Ok - BIOL 30035 - General Microbiology For BS Biology

General
Microbiology
A Modular Approach for
BS Biology students
(BIOL 30035)
Bautista, Cano, Reboa, Rodriguez

Photo Description:
SEM images of novel coronavirus
Photo Compliments to:

NIAID/Flickr, CC BY 2.0. thru http://science.thewire
Bautista, Cano, Reboa, Rodriguez were faculty from the Department of Biology, College
of Science, Polytechnic University of the Philippines.
General Instructions
Please do not write on this module. Answers to this module should be written in a separate
short, white bond paper bearing the subject title, full name, and course, year and section.
Follow the format for every activity, especially if the activity will be consisting of more than
one page. Do not forget to include the basic information, activity number and the page
number. Compile your answers and staple them together.
The Authors
GENERAL MICROBIOLOGY
(BIOL 30035)
A Modular Approach for BS Biology
students
by
Bautista, Cano, Reboa, Rodriguez
TABLE OF CONTENTS
Page No.
MODULE 1: HISTORY AND SCOPE OF MCIROBIOLOGY
Lesson 1 Evolution of Microbiology 1
Lesson 2 Origins of Microbiology 2
Lesson 3 Different Theories in Microbiology 2
Lesson 4 Diversity of Microorganism 2
Lesson 5 Impact of Microorganism 3
MODULE 2: MICROBIAL TAXONOMY

Lesson 1 Etymology and Definition 5
Lesson 2 Taxonomic Categories 5
Lesson 3 Major Taxonomic Characteristics 6
Lesson 4 Components of Taxonomy 6
Lesson 5 Classification on Hierarchy 7
Lesson 6 Microbial Phylogeny 9
MODULE 3: MICROBIAL DIVERSITY

Lesson 1 Definition of Terms 14
Lesson 2 Concept of Functional Diversity 14
Lesson 3 Diversity of Phototropic Bacteria 15
Lesson 4 Morphologically Diverse Bacteria 19
MODULE 4: MICROBIAL CELL STRUCTURE AND FUNCTION

Lesson 1 Cell Morphology and Arrangement 23
Lesson 2 Prokaryotic Cell and its Structural Parts 24
Lesson 3 Eukaryotic Cell and its Structural Parts 29
MODULE 5: MICROBIAL GROWTH

Lesson 1 Growth Requirements 33
Lesson 2 Physical Requirement 33
Lesson 3 Chemical Requirement 34
Lesson 4 Cell Division 34
Lesson 5 Microbial Growth and Quantification 35
Lesson 6 Measuring Number of Microbes 36
MODULE 6: MICROBIAL METABOLISM

Lesson 1 Microbial Nutrients 38
Lesson 2 Transporting Nutrients into the Cell 38
Lesson 3 Energy Classes of Microorganism 39
Lesson 4 Catabolism, Fermentation and Respiration 40
Lesson 5 Biosyntheses 41
MODULE 7: MICROBIAL GENETICS

Lesson 1 Structure of DNA & RNA 44
Lesson 2 Mutation 49
Lesson 3 Gene Transfer Mechanisms in Prokaryotes 52
MODULE 8: VIRAL GENOMES AND DIVERSITY

Lesson 1 Nature of Viruses 55
Lesson 2 Viruses Genome 56
Lesson 3 Taxonomy of Viruses 56
Lesson 4 Viral Replication 57
Lesson 5 Viral Infection 58
MODULE 9: BIOSAFETY AND SECURITY

Lesson 1 Biorisk and Biorisk Management 62
Lesson 2 Biosafety Principles and Biosafety Level 65
Lesson 3 Biosecurity 69
MODULE 10: MICROBIAL CONTROL AND DESTRUCTION

Lesson 1 Physical Method of Microbial Control 71
Lesson 2 Chemical Method of Microbial Control 73
MODULE 11: MICROBIAL APPLICATION IN ENVIRONMENTAL
SCIENCE AND INDUSTRY
Lesson 1 Properties of Microorganism Useful in the Industry 75
Lesson 2 Primary vs Secondary Metabolites 75
Lesson 3 Major Products for the Health Industry 76
Lesson 4 Major Industrial Products for Food and Beverage 77
Industries
GENERAL
MICROBIOLOGY
Lecture Module
GENERAL MICROBIOLOGY: A Modular Approach for BS Biology Students 1
by Bautista, Cano. Reboa, and Rodriguez
MODULE 1: HISTORY AND SCOPE OF MICROBIOLOGY
Overview:
• Microorganisms is considered as ubiquitous for it can found anywhere. It is said that
microbes are here on Earth before man was created.
• As we navigate on this lesson, we will identify what can microbes impart us in life in
order for us to fully understand its existence.
• We will start on the origin and evolution followed by the diversity of the microbes.
Followed by the good and detrimental effects of microbes that will give a tremendous
impact on both man and biosphere.
Learning Outcomes:
After successful completion of this module, the learner should be able to:
1. Describe the origins of microbiology
2. Discuss the Germ Theory of Disease
3. Identify the impact of microorganisms
Course Material:
• Microorganism also known as microbes. These are ubiquitous organism that are too
small to be seen by the unaided eye.
• Microorganism represents the major fraction of the Earth’s biomass.
• Plants and animals are engaged in the world of microbes, their evolution and survival are
influenced by microbial activities.
• Microbiology is a branch of biology that deals with microorganism and their effects on
other living things.
Evolution of Microbiology
• Microbial cells first appeared between 3.8 and 4.3 billion years ago
• First 2 billion years of Earth’s existence, microorganisms are capable to survive without
oxygen in the atmosphere.
• 1 billion years ago, phototrophic microorganisms (organisms that harvest energy from
sunlight) occurred.
• Purple sulfur bacteria and green sulfur bacteria were anoxygenic (non-oxygen
producing) were the first phototrophs.
• Cyanobacteria (oxygenic phototrophs) evolved and began the slow process of
oxygenating Earth’s atmosphere, multicellular life forms eventually evolved.
Origins of Microbiology
• Microscope is the ultimate tool in studying microbiology
• The first known image of microscope and fruiting molds was illustrated by Robert Hooke.
Cut from thin slices of cork and observed under the microscope the presence of “tiny
little boxes”. He started to formulate the “Cell Theory”.
General Microbiology Lecture Module

• Antoni van Leeuwenhoek constructed single lens microscope and first to observe
bacteria by using pepper-water infusion.
• Louis Pasteur experimented the process of fermentation and sterilization. He
disproved the “Spontaneous Generation theory”. He developed a vaccine for rabies.
• Joseph Lister introduced the aseptic technique in order to kill and prevent from
microbial infection of surgical patients.
• Ignaz Semmelweis introduced the method of hand washing.
• Robert Koch discovered the causative agent of diseases like anthrax, cholera and
tuberculosis. He used his own Koch’s postulate in identifying these diseases.
• Richard Petri developed a transparent double-sided dish known as “Petri dish”, a
standard tool for obtaining pure cultures.
Different Theories:
1. Cell Theory by Robert Hooke
- “All living organisms are composed of cells”
2. Spontaneous Generation Theory
- “Life could arise spontaneously from nonliving matter”
3. Germ Theory of Disease or Koch’s Postulate by Robert Koch
- disease agent – man - disease
Source: Madigan, M. T. et.al.. Brock Biology of Microorganisms 15th ed. (2019). Pearson Educ. Inc. p. 58.
Diversity of Microorganisms
30
• Estimated 2x 10 microbial cells on Earth
• The total amount of nitrogen and phosphorus (essential nutrients for life) within
microbial cells is nearly four times that in all plant and animal cells combined
• Microbes also represent a major fraction of the total DNA in the biosphere (about 31%),
and their genetic diversity far exceeds that of plants and animals.
• Microbes are even abundant in habitats that are too much harsh for other forms of life.
• All ecosystems are influenced greatly by microbial activities.
• The metabolic activities of microorganisms can change the habitats in which they
live, both chemically and physically, and these changes can affect other
organisms.
• Microbes provide nutritional and other benefits that are essential to human
health.

