nutrients

Article
Yogurt Alleviates Cyclophosphamide-Induced
Immunosuppression in Mice through D-Lactate
Xinru Du 1,2, *, Yongheng Yan 3, *, Yufeng Dai 1,2 and Ruijie Xu 4

1 State Key Laboratory of Food Science and Resources, Jiangnan University, Wuxi 214122, China;
[email protected]
2 School of Food Science and Technology, Jiangnan University, Wuxi 214122, China
3 School of Public Health, Shandong First Medical University, Jinan 271016, China
4 Global Health Institute, School of Public Health, Xi’an Jiaotong University, Xi’an 710061, China;
[email protected]
* Correspondence: [email protected] (X.D.); [email protected] (Y.Y.)

Abstract: Numerous studies have investigated the immunomodulatory effects of yogurt, but the
underlying mechanism remained elusive. This study aimed to elucidate the alleviating properties
of yogurt on immunosuppression and proposed the underlying mechanism was related to the
metabolite D-lactate. In the healthy mice, we validated the safety of daily yogurt consumption
(600 µL) or D-lactate (300 mg/kg). In immunosuppressed mice induced by cyclophosphamide (CTX),
we evaluated the immune regulation of yogurt and D-lactate. The result showed that yogurt restored
body weight, boosted immune organ index, repaired splenic tissue, recovered the severity of delayed-
type hypersensitivity reactions and increased serum cytokines (IgA, IgG, IL-6, IFN-γ). Additionally,
yogurt enhanced intestinal immune function by restoring the intestinal barrier and upregulating the
abundance of Bifidobacterium and Lactobacillus. Further studies showed that D-lactate alleviated
immunosuppression in mice mainly by promoting cellular immunity. D-lactate recovered body
weight and organ development, elevated serum cytokines (IgA, IgG, IL-6, IFN-γ), enhanced splenic
lymphocyte proliferation and increased the mRNA level of T-bet in splenic lymphocyte to bolster
Th1 differentiation. Finally, CTX is a chemotherapeutic drug, thus, the application of yogurt and
D-lactate in the tumor-bearing mouse model was initially explored. The results showed that both
yogurt (600 µL) and D-lactate (300 mg/kg) reduced cyclophosphamide-induced immunosuppression
Citation: Du, X.; Yan, Y.; Dai, Y.; Xu, R.
without promoting tumor growth. Overall, this study evaluated the safety, immune efficacy and
Yogurt Alleviates Cyclophosphamide-
Induced Immunosuppression in Mice applicability of yogurt and D-lactate in regulating immunosuppression. It emphasized the potential
through D-Lactate. Nutrients 2024, 16, of yogurt as a functional food for immune regulation, with D-lactate playing a crucial role in its
1395. https://doi.org/10.3390/ immunomodulatory effects.
nu16091395
Keywords: yogurt; D-lactate; cyclophosphamide (CTX); immunosuppression; gut microbiota
Academic Editors: Emilia
Vassilopoulou and Bowen Li

Received: 3 February 2024

Revised: 29 April 2024 1. Introduction
Accepted: 1 May 2024
Cyclophosphamide (CTX) is a broad-spectrum anticancer drug. It exerts the effects by
Published: 6 May 2024
interfering with the DNA synthesis of tumor cells, thereby inhibiting their proliferation
and survival. However, while killing tumor cells, CTX also exhibits toxic side effects of im-
munosuppression [1,2]. CTX suppresses the immune system through diverse mechanisms,
Copyright: © 2024 by the authors.
including encompassing the inhibition of immune cell functionality, attenuation of immune
Licensee MDPI, Basel, Switzerland. responses in T cells and B cells, as well as modulation of immune globulins, chemokines,
This article is an open access article and cytokines [3]. Immunosuppression is correlated with various chronic diseases, such
distributed under the terms and as infections and cancers [4]. Furthermore, an imbalance of immune regulation results in
conditions of the Creative Commons gastrointestinal inflammation and intestinal flora disorders [5,6]. Therefore, it is imperative
Attribution (CC BY) license (https:// to identify effective strategies for preventing and alleviating immunosuppression.
creativecommons.org/licenses/by/ Yogurt is a typical functional food. Epidemiological studies have revealed that yogurt
4.0/). can decrease the incidence of type 2 diabetes, metabolic syndrome and heart disease [7–10].

Nutrients 2024, 16, 1395. https://doi.org/10.3390/nu16091395 https://www.mdpi.com/journal/nutrients

Nutrients 2024, 16, 1395 2 of 14

Previous researches on the immunoregulation of yogurt have focused on bioactive nutrients,

such as fat acids, phytosterols, proteins, vitamins and probiotics [7,11,12]. However, D-
lactate has been almost ignored as a byproduct of bacteria fermentation in yogurt. D-lactate
is a configuration of chiral lactate. D-lactate typically has two origins in the human body. A
portion is the dietary intake digested by bacteria in conventional foods, such as yogurt or
pickles [13,14]. Lactobacillus bulgaricus can convert 90% of pyruvate into D-lactate [14]
during yogurt manufacturing. Endogenous D-lactate is processed by closely related gut
bacteria [15]. According to prevailing research, it is widely accepted that the human body
exclusively harbors L-lactate dehydrogenase, which possesses rapid metabolic capacity
towards L-lactate, while lacking D-lactate dehydrogenase. Consequently, the elevated
concentration of D-lactate in plasma results in the acidosis. However, our recent research
has demonstrated the daily intake of 2000 mg/kg of D-lactate does not affect the normal
growth of mice. Furthermore, in comparison to L-lactate, D-lactate exhibits stronger anti-
inflammatory properties due to its pharmacokinetic advantages [16]. Additionally, the
recent study also reports that D-lactate plays a crucial role in preventing colitis-associated
colon cancer in yogurt [17]. Hence, D-lactate is plausibly a potential dietary nutrient factor.
This research studies the actions of yogurt on immunosuppression by constructing
three animal models (healthy mice, immunosuppressive mice and tumor-bearing mice),
through D-lactate-dependent mechanisms. This study provides novel insights into alleviat-
ing immunosuppression and supports the benefits of traditional fermented foods and the
development of D-lactate.

2. Materials and Methods

2.1. Chemicals and Reagents
Cyclophosphamide and Levamisole hydrochloride (LM) were sourced from Aladdin.
D-sodium lactate, ConA and LPS were purchased from Sigma-Aldrich Co., St. Louis, MO,
USA. Kits for measuring creatinine (CRE), urea nitrogen (BUN), aspartate aminotransferase
(AST), and alanine aminotransferase (ALT) were acquired from the Nanjing Jiancheng
Institute of Biological Engineering (Nanjing, China). Sheep red blood cells (SRBC) were
obtained from Nanjing Senbeijia Biological Co., Ltd. (Nanjing, China). Spleen lymphocyte
extraction kit was purchased from Beijing Solarbio Science & Technology Co., Ltd. (Beijing,
China). CCK-8 Cell Counting Kit was purchased from Nanjing Vazyme Biotech Co., Ltd.
(Nanjing, China). IgA, IgG, IL-4, IL-6, and IFN-γ Elisa kits were purchased from R&D
systems. The CT26 cell line was derived from the American Type Culture Collection (ATCC)
(maintained in a humidified incubator at 37 ◦ C and 5% CO2 ).

