Open Life Sciences 2022; 17: 991–1000

Research Article

Wei Zhou, Dongying Xuan, Ting Yu*, Jincai Zhang*

Aberrant pulmonary immune response of obese

mice to periodontal infection
https://doi.org/10.1515/biol-2022-0089 less of periodontitis. Periodontitis may aggravate pul-
received January 06, 2022; accepted May 18, 2022 monary immune response in obese rodents. This may
Abstract: Obesity and periodontitis constitute mutual relate to the imbalance of the pro- and anti-inflamma-
risk factors in respiratory disorders; this study aimed tory cytokine status of lung lesions, which tends to
to explore the pulmonary immune response to period- attenuate the infiltration of alveolar macrophages.
ontal infection using combined animal models with Keywords: pulmonary immune response, periodontal
diet-induced obesity (DIO). Thirty-two C57 BL/6J mice infection, diet-induced obesity
were randomly divided into low-fat (LF) or high-fat
(HF) diet groups and fed an LF diet as a control or an
HF diet to induce obesity. The 30-week mice in the diet
group were divided into periodontal ligation group (10 1 Introduction
days using Porphyromonas gingivalis ATCC 33277) or
sham-ligation group. The expressions of the macro- Periodontitis is a nonspecific, highly prevalent dysbiosis-
phage-specific maker (F4/80), macrophage chemotactic related chronic infection characterized by the progressive
protein1 (MCP1), and inflammatory cytokines in lung destruction of periodontal supporting tissues, which can
tissues were analyzed. The mRNA and protein levels of cause systemic inflammation and infectious metastasis
F4/80, MCP1, interleukin (IL)-1β, and IL-6 expressions with potential impact on distant organs [1]. It ranks
were significantly upregulated by obesity in lung tissues. second among the most prevalent oral diseases worldwide
However, the mRNA and protein levels of F4/80, MCP1, and has become a significant public health concern [2].
and IL-6 were downregulated by periodontitis in DIO mice Previous reports have revealed the relationship between
relative to that of the HF control group. Periodontitis periodontitis and top-ten causes of death, such as dia-
increased tumor necrosis factor-α level of lung tissues betes, COVID-19 infection, cardiovascular diseases, respira-
under LF, while IL-10 was not affected by obesity regard- tory disease [3–5], and even premature mortality [6].
Extensive clinical studies clearly show that periodontitis
may increase the risk of various pneumonia diseases,
including chronic obstructive pulmonary disease (COPD),
pneumonia, and asthma [7,8]. The anatomical continuity
between the lungs and the oral cavity allows dental plaque

* Corresponding author: Ting Yu, Department of Periodontics,
to affect lung flora [9]. Some anaerobic periodontal patho-
Affiliated Stomatology Hospital of Guangzhou Medical University, gens, especially Porphyromonas gingivalis, are common
Guangdong Engineering Research Center of Oral Restoration and isolates derived from the lungs of patients with infectious
Reconstruction, Guangzhou Key laboratory of Basic and Applied pneumonia and COPD [10]. In animal studies, the intra-
Research of Oral Regenerative Medicine, 195A, Dongfeng West tracheal challenge with P. gingivalis is responsible for
Road, Yuexiu District, Guangzhou, Guangdong, China,
persistent inflammatory responses in the lungs, which
e-mail: [email protected]
* Corresponding author: Jincai Zhang, Southern Medical University, involves cell recruitment and proinflammatory cytokine
No. 1023-1063, Shatai South Road, Baiyun District, Guangzhou, production [11,12]. Extensive endeavors have either focused
Guangdong, China, e-mail: [email protected] on epidemiological data or used intratracheal challenges
Wei Zhou: Department of Periodontics, Shenzhen Stomatological with periodontal pathogens in an animal model to eluci-
Hospital, Southern Medical University, Shenzhen, Guangdong,
date the relationship between periodontitis and respiratory
China
Dongying Xuan: Southern Medical University, No. 1023-1063,
disease. Recent studies showed that P. gingivalis was
Shatai South Road, Baiyun District, Guangzhou, Guangdong, detected in the gingival, tongue, and lung tissues after
China 6 weeks of oral inoculation, implying that the systemic

Open Access. © 2022 Wei Zhou et al., published by De Gruyter. This work is licensed under the Creative Commons Attribution 4.0
International License.
992  Wei Zhou et al.

