Journal of Insect Physiology 79 (2015) 73–79

Contents lists available at ScienceDirect

Journal of Insect Physiology

journal homepage: www.elsevier.com/locate/jinsphys

Functional analysis of Bombyx Wnt1 during embryogenesis using the

CRISPR/Cas9 system
Zhongjie Zhang a,b, Abu F.M. Aslam b, Xiaojing Liu a, Muwang Li a, Yongping Huang b, Anjiang Tan b,⇑
a
Sericultural Research Institute, Jiangsu University of Science and Technology, Zhenjiang 212018, Jiangsu, China
b
Key Laboratory of Insect Developmental and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy
of Sciences, Shanghai 200032, China

a r t i c l e i n f o a b s t r a c t

Article history: Recently established, custom-designed nuclease technologies such as the clustered regularly interspaced
Received 7 November 2014 short palindromic repeat (CRISPR)-associated system provide attractive genome editing tools. Targeted
Received in revised form 7 June 2015 gene mutagenesis using the CRISPR/Cas9 system has been achieved in several orders of insects.
Accepted 8 June 2015
However, outside of studies on Drosophila melanogaster and the lepidopteron model insect Bombyx mori,
Available online 9 June 2015
little success has been reported, which is largely due to a lack of effective genetic manipulation tools that
can be used in other insect orders. To create a simple and effective method of gene knockout analysis,
Keywords:
especially for dissecting gene functioning during insect embryogenesis, we performed a functional anal-
Wnt1
Bombyx mori
ysis of the Bombyx Wnt1 (BmWnt1) gene using Cas9/sgRNA-mediated gene mutagenesis. The Wnt1 gene is
Embryos required for embryonic patterning in various organisms, and its crucial roles during embryogenesis have
Genome editing been demonstrated in several insect orders. Direct injection of Cas9 mRNA and BmWnt1-specific sgRNA
CRISPR/Cas9 into Bombyx embryos induced a typical Wnt-deficient phenotype: injected embryos could not hatch and
exhibited severe defects in body segmentation and pigmentation in a dose-dependent manner.
Quantitative real-time PCR (qRT-PCR) analysis revealed that Hox genes were down-regulated after
BmWnt1 depletion. Furthermore, large deletion, up to 18 Kb, ware generated. The current study demon-
strates that using the CRISPR/Cas9 system is a promising approach to achieve targeted gene mutagenesis
during insect embryogenesis.
Ó 2015 Elsevier Ltd. All rights reserved.

1. Introduction a short RNA (sgRNA), can cleave targeting sites (Garneau et al.,
2010). Similar to ZFNs and TALENs, the CRISPR/Cas9 system
Advancements in custom-designed nucleases have shown great induces double-strand DNA breaks (DSBs) at target genomic sites
advantages in achieving targeted gene modification and have led to that are repaired either by non-homologous end joining (NHEJ)
the development of powerful genetic tools for gene functional or by homologous recombination (HR) in the presence of homolo-
analysis. Two types of custom-designed nucleases, zinc finger gous donor template DNA.
nucleases (ZFNs) and transcription activator-like effector nucleases As an emerging genome editing technology, CRISPR/Cas9 has
(TALENs), have been extensively applied in gene targeting in a vari- been used for the genetic analysis of many organisms, including
ety of organisms, ranging from humans to flies and worms the model insect Drosophila melanogaster (Cong et al., 2013; Mali
(Bibikova et al., 2002; Carroll, 2011; Boch et al., 2009; Joung and et al., 2013; Hsu et al., 2014). However, the application of this sys-
Sander, 2013). More recently, the clustered regularly interspaced tem to non-drosophila insects is still limited, which is partially due
short palindromic repeat (CRISPR)-associated system has been to difficulties in genetic manipulation in such insect species. The
introduced as an effective genome engineering technology (Cong silkworm, Bombyx mori, is a lepidopteron model insect of economic
et al., 2013; Mali et al., 2013). Among multiple CRISPR/Cas9 sys- importance. In recent years, germline transformation has been suc-
tems, the type II CRISPR/Cas9 system is the mostly well charac- cessfully established in B. mori (Tamura et al., 2000) and has been
terised with respect to genome editing. This system is composed applied extensively for functional gene analysis and for the pro-
of an RNA-guided Cas9 endonuclease that, under the guidance of duction of bioreactors (Tan et al., 2005; Tomita et al., 2003).
Furthermore, recent progress in Bombyx targeted mutagenesis
has been made by using powerful genome editing tools, including
⇑ Corresponding author.
ZFNs, TALENs and CRISPR/Cas9 (Takasu et al., 2010; Sajwan et al.,
E-mail address: [email protected] (A. Tan).

http://dx.doi.org/10.1016/j.jinsphys.2015.06.004
0022-1910/Ó 2015 Elsevier Ltd. All rights reserved.
74 Z. Zhang et al. / Journal of Insect Physiology 79 (2015) 73–79

