Molecular Genetic Markers

Animal Genetics, 1998, 29, 150±160 MOLECULAR GENETIC MARKERS A MseI RFLP at the goat as2-casein gene Chromosomal location: Chromosome 4.3 G Cosenza1, A Rando2, E Longobardi1, P Masina2, L Ramunno1 Comments: MseI digestion of the B allele yields an additional 100-bp fragment which cannot be detected easily (see Fig. 1). Dipartimento di Scienze Zootecniche, UniversitaÁ degli Studi di Napoli `Federico II', Portici, Italy; 2Dipartimento di Scienze delle Produzioni Animali, UniversitaÁ della Basilicata, Potenza, Italy Acknowledgements: We thank Dr E. Paparo, who participated in providing the blood samples. This research was supported by R.A.I.Z. Project of the Ministero delle Risorse Agricole, Alimentari e Forestali, Italy. 1 Accepted 7 April 1997 Source/description: A polymorphic MseI restriction site has been observed in a 1.3-kb DNA fragment of the goat as2-casein gene. PCR primers, TL30 and TQ9, were designed from regions of goat as2-Cn cDNA sequence (GenBank accession number X65160)1 corresponding to exons 5 and 7 of bovine as2-Cn gene (GenBank accession number M943227).2 Two alleles have been found: the A allele (showing a fragment of about 300 bp); and the B allele (showing a fragment of about 400 bp) (Fig. 1). Primers: Forward: 59 GCCATTCATCCCAGAAAG 39 (TL30) (nucleotides 169±186) Reverse: 59 CTCTTCATTTGCGTTCCTTA 39 (TQ9) (complementary to nucleotides 221±240) References 1 Bouniol C. (1993) Gene 125, 235±6. 2 Groenen M.A.M. et al. (1993) Gene 123, 187±93. 3 Hayes H. et al. (1993) Cytogenet Cell Genet 64, 281±5. Correspondence: L Ramunno Chromosomal assignment by linkage of 19 unassigned bovine microsatellites using ovine reference populations B A Freking1, R T Stone1, M J de Gortari1*, A M Crawford2 1 Numbering is according to the sequence of goat as2-Cn cDNA (GenBank accession number X65160).1 PCR and restriction digest conditions: The 50-ml reaction mix comprised: 100 ng of genomic DNA, 10 pmol of each primer, 1.25 U of Taq DNA polymerase (Promega), 50 mm KCl, 10 mm Tris-HCl (pH 9.0), 0.1% Triton X-100, 3 mm MgCl2, dNTPs each at 400 mm and 0.04% BSA. The amplification programme consisted of 31 cycles: the first cycle involved a denaturation step at 97 °C for 2 min, an annealing step to 54 °C for 45 s and an extension step at 72 °C for 2 min 30 s. The next 29 cycles were performed under the following conditions: 94 °C for 45 s, 54 °C for 45 s, 72 °C for 2 min 30 s with a progressive increase of 4 s for each cycle in the extension step. In the 31 cycles, the conditions remained the same for denaturation and annealing steps, whereas the extension step occurred at 72 °C for 10 min. Digestion of 12 ml of each PCR amplification was accomplished with 10 U of MseI endonuclease for 5 h at 37 °C following the supplier's directions for buffer condition (Promega). DNA was analysed directly by electrophoresis in 3% agarose gel stained with ethidium bromide and visualized by ultraviolet fluorescence. Allelic frequency: Frequency of the B allele, determined in a goat population of undefined genetic type (75 samples) reared in Southern Italy, was 0.32. Mendelian inheritance: Codominant segregation was observed in 20 families. USDA, ARS, U.S. Meat Animal Research Center, PO Box 166, Clay Center, NE 68933-0166, USA; 2AgResearch Molecular Biology Unit, Otago University, Biochemistry Department, Dunedin, New Zealand; *Present address: Purdue University, Animal Disease Diagnostic Lab, West Lafayette, IN 47907, USA Accepted 18 August 1997 Source: Small-insert bovine genomic libraries in either phagemid or M13 phage were screened with (CA)11 or (GT)11 oligonucleotide probes.1 Clones containing SINE elements were discarded. PCR primers: Primer sequences and annealing temperatures are presented in Table 1. PCR conditions: PCR reactions contained 100 nm DNA, 1.5 mm MgCl2, 50 mm KCl, 10 mm Tris-HCl (pH 8.3), 30 mm dCTP, dGTP and dTTP, 3 mm dATP, 0.1 mCi [a32P]dATP (3000 Ci/mmol), 0.4 mm for each of two primers, and 0.35 U Taq polymerase. The PCR protocol was: initial denaturation, 94 °C for 3 min followed by 30 cycles of 1 min at 94 °C, 30 s at the annealing temperature and 1 min at 72 °C. The last extension at 72 °C was for 4 min. Alleles: PCR products were separated by electrophoresis on 7% denaturing polyacrylamide gels and allele sizes were estimated relative to standard lanes of M13mp18 ssDNA sequencing reactions. Alleles were observed segregating in the IMF or U.S. Meat Animal Research Center sheep mapping families.2,3 Primer pairs which amplified multiple loci or contained null alleles are indicated in Table 1. An arbitrary score indicative of ease of genotyping, sizes predicted from the bovine clone sequence, and the number and size of alleles observed in sheep are also presented in Table 1. Chromosomal location: Ovine chromosome assignments for these 19 bovine microsatellite primers are listed in Table 1. Two-point linkages of LOD > 3.0 were required for inclusion into the linkage group. Comments: These bovine microsatellites have not yet been assigned in the bovine mapping families because of either lack of heterozygosity or difficulty with interpretation of genotypes. Assignments for these homologous loci in cattle would be tentative as a result of possible amplification of closely related flanking sequences, particularly when ovine product sizes differ substantially from the predicted product size from the bovine clone. References 1 Stone R.T. et al. (1995) Mamm Genome 6, 714±24. 2 Crawford A.M. et al. (1995) Genetics 140, 703±24. 