Dev Genes Evol (2002) 212:230238 DOI 10.

1007/s00427-002-0231-6

O R I G I N A L A RT I C L E

Kevin B. Hoover Peter J. Bryant

Drosophila Yurt is a new protein-4.1-like protein required for epithelial morphogenesis

Received: 26 November 2001 / Accepted: 22 February 2002 / Published online: 17 April 2002 Springer-Verlag 2002

Abstract Proteins of the 4.1 family play a key role in the integrity of the cytoskeleton and in epithelial tissue movement, as shown by the disruption of the actin cytoskeleton in human erythrocytes caused by genetic loss of protein 4.1, and the failure of epithelial tissue migration during Drosophila embryogenesis caused by genetic loss of the 4.1 homolog Coracle. Here we report the genetic characterization of Yurt, a novel protein 4.1 family member in Drosophila that is associated with the plasma membrane of epithelial cells. Homozygous loss-offunction mutations in the yurt gene cause failure of germ-band retraction, dorsal closure, and head involution, associated with degeneration of the amnioserosa and followed by embryonic lethality. A mammalian homolog of Yurt is up-regulated in metastatic melanoma cells. These novel cytoskeletal proteins appear to play important roles in epithelial cell movements and in the morphogenetic tissue changes that depend on them. Keywords Cytoskeleton Drosophila Gastrulation Protein 4.1 FERM proteins

Introduction
Proteins of the 4.1 family often link the cytoskeleton to the plasma membrane (Hoover and Bryant 2000). They share the FERM domain (Chishti et al. 1998), a conserved 30 kDa domain that interacts with transmembrane proteins and cytoskeleton-regulating proteins. Family members in vertebrates also have spectrin- and actinbinding domains (Chishti et al. 1998). In erythrocytes, protein 4.1 anchors the cytoskeleton to the membrane through direct interactions with spectrin, actin, the PDZ
Edited by P. Simpson K.B. Hoover P.J. Bryant () Developmental Biology Center, University of California, Irvine, CA 92697, USA e-mail: [email protected] Tel.: +1-949-8244714, Fax: +1-949-8243571

protein p55 and the transmembrane protein glycophorin C (Correas et al. 1986; Marfatia et al. 1995). Loss of protein 4.1 destroys this complex and disrupts the cytoskeleton, giving rise to the disease hereditary elliptocytosis (Conboy et al. 1990; Marchesi et al. 1990). The Drosophila protein 4.1 homolog, Coracle, also contributes to a structural complex associated with the plasma membrane. It interacts with the transmembrane protein Neurexin IV at the septate junction, an epithelial cell junction considered equivalent to the tight junction of vertebrates (Noirot-Timothee and Noirot 1980; Ward et al. 1998). Genetic loss of either Coracle or Neurexin IV interferes with the ability of this junction to provide a transepithelial diffusion barrier (Baumgartner et al. 1996; Lamb et al. 1998). Coracle and Neurexin IV are also required for dorsal closure, the migration of ventrolateral epidermal cells to cover the amnioserosa and enclose the internal organs during late embryogenesis (Martinez Arias 1993; Knust 1997). How these proteins are involved in dorsal closure has not yet been elucidated. In this paper we describe the genetic characterization of a novel protein 4.1 family member, called Yurt and encoded by the yurt gene. The yurt mutant was recovered in a screen for embryonic lethal mutations causing larval cuticle defects (Jurgens et al. 1984), and was so named (Wieschaus et al. 1984) because the larval cuticle perforated by a small dorsal hole resembled a Mongolian tent called a yurt. Cloning and sequencing of yurt cDNA indicates that the gene product is a protein 4.1 relative homologous to the mouse protein Ehm2 (Expressed in high metastatic cells), which is expressed at high levels in metastatic melanoma cell lines (Shimizu et al. 2000). It is also homologous to the product of an uncharacterized Caenorhabditis gene (Wilson et al. 1994). The yurt gene is required for three morphogenetic processes that involve tissue migration: germ-band retraction, dorsal closure and head involution, and it is also required for the viability of the amnioserosa, an ectodermal tissue. These data indicate Yurt is an important structural and regulatory component of the cytoskeleton required for epithelial tissue migration.

