Molecular Microbiology

Entamoeba histolytica is an obligate protozoan parasite of humans, and amebiasis, an infectious disease which targets the intestine and/or liver, is the second most common cause of human death due to a protozoan after malaria. Although amebiasis is usually asymptomatic, E. histolytica has potent pathogenic potential. During host infection, the parasite is exposed to reactive oxygen species that are produced and released by cells of the innate immune system at the site of infection. The ability of the parasite to survive oxidative stress (OS) is essential for a successful invasion of the host. Although the effects of OS on the regulation of gene expression in E. histolytica and the characterization of some proteins whose function in the parasite's defense against OS have been previously studied, our knowledge of oxidized proteins in E. histolytica is lacking. In order to fill this knowledge gap, we performed a large-scale identification and quantification of the oxidized proteins in oxidatively stressed E. histolytica trophozoites using resin-assisted capture coupled to mass spectrometry. We detected 154 oxidized proteins (OXs) and the functions of some of these proteins were associated with antioxidant activity, maintaining the parasite's cytoskeleton, translation, catalysis, and transport. We also found that oxidation of the Gal/GalNAc impairs its function and contributes to the inhibition of E. histolytica adherence to host cells. We also provide evidence that arginase, an enzyme which converts L-arginine into L-ornithine and urea, is involved in the protection of the parasite against OS. Collectively, these results emphasize the importance of OS as a critical regulator of E. histolytica's functions and indicate a new role for arginase in E. histolytica's resistance to OS.

During its life cycle, the unicellular parasite Entamoeba histolytica is challenged by a wide variety of environmental stresses, such as fluctuation in glucose concentration, changes in gut microbiota composition, and the release of oxidative and nitrosative species from neutrophils and macrophages. The best mode of survival for this parasite is to continuously adapt itself to the dynamic environment of the host. Our ability to study the stress-induced responses and adaptive mechanisms of this parasite has been transformed through the development of genomics, proteomics or metabolomics (omics sciences). These studies provide insights into different facets of the parasite's behavior in the host. However, there is a dire need for multi-omics data integration to better understand its pathogenic nature, ultimately paving the way to identify new chemotherapeutic targets against amebiasis. This review provides an integration of the most relevant omics information on the mechanisms that are used by E. histolytica to resist environmental stresses.

Adaptation of the Entamoeba histolytica parasite to toxic levels of nitric oxide (NO) that are produced by phagocytes may be essential for the establishment of chronic amebiasis and the parasite's survival in its host. In order to obtain insight into the mechanism of E. histolytica's adaptation to NO, E. histolytica trophozoites were progressively adapted to increasing concentrations of the NO donor drug, S-nitrosoglutathione (GSNO) up to a concentration of 110 μM. The transcriptome of NO adapted trophozoites (NAT) was investigated by RNA sequencing (RNA-seq). N-acetyl ornithine deacetylase (NAOD) was among the 208 genes that were upregulated in NAT. NAOD catalyzes the deacetylation of N-acetyl-L-ornithine to yield ornithine and acetate. Here, we report that NAOD contributes to the better adaptation of the parasite to nitrosative stress (NS) and that this function does not depend on NAOD catalytic activity. We also demonstrated that glyceraldehyde 3-phosphate dehydrogenase (...

We have recently reported that Entamoeba histolytica trophozoites can adapt to toxic levels of the nitric oxide (NO) donor, S-nitrosoglutathione (GSNO). Even if the consequences of this adaptation on the modulation of gene expression in NO-adapted trophozoites (NAT) have been previously explored, insight on S-nitrosylated (SNO) proteins in NAT is missing. Our study aims to fill this knowledge gap by performing a screening of SNO proteins in NAT. Employing SNO resin-assisted capture (RAC), we identified 242 putative SNO proteins with key functions in calcium binding, enzyme modulation, redox homeostasis, and actin cytoskeleton. Of the SNO proteins in NAT, proteins that are associated with actin family cytoskeleton protein are significantly enriched. Here we report that the formation of actin filaments (F-actin) is impaired in NAT. Consequently, the ability of NAT to ingest erythrocytes and their motility and their cytopathic activity are impaired. These phenotypes can be imitated by ...

During its life cycle, the unicellular parasiteis challenged by a wide variety of environmental stresses, such as fluctuation in glucose concentration, changes in gut microbiota composition, and the release of oxidative and nitrosative species from neutrophils and macrophages. The best mode of survival for this parasite is to continuously adapt itself to the dynamic environment of the host. Our ability to study the stress-induced responses and adaptive mechanisms of this parasite has been transformed through the development of genomics, proteomics or metabolomics (omics sciences). These studies provide insights into different facets of the parasite's behavior in the host. However, there is a dire need for multi-omics data integration to better understand its pathogenic nature, ultimately paving the way to identify new chemotherapeutic targets against amebiasis. This review provides an integration of the most relevant omics information on the mechanisms that are used byto resist ...

