Encyclopedia of Microbiology - Authors' Instructions

ENCYCLOPEDIA OF MICROBIOLOGY - AUTHORS' INSTRUCTIONS PROOFREADING The t ext cont ent f or your cont ribut ion is in f inal f orm when you receive your proof . Read t he proof f or accuracy and clarit y, as well as f or t ypographical errors, but please DO NOT REWRITE. On t he Non-print it ems page t here is a long version of t he aut hor address(es). This is f or our cont act det ails and will be used t o keep our records up-t o-dat e (it will not appear in t he published work) – f or t he lead aut hor, t his is t he address t o which t he honorarium and art icle of f print s will be sent . Please check t hat t he address(es) are correct . At t he beginning of t he art icle t here is a short version of t he aut hor address(es) which shows t he aut hor af f iliat ion f or conclusion in t he published work. Please check t his f or accuracy. Keywords are shown f or indexing purposes only and will not appear in t he published work. The t ext ual Abst ract should be checked caref ully. This will appear in t he online version. Tit les and headings should be checked caref ully f or spelling and capit alizat ion. Please check t hat t he proper level of heading is used f or all sect ions in t erms of hierarchy and numbering. Review numbered art work f or proper order e. g. , t ables, f igures, and list s. Proof read t he capt ions and credit lines of illust rat ions and t ables. Ensure t hat any mat erial requiring permissions has t he required credit line and t hat you have supplied t he necessary permission document at ion. Please also check t hat t he ref erences are accurat e. Any quest ions f rom t he copy-edit ors are present ed in an accompanying Aut hor Query list at t he beginning of t he proof . Please address t hese quest ions. While it is appreciat ed t hat some art icles will require updat ing/ revising, please t ry t o keep any alt erat ions t o a minimum. Not e t hat t hese proof s may not resemble t he image qualit y of t he f inal print ed version of t he work, and are f or cont ent checking only. Art work will have been redrawn/ relabelled as necessary, and is represent ed at t he f inal size. PLEASE KEEP A COPY OF ANY CORRECTIONS YOU MAKE. DISPATCH OF CORRECTIONS Proof correct ions should be ret urned in one communicat ion wit hin 7 days using one of t he f ollowing met hods: 1. If correct ions are minor t hey should be list ed in an e-mail t o: micbproofs@elsevier. com cc’ d t o your sect ion edit or j ingrah1@eart hlink. net The e-mail should st at e t he art icle code number in t he subj ect line. Correct ions should be consecut ively numbered and should st at e t he paragraph number, line number wit hin t hat paragraph, and t hen t he correct ion. 2. If correct ions are subst ant ial, send t he amended copy by f ax FAO: Edward Taylor, Elsevier MRW Product ion Depart ment (f ax number: +44 (0)1865 843974), and also t o your sect ion edit or. Please include a covering not e clearly st at ing t he art icle code number and t it le. Not e t hat a delay in t he ret urn of proof s could mean a delay in publicat ion. Should we not receive correct ed proof s wit hin 7 days, t he edit ors and Elsevier may be f orced t o proceed wit hout your correct ions. CHECKLIST Aut hor queries addressed/ answered? ‰ Af f iliat ions, names and addresses checked and verif ied? ‰ ‘ Furt her Reading’ sect ion checked and complet ed? ‰ Permissions det ails checked and complet ed? ‰ Out st anding permissions let t ers at t ached/ enclosed? ‰ Figures and t ables checked? ‰ If you have any quest ions regarding t hese proof s please cont act : Edward Taylor, Elsevier MRW Depart ment at micbproofs@elsevier. com MICB 00102 Author Query Form Encyclopedia of Microbiology Article: 00102 OO F Dear Author, Please respond to the queries listed below. You may write your comments on this page, but please write clearly as illegible mark-ups may delay publication. If returning the proof by fax do not write too close to the paper’s edge. PR Thank you for your assistance. AUTHOR QUERIES Please check if the reference citation in Figure caption 5 has been set correctly. AU2 Because Figures 7 and 8 were not cited in order, the citation for Figure 8 has been changed to Figure 7 and vice versa. Please check if this is OK. AU3 Please clarify whether the degree symbol in the text ‘ppGpp strain)’ in the sentence beginning ‘A strain of E. coli missing both RelA . . . .’ could be deleted. AU4 Please supply a short list of suggested cross-references to other articles, using the List of articles available from the project website: http://www.elsevier.com/homepage/about/mrwd/MICB/. AU5 The glossary terms ‘Proteome, transcriptome’ are not found in the text. Also please clarify whether the glossary term ‘redox cycling’ could be changed to ‘redox cycle’ as given in the text. FI ER VI SE Please check if the text ‘and the protein Hfq and small noncoding RNAs the translation of its mRNA’ is OK in the sentence beginning ‘The ClpXP protease and the protein SprE (RssB) modulate . . . .’ EL AU6 RS T AU1 AU7 Do Figures 1, 2, 3, 4, 5, 7, 8, 9, 10, 11 and Tables 2 and 3 require permission? If so, please supply relevant correspondence granting permission. AU8 Please provide the article titles for all the reference citations in the Figure caption 1–4, 6–11 and in Tables 2 and 3. MICB 00102 2 Non-print Items Author’s Contact Information PR OO F Dr A C Matin Department of Microbiology and Immunology Stanford University Sherman Fairchild Science Bldg. D317, D317 Stanford, CA 94305-5402 USA Tel: 650-725-4745 Fax: 650-725-6757 e-mail: [email protected] T Keywords: chaperones; ClpXP protease; DNA repair; general stress response; low-shear environments; ppGpp; protein oxidation; protein phosphorylation; protein repair; sigma S; specific stress response; starvation; stress; two-component systems; two-electron reducers Abstract EL SE VI ER FI RS Bacterial existence is fraught with stresses, which bacteria counter at two levels, the specific and general stress responses (GSRs). The former is aimed at escaping the specific stress being experienced by the synthesis, for example, under starvation, of enzymes to better capture a scarce nutrient, and tends to be specific to a given stress. But in GSR, a common set of proteins is induced in order to circumvent damage to cell constituents. These are concerned with repairing, for example, cell proteins, nucleic acids, and the envelope. GSR thus makes bacteria more robust in meeting stresses in general. Stresses are sensed by many mechanisms, such as phosphorylation or oxidation of sensor proteins. The transcription of GSR genes involves mainly the s species of RNA polymerase. s levels increase under carbon as well as phosphorus starvation, but by different mechanisms, by increased protein stability in the former and increased translation in the latter. The ClpXP protease and the protein SprE (RssB) modulate s stability, and the protein Hfq and s AU6 small noncoding RNAs the translation of its mRNA. Under other stresses,  activity is enhanced through the activity of ppGpp and proteins Crl and Rsd. MICB 00102 a0005 Stress, bacterial: General and Specific A Matin, Stanford University School of Medicine, Stanford, CA, USA ª 2009 Elsevier Inc. All rights reserved. General Stress Response Regulation of Stress Response Concluding Remarks Further Reading g0015 g0020 g0025 g0030 porins Proteins in the bacterial outer membrane that form water-filled pores, permitting transport. proteome Complete protein profile of a cell. redox cycling A reduction reaction that generates unstable radicals. These give their electrons to oxygen generating reactive oxygen species (ROS). The radical is changed back to the original compound and becomes available for further ROS generation. sigma factors Small proteins that combine with the RNA polymerase core enzyme. The resulting RNA polymerase holoenzyme can transcribe various genes. Each species of RNA polymerase generally recognizes specific promoter sequences. transcriptome Complete gene transcription profile of a cell. g0040 g0045 g0050 g0055 g0060 Abbreviations VI Cyclic AMP general stress response high aspect to ratio vessels Human growth hormone histidine protein kinase integration host factor outer-membrane proteins RNAP ROS RR rRNA sRNAs TIR UTR RNA polymerase reactive oxygen species response regulator ribosomal RNA Small RNA translational initiation region untranslated region EL SE cAMP GSR HARVs HGH HPK IHF OMPs ER FI g0035 ancillary factors Proteins or other molecules that influence RNA polymerase activity. antiporter A protein in cytoplasmic membrane that brings about exchange of external protons and a cellular ion/compound. electrophiles Compounds that accept electrons. eutrophic environments Environments made nutrient-rich primarily through human activity. inclusion bodies Precipitated and denatured proteins inside a cell. These are usually formed in bacteria when a heterologous protein is overproduced. periplasm Space between outer and cytoplasmic membranes in Gram-negative bacteria. pex proteins The core set of proteins induced in response to diverse stresses. T g0010 Glossary RS AU5 g0005 PR OO F Defining Statement Introduction The Stress Response is Two-Pronged Specific Stress Response s0005 Defining Statement Introduction p0005 Bacteria