A review: Molecular identification of orchid mycorrhiza

Adv. Hort. Sci., 2024 38(1): 97­116 DOI: 10.36253/ahsc­14952 Review paper AHS Advances in Horticultural Science A review: Molecular identification of orchid mycorrhiza N.A. Shamsudin 1, J.S.S. Seelan 1, J.A. Gansau 2, N.A. Rusdi 1 (*) 1 Institue for Tropical Biology and Conservation, Universiti Malaysia Sabah, Jalan UMS, 88400 Kota Kinabalu, Sabah, Malaysia. 2 Faculty Science and Natural Resources, Universiti Malaysia Sabah, Jalan UMS, 88400 Kota Kinabalu, Sabah, Malaysia. Key words: Identification, mycorrhizal, orchid. (*) Corresponding author: [email protected] Citation: SHAMSUDIN N.A., SEELAN J.S.S., GANSAU J.A., RUSDI N.A., 2024 ­ A review: Molecular identifica‐ tion of orchid mycorrhiza. ­ Adv. Hort. Sci., 38(1): 97­116. Copyright: © 2024 Shamsudin N.A., Seelan J.S.S., Gansau J.A., Rusdi N.A. This is an open access, peer reviewed article published by Firenze University Press (http://www.fupress.net/index.php/ahs/) and distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Competing Interests: The authors declare no competing interests. Received for publication 21 July 2023 Accepted for publication 6 November 2023 Abstract: Orchids are a diverse and widespread family of flowering plants, with over 25,000 known species and more than 100,000 hybrids and cultivars. Orchids are characterised by their often showy and highly specialised flowers and have unique and intricate floral. Orchids are known to be highly dependent on their mycorrhizal fungi for nutrient uptake, especially during the early stages of their development. Orchid seeds lack the endosperm present in most other seeds, which means they cannot germinate without a source of nutrition. The relationship between orchids and mycorrhiza is known as orchid mycorrhizae or orchid mycorrhiza. In orchid mycorrhiza, the orchid plant forms a mutualistic relationship with certain species of fungi that are able to penetrate the orchid’s roots and colonise its tissues to provides the orchid with essential nutrients. Orchid mycorrhizal fungi are often highly specific, meaning that they can only form partnerships with certain orchid species, and vice versa. The importance of mycorrhizal fungi in the orchid life cycle is crucial from both evolutionary and ecological standpoints. Therefore, it is essential to acquire a thorough comprehension of this relationship and develop methodologies for isolating, identifying, and preserving significant fungal strains that are associated with different orchid species. In recent years, there has been a considerable increase in research concentration on mycorrhizal interactions in orchids. However, certain inquiries remain unresolved pertaining to the fungal communities associated with orchids as well as the divergences notices across different species and geographical locales. The present paper provides a through, and extensive analysis of the fungal life associated with orchids. This article presents a succinct overview of the molecular techniques utilised by researchers globally to isolate and identify peloton­forming fungi in both temperateterrestrial and tropical orchids. The review begins by proving a concise introduction to the background material regarding the wide range of fungal species that are linked with orchids. It then proceeds to explores the topic of orchid mycorrhizal fungi (OMF) and orchid non­mycorrhizal fungi (ONF). The subsequent analysis explores the crucial function that orchid mycorrhizal fungi play in the processes of seed germination and development. Moreover, the study elaborates on the methodologies utilised for isolating fungi, extracting fungal DNA, selecting primers, amplifying DNA and subsequent analysis sequence data. This article considers several molecular identification approaches that are used in studying orchid endophytic mycorrhizal. Using molecular approaches, orchid mycorrhizal can be further explored and identified. 97 Adv. Hort. Sci., 2024 38(1): 97­116 1. Introduction The Orchidaceae family is considered the second largest among flowering plants, with its size exceeded only by the Asteraceae family (Givnish et al., 2015). According to Govaerts et al. (2017), the number of recognised orchid species is estimated to be 29,199. The decision to classify all orchids under Appendices I and II by the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) in 2017 effectively prohibited the illicit trade of these plants (Hinsley et al., 2018). Based on the evaluations made on a total of 1770 species of orchids, it has been determined that approximately 46.5% of these species are classified under the categories of vulnerability, endangered, or critical endangered as reported by the International Union for Conservation of Nature (IUCN, 2021). This precarious state remains due to a variety of variables, including their difficult germination process and human intervention, such as overcollection caused by economic and horticultural needs (Pujasatria et al., 2020; Suresh et al., 2023). Orchids are extraordinarily important for biodiversity, conservation, and producing a vast array of therapeutic substances, nutritious foods, and ornamental plants (Hinsley et al., 2018). Orchid conservationists strive to manage market needs and biodiversity on a global scale, which would need large­scale production (Pujasatria et al., 2020). Numerous species encounter the peril of extinction; however, orchids adopt two distinct evolutionary strategies, namely sympodial growth and monopodial development, which are regulated by a diverse array of endophytic fungus species. These techniques serve to extend the longevity of orchids as herbaceous plants. (Srivastava, 2018). Orchid endophyte has a different way of penetrating and colonising their host, which makes them different from another fungal pathogen. For example, orchid fungi endophytes enter through stomata laterally in the anticlinal epidermal cell. They remain intracellularly in the shoot without colonising the cell. In contrast, pathogen fungi enter directly from the cell wall and typically grow extracellularly, potentially causing harm to the host (Sarsaiya et al., 2019). Diverse fungal taxa include mutualistic mycorhiza, endophytic fungi and considerably diverse as well as non­mycorrhizal fungal associates. The role of the root­allied fungi is not well understood. According to 98 Lee and Yeung (2018), some of these fungi may supply organic carbon, nutrients, and water to the orchid, but the degree of this transfer is typically unknown. Numerous report on specific mycorrhizal fungi also shows the ability to stimulate the embryo’s development and supply it with necessary nutrients, allowing the orchid seeds to germinate (Liu et al., 2010; Zhang et al., 2016; Shao et al., 2017; Herrera et al., 2019; Shah et al., 2019; Suresh et al., 2023). In recent years, the has been a significant transformation in the application of molecular techniques. The identification of fungi within roots has been accomplished through the application of polymerase chain reaction (PCR) techniques, employing fungal­specific primers (Gardes and Bruns, 1993). Such methods have been used to characterize mycobionts of Orchidaceae, Taylor and Bruns (1999) employed these techniques to characterise mycobionts of Orchidaceae, thereby removing the laboratories process of culturing. The region that is most frequently studied is the nuclear ribosomal internal transcriber spaces (ITS). Therefore, there is a want for molecular techniques capable of discerning distinct fungal species in cases where numerous fungal species are present in a single plant. The present review has provided an overview of the principal discoveries and methodologies utilised in the discipline, underscoring the significance of molecular techniques such as fungal DNA extraction, primer selection, polymerase chain reaction (PCR), and high throughput sequencing (HTS) in discerning the taxonomy of mycorrhizal fungi and elucidating the underlying molecular mechanisms that regulate these symbiotic relationships. Furthermore, the utilisation of molecular method has provided researchers with enhanced capabilities to explore the extensive range of orchid mycorrhizal variety. The investigation has not only shown evolutionary relationship but has also yielded significant insights into ecological and conservation concerns. A thorough comprehension of mycorrhizal connections is essential for the efficient preservation of orchid species. In addition, the exploration of orchid mycorrhizal fungus in the fields of biotechnology and agriculture has resulted in the identification of new and important mycorrhizal fungi. In the context of identifying orchid mycorrhizal fungi, many methodologies are routinely applied, encompassing the isolation and cultivation of fungi, microscopic analysis and molecular studies. The ongoing refining Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza and improvement of these techniques play a crucial role in further our understanding and fascinating associations between orchids and their mycorrhizal fungus. 