231

Materials and methods

Drosophila stocks The yurt alleles l(3)E15 and l(3)E99 were obtained from Barry Genetzky (University of Wisconsin, Madison). canoe, jun, kayak, misshapen, tailup, basket, hemipterous, coracle, and Df(3R)126c stocks were obtained from the Bloomington Stock Center (Bloomington, Ind.). The pydC5 and pydJ14 stocks were obtained from Hilary Ellis (National Cancer Institute, Frederick, Md.). Identification and sequencing of yurt cDNA The full-length yurt cDNA (LD23468) was purchased from Research Genetics (Huntsville, Ala.). For northern blotting, Drosophila larval poly (A)+ RNA (Clontech, Palo Alto, Calif.) was probed with a 766-bp XhoI fragment of the yurt cDNA radiolabeled with P32 using the Prime-It kit (Stratagene, La Jolla, Calif.). The cDNA was sequenced on both strands using the cycle sequencing protocol of the kit manufacturer (Roche, Indianapolis, Ind.). DNA sequences were aligned using SeqMan of the DNAstar program (Madison, Wis.). Translated DNA sequences of yurt and its human and Caenorhabditis homologs were aligned using the MegAlign DNAstar program (Madison, Wis.) and formatted using the BoxShade Server (http://www.ch.embnet.org/software/BOX_ form.html). Molecular analysis of yurt alleles DNA from heterozygous l(3)E15 and l(3)E99 was prepared by homogenizing adult flies in 0.2 M sucrose, 0.1 M Tris (pH 9.2), 0.1 M NaCl, 0.05 M EDTA, 0.5% SDS; extracting DNA in 1 M potassium acetate and precipitating in 95% ethanol (protocol kindly provided by S. Dimitratos, University of California at Irvine). The DNA was amplified using the manufacturers protocol (Gibco BRL, Grand Island, N.Y.) and the following primers purchased from Operon (Alameda, Calif.): l(3)E15 upper primer (5 ccaagcggggaggttcgtgtct 3) and lower primer (5 tcagctcttcgcgcagtgtattgg 3); l(3)E99 upper primer (5 agtggttggtagggcggctcagta 3) and lower primer (5 aacaagtattccggtgggcgtaag 3). Thermocycling conditions were: 30 cycles of 94C for 45 s, 65C for 30 s, 72C for 90 s. Amplified samples were electrophoresed through a 1% TAE-agarose gel, allele-specific bands removed from the gel and sequenced on both strands using specific primers and cycle sequencing (Roche, Indianapolis, Ind.) to characterize the deletions. Examination of the yurt phenotype Embryonic cuticles were cleared and mounted according to published methods (Ashburner 1989). For immunofluorescence, embryos were dechorionated, incubated in 80C Triton X-100 (0.03%)-NaCl (0.4%) solution (TNS) for 30 s then quickly cooled in excess TNS (Miller et al. 1989). Vitelline membranes were removed by vigorous shaking in heptane-methanol (1:1). Homozygous yurt embryos were identified by the use of a balancer chromosome with a GFP marker (TM3-GFP) and the absence of GFP staining. Spectrin antibody was used at 1:250 dilution (DSHB, Iowa City, Iowa), anti-phosphotyrosine at 1:250 (Transduction Laboratories, Lexington, Ky.), and anti-Dlg (Discs-large) at 1:1,000. Images were captured using a MRC 1024 Bio-Rad/Nikon Diaphot 200 laser-scanning confocal microscope. Generation of antibodies to Yurt and western blotting A 783-bp fragment, encoding 261 amino acids of Yurt (residues 425686), with a signal sequence and a Myc tag, was subcloned into the pVL1392 vector from the Baculovirus Expression Vector System (Pharmingen, San Diego, Calif.). This vector was used to

infect Sf9 cells according to the manufacturers protocol (Pharmingen, San Diego, Calif.). Sf9 culture media was harvested and concentrated for protein. Yurt fusion protein was purified on a Myc antibody column and injected into rabbits for antibody production. Antibody was purified from serum using a protein G-sepharose column and eluted using dilute glycine-HCl. The antibody was used at 1:250 for immunohistochemistry and 1:1,000 for western blotting. Lysates from stage-16 yrtE15 and yrtE15/TM3 ftz-lacZ embryos were electrophoresed, immunoblotted and probed according to published methods (Bhat et al. 1996).

Results
Identification of Yurt, a novel protein 4.1 family member in Drosophila A novel gene encoding a FERM-domain protein (Fig. 1) was identified from the Drosophila EST database, based on the significant sequence similarity of translated ESTs to the FERM domain (Chishti et al. 1998) of human erythrocyte protein 4.1 (NCBI AAA35797). By sequencing a putative full-length cDNA (LD23468) of 4,114 nucleotides we identified an open reading frame of 2,931 nucleotides beginning with a consensus start codon (Cavener 1987; Cherbas and Cherbas 1993), ending with a stop codon, and including 659 nucleotides of the 5 UTR and 524 nucleotides of the 3 UTR. For reasons described below, we will refer to this gene as yurt. The yurt cDNA is predicted to encode a protein of 976 amino acids (Fig. 1A) with significant sequence similarity to other members of the protein 4.1 family (Fig. 1B). The closest homologs (Fig. 1C) are proteins encoded by a Caenorhabditis cosmid (T04C9; Wilson et al. 1994) and human and mouse orthologs of the protein Ehm2 (8096551; Shimizu et al. 2000). All of the homology with these and other proteins is within the FERM domain, and the close homology to the Caenorhabditis and mammalian homologs within this region indicates that Yurt and its homologs should be considered as new members of the protein 4.1 family (Fig. 1B). The Yurt FERM domain consists of about 300 amino acids and includes close matches to the two calmodulin-binding sites reported from protein 4.1 (Fig. 1C; Nunomura et al. 2000). Yurt does not show significant identity with any other proteins outside the FERM domain, and unlike most vertebrate Protein 4.1 family members, there are no consensus cytoskeleton-binding domains in the C-terminal part of Yurt (Hoover and Bryant 2000). There is a consensus type II PDZ-binding motif (Daniels et al. 1998) at the C-terminus of Yurt (Fig. 1A) and a type-I motif (Songyang et al. 1997) on Ehm2. Molecular characterization of the yurt locus A completely sequenced P1 clone from the third chromosome (DS04219) contains the entire nucleotide sequence encoding Yurt, including ten exons and spanning 5,860 bp (Fig. 2A). Northern blotting of larval mRNA revealed two species of 5.5 and 4.3 kb (Fig. 2B). Since

