See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/341297354

YEAST-SPECIAL Genotypic diversity of Saccharomyces cerevisiae spoilers in a

community of craft microbreweries

Article in BrewingScience · January 2006

DOI: 10.23763/BrSc20-06latorre

CITATIONS

6 authors, including:

Diego Libkind
National University of Comahue
210 PUBLICATIONS 2,941 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Metal and acid tolerant yeasts: genomical and physiological characterization and its potential use for bioremediation approaches View project

Start-up View project

All content following this page was uploaded by Diego Libkind on 11 May 2020.

The user has requested enhancement of the downloaded file.

51 March / April 2020 (Vol. 73) YEAST-SPECIAL BrewingScience
Monatsschrift für Brauwissenschaft

M. Latorre, M. Hutzler, M. Michel, M. Zarnkow, F. Jacob and D. Libkind

Genotypic diversity of Saccharomyces The scientific organ

of the Weihenstephan Scientific Centre of the TU Munich
Yearbook 2006
of the Versuchs- und Lehranstalt für Brauerei in Berlin (VLB)
of the Scientific Station for Breweries in Munich

cerevisiae spoilers in a community of craft

of the Veritas laboratory in Zurich
of Doemens wba – Technikum GmbH in Graefelfing/Munich www.brauwissenschaft.de

microbreweries
In brewing, the yeast chosen to conduct the fermentation is one of the key factors that influences the
flavor profile. Yeasts that are deliberately not under the control of the brewer are referred to as “wild yeasts”.
The growth of wild yeasts at any stage of beer production process can cause defects that negatively impact
beer quality. Wild yeasts belonging to the Saccharomyces genus present the greatest risk, given their
physiological and morphological similarity to the inoculated yeast. The production of craft beer in Andean
Patagonia of Argentina has grown considerably and a large community of microbreweries co-exist. Most of
these have strong interactions and share many raw material suppliers. They have not yet installed proper
microbial quality control strategies and wild yeast contamination is challenging. The aim of this article was
to genetically characterize for the first time a high number of S. cerevisiae wild yeasts isolated from craft
beer that originated from Andean Patagonia, and to study the incidence of S. cerevisiae var. diastaticus
contamination. The genetic distinctiveness of 32 wild Saccharomyces was determined using multiple real-time
PCR systems and PCR-amplicon capillary electrophoresis of IGS2 region. All isolates were positive for
Saccharomyces cerevisiae, and 66 % were var. diastaticus (STA1 positive). Intriguingly, a single STA1 positive
isolate was also positive for Saccharomyces bayanus/pastorianus/uvarum and deserves further investigation.
Strain level typification showed a large diversity even in isolates from the same brewery and also permitted the
detection of well-established strains within single breweries. It also evidenced possible cross contaminations
among breweries. This study provides the first insight into the genetic diversity and distribution of a large set
of S. cerevisiae var. diastaticus in a community of microbreweries and provides important information on how
to tackle this problem in the most efficient way and thereby help improve the quality of craft beer.

Keywords: craft beer, Patagonia, spoiler yeast, Saccharomyces cerevisiae var. diastaticus

1 Introduction Patagonian glaciers offer exceptional quality for brewing [3]; II)
Barley is largely produced in La Pampa province and small-scale
Recently, the consumption and production of craft beer has plantations (and posterior malting) are also being developed in
grown rapidly worldwide and in some regions the growth of this Patagonia with promising results; III) Argentina is the only producer
industry has reached 20 – 35 % annually during the past few of hops in Latin America and the principal South-American region
years [1]. As a result, it is common to see multiple independent of cultivation is El Bolsón (near Bariloche) [2]; IV) The discovery
but considerably interconnected microbreweries coexist in certain and identification of the Saccharomyces eubayanus yeast spe-
geographical regions, however, these possess limited microbial cies, missing parent of the Lager hybrid [4, 5] in that geographic
quality control strategies. One example is the Andean region of region, generated great interest in the study and characterization
Argentinean Patagonia where by 2018 there were more than 200 of its fermentative aptitude and its potential application in the beer
microbreweries and more than 40 only in the city of Bariloche industry as a tool for productive diversification and added value.
(with a local population of 108,000 people). [1 and unpublished Fast growth in volume and the number of craft breweries as well
data]. Patagonia has unique conditions for brewing as it offers as the increased consumer demand for quality beers force brew-
all the ingredients needed for brewing: I) Fresh meltwater from ers to constantly search for efficient and affordable quality control
strategies. Microbial contamination has proven to be one of the
https://doi.org/10.23763/BrSc20-06latorre
most important limiting factors for quality improvement in beer in
general and in craft beers in particular [6–8]. The most frequent
Authors microbial spoilers are some specific bacteria and wild yeasts [9].
Growth of wild yeasts during fermentation and/or in the packaged
Mailen Latorre, Diego Libkind, Centro de Referencia en Levaduras y Tec-
nología Cervecera (CRELTEC). Instituto Andino Patagónico de Tecnologías product may lead to multiple defects, including the formation of
Biológicas y Geoambientales (IPATEC), CONICET – Universidad Nacional phenolic, acidic, fatty acid and estery off-flavors, excess of attenu-
del Comahue, Bariloche, Argentina; Mathias Hutzler, Maximilian Michel, ation as well as haze and turbidity [10]. Wild yeasts can be divided
Martin Zarnkow, Fritz Jacob, Technical University of Munich, Research
Center Weihenstephan for Brewing and Food Quality, Freising, Germany; into two groups: those belonging to the Saccharomyces genus
corresponding author: [email protected] and those that are not, the former represent the greatest risk and
BrewingScience YEAST-SPECIAL March / April 2020 (Vol. 73) 52
Monatsschrift für Brauwissenschaft