2. Orchid and its fungi diversity Orchids form a unique symbiotic relationship with the plant and animal species present in forest habitats in order to acquires nutrients, facilitate their own development, and facilitate the process of pollination. The mycorrhizal fungi, which exhibit symbiotic germination, are if significant importance in facilitating embryo development and supply vital nutrients within the natural environment. This symbiotic relationship is crucial in the effective germination of orchid seeds (Liu et al., 2010; Herrera et al., 2019). Fungi have a crucial role as the principal provider of essential nutrients for developing Orchidaceae plants, especially in setting characterised by low nutrients availability (Long et al., 2022). Orchids interact with a smaller number of mycorrhizal fungi than other mycorrhizal plants, with greater specificity for orchid mycorrhizal fungi than ectomycorrhizae, arbuscular mycorrhizae, and even ericoid mycorrhizal fungi. In symbiotic connection, fungi provide plants with water and mineral nutrients (especially phosphorus) while protecting them from biotic and abiotic stresses. In exchange, plant hosts provide carbon from photosynthesis to the fungi (Rasmussen, 1995; Tedersoo et al., 2017). Many orchid species cannot commence germination or grow without their compatible symbiotic fungus (Rasmussen, 1995; Davis et al., 2015; Fay, 2018; Attri, 2022), as their specificity of mycorrhizal connections that permit in situ symbiotic seed germination in orchids is frequently so rigorous. The aforementioned circumstance has stimulated inquiries into the importance of fungus in symbiotic relationships that are equally crucial and beneficial for the ex‐situ preservation of orchids, specifically in the context of reintroduction endeavours. The first recorded evidence of a mycorrhizal fungus in an orchid may be traced back to the year 1824, as documented by the renowned German naturalist Heinrich Link. Nevertheless, the specific function of the fungus remained ambiguous until the early 1900s when Nöel Bernard established a scientific correlation between filamentous fungi and the process of seed germination (Arditti and Pridgeon, 1997). Following this, in the early 1900s, the study of orchid endophytes emerged as a significant area of interest within the field of orchid biology research. Chand et al. (2020) conducted a comprehensive investigation wherein they isolated and identified many orchid endophytes, and thoroughly evaluated their probable role in orchid symbiosis. Orchids frequently establish symbiotic relationships with fungus that display substantial evolutionary and ecological variability. Epiphytic orchids exhibit a prevalence of both Basidiomycota and Ascomycota in their aerial roots as well as subterranean roots or rhizomes, while Chytridiomycota, Glomeromycota, Zygomycota, or Mucoromycota are present in comparatively smaller quantities (Waud et al., 2014; Cevallos et al., 2017; Egidi et al., 2018; Novotná et al., 2018). The classification of orchid fungus is determined by the existence or absence of functional pelotons within cortical cells, leading to the categorization of orchid mycorrhizal fungi (OMF) or orchid non­mycorrhizal fungi (ONF) (Li et al., 2021). 3. Orchid mycorrhizal fungi (OMF) and Orchid non­ mycorrhizal fungi (ONF) The phenomenon referred to as “orchid mycorrhiza” pertains to the symbiotic relationship established between the orchid plant and many fungal species that are capable of cohabiting within its root system. The germination of an orchid mycorrhizal fungus (OMF), and these seeds rely on one or more OMF’s for sustenance during their whole life (Bidartondo and Read, 2008). Within the realm of fungi, a subset of these organisms can be classified as transient, denoting their inability to maintain a sustained presence within the developing and maturing tissues of orchids. Conversely, there exist other fungi that establish more long­lasting associations with these plants. According to Lee and Yeung (2018), during the maturation process of orchids, specific fungi that play a role in facilitating germination persist as “permanent residents” whereas other fungi initiate germination and are subsequently replaced by different fungal partners. The identification of coiled pelotons within cortical root cells is recognised as a characteristic feature of orchid mycorrhizal fungus (OMF), as examiner in research undertaken by Dearnaley et al. (2016) as well as Rasmussen (1995). In contrast, 99 Adv. Hort. Sci., 2024 38(1): 97­116 orchid mycorrhizal fungi (ONF) pertain to a distinct classification of endophytic fungi that reside within the roots or other tissues or orchids at specified phases of their life cycle. Nevertheless, it is imperative to elucidate that oligotrophic nitrogen­ fixation bacteria (ONFs) are devoid of peloton­like structures and do not elicit any noticeable pathogenic consequences in the host plants. The aforementioned phenomenon has been emphasised in scientific inquiries conducted by Sisti et al. (2019) and Selosse et al. (2018). Several investigations, like those conducted by Herrera et al. (2019) and Waterman et al. (2011), have shown empirical evidence indicating the involvement of certain orchid mycorrhizal fungi (OMFs) in the process of decomposition. The observed mycorrhizal fungi (OMFs) have been documented to facilitate the decomposition of nearby substrates and provide essential nutrients to orchids. It is important to acknowledge that specific obligatory mycoheterotrophic fungi (OMFs) may have experienced evolutionary shifts from ancestral obligate non­photosynthetic fungus (ONFs), gradually developing mycorrhizal capacities. The aforementioned phenomenon has been thoroughly investigated in scholarly studies conducted by Selosse et al. (2018) and Wang et al. (2021). The classification of orchid mycorrhizal fungus (OMF) has a wide range of fungal species, consisting of at least 17 families from the basidiomycetes group and five families or genera from the ascomycetes group, as documented by Dearnaley (2007) and Dearnaley et al. (2012). Within this set, there are several noteworthy groups, namely Ceratobasidiaceae (Cantharellales), Tulasnellaceae, and Serendipitaceae, which were previously referred to as the Sebacinales clade B. The classification of these groupings as Rhizoctonia­type Basidiomycetes is largely acknowledged in the scientific community, as evidenced by multiple research (Rasmussen, 1995; Bayman and Otero, 2006; Sisti et al., 2019; Selosse et al., 2018; Jędryczka et al., 2023). Basidiomycetes and Ascomycetes, which are widely distributed in terrestrial ecosystems and cultivated plants globally, have notable associations with orchids (Trivedi et al., 2020; Wang et al., 2019). The significance of orchid mycorrhizal fungi (OMF) in specific microenvironments cannot be understated, as they play a crucial role in promoting the germination of orchid seeds and the subsequent growth of orchid seedlings. As a result, geographical 100 areas that display a significant occurrence of orchid mycorrhizal fungi (OMF) tend to showcase a higher range of orchid species, as documented by Li et al. (2021). In their study, Hemrová et al. (2019) conducted germination tests and developed species distribution models that integrated multiple habitat parameters. The results of their study emphasized the crucial significance of fungal symbionts in influencing the spatial distribution of orchids on a large geographical scale. Furthermore, McCormick et al. (2019) and other scientific inquiries have provided substantial data supporting a strong and positive association between the prevalence of mycoheterotrophic orchids, which depend on fungi for nourishment, and the existence of OMF. The cumulative evidence suggests that OMF has a significant role in shaping the population dynamics of orchids. 4. Orchid mycorrhizal and its roles in seed germination and development In general, asymbiotic or symbiotic procedures can be used to germinate orchid seeds (Yam and Arditti, 2009). It has been demonstrated that asymbiotic seed germination is an effective method for producing plantlets of numerous orchid species for both commercial and conservation. It was believed that root orchid mycorrhizal fungi are the actual source of seed­germinating orchid mycorrhizal fungi (Rasmussen, 1995). Root fungal endophytes are seen as advantageous plant residents that may increase their productivity and eventually support ecological functions. Roots of mature plants have provided fungi that have been isolated and tested, with several successes have been attained employing these fungi (Nontachaiyapoom et al., 2011; Sebastián et al., 2014). The in situ/ex‐situ seed baiting technique has been increasingly popular in recent years as a means of obtaining efficacious fungi that facilitate seed germination. According to previous studies conducted by Zhou and Gao (2016) and Rasmussen and Whigham (1993), it has been observed that fungus obtained from naturally occurring protocorms or seedlings possess the capacity to induce seed germination and facilitate the subsequent development of seedlings (Table 1). Shao et al. (2020) conducted a conservation project with the objective of protecting Dendrobium species Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza Table 1 a ­ List of orchid mycorrhizal fungi that had been identified and their roles in orchid micropropagation Orchid Vanda wightii (E) Paphiopedilum barbigerum (T) Serapias vomeracea (T) Epidendrum secundum (T) Dactylorhiza majalis (T) Chloraea gavilu (T) Aerides multiflora (E) Dendrobium friedericksianum (E) Fungi sp. Roles References Ceratobasidium sp. Seed germination Suresh et al. (2023) Epulorhiza sp. Seed germination and seedling development Tian et al. (2022) Tulasnella calospora Seed germination and seedling development Ghirardo et al. (2020) Ceratobasidium sp., Sebacina vermifera Seed germination and seedling development Durán­López et al. (2019) Piriformospora indica Seed germination Shah et al. (2019) Tulasnella sp. Seed germination Herrera et al. (2017) Ceratobasidium sp. Seed germination Bhatti et al. (2017) Tulasnella sp., Seed germination and seedling development Agustini et al. (2016) Seed germination Khamchatra et al. (2016) Tulasnellaceae Rigidoporus vinctus, Polyporales Ceratobasidium sp., Tulasnellaceae Flavodon flavus, Polyporales Nigroporus vinosus, Polyporales Coriolopsis retropicta, Polyporales Valsa eugeniae, Diaporthales. Paphiopedilum villosum (E) Tulasnella sp., Dendrobium lancifolium (E) Rhizoctonia sp. Seed germination Agustini et al. (2016) Liparis japonica (T) Rhizoctonia sp. Seed germination Ding et al. (2014) Dendrobium aphyllum (E) Tulasnella sp., Seed germination Zi et al. (2014) Trichoderma sp. Tulasnella sp., Epulorhiza sp. Seedling growth Zi et al. (2014) Tulasnella sp. Seed germination and seedling growth Ming et al. (2014) Xyalariaceae sp. Seed germination Chen et al. (2013) Guignardia endophyllicola Seed germination Mangunwardoyo et al. (2011) Epulorhiza sp. Seed germination and development Chutima et al. (2011) Tulasnellaceae Dendrobium aphyllum (E), Dendrobium devianum (E), and Cymbidium manni (E) Dendrobium officinal (E) Dendrobium nobile (E), Dendrobium Chrysotoxum (E), Dendrobium falconer (E), Dendrobium aphyllum (E) Dendrobium crumenatum (E) Pecteilis susannae (L.) E= epiphytes; T= Terrestrial. 