2.2. Yogurt Preparation

A simulated commercial yogurt was prepared according to a previous study [18,19].
Lactobacillus bulgaricus and Streptococcus thermophilus bacterial strains were mixed in a
1:1 ratio and incubated at 39 ◦ C for 18 h in 10% skim milk, followed by a 24h incubation
at 4 ◦ C. At the end of this process, the total viable count was 9.16 lg (CFU/mL) consistent
with the former research [20].

2.3. Determination of D-Lactate in Yogurt by High-Performance Liquid Chromatography (HPLC)

The sample pretreatment was drawing upon established approache with moderate
modification [21]. Samples were centrifuged at 12,000 r/min for 15 min. Subsequently,
10% trichloroacetic acid was added to the samples and allowed to react for two hours
before being centrifuged at 12,000 r/min for 20 min. Following this, the samples were
filtered using a 0.22 µm filtration membrane and degassed through ultrasonic means before
analysis with HPLC. The separation of L-lactate and D-lactate was achieved by Chirex 3126
(D) penicillamine LC Column [21,22].
Nutrients 2024, 16, 1395 3 of 14

2.4. Animal Experiment

Female SPF BALB/c mice weighing approximately 20.0 ± 2.0 g and aged 7 weeks
were procured from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing,
China). The mice were housed in cage and a controlled environment with a temper-
ature of 22 ± 2 ◦ C, a humidity of 50 ± 10%, and a 12-light-dark cycle, following the
Guidelines for Keeping Experimental Animals issued by the Chinese government. The
Experimental Animal Welfare and Ethics Committee of Jiangnan University approved the
study (license numbers JN.No20220315c0900425(012), JN.No20220615c0801001(198) and
JN.No20221130b07002209467).

2.4.1. Animal Experiment I

After seven days of adaptive feeding, total of 42 mice aged 5-week-old were randomly
assigned to 6 groups, with 7 mice per group. Daily records were maintained for the baseline
condition and body weight of the mice for 22 days. Based on animal welfare principles,
at the end of the experiment, the liver, spleen, and thymus were extracted and weighed
for calculation. The toxicological evaluation of yogurt and D-lactate was conducted by
assessing hepatic function (represented by ALT and AST) and renal function (represented
by BUN and CRE). CRE, BUN, AST, and ALT levels were measured using appropriate kits
and following the manufacturer’s instructions.

2.4.2. Animal Experiment II

After seven days of adaptive feeding, total of 108 mice aged 7-week-old mice were
randomly assigned to 9 groups, with 12 mice per group. In each treatment group, immuno-
suppression was induced by intraperitoneal injection of CTX (80 mg/kg) for 3 days. The
successful establishment of an immunosuppression model was recognized when the body
weight of the mice decreased by 15% of the original. Different doses of yogurt and D-lactate
were supplied during the following days. Based on animal welfare principles, on day 17 of
the experiment, 6 mice were randomly selected to inject intraperitoneally with 0.2 mL of 5%
(v/v) sheep red blood cells (SRBC). After four days, serum was collected from the eye orbit
for the HC50 value assessment. Simultaneously, 20 µL of 20% (v/v) SRBC was injected into
the right hindfoot pad for the measurement of the delayed-type hypersensitivity (DTH)
reaction. Serum, spleen, thymus, and fecal samples were collected for biochemical analysis
at the end of the experiment.

2.4.3. Animal Experiment III

After seven days of adaptive feeding, total of 70 mice aged 7-week-old mice were
randomly assigned to 7 groups, with 10 mice per group. For the tumor-bearing model,
after adjusting the CT26 cell at the logarithmic growth phase suspension to a concentration
of 1 × 106 cells/mL with PBS, the cell suspension was inoculated subcutaneously into the
right axilla of mice, with a dose of 0.2 mL per mouse. The mice were then bred for seven
days, and those who developed a tumor volume of about 50 ± 16 mm3 were deemed to
have successfully established models [23]. Subsequently, the mice were injected with CTX
every three days and orally administered yogurt and D-lactate daily. Daily observations
were made of the behavior, body weight, and tumor size of all mice. At the end of the test,
the tumor volume did not exceed the ethical limits. Based on animal welfare principles,
serum, spleen, thymus, and tumor tissues were collected for biochemical analysis at the
end of the experiment.

2.5. Methods for Physiological and Pathological Analysis

2.5.1. ELISA Assay
The IL-4, IL-6, IFN-γ, IgA, and IgG cytokines were measured using a commercial
ELISA kit and following the manufacturer’s protocols.
Nutrients 2024, 16, 1395 4 of 14

2.5.2. Histopathological Staining

The sample tissues were fixed overnight at room temperature with 10% formaldehyde,
washed with distilled water, subjected to dehydration using a gradient of alcohol, and
embedded in paraffin wax. Paraffin-embedded slices were stained. Images were taken
using a light microscope.

2.5.3. RT-qPCR Analysis

Total RNA was extracted using a Trizol reagent and assessed for purity and integrity
through NanoDrop and gel electrophoresis. RNA was converted to cDNA using a reverse
transcription kit. Gene expression levels were evaluated using a real-time quantitative PCR
system. Gene-specific primers were listed in Table 1. The relative quantification of the
target gene was determined by comparing it to β-actin and calculating the results using the
2−∆∆Ct method [24].

Table 1. Primer sequences.

Genes Primer Forward Primer Reverse

MUC-2 GATTCGAAGTGAAGAGCAAG CACTTGGAGGAATAAACTGG
Claudin5 GAGAGGAACTACCCTTATGCC ATTGAGTAATTAAACGGGACAGG
T-bet CGTTTCTACCCCGACCTTCC ATGCTCACAGCTCGGAACTC
GATA-3 AAGCTCAGTATCCGCTGACG GATACCTCTGCACCGTAGCC
Bax ACAGATCATGAAGACAGGGG CAAAGTAGAAGAGGGCAACC
Bcl-2 ATGTGTGTGGAGAGCGTCAAC AGACAGCCAGGAGAAATCAAAC
β-actin TGCTCTCCCTCACGCCATC GAGGAAGAGGATGCGGCAGT

2.5.4. Proliferation Assay of Splenic Lymphocytes

Mouse spleens were aseptically removed, and lymphocytes were collected using the
Animal Splenic Lymphocyte Isolation Kit from Beijing Solarbio Science & Technology Co.,
Ltd. (Beijing, China). [25]. Cells were incubated in 96-well plates with ConA (10 µg/mL)
and LPS (5 µg/mL) for 24 h, followed by treatment with CCK-8 solution and another 2 h
incubation [26]. The absorbance measurement at 450 nm was quantified using a Thermo
Scientific Varioskan Flash spectrophotometer (Waltham, Massachusetts, America).