immunity induced by periodontitis can alter immune 2 Materials and methods

response at distant sites only after a longer period
[13,14].
2.1 Animals
From the immunology viewpoint, the immune response
of lung tissue is largely dependent on the nutritional
Animals were obtained from and cultured in Guangdong
status of the organism; specifically, malnutrition or
Medical Laboratory Animal Center, China. Thirty-two C57
over-nutrition will accordingly give rise to immune sup-
BL/6J mice (male, 6 weeks old) were randomly divided
pression or dysfunction. Periodontitis and respiratory
into two groups: low-fat (LF/LF−) and high-fat (HF/HF−)
disorders are likely to raise multiple risk factors, such
diet groups (n = 16 per group). The HF group was fed a
as obesity [15]. It is well documented that obesity has
60% kcal HF diet for 30 weeks to induce obesity (DIO),
profound effects on asthma, acute respiratory distress
while the LF group was fed a 10% kcal LF diet (D12492
syndrome, obstructive sleep apnea, and lung infection
and D2450B, Research Diet Inc., NJ, USA) as the normal-
(as witnessed in COVID-19, H1N1 pandemic, and else)
weight control. All the mice were group-housed (3–5 mice
[16,17]. Obesity alters the mechanical properties of the
per cage) ad libitum in a specific pathogen-free environ-
respiratory system. Furthermore, it is a chronic low-grade
ment, followed by a 10–14-h day-to-night cycle, with free
metaflammation with many immunometabolic dysregu-
access to diet and water. Body weight was measured every
lations, such as systemic inflammation, dyslipidemia,
2 weeks. Sixteen-hour (overnight) fasting blood glucose
hyperglycemia, and insulin resistance [18]. Such obe-
was measured by a glucometer at 0 and 30 weeks. After
sity-derived systemic alterations weaken host immunity
30 weeks, the two diet groups were divided into period-
or demonstrate an overexuberant inflammatory response,
ontitis (−P) and periodontal health control (−C) groups (n = 8)
which finally increases the susceptibility of the lung to
based on the body-weight matching rule. P. gingivalis
injury. Diet-induced obesity (DIO) was shown to exacer-
ATCC33277-lyophilized powder (ATCC, Manassas, VA,
bate lung inflammation through enhanced eosinophil traf-
USA) was suspended in sterilized water, evenly coated
ficking from bone marrow to lung tissues in a murine
in an anaerobic blood plate, and cultured in an anae-
model of allergic asthma [19] and reduced neutrophil
robic chamber for 7 days (90% N2, 5% CO2, 5% H2 at
recruitment upon exposure to ozone [20]. The combined
37°C). Subsequently, the smallest colony was selected
effects resulted in a disturbance of the alveolar-capillary
and cultured in an 8 mL anaerobic broth in the same
barrier and led to an increased susceptibility to particle-
anaerobic environment for 1–2 days to afford turbid
induced lung inflammation [21]. These findings indicate
broth, which was then used as a working broth [22].
that obesity, as a special state of the body, may exacerbate
Under anesthesia with 4% w/v chloral hydrate (i.p.),
lung changes when subjected to other stimuli.
the P group was ligated bilaterally at maxillary second
Impaired host response has been considered a common
molars using a 5–0 silk ligature presoaked in the working
mechanism linking obesity with periodontitis. When estab-
broth for 24 h. The C group was sham-ligated at the same
lished in individuals with obesity, periodontitis is then
sites with sterile silk, which was then removed immedi-
prone to intensify the systemic inflammatory state triggered
ately. On day 10, all the mice were euthanized by cardiac
by the proinflammatory cytokines and dissemination
puncture [23]. Visceral adipose tissues, including peri-
of bacterial products [15]. Periodontitis mice induced
renal white adipose tissue (PWAT), mesenteric white
by P. gingivalis coupled with ligature over a long period
adipose tissue (MWAT), and epididymal white adipose
can afford pulmonary inflammation, in which cyto-
tissue (EWAT), were resected and weighed. The bilateral
kines play an important role in the lung [14]. Neverthe-
maxilla and lungs were removed and dissected. For the
less, the effect of periodontitis on the occurrence and
morphometric analysis, one side of the alveolar bone
development of pulmonary immune response in the pre-
was fixed in 4% w/v paraformaldehyde. The inferior
sence of obesity remains largely unexplored. We hypothe-
lobe of the left lung was fixed in 4% formaldehyde for
sized that the influence of periodontitis on the onset and
histopathological examination. The other lungs were
progression of respiratory disease might be amplified or
snap-frozen in liquid nitrogen for RNA extraction.
accelerated in obese cases. Therefore, this study aimed to
explore the pulmonary immune response to periodontal
Ethical approval: The research related to animal use has
infection in the context of DIO using combined animal
been complied with all the relevant national regulations
models.
 Aberrant pulmonary immune response of obese mice to periodontal infection  993

