and supervise the disinfection of vehicles, facilities and equipment, and, where
429
appropriate, the customs warehouses, free warehouses, free zones inside the country, prohibit
loading, reloading and unloading of animals, products, animal by products, animal feed and items
if you do not meet the conditions prescribed by this and other laws, to prohibit the use of stables and
other facilities for keeping and breeding of animals and facilities for loading, reloading and
unloading of animals, if you do not meet the conditions prescribed by this and other laws, to
prohibit slaughter of animals, collection and processing of raw materials for production and
products of animal origin, if they do not meet the conditions prescribed by this and other laws,
prohibit sale and use of products and animal by-products through which they can transmit disease
from animals to humans, to take samples of products, animal by-products, animal feed supplements
and water for watering the animals, in order to determine whether they are in accordance with the
regulations, seize and destroy products, animal by-products, animal feed and items that pose a risk
to animal health and public health, or that animal health certificate is invalid or incomplete to order
the removal of irregularities in the production, processing, storage, handling and marketing of
animal products, by-products of animal origin and animal feed etc.3
The Health Care in humans and animals is organized in the same way. Health care of animals is
done as: primary, secondary and tertiary health care of animals. Primary health care of animals
takes the measures necessary for the diagnosis, treatment, prevention and eradication of infectious
animal diseases, prevention, diagnosis and treatment of diseases, injuries and surgeries on animals,
treatment of reproductive diseases and disorders in animals, monitoring of the health of animals
intended for reproduction, implementation of measures for prevention and treatment of infertility,
artificial insemination and embryo transfer, retailing of veterinary medicine and animal feed for
their own needs, and issuing prescription of veterinary medicines and food for animals and
disinfection, decontamination, sanitation, deodoration and eradication of pests and provide
guidelines for their application, it provides veterinary services and first aid in emergencies, the
medical treatment of animals and perform disinfection, decontamination, sanitation, deodoration
and eradication of pests. Secondary health care of animals include monitoring of animal health and
issuing animal health certificates for their health and wellbeing, monitoring and studying
epidemiological conditions, animal health, physiology and pathology of reproduction and fertility of
animals, ecology, safety of products and raw materials of animal origin not for human consumption,
semen for artificial insemination, ova and embryos, water, feed and keeping records of the same,
clinical and laboratory diagnosis of animal diseases that must be reported, prevention, control and /
or eradication of infectious animal diseases in the annual order for animal health protection,
implementation of controls and safeguards against diseases, planning and implementation of
measures for disinfection, decontamination, sanitation, deodoration, eradication of pests, and
measures for prevention and eradication of infectious animal diseases, monitoring and
implementation of measures for protection against zoonoses, improvement of methods for
diagnosis, prevention and eradication of infectious animal diseases, procurement, evaluation and
application of drugs and other additional biological and medical products for the prevention,
diagnosis and treatment of those diseases in animals for which the competent authority is
responsible, monitoring, analysis and assessment of environmental impact on nature and animal
health, monitoring, analysis and protection of the environment from adverse effects as a result of
animal diseases and improper breeding and animal husbandry, monitoring and control of hygiene
and technological processes in facilities for animal husbandry and production of products and
animal by-products not intended for human consumption, providing expert assistance to veterinary
clinics, clinics and hospitals, animal owners, manufacturers of products and raw materials, feed,
veterinary medicines and other products, systematic preparation and training of doctors of
veterinary medicine and veterinary technicians for animal health in terms of natural disasters and
emergencies, keeping records for the identification of animals for animal health and realization of
regional and international cooperation in the veterinary field. Tertiary health care of animals doing
research or higher education institutions in the field of veterinary medicine and includes advice for
430
clinical diagnosis of animal diseases, expert advice, consultation and cooperation with the
competent authority and expertise and education, introduction and development of new laboratory
methods for diagnosis of infectious diseases in animals, development and introduction to new
methods for diagnosing and treating diseases and injuries in animals, development and introduction
of new veterinary procedures and reproduction and performing professional and educational
activities for the competent authority.18
The Ministry of Health in Republic of Macedonia, accountable to parliament, is responsible for the
national health care system, and develops health policy and health care law. It also oversees the
implementation of the relevant legislation at operational level. This ministry also has responsibility
for the assessment of the impact of other areas of law on the health sector. It is responsible, using its
own team of engineers, for the assessment of the infrastructure of hospitals. 6, 15
The health care system in the Republic of Macedonia is organized on three levels: primary,
secondary and tertiary level. The health care is delivered at: health stations, health centres, general
and specialized hospitals, clinical hospitals, university clinics and institutes, University Dental
Clinical Centre, Maxillofacial Surgery Clinic, Institute of Transfusion Medicine, Institute of Public
Health, and 10 Centres for public health. 8
Health care is organized on the three conventional levels: primary, secondary and tertiary. These
terms, however, relate more to the nature of the institution than to the care given there. Many
institutions in Republic of Macedonia provide both primary and secondary care without a clear
distinction. Primary care provides the first contact between the patient and the health care system.
Care is multidisciplinary and is delivered in five separate streams (in addition to dental primary
care). These streams are as follows: general medicine (therapeutics), occupational medicine,
childrens medicine, school medicine and womens medicine. Tertiary care institutions also provide
services which, in other countries would be considered secondary care or even primary care.
Secondary and tertiary health care are subdivided into specialty-consultative health care, which is
responsible for ambulatory assessment and treatment, and hospital care which is, in turn subdivided
into general and specialist care. Secondary care is organized through local health administrations
called medical centres which include polyclinics and general hospitals and are often based on a
number of geographical sites. Specialty-consultative health care is provided under the auspices of
the medical centres in ambulatory polyclinics. These also provide primary care services. Services
provided include specialist treatment, diagnostic services and rehabilitation services. Tertiary care is
provided in specialist hospitals as well as in single-purpose research institutes and in the clinics and
institutes of the Clinical Centre Mother Theresa in Skopje. 6, 15
According to the official Ministry of Health data, there were 10 centres for public health and 14
general hospitals in 2009 in the Republic of Macedonia. These facilities were all located in bigger
towns and evenly distributed across the whole territory. Additionally, secondary health care was
delivered in 3 clinical hospitals, 7 rehabilitation centres, and 8 specialized hospitals in the field of
cardiovascular diseases, tuberculosis and lung diseases, psychiatry, traumatology and orthopaedics,
obstetrics and gynaecology. 8
The Republic Institute of Health Protection is the central tertiary centre for public health activity. It
coordinates teaching activity at the medical faculty, supervises and oversees the activities of ten
regional institutes of health protection, and provides technical services to the clinical centre and to
the country as a whole. The ten regional institutes have branch offices a total of 21 which
provide services in the localities. The institutes of health protection have four basic functions:
microbiology, hygiene, epidemiology and social medicine. In addition to these functions, the
republic institute of health protection provides virological, pharmacological/toxicological and
radiation protection services to the whole country. Microbiology directorate supervises and
coordinates the immunization programs and the vertical program for HIV/AIDS. It is also
responsible for the control of communicable diseases and the administration of quarantine
431
legislation. Hygiene directorate monitors food and water control sets standards in food and water
hygiene, and also in terms of nutritional standards and nutritional analysis. It is the directorate
responsible for the study and analysis of environmental pollution. Epidemiology directorate
monitors disease patterns within the country, with a primary focus on non-communicable diseases,
it also monitors health behaviours. Social Medicine directorate collects collates and processes
demographic, epidemiological and healthcare activity data. At a national level, health economics,
organization and informatics rest within this directorate.
The main functions of the Republic Institute for Health Protection are collection of data for health
for all indicators; monitoring the health status of the population; reports and analysis of the health
status and organization of the health care system; epidemiological surveillance; immunization;
environmental monitoring; drug control; and advising the Ministry of Health on matters related to
health policy. To these ends, the institute is responsible for coordination of the operation of the 10
Institutes for Health Protection and other 21 hygiene-epidemiology stations, reference center for
health statistics, for data processing and statistical analysis, design and development of national
health information system, health promotion and health education, rapid response to communicable
disease epidemics, reference center for the processing and analysis of biological samples or
specimens, as well as physical and chemical analysis of environmental samples, for development of
emergency preparedness strategies and plans to deal with other untoward events, control of drugs,
drugs components and auxiliary drugs, monitoring and control of ionizing radiation, training center
for public health, epidemiology and hygiene for health workers and others and for development of
professional development and governance frameworks and criteria for public health, epidemiology
and hygiene worker.6, 15
Conclusion
The concept One World, One Health gives an opportunity for cooperation and communication
between Food and Veterinary Agencyand Faculty of Veterinary Medicine Skopje for one side and
official veterinarians, and the Ministry of Health, State Sanitary and Health Inspection, Health
Insurance Fund and Institute of Public Health of the Republic of Macedonia from the other side.
The integration and implementation of the food systems, like GMP, GHP, HACCP, and ISO: 22000
and other will drastically reduce the potential threat for contamination of food and appearance of
food-borne disease. But those diseases appear suddenly and the disease will be confirmed when the
clinical symptoms appears. Macedonia and other countries from the Balkan Peninsula aren`t ready
for this emerging disease, not just in human, but in livestock and wildlife.It was recently shown by
the outbreak of blue tongue disease not only on the territory in Macedonia, but also the whole of the
Balkan Peninsula. Other example for this confuse situation was the appearance of Listeria
monocytogenes as a causative agent of food borne illness in Macedonia. In the nearly future, it
need to be created a new network for cooperation between the veterinarians and physicians. This
flexible network is expected to be nimble enough to be able to adapt, form new coalitions and
respond rapidly to any new health emergencies. Internationally, this network would be built on a
number of structures and mechanisms that have been already established by agencies such as FAO,
complementary to the Food and Veterinary Agency in Republic of Macedonia, OIE, complementary
with some sectors from the Food and Veterinary Agency in Republic of Macedonia, WHO,
complementary to the Ministry of Health and Institute of Public Health of the Republic of
Macedonia, and UNICEF. It is necessary to be more employed veterinarians at the Institute for
Public Health as a compensatory mechanism for employing physicians at the Food and Veterinary
Agency. The mission of One Health is the establishment of closer professional interactions,
collaborations, and educational opportunities across the veterinary and medical professions,
together with their allied sciences, in order to improve public health and animal health. There is no
line between medicine of animals and humans. The One World, One Health concept is to diminish
432
the risk and minimize the global impact of epidemics and pandemics due to emerging infectious
diseases.
References
1. Burgos S. and Otte J.: Managing the Risk of Emerging Diseases: From Rhetoric to Action. HPAI
Research Brief No. 22, 2010
2. Frank D.: One world, one health, one medicine. Can Vet J. 2008 Nov; 49 (11): 10631065.
3. Food safety Law - Official Gazette of Republic of Macedonia 157/2010 and it modifications and
additions
4. Giessen B. W. J., Isken L. D. and Tiemersma W. E.: Zoonoses in Europe: a risk to public health.
National Institute for Public Health and the Environment, Bilthoven. The Netherlands. 2004
5. Health Care Law - Official Gazette of Republic of Macedonia 43/2012 and it modifications and additions
6. Health Care Systems in Transition - The former Yugoslav Republic of Macedonia, European
Observatory on Health Care Systems. 2000.
http://www.euro.who.int/__data/assets/pdf_file/0006/96414/E72508.pdf
7. Hristovski M. et al..: One Health - A New Professional Imperative. Macedonian Journal of Medical
Sciences. Volume 3, Issue 3, Pages 229232, 2010
8. Kamcev N. at al.: A general overview of the healthcare system in the Republic of Macedonia: health
indicators, organization of healthcare system and its challenges. EPMA Journal, 1. pp. 153-166, 2012
9. One Health: A New Professional Imperative, One Health Initiative Task Force: Final Report. American
Veterinary Medical Association, 2008
10. One World, One Health, Bulletin, No.2009-2
http://www.oie.int/fileadmin/Home/eng/Publications_%26_Documentation/docs/pdf/bulletin/Bull_20092-ENG.pdf
11. One World, One Health - edging onto a global agenda. FAO AIDE news, Update 56, 13 November 2008
http://www.fao.org/docs/eims/upload/251252/aj206e00.pdf
12. Osburn B., Scott C. and Gibbs P.: One World One Medicine One Health: emerging veterinary
challenges and opportunities. Rev. sci. tech. Off. int. Epiz. 2009, 28
13. Public Health Law - Official Gazette of Republic of Macedonia 22/2010 and it modifications and
additions
14. Paul E. and Gibbs J.: The evolution of One Health: a decade of progress and challenges for the future.
Veterinary Record 174: 85-91, 2014
15. Rationalization of health care services in Macedonia case studies: Skopje, Tetovo, Negotino, Sveti
Nikole, Center for Research and Policy Making, 2012
16. Tomley M. F and Shirley W. M.: Livestock infectious diseases and zoonoses. Phil. Trans. R. Soc. B
2009, 364, http://rstb.royalsocietypublishing.org/)
17. Sanitary and Health Inspection Law - Official Gazette of Republic of Macedonia 71/2006 and it
modifications and additions
18. Veterinary Health Law - Official Gazette of Republic of Macedonia 113/2007 and it modifications and
additions
19. http://fvm.ukim.edu.mk/en/fakultet/organizacija/dejnost/ (25.04.2015)
20. http://fvm.ukim.edu.mk/en/fakultet/organizacija/nastavno-naucni-edinici/ (25.04.2015)
21. http://www.fva.gov.mk/index.php?option=com_content&view=article&id=364&Itemid=421&lang=mk
(25.04.2015)
433
MORE THAN TWO YEARS WITHOUT DETECTION OF WILD RABIES VIRUS

IN SLOVENIA
Hostnik Peter1*, Jedert Maurer Werning2, Breda Hrovatin2, Danijela Rihtari1, Ivan Toplak1
1
University of Ljubljana Veterinary faculty, National Veterinary Institute, Gerbieva 60, Ljubljana, Slovenia
The Administration of the Republic of Slovenia for Food Safety, Veterinary Sector and Plant Protection, Dunajska 22,
1000 Ljubljana, Slovenia
Abstract
In Slovenia, wildlife-mediated rabies has been present since 1973. The main reservoir of rabies
virus in Slovenia has been in population of the red foxes. The control of rabies in wildlife was
started in 1973, but oral vaccination of foxes was introduced in 1988, first partially step by step
from west to east part of country. Since 1995 vaccinations were extended to the whole country and
it have been vaccinated successive twice per year. Since 1998 only vaccine Fuchoral has been used.
Following the vaccination campaigns, the incidence of rabies cases dramatically decreased, from
1.089 cases in 1995 to only 6 cases in 1999. In period from 2000 to 2013 each year few positive
cases were identified, until in 2011 when vaccination program is carried out also in Croatia. The
biological verification of vaccination efficacy: rabies surveillance, bait uptake and humoral
response continually have been doing. For the presence of rabies virus in average 9.8 animals (min.:
7.9, max.: 12.9) per 100 km2 is tested each year. Since 1999 all rabies positive samples were further
analysed to identify vaccine-virus-associated and wild type rabies cases. A total of three vaccineassociated rabies cases have been detected, two in red foxes and one in stone marten. Annual
biomarker positivity rates ranged from 61.2% to 77.6% in foxes. The positive jaw samples were
significantly higher in adults than in juveniles foxes. Annual immunisation of foxes rates ranged
from 46.6 % to 67.1 %.
Keywords: rabies, wildlife, per-oral vaccination, Slovenia
Introduction
Rabies is a known zoonosis from the history, which, even in the 21st century causes up to 55.000
human deaths each year, despite the possibilities of its prevention (Wunner and Briggs, 2010).
Rabies is caused by a neurotropic virus from genus Lyssavirus and Rhabdoviridae family. Inside of
Lyssavirus genus there are 14 different species of viruses. All species cause a disease, named rabies.
In EU countries 4 species have been found so far: species 1 (rabies virus), species 5 (European bat
Lyssavirus 1), species 6 (European bat Lyssavirus 2) and species 13 (Bakeloh bat Lyssavirus).
Rabies is contact-borne, usually through saliva of an infected animal, when skin or mucosa is bitten.
The virus than travels along the nerves to the central nervous system, where it multiplies and
afterwards travels back to various organs, such as heart, kidneys, skin, cornea and salivary glands,
where it is excreted in great amounts (Gould et al, 1998). Immune response after the infection is
slow and specific antibodies are rarely provable before the disease develops (Fekadu, 1988).
In the beginning of 20th century, urban form of rabies was major threat in Europe. Usually dogs
(Canis canis) were infected. Introduction of mass dog vaccination against rabies and reduction of
stray dog population led to eradication of this disease form in most of the European countries.
Around 1970 fox (Vulpes vulpes) form of rabies appeared and spread to most of the European
countries (Cliquet and Aubert, 2004). The greatest incidence of rabies in the European Union (EU)
countries was found to be between 1989 and 2003, when 11.085 cases of rabies were discovered.
434
After that year, the number of rabies cases in the EU is steadily declining, which was contributed to
good results of oral fox vaccination (http://www.rbe.fli.bund.de).
In last three decades, great improvement towards control and eradication was made in many of the
European Union countries, but in some of the EU countries, rabies is still present in wild animal
population, especially in foxes. Transmission of rabies from wild to unprotected domestic animals
is common and always possible in infected areas. Many of the EU countries, such as France,
Germany, Austria, Czech republic, Belgium, Luxemburg, Italy and the last one since 2013, Estonia,
have become free countries of rabies. Countries that have already eradicated rabies want to, of
course, control the traffic of animals through which transmission of the virus from infected areas to
countries with rabies free status is most likely, through appropriate additional demands in form of
regulations. Non-commercial transport of pets (dogs, cats and white skunks) is regulated by EU
regulative (No 998/2003), which defines demands for traffic inside EU- member countries, as well
as traffic between so-called third world countries and the EU. In case of transportation of pets
from third world and south-eastern European countries to the EU, animals must be vaccinated
against rabies beforehand. Animals from Serbia, Montenegro and Kosovo must be, aside from their
passport, accompanied by a confirmation of successful test of antibody presence. Regulative that
applies to the non-commercial animal traffic has changed. Changes came into effect on 01.01.2015.
The goal of achieving rabies free status in a country is in economic reasons and in abandonment of
obligatory dog vaccination. In these countries, such as Austria, Belgium, Cyprus, Denmark, France,
Germany, Ireland, Italy, Great Britain, Luxemburg, Spain, The Netherlands and Malta, only
vaccination of dogs and cats in traffic is necessary, meanwhile the obligatory vaccination against
rabies is not in practice (EFSA, 2006).
Rabies eradication in Slovenia

Health service is included in supervision of disease control, because rabies is also an infectious
disease of human population. In case of human injury, fast diagnostics and anti-rabies service about
the results of investigations is provided. The number of discovered rabies cases fell from 1.089
animals in 1995 to fifteen animals in three years (Hostnik et al., 1996). Slovenia presented for many
years defense line between infected and non-infected area of Croatia, Austria and Italy. Those two
countries have eradicated rabies before year 2000. In the last few years only a few positive cases
have been found on the territory of Slovenia near border with Croatia (Hostnik, 2011).
Molecular epidemiology of 93 rabies viral isolates from Slovenia, collected in the period from 1994
until 2012 showed, that Slovenian rabies viruses belong in classic European species. Phylogenetic
analysis of nucleotide sequences in a part of a nucleoprotein (1092 nt) gene and in a section of
glycoprotein (672 nt) of rabies viruses, found in fox, horse, cattle, dog, cat, marten and badger
confirmed, that the main viral reservoir are foxes. In Slovenia the discovered rabies viruses were
classified in western and eastern European group (Rihtari et al., 2011; Rihtari, 2013).
In May 2012 presence of a virus, used in vaccines (SAD B19) was confirmed in the brain tissue and
salivary glands of a fox, which showed signs of rabid infection. The case is one of the few
published worldwide (Hostnik et al., 2014). A study, committed in Slovenia did not confirm
presence of bat species of rabies (European bar rabies virus 1, European bat virus 2), which is
present in bat population of many northern and Baltic countries of Europe.
Italy had a rabies free country status from 1997 until 2008. In 2008 first rabies cases were found
near Slovenian border. In one year after the breakout new cases were found as far as 250 km west
from the first case. A spread that fast is unusual, so this data gives us a suspicion of hidden rabies
presence in Italy before 2008. In that year Italy began to use the method of oral vaccination of foxes
again (Mulatti et al., 2013). In Austria the last case of salivatic form of rabies was discovered in
2004, and then the last case of rabies in a fox in 2006, but that strain belonged to a vaccination
435
rabies virus (Mller et al., 2009). In 2011 Austria still performed vaccination in border areas with
Italy, Slovenia and Hungary.
In Hungary, oral vaccination of foxes was begun in 1992 and rabies was successfully eradicated in
the west of the country. Slovenian - Hungarian border area has not been vaccinated since 2005,
because rabies was not present there for many years (Cliquet and Aubert, 2004). The neighboring
Croatia has discovered 403 cases of rabies in 2005 and 1.060 in 2008. In May 2011 Croatia began
with vaccination of foxes in their western and northern areas and through this measurement the
protection circle around territory of Republic Slovenia was completed. In 2001/2002 and 2008/2009
number of discovered cases of rabies in Slovenia increase a little bit, which was on our opinion not
a contribution of the natural cycle of disease. Reason for higher number of positive cases in
2008/2009 can be linked to high numbers of discovered cases in Croatias areas that border
Slovenia. All of the positive cases were discovered in areas, where oral vaccination of foxes is
performed, with exception of a fox, captured by a hunter in 2008, not far from border with Italy.
In May, when oral vaccination is carried out in Slovenia, the foxes, born in March and April dont
yet have a lot of possibilities to come in contact with the vaccine, this is why foxes up to age of 6
months arent included in studying the degree of vaccination success. In 2010 biomarker was found
in 77,2% of foxes older than 6 months and the highest percentage (84,5%) was found in 2008. It is
recommended, that the percentage of adult foxes, which have taken baits should be at least 70,0%
(Cliquet and Aubert, 2004). In foxes, younger than 6 months, the percentage of those, which have
taken the bait is considerably lower and averages 32,7%, which doesnt mean, that the foxes have
been actually vaccinated, since young foxes can come in contact with tetracyclines through milk or
vomited food, that their mother has ingested (Hostnik P. et al., 2011).
Most of the blood samples for investigating antibody presence against the rabies virus was of really
bad quality, because most of the corpses were frozen and defrosted afterwards. In Austria blood
samples are collected by hunters directly after shooting a fox. Blood is collected out of heart and
great vessels (dr. Armin Deutz, personal communication). In France fox hunting was organized in
times of vaccination, only for checking the success of vaccination. Corpses were being delivered in
24 hour frame. Lower percentage of foxes with present antibodies against rabies virus in
comparison with tetracycline presence in bones of the foxes can be contributed to hemolised blood,
which influences sensitivity of the test. In future the system of sample collection for serologic tests
will absolutely have to be changed. Many recommendations that the spring vaccination should be
carried out in June is valuable, when young foxes can already come in contact with baits, but that
would demand using a thermostabile vaccine.
Control of the vaccination success is carried out after every fox vaccination. GPS system usage and
computer processing of the data in every bait used represents the first line of vaccination success
control. Meanwhile, biological monitoring of vaccination success means testing for antibody
against rabies presence and presence of the biomarker in the bones of caught foxes, which
represents the control of bait taking. Table 1 shows the number of investigated samples and
percentage of samples, positive for biomarker and specific antibodies. OIE recommendation
demands at least 70% prevalence of the foxes that have taken the bait. Vaccination level that high
assures cessation of the disease progression inside a fox population. The level of vaccinated foxes
changes every yearly season, of course. The period from April until autumn includes a big number
of young animals that have not been protected against rabies yet. Spring vaccination, carried out in
May or the beginning of June does not include all of the young animals.
Between 2007 and 2014 18.486 animal samples have been investigated, which means, that we have
investigated 11.33 animals per 100 km2 in average, which exceeds the OIE recommendation. The
last case of rabid fox, infected by the wild rabies virus was confirmed in January 18th 2013, but in
December 2014 a rabid pine marten was discovered. The diagnostic procedure confirmed infection
436
with vaccine virus in that case. A few similar cases of infections with SAD B19 vaccine virus strain
have been confirmed in the past in Austria and Germany (Mller et al., 2009).
Table 1: Control of oral vaccination of foxes in Slovenia in period from 2007 2014
Year
Tested
Positive
2007
2008
2009
2010
2011
2012
2013
2014
2.075
2.619
2.809
2.590
2.229
2.161
1.918
2.085
3
55
34
16
0
3 (1 SAD B19 strain)
1
1 (1 SAD B19 strain)
Tested/ 100
km2
10,2
12,9
13,8
12,7
10,9
10,6
9,4
10,2
Biomarker
Antibodies
70,00%
79,53%
76,07%
79,11%
85,18%
83,21%
82,81%
78,90%
62,00%
62,23%
70,77%
62,20%
74,07%
57,66%
63,02%
54,59%
Rabies in Southeastern European countries