2013; Wang et al., 2013) and has provided great advantages for different embryonic stages, in addition to the expression levels of
future endeavours in B. mori functional genomics. selected genes after knocking out BmWnt1. cDNA samples that
RNA interference (RNAi) is an efficient genetic tool for knocking were prepared from whole embryos of different developmental
out target gene expression. In D. melanogaster, transgene-based, stages (day 1 to day 9 of wild type) and from embryos at a referred
heritable RNAi approaches have been well established to silence stage (day 9 of BmWnt1 mutant) were used as templates. The PCR
target genes of interest (Kennerdell and Carthew, 2000). conditions were as follows: initial incubation at 95 °C for 1 min, 40
However, the in vivo use of RNAi in non-drosophila insects is still cycles of 95 °C for 15 s, and 60 °C for 1 min. Mastercycler EP real-
challenging, as RNAi efficiency varies significantly among different plex (Eppendorf, Wesseling-Berzdorf, Germany) was used for the
insect species. Thus, using engineered nucleases to achieve tar- qRT-PCR assays. The cycling conditions were as follow: initial incu-
geted gene mutagenesis, thereby resulting in a loss of target gene bation at 95 °C for 2 min, 40 cycles of 95 °C for 15 s, and 55 °C for
function, is a promising alternative for gene functional analysis 30 s. The primers that were used in qRT-PCR to investigate the
in these insect species. In the current study, we focused on using mRNA expression levels of BmWnt1 and the other genes of interest
B. mori Wnt1 (BmWnt1), which is a homologue of Drosophila are listed in Table 1. Another primer pair, Bmrp49F and Bmrp49R
Wnt1 (Wnt1), also known as the wingless (wg) gene, as a target gene (Table 1), which amplifies a 136-bp fragment from the B. mori ribo-
and explored its physiological functions, particularly during somal protein 49 (Bmrp49, GenBank accession number AB048205.
embryogenesis, using the CRISPR/Cas9 system. Wnt signalling reg- 1), was used as an internal control (Tan et al., 2013).
ulates a wide range of developmental process and has been com-
prehensively investigated (Sharma and Chopra, 1976; Petersen 2.4. Preparation of Cas9 mRNA and sgRNA
and Reddien, 2009). In Drosophila, the Wnt1 gene functions as a
segment polarity gene and is essential for many developmental Cas9 mRNA was prepared using the mMESSAGE mMACHINEÒ
processes, including embryonic segmentation and patterning of kit (Ambion, Austin, TX, USA) according to the manufacturer’s
the wing disc (Sharma and Chopra, 1976; Baker, 1987; Gonsalves instruction and as previously described (Wang et al., 2013). To gen-
and DasGupta, 2009; Alexandre et al., 2014). In Tribolium casta- erate sgRNA templates, four unique oligonucleotides (Wnt1-sgF1,
neum, TcWnt1 stripes are sequentially generated from anterior to Wnt1-sgF2, EGFP-sgF1, EGFP-sgF2) that encoded the T7 poly-
posterior, and RNAi knockdown results in the loss of segment merase binding site, sgRNA targeting sequence and overlap
boundaries, gnathal and appendages (Ober and Jockusch, 2006). sequence were separately annealed to a common oligonucleotide
In B. mori, BmWnt1 expression exhibits a large median domain dur- that encoded the remainder of the sgRNA sequence (sgRNA-R)
ing the blastoderm stage and is then retracted to the posterior pole (Table 1). The reaction conditions were as follows: 98 °C for
during the elongation of segments (Nakao, 2010). siRNA-mediated 2 min, 35 cycles of 94 °C for 10 s, 55 °C for 30 s, and 72 °C for
RNAi knockdown of BmWnt1 has been shown to result in a loss of 2 min, followed by a final extension period of 72 °C for 10 min.
abdominal segments and immature legs in embryos (Yamaguchi The sgRNAs were synthesised in vitro using a MAXIscriptÒ T7 Kit
et al., 2011). During Bombyx larval development, BmWnt1 was (Ambion, Austin, TX, USA) according to the manufacturer’s instruc-
essential to generate twin-spot markings (Yamaguchi et al., 2013). tions. Purified Cas9 mRNA and sgRNAs were stored at 80 °C until
To further elucidate the physiological functions of BmWnt1, par- use.
ticularly during Bombyx embryogenesis, we performed targeted
mutagenesis analysis using direct embryonic injection of both 2.5. Micro-injection of Cas9/sgRNA
Cas9 mRNA and sgRNA targeting BmWnt1. The majority of injected
embryos could not hatch and showed severe defects in body seg- B. mori eggs were prepared as previously described (Wang et al.,
mentation and pigmentation. PCR-based analysis revealed that 2013) and were injected within 6 h after oviposition. A mixture of
the injection of Cas9/sgRNA efficiently induced genomic mutagen- Cas9 mRNA (300 ng/ll) and sgRNA (300 ng/ll or 30 ng/ll) was
esis at the expected locus. Our data provides a promising approach injected into the preblastoderm Nistari embryos using a
for loss-of-function analysis, especially during embryogenesis in B. micro-injector (Narishige, Tokyo, Japan). Injection with the mix
mori and potentially in other insect species. of EGFP-specific sgRNA and Cas9 mRNA was performed as a con-
trol. Injected eggs were incubated in a humidified chamber at
25 °C for subsequent investigation.
2. Materials and methods