counter stress at two levels, specific and general, to escape a given stress and to acquire greater robustness. I will discuss here the mechanisms of escape, increased cellular robustness, and the molecular mechanisms that enable a bacterium to shift from rapid growth mode to stasis and enhanced resistance. Bacteria, like other living things, require certain physico- p0010 chemical conditions in order to thrive. Usable nutrients need to be sufficiently available, temperature and pH maintained within specific limits, and toxic influences absent. Under such optimal conditions, bacteria grow at maximal rates of which they are genetically capable. The s0010 1 MICB 00102 2 Physiology | Stress, bacterial: General and Specific PR OO F second component of the stress response is aimed at preventing and repairing the damage that the stress might cause and is activated as an insurance policy, since there is no guarantee that the first response will succeed in preventing the deleterious effects of the stress. All stresses, if not neutralized, lead to a common outcome, namely damage to the cell macromolecules, and the second tier of the stress response is aimed at preventing and repairing this damage. Thus, this facet of the stress response results in making bacteria resistant not only to the stress that is experienced but also to others, and is thus termed the general stress response (GSR). Specific Stress Response s0020 Starvation s0025 The first definitive indication that bacteria respond to p0030 stresses by a two-pronged strategy came when the proteomics of bacteria subjected to different stresses were examined. For example, starvation for carbon, nitrogen, or phosphorus resulted in the induction not only of proteins unique to that starvation condition but also to that of a core set of proteins that was common to all the starvation conditions (referred to as Pex proteins). Exposure to stresses mechanistically different from starvation, viz., oxidative, osmotic, pH, and others, also led to the induction of unique and common proteins, many of the latter being the same as the core starvation (Pex) proteins. Based on these findings, it was proposed in 1989 that the proteins unique to a specific stress were concerned in enabling the bacteria to neutralize that particular stress, while the core set of proteins was concerned with conferring resistance to stresses in general. This has been found to be the case. In this section, I will discuss the physiological role of selected proteins that are concerned with the escape response; the function of the Pex proteins that confer general resistance is discussed in subsequent sections. Examples of proteins concerned with escaping stresses p0035 are provided in Table 1. Starvation-escape response consists in the synthesis by bacteria of enzymes that amplify their capacity to obtain the scarce nutrient. This is accomplished either by increasing the concentration of the relevant enzymes or by synthesizing a new set that possess a higher affinity for the nutrient. Either way, a superior capacity is acquired to scavenge the scarce nutrient. The proteins that are induced can concern every metabolic feature: transport through the outer and cytoplasmic membranes, enzymes involved in substrate capture, and those responsible for subsequent flux through the metabolic pathways. Thus, when phosphate concentration falls below some 1 mmol l1 in the environment, cells increase the protein PhoE, which is a porin facilitating the passage of phosphate compounds through the outer membrane EL SE VI ER FI RS T animal gut flora encounters such conditions after the host has taken a meal, intracellular pathogens often immediately after invasion, and environmental bacteria in, for example, eutrophic environments. But such conditions are rare and fleeting, and as a rule, bacteria in nature exist under conditions that are not only suboptimal but can be outright hostile to their survival, exposing them to diverse kinds of stresses. p0015 A common stress is lack of food. Thus, the gut flora by its rapid growth soon exhausts the nutrients passed on to the host intestine and progresses from feast to famine, and the same is likely true of an intracellular pathogen. While eutrophic environments are on the rise due to human activities, much of the natural environment nevertheless remains severely nutrient-poor. Oceans are estimated to have 0.8 mg carbon nutrients per liter, and the concentration of individual carbon compounds in fresh water is often as low as 6–10 mg l1. Similarly, soils as rule possess little usable nutrients, as most of the 0.8–2.0% carbon in this environment is humus, which bacteria for the most part cannot use. In other natural environments, bacterial growth is restricted by the scarcity of other nutrients, such as nitrogen, phosphorus, and/or iron. p0020 The fluctuating conditions in nature expose bacteria to additional stresses. Diurnal and seasonal changes in temperature can be significant, and a host of abiological and biological factors can result in exposure to a variety of insults, such as pH, osmotic, shear, and oxidative stresses. The pathogenic bacteria have not only to be adept at surviving these stresses during their extra-host existence but also to be able to cope with deleterious influences as they attempt to survive in the host in disease initiation. For example, to infect a host, Salmonella enterica serovar Typhimurium, which causes a typhoid-like disease in mice, has to survive passage through the stomach where the average pH over a 24-h period is as low as 1.5. It then invades the interior of the host by infecting the microvilli of the gastrointestinal tract, which are low-shear environments, and it is then ingested by the host macrophage, where additional insults await – oxidative stress, nutrient deprivation, and low pH. To meet such threats to survival, bacteria have evolved elaborate adaptive responses; these are the subject of this article with special emphasis on starvation, although other stresses are also considered. s0015 The Stress Response is Two-Pronged p0025 Bacteria meet the challenge to survival posed by stresses by a two-pronged strategy. One is aimed at neutralizing and escaping the specific stress that is encountered. This response tends to be unique to each stress; thus the proteins a bacterium needs to escape, for instance, oxidative stress are different from those it utilizes to escape starvation. This is termed the specific stress response. The MICB 00102 Physiology | Stress, bacterial: General and Specific 3 t0005 Table 1 Selected escape-response proteins Function Phosphorous starvation Pst PstS (also called PhoS) PhoE PsiB and PsiC Bacterial alkaline phosphatase High-affinity phosphate transport system Periplasmic Pi-binding protein required for PstS function Porin that facilitates Pi transport through the outer membrane Glycerol phosphate transport systems Carbon–phosphorus bond lyase Carbon starvation Periplasmic-binding proteins (e.g., MalE) Glucokinase Lactate dehydrogenase  -Galactosidase CstA Glycerol kinase Glucose-6-phosphate dehydrogenase Phosphofructokinase Pyruvate kinase Aconitase Isocitrate dehydrogenase Malate dehydrogenase Enhanced transport (e.g., maltose) Substrate capture (glucose) Substrate capture (lactate) Substrate capture (lactose)/metabolic potential amplification Substrate capture (peptides)/metabolic potential amplification Substrate capture (glycerol) Enhanced flux through catabolic pathways Enhanced flux through catabolic pathways Enhanced flux through catabolic pathways Enhanced flux through catabolic pathways Enhanced flux through catabolic pathways Enhanced flux through catabolic pathways PR OO F Protein ER a T Iron chelator Substrate capture High affinity Kþ transport Decomposes superoxide Catalase Catalase Thiol-dependent hydroperoxidase Cysteine biosynthesis Cysteine biosynthesis H2O2 quencher Generates cadaverine that buffers the cytoplasm Brings about exchanges of cellular cadaverine for medium lysine Increases membrane permeability to urea which, through urease activity, buffers the cytoplasm RS FI Other stressesa Aerobactin (iron starvation) Glutamine synthetase (nitrogen starvation) Kdp (potassium starvation) Superoxide dismutase (oxidative stress) KatE (oxidative stress) KatG (oxidative stress) Thiol peroxidase (oxidative stress) Sulfate adenylyltransferase (oxidative stress) Cysteine synthase (oxidative stress) ChrR (oxidative stress) Lysine decarboxylase (acid stress) CadB (acid stress) UreI (acid stress) Text in parentheses indicates the stress. EL SE VI into the periplasmic space of Escherichia coli. Here, it interacts with a high affinity-binding protein (PstS), also induced under these conditions, promoting efficient functioning of PhoE. The compounds thus transported to the periplasm are hydrolyzed by another protein induced by phosphate starvation, the bacterial alkaline phosphatase, generating Pi. Rapid transport of the latter across the cytoplasmic membrane is ensured by the fact that a high affinity Pi transport system, Pst (energized by ATP; Km for Pi, 0.16 mmol l1), is concomitantly induced under these conditions, replacing the low affinity Pit system (energized by proton motive force; Km for Pi, 25 mmol l1) that operates under phosphate-sufficient conditions. p0040 This pattern has been demonstrated in