To prevent rabies break in through foxes from areas on the border of the EU, the EU commission
has foreseen a vaccination corridor, which divides infected areas from uninfected ones. This
vaccination corridor encompasses areas from Finnish-Russian border, through Poland, Hungary to
Balkans and Greece. After 2010 all of the remaining former Yugoslav countries have approached
fox oral vaccination program. In Serbia the program was begun in 2010, in Croatia in 2011. With
financial help from the EU all of the Southeastern European countries have become involved in the
program. Greece was considered rabies free until 2012. After discovery of a few positive cases they
too approached eradication and oral vaccination of the disease in wild animals (Tsiodras et al.,
2014). Area of Southeastern Europe involves different genotypes of rabies virus, but they all belong
to species 1. Various subgenotypes have been discovered, among them WE (west European), CE
(central European), EE (east European), T2 (Turkish 2) and SF (Serbian fox subgenotype)
(McElhinney et al., 2011). But monitoring and supervision of the disease after fox vaccination is
still relatively poor in these areas. In many countries, the number of investigated animals per 100
km2 in 2013 did not exceed OIE recommendations: in Bosnia and Herzegovina the number is 0,2
animals/100 km2, Montenegro 0,3 animals, Serbia 0,48 animals, Macedonia 1,8 animals, Romania
1,01 animals, Bulgaria 1,4 animals, Kosovo 0,6 animals, Albania 0,01 animals and Greece 0,3
animals/100 km2 (http://www.who-rabies-bulletin.org/). To achieve sufficient insight in the actual
state of rabies extent in a certain area, sufficient number of animals should be tested, considering
OIE recommendations, at least 4 animals /100 km2.
References
1.
2.
3.
4.
5.
Cliquet F, Aubert M. Elimination of terrestrial rabies in Western European countries. Dev Biol 119: 185204, 2004
EFSA Assessment of the risk of rabies introduction into the UK, Ireland, Sweden, Malta, as a
consequence of abandoning the serological test measuring protective antibodies to rabies The EFSA
Journal 436: 1-54, 2006
Fekadu M. Canine rabies. Onderstepoort Journal of Veterinary Research, 60: 421-427, 1988
Gould AR, Hyatt AD, Lunt R, Kattenbelt JA, Hengstberger S, Blacksell SD. Characterisation of a novel
lyssavirus isolated from Pteropid bats in Australia. Virus Res 54(2): 165-87, 1998
Hostnik P, Picard-Meyer E, Rihtari D, Toplak I, Cliquet F. Vaccine-induced rabies in a red fox (Vulpes
vulpes): isolation of vaccine virus in brain tissue and salivary glands. J Wildl Dis 50(2): 397-401, 2014
437

6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Hostnik P, Kova Z, Bidovec A. Rabies situation in Slovenia. V: WHO Conference on Oral

Immunization of Foxes Against Rabies in Central and Eastern Europe, Portoro, 8th - 9th November
1996. KOVA, Zoran (ur.), SCHLUTER, Hartmut (ur.). Proceedings. Ljubljana: Veterinary
Administration of Republic of Slovenia, 7-11.
Hostnik P, Rihtari D, Grom J, Malovrh T, Toplak I. Maintenance and control of vaccination belt along
neighbouring rabies infected area. Acta veterinaria, 61: 163-174, 2011
McElhinney LM, Marston DA, Freuling CM, Cragg W, Stankov S, Lalosevic D, Lalosevic V, Mller T,
Fooks AR. Molecular diversity and evolutionary history of rabies virus strains circulating in the Balkans.
J Gen Virol 92: 2171-80, 2011
Mulatti P, Bonfanti L, Patregnani T, Lorenzetto M, Ferr N, Gagliazzo L, Casarotto C, Maroni Ponti A,
Ferri G, Marangon S. 2008-2011 sylvatic rabies epidemic in Italy: challenges and experiences. Pathog
Glob Health 107(7): 346-53, 2013
Mller T, Btza HJ, Beckert A, Bunzenthal C, Cox JH, Freuling CM, Fooks AR, Frost J, Geue L,
Hoeflechner A, Marston D, Neubert A, Neubert L, Revilla-Fernndez S, Vanek E, Vos A, Wodak E,
Zimmer K, Mettenleiter TC. Analysis of vaccine-virus-associated rabies cases in red foxes (Vulpes
vulpes) after oral rabies vaccination campaigns in Germany and Austria. Arch Virol 154(7): 1081-91,
2009
OIE manual (2004) Office International des Epizooties, Manual of Standards for Diagnostic Tests and
Vaccines, 4th Edition. Paris, France
Rihtari D, Hostnik P, Grom J, Toplak I. Molecular epidemiology of rabies virus isolates in Slovenia
1994-2010. Veterinary Microbiology, 152: 181-186, 2011
Rihtari D. Prouevanje molekularno-epidemiolokih znailnosti virusa stekline pri divjih in domaih
ivalih v Sloveniji: doktorska disertacija = Study of molecular-epidemiological characteristics of rabies
virus in wild and domestic animals in Slovenia: doctoral dissertation. Ljubljana:, 2013. 1-166
Tsiodras S, Korou LM, Tzani M, Tasioudi KE, Kalachanis K, Mangana-Vougiouka O, Rigakos G,
Dougas G, Seimenis AM, Kontos V. Rabies in Greece; historical perspectives in view of the current reemergence in wild and domestic animals. Travel Med Infect Dis 12: 628-35, 2014
Wunner WH, Briggs DJ, Rabies in the 21 century. PLoS Negl Trop Dis, 4(3): 591, 2010
438
EPIZOOTIOLOGICAL IMPORTANCE OF SALMONELLA SPP. ISOLATED IN

DIFFERENT POULTRY FARMS IN SOUTHERN BAKA AND SREM REGION
Marko Paji1, Dalibor Todorovi1, Maja Velhner1, Dubravka Milanov1, Vladimir Polaek1,
Spomenka uri2, Igor Stojanov1*
1.
2.

Faculty of Veterinary Medicine, University of Belgrade, Belgrade, Serbia
Summary
Salmonella causes local and systemic infections of poultry, which may lead to substantial direct and
indirect economic losses, presenting also significant risk to human health. The aim of this study was
to monitor the occurrence of certain serotypes of Salmonella spp. isolated on poultry farms in
Southern Baka and Srem regions in the period from 2010 to 2014, as recommended by the Book of
rules of early detection, diagnostic, prevention of spreading and eradication of Salmonella spp. We
analyzed the results obtained from the laboratory for clinical bacteriology to determine number of
salmonella cases. From all samples that have been submitted for bacteriology analysis, salmonellas
were isolated from 7.3% samples. Salmonella infantis was isolated from 50.3% of all salmonellapositive samples, mostly from materials supplied from broiler farms. Salmonella enteritidis was
most frequently isolated in broiler chickens at the rate of 48.2%. There is an increasing trend in the
occurrence of Salmonella enteritidis and Salmonella infantis on poultry farms from year to year.
Our research revealed the highest incidence of salmonella isolates in broilers that died during
transportation or within the first three days upon arrival of chickens. During the five-year research
period, 65 samples from parent flocks (63 from broiler breeders and 2 from parent flocks of layers)
were salmonella positive, which makes 8.03% of all positive isolates. It is most likely that
salmonella infection occurs due to infection of parent flocks and young chickens are infected trough
both vertical and horizontal transmission.
Keywords: salmonella, broiler chickens, samples
Introduction
Salmonella does not cause clinical symptoms in poultry, but seldom may lead to increased mortality
usually during rearing and induce a decrease in egg production. People become infected with
salmonella by consuming contaminated food. These infections may be manifested in humans
through lighter or heavier clinical symptoms which may be accompanied with a long convalescing
period (Dai et al., 2004). Salmonella are a facultative Gram - negative aerobes, rod-shaped, and
classified as the Enterobacteriacae family. They do not create spores and they do not encapsulate.
Salmonellas are excreted through faeces, contaminating the environment so reinfections are
frequent. Certain serotypes such as Salmonella Enteritidis (S. Enteritidis) and Salmonella
Typhimurium (S. Typhimurium) persist inside parenchymal organs and ovaries which can cause
vertical transmission (Ili i sar., 2010). Salmonella can cause embryo death and early mortality in
chickens (in the first seven days of life). If the parent stock has been infected, incubators for
hatching chickens may also be contaminated which may lead to a large number of hatched chickens
to be infected. The process of animal feed pelleting can decrease the Salmonella contamination only
to a certain extent therefore it is crucial to maintain cleanliness in animal feed factories. Since the
Salmonella is so widespread and difficult to eliminate from the environment, it is on the eradication
439
program priority list throughout the world. The goal of this research was to determine the
prevalence of certain serotypes of Salmonella spp. in Srem and Southern Backa district from year
2010 - 2014, specified by the Book of Rules for poultry salmonellosis RS number 7/10, and to
briefly highlight control, prevention measures, and goals which should be achieved in order to
eradicate these persistent infections.

During the timeline from 2010 - 2014, samples for Salmonella examination from the Srem and
Southern Baka district were delivered to the Veterinary Institute in Novi Sad. The following
categories of poultry flocks were included in this research:
rearing broiler breeders and rearing layer breeder flocks
broiler breeders and layer breeders in production
hatcheries
Broilers
Turkey pullets
Layer chickens
Pheasants raised on farms
In this research 11.044 samples from poultry were analyzed. These samples were: parenchymatous
organs, embryonated chicken eggs, unhatched eggs, mortality during transport, and paper pads.
Salmonella spp. was isolated in a laboratory for clinical bacteriology, by using liquid media for
enrichment, selective media, differential media, and for serological typing the slide agglutination
test with specific serums (with poly-somatic and, flagella antigens) was done. The results were
processed by descriptive statistics and presented in percentages.
Results
During the 2010 - 2014 timeline, 11.044 samples were examined, 809 (7.32 %) tested positive for
Salmonella. Most frequently detected were S. Enteritidis and Salmonella Infantis (S. Infantis). In a
smaller number of samples, S. Typhimurium was isolated as well (Table 1).
Table 1: The number of isolates from Salmonella Enteritidis, Typhimurium and Infantis in poultry flocks
from Southern Baka and Srem region from 2010-2014.
Year
Salmonella Enteritidis
Salmonella
Typhimurium
2010
85
5
2011
32
/
2012
59
1
2013
89
2
2014
125
4
Total
390
12
*values in the table represent the numbers of positive samples
Salmonella Infantis
46
39
92
124
106
407
The results from this research show that the number of positive S. Enteritidis isolates had increased
in the 2011-2014 timeframe. A total of 390 samples were isolated, which is approximately 48.2% of
all the positive samples. Most of the positive samples originated from broilers (244) and layers (96).
The prevalence of positive samples from years 2010 to 2014 is presented in Fig 1 and 2.
440

Salmonella enteritidis
100
50
150
100
50
20
14
20
13
20
12
20
11
20
10
Salmonella enteritidis
150
2010
2011
2012
2013
2014
Years
Years
Fig 1 and 2: The prevalence of positive samples for S. Enteritidis from years 2010-2014.
S. Typhimurium was isolated in 12 samples at the rate of 1.48%. During the year 2011 there were
no positive cases. The prevalence of positive samples throughout the years 2010-2014, is shown in
Fig 3 and 4.
Salmonella typhimurium
Salmonella typhimurium
6
0
2010
2011
2012
2013
2014
2010
2011
Years
2012
2013
2014
Years
Fig 3 and 4: Prevalence of positive samples for S. Typhimurium from years 2010-2014.
The number of positive isolates for S. Infantis was the highest in 2013 and it was isolated from 50.3
% of all the positive samples. Most of the positive samples came from broiler farms (271) and
layers (81), which is similar to the occurrence of S. Enteritidis. The prevalence for positive samples
per year is shown in Fig 5 and 6.
Salmonella infantis
Salmonella infantis
150
100
50
0
2010
2011
2012
2013
2014
150
100
50
0
2010
Years
2011
2012
2013
2014
Years
Fig 5 and 6: The prevalence of positive samples for Salmonella Infantis from 2010-2014.
441
Discussion
The prevalence of Salmonella spp. in diagnostic materials is similar to reports from previous years
(Stojanov et al., 2006). Most of the positive samples were from broilers, mortality during
transportation, and mortality at three days old. From all of the positive samples, 521 were from
broiler farms, which is 64.40% of the whole number of samples. Broiler breeders had 65 positive
samples, which is 8.03% of all the positive samples. Sixty three positive samples were from rearing
layer breeders and only two from flock of layer breeders. Samples that came from layer chickens
were positive in 178 cases, which is 22.12% from the total number of Salmonella isolation.
Salmonella was found in pheasants in seven samples, during this five year run, and turkey pullets
had 25 positive samples.
Salmonella is isolated in high percentages in poultry flock throughout the Srem and Southern Backa
district, as well as in other regions of Serbia. Stojanov et al., (2011) were examining the presence of
S. Enteritidis and S. Infantis in poultry farms during 2009 and 2010. They had established that S.
Enteritidis was present in poultry specimens by 61.42 % in 2009 and 56.63% in 2010, in relation to
the total number of positive results. During the same period, S. Infantis was isolated at the rate of
3% (2009) and 38.05% (2010). Our findings regarding the incidence of Salmonella in farms during
the period from 2010-1014 are similar but the number of S. Infantis is increasing with regards to the
period of 2010.
During the research that was done by Ili et al., (2010), internal organs in poultry were examined, as
well as embryionated eggs and table eggs. A total of 1289 samples were examined from which 9
tested positive for S. Enteritidis and 9 for S. Typhimurium, showing the incidence of 0.7% (Ilic et
al., 2010). Matovi and his associates examined 48182 specimens from poultry during the years
2000-2005, in the Raka and Zlatibor epizootiological area. Salmonella spp, was diagnosed in 476
samples (0.98%). Similar to our finding S. Enteritidis was most often isolated (453 samples) and in
23 samples Salmonella of other serotypes was found. In their work Salmonella was isolated from
fertile and table eggs, paper pads, mortality during the first three days, pheasant chicks, mortality
during transport, carcasses and broiler chickens as well as layers and adult pheasants (Matovi et
al., 2006).
Al-Nakhli and colleagues (1999) examined the presence of Salmonella spp. in poultry farms in
Saudi Arabia, from 1988-1997. In their research 25.759 samples were examined and 1.052 i.e. (4%)
were positive for Salmonella. These samples were taken from broiler farms, layer farms, rearing
broiler breeders and rearing layer breeders. S. Enteritidis, Salmonella Virchow (S. Virchow) and S.
Infantis were the most frequently found. Poppe et al. (1991) had isolated several types of
Salmonella from a layer farm in Canada in 1991. They examined 295 samples, and isolated
Salmonella Heidelberg 59/295 (20%), S. Infantis 18/295 (6.1 %), Salmonella Hadar 17/295 (5.8 %)
and Salmonella Schvarzengrund 21/295 (7.2%). From 2007-2011 in a research performed by
Rahmani et al. (2013), 36 serotypes of Salmonella were isolated from broiler farms which are
located in three different provinces in north Iran. S. Infantis and S. Enteritidis were most frequently
isolated. Lassing et al. (2012) performed a research on 363 broiler flocks with at least 5000 broilers
in Austria. The sampling was done during the whole year. The Salmonella spp. infections were
registered in 28 flocks (7.7%). In six farms S. Enteritidis (1.7%) was isolated while in 2 flocks S.
Typhimurium (0.6%) was found. In the remaining 20 flocks: Salmonella Montevideo (4.1%), S.
Infantis (0.6%), Salmonella Senftenberg, Salmonella Tennessee and S. Virchow (0.3%) were
isolated. Data shows that the risk of horizontal transmission of Salmonella spp. to broiler chickens
is very high. The study that was conducted by Rusul and associates (1996) in Malesia, in order to
determine the prevalence of Salmonella in 230 samples from broiler chickens, has shown that the
most prevalent are S. Enteritidis, Salmonella Muenchen, Salmonella Kentucky and Salmonella
Blockley.
442
Salmonella are one of the most important bacteria which cause zoonoses. Worldwide, they are
considered to be very significant in epidemiology, and the program for eradication is mandatory in
all the EU states. In order to eliminate salmonella from the food chain it is essential to minimize the
incidence of Salmonella in breeder flocks and in other poultry farms as well (Velhner et al., 2011).
The directive, EC number 1003/2005 has required that the incidence of S. Enteritidis and S.
Typhimurium as well as other significant serotypes of Salmonellas in breeder farms should not
exceed an amount of 1% (EC, 1003/2005). For these reasons, Salmonella monitoring needs to be
more comprehensive while better management practice on farms has to become one of the primary
goals in the livestock industry in Serbia.
Conclusion
- From 2010 2014, we have established an increase in S. Infantis in poultry samples. The
highest number of samples was from broiler chickens, death during transport, and mortality in
the first three days of life.
- An increase in positive samples for S. Enteritidis was also proven for broiler farms.
- S. Typhimurium was isolated in a smaller percentage, 1.48% of all the positive samples.
- The highest amount of positive samples has come from broiler chickens (64.40%).
- In layers, positive samples were found in 22.12 % of samples.
- Salmonella Hadar and S. Virchow which are category 2 according to the Book of rules number
7/10, were not isolated at this time.
In order to prevent salmonella infections in chickens, it is essential to apply the following measures:
to purchase chickens only from farms that are free of salmonella; avoid mixing chickens from
different flocks; thermal processing of feed ingredients; to provide water not contaminated with
salmonella; prevent wild birds and rodents from accessing farms; thoroughly clean and disinfect
objects between poultry production cycles; disinfect by using fumigation for hatching eggs;
disinfect incubators after every hatching. Farm workers need to wear protective clothing and
regularly conduct personal hygiene. Treatment with antibiotics is not recommended in poultry,
unless diarrhoea and fever occur, when they can be used to reduce mortality. In laying hens
antibiotics are contraindicated.
References
1. Al-Nakhli H. M., Al-Ogaily Z. H., Nassar T. J.: Representative Salmonella serovars isolated from
poultry and poultry environments in Saudi Arabia. Revue scientifique et technique, 18, 3, 700-9, 1999.
2. Commission regulation (EC) No 1003/2005 implementing Regulation (EC) No 2160/2003 as regards a
Community target for the reduction of the prevalence of certain salmonella serotypes in breeding flocks
of Gallus gallus and amending regulation (EC) No 2160/2003. Official Journal of the European Union
2005, L 170/12, 01. 07. 2005.
3. Dai M., Petkovi J., Simonovi Lj., Rai Z.: Salmonella enteritidis in laying hens with emphasis on
presence / absence of the agent in eggs. VI Episootiology Days with International Patricipation, Book of
Abstracts, March 31 April 2, 2004, Vlasinsko lake, Serbia, organized by Section of Zoonoses SVA and
Depart. of Infec. Animal Disease and Bee Disease FVM, Belgrade, 2004, 159
4. Ili ., Jovii D., ugi G., Pavlovi I.: Salmonella spp. as part of the ecosystem. XII Epizootiology
Days with International Patricipation, Book of Abstracts, April 7-10, 2010, Oplenac, Serbia, organized
by Section of Zoonoses SVA et al, 2010, 222
5. Lassnig H., Much P., Schliessnig H., Osterreicher E., Kostenzer K., Kornschober C., Kfer J.:
Prevalence of Salmonella spp. in Austrian broiler flocks in the context of the EU-wide baseline survey
2005-2006. Berl Munch Tierarztl Wochenschr, 125, 3/4, 129-37, 2012.
443

6. Matovi K., arkovic A., Torni A., ekler M., Debeljak Z., Vaskovi N., Kolarevi M.: Prevalence of
Salmonella in Raka and Zlatibor Epizootiologic region from 2000 to 2005. VIII Episootiology Days
with International Patricipation, Book of Abstracts, April 5-8, 2006, Beograd, Serbia, organized by
Section of Zoonoses SVA and Depart. of Infec. Animal Disease and Bee Disease FVM, Belgrade and
Scientific Institut of Veterinary Medicine, Novi Sad, 2006, 127.
7. Poppe C., Irwin R. J., Forsberg C. M., Clarke R. C., Oggel J.: The prevalence of Salmonella enteritidis
and other Salmonella spp. among Canadian registered commercial layer flocks. Epidemiology &
Infection , 106, 2, 259270, 1991.
8. Pravilnik o utvrivanju mera za rano otkrivanje, dijagnostiku, spreavanje irenja, suzbijanje i
iskorenjivanje infekcija ivine odreenim serotipovima salmonella. Slubeni glasnik Republike Srbije,
broj 7/10, od 19. februara 2010.
9. Rahmani M., Peighambari S. M., Svendsen C. A., Cavaco L.M., Agers Y., Hendriksen R. S.: Molecular
clonality and antimicrobial resistance in Salmonella enterica serovars Enteritidis and Infantis from
broilers in three Northern regions of Iran. BMC Veterinary Research, 9:66, 2013.
10. Rusul G., Khair J., Radu S., Cheah C. T., Yassin R. M.: Prevalence of Salmonella in broilers at retail
outlets, processing plants and farms in Malaysia. International Journal of Food Microbiology, 33, 2/3,
183-94, 1996.
11. Stojanov I., Orli D., Doen R., Prodanov J., Velhner M.: Finding of Salmonella in materials originating
from Poultry and Pigs during 2002-2005. VIII Episootiology Days with International Patricipation, Book
of Abstracts, April 5-8, 2006, Beograd, Serbia, organized by Section of Zoonoses SVA and Depart. of
Infec. Animal Disease and Bee Disease FVM, Belgrade and Scientific Institute of Veterinary Medicine,
Novi Sad, 2006, 141-142.
12. Stojanov I., Potkonjak D., Kapetanov M., Ratajac R., Maljkovi M., Pui I., Joviin M.: Changes in
prevalence of some Salmonella serotypes in materials originating from poultry. First International
Epizootiology Days, Book of Abstracts, April 6-9, 2011, Sijarinska spa, Serbia, organized by Section of
Zoonoses SVA et al, 2011, 86.
13. Velhner M., Potkonjak D., Stojanov I., Petrovi J., Kozoderovi G.: Salmonella control in poultry
production and resistance monitoring in Serbia. Arhiv Veterinarske Medicine, 4, 2, 11-22, 2011.
444
________________________________________________________________________
Session 7
ANTIBIOTIC RESISTANCE
Full papers
_______________________________________________________________________
445
Invited lecture
POTENTIAL SPREAD OF ANTIMICROBIAL RESISTANCE VIA DRINKING WATER
IN LIVESTOCK HUSBANDRY
Igor Stojanov1, Jasna Prodanov Radulovi1, Milo Kapetanov1, Jelena Petrovi1
1

Abstract
In modern animal farm production, the expected productive results and animal health status, often
require the usage of antimicrobial drugs. The application of antimicrobials is strongly advised to the
therapeutic treatment diseased animal. However, in order to prevent the outbreak of disease in some
of phases of animal husbandry (for instance, weaning of piglets), the prophylactic treatment with
antimicrobials might be introduced. When possible, antibiotic therapy is commonly administered by
per oral route diluted in drinking water. Theoretically, in this case the water can contribute, as a
medium, for selective colonization of saprophyte or pathogenic bacteria mediated by antibiotics.
Microbial strains in the watering systems on animal farms for certain periods are exposed to diverse
antimicrobial drugs, and thus they can develop antimicrobial resistance. Consequently, not only
pathogenic bacteria but also conditionally pathogenic and saprophyte strains, as reservoirs of drug
resistance genes, can become vectors of antimicrobial resistance. Watering systems on the farms
must undergo strict and regular microbial control. Such control measures are obligatory, having in
mind the legally prescribed standards for microbiological safety of water, which stipulate that the
quality of drinking water on the farms must meet the same requirements as the human drinking
water. Therefore, water should be tested for microbial safety in the same way as the animal feed.
Particular problem of microbial control of water is associated with resistant bacterial strains, which
have developed some new qualities because of antibiotic therapy and may be the reason of
therapy failure in livestock. In that respect, the subject of our research was microbiological control
of drinking water for animals at particular points of watering systems on the farms. The aim of our
research was to identify bacterial species present in the system and to determine their antimicrobial
susceptibility. Within entire watering system, a range of organisms was isolated: Bacillus spp,
Micrococcus sp., Staphylococcus sp., Citrobacter freundii, Aeromonas spp., Pseudomonas
aeruginosa, E.coli Enterococcus spp. The susceptibility of isolated strains towards antimicrobial
drugs was variable. Reduced susceptibility to individual antibiotics was observed in Pseudomonas
spp., Aeromonas spp. and Enterococcus spp. The research strongly suggests the necessity for
microbiological control of drinking water on animal farms as well as the risk of development and
spreading of resistant bacterial strains on the farm and, potentially, in the environment.
Keywords: water, animal farms, bacteria, antimicrobial resistance
Introduction
The antimicrobial resistance, as an acquired feature of bacterial organisms during the past 2-3
decades, represents a burning problem worldwide. This problem is connected with the possibility
of the usage of antibacterial substances for future treatment of bacterial infections in both human
and veterinary medicine. One should emphasize that some microorganisms had certain antibacterial
properties as a part of their defence mechanism in the ecosystem even before the discovery of
antibiotics. In coexistence of different microorganism in the nature, the survival of an organism
often depends on its ability to develop resistance to antimicrobial substances released by
446
neighbouring commensals (Mazel and Davies, 1999). For instance, the presence of penicillinase
as the first known -lactamase was identified in E.coli by Abraham and Chain as early as 1940
(Abraham and Chain, 1940), i.e., before penicillin has been brought into clinical use. However, the
start of mass production of antimicrobial substances and thus their excessive occurrence in nature
has triggered the process of adaptation of bacterial flora and certainly prompted developing the
antimicrobial resistance.
Water is the most widespread nutritive medium on Earth inhabited by a huge number of
microorganisms, many of which have not yet been identified or even isolated (Fricker, 2003). Water
can contain a range of bacterial species. Some of them are not capable of colonizing water
distribution systems (Reasonr et al., 1989), whilst some indicator bacteria (Enterobacter,
Citrobacter and Klebsiella) and opportunistic pathogens (Aeromonas, Pseudomonas, Flavobacter
and Acinetobacter) can colonize such systems (Fricker, 2003) and make them potential transmission
points. The diseased animals are frequently treated by mass medication (Jackson and Cockcroft,
2007, Kapetanov et al., 2009). Antimicrobial substances are administered through specially design
system (called medicator) which provides optimal therapeutic doses.
The farm water supply system can be divided into two or three parts. One of them is the farm water
system, which can be the part of either local supply system (municipality, city, and village) or wells
located on the farm itself. The second part is the water distribution system to individual farm
facilities and drinking troughs, as a terminal part of the system. The quality of water from both local
(public) supply system and on the farm must be controlled, as water is considered food and daily
necessity of farm animals according to the Food Safety Law of the Republic of Serbia (Official
Gazette of the Republic of Serbia, 2009). Moreover, drinking water for animals on the farms must
meet the same microbial safety standards as those for the human drinking water (Official Gazette of
SFRY, 1987).
The occurrence and spread of induced antimicrobial resistance and its effects on the outcomes of
antibiotic therapy could be explained by extensive migration of people and goods, and big cities
(over 10 million inhabitants) are considered critical points (Hawkey, 2015). Such environments are
facing problems related to public health, sewage waters, drinking water supply and general
overpopulation.
The combination of those factors and broad usage of antimicrobial agents in human medicine and
agriculture results in development of resistant bacterial strains, especially those from the group of
Gram-negative organisms. In livestock production, occurrence of resistant strains can be attributed
to drinking water as the key factor. As reported by some researchers (Stojanov et al., 2014, Stojanov
et al., 2013) application of antimicrobial agents through farm water supply systems can lead not
only to occurrence of resistant strains, but also to the selection of individual bacterial strains within
the system itself. Prolonged therapy via antimicrobial applicators favours resistant strains, which
finally remain in the water supply system as the only microbial flora. Despite that there are not
many published papers on this topic, this problem was observed on several examined farms in
Vojvodina Province.
To that end, the subject of our research was microbiological control of water for animals at
particular points of watering systems on the farms. The aim of our research was to identify bacterial
species present in the system as well as to assess potential modification of their antimicrobial
susceptibility (increased resistance).

