Nihms 399807

NIH Public Access
Author Manuscript
Curr Protoc Microbiol. Author manuscript; available in PMC 2013 August 01.
Published in final edited form as:
NIH-PA Author Manuscript
Curr Protoc Microbiol. 2012 August ; CHAPTER: Unit6A.5. doi:10.1002/9780471729259.mc06a05s26.
Detection, Isolation, and Identification of Vibrio cholerae from

the Environment
Anwar Huq, Ph.D.,
Maryland Pathogen Research Institute, Department of Cell Biology and Molecular Genetics,
Biosciences Research Building #413, University of Maryland, College Park, College Park,
Maryland 20742, USA, Phone 301-405-7429, Fax: 301-314-1248, [email protected]
Bradd J. Haley, M.S.,
Maryland 20742 USA, Phone: 301-405-7429, Fax: 301-314-1248, [email protected]
Elisa Taviani, Ph.D.,
Maryland 20742 USA, Phone 301-405-7429, Fax: 301-314-1248, [email protected]
Arlene Chen, B.S.,
Nur A. Hasan, M.S., MBA, and
Rita R. Colwell, Ph.D.
University of Maryland Institute of Advanced Computer Studies, Maryland Pathogen Research
Institute, University of Maryland, College Park; Bloomberg School of Public Health, Johns
Hopkins University; CosmosID 3103 Biomolecular Sciences Building #296, University of
Maryland, College Park, MD 20742 USA, Phone 301-405-9550, Fax 301-4014-6654
Abstract
Recent molecular advances in microbiology have greatly improved the detection of bacterial
pathogens in the environment. Improvement and a downward trend in the cost of molecular
detection methods have contributed to increased frequency of detection of pathogenic
microorganisms where traditional culture-based detection methods have failed. Culture methods
also have been greatly improved and the confluence of the two suites of methods provides a
powerful tool for detection, isolation, and characterization of pathogens. While molecular
detection provides data on the presence and type of pathogens, culturing methods allow a
researcher to preserve the organism of interest for “–omics” studies, such as genomic,
metabolomic, secretomic, and transcriptomic analysis, which are rapidly becoming more
affordable. This has yielded a clearer understanding of the ecology and epidemiology of
microorganisms that cause disease. Specifically, important advances have been made over the past
several years on isolation, detection, and identification of Vibrio cholerae, the causative agent of
cholera in humans. In this unit, we present commonly accepted methods for isolation, detection,
and characterization of V. cholerae, providing more extensive knowledge of the ecology and
epidemiology of this organism. This unit has been fully revised and updated from the earlier unit
(Huq, Grim et al. 2006) with the latest knowledge and additional information not previously
Huq et al. Page 2
included. We have also taken into account of cost of reagents and equipment that may be
prohibitive for many researchers and have, therefore, included protocols for all laboratories,
including those with limited resources, likely to be located in regions of cholera endemicity.
Keywords
Vibrio cholerae; isolation; identification; detection; characterization
Unit 6A.4
Detection, Isolation, and Identification of Vibrio cholerae from Environmental Samples
It is well established that Vibrio cholerae, the causative agent of cholera, is autochthonous to
the aquatic environment globally and is not confined to cholera endemic areas (Kenyon,
Piexoto et al. 1984; Louis, Russek-Cohen et al. 2003; Schuster, Tyzik et al. 2011). Further,
V. cholerae cells encoding genes and mobile elements known to cause disease in humans
and confer resistance to antibiotics are found in the absence of cholera. When appropriate
methods are used, V. cholerae can be detected in these aquatic environments throughout the
year. V. cholerae culture negative water samples do not definitively indicate absence of this
organism, as cells can enter into a viable but nonculturable (VBNC) state in which they may
not form colonies on traditional bacteriological culture plates (Xu, Roberts et al. 1982;
Roszak and Colwell 1987). In VBNC state, cell densities may be extremely low, therefore, if
a small amount of water sample is collected, it may not contain a sufficient number of cells
for detection. Thus, it is important appropriate volumes of water are examined, using
appropriate methods to determine the presence of V. cholerae in a given sample.
This unit describes several widely accepted and highly cited methods used to detect,
cultivate, enumerate, and characterize V. cholerae cells in environmental samples, such as
water, sediment, plankton, and seafood, e.g., oysters. In developing countries, exposure to
V. cholerae typically occurs via consumption of natural surface water containing V. cholerae
in sufficient numbers to cause disease, whereas in developed countries exposure to V.
cholerae often occurs via consumption of raw or undercooked shellfish or travel to regions
where cholera outbreaks occur frequently. Recent outbreaks of shellfish related vibrioses
and cholera in developed countries demonstrate the need to define a reliable method for
detection of these organisms in any environmentally-derived food source (Onifade,
Hutchinson et al. 2011). Both plankton and sediment play an important role in the
occurrence and survival of V. cholerae in water and oysters. Sediment and plankton both can
occur suspended within the water column. Sediment is known to harbor V. cholerae (due to
its polar electrical charge). Plankton are known to be natural reservoirs of V. cholerae and
zooplankton blooms facilitate increases in V. cholerae density. Furthermore, an infectious

dose of V. cholerae (6 × 106 cells) (Cash, Music et al. 1974) can be present on a single
plankton body (Huq, Small et al. 1984; Rawlings, Ruiz et al. 2007). Presence of V. cholerae
in water, sediment, and plankton will also result in the presence of V. cholerae in shellfish,
as these organisms filter feed all three through their bodies and concentrate high numbers of
V. cholerae. It is, therefore, important to consider the type of sample and desired outcome
(detection, isolation, or enumeration) when choosing the appropriate bacteriological/
molecular methods discussed here. For the readers’ convenience, Table 1 and Figure 1
provide an overview of the methods provided in this unit.
STRATEGIC PLANNING
As stated above, the type of sample and the desired outcome are integral in determining
which method(s) should be used to achieve satisfactory results. Furthermore, the skill set of
Huq et al. Page 3
the laboratory members and laboratory resources are all essential in determining which tests
can be conducted as all of these facets can vary dramatically from laboratory to laboratory as
well as over time within one laboratory.
Traditional culturing methods, although yielding only a small subset of culturable bacteria in
the original sample (< 0.1% of total bacteria), do allow researchers to archive individual
strains and run a variety of informative bench top studies at a later date. These include
genetic characterization by PCR, reconstruction of metabolic pathways by phenotypic
analyses, gene expression assays, and whole genome sequencing, among many others.
However, as stated earlier, reliance on traditional culturing methods only focuses one’s
scope on those bacteria which are culturable while inherently ignoring those bacteria cells
which cannot grow on media but do remain a significant public health threat as they are
capable of causing disease (Colwell 1991).
To evaluate the presence of these organisms regardless of their culturability, a direct

detection method should be employed. Two microscopy methods are reliable, notably
fluorescent antibody coupled with direct viable count (FA-DVC), or fluorescence in situ
hybridization (FISH), a nucleic acid marker based method of detection. FISH can be utilized
to detect genomic DNA sequences specific to V. cholerae regardless of serogroup, while
FA-DVC can be used to detect V. cholerae of serogroups O1 and O139, serogroups
associated with pandemic cholera. The direct fluorescence antibody (DFA) detection of
serogroups O1 and O139 is more reliable than attempting to detect these strains via culture
methods as targeting one serogroup in the environment is rather difficult to do, considering
the vast serodiversity of V. cholerae in the environment. Both methods allow the researcher
to quantify the target if no pre-enrichment step is used. Subsequent bacterial isolation is not
possible when using this method unless a parallel sample is collected and processed using
traditional culturing methods.
Direct molecular detection using the polymerase chain reaction (PCR) can also be employed
to evaluate the presence of these organisms in environmental samples. These methods rely
on detection of species-specific nucleotide sequences, followed by amplification of the
targeted nucleic acid and visualization on an agarose gel (conventional PCR) or in an
amplification plot using computer software (Real-Time PCR). Direct detection using these
methods can be applied directly to environmental samples as well as to samples following a
pre-enrichment step in alkaline peptone water (APW) or estuarine peptone water (EPW). All
of these methods are highly sensitive, but it must be stated that absence of evidence of V.
cholerae by a particular method does not confirm absence of this organism. As with all
microbiological and molecular methods, inhibitors of the polymerase chain reaction, as well
as quality and quantity of the collected sample and sensitivity of detection for each method
must be taken into account when interpreting results. Replicate sample collection and
replicate laboratory analyses further strengthen the statistical significance of results, but can
dramatically increase level of effort as well as financial commitment.
Selection of sampling sites and specimen collection should be based on the goals of the
study. It is valuable to select a variety of sites that are diverse in their ecology, with some
sites selected with the a priori notion that they will harbor high densities of V. cholerae and
others selected with the notion that they will harbor low densities of V. cholerae. If it is the
goal to evaluate the presence or densities of V. cholerae in oysters then the overlying water
column, underlying sediment, and planktonic organisms within the water column should
also collected to discern the ecology of V. cholerae near the oyster beds of interest. During
specimen collection, environmental parameters, such as, water temperature, salinity,
conductivity, turbidity, and pH, should be recorded. For ecological investigations of
organisms autochthonous to the aquatic environment it is necessary to collect and process
Huq et al. Page 4
water, sediment, plankton, and, if possible, sea food (oyster) samples in a time series,
preferably over a multi-year period with the aim to conduct sampling at regularly spaced
intervals.
The collection of data over longer study periods allow researchers to estimate those
parameters that may be associated with changes in V. cholerae densities or presence/absence
in the selected area of interest. For studies utilizing these data to develop predictive models
of V. cholerae in water bodies, readers are encouraged to review the reports of Louis,
Russek-Cohen et al, 2003, Huq, Sack et al.2005, Constantin de Magny, Murtugudde et al.
2008, and Turner, Good et al.,2009, (Louis, Russek-Cohen et al. 2003), (Huq, Sack et al.
2005), (Constantin de Magny, Murtugudde et al. 2008) and (Turner, Good et al. 2009). In
addition to consideration of time, resources, and logistics, the protocols in this unit allow a
researcher the option to isolate and/or detect toxigenic Vibrio cholerae or total Vibrio
cholerae. For all assays, media, materials, and methods should be validated with a positive
control and a negative control. Several commonly used V. cholerae positive control strains
that are typically available from culture collections, such as the American Type Culture
Collection (ATCC), are listed in Table 2.
CAUTION: V. cholerae is a Biosafety Level 2 (BSL-2) pathogen. Follow all appropriate

guidelines and regulations for the use and handling of pathogenic microorganisms. See
UNIT 1A.1 and other pertinent resources (APPENDIX 1B) for more information.
ISOLATION AND IDENTIFICATION OF V. CHOLERAE USING TRADITIONAL

METHODS
Although developed several decades ago, traditional culturing methods continue to be
improved with the result of more reliable detection of V. cholerae from environmental
samples. The process involves either directly plating the study sample (water, plankton,
sediment, shellfish) onto TCBS, TTGA, or CHROMAgar™ Vibrio or pre-enrichment of the
sample in alkaline peptone water followed by streaking for isolation onto one or a
combination of these three agars. For environmental samples, it is highly recommended to
use pre-enrichment step to improve detection or isolation. Following an incubation period,
presumptive V. cholerae can be isolated from these media and confirmed by either
biochemical analyses (Huq, Grim et al. 2006) or immediately by PCR. Isolates can then be
serogrouped as O1, O139, or non-O1/non-O139 by a slide agglutination assay using antisera
for the O1 and O139 antigens or by PCR using primers developed to target O1 and O139
coding regions of the genomic DNA. These V. cholerae isolates can then be archived with
replicates in nutrient agar containing 0.5% NaCl overlaid with sterile mineral oil or as a
glycerol stock at −70°C. Stock cultures of V. cholerae should be periodically re-streaked for
isolation to ensure their viability and purity.
BASIC PROTOCOL 1: Specimen Collection and Transportation

If the aim is to detect and isolate V. cholerae in water samples, then screening of
concentrated water samples and plankton samples and “plankton-free” water is
recommended, since a combination of all types of samples provides a higher probability of
V. cholerae detection as well as a better understanding of the role of plankton in V. cholerae
dynamics in the study region (Huq, Colwell et al. 1990; Binsztein, Costagliola et al. 2004;
Huq, Sack et al. 2005; Turner, Good et al. 2009; Lizarraga-Partida, Wong-Chang et al. In
preparation). Water collection bottles should be cleaned with detergent, however the latter
must not leave residue, should not be anti-bacterial and they should be pre-sterilized in an
autoclave for 15 to 20 minutes at 121°C prior to use. Polypropylene bottles should be used
for water samples and glass bottles should be used for plankton samples. A sufficient
Huq et al. Page 5
volume of water and plankton should be collected to insure that appropriate analyses can be
performed. Plankton samples should be collected by passing water through a 200, 64, and/or
20-µm pore size plankton net by towing the net manually or behind a boat. Alternatively,
known volume of water can be manually passed through the net by bucket pouring or
pumping, which can be useful for quantitative analysis (Huq, Sack et al. 2005).
Processing of samples should begin soon after collection (typically within 24 hours of
collection). If enumeration of V. cholerae is desired, then the sample should be stored in a
cool box at a temperature of 10 to 15°C until processing begins (not to exceed 8 hours)
(Clesceri, Greenberg et al. 1998). However, a recent study has demonstrated that
transporting samples at ambient air temperature prior to processing can enhance the
culturability of V. cholerae in the sample (Alam, Sadique et al. 2005). Based on type of
examination, samples may require treatments; such as addition of direct viable count (DVC)
reagents, before proceeding with further examination and testing. It is recommended that
basic physiochemical parameters, e.g., temperature, salinity, pH, dissolved oxygen and
conductivity of the water be measured on site at the time of collection as it is known that V.
cholerae densities can be influenced by such parameters. If the study site is influenced by
tides, coasts and estuaries for example, the prevailing tidal level at the time of sampling
should be recorded. Furthermore, in addition to water temperature, significant correlation of
water depth, rainfall, conductivity, and copepod density with cholera outbreaks has been
reported, with lag periods from zero to eight weeks from optimum environmental conditions
to cholera outbreaks (Huq, Sack et al. 2005). These parameters can be measured on site
using portable meters (such as HACH Model CO150 Conductivity meter, HACH Chemical
Company, Loveland, CO or Dissolved oxygen and pH meter, Model 210A, Orion
Laboratories, Beverly, MA). It is important to note that in all studies of the ecology of
microorganisms in the environment several rounds of “practice” sampling and processing
should be considered to optimize the volumes of water, plankton, or other biotic and abiotic
media to be collected in order to detect or recover the specific microorganism of interest, as
well as to identify missing equipment and reagents and evaluate the ability to comprehend
and adhere to the standard methods described herein. It is hard to keep the sample collection
volumes constant as the amounts (volumes) may need to be adjusted depending on the
quality of water due to presence of seasonal plankton. The authors of this unit strongly
encourage investigators to use several methods and several types of media throughout the
duration of their studies. All methods have some error or detection limits associated with
them and, therefore, use of multiple approaches will allow the investigators to converge on
the most accurate answer. Water, sediment, and oysters isolated from different
environments, both on a global and local scale, may have different chemistry associated with
them and therefore, the different media requirement discussed in this unit may perform more
or less effectively over time and space. Diversifying one’s approach to gathering data on the
ecology of V. cholerae will help overcome these challenges. The authors also encourage the
investigators to use a range of incubation temperatures for APW enrichment and growth on
selective agar plates. It is well known that V. cholerae can grow within a wide range of
temperatures and that this group of organisms is phenotypically heterogeneous. Therefore,
utilizing two incubation temperatures may increase the probability that V. cholerae is
detected and/or isolated. It should be known that this may effectively double the amount of
work downstream, but the investigators should also be aware that several methods of
isolation and detection will allow convergence on an accurate analysis.
Materials
Pre-sterilized 500-ml glass (Qorpak, Bridgeville, PA) and 1000-ml polypropylene
containers (Nalgene, Rochester, NY)
Huq et al. Page 6
Simple Plankton nets, 200-µm, 64-µm, and 20- µm, or nets of different mesh sizes (for
size filtration of plankton) (Aquatic Research Instruments, Idaho, USA; SEA-GEAR,
Florida, USA) (See Figure 2).
Portable meter(s) that measure temperature, dissolved oxygen, pH, turbidity and salinity
(HACH Company, Colorado, USA; Geo Scientific Ltd, British Columbia, Canada; YSI
Inc. / Xylem Inc., Ohio, USA). Turbidity and salinity can be measured ex situ, i.e. in the
laboratory, preferably immediately after sample collection.
Bucket of known volume–e.g., 4 or 5 liters (optionally used for pouring water through
plankton nets). ≥ 92-oz. Whirl-Pak® Bags (Nasco, Fort Atkinson, WI)
Autoclaved and pre-weighed 100-ml polypropylene container (optionally used when
collecting sediment from an oyster bed)
Scooper/Spoon that has been wrapped in aluminum foil and autoclaved (optionally used
when collecting sediment from an oyster bed)
To collect water sample