Table 1 Saccharomyces isolates from Patagonian craft beer during 2016-2019 from 17 in the filling process. A primary contamination
microbreweries using traditional methods of cultivation can lead to a competition with the applied
culture yeast during main fermentation and
Sample Isolation culture
# Isolate Brewery Location Year to a strong increase in the spoilage yeast cell
The scientific organ
format
Yearbook 2006 medium
counts in the fermentation substrate. Usually
of the Weihenstephan Scientific Centre of the TU Munich
of the Versuchs- und Lehranstalt für Brauerei in Berlin (VLB)

1 BBT BRY 1 Bariloche 2019 YM+CuSO4 500ppm

of the Scientific Station for Breweries in Munich
of the Veritas laboratory in Zurich
of Doemens wba – Technikum GmbH in Graefelfing/Munich www.brauwissenschaft.de

occurring as secondary contaminants derived

2 BBT BRY 1 Bariloche 2019 YM+CuSO4 500ppm
from residues in bottles or in the formation
3 BBT BRY 1 Bariloche 2019 YM+CuSO4 500ppm of biofilms, this super-attenuating yeast can
4 BBT BRY 1 Bariloche 2019 YM+CuSO4 500ppm contaminate the finished product directly via
5 BBT BRY 2 Bariloche 2019 YM+CuSO4 500ppm contact with the product through beer lines,
6 BBT BRY 3 Bariloche 2019 LCSM by air circulation in the area of the filling ma-
chine and the capper [17]. In contrast to most
7 Bottle BRY 3 Bariloche 2016 LCSM
brewing strains, S. cerevisiae var. diastaticus
8 Bottle BRY 4 Bariloche 2016 LCSM
frequently sporulates [17], providing oppor-
9 Bottle BRY 5 Bariloche 2016 LCSM tunities for an efficient spread within and be-
10 BBT BRY 6 Bariloche 2019 YM+CuSO4 500ppm tween breweries. To the best our knowledge,
11 Bottle BRY 6 Bariloche 2016 LCSM there are no previous works dealing with the
incidence and distribution of different strains of
12 Bottle BRY 6 Bariloche 2016 LCSM
S. cerevisiae var. diastaticus in microbrewery
13 Bottle BRY 7 Bariloche 2016 LCSM
communities. As a case study, we selected
14 BBT BRY 8 Bariloche 2019 LCSM the region of Andean Patagonia constituted
15 BBT BRY 8 Bariloche 2019 YM+CuSO4 500ppm by a heterogeneous group of small-scale
16 BBT BRY 8 Bariloche 2019 YM+CuSO4 500ppm microbreweries with very different levels of
17 BBT BRY 9 Bariloche 2019 LCSM experience and size, but with a certain level
of relationship due to common raw materials
18 BBT BRY 9 Bariloche 2019 LCSM
and suppliers, sharing of materials (including
19 BBT BRY 9 Bariloche 2018 LCSM yeast slurries), and collaborative joint projects.
20 Bottle BRY 10 Bariloche 2016 LCSM Previous studies showed a high incidence of
21 BBT BRY 11 Bariloche 2017 LCSM microbial contamination in this community as
22 BBT BRY 11 Bariloche 2017 LCSM 69.3 % of the beers analyzed showed sig-
nificant growth of bacteria and/or wild yeasts
23 Bottle BRY 12 El Bolson 2016 LCSM
[18]. The aim of this study was to genetically
24 Bottle BRY 13 El Bolson 2016 LCSM
characterize suspected Saccharomyces wild
25 Bottle BRY 14 El Bolson 2016 LCSM yeasts at the strain level, isolated from craft
26 Bottle BRY 14 El Bolsón 2016 LCSM beers of Andean Patagonia in Argentina with a
27 Bottle BRY 14 El Bolsón 2016 LCSM special focus on S. cerevisiae var. diastaticus
diversity and distribution.
28 Bottle BRY 14 El Bolsón 2016 LCSM
29 Bottle BRY 15 Epuyen 2016 LCSM
30 Bottle BRY 15 Epuyen 2016 LCSM 2 Materials and methods
31 Bottle BRY 16 Epuyen 2016 LCSM
32 Bottle BRY 17 Córdoba 2017 LCSM 2.1 Yeast isolates and strains