3 de Gortari M.J. et al. (1998) Mamm Genome 9, 204±9. Fig. 1. Genotypes observed after MseI digestion of the fragment (about 1.3 kb) obtained by means of PCR of goat genomic DNA; M: marker. ã 1998 International Society for Animal Genetics Correspondence: B A Freking 150 MOLECULAR GENETIC MARKERS 151 Table 1. Characterization of 19 bovine microsatellites Locus Primers (59®39) BM1831 AGTTGCCTGCATTGACAGG AGAGCCTGTTAGGCTACAGCC CCCGCATTCCACACTTTC ATTCATCCAGGCTGGGAAG AGTCTCATGGATTTGCGTCC ATTCAGCCAGGATGGAAGG GGCATTCCCTAGTTTCCCTT ATAGTCCACTGGGTTGCAGG TACTCCACTCCTGAAAGAAGGC CATCAAAGCATTTGGCATTG TCCAACAACATCTTCTATCTGCC AAACATCCATTGGTGAGGGA CAGTGAAGAATTGATGCAAAGC GGAAATGGATTGGTTTCTTTG CTGAACTGAAGGGAAGAGAACC ATCCTGGTGGGTGCAGTC TCTAGATAATGGATATGTGCGTGT AAAATAGGCTGTCAGTCACAAGA CTGTTTTCCCACCAGCAAG TCCCCTCTGTCCTGTATATTGA TGTTAGTGTGTTTGAATTTGTGTG CCACTAGGAAAGTGACTAGGTTCA CAAAGAAAAGGGAGTGCATTG AGGAAGAAGGAACTAGATGCCC ACCCACATGTTTGGGAGG AGGGAAAGGCCAAAGCAC GCCTGTGAAGTTATCTAATTGGG GTCCTTTGGGGAGTTAGGC AAGTCACTGTGTGATCTGTTTGTG ATGTCAAACCCAGTTAAAATAGCA GCCTCAGGAAAGACAACCTG CCACAAAGGGACACAAAACC TGCTTACGAGTCAGCTGGTG TTTATTTTGTGCTCAGCCCC TCACAGTCTATCAACCACTCCG CTTTGACAGGATGGGGTGTC CGACCACATCAGGGATGG GCTTGCCTGGTAAACAGCTC BM2023 BM3212b BM6302 BM6433 BM7136 BM7165 BM7213 BM7243 BM8217 BM9058 BMS109 BMS1561 BMS340 BMS514c BMS629b BMS657 BMS796 BP17c Number of alleles Ovine range (bp) Predicted bovine size (bp) Annealing temperature (°C) Scorea Ovine chromosome 5 (316±332) 298 56 3 3 10 (98±144) 106 58 4 4 7 (182±194) 147 56 4 4 5 (217±227) 222 56 3 8 3 (91±94) 102 56 2 3 12 (96±124) 107 54 3 17 5 (219±235) 227 56 2 2 2 (122±124) 144 54 3 15 12 (138±162) 133 56 1 18 2 (240±246) 144 50 3 17 10 (127±147) 124 54 2 6 5 (114±132) 122 56 2 12 4 (123±147) 123 60 2 18 12 (225±269) 133 50 3 19 4 (122±130) 151 52 3 24 9 (149±165) 149 58 4 26 2 (121±135) 124 64 2 16 2 (480±486) 107 50 3 2 19 (282±470) 134 60 2 2 a Subject score for ease of genotyping: (1) relatively easy to score; (5) the most difficult. Amplifies more than one locus. Null alleles were observed in one or more reference families. b c Two polymorphic microsatellite markers in the European seabass, Dicentrarchus labrax (L.) R Castilho1,2, B McAndrew1 1 Institute of Aquaculture, University of Stirling, Stirling FK9 4LA, UK; 2UCTRA, Universidade do Algarve, Campus de Gambelas, 8000 FARO, Portugal Accepted 9 September 1997 Source/description: A size-selected genomic library (300±600 bp) was created by partially digesting DNA isolated from seabass muscle with Sau3AI. The DNA was ligated to PUC 18 plasmid (BamHI/BAP, Pharmacia) and transformed into competent E. coli cells (strain DH5; BRL Gibco). Replica nylon filters (Hybond-N-Amersham) were prehybridized (5´ SSPE, 5´ Denhardt's, 0.5% SDS, 100 mg ml±1 RNA) for 1 h at 65 °C prior to overnight hybridization at 65 °C to (GT)15 synthetic oligonucleotides radio-labelled with [g32P]ATP using T4 polynucleotide kinase. Filters were washed twice with 2´ SSC, 0.2% SDS at room temperature and with 0.2´ SSC, 0.2% SDS at 65 °C, and were exposed to X-ray film (Kodak XAR-5) with two intensifying screens at ±80 °C for 6 h. Positive clones were picked off the plates and grown in LB-ampicillin for 48 h. The plasmid DNA was extracted with phenol-chloroform and minipreparations and followed the classic alkaline lysis. Sequencing was performed with the T7 sequencing Kit (Pharmacia), according to the manufactures instructions, using 35S label. Eight per cent acrylamide gels were run for 3.5 h at 60 mA. The gel was fixed for an hour and then was dried in a Biorad gel dryer for 2 h before being exposed overnight to Kodak X-omat R film. The sequences of Dla 6 and Dla 11 have been submitted to the GenBank/EMBL database and have accession numbers Y13158 and Y13159, respectively. Primer sequences: Primer sequences were designed with the program OSP1: Dla 6: F-59-AATACGGTGGTGAATCAGTG R-59-GCTGTTGTCTTGCTGCATAG Dla 11: F-59-CACCTCTAATGCTTCCATGC R-59-CGAATGCGCTACAAATCTGC PCR conditions: A 10-ml PCR reaction contained 0.6 mm of nonlabelled forward and reverse primers, 0.06 mm [g32P]ATP-labelled forward primer, 200 mm of each dNTP, 1´ PCR buffer containing 50 mm KCl, 10 mm Tris-HCl pH 8.3 (supplied by AB Technologies), 1.5 mm MgCl2, 0.05 U of Taq Red hot DNA polymerase (AB Technologies) and 10±20 ng genomic DNA. A Hybaid thermocycler was programmed to run 94 °C for 3 min; 30 cycles at 94 °C for 2 min; 58 °C for 45 s and 72 °C for 45 s. PCR products were separated on 6% denaturing polyacrylamide gels together with an M13 control sequence in order to size the alleles. Gels were exposed to X-ray films (Kodak) for product detection. Mendelian inheritance: Mendelian inheritance could not be established as no breeding populations were available at either Institution. ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 152 MOLECULAR GENETIC MARKERS Table 1. Number of individuals (n), number of alleles (na), and observed and expected heterozygosity for two microsatellite loci in seabass from Portugal Locus Repeat structure Dla 6 (AC)26 55±115 (GT)16 99±141 Dla 11 Number of individuals, number of alleles, and observed and expected heterozygosity2 Â bidos Foz Aveiro O Milfontes Faro Total n = 91, na = 15 0.36/0.68 n = 80, na = 15 0.90/0.86 n = 17, na = 8 0.53/0.77 ± ± na = 28 0.45/0.73 na = 20 0.84/0.85 n = 59, na = 18 0.54/0.75 n = 69, na = 14 0.80/0.86 Polymorphism: The number of alleles per locus, and the observed and expected heterozygosity were established (Table 1). Chromosomal location: Unknown for both markers. Acknowledgements: This research was funded by UCTRA and also by a JNICT grant to R. Castilho. We thank Doug Cook at the Marine Gene Probe Laboratory, Dalhousie University, for technical advice. References 1 Hillier L., Green P. (1991) PCR Methods Applications 1, 124±8. 