www.sciencemag.org/cgi/content/full/science.

aam7120/DC1

Supplementary Materials for

A single mutation in the prM protein of Zika virus contributes to fetal
microcephaly
Ling Yuan,* Xing-Yao Huang,* Zhong-Yu Liu,* Feng Zhang,* Xing-Liang Zhu,* Jiu-
Yang Yu,* Xue Ji, Yan-Peng Xu, Guanghui Li, Cui Li, Hong-Jiang Wang, Yong-Qiang
Deng, Menghua Wu, Meng-Li Cheng, Qing Ye, Dong-Yang Xie, Xiao-Feng Li, Xiangxi
Wang, Weifeng Shi, Baoyang Hu, Pei-Yong Shi, Zhiheng Xu,† Cheng-Feng Qin†

*These authors contributed equally to this work.

†Corresponding author. Email: [email protected] (C.-F.Q.); [email protected] (Z.X.)

Published 28 September 2017 on Science First Release

DOI: 10.1126/science.aam7120

This PDF file includes:

Materials and Methods

Figs. S1 to S14
Tables S1 and S2
References
Materials and Methods

Ethics Statement

All animal experiments were performed in strict accordance with the guidelines of
the Chinese Regulations of Laboratory Animals (Ministry of Science and Technology
of People's Republic of China) and Laboratory Animal-Requirements of Environment
and Housing Facilities (GB 14925-2010, National Laboratory Animal Standardization
Technical Committee). All procedures were approved by the Animal Experiment
Committee of Laboratory Animal Center, AMMS, China (IACUC-13-2016-001).

Cells and Viruses

Baby hamster kidney fibroblast cell line BHK-21 (ATCC CCL10) was cultured in
DMEM (Thermo Fisher Scientific) containing 5% fetal bovine serum (FBS, Biowest).
Human Neuroblastoma cell line SH-SY5Y (ATCC CRL-2266) and Aedes albopictus
cell line C6/36 (ATCC CRL-1660) were cultured using DMEM/F12 (Thermo Fisher
Scientific) and RPMI 1640 (Thermo Fisher Scientific) containing 10% FBS,
respectively. Mouse primary neural progenitor cells (mNPC) isolated from E14.5 fetal
brain were maintained in DMEM/F12 medium supplemented with 1% B27 supplement
(Gibco), 20 ng/mL epidermal growth factor (EGF, R&D), and 10 ng/mL basic
fibroblast growth factor (bFGF, R&D).

hNPCs and human brain organoids have been adopted for the study of ZIKV
infection (5, 8, 31-35). Here, hNPCs were used. H9 human embryo stem cells (hESCs)
were cultured and passaged weekly under feeder-free conditions as described
previously (36). The hESCs were differentiated into forebrain-specific hNPCs
following a previously established protocol with several modifications (37). Briefly,
the hESCs colonies were detached (day 0) with 2 U/mL dispase for 10~15 min and
suspended in 50% essential 8TM basal medium (E8) (Gibco) and 50% neural induction
medium (NIM), consisting of DMEM/F12, NEAA, N2 supplement (Gibco) and heparin
(2 μg/mL, Sigma). Then, these hESC aggregates were cultured in NIM in non-treated
polystyrene dishes (Corning) with a daily medium change. After adhering to a plastic

2
surface (Corning) at day 7, primitive neuroepithelium (NE) cells were generated at days
8-10, followed by definitive NE cells in the form of neural-tube-like rosettes at days
14-17 of differentiation. On the 15th day, the rosettes were picked mechanically and
transferred to 10 cm dishes to form neurospheres in NIM containing B27. The
neurospheres were maintained in suspension cultures for 10 days with NIM change
every other day. For ZIKV infection, 0.2-0.5 million hNPCs were seeded into 24-well
plates with matrigel-coated cover slips one day before infection.

The historical ZIKV strain FSS13025 (GenBank number KU955593), named

CAM/2010 here, was isolated from a patient in Cambodia in 2010 (17). The
contemporary ZIKV strain GZ01 (GenBank number KU820898), named VEN/2016,
was isolated from a patient returned from Venezuela in 2016 (38). The contemporary
strain SZ01 (GenBank number KU866423), named SAM/2016, was isolated from a
patient returning from Samoa in 2016 (39). The contemporary strain
MRS_OPY_Martinique_PaRi_2015 (GenBank number KU647676), named
MTQ/2015, was isolated from a patient from Martinique in 2015 (16). ZIKV stocks
were prepared by serial-propagation of the initial viral seeds in Aedes albopictus C6/36
cells for three times. The P3 virus stocks were titrated by plaque assay on BHK-21 cells
as described below, and were used in animal and cell infection experiments. Studies
with infectious ZIKV were conducted under biosafety level 2 (BSL-2) at Beijing
Institute of Microbiology and Epidemiology with Institutional Biosafety Committee
approval.

The infection of hNPC by ZIKV was performed as described previously (5) with
several modifications. Briefly, the culture supernatants were discarded and virus-
containing medium was added to infect the cells at a MOI of 0.1. After an incubation
at 37°C for 2 hrs, the virus inoculum was removed and fresh NIM containing B27 was
added to each well. At 56 hr, cells were fixed with 4% PFA (paraformaldehyde) for 15
min at room temperature for next immunostaining, and the culture supernatants at 72
hr post infection were collected for the determination of virus titers.

Plaque Assay
3
 Virus samples were serial-diluted by 10-fold with DMEM containing 2% FBS and
300 μl of each dilutes were added onto BHK-21 cell monolayers in 12-wells and
incubated at 37°C under 5% CO2 for 1.5 hrs. The supernatants containing the viruses
were aspired and 1 mL of DMEM containing 1% low melting point agarose (Promega)
and 2% FBS was added into each well. The infected cells were cultured for another 4
days and fixed with 4% formaldehyde, followed by staining with 1% crystal violet
solution. Plaques were counted for the calculations of virus titers.