101 Adv. Hort. Sci., 2024 38(1): 97­116 Table 1 b ­ List of orchid mycorrhizal fungi that had been identified and their roles in orchid micropropagation Orchid Dendrobium nobile (E) Cymbidium eburneum (E) Fungi sp. Roles References Leptodontidium Seedling development Hou and Guo (2009) Alternaria sp., Chaetomium sp, Vegetative growth Zhao and Liu (2008) Mycena osmundicola Seed germination Kim et al. (2006) Rhizoctonia sp Seedling development Jianrong et al. (2005) Mycena osmundicolor Seed germination Hong et al. (2002) Fusarium sp. Gastrodia elata (T) Cymbidium goeringii (T) Gastrodia elata (T) Phacodium sp. Seedling development Ming and Zhou (2001) Cypripedium reginae (T) Paphiopedilum armeniacum (T) Fusarium sp. Seed germination Warcup (1981) Dendrobium discolor (E), Tulasnella cruciate, Seed germination Warcup (1981) Tulasnella irregularis, Tulasnella allantospora Calochilus sp. (T), Diuris maculata Sm. (T), Spiranthes sinensis (T) Tulasnella asymmetrica, Seed germination Tulasnella cruciate, Warcup (1981) Tulasnella irregularis, Tulasnella violea, Tulasnella allantospora Diuris sulphurea. R.Br. (T) Tulasnella asymmetrica Seed germination Warcup (1981) Orthocersa strictum (T) Tulasnella asymmetrica, Seed germination Warcup (1981) Seed germination Warcup (1981) Seed germination Warcup (1981) Seed germination Warcup (1981) Seed germination Warcup (1981) Tulasnella cruciate, Tulasnella irregularis, Tulasnella violea Thelymitra ixoides (T) Tulasnella asymmetrica, Tulasnella cruciata Thelymitra flexuosa (T) Tulasnella irregularis, Tulasnella cruciata Thelymitra media (T) Tulasnella violea, Thelymitra carnea (T) Tulasnella allantospora, Tulasnella asymmetrica Tulasnella violea E= epiphytes; T= Terrestrial. 102 Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza that have been excessively harvested. They effectively isolated and obtained fungi that enhance germination for several Dendrobium species using the seed baiting approach, as described by Huang et al. (2018). 5. Fungal DNA extraction There are various methodologies commonly employed for the isolation of orchid mycorrhizal fungus from orchid plants. These methodologies encompass the isolation of complete tissue or tissue segments, in situ seedings, trapping isolation, and isolation from a solitary peloton. Among these methods, the technique of isolating a single peloton, which involves micromanipulation­based isolation from host cells, is widely regarded as the most reliable and precise approach for extracting endophytic mycorrhizal fungi (Zettler et al., 2003; Batty et al., 2006; Zi et al., 2014; Zettler and Corey, 2018). The prevailing conventional method for molecular identification of orchid mycorrhizal fungus generally entails the extraction of DNA from agar plates or liquid cultures, as opposed to direct extraction from orchid roots (Zettler and Corey, 2018). The fungal cell wall primarily consists of around 80­90% polysaccharides, inorganic ions, lipids, polyphosphates, and proteins, which together form the matrix that binds the wall. This type of cell wall also can be characterized by microfibrillar components like chitin, β­glucan, and/or cellulose, which pose challenges in DNA extraction (Turzhanova et al., 2018). Moreover, the presence of a substantial quantity of secondary metabolites, such as melanin, can impede subsequent reactions (Fernandez et al., 2016; Janowski et al., 2019) This become a major challenge in DNA extraction of fungi as it has a robust cell walls that are resist to lysis method (Jiang et al., 2011). The isolating nucleic acids from fungi, often necessitates the incorporation of additional lysis steps, which can include enzymatic lysis, mechanical homogenization, sonication, or the use of potentially harmful chemicals (Turzhanova et al., 2018). DNA samples were gathered over a period of 15 years, during which a diverse range of extraction procedures were utilised to extract fungal DNA. Nevertheless, the extraction of DNA from the various types of fungi encountered does not have a universally optimised approach. The standard procedure for the extraction of fungal DNA typically encompasses several sequential stages. These stages involve the cultivation of fungi in either liquid or solid growth media, disruption of the fungal cell wall, elimination of proteins using phenol and chloroform, and subsequent isolation of DNA through precipitation with ethanol or isopropanol (Faggi et al., 2005). Even though the presence of polysaccharide and polyphenolic compound in the fungi may inhibit the activity and effect of DNA polymerase, but they can be easily removed by either using a vacuum or spin column and by mixing the sample with bovine serum albumin (BSA), β­mercaptoethanol (βМЕ), N­ trimethyl ammonium bromide (CTAB) and Polyvinylpyrrolidone (PVP) (Tripathy et al., 2017). A variety of methodologies have been devised to isolate DNA from fungal tissues, and the most efficacious DNA extraction procedures frequently integrate physical methodologies (such as microwave treatment, freeze/thaw cycles, homogenization using glass beads, and grinding in liquid nitrogen) with enzymatic approaches (including gluconases, chitinases, and proteases) (Zhang et al., 2010). The exists variety of ways for extracting DNA and among them, the CTAB approach (Gardes and Bruns, 1993) is frequently utilised. Additional alternatives for fungal genomic DNA isolation kits are the Omega Fungal E.Z.N.A kit (manufactured by Omega Biotech, Doraville, GA, USA), the Qiagen Plant DNeasy kit, Genomic Tip kits (Qiagen, Valencia, Cam USA), or Sangin Biotech Rapid Fungi Genomic DNA isolation kits (Long et al., 2022). In order to ascertain the effectiveness of a DNA extraction technique, it is important to evaluate both the quality and quantity of the DNA obtained. The concentration of DNA in the samples was assessed by employing spectrophotometry at wavelength of 260 nm, with measurement expressed in units of nanograms per microliter (ng/µL). In addition, the assessment of DNA purity was conducted by determining the A260/A280 ratio and A260/280 ratio utilising either a UV­VIS spectrophotometer or Nanodrop devise (Thermo Electron Scientific Instruments LLC, USA). Generally, the A260/A280 ratio exceeded 1.8 suggesting that the DNA was largely devoid of proteins. In terms of the A260/A230 ratio, if it was approximately 2, that indicate the samples did not contain significant impurities such as carbohydrates, peptides, phenols, salts, or aromatic compounds (Turzhanova et al., 2018). Furthermore, the quality of the DNA also can be evaluated through 103 Adv. Hort. Sci., 2024 38(1): 97­116 electrophoresis after PCR amplification of the genomic DNA, using gene­specific primers (Tripathy et al., 2017). The standard CTAB phenol­chloroform extraction procedure has proven effective across a wide range of species (Strugnell et al., 2006; Reineke et al., 1998) and produce a high purity of DNA (Zettler and Corey 2018). Study by Turzhanova et al. (2018) on optimization of DNA extraction methods of fungi has shown that CTAB­method and DNeasy Plant mini Kit (Qiagen) resulted a highest DNA quality, while SDS method resulted in the lowest sample yields and quality. However, CTAB­method uses toxic chemicals and requires a significant amount of bench time, both limiting its applicability when scaling up for big comparative research (Schiebelhut et al., 2017). Nowadays, commercial DNA extraction kits are more desirable since they reduce exposure to toxic chemicals and allow for faster extraction periods. These kits could offer a range of low­ to high­ throughput processing, vary in price from quite inexpensive to highly costly, and may require some specialist gear. Table 2 below shows a list of extraction methods and kits used in the extraction method of DNA orchid fungi. A large percentage of orchid mycorrhizal fungi are mycelia sterilia. Conventional techniques have led to a paraphyletic taxonomy in which unrelated fungi are grouped together, requiring molecular techniques for accurate identification, phylogenetic inference, and genetic relatedness (Sen et al., 1999; Otero et al., 2002; Shan et al., 2002; Yagame et al., 2008). Molecular sequencing, microscopic examination, and biochemical analysis were among the most used methods to identify mycorrhizal fungi. For fungi identification by morphological characterisation, it Table 2 ­ Types of manual DNA extraction protocol used to extract mycorrhizal fungi DNA Protocol name Cetytrimethyl ammo­ nium bromide (CTAB)­ Phenol­chloroform Sodium Dodecyl Sulfate Phenol Chloroform Isoamyl alcohol extraction method EZNA SP Fungal DNA Qiamp Mini Kit (Qiagen) Fungi/Yeast Genomic DNA Isolation (Norgen)* * Modified method. 104 Abbreviation Chemistry/mechanism CTAB CTAB lysis, followed by phenol chloroform purification step SDS lysis, SDS and mercaptoetha­ followed by nol lysis, phenol chloroform followed by purification step chloroform purification step Kits/supplies required DNA extraction time All reagents are made in­house 1 hour 30 min Sambrook et al. (2001); Dawson et al. (1998) All reagents are made in­house 1 hour 5 min Turzhanova et al. (2018) References PCI Buffer lysis. Followed by Phenol/chloroform /isoamyl alcohol purification step All reagents are made in­house 2 hour 10 min Varma and Kwon Chung (1991) Omega Fungal EZNA Silica based purification system Omega Fungal EZNA kit (Omega Biotek, Doraville, GA, USA) 45 min Omega (2019) QIAamp Mini kit Silica based purification system Qiamp Mini Kit (Qiagen) 35 min Turzhanova et al. (2018) Fungi/Yeast Genomic DNA Isolation Silica based purification system Fungi/Yeast Genomic DNA Isolation Kit (Norgen) More than 2 hours Kumar and Mugunthan (2018) Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza can be conducted alone or in combination with molecular analysis, and usually, most research will use both combination methods in identifying mycorrhizal fungi. However, the orchid fungus is notoriously difficult to be determined at the species level because they do not sporulate readily on cultures (Boddington and Dearnaley, 2008; Ko et al., 2011; Ma et al., 2015). 