1. Uncap pre-sterilized plastic bottle, submerge bottle to fill. Fill to half of volume
of bottle, re-cap, shake to rinse and discard. Repeat 3 to 5 times. Rinse
downstream of water sample collection site if possible.
2. Remove the sample bottle from water. Cap, leaving enough air in the bottle for
agitation and mixing.
To collect plankton
3. Rinse plankton net and cod-end of the net in the body of water to be sampled
(downstream of sample collection site if possible).
4. Filter 10 to 100 liters water through the plankton net by towing, using a
calibrated, net-mounted flow meter, or pouring known-volumes through the net
with a smaller bucket (the bucket should be clean, but without detergent, and
rinsed several times with sample water, downstream of the sample collection
site, immediately prior to sample collection).
5. For each plankton fraction of interest, rinse inside the net of the plankton net
followed by the cod-end with sterile 1X PBS using a spray or squirt bottle, or
with excess plankton-free water collected after pouring sample water through
the net. This allows any plankton adhering to the net to be flushed down to the
cod-end for collection.
6. Remove cod-end from the plankton net and decrease volume to 100 ml by
continuing to filter. This can be done by gently swirling the cod end so that
water passes through the mesh siding of that cod end.
7. Measure (with a sterile graduated cylinder) and decant plankton fraction into
sterile glass container making sure to label that bottle with the collected
plankton fraction size.
8. Repeat this process for all plankton fractions of interest.
9. Finally, collect 500 ml to 1000 ml water that passes through the 20-µm plankton
net. This is “plankton-free” water.
Huq et al. Page 7
To collect Sediment Sample

1. Collect sediment with a piston corer (Aquatic Research Instruments, Hope, ID) or a
Peterson grab (Wildlife Supply Company, Yulee, FL).
2. Sample a sediment–water interface with a wide-bore serological pipette and put in

a sterile bottle (this sediment-water interface sample can be treated as a separate
sediment sample and processed alongside the other media collected following the
same protocols).
3. Remove the remaining sediment from the sampling apparatus aseptically and put
into a sterile bottle.
To Collect Shellfish—Shellfish collection in many areas is regulated by local or state

governments. It is imperative to check these regulations with your local Fish and Wildlife
department or other relevant government bodies prior to sample collection. Collection of
shellfish may require purchase of a permit and in some locations, may be done only on
certain days. The oyster processing protocols described here can be used to evaluate store
bought oysters. However, these oysters may have been depurated and stored for some time
and results from these analyses should be described with respect to post-harvesting
conditions, not the environment from which these oysters were harvested. Additionally,
since oyster shells may be sharp, it is advised to wear gloves whenever handling oysters in
order to avoid injury.
1. Collect oysters from boats by using oyster tongs or a dredge or hand collect at low
tide when the oyster beds are easily accessible.
2. Examine oysters should for viability in the field by keeping only those oysters that
are tightly closed. Tapping the mid-shell point of an oyster on a hard surface will
allow determination whether oyster meat is present in the oyster shell because a
hollow sound will be heard when an empty oyster is tapped. Rinse sediment off of
the oyster shells with surface water, but do this only after water and plankton
samples have been collected.
3. Place viable oysters in ventilated ≥ 92-oz. Whirl-Pak® Bags (Nasco, Fort Atkinson,
WI) and transport in a cool container, but not immediately next to ice or cool packs.
Do not re-immerse oysters in water after collection.
To Collect Sediment from an Oyster Bed—If oysters are already being collected
during sample collection, it is possible to collect sediment samples at the same time in order
to avoid using a piston corer as direct sediment sample collection from a hard oyster bed
(also known as an oyster reef) may be difficult.
1. When determining whether or not oysters are present in the shell by tapping,
hollow oyster shells may contain sediment inside; therefore it is imperative to open
the oyster shells to check for sediment.
2. If sediment is found, use a scooper that has been previously wrapped in aluminum
foil and autoclaved to scrape the sediment off the shell. Place sediment in a sterile,
pre-weighed 100-ml polypropylene container.
Transportation and/or processing

Transport samples to the laboratory for processing or, preferably, begin processing
onsite within 1 hr of collection.
For samples that require transport to the laboratory to be processed after collection, store
and/or transport the samples in a cold box at 10° to 15°C. Alternatively, samples can be kept
Huq et al. Page 8
in the dark at ambient air temperature (22° to 25°C) after collection for up to 24 hours as this
may enhance recovery of Vibrio species as shown in a recent study (Alam, Hasan et al.) and
can be a useful approach for detecting vibrios in those environments where the organism is
predominantly in the viable but non-culturable (VBNC) state (Alam, Hasan et al. 2006).
This aspect of the protocol may need to be optimized for the water source and environmental
conditions.
BASIC PROTOCOL 2: Conventional Bacteriological Culture Method

Conventional culture methods for isolating V. cholerae from environmental water samples
rely on an enrichment step(s) in broth and plating on selective media, followed by
confirmation using a series of biochemical tests or PCR and serological tests to determine
strain serotype. Alternatively, biochemical tests can be bypassed and confirmation can be
done using PCR if adequate supplies of PCR reagents are available. Most water and
plankton samples require some amount of concentration. Running several practice rounds at
the desired study site will help estimate appropriate volumes of sample that should
processed in order to achieve desired goals. However, it should be pointed out that
environmental V. cholerae densities are not static, so volumes deemed to be appropriate at
one sampling point may not yield the same results at another time. We address this
inconsistency by urging the investigator to use multiple methods (if resources are available)
to isolate, detect, and characterize environmental V. cholerae during the course of their
study. Water samples, both whole water and plankton-free water should be concentrated by
filtration using 0.2-µm polycarbonate membrane filters. A good starting volume is 500-ml
and 1000 ml can be used if water passes easily through the polycarbonate membrane. If 0.2-
µm polycarbonate membrane filter clog quickly, multiple filters can be used per sample. It is
preferable to use 0.2-µm pore size filters as opposed to 0.45-µm pore-size filters as cells
VBNC bacteria are often < 0.45-µm in size. Polycarbonate membranes are preferable to
nitrocellulose membranes as the cells sit on top of the polycarbonate filters and are easily
removed by vortexing while cells get caught in the fibers of nitrocellulose membranes. It is
imperative that the cells be physically agitated off of the membrane so that they may migrate
to the microaerophilic layer of the enrichment broth discussed below.
Overnight enrichment is performed using alkaline peptone water (APW), pH 8.6 and some
investigators recommend two successive enrichments. Surface aliquots from the
microaerophilic pellicle layer are streaked for isolation onto selective bacteriological media.
Three commonly used selective media for V. cholerae isolation are thiosulfate citrate bile-
salts sucrose (TCBS) agar, tellurite taurocholate gelatin agar (TTGA), also known as
Monsur medium (Monsur 1961), and CHROMagar™ Vibrio (CHROMagar, Paris, France).
V. cholerae appears as translucent, flat, yellow colonies with elevated centers on TCBS and
colorless colonies on TTGA, often with a characteristic dark center after two days growth,
surrounded by a halo, which appears due to the hydrolysis of gelatin, and turquoise colonies
on CHROMagar™ Vibrio (Fig. 3). If possible, use more than one medium as that may allow
convergence on the best results. APW enriches for many bacteria other than V. cholerae,
therefore, direct plating of samples onto TCBS, TTGA, and/or CHROMagar™ Vibrio can
be done in parallel with APW enrichment and may yield V. cholerae colonies that can be
used for further analyses. This direct plating method is beneficial in instances when
overgrowth of non-target bacteria occurs on solid media after overgrowth in APW.
TCBS is a highly selective medium that may, in rare instances, inhibit growth of V. cholerae
and at the same time allow growth of non-Vibrio organisms, such as Aeromonas sp.,
Staphylococcus sp., and Shewanella sp. TCBS is commercially available and produced by
several companies which have global distribution. TTGA media is considered to be less
inhibitory to V. cholerae cells; however longer incubation times are needed (48 hours) to
observe the dark center that is characteristic of V. cholerae on this medium. It may be
Huq et al. Page 9
difficult to distinguish V. cholerae from V. parahaemolyticus on this medium, therefore,

modified TTGA media can be used in which V. cholerae colonies appear as brilliant blue
with fluorescence in 24 hour or less, by adding β-galactosidase (4-methylumbelliferyl-β-Δ-
galactosidase) (O'Brien and Colwell 1985). CHROMagar™ Vibrio, primarily used for the
detection of V. cholerae, V. parahaemolyticus, V. vulnificus, and V. alginolyticus,
distinguishes these organisms from each other based on a proprietary chromogenic reaction
that prevents making it in the laboratory from scratch. Both TCBS and CHROMagar™
Vibrio need not be autoclaved and incubation times for these media are shorter (24 hours)
than TTGA. TTGA media must be autoclaved prior to use. Once presumptive strains are
purified on a nonselective medium, such as gelatin agar, modified nutrient agar, or Luria
Bertani (LB) agar with 1% NaCl, they are confirmed and serogrouped by PCR or by simple
slide agglutination, employing polyclonal V. cholerae O1, O139 and monoclonal Inaba and
Ogawa antiserum.
Materials
Tissue homogenizer (hand held) to homogenize plankton (Kimble Chase Life Science
and Research Products LLC, New Jersey, USA)
Filter apparatus with vacuum source
Filter membranes, 47-mm diameter, 0.22-µm pore size
Forceps
Enrichment flask (sterile 150-ml Erlenmeyer flasks containing 25-ml APW)
Alkaline peptone water (10× and 1× APW), pH 8.6
Phosphate buffered solution (PBS), pH 7.4
Thiosulfate citrate bile-salts sucrose (TCBS) agar plates
Tellurite taurocholate gelatin agar (TTGA) plates
CHROMagar™ Vibrio (written as “CA” in the following sections)
Gelatin agar (GA), modified nutrient agar, or Luria-Bertani agar (LB) plates
Inoculating loops and needles
Incubators, 30 to 37°C
Sterile Petri dishes
Cut-resistant oyster shucking glove (Chef Revival, WI, USA)
Sterile oyster knife (Dexter-Russell, Inc., MA, USA)

Sterile toothpicks
Oxidase reagent: 1% (w/v) N,N,N’N’-Tetramethyl-p-phenylenediamine
dihydrochloride 95% alcohol for flame sterilization of forceps, loops, and needle,
bacterial cell spreader.
Sample Processing—Note: If not specified, assume APW is 1X APW.

1a. For plankton samples: Filter concentrated plankton sample through a 47-mm,
20-µm pore size polycarbonate filter (Millipore, Billerica, MA) (this step may
take a while depending on the abundance of plankton in the sampled water).
Add the filter(s) with attached bacteria to a 50 ml centrifuge tube with 25 ml of
sterile 1X PBS.
Huq et al. Page 10
Vortex the centrifuge tube in order to remove cells from the filter.
Add 1-ml whole plankton to 25-ml APW.
Add 100 to 1000 µl of whole plankton directly onto TCBS and/or CA and TTGA plates
and spread using a bacterial cell spreader.
Homogenize 10-ml of concentrated plankton samples using a glass tissue grinder by
moving the pestle up and down in the tube, while rotating, 10–20 times. Add 1-ml
homogenized plankton to an enrichment flask containing 25-ml APW.
Add 100 to 1000 µl of homogenized plankton directly onto TCBS and/or CA and TTGA
plates and spread using a bacterial cell spreader.
1b. For water samples: Filter 100 to 1000 ml (depending on bacterial density, see
comment at end of “Specimen Collection and Transportation”) water through a
47-mm, 0.22-µm pore size polycarbonate filter. Add the filter(s) with attached
bacteria to a 50 ml centrifuge tube with 12 ml of sterile 1X PBS. Vortex
vigorously for ca. 5 minutes to detach the bacteria from the filter.
Add 100 to 1000 µl of this 1X PBS containing detached bacterial cells directly onto
TCBS and/or CA and TTGA plates and spread until plates appear dry using a bacterial
cell spreader.
Add 1-ml 1X PBS containing detached bacterial cells to an enrichment flask containing
25-ml APW.
This step may be done in replicate to increase the probability of isolating V. cholerae.
However, it should be known that replication at this step dramatically increases the
magnitude of analyses downstream.
Large volumes or highly turbid sample water may require more than one polycarbonate
filter, as they will clog.
The remaining 1X PBS containing detached bacterial cells can be stored at −20°C for
other direct molecular detection methods including metagenomic analysis.
1c. For oyster samples: Rinse and scrub exterior of oysters in sterile de-ionized
water making sure to remove sediment from the oyster hinge. With extreme
caution, wearing a cut-resistant oyster shucking glove, shuck oysters with a
sterile oyster knife. It may help to also hold the oysters level on a table with a
towel between your glove and the oyster. This may add protection and stability.
When shucking, with the curved-side of the knife facing downwards, trace the
knife along the upper shell making sure to sever the adductor muscle which
holds the oyster shells shut. Shuck enough oysters to produce 250 g of oyster
meat as well as liquid surrounding the oyster meat and add to an autoclavable
kitchen blender. Add an equal volume of sterile 1X PBS and homogenize for 90
seconds.
Add 20 ml of homogenized oyster sample to an enrichment flask containing 80mL of
10× APW.
Add 100 to 1000 µl of oyster homogenate to TCBS and/or CA and TTGA plates and
spread using a bacterial cell spreader. This step may be further adjusted to include both
direct plating of 100 to 1000 µl onto agar as well as plating serial dilutions of
homogenized oyster meat in sterile 1X PBS.
If an autoclavable blender is not available the interior of the blender pitcher can be
sterilized with 10% bleach or 70% alcohol followed by multiple rinses with sterile DI
Huq et al. Page 11
water or 1X PBS. It is imperative that all bleach or alcohol be removed prior to adding
the oyster meat. Alternatively, a stomacher could be used.
To sterilize the oyster knife, dip blade into 95% ethanol and then pass through a flame.
If oyster knife is autoclavable it can be wrapped in aluminum foil and sterilized at

121°C for 15 minutes. Oysters can be shucked when blade is cool.
1d. For sediment samples: Weigh sediment samples and add an equal
volume:weight of sterile 1X PBS and vortex or shake well. Add 100-ml
sediment/PBS slurry to an enrichment flask containing 11 ml 10X APW.
Additionally add 100 to 1000-µl sediment/PBS mixture directly onto TCBS and/or CA
and TTGA plates and spread using a bacterial cell spreader. This step may be further
adjusted to include both direct plating of 100 to 1000 µl onto agar as well as plating
serial dilutions of sediment in sterile 1X PBS.
2. Incubate the APW enrichment flasks statically for 16 hr at 30 to 35°C
(overnight).
In all cases, APW enrichment flasks should not be disturbed or agitated during or after
incubation, as Vibrio species tend to migrate to the liquid-air interface.
A range of incubation temperatures can be used as V. cholerae is known to grow
between 12 and 42°C. Lower incubation temperatures for longer periods of time may
allow for more V. cholerae cells to grow while also allowing for other competitive
bacteria to grow as well. Higher incubation temperatures may inhibit growth of some
environmentally-stressed V. cholerae cells but will also inhibit growth of competitive
bacteria species. It may be beneficial to consider testing two incubation temperatures
and choosing which yields better results for your sample area of interest. Alternatively,
replicate flasks can be incubated at each temperature to increase the probability of
isolating V. cholerae (see italicized note immediately after section 1b in the Sample
Processing section).
3. Incubate TCBS, CA at 30 to 35°C for 24 ± 2 hours and TTGA plates at 30 to
35°C for 48 hours.
The same approach as stated above for incubation temperatures of APW inoculates can
be applied, and should be considered for incubation of agar plates.
Subculture smooth, flat, sucrose-fermenting, yellow colonies from TCBS and/or
turquoise blue colonies from CA, and translucent, dark-centered colonies with halo
zones from TTGA (see Figure 3) onto GA and/or modified nutrient agar plates.
Selective plating post-APW enrichment

