Plus 2 Biology QPs For Practice-10 Sets - 240318 - 125932

HSE II – MODEL QUESTION PAPER: SET 1
Time: 2 Hours
Maximum: 60 Scores BIOLOGY Cool-off Time: 15 minutes
Maximum: 30 Scores PART A: Botany Time: 1 Hour
I. Answer any 3 questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

1. Choose the correct answer and fill in the blank.
....................... is the female gametophyte of angiosperms.
(a) Embryo sac (b) Nucellus (c) Integument (d) Pollen grain
2. Name the type of interaction between an Orchid plant and Mango tree.
3. Net Primary Productivity (NPP) = …………...
4. Which group of enzymes are known as ‘molecular scissors’?
5. Plants, bacteria, fungi and animals whose genes have been altered by manipulation are called ……………
II. Answer any 9 questions from 6 – 16. Each carries 2 scores. (9 x 2 = 18)
6. The innermost wall layer of Microsporangium is Tapetum.
(a) What is its function?
(b) Write two features of Tapetal cells.
7. Explain the separation of DNA fragments using gel electrophoresis.
8. Write notes on:
(a) Microinjection (b) Biolistics
9. Define:
(a) Apomixis (b) Polyembryony
10. Field survey by a team of students recorded the following data related to number of organisms in an ecosystem
and plotted that into a figure shown below:
Observe the figure and explain the pyramid.

11. Observe the diagram and answer A and B.
12. (a) Define transgenic animals.

(b) Write any two uses of transgenic animals.
1
13. Humification and Mineralization occur during decomposition in the soil. Write the difference between these two
processes.
14. Given below in the diagram showing the transfer of pollen grains.
(a) Identify P1 & P2 with technical terms.

(b) Critically evaluate P1 & P2.
15. Observe the equation.
dN K−N
= rN ( )
dt K
(a) Which type of growth curve does it represents?
(b) What do the following notations represent?
i. N ii. r iii. K
16. (a) Construct a Grazing Food Chain (GFC) using the following organisms:
Bird, Grass, Grasshopper
(b) Write the trophic level of grasshopper.
III. Answer any 3 questions from 17 – 20. Each carries 3 scores. (3 x 3 = 9)
17. Raman is learning the post fertilization changes of an angiosperm embryo sac with the help of slides. He identified
the egg nucleus and polar nuclei with the help of his teacher.
(a) Name the other nuclei present in the embryo sac.
(b) Help Raman by giving the changes that takes place with egg nucleus and polar nucleus after fertilization.
18. Density of a population fluctuates due to changes in four basic processes.
(a) Complete the diagram by adding the points A B C and D.
(b) Explain A and D.
19. (a) What is meant by gene therapy?

(b) Briefly explain the reason for ADA deficiency disorder.
(c) Mention a treatment method for ADA deficiency.
20. Amplification of gene of interest is done using PCR.
(a) Expand PCR.
(b) Mention the three steps of this process.
(c) What are primers?
Click Here for Answers

2
Maximum: 30 Scores PART B: Zoology Time: 1 Hour
I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

1. The theory which states that the units of life were transferred to different planets including earth is .....................
2. Identify the odd one out. Justify your answer.
UAA, AUG, UAG, UGA
3. The regions with very high species richness, high degree of endemism but most threatened is
(a) Sacred groves (b) Hotspots (c) National parks (d) Sanctuary
4. Which of the following is cytokine barrier?
(a) Neutrophil (b) Lysozymes (c) Mucus (d) Interferons
5. Note the relationship between the first two words and fill up the fourth place.
LNG-20: Hormone releasing IUD Multiload 375: ………………..
II. Answer any nine questions from 6 – 16. Each carries 2 score. (9 x 2 = 18)
6. Given below are the steps of experiments conducted by Frederick Griffith. Complete the remaining steps.
• S-strain → Inject into mice → Mice die
• R-strain → Inject into mice → Mice live
• .............................
• ..............................
7. Correct the false statements given below (consider the words underlined).
a. Progesterone level is increased during proliferative phase.
b. Menopause is the first menstruation in the life of a woman.
8. To find out the unknown genotype of violet flowered pea plant, a researcher done the following cross. Observe the
diagram and answer the following questions.
a. What would be the above cross is called?

b. Can you determine the unknown genotype of violet flowered parent by drawing Punnett square?
9. “Chromosomal theory of inheritance was proved through several dihybrid crosses using fruit flies (Drosophila
melanogaster).”
a. Who conducted this experiment?
b. Why did he select Drosophila as the experimental material? (Any three reasons).
10. Diagram shown below is a surgical method used for male sterilization.
a. Name the method shown in the diagram.

b. What is the surgical method of female sterilization called?
c. What are the advantages of condoms over this method? (Any two).
3
11. “More and more children in metro cities of India suffer from allergies and asthma.” Justify this statement.
12. Metastasis and lack of Contact inhibition are two properties of cancer cells. What do you understand by these two
terms?
13. Government of India legalised MTP in 1971 with some strict conditions to check illegal female foeticides.
a. What is MTP?
b. Mention any two importance of MTP.
14. Arrange the following in hierarchical manner based on the period of their evolution.
Homo erectus, Ramapithecus, Australopithecus, Homo sapiens, Neanderthal man, Dryopithecus, Homo habilis
15. Observe the diagram shown below.
a. Identify the diagram. b. Label A, B & C.

16. Fill the columns A & B using the words given below.
A B
Evolution by anthropogenic action
Darwin’s finches
Genetic drift
Inheritance of acquired characters
(Lamarckism, Development of DDT resistant ants, Gene flow by chance, Adaptive radiation, de Vries)
III. Answer any 3 questions from 17 – 20. Each carries 3 score. (3 x 3 = 9)
17. Steps of DNA fingerprinting are shown below.
a. Complete the flow chart given below and answer the following questions.
b. Mention the principles behind the DNA fingerprinting.

c. DNA fingerprinting is a gift to forensic science. Do you agree? Give reason.
18. “Placenta is a structural and functional unit between foetus and maternal body”.
a. Name the foetal and maternal parts that are interdigitated to form placenta.
b. Why it is considered as structural and functional unit? (Any 2 reasons).
c. Placenta also acts as an endocrine gland. Do you agree? Justify.
19. Match the column A with column B.
A B
a. ZZ-ZW mechanism i. 21 Trisomy
A B
b. I I ii. Male homogamety
c. Flower colour in snap dragon iii. Point mutation
d. Haemophilia iv. Co-dominance
e. Sickle cell anaemia v. 45 chromosomes
f. Turner’s syndrome vi. Sex-linked recessive
vii. Incomplete dominance
20. Gopalan cultivated a variety of fruit crops and plants in his field and Raman destroyed the fruit crops and plants
and cultivated rubber trees which are double in number.
a. In your opinion, which method is suitable for the ecosystem? Give reason.
b. Mention any three factors that lead to the extinction of species.
Click Here for Answers

4
Time: 2 Hours

1. Name the first transgenic cow that produces human protein enriched milk.
2. Name the principle which states that two closely related species competing for the same resources cannot co-exist
indefinitely and the competitively inferior one will be eliminated eventually.
3. The first discovered restriction endonuclease is ……………………
m
4. Vertical distribution of different species occupying different levels is called ……………………
5. Microsporangium is surrounded by four wall layers. Name the layer which nourishes developing pollen grains.
co
6. Bt. Cotton is a well-known example of application of Biotechnology in Agriculture. Bt. Cotton reduces use of
pesticides. Explain.
y.
7. Anitha is studying about a circular DNA which has the following sequence.
5’ → GGAATTCC → 3’
3’ → CCTTAAGG → 5’
og
She wishes to add a new segment of DNA into it.
a. Identify the technology she planned.
b. Suggest the specific enzyme to make a cut in the DNA with above sequence.
8. Adenosine deaminase (ADA) deficiency is a hereditary disease where ADA which is crucial for functioning of
ol
immune system is absent. Explain how ADA deficiency can be treated.
9. Density of a population in a given habitat during a given period fluctuates due to changes in 4 basic processes-
bi
Natality, Mortality, Immigration & Emigration.