and institutional policies for the care and use of animals. microscope with a camera system (XSP-C204, CIC). To
The Animal Experimental Committee of Southern Medical quantify the protein expressions in the specimens, the
University approved all experimental protocols. The study integrated optical density (IOD) in the area of interest in
protocol followed all recommendations of the National the pictures was quantified by an analyzing system
Institutes of Health Guide for the care and use of labora- (Image-Pro@ Plus Version 6.0; Media Cybernetics, Inc.,
tory animals [24]. Bethesda). The final IOD value was calculated by aver-
aging the total scores of four fields for each section.

2.2 Morphometrical analysis

2.4 RNA isolation and RT-PCR
The bone tissue was fleshed and stained with 1% methy-
lene blue (MP Biomedicals, Shanghai, China) according The total RNA of the lung was extracted using TRIzol
to the reported method [25]. The frontal view of the reagent (TRIzol, Takara Bio, Kusatsu, Japan) and rever-
stained jaw was captured using the stereomicroscope sely transcribed (PrimeScript RT reagent kit, Takara Bio,
(magnification ×30). Distances from the alveolar bone Otsu, Japan) following the manufacturer’s instructions.
crest (ABC) to the cemental enamel junction (CEJ) at Primer sequences for the target genes were as follows
18 sites of the three molars were measured and averaged (5′–3′, forward and reverse):
as vertical bone loss (VBL) [23]. MCP1: ATTTCCACACTTCTATGCCTCCT and ATC
CAGTATGGTCCTGAAGATCA;
TNF-α: CAACGGCATGGATCTCAAAGAC and CTTGAA
GAGAACCTG GGAGTAGAC;
2.3 Histology IL-1β: GAAATGCCACCTTTTGACAGTG and TGGA
TGCTCTCATCAGGACAG;
Fixed lung samples were dehydrated in graded alcohol IL-6: TCTATACCACTTCACAAGTCGGA and GAA
series, cleared with dimethylbenzene, and embedded in TTGCCATTGCACAACTCTTT,
paraffin. Serial sections (thickness: 4 mm) were stained IL-10: CGGGAAGACAATAACTGCACCC and CGG
with hematoxylin–eosin (H&E) for immunohistochem- TTAGCAGTATGTTGTCCAGC.
istry analyses. Glyceraldehyde-3-phosphate dehydrogenase was used
Immunohistochemistry was carried out in two steps. as endogenous control. The reversely transcribed product
After deparaffinization and hydration, the lung sections was quantitatively determined using the SYBR Premix Ex
were boiled in EDTA solution (pH 9.0) for 15 min in a Taq PCR kit (Takara Bio, Otsu, Japan). Relative quanti-
microwave. fication was performed using a real-time PCR analyzing
Incubation with rabbit anti-mouse primary antibo- system (7500; Applied Biosystems, Waltham, MA, USA).
dies F4/80 (markers for macrophages) (1:500, GB11027; The expressions of the genes were determined using the
Servicebio), macrophage chemotactic protein (MCP1) (1:500, 2−ΔΔCT method.
GB11199; Servicebio), tumor necrosis factor (TNF)-α (1:300,
GB11188; Servicebio), interleukin (IL)-1β (1:800, GB11113;
Servicebio), IL-6 (1:800, GB11117; Servicebio), and IL-10
(1:300, GB11108; Servicebio) was performed overnight at 2.5 Statistical analysis
4°C. Incubation with a ready-to-use secondary antibody
coupled with horseradish peroxidase (goat-anti-rabbit) Statistical analysis was performed using commercial soft-
(1:200, GB23303; Servicebio) was carried out and con- ware (SPSS 22.0; IBM, Armonk, NY, USA). Independent
tinued for 40 min at 37°C, and 3,3′-diaminobenzidine samples in two groups were tested by independent t-test.
(G1211; Servicebio) was used for the color reaction. A For factorial design, data were analyzed by the two-way
blank control was incubated with phosphate-buffered analysis of variance, with diet and ligation being the
saline instead of a primary antibody. Each section with main effects. All data were expressed as mean ± standard
four fields, including two fields of peri-bronchiolar areas deviations (SDs). Typically, p < 0.05 was considered sta-
and two fields of the alveolar septum, was analyzed by a tistically significant.
994  Wei Zhou et al.