2.5.5. Delayed-Type Hypersensitivity (DTH)

On day 17 of the experiment, 0.2 mL of 5% (v/v) SRBC was injected intraperitoneally
into the mice, and the thickness of the right hindfoot pad was measured utilizing vernier
calipers. Four days after the initial injection, 20 µL of 20% (v/v) SRBC was administered to
the right hindfoot pad. The resulting increase in footpad thickness was determined 24 h
after the second injection and utilized as an indicator of DTH.

2.5.6. Serum Hemolysin

Mice were received an injection of 0.2 mL of 5% (v/v) SRBC, and after four days, serum
was obtained from blood collected from their eye orbit. The serum was diluted with SA
buffer (1:5) and added to a 96-well culture plate with a control buffer. Then, SRBC and
guinea pig serum were added to each well, and the supernatant was mixed with Drabkin’s
solution. After resting for 10 min, the optical density of each well was measured at 540 nm
using an automatic microplate reader to evaluate serum hemolysin levels.

2.5.7. Gut Microbiota Analysis

DNA was extracted from the cecal contents using the FastDNA™ Spin Kit for Feces.
Agarose electrophoresis was used to detect gDNA integrity and nucleic acid concentration.
PCR was performed using universal primer pairs on the V3–V4 high variant region of
the bacterial 16S rRNA gene [27]. The 16SrDNA sequence data were processed using
QIME V19.1 to remove any raw sequences that did not meet specific criteria. High-quality
reads were selected for bioinformatics analysis, and operational taxonomic units (OTUs)
Nutrients 2024, 16, 1395 5 of 14

were formed by clustering all valid reads with similarities greater than 97%. OTUs were
classified according to the Greengenes database, and the R package was utilized for α-
diversity, β-diversity, and species screening based on the abundance of OTUs.

2.6. Statistical Analyses

Statistical analyses were performed using GraphPad Prism 8.0. A one-way analysis of
variance (ANOVA), followed by the Bonferroni procedure, was applied to compare means
for multiple group comparisons. At the same time, a Student’s t-test was used to compare
two independent groups. The data were expressed as mean ± SEM, with a significance
level set at p ≤ 0.05.

3. Results
3.1. Detection of D-Lactate in Yogurt
The findings indicated a total lactate content of 15.43 mg/mL in yogurt, with the
specific D-lactate content measured at 5.90 mg/mL. After conversion, the proportion of total
lactate in yogurt was 1.50%, with the proportion of D-lactate being 0.57%. Additional details
concerning the dosage of yogurt and D-lactate were found in the supporting information
(Figure S1, Table S1).

3.2. Animal Experiment I: Toxicity Evaluation of Yogurt and D-Lactate in Healthy Mice
In Table 2, mice treated with yogurt and D-lactate maintained stable body weights
within the normal range. Yogurt (600 µL) and D-lactate (300 mg/kg) increased immune
organ indexes of the spleen and thymus without causing any toxic effects on the hepatic
(represented by ALT and AST) and renal function (represented by BUN and CRE). Compa-
rable results were observed in the Positive Control group treated with LM, a recognized
immunoregulatory compound [28]. The findings showed the oral safety of yogurt (600 µL)
and D-lacate (300 mg/kg) in healthy mice.

Table 2. Evaluation of immune efficacy and toxicity of yogurt and D-lactate in healthy mice.

Normal Positive Yogurt Yogurt D-Lactate D-Lactate

Control Control (200 µL) (600 µL) (75 mg/kg) (300 mg/kg)
Body weight (g) 28.01 ± 0.8 29.11 ± 1.2 28.31 ± 0.7 29.21 ± 0.5 27.26 ± 1.9 28.09 ± 1.1
Thymus index (%) 0.27 ± 0.06 0.36 ± 0.09 * 0.28 ± 0.12 0.32 ± 0.03 * 0.28 ± 0.04 0.38 ± 0.02 *
Spleen index (%) 0.32 ± 0.05 0.42 ± 0.12 * 0.38 ± 0.17 * 0.40 ± 0.19 * 0.32 ± 0.09 0.40 ± 0.10 *
Liver index (%) 4.31 ± 0.21 4.51 ± 0.09 4.33 ± 0.19 4.68 ± 0.16 4.53 ± 0.14 4.61 ± 0.08
BUN (mmol/L) 10.09 ± 0.19 10.13 ± 0.31 10.01 ± 0.46 10.32 ± 0.36 10.16 ± 0.21 10.11 ± 0.31
CRE (µmol/L) 44.03 ± 1.91 45.21 ± 2.31 42.91 ± 3.33 44.19 ± 2.98 42.98 ± 1.08 43.26 ± 0.09
ALT (IU/L) 38.21 ± 3.41 42.87 ± 2.12 40.23 ± 3.61 41.87 ± 1.97 42.09 ± 2.71 40.98 ± 3.01
AST (IU/L) 129.23 ± 23.12 136.21 ± 11.21 132.98 ± 31.21 138.12 ± 29.12 119.21 ± 38.24 129.12 ± 31.36
* p < 0.05 vs. Normal Control.

3.3. Animal Experiment II: Evaluation of Immune Efficacy of Yogurt and D-Lactate in
Immunosuppressive Mice Induced by CTX
3.3.1. Yogurt Supplementation Ameliorated CTX-Induced Immunosuppression in Mice
The experimental design was displayed (Figure 1A). Yogurt dose-dependently re-
covered the body weight (Figure 1B) and facilitated the growth of spleen and thymus
compared to the MC group (Figure 1C). The spleen of the MC group exhibited the reduced
number of splenic corpuscles and lymphocytes, dispersed germinal centers, and the unclear
distinction between the red and white pulp. However, this trend was reversed upon yogurt
administration (Figure 1D). Besides these analyses, the yogurt administration resulted in
a dose-dependent increase in serum IgA, IgG, IFN-γ, and IL-6 levels (Figure 1E–H). The
DTH reaction exhibited similar alterations. Treatment with medium or high dosages of
yogurt resulted in a significant increase in footpad thickness compared to the MC group
(Figure 1I).
 clear distinction between the red and white pulp. However, this trend was reversed upon
yogurt administration (Figure 1D). Besides these analyses, the yogurt administration re-
sulted in a dose-dependent increase in serum IgA, IgG, IFN-γ, and IL-6 levels (Figure 1E–
H). The DTH reaction exhibited similar alterations. Treatment with medium or high dos-
Nutrients 2024, 16, 1395 6 ofMC
14
ages of yogurt resulted in a significant increase in footpad thickness compared to the
group (Figure 1I).

Figure1.1.Yogurt
Figure Yogurtsupplementation
supplementation ameliorated
ameliorated CTX-induced
CTX-induced immunosuppression
immunosuppression in mice.
in mice. (A) (A) Ex-
Exper-
perimental
imental design.
design. NC:NC:
thethe normal
normal control
control group;
group; MC:MC: the
the modelcontrol
model controlgroup
group(cyclophosphamide,
(cyclophosphamide,
80 mg/kg bw); PC: the positive control group (levamisole hydrochloride, 40 mg/kg bw); LY: Low-
dose of yogurt group (200 µL); MY: Medium-dose of yogurt group (400 µL); HY: High-dose of yogurt
group (600 µL). (B) Body weight. (C) Spleen and thymus indexes. (D) Histopathology observation
of the spleen (original magnification: ×5 and ×40). (E–H) Serum cytokines of IgA, IgG, IL-6 and
IFN-γ. (I) DTH reaction and Metatarsal swelling, ** p < 0.01 and *** p < 0.005 vs. NC group. # p < 0.05,
## p < 0.01 and ### p < 0.005 vs. MC group.