several bacteria also when limitation for other nutrients is encountered. Carbon-scarce cells often also synthesize high affinitybinding proteins, for example, MalE, which binds maltose facilitating its transport into the cell. When Pseudomonas or enteric bacteria utilizing lactate or glucose as carbon source were subjected to the limitation of these substrates, they greatly increased the synthesis of lactate dehydrogenase or glucokinase, respectively. Concomitantly, there was a marked induction of several enzymes of glycolysis and tricarboxylic acid cycle, ensuring effective channeling of low levels of catabolites through them. Large amounts of glutamine synthetase, which catalyzes the first step in ammonium assimilation, are synthesized during ammonium limitation, and induction of high affinity substrate-capturing proteins occurs also during potassium and glycerol scarcity. In the former case, the cells shift to the Kdp system (high affinity; energized by ATP) from the Trk transport system (low affinity; energized by proton motive force) that is used when potassium is plentiful. Cells grown on nonlimiting concentrations of glycerol utilize a low affinity pathway for its catabolism whose initial step is catalyzed by glycerol dehydrogenase; under glycerol scarcity on the contrary, a high affinity pathway initiating with glycerol kinase is utilized. MICB 00102 4 Physiology | Stress, bacterial: General and Specific PR OO F its quinone and semiquinone valence states, producing large quantities of ROS. These compounds are referred to from here on as ‘univalent reduction-prone’ electrophiles. That bacteria do indeed experience severe oxidative p0055 stress when exposed to univalent reduction-prone compounds was demonstrated by the use of the intracellular oxidative stress sensor 29, 79-dihydrodichlorofluorescein (H2DCFDA), which is taken up by the cells and emits green fluorescence in the presence of ROS. For instance, E. coli cells exposed to chromate do indeed emit green fluorescence (Figure 1). Proteomic analysis showed that these cells induced several proteins concerned with combating oxidative stress, for example, superoxide dismutase, which decomposes the superoxide radical, and those concerned with cysteine and thiol biosynthesis, which are ROS quenchers. Mutants unable to synthesize these proteins proved more sensitive to chromate killing, and strains with bolstered capacity to synthesize antioxidant defense proteins (such as ChrR; Table 1; see below) less so compared to the wild type. Other examples of proteins that permit escape from oxidative stress are given in Table 1. A new class of enzymes, termed ChrR, has recently p0060 been discovered, which has a broad range of activity to combat oxidative stress. These enzymes bring about a simultaneous two-electron reduction of univalent reduction-prone electrophiles. Thus, for example, they convert in one step quinone into fully reduced and stable hydroquinone (QH2), bypassing semiquinone formation. The experimental approach to determine if an enzyme reduces the univalent reduction-prone electrophiles by one- or two-electron pathway utilizes pure proteins and a T Iron-challenged cells increase the synthesis of the iron siderophore, aerobactin. Thus, a combination of the synthesis of high affinity transport and other proteins coupled with a general increase in the level of metabolic enzymes ensures that the cells can effectively scavenge and utilize the scarce nutrient from the environment. p0045 These measures can of course not always succeed in alleviating starvation. For instance, cells growing on glucose can synthesize any amount of enzymes to facilitate its utilization, but this would not help if this substrate becomes completely absent from the environment. An additional measure is therefore employed, which is to derepress the synthesis of enzymes for substrates other than glucose counting on the chance that the constantly fluctuating conditions might promote their appearance in the environment. Thus, cells subjected, for instance, to glucose starvation also synthesize enzymes such as -galactosidase and CstA, which confer on them the capacity to utilize lactose and peptides, respectively, thereby acquiring the capacity to cast a wider net for alleviating carbon starvation. Oxidative Stress p0050 Ground state oxygen has two unpaired spins, and the constraints of quantum mechanics, and the resulting spin restriction, hinder its divalent reduction, favoring the univalent pathway that generates highly reactive (and toxic) oxygen species (ROS). Consequently, oxidative stress from ROS is a constant threat to bacteria and other living entities. Bacterial respiratory chains (like those of the mitochondria) leak ROS. Phagocytes possess a membrane-bound NADPH reductase, whose function is to catalyze one-electron reduction of O2 to generate ROS so as to kill the invading bacteria. When plant cells come in contact with soil-dwelling bacteria, such as Pseudomonas putida, they release an immediate burst of H2O2. Many electrophiles generated internally by bacteria or those found in the environment are also a source of oxidative stress. Examples are quinones, nitro-compounds, chromate, and several dyes; quinones such as plumagin and juglone are secreted by plants as defense mechanisms against bacteria. These compounds are vicariously attacked by cellular metabolic enzymes such as glutathione and cytochrome c reductases, and lipoyl dehydrogenase (LpDH), which reduce them by oneelectron transfer. The result is the generation of reactive radicals, such as semiquinones and Cr(V), which set up a redox cycle. In this process, the radical (e.g., semiquinone) transfers its electron to O2 or, depending on the conditions to another molecule (e.g., NO3), regenerating quinone and producing ROS or other equally destructive oxidizing agents (e.g., nitrosative radicals). With the continued activity of one-electron reducers, the quinone (or other such electrophiles) shuttles back and forth between EL SE VI ER FI RS s0030 Figure 1 Escherichia coli cells exposed to 250 mmol l1 chromate and treated with intracellular ROS sensor 29, 79dihydrodichlorofluorescein. Cells were examined at 1000 magnification with an Olympus BX60 upright fluorescence microscope. Note that the cells form snakes and fluoresce green; both are indicative of oxidative stress. Reproduced from Ackerley DF, Barak Y, Lynch SV, et al. (2006) Journal of Bacteriology 188: 3371–3381. AU7 f0005 AU8 MICB 00102 Physiology | Stress, bacterial: General and Specific source of electrons, namely NADH or NADPH. It takes advantage of the fact that cytochrome c is reduced by semiquinones but not by hydroquinones, and since reduced cytochrome c absorbs light of 550 nm wavelength, its reduction can easily be monitored in a spectrophotometer, serving as a facile probe for semiquinone formation. It was found that when quinone was reduced by a number of different cellular enzymes, such PR OO F as LpDH, large amounts of reduced cytochrome c were generated, indicating that the quinone was reduced by one-electron transfer and generated semiquinone. However, when the reduction was catalyzed by the enzyme ChrR, no reduction of the cytochrome was seen (Figure 2(a)). Thus, the latter enzyme bypassed semiquinone formation resulting in direct conversion of the quinone to QH2. (a) 1.2 14 1.1 ChrR 12 1 1 0.9 0.8 0.8 0.4 A550 ChrR LipDH LpDH 0.6 0.2 0.7 0 0 1 2 3 4 5 T 0.6 5 0.5 RS 0.4 0.3 0.2 0 0 (b) FI 0.1 1 2 3 4 5 Time (min) ER 0.8 LipDH alone LipDH in competition 0.7 VI 0.6 EL SE A550 0.5 0.4 3 0.3 2 0.2 1 0.1 0 0 1 2 3 Time (min) 4 5 6 f0010 Figure 21 (a) Reduction of cytochrome c monitored spectrophotometrically at 550 nm during LpDH- or ChrR-catalyzed reduction of 50 mmol l of a quinone species, benzoquinone. The appearance of reduced cytochrome c during the LpDH-catalyzed reaction indicates one electron transfer and generation of semiquinone, whereas the lack of this species in the ChrR-catalyzed reaction signifies a divalent mode of quinone reduction that generates QH2 completely bypassing semiquinone generation. (b) Addition of ChrR to an LpDH-catalyzed reduction of limiting benzoquinone, at the point marked by arrow 1, rapidly arrested the reduction of cytochrome c relative to LpDH alone (dashed line). The addition of fresh benzoquinone (arrows 2 and 3) reinitiated cytochrome c reduction, but with ChrR now present, only little semiquinone is generated as indicated by very limited cytochrome c reduction. This indicates that the presence of the two-electron reducer, ChrR, preempts quinone reduction by the one-electron reducer, LpDH. Reproduced from Gonzalez CF, Ackerley DF, Lynch SV, et al. (2005) Journal of Biological Chemistry 280: 22590–22595. MICB 00102 6 Physiology | Stress, bacterial: General and Specific Acid Stress s0035 Escape from acid stress involves a combination of physi- p0075 cochemical approaches as well as the use of special enzymes to ensure that the cytoplasm is not acidified. The former mechanisms include making the cytoplasmic electric potential (