Impact of Microorganism
1. Agent of disease
- microorganisms are the major cause of human death were infectious disease cause by
bacteria and viruses.
2. Agriculture
- root nodules of plant contain bacteria that fix molecular nitrogen that can be used by
plant
- microbes in the rumen of the animal convert cellulose from grass into fatty acids that
can be used by animals.
3. Food
- cause of foodborne disease and food spoilage
- not all microorganisms in foods are harmful.
- beneficial microbes are used to improve food safety and to preserve foods such as
cheese, yogurt while thru microbial fermentation can produce food like sauerkraut,
kimchi, pickles.
- colon contains diverse microbial species that assist in the digestion of complex
carbohydrates, and that synthesize vitamins and other nutrients essential to host
nutrition.
4. Industry
- harnessed to produced antibiotics, enzymes, insulin, biofuels and helps clean up waste
5. Environment
- used in bioremediation, a process that cleans up toxic wastes and pollutants
- decompose or destroy wastes, such as sewage and oil spills.
Activity / Assessment:
In a separate sheet of paper, write the name, section, module number, title and
questions. Then briefly discuss the following questions:
1. Explain the impact of microorganisms in different areas.
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
2. Describe how the cell theory originated.
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
3. Enumerate and discuss the Koch postulate?
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________

Grading System:
Each question is equivalent to 10 points per number a total of 30 points.
RUBRICS FOR SCORING ESSAY QUESTION

5 4 3 2 1
The student has full The student has a good The student has a basic The student has some The student has no
Level of Understanding understanding of the understanding of the understanding of the understanding of the understanding of
question or problem question or problem question or problem question or problem the question or
The response reflects a The response reflects The response provides problem. The
The response addresses
Synthesis of Information complete synthesis of some synthesis of little or no synthesis of response is
the question
information information information completely
Total Score = _________ / 10 x 100 = _________%
References:
As a reading material, you will be needing a book or an e-book:
- Madigan, M. T. et. al.. Brock Biology of Microrganisms (2019) 15th ed. Pearson
Education, Inc.
- Tortora, G. et.al.. Microbiology: An Introduction. (2013) 11th ed. Pearson Education, Inc.

MODULE 2: MICROBIAL TAXONOMY
Overview:
Taxonomy is the way of identifying different organisms, classifying them into categories, and
naming them. All organisms, both living and extinct, are classified into distinct groups with other
similar organisms and given a scientific name.
Hierarchical classification is one way to help scientists understand, categorize and organize the
diversity of life. In this manner, it minimizes confusion and provide reliable means of identifying
and naming an organism.
Learning Outcomes:
1. Differentiate taxonomy from systematics
2. Identify the components of taxonomy
3. Compare and contrast classification from identification
4. Recognize the proper naming of species
Course Material:
Etymology of Taxonomy:
The word taxonomy comes from a From a Greek word
taxis - arrangement or order
nomos – law
nemein - means to distribute or govern
Definition:
Taxonomy - the science of biological classification.
Taxa or Taxon – a group or level of classification or hierarchy categorized
at different levels
Systematics or phylogeny- the study of diversity of organism and their
evolutionary relationship
Dichotomous Key- means of assigning an organism to a specific taxonomic category.

Taxonomic categories or hierarchy - An ordered group of taxonomic ranks used to
classify organisms from general to specific.
 Domains (Bacteria, Archaea, and Eukarya)

 Kingdom (contains similar divisions or phyla; most inclusive taxa)

 Phylum (contains similar classes; equivalent to the Division taxa in botany).
 Class (contains similar orders)
 Order (contains similar families)
 Family (contains similar genera)
 Genus (contains similar species)
 Species (specific epithet; lowercase Latin adjective or noun; most exclusive taxa)
Major Taxonomic Characteristics:

A. Morphological characters D. Molecular characters
- General external and internal morphology - Immunological distance
- Special structures - Electrophoretic differences
- Embryology - DNA hybridization
- Karyology and other cytological factors - DNA-RNA sequence
B. Physiological characters E. Ecological characters
- Metabolic factors - Habitats
- Body secretions - Food
- Genic sterility factors - Seasonal variation
C. Geographic and behavioral characters - Parasite and host
Components of Taxonomy:
1. Classification-
- taxa are classify based on the similarities in phenotypic (phenetic) characteristics

which are expressed in an organism and can be examined visually or can be tested by
other means.
System of Classification
A. Artificial System – share the same characteristics but they are not
closely related to one another genetically.
B. Natural System – with many of the same characteristics and highly
predictive.
C. Phylogenetic (Phyletic) System – classifying organism on the
basis of descent from a common ancestor
e.g. 16S rRNA, DNA base content (G-C ratio), DNA–DNA hybridization,
DNA fingerprinting, MLST, RFLP, REP-PCR, Ribotyping, genome analyses.
Methods of Classification:
a. Phenotypic (Phenetic) Classification System:
- groups do not necessarily reflect genetic similarity or evolutionary
relatedness.
Instead, groups are based on convenient, observable
characteristics.
e.g. morphology, motility, metabolism, cell chemistry, physiologic,
biochemical, pathogenicity, antibiotic sensitivity, serological.
b. Genotypic Classification System

- considers characteristics of the genome

Classification on Hierarchy
I. Family
• encompasses a group of organisms that may contain multiple genera and
consists of organisms with a common attribute.
II. Genus
• Grouping similar genera into common families and similar families into common
orders is used for classification of plants and animals, higher taxa designations are
not useful for classifying bacteria. (i.e., division, class, and order)
III. Species
• groups of populations that can potentially interbreed freely within and among
themselves.
• collection of bacterial strains that share common physiologic and genetic features
and differ notably from other microbial species.
A. Subspecies are taxonomic subgroups within a species.
a. Biotype - a group of organisms having the same or nearly the same
genotype
b. Serotype - a group of organisms within a species that have the

same type and number of surface antigens.
c. Genotype may be given to groups below the subspecies level that

share specific but relatively minor characteristics.
B. Clone is a population of cells derived from a single parent cell and identical.
C. Strain - came from pure cultures of the same species are not identical in all
ways.
Types of Strains:
a. Serovar - a strain differentiated by serological means. Strains vary
in their antigenic properties.
b. Biovar (biotype) - strains that are differentiated by biochemical or

other non-serological means.
c. Morphovar (morphotype) - a strain which is differentiated on the

basis of morphological distinctions.
d. Isolate - a pure culture derived from a heterogeneous, wild population
of microorganisms. The term isolate is also applicable to eucaryotic
microorganisms as well as to viruses.
Strain Differentiation Methods- compare phenotypes and that, though useful,

are not as precise as genetic homologies in determining evolutionary relationships.
1. Protein Profile 3. Flow Cytometry
2. Immunological Reaction 4. Phage Typing

