Getting know to your

DATA
What is Data?
Attributes

 Collection of data objects

and their attributes Tid Refund Marital Taxable
Status Income Cheat

 An attribute is a property or 1 Yes Single 125K No

characteristic of an object 2 No Married 100K No

 Examples: eye color of a 3 No Single 70K No

person, temperature, etc. 4 Yes Married 120K No

 Attribute is also known as Objects 5 No Divorced 95K Yes

variable, field, 6 No Married 60K No

characteristic, or feature 7 Yes Divorced 220K No

 A collection of attributes 8 No Single 85K Yes

describe an object 9 No Married 75K No

 Object is also known as 10

10 No Single 90K Yes

record, point, case, sample,

entity, or instance
Attribute Values
 Attribute values are numbers or symbols assigned
to an attribute

 Distinction between attributes and attribute values

 Same attribute can be mapped to different attribute
values
 Example: height can be measured in feet or meters

 Different attributes can be mapped to the same set of

values
 Example: Attribute values for ID and age are integers
 But properties of attribute values can be different
 ID has no limit but age has a maximum and minimum
value
Types of Attributes
 There are different types of attributes
 Nominal
 Examples: ID numbers, eye color, zip codes
 Ordinal
 Examples: rankings (e.g., taste of potato chips on a
scale from 1-10), grades, height in {tall, medium,
short}
 Interval
 Examples: calendar dates, temperatures in Celsius
or Fahrenheit.
 Ratio
 Examples: temperature in Kelvin, length, time,
counts
Properties of Attribute Values
 The type of an attribute depends on which
of the following properties it possesses:
 Distinctness: = 
 Order: < >
 Addition: + -
 Multiplication: */

 Nominal attribute: distinctness

 Ordinal attribute: distinctness & order
 Interval attribute: distinctness, order &
addition
 Ratio attribute: all 4 properties
Attribute Description Examples Operations
Type

Nominal The values of a nominal attribute zip codes, employee mode, entropy,
are just different names, i.e., ID numbers, eye contingency
nominal attributes provide only color, sex: {male, correlation, 2 test
enough information to distinguish female}
one object from another. (=, )

Ordinal The values of an ordinal attribute hardness of minerals, median,

provide enough information to {good, better, best}, percentiles, rank
order objects. (<, >) grades, street correlation, run
numbers tests, sign tests

Interval For interval attributes, the calendar dates, mean, standard

differences between values are temperature in deviation,
meaningful, i.e., a unit of Pearson's
measurement exists.
Celsius or
correlation, t and
(+, - ) Fahrenheit
F tests
Ratio For ratio variables, both temperature in geometric mean,
Kelvin, monetary harmonic mean,
differences and ratios are
quantities, counts, percent variation
meaningful. (*, /) age, mass, length,
electrical current
Attribute Transformation Comments
Level

Nominal Any permutation of values If all employee ID numbers

were reassigned, would it
make any difference?

Ordinal An order preserving change of An attribute encompassing

values, i.e., the notion of good, better
new_value = f(old_value) best can be represented
where f is a monotonic function. equally well by the values
{1, 2, 3} or by { 0.5, 1,
10}.
Interval new_value =a * old_value + b Thus, the Fahrenheit and
where a and b are constants Celsius temperature scales
differ in terms of where
their zero value is and the
size of a unit (degree).

Ratio new_value = a * old_value Length can be measured in

meters or feet.
Discrete and Continuous Attributes
 Discrete Attribute
 Has only a finite or countably infinite set of values
 Examples: zip codes, counts, or the set of words in a
collection of documents
 Often represented as integer variables.
 Note: binary attributes are a special case of discrete
attributes

 Continuous Attribute
 Has real numbers as attribute values
 Examples: temperature, height, or weight.
 Practically, real values can only be measured and
represented using a finite number of digits.
 Continuous attributes are typically represented as
floating-point variables.
Types of data sets
 Record
 Data Matrix
 Document Data
 Transaction Data

 Graph
 World Wide Web
 Molecular Structures

 Ordered
 Spatial Data
 Temporal Data
 Sequential Data
 Genetic Sequence Data
Record Data
 Data that consists of a collection of
records, each of which consists of a fixed
set of attributes Tid Refund Marital Taxable
Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
Data Matrix
 If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as points
in a multi-dimensional space, where each dimension
represents a distinct attribute

 Such data set can be represented by an m by n matrix,

where there are m rows, one for each object, and n
columns, one for each attribute

Projection Projection Distance Load Thickness

of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1
Document Data
 Each document becomes a `term' vector,
 each term is a component (attribute) of the vector,
 the value of each component is the number of times the
corresponding term occurs in the document.

timeout

season
coach

game
score
team

ball

lost
pla

wi
n
y

Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0
Transaction Data
 A special type of record data, where
 each record (transaction) involves a set of items.
 For example, consider a grocery store. The set of
products purchased by a customer during one shopping
trip constitute a transaction, while the individual
products that were purchased are the items.