2.6. Scanning electron microscopy (SEM) analysis

2.1. Silkworm strains

Injected embryos were dissected at the end of embryogenesis

A multivoltine, silkworm strain, Nistari, was used for all exper-
under a microscope, and phenotypic investigation was performed.
iments. Larvae were reared on fresh mulberry leaves at 25 °C under
The dissected embryos were washed in PBS and fixed with FAA
standard conditions (Tan et al., 2005).
solution (1:1:18 ratio of 37–40% formaldehyde to acetic acid anhy-
dride to 50% ethanol). The fixed samples were dehydrated through
2.2. RNA isolation and cDNA synthesis exposure to a gradually increasing series of ethyl alcohol (50%, 60%,
70%, 80%, 90%, 95%, 100%) using a rotary machine. The embryos
Total RNA was isolated from embryos using TRIzol reagent were dried in a critical-point dryer and then coated with platinum
(Invitrogen, CA, USA) according to the manufacturer’s instructions prior to observation under a scanning electron microscope (JEOL,
and was subsequently treated with DNase I (Invitrogen, CA, USA) to Tokyo, Japan).
remove genomic DNA. For cDNA synthesis, 1 lg of total RNA was
used in a ReverAid First Strand cDNA Synthesis Kit (Fermentas, 2.7. Genomic DNA extraction and mutagenesis analysis
Lithuania, EU).
Genomic PCR, followed by sequencing, was carried out to iden-
2.3. Quantitative real-time PCR (qRT-PCR) analysis tify BmWnt1 mutant alleles induced by CRISPR/Cas9. Genomic DNA
was extracted from injected embryos with the DNA extraction buf-
qRT-PCR was performed to analyse the expression profile of fer (1:1:2:2.5 ratio of 10% SDS to 5 mol NaCl to 100 mmol EDTA to
BmWnt1 (GenBank accession number NM_001043850.1) during 500 mmol Tris–HCl, pH = 8) and incubated with proteinase K and
 Z. Zhang et al. / Journal of Insect Physiology 79 (2015) 73–79 75

Table 1
Primers used in this study.

Primer name Primer sequence (50 –30 ) Primer purpose

Wnt1-sgF1 TAATACGACTCACTATAGGAGGGGACGAGGAAGCATGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC Preparation of sgRNA templates
Wnt1-sgF2 TAATACGACTCACTATAGGCGGCTGCAGCGACAACATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC Preparation of sgRNA templates
EGFP-sgF1 TAATACGACTCACTATAGGGCGAGGAGCTGTTCACCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC Preparation of sRNA templates
EGFP-sgF2 TAATACGACTCACTATAGGCCACAAGTTCAGCGTGTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC Preparation of sgRNA templates
sgRNA-R AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA Preparation of sgRNA templates
Primer1-F AGAATGAAGTGTCTGTGGCTGTT Identification of somatic mutations
Primer1-R GTGAGAAGAACATCAAAATCTGGC Identification of somatic mutations
Primer2-F GTCCTACCACCAAGTGGTCTAT Identification of somatic mutations
Primer2-R TGCAAGTCATTGGCCTGACAGAA Identification of somatic mutations
Wnt1-F AGATTGGCCAGAGAGAACCC qRT-PCR
Wnt1-R ACGGCAACCTCTATCCACAA qRT-PCR
Th-F CGCGGACAAAGATTACAGGG qRT-PCR
Th-R AACGCAGCCTTGTACTCTCT qRT-PCR
Cad-F CTACACCCCGCCTTATACCC qRT-PCR
Cad-R TGTCGAACGTGGATTCAAGC qRT-PCR
Lab-F CCACCAGCAGAATTCGTCAG qRT-PCR
Lab-R TCTATCCTCCTCGCTCTGGT qRT-PCR
Pb-F GACCGCCTTGCCTCAATTAG qRT-PCR
Pb-R TTGAGTGTTCGTGTATGCCG qRT-PCR
Dft-F TCTCCTTCTTCAGAGCTGGA qRT-PCR
Dft-R GACGTTTAGGCTCCATTCCG qRT-PCR
Scr-F ATATTTCAAGCCCGGCCTCT qRT-PCR
Scr-R ACCGAGTGTATGACGTCCTC qRT-PCR
Antp-F CCAACAGCATATGGTCCAGC qRT-PCR
Antp-R CCCCGCTTCCTCTCAAATTG qRT-PCR
Ubx-F TCGTCAAGTCCTGGTAGAGC qRT-PCR
Ubx-R GCCATCTCTATGCGTCTCCT qRT-PCR
Abd-a-F CGGCTCAGTTTTACCACCAG qRT-PCR
Abd-a-R CATTGAACTCACCGCAGACC qRT-PCR
Abd-b-F CGTCCGGGTTCTCTCATGAT qRT-PCR
Abd-b-R TGACCAGTCCAATCCAGAGG qRT-PCR
RP49-F TCAATCGGATCGCTATGACA qRT-PCR
RP49-R ATGACGGGTCTTCTTGTTGG qRT-PCR

Note: Wnt1-sgF1, Wnt1-sgF2 and sgRNA-R were used for amplification of DNA templates to generate sgRNA; others were used for detection of targeting sites, QPCR.