Phylogenetic and molecular clock analysis

The phylogenetics analysis was performed using RAxML (fig. S4) (40). The
GTRGAMMA was used as the substitution model and one thousand bootstrap
replications were run. To test whether the evolution of the Asian lineage of ZIKV was
clockwise, we performed a Root-to-tip analysis using TempEst v1.5 (41). The
Maximum Likelihood tree obtained in the previous step was used as the input.

We then used BEAST v1.8.4 (42) to jointly estimate the phylogentic tree (fig. S5)
and to date the emergence of the conserved amino acids. The GTR+GAMMA was used
as the substitution model. To select the best fitting molecular clock and coalescent
models, we tried eight different model combinations (Table S1). Both path sampling
and stepping-stone sampling showed that the best fitting model combination was
uncorrelated relaxed lognormal molecular clock (UCLN)~Bayesian Skyline (BSKY).
Therefore, this model combination was used for subsequent Bayesian analysis.
Bayesian MCMC analysis was run for 50 million steps of which 10% were removed as
burn-in. Trees and priors were sampled every 5,000 steps.

Generation of ZIKV Mutants

The corresponding single-amino acid substitutions (fig. S8A) were introduced into
the infectious clone of CAM/2010 (WT) by using the Q5 site-directed mutagenesis kit
(NEB). The N139S reverse substitution was constructed based on the infectious clone
of VEN/2016 (43) developed in our lab. Primers used for site-directed mutagenesis
were listed in Table S2. The infectious clone plasmids were linearized by restriction

4
endonuclease digestion and purified by Phenol/Chloroform extraction. In vitro
transcribed viral RNA was prepared using Ribomax T7 or SP6 large scale RNA
production kit (Promega) and purified using Purelink RNA mini kit (Thermo Fisher
Scientific). The RNA was then transfected into BHK-21 cells using Lipofectamine
3000 reagent (Thermo Fisher Scientific). Culture supernatants were collected at 48-72
hr post-transfection. Infectious virions were detected by plaque assay and viral antigen
expression was detected by indirect immunofluoresce assay. The titers of virus stocks
were then determined by plaque-forming assay, and the substitution sites were
confirmed by RT-PCR and DNA sequencing.

Growth Curve Analysis

BHK-21, SH-SY5Y and mNPC cells were seeded onto 24-well plates one or two
days before infection to reach 90% confluence at the day of infection. The culture
supernatants were discarded and virus-containing medium was added onto the cells and
incubated at 37°C for 1.5 hrs. MOI was set to 0.1. Then the viral supernatants were
aspired, and 0.5 mL of fresh medium (DMEM containing 2% FBS for BHK-21,
DMEM/F12 containing 2% FBS for SH-SY5Y and DMEM/F12 medium containing 1%
B27 supplement (GIBCO), 20 ng/mL EGF (R&D), and 10 ng/mL bFGF (R&D) was
used for mNPC cells) was added to each well. Infected cells were cultured at 37°C with
5% CO2 and culture supernatants were collected at the indicated time points. Virus titers
were determined by plaque assay. Alternatively, viral RNA was extracted using
Purelink RNA mini kit (Thermo Fisher Scientific) and a previously established qRT-
PCR (38) was performed. A 10-fold serial dilution of In vitro transcribed ZIKV vRNA
was used for the generation of standard curves, which served for the determination of
the copies of ZIKV genome in the samples.

Animal Experiments

For virus injection at E13.5, 1 μl of ZIKV strain or mutant virus stock (5.0×105
PFU/mL) or culture medium (RPMI 1640 basic + 2% FBS) were injected into lateral
ventricle (LV) of embryonic littermate brains as described previously (4). At E16.5 or

5
E18.5, the embryos were sacrificed and brains were used for further analysis. For the
determination of viral RNA copies and virus loads, the brain tissues were grinded with
0.4 milliliter of DMEM medium containing 2% FBS, after a centrifugation of 12, 000
rpm at 4°C for 5 min, the supernatants were collected and stored at -80°C for load use.

For mouse neurovirulence test, postnatal day 1 (P1) BALB/c mice were injected
with 10 PFU of ZIKV strains intra-cerebrally into the λ point and the survival status
were observed daily up to 26 days. Survival analysis was performed using the GraphPad
Prism 6 software.

Immunohistochemistry, immunofluorescence and antibodies

Brain tissues were fixed in 4% paraformaldehyde (PFA) for 24 hrs at 4°C, then
dehydrated in 30% sucrose for 24-48 hrs. The fixed brains were frozen in tissue freezing
medium (TFM) and sectioned into 40 µm slices. The cryo-sections were blocked at
room temperature (RT) for 1 hr in 3% BSA, 10% FBS (Excell) and 0.2% Triton X-100
in PBS, then incubated in the corresponding primary antibody at 4°C overnight, and
then washed with 0.2% Triton X-100 in PBS (3×10 min), followed by incubating in the
secondary antibody at RT for 1 hr, and then washed for 3 times as described previously
(44, 45).

The antibodies used for immunostaining were as follows: Phospho-Histone 3 (P-

H3) (ab10543, 1:1000; Abcam); Activated-caspase3 (9664s, 1:500; CST); Ki67
(ab15580, 1:1000; Abcam); BrdU (ab6326, 1:500; Abcam); Tbr1 (ab31940, 1:500;
Abcam); NeuN (ab104224, 1:1000; Abcam); and ZIKV serum from a patient (1:1000).
Nuclei were stained with 4', 6-diamidino-2-phenylindole (DAPI, Invitrogen). For BrdU
labeling experiments, pregnant dams were injected with 50 mg/kg (body weight) of
BrdU in solution at 24 hr before scarification. BrdU staining was performed as
described previously (44, 45).