2 Nei M. (1978) Genetics 89, 583±90. Correspondence: R Castilho Sex-linked inheritance of the ornithine transcarbamylase (OTC) reference anchor locus in pigs n = 78, na = 17 0.40/0.74 n = 56, na = 11 0.88/0.85 n = 111, na = 19 0.42/0.71 n = 32, na = 8 0.78/0.82 Mapping the chicken SCD1 locus: assignment of a linkage group to chromosome 6 F Pitel1, A Pouzadoux1, P Langlois2, V Fillon1, C Heimel1, M Douaire2, J Gellin1, A Vignal1 1 Laboratoire de GeÂneÂtique Cellulaire, INRA-CRT, Castanet-Tolosan 31326, France; 2Laboratoire de GeÂneÂtique, INRA-ENSAR, Rennes 35000, France Accepted 18 September 1997 Source/description: The chicken SCD1 gene has been cloned and partially sequenced (Langlois, unpublished). Two PCR primers were designed from exon 5 and exon 6 sequences, respectively, to amplify an intronic fragment of this gene. The expected length of the fragment was 1276 bp. Primer sequences: SCDU: 59±TCA GAA CAT CAA CCC ACG G±39 V H Nielsen, B Thomsen SCDL: 59±AGC GCC AGC CAA ACT CAC±39 Department of Breeding and Genetics, Danish Institute of Agricultural Sciences, Research Centre Foulum, PO Box 50, DK8830 Tjele, Denmark PCR conditions: PCR amplifications were performed in 25 ml on a Techne PHC-3 thermocycler. The reaction mixes comprised 20 ng genomic DNA, 200 mm each dNTP, 1 mm each primer, 1.5 mm MgCl2, 20 mm Tris-HCl (pH 8.4), 50 mm KCl and 1 U Taq polymerase (Gibco BRL). The profile for thermal cycling was: denaturation 94°C, 1 min; annealing 58°C, 1 min; and elongation 72°C, 1.5 min. The amplified fragment was digested with 5 U RsaI, denatured by heating at 95°C and loaded on a non-denaturing Acrylamide/Bisacrylamide (49/1) gel containing 5% glycerol, to visualize a Single Strand Conformation Polymorphism1 through silver staining.2 Accepted 15 September 1997 Probe description: A 1.2-kbp fragment of the human ornithine transcarbamylase (OTC) cDNA was isolated from the plasmid pOTC after digestion with PstI. Hybridization conditions: 7% SDS; 0.26 m Na2HPO4; 5% dextran sulphate; 1% BSA; 40 mg ml±1 denatured herring sperm DNA; temperature 60 °C. First wash: 2´ SSC, 0.2% SDS at 20 °C. Second wash: 0.7´ SSC, 0.5% SDS at 60 °C. Polymorphism and Mendelian inheritance: Two alleles were observed in a 1077-bp fragment. Segregation analyses were performed in the East Lansing3 chicken reference back-cross mapping population using the Mapmanager software.4 Polymorphism: Digestion of genomic DNA from grandparents in the three-generation PiGMaP reference pedigrees (10 Large White, seven Meishan, three PieÂtrain and two Wild Boars)1 with TaqI revealed polymorphisms at the OTC reference anchor locus.2 Three allelic fragments of 3.2, 2.5 and 2.2 kb, and a constant fragment of 1.5 kb were identified. The 3.2 kb fragment was found in the Large White, the PieÂtrain and in the Wild Boar breed. The 2.5-kb fragment was observed only in the Meishan breed and the 2.2-kb fragment only in a Wild Boar. Linkage analysis and chromosomal location: The segregation pattern of SCD1 alleles in the reference population showed that this locus is located on E11, linked to ACTA25 at 0 cm, with a LOD score of 14.8. The SCD1 gene has recently been localized on chicken chromosome 6 by FISH.6 This is the first assignment of a linkage group (E11/C10) to this macrochromosome. The homologous Scd1 gene has been localized on mouse chromosome 19.7 Mendelian inheritance: Pigs from the Dutch, French, Scottish and Swedish PiGMaP pedigrees (19 grandparents, 13 parents and 61 offspring) were typed for the polymorphisms to document Mendelian segregation. Codominant sex-linked inheritance was shown. Acknowledgements: We would like to thank L. B. Crittenden and Hans Cheng for providing DNA samples of the East Lansing chicken reference family. A. Pouzadoux is supported by a EC grant from the European ChickMap program. Chromosomal localization: The OTC locus was localized to the X chromosome by linkage mapping in the PiGMaP families. References 1 Beier D.R. (1993) Mamm Genome 4, 627±31. 2 Budowie B. et al. (1991) Am J Hum Genet 48, 137±44. 3 Crittenden L.B. et al. (1993) Poultry Science 72, 334±48. 4 Manly K.F. (1993) Mamm Genome 4, 303±13. 5 Burt D.W. (1994) Anim Genet 25, 199. 6 Fillon V. et al. (1997) Cytogenet Cell Genet 78, 229±30. 7 MGD (1997) Mouse Genetic Informatics. The Jackson Laboratory, Bar Harbor, ME. World Wide Web (URL: http://www.informatics,jax.org/), August 1997. Availability: The plasmid pOTC is from the American Type Culture Collection.3 Acknowledgement: S. Lousdal and T. B. Thygesen are acknowledged for their skilful technical assistance. This study was funded by the EC's BIOTECH+ Programme (B102-CT94-3044)±PiGMaP. References 1 Archibald A.L. et al. (1995) Mamm Gen 6, 157±75. 2 O'Brien S.J. et al. (1993) Nature Genet 3, 103±12. 3 Koroleva I. et al. (1996) Mamm Gen 7, 860±2. Correspondence: F Pitel Correspondence: V H Nielsen ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 MOLECULAR GENETIC MARKERS 153 Table 1. Microsatellite from American mink Marker ID Mvi201 Mvi586 Mvi192 Primer sequence 59±39 CAGCGATCTGTCTTTGAA AGAACCTACAAAGACATCGGG GTGAGCACTTATTCAGAGCTG GAAGAAAGAGACCCAATTAAC TGAGCGGGACAGAACTGG GGAAAGCTCCAAGACCCC No. of alleles PIC Annealing temperature (°C) GenBank accession number 0.24 52 U87251 146 0.74 0.70 52 U87253 122 0.80 0.78 62 U87249 Product size (bp) Heterozygosity 154 0.26 6 7 2 Three polymorphic mink, Mustela vison, dinucleotide repeats K Brusgaard1, N Shukri1, S N Malchenko1, O Lohi2, K Christensen3,T Kruse4 1 Department of Breeding and Genetics, and 2Department of Product Quality, Danish Institute of Agricultural Sciences, DK-8830 Tjele, Denmark; 3Deptartment of Animal Science and Animal Health, The Royal Veterinary and Agricultural University, 1870 Frederiksberg, Denmark; 4Institute of Human Genetics, Aarhus University, DKÊ rhus, Denmark. 