The water samples were collected from six livestock farms, the three samples originated from pig
farms and three from poultry farms. On each farm, water samples were collected at three different
447
sampling spots. First sample was collected at the point of entry to the farm, i.e. into the water
supply system, either connection to public water supply or private well on the farm. The second
sample included the water collected from farm facilities for animal housing, yet before entering the
medicator for antibiotic application, whereas third sample was collected from drinking troughs
inside the housing facility.
Drinking troughs, from which the samples were collected, were parts of diverse supply systems. On
poultry farms, two types of drinking troughs were used open system with hanging bell-drinking
troughs and closed system of nipple waters. The latter system, i.e. nipple drinkers, was used on pig
farms. Prior to collecting the sample, the first several stream of water from the nipples was
discarded. On the same day, water samples were transported to the laboratory and inoculated.
Isolation and identification of bacteria from delivered water samples was performed using the
methods for bacteriological, viral, biological and parasitological examination of drinking water set
in the Appendix III of the Regulation on sampling procedures and methods for laboratory analysis
of drinking water (Official Gazette of the SFRY, 1987). The inhibition zones were determined by
disc diffusion method. The inoculums for determining the antimicrobial susceptibility of isolated
bacteria was prepared according to CLSI methods (CLSI, 2012), and were interpreted according to
properties listed in the catalogue of interpretation standards provided by disc manufacturer. The
susceptibility of the isolates was tested towards several antibiotics belonging to diverse classes:
Norfloxacin (5 g), Gentamycin (10g), Colistin (10g), Tetracycline (30g), Trimethoprimsulfamethoxazole (1.25 /23.75g), Doxycicline (30g), Ceftriaxone (30g), Chloramphenicol
(30g), Amoxicilline (25 g).

Microbiological analysis of water samples collected from different sampling points on the
investigated farms revealed that presence of isolated bacteria are associated with specific locations
rather than with animal species raised on given farm (pigs or poultry). Table 1 displays the data on
examined water samples collected at entry points and from sampling points inside the farm
facilities.
Table 1 Bacteria isolated from water samples collected at investigated farms (poultry and pig farms)
Bacterial species
Well / Connection to public

water supply system
Water supply system inside

the farm
Aeromonas spp.
+
16,66%
+
16,66%
Aeromonas hydrophila
0,00%
0,00%
Bacillus spp
+
83,33%
+
66,66%
Corynebacterium spp.
+
66,66%
+
50,00%
Enterococcus spp.
0,00%
0,00%
Escherichia coli
0,00%
0,00%
Streptococcus alfa hem.
+
33,33%
0,00%
Staphylococcus sp. (coagulase neg.)
+
50,00%
+
33,33%
Staphylococcus epidermidis
0,00%
+
16,66%
Micrococcus luteus
+
66,66%
+
83,33%
Citrobacter freundii
0,00%
0,00%
Pseudomonas aeruginosa
0,00%
0,00%
Pseudomonas spp.
0,00%
0,00%
Enterobacter aerogenes
0,00%
0,00%
Enterobacter sp.
0,00%
0,00%
Flavobacter sp
+
16,66%
0,00%
+ (presence of bacterial species), - (absence of bacterial species), % (presence of isolated bacteria)
448
The organisms isolated from analysed water samples indicated the lowered amount of bacteria. The
examined water samples did not contain unwanted bacteria according to the Regulation on sampling
procedures and methods for laboratory analysis of drinking water (Official Gazette of the SFRY;
1987) ruling the microbial species that must not be present in drinking water.
According to the data from the literature, bacterial species isolated in our research correspond with
the results obtained by other authors, who analysed similar samples (Lechevallier et al., 1980;
Stojanov et al., 2014). Saprophytic bacteria are considered as a part of microflora which does not
threaten human and animals health. These bacteria are usually not resistant. However, if they come
in contact with waste water from livestock farms, there is a certain possibility for resistance
development. In the research of Amos et al. (2014) the waste water can be a reservoir of resistance,
which eventually flow in the ecosystem.
Table 2 displays the results of microbial analysis of water samples collected from drinking troughs
inside animal stables. The samples were taken after flushing three flushes of water, i.e. rinsing of
water supply system. The analysed water samples were collected at the point after adding
antibiotics through the medicators, which are used in case of need for oral antimicrobial therapy.
Table 2 Bacteria isolated from water samples inside the stable (poultry and pig farms)
Bacterial species
Aeromonas spp.
Aeromonas hydrophila
Bacillus spp
Corynebacterium spp.
Enterococcus spp.
Escherichia coli
Streptococcus alfa hem.
Staphylococcus sp. (koagulaza neg.)
Drinking trough
+
+
+
+
+
-
83.33%
83.33%
0,00%
0,00%
83.33%
100,00%
83.33%
0,00%
Bacterial species
Staphylococcus epidermidis
Micrococcus luteus
Citrobacter freundii
Pseudomonas aeruginosa
Pseudomonas spp.
Enterobacter aerogenes
Enterobacter sp.
Flavobacter sp
Drinking trough
+
+
+
+
+
+
0,00%
0,00%
33,33%
100,00%
83,00%
33.33%
83.33%
33,33%
+ (presence of bacterial species), - (absence of bacterial species), % (presence of isolated bacteria)
The results from Table 2 indicate that bacterial species isolated from water samples collected from
drinking troughs differ from those isolated from the water supply system (Table 1). The presence of
Aeromans, Pseudomonas, Flavobacterium, Enterococcus and Enterobacter genera strongly
suggests bacterial contamination of water samples. Moreover, absence of saprophyte organisms
may indicate that application of antimicrobial drugs via medicators resulted in specific selection
of bacterial species thus contributing to the survival of resistant strains, which became predominant
bacterial flora of water.
The isolated bacteria from the drinkers belong to a group of opportunistic pathogens. Aermonas
species are pathogens for a different animal species. They present a threat to an animal which live in
or nearby the water. In mammals and birds, Aeromonas can cause neonatal septicaemia, mastitis,
diarrhoea, food poisoning, respectively. Pseudomonas species can be cause of different
inflammation processes of mucous membranes (otitis, mastitis, pneumonia, arthritis, enteritis,
urinary tract), and abscesses, infection of wounds, and nosocomial infection. Flavobacterium
species in humans and animals can cause nosocomial infections, pneumonia and septicaemia.
Finally, Enterobacter and Enterococcus species as a conditionally pathogen bacteria can be involved
in different infections: urinary tract, mastitis, endocarditis and septicaemia (Quinn et al., 1998).
The bacterial species identified in water samples from drinking troughs were subjected to
antimicrobial susceptibility testing.
Antimicrobial therapies practiced in pig and poultry production in our country encompass a range of
antimicrobial drugs administered in drinking water (Doen et al., 2011; Doen et al., 2014,
449
Prodanov et al., 2011, Prodanov et al., 2014). Most common antibiotics applied via the drinking
water include groups of sulphonamides, penicillin and fluoroquinolones, whereas tetracyclines,
aminoglycosides and macrolides are used to somewhat lesser extent (Doen et al., 2014). In our
research, we predominantly analysed the susceptibility tendencies of opportunistic pathogens
Pseudomonas, Aeromonas and Flavobacter as well as Enterococcus sp, Enterobacter sp. The data
on susceptibility testing of aforementioned bacteria to antimicrobial drugs are presented in Table 3.
Table 3 displays the data on the susceptibility of bacterial strains isolated from water samples
collected from drinking troughs, which were able to survive a contact with antimicrobial drugs
administered in drinking water as a therapy. Bacterial species identified in water samples collected
from the water supply system to the point of drug application into the water, were either not
detected or their isolation was obstructed by dominant strains isolated in water from drinking
troughs. To that end, our susceptibility analysis was limited to only aforementioned bacterial
strains. The problem of bacterial resistance has several aspects. The occurrence of the resistance
itself, that is, the underlying mechanism of its development, is most probably the problem of crucial
importance. Another aspect is the evolution and spread of the resistance in nature. Finally, the third
one concerns the outcome and consequences of antimicrobial resistance in animal and human
health. Potential answer to the first question is the relation of antimicrobial drugs that, through their
cidal or static effects, eliminate susceptible organisms and select for resistant and genetically
determined resistant strains, which are distinguished in nature as a consequence of antibiotic
activity (Levy, 2004).
Table 3. Susceptibility of isolated Pseudomonas aeruginosa to antimicrobial drugs
Gentamycin
Colistin
Ceftriaxone
Tetracycline
Doxycicline
Norfloxsacin
Trimethoprimsulphamethoxazole
Chloramphenicol
Amoxicillin
Pseudomonas
sp.
I
0
R
R
R
I
Aeromonas
sp.
R
R
S
R
I
R
Flavobacter
sp.
R
R
S
R
R
I
Enterococcus
sp.
S
I
S
R
R
S
Enterobacter
sp.
S
R
S
R
R
S
I
R
S
R
R
R
S
R
S
R
Extensive use of antibiotics in human and veterinary medicine and agriculture (Butaye et al., 2014)
to prophylactic and therapeutic purposes results in further development of resistance. The
mentioned conditions provide the occurrence of bacterial strains resistant to multiple antibiotics (so
called multidrug resistance MDR) and transferring the resistance genes beyond individual
bacterial genera and species. Such transfer between different taxonomic and ecologic groups is
enabled through bacteriophage, plasmid, naked DNA or transposon activity (Levy, 2002). Some
transposons can contain integrons as resistance gene carriers (Hall et al., 1999). Originally
discovered among Gram-negative bacteria, integrons have been since located in Gram-positive
commensals in nature (Nandi et al., 2004).
As visible from Table 3, the isolated bacterial species have developed resistance towards three or
more antimicrobial drugs. Aeromonas-species are commonly present in waters such as lakes, rivers,
ponds, and fishponds. According to some reports (Orozova et al. 2010), 60% of Aeromonas spp.
isolates from water and 90% from clinical material originating from fishponds were multi-resistant
towards several antibiotics (MDR). The presence of resistance genes to tetracyclines,
sulphonamides, chloramphenicol and beta-lactam antibiotics in bacteria isolated from rivers and
450
drinking water has been reported in China (Lei et al., 2013). The authors confirmed much higher
prevalence and concentration of antibiotic resistance genes in drinking water samples from
suburban sampling sites than in urban sites. These results clearly indicate the danger which
threatens a public health, because of possible options in therapy. The results of analysis of the water
samples from drinkers in stables for fattening broilers are presented in the research article of
Stojanov et al. (2015). The authors confirmed the presence of Pseudomonas aeruginosa as a
dominant bacterial strain, resistant to the three different antibiotics. The problem of the occurrence
of bacteria of the genus Pseudomonas in drinking water was addressed in the paper of Vaz-Moreira
(Vaz-Moreira et al., 2012), where 14 of 32 samples of drinking water were positive for this bacterial
organism. The analysis revealed resistance to beta-lactam antibiotics (more than 80%), Cefalotin
(100%), and carboxypenicillin (84%). The resistance to fluoroquinolones and streptomycin was
about 36% and 18%, respectively. The authors consider that Pseudomonas sp. is capable of
spreading resistance via the water. However, the resistance transmission occurs by vertical
transmission (mutation). Beside mentioned way of resistance spreading, horizontal way of
resistance spreading is quite important. Despite of legislative acts which severely ban uncontrolled
antibiotics usage, they are still widely used with no obvious clinical needs. The bacteria from
Enterobacteriaceae family and enterococcus represent the most important microorganisms in
spreading a resistance among animals and consequently on people. This transfer of resistance
occurs through food chain and animal holders (Marshall et al., 1990; Barza and Gorbach, 2002).
The research on the importance of sewage waters in spreading the bacterial resistance in nature
indicated that these waters are one of the mechanisms contributing to the maintenance of carrier
genes in nature, particularly in resistant phenotypes (Butaye et al., 2014).
Conclusion
This research has confirmed the manifold importance of regular microbiological control of drinking
water in animal husbandry. Diverse bacterial species were identified at particular sampling sites of
water supply systems on the investigated farms. Such differences can be attributed to different
supply options, the quality of the water supply system on the farm, method of administration of
antimicrobial drugs and overall sanitation and hygiene of drinking troughs. The application of
antimicrobial drugs contributes to the selection of particular bacterial strains, which can
consequently affect the overall health status of animals. Moreover, the strains, which have
developed antimicrobial resistance associated with specific drugs used in the therapy, may persist
on the drinking troughs for prolonged periods of time thus contributing to vertical and horizontal
transmission of the resistance. Via the sewage water, such strains can be transmitted to natural
environment or staff employed at slaughter lines. In this way, spread of resistance genes is
multiplied and it directly affects the therapeutic options and effectiveness of antimicrobial therapy
in humans.
Acknowledgements
This investigation was financially supported by the Ministry of Education, Science and
Technological Development, Republic of Serbia, Project No. TR 31071.
References
1.
Abraham EP, Chin E. An enzyme from bacteria able to destory penicillin. Appl. Microbiol 17 (6):
783-6, 1940
451

2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Amos A.C.G , Zhang L., Hawkey P.M., Gaze W.H., Wellington E.M.: Functional metagenomic
analysis reveals rivers are a reservoir for diverse antibiotic resistance genes, Veterinary Microbiology
171, 34, 441447, 2014.
Barza, M., S.L. Gorbach. The need to improve antimicrobial use in agriculture: ecological and human
health consequences. Clin Infect. Dis. 34, S71S144 2002.
Butaye Patrick, Duijkeren van Engeline, Prescott F. John, Schwarz: Antimicrobial resistance, in bacteria
from animals and the environment, Veterinary Microbiology, 171 269-272, 2014.
Doen, R., Prodanov-Radulovi, J., Pui, I., Stojanov, I., Stojanovi, D., Ratajac, R.:
Resistance Escherichia coli isolates to antibiotics from the organ samples originating from swine farms.
Biotechnol Anim Husb, 27 (3), 861-866, 2011.
Doen R., Prodanov-Radulovi J., Pui I., Ratajac R., Stojanov I., Gruba S.: The uncontrolled use of
antibiotics in pig production - a threat to public health. XVI International congress Feed technology,
October 28-30, 2014, Novi Sad, organized by Institute of food technology, 2014, 20-24
Fricker R.C.: The presence of bacteria in water after regrowth.,; WHO 2003., Heterophilic Plate Counts
and Drinking-water Safety. Edited by J. Bartam, J. Cotuovo, M. Exner, A. Glasmacher. London, UK.
ISBN: 1 84339 025 6.
Hall, R. M., C. M. Collis, M.-J. Kim, S. R. Partridge, G. D. Recchia, and H. W. Stokes.: Mobile gene
cassettes and integrons in evolution. Ann. N. Y. Acad. Sci. 870:6880, 1999.
Hawkey M.P.: Multidrug-resistant Gram-negative bacteria: a product of globalization, Journal of
Hospital Infection (2015), doi: 10.1016/j.jhin.2015.01.008.
Jackson G.C. Peter and Cockcroft D Pepter: Handbook of Pig medicine, Chapter 14: Antimicobial
therapeutics, 2007 p. 224.
Kapetanov M., Orli D., Potkonjak D., Milanov D., Stojanov I., Stojanovi D., Ratajac R.: Universal
Aplication of Antimicrobial Preparation Based on Free oxygen for the Disinfection of Water, Air and
Houses on Poultry Farms. 6th International Symposium on Biocides in Public Health and Environment,
Proceedings, Str. 201-202.
Lei Jiang, Xialin Hu, Ting Xu, Hongchang Zhang, Daniel Sheng, Daqiang Yin: Prevalence of antibiotic
resistance genes and their relationship with antibiotics in the Huangpu River and the drinking water
sources, Shanghai, China. Science of the Total Environment 458460, 2013.
Lechevallier W. Mark, Ramon J. Seidler, And T. M. Evans: Enumeration and Characterization of
Standard Plate Count Bacteria in Chlorinated and Raw Water Suppliest. Applied And Environmental
Microbiology, p. 922-930, 1980.
Levy B. Stuart and Marshall Bonnie: Antibacterial resistance worldwide: causes, challenges and
responses, Nature medicine supplement, vol. 10, No. 12, 2004.
Levy, S. The Antibiotic Paradox: How Misuse of Antibiotics Destroys their Curative Powers (Perseus
Cambridge, 2002.
Marshall, B., Petrowski, D. & Levy, S.B. Inter- and intraspecies spread of Escherichia coli in a farm
environment in the absence of antibiotic usage. Proc.Natl. Acad. Sci. USA 87, 66096613, 1990
Mazel D. and Davies D.: Antibiotic resistance in microbes, CMLS Cellular and molecular lief sciences,
56, 742-754, 1999.
Nandi, S., Maurer, J.J., Hofacre, C. & Summers, A.O. Gram-positive bacteria are a major reservoir of
Class 1 antibiotic resistance integrons in poultry litter. Proc. Natl. Acad. Sci. USA 101, 71187122,
2004.
Official Gazette of the Republic of Serbia: Law on Food Safety, no. 41/2009, (Slubeni glasnik
Republike Srbije: Zakon o bezbednosti hrane, br. 41/2009)
Official Gazette of the SFRY; Ordinance on the method of sampling and laboratory methods for the
analysis of drinking water. 1987, (Slubeni list SFRJ; Pravilnik o nainu uzimanja uzoraka i metoda za
laboratorijsku analizu vode za pie. 1987)
Orozova P, ChikovaV. and Najdenski H.: Antibiotic resistance of pathogenic for fish isolates of
Aeromonas spp., Bulgarian Journal of Agricultural Science, 16 (No 3), 376-38., 2010.
452

22. Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard Eleventh
Edition, M02-A11 Vol. 32 No. 1 Replaces M02-A10 Vol. 29 No. 1, Clinical and Laboratory Standards
Institute USA, January 2012.
23. Prodanov-Radulovi, J., Doen, R., Stojanov, I., Pui, I., ivkov-Balo, M., Ratajac, R. (2011).
Interaction between the mycotoxins and causative agents of swine infective diseases. Proc. Nat.
Sci.,120, 251-259.
24. Prodanov-Radulovi J., Doen R., Stojanov I., Polaek V., ivkov-Balo M., Mari D., Pui I.: The
interaction between the swine infectious diseases agents and low levels of mycotoxins in swine feed.
Biotechnol. Anim. Husb., 30,3,433-444, 2014
25. Quinn J. P., Carter, E. M., Markey, B., Carter, R. G.: Clinical Veterinary Microbiology; Mosby, 1998.
26. Reasonr D. J., Blannon J.C., Geldreich E.E. and Barnick J.: Nonphotosynthetic pigmented bacteria in a
potable water treatment and distribution system. Appl. Environ. Microbiol. 55, 919-921, 1989.
27. Stojanov I., Prodanov Radulovi Jasna, Kapetanov M., ivkov-Balo Milica, Petrovi Jelena, Ratajac
R.: Bacteriological quality of drinking water and impact on animals health. Proceedings, XVI
International congress Feed technology, Novi Sad, 28-30.10.2014, p.143-146., 2014
28. Stojanov I., Kapetanov M., Stojanovi D., Ratajac R., Prodanov-Radulovi J.: The antibiotic therapy
and their influence on bacterial flora of water on the farm. Environmental protection of urban and
suburban settlements : Proceedings, XVII International Eco-Conference, Novi Sad, Ecological
Movement of Novi Sad, p.121-125, 2013
29. Stojanov I., Prodanov Radulovi J., Kapetanov M., Ratajac R., Pavlovi I.: Antimikrobna osetljivost
Pseudomonas aeruginosa izolovanog iz vode za napajanje na farmama ivine. Meunarodna nauna
konferencija: ivotna sredina i adaptacija preivrede na klimatske promene, Book of abstracts, 2015,
p.176
30. Vaz-Moreira Ivone, Olga C. Nunes, Clia M. Manaia: Diversity and antibiotic resistance in
Pseudomonas spp. from drinking water. Science of the Total Environment 426, 366374, 2012.
453
Invited lecture
ANTIMICROBIAL ACTIVITY OF THE ESSENTIAL OILS FROM SOME AROMATIC
MEDICINAL PLANTS CULTIVATED IN SERBIA
Radomir Ratajac1*, Marina eki Stoi1, Aleksandar Milovanovi1,
Igor Stojanov1
1 Scientific Veterinary Institute Novi Sad, Rumenaki put 20, 21000 Novi Sad, Serbia
Abstract
The antiseptic qualities of aromatic and medicinal plants and their extracts have been recognized
since ancient times, while attempts to characterize these properties in the laboratory date back to the
early 1900s. It is clear from recent studies that these plants secondary metabolites have potential in
medical procedures and applications in the cosmetic, food and feed. For these reasons, and because
of high proportions of antibiotic resistance in bacteria, which is accelerated by usage and misusage
of antimicrobial drugs, the essential oils (EOs) derived from some aromatic medicinal plants
cultivated in Serbia were assessed for antibacterial activity against animal pathogens. EOs may have
potentials in the control of it, used as an active substance in intrauterine preparations for veterinary
use.
The antibacterial activity of EOs of Satureja montana L., Mentha x piperita L. and Thymus vulgaris
were examined against pathogens from animal reproductive tract, isolates (field strains originating
from cattles, mares, sows, bitches uterus and vagina, animals that had endometritis and
reproductive problems) and bacterial strains obtained from American type culture collection
(ATCC): Trueperella pyogenes, Escherichia coli, Staphylococcus aureus, and Streptococcus spp..
The EOs of the plant was extracted by hydrodistillation and analyzed by gas chromatography.
Antibacterial sensitivity of pathogens were tested in vitro using an Agar Dilution Test - ADT (two
fold dilutions of test substances at concentrations ranging from 0.0122 to 25 L mL-1) to determine
the minimal inhibitory concentration (MIC).
According to compositional analysis of the peppermint, winter savory and thyme EOs, 40, 27 and
34 chemical compounds were identified, respectively. The major constituents were: carvacrol,
limonene, menthol, p-cymene and thymol.
The results obtained from ADT have shown that EO from peppermint, savory and thyme were
effective substances used against tested isolates and bacterial ATCC strains. MICs of these
substances ranged from 0.39 to 3.12 L mL-1. However, further investigation is necessary to
confirm these results and assess the toxicity and the therapeutic effect of selected substances in vitro
and in vivo.
Keywords: essential oils; antibacterial activity; MIC; endometritis
Introduction
Plant oils and extracts have been used for a wide variety of purposes for many thousands of years.
These purposes vary from the use of rosewood and cedarwood in perfumery, to flavouring drinks
with lime, fennel or juniper berry oil, and the application of lemongrass oil for the preservation of
stored food crops. In particular, the antimicrobial activity of plant oils and extracts has formed the
basis of many applications, including raw and processed food preservation, pharmaceuticals,
alternative medicine and natural therapies (Hammer et al., 1999; Baser and Buchbauer, 2009).
454
The control (prevention and therapy) of infective animal diseases, especially zoonosis, is necessary
because, in spite of the modern improvements in slaughter hygiene and food production techniques,
food safety has been an increasingly important public health issue (Sara Burt, 2004). The abundant
use of anti-infective agents resulted in developing resistance of bacteria strains to certain antibiotics,
presence of antibiotic residues in the food of animal origin etc. To overcome these problems, a
variety of medicinal plants have been screened worldwide for their antimicrobial properties. The
aim is to find new, effective antimicrobial agents with novel modes of actions. Essential oils (EOs)
derived from aromatic medicinal plants have been reported to exhibit exceptionally good
antimicrobial effects against bacteria, yeasts, filamentous fungi, and viruses. The EOs constituents
that posses the best antibacterial features against pathogens and contain large percentage of phenol
are: carvacrol, eugenol and tymol. It is clear that their mechanisms of functioning are therefore
similar to other phenol compounds that cause damage of cytoplasma membrane, disturb active
transport and cause coagulation of cell content (Walsh et al., 2003).
The use of EOs is a possible alternative to synthetic drugs. EOs have one or more pharmacological
effects, but for veterinary medicine, the antibacterial effect is of great importance, because of that
EOs may have potentials in the control of infective animal diseases. The control of uterus infections
in animals is interesting for us because uterine function is often compromised in cattle by bacterial
contamination of the uterine lumen after parturition; pathogenic bacteria frequently persist, causing
uterine disease, a key cause of infertility (Sheldon et al., 2009). The uterine bacterial contamination
is non-specific and involves a wide range of bacterial species.
Based on the published literature, bacterial isolates can be categorized according to their potential
pathogenicity within the uterus as recognized uterine pathogens associated with uterine endometrial
lesions; potential pathogens frequently isolated from the bovine uterine lumen and cases of
endometritis, but not commonly associated with uterine lesions; or, opportunist contaminants
transiently isolated from the uterine lumen and not associated with endometritis. The recognized
uterine pathogens most often associated with clinical disease are: Trueperella pyogenes
(Arcanobacterium pyogenes), Escherichia coli, Fusobacterium necrophorum and Prevotella
melaninogenicus (Sheldon and Dobson, 2006).
While some of the oils used on the basis of their reputed antimicrobial properties have well been
documented in vitro activity, there are few published data for many others. Some studies have
concentrated exclusively on one oil or one micro-organism. While these data are useful, the reports
are not directly comparable due to methodological differences such as choice of plant extract(s), test
micro-organism(s) and antimicrobial test method (Hammer et al., 1999; Cosentino et al., 1999; Kim
et al.,1995; Lambert et al., 2001; Ratajac R. et al.,2012a; Ratajac R. et al.,2012b; Ratajac R. et al.,
2014). The aim of this study was to test a several number of essential oils against a diverse range of
organisms comprising Gram-positive and Gram-negative bacteria, involved in the pathology of
endometritis of animals. The purpose of this was to create directly comparable, quantitative,
antimicrobial data and to generate data for oils for which little data exist.
Antimicrobial activity of the EOs of peppermint, savoury and thyme (Aetheroleum Menthae
piperitae, Aetheroleum Saturejae, Aetheroleum Thymii), plants cultivated in Serbia, were evaluated
in vitro conditions against pathogens from animal reproductive tract, isolates (field strains
originating from cattles, mares, sows, bitches uterus and vagina, animals that had endometritis
and reproductive problems) and bacterial strains obtained from American type culture collection
(ATCC): Trueperella pyogenes, Escherichia coli, Staphylococcus aureus, and Streptococcus spp..
Therefore, it is assumed that all of the tested oils can demonstrate high activity against bacteria and
it might be an active substance for pharmaceutical use in intramammary and intrauterine
preparations for veterinary use.
455