6. Primer selection for fungal amplification After the completion of DNA extraction from orchid mycorrhizal fungi, the subsequent step involves the amplification of fungal DNA through the utilisation of a polymerase chain reaction (PCR) technique. This amplification process necessitates the use of primers that are specifically designed to target the ribosomal DNA (rDNA) region. The rDNA cluster consists of several components, including 18S rDNA, 5.8S rDNA, 28S rDNA, the External Transcribed Spacer (ETS), and Internal Transcribed Spacer 1 and 2, which are generally referred to as ITS1 and ITS2. The utilisation of the ITS region for molecular identification of fungi can be traced back to the early 1990s, as shown by Horton and Bruns (2001) and Seifert (2009). The utilisation of the ITS region for molecular identification is of great significance in fungal identification, principally owing to the inclusion of two remarkably variable spacers, namely ITS1 and ITS2, which frequently exhibit species­specific characteristics either independently or in conjunction. Moreover, it includes the 5.8S gene, which is renowned for its exceptional level of conservation. The high degree of sequence conservation observed in the adjacent genes, along with their designation as the region undergoing the most rapid evolution and the existence of multiple copies of the ribosomal operon, facilitates the efficiency of primer design and PCR amplification for the ITS region (Bengtsson Palme et al., 2013; Fajarningsih, 2016; Raja et al., 2017). These two spacers are copied from the ribosomal DNA, and when the ribosomal RNAs complete, they are removed from the rRNAs. Since the spacers are not used in the final structure of the ribosome, they are not strongly selected against mutations. Therefore, the identification of mycorrhizal fungus is considered efficient by using a region­specific to eukaryotes (Tedersoo and Nilsson, 2016). The nuclear ribosomal RNA genes, including the small subunit (SSU) (18S) and large subunit (LSU) (28S) are commonly utilised in scientific investigations pertaining to aquatic fungus and arbuscular mycorrhizal fungi. Nevertheless, in the case of ascomycetes and basidiomycetes, these markers generally offer taxonomic insights primarily at level beyond the species, and occasionally at the genus level. This problem is caused by the fact that the SSU and LSU sequences of the many species that belong to these fungal groupings have only minute to nonexistent differences between them. Because of this, precise distinction becomes a challenging obstacle. According to the findings of the research carried out by Nilsson et al. (2019), the ability of SSU, LSU, and protein­coding genes like the RNA polymerase gene RPB2 to be aligned across different fungal phyla is a significant benefit offered by these types of genes. This makes it possible to analyse large­scale phylogenetic relationships at the phylum and order levels, which is something that the ITS region normally has difficulty accomplishing without very identical reference sequences (Větrovský et al., 2016). Because the ITS region often ranges in length from 500­700 bases, the majority of high­throughput sequencing (HTS) studies concentrate on the shorter ITS1 or ITS2 subregions, which typically range in length from 250­400 bases. This constraint is the result of the fact that the ITS region is normally between 500­700 bases in length. According to Tedersoo et al. (2015), the ITS2 subregion in particular stands out due to the fact that it exhibits lesser length fluctuations and more universal primer sites. This, in turn, results in reduced taxonomic bias. The ITS1 and ITS2 subregions have demonstrated their suitability for second generation High­ Throughput Sequencing (HTS) techniques. However, third generation methodologies, such as those utilising PacBiosciences (PacBio) and Oxford Nanopore platforms, provide the ability to target the complete ITS region, as well as segments or even the entire adjacent rRNA genes (Nilsson et al., 2019). Targeting the entire Internal Transcribed Spacer (ITS) area, rather than its subregions has several advantages, including improved taxonomic accuracy and less amplification of non­viable organism. Nevertheless, one limitation of this methodology is its reduced efficacy when utilised on materials of subpar quality, such as ancient herbarium specimens, which degrade to a degree where doing ITS DNA sequencing becomes impractical (Tedersoo et al., 105 Adv. Hort. Sci., 2024 38(1): 97­116 2017). According to study conducted by Nilsson et al. (2019), it is recommended to allocate a significant amount of effort to the analysis and selection of primers, this is due to the fact that only a limited number of primers have the capability to amplify over 90% of fungal groups. Additionally, the process of primer selection necessitates meticulous examination of the target taxa, as highlighted by Tedersoo et al. (2015). The following table 3 and 4 show an illustrative depiction of ITS primers together with their corresponding sequences. 7. Identified fungal from orchid root by using internal transcribe region Gardes and Bruns (1993) and White et al. (1990) have produced well recognised primers in the field of fungal ecology for species­level identification based on sequencing. These primers, namely ITS1, ITS2, ITS3, ITS4, ITS1F, ITS86F, and cNL2f, are considered to be broad­spectrum primers. The ITS1 and ITS4 primers are commonly employed as standard primers in numerous laboratories (Fajarningsih, 2016). The list of endophytic fungi that have been isolated and identified from orchid roots is presented in table 5. This was accomplished by employing a broad­ spectrum primer (ITS1 and ITS4). However, some primers are designed to be specific. For example, the ITS86F primers are used primarily for medically important fungal pathogen, but they are rarely used in mycorrhizal identification, especially fungi communities from environmental samples. In orchid mycorrhizal fungi identification, the ITS1­F is one of the most effective primers for the ITS region amplification, especially for Eumycota. For example, the primer ITS1­F and ITS4 always used in pair to identified an Fusarium sp. as in the study by Sukarno et al. (2023), where they manage to identified several species of Fusarium using this primer combination. The ITS1­F and ITS4­B primer were designed to be specific basidiomycetes (Gardes and Bruns, 1993). Besides that, both primers can minimise plant sequence amplification (Taylor and McCormick, 2008). However, this primer is ineffective in amplifying some species of Tulasnellaceae that belong to Basidiomycota phylum, as their nuclear ribosomal is evolving rapidly and some primers are typically conserved along the Eumycota are not maintained in Tulasnellaceae Table 3 ­ List of recommended primer for identification of orchid mycorrhizal Primer Sequence (5’­3') References Modified ITS1ngs TCCGTAGGTGAACCTGC Oja et al. (2014) Modified ITS1Fngs GGTCATTTAGAGGAAGTAA Oja et al. (2014) Modified ITS4ngs TCCTSCGCTTATTGATATGC Oja et al. (2014) ITS4Tul2 TTCTTTTCCTCCGCTGAWTA Oja et al. (2014) TW14ngs CTATCCTGRGRGAAAYTTC Tedersoo et al. (2014) fITS9 GAACGCAGCRAAIIGYGA Ihrmark et al. (2012) gITS7 GTGARTCATCGARTCTTTG Ihrmark et al. (2012) fITS7 GTGARTCATCGAATCTTC Ihrmark et al. (2012) CCGCCAGATTCACACATTGA Taylors and McCormick (2008) ITS4Tul ITS1­OF Taylors and McCormick (2008) ITS4­OF GTTACTAGGGGAATCCTTGTT Taylors and McCormick (2008) ITS86F GTGAATCATCGAATCTTTGAA Turenne et al. (1999) ITS1F CTTGGTCATTTAGAGGAAGTAA Gardes and Bruns (1993) ITS4B CAGGAGACTTGTACACGGTCCAG Gardes and Bruns (1993) ITS1 TCCGTAGGTGAACCTGCGG White et al. (1990) ITS2 GCTGCGTTCTTCATCGATGC White et al. (1990) ITS3 GCATCGATGAAGAACGCAGC White et al. (1990) ITS4 TCCTCCGCTTATTGATATGC White et al. (1990) NS7 GAGGCAATAACAGGTCTGTGATGC White et al. (1990) GTTTCCCTTTTAACAATTTCAC White et al. (1990) cNL2f 106 AACTCGGCCATTTAGAGGAAGT/AACTTGGTCATTTAGAGGAAGT Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza Table 4 ­ List of recommended primer pair for sequencing of orchid mycorrhizal partners Primer name (forward/ reverse) Sequence (5’­3') Target region Annealing temp (oC) Target clade (orchid specific group fungi) References ITS1/ITS4 ITS1 (F) ITS4 (R) TCCGTAGGTGAACCTGCGG TCCTCCGCTTATTGATATGC ITS1/ITS2 53 All Basidiomycota White et al. (1990) ITS1/ ITS4­ Tul ITS1 (F) ITS4­Tul TCCGTAGGTGAACCTGCGG CCGCCAGATTCACACATTGA ITS1/ITS2 54 Tulasnella Taylor and McCormick (2008) ITS1­OF (F) ITS1­OF (F) ITS4­OF (R) AACTCGGCCATTTAGAGGAAGT AACTTGGTCATTTAGAGGAAGT GTTACTAGGGGAATCCTTGTT ITS1/ITS2 60 All Basidiomycota Taylor and McCormick (2008) SSU1318­Tom (F) LSU­Tom4 CGATAACGAACGAGACCTTAT GCCCTGTTCCAAGAGACTTA SSU/LSU 62 Thelephoraceae Taylor and McCormick (2008) ITS86F (F) GTGAATCATCGAATCTTTGAA ITS­2 59 Both Ascomycota and Basidiomycota White et al. (1990) ITS4 (R) TCCTCCGCTTATTGATATGC ITS3/ITS4OF ITS3 (F) ITS4OF (R) GCATCGATGAAGAACGCAGC GTTACTAGGGGAATCCTTGTT ITS­2 62 5.8S­Tulngs/ITS4­Tul2 5.8S­Tulngs CATTCGATGAAGACCGTTGC ITS­2 57 ITS4­Tul2 TTCTTTTCCTCCGCTGAWTA NS7/ITS1OF­RC NS7 (F) ITS1OF­RC­G (R) ITS1OF­RC­A (R) GAGGCAATAACAGGTCTGTGATGC ACTTCCTCTAAATGGCCGAGTT ACTTCCTCTAAATGACCAAGTT SSU 62 Some Ascomycota and Basidiomycota (including some Tulasnella) White et al. (1990) Waud et al. (2014) Waud et al. (2014) ITS1OF/ITS2 m ITS1­OF (F) ITS1­OF (F) ITS 2 m AACTCGGCCATTTAGAGGAAGT AACTTGGTCATTTAGAGGAAGT TCGCTGCGTTCTTCATCGA ITS­1 62 Some Ascomycota and Basidiomycota (including some Tulasnella) Taylor and McCormick (2008) ITS1F (F) CTTGGTCATTTAGAGGAAGTAA ITS­1 62 ITS2 (R) GCTGCGTTCTTCATCGATGC ITS4OF­RC (F) AACAAGGATTCCCCTAGTAAC cNL2F (R) GTTTCCCTTTTAACAATTTCAC Primer pair ITS1­OF/ITS4­OF SSU1318­Tom/LSU­Tom4 ITS86F/ITS4 ITS1F/ITS2 ITS4OF­RC/cNL2F (including some Tulasnella) LSU 59 All Basidomycota All Basidiomycota (inc. Serendipitaceae and Tulasnellaceae) Both ascomycota and basidomycota (including some Tulasnella) Some Ascomycota and Basidiomycota (including some Tulasnella) White et al. (1990) Taylor and McCormick (2008) Rammitsu et al. (2021) Oja et al. (2014) Gardes and Bruns (1993) White et al. (1990) Waud et al. (2014) White et al. (1990) 107 Adv. Hort. Sci., 