From 2016 – 2019, a total of 32 Saccharo-

its detection and control is challenging due to their physiological myces spoilage yeast isolates were obtained from 120 samples
and morphological similarity to the inoculated yeast. In particular, of finished beer taken from bright beer tanks (BBT) and bottles
diastatic strains of Saccharomyces cerevisiae [11], also referred (Table 1). All of them were isolated from ale type beers brewed in 17
as S. cerevisiae var. diastaticus in many publications for super- craft microbreweries from different locations in Andean Patagonia
attenuating/highly fermentative yeasts [12, 13]. These strains are (Argentina) with the exception of one strain from the province of
able to metabolize residual carbohydrates in naturally conditioned Cordoba (Argentina). Lin’s Cupric Sulfate Medium (LCSM) [19]
beers such as complex dextrins and starches due to the presence or YM with 500 ppm of cupric sulfate was used for detection and
of STA genes encoding for the enzyme glucoamylase [14]. As the isolation. These were preliminary identified as members of the
STA genes are not present in S. cerevisiae brewing strains, these Saccharomyces genus using MALDI-TOF according to previous
genes can be used for specific identification of S. cerevisiae var. reports [20, 21].
diastaticus [15]. Recently, it was demonstrated that the sole detec-
tion of the STA gene is not diagnostic of diastatic activity [17] given 2.2 Genetic identification and typification of isolates
that alleles with certain deletions might affect the synthesis of the
enzyme [16]. S. cerevisiae var. diastaticus occurs as a primary The genetic distinctiveness of each isolate was studied using
contaminant in yeast/fermentations and as a secondary contaminant qualitative real-time PCR according to Hutzler et al. [22]. For strain
53 March / April 2020 (Vol. 73) YEAST-SPECIAL BrewingScience
Monatsschrift für Brauwissenschaft

Table 2 Qualitative real-time PCR systems for differentiation of brewing-related yeast species [22–24]

Real-time PCR systems, primer and probe sequences (5´--

System name Reference S. cer. S. past. S. cer. var. dia.
>3´)
Sc-f CAAACGGTGAGAGATTTCTGTGC The scientific organ
Yearbook 2006
Sce Sc-r GATAAAATTGTTTGTGTTTGTTACCTCTG [25, 26] + + +
of the Weihenstephan Scientific Centre of the TU Munich
of the Versuchs- und Lehranstalt für Brauerei in Berlin (VLB)
of the Scientific Station for Breweries in Munich
of the Veritas laboratory in Zurich

Sc FAM-ACACTGTGGAATTTTCATATCTTTGCAACTT-BHQ1
of Doemens wba – Technikum GmbH in Graefelfing/Munich www.brauwissenschaft.de

TF-f TTCGTTGTAACAGCTGCTGATGT
TF-COXII TF-r ACCAGGAGTAGCATCAACTTTAATACC [23] + – +
TF-MGB FAM-ATGATTTTGCTATCCCAAGTT-BHQ1
BF300E CTCCTTGGCTTGTCGAA
BF-300 BF300M GGTTGTTGCTGAAGTTGAGA [25] – + –
BF300 FAM-TGCTCCACATTTGATCAGCGCCA-BHQ1
Sbp-r1 TTGTTACCTCTGGGCGTCGA
Sbp Sbp-r2 GTTTGTTACCTCTGGGCTCG [25, 26] – + –
Sbp ACTTTTGCAACTTTTTCTTTGGGTTTCGAGCA
Sd-f TTCCAACTGCACTAGTTCCTAGAGG
Sdia Sd-r GAGCTGAATGGAGTTGAAGATGG [25] – – +
Sdia FAM-CCTCCTCTAGCAACATCACTTCCTCCG-BHQ1

typification, a method based on a PCR-amplicon capillary electro- was considered to be positive when the Ct value (cycle threshold),
phoresis of partial intergenic spacer 2 (IGS2) fragment (IGS2-314 defined as the number of cycles required for the fluorescent signal
PCR-capillary electrophoresis) was employed [17]. to cross the threshold, was less than 30.