232 Fig. 1 A Predicted amino-acid sequence of the Drosophila Yurt protein, from translation of the full-length yurt cDNA. The core FERM domain, shown underlined, encompasses residues 54250, but residues 251394 (italic) also show homology to the corresponding region of other members of the protein 4.1 family, and probably should be considered part of a large variant of FERM. Residues 395976 do not show significant homology to other proteins represented in current databases. The four C-terminal residues constitute a predicted type II PDZ-binding motif (Daniels et al. 1998). B Phylogenetic tree of the protein 4.1 family, based on the alignment of full-length aminoacid sequences. The length of each pair of branches represents the number of substitutions between sequence pairs. The units at the bottom of the tree indicate the number of substitution events, and the different subfamilies are bracketed. When several mammalian homologs are known, the human representative is shown (Dm Drosophila melanogaster, Ce Caenorhabditis elegans, Dr Danio rerio, Hs Homo sapiens, Mm Mus musculus). Sequence information is from the National Center for Biotechnology Information (http://www.ncbi. nlm.nih.gov/) and Berkeley Drosophila Genome Project (http://www.fruitfly.org/index.html). C Sequence alignment of the FERM domains of the Yurt protein subfamily. Black indicates identity, and gray indicates conserved residue type. Underlined sequences are similar to the two calmodulin-binding domains of 4.1R (see text)

no additional exons could be identified within the genomic interval corresponding to the 4.114-kb cDNA sequence, the larger yurt transcript identified by this method presumably contains an extended 5 or 3 UTR. The 3 end of yurt is situated less than 1 kb from the 3 end of the gene encoding actin isoform 87E (Manseau et al. 1988).

The yurt gene corresponds to the l(3)m112 complementation group The lethal complementation group l(3)m112 was previously identified by analysis of eight EMS-induced alleles mapping just 3 to the gene encoding actin 87E (Hilliker et al. 1980; Manseau et al. 1988). Two of these alleles,

233

Fig. 2 A Schematic diagram of the genomic organization and mutations of the yurt locus. Black line indicates the DNA interval with restriction sites of enzymes noted (A AflII, B BglII, E EcoR1, X XhoI). E(15) and E(99) denote the mutations l(3)E15 and l(3)E99, respectively, and the intervals deleted are bracketed (see text). The deficiency uncovering the entire genetic interval, Df(3R)126c, is indicated by a dashed line. The exon-intron structure is denoted by white boxes indicating untranslated sequence, black boxes translated sequence and the spaces between boxes are introns. B Northern blot of larval poly (A)+ RNA probed with a fragment of yurt cDNA. Molecular weights are noted to the left. CG Cuticle preparations of wild-type (C), l(3)E15/l(3)E99 (D), l(3)E99/Df(3R)126c (E), l(3)e15/Df(3R)126c (F), and Df(3R)126c/ Df(3R)126c (G) embryos. Head is to the left and tail to the right. The white arrows in DG denote head defects and the arrowheads denote dorsal posterior holes. Note the mild U-shaped phenotype observed in E, F and G

l(3)E15 and l(3)E99, are small deletions of approximately 0.9 kb each (Manseau et al. 1988). Both of these mutations fail to complement the strong yurt mutant, yurt2 (Jurgens et al. 1984), showing that all three mutations are in the same gene. Both the l(3)m112 complementation group and the yurt mutation are uncovered by the Df(3R)126c deficiency (Jurgens et al. 1984; Manseau et al. 1988). Furthermore, yurt2 and l(3)E15 mutant transheterozygotes show the same phenotype as either mutant over the Df(3R)126c deficiency (Fig. 2DG). Primers specific for yurt were used to sequence heterozygous l(3)E15 and l(3)E99 mutants and to determine the microdeletion boundaries. The l(3)E15 deletion removes 838 bp of the first exon including the putative

234 Fig. 3 A, B Dlg staining of stage-13 wild-type (WT; A) and homozygous yrtE15 mutant (B) embryos (100 magnification). Note the presence of amnioserosa (AS) in A and absence in B, where a Malpighian tubule (MT) is visible. Arrowheads denote elongated epithelial cells in both WT and mutant (LE leading edge epithelium). CE Spectrin staining of wildtype (C) and mutant (D, E) stage 1314 embryos. AS is missing in D and torn (arrowhead) in E. Arrows in D and E indicate Malpighian tubules (MG midgut)