2024 38(1): 97­116 Table 5 ­ List of endophytic fungi that has been isolated and identified from root by using a broad­spectrum primer (ITS1 and ITS4) Orchid Species Endophytic fungal (Accession no./taxonomic affiliation) Type of primer Country References Vanda wightii Ceratobasidium_Wyd1 (MW59578) ITS1 and ITS4 India Suresh et al. (2023) Dendrobium longicornu Alternaria sp. (MN256650), Cladosporium sp. (MN256649), Coniochaeta sp. (MK225602), Penicillium sp. (MN256653), Fusarium sp. (MN256645), Fusarium sp. (MN256647), Fusarium sp. (MN256646). ITS1 and ITS4 Nepal Shah et al. (2022) Aerides rosea Tulasnellaceae sp. (JF691200) ITS1 and ITS4 China Zhao et al. (2021) Tulasnella deliquescens (LC175331) ITS1 and ITS4 China Zhao et al. (2021) Tulasnella sp. strain SSCDO­4 (MH348613 ITS1 and ITS4 China Zhao et al. (2021) Tulasnella sp. 140 (AY373281) ITS1 and ITS4 China Zhao et al. (2021) Ceratobasidium sp. GC (GQ369961), Ceratobasidium sp. FPUB 168 (EF536969), Rhizoctonia sp. Abn1b (AJ318432), Rhizoctonia sp. Onv6 (AJ318436) ITS1 and ITS4 Bangladesh Hossain (2019) Ceratobasidum sp. (JX913820), Ceratobasidum sp. (JX913820), ITS1 and ITS4 India Bhatti et al. (2017) Tulasnella sp. (AY373281)/Tulasnellaceae Rigidoporus vinctus (HQ400710)/ Polyporales Ceratobasidium sp. (HM117643)/Tulasnellaceae Flavodon flavus (JQ638521)/Polyporales Nigroporus vinosus (AB811859)/Polyporales Coriolopsis retropicta (KC867403)/Polyporales Valsa eugeniae (AY347344)/Diaporthales ITS1 and ITS4 Thailand Khamchatra et al. (2016) Aerides multiflorum Ceratobasidium sp. (Eu605733) ITS1 and ITS4 western Himalayas Hossain et al. (2013) Rhynchostylis retusa Ceratobasidium sp. (Eu605732) ITS1 and ITS4 western Himalayas Hossain et al. (2013) Pecteilis susannae (L.) Epulorhiza sp. GQ856216 Epulorhiza sp. GQ856215 Epulorhiza sp. GQ856214 Fusarium sp. GQ862347 Epulorhiza sp. FJ882028 Epulorhiza sp. GQ862346 Epulorhiza sp. FJ940903 Epulorhiza sp. FJ873174 ITS1 and ITS4 Thailand Chutima et al. (2011) Dendrobium nobile Dendrobium cucullatum Epigeneium amplum Gastrochilus calceolaris Aerides multiflora Paphiopedilum villosum (Lindl.) Stein. 108 Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza (Taylor and McCormick 2008). To address this issue, the ITS4­Tul primer has been designed to study only Tulasnella species, thereby minimising the amplification of other taxa. Two primers that are Tulasnellla specific which is ITS4­Tul and ITS4R are designed from the 3­end of ITS2 (Suárez et al., 2006). The ITS4­Tul primer is a perfect or near­perfect match for some of the core species of Tulasnella but their mismatches with the majority of other fungi make them a specific primer. ITS4­Tul has been used widely as a primer, especially for the identification of orchid mycorrhizal primarily targeted Tulasnellaceae, which are mostly reported to have the ability to promote seed germination (Oja et al., 2014; McCormick et al., 2021; Suetsugu et al., 2021). Meanwhile, ITS1­OF and ITS4­OF is nowadays are increasingly used in characterising orchid fungal symbionts as they are designed to be a broad spectrum basidiomycete specific primer (Currah and Sherburne, 1992; Taylor and McCormick, 2008; Jacquemyn et al., 2010). A study on identification of fungi identification of terrestrial orchid mycorrhizal by using broad spectrum fungal taxa primer (ITS86F/ITS4) by Waud et al. (2014) has outperformed the other primer pair. The study also assessed the efficacy of several type of broad­spectrum primer and specific primer for orchid mycorrhizal fungi to understand and characterized orchid mycorrhizal communities and suggested several suitable primer pairs. Other study also uses the broad­spectrum primer pair ITS86F/ITS4 to investigate the orchid mycorrhizal community in both epiphytic and terrestrial orchid (Cevallos et al., 2017; Johnson et al., 2021). However, the use of broad­ spectrum primer for identification of orchid mycorrhizal fungi is constrained by a primer bias, which arise from the inability of the primer to identify a specific fungus within a sample due to the mismatch during PCR. While Tulasnellaceae fungi are commonly associated with orchids (Dearnaley et al. 2012), their molecular detection poses challenges due to mismatches with universal fungal primers (Suárez et al., 2006; Taylor and McCormick 2008; Waud et al., 2014; Rammitsu et al., 2021). Moreover, previous comprehensive investigations conducted through Sanger sequencing­based methodologies have indicated distinctions between the mycorrhizal communities associated with epiphytic orchids and those associated with terrestrial orchids (Martos et al., 2012; Xing et al., 2019). The utilising of Tulasnellaceae­specific primers for the assessmen of orchid mycorrhiza; networks by metabarcoding analysis is highly recommended, particurlay in the context of epiphytic orchids, as emphasised in the research conducted by Rammitsu et al. (2021). The commonly used broad spectrum primer, ITS86F/ITS4 effectively identified Ceratobasidiaceae and Serendipitaceae fungi but proved inadequate in detecting the diversity of Tulasnellaceae fungi (Rammitsu et al., 2021). Due to significant primer biases present within the Tulasnellaceae family, which plays a crucial role as mycorrhizal symbionts in the majority of orchid species, it is imperative to exercise caution in selecting primers and thoroughly assess potential biases (Oja et al., 2014). 8. Sequencing When it comes to fungi, morphology is often the method of choice for performing the fundamental function of species distinction. However, distinguishing species based on their morphology can be difficult, particularly for fungi that do not have complex fruiting bodies, as is the case with the three families of Rhizoctonia species that are linked with orchids (Gardes and Bruns, 1993). Conventionally, it has been thought that the ‘Rhizoctonia’ complex, which includes species from three different fungal families (Tulasnellaceae, Ceratobasidiaceae, and Serendipitaceae), makes up the bulk, if not the entirety, of orchid mycorrhizal fungus. However, recent research suggests that this may not be the case. Septal ultrastructure is a defining characteristic that separates the various clades within Rhizoctonia (Currah and Sherburne, 1992), but careful inspection is still required to distinguish Sebacinaceae and Tulasnellaceae (Andersen, 1996). This problem is compounded by the fact that when the cryptic, resupinate fruiting structures are seldom observed. Basidial morphology offers suitable identification of orchid­associated Rhizoctonia species at the morphospecies level (Warcup and Talbot, 1967). However, orchid isolates are rarely induced to fruit in culture as some fungi cannot be produced in artificial circumstances (Currah et al., 1990). In order to expand knowledge of fungal variety, culture­independent technologies (sequencing and cloning) have been created. Morphological identification methods are conventional identification method that involves evaluating the 109 Adv. Hort. Sci., 2024 38(1): 97­116 morphological and microscopic features of fungi on different culture media and under different conditions. This method can be accompanied by other identification methods to help identify fungi more accurately. Other methods, such as microscopic examination or biochemical screening, can be performed alone or in conjunction with molecular analysis. With the recent development of advanced molecular techniques (e.g., next­generation sequencing), the spectrum of fungi discovered at the species level has expanded significantly, allowing for more precise ecological inferences (Peay, 2014). High­Throughput Sequencing (HTS) technologies provide a number of benefits, including the capability to identify fungi at trace levels, quick microbial community structure analysis, and cost­effectiveness (Cruz et al., 2014; Tedersoo and Nilsson, 2016; Nilsson et al., 2019). These benefits can be found in HTS technologies. According to Nilsson et al. (2019), a typical HTS metabarcoding process consists of several important stages, including DNA extraction, marker­based PCR amplification, DNA sequencing, sequence processing, and data analysis. These processes are listed in the order as follows: sampling then DNA extraction. However, one potential downside of these technologies is that they may potentially result in the spread of pollutants and mycorrhizal fungi that are not specific to orchids. Research methodology and sequencing carried out on high­throughput platforms are the two components of the most typical approaches to molecular identification. DNA microarrays, clone libraries, denaturing gradient gel electrophoresis, fluorescence in situ hybridization, and gene chip approaches are some of the other methods that can be utilised for the identification of fungi (Dearnaley, 2007). However, these technologies have short­ comings such as limited throughput, time­consuming processes, and lower accuracy. Additionally, they have been overshadowed by the growing popularity of alternative methods such as the MiSeq PE300 and HiSeq PE250 platforms (Julou et al., 2005). Furthermore, alternative methods, such as using an Illumina NovaSeq/HiSeq sequencer and the application of shotgun metagenomic technology, provide access to functional gene information from all microorganisms within a community through genomic DNA analysis (Bahram et al., 2018; Fadiji and Babalola, 2020). These methods were developed by Bahram et al. (2018) and Fadiji and Babalola (2020). An important step forward in orchid mycorrhiza 110 research has been taken thanks to the development of this technique and the growing availability of orchid and reference orchid mycorrhizal fungal genomes (Zhang et al., 2016). Because of their ability to simultaneously sequence a mixed DNA template across numerous samples with a high sequencing depth (Nilsson et al., 2019), next­generation sequencing (NGS) approaches have become practically widespread in mycorrhizal research in recent years. This is partly owing to the fact that NGS methods have grown more affordable in recent years. In contrast, sequencing DNA from individual mycorrhizal root tips may be ideal for Sanger sequencing when it comes to detecting shifts in regularly occurring fungus species (Shemesh et al., 2020). This was found by Shemesh and colleagues. In contrast to next­generation sequencing technologies, which can process millions of DNA fragments simultaneously, the Sanger sequencing method only processes one DNA fragment at a time (Slatko et al., 2018). This makes the Sanger sequencing method superior in terms of sequencing volume. This distinction has the ability to bring forth different conclusions regarding the make­up of the community. 