2.2.1 DNA extraction 2.2.3 PCR-DNA sequencing (D1/D2 26S rRNA gene and ITS)

To extract the DNA from each investigated yeast isolate these were The identity of isolates with ambiguous results obtained by RT-
cultured in YM agar slants for 48 hrs and an inoculation loop was PCR were confirmed by sequence analysis of the D1/D2 26S and
used to transfer this to a 1.5 mL tube. It was mixed with an aliquot ITS1-5.8S-ITS2 ribosomal DNA according to previous reports [27].
of 200 μL InstaGeneTM Matrix solution (Biorad, Munich, Germany).
Each tube was vortexed for ten seconds and incubated at 56 °C 2.2.4 DNA fingerprinting (PCR-capillary electrophoresis of
for 30 minutes, followed by another ten seconds of vortexing and the IGS2-314 fragment)
incubation at 96 °C for eight minutes. The incubation steps oc-
curred in a Thermomix 5436 (Eppendorf, Hamburg, Germany). For strain typification, genetic fingerprints were generated, based
After incubation, the tubes were centrifuged at 13,000 g for two on the study of the. IGS2 spacer region within the ribosomal gene
minutes then a 100 μL aliquot of the supernatant containing the cluster, using the IGS2-314 method [23]. For partial sequencing
DNA was transferred to a new 1.5 mL tube [17]. of the intergenic spacer 2 (IGS2-314) the specific primers IGS2-
314f(5’-CGGGTAACCCAGTTCCTCACT-3’) and IGS2-314r(5’-
2.2.2 Real-time polymerase chain reaction (RT-PCR) TAGCATATATTTCTTGTGTGAGAAAGGT-3’) [28] were used at
a concentration of 600 nM as described by Hutzler, Geiger and
Real-time PCR (Light Cycler® 480 II. Roche Diagnostics Deutschland Jacob [23]. PCR was performed with 22.5 μL RedTaq Mastermix
GmbH, Mannheim, Germany) was used to taxonomically classify (2 x) (Genaxxon, Ulm, Germany) and 2.5 μL template DNA with a
the isolates. The primer and TaqMan® probe sequences used are total reaction volume of 25 μL. The Mastermix contained 12.5 μL
listed in Table 2 and the RT-PCR procedure followed that of Hut- buffer solution (RedTaq Mastermix), 7.0 μL DNA-free PCR water
zler [23]. All RT-PCR systems listed in Table 2 are compatible and and 1.5 μL of each primer (Biomers, Munich, Germany). Cycling
were performed with 10 μL 2x Mastermix (Light Cycler® 480 Probe parameters were: A pre-denaturing step at 95 °C for 300 s, then 35
Master, Roche, Germany), 1.4 μL ddH2O PCR water, 0.8 μL (400 cycles for denaturing at 95 °C for 30 s, for annealing and elongation
nM) of each primer (Biomers, Ulm, Germany), 0.4 μL (200 nM) at 54 °C for 30 s and 72 °C for 40 s and for final elongation at 72 °C
probe (Biomers, Ulm, Germany; MGB probe from ThermoFisher for 300 s. PCR was performed using a SensoQuest LabCycler48s
scientific, Applied Biosystems®, USA), 0.5 μL IAC135-f (250 nM), (SensoQuest GmbH, Gottingen, Germany). Amplified fragments
0.5 μL IAC135-r (250 nM), 0.4 μL IAC135-S (HEX) (200 nM), 0.1 μL were analyzed using a capillary electrophoresis system (Agilent
IAC135 (dilution 1: 10 – 13), 0.1 μL IAC135 rev (dilution 1: 10  – 13) DNA 1000 kit) following the manufacturer`s recommendations
and 5 μL template DNA with a total reaction volume of 20 μL, using (lab on a chip, Bioanalyzer Agilent 2100, Agilent Technologies,
the same temperature protocol: 95 °C / 10 min; 40 cycles of 95 °C Santa Clara, CA, USA).
/ 10 s, 60 °C / 55 s; 20 °C. IAC135 was developed by Riedl at the
Research Center Weihenstephan for Brewing and Food Quality of 2.2.5 Dendrogram analysis of the IGS2-314 fingerprint
the Technical University Munich. IAC (internal amplification con- patterns
trol) is a control to confirm that the PCR reaction itself took place.
The yeast strains S. cerevisiae (LeoBavaricus - TUM 68®) and S. Based on the specific capillary electrophoresis IGS2-314 rDNA
pastorianus (Frisinga - TUM 34/70®) were used as a positive and patterns, a dendrogram was built using the Bionumerics program
negative control according to the RT-PCR system tested. The signal 7.6 (Applied Maths, Belgium) to show the relationship between
BrewingScience YEAST-SPECIAL March / April 2020 (Vol. 73) 54
Monatsschrift für Brauwissenschaft

Table 3 Qualitative real-time PCR systems for Saccharomyces spp. differentiation [22–24] present in S. cerevisiae, S. pastorianus, S.
Sce BF300 TF Sbp Sdia paradoxus and S. cariocanus [26], in line
Strain #
(Ct value) (Ct value) (Ct value) (Ct value) (Ct value) with MALDI-TOF data. Unsurprisingly, all
The scientific organ
1 + (20.82)
Yearbook 2006 – + (24.16) – – isolates were negative for Saccharomyces
pastorianus BF 300 system (BF = bottom
of the Weihenstephan Scientific Centre of the TU Munich
of the Versuchs- und Lehranstalt für Brauerei in Berlin (VLB)

2 + (18.50) – + (21.95) – –
of the Scientific Station for Breweries in Munich
of the Veritas laboratory in Zurich
of Doemens wba – Technikum GmbH in Graefelfing/Munich www.brauwissenschaft.de