BHK-21 cells grown on the cover slips were fixed in acetone/methanol (v/v: 3/7)
at -20°C. The cover slips were incubated with the anti-ZIKV envelope protein mAb
clone 0302156 (1:1500 diluted, BioFront Technologies) at 37°C for 1 hr. After the

6
incubation with primary antibody, the cover slips were washed with PBS for three
times. Alexa Fluor 488-labeled goat anti-mouse IgG (1:200 diluted, Zsbio) was then
added, and after 1 hr incubation, the cover slips were washed as described above. For
cell nuclei staining, DAPI (0.5 ng/μL) was added onto the cover slips and incubated for
5 min. An Olympus BX51 microscope equipped with a DP72 camera was utilized for
image capture.

Nissl Staining

Brain slices were stained with 0.1% Toluidine Blue for 30 min at RT, and then
dehydrated in sequence by 70%, 95%, 100% ethanol, each step was performed for 45 s
and repeated twice. Finally, slices were hyalinized by Xylene for at least 30 min before
sealed with neutral balsam.

Confocal Imaging

Slices were imaged on an LSM 700 (Carl Zeiss) confocal microscope, whereas
Leica MZ16F Stereomicroscope was used to achieve the images of Toluidine Blue
staining. The images were processed and quantified using Imaris, ImageJ and Adobe
Photoshop software.

Structural modeling

The structure of the prM-E protein of dengue virus (PDB code:3C5X) (26) was
used as a template for the homology modeling using the SWISS-MODEL Workspace
in the Expasy web server (46). The generated model was superimposed to the cryo-EM
structure of mature ZIKV. Structural figures were prepared with PyMol (47).

Statistical analysis

All data were analyzed using the GraphPad Prism software. Log-rank tests were
performed for the survival analysis. For the statistical analysis of other results,
statistical evaluation was performed by Student’s unpaired t test or One-Way ANOVA
with Tukey's multiple comparisons test. Data are presented as means ± SD or as
described in the corresponding legends.

7
Figure S1. Comparison of the biological characteristics of ZIKV strains.
(A) Plaque morphology of the ZIKV CAM/2010 and VEN/2016 strain. (B) Replication
characteristics of the ZIKV CAM/2010 and VEN/2016 strain on BHK-21 (left) or SH-
SY5Y (right) cells. Data was expressed as mean ± SD. (related to Figure 1)

8
Figure S2. ZIKV VEN/2016 strain infects NPCs more efficiently and leads to thinner
cortex than CAM/2010 strain.
Littermate embryonic brains were injected with CAM/2010, VEN/2016 or PBS (Mock) at
embryonic day 13.5 (E13.5) and inspected at E16.5 or E18.5. (A) Layer thickness
quantification of Fig. 1B. Mock: n = 21/5, CAM/2010: n=27/6, VEN/2016: n=30/5. CP:
cortical plate, SP: subplate, IZ: intermediate zone, SVZ: sub-ventricle zone, VZ: ventricle
zone. (B) The viral infection and replication capacity of VEN/2016 strain is greater in
embryonic brain. Images of coronal sections stained with DAPI and ZIKV antiserum (green).
Right panel: quantification of relative levels of ZIKV+ cells. CAM/2010: n=12/4,
VEN/2016: n=9/3. Scale bar: 40 μm. n for (A, B): slice numbers/brain numbers. (C) Fold
change of viral RNA copies were determined by real-time RT-PCR of whole brains (E16.5).
CAM/2010: n = 6, VEN/2016: n = 5, n: brain numbers. (D) Growth curves of different
ZIKV strains in cultured mNPC. All data are means ± SD, t test. * p<0.05, *** p<0.001,
**** p<0.0001, ### p<0.001. (related to Figure 1)

9
Figure S3. ZIKV VEN/2016 strain causes more cell death and neuronal loss than
CAM/2010 strain.
Littermate embryonic brains were injected with CAM/2010, VEN/2016 or PBS (Mock) at
E13.5 and inspected at E18.5. (A, B) VEN/2016 strain causes more cell death than CAM/2010
strain in different regions of the brain. Images of cortices (A) and striatum (B) stained with
the activated form of caspase3 (Cas3, gray) and ZIKV (Green) antisera and DAPI (blue). (A)
Right panel: quantification of Cas3+ cells. Mock and VEN/2016: n=12/5 (slice numbers/brain
numbers), CAM/2010: n=12/6. (C) Images of brain cortices stained for NeuN (mature neuron
marker, gray) and Tbrl (immature neuron marker, red). Middle and right panels:
Quantification of average thickness stained with individual markers. PBS: n = 10/5 (NeuN),
9/5 (Tbr1); CAM2010: n = 12/6 (NeuN), 9/6 (Tbr1); VN2016: n=7/5 (NeuN), 9/5 (Tbr1). All
data are means ± SD, t test. ** p<0.01, *** p<0.001, ### p<0.001. Scale bars: 40 μm (A, C),
100 μm (B). (related to Figure 1)