Plant material and Essential oils
The plant material (herb in flower - Menthae herba, Saturejae herba, Thymii herba) used for the
tests were collected from plants cultivated in the experimental field of the Institute of Field and
Vegetable Crops, Novi Sad, Serbia. Air-drying of the plants were performed in a shady place at
room temperature for 10 days (the moisture content was about 10.00% (m/m)). A weighed mass of
plants materials were submitted for 2 h to water-distillation, according to the method described in
Ph. Jug. V (2.8.12.). The oils were separated from water by decantation and were separated from
the solvent by distillation in a rotary vacuum evaporator at a temperature not higher than 50C. The
obtained EOs were dried over anhydrous sodium sulphate and were used for GC measurements and
antibacterial tests.
Gas Chromatography
GC analyses were performed using a United Technologies Packard model 439 gas chromatograph
equipped with FID, a column CP-SIL 5 CB was installed (10 m x 0.25 mm i.d., 100%
dimethylpolysiloxane). Oven temperature was programmed to subsequently at 600C/min up to
2000C, at 3.50C/min, and then held isothermal for 10 min; injector and detector temperatures, 2000C
and 2900C, respectively; nitrogen was used as gas carrier, adjusted to a linear flow of 86 mL/min.
Oil samples were dissolved in n-hexane 1:100 (1L of test oil in 100L of n-hexane) and were
injected in quantity of 1L sample solution in n-hexane. The components were identified by
comparing the retention time of the sample signal with retention times of reference standards
(Sigma, Chemical CO.; Merck-Schuchardt). The percentage composition of the oils was computed,
by the normalization method, from the GC peak areas without using correction factors. The
percentage data shown are mean values of two injections.
Organisms and growth conditions
Bacterial field strains, uterine and vaginal cultures were performed after collection with a swab
from cows, mare, sows, bitches that had endometritis and reproductive problems. Isolation and
identification were performed by routine methods that are applied in the Scientific Veterinary
Institute Novi Sad, according to PJ Quinn et al. (2011). Isolations of bacteria were done by using
blood agar (BA) medium (supplemented with 5% defibrinated sheep blood) and MacConkey agar.
The seeded plates were incubated at a temperature of 37C under aerobic, microaerophilic and
anaerobic conditions 24-72 hours. After seeding samples on nutrient media, colonies were
macroscopic reviewed. Selected suspect colonies from solid substrates were seeded to isolate pure
cultures, and then (or at the same time: directly from the sample or material-prime culture) were
performed microscopic, biochemical and serological identification.
The bacterial strains obtained from ATCC were: Trueperella pyogenes (A. pyogenes) ATCC 19411,
Escherichia coli ATCC 25922, Staphylococcus aureus ATCC 25923 and Streptococcus agalactiae
ATCC 13813.
Organisms were maintained on BA. Overnight cultures were prepared by inoculating approximately
2mL Mueller Hinton broth (MHB) with 23 colonies of each organism taken from BA. Broths were
incubated overnight at 35C. Inocula were prepared by diluting overnight cultures in saline to
approximately 106 cfu mL-1 of bacteria.
Agar dilution method
The agar dilution method followed approved by the NCCLS with the following modification: a final
concentration of 0.5% (v/v) Tween-20 (Sigma) was incorporated into the agar after autoclaving to
456
enhance oil solubility. Briefly, a series of twofold dilutions of each oil, ranging from 2.5% (v/v) to
0.0012% (v/v) (at concentrations ranging from 25 to 0.0122 L mL-1), was prepared in Mueller
Hinton (MH) agar (or MH with 5% sheep blood). Plates were dried at 35C for 30 min prior to
inoculation with 10 L spots containing approximately 104 cfu of each organism. Mueller Hinton
agar, with 0.5% (v/v) Tween-20 but no oil, was used as a positive growth control. Inoculated plates
were incubated at 35 to 37C for a period of 18 hours (for fastidious bacteria 24-72 h). Minimum
inhibitory concentrations (MICs) were determined after 18 h or 72h for fastidious bacteria. The
MICs were determined as the lowest concentration of oil inhibiting the visible growth of each
organism on the agar plate. The presence of one or two colonies was disregarded.
Results
According to compositional analysis of the peppermint EO, 40 chemical compounds were
identified, and menthol (36.74%), menthone (18.81%), menthyl-acetate (9.43%), limonene (5.99%)
and menthophuran (2.40%) were found as predominant compounds in oil. The composition of
winter savory EO: 27 chemical compounds were identified the major constituents were: carvacrol
(42.12%), limonene (24.57%) and p-cymene (19.85%). We have identified 34 components, in the
essential oil of T.vulgaris. The main components were thymol (34.41%), p-cymene (34.04%) and
carvacrol (4.92%) (Table 1).
Table 1. Essential oil composition (% of major components) of Mentha, Satureja and Thymus
Compound
Carvacrol
Limonene
Menthyl-acetate
Menthol
Menthone
Menthophuran
p-Cymene
Thymol
Peppermint
(Aetheroleum
Menthae piperitae)
5.99
9.43
36.74
18.81
2.40
-
Essential oils / (%)

Winter savory
(Aetheroleum
Saturejae)
42.12
24.57
19.85
-
Thyme
(Aetheroleum
Thymii)
4.92
34.04
34.41
In the examined population of dairy cows (68 individuals), bacterial findings from uterine samples
were: T. pyogenes (26%), E. coli (17%), P. multocida (14%), S. aureus (26%), S. uberis (9%), S.
haemolyticus (7%) and S. dysgalactiae (2%). In 50% of sows uterine samples (10), T. pyogenes
was isolated, Streptococcus spp. was presented in 20% of the samples, while in the other causes tree
bacterial species were much less presented (S. aureus, P. multocida and E. coli hem.). S. equi
subsp. zooepidemicus was isolated from mares. S. canis, P. multocida, E. coli and S. intermedius
were isolated and identified from bitches vaginal swabs (5).
The MICs of the tested oils against pathogens field (isolates) and ATCC strains obtained by the agar
dilution method are shown in Table 2. Peppermint (Aetheroleum Menthae piperitae) inhibited all
organisms at the concentration of 3.12 L mL-1. Staph. aureus and T. pyogenes were the most
susceptible organisms, average MIC values were 1.17 and 1.23 L mL-1, respectively. Savory and
thyme (Aetheroleum Saturejae, Aetheroleum Thymii) inhibited all organisms at the concentration
of 0.79 L mL-1. Thyme had the lowest average MIC of 0.43 L mL-1 against T. pyogenes, as well
as savory the lowest MIC was against the same pathogen (0.52 L mL-1). Isolates and ATCC strain
of Staph. aureus were less susceptible than other bacteria to EOs of savory and thyme (average
MIC values were 0.65 L mL-1). The results obtained have shown that EO from thyme performed
the strongest antimicrobial activity against all tested bacteria in vitro assays, except streptococci that
457
were more sensitive to the EO of savory, average MIC values for thyme and savory were 0.51 and
0.46 L mL-1, respectively. It can be observed in the correlation between the content of the major
ingredients carvacrol and thymol in oils and their good antibacterial activity.
Table 2. Minimal inhibitory concentration (MIC) of the essential oils of Satureja montana L., Mentha x
piperita L. and Thymus vulgaris against pathogens from animal reproductive tract
Bacterial field and ATCC strains / Antibacterial activity MIC L mL-1
EOs
Aetheroleum
Menthae piperitae
Aetheroleum
Saturejae
Aetheroleum
Thymii
Trueperella
(Arcanobacterium)
pyogenes
(20 field strains
+ATCC 19411)
0.78 - 1.56
( =1.23)
0.39 - 0.78
(=0.52)
0.39 - 0.78
(=0.43)
Escherichia coli
(13 field strains
+ATCC 25922)
Pasteurella spp.
(11 field strains)
Staphylococcus
aureus
(17 field strains
+ATCC 25923)
Streptococcus spp.
(15 field strains +
S. agalactiae ATCC 13813)
0.78 - 1.56
( =1.34)
0.39 - 0.78
( =0.53)
0.39 - 0.78
( =0.50)
0.78 - 1.56
( =1.35)
0.39 - 0.78
( =0.53)
0.39 - 0.78
( =0.50)
0.78 - 1.56
( =1.17)
0.39 - 0.78
( =0.65)
0.39 - 0.78
( =0.65)
1.56 - 3.12
( =1.85)
0.39 - 0.78
( =0.46)
0.39 - 0.78
( =0.51)
The sensitivity of the of different species of bacteria on selected essential oils on the basis of
average values of MIC can be summarized as follows, from the most sensitive to the most resistant:
Trueperella pyogenes > Escherichia coli > Pasteurella spp. > Staphylococcus aureus >
Streptococcus spp.. The significant difference in sensitivity between the Gram-positive and Gramnegative bacteria was not observed.

The results of the chemical composition of the EO of thyme herbs - thyme in bloom, showing that
the dominant ingredients were presented in the following concentrations: thymol (34.41%), pcymene (34.04%) and carvacrol (4.92% ) and 34 compounds were identified. Composition of EO
in our studies is consistent with the results of the examination of the EO derived from the dried
plant material: Thymus vulgaris L. and Thymus tosevii L.. Thymol (48.9%) and p-cymene (19.0%)
were the main components T. vulgaris, while carvacrol (12.8%), a-terpinyl acetate (12.3%), cismirtanol (11.2%) and thymol (10.4%) dominated in T. tosevii (Sokovi et al., 2009).
In EO obtained from peppermint in flower, we identified 83 ingredients by GC analysis. The
chemical composition of oil was dominated by menthol (36.74%), menthone (18.81%), menthyl
acetate (9.42%) and limonene (5.99%). The main component menthol in an amount up to 50% of
oil and 15 - 25% of menthone, is in accordance with the results of other researchers. In studies of
Sokovi et al. (2009) the main components of the EO of M. piperita were identified: menthol
(37.4%), methyl acetate (17.4%) and menthone (12.7%).
Chemical analysis of essential oils winter savory in bloom, indicated the following results:
identified 82 ingredients and chemical composition of oil was dominated by carvacrol (42.12%) and
limonene (24.57%). The results of our tests are in accordance with studies of the chemical
composition of the EO of selected and cultivated savory, while the significant difference in relation
to the publication, which studied the chemical composition of the essential oils of wild savory.
Namely, the selected and cultivated savory contained carvacrol in an amount from 42 to 67% as the
main component in the oil, and thymol (29-43%) was the major ingredient in the wild forms, S.
hortensis. Among the other components of the oil, these were identified: p-cymene (4.5 to 30.0%),
-terpinene (15.3 to 45.0%), -pinene (8.0%), metilthymol (5.4%), spathulenol (5.2%), 1,8-cineole
(3.8%), -terpinene (1.29%), -caryophyllene (1.90%) and -bisabolene (1.01%) (Baser et al.,
2004; Mihajilov-Krstev et al., 2009; Ad gzel A. et al., 2007). In the studies of Milosavljevic et al.
(2000), the chemical composition of the EO of savory (Satureja kitaibelii Wierzba. ex Heuff.) from
458
six different localities in Eastern Serbia trans-geraniol was the dominated compound, and only in
one locality p-cymene was the major component (34.16%). Qualitative and quantitative
compositions of the most abundant compounds (in some samples from different localities, all listed
components were not detected) were for trans-geraniol 12.98% - 29.66%, linalool 6.17% - 11.97%,
p-cymene 4.37% - 34.16%, limonene 5.68% - 10.45%, linalool 4.96% - 10.66%, caryophyllene
oxide 3.02% and 4.31%, borneol 5.36% - 10.41%, -caryophyllene 4.47% and terpinen-4-ol from
4.13% to 10.84%. The explanation for these differences in the chemical composition is in the
genetic variability of cultivated and wild varieties of plants, as well as in environmental factors.
Using the agar dilution method, tested thyme EO showed good antibacterial activity. Very similar
results were published by Hammer et al. (1999) who performed testing the antimicrobial activity of
EO of thyme herb against E. coli and Staphylococcus aureus. Using the agar dilution method, they
came to the following results: the values of MIC (% v/v) for EO were as follows: E. coli 0.12 and S.
aureus 0.25, and MIC and minimum cidal concentration (MCC) (% v/v) obtained by broth
microdilution method were: for Staph. aureus MIC - 0.03, MCC - 0.06 and for E. coli, MIC - 0.03,
MCC - 0.03.
EO of mint in the agar dilution test inhibited the growth of microorganisms at the concentration of
2.0 % (v/v) (Hammer et al., 1999), the value of MIC (%, v/v) was as follows: E. coli 0.5 and S.
aureus 1.0, and using the broth microdilution method for determination of MIC and MCC (% v/v)
the results of the EO of mint were: for Staph. aureus MIC - 0.12, MCC - 0.25 and for E. coli MIC 0.12, MCC - 0.12. MIC values in these studies are very close to our results for the tested
microorganisms E. coli and S. aureus. In another study, EOs of peppermint Mentha piperita L.
(Lamiaceae), were studied for their antimicrobial properties against human pathogenic
microorganisms. The bioactivity of the oils menthol and menthone was compared using the
combination of in vitro techniques such as microdilution, agar diffusion, and bioautography. It was
shown that all of the peppermint oils screened moderately inhibited human pathogenic
microorganisms. The growth of S. aureus was inhibited by two investigated commercial oil, the
MIC values were 0.625 mg mL-1. S. epidermidis is also inhibited, but with a moderate activity of
the oil, because the values of MIC were 0.625 to 2.5 mg mL-1. Using the bioautography assay,
menthol was found to be responsible for the antimicrobial activity of these oils (Gokalp Iscan et al.,
2002).
In the studies conducted by Milosavljevic et al. (2000), the EOs from savory were studied for
antimicrobial activity by dilution method (agar and broth). E. coli (ATSS 25922) and S. aureus
showed sensitivity. MIC and minimum lethal concentration (MLC) were for E. coli from 2 to 8
L/mL, and S. aureus from 1 to 2 L/mL. These values are more than doubled in comparison to the
results that we got in our experiments, which can be explained by the chemical composition of the
oils. The dominant ingredient was carvacrol in the oil that we used, and oils used in this research
had a trans-geraniol in the highest concentration. Other studies have also confirmed the
antibacterial potency of EO of S. hortensis L., against various bacterial strains Staphylococcus
aureus (ATCC 25923, ATCC 6538), and Escherichia coli (ATCC 8739, ATCC 25922). The testing
was conducted in order to compare the two methods: disk diffusion and microdilution. EO was
found to have good activity against all tested Gram-negative bacteria (microdilution method), the
MIC were from 0.05 to 0.78 L/mL. MIC values for the tested Gram-positive bacteria were in the
range of from 0.20 to 0.39 L/mL (Mihajilov-Krstev et al., 2010). EOs of savory herb from our
region, used in this study showed more activity against staphylococci compared with essential oil
originating from Turkey (MIC 15.62 to 62.50 L/mL), and also the value of MIC for Streptococcus
(S. pyogenes KUKEM-676) were much higher MIC 62.50 L/mL (Adiguzel A. et al., 2007).
The results of chemical composition of EOs showed the presence of 8 terpenoids (monoterpenoids
being most abundant), with noticeable qualitative and quantitative differences among the species.
These compounds were present in higher concentration: carvacrol, menthol and thymol. However,
459
according to the phenolic and terpenoid characterisation of the examined EOs, they could be
regarded as a possible new potent source of natural products.
Considering antimicrobial potential, overall activity of EOs can be ranged as follows from the most
potent: Thymus vulgaris > Satureja montana L. > Mentha x piperita L.. These results undoubtedly
validate the common use of these plant extracts in traditional and official medicine, as well as a
potent source of natural medical substances. However, further research is necessary to confirm
these results and assess the toxicity and the therapeutic effect of selected substances in vivo.
Acknowledgements
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Adiguzel A., Ozer H., Kilic H., Cetin B.: Screening of antimicrobial activity of essential oil and
methanol extract of Satureja hortensis on foodborne bacteria and fungi. Czech J. Food Sci., 25: 8189.,
2007
Baser Husnu K. Can et Gerhard Buchbauer: Handbook of essential oils: science, technology and
applications, CRC Press Taylor & Francis Group, 2010
Burt Sara: Essential oils: their antibacterial properties and potential applications in foods a review,
International Journal of Food Microbiology 94, p. 223-253., 2004
Cosentino, S., Tuberoso, C.I.G., Pisano, B., Satta, M., Mascia, V., Arzedi, E., Palmas, F.: In vitro
antimicrobial activity and chemical composition of Sardinian Thymus essential oils. Letters in Applied
Microbiology 29, 130 135., 1999
Gokalp Iscan, Nese Kirimer, Mine Kurkcuoglu, K. Husnu Can Baser, Fatih Demirci: Antimicrobial
Screening of Mentha piperita Essential Oils. J. Agric. Food Chem. 50, 3943-3946, 2002
Hammer, K.A., Carson, C.F., Riley, T.V.: Antimicrobial activity of essential oils and other plant
extracts. Journal of Applied Microbiology 86, 985 990., 1999
Kim, J., Marshall, M.R., Wei, C.-I.: Antibacterial activity of some essential oil components against five
foodborne pathogens. Journal of Agricultural and Food Chemistry 43, 2839-2845., 1995
Lambert,R.J.W.,Skandamis,P.N.,Coote,P.,Nychas,G.-J.E.: A study of the minimum inhibitory
concentration and mode of action of oregano essential oil, thymol and carvacrol. Journal of Applied
Microbiology 91, 453462., 2001
Mihajilov-Krstev, T., Radnovi, D., Kiti, D., Zlatkovi, B., and S. Brankovi: Composition and
antibacterial activity of S. hortensis L. essential oil. Central European Journal of Biology, 2009
Mihajilov-Krstev Tatjana, Radnovi Dragan, Kiti Duanka, Stojanovi-Radi Zorica i Zlatkovi Bojan:
Antimicrobial activity of Satureja hortensis L. essential oil against pathogenic microbial strains. Arch.
Biol. Sci., Belgrade, 62 (1), 159-166, 2010
Milosavljevi, P. N., Velikovi, T. D., Ranelovi, V. N.: Antibacterial Activity and chemical
composition of Essential Oil of Savory (Satureja kitaibelii Wierzb. ex Heuff.). Proceeding of 6th
Symposium on Flora of the Southeastern Serbia, Sokobanja, 2000, 181-185
Quinn J.P., Markey K.B., Leonard C.F., FitzPatrick S.E., Fanning S., Hartigan J.P.: Veterinary
Microbiology and Microbial Disease, Second Edition, Wiley-Blackwell, 2011
Ratajac R., Stojanovi D., Milanov D., Petrovi J., Vasi R., eki-Stoi M., Stojanov I., Lako B.:
Potential use of essential oils and their components in the control of reproductive infection of
animals.Book of Abstracts, 2nd Annual Conference Plant Natural products: From science to
Bioproducts, PlantEngine COST Action FE 1006, 26-28 September 2012, Cluj-Napoca, Romania,
University of Agricultural Sciences and Veterinary Medicine, 2012a, 44-45
460

14. Ratajac R., Stojanovi D., Milanov D., Petrovi J., Vasi R., Stojanov I., Lako B.: In vitro antibacterial
activity of the Oleum Menthae piperitae (Mentha xpiperita L., Lamiaceae) against Arcanobacterium
pyogenes. Book of Abstracts, 13th Congress of the International Society for Ethnopharmacology,
September 2-6, Graz, Austria, Institute of Pharmaceutical Sciences, 2012b, 202
15. Ratajac R., eki-Stoi M., Stojanov I., Milovanovi A., Petrovi J., Stojanovi D., Jezdimirovi M.:
Antibacterial activity of essential oil of Satureja montana L.and its potential use in the control of
reproductive infection of animals. Book of Abstracts, International Symposium Natural products and
drug discovery - future perspectives, 13-14 November 2014, Vienna University of Technology, Vienna,
Austria, University of Technology, 2014, 66
16. Sheldon I.M., Dobson H.: Postpartum uterine health in cattle, Animal Reproduction Science 8283,
295306, 2004
17. Sheldon I Martin, James Cronin, Leopold Goetze, Gaetano Donofrio, and Hans-Joachim Schuberth:
Defining Postpartum Uterine Disease and the Mechanisms of Infection and Immunity in the Female
Reproductive Tract in Cattle, Biol Reprod. December; 81(6): 10251032, 2009
18. Sokovi D. Marina, Vukojevi Jelena, Marin D. Petar, Brki D. Dejan, Vajs Vlatka, and Leo J. L. D.
van Griensven: Chemical Composition of Essential Oils of Thymus and Mentha Species and Their
Antifungal Activities, Molecules, 14, 238-249, 2009
19. Walsh S.E., Maillard J.-Y., Russell A.D., Catrenich C.E., Charbonneau D.L. and Bartolo R.G..:
Activity and mechanisms of action of selected biocidal agents on Gram-positive and -negative bacteria,
Journal of Applied Microbiology 94, 240247., 2003
461
ANTIMICROBIAL ACTIVITY OF BLACKBERRY JUICE FROM SERBIA ON ANIMAL

PATHOGENS
Tamara Krsti1*, Ljiljana Suvajdi2, Sran Stojanovi1, Tama Petrovi3, Maja Bekut4,
Neboja Ili5, Zoran Suvajdi6
1. Faculty of Pharmacy, European University, Novi Sad, Serbia
2. Medical Faculty, Department for Pharmacy, University of Novi Sad, Serbia
3. Scientific Veterinary Institute "Novi Sad", Novi Sad, Serbia
4. Medical Faculty, University of Novi Sad, Serbia
5. Institute of Food Technology, University of Novi Sad, Novi Sad, Serbia
6. Veterinary ambulance, STRIKS, erevi
Abstract
Many of animals are herbivores or omnivorous. Fruits take a big part in those types of
nourishments. Rich chemical compositions of blackberry provide animals, which eat them, with
many beneficial effects. The aim of this survey was to investigate antimicrobial activity of
blackberry juice from Serbia against animal pathogens.
Juice was obtained by squeezing fresh fruits through sterile gauze on Buchners funnel into the
glass bottle. Investigated microorganisms were indigenous animal isolates and reference isolates of
ATCC (American Type Culture Collection) strains. Thirteen bacteria, two fungi and one alga
species were tested. Positive controls were antibiotics Streptomycin (2000 g/ml) and Nystatin
(6.25 g/ml) and negative control was saline. The microbial susceptibility assay was performed in
accordance with the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2006)
using agar well diffusion method. The density of the suspensions of tested microorganisms was
adjusted to turbidity equal of 0.5 MacFarland standard. Wells (5 mm in diameter, volume 80 l)
made in agar were filled with juice, negative and positive control. The agar plates were incubated at
37C for 24 hours. Antimicrobial activity of tested samples was determined by the measurement of
the zones of microbial growth inhibition. All tests were performed in triplicates. Statistical analysis
was performed in Microsoft Office Excel 2007 program using mean value.
This study has demonstrated antibacterial activity of blackberry juice against Gram positive
bacteria. Diameters of inhibition zones were: 21 mm (Staphylococcus aureus), 20 mm
(Staphylococcus aureus ATCC 11632), 18 mm (Streptococcus agalactiae), 20 mm (Rhodococcus
equi), 26 mm (Rhodococcus equi ATCC 6939), 23 mm (Trueperella pyogenes), 30 mm
(Arcanobacterium haemolyticum) and 24 mm (Enterococcus). Inhibition zones were smaller against
Gram negative bacteria: 16 mm (Pseudomonas aeruginosa), 15 mm (Pseudomonas aeruginosa
ATCC 10145), 14 mm (Salmonella enteritidis), 14 mm (Salmonella typhymurium ATCC 14028)
and 20 mm (Acinetobacter lwoffii). Juice activity was one to two thirds of the activity of
Streptomycin. On fungi and alga blackberry juice showed no action.
Blackberry juice from Serbia possesses antibacterial activity, but there is no antifungal or antialgal
activity against tested microorganisms.
Keywords: blackberry, juice, antibacterial, antifungal, antialgal effect
Introduction
Plant-animal interactions are ubiquitous in natural populations (Schemske and Horvitz, 1988).
Many of animals are herbivores or omnivorous. Fruits take a big part in those types of
462
nourishments. Use of herbal antimicrobial agents in animal nutrition is an important approach for
infections prevention and therapy.
Due to their frequent application, the resistance to conventional antibiotics is growing among
domestic and even wild animals` pathogen microorganisms (Velhner et al., 2012). Plants with
antimicrobial activity are a good alternative to conventional antibiotic therapy of infected animals,
because they are readily available, harmless to health and have attractive flavors (Krsti et al.,
2014).
Rich chemical compositions of blackberry provide animals, which eat them, with many beneficial
effects. Previous observations have suggested that blackberry extract exhibits anti-inflammatory,
anticancer, and antiviral properties (Dai et al., 2009; Dai et al., 2007; Caranagh et al., 2003;
Danaher et al., 2011) and a limited number of reports have demonstrated antibacterial activity of
blackberries and raspberries against skin and enteric pathogens (Gonzalez et al., 2013). However,
the antimicrobial effect of blackberry juice as a topical agent against animal pathogens has not yet
been demonstrated. The aim of this survey was to investigate antimicrobial activity of blackberry
juice from Serbia against animal pathogens.