3 Results weight after 10 days with sham-ligation/ligation (HF group:

43.2 ± 4.6 g; LF group: 28.7 ± 1.9 g) (p < 0.001). Similar
tendency was also found in terms of the blood glucose
3.1 Establishment of the DIO model and the
(HF group: 172.23 ± 28.90 mg/dl; LF group: 84.71 ± 22.01 mg/dl)
periodontitis model (p < 0.001).The weight percentages of white adipose tis-
sues were significantly increased in the HF group than in
The mice in this study were of uniform weights and had the LF group (p < 0.001), such as EWAT (1.64 ± 0.42 and
normal blood glucose at the initial stage (Figure 1A). After 0.56 ± 0.26), PWAT (0.87 ± 0.54 and 0.19 ± 0.18), and
30 weeks, the body weight was significantly increased in MWAT (1.05 ± 0.54 and 0.23 ± 0.19).
the HF group (51.70 ± 5.54 g) compared with that of the LF As clearly shown in Figure 1B, P group had more VBL
group (31.30 ± 4.26 g) (p < 0.001), and so did the body in periodontium than that of C group (P < 0.05). However,

Figure 1: (A) Body weight changes in 6-week-old male C57BL/6 mice fed either with LFD or HFD during the experiment. The measurements
were carried out every 2 weeks before 30 weeks and 10 days after ligation (n = 8 per group), values are presented as mean ± SD; ns, no
significance; *p < 0.05; **p < 0.01. (B) The CEJ–ABC distance of periodontitis group (P group) with significantly increased VBL compared
with that of the control group (C group) (n = 6 per group). (C–F) Representative methylene blue staining of alveolar bone in LFC (C), LFP (D),
HFC (E), and HFP (F) groups. Green lines denote ABC level, red lines: CEJ junction level, and yellow lines indicate the distance from CEJ to
ABC. Values are presented as mean ± SD**; ns, no significance; *p < 0.05; **p < 0.01; black scale bars: 150 μm.
 Aberrant pulmonary immune response of obese mice to periodontal infection  995

VBL was not affected by diet regardless of sham-ligation mild inflammatory cell infiltration. The morphometrical
or ligation. analysis of the lung tissue of HF mice shows alveolar
septal thickening and bronchial secretions, which are sub-
stantially greater than that of LF mice. In the HF group,
mixed infiltrate containing numerous alveolar macro-
3.2 Recruitment of inflammatory cells phages and neutrophils around the peribronchiolar region
in lung tissues with obesity or and alveolar spaces are observed (Figure 2A(c) and A(d).
periodontitis Lung inflammation was further defined by increased infil-
tration of inflammatory cells, which was examined by
Representative H&E-stained lung sections are shown macrophage maker F4/80 antibody staining (Figure 2B).
in Figure 2A to illustrate the differences in pulmonary The majority of infiltrated macrophages was found in peri-
inflammation among the four groups. LFC mice-featured bronchiolar regions and alveolar spaces in the HFC and
normal lung architecture (Figure 2A(a)) and the histological HFP groups (Figure 2B(c) and B(d)). In comparison, the
features in LFP mice were similar to LFC (Figure 2A(b)), pri- expression of F4/80 macrophages was weaker in the LFC
marily characterized by normal histological features and group, which scattered slightly in peri-bronchiolar regions

Figure 2: Effects of DIO and periodontitis on lung histopathological changes. (A) Mice lung tissue sections stained with hematoxylin and
eosin (H&E) for inflammatory cells in four different groups. (B) The lung tissue sections stained by F4/80 antibody for macrophage
infiltration in four different groups. (C) Immunohistochemistry (IHC) staining fields and (D) the mRNA relative expressions of MCP1
(magnification ×200). Groups: LFC (a), LFP (b), HFC (c), or HFP (d). ns, no significance; *p < 0.05; **p < 0.01 (n = 8 per group). Black scale
bars: 100 μm.
996  Wei Zhou et al.