) positive, so as to oppose the entry of protons that, of course, are positively charged. It also includes changes in the composition of the cytoplasmic membrane so as to render it less permeant to protons. In Clostridium acetobutylicum, for example, exposure to low pH results in a decrease in the ratio of unsaturated to saturated fatty acids and an increase in cyclopropane fatty acid content. An increase in phospholipids with amino acid head groups is another measure that appears to be aimed at decreasing proton permeability of the cytoplasmic membrane. The enzymes involved are amino acid decarboxylases. p0080 A well-studied system involves lysine decarboxylation, which removes CO2 from lysine and generates cadaverine. Cadaverine picks up a proton, thereby contributing to the deacidification of the cytoplasm. The protonated cadaverine is exchanged for external lysine by the antiporter CadB. Another enzyme involved in the buffering to the cytoplasm is urease, which is thought to be critically important in the ability of the gastric ulcer/carcinomacausing bacterium Helicobacter pylori to colonize the stomach. This bacterium synthesizes a special membrane protein called UreI that enhances urea transport into the cell. Urea is present in the gastric juice, but its permeation into the cell without UreI is too slow to be effective in enabling H. pylori to keep a neutral cytoplasm. VI 100 10 3 SE 1000 3.5 2.5 2 1.5 1 1 0.1 0 A660 10000 EL H2O2 (µm mol l–1) in growth medium ER FI RS T PR OO F In an extension of this experimental approach, limiting concentrations of quinone were used, which ensured that the reaction ceased because all the available quinone in the reaction mix was exhausted. Figure 2(b) shows that in such a situation when ChrR is added to an in-progress LpDH-catalyzed quinone reduction, cytochrome reduction is swiftly halted, indicating that the LpDH is no longer generating semiquinone. Addition of further quinone to the reaction mix reinitiated cytochrome c reduction but at a very low rate and this too was soon halted. The experiment thus indicated that when ChrR is present, quinone is made largely nonavailable to LpDH, so semiquinone formation ceases. Experiments using other single-electron reducing enzymes have given similar results. Thus, not only ChrR constitutes a safe pathway for the univalent reduction-prone electrophiles, such as quinones, it is also effective in preempting their reduction by the one-electron reducers, thereby affording a two-way protection to the cell exposed to such electrophiles. p0070 There is in fact another level at which ChrR protects the cell against oxidative stress and that is by virtue of the fact that QH2, which it generates, is an effective quencher of ROS, such as H2O2. Strains of P. putida devoid of ChrR and those overproducing this enzyme were grown in the presence of 3 mmol l1 H2O2. The different cell cultures exhibited lag phases of varying duration, following which normal growth was seen (Figure 3). The ChrR overproducing strain was the first to recover, followed by the wild type, and finally the ChrR mutant. The recovery correlated with the ability of each strain to remove H2O2 from the medium, indicating that the cellular ChrR bolsters this capacity. Protein carbonylation, which is an indication of oxidative damage, was greatest in the strain devoid of ChrR and least in the one overproducing this enzyme. p0065 0.5 2 4 6 8 10 Time (h) 12 14 0 16 f0015 Figure 3 H2O2 scavenging (open symbols) and growth (as measured by increase in absorbance at 660 nm, solid symbols) of ChrR-overproducing (^), wild-type (&), and ChrR-deficient (N ) strains of P. putida. Note that the overproducing strain is most efficient in decomposing H2O2. Reproduced from Gonzalez CF, Ackerley DF, Lynch SV, et al. (2005) Journal of Biological Chemistry 280: 22590–22595. General Stress Response s0040 Cross-Protection s0045 As mentioned above, cells respond to different insults not p0085 only by measures aimed at escaping a particular stress, but also by bolstering the cellular machinery meant to prevent and repair damage to macromolecules that may result if the escape response fails. The evolutionary basis for this is obvious: the external environment is often so unforgiving that the escape response strategies can often at best have only a partial success and survival necessitates that measures be activated to deal with the damaging effect of stresses. This is the function of the (Pex) core set of proteins that are synthesized regardless of the nature of stress, and they confer on the cell a robustness enabling it to withstand stresses in general. Proteomic analysis of cultures starved for glucose or p0090 other nutrients showed that the proteins synthesized fall into different temporal classes and that this synthesis program is essentially complete in 4 h after the onset of starvation. The Pex proteins for the most part exhibit a MICB 00102 Physiology | Stress, bacterial: General and Specific t0010 Table 2 Stress-induced resistances Starvation Heat Cold pH extremes Oxidation Hyperosmosis CI2 CIO2 Ethanol Acetone Deoxycholate Toluene Irradiation Antibiotics and other antimicrobials Biochemical Basis (b) 100 Percent survival Percent survival EL SE VI 100 10 10 1 0 2 4 6 8 10 12 14 16 57 °C challenge (min) s0050 The comprehensive resistance that stresses confer on cells p0100 is due to the fact that the core set of proteins are concerned with protecting vital cell macromolecules – proteins, DNA, cell envelope – from damage as well as to bring about repair of any damage that may still result. Envelope protection and reinforcement is afforded by proteins such as D-alanine carboxypeptidase, which increases peptidoglycan cross-linkage, and the products of the otsBA (pexA) genes which protect the cell membrane by promoting trehalose biosynthesis. Furthermore, several periplasmic proteins concerned with the proper folding of proteins in this cell compartment are T RS FI ER Reproduced from Matin A (2001). In: Bolton S (ed.) Encyclopedia of Environmental Microbiology, vol. 6, pp. 3034–3046. New York: John Wiley and Sons. (a) starvation-mediated cross-protection against heat, involving exposure to the normally lethal temperature of 57  C. For the first 4 h after the onset of starvation, increasing resistance to heat is exhibited the longer the cells are starved, with maximal resistance being acquired within this period. The phenomenon is completely dependent on protein synthesis during starvation, since its inhibition by inclusion in the starvation regime of chloramphenicol or by other means prevents resistance development. Since the core protein set is synthesized regardless of p0095 the nature of stress, it follows that exposure to any stress and not just starvation should confer general resistance. This is indeed the case as is illustrated in Figure 4(b), which shows that cells exposed to adaptive doses of a variety of mechanistically unrelated stresses become more resistant to lethal concentrations of H2O2. PR OO F sustained pattern of synthesis through this period, leveling off at its end. Consistent with their role in enhancing cellular robustness, it was found that inhibition of protein synthesis in a starving culture had a time-dependent effect on starvation survival, with maximum resistance developing after 4 h of protein synthesis during starvation. That the core proteins are involved in conferring general resistance on the cell is further indicated by the fact that the cross-protection that starvation confers on cells against unrelated stresses, for example, heat, oxidation, hyperosmosis, and others (Table 2), is also dependent on the time, up to 4 h, for which they have been starved. This phenomenon is illustrated in Figure 4(a) for the 7 6 0 15 30 45 60 H2O2 challenge (min)   f0020 Figure 4 (a) Induction of thermal resistance in Escherichia coli. Cells grown at 37 C were exposed to 57 C during exponential growth & & (o), or at 1 h (
), 2 h (N ), 4 h ( ), or 24 h ( ) after glucose exhaustion from the medium. () Represents culture starved in the presence of chloramphenicol. (b) Comparison of the H2O2 resistance of glucose-starved E. coli cultures to growing cultures adapted by heat, H2O2, or ethanol. Symbols: (o) untreated; () ethanol-adapted; (