start codon, and presumably constitutes a protein-null mutation. The l(3)E99 deletion removes 703 bp, deleting the second and third exons (Fig. 2A). These results show clearly that yurt corresponds to the l(3)m112 complementation group. Yurt mutants fail to complete germ-band retraction, dorsal closure and head involution Yurt mutants show defects in at least three morphogenetic movements that occur during gastrulation in Drosophila. The first affected movement is germ-band retraction, which brings the posterior tip of the germ band back from its temporary anterior-dorsal position to the posterior tip, exposing the amnioserosa. Yurt mutants frequently have a tail-up (Fig. 2E-F) phenotype, which is characteristic of embryos that fail to complete germ-band retraction (Frank and Rushlow 1996; Byars et al. 1999). The second morphogenetic process affected in yurt mutants is dorsal closure, in which the two sides of the ectoderm expand dorsally and eventually seal over the dorsal surface of the embryo. Defective dorsal closure in the yurt mutant produces a small posterior hole in the cuticle, similar to that observed in dlg (Perrimon 1988) and

pnr (Heitzler et al. 1996) mutants but less extreme than the complete dorsal-open phenotype seen in canoe, jun, kayak, misshapen, basket, hemipterous, raw, and coracle (Jurgens et al. 1984; Fehon et al. 1994; RiesgoEscovar et al. 1996; Kockel et al. 1997). Furthermore, among the dorsal-open mutants, only raw (Byars et al. 1999), dlg (Perrimon 1988), and pnr (Heitzler et al. 1996) exhibit the tail-up phenotype seen in yurt. Since the posterior region of the embryo is sealed last in dorsal closure (Martinez Arias 1993), the posterior-hole phenotype seen in yurt mutants suggests that the late stages of dorsal closure are most strongly affected by loss of this gene product. The third process affected in yurt mutants is head involution, which involves movement of the anterior ectoderm to the interior, leaving the larva with no external head (Nassif et al. 1998). In yurt embryos, holes in the head cuticle and defects in the cephalopharyngeal head skeleton (Fig. 2DG) indicate that this process fails. No segmentation or embryonic patterning defects were apparent.

235

Fig. 4 A western blot of protein from two wild-type (WT, OreR) embryos and two homozygous yrtE15 mutant (yrt) embryos probed with rabbit anti-Yurt antibody (see Materials and methods). Note the presence of Yurt protein at the expected molecular weight in WT embryos and a faint band in the yrt embryos suggesting a small amount of residual protein, possibly of maternal origin. BD Staining of stage 1314 wild-type embryo for Yurt (green; B, D) and phosphotyrosine (Ph-Tyr; red; C, D) epitopes. Yellow signal denotes the overlap of phosphotyrosine and Yurt staining. Phosphotyrosine epitopes concentrate at adherens junctions (see text). Note the significant overlap of the epitopes in the most dorsal border of the leading edge epithelium (arrow), where it meets the aminoserosa (AS), and at several AS cell borders (arrowheads). EG Staining of wild-type stage-4 embryo with antibodies for Yurt (green; E, G) and Dlg (red; F, G). Note the apical localization of Yurt (noted as a), the lateral localization of Dlg at this early developmental stage and the lack of overlapping localization (would be yellow). Basal is indicated with b

ferentiation, but to degeneration of mature amnioserosal cells. The Yurt protein is localized to the plasma membrane and cytosolic aggregations To better characterize the function of Yurt, an antibody was generated against a non-conserved region in the C-terminal part of the protein. Immunoblotting indicates that the protein is expressed at the predicted molecular weight of 100 kDa in wild-type embryos. There is a small amount of residual protein in homozygous mutant l(3)E15 embryos (Fig. 4A) which is probably of maternal origin since this mutation is predicted to be a protein-null. During the stages of extended germ band and dorsal closure, Yurt is expressed at the plasma membrane of the epidermis and amnioserosa (Fig. 4B). There is overlap with phosphotyrosine staining, which is associated with adherens junctions (Woods and Bryant 1993), especially at the leading edge (Mller and Wieschaus 1996). Staining of syncytial-blastoderm embryos shows expression of Yurt on the apical plasma membrane, apical to the lateral membrane staining of Dlg (Fig. 4C). Staining with a marker for the septate junction (Dlg), the apical plasma membrane (Cr) and the lateral membrane (Fas III), showed overlapping staining in each case (data not shown). Thus Yurt protein is localized to the apical and lateral domains of the epithelial plasma membrane. Yurt protein is also detected in the cytosol of epidermal and amnioserosa cells (Fig. 4B). This localization is punctate, suggesting that the protein is associated either with a protein complex or an organelle. Phosphotyrosine epitopes colocalize with Yurt in some of the cytoplasmic aggregations. Yurt protein is also expressed in the hindgut, foregut, and all ectodermal derivatives (data not shown). The localization of Yurt protein to the plasma membrane is consistent with the known function and localization of other FERM-domain proteins (Tsukita and Yonemura 1999; Cuppen et al. 1999).