8000 A Accepted 24 September 1997 Source/description: A mink cosmid library was constructed from a Royal Pastel male. The cosmid clones SH201, SH585 and SH192 were isolated after screening with a g-32PdATP-labelled (GT)9 oligonucleotide. Sequencing of the microsatellite repeat was performed after subcloning of Sau3A-digested cosmids in the BamH1 site of pUC19 vector. The markers were named Mvi201, Mvi586 and Mvi192, respectively. Chromosomal localization: The cosmids were localized to mink chromosomes by fluorescent in situ hybridization. SH201 was localized to chromosome 7q2,1, SH586 was localized to the chromosome-11-centromeric region and SH192 was localized to the chromosome-6-centormeric region. PCR conditions: Approximately 40 ng of DNA was amplified in a total volume of 25 ml containing 15 pmol of each primer, 0.2 mm dNTP, 0.4 U Taq Polymerase (Pharmacia) and 2.5 ml 10´ PCR buffer (100 mm Tris-HCl, pH 9.0, 15 mm MgCl2, 500 mm KCl, 0.1% v/w gelatine and 1% Triton X-100). Amplification was carried out in a OmniGene Temperature cycler (Hybaid). PCR cycling consisted of a denaturing step of 3 min at 93 °C, followed by 30 cycles at the annealing temperature for 20 s, 72 °C for 10 s followed by 30 s at 93 °C and a final cycle at 72 °C for 20 min. Mendelian inheritance: Autosomal codominant segregation was demonstrated in Danish fullsib mink pedigrees. Polymorphism: Studies for variation were performed in five populations of unrelated farm mink: two lines of Scanblack; two lines of Royal Pastel; and one line of Standard mink `Wild' (Table 1). The size of the alleles were scored using a 50±500-bp ladder (Pharmacia), together with the amplified isolated clone as an external size marker. Acknowledgements: We thank Mr S. Svendsen for skilful technical assistance. This work was supported by the Danish Project AVL 93SH±2. Correspondence and present address: Klaus Brusgaard, Institute of Clinical Research, Department of Clinical Biochemistry and Genetics, Odense University Hospital, DK-5000 Odense C, Denmark Characterization of 24 equine microsatellite loci W A van Haeringen1, L H P van de Goor1, N van der Hout1, J A Lenstra2 1 Dr Van Haeringen Laboratorium b.v., PO Box 408, 6700 AK Wageningen, The Netherlands; 2 Faculty of Veterinary Medicine, PO Box 80165, 3508 TD Utrecht, The Netherlands Accepted 7 October 1997 Source: A plasmid library of size-selected horse fragments was screened with a (CA)25 oligonucleotide. Primers were developed after sequencing of the positive clones (Table 1). Primer sequences: Primer sequences, repeat sequences, accession numbers, base pair ranges and annealing temperatures are presented in Table 1. Table 1. Characterization of 24 microsatellite loci Locus (bp) VHL11 VHL47 VHL57 VHL60 VHL63 VHL64 VHL66 VHL73 VHL78 VHL81 Primers (forward/reverse) Repeat sequence Access no. EMBL Number of alleles Size range (bp) Annealing temperature (°C) CGGCACCAGGTCATCACCACG GAGTCGGGGCTTTGTTTGACAG GTTTGCTGTGGTTACCAGGCAGA GCAAATTGAATATTTGAAGTTGAGAC GGCTCCTAAACATCCAGCAG GTGAGGCTCCAAGTACCTCT GACTGTTTAACCACCTACGTGA CACTACATAGCTTCAAAGTGGA GCTTTTAAAATGGTATGAATCTCCA AAAGAAGGAATCAGGCAAACACTCTA GGATTTATGACTGTACATGTGCA CTTATATATAGCGCAGAGACATTG TCTTTAAAATTTGATGCACAATGGT GGGGAGAATTTACTTATCTTGAC GGTCATTCTCCCAAAGCAAAAC AAGAGAAGGTGGATTTCAGAGG CAGGTCTTCTGGAGGAAACC CTAAGGGCAAAGGAAACAGG CAACTATGTACTTTGGGGAGCT GTCCATGAAATTCTAGTTGTTGC (AC)6TC(AC)2AAG(AC)2 Y11654 1 117 57 (CA)13 X86449 8 126±144 55 (AC)3GTG(CA)3 CT(CA)3±(CA)6 (CA)17 Y11655 1 125 60 Y08439 1 147 57 (AC)4TCAT(AC)5 (CA)4(TA)2(CA)3 (AC)6± (AC)5±(AC)6 Y11656 1 118 57 Y11657 2 182±186 57 (ACAT)4(AC)14 Y08440 3 102±108 57 (AC)6AT(AC)4 Y08441 1 122 57 (AC)17±(AC)3AT(AC)2 Y08442 5 98±106 57 (AC)16(TCAC)2TCA Y08443 5 162±174 57 ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 154 MOLECULAR GENETIC MARKERS Table 1. Continued Locus (bp) VHL88 VHL108 VHL121 VHL123 VHL126 VHL134 VHL137 VHL149 VHL161 VHL162 VHL179 VHL204 VHL209 VHL219 Primers (forward/reverse) Repeat sequence Access no. EMBL Number of alleles Size range (bp) Annealing temperature (°C) CCACCTTCACAATTATCAGTGAC TGGTCCTCATCATCTAGTTCCT TTTCTTTCCCTCAGGCTGGA GACCTAAGAGAACCCCTTAAGT AATGCACATGCCATAGTGCTC GCTTCCCAGACTCTCATTTGG CCTCCTTCACAGTGAAGTGC GAGTATATAGCTCCAGACCTC GACCCAACATTGTATGTAAGCG TGTGAATAGATATAAGTTGCTTGC CTGGGAACAGAATCAAGACTTG TAATATGCATGTATCTGATAGCTC CCCAAACATTTTTGACTGATGC TTATTTCTAAAGGGGTACGGCT GGAGGCGTTCTGGTCACGTT ACTTCAGCCTGTTTGCAGTCA GTTCCACCTTCCTCTGGATC GTGTGTCGCTAGGATTCAATCA GCTACTCTTTTACTCCTACTGC CTCTCGATGTAAGTGCTTGTGC CTGTCATCCATCTGCAGTGTTC GAATATCTGTAAACTCGTGGAGG ACTGAAGTTGAGAATCATTAATGG ACTTCCTCGACATCCTTCCCT TCTTACATCCTTCCATTACAACTA TGATACATATGTACGTGAAAGGAT ACTTATTGGTTTATCTTTGCCATC CTACATCTCAGTGTTCTTATCTG (AC)4T(CA)10 Y11658 2 128±132 60 (AN)18G(AN)4GT (AN)14±(AN)19 (TC)4± (TC)3TT(TC)6(CA)3 (TACA)2(CA)3GA(CA)5 (TCTCTG)2(TC)8 (AC)10TC(AC)2 (AC)12AA(AC)5 Y08445 1 191 57 Y11659 1 122 57 Y08446 5 149±161 57 Y08447 2 85±87 57 (TC)9AC(TC)5TA(TC)5AC (TC)5TTT(CA)9TA(CA)4 (CA)4TG(CA)3CT(AC)18 Y08448 4 157±163 57 Y08449 2 149±163 57 (AC)3AT(AC)4AA(AC)6 Y11660 1 74±76 57 (AC)5± (AC)12 Y11661 3 160±164 57 (AT)2ACATG(CA)4TA(CA)3 Y11662 1 96±100 57 (AC)2(ACAT)2(AC)6AT(AC)2 Y11663 2 145±149 60 (CA)10TAT(AC)3 Y11664 2 91±93 57 (AC)17 Y08451 7 84±98 57 (AC)8AG(AC)3 Y11665 2 96±100 57 PCR conditions: PCR amplifications were performed in a 15-ml PCR mixture containing 1 ml of isolated DNA (»75±125 ng), 10 mm TrisHCl (pH 8.3), 50 mm KCl, 1.5 mm MgCl2 