) heat-adapted; (N ) H2O2-adapted; (&) glucose-starved. Reproduced from Jenkins DE, Schultz JE, and Matin A (1988) Journal of Bacteriology 170: 3910–3914. MICB 00102 8 Physiology | Stress, bacterial: General and Specific upregulated by stress; these include Dsb proteins that play a role in the formation or isomerization of disulfide bonds in proteins secreted into the periplasm, and peptidyl-prolyl isomerases concerned with the proper folding of proline-containing substrates. A consequence of stress is the accumulation in the periplasm of misfolded outer membrane proteins (OMPs) due to the stress and excessive OMP synthesis. The OMP mRNAs are unusually stable. Two small noncoding RNAs, RybB and MicA, are induced under stress, especially the envelope stress, which selectively accelerates the decay of these mRNAs, thereby minimizing stress by preventing excessive OMP production. PR OO F translocation across membranes. The chaperones DnaK, DnaJ, and GrpE, as well as GroEL and GroES are among the most extensively studied. These proteins are widely conserved through evolution: hsp70 is the eukaryotic homologue of the bacterial chaperone DnaK and hsp60 that of GroEL. It is thought that the nascent polypeptide chains or p0110 denatured proteins (referred to from here on as ‘substrate proteins’) bind DnaK and DnaJ (Figure 5). Interaction between the chaperones in the presence of ATP results in the formation of a ternary complex consisting of the substrate protein, DnaK–ADP, and DnaJ. Dissociation of this complex is mediated by interaction with GrpE and by binding of ATP. The final stages of folding/repair in most cases involve GroEL and GroES. This model is supported by several lines of evidence. For example, the denatured enzyme rhodanese aggregates in a buffer solution, but not in the presence of DnaK, DnaJ, and ATP, as the protein is protected by the ternary complex formation. Addition of GrpE, GroEL, and GroES results in efficient refolding and activation of the enzyme. In bacteria lacking these s0055 Protein repair This is brought about by proteins called chaperones, which are a large and diverse group with indispensable physiological roles under all growth conditions, but which become more important under stress. Apart from conferring stress resistance, the chaperones are responsible for proper folding of nascent proteins and protein RS T p0105 Ribosome ADP Dnak FI ATP ADP Pi ER DnaJ ADP ADP ADP ATP EL SE VI GrpE ATP ADP + Pi GroEL GroES f0025 Figure 5 Schematic of the two-step pathway involved in the folding of nascent proteins and repair of damaged proteins. Reproduced from Mayhew M and Hartl F (1996) Molecular chaperone proteins. In: Neidhardt F et al. (eds.) Escherichia coli and Salmonella AU1 typhimurium: Cellular and Molecular Biology, pp. 922–937. Washington, DC: American Society for Microbiology. MICB 00102 Physiology | Stress, bacterial: General and Specific DNA repair s0060 PR OO F Several enzymes induced by stresses are concerned with p0120 DNA repair. Examples are endonuclease III and IV, Dps (PexB), and AidB, which reverse DNA methylation. A role for DnaK in DNA repair has also been reported. A major mechanism for DNA repair is the SOS response, which is activated by many different stresses, such as starvation, oxidative stress, irradiation, and antibiotic treatment, which result in DNA damage. This response promotes various kinds of DNA repair such as excision repair. This is aimed at excising pyrimidine dimers and other bulky lesions found in damaged DNA. The enzymes involved are UvrABC endonuclease, which is a made up of proteins encoded by the uvrA, uvrB, and uvrC genes, helicase II (encoded by uvrD gene), DNA polymerase I, and DNA ligase. The UvrABC endonuclease makes incisions on each side of the lesion, generating a 12 to 13 base pair oligonucleotide. Different components of the enzyme act separately in this process. UvrA and UvrB interact to form a UvrA2UvrB complex, which identifies the DNA lesion and locally unwinds it, producing a kink in the DNA of 130 . This is followed by dissociation of the UvrA protein and formation of a stable UvrB–DNA complex, which is acted upon by UvrC to make the incision. The function of helicase II is to release the oligonucleotide and to free UvrC after the excision of the nucleotide. The gap generated by the incision is filled by DNA polymerase I, which carries out the repair synthesis, and DNA ligase, which fills the remaining nick. VI ER FI RS T chaperones, newly synthesized proteins aggregate in vivo. However, this aggregation is prevented if the chaperone production is restored. Similarly, proteins imported into the yeast mitochondria from the cytosol show defective assembly in mutants missing hsp60 (GroEL homologue), and most soluble denatured proteins of E. coli form complexes with GroEL as a prelude to their repair. Strikingly, proteins in their native state do not interact with the chaperones. Exposure to stresses results in association of a large number of proteins in vivo with chaperones presumably to escape damage. In essence, chaperones are slow ATPases, which, when bound to ADP, have a high affinity for denatured proteins, but a low affinity for them when bound to ATP. These characteristics determine the duration of their action on an unfolded part of a protein and ensure the continuation of the process until renaturation is complete. p0115 Bacteria are often used in industry and laboratory to overproduce heterologous proteins as the process is fast and economical. However, often the overproduced protein is denatured within the cell and precipitates, resulting in the formation of inclusion bodies. A protective role against this denaturation for DnaK was demonstrated by its overproduction in the cells. Human growth hormone (HGH) is produced industrially using E. coli transformed with a high copy number plasmid containing the hgh gene that encodes this hormone. In control cells producing normal levels of DnaK, the HGH produced in the cell formed massive inclusion bodies, but in cells overproducing this chaperone there was marked breakup of these bodies (Figure 6) and a corresponding increase in the soluble hormone. 9 (b) EL SE (a) f0030 Figure 6 Transmission electron micrographs of Escherichia coli cells fixed in late exponential phase growth from cultures overproducing HGH protein. (a) Overproduction of HGH alone; (b) HGH overproduction along with that of DnaK. Note that in the latter, the HGH inclusion bodies are much smaller; there is corresponding increase in soluble HGH. Magnification, 26 000 . Reproduced from Blum P Velligan M, Lin N et al. (1992) Biotechnology 10: 301–303. Regulation of Stress Response s0065 Shift in the cellular gene expression and protein synthesis p0125 profile under stressful conditions involves several factors, viz., changes in the concentration of sigma factors, ancillary regulatory molecules, and chemical alteration in certain proteins. Salient examples of each will be discussed. Sigma Factors s0070 Sigma () factors are small proteins that associate with the p0130 RNA polymerase (RNAP) ‘core’ enzyme and determine what promoter the resulting ‘holoenzyme’ will recognize (Figure 7). The core RNAP (abbreviated as E) is made up AU2 of four polypeptides, 2 9. Examples of sigma factors that play a role in stress response are 70, s, 32, and 54; their holoenzymes recognize specific DNA sequences present in a region called the promoter that is located, as a rule, 10 and 35 nucleotides upstream of the transcriptional start site. The 70 holoenzyme E70 is indispensable under all growth conditions and is referred to as the vegetative sigma factor. The consensus promoter sequences recognized by three of these holoenzymes are MICB 00102 10 Physiology | Stress, bacterial: General and Specific RNA polymerase (core enzyme) Sigma PR OO F Transcription 5′ 5′ mRNA start C T G T T G A C A A T T A A T C A T CG A A C T A G T T A A C T A G T A C G CA A G C T A T T C C T G T GG A T A A C C A T G T G T A T T A G A G T T A G A A A A C A T GG T T C C A AA A T CGCC T T T T GC T G T A T A T A C T C A C A G CA T A T T T T T GAG T TGTGT A T A ACCCC T CA T T C TGA T C C C A G C TT T A G T T GC A TG A A C T CGC A T G T C T C C A T AGA A T G C G C G C TA C T T T C T T G A C AC C T T T T C GG C A T C G C C C T A A A A T T C G G C G T C –35 sequence Pribnow box TT G A CA TA TA AT RS Consensus T 1. 2. 3. 4. 5. 6. Promoter sequence FI f0035 Figure 7 Schematic representation of RNA polymerase holoenzyme showing the 2.4 and 4.2 regions, which recognize respectively the –10 and –35 promoter elements. Reproduced from Madigan MT and Martinko JM (2006) Brock of Microorganisms, p. vi. Upper Saddle River, NJ: Prentice Hall. EL SE VI ER E70: –10: TATAAT, –35: TTGACA; E32: –10: CATNTA, –35: CTTGAA; and E54: GG-N10GC. (Es-recognized promoters are discussed below.) It should be noted that considerable variations from these sequences are tolerated by different species of RNAP, the enzyme species differ in their promiscuity in this respect, and a given promoter sequence can be recognized by different RNAP depending on specific conditions. For example, during starvation or osmotic stress, the transcription of the gene encoding an oxidative stress protection protein, Dps (also known as PexB), depends upon increased cellular levels of Es. However, under oxidative stress, E70 with the help of the ancillary factor, called the integration host factor (IHF), allows transcription of pexB without Es. Other genes are also transcribed by different RNAP species depending upon the presence of modifying conditions. p0135 While all of these holoenzymes have a role in different stresses, their major role is concentrated on particular conditions. Thus, E70 primarily transcribes the exponential phase genes and those concerned with the stressescape response; E32, the heat shock and starvation genes; Es, the genes that are commonly expressed under stresses in general; and E54, genes of diverse functions including those involved in starvation, flagellar synthesis, and in cell growth on nonpreferred substrates, such as environmental pollutants. The RNAP holoenzyme most important in inducing p0140 the GSR in bacteria is Es, as it controls the expression of some 140 core stress genes that are induced by diverse stresses and are responsible for this response. s bears close homology with 70 in critical regions of the sigma protein referred to as regions 2.4 and 4.2, which recognize respectively the –10 and –35 promoter elements. Indeed, E70 and Es recognize many of the same promoters in vitro. In vivo however, under stresses such as starvation, despite the fact that 70 is more abundant in the cells than s, Es