3. After enrichment in APW, collect surface growth (may be present as a whitish
film) from the enrichment flask with an inoculating loop and streak onto TCBS
and/or CA and TTGA plates.
4. Incubate the plates 16 to 24 hr at 30 to 35°C for TCBS and CA or 48 hr at 30 to
35°C for TTGA.
5. Subculture smooth, flat, sucrose-fermenting, yellow colonies from TCBS and/or
turquoise blue colonies from CA, and translucent, dark-centered colonies with
halo zones from TTGA (see Figure 3) onto GA and/or modified nutrient agar
plates, respectively.
To subculture presumptive V. cholerae colonies from these selective media, touch the
top-center of the colony using a sterile inoculating loop. Take care not to touch the
Huq et al. Page 12
surface of the agar and any other surrounding bacteria (even if they too are presumptive
V. cholerae). If plates are heavily overgrown with bacteria, try to touch the top-center of
a presumptive V. cholerae colony and re-streak onto selective media again to isolate a
single colony.
If TCBS is used, morphology should be registered only on recent and well-isolated
colonies.
ALTERNATE PROTOCOL 1: Bacteriological Culture Method for Situations of Limited

Resources
This alternative protocol can be used to presumptively estimate the presence of culturable V.
cholerae in surface waters in regions where even general microbiology resources are limited.
Bacteriological methods are based on the work of Choopun et al.(Choopun, Louis et al.
2002). Yellow colonies isolated from TCBS that give negative reactions (no color change)
in esculin hydrolysis and arginine dihydrolase assays can be presumptively identified as V.
cholerae.
Glassware can be used for assays and can be sterilized by wrapping in aluminum foil or
newspaper and then heated in an oven at 180°C for 2 hours. Sterilization can also be
accomplished by microwaving materials for 5 minutes. Investigators must make sure that no
non-microwavable materials are used (i.e., aluminum foil). Mineral oil should be sterilized
by heating in an oven at 170°C for 1 to 2 hours. If it is not possible to procure autoclavable

sample collection bottles then store bought drinking water bottles may be used. It is
important to rinse these bottles with surface water from the collection site 3 to 5 times prior
to collecting the sample for analysis.
Materials
1 Liter Plastic or glass water sample collection bottles
Enrichment bottle (1 Liter glass bottles)
Aluminum foil
Newspaper or other paper source
Conventional oven or microwave
Incubators, 30 to 37°C
Inoculating loops and needles
Sterile petri dishes
Sterile toothpicks
Sterile test tubes capped with paper, cotton, or aluminum foil prior to sterilization
Alkaline peptone water (10× and 1× APW), pH 8.6
Thiosulfate citrate bile-salts sucrose (TCBS) agar plates
Selective media for V. cholerae isolation (TTGA, TCBS, or CA)
Gelatin agar (GA), modified nutrient agar, or Luria-Bertani agar (LB) plates
Heart infusion agar containing 0.1% esculin and 0.05% ferric chloride.
Luria-Bertani broth containing 1% (wt/vol) L-arginine (pH 6.8) and phenol red powder
added as an indicator.
Sterile mineral oil
Huq et al. Page 13
1. Add 100-ml to a sterile bottle containing 900-ml 10X APW and shake or
swirl well.
2. Incubate at 30 to 35°C overnight.
3. With a sterile loop or toothpick dab the upper pellicle layer of the incubated
sample and streak for isolation onto a selective medium for V. cholerae
isolation (TTGA, TCBS, or CA). Incubate plates at 30 to 35°C overnight (or
48 hours if TTGA agar is used).
If incubators are not available then 10X APW inoculation can be left to sit at room
temperature for 24 hours and agar plates can be inverted (agar-side up) and left to sit in the
dark until growth occurs (up to 2 days).
4. For esculin hydrolysis assay gently touch the top and center of a yellow non-
swarming colony with a sterile loop or toothpick and inoculate into heart
infusion agar containing 0.1% esculin and 0.05% ferric chloride.
5. For arginine dihydrolase assay simultaneously inoculate Luria-Bertani broth
containing 1% (wt/vol) L-arginine (pH 6.8) and phenol red powder (Difco)
added as an indicator. After inoculation cover with ca. 0.5 cm sterile mineral oil.
6. Incubate esculin hydrolysis assays at 30 to 35°C for 72 hours or at room
temperature for approximately 96 hours and arginine dihydrolase assays for 24
hours at 35°C or 48 to 72 hours at room temperature.

Blackening of the esculin hydrolysis medium after incubation indicates that that there was a
positive reaction while appearance of a red color after incubation of the arginine dihydrolase
assay was considered a positive reaction. For both assays, a negative control (uninoculated
assays) should be incubated at the same temperature for the same time as a comparator.
Used materials, including inoculated media, can be sterilized by microwaving for 5 minutes.
Used materials can also be sterilized in a dry oven at 180°C for 2 to 3 hours.
BASIC PROTOCOL 3: Serogroup Determination

More than 200 serogroups of V. cholerae have been described to date based on antigenic
property of cell surface polysaccharides of which, serogroup O1 and O139 have been
implicated with epidemics of cholera while non-O1/non-O139 serogroups are known to
cause sporadic outbreaks. However, serogroup O37 was responsible for a localized outbreak
of cholera in Czechoslovakia and Sudan. The remaining serogroups collectively and
commonly termed as non-O1/non-O139, predominate the strains of V. cholerae isolated
from the aquatic environment (Sack, Siddique et al. 2003). Although reported mostly in O1
and O139 serogroup clinical isolates, the cholera toxin gene can be found in non-O1/non-
O139 strains from the aquatic environment globally as well as other Vibrio species
(Chakraborty, Mukhopadhyay et al. 2000; Malayil, Turner et al. 2010). However, because of
the epidemic potential, the method to determine O1 and O139 serogroup is mentioned
below. Strains other than O1 or O139 serogroup need not be serogrouped unless there is a
special need. In which case, those strains should be sent to a Reference Center for
serotyping, since antisera for serogroups other than O1 and O139 are not commercially
available.
Materials
Antiserum for serogroup O1 and O139 V. cholerae
Glass slides
Wax pencils
Huq et al. Page 14
Phosphate buffered saline (PBS)

1. Draw 2 squares approximately 6 cm × 6 cm on a microscope slide with a wax
pencil. Add one drop of PBS in each square.
2. Add a loopful of fresh growth (6–16 hr subculture on non-selective media) into

each drop and resuspend.
3. Add an equal sized drop of group O1 polyvalent antiserum to one of the drops.
4. Mix the antiserum-culture suspension by tilting the slide back and forth. Determine
if the reaction clumps (i.e., agglutinates) within 0.5 to 1 min, indicating a positive
result.
Agglutination can be better visualized by looking through microscope slide with a
bright lamp in the near background.
Autoagglutination, clumping in the saline solution without antiserum, is indicative
of a “rough” morphotype and cannot be typed by antisera.
5. Test non-O1 serogroup colonies with O139 antisera, following steps 1–4 (Basic
Protocol 3) using O139 antisera.
MOLECULAR METHODS FOR DETECTION AND IDENTIFICATION OF V.

CHOLERAE ISOLATES
Conventional PCR and Real-Time PCR have recently been used to characterize V. cholerae
strains, along with confirming a strain as V. cholerae or confirming the presence of V.
cholerae in environmental or clinical samples. Further, the increase in genome sequences
now available has allowed development of PCR-based typing schemes for analysis to
variants of strains, genes, and mobile genetic elements, including pathogenicity islands. The
body of knowledge derived from the V. cholerae pangenome continues to provide
researchers with targets useful in strain identification and characterization.
Identification and characterization of Suspected or Presumptive V. cholerae Isolates by

PCR
The polymerase chain reaction (CPMB 15.1) is a useful alternative to labor-intensive
biochemical tests, which are occasionally difficult to interpret, and often requiring
replication, as well as several days of incubation and media preparation. Ideally, at least an
oxidase test (Basic Protocol 2) should be done on presumptive colonies to reduce the
number of presumptive V. cholerae isolates that are not V. cholerae. In this method, crude
template is prepared by boiling to lyse the cells. Genomic regions within this template are
amplified using PCR pimers specific to V. cholerae and targeting the internal transcribed
spacer (ITS) region between 16S and 23S rDNA or the outer membrane protein subunit W
(ompW). Confirmed V. cholerae strains can be screened for the genes associated with
virulence and their variants (Table 3) and a more comprehensive list of relevant targets, with
PCR conditions and expected amplicons, is listed in Supplementary Table 1. PCR products
are analyzed by gel electrophoresis and visualized under UV light with ethidium bromide.
Positive and negative controls should be run in parallel and should include eubacterial 16S
rDNA PCR reaction for each sample to test template quality. (See Table 3 for PCR primers,
expected amplicon size and reference). Further, phenotypic and genetic screens on V.
cholerae isolates can be done following the methods of Son and Taylor (Son and Taylor,
2011).
Huq et al. Page 15
SUPPORT PROTOCOL 1: Preparation of crude DNA template by boiling

A crude DNA template, suitable for analysis in Basic Protocol 4, Alternate Protocol 2, and
Basic Protocol 5, can be prepared by boiling a small overnight culture or a loopful on culture
from a fresh agar plate.
Materials
1-ml overnight culture or loopful of pure culture from agar plate
1a. From broth: Centrifuge a 1-ml culture (overnight growth at 35°C)
and resuspend in 1-ml sterile water.
1b. From agar plates: Resuspend a loopful of pure culture (50–100
colonies) of suspected or presumptive V. cholerae into 300-µl of
sterile water by vigorously vortexing. Plates should be a fresh
overnight subculturing demonstrating only one morphology.
2. In a sterile 2-ml microcentrifuge tube, dilute the suspension 1:1000
in sterile water.
Alternately, a single isolated colony can be resuspended into 20-µl
of sterile water.
3. Place the microcentrifuge tube containing the resuspended culture
into a boiling water bath for 10 min.

4. Cool tube to room temperature by allowing tube to sit on bench
(approximately 30 minutes).
Treatment of crude DNA template with 10-mg/mL bovine serum
albumin (BSA) (4-µl per 100-µl supernatant) may help to limit PCR
inhibition and yield more accurate results. It is also beneficial to
make a 1:10 dilution and a 1:1000 dilution (supernatant:sterile DI
water) and use this for PCR as well as a dilution may also help to
remove PCR inhibitors.
BASIC PROTOCOL 4: Vibrio cholerae-specific PCR - ITS (Chun, Huq et al. 1999)
The following PCR methods can be used to confirm isolates as V. cholerae by targeting the
internal transcribed spacer (ITS) region between 16S and 23S rDNA or the outer membrane
protein subunit W (ompW) specific to V. cholerae.
Materials
20 µM PCR primers (Table 3)

25 µm dNTPs (APPENDIX 2A)*
Taq DNA polymerase
PCR amplification buffer, 10X (APPENDIX 2A)
Sterile water
Molecular weight ladder (e.g. Hyperladder IV, Bioline, Taunton, MA)
Thermal cycler (BioRad, Hercules, CA)
Microcentrifuge tubes
Boiling water bath
Huq et al. Page 16
PCR tubes
Horizontal gel apparatus, gel tray and comb.
Power supply for gel apparatus

1 µg/ml ethidium bromide staining solution (APPENDIX 2A)
UV transilluminator (UVP, Upland, CA)
*”All-in-one” PCR mastermix can be purchased as an alternative to buying the necessary
reagents separately. This can facilitate screening large numbers of strains. PCR primers and
nuclease-free water will need to be purchased separately. Several products include, but are
not limited, to GoTaq® Green Master Mix (Promega, Madison, WI) and Multiplex PCR 5X
Master Mix(New England BioLabs, Ipswich, MA) for detecting multiple targets by PCR.
*Alternative DNA staining dyes that may be less mutagenic have recently been developed
and can be explored as an alternative to ethidium bromide. Dyes include GelRed™ and
GelGreen™ (Biotium, Hayward, CA), SYBR® Safe DNA Gel Stain (Life Technologies,
Grand Island, NY). Gels stained with GelGreen™ can be visualized with a laser-based gel
scanner or a Dark Reader that uses visible blue light for excitation. Gels stained with
SYBR® Safe DNA Gel Stain can be visualized under blue light as well.
5. Set up V. cholerae- specific ITS (Internal Transcribed Spacer region) PCR in a
total reaction volume of 25-µl, containing the following.

5 µl template (step 4)
1X reaction buffer
200 µM dNTPs
800-nM primers (pVC-F2, pVCM-R1)
0.625 U Taq DNA polymerase.
6. Amplify the V. cholerae-specific ITS target with the following cycle conditions:
Initial denaturation : 1 min at 94°C (initial denaturation)
30 cycles: 1 min at 94°C (denaturation)
1 min at 60°C (annealing)
1 min at 72°C (extension)
Final extension: 10 min at 72°C.
Perform Agarose Gel Electrophoresis and Visualize Results

7. Run PCR product out on a 1.5% agarose gel in 1X TAE for 1–2 hrs at 5-V/cm
(CPMB 2.5A).
8. 8. Stain the gel in 1 µg/ml ethidium bromide staining solution for 15 min.
9. Destain the gel in distilled water for 15 min.
10. Visualize the products by viewing the gel using a handheld UV lamp,
transilluminator, or gel documentation system.
The V. cholerae 16S-23S rDNA intergenic spacer region amplicon is 300-bp in
size (Fig 4, lane 2).
11. Screen ITS-PCR confirmed V. cholerae isolates for the virulence-associated
factors listed in Table 3 and/or Supplementary Table 1. See Figure 4.
Huq et al. Page 17
* Using GoTaq® Green Master Mix (Promega, Madison, WI), prepare the PCR reaction as
follows for a total reaction volume of 25 µL; 5µl template DNA (step 4, 12.5 µl 2× GoTaq®
Master Mix (containing GoTaq® DNA Polymerase, 400µM dATP, 400µM dGTP, 400 µM
dCTP, 400 µM dTTP, 2mM MgCl2), 1µl of each primer (20 µM pVC-F2 and pVCM-R1),
5.5 µl nuclease free water
ALTERNATE PROTOCOL 2: Multiplex PCR assay for detection of ompW (V. cholerae-
specific) and ctxA (toxigenicity) (Nandi, Nandy et al. 2000)
This protocol can be used in place of Basic Protocol 4 since it detects for the V. cholerae-
specific ompW sequence. It also allows for the detection of the ctxA gene of the cholera
toxin.
Materials
Crude DNA template (Support Protocol 1) or extracted genomic DNA (Basic Protocol
10)
Reaction buffer
250 uM dNTPs
Omp W F and R primers
ctxA F and R primers

Taq polymerase
1.5% agarose gel
TAE buffer
Ethidium bromide staining solution
5. Set up ompW-ctxA multiplex PCR in a total reaction volume of 25-
µl, containing the following:
10 to 20 ng of crude DNA template (Basic Protocol 4, step 4)
or extracted genomic DNA (Basic Protocol 11, DNA extraction
using phenol, chloroform, and isoamyl alcohol, step 13)
1X reaction buffer
250-µM dNTPs
1.2-pmol/µl of ompW (ompW-F, R) primers
0.25-pmol/µl ctxA (ctxA-F, -R) primers

0.625-U Taq polymerase.
6. Amplify the targets with the following cycle conditions:
Initial denaturation: 5 min at 94°C
30 cycles: 30 sec at 94°C (denaturation)
30 sec at 64°C (annealing)
30 sec at 72°C (extension)
Final extension 7 min at 72°C.
7. Run PCR product out on a 1.5% agarose gel in 1X TAE for 1–2 hrs
at 5-V/cm (CPMB 2.5A).
8. Stain the gel 15 min in 1 µg/ml ethidium bromide staining solution.
Huq et al. Page 18
9. Destain the gel 15 min in distilled water.