a. Differentiate Natality and Mortality.
b. Differentiate Immigration & Emigration.
of
10. Match the following:

A B
nk
Pollen Monocarpellary
Monoecious Diploid
Endosperm Embryo sac
Female gametophyte Haploid
ba
Male & female flower

on same plant
Triple fusion
11. Pond is a self-sustainable unit. Some organisms related to pond ecosystem is listed below:
Tadpole, fish, water, plants, kingfisher
a. Construct a food chain with the listed organisms.
b. Point out trophic level of each organism in the constructed food chain.
12. Two students, Unni and Kannan studied inter-specific interactions between different species. Can you help them
by naming the interaction between species in different cases?
Case number Species A Species B
1 + +
2 - -
3 + -
4 + 0
13. The given figure represents the reactions associated with PCR.
01
a. Expand PCR.
b. Name the steps A, B, C in the process.
m
co
14. Correct the following statements considering the underlined part.
a. Ovary develops into seed.
b. In flowering plants, zygote is formed inside the microsporangium.
c. Ovules develop into fruit.
y.
d. Primary endosperm cell (PEC) develops into embryo.
15. Population growth may be exponential or logistic. Differentiate between them.
og
16. Given below a schematic representation with circles and squares which shows four factors/processes influence the
population density. Write the factors in circles and squares.
ol
bi
of

17. (a) While learning trophic levels in class-room, teacher asked you to explain ‘standing crop’. Explain.
(b) Distinguish between mutualism and parasitism. Give one example for each.
nk
18. Raju is a diabetic patient who takes insulin injections regularly. The insulin used by such patients is produced by
genetically engineered organisms. Write different steps involved in the production of insulin by genetic
engineering.
ba
19. Three different flowers are given.

(i) Maize (ii) Vallisneria (iii) Rose
a) Group them based on pollinating agents.
b) Mention one adaptation of each flower related with the agents of pollination.
20. Diagram shows a typical agarose gel showing migration of DNA fragments.
a. Which of the bands has largest and smallest DNA fragments?

b. How can you make fragments of DNA for electrophoresis?
c. Explain separation of DNA fragments using electrophoresis.
👉 Click Here for Answers

02

1. The gene flow by chance causing change in frequency is called .......................
2. Name the process of differentiation of spermatids to spermatozoa.
3. Ovulation occurs on ……………… of the Menstrual cycle.
(a) 10th day (b) 14th day (c) 1-5th day (d) 15-28th day
4. Who popularized the term Biodiversity?
5. Swiss cheese has large holes due to production of CO2 by a bacterium called …………………
Answer any 9 questions from 6 – 16. Each carries 2 scores. (9 x 2 = 18)
6. a) Expand BAC and YAC.
m
b) Mention any two salient features of human genome.
7. Observe the figure given below:
co
y.
(a) Identify the disorder and its genetic constitution.
og (b) Write any two symptoms of this disorder.
ol
8. (a) “Microbes can be used for energy purposes”. Do you agree? Justify.
(b) Name any two microbes used as biofertilizers.
bi
A B
Ringworms Interferon
of
Cytokine barriers Helper T-cells

Oncogenes Trichophyton
HIV Cancer
nk
10. Observe the diagram given.

ba
a. Identify the molecule. Which cell produces this?

b. Mention its importance.
11. (a) Briefly explain the theory of Abiogenesis.

(b) Who experimentally disproved this theory?
12. Write down the single word for the following.
a. Blastocyst becomes embedded in the endometrium.
b. Mammary glands produce milk towards the end of pregnancy.
c. Cap-like structure at the tip of sperm head.
d. Yellow-coloured structure developed from ruptured Graafian follicle after ovulation.
13. Expand: (i) GIFT (ii) ICSI
14. Distinguish between divergent evolution and convergent evolution.
03
15. Write down any 4 salient features of genetic code.
16. To find out the unknown genotype of violet flowered pea plant, a researcher done the following cross. Observe the
diagram and answer the following questions.
a. What would be the above cross is called? Define it.

b. Mention its significance.
Answer any 3 questions from 17 – 20. Each carries 3 scores. (3 x 3 = 9)
m
17. Understanding the warning signs of drug/alcohol abuse is important to save the people in Adolescence period.
a. Mention any three such warning signs.
b. Mention any three ways for prevention and control of drug/alcohol abuse.
co
18. T.H Morgan conducted some experiments using Drosophila melanogaster and made important observations
regarding linkage and recombination.
a. Define linkage and recombination.
y.
b. Mention his any two conclusions from this experiment.
19. (a) Mention any two examples for co-extinction.
(b) Biodiversity (species richness) is highest in tropics. Give any two reasons.
(c) Define the term hotspots.
og
20. (a) Prepare a flowchart showing the Central Dogma of Molecular Biology.
(b) Name the initiator codon and the amino acid coded by it.
ol
bi
of
nk
ba
04
Time: 2 Hours

1. Note the relationship between first two words and fill up the fourth place.
Number of births in the population during a given period: Natality
Number of deaths in the population during a given period: ………………
2. The capacity to generate a whole plant from any cell/explant is called …………...
3. Restriction enzymes belong to a larger class of enzymes called nucleases. These are of two kinds such as …………
and …………….
4. Label the parts A and B in the given figure.
5. Expand the abbreviation GPP.

6. Consider pond as an ecosystem showing the number of individuals in the following categories.
Carnivores- 2500, Producers- 15000, Herbivores- 5000
a. Draw the pyramid of numbers in this ecosystem.
b. Comment on the energy flow in the ecosystem.
7. Genetically Modified Organism (GMO) is always a debatable topic among scientists, academicians and public. State
any four advantages of GMOs.
8. A picture showing transverse section of a young anther is given below. Label A to D.
9. Bt toxin is produced by Bacillus thuringiensis that can kill certain insects.

a. Name the bacterial gene that is producing this toxin.
b. Why the toxin produced by the bacterium is non-toxic to it?
10. Ecological pyramids are usually upright. Meanwhile some pyramid of biomass is inverted. Explain the reason.
11. What is Biopiracy? Explain with an example.
12. Population interactions may be beneficial or harmful. Briefly explain any two interactions with examples.
13. After fertilization in flowering plants, seeds bearing embryos are found inside the fruits.
a. Name the parts that give rise to embryo and fruits.
b. What is the thick wall of the fruit that is protective in function called?
14. Distinguish between GFC and DFC.
15. Recombinant DNA technology can be accomplished only if we have the following key tools i.e. Restriction enzymes.
Polymerase enzyme, Ligases and Vectors.
State the functions of (a) Ligases (b) Restriction enzymes
16. Briefly explain Brood parasitism in birds.
01
17. (a) One of the speakers in the National Children’s Science Congress delivered a talk about Transgenic animals.
Explore any 2 benefits of transgenic animals.
(b) Expand ELISA.
18. Transfer of pollen grains from the anther to the stigma of a flower is called pollination. Grass plants generally have
small, inconspicuous flowers while plants belonging to many angiosperm families bear conspicuous coloured
flowers.
a. Comment on the type of pollination taking place in these two groups.
b. What are the salient features present in these two groups for effective pollination?
19. Given below is the bar diagram showing age structure of three different populations. Observe the diagram carefully
and answer the following questions.
a. Identify the types of populations A, B and C.

b. Give a brief account of age pyramids.
20. The below picture shows cloning vector pBR322.
a. What is ori? Mention its importance.

b. How does the insertion of foreign DNA at Bam HI site select?
c. How many cloning sites are depicted in this vector as shown in the figure?
02

1. Observe the diagram below:
5’ ATTCG 3’
Which among the following is the complimentary sequence of the DNA fragment shown above?
a. 5’ → ATTCG → 3’ b. 3’ → ATTCG → 5’
c. 3’ → TAAGC → 5’ d. 3’ → CGAAT → 5’
2. One among the contraceptive method is peculiar. Find the odd one. What is common among others?
a. Periodic abstinence b. Coitus interruptus
c. Lactational amenorrhea d. IUDs
m
3. The process of fusion of a sperm with ovum is called ………….
4. Which of the following is not a Mendelian disorder?
Colour blindness, Down’s syndrome, Haemophilia, Thalassemia
co
5. Identify the disease shown in the following figure and write the causative organism of the disease.
y.
og
ol
II. Answer any nine questions from 6 – 16. Each carries 2 scores. (9 x 2 = 18)
6. The sequence of template strand of a gene is given below.
bi
3’ CACGTGGACTGAGGACTCCTC 5’
Construct the base sequence of mRNA transcribed from this.

of
7. a) Arrange the given chemical compounds in the sequential order as per the concept of origin of life.
(Ammonia, Hydrogen, Protein, Nucleic acid, Amino acid)
nk
b) Correlate Miller’s experiment with this.