specifically targets the stress genes. Subtle differences in the promoter sequences and the role of ancillary factors account for this specificity. Specific features of s-recognized promoters s0075 Es-recognized promoters differ from those that E70 p0145 recognizes in following respects. (1) They possess special features around their –10 region. Thus, a cytosine (C) at –13 position (i.e., 13 nucleotides upstream of the transcriptional start site) and a thymidine (T) at –14 facilitate Es binding to the promoter. Indeed, the –13 C may antagonize E70 binding due to the differences in charged amino acids in the two sigma factors. In one instance, MICB 00102 Physiology | Stress, bacterial: General and Specific 11 PR OO F more than one-third the level of 70. Nevertheless, it becomes the most active sigma factor in stressed cells because proteins like Crl, by binding to Es, greatly enhance its activity. The small nucleotide, guanosine tetraphosphate (ppGpp), has a similar role; this is discussed further below. Certain cell metabolites such as glutamate and acetate may also have a role in stimulating Es efficiency. The mechanism by which s concentration increases under stress has received a lot of attention and is discussed below. Ancillary Regulatory Molecules s0085 Cyclic AMP (cAMP) s0090 As stated above, the core stress genes responsible for gen- p0160 eral resistance are transcribed mainly by Es and other species of RNAP bound to alternate sigma factors. However, E70 does have a role in stress gene expression. The stress genes that this polymerase species transcribes tend to have weak promoters, that is, they deviate from the canonical promoter sequence that E70 recognizes. Consequently, the transcription of these genes depends on the availability of ancillary transcriptional factors. This is the case with several starvation genes concerned with uptake of different compounds, and their efficient metabolism when they are present at low concentration. These genes are transcribed if cAMP is available. cAMP binds a protein called CRP, and the resulting complex binds to a specific sequence (AGTGAN6TAACA) present upstream of the promoters of these genes, facilitating transcription by E70. cAMP is present in cells at low concentration under nutrient-sufficient conditions but is increased dramatically during starvation, thereby promoting the transcription of these genes by E70. The cAMP-dependent stress genes, however, play no role in enhanced general resistance, since starved cAMP-deficient strains exhibit the same degree of cross-protection against stresses in general as do cAMPproficient strains. The role of these genes appears to be confined to the escape response by encoding proteins that enhance the cellular scavenging capacity by improving cellular uptake and metabolic functions. Given the similarity between the E70and Es promo- p0165 ters, the following finding is of interest: changing the position of the CRP-binding site in certain genes can alter promoter preference from Es to E70 and vice versa. FI RS T introduction of C at this position in a E70 promoter improved its recognition by Es. Adenine (A)/T-rich stretch is also involved, TAA at positions –6 to –4 being a common feature of Es-recognized promoters; this feature may allow easier promoter melting (i.e., unwinding of the DNA strands to permit transcription). (2) Es can tolerate much wider deviations from consensus promoter sequences than E70 and can, for example, recognize promoters with degenerate –35 sequences, possibly because it does not need such a sequence in vivo, or is able to recognize other sequences in place of this sequence. (3) While the requirement of a 17 base pair space between the –10 and –35 region is a strong preference of E70, Es is more relaxed in this requirement. Indeed, many Es-recognized promoters exhibit –35 like elements at other positions. (4) Certain AT-rich sequences present upstream of the –35 region favor Es binding to the promoter; the C-terminal domains of the RNAP subunit play a role in this. (5) Both E70- and Es-recognized promoters tend to possess –10-like elements downstream of the transcriptional start site. Since early transcript complexes retain the sigma factors, these sequences cause the transcription to pause. s is released more rapidly than 70 from these complexes; thus the pause is shorter when Es is the transcriber, and this may facilitate Es-mediated transcription of promoters that are recognized by both E70 and Es. s s0080 Other factors involved in favoring E -mediated transcription Several trans-acting proteins seem to favor Es-mediated transcription over that of E70. Examples are H-NS, IHF, and Lrp. The mechanisms are not understood. In the case of H-NS, one possible mechanism is that the binding of this protein to a promoter interacting with E70, but not Es, renders the promoter unavailable for transcription. Changes in core RNAP, cytoplasmic ionic composition, as well as DNA supercoiling can also influence what RNAP species will transcribe a given gene. p0155 A major factor responsible for a shift to different RNAP species under stress is competition for the RNAP core enzyme. The core RNAP concentration in bacterial cell is limiting and different sigma factors have to compete for it. 70 possesses highest affinity for the core enzyme of all sigma factors and is present in excess; this accounts for the predominance of E70 in unstressed cells. In stressed cells, even though 70 retains its quantitative dominance, the balance shifts to RNAP species containing the alternate sigmas. Several factors account for this. E70 dissociates so that core RNAP concentration goes up. The effectiveness of 70 to bind to core RNAP is impaired due to the activity of the stationary phase-specific protein Rsd, and the small 6S RNA. s has the lowest affinity of all sigma factors for RNAP and its increased synthesis under stress notwithstanding; it never attains EL SE VI ER p0150 Guanosine tetraphosphate (ppGpp) s0095 The small nucleotide ppGpp has been studied intensively p0170 in the context of the stringent response, which refers to the phenomenon whereby amino acid starvation results in rapid downregulation of ribosomal RNA (rRNA) biosynthesis and ribosomes. It is now known that the concentration of this nucleotide goes up also in response to starvation for other nutrients as well as in stresses. Its synthesis, initially as pppGpp (which is later MICB 00102 Physiology | Stress, bacterial: General and Specific In response to specific stimuli, the phosphorylated form is stabilized; for this reason, it is also called the ‘sensor kinase’. In turn, the HPK phosphorylates the response regulator (RR) protein at a conserved aspartic acid residue. This phosphorylated form of the protein then activates transcription of the target loci. Several pairs of such proteins have been found; these initiate special adaptive strategies in response to specific environmental cues. The HPKs of different systems share homology of about 100 amino acids at their C-terminus; the RRs share homology in the 130 amino acid segments of their N-terminal ends. Among the environmental stimuli sensed by the different two-component systems are phosphate and nitrogen starvations, osmotic changes, and chemotactic stimuli. Here, the phenomenon is illustrated in the context of sensing phosphate starvation. As stated above (Table 1), several genes are induced in p0195 response to phosphate starvation; together these genes are referred to as the phosphate regulon. This regulon is under the control of the phoBR operon encoding the PhoB and PhoR proteins. The PhoB protein is a positive regulator of this regulon, since EL SE VI ER FI RS T dephosphorylated to ppGpp), involves two pathways in E. coli: by the ribosome-associated protein RelA, when the ribosome A-site contains an uncharged tRNA during amino acid starvation, and by the protein SpoT, which is responsible for ppGpp synthesis in most other stresses. SpoT can also degrade ppGpp and thus has a dual role. A strain of E. coli missing both RelA and SpoT (referred to AU3 as ppGpp strain) cannot synthesize this nucleotide and fails to lower its ribosome production under starvation conditions; such strains are referred to as relaxed strains. In other bacteria, for example, Streptococcus mutans, additional enzymes appear to be involved in ppGpp synthesis, such as RelP and RelQ. p0175 In general, ppGpp positively affects the transcription of stress-related genes and negatively those related to growth. It exerts its regulation by binding to 9 subunits of RNAP near its active site, as has recently been confirmed by crystal structure. This regulation is affected by several mechanisms, such as direct effect on the rate of formation and stability of the open complex, interference with promoter clearance (which obstructs further rounds of transcription), and competition with nucleotide triphosphates used in mRNA synthesis. p0180 A major role of ppGpp in the stress response is that it increases the ability of s (and that of other minor sigma factors) to compete with 70 for binding to the core enzyme. This has been shown in in vitro transcriptional assays and is supported by the finding that ppGppdeficient cells exhibit decreased fractions of both s and 54 bound to the core polymerase. The protein DksA may have a role in augmenting this effect. As can be expected from these findings, absence of ppGpp greatly compromises starvation survival, and proteomic and transcriptomic analyses have shown that this is because of the lack of stress protein synthesis; instead, the cells continue to express growth-specific proteins. Thus, ppGpp is a necessary adjunct to s for stress survival, and although much of this effect is likely to be affected by ensuring s function, some are likely to be directly due to ppGpp activity. p0185 ppGpp has important roles also in growing cells, where it is required for amino acid synthesis – a deficient strain cannot grow in the absence of exogenously provided amino acids. Further, ppGpp deficiency affects bacterial virulence, for example, expression of genes involved in pathogenicity island formation. PR OO F 12 s0100 Chemical Alteration in Proteins s0105 Protein phosphorylation p0190 An important mechanism in bacteria for sensing starvation and other stresses, which involves chemical alteration of proteins, is the so-called two-component system. One component of this pair is a histidine protein kinase (HPK) that autophosphorylates at a conserved histidine residue. 