10. Visualize the products by viewing the gel under UV light.
The ompW and ctxA amplicons are 588 and 302-bp in length,
respectively.
Screen samples giving a positive result for isolation of V. cholerae
using the traditional culture method as described in Basic Protocol
2, if desired.
BASIC PROTOCOL 5: Multiplex PCR assay for detection of O1 and O139 serogroup V.
cholerae and ctxA (Hoshino, Yamasaki et al. 1998)
The multiplex PCR assay is performed to confirm O1 and O139 somatic antigens and for the
simultaneous detection of the α-subunit of the cholera toxin gene sequence, ctxA in
confirmed V. cholerae isolates.
Materials
25 µm dNTPs (APPENDIX 2A)*
Taq DNA polymerase
PCR amplification buffer, 10X (APPENDIX 2A)

Sterile water
Molecular weight ladder (e.g. Hyperladder IV, Bioline, Taunton, MA)
Boiling water bath
PCR tubes
1 µg/ml ethidium bromide staining solution (APPENDIX 2A)
Set up O1/O139-rfb/ctxA multiplex PCR in a total reaction volume of 30-µl,
1.
containing the following:
10 to 20 ng of crude DNA template (Support Protocol 1, step 4) or extracted
genomic DNA (Basic Protocol 10, step 13)
1X reaction buffer
210 µM dNTPs
0.5 µM O1-rfb (O1F2-1, O1R2-2) primers
0.27 µM O139-rfb (O139F2, O139R2) primers
0.17-µM ctxA (VCT1, VCT2) primers
0.75-U Taq polymerase.
Huq et al. Page 19

35 cycles: 1 min at 94°C (denaturation)

1 min at 55°C (annealing)
1 min at 72°C (extension)
Final extension: 7 min at 72°C.
3. Run PCR product out on a 2.0% agarose gel in 1X TAE for 1–2 hrs at 5-V/cm
(CPMB 2.5A).
4. Stain the gel 15 min in 1 µg/ml ethidium bromide staining solution.
5. Destain the gel 15 min in distilled water.
6. Visualize the products by viewing the gel under UV light.
The O1-rfb, O139-rfb, and ctxA amplicons are 192, 449, and 308-bp in length, respectively.
(See Fig 4)
Real-Time PCR for Detection of V. cholerae—DNA-based methods such as PCR

increasingly have been employed. These are designed for rapid, sensitive analysis of a range
of clinical and environmental samples. End point PCR is not quantitative and the presence of
the PCR product(s) must be verified using a procedure such as southern hybridization and
gel electrophoresis (Lyon 2001).
It is important to note that, as in the case of conventional PCR, real-time PCR is not able to
discriminate between culturable versus VBNC and dead cells, as well as naked DNA (that
may amplify if the nucleic acid is not completely degraded) which can affect estimation in a
quantitative assay. Furthermore, the presence of substances that inhibit PCR, often present in
environmental samples, can also result in a false negative (Lyon, 2001). Few studies have
been designed and validated for a quantitative real-time PCR method for detection and
quantification of V. cholerae. Oligonucleotide primers and probes for Real-Time PCR
assays are listed in Table 4.
We highly recommend conducting all real-time PCR tests in a UV hood as well as sterilizing
all equipment (making sure to not expose reagents, primers, or probes to ultraviolet
radiation) used for real-time PCR. This reduces risk of contamination.
BASIC PROTOCOL 6: TaqMan assay for detection of V. cholerae (Lyon 2001)

The TaqMan assay is a real-time PCR method based on 5' exonuclease activity of Thermus
aquaticus DNA polymerase used to hydrolyze an internal probe labeled with a fluorescent
reporter dye (FAM, Cy3, Cy5, TET) and a quencher dye. During PCR amplification,
hydrolyzation of the probe separates the reporter dye from the quencher dye which results in
increasing fluorescence proportional to the amount of template DNA present in the reaction,
thereby giving a quantitative estimation. Lyon et al. (Lyon 2001) developed a method for a
quantitative, sensitive, and rapid detection of V. cholerae in pure cultures, seawater, raw
oysters with primers and probes directed toward the non-Classical specific hemolysin (hylA)
gene of V. cholerae O1, O139 and non-O1/O139 (Table 4). Another quantitative TaqMan
assay was developed for detection of the ctxA gene in seawater and oysters with the
sensitivity of <10 CFU per reaction (Blackstone, Nordstrum et al. 2007).
Materials
TaqMan® PCR Reagent Kit
Huq et al. Page 20
10X TaqMan buffer A

25 mM MgCl2
dATP, dCTP, dGTP, and dUTPs

Taq DNA polymerase
AmpErase UNG (1U/µL)
Forward Primer
Reverse Primer
probe (FAM)
The TaqMan V. cholerae-specific probe is an oligonucleotide with a 5’ reporter dye
(FAM-6-carbooxyfluorescein) and a 3’ quencher dye (TAMRA-6-carboxy-N’N’N’N’-
tetramethylrhodamine).
Optical reaction tubes or plates
Optical reaction tube caps or plate seal
Real-Time PCR (qPCR) machine
1. Set up Real Time PCR with a total amplification reaction mixture of 50-µl per
sample containing the following.2.5µl DNA sample (100 ng/µl) [Copy Editor:
Please ask author if you use the crude prep in SP1 or the DNA as prepared in BP
8.]
1X TaqMan buffer A
5 mM MgCl2
200 µM (each) dATP, dCTP, and dGTP; 400 µM dUTP
0.02 µM hylA-probe
0.3 µM hylA-F primer
0.3 µM hylA-R primer
1 U of AmpErase uracil N-glycosylase
2.5 U of AmpliTaqGold DNA polymerase
Initial hold: 5 min at 50°C

40 cycles: 20 sec at 95°C
1 min at 60°C
3. Results are interpreted using computer software available with Real-Time PCR
machines by monitoring increase in fluorescence throughout the amplification
cycles and reported as Ct value. The Ct value is the number of amplification
cycles required to detect a fluorescent signal above a given threshold. Ct levels
are inversely proportional to the amount of target nucleic acid in the sample. In
general, Ct values < 29 are considered strong positive reactions and are
indicative of abundant target nucleic acid in the sample, while Ct values of 30 to
35 are positive reactions indicative of moderate amounts of the target, and Ct
Huq et al. Page 21
values of 38 to 40 are considered weak reactions with little or no target nucleic

acid in the sample (Figure 5).
BASIC PROTOCOL 7: SYBR Green assay for detection of V. cholerae (Gubala, 2006)
An alternative Real-Time PCR method involves the use of a dsDNA binding dye such as
SYBR Green I. In this technique the amplification products are distinguishable by analysis
of their melting temperature (Gubala, 2006). This assay was used in two studies to develop a
multiplex real-time PCR of four and six target genes for V. cholerae and other vibrios
detection in sea, estuarine and river water samples, and seafood (Table 4) (Gubala and Proll
2006; Gubala 2006).
Materials
LightCycler® FastStart DNA Master SYBR Green I
LightCycler® FastStart Enzyme
LightCycler® FastStart Reaction Mix SYBR Green
MgCl2 Stock Solution, 25 mM
H2O, PCR-gradeTaq DNA polymerase
Forward Primer
Reverse Primer
Optical reaction tubes or plates
Optical reaction tube caps or plate seal
Smart Cycler (Cepheid, Sunnyvale, Calif.)
1a. For a single target, prepare the amplification reaction mixtures: 25 µl containing:
1 µl template DNA.
0.2 µM of each primers,
2.5 µl of LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics, Laval,
Quebec, Canada),
3.75 mM MgCl2 (final concentration)
1b. For Multiplex PCR, prepare Amplification reaction mixtures: 25 µl containing:
1 µl template DNA.
0.08 µM each rtxA primers;

0.15 µM each epsM primers;
0.40 µM each mshA primers;
0.20 µM each tcpA primers;
3 µl of LightCycler FastStart DNA Master SYBR Green I,
4.0 mM MgCl2 (final concentration).
initial denaturation: 150 sec at 95°C
45 cycles (single assays) 15 sec at 95°C
Huq et al. Page 22
35 cycles (multiplex assay): 30 sec at 60°C

30 sec at 72 °C
3. Results are interpreted using designated computer software. As with the

TaqMan assay, results are expressed in Ct values, the number of amplification
cycles required to detect a fluorescent signal above a given threshold. In a
multiplex SYBR Green real-time PCR, the amplification products are
distinguished based on their melting temperature (Tm). The Tm values of each of
the products are calculated at the completion of PCR amplification monitoring
the fluorescence in increasing temperature between 60°C and 95°C, at a given
rate. The Tm peaks are calculated based on the initial fluorescence curve.
BASIC PROTOCOL 8: Direct PCR for Environmental Samples

Three types of targets are used to detect V. cholerae in environmental samples by PCR:
species-specific genes (16S rDNA, ITS, ompW); serogroup-specific genes (O1 and O139
wbe); and toxin and pathogenic factor genes (ctx, tcpA, etc.). Briefly, water, plankton,
oyster, and/or sediment samples are collected and concentrated. DNA is extracted from the
samples, using a modification of the method of Murray and Thompson (Murray and
Thompson 1980) and PCR is performed on the extracted DNA using a multiplex (ompW
and ctxA) primer array. The PCR protocols described in Basic Protocol 5 (Sub-Protocols 1
and 2 and Alternative Sub-Protocol 1) are used and the DNA template is derived from the
DNA extraction method described in this Basic Protocol (below). Positive and negative
controls should be run in parallel and should include a eubacterial 16S rDNA PCR reaction
on each sample to test template quality. (See Table 3 for PCR primers and reference)
Materials
Pre-sterilized glass (240-ml, Qorpak, Bridgeville, PA) and plastic (500-ml, Nalgene,
Rochester, NY) containers
Simple Plankton net, 64 µm, or nets of different mesh sizes (for size filtration of
plankton) (Aquatic Research Instruments, Florida, USA) (See Figure 2)
Portable meter(s) to measure temperature, dissolved oxygen, pH, and salinity (HACH
Company, Colorado, USA)
Bucket of known volume (5 liter) (optional)
Tissue homogenizer (hand held or powered) to homogenize plankton (Kontes,
Vineland, NJ)
Filter apparatus with vacuum source
Filter membranes, 47-mm diameter, 0.22-µm pore size

Sterile 150-ml Erlenmeyer flasks containing 25-ml APW
Alkaline peptone water (APW), pH 8.6
TE buffer (APPENDIX 2A)
10% SDS
Proteinase K solution (20-mg/ml, 2%)
5 M NaCl
CTAB/NaCl solution
Chloroform/isoamyl alcohol (24:1)
Huq et al. Page 23
Phenol/chloroform/isoamyl alcohol (25:24:1)

Isopropanol
70% ethanol
25 mM dNTPs (APPENDIX 2A)
Taq DNA polymerase
10× Reaction Buffer, 500-mM KCl, 100-mM Tris-HCl pH 8.3 (at 25°C), 15-mM Mg2+
Sterile water
Molecular weight ladder (Hyperladder IV, Bioline, Taunton, MA)
Boiling water bath
PCR tubes

1 µM ethidium bromide staining solution (APPENDIX 2A)
Collection and concentration of environmental sample—For water and plankton

samples
1a. Collect sample as described in the conventional bacterial culture method above
(Basic Protocol 1).
2a. Perform enrichment in APW using the conventional bacterial culture method
(Basic Protocol 1).
For sediment samples
1b. Add sediment to 100-ml of distilled water until the final volume reaches 200-ml.
Mix well and allow the sediment to settle. Remove particulate matter by
centrifuging a 10-ml aliquot of the slurry for 8 min at 1000 × g, room
temperature.
2b. For sediment samples, enrich 1-ml of the sediment slurry in an APW enrichment
flask, as for water and plankton samples.
For oyster samples
1a. Collect sample as described in the conventional bacterial culture method above
(Basic Protocol 1)
2b. Perform enrichment in APW using the conventional bacterial culture method
(Basic Protocol 1)
Processing these samples in 10-fold dilutions and in triplicate or quintuplicate (i.e.,
triplicates or quintuplicates of 100, 10, and 1 ml of water) followed by direct PCR on these
dilutions will allow a quantitative estimation of the Most Probable Number (MPN) PCR
target in each sample. This can be done for all collected sample types and dilutions for
Huq et al. Page 24
oysters and sediments would be 10-fold weight increments (i.e., 10, 1, 0.1 g of homogenized
oysters. For more information on the Most Probable Number assay see Standard Methods
for the Examination of Water and Wastewater (Clesceri and Greenberg, et al. 1998).
DNA extraction using phenol, chloroform, and isoamyl alcohol

3. Microcentrifuge a 1-ml aliquot from the upper surface (i.e., top 1–2 mm) of the
APW enrichment for 5 min at 12,000 × g, room temperature.
4. Resuspend the cell pellet in 567 µl TE buffer.
5. Add 30 µl of 10% SDS, followed by 3 µl Proteinase K solution.
6. Incubate the suspension 1 hr at 35°C.
7. Add 100 µl of 5M NaCl, followed by 80 µl of CTAB/NaCl solution.
8. Incubate mixture 10 min at 65°C.
9. Add 800-µl phenol/chloroform/isoamyl alcohol (25:24:1), vortex and centrifuge
5 min at 12,000 × g, room temperature.
10. Transfer aqueous phase (supernatant) to a new microcentrifuge tube. Add 800-µl
of chloroform/isoamyl alcohol (24:1), vortex, and centrifuge 5 min at 12,000 ×
g, room temperature.
11. Transfer aqueous phase (supernatant) to a new microcentrifuge tube. Precipitate

DNA with an equal volume of isopropanol.
12. Pellet DNA by centrifuging 5 min at 12,000 × g, 25°C. Wash DNA with 1 ml of
70% ethanol and centrifuge 5 min at 12,000 × g, 25°C.
13. Dry pellet in vacuum desiccator or lyophilizer and resuspend in 100 µl TE
buffer.
Quick DNA extraction

1. Remove a 1-ml aliquot from the upper surface (i.e., top 1–2 mm) of the APW
enrichment.
2. Boil for 10 minutes.
3. Put on ice, then centrifuge to pellet cell material.
4. Remove ca. 700-µl supernatant and add this to a sterile 1.5-ml microcentrifuge
tube. This supernatant contains community DNA.
5. Add 28-µl of 10-mg/mL bovine serum albumin (BSA) (4-µl per 100-µl
supernatant). It is also beneficial to make a 1:10 dilution (supernatant:sterile DI
water) and use this for PCR as well as a dilution may help to remove PCR
inhibitors that can be present in community DNA samples.
Perform Direct PCR

1. Perform the PCR protocols described in Basic Protocol 4 or Alternate Protocol 2 or
Basic Protocol 5 on the extracted DNA template. Additionally, PCR assays
described in Supplementary Table 1 can be explored to evaluate the presence of
other V. cholerae virulence genes not targeted in these three protocols.
Huq et al. Page 25
BASIC PROTOCOL 9: Colony Blot Hybridization with Labeled RNA or DNA Probes
The colony lift procedure is used to immobilize DNA from bacterial colonies onto
nitrocellulose or nylon filters to allow quick screening of a large number of colonies for
genetic elements of interest by hybridization. The colony blot hybridization procedure is

culture based, so it is dependent upon the presence of V. cholerae in the sample as viable,
culturable cells. Its detection by hybridization precludes the necessity of numerous
biochemical tests. Its advantage over PCR is that isolation is performed simultaneously with
blot preparation and enumeration can be performed more easily. Briefly, LB or modified
nutrient agar spread plates are prepared from water samples and incubated overnight. Other
plating media can be used, but the media should be relatively rich and non-selective to allow
for vigorous growth and cells with a high RNA content. Nitrocellulose (or nylon)
membranes are overlaid, lifted, and treated to bind RNA (Rehnstam, Norqvist et al. 1989)
(or DNA) to the membrane. Plates to be lifted should contain 50 to 150 well-defined
colonies, 2.0–3.0-mm in size. Membranes should be handled with sterile forceps only and
can be sterilized in an autoclave between two pieces of filter paper for 15 min prior to use.
For RNA blots, care should be taken to minimize RNase contamination. Blots are then
hybridized with labeled probe specific for V. cholerae (and V. mimicus), 5’-
ACTTTGTGAGATTCGCTCCACCTCG-3’ (Heidelberg 1997; Heidelberg, Heidelberg et
al. 2002) or toxigenic V. cholerae (ctxA). V. mimicus is a closely related species to V.
cholerae which was previously described as biochemically atypical V. cholerae (non-sucrose
fermenting indicated by green colonies instead of yellow colonies on TCBS). V. mimicus
produces a variety of toxins, including cholera toxin (potential reservoir) and has caused
sporadic diarrhea (Ramamurthy et al., 1994). Fluorescently labeled probes are preferred
(e.g., see CPMB 3.18); however, the DIG system (Roche) offers a good alternative when a
variable mode imager (such as Typhoon, GE Healthcare) or an alternative machine, such as
Dark Reader (Clare Chemical Research, Colorado, USA), for detection of the fluorochrome
is not available. The V. cholerae-specific RNA colony blot/hybridization protocol is
presented first and then a ctxA-DNA colony blot/DIG (Roche) hybridization protocol is
presented.
Materials
85-mm sterile nitrocellulose membranes, 0.22-µm (GE Osmonics)
LB or modified nutrient agar plates
10% SDS
3X SSC (APPENDIX 2A)
65°C incubator
70°C oven
Pre-washing solution
Hybridization solution base
DEPC-treated water (APPENDIX 2A)
Washing solution
Fluorescein-labeled Vchomim1276 probe, reconstituted at 25-ng/µl
Typhoon Scanner (GE Healthcare) or Dark Reader (Clare Chemical)
NOTE: All solutions should be DNase and RNase-free. For RNA colony blot hybridization,
use DEPC-treated water (see APPENDIX 2A) to make hybridization solutions.
Huq et al. Page 26
Spread-plate preparation
1. For detection, prepare spread plates from APW enrichment flasks using APW as
diluent and plating three serial-fold dilutions onto LB or modified nutrient agar
plates.
2. For enumeration (and detection), spread plate appropriate dilutions onto LB or
modified nutrient agar plates on-site without APW enrichment.
Alternatively, 100–500-ml of water may be filtered through the 0.22-µm nylon
membranes and overlaid onto an agar plate. If this method is preferred, incubate
membrane and plate overnight at 30°C and then proceed to Step 7.
3. Incubate plates overnight at 30°C
Colony lift
4. Mark membranes using a lead pencil with Blot ID (e.g., medium, sample,
dilution) that matches plate to be lifted and orientation marks (asymmetrical).
5. Overlay membrane, starting from the center to ensure there are no air bubbles.
6. Allow at least 15 minutes for transfer.
7. Replica-plate the membrane onto a fresh modified nutrient agar plate,
transferring orientation markings.