9. Conclusions This review provides an overview of the most significant literature in orchid mycorrhizal fungi from about 2002­2023. The molecular identification of orchid mycorrhiza represents a significant advancement in our understanding of the complex relationships between orchids and their mycorrhizal fungal. In addition, finding the most appropriate extraction method and choosing a suitable primer for amplification is essential to ensure accurate identification. Moreover, the utilization of molecular techniques compliments morphology­based identifications offers a reliable, unbiased, and frequently more precise tools for confirming species. It is particularly beneficial for cryptic species, hybrids, morphological variables organism such as mycorrhizal, or situations when usual identification methods fail. Based on the review, the ITS regions prove to be a great primer in the field of mycorrhizal studies to its inherent variability, widespread applicability and straightforward amplification process and compatibility with established databases. This technique enables researchers to accurately identify the specific fungal species Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza associated with a particular orchid species and to investigate the functional tole of these fungi in orchid growth and development. With the advancement of molecular techniques, it is now possible to examine the genetic diversity of these fungi and understand the evolutionary relationship between different orchid mycorrhizal fungi. These may lead to the development of new conservation strategies for these unique and valuable plant species. Acknowledgements We would like to thank to Sabah Biodiversity Centre for research License (JKM/MBS.1000­2/2 JLD.15(55)). This work was supported by the Ministry of Higher Education [FRGS/1/2021/WAB11/UMS /02/3] and University Malaysia Sabah [UMS GREAT GUG0059­1/2023]. References AGUSTINI V., SUFAATI S., SUHARN O., SUWANNASA I., 2016 ­ Rhizoctonia‐like fungi isolated from roots of Dendrobium lancifolium var. papuanum and Calanthe triplicata in Papua, Indonesia. ­ Biodiversitas, 17(1): 377­383. ANDERSEN T.F., 1996 ­ A comparative taxonomic study of Rhizoctonia sensu lato employing morphological, ultrastructural and molecular methods. ­ Mycol. Res., 100(9): 1117­1128. ARDITTI J., PRIDGEON A.M., 1997 ­ Orchid biology: Review and perspective, VII. Springer, Dordrecth, Germany, pp. 394. ATTRI L.K., 2022 ­ A study on mycorhizal associations in an economically important orchid. ­ J. Phytol. Res., 2(4): 38­43. BAHRAM M., HILDEBRAND F., FORSLUND S.K., ANDERSON J.L., SOUDZILOVSKAIA N.A., BODEGOM P.M., BENGTSSON­PALME J., ANSLAN S., COELHO L.P., HAREND H., HUERTA­CEPAS J., MEDEMA M.H., MALTZ M.R., MUNDRA S., OLSSON P.A., PENT M., PÕLME S., SUNAGAWA S., RYBERG M., TEDERSOO L., BORK P., 2018 ­ Structure and function of the global topsoil microbiome. ­ Nature, 560(7717): 233­237. BATTY A.L., BRUNDRETT M.C., DIXON K.W., SIVASITHAMPARAM K., 2006 ­ In situ symbiotic seed germination and propagation of terrestrial orchid seedlings for establishment at field sites. ­ Aust. J. Bot., 54(4): 375­381. BAYMAN P., OTERO J.T., 2006 ­ Microbial endophytes of orchid roots, pp. 153­177. ­ In: SCHULZ B.J.E., C.J.C. BOYLE, and T.N. SIEBER (eds.) Microbial root endophytes. Vol. 9. Springer, Berlin, Heidelberg, Germany, pp. 387. BENGTSSON PALME J., RYBERG M., HARTMANN M., BRANCO S., WANG Z., GODHE A., GODH E., DE WIT P., SÁNCHEZ­GARCÍA M., EBERSBERGER I., DE SOUSA F., AMEND A., JUMPPONEN A., UNTERSEHER M., KRISTIANSSON K., ABARENKOV K., BERTRAND Y.J.K., SANLI K., ERIKSSON K.M., VIK U., VELDRE V., NILSSON R.H., 2013 ­ Improved software detection and extraction of ITS1 and ITS 2 from ribosomal ITS sequences of fungi and other eukaryotes for analysis of environmental sequencing data. ­ Methods Ecol. Evol., 4: 914­919. BHATTI S.K., VERMA J., JASPREET K.S., PATHAK P., 2017 ­ Symbiotic seed germination of Aerides multiflora Roxb. a study in vitro. ­ J. Orchid Soc. India., 31: 85­91. BIDARTONDO M.I., READ D.J., 2008 ­ Fungal specificity bottlenecks during orchid germination and development. ­ Mol. Ecol., 17(16): 3707­3716. BODDINGTON M., DEARNALEY J.D.W., 2008 ­ Morphological and molecular identification of fungal endophytes from roots of Dendrobium speciosum. ­ Proc. R. Soc. Qld., 114: 13­17. CEVALLOS S., SÁNCHEZ­RODRÍGUEZ A., DECOCK C., DECLERCK S., SUÁREZ J.P., 2017 ­ Are there keystone mycorrhizal fungi associated to tropical epiphytic orchids?. ­ Mycorrhiza, 27: 225­232. CHAND K., SHAH S., SHARMA J., PAUDEL M.P., PANT B., 2020 ­ Isolation, characterization, and plant growth‐ promoting activities of endophytic fungi from a wild orchid Vanda Cristata. ­ Plant Signal. Behav., 15(5): 1744294. CHEN J., ZHANG L.­C., XING Y.­M., WANG Y.­Q., XING X.­K., ZHANG D.­W., LIANG H.­Q., GUO S.­X., 2013 ­ Diversity and taxonomy of endophytic Xylariaceous fungi from medicinal plants of Dendrobium (Orchidaceae). ­ PLoS ONE, 8(3): e58268. CHUTIMA R., DELL B., VESSABUTR S., BUSSABAN B., LUMYONG S., 2011 ­ Endophytic fungi from Pecteilis susannae (L.) Rafin (Orchidaceae), a threatened terrestrial orchid in Thailand. ­ Mycorrhiza, 21(3): 221­ 229. CRUZ D., SUÁREZ J.P., KOTTKE I., PIEPENBRING M., 2014 ­ Cryptic species revealed by molecular phylogenetic analysis of sequences obtained from basidiomata of Tulasnella. ­ Mycologia, 106(4): 708­722. CURRAH R.S., SHERBURNE R., 1992 ­ Septal ultrastructure of some fungal endophytes from boreal orchid mycorrhizas. ­ Mycol. Res., 96(7): 583­587. CURRAH R.S., SMRECIU E.A., HAMBLETON S., 1990. ­ Mycorrhizae and mycorrhizal fungi of boreal species of Platanthera and Coeloglossum (Orchidaceae). ­ Canad. J. Bot., 68(6): 1171­1181. DAVIS J.B., PHILLIPS R.D., WRIGHT M., LINDE C.C., DIXON K.W., 2015 ­ Continent‐wide distribution in mycorrhizal fungi : implications for the biogeography of specialized 111 Adv. Hort. Sci., 2024 38(1): 97­116 orchids. ­ Ann. Bot., 116(3): 413­421. DAWSON M.N., RASKOFF K.A., JACOBS D.K., 1998 ­ Field preservation of marine invertebrate tissue for DNA analyses. ­ Mol. Mar. Biol. Biotechnol., 7(2): 145­152. DEARNALEY J., PEROTTO S., SELOSSE M. A., 2016 ­ Structure and development of orchid mycorrhizas, pp. 63­86. ­ In: MARTIN F. (ed) ­Molecular mycorrhizal symbiosis. John Wiley & Sons, Inc., New York, pp. 506. DEARNALEY J.D.W., 2007 ­ Further advances in orchid mycorrhizal research. ­ Mycorrhiza, 17(6): 475­486. DEARNALEY J.D.W., MARTOS F., SELOSSE M.A., 2012 ­ Orchid mycorrhizas: Molecular ecology, physiology, evolution and conservation aspects, pp. 207­230. ­ In: HOCK B. (ed.) Fungal associations. Vol. 9. Springer, Berlin, Germany, pp. 406. DING R., CHEN X.H., ZHANG L.J., YU BO, QU X.D., DUAN R., XU Y.F., 2014 ­ Identity and specificity of rhizoctonia‐ like fungi from different populations of Liparis japonica (Orchidaceae ) in Northeast China. ­ PLoS ONE, 9(8): e105573. DURÁN­LÓPEZ M.E., CAROCA­CÁCERES R., JAHREIS K., NARVÁEZ­VERA M., ANSALONI R., CAZAR M.E., 2019 ­ The micorryzal fungi Ceratobasidium Sp. and Sebacina vermifera promote seed germination and seedling development of the terrestrial orchid Epidendrum secundum Jacq. ­ S. Afr. J. Bot., 125(54): 54­61. EGIDI E., MAY T.W., FRANKS A.E., 2018 ­ Seeking the needle in the haystack: undetectability of mycorrhizal fungi outside of the plant rhizosphere associated with an endangered Australian orchid. ­ Fungal Ecol., 33: 13­ 23. FADIJI A.E., BABALOLA O.O., 2020 ­ Metagenomics methods for the study of plant‐associated microbial communities: a review. ­ J. Microbiol. Methods, 170: 105860. FAGGI E., PINI G., CAMPISI E., 2005 ­ Use of magnetic beads to extract fungal DNA. ­ Mycoses., 48: 3­7. FAJARNINGSIH N.D., 2016 ­ Internal transcribed spacer (its) as DNA barcoding to identify fungal species: a review. ­ Squalen Bull., 11(2): 37­44. FAY M.F., FEUSTEL M., NEWLANDS C., GEBAUER G. 2018 ­ Inferring the mycorrhizal status of introduced plants of Cypripedium calceolus (Orchidaceae) in northern England using stable isotope analysis. ­ Bot. J. Linn., 186(4): 587­590. FERNANDEZ C.W., LANGLEY J.A., CHAPMAN S., McCORMACK M.L., KOIDE R.T., 2016 ­ The decomposition of ectomycorrhizal fungal necromass. ­ Soil Biol. Biochem., 93: 38­49. GARDES M., BRUNS T.D., 1993 ­ ITS Primers with enhanced specificity for basidiomycetes‐application to the identification of mycorrhizae and rusts. ­ Mol. Ecol., 2(2): 113­118. GHIRARDO A., FOCHI V., LANGE B., WITTING M., SCHNITZLER J.P., PEROTTO S., BALESTRINI R., 2020 ­ Metabolomic adjustments in the orchid mycorrhizal 112 fungus Tulasnella calospora during symbiosis with Serapias vomeracea. ­ New Phytol., 228(6): 1939­1952. GIVNISH T.J., SPALINK D., AMES M., LYON S.P., HUNTER S.J., ZULUAGA A., ILES W.J.D., CLEMENTS M.A., ARROYO M.T.K., LEEBENS­MACK J., ENDARA L., KRIEBEL R., NEUBIG K.M., WHITTEN W.M., WILLIAMS N.H., CAMERON K.M., 2015 ­ Orchid phylogenomics and multiple drivers of their extraordinary diversification. ­ Proc. R. Soc. B: Biol. Sci., 282(1814): 20151553. GOVAERTS R., BERNET P., KRATOCHVIL K., GERLACH G., CARR G., ALRICH P., PRIDGEON A.M., PFAHL J., CAMPACCI M.A., HOLLAND BAPTISTA D., TIGGES H., SHAW J., CRIBB P., GEORGE A., KREUZ K., WOOD J. J., 2017 ­ World checklist of Orchidaceae, Kew: Facilitated by the Royal Botanic Gardens. ­ http://apps.kew.org/wcsp/. HEMROVÁ L., KOTILÍNEK M., KONEČNÁ K., PAULIČ R., JERSÁKOVÁ J., TĚŠITELOVÁ T., KNAPPOVÁ J., MÜNZBERGOVÁ J., 2019 ­ Identification of drivers of landscape distribution of forest orchids using germination experiment and species distribution models. ­ Oecologia, 190(2): 411­423. HERRERA H., VALADARES R., CONTRERAS D., BASHAN Y., ARRIAGADA C., 2017 ­ Mycorrhizal compatibility and symbiotic