fermenting). The BF300 Primer system was

3 + (20.49) – + (22.18) – –
generated via subtractive hybridization and
4 + (20.59) – – – –
subsequent design of a real-time PCR system
5 + (26.41)* –* –* + (22.22)* + (27.04)* and is also a marker for S. pastorianus and
6 + (20.38) – + (23.62) – + (25.30) some S. bayanus strains [25]. Twenty-eight
7 + (18.98) – + (21.11) – – isolates were positive for the PCR system
TF-COXII based on the mitochondrial COXII
8 + (19.84) – + (21.59) – + (26.44)
genetic marker. This primer system is used to
9 + (18.55) – + (18.85) – + (23.35)
differentiate Saccharomyces cerevisiae from
10 + (19.07) – – – + (26.06) S. pastorianus, S. uvarum and S. bayanus
11 + (18.98) – + (21.89) – + (26.54) [23]. Isolate 5 represented a unique case
12 + (21.31) – + (24.98) – + (26.84) given it was the only positive yeast for the
13 + (19.58) – + (22.44) – + (26.23) Sbp system (located on the ITS1-5.8S-ITS2)
which detects species belonging to either
14 + (19.43) – + (23.88) – + (24.92)
S. bayanus, S. pastorianus, S. uvarum or
15 + (17.62) – – – + (22.16) S. eubayanus. Twenty-one isolates were
16 + (18.76) – + (23.22) – + (23.69) positive for the STA1 gene marker which was
17 + (18.11) – + (23.02) – + (27.88) designed to specifically detect S. cerevisiae
18 + (19.07) – + (22.24) – + (25.57) var. diastaticus, given this gene is responsible
for the synthesis of glucoamylase enzyme that
19 + (22.09) – – – + (27.97)
allows dextrin assimilation leading to super-
20 + (20.07) – + (23.26) – + (25.57)
attenuated beers. The remaining 11 isolates
21 + (20.94) – + (22.04) – + (25.70) that were negative for Sdia were positive for
22 + (18.78) – + (20.09) – – TF-COXII system, suggesting that they could
23 + (20.88) – + (23.55) – – be a brewing ale strain or a STA1 negative
Saccharomyces cerevisiae spoiler.
24 + (20.08) – + (22.99) – + (25.61)
25 + (20.51) – + (22.06) – + (25.45)
The isolates 4, 5, 10, 15, 19 and 30 showed
26 + (17.38) – + (18.34) – – ambiguous RT-PCR results. For this reason,
27 + (18.04) – + (19.23) – – one additional system was used according to
28 + (17.82) – + (19.80) – – Salinas et. al. [22, 29] to detect S. cerevisiae
29 + (19.68) – + (22.94) – + (24.46) top-fermenting yeast. With the exception of
isolate 5 all the isolates had positive signals
30 + (20.11) – – – + (26.43)
confirming their S. cerevisiae identity: 4 (Ct
31 + (21.14) – + (23.88) – + (26.80) value = 27.01), 10 (Ct value = 25.26),15 (Ct
32 + (19.93) – + (24.06) – – value = 23.26), 19 (Ct value = 27.99), and 30
(*) Average results of two replicates (Ct value = 27.14). It is probable that these
isolates have nucleotide differences at the
the investigated yeast isolates and reference top-fermenting strain COXII target sequences of the TF Real-Time PCR system, given
Saccharomyces cerevisiae SafAle S-04 and SafAle US-05 of Fer- a considerable variability in this sequence for S. cerevisiae has
mentis®. The clustering was built using a Dice similarity coefficient been reported previously [5, 30]. Due to the Sdia system (STA1 +)
and the methodology applied was UPGMA. The patterns were positive result these 5 isolates were considered to be S. cerevisiae
optimized using an optimization degree of 0.3 % and a tolerance var. diastaticus. Taking into account all the positive results for Sdia
set of 1 % with a tolerance change of 0.2 %. loci, 66 % of the total isolates can be assigned to S. cerevisiae
var. diastaticus, representing 17.5 % of the beer samples ana-
lyzed (N = 120) and 47 % of the breweries studied (N = 45). Thus,
3 Results and discussion this species becomes the most relevant yeast contaminant of the
southern Argentina craft beer industry. Given that there not many
All 32 yeast isolates that were confirmed as belonging to the studies focusing on the incidence of S. cerevisiae var. diastaticus
genus Saccharomyces by the MALDI-TOF approach were ana- in brewing, these values are hard to compare and discuss. For
lyzed using five specific Saccharomyces real-time polymerase example, Meier-Dörnberg et al. [11] found higher values given that
chain reaction (RT-PCR) systems (Table 2) and the results are between 2008 and 2017, 56 % of the 100 samples of beer tested
shown in table 3. The RT-PCR results showed that all isolates contained S. cerevisiae var. diastaticus. Isolate 5 represents a
were positive for Sce locus which detects ITS1-5.8S-ITS rDNA salient case given it was positive for the Salinas et al. system (Ct
55 March / April 2020 (Vol. 73) YEAST-SPECIAL BrewingScience
Monatsschrift für Brauwissenschaft

value = 26.74) and Sdia system but was also

positive for Sbp. Consequently, the ITS and
D1/D2 regions were sequenced. The results
showed 100 % identity with Saccharomy- Yearbook 2006
The scientific organ

ces uvarum CBS 395 (accession number

of the Weihenstephan Scientific Centre of the TU Munich
of the Versuchs- und Lehranstalt für Brauerei in Berlin (VLB)
of the Scientific Station for Breweries in Munich
of the Veritas laboratory in Zurich
of Doemens wba – Technikum GmbH in Graefelfing/Munich www.brauwissenschaft.de

NR153310.1). Further studies are needed

to clarify the situation of this particular strain,
including WGS in order to detect a possible
hybrid scenario.