was then purified via a standard phenol:chloroform extraction and 3. Results

isopropanol precipitation extraction, followed by RNaseA treat-
ment. The PCR conditions were as follows: 98 °C for 2 min, 35 3.1. Expression profile of the BmWnt1 gene during embryogenesis
cycles of 94 °C for 10 s, 55 °C for 30 s, and 72 °C for 1 min, followed
by a final extension period of 72 °C for 10 min. The PCR products The temporally relative mRNA expression levels of BmWnt1
were cloned into pJET1.2 vectors (Fermentas, Lithuania, EU) and during embryonic stages were investigated by qRT-PCR every
directly sequenced. The PCR products were also used for T7 24 h after oviposition. BmWnt1 expression was at its highest level
endonuclease I (T7EI) assay as previously described (Kondo and at the beginning of embryogenesis and subsequently decreased as
Ueda, 2013). The primers that were designed to detect mutagene- development progressed, reaching its minimum level at the end of
sis in targeted sites were as follows: primer1-F and primer1-R embryogenesis (Fig. 1). This result revealed that the maternal
detected targeting site 1, primer2-F and primer2-R detected target- supply of the BmWnt1 transcript agreed with what has been
ing site 2, and primer1-F and primer2-R detected mutations that
spanning targeting sites 1 and 2. The primer sequences are listed
in Table 1.

2.8. Immunoblot analysis

Proteins were extracted from embryos at the ninth day.

Samples were homogenised, dissolved in PBS and quantified using
a BCA kit (Thermo, Lithuania, EU). Extracted proteins were sepa-
rated by 10% SDS/PAGE and transferred to a nitrocellulose mem-
brane (GE Healthcare, Wisconsin, USA). The polyclonal rabbit
anti-BmWnt1 primary antibody was used for BmWnt1 detection
(1:1000 dilution; Youke, Shanghai, China). And a-Tubulin detected
by the rabbit anti-a-tubulin primary antibody (1:5000 dilution;
Vazyme Biotech, Piscataway, USA) was used as the control.
Horseradish peroxidase-conjugated anti-rabbit IgG (1:5000 dilu-
Fig. 1. Temporal expression of the BmWnt1 gene. The relative mRNA levels of
tion; Beyotime, Shanghai, China) was used as a secondary anti- BmWnt1 in embryos from day 1 (D1) to day 9 (D9). RP49 was used as a control for
body. Signal detection was achieved using the ECL Plus Western normalisation. During the process of embryonic development, gene expression
Blotting Detection Kit (GE Health-care, USA). levels decreases gradually. The data shown are mean values ± S.E.M. (n = 3).
76 Z. Zhang et al. / Journal of Insect Physiology 79 (2015) 73–79

previously observed (Nakao, 2010) and indicated that BmWnt1 targeting efficiency were left out. The rest of target sequences were
may play a vital role in Bombyx during early embryogenesis. blasted according to B. mori genome to avoid those relevant
sequences with high identity. Finally, two 23-bp sgRNA target sites
were identified and named S1 and S2 (Fig. 2). S1 and S2 were sep-
3.2. Cas9/sgRNA injection induced dose-dependent embryonic lethality
arately located on exon 1 and exon 3, and the fragment spanning
the two sites was 18,081 bp in length (Fig. 2). sgRNAs that were
The genomic structure of BmWnt1 is composed of four exons
synthesised in vitro were mixed with Cas9 mRNA and injected into
and three introns (Fig. 2). The open reading frame of BmWnt1
preblastoderm embryos. A total of 320 eggs were injected with the
was screened to identify sgRNA targeting sites according to the
Cas9/BmWnt1-specific sgRNA mixture at a concentration of
GGN19GG rule (Hwang et al., 2013). Subsequently, target
300 ng/ll Cas9 and 300 ng/ll sgRNA. A total of 240 eggs were
sequences with high and low GC content which might affect

Fig. 2. Schematic diagram of sgRNA targeting sites. The four boxes indicate the four exons of BmWnt1, and the black line represents the gene locus. The sgRNA targeting sites,
S1 and S2, are located on the sense strand of exon-1 and the sense strand of exon-3, respectively. Primer1-F and primer-1R were used to anneal to the upstream and
downstream regions of targeting site 1, respectively. Primer2-F and primer-2R were used to anneal to the upstream and downstream regions of targeting site 2, respectively.
The sgRNA targeting sequence is in black, and the protospacer adjacent motif (PAM) sequence is in red. (For interpretation of the references to colour in this figure legend, the
reader is referred to the web version of this article.)