The amnioserosa degenerates in Yurt mutants To better characterize the yurt phenotype, embryos were stained for cytoskeletal proteins and DNA markers. Antispectrin staining indicates that the brain lobes of yurt embryos remain exposed instead of being internalized (data not shown). This reveals a failure of the dorsal ridge to migrate and enclose the brain in epidermis. Stage 1314 yurt l(3)E15 mutants stained with anti-Dlg or anti-spectrin show herniated Malpighian tubules, posterior hindgut and sometimes midgut (Fig. 3AE). In Fig. 3, a stage-12 embryo demonstrates herniation of Malpighian tubules through an opening in the amnioserosa (Fig. 3E) while a slightly older stage-13 embryo demonstrates protrusion of midgut, hindgut and Malpighian tubules through the opening caused by complete absence of amnioserosa (Fig. 3D). To characterize the amnioserosa in yurt mutants, they were stained for Krppel, a marker of differentiated amnioserosa (Gaul et al. 1987; Yip et al. 1997). Krppel is expressed in the amnioserosa of yurt mutants, even in degenerating amnioserosa (data not shown), indicating the defect in the amnioserosa is not due to improper dif-

236

Discussion
The Drosophila Yurt protein, its mammalian homologs, and the Caenorhabditis predicted protein T04C9.6 represent a new set of orthologs within the protein 4.1 family. Ehm2 was identified by its up-regulation in highly metastatic mouse melanoma cell lines as shown by mRNA differential display (Shimizu et al. 2000), and homologs in dog and human have been identified by sequence similarity. The Caenorhabditis homolog was identified from genomic DNA sequence but its function is unknown (Wilson et al. 1994). Other subfamilies within the protein 4.1 family include the Novel Band 4.1-like (Nbl4) proteins represented by CG11339 and CG5022 in Drosophila and Nbl4 in fish and mammals (Chishti et al. 1998); the prototypic protein 4.1 subfamily, represented in Drosophila by Coracle (Fehon et al. 1994) and CG1283, and in mammals by four closely related proteins named protein 4.1R, 4.1G, 4.1B, and 4.1N (Peters et al. 1998); and the ERM subfamily represented by the single family member Moesin in Drosophila but containing three distinct proteins Ezrin, Moesin and Radixin in mammals (Tsukita and Yonemura 1997); and Merlin (Gusella et al. 1999) in both Drosophila and mammals (Fig. 1A). Analysis of the Drosophila genome sequence using the SMART domain identification program (Schultz et al. 2000) predicts a total of 38 FERM domains in 35 proteins, including many that are more distant relatives of Yurt than those shown in Fig. 1B. These other FERM-containing proteins include a variety of myosin relatives, protein tyrosine phosphatases, focal adhesion kinases and other multi-domain proteins of uncertain function. Structural studies of some FERM domains suggest that they contribute to the membrane cytoskeleton by mediating the binding of FERM-containing proteins to the plasma membrane in a mechanism regulated by phosphoinositides as well as intramolecular interactions within the FERM domain (Hamada et al. 2000; Pearson et al. 2000). The identification of the common principles as well as the functional diversity of FERM-domain proteins will be a major task even in relatively simple model organisms. Our identification of loss-of-function mutations affecting the Yurt protein reveals important roles in early epithelial morphogenesis and cell survival. Yurt embryos fail to complete germ-band retraction, dorsal closure and head involution (Martinez Arias 1993), and they show apparent degeneration of the amnioserosa. Of course, some of these defects may be secondary to others; for example, since tension in the amnioserosa contributes force for dorsal closure (Kiehart et al. 2000), the loss of this tissue could be indirectly responsible for the failure of dorsal closure in yurt mutants. Similar defects are observed in mutants affecting members of the u-shaped (ush) family (tup, ush, hnt, srp) of transcription factors, which fail to begin or complete germ-band retraction, and show degeneration of the amnioserosa (Clifford and Schupbach 1992; Fernandez et al. 1995; Frank and Rushlow 1996; Byars et al. 1999). Ush genes genetically

interact with one another and are involved in cell migration and dorsal closure (Goldman-Levi et al. 1996; Cubadda et al. 1997; Moore et al. 1998). Since yrt and the ush genes function in cell migration and have similar mutant phenotypes, we have tested for genetic interactions by studying the phenotypes of transheterozygous larvae and adult flies. However, these simple tests revealed no interactions, suggesting that yurt and ush function in distinct genetic pathways. Dorsal closure has been extensively studied in Drosophila as an example of epithelial morphogenesis. The genes involved in dorsal closure have been categorized into those encoding structural proteins (class I: coracle, myosin), those required for the DJNK signaling cascade (class II: basket, jun-related antigen), and those required for Dpp signal transduction (class III: punt, schnurri; Byars et al.1999). In class II and IIII mutants, the dorsally migrating lateral epithelium fails to elongate but class I mutants show normal elongation of the lateral epidermis (Young et al. 1993; Fehon et al. 1994). The epithelium in yurt mutants elongates normally, suggesting that Yurt is a class I protein with a structural function. Other genes that are required for dorsal closure, but have not been categorized, include discs-large (Woods and Bryant 1991) and canoe (Miyamoto et al. 1995), both of which encode PDZ domain-containing putative scaffolding proteins. Ca2+-regulated plasma membrane formation is also probably involved in dorsal closure (Kiehart 1999). Thus, dorsal closure involves the concerted activity of proteins that are required for cytoskeletal structure, signal transduction and intracellular ion concentrations. The Yurt protein is localized to the plasma membrane at all developmental stages analyzed. During cellularization it is localized at the apical plasma membrane, and when cellularization is complete it is uniformly associated with the plasma membrane (Fig. 4B, C). After cellularization it becomes localized to cytoplasmic aggregations (Fig. 4B). Merlin, another Drosophila protein 4.1 superfamily member, is also localized at endocytic structures in cell lines (McCartney and Fehon 1996), but this cytoplasmic form is probably inactive (LaJeunesse et al. 1998). This raises the possibility that cytosolic Yurt could be the inactive form while the membrane-associated form could be active. Alternatively, one of these localization patterns could be artefactual. Further investigations into the localization of Yurt in static and moving epithelium will be necessary to address this question. Since protein 4.1 family members organize protein complexes at the plasma membrane (Hoover and Bryant 2000), we have tested whether Yurt forms a complex with other membrane-associated proteins. Several candidates were identified on the basis of a consensus protein 4.1 binding site, consisting of a continuous stretch of five to seven positively charged residues (Hoover and Bryant 2000; Klebes and Knust 2000). These candidates included the Discs-large (Dlg) protein (Woods and Bryant 1991; Hoover and Bryant 2000), and the rasinteracting protein Canoe (Cno; Miyamoto et al. 1995). We were unable to demonstrate a genetic or biochemical