1. Mutations in phoB, which inactivate the protein, or deletion of this gene, render the phosphate regulon noninducible. 2. Sequence analysis shows that upstream of the phoA, phoBR, phoE, and pstS (phoS) promoters is a highly conserved 18-bp region (CTNTCATANANCTGTCAN) called the phosphate box. In vitro studies demonstrate that purified PhoB protein binds to the phosphate box and that this binding is required for the transcription of the phosphate regulon genes. 3. PhoB bears close homology to the RRs in other systems, such as NtrC (involved in sensing nitrogen starvation) and OmpR (involved in sensing osmotic stress). The phoR gene has a hydropathy profile typical of a p0200 membrane protein, and it shows homology to the HPK family of proteins. Like other sensor kinases, it autophosphorylates, a condition that is stabilized by phosphate starvation. It then phosphorylates PhoB, which activates the transcription of the phosphate regulon as discussed above. Protein oxidation s0110 This type of chemical alteration is involved in activating p0205 genes that protect against oxidative stress specifically in response to the ROS, H2O2, and O2. A more general mechanism that activates many of the same genes in response to diverse stresses is controlled by s, as discussed above. H2O2 is generally sensed by the transcriptional factor p0210 OxyR and O2, by the SoxR/Sox S proteins, although the two systems probably overlap. H2O2 directly oxidizes MICB 00102 Physiology | Stress, bacterial: General and Specific 13 Regulation of S Synthesis p0220 As stated above, s is the most important regulatory element in the GSR. Its cellular levels and/or activity increase in response to starvation for diverse individual nutrients as well as other stresses, and how this is accomplished is now understood in some detail at all three levels of control – transcriptional, translational, and posttranslational. I will discuss the results mainly in the context of starvation stress, unless the available information is confined to another stress. VI ER FI RS s0115 The SoxRS regulon EL SE Oxidation Transcriptional control SoxR SoxRS regulon SoxS f0040 Figure 8 Schematic of SoxRS regulation of the genes involved in defense against O2 radical. The change in the configuration of the SoxR protein upon oxidation by O2 is schematically represented to show that in its altered configuration, it can activate SoxS transcription, which in turn activates the individual genes of the SoxRS regulon. Reproduced from Matin A (2001) In: Bolton S (ed.) Encyclopedia of Environmental Microbiology, vol. 6, pp. 3034–3046. New York: John Wiley and Sons. s0120 PR OO F The rpoS gene is located in an operon downstream of the p0225 nlpD gene and is transcribed from two promoters, one within the nlpD gene and the other upstream of this gene. Use of transcriptional fusions suggested regulation in E. coli at this level under starvation, and by ppGpp. However, direct measurement of rpoS transcription in E. coli, by quantifying the rpoS mRNA levels and determination of its half-life, indicates that enhanced transcription has no role in the observed increased levels of this sigma factor in starvation. Translational control s0125 The main rpoS transcript contains an unusually long p0230 untranslated region (UTR), which is central to its translational control. The UTR may form two types of hairpin structures. One of these sequesters the translational initiation region (TIR) by pairing with a complementary sequence present within the coding region of the rpoS mRNA (called the antisense element), thereby making it unavailable to the ribosomes for translation. Other hairpins may form due to complementary sequences within the UTR. It is possible that both types of secondary structures have a role in regulating rpoS mRNA translation, although the involvement of the antisense elementmediated secondary structure in this regulation has not been documented yet. But considerable evidence is available indicating that secondary structures within the UTR minimize rpoS translation in unstressed cells and that their relaxation under certain stresses is the major reason for increased cellular s concentration (Figure 9). Small noncoding RNA (sRNAs) and the RNA-binding protein, Hfq, play a role in this phenomenon. For example, the sRNA, RprA, possesses a complementary sequence to the UTR stretch of rpoS mRNA, which is involved in hairpin formation. Base pairing and hydrogen bonding by this sRNA is able to open the hairpin, free TIR, and permit translation to proceed. Another sRNA, DsRA, is induced under cold stress and promotes rpoS translation by a similar mechanism. Under phosphate starvation, the synthesis of s is p0235 regulated at the translational level, but its mechanism is not known. Some five other sRNAs are known to affect rpoS translation, but none of these appears to have a role under these starvation conditions. It is possible that an as yet undiscovered sRNA is involved or that the control is exerted through modulation of the antisense elementmediated hairpin. Additional possibilities involve regulation through a variety of proteins that are known to regulate rpoS translation. These include the nucleoid protein HU that binds two regions in the rpoS mRNA and may influence its secondary structure; the histone-like protein StpA; the cold shock proteins CspC and CspE; a PTS protein; and DnaK. T OxyR. The conserved cysteines, at positions 199 and 208, are in free thiol form in OxyR; H2O2 converts them to disulfide form. The resulting conformational change, which has been documented by crystal structure, enables OxyR to activate the transcription of genes involved in escape from oxidative stress (Table 1). Upon removal of the H2O2 stress, OxyR is reduced by glutaredoxin 1. p0215 The SoxR protein is constitutively synthesized and also becomes activated by direct oxidation, in this case by O2. The protein is a homodimer with two [2Fe-2S] centers per dimer; these centers are the loci of redox changes, that is [2Fe-2S]1þ>[2Fe-2S]2þ conversion. The oxidized SoxR activates soxS gene transcription, which in turn induces a collection of genes called the soxRS regulon (Figure 8). These genes encode enzymes that can decompose O2 (Table 1) as well as repair the damage to DNA that may result from oxidative stress, such as the endonuclease IV, mentioned above. At the termination of the stress, SoxR is reduced by an NADPHdependent SoxR reductase. MICB 00102 14 Physiology | Stress, bacterial: General and Specific (a) RpoS CCCAAAUGCCUA A A GG GGAACAUUGCUUAAAGUUUUACGUUCGCA––5’ 63 nt CCACCUUAUG G GGGAUCACGGGU A G A G G U A G A G 5’––UAAGCAUGGAA A U CC CCU A A C AACGAAUUGCUGUGUGUA––3’ PR OO F (b) RprA G U A G A G 5’––UAAGCAUGGAA A U CC CCU (c) A A C AACGAAUUGCUGUGUGUA––3’ CCCAAAUGCCUA A A GG GGAACAUUGCUUAAAGUUUUACGUUCGCA––5’ 63 nt GGGA UCAC GGGU AGGA GCCA C CUU AUG FI RS T s f0045 Figure 9 The untranslated region (UTR) of the rpoS mRNA that encodes  . Note that the sequences upstream of the translational initiation codon (ATG) of the RNA includes regions of internal complementarity that result in the formation of a hairpin structure. This prevents the availability of the initiation codon. The small noncoding RNA, RprA, has regions of homology to the UTR of the rpoS mRNA (shown in red; B). Hydrogen bonding between the homologous regions of RprA and rpoS mRNA opens the hairpin, permitting translation (C). Reproduced from Matin A and Lynch SV (2005) ASM News 71(5): 235–240. Washington, DC: American Society for Microbiology. s0130 Posttranslational control It was thought that the control of s synthesis in carbon starvation also occurred at the translational level. Direct measurements of rpoS mRNA translational efficiency, however, disproved this notion and showed that the increase under these conditions is solely due to enhanced stability of the sigma protein. The experimental results shown in Table 3 indicate this fact. In this experiment, the rates of rpoS mRNA and s synthesis and their half lives were measured, which permitted calculation of the rpoS mRNA translational efficiency, that is, the sigma s protein synthesized per unit of the mRNA. E. coli