Table 2
Embryonic mutagenesis induced by Cas9/sgRNA injection targeting BmWnt1.

sgRNAs for injection sgRNA concentration Numbers of injected Hatching Embryos with Embryos with Posterior Embryos with pigmentation
(ng/ll) embryos ratio defective legs truncation phenotype
Wnt1 sgRNA 300 320 6.6% 90.6% 81.9% 81.9%
30 240 28.8% 42.5% 18.8% 18.8%
EGFP sgRNA 300 160 65.6% 0 0 0

Fig. 3. Mutants with abnormal segmentation and pigmentation induced by Cas9–sgRNA injection. (a) Lateral view of wild type (WT) larva. Bar = 500 lm. (b) Segments
posterior to A6 are missing. Bar = 500 lm. (c) Ventral view of WT larva. Bar = 500 lm. (d) Ventral view of mutant embryo. Bar = 500 lm. The red arrows indicate abnormal
thoracic legs. The blue arrows indicate malformed prolegs. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this
article.)
 Z. Zhang et al. / Journal of Insect Physiology 79 (2015) 73–79 77

injected with the Cas9/BmWnt1-specific sgRNA mixture at a con- to sixth abdominal segments (A3–A6) and a pair of tail prolegs in
centration of 300 ng/ll Cas9 mRNA and 30 ng/ll sgRNA (Table 2). A11 (Fig. 3a and c). However, body segments posterior to A6 were
An additional 160 eggs were injected with mixture of 300 ng/ll lacking in BmWnt1 knockout embryos (Fig. 3b). Thoracic and
Cas9 mRNA and 300 ng/ll EGFP-specific sgRNA as a control abdominal legs did not develop in knockout individuals (Fig. 3d).
(Table 2). Hatching ratio was investigated 10 days after injection. To further analyse the phenotypes of the defective legs, we per-
When injected with 300 ng/ll concentrations of Cas9 mRNA and formed scanning electron microscope (SEM) analysis, and the
BmWnt1-specific sgRNA (Table 2), the hatching ratio was only results showed that T1–T3 thoracic legs were defective and did
6.6%, showing severe embryonic lethality. When the sgRNA con- not have pretarsi (Fig. 4d). The prolegs also failed to develop
centration was reduced to 30 ng/ll (the Cas9 mRNA concentration (Fig. 4f), and the claws of the prolegs were interior and failed to flip
was 300 ng/ll), the hatching ratio exhibited a dose-dependent outward (Fig. 4h). Compared to the black WT neonatal larva, the
effect and recovered by 28.8%. The hatching ratio in the control BmWnt1 knockout embryos were reddish brown (Fig. 3b and d).
group was 65.6%, which was similar to genetic transformation A dose-dependent phenotypic effect also appeared in a number
experiments previously reported by our laboratory (Tan et al., of embryos. In the embryos that were injected with 300 ng/ll
2013; Xu et al., 2014). BmWnt1-specific sgRNA, approximately 91% (290/320) showed
defects at legs and 82% (261/320) showed segmentation and pig-
mentation phenotype (Table 2); in the 30 ng/ll injection group,
3.3. Cas9/sgRNA injection induced deleterious defects in embryonic 43% (102/240) and 19% (45/240) showed these phenotypes, respec-
segmentation and pigmentation tively (Table 2). The majority of the mutants exhibited defective
phenotypes in both segmentation and pigmentation.
To explore the embryonic lethality phenotype, we dissected
Cas9/sgRNA-treated embryos under a microscope. In a previous
report in which BmWnt1 transcript was knocked down by siRNA 3.4. Targeted mutagenesis at the BmWnt1 locus
(Yamaguchi et al., 2011), Bombyx embryos showed defects in
appendage development. The wild-type (WT) silkworm neonate To confirm that the phenotypic defects described above were
consists of three pairs of thoracic legs from the first to third tho- due to genomic mutagenesis induced by injection of Cas9/sgRNA
racic segments (T1–T3), four pairs of abdominal legs from the third targeting BmWnt1, we performed PCR-based analysis using DNA

Fig. 4. Scanning electron microscopy of WT and mutant larva. (a) Lateral view of WT embryo. Bar = 500 lm. (b) T2 Thoracic leg pretarsi are hypoplastic. Bar = 500 lm. (c)
Thoracic legs of WT embryo. Bar = 100 lm. (d) T1–T3 thoracic legs are almost defective without pretarsi. Bar = 100 lm. (e) Ventral view of abdominal legs of WT embryo.
Bar = 100 lm. (f) Ventral view of a Cas9–sgRNA injected embryo. All abdominal legs were defective. Bar = 100 lm. (g) A proleg of a WT embryo. Bar = 10 lm. (h) Enlargement
of a A3 proleg in the same embryo that was shown in (f). Bar = 10 lm. Co: Coxa, Tr: Trochanter, Fe: Femur, Ti: Tibia, Cl: Claw, Pl, Planta, Cr: Crotchet. The red arrow indicates
an abnormal thoracic leg. The blue arrow indicates malformed prolegs. (For interpretation of the references to colour in this figure legend, the reader is referred to the web
version of this article.)
78 Z. Zhang et al. / Journal of Insect Physiology 79 (2015) 73–79

extracted from injected embryos as a template. Genomic DNA was

extracted from twenty randomly selected mutant individuals and
the fragments spanning one or both target sites were amplified
and sequenced. Both non-deletion and deletion mutations were
detected in all twenty individuals (Fig. 5a). The average length of
a deletion between S1 and S2 was approximately 18 kb, suggesting
that Cas9/sgRNA injection could induce deletions of large frag-
ments of DNA. Genotyping using T7EI showed that PCR fragments
spanning the target sites could be cut into expected bands in
mutant individuals (Fig. 5b). Western blotting analysis revealed
that no signal was detected in mutant embryos (Fig. 5c).