3.3.2. Yogurt Supplementation Regulated Intestinal Immunity and Gut Microbiota in

CTX-Induced Mice
As was showed in Figure 2, the standard group showed typical glandular structures
and slender villi arranged tightly and completely in the intestines. In contrast, the MC group
suffered from significant injury to the intestinal wall, featuring shortened and detached
villi. However, the medium and high dosage of yogurt groups exhibited restored villi
length (Figure 2A). Yogurt upregulated the expression of MUC-2 (Figure 2B) and claudin5
 Nutrients 2024, 16, 1395 7 of 14

(Figure 2C), enhancing the integrity of the intestinal barrier. The detected biomarkers of
the ratio of IL-4 and IFN-γ related to immune responses in the intestine were significantly
improved by yogurt (Figure 2D). Data from the α-diversity (Figure 2E) of Chao1, Shannon,
Simpson and ACE index indicated that yogurt modulated the overall diversity of gut
microbiota. The β-diversity analysis showed that the gut microbiota composition in yogurt
group was distinct from the NC and MC groups (Figure 2F), characterized by 4187 unique
OTUs (Figure 2G). At the phylum level, the ratio of Firmicutes to Bacteroidetes (F/B)
was a biomarker to assess pathological status. F/B tended to increase moderately by
yogurt supplementation (Figure 2H). At the genus level, according to the heat map analysis
(Figure 2I), yogurt consumption resulted in a dominate abundance of beneficial bacteria of
Lactobacillus, Streptococcus, Bifidobacterium, Akkermansia and Ruminococcus. Yogurt
especially increased the abundance of Bifidobacterium and Lactobacillaceae (Figure 2I,J).
In addition, it mitigated the harmful bacteria such as Desulfovibrio, Staphylococcus, and
Escherichia. We examined the D-lactate level by HPLC in the gut contents to assess the
Nutrients 2024, 16, x FOR PEER REVIEW 8 of 16
potential involvement of D-lactate in intestinal immunity. The results showed high D-lactate
levels in the feces of yogurt groups but minimal changes in D-lactate groups (Figure 2K).

Figure 2. Cont.
Nutrients 2024, 16, 1395 8 of 14

Figure 2. Yogurt supplementation regulated intestinal immunity and gut microbiota in CTX-induced
Figure 2. Yogurt supplementation regulated intestinal immunity and gut microbiota in CTX-in-
mice. NC: the normal control group; MC: the model control group (cyclophosphamide, 80 mg/kg
duced mice. NC: the normal control group; MC: the model control group (cyclophosphamide, 80
bw); PC: the positive control group (levamisole hydrochloride, 40 mg/kg bw); LY: Low-dose of
yogurt group (200 µL); MY: Medium-dose of yogurt group (400 µL); HY: High-dose of yogurt group
(600 µL); LD: Low-dose of D-lactate group (75 mg/kg bw); MD: Medium-dose of D-lactate group
(150 mg/kg bw); HD: High-dose of D-lactate group (300 mg/kg bw). (A) Histopathology observation
of the ileum tissue (original magnification: ×25). (B) Relative mRNA level of MUC-2. (C) Relative
mRNA level of claudin5. (D) Cytokines of IFN-γ/IL-4 in ileum tissue. (E) Alpha diversity of Chao 1,
Shannon, Simpson and ACE indexes. (F,G) PCA and Venn diagram of gut microbiota. (H) The ratio
of Firmicutes to Bacteroidetes abundance. (I) Heatmap. (J) The relative abundance of Bifidobacterium
and Lactobacillus. (K) The D-lactate concentration in feces. * p < 0.05, ** p < 0.01 and *** p < 0.005 vs.
NC group. # p < 0.05, ## p < 0.01 and ### p < 0.005 vs. MC group.

3.3.3. D-Lactate Supplementation Ameliorated Immunosuppression in CTX-Induced Mice

The experimental design was displayed (Figure 3A). The mice administered with
D-lactate showed a significant increase in body weight (Figure 3B) and organ development
(Figure 3C) dose-dependently. D-lactate ameliorated splenic tissue damage induced by
CTX (Figure 3D). Furthermore, splenic lymphocytes were isolated and stimulated by ConA
and LPS in vitro to assess transformation capacity of T cells and B cells respectively. The
splenic lymphocyte proliferation was measured by SI values. The result indicated that
treatment with D-lactate significantly boosted the ConA-stimulated proliferation responses
of T cells in immunosuppressive mice (Figure 3E). No similar results were observed in
LPS-stimulated proliferation responses of B cells. The results demonstrated that CTX
caused a decrease in the relative mRNA expression levels of T-bet, GATA3, Foxp3, and
RORγt in splenic lymphocytes mice. The medium and high dosage of D-lactate increased
T-bet mRNA level (Figure 3F), while only the high dosage of D-lactate increased GATA3
mRNA level in splenic lymphocytes (Figure 3G). However, no alteration was observed in
the expression level of Foxp3 (Figure 3H) and RORγt (Figure 3I). CTX inhibited immune
cell cytokine production and resulting in immunosuppression. However, the suppression
of cytokine levels (Figure 3J–M) was significantly eased by D-lactate. The HC50 values
were used to assess murine humoral immune function, as reflected by the serum hemolysin
index [29]. The levels of HC50 were not differentially affected by the three D-lactate
treatments (Figure 3N).
Nutrients 2024, 16, 1395
Nutrients 2024, 16, x FOR PEER REVIEW 9 of10
14 of 16