2. Nomenclature - branch of taxonomy concerned with the assignment of names to

taxonomic groups in agreement with published rules.
-Carolus Linnaeus introduced a formal system of classification dividing living
organisms into two kingdoms— Plantae and Animalia.
- Every organism is assigned a genus and a species of Latin or Greek derivation
by the addition of the appropriate suffix.
- naming of microorganisms according to established rules and guidelines set forth
in the International Code of Nomenclature of Bacteria (ICNB) or the Bacteriological Code
(BC).
- The taxonomic classification scheme for prokaryotes is found in Bergey’s Manual
of Systematic Bacteriology.
- rules governing microbial nomenclature is limited to two taxa, genus and species
known as binomial nomenclature.
Pointers on How to write the scientific name:
1. Suffixes for order and family are written as -ales and –aceae
e.g. Streptococcaceae family type genus is Streptococcus
2. The genus and specific epithet (species), both names are printed underlined or
italicized.
e.g. Streptococcus pyogenes
3. The genus name is always capitalized in first letter and is always a noun. The
species name is lowercase in first letter and is usually an adjective.
e.g. Klebsiella pneumoniae
4. The name may be abbreviated by using the uppercase form of the first letter of the
genus designation followed by a period (.) and the full species name, which is never
abbreviated.
e.g. S. aureus
Naming of Bacteria based on Cell Arrangement
a. Cocci – round c. Spiral

• Staphylococci – in clusters Spirochete
• Streptococci – in chains
• Diplococci – in pairs
• Sarcinae – packets of four
b. Bacilli – rod
• Diplobacilli – in pairs
• Streptobacilli – in chain
• Coccobacilli
3. Identification - the process of determining a particular (organism) belongs to a

recognized taxon. The process by which a microorganism’s key features are delineated.

Identification method:
a. Genotypic characteristics - relate to an organism’s genetic makeup, including
the nature of the organism’s genes and constituent nucleic acids.
e.g. hair color, height
b. Phenotypic characteristics - are based on features beyond the genetic level,
including both readily observable characteristics and features that may require
extensive analytic procedures to be detected.
e.g. skin color
Comparison between Genotype from Phenotype
https://www.technologynetworks.com/genomics/articles/genotype-vs-phenotype-examples-and-definitions-318446
Methods in Bacterial Identification
1. Microscopic morphology - Gram Staining, Shapes, arrangements, motility

2. Macroscopic morphology – colony appearance, motility
3. Physiological / biochemical characteristics – aerobic, anaerobic,
photosynthetic, growth on selective media
4. Chemical analysis – e.g.peptides and lipids in cell membranes
5. Phage Typing – which phage infects the bacterium
6. Serological analysis – what antibodies are produced against the bacterium
7. Pathogenicity – what diseases does the bacterium cause.
8. Genetic & molecular analysis
• G + C base composition
• DNA analysis using genetic probes
• Nucleic acid sequencing & rRNA analysis
Microbial Phylogeny
• most biologists divide all living organisms into 3 domains:
• Domain Archaea
• Domain Bacteria
• Domain Eucarya
• rRNA sequence data suggests that Archaea & Eucarya may share a more recent
common ancestor with each other than with Bacteria.
• There is often great metabolic and ecological diversity among the members of a
group, perhaps reflecting parallel evolution of such things as fermentation
pathways, photosynthetic pathways, etc.

https://microbe.net/simple-guides/fact-sheet-rrna-in-evolutionary-studies-and-environmental-sampling
th
Source: Tortora, G. et.al. Microbiology: An Introduction. (2013) 11 ed. p. 280.
1. Phylogeny of domain Archaea

- Based primarily on rRNA sequence data, domain Archaea is divided into two
phyla:
a. Phylum Crenarchaeota
•
Originally containing thermophylic and hyperthermophilic sulfur-
metabolizing archaea
• Recently discovered Crenarchaeota are inhibited by sulfur & grow
at lower temperatures
b. Phylum Euryarchaeota
• Contains primarily methanogenic archaea, halophilic archaea, and
thermophilic, sulfur-reducing archaea
2. Phylogeny of domain Bacteria

- The 2nd edition of Bergey’s Manual of Systematic Bacteriology divides domain
Bacteria into 23 phyla. Nine of the more notable phyla
a. Phylum Aquiflexa
• The earliest “deepest” branch of the Bacteria
• Contains genera Aquiflex and Hydrogenobacter that can obtain
energy from hydrogen via chemolithotrophic pathways

b. Phylum Cyanobacteria
• Oxygenic photosynthetic bacteria
c. Phylum Chlorobi
• The “green sulfur bacteria”
• Anoxygenic photosynthesis
• Includes genus Chlorobium
d. Phylum Proteobacteria
• The largest group of gram-negative bacteria
• All major nutritional types are represented: phototrophy,
heterotrophy, and several types of chemolithotrophy
• Sometimes called the “purple bacteria,” although very few are
purple; the term refers to a hypothetical purple photosynthetic
bacterium from which the group is believed to have evolved
• Divided into 5 classes: Alphaproteobacteria, Betaproteobacteria,
Gammaproteobacteria, Deltaproteobacteria, Epsilonproteobacteria
• Other medically important Proteobacteria include genera
Haemophilus, Vibrio, Camphylobacter, Helicobacter, Rickessia,
Brucella
A. Photosynthetic genera:
- Purple Sulfur Bacteria
Chromatium and Thiocapsa (purple sulfur bacteria)
Rhodospirillum, Rhodoferax, Rhodobacter (purple
non-sulfur bacteria)
- Green Sulfur bacteria
Chlorobium, Chlorobaculum, “Chlorochromatium”
(green sulfur bacteria)
Chloroflexus, Heliothrix, Roseiflexus (green non-
sulfur bacteria)
- Sulfur chemolithotrophs
genera Thiobacillus and Beggiatoa
- Nitrogen chemolithotrophs (nitrifying bacteria)
genera Nitrobacter and Nitrosomonas
- Other chemolithotrophs
genera Alcaligenes, Methylobacilllus, Burkholderia
- Aerobic Anoxygenic Phototrophs
genera Roseobacter, Erythrobacter
- Other Phototrophic Bacteria
genera Heliobacterium, Chloracidobacterium
B. Gram Negative Enteric Bacteria

- The family Enterobacteriaceae
genera Escherichia, Proteus, Enterobacter,
Klebsiella,Salmonella, Shigella, Serratia,
- The family Pseudomonadaceae
genus Pseudomonas
e. Phylum Firmicutes
• “Low G + C gram-positive” bacteria
• Divided into 3 classes:

1. Class I – Clostridia; includes genera Clostridium and

Desulfotomaculatum, and others
2. Class II – Mollicutes; bacteria in this class cannot make
peptidoglycan and lack cell walls; includes genera
Mycoplasma, Ureaplasma, and others
3. Class III – Bacilli; includes genera Bacillus, Lactobacillus,
Streptococcus, Lactococcus, Geobacillus, Enterococcus,
Listeria, Staphylococcus, and others
f. Phylum Actinobacteria
• “High G + C gram-positive” bacteria
• Includes genera Actinomyces, Streptomyces, Corynebacterium,
Micrococcus, Mycobacterium, Propionibacterium
g. Phylum Chlamidiae
• Small phylum containing the genus Chlamydia
h. Phylum Spirochaetes
• The spirochaetes
• Characterized by flexible, helical cells with a modified outer
membrane (the outer sheath) and modified flagella (axial filaments)
located within the outer sheath
• Important pathogenic genera include Treponema, Borrelia, and
Leptospira
i. Phylum Bacteroidetes
• Includes genera Bacteroides, Flavobacterium, Flexibacter, and
Cytophyga; Flexibacter and Cytophyga are motile by means of
“gliding motility”
3. Phylogeny of domain Eucarya

The domain Eucarya is divided into four kingdoms:
a. Kingdom Protista
protozoa and algae
b. Kingdom Fungi
fungi (molds, yeast, and fleshy fungi)
c. Kingdom Animalia
the multicellular animals
d. Kingdom Plantae
the multicellular plants
Activities/Assessments:
In a separate sheet of paper, write the name, section, module number, title and questions.
Then briefly discuss the following questions:
1. Describe the genotypic from phenotypic characteristics.

______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
2. Explain how important is the components of taxonomy in microbiology?

______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
3. Differentiate Systematics from Taxonomy?

______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
______________________________________________________________________
Grading System:
Each question is equivalent to 10 points per number a total of 30 points.

5 4 3 2 1
the question
Total Score = _________ / 10 x 100 = _________%
References:
As a reading material, you will be needing a book or an e-book.

• Madigan, M. T.. Brock Biology of Microorganisms (2019) 15th ed. Pearson Education,
Inc.
• Tille, Patricia M. Bailey and Scott’s Diagnostic Microbiology (2017) 14th ed. Elsevier
• Tortora, G. et al.. Microbiology: An Introduction (2013) 11th ed. Pearson Education,
Inc.
• https://www.cliffsnotes.com/study-guides/biology/plant-biology/systematics/types-of-
classifications
• https://microbe.net/simple-guides/fact-sheet-rrna-in-evolutionary-studies-and-
environmental-sampling
• https://www.technologynetworks.com/genomics/articles/genotype-vs-phenotype-
examples-and-definitions-318446

MODULE 3: MICROBIAL DIVERSITY
Overview:
Microbial diversity is composed of both phylogenetic and functional diversity. In congruence

between phylogeny and functional traits of microorganism which can result from different patterns.
Diversity of Phototrophic bacteria and morphologically diverse bacteria and its species were
described morphologically and physiologically.
Learning Outcomes:
1. Differentiate phylogenetic from functional diversity.
2. Identify the different species in phototrophic and morphologic diverse bacteria.
3. Differentiate the identified species from phototrophic and morphologic diverse bacteria.
Course Material:
Definition of Terms:
• Phototrophy – the use of light energy is prevalent in the microbial world.
• Photosynthesis is considered the most important biological process
• Phototrophs – organisms that carry out photosynthesis
• Autotrophs – photosynthetic organisms that are capable of growing with carbon dioxide as
the sole source of carbon.
• Photoautotrophs - energy comes from light is used in the reduction of CO2 to organic
compounds
• Photoheterotrophs – phototrophs that use organic carbon as their carbon source
Phylogenetic diversity is the component of microbial diversity that deals with

evolutionary relationships between microorganisms.
• Encompasses the genetic and genomic diversity of evolutionary lineages and so
can be defined on the basis of either genes or organism.
• Phylogenetic diversity is defined on the basis of ribosomal RNA gene
phylogeny, which is thought to reflect the phylogenetic history of the entire
organism.

Functional diversity is the component of microbial diversity that deals with diversity
in form and function as it relates to microbial physiology and ecology.
Result from phylogeny and functional traits of microorganism
1. Gene loss - trait present in the common ancestor of several lineages is
subsequently lost in some lineages but retained in others that over evolutionary
time became quite divergent.
2. Convergent Evolution - trait has evolved independently in two or more lineages
and is not encoded by homologous genes shared by these lineages.
3. Horizontal Gene Transfer - genes that confer a particular trait are homologous
and have been exchanged between distantly related lineages.
I. Photoautotrophy - is the process by which organisms convert radiant energy into

biologically useful energy and synthesize metabolic compounds using only carbon dioxide
or carbonates as a source of carbon.
Two distinct sets of reactions

(1) light reactions that produce ATP;
(2) light-independent dark reactions that reduce CO2 to cell
material for autotrophic growth.
Photosynthesis requires light-sensitive pigment

a. chlorophylls—present in plants, algae, and cyanobacteria
b. bacteriochlorophylls – present in anoxygenic phototrophs.
Oxygenic photosynthesis- the photosynthetic process in cyanobacteria (and

chloroplasts).
Anoxygenic photosynthesis - O2 is not produced.
- Absorption of light energy by chlorophylls and bacteriochlorophylls begins

the process of photosynthetic energy conversion, and the net result is
chemical energy, ATP.
II. Diversity of Phototrophic Bacteria

• Phototrophic microorganisms, those microbes that conserve energy from light.
• First phototrophic organisms were anoxygenic phototrophs, organisms that do
not generate O2 as a product of photosynthesis.
• Instead of H2O, these organisms likely to used H2, ferrous iron (Fe2+), or H2S as
the electron donor for photosynthesis.
• Anoxygenic photosynthesis is present in six bacterial phyla: the Proteobacteria,
Chlorobi, Chloroflexi, Firmicutes, Acidobacteria, and Gemmatimonadetes.
• All phototrophic bacteria use chlorophyll-like pigments to harvest energy from light
and transfer this energy in cytoplasmic membrane to increase the amount of
pigment for better use of light of low intensities for the production of ATP.
• couple light energy to carbon fixation through a variety of different mechanisms
but not all phototrophs fix CO2.
• Two different types of photosynthetic reaction centers:
a. type I reaction centers (FeS-type)
b. type II reaction centers (quinone-type, or Q-type)

• Both types of reaction centers are present in Cyanobacteria whereas only one
type or the other is present in anoxygenic phototrophs
A. Cyanobacteria
Key Genera: Prochlorococcus, Crocosphaera, Synechococcus,
Trichodesmium, Oscillatoria, Anabaena
- both unicellular and filamentous.
- 0.5µm in diameter, as large as 100 µm in diameter.
- First oxygen evolving phototrophic organisms on Earth.
- oxygenic phototrophs, have both FeS-type and Q-type photosystems.
- some can assimilate simple organic compounds such as glucose and acetate if
light is present, a process called photoheterotrophy.
- have specialized membrane systems called thylakoids that increase the ability
of cells to harvest light energy.
- cell wall contains peptidoglycan and is structurally similar to that of other
Gram-negative bacteria.
- have photopigments, fluorescent and emit light when visualized using a
fluorescence microscope.
- Photopigment produces chlorophyll a, known as phycobilins, function as
accessory pigments in photosynthesis.
a. Phycocyanin -responsible for the blue-green color of most

cyanobacteria
b. Phycoerythrin - species producing phycoerythrin are red or brown
- exhibit gliding motility