3.5. Transcription levels of genes affected by BmWnt1 knockout

The deleterious defects that were found in both the segmenta- Fig. 6. Relative gene expression of in BmWnt1 mutants. Transcription levels of all B.
tion and pigmentation of BmWnt1 mutants led to the question of mori Hox gene homologues, including Labial (Lab), Proboscipedia (Pb), Deformado
(Dfd), Comba sexual reduciada (Scr), Antennapedia (Antp), Ultrabithorax (Ubx),
what genes other than BmWnt1 were involved in producing the Abdominal A (Abd-A), and Abdominal B (Abd-B), were less than 30% in the BmWnt1
observed deleterious phenotypes. Hox genes have been reported mutant. Tyrosine hydroxylase (Th) was expressed at only 56% of the level of wild
to be involved in insect segmentation and pigmentation (Lewis, type. The data shown are mean values ± S.E.M. (n = 3).
1978; Celniker and Lewis, 1990; Weatherbee et al., 1999; Martin
and Kimelman, 2009); therefore, we analysed the transcription
levels of Hox genes in BmWnt1 mutant embryos at day 9 after analysis and found that Th expression in BmWnt1 knockout mutant
egg laying by qRT-PCR. The results indicated that all B. mori Hox embryos was significantly down-regulated, as expected (Fig. 6).
gene homologues, including Labial (Lab), Proboscipedia (Pb),
Deformed (Dfd), Sex combs reduced (Scr), Antennapedia (Antp), 4. Discussion
Ultrabithorax (Ubx), Abdominal A (Abd-A), and Abdominal B
(Abd-B), were significantly down-regulated in BmWnt1 mutant In the present study, we performed embryonic mutagenesis
embryos (Fig. 6). These findings suggested that B. mori Hox genes analysis using the direct injection of Cas9 mRNA and sgRNA to tar-
are regulated at least in part by BmWnt1. Additionally, tyrosine get BmWnt1. Similar to previous studies that have introduced
hydroxylase (Th) has been shown to be responsible for the choco- shRNA-mediated RNAi during the Bombyx embryonic stage
late colouration of the epidermis of the sch mutant silkworm (Liu (Yamaguchi et al., 2011), the present method led to effective muta-
et al., 2010). Because BmWnt1 knockout also produced a similar genesis in BmWnt1 loci and therefore resulted in severe develop-
chocolate colouration of the epidermis, we performed qRT-PCR mental defects during embryogenesis. These results were
comparable to those found in previously reported studies that
utilised dsRNA- or shRNA-mediated embryonic RNAi (Quan
et al., 2002; Yamaguchi et al., 2011). Unlike RNAi,
Cas9/sgRNA-mediated knockout does not seem to inhibit transcrip-
tion itself, although proper translation was found to be disrupted
(Fig. 6). Considering that the CRISPR/Cas9 system works at a geno-
mic level, if somatic mutagenesis achieves a complete loss of func-
tion and results are still ambiguous, they can be compared with
results obtained from RNAi, which works at a transcriptional level.
Furthermore, superior to the transient effects produced by RNAi,
the translational disruption that is mediated by CRISPR/Cas9 is
stable and, most likely, heritable.
The Wingless/Wnt1 signalling pathway generates patterns in
various animals, ranging from flies to humans (Sharma and
Chopra, 1976; Bejsovec, 2013). In insects, the majority of our
knowledge about the Wnt protein is based on genetic analyses of
the first identified Wnt gene, which is the Wnt1/Wg gene in D. mel-
anogaster. Wnt1 acts as a ligand in the Wnt signalling pathway,
which plays a vital role in embryonic posterior growth and axis
patterning (Murat et al., 2010). The BmWnt1 gene functions as a
segment polarity gene and is essential for embryonic development;
a previous study reported that embryos exposed to BmWnt1 RNAi
Fig. 5. CRISPR/Cas9-induced mutagenesis. (a) Various deletion or non-deletion embryos lacked abdominal segments and displayed immature tho-
genotypes in G0 injected embryos. In non-deletion events, few nucleotides had
racic legs (Yamaguchi et al., 2011). Similar with the transient
been removed at a single target site. In deletion events, the fragment spanning the
two sites and the varying lengths of flanking sequences were deleted. The numbers effects caused by RNAi, using the CRISPR/Cas9 system also resulted
in brackets in the middle of each sequence refer to the 18,081-bp-long interspace in malformed embryos and embryonic lethality. The resultant
fragment that was found between the S1 and S2 sites. The red sequence indicates deleterious segmentation defects led to the question of what other
PAM sequence. (b) T7EI assay of mutants. The panels of S1 and S2 showed PCR genes were being affected. It is well known that Hox genes encode
products amplified from WT and mutants treated with T7EI. An additional band of a
smaller size was detect in mutants. (c) BmWnt1 protein was not detected in
for transcription factors that are expressed in well defined patterns
mutants by Western blotting analysis. (For interpretation of the references to colour along the anterior-posterior axis of the embryo and control early
in this figure legend, the reader is referred to the web version of this article.) developmental processes, including body plan establishment,
 Z. Zhang et al. / Journal of Insect Physiology 79 (2015) 73–79 79