237

interaction with either of these proteins. This was surprising, especially for Dlg, given the phenotypic similarity of dlg and yurt mutants (Perrimon 1988), and studies showing direct binding between human protein 4.1 and human Dlg (Lue et al. 1994). In Drosophila, the region of Dlg homologous to the 4.1-binding site in human Dlg is required for localization to the plasma membrane; however, neither Yurt not Coracle appear to be a binding partner for this domain because Dlg is localized correctly in both yurt and coracle mutants (our unpublished results) and Coracle and Dlg do not co-immunoprecipitate (Ward et al. 1998). The multiple epithelial defects in yurt embryos suggest that the gene product is required for a general mechanism of epidermal movement. This is distinct from another Drosophila protein 4.1 family member, Coracle, in which hypomorphic or null alleles show dorsal closure defects, but no defects in germ-band retraction or head involution (Fehon et al. 1994; Lamb et al. 1998). How Yurt affects epithelial migration is not clear since neither actin nor spectrin are mislocalized in yurt mutants. The mouse Yurt ortholog, Ehm2, is up-regulated in metastatic melanoma cells (Shimizu et al. 2000), suggesting that increased levels of Ehm2 may be important for the invasiveness and motility observed in these epithelial cells. Thus other members of the Yurt subfamily, in addition to Yurt, may play important roles in epithelial cell movements.
Acknowledgements We thank Helen Skaer for reviewing the manuscript prior to submission, Dan Knauer and his lab. for their assistance with generating antibodies, Hilary Ellis, David Strutt, Marek Mlodzik, Ernst Hafen, Judith Lengyel, Stephane Noselli, Bob Kreber and Barry Ganetzky for sending fly stocks, and Douglas Cavener and Ryu Ueda for providing antibodies. This investigation was supported by grant CA66263 from the National Institutes of Health.

References
Ashburner M (1989) Drosophila: a laboratory handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), pp 11331 Baumgartner S, Littleton JT, Broadie K, Bhat MA, Harbecke R, Lengyel JA, Ehrismann CR, Prokop A, Bellen HJ (1996) A Drosophila neurexin is required for septate junction and blood-nerve barrier formation and function. Cell 87:1059 1068 Bhat MA, Philp AV, Glover DM, Bellen HJ (1996) Chromatid segregation at anaphase requires the barren product, a novel chromosome-associated protein that interacts with Topoisomerase II. Cell 87:11031114 Byars CL, Bates KL, Letsou A (1999) The dorsal-open group gene raw is required for restricted DJNK signaling during closure. Development 126:49134923 Cavener DR (1987) Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res 15:13531361 Cherbas L, Cherbas P (1993) The arthropod initiator: the capsite consensus plays an important role in transcription. Insect Biochem Mol Biol 23:8190 Chishti AH, Kim AC, Marfatia SM, Lutchman M, Hanspal M, Jindal H, Liu SC, Low PS, Rouleau GA, Mohandas N, Chasis JA, Conboy JG, Gascard P, Takakuwa Y, Huang SC, Benz EJJ,