8. Preheat SDS, SSC, and Pyrex dishes (for holding filter paper) to 65°C.
9. Place membrane, colony side up, on the filter paper (cut to just slightly larger
than the membrane) pre-wetted with 10% SDS, enclosed in a Pyrex dish, for 5
minutes at 65°C. Cover Pyrex dish containing wetted filter paper and membrane
with Saran wrap or equivalent film to prevent the filter paper from drying out.
It is important to use filter paper pre-wetted, but not saturated with 10% SDS or
3X SSC (next step) to prevent colonies from over-swelling and losing their
circular shape. Pour or pipet the liquid onto the filter paper, let soak briefly,
remove air bubbles, and then pour off excess. Ensure that there is no pooled
liquid on the filter paper prior to placing membrane.
10. Incubate the membrane 15 min at 65°C on fresh filter paper wetted with 3X
SSC. Cover Pyrex dish containing wetted filter paper and membrane with Saran
wrap or equivalent film to prevent the filter paper from drying out.
11. Let membranes air-dry 10 min on filter paper.
12. Bake membranes 15 min at 70°C.
RNA-Colony Blot Hybridization

13. Wash membranes three times in adequate pre-washing solution for 15 minutes at
room temperature.
14. Wash membranes 1.5 hr at 60°C in prewashing solution.
15. After pre-washing steps, rinse membranes in DEPC-treated water.
Hybridization solution base will form a precipitation upon maintaining at room
temperature. If this happens, heat to 40–50°C to resuspend.
16. Pre-hybridize the membranes 30 min at 60°C in hybridization solution at a ratio
of 10-ml pre-hybridization solution per 100-cm2 of blot membrane.
Huq et al. Page 27
85 mm-membranes have a surface area of ~60-cm2.

17. Pour off pre-hybridization solution and add hybridization solution plus probe
(32-µl/10-ml solution) at a ratio of 10-ml hybridization solution per 100-cm2
blot.
18. Hybridize overnight (16–20 hours ideally) at 60°C.
19. After hybridization, wash membranes 30 min at 60°C in washing solution.
20. View/image the membrane using Typhoon Scanner or Dark Reader.
21. From replica-plates, subculture colonies that were positive by blot hybridization
for further analysis, if desired.
ALTERNATE PROTOCOL 3: Colony Blot Hybridization with using DIG-labeled ctx DNA
probe
The previous colony blot hybridization protocol (Basic Protocol 9) is used to detect V.
cholerae and closely related V. mimicus. This protocol, on the other hand, targets only
toxigenic strains of V. cholerae. The presence of ctxA is confirmed by hybridization using a
ctxA-specific DNA-probe. There may be some cross-reactivity of the probe with the heat-
labile toxin (LT) of E. coli (Dallas and Falkow 1980). Colony blots are prepared following
the method of Pal et al, 1992 (Pal, Ramamurthy et al. 1992). The hybridization is done
according to the DIG protocol (Roche). The protocol is given here; readers are encouraged
to consult the manual accompanying the High Prime kit. The DIG DNA probe-labeling
protocol is given in a support protocol. The ctxA probe can be produced from PCR, using
the pCTA primer set (see Table 3) or from EcoRI digestion of plasmid, pKTN901, which
contains a 540-bp XbaI-ClaI fragment of ctxA (Kaper, Morris et al. 1988).
Materials
Luria-Bertani (LB) agar plates (APPENDIX 4A)
Sterile nylon (or nitrocellulose) membranes, 85mm, 0.22-µm (GE Osmonics)
Whatman filter paper, #3
Lysis buffer
Neutralization solution
UV crosslinker or transilluminator
1X SSC buffer (APPENDIX 2A)
Proteinase K solution
Incubators, 37°C and 42°C
Shaking water bath
DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, kit includes DIG
Easy Hyb granules, 10X Blocking solution, CSPD, anti-digoxigen-AP conjugate, DIG
High Prime)
Stringency wash solution I
Stringency wash solution II
Maleic Acid Buffer
Washing Buffer
Huq et al. Page 28
Blocking Solution, 1X in Maleic Acid Buffer

Antibody Solution, 1:10000 anti-digoxigenin-AP conjugate in Blocking Solution
Detection Buffer
X-ray film (Kodak or Fuji)
Film developer
Blot Preparation
1. Prepare spread plates as above, using LB agar plates (See Basic Protocol 9, steps
1 to 3).
2. Incubate the plates overnight at 37°C
3. Mark membranes using a lead pencil, including Blot ID (e.g., medium, sample,
dilution) that matches plate to be lifted and orientation marks (asymmetrical).
4. Overlay membrane, starting from the center to ensure there are no air bubbles.
5. Transfer at least 15 min.
6. Transfer the blot onto a new LB plate keeping colony side up and incubate 3 hr
at 37°C. Wrap the master plate with parafilm and keep at 10–15°C.
Master plates can be kept like this for up to 2 weeks.

7. Place membranes, colony side up, onto #3 Whatman filter paper pre-soaked with
lysis buffer. Incubate 10 min at room temperature.
8. Remove the membrane from lysis buffer and place onto #3 Whatman filter paper
presoaked with neutralization solution
9. Repeat step 8.
10. Remove membrane from neutralization solution and place onto #3 Whatman
filter paper and air dry (approximately 30 minutes).
11. Immobilize colonies onto the membrane using a UV crosslinker or
transilluminator.
Damp membranes should be crosslinked at an output intensity of 120-mJ/cm2,
which corresponds to the optimal or auto-crosslink setting on commercially
calibrated machines. Transilluminators or hand-held UV lamps can be used, if
calibrated; however, the following times should be sufficient: 1 min for 254-nm
lamps or 3 min for 302-nm lamps.

12. Rinse the blot two times in 1X SSC buffer and air dry (approximately 30
minutes).
13. Treat membranes 30 min at 42°C with 100-ml Proteinase-K solution using
gentle shaking.
14. Rinse filters three times in 1X SSC in a shaking water bath at room temperature
for 10 min each. Let air dry (approximately 30 minutes).
Prehybridization and Hybridization

15. Preheat DIG-Easy Hybridization buffer to 42°C
16. Prehybridize blots in preheated DIG-Easy Hybridization buffer for 30 min at
42°C with gentle agitation.
Huq et al. Page 29
17. Denature the DIG-labeled probe by boiling for 5 min and rapidly cooling on ice.
18. Pour off pre-hybridization solution.
19. Add fresh DIG-Easy Hybridization Solution plus denatured probe (25 ng/ml
solution) and incubate overnight at 42°C.
Stringency washes
20. Pour off probe-containing hybridization solution and store up to 2 months at
−20°C.
Probe-containing hybridization solution can be reused several times.
21. Wash membrane two times in Stringency Wash Solution I for 5 min at room
temperature under constant agitation.
22. Wash two times in Stringency Wash Solution II for 15 min at 65°C under
constant agitation.
Detection
23. Rinse membrane briefly (5 min) in Washing Buffer.
24. Incubate the membrane 30 min at 25°C in Blocking Solution.
25. Incubate the membrane 30 min at 25°C in Antibody Solution for 30 min.
26. Wash the membrane two times in Washing Buffer, for 15 min each.
27. Equilibrate the membrane in Detection Buffer for 5 min at 25°C.
28. Place membrane in hybridization pouch. Add CSPD to the membrane, cover and
incubate at room temperature for 5 min.
29. Remove excess liquid from pouch, seal, and incubate at 37°C for 10 min.
30. Expose the membrane to X-ray film for 20 min at room temperature and
develop.
If film is under- or over-exposed, repeat step 30 and vary time of exposure
accordingly.
31. From master plates (step 6), subculture colonies that were positive by blot
hybridization for further analysis.
SUPOORT PROTOCOL 2: DNA-labeling of ctxA probe using DIG-High Prime

PCR or digestion-generated probes can be labeled by DIG-High Prime (Roche), randomly

incorporating Digoxigenin-11-dUTP. A 563-bp ctxA fragment can be produced by
amplifying extracted DNA from a toxigenic laboratory reference strain. The PCR product
should be purified by using a PCR clean-up kit or by gel electrophoresis and extraction.
Alternately, a PCR product may be labeled during the PCR amplification using the PCR
DIG Probe Synthesis Kit (Roche). A 554-bp ctxA probe is also available on a plasmid,
pKTN901(Kaper, Morris et al. 1988), which has been widely used (Pal, Ramamurthy et al.
1992; Islam, Rahman et al. 2005). The XbaI-ClaI fragment can be removed from the
plasmid by digestion with EcoRI and gel purified. Labeled probes can then be used in the
DIG-based hybridization above.
Materials—DNA extracted from toxigenic (ctxA+) V. cholerae reference strain (ATCC)

Forward and reverse pCTA primers for amplifying ctxA (Table 6A.5.4) Plasmid pKTN901
Huq et al. Page 30
(available from Dr. James Kaper, [email protected]) or other source of ctxA probe
EcoRI restriction endonuclease (or other restriction enzyme depending on source of ctxA
probe) and restriction buffer
Sterile distilled water

Boiling water bath
DIG-High Prime
Ice/water bath
Incubator, 37°C
0.2 M EDTA, pH 8.0
1. For PCR-generated ctxA target fragment, amplify extracted DNA of a toxigenic
(ctxA+) V. cholerae reference strain using the pCTA primer set.
2. For digestion-generated ctxA target fragment, digest plasmid, pKTN901, with
EcoRI for 2 hrs at 37°C
3. Clean-up PCR reaction product or digestion product by gel electrophoresis
followed by gel extraction (CPMB 2.6).
4. Bring 1-µg of purified ctxA fragment up to a total volume of 16-µl in sterile
distilled water.
5. Denature by placing in a boiling water bath for 10 min, followed by rapidly chilling
in an ice bath (5 min).
6. Add 4-µl of DIG-High Prime to the DNA solution, mix, and centrifuge briefly to
collect liquid.
7. Incubate overnight at 37°C.
8. Stop reaction by adding 2-µl of EDTA and/or by heating to 65°C for 10 min.
IMMUNOLOGICAL METHODS FOR DIRECT DETECTION OF V. CHOLERAE

IN ENVIRONMENTAL SAMPLES
Conventional culture methods are ineffective when bacterial cells have entered into the
viable but non-culturable (VBNC) state. Thus, direct detection becomes extremely
important. Despite the ubiquitous nature of V. cholerae, isolation and detection by
traditional methods are difficult since these methods rely on culturing the organism. The
discovery of monoclonal antibody in the 1980s and, subsequently, the development of a
monoclonal antibody against V. cholerae O1 triggered development of direct detection

methods for this bacterial species (Xu, Roberts et al. 1984; Hasan, Loomis et al. 1992).
Using immunological methods, the mystery concerning the inability to culture V. cholerae
in environmental samples was reported during inter-epidemic period in Bangladesh (Roszak
and Colwell 1987; Huq, Colwell et al. 1990). These difficulties arise from several possible
factors: low density, inter-specific competition, cell state, and health (VBNC, starved).
Fluorescent In-Situ Hybridization (FISH) allows direct detection of taxa-specific nucleic
acid followed by visualization using microscopy and the polymerase chain reaction offers a
molecular-based alternative to the traditional culture and immunological methods (discussed
later).
Huq et al. Page 31
BASIC PROTOCOL 10:Fluorescent In-Situ Hybridization (FISH) Detection of V. cholerae

Direct quantification methods without the need to enrich and culture can yield highly
accurate and quick estimates of taxon-specific densities in water bodies. Fluorescence In-
Situ Hybridization (FISH) accomplishes this with a fluorescently-labeled oligonucleotide

probe that is visualized under epifluorescence or confocal laser scanning microscopy. This
method is reliable for accurate estimations of V. cholerae cells in media as it allows one to
quantify both culturable and non-culturable (VBNC) V. cholerae cells.
Materials
4% paraformaldehyde solution in 1X PBS
1X PBS
1X PBS-ethanol solution (1:1, PBS: absolute ethanol)
1.5 or 2-ml microcentrifuge tubes
FITC-labeled probe, Vchomim1276, 6-FAM (fluorescein phosphoramidite) labelled
probe (5’-[5FITC] ACTTTGTGAGATTCGCTCCACCTCG-3’) at a working
concentration of 50 ng/µl in sterile water (final concentration, 5 ng/µl).
Multiwell slides
0.01% poly-L-lysine solution (PLL)