Preparation of juice
Juice was obtained by squeezing fresh fruits through sterile gauze on Buchners funnel into the
glass bottle.
Investigated microorganisms
Investigated microorganisms were indigenous animal isolates and reference isolates of ATCC
(American Type Culture Collection) strains. Thirteen bacteria of which eight Gram positive
(Staphylococcus aureus, Staphylococcus aureus ATCC 11632, Streptococcus agalactiae,
Rhodococcus equi, Rhodococcus equi ATCC 6939, Trueperella pyogenes, Arcanobacterium
haemolyticum and Enterococcus sp.) and five Gram negative (Pseudomonas aeruginosa,
Pseudomonas aeruginosa ATCC 10145, Salmonella enteritidis, Salmonella typhymurium ATCC
14028 and Acinetobacter lwoffii) two fungi (Candida albicans and Candida albicans ATCC 24433)
and one alga specie (Protothecca zopfii) were tested.
Microbial susceptibility assay
Positive controls were antibiotics Streptomycin (2000 g/ml) and Nystatin (6.25 g/ml) and
negative control was saline. The microbial susceptibility assay was performed in accordance with
the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2006) using agar well
diffusion method. The density of the suspensions of tested microorganisms was adjusted to turbidity
equal of 0.5 MacFarland standard. Wells (5 mm in diameter, volume 80 l) made in agar were filled
with juice, negative and positive control. The agar plates were incubated at 37C for 24 hours.
Antimicrobial activity of tested samples was determined by the measurement of the zones of
microbial growth inhibition. All tests were performed in triplicates.
Statistical analysis was performed in Microsoft Office Excel 2007 program using mean value.
463
Results
Antibacterial activity
Results are shown in graphs.
This study has demonstrated antibacterial activity of blackberry juice against Gram positive
bacteria. Of all eight tested bacteria the most susceptible bacteria was Arcanobacterium
haemolyticum with inhibiton zone of 30 mm and the most resistant was Streptococcus agalactiae
with inhibition zone of 18 mm.
30
25
20
15
10
5
0
Sa
Sa ATCC
11632
Sg
Re
Re ATCC
6939
Tp
Ah
Graph 1. Antibacterial activity of blackberry juice against Gram positive bacteria. Sa-Staphylococcus aureus, Sa ATCC
11632-Staphylococcus aureus ATCC 11632, Sg-Streptococcus agalactiae, Re-Rhodococcus equi, Re ATCC 6939Rhodococcus equi ATCC 6939, Tp-Trueperella pyogenes, Ah-Arcanobacterium haemolyticum and E-Enterococcus sp.
Inhibition zones were smaller against Gram negative bacteria. Of all five tested bacteria the most
susceptible bacteria was Acinetobacter lwoffii with inhibiton zone of 20 mm and the most resistant
were Salmonella enteritidis and Salmonella typhymurium ATCC 14028 with inhibition zone of 14
mm.
20
15
10
5
0
Pa
Pa ATCC
10145
Se
St ATCC
14028
Graph 2. Antibacterial activity of blackberry juice against Gram negative bacteria. Pa- Pseudomonas aeruginosa, Pa
ATCC 10145-Pseudomonas aeruginosa ATCC 10145, Se-Salmonella enteritidis, St ATCC 14028-Salmonella
typhymurium ATCC 14028 and A-Acinetobacter lwoffii
464
Juice activity was one to two thirds of the activity of Streptomycin.

60
50
40
30
20
10
0
Sa
Sa (a)
Sg
Re
Re (a)
Tp
Ah
Blackberry juice
Pa
Pa (a)
Se
St (a)
Streptomycin
Graph 3. Antibacterial activity of blackberry juice in comparison to antibacterial activity of Streptomycin. SaStaphylococcus aureus, Sa (a)-Staphylococcus aureus ATCC 11632, Sg-Streptococcus agalactiae, Re-Rhodococcus
equi, Re (a)-Rhodococcus equi ATCC 6939, Tp- Trueperella pyogenes, Ah-Arcanobacterium haemolyticum, EEnterococcus, Pa-Pseudomonas aeruginosa, Pa (a)-Pseudomonas aeruginosa ATCC 10145, Se- Salmonella
enteritidis, St (a)-Salmonella typhymurium ATCC 14028 and A-Acinetobacter lwoffii
On fungi and alga blackberry juice showed no action.
30
25
20
Blackberry juice
15
Nystatin
10
5
0
Candida albicans
Candida albicans ATCC

24433
Graph 4. Antibacterial activity of blackberry juice against fungi
465
35
30
25
Blackberry juice
20
Nystatin
15
10
5
0
Protothecca zopfii
Graph 5. Antibacterial activity of blackberry juice against alga

Riaz et al. showed antibacterial activity of blackberry against Salmonella typhy, Staphylococcus
aureus and Pseudomonas aeruginosa. Their diameters of inhibition zones were 11 0.2, 11 0.23
and 11 0.26 mm. Named results were obtained by methanolic fruit extract in the highest
concentration they have investigated (2000 g/dl). Our diameters of inhibition zones for the same
bacteria were 14, 21 and 16 mm, respectively, which is higher than their results.
They also tested the fungal susceptibility on blackberry fruit methanol extract. Their survey, as
ours, showed no antifungal activity of blackberry fruit against Candida albicans.
Another study conducted by Radovanovi et al. showed antimicrobial activity of polyphenol
extracts from wild blackberry fruits grown in Southeast Serbia. Their diameters of inhibition zones
for Pseudomonas aeruginosa, Salmonella enteritidis and Staphylococcus aureus were 13.4 2.3, 14
0.9 and 13.7 1.3 mm, respectively. Our results are higher for Pseudomonas aeruginosa and
Staphylococcus aureus and they are 15 and 21 mm, respectively. For Salmonella enteritidis our
results are identical as theirs, but they investigated methanolic extract and we investigated pure
blackberry fruit juice.
Blackberry juice from Serbia possesses antibacterial activity, but there is no antifungal or antialgal
activity against tested microorganisms. Antibacterial activity of blackberry juice from Serbia is not
only measurable to antibacterial activity of methanol blackberry fruit extracts, it even shows higher
antibacterial activity against some pathogens.
Acknowledgements
This work was supported by the Ministry of Education, Science and Technological Development,
Republic of Serbia, Project number 46012 and 41012.
References
1.
2.
Cavanagh M., Hipwell M., Wilkinson M.: Antibacterial activity of berry fruits used for culinary
purposes. Journal of Medicinal Food, 6, 1, 5761, 2003
Clinical and Laborathory Standards Institute.: Methods for Dilution Antimicrobial Susceptibility Tests
for Bacteria that Grow Aerobically. M7-A7, 11, 2006
466

3.
4.
5.
6.
7.
Dai J., Gupte A., Gates L., Mumper J.: A comprehensive study of anthocyanin-containing extracts from
selected blackberry cultivars: extraction methods, stability, anticancer properties and mechanisms. Food
and Chemical Toxicology, 47, 4, 837847, 2009
Dai J., Patel D., Mumper J.: Characterization of blackberry extract and its antiproliferative and antiinflammatory properties. Journal of Medicinal Food, 10, 2, 258265, 2007
Danaher J., Wang C., Dai J., Mumper J., Miller S.: Antiviral effects of blackberry extract against herpes
simplex virus type 1. Oral Surgery Oral Medicine, Oral Patholology Oral Radiology, 112, 3, e31e35,
2011
Gonzalez A., Escamilla C., Danaher J., Dai J., Ebersole L., Mumper J.: Antibacterial effects of
blackberry extract target periodontopathogens. Journal of Periodontal Research. 48, 1, 8086, 2013
Krsti T., Suvajdi Lj., Stojanovi S., Velhner M., Milanov D., Boji G., Ili N.: Different
antimicrobial effects of raspberry depending on the method of active components isolation. Food &
Feed Research, 41, 2, 125-130, 2014
8.
Riaz M., Ahmad M., Rahman N.: Antimicrobial screening of fruit, leaves, root and stem of Rubus
fruticosus. Journal of Medicinal Plants Research, 24, 5, 5920-5924, 2011
9. Radovanovi B., Anelkovi S., Radovanovi A., Anelkovi M.: Antioxidant and Antimicrobial
Activity of Polyphenol Extracts from Wild Berry Fruits Grown in Southeast Serbia. Tropical Journal of
Pharmaceutical Research, 12, 5, 8139, 2013
10. Schemske W., Horvitz C.: Plant-Animal Interactions and Fruit Production in a Neotropical Herb: A Path
Analysis. Ecology, 69, 4, 1128, 1988
11. Velhner M., Suvajdi Lj., Petrovi J., eperanda M.: Antimicrobial resistance of Escherichia coli in
wild animals. Arhiv Veterinarske Medicine, 5, 2, 35-44, 2012
467
ANTIBIOTIC RESISTANCE TO FLUOROQINOLONES IN SALMONELLA SPP.:

RECENT FINDINGS IN SERBIA AND BRIEF OVERVIEW ON EPIDEMIOLOGY,
MOLECULAR TYPING METHODS AND SALMONELLA CONTROL
Maja Velhner1*, Gordana Kozoderovi2, Zora Jelesi3
1
Scientific Veterinary Institute Novi Sad, Novi Sad, Serbia,

Faculty of Education in Sombor, Department of Natural Sciences and Mathematics, University of Novi Sad, Serbia,
3
Institute of Public Health of Vojvodina, Novi Sad, Serbia
Abstract
Resistance to fluroquinolones (FQ) presents a critical public health concern. The therapy in patients
infected with salmonella may become compromised if resistance to FQ occurs, since they are the
drugs of choice in the treatment of complicated salmonelloses. European Committee on
Antimicrobial Susceptibility Testing (EUCAST) has recommended clinical and epidemiological
breakpoints and methods for detection of antimicrobial resistance (AMR) and their recommendation
was recently adopted in Serbia in human medicine. During the period from 2010 to 2015, we
determined minimal inhibitory concentrations for ciprofloxacin in Salmonella spp. isolates that are
most frequently found in humans and animals. Resistance to FQ was confirmed in Salmonella
Infantis and Salmonella Kentucky isolates from chickens and turkeys or the products thereof.
In cases where identification of the source of salmonella infection is demanded, it is essential to
apply adequate food premises swabbing and/or environmental swabbing. Application of sensitive
bacteriological methods for isolation and identification of salmonella, implementation of molecular
typing methods and keeping records about the specific outbreaks is of key importance. In our
laboratories, we use pulse field gel electrophoresis as a molecular typing tool and by using this
technique we have revealed the clonal spread of Salmonella Infantis harboring resistance to FQ. To
detect epidemiological links of Salmonella Enteritidis, random amplified polymorphic DNA
method was helpful.
In this review, we described the occurrence of FQ resistance in isolates originating from Serbia. The
worldwide spread of multiple resistant Salmonella spp. is also briefly discussed. In years to come, it
is highly important to restrict salmonella shedding in breeder flocks, and prevent salmonella
dissemination through the food chain. The important goal is also to harmonize AMR testing of
human clinical isolates and isolates from animals and food products at national level.
Keywords: Salmonella, antimicrobial resistance, molecular typing methods, clonal spread
Introduction
Fluroquinolones (FQ) are synthetic antibiotics frequently used for treatment of gastrointestinal
infections caused by Salmonella spp. and Escherichia coli. The prudent use of such antibiotics is
highly important because this is the only way to prevent resistance development. Salmonella
resistant to FQ is not often isolated in developed countries and it is usually found in travelers that
become infected abroad or from imported foods (Le Hello et al., 2011). Resistance (R) to FQ in
Serbia is determined applying recommendation by Clinical Laboratory Standard Institute (CLSI,
documents M07-A9 and M100-S22), i.e., minimal inhibitory concentration (MIC) for nalidixic acid
(NAL) is R>32mg/L and for ciprofloxacin (CIP), R>4 mg/L. In regard to current legislative in
Serbia, the clinical breakpoints recently adopted are reinforced from European Committee on
Antimicrobial Susceptibility Testing-EUCAST, meaning that resistance to CIP is reported in strains
468
having MICs of >1 mg/L. Epidemiological cut-off value (ECOFF) is recommended at MIC < 0.064
mg/L. European Centre for Disease Control and Prevention (ECDC) has issued a technical
specification on harmonized monitoring and reporting of antimicrobial resistance (ECDC
Technical Document, 2014). Accordingly, it is important to perform AMR testing in Salmonella
spp., Campylobacter jejuni, C. coli, Escherichia coli and Enterococcus spp. and to determine MIC
for the target antibiotics applying interpretative thresholds of AMR (EFSA Journal, 2012).
EUCAST clinical breakpoints and epidemiological cut-off values for the priority list of
antimicrobials in salmonellas are also provided in the ECDC Technical Document, March 2014.
Worldwide spread of multiple resistant clones of Salmonella spp.

The occurrence of multiple resistant Salmonella Typhimurium definitive phage type 104
(STDT104) presents the most significant example of an international clonal spread (Threlfall,
2000). The STDT104 was first isolated from cattle in England and Wales in 1991 and soon after
that it was also found in humans. This clone harbors resistance to ampicillin, chloramphenicol,
streptomycin, sulphonamides and tetracyclines. It also became resistant to quinolones and decreased
susceptibility to fluoroquinolones was also recorded. The related strain Salmonella Typhimurim
variant Copenhagen DT204 is highly resistant to fluoroquinolones and is reported in some
European countries. The STDT204 possesses the following substitution on topoisomerase genes:
gyrASer83Ala, Asp87Asn; gyrB Ser464Phe and parC Ser80Ile (Guerra et al., 2003). The
incidence of both clones has decreased in developed countries due to the restriction of antibiotic use
(Butaye et al., 2006) but S. Typhimurium continues to spread clonally carrying peculiar
mechanisms of resistance having the capacity to survive in the environment for years.
The occurrence of FQ resistant salmonellas is of great concern because of frequent use of FQ in
patient therapy. The occurrence of FQ resistant salmonella is mandatory reported to medical and
veterinary authorities. This was the case when S. Swarcengrund emerged resistant to FQ in the US
causing nosocomial outbreaks in two nursing homes and one hospital in the state of Oregon. The S.
Swarcengrund was probably introduced in the country by an American tourist, who was
hospitalized in Philippines. In these strains, two distinctive point mutations TCCTTC and
GACGGC on gyrA gene were found and are attributed to substitutions of the following amino
acids: (Ser83Phe) and (Asp87Gly), respectively. PFGE analysis has shown that isolates from
patients and environmental samples are indistinguishable. The discovery of S. Swarcengrund in
nursing homes and one hospital in the state of Oregon is a clear example of an outbreak caused by a
traveler (Olsen et al., 2001).
S. Kentucky (SK) presents the most striking evidence of intercontinental spread of FQ resistant
salmonellas. The SK strain originates mostly from African continent and Middle East. Its clonal
nature was determined by multilocus sequence typing and it was confirmed that MLST198 clones
are the most prevalent. Applying PFGE with XbaI enzyme, the cluster X1 appears to be the most
frequent in SK. S. Kentucky may harbor multiple resistant phenotype and some strains are also
resistant to extended spectrum - lactamases (ESBLs) or emerge as superbugs producing
cefalosporinase (AmpC) and carbapenemase. Having in mind that carbepenems present the last
therapeutic option in cases of food borne illness caused by Gram-negative bacteria, reporting the
occurrence of multiple resistant strains of SK is an imperative worldwide (Le Hello et. al. 2013).
Molecular typing methods in detection of the source of Salmonella infection

It is important to detect the source of salmonella infection and from that aspect, a comprehensive
epidemiological work on farms and food processing premises is required. It is also important to
keep records about the source of the material, to use appropriate swabbing techniques, to apply
469
sensitive bacteriology methods for isolation of bacteria, as well as to perform serotyping and data
analysis. Serotyping and resistotyping are indeed first in line to indicate the genetic similarities
between isolates. In Salmonella spp. highly resistant to FQ, critical point mutations on
topoisomerase genes may incline epidemiological relatedness between strains (Olsen et al., 2001,
Guerra et al., 2003).
Molecular typing methods are used for detection of the source of infection by salmonellas and they
are constantly improving. We have summarized some of previously available techniques (Velhner
et al., 2007) as well as the most recent ones (Kozoderovi er al., 2014). Briefly, multilocus sequence
typing (MLST) and multiple locus variable number tandem-repeat assays (MLVA) are currently the
most successful molecular typing methods for salmonellas. Since these methods are not applicable
in some countries, alternatively other PCR based methods (ERIC PCR; RAPD; Rep-PCR; RFLP)
and pulse field gel electrophoresis (PFGE) are used (Olive and Bean, 1999). The PFGE is not
suitable for molecular typing of S. Enteritidis due to high genetic similarities between the strains.
Since S. Enteritids emerge rarely as multiple resistant strain, resistotyping may present fairly
informative or even relevant tool for determining specific outbreaks. Emerging mechanism of
resistance, although not so common, such as resistance to aminoglycosides by producing 16S rRNA
methyltransferase enzymes, was identified in Salmonella spp. (including S. Enteritidis) associated
with nosocomial outbreaks or food poisoning (Hopkins and Gonzales-Zorn, 2012). Identification of
such limited, yet important, mechanisms of resistance could be used to determine specific outbreaks
caused by Salmonellae.
Applying random amplified polymorphic DNA-RAPD analysis, we demonstrated that same
genotypes of S. Enteritidis are shared in humans, food and poultry in Serbia (Kozoderovi et al.,
2011). However, this method is suitable for analysis of large number of isolates due to the relatively
low discriminatory power.
Situation in Serbia regarding resistance to fluoroquinolones in Salmonella

Random resistance monitoring in Serbia revealed that all types of chickens (breeders, layers and
broilers) have been infected with S. Infantis resistant to NAL and tetracycline (also resistant to CIP
according to EUCAST breakpoint). This salmonella is also frequently isolated from humans, thus
presenting a serious contaminant in poultry and food production in Serbia (Raeta et al., 2014,
Velhner et al., 2014, Petrovi et al., 2014). The MIC to CIP in 14.0% of isolates was 2 mg/L, and
two point mutations Ser83Tyr and Ser80Arg were found on gyrA and parC genes, respectively
(Velhner et al., 2014). Salmonella Kentucky was found in turkeys raised on farm located in
Southern Baka region. It appears as a multiple resistant strain and three different resistance
phenotypes were detected. In each case, the resistance to CIP was accomplished with MIC of 8
mg/L. We found evidence that the efflux mechanism plays a role in S. Infanits strains with a single
point mutation on gyrA gene (the MIC-CIP was 1 mg/L) (Velhner et al., 2014, Arnaut et al.,2014).
On the other hand, we established that S. Kentucky probably does not recruit efflux mechanism in
attaining resistance to (fluoro)quinolones since the MIC to CIP and NAL in the presence of efflux
inhibitor Phe-Arg--Naphthylamide-PAN decreases only one to three dilution steps (unpublished
data). S. Typhimurium (ST) isolated from poultry in Sothern Baka and Srem region is susceptible
to antibiotics but so far molecular typing methods have not been applied for ST in our laboratory
(Velhner et al., 2014). Salmonella Enteritidis isolated from human specimens in Serbia is mostly
susceptible to antibiotics although there is a small number of isolates manifesting reduced
susceptibility to ampicillin (two isolates out of 878), cefalothin (one isolate) and
trimethoiprim/sulfamethoxazole (one isolate) (Kozoderovi et al., 2012). Out of 30 randomly
selected S. Enteritidis from poultry, one isolate was found to be multiple resistant to ampicillin,
cefalothin, nalidixic acid and tetracycline, one isolate was resistant to ampicillin and four isolates
were resistant to nalidixic acid only (Kozoderovi et al., 2011).
470
Restriction of salmonella incidence on poultry farms

Good management practice and vaccination approach will reduce salmonella shedding on poultry
farms in long term. National control program addressing infections of poultry, turkeys and pigs with
S. Enteritidis, S. Typhimurium and S. Infanits is highly required in Serbia and has to become
mandatory. It is important to determine the time schedule for salmonella restriction in coming years
in Serbia. The summary of current National legislative and European Directives regarding
salmonella control and AMR monitoring was published recently (Velhner et al., 2014). The
incidence of salmonella in breeder flocks in European Union has to be minimized to reach the
incidence of < 1% (EC 1003/2005, Voss M., 2004). Reduction of zoonotic bacteria in livestock
production is ultimately the primary goal at a national level. In that respect, specialists from
veterinary and agriculture sector need to continuously focus on methods and strategies aimed at
providing safe food for citizens of Serbia.
Conclusion
Salmonellae are very important food borne pathogens. These bacteria may harbor different
mechanisms of resistance and because of their easy spreading and substantial virulent potential such
organisms are perpetuating on animal farms and unfortunately in hospital settings for a long time. It
is very difficult to eliminate salmonellas from farms. The important concern regarding infections
caused by salmonella is monitoring of the AMR and molecular typing. In veterinary sector, typing
methods are used less commonly; however, if outbreaks of human salmonelosis occur, molecular
typing is imperative. Epidemiologists have shown unequivocally that domestic animals and
products are implicated in food borne illness caused by Salmonellas. We demonstrated the
importance of systematic AMR surveillance in Serbia because the research work itself is not
sufficient in determining the occurrence of resistance in zoonotic pathogens and commensal
bacteria in our community.
Acknowledgment
This work was financially supported by a grant from the Ministry of Education, Science and
Technological Development, Republic of Serbia, Project number TR 31071.
References:
1.
2.
3.
4.
5.
6.
Arnaut M., Velhner M., Suvajdi L., Milanov D., Petrovi J., Kozoderovi G.: The role of efflux pump
and other mechanisms of antimicrobial resistance to (fluoro)quinolones in epidemic isolates of
Salmonella Typhimurium, Salmonella Kentucky and Salmonella Infantis. Arhiv Veterinarske Medicine,
7, 1, 71-80, 2014.
Butaye P., Michael G.B., Schwarz S., Barrett T.J., Brisabois A., White D.G.: The clonal spread of
multidrug-resistant non-typhi Salmonella serotypes. Microbes and Infection, 8,7, 1891-1897, 2006.
Clinical and Laboratory Standards Institutes, antimicrobial susceptibility testing M02-A11.
Clinical and Laboratory Standards Institutes, antimicrobial susceptibility testing standard M07-A9
European Centre for Disease Control and Prevention, ECDC Technical document, 2014.
European Food Safety Authority Journal (EFSA Journal), 10(6):2742, 2012: Technical specifications on
the harmonized monitoring and reporting of antimicrobial resistance in Salmonella, Campylobacter and
indicator Escherichia coli and Enterococcus spp. bacteria transmitted through food.
471