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
Graph Data
 Examples: Generic graph and HTML Links
<a href="papers/papers.html#bbbb">
Data Mining </a>
<li>
2 <a href="papers/papers.html#aaaa">
Graph Partitioning </a>
<li>
5 1 <a href="papers/papers.html#aaaa">
Parallel Solution of Sparse Linear System of Equations </a>
<li>
2 <a href="papers/papers.html#ffff">
N-Body Computation and Dense Linear System Solvers
5
Chemical Data
 Benzene Molecule: C6H6
Ordered Data
 Sequences of transactions
Items/Events

An element of the
sequence
Ordered Data
 Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
Ordered Data

 Spatio-Temporal Data

Average Monthly
Temperature of land
and ocean
Summary Statistics
 Summary statistics are numbers that
summarize properties of the data

 Summarized properties include frequency,

location and spread
 Examples: location - mean
spread - standard deviation

 Most summary statistics can be calculated in a

single pass through the data
Frequency and Mode
 The frequency of an attribute value is the
percentage of time the value occurs in the
data set
 For example, given the attribute ‘gender’ and a
representative population of people, the gender
‘female’ occurs about 50% of the time.
 The mode of a an attribute is the most
frequent attribute value
 The notions of frequency and mode are
typically used with categorical data
 Percentiles
 For continuous data, the notion of a
percentile is more useful.
Given an ordinal or continuous attribute
x and a number p between 0 and 100, the
pth percentile is a value x p of x such that
p% of the observed values of x are less
than x p .
 For instance, the 50th percentile is the
value x50% such that 50% of all values of x
 are less than x50% .
Measures of Location: Mean and
Median
 The mean is the most common measure of the
location of a set of points.
 However, the mean is very sensitive to outliers.
 Thus, the median or a trimmed mean is also
commonly used.
Measures of Spread: Range and
Variance
 Range is the difference between the max and min
 The variance or standard deviation is the most
common measure of the spread of a set of points.

 However, this is also sensitive to outliers, so that

other measures are often used.
Visualization Techniques: Histograms
 Histogram
 Usually shows the distribution of values of a single variable
 Divide the values into bins and show a bar plot of the number of objects
in each bin.
 The height of each bar indicates the number of objects
 Shape of histogram depends on the number of bins
 Example: Petal Width (10 and 20 bins, respectively)
Visualization Techniques: Box Plots
 Box Plots outlier

 Invented by J. Tukey
Another way of
10th percentile

displaying the
distribution of data
 Following figure 75th percentile

shows the basic part 50th percentile

of a box plot 25th percentile

10th percentile
Similarity and Dissimilarity
 Similarity
 Numerical measure of how alike two data objects are.
 Is higher when objects are more alike.
 Often falls in the range [0,1]
 Dissimilarity
 Numerical measure of how different are two data objects
 Lower when objects are more alike
 Minimum dissimilarity is often 0
 Upper limit varies
 Proximity refers to a similarity or dissimilarity
Similarity/Dissimilarity for Simple Attributes
p and q are the attribute values for two data objects.
Euclidean Distance

 Euclidean Distance
n
dist  ( p
k 1
k  qk ) 2

Where n is the number of dimensions (attributes) and

pk and qk are, respectively, the kth attributes
(components) or data objects p and q.

 Standardization is necessary, if scales differ.