Ethanol solutions (50, 80, and 96%)
Hybridization solution
Washing buffer solution
Anti-fade agent, Citifluor AF1
50-ml centrifuge tubes
Whatman filter paper
Incubator or water bath set to 45°C.
Sample preparation
1. Filter water (ca. 500 to 1000 ml) through a 0.2 µm polycarbonate membrane, and
resuspend cells attached to membrane in 5 ml 1X PBS.
2. Centrifuge 1 ml of 1X PBS re-suspension at 13,000 g for 10 min in microcentrifuge
tube. Discard supernatant and resuspend in 250 µl of 1X PBS
3. Fix cells by adding 750 µl of fresh 4% paraformaldehyde solution and incubate at

room temperature (22–25°C) for 1hr.
4. Next, pellet the cell solution by centrifugation at 13,000 g for 5 min. Discard the
supernatant and then wash the cell twice with 1X PBS.
5. Concentrate the cells by centrifugation and re-suspend in 100 µl PBS-ethanol
solution.
6. Store cells at −20°.
Hybridization
1. Immerse multiwell slides in 0.01% PLL solution for 10 min and air-dry.
2. Spot 5 µl aliquots of fixed cells onto slides and air-dry.
Huq et al. Page 32
3. Wash slides for 3 min each in successive ethanol solutions (50, 80 and 96%) and
then air-dry. Pre-warm humid chamber, slides and filter paper soaked with
hybridization solution at 45°C for 10 minutes.
4. To each well, add 5 µl aliquot of Hybridization solution containing 5 ng/µl of

labeled probe.
5. Perform hybridization at 45°C for 24 hrs in the humid chamber using hybridization
soaked paper.
6. Pre-warm the washing buffer solution at 45°C for 10 minutes before washing the
slides and incubate at 45°C for 10 minutes.
7. Wash slides in sterile deionized water and air-dry at room temperature.
8. Add anti-fading agent to each well and a cover slip is applied.
9. Fluorescence is visualized under epifluorescence microscopy (Fig. 6.)
BASIC PROTOCOL 11: Direct Fluorescent Antibody – Direct Viable Count (DFA-DVC)
Method
The direct fluorescent antibody staining method for rapid detection of V. cholerae serogroup
O1 and O139 is a very useful, direct, and culture-independent method. Coupled with the
direct viable count method of Kogure et al. (1979), it can distinguish culturable, viable cells
from viable but non-culturable cells (VBNC) of V. cholerae (Chowdhury, Hasan et al.
1994). It is a two-step method where samples are incubated with yeast extract in the
presence of nalidixic acid, after which actively viable, substrate-responsive cells become
enlarged and elongated (Kogure, Simidu et al. 1979). Next, an aliquot from this suspension
are air dried on a glass slide and stained with fluorescent labeled monoclonal antibody,
raised against ‘A’ factor of V. cholerae O1 lipopolysaccharide that reacts with both
serotypes, Ogawa and Inaba (Colwell, Tamplin et al. 1990; Hasan, Bernstein et al. 1994).
Antibodies against V. cholerae O139 are also available (Hasan, Huq et al. 1995). When
observed under an epifluorescent microscope, elongated cells of V. cholerae O1 or O139,
(based on the type of antibody used) exhibit a bright green fluorescing periphery (the outer
cell wall) with a dark interior (Fig. 7). V. cholerae O1 and O139 DVC-DFA positive
samples can be confirmed by PCR (Binsztein, Costagliola et al. 2004). DFA-DVC is a rapid
method by which one can determine the presence of V. cholerae within 8 hr (when the DVC
incubation is 6 hr); however, overnight incubation with yeast extract and nalidixic acid is
preferred. Kits for V. cholerae O1 (CholeraDFA) and O139 (BengalDFA) DFA tests are
commercially available (New Horizon Diagnostics, Columbia, MD).
Materials
Concentrated water or homogenized plankton sample (Basic Protocol 2)
Yeast extract, 2.5% solution in distilled water
Nalidixic acid, 0.2% solution in distilled water
35°C incubator
Formaldehyde solution, 37–40%, or fresh 4% formaldehyde solution made from
paraformaldehyde
Micropipettes
Multiwell slides and cover slips
Absolute methanol
Huq et al. Page 33
Distilled or deionized water

Phosphate buffered saline (PBS; APPENDIX 2A)
Humid chamber: 50-ml centrifuge tube containing 1–2 strips of saturated filter paper
CholeraDFA and/or BengalDFA kit (test kit comes with FITC-conjugated DFA reagent,
positive and negative control, slides and fluorescent mounting medium; New Horizon
Diagnostics).
Epifluorescent microscope, with FITC filter set
NOTE: All solutions should be 0.1 µm filtered and sterile, as VBNC cells of V. cholerae
appear as small coccoid cells in a size range of 0.1 to 0.8 µm
Perform DVC incubation

1. To 1 ml concentrated water or homogenized plankton sample (Basic Protocol 1),
add 10-µl yeast extract solution and 10-µl nalidixic acid solution.
2. Freeze (-20°C) a parallel sample (1-ml) for PCR confirmation.
3. Incubate the mixture at 25°C for a minimum of 6 hrs to overnight.
4. Fix the sample by adding formaldehyde to a final concentration of 3% (v/v) and
incubating 30 min at room temperature in the dark.
Fixed samples can be stored at 4°C in the dark for up to 6 months.
Perform DFA protocol

5. Place 5 to 10 µl of the fixed sample onto a glass slide and air dry (approximately
15–20 minutes).
6. Fix by adding 5 µl methanol and air dry (1–5 minutes).
7. Add 10-µl of reconstituted FITC-conjugated specific DFA reagent (Hasan,
Bernstein et al. 1994), as supplied by Cholera DFA or BengalDFA kit.
8. Incubate 30 min at 37°C in humid chamber. Protect slide from light.
9. Rinse slide with ~50 ml PBS (each). Air dry slides in the dark (approximately
15–20 minutes).
10. Mount slide with one drop of kit-provided Fluorescent Mounting Medium and
add cover slip.
Observe under an epifluorescent microscope (see Fig 7).
11.
BASIC PROTOCOL 12: Indirect Fluorescent Antibody (IFA) Method

This immunofluorecent method for detection of V. cholerae serogroup O1 in aquatic
environmental samples was first introduced by Xu et al. in 1984 (Xu, Roberts et al. 1984).
Antiserum specific for O1 somatic antigen produced in rabbits was used with fluorescein-
isothiocyanate (FITC)-conjugated anti-rabbit globulin goat serum, with rhodamine
isothiocyante (RITC)-conjugated bovine serum albumin as the background stain. This
method was found to be very useful for detecting organisms in samples which gave negative
results by culture (Brayton, Roszak et al. 1986; Huq, Colwell et al. 1990). It was later
optimized and packaged as the direct fluorescent antibody staining kit for V. cholerae O1,
Cholera DFA by Hasan et al. (Hasan, Bernstein et al. 1994). The IFA protocol remains
useful for laboratories where commercial DFA kits for V. cholerae are not readily available.
Huq et al. Page 34
Materials
Concentrated water or homogenized plankton sample (Basic Protocol 2)
Multiwell, Teflon-coated slides

Glass coverslips
Phosphate buffered saline (PBS; APPENDIX 2A)
95% ethanol
Incubators, set to 55°C and 35°C
50-ml screw-cap centrifuge tubes
Filter paper, cut into thin strips to fit inside centrifuge tubes
FA Rhodamine counterstain (Becton Dickinson)
Polyvalent V. cholerae O1 antiserum (Difco)
FITC-conjugated anti-rabbit globulin goat serum (Sigma)
Mounting medium, such as FA (Difco) or Citifluor AF1/AF3 (Electron Microscopy
Sciences, Hatfield, Pennsylvania, USA)
Epifluorescent microscope with FITC bandwidth filter
Prepare and fix samples

1. Add an appropriate amount (dependent on concentration of sample and well
size) of each sample to be tested to a Teflon-coated multiwell slide. Air dry (15–
20 minutes) at room temperature.
2. Fix the sample by adding 95% ethanol to each well containing sample. Air dry
(5–10 minutes) at room temperature.
3. Heat slide 10 min in a 55°C incubator.
Slides may be stored up to 1 month at −70°C at this point.
Staining procedure
4. Rinse the slide(s) with ~50-ml PBS and air dry (15–20 minutes).
5. While slide is drying, prepare humid chamber for use. Equilibrate chamber in
35°C incubator (~15 min).
6. To each dry sample well, add 1 to 2 drops of a 1:20 dilution of FA Rhodamine

Counterstain. Incubate in humid chamber 30 min at 35°C.
Minimize exposure to light from this step forward.
7. Rinse slide in PBS by gently flooding (~50-ml), then soak in the same solution
10 min at room temperature. Remove and rinse again briefly in PBS.
8. Allow slide to air dry (15–20 minutes).
9. Add 5–10-µl of V. cholerae O1-specific antiserum. Incubate in humid chamber
30 min at 35°C.
10. Repeat steps 7 and 8. Use fresh PBS for washing.
11. Add 1–2 drops undiluted FITC-conjugated anti-rabbit globulin goat serum and
incubate in humid chamber 30 min at 35°C.
Huq et al. Page 35
12. Repeat washing steps 7 and 8 using fresh PBS.

13. Mount each slide with a glass cover slip and a low fluorescence, anti-quenching
mounting medium, such as Citifluor AF1.
14. Examine samples immediately using a epifluorescent microscope with a FITC

band-pass filter.
REAGENTS AND SOLUTIONS

Use deionized, distilled water in all recipes and protocol steps. For common stock
solutions, see APPENDIX 2A; for suppliers, see SUPPLIERS APPENDIX.
Alkaline Peptone Water (1×)

Peptone, 10-g
Sodium chloride, 10-g
Adjust volume to 1 liter with water
Adjust pH to 8.6 with NaOH
Autoclave to sterilize
Store up to 6 months at 2–8°C
Alkaline Peptone Water (10×)

Peptone, 100-g
Adjust pH to 8.6 with NaOH
Store up to 6 months at 2–8°C
Estuarine Peptone Water (EPW)

autoclaved natural estuarine water amended with 1% peptone
Thiosulfate Citrate Bile Salts Sucrose (TCBS) Agar

Yeast extract, 5-g
Peptone, 10-g
Sodium thiosulfate, 10-g
Sodium citrate, 10-g
Ox Bile, 8-g
Sucrose, 20-g
Ferric citrate, 1-g
Bromothymol blue, 0.04g
Thymol blue, 0.04-g
Huq et al. Page 36
Agar, 14-g
Boil to completely dissolve

IMPORTNANT NOTE: Do not autoclave.
This medium is also available commercially as a dehydrated powder from Oxoid
(Remel, Lenexa, KS, USA)
Modified Nutrient Agar

Beef extract, 3-g
Peptone, 5-g
Agar, 15-g
Store up to 1 month at 2–8 °C
Monsur’s Tellurite Taurocholate Gelatin Agar (TTGA)

Tryptone, 10-g
Sodium taurocholate, 5-g
Sodium carbonate, 1-g
Gelatin, 30-g
Agar, 15-g
Boil to completely dissolve ingredients
Final pH should be 8.5. If it is not, adjust with HCl
Autoclave and add potassium tellurite to 1% (w/v) final
Gelatin Agar (GA)

Neopeptone, 4-g
Yeast extract, 1-g
Gelatin, 15-g
Agar, 15-g
Huq et al. Page 37
Modified HPCA medium

Peptone, 3.0-g
Soluble casein, 0.5-g

Potassium phosphate dibasic, 0.2-g
Magnesium sulfate, 0.05-g
Ferric chloride, 0.001-g
Agar, 15.0-g
Adjust pH to 7.2 with HCl
Hybridization solution
0.9M NaCl
20 mM Tris-HCl
0.01% SDS, pH 7.2,

35% Formamide
Washing buffer solution

0.9M NaCl
20mM Tris-HCl
0.01% SDS
1X PBS-ethanol solution
50% 1X PBS
50% absolute ethanol
Methyl Red indicator solution

Dissolve 0.1 g Methyl Red in 300 ml of 95% ethanol. Adjust volume to 500 ml with
water. Store up to 6 months at 2–8°C.
Pre-washing solution
Prepare the following in DEPC-treated water (APPENDIX 2A)
SSC, 3X (APPENDIX 2A), RNase-free
SDS, 0.1%, RNase-free
Prepare fresh
Hybridization solution base

Prepare the following in DEPC-treated water (APPENDIX 2A)
NaCl, 0.9-M
Huq et al. Page 38
Sodium phosphate (pH 8.0), 50-mM

EDTA, 5-mM
SDS, 0.5%
Store up to 1 month at room temperature
Precipitation will occur upon standing at room temperature. Heat to 45° to 50°C to
resuspend.
Washing solution
Prepare the following in DEPC-treated water (APPENDIX 2SA)
SSC, 1X (APPENDIX 2A)
SDS, 0.1%
Prepare fresh
CTAB/NaCl Solution
Add 4 g NaCl to 80-ml water and dissolve. Slowly add 10 g of
cetyltrimethylammonium bromide (CTAB) while heating and stirring at 65°C. Adjust
volume to 100-ml with water. Store up to 6 months at room temperature.
Fluorescein-labeled Vchomim1276 probe

5’-ACTTTGTGAGATTCGCTCCACCTCG-3’, with 5’ Fluorescein label.
Resuspend probe to a working concentration of 25-ng/µl. Add probe to hybridization
solution base at a ratio of 32-µl per 10-ml of solution.
Cell Lysis Buffer

Sodium hydroxide, 0.5-N
Sodium chloride, 1.5-M
Prepare fresh
Blot Neutralization Solution

0.5 M Tris-HCl, pH 7.2 (APPENDIX 2A)
Store up to 6 months at 2–8°C.
Proteinase K Solution (40-µg/ml)

Proteinase K, 4-mg
1× SSC (APPENDIX 2A), 100-ml
Store up to 2 months at −20°C.
Stringency Wash Solution I

SSC, 2X (APPENDIX 2A)
SDS, 0.1%
Prepare fresh
Huq et al. Page 39
Stringency Wash Solution II

SSC, 0.5X (APPENDIX 2A)
SDS, 0.1% (w/v)

Prepare fresh
Washing Buffer
Maleic Acid, 0.1-M
Tween 20, 0.3% (v/v)
Adjust pH to 7.5 with solid NaOH
Prepare fresh
Maleic Acid Buffer

Maleic Acid, 0.1-M
Adjust pH to 7.5 with solid NaOH
Prepare fresh
Detection Buffer
0.1 M Tris-HCl, pH 9.5 (APPENDIX 2A)
Store up to 1 month at room temperature
COMMENTARY
Background Information
Understanding the natural ecology of an infectious agent outside of the human body is
essential to understanding the epidemiology of the associated disease and especially
necessary in any attempt to prevent illness caused by exposure to that pathogen. It is well
established that V. cholerae is autochthonous to the aquatic environment globally and even
in regions where cholera is absent (Haley, Chen et al. 2012). However, these environments
are highly heterogeneous and change over time. It is also well established that seasonal
fluctuation in environmental parameters is associated with changes in environmental

pathogen densities and disease prevalence. It is, therefore, necessary to understand the
influence of the environment on presence and number of these organisms. This requires an
holistic approach toward investigation of the microbial ecology of an infectious disease.
Temporal and spatial studies of V. cholerae in water, planktonic organisms, sediment, and
shellfish, coupled with recording physical and chemical parameters of the study
environment (regardless of presence or absence of V. cholerae) allows investigators to
estimate changes in the presence or density of V. cholerae in a particular region. This
information can be used to help predict the public health safety of water bodies or seafood,
thereby reducing risk of illness and loss of revenue from inaccurate prediction of the
presence of pathogens in water bodies used for recreation or shellfish harvesting. Although,
cholera is a public health threat for developing nations more than for developed nations,
methods for V. cholerae discussed in this chapter can be applied to other waterborne
pathogens with addition of methods specific to the microorganism of interest.
Huq et al. Page 40
As commented above, multiple approaches should be taken to study the ecology of

pathogens in the environment. The coupling of methods can overcome limitations inherent
in any one particular method and allow convergence on the precise answer(s). However,
increase in the cost and time commitment needs to be considered. An investigator should
first determine the data or results needed, appropriateness of available methods, and
feasibility of carrying out the procedures to achieve the goal. If the microorganism of
interest is not detected, it is not appropriate to conclude that the pathogen is absent from
study, but rather that it was not detected by the methods used. In this scenario, use of
multiple methods reduces “not detected” results. Further, parallel replication of assays will
enhance accuracy and statistical power of the results.
Critical Parameters and Troubleshooting—Successful detection and isolation of V.

cholerae is dependent on both its presence in the environment as well as the method used for
detection. V. cholerae undergoes the VBNC state at prolonged low temperatures, which will
influence whether culture of the bacterium will succeed when water temperatures are low.
Lack of growth on media is indicative of V. cholerae in the VBNC state rather than an
absence of V. cholerae in the water body of interest. In such instances, inclusion of direct
detection methods (DFA, IFA, FISH, direct PCR) will provide more precise results with
respect to the presence of V. cholerae. If such methods are used in conjunction with
culturing methods then the methods should be used throughout the entirety of the study
rather than alternating methods based on the prevailing environmental conditions.
The culturing methods presented in this unit are the most commonly used culture-based
protocols for isolation of V. cholerae (Morris, Merson et al. 1979; Rennels, Levine et al.
1980). Other methods have been described and may be suitable for certain study
environments. Alkaline bile peptone water (Spira, Huq et al. 1981), Monsur’s tellurite
taurocholate broth (Monsur 1961), and sodium-gelatin phosphate broth (Rennels, Levine et
al. 1980) have been described as enrichment media that are effective for culturing V.
cholerae. A second enrichment step may be used, but will add an additional 6 to 8 hr to an
already lengthy protocol. There is also the concern that repeated passaging of cells will
allow for population and genotypic alterations to occur by favoring cells which grow more
readily in enrichment broths, allowing for mutations to accumulate, i.e. natural mutations
occurring during cell division. The latter is a concern in isolating cells whose genomes will
be sequenced, as accumulation of SNPs and genomic rearrangements and possibly
horizontal transfer of mobile elements or loss of genomic islands in the enrichment broth
will yield inaccurate genomic data about the cells in the environment. Such data may
erroneously lead to assumptions on virulence factors, phylogeny, or origin of the strains.
Essentially, the minimum amount of culturing steps should be used to obtain accurate
results.
As V. cholerae can grow at a wide range of temperatures, several incubation temperatures in