7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Guerra B., Malorny B., Schroeter A., Helmuth R.: Multiple resistance mechanisms in fluoroquinoloneresistant Salmonella isolates from Germany. Antimicrobial Agents and Chemotherapy, 47, 6, 2059,
2003.
Hopkins K., Gonzales-Zorn B.: a6S rRNA Methyltransferases: An emerging resistance mechanism
against aminoglycosides in Salmonella. In Annous B.A. and Gurtler J.B.(ed). Salmonella Distribution,
Adaptation, Control Measures and Molecular Technology, pp. 239-250, 2012, InTech, Croatia.
Kozoderovi G., Velhner M., Jelesi Z., Stojanov I., Petrovi T., Stojanovi D., Goli N.: Molecular
typing and antimicrobial resistance of Salmonella Enteritidis isolated from poultry, food, and humans in
Serbia. Folia Microbiologica, 56, 1, 66-71, 2011.
Kozoderovi G, Velhner M., Jelesi Z., Goli N., Lozo J., Kehrenberg C.: Prevalence of quinolone
resistance and mutations in the topoisomerase genes in Salmonella enterica serotype Enteritidis isolates
from Serbia. International Journal of Antimicrobial Agents, 40, 5, 455-457, 2012.
Kozoderovi G., Velhner M.: Use of Molecular Typing Methods in Infection Control. Abstract Book,
Clinical Microbiology, Infectious Diseases, Immunology and Epidemiology, The 6th EURASIA
Congress of Infectious Diseases, 24-27 September 2014, Belgrade, Serbia, Belgrade, EACID, p.196198, 2014.
Le Hello S., Hendriksen R.S., Doublet B., Fisher I., Nielsen E.M., Whichard J.M., Bouchrif B., Fashae
K., Granier S.A., Jourdan Da Silva N., Cloeckaert A., Threlfall E.J., Angulo F.J., Aarestrup F.M., Wain
J., Weill F.X.: International spread of epidemic population of Salmonella enterica serotype Kentucky
ST198 resistant to ciprofloxacin. The Journal of Infectious Diseases, 204, 5, 675-684, 2011.
Le Hello S., Harrois D., Bouchrif B., Sontag L., Elhani D., Guibert V., Zerouali K., Weill FX: Highly
drug-resistant Salmonella enterica serotype Kentucky ST198-X1: a microbiological study. The Lancet
Infectious Diseases, 13, 8, 672-679, 2013.
Olive M.D., Bean P.: Principles and application of methods for DNA-based typing of microbial
organisms. Journal of Clinical Microbiology, 37, 6, 1661-1669, 1999.
Olsen S.J., DeBess E.E., McGivern T.E., Marano N., Eby T., Mauvais S., Balan V.K., Zirnstein G.,
Cieslak P.R., Angulo F.J.: A nosocomial outbreak of fluoroqquinolone-resistant Salmonella infection.
The New England Journal of Medicine, 344, 21, 1572-1579, 2001.
Petrovi J., Bokovi T. Velhner M.: Salmonella Infantis irenje u lancu proizvodnje mesa i pojava
rezistenog klona. Zbornik radova 12.Simpozijuma sa meunarodnim ueem 'Zdravstvena zatita,
selekcija i reprodukcija svinja', Srebrno jezero, 17-19 oktobar 2014.godine, [urednik Dragan
Rogoarski], Poarevac, Veterinarski specijalistiki institut, str.129-130, 2014.
Raeta M., Teodorovi V., Buni O., Kati V., Brankovi-Lazi I., Polaek V., Vidanovi D.:
Antibiotic resistance and molecular studies on Salmonella enterica subspecies enterica serovar Infantis
isolated in human cases and broiler carcasses. Acta Veterinaria, 64, 2, 257-267, 2014.
Threlfall J. E.: Epidemic Salmonella Typhimurium DT 104 a truly international multiresitant clone.
Journal of Antimicrobial Chemotherapy, 46, 1, 7-10, 2000.
Velhner M., Kozoderovi G., Jelesi Z.: Molekularna karakterizacija Salmonella enterica serotip
Enteritidis: priznate metode i njihova primena u odreivanju klonalnog diverziteta: Available methods
and applicability in the research of clonal diversity. Savremena poljoprivreda, 56, 1-2, 112-121, 2007.
Velhner M., Kozoderovi G., Grego E., Gali N., Stojanov I., Jelesi Z., and Kehrenberg C.: Clonal
spread of Salmonella enterica serovar Infantis in Serbia: acquisition of mutations in the topoisomerase
genes gyrA and parC leads to increased resistance to fluoroquinolones. Zoonoses and Public Health, 61,
364-370, 2014.
Voss M.: Control of Salmonella and other zoonotic agents in the European Community- current status
of legislation. Lohmann Information, 42, 18-28, 2007.
472
ANTIMICROBIAL SUSCEPTIBILITY OF MASTITIS PATHOGENS TO IODINELITHIUM COMPLEX IN VITRO

Marina eki Stoi1*, Radomir Ratajac1, Aleksandar Milovanovi1, Jelena Petrovi1, Igor
Stojanov1, Jelena Api1
1

Abstract
Mastitis is the most common reason for antimicrobial use in dairy herds. Antimicrobial resistance of
mastitis pathogens is becoming major problem in the recent time. The use of germicidal teat dips is
one of the measures taken by the dairy industry to control mastitis. Iodine compounds are
commonly used disinfectants in teat dips. We studied in vitro antimicrobial activity of IodineLithium--Dextrin complex (ILD)- known as Armenicum, on 4 ATTC isolates (Pseudomonas
aeruginosa ATTC 27853, Streptococcus agalactiae ATTC 13813, Staphylococcus aureus ATTC
25923, Escherichia coli ATTC 25922). The response of these isolates to iodine varied.
We observed the antimicrobial activity of iodine in this complex on mastitis pathogens and we
determinated variations in minimum inhibitory concentrations (MICs). MICs were determinated by
the broth dilution method according to CLSI with final inoculums of bacterial isolates of
5x107cfu/ml. The results obtained using the two different medias (tryptic soy broth (TSB) and 0.9%
Sodium Chloride Solution) showed huge differences; the MICs values for all isolates had much
higher values in TSB than in Sodium Chloride Solution.
Results showed that in vitro antibacterial activity of ILD is very dependent on the growth media
composition and studied strain. Differences in MICs values can be explained by negative influence
of growth media proteins on iodine activity.
Keywords: antibacterial susceptibility, mastitis pathogens, iodine-lithium complex
Introduction
Mastitis, an inflammatory reaction of mammary gland is the major problem at the dairy farms
worldwide. Mastitis results in economic loss for producers by increasing the costs of production and
by decreasing productivity.
Increasing antimicrobial resistance has become a serious concern worldwide. The most common
pathogens that lead to mastitis forms in cows (either subclinical or clinical) are Staphylococci (S.
aureus). They are closely followed by Streptococci and Escherichia coli (E. coli) which in some
species or settings may have a similar or higher prevalence than that of Staphylococcal mastitis.
Other gram negative organisms isolated from clinical and subclinical mastitis in cows belong to the
genera Pasteurella, Proteus, Pseudomonas or Serratia (Contreras and Rodrguez, 2011).
Antimicrobial resistance of mastitis pathogens has received recent attention, as antibiotic therapy is
a major and a primary tool for mastitis control in lactating and dry cows (Rajala-Schultz et al.,
2004)
Mastitis cannot be totally eliminated from a herd, but the incidence can be held at minimum.
Prevention is the key in mastitis control. A control program should emphasize factors that reduce
the rate of new infections (Arnold, 2011).
473
Teat disinfection is the cornerstone of all mastitis control programs. Disinfecting the teats after
milking (post-milking teat dipping/spraying) is one of the key principal of the 5-point plan
introduced in the 1960s and, since then has been shown to be effective in a huge number of studies.
Pre-milking disinfection is now commonly seen on farm also.
More than 10 different active ingredients have been used in teat disinfectants throughout the world
over the past 30 years. The most commonly used active agents are: iodine, chlorhexidine,
quaternary ammonium compounds, hydrolysed fatty acids, hypochlorite, and acid anionic
compounds.
Many studies have indicated that teat disinfection is a beneficial practice for controlling mastitis
(Oliver et al., 1993; Magnusson et al., 2006; Gibson et al., 2008).
The objective of this study was to determinate the in vitro antimicrobial susceptibility of mastitis
pathogens (Gram- negative and Gram- positive bacteria) to iodine-lithium complex in vitro in
different medias.

Study material, reagents and media
To determinate the minimal inhibitory concentration (MIC), ILD ArmenicumTM obtained from
Armenicum CJSC (Yerevan, Armenia) was tested against Gram-positive and Gram-negative
strains. ILD is an aqueous solution of iodinelithium inclusion complex with low molecular
weight a-dextrin and polyvinyl alcohol. ILD contains 0.16 g of iodine, 0.24 g of potassium iodide,
0.004 g of lithium chloride, 0.06 g of polyvinyl alcohol, 20 g of a-dextrin and 0.114 g of sodium
chloride in a total volume of 20 mL.11 Working dilutions of ILD were prepared after vigorous
shaking and quick v/v dilution in tryptic soy broth (TSB) or in 0.9% Sodium Chloride Solution.
Bacterial isolates
Bacterial isolates that were used in this study were two gram-positive strains (Staphylococcus
aureus ATTC 25923, and Streptococcus agalactiae ATTC 13813) and two gram-negative strains
(Pseudomonas aeruginosa ATTC 27853 and Escherichia coli ATTC 25922).
Inoculation preparation
The strain of bacterial isolates that were used were cultivated on nonselective medium (blood agar
with 5% of defibrillated sheep blood) and incubated for 24h. After 24h growth, the colonies were
taken from nutrient agar and resuspended in saline solution, The suspension was adjusted to a
turbidity equivalent to a 0.5 McFarland standard, which contained approximately 5x108 cfu/mL.
In vitro antimicrobial susceptibility testing- MIC determination
Eleven numbered sterile screw tubes (10x100 mm) were prepared for each strain. Serial 2-fold
dilutions of ILD were prepared in 1 ml volumes of tryptic soy broth (TSB). 1 mL of TSB (tryptic
soy broth) medium was distributed in every tube, except for the tube number 1. In the first two
tubes in the row, 1 mL of tested agent was added; tube 2 was stirred and 1 mL was transferred in
tube 3. This successive transference was repeated until tube 10. After that, 9 ml of TSB was added
in each of 11 tubes and the 100l of 0,5MF inoculum of tested microorganism was added after that.
The eleventh tube was prepared as negative control (containing TSB and 100l of 0.5 McFarland
inoculum of tested microorganism). Incubation was performed at 37oC for 24 hours. After this
period, the reading was performed; the MIC is the concentration of of ILaD that inhibited visible
growth compared with the control growth tube.
474
To detect the variations in antibacterial efficacy of ILaD in various growth media, the same
procedure was repeated using 0.9% Sodium Chloride Solution for initial dilution of ILaD. Except,
after making dilutions, after 2h of exposure , from each tube, 10 l was transferred on selective agar
plate and then were incubated for 24h at 37oC. After this period, the reading was developed; the
MIC is the concentration of of ILaD that inhibited visible growth compared with the negative
control.
Results
The MIC values were determined for ATTC strains, with the final inoculums of 5x107 cfu/mL. for
both groups (ILD diluted in TSB and ILD diluted in 0.9% Sodium Chloride Solution). ILD
diluted in TSB showed remarkably low bactericidal activity. MIC values were determinate in
according with turbidity of solution in tubes. The MIC values for Pseudomonas aeruginosa (photo
1), Escherichia coli (photo 2), Staphylococcus aureus (photo 3) after 24h of incubation were
800mg/L of iodine. Streptococcus agalactiae showed little bit higher sensitivity on ILD solution.
MIC value that was recorded for Streptococcus agalactiae (photo 4) was 400mg/L of iodine.
1. Pseudomonas aeruginosa
2. Escherichia coli
3. Staphylococcus aureus
4. Streptococcus agalactiae
475
ILD diluted in 0.9% Sodium Chloride Solution showed marked bactericidal activity in all 4 ATTC
isolates (slika 2). MIC values were 0,4mg/L and 0,8 mg/L of iodine. MICs for Pseudomonas
aeruginosa, Staphylococcus aureus and Escherichia coli (photo 5) were 0.8 mg/L. Streptococcus
agalactiae, as in previous group (dilution with TSB), showed MIC values different than the other
strains. For this bacterial isolate, ILD inhibited visible growth at lower concentration of iodine:
MIC was 0.4 mg/L.
5. Reduction of growth of Escherichia coli on selective agar plate
Discussion
Mastitis therapy accounts for a very large proportion of antibiotic drug use in dairy production and
one of the aims of organic production is to reduce the use of antibiotics (Hamilton at al., 2006).
Among all mastitis pathogens, Staphylococcus aureus (S.aureus) is the most common etiological
pathogen of contagious bovine mastitis and it has the potential to develop resistance to almost all
the antimicrobial agents (Barkema et al., 2009). This antimicrobial resistance developed by the
pathogens is one of main reasons of low cure rate of mastitis (Gao et al., 2012). The emergence
resistant strains in dairy animals are of great concern for livestock and public health. Teat
disinfection is an important measure in mastitis control. The use of germicidal teat dips is one of the
measures taken by the dairy industry to control mastitis. Cleaning the teat with disinfectant and
drying the teat before milking was the most effective approach in reducing teat-end microbial load
on dairy farms. The mostly use disinfect is iodine, but different results in its effectiveness were
recorded. The effectiveness does depend on formulation in which iodine is. Molecular iodine (I2) is
practically water insoluble unless iodide (sodium or potassium salts) is present in the solution to
form the water-soluble ion (I3 ). Different concentration of iodine in the solutions and the presence
of others agents in it that have role to fortify the activity and solubility of iodine are also very
important. Aqua solution and alcohol solution are resulting in different efficacy. For example, the
determined minimum inhibitory concentration of Polyvidine in aqueous solution was of 6250
12500 mg/L and for alcoholic solutions, the MIC for E.coli was 1560 mg/L (Gava et al. 2009).
Azizoglu et al. (2013) were investigated the response of 37 Staphylococcus aureus on commercially
available topical 10% Povidone-Iodine solution containing 1% titratable iodine. MICs for SA
isolates were in range 500-2000mg/L which shows that MIC value can depends on strains that were
used and its resistance.
The activity of iodine also depends on presence of nutrition material in disinfect formulation. ILD
diluted in Mueller-Hinton Broth (MHB) loses carrier-bound iodine-dependent bactericidal activity
by interacting with nutrients, i.e. amino acids, peptides, proteins etc, existing in broth (Davtyan et
al., 2007). In according with the results that are available, there is big difference in MIC values of
ILD diluted in different broth. MIC values of ILD diluted in MHB for Staphylococcus aureus
was 512mg/L. MIC values of ILD diluted in MHB for Pseudomonas aeruginosa and Escherichia
coli were 1025mg/L (Davtyan et al., 2007). With different broth for dilution, when PSB was used
instead of MHB, results showed MIC values that were 20-40 times lesser (25mg/L). Our results also
476
showed huge differences in MIC values when different broths were used. When TSB was used the
MIC values for Pseudomonas aeruginosa, Escherichia coli, Staphylococcus aureus after 24h of
incubation were 800mg/L of iodine. MIC value for Streptococcus agalactiae was 400mg/L of
iodine. When our experiment was repeated with 0,9% Sodium Chloride Solution, ILD showed
greater antibacterial activity: MICs were in a range 0,4 -0,8 mg/L. These huge differences can be
explained by the presence/absence of nutrients- as in case with MHB/PBS dilution of ILD.
Davtyan et al. (2004), showed that ILD diluted in 0,9% Sodium Chloride Solution displayed
marked bactericidal activity against E.coli, S aureus, among others, during 0,5-30min exposures.
Conclusion
In our study, after 24h exposure bactericidal effect of ILD for studied reference strains (as possible
causative agents of subclinical and clinical mastitis pathogens) was recorded.
The in vitro results of bactericidal activity of ILD showed big differences in iodine concentration
for the same formulation (ILD) in different broths. The results were very dependable on
composition of broth and presence of nutrient. 0.9% Sodium Chloride Solution resulted as media in
which Iodine doesnt interact with so much nutrients so its bactericidal activity is much higher.
ILD is very effective formulation but further studied in vivo are needed.
Acknowledgements
References:
1.
2.
3.
4.
5.
6.
7.
8.
9.
Arnold M.. Staphylococcus aureus mastitis. University of Kentucky College of Agriculture, Lexington,
KY,40546: 1-4, 2011
Barkema, H.W., Green, M.J., Bradley, A.J., Zadoks, R.N.: Invited review: the role of contagious disease
in udder health. J. Dairy Sci., 92, 47174729, 2009.
Contreras G. Andres and Rodrguez Juan Miguel: Mastitis: Comparative Etiology and Epidemiology, J
Mammary Gland Biol Neoplasia, 16:339356, 2011
Davtyan TK, Hakobyan IS, Manukyan HA, Avetisyan SA and Gabrielyan ES: Phagocytosis and
oxidative burst down-modulation by potent mikrobicide lithium-iodophore, national Academy of
Science of RA, Electronic Journal of Science, 2(3), 2004
Davtyan TK, Hakobyan IS, Muradyan RE, Hovhannisyan HG, Gabrielyan ES. Evaluation of amino
acids as mediators for the antibacterial activity of iodine-lithium-alpha-dextrin in vitro and in vivo. J
Antimicrob Chemother., 59(6):1114-22, 2007
Dengfeng Wang, Zhicai Wang, Zuoting Yan, Jianyong Wu, Tariq Ali, Jianjun Li,Yanli Lv , Bo Han:
Bovine mastitis Staphylococcus aureus: Antibiotic susceptibility profile, resistance genes and molecular
typing of methicillin-resistant and methicillin-sensitive strains in China, Infection, Genetics and
Evolution (31), , 916, 2015
Gao, J., Ferreri, M., Yu, F., Liu, X., Chen, L., Su, J., Han, B.: Molecular types and antibiotic resistance
of Staphylococcus aureus from bovine mastitis in a single herd in China. Vet. J.,192, 550552, 2012.
Gibson, H., L. A. Sinclair, C. M. Brizuela, H. L. Worton, and R. G. Protheroe: Effectiveness of selected
premilking teat-cleaning regimes in reducing teat microbial load on commercial dairy farms. Lett. Appl.
Microbiol., 46:295300, 2008.
Hamilton Cecilia, Emanuelson Ulf, Forslund Kristina, Hansson Ingrid and Ekman Torkel: Mastitis and
related management factors in certified organic dairy herds in Sweden, Acta Veterinaria Scandinavica,
48:11, 2006
477

10. Magnusson, M., A. Christiansson, B. Svensson, and C. Kolstrup: Effect of different premilking manual
teat-cleaning methods on bacterial spores in milk. J. Dairy Sci., 89:38663875, 2006,
11. Oliver, S. P., M. J. Lewis, T. L. Ingle, R. E. Gillespie, K. R. Matthews, and H. H. Dowlen: Pre-milking
teat disinfection for the prevention of environmental pathogen intramammary infections. J.Food Prot.,
56:852855, 1993
12. Priscila Gava Mazzola, Angela Faustino Jozala, Letcia Clia de Lencastre Novaes, Patricia Moriel,
Thereza Christina Vessoni Penna, Minimal inhibitory concentration (MIC) determination of
disinfectant and/or sterilizing agents, Brazilian Journal of Pharmaceutical Sciences, vol. 45, n.2, 2009
13. Rajala-Schultz P.J., Smith K.L., Hogan J.S., Love B.C.: Antimicrobial susceptibility of mastitis
pathogens from first lactation and older cows, Veterinary Microbiology ,102, 3342, 2004
478
RANDOM AMPLIFIED POLYMORPHIC DNA ANALYSIS RAPD AND RESISTANCE

TO ANTIMICROBIAL AGENTS IN SALMONELLA SPP. ISOLATED FROM POULTRY
IN SOUTHERN BAKA AND SREM REGION
Dalibor Todorovi1, Maja Velhner1*, Marko Paji1, Bojana Pruni1, Dubravka Milanov1,
Vladimir Polaek1, Dejan Bugarski2
1
Scientific Veterinary Institute Novi Sad, Novi Sad, Republic of Serbia

Ministry of Agriculture and Environmental Protection, Veterinary Directorate, Republic of Serbia,
Abstract
During the year 2014, single isolates of Salmonella spp. were collected from 55 poultry farms in
Southern Baka and Srem region. The research goal was to perform resistotyping as recommended
by the Clinical Laboratory Standards Institute-CLSI (documents M07-A9 and M100-S22). Minimal
inhibitory concentration to ciprofloxacin (MIC) in Salmonella Infantis was determined and
molecular typing applying the Random Amplified Polymorphic DNA-RAPD method was
performed for Salmonella Enteritidis, isolated from five broiler breeder farms, four farms of layer
hens and nine broiler farms.
Salmonella Enteritidis (26 isolates) was susceptible to all antibiotics included in the antibiogram
and similar results were obtained for Salmonella Typhimurium, (resistance to tetracycline in one
isolate). The results were comparable to the results from previous years. Resistance to nalidixic acid
and tetracycline is widespread in epidemic strains of S. Infantis in Serbia. Out of 28 S. Infantis
isolates, 17 were found resistant to nalidixic acid and tetracycline. In the year 2014 we have
detected ciprofloxacin resistance in one isolate and the minimal inhibitory concentration was 4
mg/L. It is evident that Salmonella Infantis has become one of the most important contaminants in
the food chain and has to be considered in the eradication programs.
The RAPD analysis of Salmonella Enteritidis was more discriminative in isolates from broilers and
broiler breeders comparing to isolates from layer chickens. Briefly, we found three different
genotypes of Salmonella Enteritidis isolated from five broiler breeder farms and four genotypes
were detected in isolates from nine broiler farms. Isolates from layers were indistinguishable. In
Serbia there are only two layer breeder farms and it is possible that genetic diversity in Salmonella
Enteritidis is less common in strains from layer hens in our country. For more conclusive results of
RAPD analysis, higher numbers of isolates have to be included in molecular typing research.
Keywords: salmonella,
fluoroquinolones
poultry,
resistance,
RAPD,
minimal
inhibitory
concentration,
Introduction
Salmonella enterica serovar Infantis (S. Infants) presents a very serious contaminant in the food
chain in Serbia (Raeta et al., 2014). The clones resistant to nalidixic acid (NAL) and tetracycline
(TET) were detected in broiler chickens, food and humans (Velhner et al., 2014a; Raeta et al.,
2014). Resistance to quinolones is attributed to mutations on topoisomerase genes. These genes are
encoding GyraseA and topoisomerase IV enzymes. Topoisomearse enzymes are introducing
negative supercoilinig in the chromosomal DNA thus participating in the replication process. The
gyrA and gyrB genes are encoding GyraseA while parC and parE genes are encoding
topoisomersae IV. Point mutations at quinolone resistance determining region (QRDR) of the gyrA,
gyrB, parC and parE genes cause resistance to (fluoro)quinolones (Giraud et al., 2006). The point
479
mutations are detected by polymerase chain reaction (PCR) and sequencing. In S. Infantis from
Serbia in the gyrA gene, a single mutation leading to Ser83Tyr amino acid exchange was
detected. In strains with minimal inhibitory concentration to ciprofloxacin of 2mg/L, another
substitution of Ser80Arg on parC gene was also found (Velhner et al., 2014a). It was concluded
that resistance to (fluoro)quinolones has increased and this is particularly worrisome in human and
poultry isolates.
Salmonella enterica serovar Enteritidis (S. Enteritidis) isolated in poultry flocks in Southern Baka
and Srem district, does not exhibit resistance phenotype except in very rare cases. Because of their
virulent potential S. Enteritidis is at the priority list for eradication programs around the world. For
the purpose of epidemiological studies the PCR based method called Random Amplified
Polymorphic DNA-RAPD analysis could be used (Velhner et al., 2007). In previous work, the
RAPD method was applied to examine genetic relatedness in S. Enteritidis. It was revealed that
same genotypes of S. Enteritidis are shared in humans, food and poultry in Serbia (Kozoderovi et
al., 2011).
The main focus of this work is to briefly present the resistance to (fluoro)quinolones in S. Infantis
collected during the year 2014, from single poultry farms located in Southern Baka and Srem
region. The RAPD method was used in a small number of S. Enteritidis from unrelated farms to test
the molecular typing capacity of the method.

Source of bacterial isolates
Twenty eight isolates of S. Infantis from single poultry farms in Southern Baka and Srem region
were collected during the year 2014. The resistotyping and MIC analysis was performed to monitor
antimicrobial resistance. Resistotyping was performed also on 26 S. Enteritidis isolates, and one S.
Typhimurium isolate from the same region. RAPD was done for S. Enteritidis recovered from five
broiler breeder farms, nine broiler farms and four layer farms.
Resistotyping and determination of minimal inhibitory concentration (MIC)
Resistotyping and MIC analysis were done according to the recommendations of the Clinical
Laboratory Standard Institute (CLSI, documents M100-S22 and M07-A9). The following
antibiotics were included in resistotyping: Ampicilin 10 g (AMP), Amoksicilin/klavulanic acid 20
g + 10 g (AMC), Chloramphenicol 30 g (CAP), Ciprofloxacin 5 g (CIP), Gentamycin 10 g
(GEN), Nalidixic acid 30 g (NAL), Streptomycin 10 g (STR), Sulphonamides 300 g (SA),
Tetracycline 30 g (TET), Trimethoprim/sulfamethoxazole 1.25 g + 23.75 g (SXT),
Trimethoprim 5 g (TMP), Cefpodoxime 10 g (CPD), Cefotaxime 30 g (CTX), Ceftazidime 30
g (CAZ) (BioRad, Marnes-la-Coquette, France). MIC to ciprofloxacin (Sigma Aldrich, Mnchen,
Germany) was interpreted as resistant at a concentration of > 4 mg/L.
RAPD typing
DNA isolation was done using the commercial kit for DNA isolation (Qiagen, Hilden, Germany).
The primers used for RAPD typing were: P1254-5` CCG CAG CCA A, 23L-5` CCG AAG CTG C,
OPB17-5` AGG GAA CGA G and OPB4-5` AAT CGG GCT G. The PCR protocol consisted of the
following cycling temperatures: initial four cycles 4min at 94C, 4min 35C, 4 min 72C followed
by 35 cycles of 94C, 30 sec., 35C 1 min, 72C 2 min, and extension 72C 10 min (Betancor et al.,
2004). The PCR was run in Thermal cycler TECHNE (Bibby Scientific LTD, UK). Agarose gel
480
electrophoresis was done by applying 2% agarose gel (AppliChem, Darmstadt, Germany) prepared
in 1x TBE buffer, supplemented with ethidium bromide at a concentration of 0.5 l/10 mL.