10
Figure S4. ZIKV VEN/2016 strain disturbs the proliferation and differentiation of
NPC more significantly than CAM/2010 strain.
Littermate embryonic brains were injected with CAM/2010, VEN/2016 or PBS (Mock)
at E13.5 and inspected at E16.5 or E18.5. (A) Quantification of P-H3+ cells in the VZ
of Fig. 1D. Mock: n=11/4 (slice numbers/brain numbers), CAM/2010: n=7/4,
VEN/2016: n=5/3. (B) E18.5 brain sections stained for ZIKV (gray), Ki67 (green), and
BrdU (red). Right panel: quantification of cell-cycle exit index (Ki67-BrdU+/BrdU+).
Mock: n=7/5, CAM/2010: n=9/6, VEN/2016: n=8/5. Scale bar: 40 μm. All data are
means ± SD, t test. * p<0.05, *** p<0.001, ### p<0.001. (related to Figure 1)

11
Figure S5. Identification of variations among ZIKV strains of the Asian lineage.
Sequence comparison was performed using MEGA6 software. The genbank accession
numbers and isolated years of the ZIKV strains were listed. The CAM/2010 Strain (blue)
was set as the reference sequence. The contemporary ZIKV strains used in this work were
labeled in red. Variations were presented in accordance with their locations in viral
genome. The various colors indicated different boxes of variations. The deep blue colored
variations were unique for the SAM/2016 clade. (related to Figure 2)

12
Figure S6. Maximum likelihood analysis of the Asian lineage of ZIKV.
The four strains used in this study were highlighted using black arrows. Conserved amino
acid changes were inferred using the CAM/2010 strain as the parental strain. Only
bootstrap values along the major branches were labeled. Scale bar represent
substitutions/site/year. (related to Figure 2)

13
Figure S7. A Bayesian phylogentic analysis of the Asian lineage of ZIKV.
The positions of CAM/2010, VEN/2016, SAM/2016 and MTQ/2015 were indicated with
black arrows. Conserved amino acid changes were inferred using the CAM/2010 strain as
the parental strain. The green bars indicated the 95% highest probability density intervals
of the age of the lineage. (related to Figure 2)

14
Figure S8. Characterization of recombinant ZIKV mutants.
(A) Description of ZIKV single-site mutants. Locations of substitutions are shown in the
diagrams of the ZIKV genome. (B) Viral protein expression in BHK-21 cells transfected
with vRNA of WT or ZIKV mutants at 48 hr post transfection. (C) Plaque morphology
and stock titers of various ZIKV mutants. (related to Figure 3)

15
Figure S9. Generation and characterization of the VEN2016-N139S mutant.
(A) Expression of ZIKV antigen in VEN/2016 or VEN/2016-N139S vRNA-transfected
BHK-21 cells. (B) Plaque morphologies of the VEN/2016 strain and the VEN/2016-
N139S mutant. The corresponding stock titers were listed. (related to Figure 3)

16
Figure S10. The S139N mutant infects hNPCs with higher efficiency and caused more
cell death.
(A) hNPCs derived from hESCs was confirmed by immunostaining for Sox2 (red), a
marker for NPC. Almost all cells were positive for Sox2. Scale bar: 40 μm. (B) Left panel:
quantification of infection rate of Fig. 3D. Right panel: quantification of Cas3+ cells of Fig.
3D. MOCK: n=639, WT: n=851, S139N: n=515. n: cell numbers. All data are means ±
SD, t test. * p<0.05, *** p<0.001, ## p<0.01, ### p<0.001. (related to Figure 3)

17
Figure S11. ZIKV S139N mutant infects NPCs more efficiently and leads to thinner
cortex than WT.
(A) mNPC cells were infected with ZIKV WT (CAM/2010) and S139N mutant
respectively, MOI was set to 0.1. At different time points after infection, the culture
supernatants were harvested and vRNA in the samples were isolated and quantified by
qRT-PCR. Results shown include two technical replicates (n=2). (B-D) Littermate
embryonic brains were injected with culture media, WT or S139N mutant strain at E13.5
and inspected at E16.5 or E18.5. (B) Layer thickness quantification of Fig. 4B. Mock:
n=26/7, WT: n=27/6, S139N: n=32/7. (C) The virus loads in E16.5 brains were
determined by plaque assay. (D) Images of E16.5 coronal sections stained with DAPI
and ZIKV antiserum (green). Right panel: quantification of relative levels of ZIKV+ cells.
WT and S139N: n = 9/3. All data are means ± SD, t test. * p<0.05, ** p<0.01, ***
p<0.001, ## p<0.01, ### p<0.001. n means slice numbers/brain numbers in (B and D). Scale
bars: 40 μm. (related to Figure 4)

18
Figure S12. ZIKV S139N mutant disturbs the proliferation and differentiation
of NPC more significantly than WT.
Littermate embryonic brains were injected with culture media (mock), WT or S139N
mutant strain at E13.5 and inspected at E16.5. Brain sections were stained for ZIKV
(gray), Ki67 (green), and BrdU (red). Right panel: quantification of cell-cycle exit
index and Ki67+BrdU+/BrdU+ Cells. Mock and WT: n=10/3, S139N: n=11/3. All data
are means ± SD, t test. *** p<0.001, ### p<0.001. n: slice numbers/brain numbers.
Scale bars: 40 μm. (related to Figure 4)

19
Figure S13. The S139N mutant causes more apoptosis than WT and N130S mutant
in different regions of the brain.
(A) Images of cortices stained with Cas3 (gray), ZIKV (Green) and DAPI. Right panel:
quantification of Cas3 positive cells. Mock: n=9/7, WT: n9/6, N130S: n=15/7, S139N:
n=l0/7. (B) Images of striatum stained with Cas3 (gray), ZIKV (Green) and DAPI (blue).
All data are means ± SD, t test. *** p<0.001, # p<0.05 ### p<0.001. n: slice
numbers/brain numbers. Scale bars for (A): 40 μm, (B): 100 μm. (related to Figure 4)

20
Figure S14. Mapping of the S139N substitution on immature ZIKV virions.
(A) Homology model of ZIKV prM-E proteins. The predicted model of an icosahedral
asymmetric unit of the three prM-E monomers was built based on crystal structure of the
prM-E protein of dengue virus (26), and the model was then fitted into the cryo-EM
structure of mature ZIKV (47). Domain I, II, III, transmembrane (TM) of E, M and prM
are colored in red, yellow, blue, cyan, orange and green respectively. The residue of
Ser139 in prM is shown as sticks. (B) Structural model of the immature virion (PDB code:
3C6D) of dengue virus (26), a flavivirus closely related to ZIKV. The amino acid
homologous with S/N139 was shown as red spheres. Yellow regions represented the pr
peptide. (related to Figure 4)

21
Table S1. Comparison of different molecular clock and coalescent model
combinations using path sampling and stepping-stone sampling methods.