APW and TCBS, TTGA, or CA can be used for V. cholerae isolation. Incubating at the
lower range of recommended temperatures (near 30°C) may enhance the growth of
environmentally stressed cells exposed to low temperatures, but this may require longer
incubation times on solid media. Incubating media at higher temperatures (> 37°C) may
inhibit the growth of some non-Vibrio species but may also inhibit the growth of stressed V.
cholerae cells. If possible, incubate media in parallel at multiple temperatures. Furthermore,
stepwise increase in incubation temperature, 25°C (1–2hr) → 30°C (1–2hr) → 35°C can be
used to sensitize the stressed cells to adapt and grow.
We strongly advise that a subculturing step onto non-selective media be utilized after
isolation from TCBS, TTGA, or CA. This step serves two purposes. First, it is critical that
pure colonies be isolated before proceeding to any genomic or phenotypic characterization
Huq et al. Page 41
steps. Secondly, growth on TCBS is not suitable for the oxidase test, serotyping, or for direct
PCR.
It is known that PCR amplification of target DNA in environmental samples can be inhibited
by dissolved organics, such as humic acid. For that reason, we suggest performing a DNA
extraction first. This typically adds only 3 to 4 hr to the protocol and results in high yield
DNA with a decrease in inhibition during PCR amplification. For all direct PCR
examinations (PCR on extracted or boiled APW), include the eubacterial PCR reaction to
confirm template quality on samples. Further, we strongly suggest that direct PCR be done
on 1:10, 1:100 dilutions (DNA template:TE buffer or DNA template: nuclease free water) in
parallel with undiluted samples.
FISH allows visual quantification of all V. cholerae cells, regardless of their culturability, in
a sample. One problem with this method is observation of auto-fluorescing constituents
found in environmental water samples. All “positive” samples should be documented by
digital or film photography, and confirmation by conventional PCR and/or Real-Time PCR
of a parallel sample (frozen, but not fixed) is advisable.
The following table (Table 5) outlines some of the more common problems that may be
experienced in performing the basic and alternate protocols from this unit. This is not an
exhaustive list; others may be encountered. Please consult the troubleshooting sections from
the referenced CPMB sections for further advice.
Anticipated Results—V. cholerae can be easily isolated from estuarine environments

during the warm summer months, even in non-epidemic areas. Those chances decrease
during the colder winter months, even from samples that are positive by PCR or DFA.
Figure 3 shows the typical growth of V. cholerae on TCBS, TTGA, and CA media. Growth
on TCBS by V. cholerae appears as small (1 to 3-mm diameter), flat, yellow colonies (Fig.
3). V. cholerae appear as medium to large (2 to 5-mm in diameter), flat, translucent colonies
on TTGA (Fig. 3). There will be a zone of clearing (or halo) surrounding V. cholerae
colonies due to hydrolysis of gelatin. A dark center usually develops after 24 hr. Growth on
CA by V. cholerae appears as medium to large (2 to 5-mm in diameter) turquoise colonies.
However, V. cholerae is a highly heterogeneous species can exhibit various colony
morphologies including a rugose form (White 1940). Several different V. cholerae isolates
should be used as positive controls as comparators for cultured cells. These selective media,
TCBS, TTGA, and CA are all selective, but still allow the growth of other Vibrio species
and related bacteria. For example, V. parahaemolyticus will appear as blue-green
(occasionally yellow) colonies, V. vulnificus will appear as greenish yellow colonies, and V.
alginolyticus as larger, sometimes swarming yellow colonies on TCBS. Therefore, colonies
growing on these media are not necessarily all V. cholerae, hence they are labeled as
presumptive until they can be confirmed by PCR. If several of these solid media are
available to the investigator then it may be beneficial to “dot” or streak for isolation,
presumptive V. cholerae colonies isolated from one media onto another that is selective for
V. cholerae as well (TCBS → CA and TTGA, for instance). Visualizing the color and
morphology of an isolate on one selective media that was recovered from a different
selective media may help the investigator determine whether or not to proceed with PCR
confirmation of that isolate.
Supplementary Table 1 lists a comprehensive, yet not exhaustive set of PCR primers used to
characterize V. cholerae isolates. This table also lists the reaction temperatures and times as
well as the expected amplicon size. Positive control strains known to encode the target
region and yielding an appropriate size amplicon should be used for all PCR reactions.
Huq et al. Page 42
Time Considerations—Choosing the appropriate methods discussed in this unit will

determine how rapidly results can be achieved. Clinical diagnosis requires rapid
determination of the etiological agent and rapid non-culturing techniques are currently being
developed. In the case of cholera, symptoms are often distinguishable from other infections
and stool typically requires no need for enrichment in APW and readily yield V. cholerae
colonies on TCBS agar. Environmental monitoring often requires more time, depending on
the method. However, PCR screening can be performed in 6–24 hours depending on the
template, and DFA can be done in 4 hours or 24 hours if coupled with DVC. Use of multiple
methods and genotypic characterization will significantly increase the amount of time
needed to complete this work. In-depth genotypic characterization can be done in intervals
after several rounds of sample collection and V. cholerae isolation. It is important to confirm
any presumptive strain as being V. cholerae before time and resources are dedicated to
genotypic characterization. As with any proposed work, a daily schedule with estimated
timeframes may be helpful in efficiently accomplishing the investigators’ goals.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
This work was partially supported by the grants from National Science Foundation Grant 0813066, NIH Grant
2RO1A1039129-11A2, National Institutes of Health-Fogarty International Center Grant 1RC1TW008587-01, US
Army Medical Research and Material Command Grant W81XWHO9201, NOAA Grant S0660009, and DHS
Contract HSHQDC-10-C-00177.
Literature Cited
Alam M, Hasan NA, et al. Seasonal cholera caused by Vibrio cholerae serogroups O1 and O139 in the
coastal aquatic environment of Bangladesh. Appl Environ Microbiol. 2006; 72(6):4096–4104.
[PubMed: 16751520]
Alam M, Sadique A, et al. Effect of Transport at Ambient Temperature on Detection and Isolation of
Vibrio cholerae from Environmental Samples. Appl Environ Microbiol. 2005 In Press.
Binsztein N, Costagliola M, et al. Viable but nonculturable Vibrio cholerae O1 in the aquatic
environment of Argentina. Appl Environ Microbiol. 2004; 70(12):7481–7486. [PubMed: 15574951]
Blackstone GM, Nordstrum JL, et al. Use of a real time PCR assay for detection of the ctxA gene of
Vibrio cholerae in an environmental survey of Mobile Bay. J Microbiol Methods. 2007; 68(2):254–
259. [PubMed: 17034889]
Brayton PR, Roszak D, et al. Fluorescent antibody enumeration of V. cholerae in the marine
environment. IFREMER. 1986; 3:507–514.
Cash R, Music S, et al. Response of man to infection with Vibrio cholerae I. Clinical, serologic, and
bacteriologic responses to a known inoculum. J. Infect. Dis. 1974; 129:45–52. [PubMed: 4809112]
Chakraborty S, Mukhopadhyay AK, et al. Virulence genes in environmental strains of Vibrio cholerae.
Appl. Environ. Microbiol. 2000; 66(9):4022–4028. [PubMed: 10966424]
Choopun N, Louis V, et al. Simple procedure for rapid identification of Vibrio cholerae from the
aquatic environment. Appl Environ Microbiol. 2002; 68(2):995–998. [PubMed: 11823252]
Chowdhury MAR, Hasan JAK, et al. DVC-DFA: A simplified technique for detection of viable Vibrio
cholerae O1 and O139. Can. J. Microbiol. 1994; 42:87–93. [PubMed: 8595602]
Chun J, Huq A, et al. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and
Vibrio mimicus. Appl Environ Microbiol. 1999; 65:2202–2208. [PubMed: 10224020]
Clesceri, L.; Greenberg, A., et al., editors. Amer Pub Health Assoc. 1998. Standard methods for the
examination of water and wastewater.
Colwell R. Viable but non-culturable bacteria in the aquatic environment. Culture. 1991; 12:1–4.
Huq et al. Page 43
Colwell, R.; Tamplin, M., et al. Sack, RB.; Zinnaka, Y. Advances in Research on Cholera and Related
Diarrhoeas. Tokyo: K.T.K. Scientific Publishers; 1990. Environmental aspects of Vibrio cholerae
in transmission of cholera; p. 327-343.
Constantin de Magny G, Murtugudde R, et al. Environmental signatures associated with cholera

epidemics. Proc Nat Acad Sci. 2008; 105(46):17676–17681. [PubMed: 19001267]
Dallas W, Falkow S. Amino acid sequence homology between cholera toxin and Escherichia coli heat-
labile toxin. Nature. 1980; 288:499–501. [PubMed: 7003397]
Gubala A, Proll D. Molecular-Beacon Multiplex Real-Time PCR Assay for Detection of Vibrio
cholerae. Appl Environ Micbrobiol. 2006; 72(9):6424–6428.
Gubala AJ. Multiplex real-time PCR detection of Vibrio cholerae. J Microbiol Methods. 2006; 65(2):
278–293. [PubMed: 16153727]
Haley BJ, Chen A, et al. Vibrio cholerae in an Historically Cholera-Free Country. Environ Microbiol
Rep. 2012 In press.
Hasan J, Huq A, et al. Development and testing of monoclonal antibody-based rapid
immunodiagnostic test kits for direct detection of Vibrio cholerae O139 synonym Bengal. J Clin
Microbiol. 1995; 33(11):2935–2939. [PubMed: 8576349]
Hasan, J.; Loomis, L., et al. 92nd Gen Mtg Am Soc Microbiol. New Orleans, LA, USA: 1992.
Development of a fast, simple, and sensitive immunoassay to detect Vibrio cholerae O1 from
clinical samples using SMART™ Kit.
Hasan JAK, Bernstein D, et al. Cholera DFA: An improved direct fluorescent monoclonal antibody
staining kit for rapid detection and enumeration of V. cholerae O1. FEMS Microbiol Lett. 1994;
120:143–148. [PubMed: 8056287]

Heidelberg, J. Vibrio/Photobacterium, Vibrio vulnificus, Vibrio cholerae/Vibrio mimicus, and Vibrio
cincinnatiensis associated with zooplankton in the Choptank River, Maryland. Ph.D. thesis.
University of Maryland College Park; 1997. Seasonal abundance of bacterioplankton populations
of Bacteria, gamma proteobacteria.
Heidelberg J, Heidelberg K, et al. Seasonality of Chesapeake Bay bacterioplankton species. Appl
Environ Microbiol. 2002; 68(11):5488–5497. [PubMed: 12406742]
Hoshino K, Yamasaki S, et al. Development and evaluation of a multitest PCR assay for rapid
detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol Med Microbiol. 1998;
20(3):201–207. [PubMed: 9566491]
Huq A, Colwell R, et al. Detection of Vibrio cholerae O1 in the aquatic environment by fluorescent
monoclonal antibody and culture method. Appl Environ Microbiol. 1990; 56(8):2370–2373.
[PubMed: 2206100]
Huq, A.; Grim, C., et al. Taylor, R. Current Protocols in Microbiology. New York: John Wiley &
Sons; 2006. Detection, Isolation, and Identification of Vibrio cholerae from the Environment; p.
6A.5.1-6A.5.38.
Huq A, Sack R, et al. Critical Factors Influencing the Occurrence of Vibrio cholerae in the
Environment of Bangladesh. Appl Environ Microbiol. 2005; 71(8):4645–4654. [PubMed:
16085859]
Huq, A.; Small, EB., et al. Vibrios in the Environment. New York, New York: John Wiley & Sons;
1984. The role of plantonic copepods in the survival and multiplication of Vibrio cholerae in the
aquatic environment; p. 521-534.
Islam M, Rahman M, et al. Organization of the CTX prophage in environmental isolates of Vibrio
mimicus. Microbiol Immunol. 2005; 49(8):779–784. [PubMed: 16113506]
Kaper, J.; Morris, J., et al. Tenover, F. DNA probes for infectious diseases. Boca Raton, FL: CRC
Press; 1988. DNA probes for pathogenic Vibrio species; p. 65-77.
Kenyon JE, Piexoto DR, et al. Seasonal variations of Vibrio cholerae (non-O1) isolated from
California coastal waters. Appl Environ Microbiol. 1984; 47(6):1243–1245. [PubMed: 6742842]
Kogure K, Simidu U, et al. A tentative direct microscopic method for counting living marine bacteria.
Can. J. Microbiol. 1979; 25:415–420. [PubMed: 378340]
Lizarraga-Partida ML, Wong-Chang I, et al. Vibrio cholerae O1 and non-O1 in two coastal lagoons of
Veracruz, Mexico. In preparation.
Huq et al. Page 44
Louis V, Russek-Cohen E, et al. Predictability of Vibrio cholerae in Chesapeake Bay. Appl Environ
Lyon WJ. TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139 in pure
cultures, raw oysters, and synthetic seawater. Appl Environ Microbiol. 2001; 67(10):4685–4693.
[PubMed: 11571173]
Malayil, L.; Turner, JW., et al. Vibrios in the Environment. Biloxi, MS: 2010. Novel Reservoirs of the
CTX gene.
Monsur K. A highly selective gelatin-taurocholate-tellurite medium for the isolation of Vibrio
cholerae. Trans R Soc Trop Med Hyg. 1961; 55:440–442. [PubMed: 14475439]
Morris G, Merson M, et al. Comparison of four plating media for isolating Vibrio cholerae. J Clin
Murray M, Thompson W. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res.
1980; 8:4321–4325. [PubMed: 7433111]
Nandi B, Nandy R, et al. Rapid method for species-specific identification of Vibrio cholerae using
primers targeted to the gene of outer membrane protein OmpW. J. Clin. Micro. 2000; 38(11):
4145–4151.
O'Brien M, Colwell RR. Modified taurochalate-tellurite-gelatin agar for imporved differentiation of
Vibrio species. J Clin Microbiol. 1985; 22(6):1011–1013. [PubMed: 3934207]
Onifade TJ, Hutchinson R, et al. Toxin producing Vibrio cholerae O75 outbreak, United States, March
to April 2011. Euro Surveill. 2011; 16(20):19870. [PubMed: 21616048]
Pal A, Ramamurthy T, et al. Reassessment of the prevalence of heat-stable enterotoxin (NAG-ST)
among environmental Vibrio cholerae non-O1 strains isolated from Calcutta, India, by using a
NAG-ST DNA probe. Appl Environ Microbiol. 1992; 58(8):2485–2489. [PubMed: 1514795]
Rawlings TK, Ruiz GM, et al. Association of Vibrio cholerae O1 El Tor and O139 Bengal with the
Copepods Acartia tonsa and Eurytemora affinis. Appl Environ Micbrobiol. 2007; 73(24):7926–
7933.
Rehnstam A-S, Norqvist A, et al. Identifcation of Vibrio anguillarum in fish by using partial 16S
rRNA sequences and a specific 16S rRNA oligonucleotide probe. Appl Environ Microbiol. 1989;
55:1907–1910. [PubMed: 2782871]
Rennels M, Levine M, et al. Selective vs. nonselective media and direct plating vs. enrichment
technique in isolation of Vibrio cholerae: recommendations for clinical laboratories. J Infect Dis.
1980; 142(3):328–331. [PubMed: 7003031]
Roszak D, Colwell R. Survival strategies of bacteria in the natural environment. Microbiol Rev. 1987;
51(3):365–379. [PubMed: 3312987]
Sack R, Siddique A, et al. A 4-Year Study of the Epidemiology of Vibrio cholerae in Four Rural Areas
of Bangladesh. J Infect Dis. 2003; 187:96–101. [PubMed: 12508151]
Schuster BM, Tyzik AL, et al. Ecology and genetic structure of a northern temperate Vibrio cholerae
population related to toxigenic isolates. Appl Environ Microbiol. 2011; 77(21):7568–7575.
[PubMed: 21926213]
Spira W, Huq A, et al. Uptake of Vibrio cholerae biotype eltor from contaminated water by water
hyacinth (Eichornia crassipes). Appl Environ Microbiol. 1981; 42(3):550–553. [PubMed:
7294788]
Turner JW, Good B, et al. Plankton composition and environmental factors contribute to Vibrio
seasonality. ISME J. 2009; 3(9):1082–1092. [PubMed: 19421235]
White P. The characteristic hapten and antigen of rugose races of cholera and El Tor vibrios. j Pathol
Bacteriol. 1940; 50:160–164.
Xu HS, Roberts N, et al. An indirect fluorescent antibody staining procedure for detection of Vibrio
cholerae serovar O1 cells in aquatic environmental samples. J. Microb. Methods. 1984; 2:221–
231.
Xu HS, Roberts NC, et al. Survival and viability of nonculturable Escherichia coli and Vibrio cholerae
in the estuarine and marine environment. Microbiol Ecol. 1982; 8:313–323.
Huq et al. Page 45
Figure 1.
Flowchart of methods (protocols) used to detect and/or isolate and characterize V. cholerae
from the environment.
Huq et al. Page 46
Figure 2.
Simple plankton net (Aquatic Research Instruments, Hope, ID, USA). The net is comprised
of a metal ring and bridle, a heavy-duty nylon net of variable mesh size, and a PVC cod-end
or collecting bucket which can be removed for easy sample collection. A flow meter may be
mounted in the mouth of the net to the metal ring to measure volume when the net is towed.
Huq et al. Page 47
Figure 3.
Growth of V. cholerae O1 on (A) TCBS, (B) TTGA, (C) CHROMagar Vibrio, courtesy of
Dr. Munir Alam, International Center for diarrheal Disease Research, Bangladesh. [*Color]
Huq et al. Page 48
Figure 4.
Results of PCR assays used to detect and characterize V. cholerae. Lane 1, Hyperladder IV
(Bioline); lane 2, V. cholerae-specific ITS; lane 3, ctxA (pCTA); lane 4, tcpA of V. cholerae
O1 Classical, lane 5, tcpA of V. cholerae O1 El Tor; lane 6, tcpA of V. cholerae O139; lane
7, toxR; lane 8, zot; lane 9, ompU; lane 10, O1-O139/ctxA multiplex of V. cholerae O1 and
O139.
Huq et al. Page 49
Figure 5.
Real-Time PCR amplification curves of V. cholerae spiked in fliter sterilized water.
[*Color]
Huq et al. Page 50
Figure 6.
Fluorescent In-Situ Hybridization (FISH) image of V. cholerae cells under epifluorescence
microscopy. [*Color]
Huq et al. Page 51
Figure 7.
DFA staining of V. cholerae O1 using the CholeraDFA Kit (New Horizon Diagnostics). (A)
Fresh culture; (B) VBNC cells; (C) and (D), DVC-incubated cells. [*Color]
Huq et al. Page 52
Table 1
Overview of Methods Presented in This Unit for Isolation and Detection of V. cholerae.
Protocol Included methodology Protocol ID