Figure
Figure 3. D-lactate 3. D-lactate supplementation
supplementation ameliorated immunosuppression
ameliorated immunosuppression in CTX-induced
in CTX-induced mice. (A)mice.
Ex- (A)
Experimental design. NC: the normal control group; MC: the model control group (cyclophospha-
perimental design. NC: the normal control group; MC: the model control group (cyclophosphamide,
mide, 80 mg/kg bw); PC: the positive control group (levamisole hydrochloride, 40 mg/kg bw); LD:
80 mg/kg bw); Low-dose
PC: the positive control
of D-lactate groupgroup (levamisole
(75 mg/kg bw); MD:hydrochloride,
Medium-dose of40 mg/kggroup
D-lactate bw);(150
LD:mg/kg
Low-bw);
dose of D-lactate group
HD: (75 mg/kg
High-dose bw); group
of D-lactate MD: Medium-dose
(300 mg/kg bw).of D-lactate
(B) group
Body weight. (C)(150 mg/kg
Spleen bw); HD:
and thymus indexes.
(D) Histopathology
High-dose of D-lactate group (300 observation
mg/kg bw). of the(B)
spleen
Body(original
weight.magnification:
(C) Spleen and×5 and ×40). (E)
thymus Stimulating
indexes.
index (SI). (F-I) Relative mRNA level of T-bet, GATA3, Foxp3 and RORγt. (J-M) Serum cytokines of
(D) Histopathology observation of the spleen (original magnification: ×5 and ×40). (E) Stimulating
IgA, IgG, IL-6 and IFN-γ. (N) Serum half hemolysis value (HC50), ** p < 0.01 and *** p < 0.005 vs. NC
index (SI). (F–I)group.
Relative# p <mRNA
0.05, ## plevel
< 0.01ofand
T-bet,
### p GATA3,
< 0.005 vs.Foxp3 and RORγt. (J–M) Serum cytokines of
MC group.
IgA, IgG, IL-6 and IFN-γ. (N) Serum half hemolysis value (HC50 ), ** p < 0.01 and *** p < 0.005 vs. NC
group. # p < 0.05,
3.4.##Animal
p < 0.01 and ### p <
Experiment III:0.005
Evaluation
vs. MCofgroup.
Immune Efficacy of Yogurt and D-Lactate in CT26
Tumor-Bearing Mice
3.4. Animal Experiment III: Evaluation
The experimental of Immune
design Efficacy (Figure
was displayed of Yogurt and
4A). D-Lactate
Yogurt in CT26
effectively ameliorated
Tumor-Bearing Mice
CTX-induced body weight loss in CT26 tumor-bearing mice (Figure 4B). Yogurt restored
The experimental design was (Figure
the organ development displayed (Figure
4C) and 4A). Yogurt
promoted effectively
the cytokine secretionameliorated
of IL-6 and IFN-
CTX-inducedγbody weight
(Figure 4D) inloss in CT26 tumor-bearing
tumor-bearing mice
mice treated with (Figure
CTX. 4B). Yogurt
The tumor restored
tissue (Figure 4E) and
the analysis of tumor weight on the day 20 (Figure 4F) revealed that
the organ development (Figure 4C) and promoted the cytokine secretion of IL-6 and IFN-γ the tumor inhibition
(Figure 4D) inrates of the CTX and
tumor-bearing C + treated
mice Y groupswith
wereCTX.
68.02 The
± 5.6% and 71.34
tumor ± 4.8%,
tissue respectively.
(Figure 4E) and The
Bax/Bcl-2 ratio expression of colorectal cancer was enhanced with the
the analysis of tumor weight on the day 20 (Figure 4F) revealed that the tumor inhibition statistical difference
rates of the CTX and C + Y groups were 68.02 ± 5.6% and 71.34 ± 4.8%, respectively. The
Bax/Bcl-2 ratio expression of colorectal cancer was enhanced with the statistical difference
in the CTX and C + Y groups compared to the control group (Figure 4G). This observation
suggests that yogurt consumption did not compromise the antitumor efficacy of CTX.
Similarly, the experimental design of D-lactate was displayed (Figure 4H). Significant
Nutrients 2024, 16, x FOR PEER REVIEW 11 of 16

Nutrients 2024, 16, 1395 10 of 14

in the CTX and C + Y groups compared to the control group (Figure 4G). This observation
suggests that yogurt consumption did not compromise the antitumor efficacy of CTX.
Similarly, the experimental design of D-lactate was displayed (Figure 4H). Significant var-
variations in body weight were observed among the groups (Figure 4I). The C + D group
iations in body weight were observed among the groups (Figure 4I). The C + D group
enhanced organ index (Figure 4J) and cytokine secretion levels (Figure 4K) compared to the
enhanced organ index (Figure 4J) and cytokine secretion levels (Figure 4K) compared to
CTX group. D-lactate did not impact the antitumor effectiveness of CTX, as evidenced by
the CTX group. D-lactate did not impact the antitumor effectiveness of CTX, as evidenced
tumorgrowth
by tumor growth inhibition
inhibition rates
rates of 70.28%
of 70.28% ± 2.6%
± 2.6% for thefor
C the
+ DC + D (Figure
group group (Figure 4L,M) and the
4L,M) and
promotion of tumor apoptosis (Figure 4N). In summary, yogurt and D-lactate
the promotion of tumor apoptosis (Figure 4N). In summary, yogurt and D-lactate allevi- alleviated the
ated the immunosuppressive effect of CTX in tumor-bearing mice and did not affect the antitumor
immunosuppressive effect of CTX in tumor-bearing mice and did not affect the
efficacy
antitumor of CTX.
efficacy of CTX.

Figure
Figure 4. Evaluation
4. Evaluation of efficacy
of immune immune efficacy
of yogurt andofD-lactate
yogurt inand D-lactate
CT26 in CT26
tumor-bearing tumor-bearing
mice. (A,H) mice.
Experimental design, Blank:
(A,H) Experimental healthyBlank:
design, mice; Control:
healthytumor
mice;model group;
Control: CTX:model
tumor cyclophosphamide
group; CTX: cyclophos-
phamide (40 mg/kg bw); C + Y: cyclophosphamide + yogurt (cyclophosphamide, 40 mg/kg bw;
yogurt, 600 µL); C + D: cyclophosphamide + D-lactate (cyclophosphamide, 40 mg/kg bw; D-lactate,
300 mg/kg bw). (B,I) Body weight. (C,J) Immune Organ index. (D,K) Serum cytokines of IL6
and IFN-γ. (E,L) Images of tumor tissues at treatment termination. (F,M) tumor weight at 20 d.
(G,N) Relative mRNA level of Bax/Bcl-2 ratio, ** p < 0.01, *** p < 0.001 vs. control group. # p < 0.05,
## p < 0.01 vs. CTX group. **** p < 0.0001.
Nutrients 2024, 16, 1395 11 of 14