8. Make pairs by putting the related items together stating their relationship.
Monascus purpureus, Trichoderma polysporum, Ethanol, Blood clot,
ba
Streptokinase, Statin, Saccharomyces cerevisiae, Cyclosporine

9. The treatment facility advertised in the brochure of a private clinic is shown below.
IVF ZIFT GIFT IUI
a. Can you suggest what type of clinic it is?
b. Expand any three of them.
10. Lakshmi and Sujitha are two nursery students. Sujitha gets common cold very often. Lakshmi not.
a. How do you interpret this in an immunological aspect?
b. What are the common barriers protecting Lakshmi from cold?
11. A bacterial infection was effectively controlled by using a specific antibiotic for a long time. But now- a- days this
antibiotic is not found to be so effective to control the said infection. Give a scientific explanation for this
phenomenon based on evolution.
12. After analyzing the karyotype of a short statured round headed person with mental retardation, a general physician
noticed an addition of autosomal chromosome.
16
Answer the following questions.
a. Addition or deletion of chromosome generally results in………………….
b. What may be the possible syndrome or disorder the above person should suspected to be?
c. Suggest two more morphological peculiarities to confirm the chromosome disorder in that person.
13. Analyzing the relationship among different columns, fill the gap appropriately.
Salmonella typhi (a) High fever, constipation
Rhinovirus Common cold (b)
(c) (d) Recurring fever and chill
14. A couple has 2 daughters. The blood group of husband and wife is ‘O’.
a. What are the possible blood groups the children should have?
b. Whether any change in blood group will occur if they have two sons instead of daughters?
Substantiate your answer.
15. It is evident that, it is the genetic make-up of the sperm that determine the sex of the child in human beings.
m
Substantiate.
16. The below graph shows the levels of ovarian hormones in a normally menstruating woman during the follicular
co
phase.
a. Name a & b.
y.
og
b. Mention the role of pituitary hormones in maintaining this condition.

ol
17. a) Draw a flowchart showing the process of spermatogenesis. (2)

b) What is meant by Spermiation? (1)
bi
18. Categorize the given birth control methods into three groups with proper heads.
Cervical caps, Vasectomy, CuT, Tubectomy, Diaphragms, Condoms, Lippes loop

of
19. “Biodiversity is the rich variety of life that makes our world a thriving and beautiful tapestry of different plants,
animals, and ecosystems, working together in harmony.”
nk
a. Point out the levels of diversity in nature. (1)

b. Give a brief description about “The Evil Quartet.” (2)
20. In a paternity dispute, the VNTR DNA samples of parent and child were DNA fingerprinted.
The diagrammatic representation of the DNA fingerprint is shown below.
ba
a. What is your opinion about the paternity of child? Substantiate your opinion. (1)
b. List down any four major steps of molecular biological procedures adopted for this. (2)
17
Time: 2 Hours

1. Fill up the blanks with appropriate terms in the given pyramid of trophic level:
2. Observe the relation in the first pair and fill up the blank in the second.
Cry I Ac: Control cotton bollworm ……………….: Control corn borer
3. Fill up the blanks after reading the statement:
The post fertilization events in angiosperms.
Zygote : Embryo
Ovule : ………………
Ovary : ………………
4. Sucker fish and shark live in close association is a classic example of ……………….
5. In PCR, repeated amplification is achieved by the use of a thermostable DNA polymerase isolated from a bacterium
called .....................
6. Population interactions:
Case Species x Species y Species z
1 + + 0
2 0 - +
3 - + -
Where ‘+’ beneficial interaction
‘-‘ detrimental interaction
‘0’ neutral interaction
Observe the interactions of populations of 3 species as shown in the table. Name the interactions between:
a. Species x and species y in case 1
b. Species y and species z in case 2
c. Species x and species z in case 3
d. Species y and species z in case 1
7. Pre-fertilization events of sexual reproduction in all organisms are gametogenesis and gamete transfer. What are
the post fertilization events?
8. Observe the sketch of stirred-tank bioreactor and label the parts A, B, C and D.
01
9. Briefly explain Somatic hybridisation.
10. Emasculation and Bagging are two steps of a crop improvement program called Artificial hybridisation. Explain
them.
11. Observe the cloning vector and explain the following:
a. ori b. rop
12. Biotechnology has important application in the field of Molecular Diagnosis. Justify with two examples.
13. a) Define Verhulst-Pearl Logistic Growth.
b) Write the equation to describe this.
14. What is meant by competition in population interaction? Give one example.
15. Define the terms: (a) Trophic level (b) Food web.
16. Briefly explain the processes fragmentation and leaching.
17. Plus Two students of a school on their study tour collected flowers showing the following character:
1) Flowers are with light pollen grains
2) Colourful flowers
3) Nectar producing flowers
4) Flowers with feathery stigma
a. Arrange the characters under different pollination groups in the given table.
b. Write the name of 2 flowers pollinating through water.
Entomophilous flowers Anemophilous flowers
……………………… ………………………
……………………… ………………………
……………………… ………………………
18. a) Mention any two features that are required to facilitate cloning into a vector.
b) Since DNA is a hydrophilic molecule, it cannot pass through cell membranes. So bacterial cells are made
‘competent’ to take up alien DNA or plasmid. Prepare a flowchart showing the steps of this process.
19. (a) Rani wrote name of the following organisms in her notebook. Arrange the terms in a food chain sequence.
Man, hen, earthworm, mango-tree
(b) Explain food chain and name the types of food chain.
A B
(a) Agrobacterium Tissue culture
(b) Eli Lilly Rosie
(c) Transgenic cow RNA interference
(d) Bio-piracy Insulin
(e) Micropropagation GMO
(f) Bt Cotton Basmati rice
02

1. Note the relationship between first two terms and suggest a suitable term for the fourth place.
a. Sperm: Seminiferous tubules Ovum: ……………
b. Progesterone: Corpus luteum HCG: ……………
2. Given are two unlabelled diagrams depicting invertebrate and vertebrate diversity. What do A and B stand for?
3. Select the Assisted Reproductive Technique that uses an early embryo with up to 8 blastomeres.
a. ZIFT b. IUT c. GIFT d. IUI
4. Name the phenomenon where both phenotypic and genotypic ratios are found to be same.
5. Expand SNPs.
II. Answer any nine questions from 6 – 16. Each carries 2 score. (9 x 2 = 18)
6. Symbols used in human pedigree analysis and their meanings are provided in the table. Fill the blanks with suitable
symbols or meanings.
Symbols Meanings
a. …………………
b. ………………. Female
Mating
c. ………………….
d. …………………. Affected male
7. Observe the graph given.
a) What do A and B stand for?

b) Mention one function A and B.
8. A DNA molecule which contains most of its nitrogen in the form of 15N is allowed to replicate in a medium
containing the nitrogen source 14N.
a. What will be the percentage of DNA strands that contain 15N after 2 rounds of replication?
b. Who conducted this experiment and what conclusion they reached from this experiment?
Methanobacterium Immunosuppressant
Monascus purpureus Cholesterol lowering agent
Bacillus thuringiensis Biogas
Trichoderma polysporum Biological control
Biofertilizer
10. A list of human diseases is given below. Categorize them into distinct groups with suitable titles.
Ascariasis, Typhoid, Diphtheria, Malaria, Pneumonia, Amoebiasis, Elephantiasis
11. Raju had lost his mother at birth. He is unhealthy and prone to diseases easily. In his doctor’s opinion, Raju’s ill
health is due to lack of drinking mother’s milk. How will you justify the doctor’s opinion in the light of your
knowledge of immunity?
12. Central dogma of molecular biology is given in the diagram.
03
a. What do A, B and C stand for?
b. In which organisms, the central dogma is reversed?
13. Certain facts related to a human disorder are given.
• It is an inborn error in metabolism.
• It is inherited as an autosomal recessive trait.
• The affected person is mentally retarded.
a. Name the disorder.
b. What are the physiological processes behind this mental retardation?
14. A genetic cross is represented below.
a. Identify the given cross and mention the ratio.