and alveolar spaces in the LFP group (Figure 2B(a) and significantly impacted mRNA level of MCP1 (F = 12.78,
B(b)). Diet significantly affected F4/80 protein of mice (F = p ≤ 0.01). MCP1 level was doubled in the HFC group
14.975, p ≤ 0.01). The HFC group showed an elevated pro- than in the LFC group (HFC vs LFC, p ≤ 0.01). However,
tein level of F4/80 compared with that of the LFC group mRNA level of MCP1 was less affected by periodontitis
(HFC vs LFC, p ≤ 0.01); however, there was no significant (HFP vs LFP, p > 0.05). The LFP group showed upregu-
difference between HFP and LFP (p > 0.05) or between lated MCP1 mRNA levels without significance compared
HF and LF groups (HFP vs HFC, p > 0.05; LFP vs LFC, to that of the LFC group (Figure 2D).
p > 0.05).
The protein levels of MCP1 in these groups also
showed similar variation behavior as described above. 3.3 Effect of periodontitis on the expression
Typically, the diet had a significant effect on MCP1 pro- of inflammatory cytokines in lung tissue
tein (F = 13.433, p ≤ 0.01), as manifested by the increased
MCP1 level in the HFC group compared to that of the As indicated in Figure 3, immunohistochemistry staining
LFC group (HFC vs LFC, p ≤ 0.01). The HFP group also showed that the positive staining areas of TNF-α, IL-1β,
showed upregulated protein levels compared to that of and IL-6 proteins were not obvious in LFC; instead, they
the LFP group, without detectable significance (HFP vs became more scattered near peri-bronchiolar regions and
LFP, p > 0.05). RT-PCR results showed that diet also alveolar spaces in other groups. The immunohistochemistry

Figure 3: Illustrations of lung inflammation cytokine immunostaining. Columns show the immunohistochemistry staining fields of TNF-α,
IL-1β, IL-6, and IL-10 (magnification ×200). Rows show LFC, LFP, HFC, and HFP groups. Black scale bars: 100 μm.
 Aberrant pulmonary immune response of obese mice to periodontal infection  997

results showed that diet had a significant effect on TNF-α without significance between the HFP and LFP groups
protein (F = 8.41, p ≤ 0.01), there was an interaction (HFP vs LFP, p > 0.05).
between the two influencing factors (diet and ligation) Regardless of sham-ligation or ligation, the HF group
that changed TNF-α (F = 5.042, p ≤ 0.05). Specifically, exhibited elevated expression of IL-1β proteins compared
the LFP group showed increased protein levels of to that of the LF group (p ≤ 0.01). The relative mRNA
TNF-α (LFP vs LFC, p ≤ 0.05). However, the expression expression of IL-1β was also significantly higher in the
decreased without significance in the HF diet groups lung tissues in the context of obesity (HFC vs LFC, HFP vs
(HFP vs HFC, p > 0.05). The expression of TNF-α in the LFP, p ≤ 0.05).
HFC group was higher than that in the LFC group (HFC The immunohistochemistry and RT-PCR results
vs LFC, p ≤ 0.05), but no significant difference was found showed that diet had a significant effect on IL-6 response
in the P groups (HFP vs LFP, p > 0.05). A similar varia- level (p ≤ 0.05), while the significance was absent in
tion tendency was also found in mRNA levels of TNF-α. ligation cases (p > 0.05). The HFC group showed increased
The highest expression was found in the HFC group, protein level of IL-6 (HFC vs LFC, p < 0.05), and the mRNA
which was nearly three times higher than that of the response was significantly elevated by nearly one-fold in the
LFC group (HFC vs LFC, p ≤ 0.05), showing upregulated context of diet (p < 0.05). However, the HFP group displayed
protein levels when compared with that of the HFP upregulated IL-6 response without significance com-
group (HFC vs HFP, p > 0.05). The expression of TNF-α pared to that of the LFP group (HFP vs LFP, p > 0.05).
in the LFP group was higher than that in the LFC group The expression of IL-10 proteins was found near
(LFP vs LFC, p ≤ 0.05), but the expression was increased alveolar spaces and peri-bronchiolar regions. The results

Figure 4: The mRNA relative expressions of TNF-α (A), IL-1β (B), IL-6 (C), and IL-10 (D) in lung tissues of mice. Real-time RT-PCR was performed
to calculate the target gene expression in the test sample = 2−ΔΔCT. The mRNA level of each group was normalized to the level of LFC and
presented as a fold increase. ns, no significance; *p < 0.05; **p < 0.01 (n = 8 per group).
998  Wei Zhou et al.