In the year 2014 we detected one out of 28 S. Infantis isolates resistant to FQ (MIC 4 mg/L). The
MIC break points were as recommended by CLSI (document M100-S22). Eight isolates exhibited
MIC of 2 mg/L to CIP. The obtained results indicate the importance of resistance monitoring in S.
Infantis from Serbia and point out the necessity of prudent use of antibiotics in the future. S. Infantis
tends to spread clonally (Hauser et al., 2012) and from that aspect it is not surprising that flocks of
laying hens and breeder flocks are also infected. However, the results of MIC analysis clearly show
that S. Infantis from broilers has much higher MIC values than in layers, due to the uncontrolled
therapy of broiler chickens, at the end of fattening (Table 1). Interestingly nine isolates have MIC <
0.031 mg/L raising possibility that some of the strains that emerged on poultry farms have maybe
originated from animal feed.
Table 1: MIC CIP distribution in S. Infantis isolates from poultry farms in Southern Baka and Srem region
No
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Number of
the sample
3947
4143
4682
4716/1
4855
5580
5582
5656
5736/1
7639/3
9643
9784
9849/2
10175
10101
9699
11420/2
11288
10596
12913
12140
13220/1
5653
6597
9815/2
12777
12473
8761
Poultry flocks
Resistotype
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Broilers
Layers
Layers
Layers
Layers
Layers
Broiler breeders
/
NAL
NAL, TET
NAL, TET
NAL, TET
NAL, TET
NAL, TET
NAL, TET
NAL, TET
NAL, TET
NAL, TET
/
/
/
NAL, TET
NAL, TET
NAL, TET
NAL, TET
NAL, TET
/
NAL, TET
NAL, TET
NAL, TET
/
/
/
/
/
MIC-CIP
mg/mL
0,031
0,5
2
2
2
4
2
0,25
1
1
1
0,031
0,007
0,015
2
0,25
1
2
2
0,015
2
0,5
0,25
0,031
0,5
0,015
0,007
0,015
S. Enteritidis (26 isolates) were susceptible to antibiotics included in resistotyping while S.

Typhimurium (one isolate) was resistant to tetracycline and this results are comparable to the results
of resistotyping from previous years (Velhner et al., 2014b). There are many ways for Salmonella to
enter the food chain and stubbornly persist in poultry premises for years. Those are the reasons why
481
it is extremely difficult to eradicate it from the food and feed chain (Velhner et al., 2011). The first
important step is to determine the source of infection and pursue a comprehensive monitoring
system and eradication program.
We have performed the RAPD method on a small number of S. Enteritidis from broiler breeders,
broilers and laying hens for genetic analysis. This method utilizes the PCR technique and from that
aspect it is available for laboratories with basic PCR equipment. In the RAPD method, primers are
binding randomly to genomic DNA which enables detection of fragments between primer binding
sites. The gel bends are compared and recorded and even if one band differences are obtained this
means that S. Enteritidis are genetically different. In this work in S. Enteritidis from broiler breeders
we detected three different RAPD profiles (AAAA, BBAA, ABAA), in layer hens only one
genotype was recorded, namely the AAAA group (Fig 1) in broilers four genotypes were detected
(AAAA, ABBB, BCAA and ACAA), (Fig 2). Since there are only two breeder laying flocks in
Serbia and S. Enteritidis is genetically quite similar, the result from the experiment is not very
surprising.
Fig 1: RAPD typing of S. Enteritidis isolates from broiler breeders and layers in Southern Baka and
Srem Region (consecutive numbers are broiler breeder farms 1-5, layers 6-9, capital letters are
denoting the RAPD patterns)
Molecular typing of S. Enteritidis from broilers and broiler breeders displays some diversity but still
at a low level, meaning that S. Enteritidis from specific outbreaks would be difficult if impossible to
distinguish applying RAPD only.
482
The RAPD method is used widely but does not present the method of choice for molecular typing
of small number of isolates because of lower discriminatory power and poor reproducibility.
Nowadays, multilocus sequence typing (MLST) and multi locus variable number of tandem repeats
(MLVA) are golden standards for genetic typing of S. Enteritidis (Kozoderovi et al., 2014).
Fig 2: RAPD typing of S. Enteritidis isolates from broilers in Southern Baka and Srem Region (consecutive
numbers are broiler farms; capital letters are denoting the RAPD patterns)
Conclusion
Resistance to FQ in S. Infantis has increased over the years in Serbia. Smaller number of strains
may contaminate poultry farms through feed. The MIC analysis has shown that broiler chickens are
infected with increasingly resistant S. Infantis comparing to layer hens. Careful antibiotic use
especially of FQ is necessary in Serbia. RAPD technique could be applied for molecular typing, but
keeping in mind the limitations of the method. Therefore the best is to combine RAPD with
resistotyping and other genetic methods, to increase the chances of distinguishing isolates from a
specific outbreak and determine the source of infection.
Acknowledgement
This work was financially supported by a grant from the Ministry of Education, Science and
Technological Development, Republic of Serbia, Project number TR 31071.
483
References:
1.
Betancor L., Schelotto F., Martinez A., Pereira M., Algorta G., Rodrguez M.A., Vignoli R.,
Chabalgoity J.A.: Random amplified polymorphic DNA and phenotyping analysis of Salmonella
enterica serovar Enteritidis isolates collected from humans and poultry in Uruguay from 1995 to 2002.
Journal of Clinical Microbiology, 42, 3, 1155-1162, 2004.
2. Clinical and Laboratory Standards Institute 2012a: Methods for Dilution Antimicrobial Susceptibility
Tests for Bacteria that Grow Aerobically; Approved Standard-Ninth Edition. CLSI document M07-A9.
CLSI Wayne, PA, USA.
3. Clinical and Laboratory Standards Institute, 2012b: Performance Standards for Antimicrobial
Susceptibility Testing; Twenty-Second Informational Supplement. Clinical and Laboratory Standards
Institute document M100-S22, CLSI, Wayne, PA, USA.
4. Giraud E., Baucheron S., Cloeckaert A.: Resistance to fluoroquinolones in Salmonella: emerging
mechanisms and resistance prevention strategies. Microbes and Infection 8, 7, 1937-1944, 2006.
5. Hauser E., Tietze E., Helmuth R., Junker E., Prager R., Schroeter A., Rabsch W., Fruth A., Toboldt A.,
Malorny B.: Clonal dissemination of Salmonella enterica serovar Infantis in Germany. Foodborne
Pathogen and Disease, 9, 4, 352-360, 2012.
6. Kozoderovi G., Velhner M., Jelesi Z., Stojanov I., Petrovi T., Stojanovi D., Goli N.: Molecular
typing and antimicrobial resistance of Salmonella Enteritidis isolated from poultry, food, and humans in
Serbia. Folia Microbiologica, 56, 1, 66-71, 2011.
7. Kozoderovi G., Velhner M.: Use of Molecular Typing Methods in Infection Control. Abstract Book,
Clinical Microbiology, Infectious Diseases, Immunology and Epidemiology, The 6th EURASIA
Congress of Infectious Diseases, 24-27 September 2014, Belgrade, Serbia, Belgrade, EACID, p.196198, 2014.
8. Raeta M., Teodorovi V., Buni O., Kati V., Brankovi-Lazi I., Polaek V., Vidanovi D.:
Antibiotic resistance and molecular studies on Salmonella enterica subspecies enterica serovar Infantis
isolated in human cases and broiler carcasses. Acta Veterinaria, 64, 2, 257-267, 2014.
9. Velhner M., Potkonjak D., Stojanov I., Stojanovi D., Petrovi J., Kozoderovi G.: Salmonella control
in poultry production and resistance monitoring in Serbia. Arhiv Veterinarske Medicine, 4,2, 11-22,
2011.
10. Velhner M., Kozoderovi G., Jelesi Z.: Molekularna karakterizacija Salmonella enterica serotip
Enteritidis: priznate metode i njihova primena u odreivanju klonalnog diverziteta. Savremena
poljoprivreda, 56, 1-2, 112-121, 2007.
11. Velhner M., Kozoderovi G., Grego E., Gali N., Stojanov I., Jelesi Z., and Kehrenberg C.: Clonal
spread of Salmonella enterica serovar Infantis in Serbia: acquisition of mutations in the topoisomerase
genes gyrA and parC leads to increased resistance to fluoroquinolones. Zoonoses and Public Health, 61,
364-370, 2014a.
12. Velhner M., Todorovi D., Paji M., Stojanov I.: Antimicrobial resistance of Salmonella spp. Isolated
from poultry farms in Southern Baka and Srem County. XVI International Symposium Feed
Technology, Abstract Book, 28-30, 10. 2014 Novi Sad, Serbia, p 57, 2014b
484

DETECTION OF INFECTED GOATS WITH CAE VIRUS-CONTROL
MEASURES AND PREVENTION
Miodrag Radinovi1*, Marija Paji1, Stanko Bobo1, Branka Vidi2, Sara Savi2, Annamaria Galfi1
1
Faculty of Agriculture, University of Novi Sad, Novi Sad, Serbia

2
Abstract
Arthritis-encephalitis is a persistent viral disease of goats that is characterized by neurological
changes, interstitial pneumonia and arthritis. The causative agent is a virus from the family
Retroviridae, genus Lentivirus. For the first time the disease was mentioned in 1964 in Switzerland
and the causative agent was identified in 1980. The disease is now present on all continents and it
affects mainly goats of dairy breeds regardless of race and age, can infect sheep but this kind of
virus transmission to other species is rarity. The disease does not have zoonotic potential.
The virus is transmitted from infected goats to offspring by suckling colostrums or milk. The
expansion is possible also by direct contact and during milking. Iatrogenic transmission of infection
via contaminated equipment has to be taken into account. Clinical symptoms in younger animals are
related to nervous symptoms and in the adults arthritis and mastitis are more often present.
The study was conducted on dairy goats which were in control for presence of antibodies to CAE
virus, in a group of young animals which were separated from adults infected goats and fed
colostrums and milk after heat treatment. At the time of the serological examination group of
goatlings was aged 90-120 days. Control pointed out that in young animals which at the moment of
formation of groups that were serologically negative on subsequent samplings; there were a number
of seropositive individuals. From a total of 156 specimens of which are formed five groups after 90
days from the first examination there was 51 seropositive to CAEV.
Keywords: goats, CAE, infection, ELISA, prevention
Introduction
Arthritis encephalitis (caprine arthritis encephalitis, CAE) is a viral incurable disease of goats
present in most countries engaged in intensive production of goat's milk. The disease is manifested
by several symptoms, depending on the age of the animal (Peterhans et al, 2004). Infection is
manifested clinically as polysynovitis-arthritis in adult goats and less commonly as progressive
paresis (leuko-encephalomyelitis) in goatlings. There are signs of nervous system disorders in
goatlings up to the age of six months that are manifested by paresis and paralysis of the extremities
particularly the hind legs. This form of the disease regularly ends with mortality. In older animals
the symptoms are swelling of the ankles, indurations of the udder, mastitis, interstitial pneumonia
and thinness (Woodard et al, 1982). The damage that causes the disease is manifested with
mortality in goatlings, reducing milk production, increased number of somatic cells and premature
culling from breeding. Goats can be infected and asymptomatic, and express clinical manifestations
that may be due to stress. In addition to clinical examination, certain diagnosis of diseases includes
serological examinations of blood.
485
According to some research infected goats in the first lactation produces 100 litres less milk. Milk
from infected goats contains higher number of somatic cells in comparison to healthy animals
(Lerondelle et al, 1995). Subclinical or clinical interstitial pneumonia, indurative mastitis ("hard
udder), and chronic wasting have also been attributed to infection with this virus. Most CAE virus
infections, however, are subclinical. Infection with the CAE virus decreases the lifetime
productivity of dairy goats and is a barrier to exportation of goats.

Research was conducted on a dairy goat farm, with 450 goat alpine breed. Average milk production
on farm was 550 litres per year. Symptoms pointing on arthritis-encephalitis were observed in
animals so serological examination of animals was organized in order to detect infected animals.
Also in group of goatlings blood sampling and serological examination were carried out.
Blood samples were also taken in a group of young animals which were separated from adults
infected goats and fed colostrums and milk after heat treatment. At the time of the serological
examination group of kids was aged 90-120 days. After first negative analysis kids were placed in
separated boxes allocated from adult goats. Blood samples were taken from the jugular vein with a
needle diameter of 0.7 mm in vacutainers tube volume 6 millilitres and delivered the same day in
the Laboratory for serological diagnosis of viral diseases of Scientific Veterinary Institute in Novi
Sad. Antibodies to the virus CAE were determined by ELISA Antibody ELISA Test Kit CHEKIT
CAEV / MVV Screening, IDEXX, Lot No. 210-W261 and Antibody Test Kit CHEKIT CAEV /
MVV Confirmation, IDEXX, Lot No. 210-U351, following manufacturer instructions.

Results of serological analysis of blood serums from adult goats are shown in table 1. There was in
total 204 samples taken from goats and 76 samples were positive, counting 37.2 %. Samples were
taken during 6 months in six different sampling.
Table 1. Results of serological examination of goat blood on CAEV
A
Sampling
D
E
F
Total
Total
51
13
15
36
81
8
204
samples
Positive
5
13
2
20
36
4
76
samples 9.8% 100% 13.3% 55.5% 44.4% 50% 37.2%
Blood samples were taken from reproductive males also, there were in total 11 samples and 7 were
positive on CAEV, counting 63.6%.
Table 2. Results of serological analysis of goatling blood samples on CAEV, first sampling
Number of
samples
Positive
samples
Box
3
25
23
37
30
41
156
0
0.0%
1
4.3%
5
13.5%
3
10%
1
2.4%
10
6.4%
486
Total
In group of goatlings samples were taken from each animal before placing them in boxes for
grazing. After 90 days another sampling was done and showed a number of new seropositive
animals. Results of this analysis are shown in table 2.
In first sampling from total 156 samples there were 10 positive samples on CAEV, counting 6.4 %
of animals.
Table 3. Results of serological analysis of goatling blood samples on CAEV, second sampling
Number of
samples
Positive
samples
Box
3
25
23
37
30
41
Total
156
8
5
8
8
22
51
32.0% 21.7% 21.6% 26.6% 53.6% 32.7%
In second sampling from total 156 samples there were 51 positive samples on CAEV, counting 32.7
% of animals. So in 120 days period there were 41 new positive animals.
Infection of goats with CEAV is widely spread in dairy goats herds, affecting on production and
reproduction of animals in infected herds (Kaba et al, 2012). Seroprevance of infection is different
in herds and has tendency of increasing through time (Bradley, 2014). In tested herd seroprevance
was 37.2% in adult animals and in young animals it was increasing with age of animals from 6.4%
to 32.7% in animals with six to eight months of age. Increasing prevalence rates with age is best
explained by horizontal transmission due to contact with CAEV infected goats (Synge et al, 2010).
For transmission of CAEV it is necessary to achieve direct contact although some authors
allegation says that virus can be found in trachea (Narayan, 1985) which allows respiratory
infection. Our study has showed that goatlings that are not infected by ingestion of raw milk or
colostrums can also be infected by contact with seropositive animals.
Acknowledgments
This study was supported by Ministry of Education, Science and Technological Development, grant
No. TR 31034 and 31071.
References
1.
2.
3.
4.
5.
6.
Bradley Todd Jones. The current prevalence of caprine arthritis encephalitis virus in Midwestern goat
herds, The Dissertation-Thesis, 2014.
Ghanem YM,El-Khodery SA, Ashraf AS, Elragaby SA, Abdelkader AH, Heybe A. Prevalence and risk
factors of caprine arthritis encephalitis virus infection (CAEV) in Northern Somalia. Small Ruminant
Research, 85:142-148, 2009.
Kaba J,, Strzalkowska N, Jozwik A, Krzyzewski J, Bagnicka E. Twelve-year cohort study on the
influence of caprine arthritis-encephalitis virus infection on milk yield and composition. Journal of
Dairy Science, 95:1617-1622, 2012.
Lerondelle C, Greenland T, Jane M, Mornex JF. Infection of lactating goats by mammary instillation of
cell-borne caprine arthritis-encephalitis virus. Journal of Dairy Science, 78:850-855, 1995.
Narayan O CL. Lentiviral Diseases of Sheep and Goats: Chronic Pneumonia Leukoencephalomyelitis
and Arthritis. Reviews of Infectious Diseases, 7:89-98, 1985.
Peterhans E., Greenland T., Badiola J., Harkiss G., Bertoni A., Amorenae B., Eliaszewiczf M., Justeg
R.A,, Kranigh R., Lafonti J-P., Lenihanj P., Pturssonk G., Pritchardl G., Thorleym J., Vitun C.,
487
7.
8.
9.
Mornexb J-F., Ppinn M. Routes of transmission and consequences of small ruminant lentiviruses
(SRLVs) infection and eradication schemes. Veterinary Research; 35:257-274, 2004.
Rowe JD, East NE. Risk factors for transmission and methods for control of caprine arthritisencephalitis virus infection. The Veterinary Clinics of North America Food Animal Practice.
Philadelphia, Pennsylvania: W.B. Saunders Company, 1997.
Synge BA, Ritchie CM. Elimination of small ruminant lentivirus infection from sheep flocks and goat
herds aided by health schemes in Great Britain. Veterinary Record, 167:739-743, 2010.
Woodard JC, Gaskin JM, Poulos PW, MacKay RJ, Burridge MJ. Caprine arthritis-encephalitis:
Clinicopathologic study. American Journal of Veterinary Research, 43:2085-2096, 1982
488

IMMUNOGLOBULIN G CONCENTRATION AND ULTRASONOGRAPHY OF THE
COWS UDDER WITH SUBCLINICAL MASTITIS
Annamaria Galfi1*, Miodrag Radinovi1, Marija Paji1, Stanko Bobo1, Branka Vidi2, Sara Savi2,
Dubravka Milanov2
1
Faculty of Agriculture, Novi Sad, R. Srbija

Scientific Veterinary Institute Novi Sad, Novi Sad, R. Srbija
Abstract
Subclinical mastitis represents a secretion disorder of the mammary gland which is characterized by
finding of microbiological causes of mastitis in milk without clinical symptoms of the disease.
Immunoglobulins in milk have an important role in udder defence from infection and mastitis. The
most important immune component in cows colostrum and milk is IgG at whose concentration
significantly affects phase of lactation period, where it is the highest during involution of the
mammary gland. In this period, the mammary gland is the least sensitive to the occurrence of
infections.
Ultrasonography allows the visualization and differentiation of morphological structures of healthy
mammary gland, and its pathological alterations such as inflammation (subclinical and clinical
mastitis), haematomas, abscesses and oedema of the udder parenchyma, stenoses, obstructions and
fibrous changes of the teat canal.
The changes that occur in the mammary gland during subclinical and clinical mastitis can easily be
recognized and differentiated by ultrasonography, with increases of IgG concentration in milk
serum. The highest concentration of immunoglobulin G was recorded in the pre-drying period of
the mammary gland with subclinical mastitis where Staphylococcus haemolyticus was isolated and
estimated as 22.28 g/L. Ultrasound examination of the udder showed irregular contour of teat canal
and milk sinus, with impossibility of distinguishing the three-layered structure of the teat wall. The
lowest level of IgG (0.89 g/L) was recorded in animals with positive bacteriological finding in early
lactation period.
The aim of this paper is to highlight the importance of immunoglobulin G concentration in milk of
cows with different ultrasound findings of udder.
Key words: cows, udder, subclinical mastitis, immunoglobulin, ultrasonography
Introduction
In modern cattle production, mastitis is one of the most significant diseases of dairy cows that
causes severe economic losses. In addition, this disease is reducing milk quality and its safety.
Beside this, mastitis affects animal welfare and is one of the main reasons for the use of antibiotics
in dairy cows which leads to an increase in the risk of occurrence of microorganisms resistant to
certain drugs. Inflammatory processes in the mammary gland of cows is usually due to the presence
of infectious agents bacterial origin, which can lead to secretion disorder of the udder, an increase in
somatic cell count and mastitis (Radinovi et al., 2014), whereby the subclinical form characterized
by microbiological findings of pathogens without clinical manifestations of disorders. Subclinical
mastitis is important due to the fact that it is 15 to 40 times more prevalent than the clinical form, is
489
of long duration, difficult to detect, adversely affects milk quality and production of dairy animals
and constitutes a reservoir of microorganisms that can affect other animals within the herd (Sharif
and Muhammad, 2008).
Important role in udder defence from mastitis pathogens have three classes of immunoglobulin: IgG
(IgG1, IgG2), IgA and IgM (Sordillo et al., 2002; 2007). The most important immune component in
bovine colostrum and milk is immunoglobulin G on whose concentration significantly affects udder
health status and phase of lactation period. The highest concentration of IgG is during involution of
the mammary gland (Gapper et al., 2007; Bobo et al., 2014). In this period, the mammary gland is
the least sensitive to the occurrence of infections. In udder secretion, predominant immunoglobulin
is IgG1 (81%) which is derived from blood into milk selective transport (Gapper et al., 2007). Other
classes of immunoglobulin are present in low concentrations in milk (Table 1).
Table 1. Immunoglobulins in bovine colostrum and milk (Butler, 1973)
Immunoglobulin
Concentration,
mg/mL
% of total
immunoglobulins
Colostrum
Milk
Colostrum
Milk
IgG1
47.60
0.59
81.0
73.0
IgG2
IgA
IgM
2.90
3.90
4.20
0.02
0.14
0.05
5.0
7.0
7.0
2.5
18.0
6.5
Ultrasound, as a non-invasive and simple method, that allows visualization of physiological

structure of the mammary gland and its pathological alterations such as inflammation (subclinical
and clinical mastitis), haematomas, abscesses and oedema of the udder parenchyma, stenoses and
obstruction of the teat canal (Javadi and Acorda, 2011; Kotb et al., 2014).
The aim of this paper is to highlight the importance of immunoglobulin G concentration in milk of
cows with different ultrasound findings of udder.

The experiment was conducted on a dairy farm of Holstein-Friesian breed. Following the
production cycle, milk samples were taken from cows in the pre-drying period and from the same
cows in early lactation period. Quarter milk samples for bacteriological analysis were taken during
the morning milking aseptically from the teat canal in sterile test tubes. Before sampling, cleaning
and disinfection of the udder teats was done using 76% alcohols. The samples were labelled and
submitted to the laboratory for analysis at the temperature of refrigerators. A total of 54 quarter
milk samples were examined. Out of this number, 28 were from cows in pre-drying period and 26
samples were from cows in early lactation period. Bacteriological processing of samples was
performed by seeding on the nutrient media with aerobic cultivation in the Laboratory for
Bacteriology, Microbiology and Parasitology, Scientific Veterinary Institute "Novi Sad", Novi Sad.
Determination of immunoglobulin G concentration in milk serum was performed in the Laboratory
of Food Hygiene, Faculty of Agriculture, Novi Sad, using the RID plate manufactured by INEP,
Zemun, according to manufacturers instruction.
Ultrasound examination of cows udder was performed to diagnose subclinical form of mastitis,
using ultrasound device Esaote pie medical- falco (Netherlands) connecting with a 6-8 MHz linear
transducer. Ultrasound gel was applied to the transducer and to the udder skin to ensure proper
490
contact between the transducer and skin. The ultrasound examination of the udder parenchyma is
performed using the direct contact method (transcutaneous echography) with a 6 MHz linear probe,
while examination of the teat structures is conducted by water bath method with a help of a 8
MHz linear probe (Fasulkov, 2012).