Specimen collection and transportation. Basic Protocol 1
Isolation of presumptive V. Conventional bacteriological culture method for V. cholerae Basic Protocol 2
cholerae and confirmation,
Alternate method for presumptive identification Alternative Protocol 1
using traditional methods
Serogroup determination Basic Protocol 3
Preparation of DNA templates and confirmation of suspected or Support Protocol 1 and

presumptive V. cholerae by PCR Basic Protocol 4
Molecular methods for detection
Real Time PCR Basic Protocols 6 and 7
of V. cholerae Isolates
Colony blot hybridization with labeled DNA or RNA hybridization Basic Protocol 9
probes
Molecular methods for direct Fluorescence In Situ Hybridization (FISH) Basic Protocol 10
detection of V. cholerae in Direct PCR Basic Protocol 8
environmental samples
Direct detection and/or Direct Fluorescent Antibody – Direct Viable Count (DFA-DVC) Basic Protocol 11
enumeration of V. cholerae
using immunological methods Indirect Fluorescent Antibody (IFA) method Basic Protocol 12
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Table 2
V. cholerae positive control strains.
Year of
Huq et al.
Strain Serogroup Serotype Biotype Source Isolation

V. cholerae NCTC 8457 O1 Inaba El Tor Clinical case (pilgrim en route to Mecca) from a quarantine station in El Tor (Al-Tur), Egypt 1930
V. cholerae MAK 757 O1 Ogawa El Tor Clinical case from Makassar, Celebes Islands, a coastal region (now Sulawesi, Indonesia) 1937
V. cholerae N16961 O1 Inaba El Tor Clinical case from Bangladesh 1975
V. cholerae 2010EL-1786 O1 Ogawa El Tor Clinical case from Artibonite Department, Haiti 2010
V. cholerae NCTC 569B O1 Inaba Classical Clinical case in India 1948
V. cholerae O395 O1 Ogawa Classical Clinical case from India 1964
V. cholerae LMG 4406 non-O1/non-O139 NA Albensis Fish isolate from the Elbe River, Germany 1896
V. cholerae 26 non-O1/non-O139 NA NA Environmental isolate from Santa Cruz, CA, USA (Pacific Ocean) 1983
V. cholerae MO45 O139 NA NA Clinical isolate from Madras, India 1992
Page 53
Huq et al. Page 54
Table 3
PCR targets and primers for V. cholerae.
Target Primer Sequence (5’-3’) Amplicon Ref.

pVC-F2 TTAAGCSTTTTCRCTGAGAATG
ITS 295-310 (Chun, Huq et al. 1999)
PVCM-R1 AGTCACTTAACCATACAACCCG
PCTA-94F CGGGCAGATTCTAGACCTCCTG
ctxA 563 (Fields, Popovic et al. 1992)
PCTA-614R CGATGATCTTGGAGCATTCCCAC
pToxR-101F CCTTCGATCCCCTAAGCAATAC
toxR 778 (Rivera, Chun et al. 2001)
pToxR-837R AGGGTTAGCAACCGATGCGTAAG
pTcpA-72F CACGATAAGAAAACCGGTCAAGAG 452
tcpA pTcpAET-477R CGAAAGCACCTTCTTTCACGTTG 621 (Keasler and Hall 1993)
pTcpACL-647R TTACCAAATGCAACGCCGAATG
PZot-225F TCGCTTAACGATGGCGCGTTTT
zot 946 (Rivera, Chun et al. 2001)
PZot-1129R AACCCCGTTTCACTTCTACCCA
pOmpU-80F ACGCTGACGGAATCAACCAAAG
ompU 868 (Rivera, Chun et al. 2001)
pOmpU-906R GCGGAAGTTTGGCTTGAAGTAG
VCT1 ACAGAGTGAGTACTTTGACC
ctxA 308 (Hoshino, Yamasaki et al. 1998)
VCT2 ATACCATCCATATATTTGGGAG
O1F2-1 GTTTCACTGAACAGATGGG
O1-rfb 192 (Hoshino, Yamasaki et al. 1998)
O1R2-2 GGTCATCTGTAAGTACAAC
O139F2 AGCCTCTTTATTACGGGTGG
O139-rfb 449 (Hoshino, Yamasaki et al. 1998)
O139R2 GTCAAACCCGATCGTAAAGG
ompW-F CACCAAGAAGGTGACTTTATTGTG
ompW 588 (Nandi, Nandy et al. 2000)
ompW-R GAACTTATAACCACCCGCG
CtxA-F CTCAGACGGGATTTGTTAGGCACG (Shirai, Nishibuchi et al. 1991; Nandi, Nandy et al.

ctxA 302
CtxA-R TCTATCTCTGTAGCCCCTATTACG 2000)
16S 16S-F CAGCMGCCGCGGTAATWC

888 (Amann, Ludweg et al. 1995)
rDNAa 16S-R ACGGGCGGTGTGTRC
a
Currently, there are no published 23S rDNA PCR primers specific for V. cholerae.
Huq et al. Page 55
Table 4
Real-Time PCR primers and probes.
Primer/Probe/Beacon Name Sequence Ref

hylA-probe FAM-TCAACCGATGCGATTGCCCAAGA-TAMRA 1
hylA-F-primer TGCGTTAAACACGAAGCGAT (Lyon, 2001)
hylA-R-primer AAGTCTTACATTGTGCTTGGGTCA
MBrtxA CGCGATCACCAGAGCGCCAAGAAGTGACTCGTAGATCGCG 2
MBepsM CGCGATGCCACCGACATCGTAACGCTCCGATCGCG 3
(Gubala and Proll, 2006)
MBompW CCGAAGAAACAACGGCAACCTACAAAGCTTCGG 4
MBtcpA CGCGACGCTGAAACCTTACCAAGGCTGACCAAGTCGCG 5
1
The TaqMan V. cholerae-specific probe is an oligonucleotide with a 5’reporter dye (FAM-6-carbooxyfluorescein) and a 3’quencher dye
(TAMRA-6-carboxy-N’N’N’N’-tetramethylrhodamine).
2
FAM (6-carboxyfluorescein) fluorophore and Dabcyl quencher
3
Texas Red fluorophore and BHQ2 quencher
4
Cy5 fluorophore and BHQ3 quencher
5
Cy3 fluorophore and BHQ2 quencher
Huq et al. Page 56
Table 5
Common problems that may be experienced in performing the basic and alternate protocols from this unit
Basic Protocol 1
Check pore size of plankton net and ensure that it is 64 mm.

Zooplankton should be sampled near dawn or dusk (1-2 hr after sunrise or before
Little or no plankton in cod-end collecting bucket
sunset) when they are nearer to the surface.
Filter more water through plankton net.
Basic Protocol 2
Adjust dilution volumes and/or incobation temperature.

No V. cholerae growth
Incubate petri dishes at several temperatures
V. cholerae overgrowth Adjust dilutions or use a smaller volume loop to spread onto agar
Basic Protocol 3
Autoagglutination or clumping in saline without “Rough” morphotypes cannot be serogrouped with anitsera. Use O1/O139 rfb PCR
antisera primers with Basic Protocol 4 to test for toxigenic serogroups.
Support Protocol 1
Low DNA concentration Increase volume of boiled cells
Basic Protocol 4
Ensure all components are added to reaction at the proper concentration.

Use fresh dNTPs.
Prepare fresh crude template of positive control as it will degrade over time.
No PCR product with positive control
Dilute crude template 1:5000 or more and repeat the control reaction.
Quantify crude template by gel electrophoresis (~10 ml) to ensure sufficient
template concentration.
PCR product with negative control Most likely caused by carry-over contamination in one of the reaction components.
Make new components.
Basic Protocols 6 and 7

Use fresh dNTPs.

Weak amplification with positive control
Strong amplification with negative control Most likely caused by carry-over contamination in one of the reaction components.
Basic Protocol 8
Positive control is negative Ensure solutions used are RNase-free.
Huq et al. Page 57
Basic Protocol 1
Increase incubation time of lysis step (10% SDS), especially if colonies are larger
than 3 mm.
Ensure that the correct microscope filter is used for fluorochrome selected. (Other
fluorochromes may be used.)
Check scanning settings on detection instrument.

Positive control gives weak signal
Increase probe concentration and/or hybridization time.
Alternate Protocol 3
Ensure that solutions are used in correct order.

Overexposure to UV source will degrade DNA template. Consider using positively
Positive control is negative or weak charged nylon membranes, which do not need crosslinking.
Extend hybridization time.
Extend development time.
Check hybridization temperature.

Positive control is overdeveloped or background is
Do not allow membrane to dry.
high
Decrease development time.
Basic Protocol 9
Positive control from Alternate Protocol 3 is negative Check efficiency of probe labeling reaction.
or weak Increase probe concentration (≤ 25 ng/ml)
Basic Protocol 10
Increase probe concentration

Weak Fluorescence Check hybridization temperature
Increase hybridization time
Nonspecific Staining Perform more stringent wash step
Basic Protocol 11

Use fresh dNTPs.
No PCR product with positive control
PCR product with negative control Most likely caused by carry-over contamination in one of the reaction components.
Basic Protocol 11
Ensure that the proper filter set is used on fluorescent microscope.

Positive control is negative Bengal DFA (V. cholerae O139) kit positive control is sometimes poor. Prepare
positive control from laboratory reference strain.
Basic Protocol 12
Huq et al. Page 58
Basic Protocol 1
Positive control signal is weak Increase amount of V. cholerae O1 antiserum and FITC conjugate.

Nihms 399807

Uploaded by

Copyright:

Available Formats

Nihms 399807

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Nihms 399807

Uploaded by

Copyright:

Available Formats

NIH Public Access

Curr Protoc Microbiol. 2012 August ; CHAPTER: Unit6A.5. doi:10.1002/9780471729259.mc06a05s26.

Detection, Isolation, and Identification of Vibrio cholerae from

zooplankton blooms facilitate increases in V. cholerae density. Furthermore, an infectious

To evaluate the presence of these organisms regardless of their culturability, a direct

CAUTION: V. cholerae is a Biosafety Level 2 (BSL-2) pathogen. Follow all appropriate

ISOLATION AND IDENTIFICATION OF V. CHOLERAE USING TRADITIONAL

isolation to ensure their viability and purity.

BASIC PROTOCOL 1: Specimen Collection and Transportation

To collect water sample

To collect Sediment Sample

2. Sample a sediment–water interface with a wide-bore serological pipette and put in

To Collect Shellfish—Shellfish collection in many areas is regulated by local or state

Transportation and/or processing

BASIC PROTOCOL 2: Conventional Bacteriological Culture Method

difficult to distinguish V. cholerae from V. parahaemolyticus on this medium, therefore,

Sterile oyster knife (Dexter-Russell, Inc., MA, USA)

Sample Processing—Note: If not specified, assume APW is 1X APW.

If oyster knife is autoclavable it can be wrapped in aluminum foil and sterilized at

Selective plating post-APW enrichment

ALTERNATE PROTOCOL 1: Bacteriological Culture Method for Situations of Limited

by heating in an oven at 170°C for 1 to 2 hours. If it is not possible to procure autoclavable

hours at 35°C or 48 to 72 hours at room temperature.

BASIC PROTOCOL 3: Serogroup Determination

Phosphate buffered saline (PBS)

2. Add a loopful of fresh growth (6–16 hr subculture on non-selective media) into

MOLECULAR METHODS FOR DETECTION AND IDENTIFICATION OF V.

Identification and characterization of Suspected or Presumptive V. cholerae Isolates by

SUPPORT PROTOCOL 1: Preparation of crude DNA template by boiling

from a fresh agar plate.

into a boiling water bath for 10 min.

20 µM PCR primers (Table 3)

Power supply for gel apparatus

total reaction volume of 25-µl, containing the following.

Perform Agarose Gel Electrophoresis and Visualize Results

ctxA F and R primers

0.25-pmol/µl ctxA (ctxA-F, -R) primers

9. Destain the gel 15 min in distilled water.

PCR amplification buffer, 10X (APPENDIX 2A)

2. Amplify the targets with the following cycle conditions:

35 cycles: 1 min at 94°C (denaturation)

Real-Time PCR for Detection of V. cholerae—DNA-based methods such as PCR

BASIC PROTOCOL 6: TaqMan assay for detection of V. cholerae (Lyon 2001)

10X TaqMan buffer A

dATP, dCTP, dGTP, and dUTPs

Initial denaturation: 5 min at 94°C

values of 38 to 40 are considered weak reactions with little or no target nucleic

0.08 µM each rtxA primers;

35 cycles (multiplex assay): 30 sec at 60°C

3. Results are interpreted using designated computer software. As with the

BASIC PROTOCOL 8: Direct PCR for Environmental Samples

Filter membranes, 47-mm diameter, 0.22-µm pore size

Phenol/chloroform/isoamyl alcohol (25:24:1)

Power supply for gel apparatus

Collection and concentration of environmental sample—For water and plankton

DNA extraction using phenol, chloroform, and isoamyl alcohol

11. Transfer aqueous phase (supernatant) to a new microcentrifuge tube. Precipitate

Quick DNA extraction

Perform Direct PCR