The PCR amplification of the IGS2-314 locus

was used to typify the isolates and the two
main top-fermenting yeasts used by craft
breweries in Argentina were included in the
analysis as references (Fig. 1). The results
show a great genetic diversity among the
isolates for the IGS2-314 locus and all iso-
lates had different banding patterns to the
reference strains, strain 27 being the most
similar to strain S-04 (81.8 % of similarity). The
reference strain US-05 had very low similarity
(< 21 %) with the rest of the studied isolates.
Eight of the 17 breweries from which isolates
were studied here had multiple isolates and
for 75 % of these cases (6 out of 8 breweries)
the isolates from the same brewery did not
share similar banding patterns (e. g BRY 1,
BRY 3, BRY 6, BRY 11, BRY 14 and BRY 15).
For example, breweries 6 and 14 had three Fig. 1 IGS2-314 rDNA band-based genetic relationship between Saccharomyces cerevi-
isolates each and based on our typification siae spoiler isolates (dendrogram built with Bionumerics 7.6). The dots indicate
STA1-positive strains thus S. cerevisiae var. diastaticus identity. The code of the
approach all belong to distinct strains. The brewery (BRY) is in the right side of the figure
genetic heterogeneity found between strains
from the same brewery suggest diversity of spoiler yeasts possibly indeed an important and interesting aspect. The craft beer industry
associated with different contamination events and sources. On in this region has only started in the last few years, before that there
the other hand, for breweries with multiple isolates such as BRY were almost no small local breweries. Nevertheless, similar beer
1, 8 and 9 identical (100 % similarity) or almost identical (88.9 % spoilers have settled in the breweries, which are also located in
for BRY 1) it was also possible to detect genetic fingerprints for 3 different geographic areas. This shows that the substrate and the
isolates in each case (Fig. 1). This is an indication that those strains respective environments are very similar. As far as the substrate
are well established in one particular brewery and is spread to the is concerned, it is obvious that water, malt (probably mainly pale
different batches by contaminated re-pitching brewing yeast, other barley malt), were used in similar grist portions and similar hop
process pathways or improperly sanitized equipment and surfaces. products with similar hopping techniques. In any case, there are
An interesting case is that of BRY 9 where STA-positive isolate many possibilities that beer-spoiling yeasts can find niches. In
19 was obtained almost one year before the genetically identical addition, the breweries certainly have connection points and likely
isolates 18 and 17. The brewery moved their facilities to a new help each other out with raw materials. One alternative reason for
location in between the collection of the isolates, which suggests the similar wild yeasts found in different breweries could be the use
that this strain is strongly established in the brewery equipment. of the same dry yeast strains and suppliers given contaminated
dry yeast and more likely re-pitched dry yeast can be a potential
Another interesting finding is the high number of cases (5) in which source of wild yeast contaminations.
similar genetic patterns (> 89.0 % of similarity) and STA condition
were obtained for isolates of different breweries. For example, In terms of the distribution of STA+ condition and thus var. dia-
isolates 14, 15 and 16 (BRY 8) are identical to isolate 23 (BRY staticus identity among the dendrogram, we observed that this
12), also isolates 8 (BRY 4) and 21 (BRY 11); 6 (BRY 3) and 29 trait is considerably widespread among most of the groups with a
(BRY 15); 12 (BRY 6) and 30 (BRY 15); and isolates 11 (BRY 6), few exceptions of clusters of isolates that have either positive and
25 (BRY 10) and 20 (BRY 14). These results suggest potential negative STA cases. Probably the most notable case is that of the
cases of cross contamination between breweries due to some kind cluster of isolates 14, 15, 16 and 23 with 100 % similarity (Fig. 1),
of interaction like contract filling, beer or yeast slurry exchange, the latter being STA- and the rest positive. It should be noted that
or even collaborative beer projects. Another explanation could be isolate 23 comes from a different brewery and a close inspection of
that the breweries share the same provider for raw materials or the banding patterns suggests the existence of a slight difference
equipment. The possible connection of contamination pathways is in the size of the unique diagnostic band that should be further
BrewingScience YEAST-SPECIAL March / April 2020 (Vol. 73) 56
Monatsschrift für Brauwissenschaft

studied to confirm if it belongs to the same strain as the other 3 produced, and the need to eliminate non-sanitary equipment or
isolates. It was observed that 4 of the 8 breweries with more than accessories, implement proper cleaning and sanitizing protocols
1 isolate analyzed, showed strains that were positive for STA1 and microbial quality control strategies in the breweries. This is the
and negative to this
Yearbook 2006
The scientific organ
gene. Given the lack of information of how the first study that provides source tracking profiles at a strain level
STA gene is spread among brewing-related S. cerevisiae strains of a high number of S. cerevisiae var. diastaticus isolates that
of the Weihenstephan Scientific Centre of the TU Munich
of the Versuchs- und Lehranstalt für Brauerei in Berlin (VLB)
of the Scientific Station for Breweries in Munich
of the Veritas laboratory in Zurich
of Doemens wba – Technikum GmbH in Graefelfing/Munich www.brauwissenschaft.de