4. Discussion
The present study provided direct evidence of yogurt to alleviate the CTX-induced
immunosuppression. Furthermore, D-lactate was identified as a potential substance re-
sponsible for the immunomodulatory effects of yogurt. Although the results appeared
promising, some statements and discussion still required to be supplied.
The first question was regard to the dosage information of yogurt and D-lactate.
Figures S1 and S2 displayed the lactate concentration in simulated commercial yogurt. The
data illustrated that the total lactate content in yogurt was 1.50% and D-lactate content was
0.57%. According to FDA, the recommended daily intake of yogurt for a human weighed
80 kg was 150–200 g, which was converted to 300–400 µL per day in mice. Accordingly, a
human weighing 80 kg consuming 200 g yogurt a day was equivalent to a mouse weighing
20 g ingested with about 4 mg D-lactate per day. This served as the basis for the dosage of
yogurt and D-lactate in the experimental design.
The second question revolved the modulation of gut microbiota in immunosuppressive
mice by yogurt. From the data of α-diversity, the increase of Chaos, Simpson and ACE
indexes in the model group mice were possibly attributed to the upregulated abundance
of pathogenic microbiota [30] (Figure S2). It was speculated that the increased indexes of
Chaos, Shannon, Simpson and ACE in yogurt group might contribute to the enhanced
diversity of beneficial gut bacteria [7,31]. Further β-diversity analysis of the gut microbiota
has validated that hypothesis (Figure S3). The findings of β-diversity coincided precisely
with the α-diversity results. Particularly, Lactobacillus and Bifidobacterium showed a
notable increase, which are potentially considered to hydrolyze carbohydrates in the
intestine to produce D-lactate [32]. Correlational probiotic strains, including Lactobacillus
reuteri ATCC 55730 [33], Lactobacillus johnsonii La [34], and L. reuteri DSM 17938 [35,36]
have been reported to produce D-lactate. The results of D-lactate detection in intestinal
contents provided further inference. Therefore, it was reasonable to speculate that the
increasing D-lactate concentration in feces was potentially associated with the remodeling
of the intestinal flora. Furthermore, studies have demonstrated that microbial D-lactate
can affect macrophage function locally and maintain mucosal integrity within the gut [37].
Thus, yogurt consumption enhanced the intestinal immune function by hypothetically
reshaping the gut microbiota to boost beneficial probiotics producing D-lactate in the
intestine. Nevertheless, it cannot be ruled out that the gut immunity might be modulated
by the oral administration of D-lactate through other pathways.
The third question was to discuss the mechanism by which D-lactate alleviated im-
munosuppression. Immunocytes can be categorized into T cells and B cells. Our findings
demonstrated that D-lactate enhanced the immune response of splenic T cells stimulated
by ConA, thereby augmenting their capacity for lymphocyte transformation. However, no
significant differences were observed regarding the immune response of splenic B cells.
Consequently, we further examined the expression levels of nuclear transcription factors of
the T cell family in the mouse spleen. T-bet was a nuclear transcription factor specifically
expressed in Th1 cells, regulating cellular immune function. GATA3 was a key transcription
factor involved in the development of Th2 cells, regulating humoral immunity. A delicate
balance between Th1 and Th2 cells was crucial for the healthy host [38,39]. Foxp3 was
a transcriptional regulatory factor that was critical for the development and suppressive
function of regulatory T cells. RORγt was a lineage-specific transcription factor for T
helper 17 cells. The results demonstrated that the ingestion of medium and high doses of
D-lactate resulted in an increase in the expression level of T-bet, while only a high dose of
D-lactate elevated the expression level of GATA3. This indicated that D-lactate regulated
the differentiation of Th cells towards Th1 cells and alleviated immunosuppressive by
enhancing cellular immunity. These findings were consistent with the negative results of
HC50 (an indicator for measuring humoral immunity) and positive results of DTH (the vivo
detection of cellular immunity) [40]. Therefore, D-lactate exerted its mitigating effect on
immunosuppression by promoting Th cell differentiation to Th1 and enhancing the cellular
immunity of splenic lymphocytes.
Nutrients 2024, 16, 1395 12 of 14

The fourth question addressed why the tumor model was constructed. In healthy mice
and immunosuppression mice, we verified the safety and immune efficacy of daily intake of
600 µL yogurt or 300 mg/kg D-lacate in mice. However, whether yogurt or D-lactate could
be applied to clinical cancer chemotherapy patients remains debatable. In the tumor model,
we conducted preliminary exploration of the therapeutic effects of yogurt and D-lactate
on CTX chemotherapy. Our research findings demonstrated that yogurt and D-lactate can
alleviate CTX-induced immunosuppression to a certain extent in the mouse tumor model,
and they had no detrimental effects on the antitumor efficacy of CTX. The findings from
this study have provided preliminary data support for the clinical application of yogurt
and D-lactate in alleviating immunosuppressive.
Although our research has successfully assessed the mitigating effects of yogurt and
D-lactate on immunosuppression, several limitations remain. The immune efficacy of other
bioactive ingredients in yogurt cannot be denied, but this study focuses on evaluating
the benefits of D-lactate in yogurt, aiming to develop D-lactate as a new type of food
functional factor. The potential benefits of other components in yogurt should be explored
in the future. Additionally, further exploration of the specific production of D-lactate by
gut microbiota was valuable for developing D-lactate into a new type of food nutrient
factor. Furthermore, mechanistic investigations at the molecular level have elucidated
that lactate exerted its effects through specific binding to its receptor GPR81 [41]. Using
flow cytometry to subtype lymphocytes might be advantageous for investigating the
involvement of GPR81 in immune responses at a more advanced scientific level. On the
other hand, despite our research findings has demonstrated the positive adjunctive effect
of D-lactate on chemotherapy, clinical trials were warranted to validate these findings and
establish the utility of yogurt as an immunomodulatory food product. D-lactate remained
to determine whether it was comparable to the clinical drug Mesna.

5. Conclusions
In summary, this study effectively demonstrated the mitigating effects of yogurt
on immunosuppression. The alleviation of yogurt on immunosuppression is partially
attributed to the enhanced cellular immunity of D-lactate on splenic lymphocytes. This
article provides a new interpretation of yogurt as a functional food exerting physiological
effects, making a positive contribution to the functional food segment.

Supplementary Materials: The following supporting information can be downloaded at: https:
//www.mdpi.com/article/10.3390/nu16091395/s1, Figure S1. The chromatogram of lactate con-
centration in simulated commercial yogurt detected by high-performance liquid chromatography
(HPLC). Table S1. The lactate concentration in simulated commercial yogurt. Figure S2. The relative
abundance of Escherichia coli, Desulfovibrio and Staphylococcus in the fecal of CTX-induced mice.
Statistical significance was evaluated by performing a one-way ANOVA followed by the Tukey test
on the values presented as mean ± SEM. * p < 0.05, ** p < 0.01, *** p < 0.001 vs. normal control group
(NC). # p < 0.05, ## p < 0.01, ### p < 0.001 vs. model control group (MC). Figure S3.The relative
abundance of Streptococcus, Akkermansia and Ruminococcus in the fecal of CTX-induced mice.
Statistical significance was evaluated by performing a one-way ANOVA followed by the Tukey test
on the values presented as mean ± SEM (n = 10). * p < 0.05, ** p < 0.01, *** p < 0.001 vs. normal control
group (NC). # p < 0.05, ## p < 0.01, ### p < 0.001 vs. model control group (MC).
Author Contributions: Conceptualization, X.D.; methodology, Y.D. and R.X.; software, X.D.; valida-
tion, X.D.; formal analysis, X.D.; investigation, Y.Y.; data curation, X.D. and Y.Y.; writing—original
draft preparation, X.D.; writing—review and editing, Y.D.; visualization, Y.Y.; supervision, Y.Y. All
authors have read and agreed to the published version of the manuscript.
Funding: This research was funded by the National Natural Science Foundation of China (grant no.
32272290 and 31972973).
Institutional Review Board Statement: The Institutional Animal Ethics Committee of Jiangnan Uni-
versity approved all animal experimental procedures (protocol numbers JN.No20220315c0900425(012),
JN.No20220615c0801001(198)and JN.No20221130b0700220(467).
Nutrients 2024, 16, 1395 13 of 14

Informed Consent Statement: Not applicable.