cells were cultured in a glucose-limited chemostat in order to SE VI ER p0240 precisely establish the relationship between dwindling glucose concentration in the medium and the above mentioned parameters (Table 3). As the available glucose diminished, both s synthesis rate and rpoS mRNA translational efficiency declined. Meanwhile, however, the stability of the sigma protein increased from 7- to 16fold, accounting for the observed overall increase in the cellular levels of s. What accounts for the instability of the sigma protein p0245 under carbon-sufficient conditions? The answer came with the discovery that a specific protease, called ClpXP, which is composed of two proteins, ClpX and ClpP, is involved in this regulation. It rapidly degrades EL t0015 Table 3 s synthesis rate and rpoS mRNA translational efficiency in glucose-sufficient cells and those subjected to increasing degree of glucose starvation (last three rows) Glucose concentration (M) s Concentrationa s half-life (min) s synthesis rate rpoS mRNA concentration 103 (glucose sufficiency) 2.2  106 1.3  106 1.2  106 190 270 300 570 5 11 34 >60 55 34 13 ND 1.0 0.75 0.52 0.5 a pmol mg1 cell protein. pmol per mg cell protein per min. c Relative units. d s  synthesis rate/rpoS mRNA concentration. ND, not determined. Reproduced from Zgurskaya HI, Keyhan M, and Matin A (1997) Molecular Microbiology 24(3): 643–651. b MICB 00102 Physiology | Stress, bacterial: General and Specific 15 Labeled σs (%) 100 90 80 70 60 50 40 0 5 10 20 15 Time (min) 25 30 T s f0050 Figure 10 Comparison of  stability in exponential phase (solid symbols) and stationary phase (open symbols) cultures in clpP-proficient (circles) and clpP-deficient (squares) backgrounds. Note that in a wild-type background, s is stable only in the stationary phase, but in a mutant missing the Clp protein, it is stable in both the phases of growth. Reproduced from Schweder T, Kyu-ho L, Lomovskaya O, et al. (1996) Journal of Bacteriology 178(2): 470–476. at their N- or C-terminal ends, called the ssrA tag, and may unfold the target proteins by acting on this tag. The stability of the protein structure adjacent to the tag also appears to have a role – the less stable this structure, the easier it is for ClpXP to degrade a protein. If ClpXP protease can degrade s in exponential phase p0250 cells, why does this protein become resistant to this protease in the stationary phase? Another protein, SprE (RssB), has a role in this phenomenon. SprE is a homologue of RR proteins, mentioned above, but is unique in its C-terminal output domain and in the fact that it controls the stability of a protein. SprE forms a quaternary complex with ClpP, ClpX, and s, and this complex can degrade the sigma protein in vitro. SprE is active in exponential phase cells, but becomes inactive under carbon starvation, and this is thought to account for the fact that s stability increases under these conditions. By analogy to other RRs, it was assumed that SprE is active in its phosphorylated state, but the search for a cognate sensor kinase (see above) has remained elusive. According to some researchers, SprE may be phosphorylated by several different kinases or small molecule phosphate donors. According to others, however, phosphorylation at the conserved aspartate of SprE may not be necessary for its activity. It was shown that SprE, in which the conserved aspartate is mutated, still retains full activity. What activates SprE remains unknown. PR OO F 110 VI ER FI RS s in unstressed cells, but not in those experiencing carbon starvation (Figure 10). ClpP is a double-ring peptidase with 14 active sties on the inside of the ring. The hexameric rings of ClpX bind to one or both ends of the ClpP chamber. The target proteins are recognized by ClpX, which unfolds the proteins to be degraded using ATP and feeds them into the ClpP chamber (Figure 11). Remarkably, despite the fact that the bacterial cell also contains several other proteases, ClpAP, Lon, HslUV, and FtsH, s is degraded only by the ClpXP protease. The stretch between 173 and 188 amino acids within the s protein is required for its recognition as a ClpXP target. ClpX targets proteins containing an 11-amino acid stretch Activity control EL SE ClpX Peptide release ClpP Binding Unfolded substrate Native substrate Unfolding ADP s0135 Control at the level of activity of s evidently operates in p0255 nitrogen starvation. Under these conditions, the core set of proteins are still synthesized even though s levels show only a very modest increase. Thus, it is thought that the sigma protein is more active under these Degradation Translocation ADP f0055 Figure 11 Schematic representation of native protein degradation by ClpXP protease. The ClpX component of the protease binds the substrate protein and unfolds it by its ATPase activity. The unfolded protein is translocated through the ClpP chamber, a process that also requires ATP, and is degraded; the resulting peptide fragments are released. Reproduced from Kenniston JA, Burton RE, Siddique SM, et al. (2004) Journal of Structural Biology 146: 130–140. MICB 00102 Physiology | Stress, bacterial: General and Specific conditions. The factors that may account for this are hypothesized to be those that increase the competitiveness of s for RNAP. These have been discussed above (see ‘Other factors involved in favoring Es-mediated transcription’). s0140 Regulation under low-shear/simulated microgravity conditions As alluded to above, low-shear environments, such as brush border microvilli of the gastrointestinal, respiratory, and urogenital tracts, are common routes of microbial infection. Low shear environments closely resemble microgravity conditions experienced by astronauts during space flight. There has therefore been considerable interest in studying the biological effects of these conditions. On Earth, the effects of such environments are simulated by the use of special cultivation equipment that utilizes high aspect to ratio vessels (HARVs). Early studies strongly indicate that these conditions weaken the human immune response and make bacteria more virulent and stress-tolerant; these have obvious implications for the control of disease on Earth and astronauts’ health. Studies on the regulation of this phenomenon have resulted in some intriguing findings. Thus, the increased bacterial resistance that low-shear environments confer on bacteria appears to be independent of s in exponential but not in stationary phase. Further, these environments markedly enhance rpoS translational efficiency regardless of the growth phase and promoted s instability, especially in the exponential phase. Since both these regulatory phenomena involve macromolecular folding pattern, the findings raise the possibility that low-shear/microgravity environments can influence these patterns. Concluding Remarks s0150 It is evident that in response to hostile and frequently p0270 fluctuating conditions in nature, bacteria have evolved highly sophisticated mechanisms that permit them to swiftly shift between rapid growth and static survival modes. Our understanding of this phenomenon has enhanced greatly in the last two decades, and further progress is likely to yield information that will permit better control of bacterial growth – its enhancement toward beneficial ends, such as ecosystem management, industrial processes, and bioremediation, as well as its mitigation as in disease. s0145 Sensing starvation VI Given that the regulation of the starvation response differs depending on the missing nutrient, it seems likely that the dearth of different nutrients is sensed by different mechanisms. The sensing mechanism in the case of carbon starvation could be an effector that inactivates SprE or ClpXP. Recent reports indicate that an increase in denatured proteins may have a role. Starvation affects EL SE p0265 ER FI RS T p0260 fidelity of ribosomes, resulting in the synthesis of abnormal proteins with a proclivity for oxidation. The latter sequester Clp, impairing ClpXP activity, resulting in the stabilization of s. In this view, starvation is sensed by the increase in aberrant proteins. Phosphate and nitrogen starvations may involve the PhoBR- and NtrBC-sensing systems mentioned above. In P. putida, a G-protein, called FlhF, which is situated at the cell pole, may be involved in sensing stress, as its absence robs the cell of the capacity to develop the general stress resistance. PR OO F 16 See also: AU4 Further Reading Gottesman S (2004) The small RNA regulators of Escherichia coli: Roles and mechanisms. Annual Review of Microbiology 58: 303–328. Matin A (1991) The molecular basis of carbon starvation-induced general resistance in E. coli. Molecular Microbiology 5: 3–11. Matin A (2001) Stress response in bacteria. In: Bolton S (ed.) Encyclopedia of Environmental, vol. 6, pp. 3034–3046. New York: John Wiley and Sons. Nystrom T (2004) Stationary phase physiology. Annual Review of Microbiology 58: 161–181. Peterson CN, Mandel MJ, and Silhavy J (2005) Escherichia coli starvation diets: Essential nutrients weigh in distinctly. Journal of Bacteriology 187(22): 7549–7553. Typas A, Becker G, and Hengge R (2007) The molecular basis of selective promoter activation by the sigmas subunit of RNA polymerase. Molecular Microbiology 63(5): 1296–1306. b0005 b0010 b0015 b0020 b0025 b0030