b. Elaborate upon the significance of such a cross.
m
15. Mention any four factors that affect Hardy-Weinberg equilibrium.
16. Some terms related to biodiversity conservation are given. Arrange these terms under two suitable headings.
co
Biosphere reserves, National parks, Zoological parks, Wildlife sanctuaries, Cryopreservation of gametes, Seed
banks, Botanical gardens, Sacred groves
y.
17. Diagram shown below is a surgical method used for female sterilization.
og
a. Name the surgical method and mention how it works.
b. Mention one advantage and one disadvantage of this
method.
c. Name two contraceptives that can be used as emergency
ol
contraceptives.
18. Observe the diagram provided and identify the process.

bi
a. Label A, B, C and D.
of
b. Why are gametes produced haploid even though the

gamete mother cells are diploid?
nk
19. Given below is the diagram of a replication fork drawn by a student.
a. Redraw the diagram correctly and label it.

ba
b. Why does discontinuous synthesis of DNA occur in

one strand?
20. Observe the diagrammatic representation and answer the questions:
a. Explain the phenomenon shown in the figure.

b. How can it be considered as evidence of
evolution?
c. Write any other example for this phenomenon.
Explain.

04
Time: 2 Hours

1. In Maize, the chromosome number present in the meiocyte is 20. Give the number of chromosomes present in
the following:
a. Maize pollen b. Maize endosperm
2. DNA fragments can be seen as bright orange-coloured bands when they are stained with ………………. and exposed
to UV radiation.
3. Of the incident solar radiation, less than 50% is ……………….
4. Expand GEAC.
5. The expansion of distributional range of a species when the competing species is removed is called ……………….
6. Raju went to a Rice Research station on his study tour. There he noticed a scientist working on rice plants using
scissors and forceps. To his surprise he saw the scientist covering the inflorescence with paper bags.
a. Name the techniques the scientist was doing.
b. Give the purpose of these techniques.
7. Observe the diagram given below:
a. What does the given picture indicate?

b. In this process, three steps occur simultaneously. Name them.
8. In human beings, certain diseases are caused due to genetic disorders.
a. Name the method that allows the correction of a gene defect that has been diagnosed in a child or embryo.
b. How this method has been used for treating ADA (Adenosine deaminase) deficiency?
9. Infection by nematodes causes threat to cultivation and yield loss of tobacco plants. A strategy has been developed
at RNA level to control this infestation.
a. Name the process.
b. Explain how this process works at the molecular level.
10. What is meant by bioreactors? Name the most commonly used type of bioreactors.
11. In a marine ecosystem, a population of phytoplankton (150,000) supports a standing crop of fishes (40,000).
a. Draw the pyramid of biomass and
b. The pyramid of numbers in this ecosystem.
01
12. Observe the diagram of enlarged view of a microsporangium showing wall layers. Label A, B, C & D.
13. Rashid isolated a natural plasmid from a bacterium and planning to facilitate cloning. What are the minimum
requirements for considering the isolated plasmid as a vector?
14. Predators in nature are ‘prudent’. Explain.
15. Briefly explain Connell’s field experiments.
16. Pond performs all the functions of an ecosystem. Justify.
17. Copy the picture given below and mark the following:
a. Hilum b. Funicle c. Micropylar pole d. Nucellus e. Embryo sac f. Chalazal pole

18. Interspecific interaction arises from the interaction of populations of two different species. If we assign + for
beneficial, - for detrimental and 0 for neutral interactions, copy and complete the following chart.
Species A Species B Name of interaction
………………. ………………. Mutualism
- - ……………….
………………. ………………. Commensalism
………………. ………………. Amensalism
+ - ……………….
19. Restriction endonucleases are the enzymes used to cut the DNA molecules.
a. Give the general terms for the specific sequences where these enzymes cut the DNA.
b. Name the enzyme that joins the foreign DNA and vector DNA.
c. Give any two procedures to introduce the recombinant DNA into the host cell.
20. (a) What are the three critical research areas of biotechnology?
(b) Mention three options that can be thought for increasing food production.
02

1. Note the relationship between the first pair and complete the second pair.
a. Natural selection: Darwin Inheritance of acquired characters: ………………
b. Heart of vertebrates: Homologous organs Flippers of Penguin and Dolphin: ……………….
2. Choose the odd one from the following and write the common features of others.
a. Estrogen b. Androgen c. Relaxin d. Progesterone
3. Identify the diagram and write how it acts.
4. Expand the abbreviation UTRs.

5. Morphine is extracted from latex of ……………….
6. Complete the table using suitable terms.
Turner’s syndrome (a)………… Sterile female
(b) ………… 44A+XXY (c) …………
(d) ………… Trisomy 21 Mental retardation
7. In pea plant the gene for yellow seed colour is dominant over green and round seed shape is dominant over
wrinkled. Write the four types of gametes formed in a heterozygous pea plant with yellow and round seeds (YyRr).
8. Arrange the following diseases in the following columns in a meaningful order.
Typhoid, Ringworms, Amoebiasis, AIDS, Malaria, Pneumonia, Common cold
Bacterial Viral Protozoan Fungal
9. A transcription unit is given below. Observe it and answer the questions.
a. How can you identify the coding strand?

b. Write the sequence of RNA formed from this unit.
10. In a class room discussion, a student argues that allergic reactions are more common in children of metro cities
than in villages.
a. Do you agree with this statement?
b. Which type of immunoglobulin is responsible for allergic reactions?
c. Suggest two drugs which reduce allergic symptoms.
11. Match the columns B & C with respect to A.
A B C
Monascus purpureus Streptokinase Antibiotic
Streptococcus Statin Immune suppressant
Penicillium notatum Cyclosporine A Clot buster
Trichoderma polysporum Penicillin Cholesterol lowering agent
12. Some stages of the embryonic development are given below. Observe these diagrams and answer the questions.
03
a. What is A & B?
b. Which layer of blastocyst is attached to the endometrium? Name that process.
13. Distinguish between euchromatin and heterochromatin.
14. (a) State Hardy-Weinberg principle.
(b) What is meant by founder effect?
Duration Phases of menstrual cycle
1-5th day Ovulatory phase
5-13th day Menstrual phase
14th day Luteal phase
th
15-28 day Follicular phase
16. A collection of peppered moths made in England during different period is given below.
Years
Types of moths
1850 1920 1980
White winged moth 1200 305 1150
Dark winged moth 315 1100 302
a. What is your observation?
b. Name the evolutionary process behind this phenomenon.
c. Write the reason for decreased number of white winged moth in 1920.
17. The first child of a couple is affected with phenylketonuria. During the second pregnancy they visited a genetic
counsellor and he prepared a pedigree chart of their family.
a. What is pedigree analysis?
b. Draw the symbols for
i. Normal male ii. Affected female iii. Sex unspecified iv. Consanguineous mating
18. In E. coli, lactose catabolism is controlled by Lac operon. Lac operon in the absence of inducer (lactose) is given.
a. What is ‘P’?
b. Name the enzymes produced by the structural genes
‘Z’, ‘Y’ and ‘a’.
c. Redraw the diagram in the presence of an inducer.
19. “STIs present a major health concern in both industrialized and developing countries.”
a. What do you mean by STIs?
b. Name two STIs.
c. Suggest two preventive measures.
20. The given graph shows the distribution of insects in different latitudes of earth.
a. What is your observation?

b. List the three reasons for greater biodiversity in
tropical regions.
c. Write two causes of biodiversity losses.

04
Time: 2 Hours

1. A date palm seed discovered during archeological investigation retained viability even after 10000 years. The
retention of viability is due to the state of inactivity of embryo called ……………….
2. Sequences of base pairs in DNA that reads the same on both the strands when the orientation of reading is kept
the same are called ………………. sequences.
3. In a given habitat, the maximum number possible for a species is called ………………. of that species in that habitat.
4. Name a source of pest resistant gene.
5. Observe the following food chain:
What is this type of food chain called?