Model Path sampling Stepping-stone sampling

combinations Log Marginal Ranking Log Marginal likelihood Ranking
likelihood
Strict, Constant -21811.140 6 -21810.432 6
Strict, Exponential -21815.277 8 -21815.957 8
Strict, BSKY -21805.911 2 -21806.350 3
Strict, SkyGrid -21812.862 7 -21810.557 7
UCLN, Constant -21807.763 4 -21807.495 4
UCLN, -21805.921 3 -21805.748 2
Exponential
UCLN, BSKY -21801.019 1 -21801.559 1
UCLN, SkyGrid -21809.496 5 -21810.248 5

Two molecular clocks were tested: Strict (strict clock) and UCLN (uncorrelated relaxed
lognormal molecular clock). Four tree priors were tested: Constant (constant size),
Exponential (exponential growth), BSKY (non-parametric Bayesian skyline) and
SkyGrid (Bayesian SkyGrid). Both path sampling and stepping-stone sampling showed
that the best fitting model combination was UCLN-BSKY. This model combination
was used for subsequent Bayesian analysis.

22
Table S2. Primer sets for the generation of ZIKV mutants.

Substitution Primer Sequence (5′-3′)

P-T106A-F GAGACGAGGCgCAGATACTAG
T106A
P-T106A-R TTCTTCTCCTTCCTAGCATTG

P-S109N-F ACAGATACTAaTGTCGGAATTG
S109N
P-S109N-R GCCTCGTCTCTTCTTCTC

P-N130S-F AGACGTGGGAgTGCATACTATATG
N130S
P-N130S-R AGTGACCTCCACTGCCAT

P-S139N-F TTGGACAGAAaCGATGCTGGG
S139N
P-S139N-R GTACATATAGTATGCATTCCCAC

P-K709R-F AGAGGTGCCAgGAGAATGGCA
K709R
P-K709R-R CACAGTGGCTTCAAATGC

P-N3144S-F CTCATTCGGAgTATGGAGGCTG
N3144S
P-N3144S-R CTGCACCACTAGGTTGGT

P-GZN139S-F CTTGGACAGAagtGATGCTGGGG
VEN/2016-N139S
P-GZN139S-R TACATATAGTATGCACTCC

23
References and Notes
1. G. W. Dick, S. F. Kitchen, A. J. Haddow, Zika virus. I. Isolations and serological specificity.
Trans. R. Soc. Trop. Med. Hyg. 46, 509–520 (1952). doi:10.1016/0035-9203(52)90042-4
Medline
2. E. J. Rubin, M. F. Greene, L. R. Baden, Zika virus and microcephaly. N. Engl. J. Med. 374,
984–985 (2016). doi:10.1056/NEJMe1601862 Medline
3. B. Parra, J. Lizarazo, J. A. Jiménez-Arango, A. F. Zea-Vera, G. González-Manrique, J.
Vargas, J. A. Angarita, G. Zuñiga, R. Lopez-Gonzalez, C. L. Beltran, K. H. Rizcala, M.
T. Morales, O. Pacheco, M. L. Ospina, A. Kumar, D. R. Cornblath, L. S. Muñoz, L.
Osorio, P. Barreras, C. A. Pardo, Guillain-Barré syndrome associated with Zika virus
infection in Colombia. N. Engl. J. Med. 375, 1513–1523 (2016).
doi:10.1056/NEJMoa1605564 Medline
4. C. Li, D. Xu, Q. Ye, S. Hong, Y. Jiang, X. Liu, N. Zhang, L. Shi, C.-F. Qin, Z. Xu, Zika virus
disrupts neural progenitor development and leads to microcephaly in mice. Cell Stem Cell
19, 120–126 (2016). doi:10.1016/j.stem.2016.04.017 Medline
5. H. Tang, C. Hammack, S. C. Ogden, Z. Wen, X. Qian, Y. Li, B. Yao, J. Shin, F. Zhang, E. M.
Lee, K. M. Christian, R. A. Didier, P. Jin, H. Song, G. L. Ming, Zika virus infects human
cortical neural progenitors and attenuates their growth. Cell Stem Cell 18, 587–590
(2016). doi:10.1016/j.stem.2016.02.016 Medline
6. K. Y. Wu, G.-L. Zuo, X.-F. Li, Q. Ye, Y.-Q. Deng, X.-Y. Huang, W.-C. Cao, C.-F. Qin, Z.-G.
Luo, Vertical transmission of Zika virus targeting the radial glial cells affects cortex
development of offspring mice. Cell Res. 26, 645–654 (2016). doi:10.1038/cr.2016.58
Medline
7. J. J. Miner, B. Cao, J. Govero, A. M. Smith, E. Fernandez, O. H. Cabrera, C. Garber, M. Noll,
R. S. Klein, K. K. Noguchi, I. U. Mysorekar, M. S. Diamond, Zika virus infection during
pregnancy in mice causes placental damage and fetal demise. Cell 165, 1081–1091
(2016). doi:10.1016/j.cell.2016.05.008 Medline
8. P. P. Garcez, E. C. Loiola, R. Madeiro da Costa, L. M. Higa, P. Trindade, R. Delvecchio, J. M.
Nascimento, R. Brindeiro, A. Tanuri, S. K. Rehen, Zika virus impairs growth in human
neurospheres and brain organoids. Science 352, 816–818 (2016).
doi:10.1126/science.aaf6116 Medline
9. S. A. Rasmussen, D. J. Jamieson, M. A. Honein, L. R. Petersen, Zika virus and birth defects—