indicate that IL-10 levels were unaffected by either diet or the lung of DIO mice; however, IL-10 level was unaffected
ligation. The differences of TNF-α, IL-1β, IL-6, IL-10 pro- by either periodontitis or obesity, which implicates the
tein, and gene expressions among different groups are imbalance of the pro- and anti-inflammatory cytokine pro-
shown in Figures 3 and 4. tein status of the lung lesion in obese mice coupled with
periodontitis. We also observed that periodontitis induced
by ligation with P. gingivalis can dramatically upregulate
the TNF-α level in lung tissue under LF diet. However, DIO
4 Discussion mice with periodontitis showed sluggish inflammatory
response with reduced expression of TNF-α level com-
In this study, we aimed to explore the potential effect of pared with that of DIO mice. Furthermore, TNF-α and
periodontitis on the occurrence and development of lung IL-6 were more likely to be downregulated in DIO mice
inflammation status in mice with DIO. A combined diet- with periodontitis when compared with their obesity-
periodontal ligation model was established. The weight only counterparts. Similar behavior was identified in
of mice induced by an HF diet for 15–16 weeks, which DIO mice with altered immune responses when infected
exceeded 10 g or 20–25% higher than that of control with P. gingivalis. Specifically, the animals with DIO for
mice, was generally taken as obesity standard for rodents 16 weeks and subjected to oral infection or systemic
[26]. The C57BL/6J mouse strain, seemingly susceptible to inoculation of live P. gingivalis showed a blunted inf-
the development of metabolic syndrome, must consume lammatory response with reduced expression of serum
an HF diet and remain obese for a long duration before TNF-α and IL-6 compared with that of lean mice [34].
the pulmonary phenotype characteristics of obese mice Some reports evidenced that periodontal infection in the
are observed [27]. In this regard, we combined mouse context of obesity dramatically affected the regional and
models of DIO and ligation-induced periodontitis by systemic immune systems. Interestingly, Zuomin Wang
feeding a 60% kcal HF diet for 30 weeks plus 10 days [14] reported that, relative to that of the control group,
and observed that HF group had 50% body weight gain the mRNA expression level of cytokines TNF-α in the
compared with that of LF group. It is also acknowledged lung tissue of the ligature plus P. gingivalis-induced per-
that obesity reflects a state of low-grade systemic inflam- iodontitis groups increased significantly at 8 weeks but
mation and immune dysfunction, with inflammatory acti- otherwise not obviously at 2 weeks. Our result showed
vation at sites distant to the adipose tissue. Previous that periodontitis induced by ligation with P. gingivalis
studies demonstrated that obese mouse models exhib- could upregulate TNF-α levels in lung tissue under an LF
ited sterile lung injury and inflammation, such as innate diet at 10 days. The different findings can be attributed
airway hyper-responsiveness and macrophage recruit- to the different settings of the control group. Specifi-
ment [28,29]. Similarly, we found that obese mice induced cally, our study used an LF diet as control, upon which
by HF were characterized by alveolar septum thickening the mice gained weight of 12 g compared to that of the
and bronchial secretions, which were more evident than initial stage. In other words, mice under an LF diet for
LF mice, as well as elevated macrophage marker F4/80 30 weeks plus 10 days were also obese compared to their
protein and MCP1 levels in lung tissue. These findings initial states. It was quite different from the control group
suggest that recruitment of alveolar macrophages to lung used in Zuomin Wang’s study, in which the mice were fed
focus was enhanced in the context of obesity, but the a normal diet for 2 weeks. This finding implies that obese
regulation caused by periodontitis was not significant. treatment for a long duration may exacerbate lung
Compared with high diet mice with no periodontitis, DIO changes when subjected to periodontitis.
mice with periodontitis tended to downregulate alveolar To the best of our knowledge, it is the first report to
macrophage recruitment. Several studies demonstrated demonstrate that periodontitis affects the lung inflam-
that obese mice had an ameliorative or augmentative effect mation state of DIO animal models. Despite the encoura-
on lung injury and inflammation after Escherichia coli LPS ging findings, the limitations are also included based on
[30], hyperoxia [31], ozone [20], or particulate exposures experimental results. First, ligation for 10 days see-
[21]. The inconsistent results are due in large part to the mingly induces a subacute form of periodontal destruc-
type and degree of initiating injury and the timing of injury tion in mice, thus distinguishing it from the chronic lesion
and examination [32]. TNF-α, IL-1β, IL-6, and IL-10 are of periodontitis in the human body. However, the early-
early-response mediators, which are largely secreted by stage symptoms or acute status of periodontal diseases
innate immune cells, including macrophages [33]. In this may also occur. Obesity triggered by an HF diet would
study, TNF-α, IL-1β, and IL-6 levels were upregulated in be more complicated, upon which the individual effects
 Aberrant pulmonary immune response of obese mice to periodontal infection  999