(9 x 2 = 18)
II. Answer any 9 questions from 6 – 16. Each carries 2 scores.
6. Using genetically modified crops, farmers can minimize use of insecticides and pesticides during cultivation.
a. Give name of one such genetically modified pest resistant crop.
b. Which gene is used for its production?
c. Write about its mode of action.
7. In large number of plants, pollination is carried out by insects. List four characters of flowers that help insect
pollination.
8. EcoRI is a restriction endonuclease. What do E, Co, R, I represent?
9. The following graph shows two types of pollution growth curves.
a. Name the growth curves.

b. What does K stand for?
10. Given number of individuals in a grass land ecosystem.
Grasshopper – 1500 Grass – 5,842,000 Wolf – 28 Birds – 215
a. Draw a pyramid of numbers showing various trophic levels.
b. Explain trophic level.
11. Nita found that her grandma used to inject human insulin that is genetically engineered. She wants to know how such
insulin can be produced. Give her an idea about structure of insulin and production of genetically engineered insulin.
12. In rice, the chromosome number present in the meiocyte is 24. Give the number of chromosomes present in the
following. Justify your answer.
a. rice pollen b. rice endosperm
13. How can we make a host cell competent to receive a foreign gene or DNA?
14. Rate of biomass production is called productivity and it can be divided into GPP and NPP.
01
a. Define GPP and NPP. b. How can we relate GPP and NPP?
15. Humification leads to accumulation of a dark-coloured amorphous substance. Identity the substance and its
peculiarities.
16. Differentiate natality and mortality. Write the alphabets used to indicate natality and mortality.
III. Answer any 3 questions from 17 to 20. Each carries 3 scores. (3 x 3=9)
17. Students involved in nature club activity found some inter-specific interactions between organisms in a garden
area. They made a table of interaction giving ‘+’ for beneficial interaction, ‘-‘ for detrimental and ‘0’ for neutral
interaction.
Species A Species B
i. + +
ii. - -
iii. + 0
iv. - 0
a. Give name of interaction in each case.
b. Explain how parasitism differs from predation.
c. Give the significance of species interaction.
18. (a) Match the Column A with Column B.
Column A Column B
(a) Human Alpha lactalbumin (1) ELISA
(b) Molecular diagnostics (2) Eli Lilly
(c) Genetically engineered Insulin (3) Corn Borer
(d) Cry I Ab (4) Rosie
(5) Boll Worm
(b) What is the principle of ELISA?
19. Identify the following figure and label A to E.
20. While studying nucleotide sequence, Raj found that following sequence which can be recognized by some enzymes:
5’ – GAATTC – 3’
3’ – CTTAAG – 5’
a. Give salient features of this sequence.
b. Write name of enzymes which recognize such sequences.
c. Elaborate importance of this enzyme in Genetic engineering.
02

1. The implanted stage during embryonic development is
a. Gastrula b. Morula c. Zygote d. Blastocyst
2. Select the initiation codon from the triplet codons given below:
a. AAA b. AUG c. GUA d. UGA
3. Pick out the odd one giving reason.
a. HIV b. Haemophilia c. Genital warts d. Hepatitis B
4. The scientist who proposed Rivet Popper Hypothesis is ………………….
5. Expand the following terms:
a. MALT b. NACO
II. Answer any 9 questions from 6-16. Each carries 2 scores. (9 x 2=18)
6. When the urine sample of a lady was tested, presence of HCG was found.
a. Expand HCG.
b. What does the presence of HCG indicate?
c. Which is the source of HCG?
7. CuT is a contraceptive device.
a. Suggest the contraceptive action of CuT.
b. Name the hormone releasing IUDs.
8. As part of a dispute of parentage, the Court put an order to conduct a test for proving the father of the child.
a. Name the test used.
b. Procedure of the test is given below. Complete it.
i. Isolation of DNA
ii. DNA is cut using restriction endonuclease
iii. …………………
iv. …………………
v. Hybridisation using VNTR probe
vi. ………………….
9. Observe the figure given below:
a. Identify the figure.

b. How many histone molecules are present in the histone core?
c. Distinguish Euchromatin and Heterochromatin.
10. Distinguish Darwinian variation and Mutational variation. (Any 4 differences).
11. State whether the following statements are true or false. If false, rewrite them by changing the word underlined.
a. Double helical model of DNA was proposed by Jacob and Monod.
b. Sugar present in RNA is Ribose.
c. Introns are the coding sequences of a eukaryotic gene.
d. DNA replication occurs by semi-conservative method.
12. During a monohybrid cross involving a tall pea plant, the offspring population were tall and dwarf in equal ratios.
Work out a cross to show it is possible.
13. Stanley Miller set up an experimental apparatus as shown below.
03
a. Which theory was proven by this experiment?
b. State that theory and name the scientists who proposed it.
14. Read the principle and answer the questions:
“Allele frequencies in a population are stable and is constant from generation to generation.”
a. Name the principle mentioned here.
b. Mention any three factors that affect the equilibrium.
15. In an E. coli culture, lactose is used as food instead of glucose.
a. How do the bacteria respond to the above situation at genetic level?
b. If lactose is removed from the medium, what will happen?
16. (a) Expand STDs.
(b) A person has earlier symptoms of STDs. What will happen if he/she does not consult a doctor? (Mention
any two consequences).
17. Blood of a man is tested positive for cannabinoid.
a. What are these?
b. Mention any 4 ill-effects of alcoholism.
18. The diagrammatic representation of a process in bacteria is given below:
a. Identify the process.

b. Name the enzyme involved in this process.
c. Explain the three major steps in this process.
19. Mention and explain three arguments of the reasons for biodiversity conservation.
20. (a) Mention any two properties of an ideal contraceptive.
(b) Categorise the given birth control methods into two groups under proper headings.
Cervical caps, vasectomy, diaphragms, condoms, tubectomy
04
Time: 2 Hours

1. After syngamy and triple fusion in embryo sac, embryo will be diploid and ……………… will be triploid.
2. Natural interlinked food chains are called ……………….
3. Fill in the blank:
Alpha I-antitrypsin is used to treat the disease ...............
4. Write the name of technique used to remove the DNA from the gel.
5. Note the relationship of first pair and fill up the blank suitably.
Mortality: No. of deaths in the population during a given period.
……………….: No. of births in the population during a given period.
6. Write any three parts of a monocot embryo and write one peculiarity of each of these three parts.
7. A list of organisms is given. Place them in different trophic levels.
Grass, Man, Fishes, Birds, Lion, Grasshopper, Zooplankton, Trees
8. Name the interaction between sea anemone and clown fish. Justify your answer with suitable explanation.
9. How does the inactive protoxin of Bacillus thuringiensis gets converted into active toxin when an insect ingests it?
10. Synergids have a special cellular thickening at micropylar tip. Write the name of name and function of the structure.
11. A biologist studied the population of rats in a barn. He found that the average natality was 250, average mortality
240, immigration 20 and emigration 30. Calculate the net increase in population with suitable explanation.
12. Given below is a data showing number of individuals and dry weight of different trophic levels in a grassland
ecosystem. Construct,
a. Pyramid of number.
b. Pyramid of biomass.
Number of
Trophic level Dry weight (Kg m-2)
individuals
Primary producer 5,842,000 809
Primary consumer 7,08,000 37
Secondary consumer 3,54,000 11
Tertiary consumer 3 1.5
13. Many countries encourage the cultivation of Genetically Modified Crops (G. M. Plants). Write any two advantages
of GM plants.
14. Match the items of column A with B:
A B
(a) Cloning Vector (i) Bioreactor
(b) Separation of DNA fragments (ii) Taq polymerase
(c) PCR (iii) Electrophoresis
(d) Converts raw materials into (iv) Hind II
specific products (v) pBR322
15. Pyramid of energy is never been inverted. Why?
16. Restriction endonuclease recognises a specific sequence in the DNA. Name that sequence and write its peculiarity.
17. Read the statements below and identify the mode of interaction between the species.
01
a. Tiger eating deer
b. Butterfly feeding pollen
c. Human liver fluke feed on snail
d. Lice on humans
e. Orchid attached to a tree
f. Mycorrhizal association of fungi and roots of higher plants
g. Sparrow eating seed
h. Egrets foraging close to cattle
18. A novel strategy to prevent nematode manifestation is based on ‘RNA interference’.
a. Explain RNA interference.
b. Can you suggest how it can be used for producing nematode resistant plant?
19. Observe the diagram given below:
a. Identify the diagram and the parts A, B and C.