Maintaining proper mRNA levels is a key aspect in the regulation of gene expression. The balance between mRNA synthesis and decay determines these levels. We demonstrate that most yeast mRNAs are degraded by the cytoplasmic 5 0 -to-3 0 pathway (the ''decaysome''), as proposed previously. Unexpectedly, the level of these mRNAs is highly robust to perturbations in this major pathway because defects in various decaysome components lead to transcription downregulation. Moreover, these components shuttle between the cytoplasm and the nucleus, in a manner dependent on proper mRNA degradation. In the nucleus, they associate with chromatin-preferentially $30 bp upstream of transcription startsites-and directly stimulate transcription initiation and elongation. The nuclear role of the decaysome in transcription is linked to its cytoplasmic role in mRNA decay; linkage, in turn, seems to depend on proper shuttling of its components. The gene expression process is therefore circular, whereby the hitherto first and last stages are interconnected.

F ollowing its synthesis in the nucleus, mRNA undergoes various stages that are critical for the proper synthesis, localization and possibly functionality of its encoded protein. Recently, we have shown that two RNA polymerase II (Pol II) subunits, Rpb4p and Rpb7p, associate with the nascent transcript co-transcriptionally. This "mRNA imprinting" lasts throughout the mRNA lifetime and is required for proper regulation of all major stages that the mRNA undergoes. Other possible cases of cotranscriptional imprinting are discussed. Since mRNAs can be transported from the synthesizing cell to other cells, we propose that mRNA imprinting can also affect the phenotype of the recipient cells. This can be viewed as "mRNAbased epigenetics."

Little is known about crosstalk between the eukaryotic transcription and translation machineries that operate in different cell compartments. The yeast proteins Rpb4p and Rpb7p represent one such link as they form a heterodimer that shuttles between the nucleus, where it functions in transcription, and the cytoplasm, where it functions in the major mRNA decay pathways. Here we show that the Rpb4/7 heterodimer interacts physically and functionally with components of the translation initiation factor 3 (eIF3), and is required for efficient translation initiation. Efficient translation in the cytoplasm depends on association of Rpb4/7 with RNA polymerase II (Pol II) in the nucleus, leading to a model in which Pol II remotely controls translation. Hence, like in prokaryotes, the eukaryotic translation is coupled to transcription. We propose that Rpb4/7, through its interactions at each step in the mRNA lifecycle, represents a class of factors, ''mRNA coordinators,'' which integrate the various stages of gene expression into a system.

Promoters are DNA elements that enable transcription and its regulation by trans-acting factors. Here, we demonstrate that yeast promoters can also regulate mRNA decay after the mRNA leaves the nucleus. A conventional yeast promoter consists of a core element and an upstream activating sequence (UAS). We find that changing UASs of a reporter gene without altering the transcript sequence affects the transcript's decay kinetics. A short cis element, comprising two Rap1p-binding sites, and Rap1p itself, are necessary and sufficient to induce enhanced decay of the reporter mRNA. Furthermore, Rap1p stimulates both the synthesis and the decay of a specific population of endogenous mRNAs. We propose that Rap1p association with target promoter in the nucleus affects the composition of the exported mRNP, which in turn regulates mRNA decay in the cytoplasm. Thus, promoters can play key roles in determining mRNA levels and have the capacity to coordinate rates of mRNA synthesis and decay.

In eukaryotes, nuclear mRNA synthesis is physically separated from its cytoplasmic translation and degradation. Recent unexpected findings have revealed that, despite this separation, the transcriptional machinery can remotely control the cytoplasmic stages. Key to this coupling is the capacity of the transcriptional machinery to "imprint" the transcript with factors that escort it to the cytoplasm and regulate its localization, translation and decay. Some of these factors are known transcriptional regulators that also function in mRNA decay and are hence named "synthegradases". Imprinting can be carried out and/or regulated by RNA polymerase II or by promoter cis-and trans-acting elements. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation. j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / b b a g r m Please cite this article as: N. Dahan, M. Choder, The eukaryotic transcriptional machinery regulates mRNA translation and decay in the cytoplasm, Biochim. Biophys. Acta (2012), http://dx.