of metabolic syndrome elements on pulmonary injury [4] Genco RJ, Sanz M. Clinical and public health implications of
lesion, such as hyperglycemia, dyslipidemia, hypoadipo- periodontal and systemic diseases: An overview. Periodontol
nectinemia, and hyperleptinemia, are difficult to be unam- 2000. 2020 Jun;83(1):7–13.
[5] Marouf N, Cai W, Said KN, Daas H, Diab H, Chinta VR, et al.
biguously identified. Second, the underlying mechanism
Association between periodontitis and severity of COVID-19
behind the fact that periodontitis influences pulmonary infection: A case-control study. J Clin Periodontol. 2021
immune status in obese mice remains to be fully unveiled. Apr;48(4):483–91.
Further endeavors are necessary to elucidate cytological [6] Romandini M, Baima G, Antonoglou G, Bueno J, Figuero E, Sanz M.
and molecular effects on pulmonary immune dysregula- Periodontitis, edentulism, and risk of mortality: A systematic
review with meta-analyses. J Dent Res. 2021 Jan;100(1):37–49.
tion and systemic events both in vitro and in vivo.
[7] Gomes-Filho IS, Cruz SSD, Trindade SC, Passos-Soares JS,
Carvalho-Filho PC, Figueiredo ACMG, et al. Periodontitis and
respiratory diseases: A systematic review with meta-analysis.
Oral Dis. 2020;26(2):439–46.
5 Conclusion [8] Lopes MP, Cruz ÁA, Xavier MT, Stöcker A, Carvalho-Filho P,
Miranda PM, et al. Prevotella intermedia and periodontitis
are associated with severe asthma. J Petiodontol.
In conclusion, we presented evidence that periodontitis
2020;91(1):46–54.
influences the innate immune response of pulmonary in [9] Mammen MJ, Scannapieco FA, Sethi S. Oral-lung microbiome
the context of obesity. This is presumably related to the interactions in lung diseases. Periodontol 2000. 2020
imbalance of the pro- and anti-inflammatory cytokine pro- Jun;83(1):234–41.
tein status of the lung lesion, which tended to attenuate [10] He Y, Shiotsu N, Uchida-Fukuhara Y, Guo J, Weng Y,
Ikegame M, et al. Porphyromonas gingivalis induced cell
infiltration of alveolar macrophages. This study highlights
death with disruption of tight junctions in human lung
the importance of prophylaxis and treatment of periodon- epithelial cells. Arch Oral Bio. 2020;118:104841.
titis in obese individuals with a respiratory disorder. [11] Mei F, Xiu M, Huang X, Long Y, Lu X, Wang X, et al.
Porphyromonas gingivalis and its systemic impact: current
Funding information: This study was supported by the status. Pathogens. 2020;9(11):944.
Southern Medical University Scientific Research Initiation [12] Watanabe N, Yokoe S, Ogata Y, Sato S, Imai K. Exposure to
Porphyromonas gingivalis induces production of proinflam-
(PY2018N107); Natural Science Foundation of Guangdong
matory cytokine via TLR2 from human respiratory epithelial
Province, China (Grant 2022A1515010497); Guangzhou Science, cells. J Clin Med. 2020;9(11):3433.
Technology and Innovation Commission; Guangdong Medical [13] Hamamoto Y, Ouhara K, Munenaga S, Shoji M, Ozawa T,
Research Foundation (Grant B2020209); and National Natural Hisatsune J, et al. Effect of Porphyromonas gingivalis infection
Science Foundation of China (Grant 81700985). on gut dysbiosis and resultant arthritis exacerbation in mouse
model. Arthritis Res Ther. 2020 Oct 19;22(1):249.
[14] Tian H, Zhang Z, Wang X, Liu W, Wang Z. Role of experimental
Conflict of interest: Authors state no conflict of interest. periodontitis in inducing pulmonary inflammation in mice
[published online ahead of print, 2021 Jun 26]. Oral Dis.
Data availability statement: The datasets generated during 2021;10.1111/odi.13949.
and/or analyzed during the current study are available [15] Suvan JE, Finer N, D’Aiuto F. Periodontal complications with
from the corresponding author on reasonable request. obesity. Periodontol 2000. 2018 Oct;78(1):98–128.
[16] Memtsoudis SG, Ivascu NS, Pryor KO, Goldstein PA. Obesity as
a risk factor for poor outcome in COVID-19-induced lung injury:
the potential role of undiagnosed obstructive sleep apnoea.
Br J Anaesth. 2020;152(2):e262–3.
[17] Popkin BM, Du S, Green WD, Beck MA, Algaith T, Herbst CH,
References et al. Individuals with obesity and COVID-19: A global per-
spective on the epidemiology and biological relationships.
[1] Slots J. Periodontitis: facts, fallacies and the future. Obes Rev. 2020 Nov;21(11):e13128.
Periodontol 2000. 2017;75(1):7–23. [18] Mouton AJ, Li X, Hall ME, Hall JE. Obesity, hypertension, and
[2] GBD 2017 Oral Disorders Collaborators, Bernabe E, cardiac dysfunction: novel roles of immunometabolism in
Marcenes W, Hernandez CR, Bailey J, Abreu LG, Alipour V, et al. macrophage activation and inflammation. Cir Res.
Global, regional, and national levels and trends in burden of 2020;126:789–806.
oral conditions from 1990 to 2017: a systematic analysis for [19] Park YH, Oh EY, Han H, Yang M, Park HJ, Park KH, et al. Insulin
the global burden of disease 2017 study. J Dent Res. resistance mediates high-fat diet-induced pulmonary fibrosis
2020;99(4):362–73. and airway hyperresponsiveness through the TGF-β1 pathway.
[3] Ahmad FB, Anderson RN. The leading causes of death in the US Exp Mol Med. 2019;51:1–12.
for 2020. JAMA. 2021 May 11;325(18):1829–30. doi: 10.1001/ [20] Tashiro H, Cho Y, Kasahara DI, Brand JD, Bry L, Yeliseyev V,
jama.2021.5469 et al. Microbiota contribute to obesity-related increases in the
1000  Wei Zhou et al.