b. Briefly explain the applications of this technique.
20. Flowering plants evolved an array of adaptations to achieve pollination.
a. Explain 3 types of pollination.
b. Illustrate pollination in Vallisnaria.
02

1. Observe the relationship between first pair and write the missing one.
Menstrual phase: 1-5th day Ovulatory phase: ……………….
2. Name the non-steroidal, once in a week pill developed by CDRI.
3. In a DNA sample, adenine is 22%. Find out the percentage of guanine.
4. Name the confirmatory test for typhoid fever.
5. According to Global estimate of ………………., about 7 million species would have on earth.
a. Robert May b. David Tilman c. Edward Wilson d. Alexander von Humboldt
II. Answer any 9 questions from 6-16. Each carries 2 scores. (9 x 2=18)
6. (a) Complete the flow chart.
(b) What is the role of LH in female reproductive system?

7. India achieved a lot in reproductive health through RCH programme.
a. Expand RCH.
b. Write any 2 objectives of RCH programme.
8. Haemophilia is more common in males than in females. Justify.
9. Two Pedigree charts are given below. Name the types of genetic traits shown in A& B and give suitable example
for each.
10. Name the schematic structure and label A, B& C:
11. (a) Expand the term HGP.

(b) Name the two methodologies of HGP.
12. p2+2pq+q2=1 is a binomial expression regarding an evolutionary principle.
a. Name the evolutionary principle.
b. Name any two factors affecting this evolutionary principle.
13. Name 2 examples for evolution due to anthropogenic action.
14. Fill in the blanks:
03
15. In sewage treatment plants, the Secondary treatment is also known as biological treatment. Write the steps
involved in it.
16. When we move towards polar regions from tropical regions there is a gradual decrease in biodiversity. Give two
reasons for this.
17. Placenta act as a physiological connection between mother and foetus.
a. Write any 2 functions of Placenta other than hormone secretion.
b. Name the placental hormones.
18. Fill the columns appropriately.
19. Diagram of lac operon is given:
a. Name the inducer of lac operon.

b. Redraw the lac operon in presence of inducer.
20. (a) Carcinogens are cancer causing agents. Write different types of carcinogens.
(b) What is meant by metastasis?
04
Time: 2 Hours

1. Some type of Orchids lives on the branches of mango trees. The relationship between mango tree and Orchid is an
example of
a) Mutualism b) Predation c) Commensalism d) Parasitism
2. In flowering plants, double fertilization occurs during reproduction. One of the events of double fertilization is triple
fusion. Name the other event.
3. Identify palindrome sequence from the following.
5’- GAATTC -3’ 5’- ATCG -3’ 5’- AAAAA -3’ 5’- CCCCC -3’
a) b) c) d)
3’- CTTAAG -5’ 3’- TAGC -5’ 3’- TTTTTT -5’ 3’- GGGGG -5’
4. Which of the following is a detritivore?
a) Earthworm b) Virus c) Fox 4) Cow
5. Biotechnology in agriculture leads to pest resistant plants, which could decrease the amount of pesticides used.
For example, Bt cotton. Expand the letters ‘B‘ and ‘t’.
6. Given diagram shows an important process in biotechnology.

b. Some of the events of this process are given below. Arrange them in correct order:
i. Cut out DNA bands
ii. Expose to UV
iii. Force DNA to move through gel
iv. Stain DNA with ethidium bromide
7. Explain the equation GPP – R = NPP.
8. A diagram of LS of a flower showing growth of pollen tube is given below. Label A to D.
01
9. Match the column A with column B:
A B
a) C peptide HIV
b) ADA deficiency Insulin
c) PCR Bone marrow transplantation
d) Transgenic mice Basmati
Vaccine safety
10. Among many, there are two core techniques that enabled birth of modern biotechnology. Name and briefly explain
them.
11. Flowers are classified into Chasmogamous and Cleistogamous flowers.
a. Cleistogamous flowers are autogamous. Justify.
b. Define autogamy.
12. What is meant by Resource partitioning? Explain with an example.
13. A given species may occupy more than one trophic level in the same ecosystem at the same time. Justify this
statement with suitable example.
14. Prey species have evolved a variety of defense mechanisms to lessen the impact of predation. Mention any four of
them.
15. Analyze the following diagram showing the representation of age pyramids for human population. All items are
mislabeled. Correct them.
16. Expand short forms used in Biotechnology.

A) PCR B) ELISA C) GEAC D) GMO
17. Isolation of the Genetic Material (DNA) is the first step of recombinant DNA technology. Give an outline about this
process.
18. Seeds have many advantages in terms of survival and reproduction. Explain.
19. (a) The pyramid of biomass in sea is generally inverted. Give reason.
(b) What are the limitations of ecological pyramids?
20. (a) Describe the terms (i) Totipotency (ii) Micropropagation
(b) Mention any two advantages of tissue culture.
02

1. Z-values of a frugivorous bat species are given below. Which value is not applicable to continents?
(a) 0.6 (b) 0.65 (c) 0.2 (d) 0.68
2. Which of the following combinations do not apply to DNA?
(a) Deoxyribose, Guanine (b) Ribose, Adenine
(c) Deoxyribose, Uracil (d) Guanine, Thymine
(1) (a) and (b) (2) (b) and (c) (3) (c) and (d) (4) (a) and (d)
3. Select the odd one out and justify your selection.
Malaria, Cancer, Amoebiasis, Filariasis
4. Feeding in the first few days is essential for preventing infections in a newly born baby. Why?
5. Which of the following pairs of STDs is completely curable?
(a) HIV, Hepatitis-B (b) Hepatitis-B, Gonorrhea
(c) Syphilis, Gonorrhea (d) Chlamydomonas, genital-herpes
6. Distinguish in situ conservation from ex situ conservation with one example each.
7. (a) The following table shows the F, generation of a dihybrid cross. Identify the ‘Phenotype’ with homozygous
recessive genotype. Find out A : B : C : D.
No. Phenotype No. of offspring (F2)
1. A 21
2. B 7
3. C 63
4. D 21
(b) State Mendel’s Law of Segregation.
8. LH and FSH are gonadotrophins. Distinguish their roles in males and females.
9. Examine the following fragment of beta globin chain in human haemoglobin and identify the hereditary disease
with reason.
10. What are the advantages of biofertilizers over chemical fertilizers? Give an example for biofertilizer.
11. The diagram shown below represents the operation of natural selection on different traits. Observe the diagrams
and answer the following.
a. The graph C shows a marked difference from graph A. why?

b. What is the evolutionary significance of directional selection?
03
12. Examine the diagram of mRNA given below. Mark the 5’ and 3’ ends of the mRNA by giving reasons.
13. Morphine is said to be an abused drug. Discriminate the terms ‘use’ and ‘abuse’ of drugs based on this example.
14. Differentiate Active immunity from Passive immunity. Give an example for Passive immunity.
15. What would happen if both strands of the DNA act as template for transcription?
16. Schematic representation of gametogenesis is given below. Identify A and B. Write one difference between A & B.
17. One couple came to know that they have a girl child during 4th month of pregnancy and they decide to do MTP.
a. Expand and define MTP.
b. At which stage of pregnancy is MTP relatively safe?
c. How will you respond to the decision of female foeticide by the couple?
18. In an E. coli culture lactose is used as food instead of glucose. If so, answer the following questions:
(a) How do the bacteria respond to the above situation at genetic level?
(b) If lactose is removed from the medium what will happen?
19. Examine the pictures of Darwin’s Finches given below and answer the following questions:
(a) What phenomenon in evolution is represented in the picture?