and 6 pmol of each primer (Perkin Elmer, Foster City, CA), 1.2 U Amplitaq (Perkin Elmer). PCR amplification was done on a Perkin Elmer GeneAmp PCR system. Thirty cycles of 30 s 94°C, 30 s annealing temperature and 30 s 72°C were performed. International standards: In the international nomenclature for parentage control with horse microsatellites, base pair values of alleles are renamed to and presented in an alphabetical order (e.g. VHL47: 136 bp = `L', 138 bp = `M', 140 bp = `N'). In publications of equine primers, four reference samples are included. Allele sizes of these reference samples are used to determine the alphabetical nomenclature of the microsatellite locus (Table 2). The reference Table 2. Allele frequencies, PIC, heterozygosity and PE values for 11 polymorphic loci detected in four breeds (n = number of individuals analysed per breed). The alphabetical nomenclature of four reference samples is presented2 Locus VHL47 VHL66 Allele alphabetical G H I J K L M N O P K L M Size (bp) 126 128 130 132 134 136 138 140 142 144 Breed 1 FP (n = 42) 0.226 ± 0.145 0.387 ± 0.048 0.145 0.048 ± ± SP (n = 54) 0.519 ± 0.010 0.010 ± 0.058 0.327 0.077 ± ± DW (n = 46) 0.479 ± ± ± ± ± 0.146 0.208 0.167 ± SB (n = 46) 0.203 ± ± 0.072 ± ± 0.304 0.261 0.145 0.014 PIC 0.717 0.550 0.630 0.735 HTZ 0.752 0.614 0.678 0.771 PE 0.537 0.354 0.432 0.554 104 106 108 0.090 0.410 0.500 0.264 0.340 0.396 0.205 0.670 0.125 0.157 0.743 0.100 PIC 0.483 0.584 0.440 0.374 HTZ 0.574 0.658 0.493 0.413 ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 Reference samples 1 2 M/N M/N 3 O/O 4 N/O O/O O/P M = 138 bp * M/M O/P M = 108 bp MOLECULAR GENETIC MARKERS Table 2. Continued Locus VHL78 VHL81 VHL123 VHL126 VHL134 VHL161 Allele alphabetical K L M N O K L M N O P J K L M N O P L M J K L M L M N Size (bp) PE Breed 1 FP (n = 42) 0.281 SP (n = 54) 0.363 DW (n = 46) 0.258 SB (n = 46) 0.215 Reference samples 1 2 3 4 98 100 102 104 106 ± 0.165 0.582 0.063 0.190 0.050 0.030 0.560 0.040 0.320 ± 0.014 0.268 0.099 0.620 ± 0.012 0.500 0.098 0.390 M/M M/O M/O PIC 0.546 0.511 0.470 0.504 HTZ 0.594 0.579 0.535 0.588 PE 0.353 0.318 0.281 0.301 162 164 166 168 170 172 0.026 ± 0.355 0.382 0.171 0.066 ± ± 0.094 0.623 0.264 0.019 ± ± 0.303 0.202 0.461 0.034 ± ± 0.143 0.171 0.629 0.057 M/O M/O PIC 0.638 0.470 0.589 0.508 HTZ 0.693 0.533 0.653 0.551 PE 0.437 0.282 0.380 0.322 149 151 153 155 157 159 161 ± 0.036 0.440 0.488 ± ± 0.036 0.038 0.019 0.396 0.519 ± ± 0.028 0.075 0.032 0.310 0.581 ± ± ± 0.236 ± 0.153 0.611 ± ± ± M/M M/M PIC 0.471 0.482 0.489 0.486 HTZ 0.565 0.565 0.560 0.548 PE 0.274 0.288 0.294 0.291 85 87 0.183 0.817 0.194 0.806 0.011 0.989 0.111 0.889 PIC 0.254 0.264 0.021 0.178 HTZ 0.299 0.313 0.021 0.197 PE 0.127 0.132 0.010 0.089 157 159 161 163 0.622 0.268 0.049 0.061 0.217 0.509 0.245 0.028 0.419 0.244 0.012 0.326 0.318 0.258 0.045 0.379 PIC 0.474 0.571 0.588 0.623 HTZ 0.535 0.633 0.659 0.686 PE 0.288 0.364 0.372 0.412 160 162 164 0.370 0.630 ± 0.208 0.792 ± ± 0.939 0.061 ± 1.000 ± PIC 0.358 0.275 0.108 ± HTZ 0.466 0.329 0.115 ± ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 M/O M = 102 bp M/M M/O M = 166 bp L/M L/M M = 155 bp M/M M/M M = 87 bp M/M M/M M/M M/M M/M K/M M/M M/M M = 163 bp M/M M/M M = 162 bp 155 156 MOLECULAR GENETIC MARKERS Table 2. Continued Locus VHL204 VHL209 VHL219 Allele alphabetical M N M N O P Q R S T M N O Size (bp) Breed 1 FP (n = 42) SP (n = 54) DW (n = 46) SB (n = 46) PE 0.178 0.138 0.054 ± 91 93 1.000 ± 0.990 0.010 0.927 0.073 0.762 0.238 PIC ± 0.019 0.127 0.297 HTZ ± 0.020 0.135 0.363 PE ± 0.009 0.063 0.148 84 86 88 90 92 94 96 98 0.319 0.028 0.167 0.069 0.319 0.083 ± 0.014 0.212 0.058 0.202 0.058 0.404 0.067 ± ± 0.703 ± 0.041 0.203 0.041 ± ± 0.014 0.577 ± ± 0.197 0.042 ± 0.127 0.056 PIC 0.718 0.704 0.416 0.565 HTZ 0.756 0.741 0.461 0.607 PE 0.537 0.522 0.248 0.378 96 98 100 1.000 ± ± 1.000 ± ± 0.958 ± 0.042 1.000 ± ± PIC ± ± 0.077 ± HTZ ± ± 0.080 ± PE ± ± 0.039 ± Reference samples 1 2 3 4 M/M M/M M = 91 bp M/M M/M M/M M/P M/M M/M M/M M/M M = 84 bp M/M M/M M = 96 bp 1 FP: Falabella ponies; SP: Shetland ponies; DW: Dutch warmblood; SB: standardbred. *Although the relationships between the alphabetical nomenclature and PCR fragment length are shown, other laboratories should use the reference samples to calibrate the allele assignment for these markers. samples are defined as equine samples one through four from the 1994 ISAG/ISBC thoroughbred comparison test. Material from these horses can be obtained at the Equine Blood Typing and Research Centre, Massey University, Palmerston North, New Zealand. Polymorphisms: Four test breeds (Falabella ponies, Shetland ponies, Dutch warmblood, and standardbred) were analysed constituting a total of 188 animals for identification of polymorphism. Allele frequencies for 11 markers (polymorphic for these test breeds) are presented in Table 2. In a small test group (15 samples related to the Horse Genome Project and three samples per breed of Friesian horses, Appaloosa ponies and Fjord horses), polymophisms were detected for VHL64, VHL88, VHL137 and VHL179. All reference samples were homozygous for these primers (corresponding to M/M) Primers developed for locus VHL57 showed unexpected results. At an annealing temperature of 57°C, products were amplified ranging from 98 to 238 bp with regular 20 bp intervals instead of the microsatellite locus. The predicted microsatellite alleles were found at an annealing temperature of 60°C. All other primer sets resulted in PCR products of expected sizes. The markers included in this report will be included in the horse genome project, thus contributing to increase the number of markers on the equine genetic map. Mendelian inheritance: In all families used with the Horse Genome Project, as well as 42 related Falabella ponies, transmission of alleles was consistent with codominant, autosomal alleles according to Mendelian inheritance. No null alleles were observed in 42 related Falabella ponies. References 1 Botstein D. et al. (1980) Am J Hum Genet 32, 314±31. 