The study included 54 quarter milk samples for determination of immunoglobulin G concentration
and the presence of bacteria, cause of mastitis. 30 quarter milk samples had negative bacteriological
findings (55.5%), while the other 24 samples were positive to bacteria (44.5%).
Immunoglobulin G concentration in milk serum of cows in different lactation stage with negative
and positive bacteriological findings are shown in Table 2. The lowest concentration of IgG
determined in early lactation period with positive bacteriological finding and counted 0.89 g/L. The
highest Ig G concentration was observed in milk serum with positive finding in pre-drying period
and it was 22.28 g/L.
Table 2. Ig G concentration in milk serum of cows with negative and
positive bacteriological findings
Bacteriological
findings
lactation
period
Negative
pre-drying
early lactation
Positive
IgG concentration
minimum
maximum
mean value
3.43
1.53
10.02
13.03
6.92 1.78
4.21 3.09
pre-drying
2.24
22.28
6.72 5.75
early lactation
0.89
19.23
5.13 5.50
Ultrasound appearance of the cows udders without mastitis and those with subclinical and clinical
mastitis are shown in Figure 1. The glandular parenchyma of cows udder without mastitis appeared
as homogenous and hyperechoic structure with anechoic zones which correspond to a blood vessel
or a lactiferous duct (Ayadi et al., 2003; Rambabu et al., 2008). Mastitis produces an increased
heterogeneous echogenicity of udder structures. Before milking, milk alveoli showed anechoic fluid
with suspended hypoechoic dots which echogenicity increased after milking.
Figure 1. Ultrasound appearance of the cows udder without mastitis (A),

with subclinical mastitis (B) and clinical mastitis (C)
491
Immunoglobulin G concentration in milk serum of cows during early lactation period was
significantly lower compare to the pre-drying period and amounted to 4.21 g/L, while in the predrying period was 6.92 g/L. These finding correspond to the results of research Krol et al. (2010)
and Bobo et al. (2014). The lowest concentration of IgG was observed in the period after
parturition with positive bacteriological findings and amounted to 0.89 g/L, while the highest
concentration recorded in pre-drying period with positive findings and was 22.28 g/L.
Ultrasound appearance of cows udder with subclinical form of mastitis indicates the characteristic
findings such as irregular contours of teat canal and sinus, with impossibility to recognize papillary
layers of teat wall, the loss of clear boundaries parenchyma of the udder structures. The milk alveoli
are seen as anechoic structure with suspended hypoechoic areas, where these findings correspond to
research Kotb et al. (2014) and Javadi and Acorda (2011). Increased echogenicity of milk cistern of
cows with clinical mastitis is caused by the presence of pus and clots in it.
Ultrasonography of the mammary gland may have great diagnostic importance as a simple, noninvasive and fast method in determination of mastitis and easy distinguish between animals with
and without changes in the glandular parenchyma and teat structures.
Acknowledgments
This study was supported by Ministry of Education, Science and Technological Development, grant
No. TR 31034 and 31071.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Ayadi M, Caja G, Such X, Knight CH. Use of ultrasonography to estimate cistern size and milk storage
at different milking intervals in the udder of dairy cows. J. Dairy Res. 2003; 70(1): 1-7.
Bobo FS, Galfi LA., Radinovi M, Paji JM, Mai SZ. Effect of lactation stage and bacteriological
findings on IgG concentration in milk serum of cows. Veterinary Medicine. Kharkiv. 2014; 99: 93-5.
Butler JE. Synthesis and distribution of immunoglobulins. J. Am. Vet. Med. Assoc. 1973; 163: 795-8.
Fasulkov IR. Ultrasonography of the mammary gland in ruminants: a review. Bulgarian Journal of
Veterinary Medicine. 2012; 15(1): 1-12.
Javadi T, Acorda JA. Ultrasound features and echo mean values of udder and teat in dairy cows with
mastitis. Philipp. J. Vet. Anim. Sci. 2011; 37(2): 167-76.
Kotb EEZ, Abu-Seida AM, Fadel MS. The correlation between ultrasonographic and laboratory finding
of mastitis in buffaloes (Bubalus bubalis). Global Veterinaria. 2014; 13(1): 68-74.
Krol J, Litvinczuk Z, Brodziak A, Barlowska J. Lactoferrin, lysozyme and immunoglobulin G content in
milk of four breeds of cows managed under intensive production system. Polish journal of veterinary
science. 2010; 13(2): 357-61.
Gapper LW, Copestake DE, Otter De, Indyk HE. Analysis of bovine immunoglobulin G in milk,
colostrum and dietary supplements: a review. Anal Bioanal Chem. 2007; 389: 93-109.
Radinovi M, Bobo S, Paji M, Galfi A. Uticaj uzronika mastitisa na higijensku ispravnost mleka. 25.
Savetovanje veterinara Srbije. Zlatibor. 11-14. septembar 2014; 267-72.
Rambabu K, Sreenu M, Suresh Kumar RV. Ultrasonography of the udder and teat in buffaloes: A
comparision of four methods. Buffalo Bulletin. 2008; 27(4): 269-73.
Sharif A, Muhammad G. Somatic cell count as an indicator of udder health status under modern dairy
production: a review. Pakistan Vet. J. 2008; 28(4): 194-200.
Sordillo LM, Shafer-Weaver K, DeRosa D. Immunobiology of the mammary gland. Journal of dairy
science. 1997; 80(8): 1851-65.
Sordillo LM, Streicher KL. Mammary gland immunity and mastitis susceptibility. Journal of mammary
gland biology and neoplasia. 2002; 7(2):135-46
492
Supplement to Session 2: Food anf feed safety and quality

REMEDIATION OF BY-PRODUCTS OF SLAUGHTERED LIVESTOCK
Djordje Okanovi1*, Milutin Risti1
1
Institute of food technology, University of Novi Sad, Serbia

Abstract
The importance of harmless removal of animal wastes increases with the intensification of animal
breeding and with development of meat processing plants. It is irreplaceable, preventive veterinary
and sanitary measure used in control of livestock diseases and zoonosis. Nowadays, it has a big role
in environment protection.
To the most rational solutions of their disposal belong their processing into feed, or raw materials
for chemical industry and production of biofuels. Manufacturing of feed from sanitary safe raw
materials (animal by-products belonging to Category 3 products) they are multiply valorized, with
assurement of the rational development of cattle growing and of protection of the environment.
Application of biofuels contributes to reduction of oil consumption (i.e. of imports), reduction of
emissions of detrimental gases, stimulation of sustainable development of rural regions and
increasing of available quantities of high-quality animal feed.
If all mentioned ecological and economical aspects are recognized properly, it becomes clear that
organized solving of safe disposal of inedible by-products obtained from slaughtered or died
animals by their technical processing is a valuable task. This contributes to prevention of spreading
of contagious diseases, to prevention and rehabilitation of the environment and to rational use of
waste materials.
Keywords: by-products of animal origin, harmless removal, environment
Introduction
Under industrial conditions of slaughtering of swine, cattle and poultry inedible by-products are
obtained besides the meat. A number of these by-products have potential to be used as feed
ingredients of animal origin and technical fat. This topic attracted attention of many researchers.
Solution for the problem on harmless removal of wastes of animal origin has gone through different
stages and was always closely linked to diseases of animals and people, as well as to environmental
protection. According to Regulation EU 1069 (2009), inedible by-products from healthy cattle that
do not have nerve tissues (blood, tabular and tubular bones, ribs) may be prepared as feed for pets
(Okanovi et al., 2011).
For better utilization of raw materials of animal origin, better performance of technological
processes and production of the high-quality products, good knowledge of raw material
characteristics is necessery. Studying the structure and parameters to be used for calculation the
potential amount of animal waste, Ristic et al. (2011), stated that the processed by-products from
slaughtered animal represent nutrient-rich feed suitable for animal.
Quality of products obtained by processing of animal wastes depends largely on the composition of
initial raw material. Nutritional characteristics as well as other indicators of quality are determined
by, first of all, the content and composition of nutrients in initial raw material (Okanovic et al.,
2010a). Examining the quality of raw materials suitable for the technical processing of feed for
493
animal feeding, Ristic et al. (2008a) determined that the protein feed produced from slaughterhouse
by-products is an excellent source of protein of high biological value. According Gmez-Jurez et
al. (1999) inedible by-products of slaughtered pigs contained significant amount of essential amino
acids and vitamins suitable for feeding poultry. Park at al. (1996) found that the collagen of bone
and tendon collagen contained 22.2 and 33.0% glycine as opposed to muscle protein that it
contained only 5%.
Fundamental task of agriculture is the production of adequate quantities of high quality foods and
raw materials of organic origin for the existing Worlds population and for high increasing of that
population of about 93 million people per year. Even growing demands for food production impose
the needs of more efficient managing with economic resources that such one production follows.
Management with agricultural resources is crucial for survival of mankind, i.e. for the economic,
cultural and social development of the society (Meyer, 2007).
Meat industry by-product
Meat industry is important linker of food production chain (Okanovic et al., 2009). Solution of the
problem on harmless removal of waste products of animal origin, have exceptionally economic
important, today, it is un-replaceable veterinarian-sanitary and preventive usage in suppression
cattle infections and zoonoses, and special attention is paid to environment protection and
rehabilitation (Baras et al., 2007).
Based on the review of the total of slaughter livestock in the Serbia in 2013 (Statistical Office of the
Republic of Serbia, 2013), and the average amount of by-products obtained by livestock slaughter
Ristic et al. (2011), we can get the potential amount of inedible by-products (Table 1.).
Table 1. Animal by-product quantities in Serbia in 2013 (Statistical Office of the Republic of Serbia)
Slaughtered livestocks, pcs
By-product, kg/pcs
By-product, t
318 000
44,79
14 243
Swines
5 684 000
12,00
68 208
Sheep
1 537 000
7,16
11 005
64 552 000
0,60
38 731
Cattle
Poultry
132 187
TOTAL
In Serbia in 2013 slaughtered 318 000 pieces of cattle, 5 684 000 pcs pigs, 1 537 000 pcs sheep and
64 552 000 pcs poultry, so as a consequence we had the 132 187 t of animal waste.
Quantity of animal wastes which are appeared in circulation of goods (raw meat, intestines, cured
products, sausages, and fat) as well as quantity of died animals corpses which can be collected,
should be added on this quantity. If the production of livestock and meat industry are not going to
change drastically, there are cca 150 000 t of the animal by-products annually or cca 500 t daily,
which should be harmless removed
Legislation in the EU and Serbia
In the European Union area of by-products of animal origin (animal carcasses and by-products from
the facilities for slaughtering and meat processing and preparation of meat products) is regulated by
Regulation (EC) no. 1069/2009 and Regulation (EC) 142/2011.
494
On the territory of Serbia treatment of by-products of animal origin provided for by the Law on
Veterinary Medicine (Official Gazette of RS No. 91/2005). In accordance with the Act, local
authorities in its territory organized zoohygienic service that performs removes corpses of innocent
animals from public areas and facilities for the cultivation, possession or transport of animals and
their transport to the facility for collection, processing or destruction of by-products of animal
origin in a manner that does not represent a risk to other animals, humans or the environment.
Amendments to the Law stipulates the obligation that the local government must have a facility
built for the collection of animal carcasses and the collection of small quantities of other byproducts of animal origin from the facilities for slaughtering animals and food of animal origin as a
household.
It is forbidden to throw the corpses into rivers or other waterways or drains or leave them on the
roads, open space, in the woods or elsewhere. Animal corpses and other by-products of animal
origin must be collected, processed, or destroy the facilities for processing, treatment or destruction
of animal corpses and other by-products of animal origin and only in exceptional cases, by-products
of animal origin are being buried or burned on the animal cemetery or pit tomb, which meets the
requirements.
Veterinary and sanitary conditions for the construction of facilities for collecting, processing and
destruction of by-products of animal origin are regulated by the "Regulation on the Classification
and treatment of the by-products of animal origin, veterinary-sanitary conditions for the
construction of facilities for the collection, processing and disposal of waste products of animal
origin, method of official control and self-control, as well as the conditions for animal cemeteries
and grave pits" Official Gazette of RS, (2011).
Order on taking measures to prevent the occurrence, detection, prevention of the spread, prevention
and eradication of Transmissible Spongiform Encephalopathy (Official Gazette of RS No. 17/2006)
wastes of animal origin, depending on the hazards of classified as a Category 1, Category 2 and the
Category 3. Category 1 material carries the risk associated with diseases transmissible
encephalopathy spongiform (all communicable diseases from spongiform encephalopathy,
including mad cow disease) and Category 2 material, the risks associated with other animal
diseases and zoonoses.
Collection and harmless removal of by-products

Correct solution of harmless removal of animal by-products can be perceived with three key aspects
that should fulfil the technological solutions for solving of disposal of such materials by their
processing, namely: with the epidemiologic-epizoothiologic aspect, with aspects of environment
protection, and economic aspect (Okanovi et al., 2008).
According to Risti et al. (2008b) the best method of harmless removal of animal by-products is
their technical processing in separate categories into products for chemical industry, bio-fuels and
feed for definite kinds of animals. Prerequisite for safe disposal of animal wastes using one of the
described methods is organized collection and delivery of raw materials. In such collecting circle,
organizing of collection of animal wastes represents very delicious problem, from whose solution to
a very high degree depends the successful operation of the plant that is going to process such raw
materials. Important role in solving of the problem have local municipal communities. They are,
according the existing legislative rules on suppression of contagious diseases, obliged to organize
safe disposal of animal wastes in their region. In other words, organization of collecting of
mentioned raw materials should be based on contractual linking of plants for safe disposal and
processing of animal wastes and local municipal communities or their corresponding organizations
(slaughterhouses, animal farms etc.) (Kormanjo et al., 2013).
495
Figure 1. Organizing of collection storage and safe disposal of animal wastes
Exceptionally important is to emphasize the necessity of transferring of animal wastes from the
place where they were generated to the storage place as fast as possible, as well as the necessity of
rapid performing of the procedure of their processing. This is very significant, not only from the
epidemiologic-epizoothiologic aspect or from environment protection aspects, but from the aspect
of their technical processing. Namely, fresh raw materials are processed easier, with generation of
lower quantities of waste gases and obtaining of better quality products (Njei and Okanovi,
2009).
Economic side of this problem implies collection and safe disposal of huge quantities of biological
materials that necessitate costs, which have to be incorporated in prices of the obtained products. If
wastes of animal origin were not processed (recycled), they represent lost raw material that was
possible to incorporate in production of proteinaceous - energetic feed, technical fat for chemical
industry or of fuels with high calorific value (Okanovi, 2010; Tica et al., 2011).
According to the European Union directives included in the Regulation (EC) No 1609 (2009), with
processing of sanitary safe inedible by-products obtained during slaughtering of animals (materials
Category 3), it is possible to obtain:
-
proteinaceous, protein-mineral and energetic products aimed for animal feeding,

technical fats,
feathers for textile industry,
skins, horns, hoofs, hairs,
and from died animals (materials Category 2):

-
production of meat-and bone meal as an energy source,

production of technical fat as an energy source or raw material for further processing in
chemical industry for production of bio-diesel, and
production of biogas, compost.
496
We shall mention only that with the respecting procedures of blood collection and its technological
processing various articles for human use can be obtained, primarily products, which are used as
functional additives in manufacturing of meat products. Special processing procedures enable their
use as raw materials in pharmaceutical industry or for production of functional foods (MatekaloSverak et al. 2007; Carretero and Pars, 2000).
On the other hand, industrial waste blood can be collected and processed using corresponding
technological procedure in a plant for processing of other animal by-products, using special
processing unit. Such one procedure enables obtaining of feed with high protein content, which,
mostly, contains high quantities of essential amino acids, vitamins and mineral substances, and
particularly irons (Lasekan, et al., 2013; uki and Okanovi, 2011).
Safe disposal of the described animal wastes (material Category 1) by combustion on high
temperatures (over 850-1 200C) enables obtaining of warm water or steam as an energy source for
processing plant that use warm water or steam, and ash as construction material for roads. Articles
(meat- and bone meal and fat) obtained by processing of materials of Category 1 are suitable for use
as energetic fuel, i.e. as fuel for direct combustion in architecturally separated objects, respecting
the corresponding legislative rules (Njei and Okanovi, 2010).
Conclusions
Agricultural and food industry by-products, if not valorised, are disposed on landfills, in
lagoons, buried in arid terrains or in open water courses, thus contaminating the
environment.
In Serbia in 2013 slaughtered 318 000 pieces of cattle, 5 684 000 pcs pigs, 1 537 000 pcs
sheep and 64 552 000 pcs poultry, so as a consequence we had the 132 187 t of animal
waste. It is about cca 500 t daily, which should be harmless removed
If all mentioned ecological and economical aspects are recognized properly, it becomes clear
that organized solving of safe disposal of inedible by-products obtained from slaughtered or
died animals by their technical processing is a valuable task. This contributes to prevention
of spreading of contagious diseases, to prevention and rehabilitation of the environment and
to rational use of waste materials.
To the most rational solutions of their disposal belong their processing into feed, or raw
materials for chemical industry and production of bio-fuels. Manufacturing of feed from
sanitary safe raw materials they are multiply valorised, with assurement of the rational
development of cattle growing and of protection of the environment. Application of biofuels contributes to reduction of oil consumption (i.e. of imports), reduction of emissions of
detrimental gases, stimulation of sustainable development of rural regions.
Acknowledgments
This research was part of the project Improvement and development of hygienic and technological
procedures in producing food animal origin in order to obtain high-quality and safe products
competitive on world markets, funded by the Ministry of Education and Science Republic of
Serbia, and the project Improvement of technological process of production and quality protein
feed from poultry feathers which is financially supported by the Provincial Secretariat for Science
and Technological Development, Autonomous Province of Vojvodina
References
1.
Baras J., Turubatovi L., Matekalo-Sverak V.: Cleaner production is the pathway to sustainable
development. Tehnologija mesa 48(1-2): 83-92, 2007.
497

2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Carretero, C., Pars, D.: Improvement of the microbiological quality of blood plasma for human
consumption purposes, Recent Research Development in Agricultural and Food Chemistry, 4, 203216,
2000.
uki V., Okanovi .: Application of best available techniques in meat processing. Food and Feed
Research, 2, 87-93, 2011.
Gmez-Jurez, C., Castellanos, R., Ponce-Noyola, T., Caldern V., Figueroa J.: Protein recovery from
slaughterhouse wastes. Bioresource Technology, 70, 129-133, 1999.
Kormanjo ., Filipovi S., Radovi V., Okanovi ., Njei Z.: Influence of the applied pressure of
processing upon bioactive components of diets made of feathers, Hemijska industrija, 67(1), 135-138,
2012.
Lasekan, A., Abu Bakar, F., Hashim, D.: Potential of chicken by-products as sources of useful
biological resources, Waste Management 33(3), 552-565, 2013.
Law on Veterinary Medicine: Official Gazette of RS, No. 91, 2005
Matekalo-Sverak, V., Turubatovi, L., Babi, J., Trbovi, D., Milievi, D.: Utilization of powdered
hemoglobin in formed meat products. 53rd ICoMST, Beijing, China, Proceedings, 431-432, 2007.
Meyer R.: Comparison of scenarios on futures of European food chains. Trends in Food Science &
Technology, 18(11), 540-545, 2007.
Njei Z., Okanovi .: Model analize uticaja i rizika od efluenata u masovnoj proizvodnji hrane,
Kvalitet, 19(5-6), 44-46, 2009.
Njei Z., Okanovi .: Environmental protection in meat industry, Food and Feed Research, 37(1),
31-36, 2010.
Okanovi, ., Risti M, Deli, S.: Sporedni proizvodi poljoprivrede i prehrambene industrije i kvalitet
ivotne sredine, Kvalitet, 18(9-10), 65-68, 2008
Okanovi ., Mastilovi J., Risti M.: Sustainability of food production chain. Tehnologija mesa 50(12), 140-147, 2009.
Okanovi, ., Risti, M., Kormanjo, ., Njei, Z., Lili, S., Gruji, R.: Chemical and nutritional
quality of slaughter pigs by-products, Quality of Life, 1(1), 55-60, 2010a.
Okanovi , Tica N., Zeki V., Vukoje V., Mili D.: Profitability of investment in plant for processing
animal waste, Technics technologies education management-TTEM, 5(2), 296-300, 2010b.
Okanovi ., Risti M., Nikoli-Stajkovi S.: Remediation of by-products from slaughtered animals in
regard to new regulations, Tehnologija mesa 52(1), 31-38, 2011.
Park, E., Lee, H., Song, K.B.: Characterization of plasma proteins from bloods of slaughtered cow and
pig and utilization of the proteins as adhesives, Agricultural Chemistry and Biotechnology, 39, 123126,
1996.
REGULATION (EC) No 1069 of the European Parliament and of the Council, 2009.
REGULATION (EU) No 142 of the European Parliament and of the Council, 2011
Regulation on the Classification and treatment of the by-products of animal origin, veterinary-sanitary
conditions for the construction of facilities for the collection, processing and disposal of waste products
of animal origin, method of official control and self-control, as well as the conditions for animal
cemeteries and grave pits, Official Gazette of RS, No. 31/2011;
Risti M., Okanovi ., Matekalo-Sverak V., Kormanjo .: Ispitivanje mogunosti korienja creva
svinja za proizvodnju proteinskih hraniva, Tehnologija mesa, 5-6, 159-201, 2008
Risti M., Okanovi ., Radusin T.: Contemporary approach to animal by-products disposal problems,
Food processing, quality & safety, 35(2) 81-92, 2008
Risti M., Okanovi ., Saka M.: Karakteristike ivotinjskih sporednih proizvoda i njihova namena,
Monografija, FINS Novi Sad, broj strana 195, 2011.
Statistical Office of the Republic of Serbia 2013: http://webrzs.stat.gov.rs/WebSite/
Tica N., Vukoje V., Okanovi ., Zeki V., Mili D.: Economic analysis of possibilities for investments
into the animal waste treatment in Serbia Technics Technologies Education Management-TTEM, 6(3)
772-775, 2011.
498
CIP -
,
619(082)
INTERNATIONAL Symposium of Veterinary Medicine (1 ; 2015 ; Vrdnik)
Proceedings [Elektronski izvor] / First International Symposium of Veterinary
Medicine "One Health - New Challenges" (ISVM2015), Vrdnik, May 21-23, 2015. ;
[editor in chief Tama Petrovi]. - Novi Sad : Scientific Veterinary Institute "Novi Sad",
2015 (Novi Sad : Multidizajn). - 1 elektronski optiki disk (CD-ROM) ; 12 cm
Tira 250. - Bibliografija uz svaki rad.
ISBN 978-86-82871-36-1
a) -
COBISS.SR-ID 296575239
499

Proceeding ISVM2015c

Uploaded by

Copyright:

Available Formats

Proceeding ISVM2015c

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Proceeding ISVM2015c

Uploaded by

Copyright:

Available Formats

SCIENTIFIC VETERINARY INSTITUTE NOVI SAD

INSTITUTE OF VETERINARY MEDICINE OF SERBIA

One Health New Challenges

First International Symposium of

Hotel "Premier Aqua" - Vrdnik

First International Symposium of Veterinary Medicine ISVM2015

For the Publisher

First International Symposium of Veterinary Medicine ISVM2015

CO-ORGANISERS and SUPPORTERS

FISH Corp.2000 d.o.o.

Dr Vladimir Polaek, Research Associate

Dr Branka Vidi, Principal Research Fellow

Dr Jadranka uti, Research Associate

Dr Sava Lazi, Principal Research Fellow

Dr Milica ivkov-Balo, Senior Research Associate

Dr Tama Petrovi, Senior Research Associate

Dr Jelena Petrovi, Senior Research Associate

Dr Vladimir Radosavljevi, Research Associate

Dr Dragana Ljubojevi, Research Associate

Dr Sara Savi, Research Associate

Petar Bakmaz, secretary of Organizing Committee

First International Symposium of Veterinary Medicine ISVM2015

Dr Dubravka Milanov,Senior Research Associate(Serbia)

Dr Dobrila Jaki-Dimi,Principal Research Fellow (Serbia)

Dr Tania Hubenova, professor (Bulgaria)

Dr Theresa Bernardo, Principal Research Fellow (USA)

Dr Igor Stojanov, Senior Research Associate (Serbia)

Dr Branka Vidi, Principal Research Fellow (Serbia)

Dr Sara Savi, Research Associate (Serbia)

Dr Tama Bakonyi, Principal Research Fellow (Hungary)

Dr Dejan Bugarski, Research Associate (Serbia)

Dr Sava Lazi, Principal Research Fellow (Serbia)

Dr Vladimir Polaek, Research Associate (Serbia)

Dr Duan Orli, Principal Research Fellow (Serbia)

Dr Marjana Todorevi, Postdoc.Research Assistant(UK)

Dr Juan Carlos Saiz, Principal Research Fellow (Spain)

Dr Jadranka uti, Research Associate (Serbia)

Dr Ivan Pavlovi, Principal Research Fellow (Serbia)

Dr Miroslav Uroevi, Research Associate (Serbia)

Dr Vladimir Radosavljevi, Research Associate (Serbia)

Dr Jasna Prodanov Radulovi,ResearchAssociate (Serbia)

Dr Aleksandar Mai, Adjunct professor (Canada)

Dr Petr Kralik, Research Associate (Czech Republic)

Dr Stanko Bobo, professor (Serbia)

Dr Dragana Dimitrijevi , PhD (Serbia)

Dr Maja Velhner, Principal Research Fellow (Serbia)

Dr Bojana Grgi, MSc (Serbia)

Dr Aymeric Hans, Senior Research Associate (France)

Dr Milovan Joviin, Research Associate (Serbia)

Dr Vesna Miloevi, professor (Serbia)

Dr Radomir Ratajac, Research Associate (Serbia)

Dr Duan Laloevi, professor (Serbia)

Dr Dragana Ljubojevi, Research Associate (Serbia)

Dr Ivan Bogut, professor (Croatia)

Dr ivoslav Grgi, Research Associate (Serbia)

Dr Milica ivkov-Balo,Senior ResearchAssociate(Serbia)

Dr Diana Lupulovi, Research Associate (Serbia)

Dr Milo Kapetanov, Principal Research Fellow (Serbia)

Dr Aleksandar Milovanovi, Research Associate (Serbia)

Dr. Corinna Kehrenberg, professor (Germany)