- some filamentous cyanobacteria form hormogonia, short, motile filaments that
break off from longer filaments to facilitate dispersal in times of stress.
- some form Akinetes, cells with thickened outer walls.
- many are capable of nitrogen fixation.
a. Cyanothece and Crocosphaera -fix nitrogen only at night when

photosynthesis does not occur
b. Trichodesmium – fix nitrogen during the day
c. Nostocales and Stigonematales - facilitate nitrogen fixation by
forming specialized cells called heterocysts
Five Morphological groups of Cyanobacteria :

(1) Chroococcales -unicellular, dividing by binary fission;
(2) Pleurocapsales - unicellular, dividing by multiple fission (colonial);
(3) Oscillatoriales - filamentous non-heterocystous forms;
(4) Nostocales - filamentous, divide along a single axis, and are capable
of cellular differentiation; and
(5) Stigonematales - morphologically similar to Nostocales except that
cells divide in multiple planes, forming branching filaments.
Synechococcus and Prochlorococcus the most abundant phototrophs in the

oceans
Two groups of Marine Nitrogen Fixation:

a. Crocosphaera - dominate nitrogen fixation in most of the Pacific

Ocean and are widespread in tropical and subtropical habitats
b. Trichodesmium - dominant nitrogen-fixer in the North Atlantic
Ocean and parts of the Pacific where dissolved iron
concentrations are elevated.
c. Calothrix and Richelia - form symbiotic associations with diatom
found in tropical and subtropical oceans.
d. Nodularia and Anabaena- dominate nitrogen fixation in cold waters of
the Northern Hemisphere and are often observed in the Baltic
Sea
B. Purple Sulfur Bacteria

Key Genera: Chromatium, Ectothiorhodospira
- Purple sulfur bacteria are distinguished by the location of sulfur granules and
by their photosynthetic membranes.
- anoxygenic phototrophs that use hydrogen sulfide (H2S) as an electron donor for
photosynthesis.
- found in lakes, marine sediments, and “sulfur springs,” where H2 produced
can support the growth of purple sulfur bacteria
- also found in microbial mats and salt marsh sediments.
- Carotenoid – accessory pigment involved in light harvesting.
- under the Q-type system that contain either bacteriochlorophyll a or b, and carry
out CO2 fixation by the Calvin cycle.
Two Families Purple Sulfur Bacteria:

1. Chromatiaceae
- store sulfur granules in the periplasmic space and have vesicular
intracellular photosynthetic membrane systems.
- stratified lakes containing sulfide and in the anoxic sediments of salt
marshes.
Example: Genera Chromatium and Thiocapsa
2. Ectothiorhodospiraceae
- oxidize H2S to S0 that is deposited outside the cell have lamellar
intracellular photosynthetic membrane systems
- extremely halophilic (salt loving) or alkaliphilic (alkalinity loving)
- found in saline lakes, soda lakes, and salterns, where abundant levels of
sulfate
Example: Genera Ectothiorhodospira and Halorhodospira
C. Purple Non-Sulfur Bacteria

Genera: Rhodospirillum, Rhodoferax, Rhodobacter
- most metabolically versatile of all microbes.
- they are not always purple; these organisms synthesize an array of carotenoids
that can give purple bacteria their colors, usually purple, red, or orange.
- photoheterotrophs (a condition where light is the energy source and an organic
compound is the carbon source),
- use a Q-type photosystem, and contain either bacteriochlorophyll a or b
- can conserve energy through a variety of metabolic processes
- all purple non-sulfur bacteria can fix N2 and will thrive under such conditions,

rapidly outcompeting other bacteria
Aerobic Anoxygenic Phototrophs

Key Genera: Roseobacter, Erythrobacter
- Obligatory aerobic heterotrophs use light as a supplemental source of energy
to support growth.
- Able to photosynthesize when grown on a day/night cycle.
- The primary physiological difference with the purple non-sulfur bacteria:
*aerobic anoxygenic phototrophs are strict heterotrophs
*employ anoxygenic photosynthesis only under oxic conditions as a
supplemental source of energy.
- contain bacteriochlorophyll a and a Q-type photosystem, but are unable to
fix CO2
- rely on organic forms of carbon as their carbon source.
- Carotenoids are pigment that give colors of yellow, orange, or pink to cultures
D. Green Sulfur Bacteria

Key Genera: Chlorobium, Chlorobaculum, “Chlorochromatium”
- typically non-motile and strictly anaerobic anoxygenic phototrophic short to
long rods.
- oxidize hydrogen sulfide (H2S) as an electron donor for autotrophic growth,
oxidizing it first to sulfur (S0) and then to sulfate the S0 produced by green sulfur
bacteria is deposited only outside the cella
- unique means of autotrophy in phototrophic bacteria
- contain bacteriochlorophyll c, d, or e and house these pigments in unique
structures called chlorosomes
- Chlorosomes are oblong bacteriochlorophyll rich bodies bounded by a thin, non-
unit membrane and attached to the cytoplasmic membrane in the periphery of the
cell
- use an FeS-type photosystem’
- live in anoxic, sulfidic, illuminated aquatic environments
- tend to have a greater tolerance of H2S than do other anoxygenic phototrophs
- found at the greatest depths of all phototrophic microorganisms in lakes or
microbial mats, where light intensities are low and H2S levels the highest.
- Chlorobaculum tepidum is thermophilic and forms dense microbial mats in high-
sulfide hot springs.
- C. tepidum also grows rapidly and is amenable to genetic manipulation by both
conjugation and transformation and has become the model organism for studying
the molecular biology of green sulfur bacteria.
- “Chlorochromatium aggregatum” has been used to describe a commonly
observed green-colored consortium that is green because the epibionts contain
green-colored carotenoids
- “Pelochromatium roseum” is brown because its epibionts produce brown-
colored carotenoids
E. Green Non-sulfur Bacteria

Key Genera: Chloroflexus, Heliothrix, Roseiflexus
- filamentous (gliding motility), anoxygenic phototrophs of the phylum
Chloroflexi.
- both aerobic and anaerobic chemoorganotrophs that grow well in the dark

by aerobic respiration of a wide variety of carbon sources.