and within the brewery environment, it is difficult to draw more show strain distribution within one specific brewery and across
conclusions from the correlation of the presence of the STA gene different breweries in one geographical region. There are some
and the isolates genetic typification. recent S. cerevisiae var. diastaticus studies but their focus is more
on strain characterization and statistical distribution than strain
The genetic typification again showed isolate 5 as a unique case, tracking across different connected breweries [16]. The applied
given it displays a banding pattern very different from the others methods in this article and the data collected have the potential
(only 46.5 % similarity) confirming that it is a very interesting strain to assess different contamination sources and routes in order to
that requires a deeper analysis. improve the quality of Argentine craft beers. The strains studied in
this work were cryo-preserved and incorporated into the IPATEC
microbial collection given that they will be useful as a reference
4 Conclusions for designing strategies for the detection and control of spoilage
microorganisms in micro-breweries, the study of their physiological
The identity and genetic distinctiveness of 32 suspected S. cer- and genetic characteristics, as well as their potential application
evisiae isolates regarded as beer contaminants from craft beers in brewing innovation.
produced in Argentinian Patagonia was determined using a com-
bination of methodologies including MALDI-TOF, real-time PCR Acknowledgements
and PCR-amplicon capillary electrophoresis. The real-time PCR
approach proved useful for a rapid confirmation of S. cerevisiae The present work was financially supported by Universidad Nacional
identity and the detection of STA-positive isolates hence assign- del Comanue (B199), CONICET (PIP11220130100392CO) and
ment to S. cerevisiae var. diastaticus, which was the majority of the Ministerio de Educación (SPU) with projects funded to DL. ML is
isolates (66 %). The IGS2-314 analysis provided the right level of a CONICET PhD fellow.
genetic variability among the isolates to allow finding very interest-
ing cases such as 3 different breweries with multiple isolates of
the same strain, and also several different breweries with putative 5 References
identical contaminant strains. Both studies agreed on the genetic
uniqueness of isolate 5, which deserves further attention. A working 1. Libkind, D. and Bruzone, C.: La madre estaba en la Patagonia, Alimentos
hypothesis could be that it represents a hybrid of S. uvarum and a Argentinos. Ministerio de Agroindustria de la Nación., (2018), p. 82.
STA+ S. cerevisiae strain, for which genome sequencing analysis 2. Lugones, G.; Britto, F.; Carro, A.; Lugones, M.; Quiroga, J.; Reinoso,
will be applied in the future. The large genetic diversity of strains L.; Monasterios, C. and Serovic, L.B.: Asociación ciencia-empresa para
(and STA gene condition) found even among isolates of some la “domesticación” de la levadura andina y la introducción de mejoras
breweries suggests that craft breweries in Patagonia, Argentina, en la producción de cerveza, (2019), p. 65.
are in contact with a large diversity of S. cerevisiae beer spoilers 3. Toncek, A.: Cervezas de los Andes, Caleuche, Rio Negro, Argentina,
possibly associated with distinct contamination events/sources. It 2016.
is worth mentioning that is almost impossible to find wild S. cer- 4. Libkind, D.; Hittinger, C.T.; Valerio, E.; Goncalves, C.; Dover, J.; John-
evisiae strains in the natural environment of Andean Patagonia [4, ston, M.; Goncalves, P. and Sampaio, J.P.: Microbe domestication
31]. Thus, most probably these contaminants arrive to the brewery and the identification of the wild genetic stock of lager-brewing yeast,
with raw material and establish there when possible, as seen in Proceedings of the National Academy of Sciences, 108 (2011), no. 35,
a few breweries in this study where the same strain appears sev- pp. 14539-14544.
eral times, even after moving to a different location. In addition, 5. Peris, D.; Sylvester, K.; Libkind, D.; Gonçalves, P.; Sampaio, J.P.; Al-
more than a few breweries shared contaminant strains, which exander, W.G. and Hittinger, C.T.: Population structure and reticulate
is indicative of cross contamination maybe arising from several evolution of Saccharomyces eubayanus and its lager-brewing hybrids,
type of interactions and exchanges that are common to the craft Molecular Ecology, 23 (2014), no. 8, pp. 2031-2045.
industry. Saccharomyces var. diastaticus (STA1-positive) was 6. Manzano, M.; Iacumin, L.; Vendrames, M.; Cecchini, F.; Comi, G.
the most relevant case in this study and showed a large genetic and Buiatti, S.: Craft Beer Microflora Identification Before and After a
heterogeneity, indicating the existence of multiple strains for this Cleaning Process, Journal of the Institute of Brewing, 117 (2011), no.
yeast. Hopefully, additional WGS studies will allow us to gain a 3, pp. 343-351.
better understanding of genomic basis of this strain differentiation 7. Giovenzana, V.; Beghi, R. and Guidetti, R.: Rapid evaluation of craft
and the mechanisms by which STA genes spread among spoiling beer quality during fermentation process by vis/NIR spectroscopy,
strains. Overall, the data shows that S. cerevisiae var. diastaticus Journal of Food Engineering, 142 (2014), pp. 80-86.
is an important contaminant in the brewing industry and is clearly 8. Back, W.: Atlas and Handbook of Beverage Biology, Hans Carl Verlag,
one of the most frequent yeast spoilers in the craft industry based Nuremberg, Germany, 2006.
in the south of Argentina. Despite the rapid growth of the craft 9. Deak, T.: Handbook of Food Spoilage Yeasts, CRC Press, 2007.
breweries in Patagonia, Argentina, our findings indicate that more 10. Moretti, E.: Development of guidelines for microbiological control in
attention should be paid to the microbiological quality of the beers microbrewery, Department Of Economical and Food Science. University
57 March / April 2020 (Vol. 73) YEAST-SPECIAL BrewingScience
Monatsschrift für Brauwissenschaft

of Perugia, (2013), p. 72. 22. Hutzler, M.; Koob, J.; Schneiderbanger, H.; Mueller-Auffermann, K. and
11. Meier-Dörnberg, T.; Jacob, F.; Michel, M. and Hutzler, M.: Incidence of Jacob, F.: Yeast identification and characterization, Brewing Microbiol-
Saccharomyces cerevisiae var. diastaticus in the Beverage Industry: ogy Managing Microbes, Ensuring Quality and Valorising Waste, 1st
Cases of Contamination, 2008 – 2017, Master Brewers Association of ed. Hill, A. ed., Woodhead Publishing, London, (2015), pp. 65-104.
Yearbook 2006
The scientific organ

the Americas TQ, 54 (2017), no. 4, pp. 140-148. 23. Hutzler, M.; Geiger, E. and Jacob, F.: Use of PCR-DHPLC (Polymerase
of the Weihenstephan Scientific Centre of the TU Munich
of the Versuchs- und Lehranstalt für Brauerei in Berlin (VLB)
of the Scientific Station for Breweries in Munich
of the Veritas laboratory in Zurich
of Doemens wba – Technikum GmbH in Graefelfing/Munich www.brauwissenschaft.de