Reviewing the evidence for causality. N. Engl. J. Med. 374, 1981–1987 (2016).
doi:10.1056/NEJMsr1604338 Medline
10. A. D. Haddow, A. J. Schuh, C. Y. Yasuda, M. R. Kasper, V. Heang, R. Huy, H. Guzman, R.
B. Tesh, S. C. Weaver, Genetic characterization of Zika virus strains: Geographic
expansion of the Asian lineage. PLOS Negl. Trop. Dis. 6, e1477 (2012).
doi:10.1371/journal.pntd.0001477 Medline
11. N. R. Faria, R. D. S. D. S. Azevedo, M. U. G. Kraemer, R. Souza, M. S. Cunha, S. C. Hill, J.
Thézé, M. B. Bonsall, T. A. Bowden, I. Rissanen, I. M. Rocco, J. S. Nogueira, A. Y.
Maeda, F. G. D. S. Vasami, F. L. L. Macedo, A. Suzuki, S. G. Rodrigues, A. C. R. Cruz,
 B. T. Nunes, D. B. A. Medeiros, D. S. G. Rodrigues, A. L. N. Queiroz, E. V. P. da Silva,
D. F. Henriques, E. S. T. da Rosa, C. S. de Oliveira, L. C. Martins, H. B. Vasconcelos, L.
M. N. Casseb, D. B. Simith, J. P. Messina, L. Abade, J. Lourenço, L. C. J. Alcantara, M.
M. de Lima, M. Giovanetti, S. I. Hay, R. S. de Oliveira, P. D. S. Lemos, L. F. de Oliveira,
C. P. S. de Lima, S. P. da Silva, J. M. de Vasconcelos, L. Franco, J. F. Cardoso, J. L. D.
S. G. Vianez-Júnior, D. Mir, G. Bello, E. Delatorre, K. Khan, M. Creatore, G. E. Coelho,
W. K. de Oliveira, R. Tesh, O. G. Pybus, M. R. T. Nunes, P. F. C. Vasconcelos, Zika
virus in the Americas: Early epidemiological and genetic findings. Science 352, 345–349
(2016). doi:10.1126/science.aaf5036 Medline
12. V. Heang, C. Y. Yasuda, L. Sovann, A. D. Haddow, A. P. Travassos da Rosa, R. B. Tesh, M.
R. Kasper, Zika virus infection, Cambodia, 2010. Emerg. Infect. Dis. 18, 349–351 (2012).
doi:10.3201/eid1802.111224 Medline
13. F. R. Cugola, I. R. Fernandes, F. B. Russo, B. C. Freitas, J. L. Dias, K. P. Guimarães, C.
Benazzato, N. Almeida, G. C. Pignatari, S. Romero, C. M. Polonio, I. Cunha, C. L.
Freitas, W. N. Brandão, C. Rossato, D. G. Andrade, Dde. P. Faria, A. T. Garcez, C. A.
Buchpigel, C. T. Braconi, E. Mendes, A. A. Sall, P. M. Zanotto, J. P. Peron, A. R.
Muotri, P. C. Beltrão-Braga, The Brazilian Zika virus strain causes birth defects in
experimental models. Nature 534, 267–271 (2016). Medline
14. Y. Simonin, F. Loustalot, C. Desmetz, V. Foulongne, O. Constant, C. Fournier-Wirth, F.
Leon, J.-P. Molès, A. Goubaud, J.-M. Lemaitre, M. Maquart, I. Leparc-Goffart, L. Briant,
N. Nagot, P. Van de Perre, S. Salinas, Zika virus strains potentially display different
infectious profiles in human neural cells. EBioMedicine 12, 161–169 (2016).
doi:10.1016/j.ebiom.2016.09.020 Medline
15. F. C. Zhang, X. F. Li, Y. Q. Deng, Y. G. Tong, C. F. Qin, Excretion of infectious Zika virus
in urine. Lancet Infect. Dis. 16, 641–642 (2016). doi:10.1016/S1473-3099(16)30070-6
Medline
16. G. Piorkowski, P. Richard, C. Baronti, P. Gallian, R. Charrel, I. Leparc-Goffart, X. de
Lamballerie, Complete coding sequence of Zika virus from Martinique outbreak in 2015.
New Microbes New Infect. 11, 52–53 (2016). doi:10.1016/j.nmni.2016.02.013 Medline
17. C. Shan, X. Xie, A. E. Muruato, S. L. Rossi, C. M. Roundy, S. R. Azar, Y. Yang, R. B. Tesh,
N. Bourne, A. D. Barrett, N. Vasilakis, S. C. Weaver, P.-Y. Shi, An infectious cDNA
clone of Zika virus to study viral virulence, mosquito transmission, and antiviral
inhibitors. Cell Host Microbe 19, 891–900 (2016). doi:10.1016/j.chom.2016.05.004
Medline
18. S. I. Yun, B.-H. Song, J.-K. Kim, G.-N. Yun, E.-Y. Lee, L. Li, R. J. Kuhn, M. G. Rossmann,
J. D. Morrey, Y.-M. Lee, A molecularly cloned, live-attenuated japanese encephalitis
vaccine SA14-14-2 virus: A conserved single amino acid in the ij hairpin of the viral E
glycoprotein determines neurovirulence in mice. PLOS Pathog. 10, e1004290 (2014).
doi:10.1371/journal.ppat.1004290 Medline
19. S. D. Dowall, V. A. Graham, E. Rayner, B. Atkinson, G. Hall, R. J. Watson, A. Bosworth, L.
C. Bonney, S. Kitchen, R. Hewson, A susceptible mouse model for Zika virus infection.