segmentation and appendage formation (Mallo and Alonso, 2013). Garneau, J.E., Dupuis, M.È., Villion, M., Romero, D.A., Barrangou, R., Boyaval, P.,
Fremaux, C., Horvath, P., Magadán, A.H., Moineau, S., 2010. The CRISPR/Cas
We therefore investigated Hox gene expression by qRT-PCR analy-
bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468,
sis and found that all eight Hox homologues were down-regulated 67–71.
at the transcriptional level. This suggested that the Wnt signalling Gonsalves, F.C., DasGupta, R., 2009. Function of the wingless signaling pathway in
pathway might regulate the expression of Hox genes to control the Drosophila. Methods Mol. Biol. 469, 115–125.
Hsu, P.D., Lander, E.S., Zhang, F., 2014. Development and applications of CRISPR-
development of segments during embryonic development. Another Cas9 for Genome engineering. Cell 157, 1262–1278.
phenotype that was noted in BmWnt1 knockout embryos was a Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T.,
reddish brown colouration of their skin. This phenotype was simi- Yeh, J.R., Joung, J.K., 2013. Efficient genome editing in zebrafish using a CRISPR-
Cas system. Nat. Biotechnol. 31, 227–229.
lar to the Bombyx sch mutant, which also produced a reddish Joung, J.K., Sander, J.D., 2013. TALENs: a widely applicable technology for targeted
brown colouration in the neonate head and epidermis (Liu et al., genome editing. Nat. Rev. Mol. Cell Biol. 14, 49–55.
2010). It was found that mutation of tyrosine hydroxylase (Th) Kennerdell, J.R., Carthew, R.W., 2000. Heritable gene silencing in Drosophila using
double-stranded RNA. Nat. Biotechnol. 18, 896–898.
was responsible for this phenotype; therefore, we also investigated Kondo, S., Ueda, R., 2013. Highly improved gene targeting by germline-specific Cas9
the expression levels of Th in BmWnt1 knockout embryos using expression in Drosophila. Genetics 195, 715–721.
qRT-PCR and found that Th was down-regulated in mutant silk- Lewis, E.B., 1978. A gene complex controlling segmentation in Drosophila. Nature
276, 565–570.
worms, suggesting that the Th gene may be regulated by Liu, C., Yamamoto, K., Cheng, T.C., Kadono-Okuda, K., Narukawa, J., Liu, S.P., Han, Y.,
BmWnt1. Further analyses are needed to investigate the expression Futahashi, R., Kidokoro, K., Noda, H., Kobayashi, I., Tamura, T., Ohnuma, A.,
pattern of other genes involved in the Wnt1 signalling pathway in Banno, Y., Dai, F.Y., Xiang, Z.H., Goldsmith, M.R., Mita, K., Xia, Q.Y., 2010.
Repression of tyrosine hydroxylase is responsible for the sex-linked chocolate
BmWnt1 mutant embryos. Considering that the loss of BmWnt1
mutation of the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. U.S.A. 107, 12980–
function is embryonic lethal, BmWnt1 represents an ideal target 12985.
gene for developing a transgene-based, embryonic lethal system. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church,
Recently, our laboratory produced a successful example of G.M., 2013. RNA-guided human genome engineering via Cas9. Science 339
(6121), 823–826.
transgenic TALENs technology in B. mori (Xu et al., 2014). This tech- Mallo, M., Alonso, C.R., 2013. The regulation of Hox gene expression during animal
nology combined piggyBac-based transgenesis and TALENs and development. Development 140, 3951–3963.
should also be suitable for establishing a transgenic CRISPR/Cas Martin, B.L., Kimelman, D., 2009. Wnt signaling and the evolution of embryonic
posterior development. Curr. Biol. 19, R215–R219.
system in B. mori. Transgene-based, somatic mutagenesis tech- Murat, S., Hopfen, C., McGregor, A.P., 2010. The function and evolution of Wnt genes
nologies using the TALEN or CRISPR/Cas systems will be particu- in arthropods. Arthropod Struct. Dev. 39, 446–452.
larly useful for functional analysis of target genes that do not Nakao, H., 2010. Characterization of Bombyx embryo segmentation process:
expression profiles of engrailed, even-skipped, caudal, and wnt1/wingless
currently have assessable phenotypes. Furthermore, if appropriate homologues. J. Exp. Zool. B Mol. Dev. Evol. 314, 224–231.
cis-regulatory elements can be applied to regulate TALEN or Cas9 Ober, K.A., Jockusch, E.L., 2006. The roles of wingless and decapentaplegic in axis
expression in a controlled manner, conditional genomic editing and appendage development in the red flour beetle, Tribolium castaneum. Dev.
Biol. 294, 391–405.
may be achieved, which would greatly facilitate functional gene Petersen, C.P., Reddien, P.W., 2009. Wnt signaling and the polarity of the primary