Euclidean Distance

3
point x y
2 p1 p1 0 2
p3 p4 p2 2 0
1 p3 3 1
p2 p4 5 1
0
0 1 2 3 4 5 6

p1 p2 p3 p4
p1 0 2.828 3.162 5.099
p2 2.828 0 1.414 3.162
p3 3.162 1.414 0 2
p4 5.099 3.162 2 0
Distance Matrix
Minkowski Distance

 Minkowski Distance is a generalization of

Euclidean Distance
1
n
dist  (  | pk  qk r r
|)
k 1
Where r is a parameter, n is the number of dimensions
(attributes) and pk and qk are, respectively, the kth
attributes (components) or data objects p and q.
Minkowski Distance: Examples
 r = 1. City block (Manhattan, taxicab, L1 norm)
distance.
 A common example of this is the Hamming distance, which is
just the number of bits that are different between two binary
vectors

 r = 2. Euclidean distance

 r  . “supremum” (Lmax norm, L norm) distance.

 This is the maximum difference between any component of the
vectors

 Do not confuse r with n, i.e., all these distances

are defined for all numbers of dimensions.
Minkowski Distance
L1 p1 p2 p3 p4
p1 0 4 4 6
p2 4 0 2 4
p3 4 2 0 2
p4 6 4 2 0

point x y L2 p1 p2 p3 p4
p1 0 2 p1 0 2.828 3.162 5.099
p2 2 0 p2 2.828 0 1.414 3.162
p3 3 1 p3 3.162 1.414 0 2
p4 5 1 p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5
p2 2 0 1 3
p3 3 1 0 2
p4 5 3 2 0
Distance Matrix
Mahalanobis Distance

mahalanobis( p, q)  ( p  q) 1( p  q)T

 is the covariance matrix of the

input data X

1 n
 j ,k   ( X ij  X j )( X ik  X k )
n  1 i 1

For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.

Mahalanobis Distance
Covariance Matrix:

 0.3 0.2
C
 
 0. 2 0. 3
B A: (0.5, 0.5)
B: (0, 1)
A C: (1.5, 1.5)

Mahal(A,B) = 5
Mahal(A,C) = 4
Common Properties of a Distance
 Distances, such as the Euclidean
distance, have some well known
properties.
1. d(p, q)  0 for all p and q and d(p, q) = 0 only if
p = q. (Positive definiteness)
2. d(p, q) = d(q, p) for all p and q. (Symmetry)
3. d(p, r)  d(p, q) + d(q, r) for all points p, q, and r.
(Triangle Inequality)
where d(p, q) is the distance (dissimilarity)
between points (data objects), p and q.

 A distance that satisfies these

properties is a metric
Common Properties of a Similarity

 Similarities, also have some well known

properties.
1. s(p, q) = 1 (or maximum similarity) only if p = q.

2. s(p, q) = s(q, p) for all p and q. (Symmetry)

where s(p, q) is the similarity between points

(data objects), p and q.
Similarity Between Binary Vectors
 Common situation is that objects, p and q,
have only binary attributes
 Compute similarities using the following
quantities
M01 = the number of attributes where p was 0 and q was 1
M10 = the number of attributes where p was 1 and q was 0
M00 = the number of attributes where p was 0 and q was 0
M11 = the number of attributes where p was 1 and q was 1

 Simple Matching and Jaccard Coefficients

SMC = number of matches / number of attributes
= (M11 + M00) / (M01 + M10 + M11 + M00)

J = number of 11 matches / number of not-both-zero attributes values

= (M11) / (M01 + M10 + M11)
SMC versus Jaccard: Example
p= 1000000000
q= 0000001001

M01 = 2 (the number of attributes where p was 0 and q was 1)

M10 = 1 (the number of attributes where p was 1 and q was 0)
M00 = 7 (the number of attributes where p was 0 and q was 0)
M11 = 0 (the number of attributes where p was 1 and q was 1)

SMC = (M11 + M00)/(M01 + M10 + M11 + M00) = (0+7) /

(2+1+0+7) = 0.7

J = (M11) / (M01 + M10 + M11) = 0 / (2 + 1 + 0) = 0

Cosine Similarity
 If d1 and d2 are two document vectors, then
cos( d1, d2 ) = (d1  d2) / ||d1|| ||d2|| ,
where  indicates vector dot product and || d || is the length of vector
d.

 Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2

d1  d2= 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 +
0*2 = 5
||d1|| = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0)0.5 = (42)
0.5 = 6.481

||d2|| = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6)

0.5 = 2.245

cos( d1, d2 ) = .3150

Extended Jaccard Coefficient (Tanimoto)

 Variation of Jaccard for continuous or

count attributes
 Reduces to Jaccard for binary attributes