2 ISAG Society News: Report of the ISAG/ISBC Thoroughbred Standardization Test at the 25th International Conference on Animal Genetics, Tours, France, July 1996 (1996) Anim Genet 27, 444. Correspondence: W A van Haeringen Eight canine tetranucleotide repeats D Mariat, Y Amigues, M Y Boscher Labogena, Domaine de Vilvert, 78352 Jouy En Josas, France Accepted 3 November 1997 Source/description: One hundred micrograms of a Beagle DNA was digested with Sau3A and the fragments from 2 to 16 kb were selected after separation on agarose gel (Metaphor, FMC, Rockland, ME). The fragments were electroeluted, dephosphorylated and ligated into BamHI-digested vector pUC18. Escherichia coli SURE competent cells (Stratagene, La Jolla, CA) were then transformed using a standard procedure. About 5000 clones were screened using DIG-labelled oligonucleotides (AAGG)6, and (ATCC)6 with the labelling and immunological detection kit of Boehringer (Mannheim, Germany). Probes were hybridized to membranes (Hybond- ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 MOLECULAR GENETIC MARKERS N+; Amersham International, Amersham, UK) at 62 °C1. Positive clones were sequenced and primers were designed using the program OLIGO 4.0. Primer sequences: DGN3: upper primer: lower primer: DGN6: upper primer: lower primer: DGN8: upper primer: lower primer: DGN10: upper primer: lower primer: DGN13: upper primer: lower primer: DGN14: upper primer: lower primer: DGN17: upper primer: lower primer: DGN18: upper primer: lower primer: TTT GGA GAT CCG GTG TAT TCT GGC GGA GAT TCA GAT CTC ATA GCA TCT TTT AAG CTG AGG GAT TCT GCC ACC ACC CTA CAC TAT AGG GAT AAA TTA CTG GTA GAT ATT TAC GTA TAT TAT CTC AGG AAA GGT GTT ATC CAC ACC TAA CAG TCA GGC CTA TGT GTC TCT AGC GCT GTG GCT GTG TTA ATC TCT ACC GCA GTG CTA TTT TGG TCT GGG TGT CCA GGT ATC AAT TGT CAA CTG TAA TGT AGT GTC TTG TAA GCC AAA TAT GAA AAG CCT TCA ATG CAG GGG AGC AGT TCA CAT TGC ATT TCT CTT ATG CAC ATG CTG AGC CCC CCT CTC TGC TGG C C GAA C T C C G G C TGG C C C HotStart PCR conditions: Duplex amplifications of microsatellites (DGN3 and DGN14, DGN6 and DGN10, DGN8 and DGN13, and DGN 17 and DGN18) were performed with the following primer concentrations: 3.5 mm and 1.25 mm for DGN6 and DGN10, respectively; 1 mm and 0.75 mm for DGN3 and DGN14, respectively; 1.75 mm and 0.5 mm for DGN8 and DGN13, respectively; and l.5 mm for DGN17 and DGN18. Each primer mixture was adjusted to a final volume of 10 ml and added to 5 ml of DNA and 20 ml of mineral oil. After heating for 5 min at 94 °C, 10 ml of reaction mixture was added (220 mm Tris± HCl pH 9, 59 mm (NH4)SO4, 0.03% Tween-20, 5.9 mm MgCl2, 0.73 mm dNTPs, 12.5% DMSO, 1.25 units of Taq DNA polymerase) followed by 30 cycles of 30 s at 94 °C, 30 s at 55 °C and 1 min at 72 °C. Polymorphism: PCR products of DNA from 45 mixed-breed dogs were detected on an ABI PRISM 373 Sequencer and allele sizes were analyzed using GenScan Analysis software. Results are summarized in Table 1. Table 1. Polymorphism data Microsatellite DGN3 DGN6 DGN8 DGN10 DGN13 DGN14 DGN17 DGN18 Cloned motif (TCTA)12 (GGAA)17 (GAAA)28 (AAGG)12(GAAA)19 (GAAA)25 (GGAA)24 (GAAA)53 (GAAA)77 Average size (bp) 200 320 240 250 320 250 350 550 No. of alleles PIC PE 12 13 18 12 24 24 24 41 0.79 0.83 0.87 0.83 0.93 0.73 0.92 0.85 0.65 0.70 0.76 0.69 0.87 0.56 0.85 0.91 Reference 1 Rothuizen J. et al. (1994) Theor Appl Genet 89, 403±6. Correspondence: D Mariat Isolation of four pig male-specific DNA fragments by RDA J PeÂrez-PeÂrez, C BarragaÂn Area de Mejora GeneÂtica Animal, Centro de InvestigacioÂn y TecnologõÂa, Instituto Nacional de Investigaciones Agrarias, Carretera de la CorunÄa Km 7, 28040 Madrid, Spain 157 Accepted 3 November 1997 Source/description: Four independent male-specific DNA fragments were isolated using a representation difference analysis (RDA) method.1 Genomic DNA from an Iberian male pig and a Landrace female pig were used as tester and driver, respectively. The resulting PCR products were cloned in the BamHI site of pUC18. Thirty-one recombinant plasmids from white colonies were analysed by restriction and were grouped according to the size of their inserts. Redundancy amongst the clones was determined by probing dot blots of all the clones with one member of each group. From this analysis, the present authors identified eight independent clones. When used to probe genomic pig DNA, four of these clones only hybridized to male DNA, as illustrated in the Southern blot in Fig. 1A: clones 1 (6/31), 2 (5/31), 4 (11/31) and 5 (5/31). The multiple fragments detected suggest that the cloned sequences represent repetitive DNA. The remaining clones hybridized to repetitive sequences present in both males and females, and were not analysed in more detail because the present authors consider these to be artefacts of the technique. The cloned fragments were used to probe genomic Southern blots of DNA from both sexes of two breeds of pigs (Duroc and Landrace) and DNA from other mammalian species (Ovis aries, Bos taurus and Homo sapiens). The present authors obtained the same results with other breeds of pigs and no hybridization signal with the other mammals with these experimental conditions. The cloned DNA sequences were sequenced (GenBank accession numbers: clone 1, AF027210; clone 