analysis in insects, including BmWnt1. The current study not only body axis. Cell 139, 1056–1068.
exploited the biological functions of BmWnt1 during embryogene- Quan, G.X., Kanda, T., Tamura, T., 2002. Induction of the white egg 3 mutant
phenotype by injection of the double-stranded RNA of the silkworm white gene.
sis using the CRISPR/Cas system but also provided a simple and
Insect Mol. Biol. 11, 217–222.
effective method for dissecting gene function that is comparable Sajwan, S., Takasu, Y., Tamura, T., Uchino, K., Sezutsu, H., Zurovec, M., 2013. Efficient
to using RNAi, particularly during Bombyx embryogenesis. disruption of endogenous Bombyx gene by TAL effector nucleases. Insect
Biochem. Mol. Biol. 43, 17–23.
Sharma, R.P., Chopra, V.L., 1976. Effect of the Wingless (wg1) mutation on wing and
Acknowledgements haltere development in Drosophila melanogaster. Dev. Biol. 48, 461–465.
Takasu, Y., Kobayashi, I., Beumer, K., Uchino, K., Sezutsu, H., Sajwan, S., Carroll, D.,
Tamura, T., Zurovec, M., 2010. Targeted mutagenesis in the silkworm Bombyx
This work was supported by grants from Strategic Pioneer mori using zinc finger nuclease mRNA injection. Insect Biochem. Mol. Biol. 40,
Projects of Chinese Academy of Sciences (XDA04020202), the 759–765.
Tamura, T., Thibert, C., Royer, C., Kanda, T., Abraham, E., Kamba, M., Komoto, N.,
National Science Foundation of China (31272037 and 31372257)
Thomas, J.L., Mauchamp, B., Chavancy, G., Shirk, P., Fraser, M., Prudhomme, J.C.,
and the External Cooperation Program of BIC, Chinese Academy Couble, P., 2000. Germline transformation of the silkworm Bombyx mori L. using
of Sciences (GJHZ201305). a piggyBac transposon-derived vector. Nat. Biotechnol. 18, 81–84.
Tan, A., Tanaka, H., Tamura, T., Shiotsuki, T., 2005. Precocious metamorphosis in
transgenic silkworms overexpressing juvenile hormone esterase. Proc. Natl.
References Acad. Sci. U.S.A. 102, 11751–11756.
Tan, A., Fu, G., Jin, L., Guo, Q., Li, Z., Niu, B., Meng, Z., Morrison, N.I., Alphey, L., Huang,
Y., 2013. Transgene-based, female-specific lethality system for genetic sexing of
Alexandre, C., Baena-Lopez, A., Vincent, J.P., 2014. Patterning and growth control by
the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. U.S.A. 110, 6766–6770.
membrane-tethered Wingless. Nature 505, 180–185.
Tomita, M., Munetsuna, H., Sato, T., Adachi, T., Hino, R., Hayashi, M., Shimizu, K.,
Baker, N.E., 1987. Molecular cloning of sequences from wingless, a segment polarity
Nakamura, N., Tamura, T., Yoshizato, K., 2003. Transgenic silkworms produce
gene in Drosophila: the spatial distribution of a transcript in embryos. EMBO J. 6,
recombinant human type III procollagen in cocoons. Nat. Biotechnol. 21, 52–56.
1765–1773.
Wang, Y., Li, Z., Xu, J., Zeng, B., Ling, L., You, L., Chen, Y., Huang, Y., Tan, A., 2013. The
Bejsovec, A., 2013. Wingless/Wnt signaling in Drosophila: the pattern and the
CRISPR/Cas system mediates efficient genome engineering in Bombyx mori. Cell
pathway. Mol. Reprod. Dev. 80, 882–894.
Res. 23, 1414–1416.
Bibikova, M., Golic, M., Golic, K.G., Carroll, D., 2002. Targeted chromosomal cleavage
Weatherbee, S.D., Nijhout, H.F., Grunert, L.W., Halder, G., Galant, R., Selegue, J.,
and mutagenesis in Drosophila using zinc-finger nucleases. Genetics 161 (3),
Carroll, S., 1999. Ultrabithorax function in butterfly wings and the evolution of
1169–1175.
insect wing patterns. Curr. Biol. 9, 109–115.
Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T.,
Xu, J., Wang, Y., Li, Z., Ling, L., Zeng, B., James, A.A., Tan, A., Huang, Y., 2014.
Nickstadt, A., Bonas, U., 2009. Science 326 (5959), 1509–1512.
Transcription activator-like effector nuclease (TALEN)-mediated female-specific
Carroll, D., 2011. Genome engineering with targetable nucleases. Annu. Rev.
sterility in the silkworm, Bombyx mori. Insect Mol. Biol. http://dx.doi.org/
Biochem. 83, 409–439.
10.1111/imb.12125.
Celniker, S.E., Lewis, E.B., 1990. Molecular basis of transabdominal – a sexually
Yamaguchi, J., Mizoguchi, T., Fujiwara, H., 2011. SiRNAs induce efficient RNAi
dimorphic mutant of the bithorax complex of Drosophila. Proc. Natl. Acad. Sci.
response in Bombyx mori embryos. PLoS ONE 6, e25469.
U.S.A. 90, 1566–1570.
Yamaguchi, J., Banno, Y., Mita, K., Yamamoto, K., Ando, T., Fujiwara, H., 2013.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W.,
Periodic Wnt1 expression in response to ecdysteroid generates twin-spot
Marraffini, L.A., Zhang, F., 2013. Multiplex genome engineering using CRISPR/
markings on caterpillars. Nat. Commun. 4, 1857.
Cas systems. Science 339 (6121), 819–823.