Bretscher A, Fehon RG, Gusella JF, Ramesh V, Solomon F, Marchesi VT, Tsukita S, Anderson JM, Bryant PJ, Hoover KB (1998) The FERM domain: a unique module involved in the linkage of cytoplasmic proteins to the membrane. Trends Biochem Sci 23:281282 Clifford R, Schupbach T (1992) The torpedo (DER) receptor tyrosine kinase is required at multiple times during Drosophila embryogenesis. Development 115:853872 Conboy J, Marchesi S, Kim R, Agre P, Kan YW, Mohandas N (1990) Molecular analysis of insertion/deletion mutations in protein 4.1 in elliptocytosis. II. Determination of molecular genetic origins of rearrangements. J Clin Invest 86:524530 Correas I, Speicher DW, Marchesi VT (1986) Structure of the spectrin-actin binding site of erythrocyte protein 4.1. J Biol Chem 261:1336213366 Cubadda Y, Heitzler P, Ray RP, Bourouis M, Ramain P, Gelbart W, Simpson P, Haenlin M (1997) u-shaped encodes a zinc finger protein that regulates the proneural genes achaete and scute during the formation of bristles in Drosophila. Genes Dev 11:30833095 Cuppen E, Wijers M, Schepens J, Fransen J, Wieringa B, Hendriks W (1999) A FERM domain governs apical confinement of PTP-BL in epithelial cells. J Cell Sci 112:32993308 Daniels DL, Cohen AR, Anderson JM, Brunger AT (1998) Crystal structure of the hCASK PDZ domain reveals the structural basis of class II PDZ domain target recognition. Nat Struct Biol 5:317325 Fehon RG, Dawson IA, Artavanis-Tsakonas S (1994) A Drosophila homologue of membrane-skeleton protein 4.1 is associated with septate junctions and is encoded by the coracle gene. Development 120:545557 Fernandez R, Tabarini D, Azpiazu N, Frasch M, Schlessinger J (1995) The Drosophila insulin receptor homolog: a gene essential for embryonic development encodes two receptor isoforms with different signaling potential. EMBO J 14:3373 3384 Frank LH, Rushlow C (1996) A group of genes required for maintenance of the amnioserosa tissue in Drosophila. Development 122:13431352 Gaul U, Seifert E, Schuh R, Jackle H (1987) Analysis of Kruppel protein distribution during early Drosophila development reveals posttranscriptional regulation. Cell 50:639647 Goldman-Levi R, Miller C, Greenberg G, Gabai E, Zak NB (1996) Cellular pathways acting along the germband and in the amnioserosa may participate in germband retraction of the Drosophila melanogaster embryo. Int J Dev Biol 40:10431051 Gusella JF, Ramesh V, MacCollin M, Jacoby LB (1999) Merlin: the neurofibromatosis 2 tumor suppressor. Biochim Biophys Acta 1423:M29M36 Hamada K, Shimizu T, Matsui T, Tsukita S, Hakoshima T (2000) Structural basis of the membrane-targeting and unmasking mechanisms of the radixin FERM domain. EMBO J 19:4449 4462 Heitzler P, Haenlin M, Ramain P, Calleja M, Simpson P (1996) A genetic analysis of pannier, a gene necessary for viability of dorsal tissues and bristle positioning in Drosophila. Genetics 143:12711286 Hilliker AJ, Clark SH, Chovnick A, Gelbart WM (1980) Cytogenetic analysis of the chromosomal region immediately adjacent to the rosy locus in Drosophila melanogaster. Genetics 95:95110 Hoover,KB, Bryant PJ (2000) The genetics of the protein 4.1 family: organizers of the membrane and cytoskeleton. Curr Opin Cell Biol 12:229234 Jurgens G, Wieschaus E, Nusslein-Volhard C (1984) Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. II. Zygotic loci on the third chromosome. Rouxs Arch Dev Biol 193:283295 Kiehart DP (1999) Wound healing: the power of the purse string. Curr Biol 9:R602R605 Kiehart DP, Galbraith CG, Edwards KA, Rickoll WL, Montague RA (2000) Multiple forces contribute to cell sheet morphogenesis for dorsal closure in Drosophila. J Cell Biol 149:471490