PLOS Negl. Trop. Dis. 10, e0004658 (2016). doi:10.1371/journal.pntd.0004658 Medline
20. G. V. A. França, L. Schuler-Faccini, W. K. Oliveira, C. M. P. Henriques, E. H. Carmo, V. D.
Pedi, M. L. Nunes, M. C. Castro, S. Serruya, M. F. Silveira, F. C. Barros, C. G. Victora,
Congenital Zika virus syndrome in Brazil: A case series of the first 1501 livebirths with
complete investigation. Lancet 388, 891–897 (2016). doi:10.1016/S0140-6736(16)30902-
3 Medline
21. J. H. Pettersson, V. Eldholm, S. J. Seligman, Å. Lundkvist, A. K. Falconar, M. W. Gaunt, D.
Musso, A. Nougairède, R. Charrel, E. A. Gould, X. de Lamballerie, How did Zika virus
emerge in the Pacific Islands and Latin America? mBio 7, e01239-16 (2016).
doi:10.1128/mBio.01239-16 Medline
22. L. Wang, S. G. Valderramos, A. Wu, S. Ouyang, C. Li, P. Brasil, M. Bonaldo, T. Coates, K.
Nielsen-Saines, T. Jiang, R. Aliyari, G. Cheng, From mosquitos to humans: Genetic
evolution of Zika virus. Cell Host Microbe 19, 561–565 (2016).
doi:10.1016/j.chom.2016.04.006 Medline
23. D. Musso, D. J. Gubler, Zika virus. Clin. Microbiol. Rev. 29, 487–524 (2016).
doi:10.1128/CMR.00072-15 Medline
24. E. Oehler, L. Watrin, P. Larre, I. Leparc-Goffart, S. Lastère, F. Valour, L. Baudouin, H.
Mallet, D. Musso, F. Ghawche, Zika virus infection complicated by Guillain-Barre
syndrome—Case report, French Polynesia, December 2013. Euro Surveill. 19, 20720
(2014). doi:10.2807/1560-7917.ES2014.19.9.20720 Medline
25. S. Cauchemez, M. Besnard, P. Bompard, T. Dub, P. Guillemette-Artur, D. Eyrolle-Guignot,
H. Salje, M. D. Van Kerkhove, V. Abadie, C. Garel, A. Fontanet, H.-P. Mallet,
Association between Zika virus and microcephaly in French Polynesia, 2013-15: A
retrospective study. Lancet 387, 2125–2132 (2016). doi:10.1016/S0140-6736(16)00651-6
Medline
26. L. Li, S.-M. Lok, I.-M. Yu, Y. Zhang, R. J. Kuhn, J. Chen, M. G. Rossmann, The flavivirus
precursor membrane-envelope protein complex: Structure and maturation. Science 319,
1830–1834 (2008). doi:10.1126/science.1153263 Medline
27. T. C. Pierson, M. S. Diamond, Degrees of maturity: The complex structure and biology of
flaviviruses. Curr. Opin. Virol. 2, 168–175 (2012). doi:10.1016/j.coviro.2012.02.011
Medline
28. V. M. Prasad, A. S. Miller, T. Klose, D. Sirohi, G. Buda, W. Jiang, R. J. Kuhn, M. G.
Rossmann, Structure of the immature Zika virus at 9 Å resolution. Nat. Struct. Mol. Biol.
24, 184–186 (2017). doi:10.1038/nsmb.3352 Medline
29. K. A. Tsetsarkin, R. Chen, M. B. Sherman, S. C. Weaver, Chikungunya virus: Evolution and
genetic determinants of emergence. Curr. Opin. Virol. 1, 310–317 (2011).
doi:10.1016/j.coviro.2011.07.004 Medline
30. Y. Liu, J. Liu, S. Du, C. Shan, K. Nie, R. Zhang, X.-F. Li, R. Zhang, T. Wang, C.-F. Qin, P.
Wang, P.-Y. Shi, G. Cheng, Evolutionary enhancement of Zika virus infectivity in Aedes
aegypti mosquitoes. Nature 545, 482–486 (2017). doi:10.1038/nature22365 Medline
31. M. F. Wells, M. R. Salick, O. Wiskow, D. J. Ho, K. A. Worringer, R. J. Ihry, S. Kommineni,
B. Bilican, J. R. Klim, E. J. Hill, L. T. Kane, C. Ye, A. Kaykas, K. Eggan, Genetic
ablation of AXL does not protect human neural progenitor cells and cerebral organoids
 from Zika virus infection. Cell Stem Cell 19, 703–708 (2016).
doi:10.1016/j.stem.2016.11.011 Medline
32. E. Gabriel, A. Ramani, U. Karow, M. Gottardo, K. Natarajan, L. M. Gooi, G. Goranci-
Buzhala, O. Krut, F. Peters, M. Nikolic, S. Kuivanen, E. Korhonen, T. Smura, O.
Vapalahti, A. Papantonis, J. Schmidt-Chanasit, M. Riparbelli, G. Callaini, M. Krönke, O.
Utermöhlen, J. Gopalakrishnan, Recent Zika virus isolates induce premature
differentiation of neural progenitors in human brain organoids. Cell Stem Cell 20, 397–
406.e5 (2017). doi:10.1016/j.stem.2016.12.005 Medline
33. F. Zhang, C. Hammack, S. C. Ogden, Y. Cheng, E. M. Lee, Z. Wen, X. Qian, H. N. Nguyen,