(b) Explain the phenomenon with the help of an additional example.
20. Some genetic abnormalities, their genotypes and features are distributed in columns A, B and C respectively.
Match them correctly.
A B C
Down’s syndrome 44 A + XO Rudimentary ovary and sterility
Furrowed tongue and partially
Turner’s syndrome 44 A + XXY
opened mouth
Klinefelter’s syndrome 45 A + XX/XY Gynecomastia and sterility
04
Time: 2 Hours

1. The density of population in a given habitat increase or decrease due to different reasons. Name two
factors responsible for increase in population in a given area.
2. The rate of biomass production in an ecosystem is called productivity. They are of 2 types, gross
primary productivity and net primary productivity. How these productivities are related?
3. From the following, select the two having haploid chromosome number.
a. Egg b. Endosperm c. Zygote d. Pollen
4. Which among the following is a selectable marker in pBR322?
a. Ori b. Hind III c. ampR d. rop
5. Give two examples for cry genes.
6. A list of different organisms in an ecosystem is given below. Arrange them in 1st, 2nd, 3rd and 4th trophic level.
i. Phytoplankton ii. Man iii. Fish iv. Zooplankton
7. In many grasses, seeds are formed only after fertilization. There are reports that in some grasses, seeds are formed
without fertilization. Explain the phenomenon.
8. What is stratification? Explain with example.
9. (a) Identify the picture A and B.
(b) What is meant by the terms syncarpous and apocarpous?

10. Imagine you are appointed as biotechnologist in a National Institute. What are the basic steps to be designed to
produce a genetically modified organism? (Hint: 3 points)
11. (a) In a pond, there were 30 lotus plants last year and through reproduction 14 new plants are added. Calculate
birth rate.
(b) Besides birth rate, mention any two attributes of a population.
12. Alpha-I antitrypsin and alpha-lactalbumin are two biological products produced from transgenic animals. Write the
uses of these two products.
13. Use of a thermostable DNA polymerase from the bacterium, Thermus aquaticus, made it possible to generate billion
copies of DNA in a very short time using a process.
a. Name the process.
b. Name the three important steps involved in this process.
01
14. Parasitism is a type of interspecific interaction where one (parasite) is benefitted and the other (host) is harmed.
Explain two types of parasites with examples.
15. Name the following:
a. A nematode that infects the roots of tobacco plants.
b. A cellular defense mechanism in all eukaryotes that was used as a novel strategy to prevent this infestation.
c. A vector used to introduce nematode-specific genes into the host plant.
d. Mobile genetic elements used as a source of complementary RNA for RNAi.
16. Analyze the given graphical representation.
a. Identify the curves C1 and C2.

b. Write down the equations E1 and E2.
17. The discovery of Restriction Endonuclease is considered as a milestone in the history of genetic engineering.
a. Which is the first discovered restriction endonuclease?
b. What are the criteria for naming of restriction endonuclease?
18. In plants, the developmental stages of male gametes consist of microsporogenesis and male gametophyte. Arrange
the following terms in their correct developmental sequence.
Pollen grain
Sporogenous tissue
Anther
Microspore tetrad
Pollen mother cell
Male gamete
19. Although biotechnology offers many benefits to humans, it also raises some ethical issues.
a. Explain any two ethical issues regarding application of biotechnology.
b. State any two steps taken by the Government of India to overcome such problems.
20. (a) What are decomposers? Give two examples.
(b) Suggest another name for decomposers.
(c) Briefly explain action of decomposers on their food.
02

1. Which of the following do not have similar sex chromosomes (Homogametic)?
(a) Human female (b) Drosophila female (c) Bird female (d) Bird male
2. Which among the following does not belong to Assisted Reproductive Technology?
(a) ICSI (b) IUD (c) IUT (d) GIFT
3. Note the relationship between the terms of first pair and fill up the fourth place.
Prokaryotes: Polycistronic structural gene Eukaryotes: ……………….
4. Which of the following sets of gases were used in Miller’s experiment?
(a) CH4, NO2, H2O, CO2 (b) NH3, NO2, H2O, H2 (c) H2, CH4, NH3, H2O (d) H2O, N2, CH4, H2
5. Diagram of mammalian sperm is given. Label the marked parts.
6. Symptoms of some diseases are given below. Identify the diseases.
a. Chill and high fever recurring every 3-4 days.
b. Internal bleeding, muscular pain, blockage of intestinal passage.
c. Chronic inflammation of the limbs, deformity of limbs and genital organs.
d. Dry, scaly lesions on skin, nails, scalp etc. Intense itching.
7. One of your neighbors is suffering from itching, fluid discharge, slight pain and swelling in genital region.
a. What do you think the disease he is suffering from?
b. What measures are to be taken to prevent such disease?
8. Distinguish between homologous and analogous organ with one example for each.
9. (a) Mention any two desirable features of a better contraceptive method.
(b) Write any two advantages of Saheli over conventional contraceptive pills.
10. Briefly explain the steps of processing of hnRNA in eukaryotes to form mRNA.
11. “Gopalan argues that if father is of ‘A’ blood group, mother is of ‘B’ blood group. Their children can only be ‘A’
group, ‘B’ group or ‘AB’ group.”
a. Do you agree with Gopalan’s argument?
b. Give reason for your answer.
12. a) Complete the flowchart of chromosomal disorders by filling the blank boxes (A and B).
Aneuploidy
Trisomy of sex
………(A)……….
chromosome
XXY XO
Tuner’s
………(B)……….
Syndrome
b) What is aneuploidy?
13. Read carefully the sequence of codons in the mRNA unit and answer the questions.
03
a. What change is needed in the first codon to start the translation process?
b. If translation starts by that change, till which codon it can continues? Why?
14. BOD of some water samples are given below:
A. Sample 1 - 200 mg/L
B. Sample 2 - 80 mg/L
C. Sample 3 - 300 mg/L
D. Sample 4 - 25 mg/L
a. Which of the above water sample is most polluted?
b. What is meant by flocs? What is its role in sewage treatment?
15. Observe the diagram and answer the questions:
a. Identify the process shown in the figure and

define it.
b. Identify the structure B. Write any one function
of it in the process shown in the diagram.

A B
a. Natural selection (1) Convergent evolution
b. Inheritance of acquired
(2) Genetic drift
characters
c. Analogous structures (3) Charles Darwin
d. Gene flow by chance (4) Lamarckism
17. “Nature provides all for the need of man but not for his greed.”
a. Do you agree with this statement? Justify your answer.
b. There are 3 categories of reasons for conservation of biodiversity. Mention them.
18. Observe the diagram, and answer the questions:
a. Identify A and B.
b. What is the function of C?
c. In which of the marked part reduction division
takes place? What is the significance of it?
19. “Prediction of the sequence of amino acids from the nucleotide sequence in mRNA is very easy, but the exact
prediction of the nucleotide sequence in mRNA from the sequence of amino acids coded by mRNA is difficult.”
a. Which properties of the genetic code is the reason for above condition? Explain.
b. AUG has dual functions. What are they?
20. Prepare a pamphlet for an awareness programme in your school about the measures to prevent and control alcohol
and drug abuse in adolescents.