Data Availability Statement: Data will be made available on request.
Acknowledgments: We would like to express our sincere appreciation to Haitao Li for his invaluable
guidance and support. We also appreciate the assistance provided by colleagues and teachers
throughout this research.
Conflicts of Interest: The authors declare no conflicts of interest.

References
1. Li, K.; Cao, Y.X.; Jiao, S.M.; Du, G.H.; Du, Y.G.; Qin, X.M. Structural Characterization and Immune Activity Screening of
Polysaccharides with Different Molecular Weights from Astragali Radix. Front. Pharmacol. 2020, 11, 582091. [CrossRef]
2. Xie, H.; Fang, J.; Farag, M.A.; Li, Z.; Sun, P.; Shao, P. Dendrobium officinale leaf polysaccharides regulation of immune response
and gut microbiota composition in cyclophosphamide-treated mice. Food Chem. X 2022, 13, 100235. [CrossRef]
3. Douglas, A.; Stevens, B.; Lynch, L. Interleukin-17 as a key player in neuroimmunometabolism. Nat. Metab. 2023, 5, 1088–1100.
[CrossRef] [PubMed]
4. Martin, T.D.; Patel, R.S.; Cook, D.R.; Choi, M.Y.; Patil, A.B.; Liang, A.C.; Li, M.Z.; Haigis, K.M.; Elledge, S.J. The adaptive immune
system is a major driver of selection for tumor suppressor gene inactivation. Science 2021, 373, 1327–1335. [CrossRef] [PubMed]
5. Schluter, J.; Peled, J.U.; Taylor, B.P.; Markey, K.A.; Smith, M.; Taur, Y.; Niehus, R.; Staffas, A.; Dai, A.; Fontana, E.; et al. The gut
microbiota is associated with immune cell dynamics in humans. Nature 2020, 588, 303–307. [CrossRef] [PubMed]
6. Kempen, J.H.; Newcomb, C.W.; Washington, T.L.; Foster, C.S.; Sobrin, L.; Thorne, J.E.; Jabs, D.A.; Suhler, E.B.; Rosenbaum, J.T.;
Sen, H.N.; et al. Use of Immunosuppression and the Risk of Subsequent Overall or Cancer Mortality. Ophthalmology 2023, 130,
1258–1268. [CrossRef] [PubMed]
7. Daniel, N.; Nachbar, R.; Tran, T.T.T.; Ouellette, A.; Varin, T.V.; Cotillard, A.; Quinquis, L.; Gagné, A.; St-Pierre, P.; Trottier, J.; et al.
Gut microbiota and fermentation-derived branched chain hydroxy acids mediate health benefits of yogurt consumption in obese
mice. Nat. Commun. 2022, 13, 1343. [CrossRef] [PubMed]
8. Kok, C.R.; Hutkins, R. Yogurt and other fermented foods as sources of health-promoting bacteria. Nutr. Rev. 2018, 76, 4–15.
[CrossRef] [PubMed]
9. Barengolts, E.; Smith, E.D.; Reutrakul, S.; Tonucci, L.; Anothaisintawee, T. The Effect of Probiotic Yogurt on Glycemic Control in
Type 2 Diabetes or Obesity: A Meta-Analysis of Nine Randomized Controlled Trials. Nutrients 2019, 11, 671. [CrossRef]
10. Wu, L.; Sun, D. Consumption of Yogurt and the Incident Risk of Cardiovascular Disease: A Meta-Analysis of Nine Cohort Studies.
Nutrients 2017, 9, 315. [CrossRef]
11. Aslam, H.; Marx, W.; Rocks, T.; Loughman, A.; Chandrasekaran, V.; Ruusunen, A.; Dawson, S.L.; West, M.; Mullarkey, E.; Pasco,
J.A.; et al. The effects of dairy and dairy derivatives on the gut microbiota: A systematic literature review. Gut Microbes 2020,
12, 1799533. [CrossRef]
12. Başpinar, B.; Güldaş, M. Traditional plain yogurt: A therapeutic food for metabolic syndrome? Crit. Rev. Food Sci. Nutr. 2020, 61,
3129–3143. [CrossRef] [PubMed]
13. Adeva-Andany, M.M.; López-Ojén, M.; Funcasta-Calderón, R.; Ameneiros-Rodríguez, E.; Donapetry-García, C.; Vila-Altesor, M.;
Rodríguez-Seijas, J. Comprehensive review on lactate metabolism in human health. Mitochondrion 2014, 17, 76–100. [CrossRef]
[PubMed]
14. Jia, B.; Pu, Z.J.; Tang, K.; Jia, X.; Kim, K.H.; Liu, X.; Jeon, C.O. Catalytic, Computational, and Evolutionary Analysis of the d-Lactate
Dehydrogenases Responsible for d-Lactic Acid Production in Lactic Acid Bacteria. J. Agric. Food Chem. 2018, 66, 8371–8381.
[CrossRef] [PubMed]
15. Blake, A.B.; Guard, B.C.; Honneffer, J.B.; Lidbury, J.A.; Steiner, J.M.; Suchodolski, J.S. Altered microbiota, fecal lactate, and fecal
bile acids in dogs with gastrointestinal disease. PLoS ONE 2019, 14, e0224454. [CrossRef] [PubMed]
16. Yan, Y.; Li, X.-x.; Yang, Q.; Zhang, H.; Hettinga, K.A.; Li, H.; Chen, W. Dietary D-Lactate Intake Facilitates Inflammatory Resolution
by Modulating M1 Macrophage Polarization. Mol. Nutr. Food Res. 2022, 66, e2200196. [CrossRef] [PubMed]
17. Li, X.; Yan, Y.; Du, X.; Zhang, H.; Li, H.; Chen, W. Yogurt Prevents Colitis-Associated Colorectal Cancer in Mice. Mol. Nutr. Food
Res. 2023, 67, e2300444. [CrossRef]
18. Cho, W.-Y.; Hong, G.-E.; Lee, H.-J.; Yeon, S.-J.; Paik, H.-D.; Hosaka, Y.Z.; Lee, C.-H. Effect of Yogurt Fermented by Lactobacillus
Fermentum TSI and L. Fermentum S2 Derived from a Mongolian Traditional Dairy Product on Rats with High-Fat-Diet-Induced
Obesity. Foods 2020, 9, 594. [CrossRef]
19. Tang, C.; Zhao, H.; Kong, L.; Meng, F.; Zhou, L.; Lu, Z.; Lu, Y. Probiotic Yogurt Alleviates High-Fat Diet-Induced Lipid
Accumulation and Insulin Resistance in Mice via the Adiponectin Pathway. J. Agric. Food. Chem. 2023, 71, 1464–1476. [CrossRef]
20. Fan, X.; Shi, Z.-Q.; Xu, J.; Li, C.; Li, X.; Jiang, X.; Du, L.; Tu, M.; Zeng, X.; Wu, Z.; et al. Characterization of the effects of binary
probiotics and wolfberry dietary fiber on the quality of yogurt. Food Chem. 2022, 406, 135020. [CrossRef]
21. Yan, Y.; Xu, R.; Li, X.-x.; Yao, Z.; Zhang, H.; Li, H.; Chen, W. Unexpected immunoregulation effects of D-lactate, different from
L-lactate. Food Agric. Immunol. 2022, 33, 286–301. [CrossRef]
Nutrients 2024, 16, 1395 14 of 14