- Dehalococcoidetes, a group of dehalogenating bacteria that use halogenated
organic compounds as electron acceptors in anaerobic respiration.
- Chloroflexus forms thick microbial mats in neutral to alkaline hot springs along
with thermophilic cyanobacteria
- grow best as photoheterotrophs using simple carbon sources as electron
donors such as H2 or H2S. for photosynthesis.
- contain bacterioclorophyll a and chlorosomes that contain bacteriochlorophyll
c and in this way are similar to green sulfur bacteria.
- contain Q-type photosynthetic reaction center that resemble to purple bacteria.
F. Other Phototrophic Bacteria

Key Genera: Heliobacterium, Chloracidobacterium
1. Heliobacteria
- group of phototrophic gram-positive Bacteria found within the phylum
Firmicutes
- anoxygenic phototrophs that have an FeS-type photosystem and that
produce a unique pigment, bacteriochlorophyll g
- grow photoheterotrophically using a narrow range of organic compounds
including pyruvate, lactate, acetate, or butyrate.
Five genera: Heliobacterium, Heliophilum, Heliorestis,

Heliomonas, and Heliobacillus.
- Rod-shaped or filamentous cells from in bundles
- strict anaerobes
- grow chemotrophically in darkness by pyruvate fermentation
- produce endospores, like Bacillus or Clostridium species
- reside in soil, especially paddy (rice) field soils, where their nitrogen
fixation activities
- found in highly alkaline environments, such as soda lakes and surrounding
alkaline soils.
III. Morphologically Diverse Bacteria

I. Spirochetes
- Gram negative, motile, tightly coiled Bacteria, typically slender and flexuous in
shape, highly flexible and quite thin (60.5 μm).
- corkscrew-like motion that allows cells to burrow through viscous materials or tissues
- contains endoflagella which is found in the cell periplasm, with outer sheath
- found in aquatic sediments and in animals.
- an important human sexually transmitted disease.
• Spirilla
- often confused with the spirochetes
- rigid cells, helically curved rod-shaped cells, motile by means of polar flagella
- lack the outer sheath, endoflagella, and corkscrew-like motility of spirochetes
- Spirulina - long helical filaments that superficially resemble spirochetes

Key Genera: Spirochaeta, Cristispira, Treponema, Borrelia, Leptospira

1. Spirochaeta
- free-living, anaerobic, and facultative aerobic spirochetes.
- common in aquatic environments such as freshwater and sediments, and also in
the oceans.
a. Spirochaeta plicatilis
- large spirochete found in sulfidic freshwater and marine habitats.
- 20 or so endoflagella inserted at each pole
- arranged in a bundle that winds around the coiled protoplasmic
cylinder.
b. Spirochaeta stenostrepta
- an obligate anaerobe commonly found in H2S-rich black muds.
- ferments sugars to ethanol, acetate, lactate, CO2, and H2.
2. Cristispira
- found in nature only in the crystalline style of certain molluscs, such as clams and
oysters.
- lives in both freshwater and marine molluscs
- has not been cultured
3. Treponema
A. Treponema
- Anaerobic or microaerophilic; commensals or pathogens of humans and
animals
a. T. pallidum
- the causal agent of syphilis
- not helical but flat and wavy.
- thin, measuring only 0.2 μm in diameter
- uses dark-field microscopy for suspected syphilitic lesions
b. Treponema denticola
- common in the human oral cavity associated with gum disease
- ferments amino acids such as cysteine and serine, forming acetate as
the major fermentation acid, as well as CO2, NH3, and H2S.
- common in the rumen, the digestive forestomach of ruminant animals
c. Treponema saccharophilum
- large, pectinolytic spirochete found in the bovine rumen where it ferments
pectin, starch, inulin, and other plant polysaccharides.
d. Treponema primitia
- can be found in the hindgut of certain termites, fermentation of cellulose
causes production of H2 and CO2.
- contain an acetogen, which is an important component of the insect’s
nutrition

e. Treponema azotonutricium
- found in the termite hindgut and is capable of nitrogen fixation.
4. Borrelia
- animal or human pathogens, causing diseases in cattle, sheep, horses, and
birds
- the bacterium is transmitted to the animal host from the bite of a tick
a. Borrelia burgdorferi
- the causative agent of the tickborne Lyme disease, which infects
humans and animals.
- one of the few known bacteria that has a linear chromosome
5. Leptospira and Leptonema

- the two genera contain strictly aerobic spirochetes that oxidize long-chain fatty
acids as electron donors and carbon sources.
Leptospira
- thin, finely coiled, and usually bent at each end into a semi-circular hook
- some free-living and many parasitic
Two major species of Leptospira:

a L. interrogans (parasitic) - parasitic for humans and animals
*Rodents are the natural hosts of most leptospiras, although dogs
and pigs are also important carriers of certain strains.
b L. biflexa (free-living) -
*Leptospirosis - a disorder in which the organism localizes in the kidneys and

liver, causing nephritis and jaundice
Activities / Assessment:
1. Differentiate the six Phototrophic Bacteria according to:

a. pigment
b. habitat
c. species/genera
d. type of photosystem
e. Oxygen type
2. Describe the Morphologically Diverse Bacteria according to:

a. Morphology c. Motility e. Disease
b. habitat d. Type of flagella
Grading System:

• Five points for each number will be given to each species that will be differentiated or
describe.
• Question #1 has a total points of 30 while in Question # 2 has a total points of 25
• Total score of 55 points for this assessment
Reference:

• Madigan, M. T. et.al.. Brock Biology of Microorganisms. (2019) 15th ed. Pearson
Education, Inc.
MODULE 4: MICROBIAL CELL STRUCTURE AND FUNCTION
Overview:
Bacteria are very small to be seen by our naked eye. Do we know how they function? Even we
could not see them, by learning the structure of these microorganism and on how it functions, it
could help us understand them much better.
Learning Outcomes:
1. Identify the different microbial structures
2. Determine the function of each structure
3. Compare and contrast prokaryote from eukaryote
Course Material:
Morphology – deals with the size, shape and arrangement of a living organism.
Cell Morphology – the study of the size and shape of the cell.
Bacterial Size: less than 3 micrometers (μm) in size.

Size of cocci - range from 0.5 to 3 μm
Size of bacilli - range from 0.15 to 2 μm (width) to 0.5 to 20 μm (length).
Bacterial Shapes:
1. Cocci – spherical and ovoid
2. Bacilli – cylindrical
3. Spiral – curve or loose spiral
Bacterial Arrangement:
1. Singly - single
2. Strepto – in chain *Unusual shape
3. Staphylo – in cluster Spirochetes – tightly coiled
4. Diplo – in pairs
5. Sarcinae – three dimensional cubes

Arrangement in cocci Arrangement in bacilli

a. Singly a. Singly
b. Diplococci b. Diplobacilli
c. Streptococcus c. Streptobacilli
d. Staphylococcus
I. Prokaryotic Cell
A. Structural Parts
1. Cell Membrane (Cytoplasmic Membrane)
- “gatekeeper” for the entrance and exit of dissolved substances
Three Major Function of Cytoplasmic Membrane

i. cell’s permeability (selective) barrier, preventing the passive leakage of
solutes into or out of the cell.
ii. anchors several proteins that catalyze a suite of key cell functions.
iii. plays a major role in energy conservation and consumption.
- energy conservation takes place in:

i. mitochondrion (respiration)
ii. chloroplast (photosynthesis)
a. Bacterial Membrane
- phospholipid bilayer containing embedded proteins.
- composed of:
i. hydrophobic (water-repelling) - fatty acids (inward)
ii. hydrophilic (water-attracting) - glycerol molecule containing
phosphate (exposed to cytoplasm)
- Hopanoids
- strengthened by sterol-like molecules that is present in bacteria
- Sterols strengthen the membranes of eukaryotic cells where there
is an absence of cell wall
b. Archaeal Membrane
- cytoplasmic membrane of Archaea is structurally similar to those of
Bacteria and Eukarya, but the chemistry is somewhat different.