seed germination of orchids from the Coastal Range and Andes in South Central Chile. ­ Mycorrhiza, 27(3): 175­188. HERRERA P., SUÁREZ J.P., SÁNCHEZ­RODRÍGUEZ A., MOLINA M.V.C., PRIETO M., MÉNDEZ M., 2019 ­ Many broadly‐shared mycobionts characterize mycorrhizal interactions of two coexisting epiphytic orchids in a high elevation tropical forest. ­ Fungal Ecol., 39: 26­36. HINSLEY A., DE BOER H.J., FAY M.F., GALE S.W., GARDINER L.M., GUNASEKARA R.S., KUMAR P., MASTERS S., METUSALA D., ROBERTS D.L., VELDMAN S., WONG S., PHELPS J., 2018 ­ A review of the trade in orchids and its implications for conservation. ­ Bot. J. Linn. Soc., 186(4): 435­455. HONG I.P., KIM H.K., PARK J.S., KIM G.P., LEE M.W., GUO S.X., 2002 ­ Physiological characteristics of symbiotic fungi associated with the seed germination of Gastrodia elata. ­ Mycobiology, 30(1): 22­26. HORTON T.R., BRUNS T.B., 2001 ­ The molecular revolution in ectomycorrhizal ecology: peeking into the black‐box. ­ Mol. Ecol., 10(8): 1855­1871. HOSSAIN M.M., 2019. ­ Morpho‐molecular characterization of Ceratobasidium sp.: A mycorrhizal fungi isolated from a rare epiphytic orchid Gastrochilus calceolaris (J. E. Sm.) D. Don. ­ Bangladesh J. Plant Taxon., 26(2):249­257. HOSSAIN M.M. RAHI P., GULATI A., SHARMA M., 2013 ­ Improved ex vitro survival of asymbiotically raised seedlings of Cymbidium using mycorrhizal fungi isolated from distant orchid taxa. ­ Sci. Hortic., 159: 109­116. HOU X.Q., GUO S.X., 2009 ­ Interaction between a dark Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza septate endophytic isolate from Dendrobium Sp. and roots of D. Nobile seedlings. ­ J. Integr. Plant Biol., 51(4): 374­381. HUANG H., ZI X.M., LIN H., GAO Y.G., 2018 ­ Host‐ specificity of symbiotic mycorrhizal fungi for enhancing seed germination, protocorm formation and seedling development of over‐collected medicinal orchid, Dendrobium Devonianum. ­ J. Microbiol., 56(1): 42­48. IHRMARK K., BÖDEKER I.T.M., CRUZ­MARTINEZ K., FRIBERG H., KUBARTOVA A., SCHENCK J., STRID Y., STENLID J., BRANDSTRÖM DURLING M., CLEMMENSEN K.E., LINDAHL B.J., 2012 ­ New primers to amplify the fungal ITS2 region ‐ evaluation by 454‐sequencing of artificial and natural communities. ­ FEMS Microbiol. Ecol., 82(3): 666­677. IUCN, 2021 ­ The IUCN red list of threatened species, Version 2021‐1. ­ www.iucnredlist.org. JACQUEMYN H., HONNAY O., CAMMUE B.P.A., BRYS R., LIEVENS R., 2010 ­ Low specificity and nested subset structure characterize mycorrhizal associations in five closely related species of the genus orchis. ­ Mol. Ecol., 19(18): 4086­4095. JANOWSKI D., WILGAN R., LESKI T., KARLINSKI L., RUDAWSKA M., 2019 ­ Effective molecular identification of ectomycorrhizal fungi: revisiting DNA isolation methods. ­ Forests, 10(3): 1­10. JĘDRYCZKA E., HENDEL P., NABRDALIK M., 2023 ­ Rhizoctonia spp. as beneficial and mycorrhizal fungi, pp. 213­220. ­ In: SHARMA V., R. SALWAN, E. MOLISZEWSKA, D. RUANO ROSA, and M. JEDRYCZKA (eds.) The chemical dialogue between plants and beneficial microorganisms. Academic Press, London, Uk, pp. 365. JIANG Y.X., WU J.G., YU K.Q., AI C.X., ZOU F., ZHOU H.W., 2011 ­ Integrated lysis procedures reduce extraction biases of microbial DNA from mangrove sediment. ­ J. Biosci. Bioeng., 111(2): 153­157. JIANRONG W., SUFEN H., YOUYONG Z., MEI L., GUANGPING W., WENLIN G., 2005 ­ Ultra‐structure of symbiosis mycorrhizal between Cymbidium goeringii and Rhizoctonia sp. ­ J. Nanjing For. Univ., 29(4): 105­ 108. JOHNSON L.J., GÓNZALEZ­CHÁVEZ M.D.C.A., CARRILLO­ GONZÁLEZ R., PORRAS­ALFARO A., MUELLER G.M., 2021 ­ Vanilla aerial and terrestrial roots host rich communities of orchid mycorrhizal and ectomycorrhizal fungi. ­ Plants, People, Planet, 3(5): 541­552. JULOU T., BURGHARDT B., GEBAUER G., BERVEILLER B., DAMESIN C., SELOSSE M. A., 2005 ­ Mixotrophy in orchids: insights from a comparative study of green individuals and nonphotosynthetic individuals of Cephalanthera Damasonium. ­ New Phytol., 166(2): 639­653. KHAMCHATRA N., DIXON K.W., TANTIWIWAT S., PIAPUKIEW J., 2016 ­ Symbiotic Seed germination of an endangered epiphytic slipper orchid, Paphiopedilum villosum (Lindl.) Stein. from Thailand. ­ S. Afr. J. Bot., 104: 76­81. KIM Y.I., CHANG K.J., KA K.H., HUR H., HONG I.P., SHIM J.O., LEE T.S., LEE J.Y., LEE M.W., 2006 ‐ Seed germination of Gastrodia elata using symbiotic fungi, Mycena osmundicola. ­ Mycobiology, 34(2): 79. KO T.W.K., STEPHENSON S.L., BAHKALI A.H., HYDE K.D., 2011 ­ From morphology to molecular biology: can we use sequence data to identify fungal endophytes? ­ Fungal Divers., 50 113­120. KUMAR M., MUGUNTHAN M., 2018 ­ Evaluation of three DNA extraction methods from fungal cultures. ­ MJAFI., 74(4): 333­336. LEE Y.I., YEUNG E.C., 2018 ­ Orchid propagation: From laboratories to greenhouses ‐ Methods and protocols. ­ Springer, New York, pp. 535. LI T., WU S., YANG W., SELOSSE M.A., GAO J., 2021 ­ How mycorrhizal associations influence orchid distribution and population dynamics. ­ Front. Plant Sci., 12: 647114. LIU H., LU Y., LIU H., 2010 ­ Studies of mycorrhizal fungi of chinese orchids and their role in orchid conservation in china ‐ a review. ­ Bot. Rev., 76: 241­262. LONG Y., NONG Q., XIE L., ZHANG W., CHEN Y., ZHANG Y., 2022 ­ Tiankengomelania Guangxiense, gen. et sp. nov., a dark septate endophytic fungus, promotes the growth of the medicinal orchid Dendrobium Officinale. ­ Fungal Biol., 126(5): 333­341. MA X., KANG J., NONTACHAIYAPOOM S., WEN T., HYDE K.D., 2015 ­ Non‐mycorrhizal endophytic fungi from orchids. ­ Curr. Sci., 109(1): 72­87. MANGUNWARDOYO W., SUCIATMIH S., GANDJAR I., 2011 ­ Frequency of endophytic fungi isolated from Dendrobium crumenatum Sw. (Pigeon Orchid) and antimicrobial activity. ­ Biodiversitas J. Biol. Div., 13(1): 34­39. MARTOS F., MUNOZ F., PAILLER T., KOTTK I., GONNEAU C., SELOSSE M. A., 2012 ­ The role of epiphytism in architecture and evolutionary constraint within mycorrhizal networks of tropical orchids. ­ Mol. Ecol., 21(20): 5098­5109. McCORMICK M., BURNETT R., WHIGHAM D., 2021 ­ Protocorm‐supporting fungi are retained in roots of mature Tipularia discolor orchids as mycorrhizal fungal diversity increases. ­ Plants, 10(6): 1251. McCORMICK M.K., WHIGHAM D.F., NEILL J.P.O., BECKER J.J., WERNER S., RASMUSSEN H.N., BRUNS T.D., TAYLOR T.D., 2019 ­ Abundance and distribution of Corallorhiza odontorhiza reflect variations in climate and ectomycorrhizae. ­ Ecol. Monogr., 79(4): 619­635. MING L., ZHOU Z., 2001 ­ Studies and applications on mycorrhiza of Paphiopedilum armeniacum. ­ J. Biol., 18(6): 17­18. MING X.T., WANG C.L., CHEN X.M., ZHOU Y.Q., WANG Y.Q., LOU A.X., LIU Z.H., GUO S.X., 2014 ­ In vitro seed germination and seedling growth of an endangered 113 Adv. Hort. Sci., 2024 38(1): 97­116 epiphytic orchid, Dendrobium officinale, endemic to china using mycorrhizal fungi (Tulasnella Sp.). ­ Sci. Hortic., 165(2104): 62­68. NILSSON R.H., ANSLAN S., BAHRAM M., WURZBACHER C., BALDRIAN P., TEDERSOO L., 2019 ­ Mycobiome diversity: high‐throughput sequencing and identification of fungi. ­ Nat. Rev. Microbiol., 17(2): 95­ 109. NONTACHAIYAPOOM S., SASIRAT S., MANOCH L., 2011 ­ Symbiotic seed germination of Grammatophyllum speciosum Blume and Dendrobium draconis Rchb. f., native orchids of Thailand. ­ Sci. Hortic., 130(1): 303­ 308. NOVOTNÁ A., BENÍTEZ A., HERRERA P., CRUZ D., FILIPCZYKOVÁ E., SUÁREZ J.P., 2018 ­ High diversity of root‐associated fungi isolated from three epiphytic orchids in Southern Ecuador. ­ Mycocience, 59(1): 24­ 32. OJA J., KOHOUT P., TEDERSOO L., KULL T., KÕLJALG U., 2014 ­ Temporal patterns of orchid mycorrhizal fungi in meadows and forests as revealed by 454 Pyrosequencing. ­ New Phytol., 205(4): 1608­1618. OMEGA BIOT­TEK. E.Z.N.A.®, 2019 ­ Fungal DNA Mini Kit. ­ https://www.omegabiotek.com/product/e­z­n­a­ fungal­dna­mini­kit/ OTERO J.T., ACKERMAN J.D., BAYMAN P., 2002 ­ Diversity and host specificity of endophytic Rhizoctonia‐like fungi from tropical orchid. ­ Am. J. Bot., 89(11): 1852­1858. PEAY K.G., 2014 ­ Back to the future: Natural history and the way forward in modern fungal ecology. ­ Fungal Ecol., 12(C): 4­9. PUJASATRIA G.C., MIURA C., KAMINAKA H., 2020 ­ In vitro symbiotic germination: a revitalised heuristic approach for orchid species conservation. ­ Plants, 9(12): 1742. RAJA H.A., MILLER A.N., PEARCE C.J., OBERLIES N.H., 2017 ­ Fungal identification using molecular tools: a primer for the natural products research community. ­ J. Nat. Prod., 80(3): 756­770. RAMMITSU K., KAJITA T., IMAI R., OGURA­TSUJITA Y., 2021 ­ Strong primer bias for Tulasnellaceae fungi in metabarcoding: specific primers improve the characterization of the mycorrhizal communities of epiphytic orchids. ­ Mycoscience, 62(6): 356­363. RASMUSSEN H.N., 1995 ­ Terrestrial orchids ‐ From seeds to mycothophic plants. ­ Cambridge University Press, Cambridge, New York, pp. 460. RASMUSSEN H.N., WHIGHAM D.F., 1993 ­ Seed ecology of dust seeds in situ: a new study technique and its application in terrestrial orchids. ­ Am. J. Bot., 80(12): 1374­378. REINEKE A., KARLOVSKY P., ZEBITZ C.P.W., 1998 ­ Preparation and purification of DNA from insects for aflp analysis. ­ Insect Mol. Biol., 7(1): 95­99. SAMBROOK J., MACCALLUM P., RUSSELL D., 2001 ­ Molecular cloning: A laboratory manual. 3rd edition. ­ Cold Spring Harbor Press, Cold Spring Harbor, NY, USA, 114 pp. 2344. SARSAIYA S., SHI J., CHEN J., 2019 ­ A comprehensive review on fungal endophytes and its dynamics on orchidaceae plants: current research, challenges, and future possibilities. ­ Bioengineered., 10(1): 316­334. SCHIEBELHUT L.M., ABBOUD S.S., GÓMEZ DAGLIO L.E., SWIFT H.F., DAWSON M.N., 2017 ­ A comparison of DNA extraction methods for high‐throughput DNA analyses. ­ Mol. Ecol. Resour., 17(4): 721­729. SEBASTIÁN F., VANESA S., EDUARDO F., GRACIELA T., SILVANA S., 2014 ­ Symbiotic seed germination and protocorm development of Aa Achalensis Schltr., a terrestrial orchid endemic from Argentina.