22. Zhu, Z.; Neirinck, L.G. Chiral separation and determination of R-(-)- and S-(+)-baclofen in human plasma by high-performance
liquid chromatography. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2003, 785, 277–283. [CrossRef] [PubMed]
23. Park, J.; Kim, J.S.; Yang, G.; Lee, H.-H.; Shim, G.; Lee, J.; Oh, Y.K. Lysyl oxidase-responsive anchoring nanoparticles for modulation
of the tumor immune microenvironment. J. Control. Release 2023, 360, 376–391. [CrossRef] [PubMed]
24. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108.
[CrossRef]
25. Bai, Z.; Yang, P.; Yu, F.; Li, Z.; Yao, Z.; Martinez, J.; Li, M.; Xu, H. Combining adoptive NK cell infusion with a dopamine-releasing
peptide reduces senescent cells in aged mice. Cell Death Dis. 2022, 13, 305. [CrossRef] [PubMed]
26. Xu, D.; Hu, J.-l.; Zhong, Y.; Zhang, Y.; Liu, W.; Nie, S.; Xie, M. Effects of Rosa roxburghii & edible fungus fermentation broth on
immune response and gut microbiota in immunosuppressed mice. Food Sci. Hum. Wellness 2023, 13, 154–165.
27. Zhang, Y.; Tang, Y.; Cai, L.; He, J.; Chen, L.; Ouyang, K.; Wang, W. Chimonanthus nitens Oliv Polysaccharides Modulate Immunity
and Gut Microbiota in Immunocompromised Mice. Oxidative Med. Cell. Longev. 2023, 2023, 6208680. [CrossRef] [PubMed]
28. Wang, J.; Liu, J.; Wang, M.; Zhao, F.; Ge, M.; Liu, L.; Jiang, E.; Feng, S.; Han, M.; Pei, X.; et al. Levamisole Suppresses CD4(+)
T-Cell Proliferation and Antigen-Presenting Cell Activation in Aplastic Anemia by Regulating the JAK/STAT and TLR Signaling
Pathways. Front. Immunol. 2022, 13, 907808. [CrossRef]
29. Yu, Q.; Nie, S.; Wang, J.; Liu, X.; Yin, P.-F.; Huang, D.; Li, W.; Gong, D.; Xie, M. Chemoprotective effects of Ganoderma atrum
polysaccharide in cyclophosphamide-induced mice. Int. J. Biol. Macromol. 2014, 64, 395–401. [CrossRef]
30. Yin, H.; Li, R.; Liu, J.; Sun, Y.; Zhao, L.; Mou, J.; Yang, J. Fucosylated chondroitin sulfate from sea cucumber Stichopus chloronotus
alleviate the intestinal barrier injury and oxidative stress damage in vitro and in vivo. Carbohydr. Polym. 2024, 328, 121722.
[CrossRef]
31. Hasegawa, Y.; Pei, R.; Raghuvanshi, R.; Liu, Z.; Bolling, B.W. Yogurt Supplementation Attenuates Insulin Resistance in Obese
Mice by Reducing Metabolic Endotoxemia and Inflammation. J. Nutr. 2023, 153, 703–712. [CrossRef] [PubMed]
32. Łukasik, J.; Salminen, S.; Szajewska, H. Rapid review shows that probiotics and fermented infant formulas do not cause d-lactic
acidosis in healthy children. Acta Paediatr. 2018, 107, 1322–1326. [CrossRef] [PubMed]
33. Connolly, E.; Abrahamsson, T.R.; Björkstén, B. Safety of D(-)-Lactic Acid Producing Bacteria in the Human Infant. J. Pediatr.
Gastroenterol. Nutr. 2005, 41, 489–492. [CrossRef] [PubMed]
34. Haschke-Becher, E.; Brunser, O.; Cruchet, S.; Gotteland, M.; Haschke, F.; Bachmann, C. Urinary D-Lactate Excretion in Infants
Receiving Lactobacillus johnsonii with Formula. Ann. Nutr. Metab. 2008, 53, 240–244. [CrossRef] [PubMed]
35. Papagaroufalis, K.; Fotiou, A.; Egli, D.; Tran, L.-A.; Steenhout, P.G. A Randomized Double Blind Controlled Safety Trial Evaluating
d-Lactic Acid Production in Healthy Infants Fed a Lactobacillus reuteri-containing Formula. Nutr. Metab. Insights 2014, 7, 19–27.
[CrossRef] [PubMed]
36. Li, M.; Laura, B.L.; Chen, X.; Wang, M.; Kuhlenschmidt, T.B.; Kuhlenschmidt, M.S.; Fahey, G.C.; Donovan, S.M. Microbial
composition and in vitro fermentation patterns of human milk oligosaccharides and prebiotics differ between formula-fed and
sow-reared piglets. FASEB J. 2012, 142, 681–689. [CrossRef] [PubMed]
37. Morita, N.; Umemoto, E.; Fujita, S.; Hayashi, A.; Kikuta, J.; Kimura, I.; Haneda, T.; Imai, T.; Inoue, A.; Mimuro, H.; et al.
GPR31-dependent dendrite protrusion of intestinal CX3CR1+ cells by bacterial metabolites. Nature 2019, 566, 110–114. [CrossRef]
[PubMed]
38. Min, F.; Hu, J.-l.; Huang, T.; Huang, Y.; Nie, S.; Xiong, T.; Xie, M. Effects of Lactobacillus casei NCU011054 on immune response
and gut microbiota of cyclophosphamide induced immunosuppression mice. Food Chem. Toxicol. 2023, 174, 113662. [CrossRef]
39. Kim, J.; Lee, H.; You, S. Dried Ginger Extract Restores the T Helper Type 1/T Helper Type 2 Balance and Antibody Production in
Cyclophosphamide-Induced Immunocompromised Mice after Flu Vaccination. Nutrients 2022, 14, 1984. [CrossRef]
40. Bai, R.-b.; Zhang, Y.; Fan, J.-m.; Jia, X.; Li, D.; Wang, Y.; Zhou, J.; Yan, Q.; Hu, F. Immune-enhancement effects of oligosaccharides
from Codonopsis pilosula on cyclophosphamide induced immunosuppression in mice. Food Funct. 2020, 11, 3306–3315. [CrossRef]
41. Colucci, A.; Tassinari, I.D.Á.; Loss, E.d.S.; Fraga, L.S.d. History and Function of the Lactate Receptor GPR81/HCAR1 in the Brain:
A Putative Therapeutic Target for the Treatment of Cerebral Ischemia. Neuroscience 2023, 526, 144–163. [CrossRef] [PubMed]

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual
author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to
people or property resulting from any ideas, methods, instructions or products referred to in the content.