2, AF027211; clone 4, AF002659; and clone 5, AF027212). Three of these sequences (1, 2 and 5) exhibited high levels of identity [(1) 87% over 800 bp; (2) 46% over 644 bp; (5) 84% over 355 bp] to a previously described pig sequence (EMBL accession number: X12696).2 As this sequence is a pig male- specific repetitive DNA, the database matches confirm the results obtained from the Southern blots. The cloned fragments are shown by arrows in Fig. 1A. Although the sequence of clone 4 (GenBank accession number: AF002659) showed no significant matches to the other sequences in the DNA sequence databases, it revealed similar Southern blot patterns to those detected with clones 1, 2 and 5. A detailed examination of the previously described sequence2 shows three motifs, each repeated twice in the sequenced fragment. The regions of sequence similarity between these clones in the present study (1, 2 and 5) and the published sequence are illustrated in Fig. 1B. The original aim of these experiments was to obtain breedspecific markers to discriminate between Iberian and Landrace pigs. The present authors used male and female DNA as a means of checking the efficacy of the RDA method. If the method worked, chromosome-Y-specific fragments had to be obtained. However, the RDA experiments yielded only Y-chromosome-specific repetitive sequences. The present authors assume that these results reflect the greater abundance of male- specific repeats compared to the hypothetical breed specific markers. Experimental methods: The RDA method was carried out as described,1 using BamHI oligonucleotides. Three cycles of selective PCR amplification and hybridization were done. The RDA PCR products were digested with BamHI, dephosphorylated to avoid multiple inserts and ligated to BamHI cleaved pUC18. A nonradioactive labelling system (Amersham, Amersham, UK; Fluorescein Gene Images: RPN 3510) was used for the Southern and dot blots. DNA were fixed to a nylon membrane for 2 h at 80 °C, and hybridizations were carried out in the recommended kit buffer at 65 °C. Acknowledgements: We are grateful to S. Marco for his help in digitizing the images and to A. Zaballos for his help with the sequence comparisons. References 1 Lisitsyn N. et al. (1993) Science 259, 946±51. 2 McGraw R. et al. (1988) Nucl Acids Res 16, 10389. Correspondence: J. PeÂrez-PeÂrez (e-mail: [email protected]) ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 158 MOLECULAR GENETIC MARKERS Fig. 1. (A) Southern blot of male (M) and female (F) pig DNA digested with BamHI. The clones used as probes are indicated above the lanes. The arrows mark (from top to bottom) the cloned fragments 1, 2, 4 and 5, respectively. DNA size markers are on the right hand side of the figure. (B) Pig repetitive DNA sequence.2 The repeated motifs are shown as boxes. The regions of sequence identity between the published male-specific pig repetitive DNA, and clones 1, 2 and 5 are indicated by the lines under the fragment. Alpaca microsatellites at the VIAS A1 and VIAS A2 loci H C McPartlan, M E Matthews, N A Robinson Victorian Institute of Animal Science, 475 Mickleham Road, Attwood, Victoria 3049, Australia Accepted 5 November 1997 Source/description: An alpaca genomic library was constructed in pUC18 using size-selected Sau3A fragments(between 350 and 517 bp). The library was screened using a (CA)n probe random primed with [a-32P]dATP. Positive clones were identified and ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 MOLECULAR GENETIC MARKERS sequenced using M13 forward and reverse primers. PCR primers were then identified that amplified across the microsatellites. The repeats were in the forms of (GT)9 for VIAS A1 (EMBL AJ001565) and (TG)5N46(GT)6(AT)6 for VIAS A2 (EMBL AJ001566). Primer sequences: VIAS A1: F- TTTAAGTGGTATAGACAGACACTAATG VIAS A1: R- GTCATTGGTCATCCAACT VIAS A2: F- CTGATATTTAACATTTTGAGAAGGTTAC VIAS A2: R- TGCACCTTTCTTGTTAATTTATAACTAG 159 Acknowledgements: This work was supported by Mr P. Visconte and Agriculture Victoria. Correspondence: H C McPartlan Characterization and mapping of 15 novel chicken microsatellite loci PCR conditions: The forward primer was end-labelled with [g-33P]dATP. The PCR mixture comprised of 10 mm Tris±HCl pH 8.3, 50 mm KCl, 1.5 mm MgCl2, 0.001% (w/v) gelatin, 1 U Ampiltaq gold, primers at 0.2 mm and 200 mm of each dNTP. Approximately 100 ng of DNA was amplified in a 5 ml volume using the programmes: 95 °C 10 min (95 °C 45 s, 52 °C 45 s) ´ 30 72 °C 1 h for VIAS A1; and 95 °C 10 min (95 °C 45 s, 50 °C 45 s) ´ 30 72 °C 10 min for VIAS A2, reactions being performed on a Hybaid Omnigene. Allele frequencies: Alleles were compared to an M13 sequencing ladder and named according to their size in base pairs. Table 1 shows the frequency of alleles from 30 (VIAS A1) and 27 (VIAS A2) unrelated animals. Mendelian inheritance was demonstrated. Table 1. Frequency of alleles VIAS A1* Allele (bp) Frequency VIAS A2y Allele (bp) Frequency 142 144 146 0.72 0.030 0.250 195 197 201 0.315 0.611 0.074 *PIC 0.352; heterozygosity 0.4299; average power of exclusion 19.28%. yPIC 0.443; heterozygosity 0.532; average power of exclusion 25.3% D Dawson, S McConnell, A Wardle, M Gibbs, T Burke Department of Biology, University of Leicester, Leicester LE1 7RH, UK Accepted 15 December 1997 Source and description: For all the clones except 2F6, chicken (Gallus gallus) size-selected (300±600 bp) MboI genomic fragments were isolated from a pBluescript library enriched for (CA)n and (GA)n sequences. Clone 2F6 was isolated from a library enriched for tetranucleotide repeats1, but in both cases, enrichment was essentially by the method