12. Jespersen, L.; van der Aa Kühle, A. and Petersen, K.M.: Phenotypic Chain Reaction-Denaturing High Performance Liquid Chromatography)
and genetic diversity of Saccharomyces contaminants isolated from for the Rapid Differentiation of Industrial Saccharomyces pastorianus
lager breweries and their phylogenetic relationship with brewing yeasts, and Saccharomyces cerevisiae Strains, Journal of the Institute of
International Journal of Food Microbiology, 60 (2000), no. 1, pp. 43-53. Brewing, 116 (2010), no. 4, pp. 464-474.
13. Marín-Navarro, J.; Gurgu, L.; Alamar, S. and Polaina, J.: Structural and 24. Sampaio, J.P.; Pontes, A.; Libkind, D. and Hutzler, M.: Taxonomy,
functional analysis of hybrid enzymes generated by domain shuffling diversity, and typing of brewing yeasts, Brewing Microbiology: Current
between Saccharomyces cerevisiae (var. diastaticus) Sta1 glucoam- Research, Omics and Microbial Ecology, Bokulich and Bamforth ed.,
ylase and Saccharomycopsis fibuligera Bgl1 β-glucosidase, Applied (2017), Caister Academic Press Norfolk, UK, pp. 85-118.
Microbiology and Biotechnology, 89 (2011), no. 1, pp. 121-130. 25. Brandl, A.: Entwicklung und Optimierung von PCR-Methoden zur De-
14. Adam, A.C.; Latorre-García, L. and Polaina, J.: Structural analysis of tektion und Identifizierung von brauereirelevanten Mikroorganismen
glucoamylase encoded by the STA1 gene of Saccharomyces cerevisiae zur Routine-Anwendung in Brauereien, 119-133 (2006).
(var. diastaticus), Yeast, 21 (2004), no. 5, pp. 379-388. 26. Josepa, S.; Guillamon, J.M. and Cano, J.: PCR differentiation of Sac-
15. Balogh, I. and Maráz, A.: Presence of STA gene sequences in brewer’s charomyces cerevisiae from Saccharomyces bayanus/Saccharomyces
yeast genome, Letters in Applied Microbiology, 22 (1996), no. 6, pp. pastorianus using specific primers, FEMS Microbiology Letters, 193
400-404. (2000), no. 2, pp. 255-259.
16. Krogerus, K.; Magalhães, F.; Kuivanen, J. and Gibson, B.: A deletion 27. Hutzler, M.: Entwicklung und Optimierung von Methoden zur Identifi-
in the STA1 promoter determines maltotriose and starch utilization in zierung und Differenzierung von getränkerelevanten Hefen, Dissertation,
STA1+ Saccharomyces cerevisiae strains, Applied Microbiology and TU München. (2009), p. 283.
Biotechnology, 103 (2019), no. 18, pp. 7597-7615. 28. Büchl, N.R.; Hutzler, M.; Mietke-Hofmann, H.; Wenning, M. and Scherer,
17. Meier-Dörnberg, T.; Kory, O.I.; Jacob, F.; Michel, M. and Hutzler, M.: S.: Differentiation of probiotic and environmental Saccharomyces
Saccharomyces cerevisiae variety diastaticus friend or foe? – spoilage cerevisiae strains in animal feed, Journal of Applied Microbiology, 109
potential and brewing ability of different Saccharomyces cerevisiae (2010), no. 3, pp. 783-791.
variety diastaticus yeast isolates by genetic, phenotypic and physi- 29. Salinas, F.; Garrido, D.; Ganga, A.; Veliz, G. and Martínez, C.: Taqman
ological characterization, FEMS Yeast Research, 18 (2018), no. 4. real-time PCR for the detection and enumeration of Saccharomyces
18. Latorre, M.: Contaminantes microbianos en cervezas artesanales cerevisiae in wine, Food Microbiology, 26 (2009), no. 3, pp. 328-332.
embotelladas de la Patagonia Andina, Licenciate Thesis, Universidad 30. Peris, D.; Langdon, Q.K.; Moriarty, R.V.; Sylvester, K.; Bontrager, M.;
Nacional del Comahue, Bariloche, Argentina, 2016. Charron, G.; Leducq, J.-B.; Landry, C.R.; Libkind, D. and Hittinger,
19. Lin, Y.: formulation and testing of cupric sulphate medium for wild C.T.: Complex Ancestries of ager-Brewing Hybrids Were Shaped by
yeast detection, Journal of the Institute of Brewing, 87 (1981), no. 3, Standing Variation in the Wild Yeast Saccharomyces eubayanus, PLOS
pp. 151-154. Genetics, 12 (2016), no. 7, p. e1006155.
20. Lauterbach, A.; Usbeck, J.C.; Behr, J. and Vogel, R.F.: MALDI-TOF 31. Eizaguirre, J.I.; Peris, D.; Rodríguez, M.E.; Lopes, C.A.; De Los Ríos, P.;
MS typing enables the classification of brewing yeasts of the genus Hittinger, C.T. and Libkind, D.: Phylogeography of the wild Lager-brewing
Saccharomyces to major beer styles, Plos One, 12 (2017), no. 8, p. ancestor (Saccharomyces eubayanus) in Patagonia: Saccharomyces
e0181694. eubayanus in Patagonia, Environmental Microbiology, 20 (2018), no.
21. Usbeck, J.C.; Kern, C.C.; Vogel, R.F. and Behr, J.: Optimization of ex- 10, pp. 3732-3743.
perimental and modelling parameters for the differentiation of beverage
spoiling yeasts by Matrix-Assisted-Laser-Desorption/Ionization –Time-
of-Flight Mass Spectrometry (MALDI–TOF MS) in response to varying
growth conditions, Food Microbiology, 36 (2013), no. 2, pp. 379-387. Received 29 January 2020, accepted 25 March 2020

View publication stats