coupled processes Transcription in the nucleus and mRNA decay in the cytoplasm are data Supplementary http://genesdev.cshlp.org/cgi/content/full/22/15/2022/DC1 "Supplemental Research Data" References http://genesdev.cshlp.org/cgi/content/full/22/15/2022#References This article cites 28 articles, 18 of which can be accessed free at: service Email alerting click here top right corner of the article or Receive free email alerts when new articles cite this article -sign up in the box at the http://genesdev.cshlp.org/subscriptions/ go to: Genes and Development To subscribe to

RNA Polymerase II (pol II) is a large multi-subunit complex that is responsible for the synthesis of all eukaryotic mRNAs. Its correct and timely recruitment to promoter regions is a crucial step of transcription regulation, involving complicated and well-controlled networks of protein-DNA and protein-protein interactions. The best-studied pol II is the yeast complex consisting of 12 subunits (Rpb1-12). Rpb4 and Rpb7 form a dissociable heterodimer (Rpb4/7). The unique location of Rpb4/7 within the transcription initiation complex, and its capacity to interact with various transcription factors, suggest that it provides important links to the network of interactions that control transcription initiation. Moreover, Rpb4/7 executes some non-transcriptional activities, including mRNA transport. Hence, Rpb4/7 functions at the interface of transcriptional and post-transcriptional machinery.

Curved DNA molecules and unusually small circles have been obtained by ligation of synthetic 21-base precursors: TCTCTAAAAAATATATAAAAA TTTTTTATATATTTTTAGAGA 3' The ligation resulted in the formation of double-stranded oligo-(precursor)s possessing a strong 10.5-base-pair (bp) periodicity of the runs of adenines. Two-dimensional polyacrylamide gel electrophoresis of the ligation products showed two distinct families of spots: (a) noncircular oligo(precursor)s of 21 to 231

Little is known about crosstalk between the eukaryotic transcription and translation machineries that operate in different cell compartments. The yeast proteins Rpb4p and Rpb7p represent one such link as they form a heterodimer that shuttles between the nucleus, where it functions in transcription, and the cytoplasm, where it functions in the major mRNA decay pathways. Here we show that the Rpb4/7 heterodimer interacts physically and functionally with components of the translation initiation factor 3 (eIF3), and is required for efficient translation initiation. Efficient translation in the cytoplasm depends on association of Rpb4/7 with RNA polymerase II (Pol II) in the nucleus, leading to a model in which Pol II remotely controls translation. Hence, like in prokaryotes, the eukaryotic translation is coupled to transcription. We propose that Rpb4/7, through its interactions at each step in the mRNA lifecycle, represents a class of factors, ''mRNA coordinators,'' which integrate the various stages of gene expression into a system.

Rpb4p and Rpb7p are subunits of the RNA polymerase II of Saccharomyces cerevisiae that form a dissociable heterodimeric complex. Whereas the only reported function of Rpb7p is related to transcription, Rpb4p has been found to also act in mRNA export and in the major mRNA decay pathway that operates in the cytoplasm, thus raising the possibility that Rpb4p links between the nuclear and cytoplasmic processes. Here we show that both Rpb4p and Rpb7p shuttle between the nucleus and the cytoplasm. Shuttling kinetics of the two proteins are similar as long as their interaction is possible, suggesting that they shuttle as a heterodimer. Under normal conditions, shuttling of Rpb4p and Rpb7p depends on ongoing transcription. However, during severe stresses of heat shock, ethanol, and starvation, the two proteins shuttle via a transcription-independent pathway. Thus, Rpb4p and Rpb7p shuttle via two pathways, depending on environmental conditions. by guest http://ec.asm.org/ Downloaded from transcription, linking the functions of Rpb4 and Rbp7 in the nucleus with those in the cytoplasm. The other operates during severe stress conditions and is independent of transcription.

Maintaining appropriate mRNAs levels is vital for any living cell. mRNA synthesis in the nucleus by RNA polymerase II core enzyme (Pol II) and mRNA decay by cytoplasmic machineries determine these levels. Yet, little is known about possible cross-talk between these processes. The yeast Rpb4/7 is a nucleo-cytoplasmic shuttling heterodimer that interacts with Pol II and with mRNAs and is required for mRNA decay in the cytoplasm. Here we show that interaction of Rpb4/7 with mRNAs and eventual decay of these mRNAs in the cytoplasm depends on association of Rpb4/7 with Pol II in the nucleus. We propose that, following its interaction with Pol II, Rpb4/7 functions in transcription, interacts with the transcript cotranscriptionally and travels with it to the cytoplasm to stimulate mRNA decay. Hence, by recruiting Rpb4/7, Pol II governs not only transcription but also mRNA decay.