described by Armour et al.2. Modifications included the elimination of the PCR-amplification of the input DNA1. Clones that cross-hybridized to 32P-labelled poly(dA-dC).poly(dG-dT) oligonucleotides or (ATCC)n were sequenced using DyeDeoxy terminators (Applied Biosystems, Warrington, UK) on an ABI 373A sequencing machine. PCR primers (Table 1) were designed with the assistance of primer v.0.53. The lengths of the amplified PCR products and repeat array sequences of the original sequenced clones, together with the EMBL accession numbers for the full cloned sequences, are given in Table 1. PCR conditions: Each 10-ml reaction contained about 50 ng of genomic DNA, 1 mm of each primer and 0.25 units DNA polymerase (Thermoprime Plus, Advanced Biotechnologies, Epsom, UK) in the manufacturer's buffer [final concentrations 20 mm (NH4)2SO4, 75 mm Tris-HCl pH 9.0, 0.01% (w/v) Tween], containing Y mm Table 1. Microsatellite details and map locations Locus name Clone name Accession number Repeat LEI0179 2F6 X78611 (ATCC)11 LEI0195 81C12 Z83767 (CT)8GT(CT)3CG(CA)15 LEI0196 81D04 Z83768 (CA)28 LEI0197 84C10 Z83776 (CA)12TA(CA)11 LEI0198 82F10 Z83771 (CA)24T(A)20 LEI0199 83A02 Z83772 (CA)17 LEI0200 83B01 Z83773 (CA)19 LEI0204 81C09 Z83766 (CA)20 LEI0206 81E01 Z83770 (CA)20 LEI0223 MC19B04 Z95313 (CA)18 LEI0224 MC19B10 Z95314 (CA)15 LEI0247 MC20F09 Z95315 (CA)14CG(CA)8 LEI0251 MC21B11 Z95317 (CA)16 LEI0252 MC21E12 Z95318 (CA)4{CT(CA)6}9CT(CA)5 LEI0253 MC22G05 Z95319 (CA)16(TA)6 Primer sequences (59±39) [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] [f] [r] ATCCCCGAGGCATCCATCCA CCAGGGGCCATCTCCACCTG TCTCCATATGCTTCCCTTCA TTTCATTTTTCACTGCTCTGG ACCCATGAATGTTTCCTATGC GATCCCTTCCTAATACATAGTC CAAATGCTGCCAGTAGGTCTG CGTTTCCCTCCGGCTTAC CAAGGGCAGACATAAGCACA AAAGCTTTTAAACCAATCTGAA TTAAGAGTAATTTCAAACAGTTCAGC ATTTGTAGGTTTTCTGTGCTGC GATCTCAAAGGTTTTTGTTCTTAG ATTAGAGGAACGTAATGCTAAACTG CTCAGCGCACCGCATTAC GTGCAAAGTTTGACGCAGTG TGCTCAGAAAACACGGCTGC CGGGAAGCTTGGAATTCTGC TTCAGGAAAGAGAAATGTGTGC GGTTGTGGTTGGATATGGTGAC GGCAATGAAGTGTGAGGTTGAC ATCCACTGTTCTTCTGCTGCAC CATTTACACATATGTAGACACACAGT GTTGCAGTTTACAAGTTGGC GGGTTACTCTTATGTTTAATGATGTC GATCTAGAAATGGCTGACTGAC ATCAGCTGCCACAGTAATGC GCCTCAGAACAAGTGAAGCG ATCTTACCAGCCTAACTTCTCTG GATCATTTTCAATGGAGGAC Annealing MgCl2 temperature conc. L Compton map (°C) (mm) (bp) location* East Lansing map location* 55 1. 0 143 X 53 1. 0 261 Chromosome 2 Chromosome 2 54 1. 0 210 C10 Chromosome 6 55 1. 5 142 polymorphic E36 51 1. 5 149 X Chromosome 1 55 1. 5 140 polymorphic E36 56 1. 5 154 Chromosome 4 X 55 1. 5 169 X X 55 2. 0 173 X X 55 1. 5 188 X Chromosome 3 55 1. 5 128 X X 55 1. 5 184 Chromosome 2 X 55 2. 0 118 C28 E48 55 1. 5 309 polymorphic Chromosome 1 55 1. 5 148 Chromosome 4 X Chromosome 8 *The linkage group is indicated where chromosome is as yet unknown: (X) locus not informative in this family; (polymorphic) polymorphic, but not yet mapped in this family. L, length of PCR product from sequenced clone. ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160 160 MOLECULAR GENETIC MARKERS MgCl2 and 0.2 mm of each dNTP, where Y varied from 1.0 to 2.0 mm (Table 1). The reaction profile was: 96°C, 1 min; X°C, 30 s; 72°C, 30 s for 30 cycles in a Perkin Elmer model TC1 thermal cycler or 94°C, 1 min for one cycle; 94°C 1 min, X°C 30 s, 72°C 30 s for five cycles; 90°C 30 s, X°C 30 s, 72°C 30 s for 25 cycles; and 72°C 3 min for one cycle in a Hybaid TouchdownTM thermal cycler, where X varied from 51 to 56°C (Table 1). Reaction products were mixed with ficoll loading buffer and analysed on a 6% non-denaturing polyacrylamide or 3% Metaphor agarose (FMC Bioproducts, Rockland, ME) gels stained with ethidium bromide or on a silver stained 4% denaturing polyacrylamide gel. Polymorphisms: For all the microsatellites mapped in the East Lansing reference backcross4 (Table 1), polymorphism was seen in the female White Leghorn and the male (Jungle Fowl ´ White Leghorn) F1 and codominant Mendelian inheritance was observed in 52 backcross offspring. For those mapped in the Compton reference backcross5, polymorphism was seen in the parental birds of chicken lines N and 15I, and codominant Mendelian inheritance was observed in 56 backcross offspring. Chromosomal location: The markers were positioned within the current East Lansing or Compton linkage map by comparison of the segregation patterns with the database of markers typed in the respective family (International Poultry Gene Mapping Committee) using Map Manager v2.66 (Table 1). LEI0251 is an exceptionally useful marker since it connects two previously independent linkage groups (C28 and E48). The present authors anticipate that the three markers which were monomorphic in both the East Lansing and Compton families will prove useful for mapping in other crosses1. Acknowledgements: We thank Miss H. Clark and Mr A. Parham for technical assistance, Dr N. Bumstead (Institute of Animal Health, UK) and Dr H. Cheng (East Lansing, Michigan, USA) for providing DNA samples of the reference populations and for allocation of marker map positions, and Mr S. Bayliss for valuable assistance with sequencing. This research was supported by the BBSRC and the European Commission. References 1 Gibbs M. et al. (1997) Anim Genet 28, 401±17. 2 Armour J.A.L. et al. (1994) Hum Mol Gen 3, 599±605. 3 Lincoln S.E. et al. (1991) primer v.0.5, MIT Center for Genome Research, MA, USA. 4 Crittenden L.B. et al. (1993) Poultry Sci 72, 334±48. 5 Bumstead N. & Palyga J. (1992) Genomics 13, 690±7. 6 Manly K.F. (1993) Mamm Genome 4, 303±13. Correspondence: T Burke (e-mail: [email protected]) ã 1998 International Society for Animal Genetics, Animal Genetics 29, 150±160