04
Time: 2 Hours

1. By observing the relationship of the first pair fill up the blanks:
GFC: Producers and consumers DFC: Dead organic matter and ……………….
2. The size of a population is not static. Which of the following leads to decrease in population?
a) Natality & Mortality b) Mortality & Emigration
c) Mortality & Immigration d) Natality & Immigration
3. Development of fruit without fertilization and are seedless known as
a. Polyembryony b. Apomixis
c. Parthenocarpy d. Parthenogenesis
4. What is the function of Restriction Endonuclease in recombinant DNA technology?
a. Link together fragments of DNA
b. Make millions of copies of DNA
c. Cut DNA into many fragments
d. Separate fragments of DNA
5. Vitamin ‘A’ enriched rice is called ……………….
6. What is a false fruit? Cite an example.
7. A population has certain attributes that an individual organism does not. What are they?
8. Parasites evolved special adaptations to live on host. What are they?
9. A multinational company successfully cloned a gene of interest and also optimized the conditions to induce the
expression of target protein.
a. Name the apparatus for large scale production of such proteins.
b. Briefly explain the apparatus.
10. There are many features required to facilitate successful cloning into a vector. Write shortly any two such features
required by a vector.
11. The early stages of embryo development are similar in both dicots and monocots. However, mature embryos have
differences. Write two major differences between dicot embryo and monocot embryo.
12. What is meant by insertional inactivation in biotechnology? Mention its importance.
13. A farmer approached an Agriculture officer to tell his grievance i.e., reduction in tobacco yield due to root damage
by nematodes.
a. What is your suggestion to prevent this infestation?
b. Briefly explain the process.
14. (a) Identify the type of ecological pyramid given below.
(b) Pyramid of energy is always upright. Why?
01
15. Detritivores play a major role in decomposition.
a. What are detritivores?
b. Write an example for a detritivore.
16. Analyse the following table showing population interaction:
Species A Species B Name of interaction
+ (i) Commensalism
+ + (ii)
a. Identify (i) and (ii).
b. Define (ii).
17. Bt cotton is a transgenic pest resistant plant.
a. How this was achieved?
b. How does this plant survive on pest attack?
18. Egg cell formation in angiosperms involves megasporogenesis and female gametophyte development.
a. Briefly write the various steps involved in female gametophyte development.
b. Mature angiosperm embryo sac at maturity, though 8 nucleated is 7 celled.
What is your explanation related to this statement? Explain.
19. Observe the following diagram.
a. Identify the figure.

b. Label A, B and C.
c. Mention two types of restriction enzymes.
20. Decomposition is a process by which decomposers break down complex organic matter into inorganic substances
like carbon dioxide, water and nutrients. Briefly explain the five steps of decomposition.
02

1. The family of Queen Victoria shows a number of haemophilic descendants as she was the carrier of the disease.
Name the pattern of inheritance of this royal disease.
2. Identify the ancestor species of human being from the following features:
a. First human-like being (hominid). Brain capacity: 650-800 cc. Did not eat meat.
b. Large brain of 900 cc. Ate meat.
3. Note the relation between first two terms and fill in the blanks.
a. Erythroxylum coca: Cocaine Papaver somniferum: ……………….
b. Benign tumour: Do not spread ……………….: Spread to other parts
4. The packaging of chromatin at higher level requires additional set of proteins called ……………….
5. Rearrange the following in correct sequence:
Mammary tubules → mammary alveoli → lactiferous duct → mammary ampulla → mammary duct
6. Complete the table by filling a, b, c and d. (Scores 2)
Disease Pathogen Symptoms
Pneumonia …… a ….. Alveoli filled with fluid
Common cold ……b ….. Nasal congestion and discharge
…… c ….. Plasmodium vivax Chill and fever
Filariasis Wuchereria …… d …..
7. The list given below includes various stages of HIV infection. Arrange them according to correct sequence.
Viral replication – Macrophage - Helper T cell – Formation of DNA – Progeny virus – Viral
particle – Release of progeny virus
8. Observe the picture given below:
a. Identify the syndrome and write the genotype.

b. It occurs in both sexes (male and female). Write the reason.
9. Result of a famous experiment is given in the figure. Answer the questions.
a. Identify the experiment.

b. Which property of the DNA is proved by this experiment?
10. Given below is the diagrammatic representation of first stage of a process in bacteria.
b. Name the enzyme which catalyzes this process.
c. What are the additional complexities in eukaryotes for
this process?
03
11. (a) Define mutation.
(b) What are the different types of mutation?
12. Observe the inheritance shown in A and B.
(A) (B)
a. Name the type of the inheritance shown in A & B.

b. What is the difference between the two types of inheritance?
13. Amniocentesis for sex determination is banned in our country. Is this ban necessary? Comment on use of
amniocentesis.
14. All copulations lead to fertilisation and pregnancy. Give reason.
15. Observe the diagram provided (Do not copy the picture).
a. Label A & B.
b. Write the name and function of the structure forming
inside the ovary after the rupture of Graafian follicle.
16. In our state, waste management is a problem. Government promotes and gives subsidy to Biogas plants. Comment
the functioning of biogas plants with the help of microbes.
17. (a) Paternity or maternity can be determined by certain scientific methods. What is it? Define.
(b) Briefly explain the principles of this technique.
(c) Comment on its other applications.
18. (a) What is ART?
(b) Diagnostic report of two couples having infertility problems are given below. Suggest a suitable Assisted
Reproductive Technologies (ART) for each problem in expanded form.
i. The woman cannot produce ovum. ii. The man has very low sperm count in semen.
19. Four groups of organs are given below. Read them carefully and answer the questions:
i. Thorns of Bougainvillea and tendrils of Cucurbita ii. Eyes of Octopus and mammals
iii. Flippers of Penguin and Dolphin iv. Forelimbs of Cheetah and man
a. Categorise the four groups of organs as homologous organs and analogous organs.
b. Based on each group of organs differentiate convergent evolution and divergent evolution.
20. Two approaches of conservation of biodiversity are shown as A and B.
a. Identify the type of biodiversity conservation shown in A and B.

b. Write the difference between the two types of biodiversity conservation shown in A and B.
c. Which of the above approach is more desirable when there is an urgent need to save a species?
04

Plus 2 Biology QPs For Practice-10 Sets - 240318 - 125932

Uploaded by

Copyright:

Available Formats

Plus 2 Biology QPs For Practice-10 Sets - 240318 - 125932

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Plus 2 Biology QPs For Practice-10 Sets - 240318 - 125932

Uploaded by

Copyright:

Available Formats

HSE II – MODEL QUESTION PAPER: SET 1

Maximum: 30 Scores PART A: Botany Time: 1 Hour

I. Answer any 3 questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

Observe the figure and explain the pyramid.

12. (a) Deﬁne transgenic animals.

(a) Identify P1 & P2 with technical terms.

19. (a) What is meant by gene therapy?

Click Here for Answers

I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

a. What would be the above cross is called?

a. Name the method shown in the diagram.

a. Identify the diagram. b. Label A, B & C.

b. Mention the principles behind the DNA fingerprinting.

Click Here for Answers

Maximum: 30 Scores PART A: Botany Time: 1 Hour

I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

Natality, Mortality, Immigration & Emigration.

10. Match the following:

Male & female flower

III. Answer any 3 questions from 17 – 20. Each carries 3 scores. (3 x 3 = 9)

19. Three different ﬂowers are given.

a. Which of the bands has largest and smallest DNA fragments?

👉 Click Here for Answers

I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

Cytokine barriers Helper T-cells

10. Observe the diagram given.

a. Identify the molecule. Which cell produces this?

11. (a) Briefly explain the theory of Abiogenesis.

a. What would be the above cross is called? Define it.

Answer any 3 questions from 17 – 20. Each carries 3 scores. (3 x 3 = 9)

Maximum: 30 Scores PART A: Botany Time: 1 Hour

I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

5. Expand the abbreviation GPP.

9. Bt toxin is produced by Bacillus thuringiensis that can kill certain insects.

a. Identify the types of populations A, B and C.

a. What is ori? Mention its importance.

👉 Click Here for Answers

I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

Construct the base sequence of mRNA transcribed from this.

b) Correlate Miller’s experiment with this.

Streptokinase, Statin, Saccharomyces cerevisiae, Cyclosporine

III. Answer any 3 questions from 17 – 20. Each carries 3 scores. (3 x 3 = 9)

17. a) Draw a flowchart showing the process of spermatogenesis. (2)

Cervical caps, Vasectomy, CuT, Tubectomy, Diaphragms, Condoms, Lippes loop

a. Point out the levels of diversity in nature. (1)

👉 Click Here for Answers

Maximum: 30 Scores PART A: Botany Time: 1 Hour

I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

👉 Click Here for Answers

I. Answer any three questions from 1 – 5. Each carries 1 score. (3 x 1 = 3)

a) What do A and B stand for?

a. Identify the given cross and mention the ratio.

18. Observe the diagram provided and identify the process.

b. Why are gametes produced haploid even though the

19. Given below is the diagram of a replication fork drawn by a student.

a. Redraw the diagram correctly and label it.

b. Why does discontinuous synthesis of DNA occur in

20. Observe the diagrammatic representation and answer the questions:

a. Explain the phenomenon shown in the figure.