Y. Li, B. Yao, M. Xu, T. Xu, L. Chen, Z. Wang, H. Feng, W. K. Huang, K. J. Yoon, C.
Shan, L. Huang, Z. Qin, K. M. Christian, P. Y. Shi, M. Xu, M. Xia, W. Zheng, H. Wu, H.
Song, H. Tang, G. L. Ming, P. Jin, Molecular signatures associated with ZIKV exposure
in human cortical neural progenitors. Nucleic Acids Res. 44, 8610–8620 (2016).
doi:10.1093/nar/gkw765 Medline
34. X. Qian, H. N. Nguyen, F. Jacob, H. Song, G. L. Ming, Using brain organoids to understand
Zika virus–induced microcephaly. Development 144, 952–957 (2017).
doi:10.1242/dev.140707 Medline
35. J. Dang, S. K. Tiwari, G. Lichinchi, Y. Qin, V. S. Patil, A. M. Eroshkin, T. M. Rana, Zika
virus depletes neural progenitors in human cerebral organoids through activation of the
innate immune receptor TLR3. Cell Stem Cell 19, 258–265 (2016).
doi:10.1016/j.stem.2016.04.014 Medline
36. J. Beers, D. R. Gulbranson, N. George, L. I. Siniscalchi, J. Jones, J. A. Thomson, G. Chen,
Passaging and colony expansion of human pluripotent stem cells by enzyme-free
dissociation in chemically defined culture conditions. Nat. Protoc. 7, 2029–2040 (2012).
doi:10.1038/nprot.2012.130 Medline
37. X. Q. Zhang, S. C. Zhang, Differentiation of neural precursors and dopaminergic neurons
from human embryonic stem cells. Methods Mol. Biol. 584, 355–366 (2010).
doi:10.1007/978-1-60761-369-5_19 Medline
38. X. F. Li, H. L. Dong, X. Y. Huang, Y. F. Qiu, H. J. Wang, Y. Q. Deng, N. N. Zhang, Q. Ye,
H. Zhao, Z. Y. Liu, H. Fan, X. P. An, S. H. Sun, B. Gao, Y. Z. Fa, Y. G. Tong, F. C.
Zhang, G. F. Gao, W. C. Cao, P. Y. Shi, C. F. Qin, Characterization of a 2016 clinical
isolate of Zika virus in non-human primates. EBioMedicine 12, 170–177 (2016).
doi:10.1016/j.ebiom.2016.09.022 Medline
39. Y. Q. Deng, H. Zhao, X. F. Li, N. N. Zhang, Z. Y. Liu, T. Jiang, D. Y. Gu, L. Shi, J. A. He,
H. J. Wang, Z. Z. Sun, Q. Ye, D. Y. Xie, W. C. Cao, C. F. Qin, Isolation, identification
and genomic characterization of the Asian lineage Zika virus imported to China. Sci.
China Life Sci. 59, 428–430 (2016). doi:10.1007/s11427-016-5043-4 Medline
40. A. Stamatakis, RaxML–VI–HPC: Maximum likelihood–based phylogenetic analyses with
thousands of taxa and mixed models. Bioinformatics 22, 2688–2690 (2006).
doi:10.1093/bioinformatics/btl446 Medline
41. A. Rambaut, T. T. Lam, L. Max Carvalho, O. G. Pybus, Exploring the temporal structure of
heterochronous sequences using TempEst (formerly Path-O-Gen). Virus Evol. 2, vew007
(2016). doi:10.1093/ve/vew007 Medline
42. A. J. Drummond, A. Rambaut, BEAST: Bayesian evolutionary analysis by sampling trees.
BMC Evol. Biol. 7, 214 (2007). doi:10.1186/1471-2148-7-214 Medline
43. Z. Y. Liu, J. Y. Yu, X. Y. Huang, H. Fan, X. F. Li, Y. Q. Deng, X. Ji, M. L. Cheng, Q. Ye,
H. Zhao, J. F. Han, X. P. An, T. Jiang, B. Zhang, Y. G. Tong, C. F. Qin, Characterization
of cis-acting RNA elements of Zika virus by using a self-splicing ribozyme-dependent
infectious clone. J. Virol. JVI.00484-17 (2017). doi:10.1128/JVI.00484-17 Medline
44. F. Zhang, D. Xu, L. Yuan, Y. Sun, Z. Xu, Epigenetic regulation of Atrophin1 by lysine-
specific demethylase 1 is required for cortical progenitor maintenance. Nat. Commun. 5,
5815 (2014). doi:10.1038/ncomms6815 Medline
45. D. Xu, F. Zhang, Y. Wang, Y. Sun, Z. Xu, Microcephaly-associated protein WDR62
regulates neurogenesis through JNK1 in the developing neocortex. Cell Reports 6, 104–
116 (2014). doi:10.1016/j.celrep.2013.12.016 Medline
46. J. Kopp, T. Schwede, The SWISS-MODEL Repository: New features and functionalities.
Nucleic Acids Res. 34, D315–D318 (2006). doi:10.1093/nar/gkj056 Medline
47. V. A. Kostyuchenko, E. X. Lim, S. Zhang, G. Fibriansah, T. S. Ng, J. S. Ooi, J. Shi, S. M.
Lok, Structure of the thermally stable Zika virus. Nature 533, 425–428 (2016).
10.1038/nature17994 Medline