pulmonary response to ozone. Am J Respir Cell Mol Biol. [28] Huang WC, Liu CY, Shen SC, Chen LC, Yeh KW, Liu SH, et al.
2019;61(6):702–12. Protective effects of Licochalcone A improve airway hyper-
[21] Leikauf GD, Kim SH, Jang AS. Mechanisms of ultrafine particle- responsiveness and oxidative stress in a mouse model of
induced respiratory health effects. Exp Mol Med. asthma. Cells. 2019;8(6):617.
2020;52:329–37. [29] Russo L, Lumeng CN. Properties and functions of adipose
[22] Kimura S, Nagai A, Onitsuka T, Koga T, Fujiwara T, Kaya H, et al. tissue macrophages in obesity. Immunology.
Induction of experimental periodontitis in mice with 2018;155(4):407–17.
Porphyromonas gingivalis-adhered ligatures. J Periodontol. [30] Guo H, Zuo Z, Wang F, Gao C, Chen K, Fang J, et al. Attenuated
2000 Jul;71(7):1167–73. Cardiac oxidative stress, inflammation and apoptosis in Obese
[23] Li CH, Amar S. Morphometric, histomorphometric, and micro- Mice with nonfatal infection of Escherichia coli. Ecotoxi Env
computed tomographic analysis of periodontal inflammatory Saf. 2021;225:112760.
lesions in a murine model. J Periodontol. 2007;78(6):1120–8. [31] Zheng G, Ren H, Li H, Li X, Dong T, Xu S, et al. Lycium barbarum
[24] National Institutes of Health. Guide for the Care and Use of polysaccharide reduces hyperoxic acute lung injury in mice
Laboratory animals. 8th edn. Washington: National Academies through Nrf2 pathway. Biom Pharma. 2019;111:733–9.
Press, US; 2011. [32] Suratt BT. Mouse modeling of obese lung disease.
[25] Yu T, Zhao L, Huang X, Xie M, Wang X, Ma C, et al. Postoperative insights and caveats. Am J Respir Cell Mol Biol.
weight loss masks metabolic impacts of periodontitis in obese 2016;55(2):153–8.
rodents. J Periodontol. 2017;88(6):e97–e108. [33] Shapouri-Moghaddam A, Mohammadian S, Vazini H,
[26] Wang P, Li D, Ke W, Liang D, Hu X, Chen F. Resveratrol-induced Taghadosi M, Esmaeili SA, Mardani F, et al. Macrophage
gut microbiota reduces obesity in high-fat diet-fed mice. plasticity, polarization, and function in health and disease.
Int J Obes. 2020;44:213–25. J Cell Physi. 2018;223(9):6425–40.
[27] Avtanski D, Pavlov VA, Tracey KJ, Poretsky L. Characterization [34] Amar S, Zhou Q, Shaik-Dasthagirisaheb Y, Leeman S.
of inflammation and insulin resistance in high-fat diet-induced Diet-induced obesity in mice causes changes in immune
male C57BL/6J mouse model of obesity. Anim Model Exp Med. responses and bone loss manifested by bacterial challenge.
2019;2(4):252–8. Proc Natl Acad Sci U S A. 2007;104(51):20466–71.