238 Klebes A, Knust E (2000) A conserved motif in Crumbs is required for E-cadherin localisation and zonula adherens formation in Drosophila. Curr Biol 10:7685 Knust E (1997) Drosophila morphogenesis: movements behind the edge. Curr Biol 7:R558R561 Kockel L, Zeitlinger J, Staszewski LM, Mlodzik M, Bohmann D (1997) Jun in Drosophila development: redundant and nonredundant functions and regulation by two MAPK signal transduction pathways [published erratum appears in Genes Dev (1998) 12(3):447]. Genes Dev 11:17481758 LaJeunesse DR, McCartney BM, Fehon RG (1998) Structural analysis of Drosophila merlin reveals functional domains important for growth control and subcellular localization. J Cell Biol 141:15891599 Lamb RS, Ward RE, Schweizer L, Fehon RG (1998) Drosophila coracle, a member of the protein 4.1 superfamily, has essential structural functions in the septate junctions and developmental functions in embryonic and adult epithelial cells. Mol Biol Cell 9:35053519 Lue RA, Marfatia SM, Branton D, Chishti AH (1994) Cloning and characterization of hdlg: the human homologue of the Drosophila discs large tumor suppressor binds to protein 4.1. Proc Natl Acad Sci USA 91:98189822 Manseau LJ, Ganetzky B, Craig EA (1988) Molecular and genetic characterization of the Drosophila melanogaster 87 E actin gene region. Genetics 119:407420 Marchesi SL, Conboy J, Agre P, Letsinger JT, Marchesi VT, Speicher DW, Mohandas N (1990) Molecular analysis of insertion/deletion mutations in protein 4.1 in elliptocytosis. I. Biochemical identification of rearrangements in the spectrin/actin binding domain and functional characterizations. J Clin Invest 86:516523 Marfatia SM, Leu RA, Branton D, Chishti AH (1995) Identification of the protein 4.1 binding interface on glycophorin C and p55, a homologue of the Drosophila discs-large tumor suppressor protein. J Biol Chem 270:715719 Martinez Arias A (1993).Development and patterning of the larval epidermis of Drosophila. In: Bate M, Martinez Arias A (eds) The development of Drosophila melanogaster. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. pp 517 608 McCartney BM, Fehon RG (1996) Distinct cellular and subcellular patterns of expression imply distinct functions for the Drosophila homologues of moesin and the neurofibromatosis 2 tumor suppressor, merlin. J Cell Biol 133:843852 Miller KG, Field CM, Alberts BM (1989) Actin-binding proteins from Drosophila embryos: a complex network of interacting proteins detected by F-actin affinity chromatography. J Cell Biol 109:29632975 Miyamoto H, Nihonmatsu I, Kondo S, Ueda R, Togashi S, Hirata K, Ikegami Y, Yamamoto D (1995) canoe encodes a novel protein containing a GLGF/DHR motif and functions with Notch and scabrous in common developmental pathways in Drosophila. Genes Dev 9:612625 Moore LA, Broihier HT, Van Doren M, Lunsford LB, Lehmann R (1998) Identification of genes controlling germ cell migration and embryonic gonad formation in Drosophila. Development 125:667678 Mller HAJ, Wieschaus E (1996) armadillo, bazooka, and stardust are critical for early stages in formation of the zonula adherens and maintenance of the polarized blastoderm epithelium in Drosophila. J Cell Biol 134:149163 Nassif C, Daniel A, Lengyel JA, Hartenstein V (1998) The role of morphogenetic cell death during Drosophila embryonic head development. Dev Biol 197:170186 Noirot-Timothee C, Noirot C (1980) Septate and scalariform junctions in arthropods. Int Rev Cytol 63:97140 Nunomura W, Takakuwa Y, Parra M, Conboy JG, Mohandas N (2000) Ca(2+)-dependent and Ca(2+)-independent calmodulin binding sites in erythrocyte protein 4.1. Implications for regulation of protein 4.1 interactions with transmembrane proteins. J Biol Chem 275:63606367 Pearson MA, Reczek D, Bretscher A, Karplus PA (2000) Structure of the ERM protein moesin reveals the FERM domain fold masked by an extended actin binding tail domain. Cell 101: 259270 Perrimon N (1988) The maternal effect of lethal(1)discs-large-1: a recessive oncogene of Drosophila melanogaster. Dev Biol 127:392407 Peters LL, Weier HU, Walensky LD, Snyder SH, Parra M, Mohandas N, Conboy JG (1998) Four paralogous protein 4.1 genes map to distinct chromosomes in mouse and human. Genomics 54:348350 Riesgo-Escovar JR, Jenni M, Fritz A, Hafen E (1996) The Drosophila Jun-N-terminal kinase is required for cell morphogenesis but not for DJun-dependent cell fate specification in the eye. Genes Dev 10:27592768 Schultz J, Copley RR, Doerks T, Ponting CP, Bork P (2000) SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res 28:231234 Shimizu K, Nagamachi Y, Tani M, Kimura K, Shiroishi T, Wakana S, Yokota J (2000) Molecular cloning of a novel NF2/ ERM/4.1 superfamily gene, ehm2, that is expressed in highmetastatic K1735 murine melanoma cells. Genomics 65:113 120 Songyang Z, Fanning AS, Fu C, Xu J, Marfatia SM, Chishti AH, Crompton A, Chan AC, Anderson JM, Cantley LC (1997) Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science 275:7377 Tsukita S, Yonemura S (1997) ERM (ezrin/radixin/moesin) family: from cytoskeleton to signal transduction. Curr Opin Cell Biol 9:7075 Tsukita S, Yonemura S (1999) Cortical actin organization: lessons from ERM (ezrin/radixin/moesin) proteins. J Biol Chem 274: 3450734510 Ward RE, Lamb RS, Fehon RG (1998) A conserved functional domain of Drosophila coracle is required for localization at the septate junction and has membrane-organizing activity. J Cell Biol 140:14631473 Wieschaus E, Nusslein-Volhard C, Jurgens GE (1984) Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. III. Zygotic loci on the X-chromosome and the fourth chromosome. Rouxs Arch Dev Biol 193:296307 Wilson R, Ainscough R, Anderson K, Baynes C, Berks M, Bonfield J, Burton J, Connell M, Copsey T, Cooper J (1994) 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368:3238 Woods DF, Bryant PJ (1991) The discs-large tumor suppressor gene of Drosophila encodes a guanylate kinase homolog localized at septate junctions. Cell 66:451464 Woods DF, Bryant PJ (1993) Apical junctions and cell signalling in epithelia. J Cell Sci Suppl 17:171181 Yip ML, Lamka ML, Lipshitz HD (1997) Control of germ-band retraction in Drosophila by the zinc-finger protein HINDSIGHT. Development 124:21292141 Young PE, Richman AM, Ketchum AS, Kiehart DP (1993) Morphogenesis in Drosophila requires nonmuscle myosin heavy chain function. Genes Dev 7:2941