­ Mycorrhiza, 24(1): 35­43. SEIFERT K.A., 2009 ­ Progress towards DNA Barcoding of fungi. ­ Mol. Ecol. Resour., 9: 83­89. SELOSSE M.A., SCHNEIDER­MAUNOURY L., MARTOS F., 2018 ­ Time to re‐think fungal ecology? Fungal ecological niches are often prejudged. ­ New Phytol., 217(3): 968­972. SEN R., HIETALA A.M., ZELMER C.D., 1999 ­ Common anastomosis and internal transcribed spacer rflp groupings in binucleate rhizoctonia isolates representing root endophytes of Pinus sylvestris, Ceratorhiza spp. from orchid mycorrhizas and a phytopathogenic anastomosis group. ­ New Phytol., 144(2): 331­ 341. SHAH S., SHAH B., SHARMA R., REKADWAD B., SHOUCHE Y. S., SHARMA J., PANT B., 2022 ­ Colonization with non‐ mycorrhizal culturable endophytic fungi enhances orchid growth and indole acetic acid production. ­ BMC Microbiol., 22(1): 1­13. SHAH S., THAPA B.B., CHAND K., PRADHAN S., SINGH A., VARMA A., THAKURI L. S., JOSHI P., PANT B., 2019 ­ Piriformospora indica promotes the growth of the in­ vitro‐raised Cymbidium aloifolium plantlet and their acclimatization. ­ Plant Signal. Behav., 14(6): 1­7. SHAN X.C., LIEW E.C.Y., WEATHERHEAD M.A., HODGKISS I.J., 2002 ­ Characterization and taxonomic placement of rhizoctonia‐like endophytes from orchid roots. ­ Mycologia, 94(2): 230­239. SHAO S.C., BURGESS K.S., CRUSE­SANDERS J.M., LIU Q., FAN X.L., HUANG H., GAO J.Y., 2017 ­ Using in situ symbiotic seed germination to restore over‐collected medicinal orchids in Southwest China. ­ Front. Plant Sci., 8: 1­10. SHAO S.C., WANG Q.X., BENG K.C., ZHAO D.K., JACQUEMYN H., 2020 ­ Fungi isolated from host protocorms accelerate symbiotic seed germination in an endangered orchid species (Dendrobium chrysotoxum) from Southern China. ­ Mycorrhiza, 30(4): 529­539. SHEMESH H., BOAZ B.E., MILLAR C.I., BRUNS T.D., 2020 ­ Symbiotic interactions above treeline of long‐lived pines: mycorrhizal advantage of limber pine (Pinus Flexilis) over Great Basin Bristlecone Pine (Pinus Shamsudin et al. ‐ Molecular identification of orchid mycorrhiza Longaeva) at the seedling stage. ­ J. Ecol., 108(3): 908­ 916. SISTI L.S., FLORES­BORGES D.N.A., DE ANDRADE S.A.L., KOEHLER S., BONATELLI M.L., SAMPAIO MAYER J.L., 2019 ­ The role of non‐mycorrhizal fungi in germination of the mycoheterotrophic orchid Pogoniopsis schenckii Cogn. ­ Front. Plant Sci., 10: 1­13. SLATKO B.E., GARDNER A.F., AUSUBEL F.M., 2018 ­ Overview of next‐generation sequencing technologies.‐ Curr. Protoc. Mol. Biol., 122(1): 1­11. SRIVASTAVA S., KADOOKA C., UCHIDA J.Y., 2018 ­ Fusarium species as pathogen on orchids. ­ Microbiol. Res., 207: 188­195. STRUGNELL J., NORMAN M., COOPER A., 2006 ­ DNA from beach‐washed shells of the Ram’s Horn squid, Spirula Spirula. ­ Bull. Mar. Sci., 78(2): 389­391. SUÁREZ J.P., WEIß M., ABELE A., GARNICA S., OBERWINKLER F., KOTTKE I., 2006 ­ Diverse tulasnelloid fungi form mycorrhizas with epiphytic orchids in an Andean Cloud Forest. ­ Mycol. Res., 110(11): 1257­ 1270. SUETSUGU K., HARAGUCHI T.F., TANABE A.S., TAYASUN I., 2021 ­ Specialized mycorrhizal association between a partially mycoheterotrophic orchid Oreorchis Indica and a Tomentella Taxon. ­ Mycorrhiza, 31(2): 243­250. SUKARNO N., MURSIDAWATI S., LISTIYOWATI S., NUGRAHA N.H., FADILLAH W.N., WAITE M., 2023 ­ Root associated Fusarium solani species complex (FSSC) in epiphytic and terrestrial orchids. ­ Biodiversitas J. Biol. Div., 24(5): 2577­2586. SURESH L., RAVEENDRAN R., DECRUSE W., 2023 ­ Specific primers improve the characterizations. ­ Plant Sci. Today, 10(3): 375­384. TAYLOR D.L., BRUNS T.D., 1999 ­ Community structure of ectomycorrhizal fungi in a Pinus muricata forest: Minimal overlap between the mature forest and resistant propagule communities. ­ Mol. Ecol., 8(11): 1837­1850. TAYLOR D.L., McCORMICK M.K., 2008 ­ Internal transcribed spacer primers and sequences for improved characterization of basidiomycetous orchid mycorrhizas. ­ New Phytol., 177(4): 1020­1033. TEDERSOO L., ANSLAN S., BAHRAM M., PÕLME S., RIIT T., LIIV I., KÕLJALG U., KISAND V., NILSSON R.H., HILDEBRAND F., BORK P., ABARENKOV K., 2015 ­ Shotgun metagenomes and multiple primer pair‐ barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi. ­ MycoKeys, 10: 1­43. TEDERSOO L., BAHRAM M., PÕLME S., KÕLJALG U., YOROU N.S., WIJESUNDERA R., RUIZ L.V., VASCO­PALACIOS A. M., THU P.Q., SUIJA A., SMITH M.E., SHARP C., SALUVEER E., SAITTA A., ROSAS M., RIIT T., RATKOWSKY D., PRITSCH K., PÕLDMAA K., PIEPENBRING M., PHOSRI C., PETERSON M., PARTS K., PÄRTEL K., OTSING E., NOUHRA E., NJOUONKOU A.L., NILSSON R.H., MORGADO L.N., MAYOR J., MAY T.W., MAJUKIM L., LODGE D.L., LEE S.S., LARSSON K.H., KOHOUT P., HOSAKA K., HIIESALU I., HENKEL T.W., HAREND H., GUO L.D., GRESLEBIN A., GRETLET G., GEML J., GATES G., DUNSTAN W., DUNK C., DRENKHAN R., DEARNALEY J., DE KESEL A., DANG T., CHEN X., BUEGGER F., BREARLEY F.Q., BONITO G., ANSLAN S., ABELL S., ABARENKOV K., 2014 ­ Global diversity and geography of soil fungi. ­ Science, 346(6213): 1256688. TEDERSOO L., BAHRAM M., PUUSEPP M., NILSSON R.H., JAMES J.Y., 2017 ­ Novel soil‐inhabiting clades fill gaps in the fungal tree of life.­ Microbiome, 5(1): 1­10. TEDERSOO L., NILSSON R.H., 2016 ­ Molecular identification of fungi, pp. 301­322. ­ In MARTIN F. (ed.) Molecular mycorrhizal symbiosis. John Wiley & Sons, Inc., New York, pp. 506. TIAN F., LIAO X.F., WANG L.H., BAI X.X., YANG Y.B., LUO Z.Q., YAN F.X., 2022 ­ Isolation and identification of beneficial orchid mycorrhizal fungi in Paphiopedilum barbigerum (Orchidaceae). ­ Plant Signal. Behav., 17(1): 2005882. TRIPATHY S.K., MAHARANA M., ITHAPE D.M., LENKA D., MISHRA D., PRUSTI A., SWAIN D., MOHANTY M.R., RESHMI RAJ K.R., 2017 ­ Exploring rapid and efficient protocol for isolation of fungal DNA. ­ IJCMAS, 6(3): 951­960. TRIVEDI P., LEACH J.E., TRINGE S.E., SA T., SINGH B.K., 2020 ­ Plant‐microbiome interactions: from community assembly to plant health. ­ Nat. Rev. Microbiol., 18(11): 607­621. TURENNE C.Y., SANCHE S.E., HOBAN D.J., KARLOWSKY J.A., KABANI A.M., 1999 ­ Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. ­ J. Clin. Microbiol., 37(6): 1846­1851. TURZHANOVA A.S., RUKAVITSYNA I.V., KHAPILNA O.N., KALENDAR R.N., 2018 ­ Optimization of DNA extraction from filamentous fungi Alternaria sp. and Fusarium sp. ­ Eurasian J. Appl. Biotechnol., 3: 1­9. VARMA A., KWON CHUNG K.J., 1991 ­ Rapid method to extract DNA from Cryptococcus Neoformans. ­ J. Clin. Microbiol., 29(4): 810­812. VĚTROVSKÝ T., KOLAŘÍK M., ŽIFČÁKOVÁ L., ZELENKA T., BALDRIAN P., 2016 ­ The Rpb2 gene represents a viable alternative molecular marker for the analysis of environmental fungal communities. ­ Mol. Ecol. Resour., 16(2): 388­401. WANG D., JACQUEMYN D., GOMES S.F.I., VOS R.A., VINCENT S.F.T., 2021 ­ Symbiont switching and trophic mode shifts in Orchidaceae. ­ New Phytol., 231(2): 791­ 800. WANG Z., JIANG Y., DEANE D.C., HE F., SHU W., LIU Y., 2019 ­ Effects of Host phylogeny, habitat and spatial proximity on host specificity and diversity of pathogenic and mycorrhizal fungi in a subtropical forest. ­ New Phytol., 223(1): 462­474. WARCUP J.H., 1981 ­ The mycorrhizal relationship of 115 Adv. Hort. Sci., 2024 38(1): 97­116 Austaralian orchids. ­ New Phytol., 87(2): 371­381. WARCUP J.H., TALBOT P.H.B., 1967 ­ Perfect states of rhizoctonias associated with orchids. ­ New Phytol., 66(4): 631­641. WATERMAN R.J., BIDARTONDO M.I., STOFBERG J., COMBS J.K., GEBAUER G., SAVOLAINEN V., BARRACLOUGH T.G., PAUW A., 2011 ­ The effects of above‐ and belowground mutualisms on orchid speciation and coexistence. ­ Am. Nat., 177(2): E54­E68. WAUD M., BUSSCHAERT P., RUYTERS S., JACQUEMYN H., LIEVENS B., 2014 ­ Impact of primer choice on characterization of orchid mycorrhizal communities using 454 pyrosequencing. ­ Mol. Ecol. Resour., 14(4): 679­699. WHITE T.J., BRUNS T.D., LEE S.B., TAYLOR R.J., 1990 ­ Amplification and direct sequencing of fungal ribosomal Rna Genes for Phylogenetics. ­ In: INNIS M.A., D.H. GELFAND, J.J. SNINSKY, and T.J. WHITE (eds.) PCR Protocols: a guide to methods and applications. Academic Press, Inc. San Diego, CA, USA, pp. 482.. XING X., JACQUEMYN H., GAI X., GAO Y., LIU Q., ZHAO Z., 2019 ­ The impact of life form on the architecture of orchid mycorrhizal networks in tropical forest. ­ Oikos, 128(9): 1254­1264. YAGAME Y., YAMATO M., SUZUKI A., IWASE K., 2008 ­ Ceratobasidiaceae mycorrhizal fungi isolated from nonphotosynthetic orchid Chamaegastrodia Sikokiana. ­ Mycorrhiza, 18(2): 97­101. YAM T.W., ARDITTI J., 2009 ­ History of orchid propagation: a mirror of the history of biotechnology. ­ Plant Biotechnol. Rep., 3(1): 1­56. ZETTLER L.W., COREY L.L., 2018 ­ Orchid mycorrhizal fungi: Isolation and identification techniques, pp. 27­59. ­ In: LEE Y., and E.C.I. TAK (eds.) Orchid propagation: From laboratories to greenhouses ‐ Methods and Protocols. 116 Springer, New York, pp. 535. ZETTLER L.W., McINNIS T.M., 1994 ­ Light enhancement of symbiotic seed germination and development of an endangered terrestrial orchid (Platanthera integrilabia). ­ Plant Sci., 102(2): 133­138. ZHANG G.Q., XU Q., BIAN C., TSAI W.C., YEH C.M., LIU K.W., YOSHIDA K., ZHANG L.S., CHANG S.B., CHEN F., SHI Y., SU Y.Y., ZHANG Y.Q., CHEN L.J., YIN Y., LIN M., HUANG H., DENG H., WANG Z.W., ZHU S.L., ZHAO X., DENG C., NIU S.C., HUANG J., WANG M., LIU G.H., YANG H.Y., XIAO X.J., HSIAO Y.Y., WU W.L., CHEN Y.Y., MITSUDA N., OHME TAKAGI M., LUO Y.B., VAN DE PEER Y., LIU Y.Z., 2016 ­ The Dendrobium catenatum Lindl. genome sequence provides insights into polysaccharide synthase, floral development and adaptive evolution. ­ Sci. Rep., 6(1): 10929. ZHANG Y.J., ZHANG S., LIU X.Z., WEN H.A., WANG M., 2010. ­ A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains. ­ Lett. Appl. Microbiol., 51(1): 114­118. ZHAO J.N. LIU H.X., 2008 ­ Effects of fungal elicitors on the protocorm of Cymbidium eburneum. ­ Eco. Sci., 27(2): 134­137. ZHAO D.K., SELOSSE M.A., WU L., LUO Y., SHAO S.C., RUAN Y.L., 2021 ­ Orchid reintroduction based on seed germination‐promoting mycorrhizal fungi derived from protocorms or seedlings. ­ Front. Plant Sci., 12: 1­11. ZHOU X., GAO J.Y., 2016 ­ Highly compatible epa‐01 strain promotes seed germination and protocorm development of Papilionanthe Teres (Orchidaceae). ­ Plant Cell, Tissue Organ Cult., 125(3): 479­493. ZI X.M., SHENG C.L., GOODALE U.M., SHAO S.C., GAO J.Y., 2014 ­ In situ seed baiting to isolate germination‐ enhancing fungi for an epiphytic orchid, Dendrobium aphyllum (Orchidaceae). ­ Mycorrhiza, 24(7): 487­499.