Comparison in Cytoplasmic Membrane

Bacteria and Eukarya Archaea
Structure Same Same
Lipid Layer Lipid Bilayer Lipid Monolayer
ether bonds between

ester linkages bond fatty
Chemical Structure glycerol and a
acids to glycerol
hydrophobic side
Hopanoids Present Absent
2. Cell wall
- layer outside the cytoplasmic membrane
- gives shape and rigidity on the cell
- confers structural strength on the cell in order to keep it from bursting due to
osmotic pressure.
For example, the penicillins and cephalosporins, target bacterial cell wall
synthesis, leaving the cell susceptible to osmotic lysis. Since human cells lack
cell walls and are therefore not a target of such antibiotics, these drugs are of
obvious benefit for treating bacterial infection.
Two Major Group:

a. Gram positive – thicker and have single type of molecule
b. Gram negative – consists of two layers
2.1. Bacterial Cell wall

2.1.1. Lysozyme
- weakens the peptidoglycan and cause cell lysis
- act as a major line of defense against bacterial infection which are
present in human secretions including tears, saliva, and other bodily
fluids.
- destroys pre-existing peptidoglycan, penicillin blocks a key step in its
biosynthesis
2.1.2. Peptidoglycan
- made up of rigid polysaccharide
- not present in Archaea and Eukarya
- composed of alternating repeats of two modified glucose residues
a. N-acetylglucosamine
b. N-acetylmuramic acid
- 90% of cell wall in a Gram positive bacteria consist of peptidoglycan and
form many layers
i. Teichoic acid - embedded in the cell wall and function to bind
divalent metal ions, such as Ca2+ and Mg2+, prior to their
transport into the cell.
ii. Lipoteichoic acid - covalently bonded to membrane lipids rather
than to peptidoglycan
iii. LPS or lipopolysaccharide
- small amount of peptidoglycan in cell wall of Gram negative

- Outer membrane is found in second lipid bilayer
Two Components of LPS:

a. Core polysaccharide
b. O specific polysaccharide
2.1.3. Periplasm
- space, located between the outer surface of the cytoplasmic membrane
and the inner surface of the outer membrane, spans about 15 nm
2.1.4.Porins
- channels for the entrance and exit of solutes
Two Kinds of Porins:
a. Non-specific porins - form water-filled channels
through which virtually any very small hydrophilic substance can
pass.
b. Specific porins- contain a binding site for one or a
group of structurally related substances
2.2. Archaeal Cell Wall
Methanogens- cell walls of certain methane-producing Archaea
a. Pseudomurein and other Polysaccharide Cell Walls

The term “murein” is from the Latin word for wall and was an
old term for peptidoglycan.
Pseudomurein is immune from destruction by both lysozyme and
penicillin which are molecules that destroy peptidoglycan.
Two Components of Pseudomurein:

i. N-acetylglucosamine (also present in peptidoglycan)
ii. N-acetyltalosaminuronic acid
b. S- layer
Paracrystalline surface layer or S layer – most common type of cell
wall in Archaea.
- consists of interlocking molecule of protein or glycoprotein.
- retains periplasmic proteins and prevents their drifting away
in gram-negative Bacteria.
Example: Methanocaldococcus jannaschii
3. Cell Surface Structures:

3.1 Capsule
- organized in a tight matrix that excludes small particles and is tightly
attached
- readily visible by light microscopy if cells are treated with India ink,
which stains the background but not the capsule,
3.2 Slime

- more easily deformed and loosely attached, it will not exclude particles
and is more difficult to see microscopically
* Example of Bacteria with cell surface: Bacillus anthracis and
Streptococcus pneumoniae
3.3 Fimbriae, Pili and Hami

3.3.1. Fimbriae
- thin (2–10 nm in diameter) filamentous structures made
of protein that extend from the surface of a cell
- enable cells to stick to surfaces
- form pellicles (thin sheets of cells on a liquid surface) or
biofilms on solid surfaces.
3.3.2. Pili
- typically longer and only one or a few pili are present on the surface of a
cell
- All Gram negative produce pili while many Gram positive contain pili.
- Pili can be receptors for certain types of viruses, they can be easily seen
under the electron microscope when they become coated with virus
particles
Functions of pili:
i. Conjugation - facilitating genetic exchange between cells
(conjugative or sex pili)
ii. Adhesion - adhering of pathogens to specific host tissues that
they invade (Type IV and other pili).
3.3.3.Hami or hamus
- this group have unique attachment structure resembles a tiny
grappling hook.
- Hami structurally resemble type IV pili except for their barbed
terminus, which functions to attach cells both surfaces and to each
other.
Function of Hami:
i. affix cells to a surface to form a networked biofilm
ii. preventing cells from being washed away in groundwater
flowage.
Function of outer surface layers:

a. Attachment
- Bacterial cell surface polysaccharides assist in the attachment of
microorganisms to solid surfaces.
- When the opportunity arises, many bacteria will bind to solid surfaces,
often forming a thick layer of cells called a biofilm.
b. Virulence factors
- molecules that contribute to the pathogenicity of a bacterial pathogen
c. Preventing dehydration
4. Cell Inclusion:
a. Poly-β-hydroxybutyric acid (PHB)

b. Glycogen
c. Polyphosphate granules
d. Elemental sulfur – present in periplasm
e. Carbonate
f. Magnetosomes
Gloeomargarita - organism able to process “biomineralization”.
5. Gas vesicles
- conical-shaped structures made of protein.
- length:300 -1000 nm; width: 45 -120 nm
- Gas vacuoles are irregular bright inclusions seen in light microscopy or
transmission electron microscope.
Two Proteins in Gas Vesicles:

a. GvpA (major protein)-forms the watertight vesicle shell and is a small,
hydrophobic, and very rigid protein.
b. GvpC (minor protein)- functions to strengthen the shell of the gas vesicle
by cross-linking.
6. Endospores - highly differentiated cells that are extremely resistant to heat, harsh
chemicals, and radiation.
Parts of the endospore:

a. exosporium – outermost layer, protein covering
b. spore coats – innermost layer, spore-specific protein
c. cortex - consists of loosely cross-linked peptidoglycan.
Core - inside the cortex which contains the core wall, cytoplasmic
membrane, cytoplasm, nucleoid, ribosomes, and other cellular
essentials.
*Dipicolinic acid - one substance found in endospores but not in vegetative cells.
Accumulates in the core that contain large amount of calcium. DPA complex
inserts between bases in DNA, which helps stabilize DNA against heat
denaturation.
*Some bacterial endospores survive heating to temperatures as high as 150°C,
although 121°C, the standard for microbiological sterilization kills the endospores
of most species.
Structures and Features of Endospores:

• visible by light microscopy as strongly refractile structures.
• impermeable to most dyes, unstained regions within cells that have been
stained with basic dyes such as methylene blue. Special stains and
procedures must be used.
• In the classical endospore-staining protocol, the stain malachite green is
used and is infused into the spore with steam.
• can be seen in electron microscope

Function: survival structures and enable the organism to endure unfavorable

growth conditions, including but not limited to extremes of temperature, drying, or
nutrient depletion
- dormant stage of a bacterial life cycle:
vegetative cell endospore vegetative cell
Example: Bacillus and Clostridia
Steps in Vegetative Cell Process:
1. activation - occurs when endospores are heated for several minutes at an
elevated but sub-lethal temperature
2. germination - rapid process (occurring in a matter of minutes), is signaled by
the loss of refractility of the endospore and loss of resistance to heat and
chemicals.
3. outgrowth - involves visible swelling due to water uptake and synthesis of
RNA, proteins, and DNA.
7. Cell locomotion:
Flagellum (bacteria) or archaellum (archaea) – used for locomotion and these
are tiny rotating machines that function to push or pull the cell through a liquid.
Bacterial flagella are long, thin appendages (15–20 nm wide, depending on the
species) free at one end and anchored into the cell at the other end.
Flagella Structure:
a. filament – main part, contains flagellin
b. hook - consists of a single type of protein and connects the filament to
the flagellum motor in the base.
c. basal body – the rotor and stator made up to build up this structure.
Flagellar Arrangement:
a. atrichous - absence of flagella
b. monotrichous – presence of flagella at one side
c. amphitrichous – presence of flagella at both sides
d. lophotrichous – tuft of flagella at one side
e. peritrichous – presence of flagella on the entire body
Two major types of prokaryotic cell movement:
1. swimming motility –
Bacterial movement powered by rotating flagella
2. gliding motility –
Gliding bacteria are filamentous or rod-shaped, and the gliding

process requires that the cells be in contact with a solid surface.

i.e. Filamentous cyanobacteria
Gram-negative bacteria
Myxococcus xanthus,
Cytophaga
Flavobacterium
II. Eukaryotic Cell and its Parts
– structurally more complex and much larger cells.

Example: fungi, algae and protozoa and other protist.
A. Nucleus- contains the chromosomes

B. Nuclear Membrane – contain pores formed from holes where the inner and outer
membranes are joined.
Cell Division: divide by a process in which the chromosomes are replicated, the
nucleus is disassembled, the chromosomes are segregated into two sets, and a
nucleus is reassembled in each daughter cell.
2 Genetic states:
a. haploid - (one copy of chromosome)
b. diploid - (two copies of chromosome)
Types of Cell Division:

1. Mitosis- the chromosomes condense, divide, and are separated into two
sets, one for each daughter cell
2. Meiosis I - homologous chromosomes segregate into separate cells, changing the
genetic state from diploid to haploid.
Meoisis II - the two haploid cells divide to form a total of four haploid cells called
gametes
C. Mitochondria – where respiration occurs

- The number of mitochondria per cell depends somewhat on the cell type and
size
- enclosed by a double membrane system:
a. outermost mitochondrial membrane is permeable and contains pores
that allow the passage of small molecules.
b. innermost membrane is less permeable and its structure more closely
resembles that of the cytoplasmic membrane of Bacteria.
Parts of Mitochondrion:
1. Cristae
- formed by invagination of the inner membrane, contain the enzymes
needed for respiration and ATP production.
- contain transport proteins that regulate the passage of key molecules
such as ATP into and out of the matrix
2. Matrix
- innermost compartment of the mitochondrion

D. Chloroplast - chlorophyll-containing organelles of phototrophic microbial eukaryotes

such as the algae and function to carry out photosynthesis.
Thylakoids - Chlorophyll and all other components needed for ATP synthesis in
chloroplasts are located in a series of flattened membrane discs.
- highly impermeable and its major function is to form a proton motive force that
results in ATP synthesis.
E. Endoplasmic reticulum (ER) - a network of membranes continuous with the nuclear

membrane.
Two types of endoplasmic reticulum:
1. rough ER - which contains attached ribosomes
2. smooth ER – which does not contain ribosomes
F. Golgi complex - products of the ER are chemically modified and sorted into those
destined for secretion versus those that will function in other membranous structures
in the cell.
- glycosylation happened in Golgi complex.
G. Lysosomes - fuses with food that enters the cell in vacuoles and then releases
digestive enzymes that break down the foods for biosynthesis and energy generation.
H. Cytoskeleton – the framework of cell

a. microtubules - maintaining cell shape and cell motility by cilia and flagella,
moving chromosomes during mitosis.
b. microfilaments -smaller than microtubules, about 7 nm in diameter
- function in maintaining or changing cell shape, in cell motility.
c. intermediate filaments - fibrous keratin proteins that form into fibers 8–12 nm
in diameter and function in maintaining cell shape and positioning organelles in
the cell.
I-J. Flagella and Cilia - present on the surface of many eukaryotic microbes and function
as organelles of motility, allowing cells to move by swimming.
Cilia - essentially short flagella that beat in synchrony to propel the cell, usually
quite rapidly through the medium.
Flagella - long appendages present singly or in groups that propel the cell along,
more slowly than by cilia, a whip-like motion.
***Dynein a protein attached to the microtubules and uses ATP to drive motility.
Assessment:
1. Compare and contrast the prokaryotes from eukaryotes.
2. What are the structural reasons for the rigidity that is conferred on the cell wall
by the peptidoglycan structure?
3. What is the function of gas vesicles?
4. Describe the structure and function of a bacterial flagellum.

5. How are the mitochondrion and the hydrogenosome similar structurally?
Grading System:

5 4 3 2 1
the question
Total Score = _________ / 10 x 100 = _________%
References:

• Engelkirk, P.G.. Burton’s Microbiology for Health Sciences. (2011) 9th ed. Lippincott
Williams & Wilkins
• Madigan, M.T.. Brock Biology of Microorganisms (2019) 15th ed. Pearson Education, Inc.
• Tille, Patricia M.. Bailey and Scott’s Diagnostic Microbiology (2017) 14th ed. Elsevier
• Tortora, G. et al.. Microbiology: An Introduction. (2013) 11th ed. Pearson Education, Inc.

MODULE 5: MICROBIAL GROWTH
Overview:
Microbes that are “growing” are increasing in number, accumulating into colonies. Many
bacteria survive and grow slowly in nutrient-poor environments by forming biofilms.
Learning Outcomes:
1. identify the microbial growth requirements.
2. determine how bacteria grow exponentially using generation time; and
3. describe different microbial growth phases.
Course Material:
Growth Factors may require small amounts of certain organic compounds for growth
because they are essential substances that the organism is unable to synthesize from available
nutrients.
The requirements for microbial growth can be divided into two main categories: physical
and chemical.
I. Physical Requirements:
1. temperature - Most microorganisms grow well at the temperatures that humans
favor.
Classified into three primary groups:

a. psychrophiles (cold-loving microbes) at 0⁰C.

b. mesophiles (moderate-temperature– loving microbes) - 25–40°C, are
the most common type of microbe.
c. thermophiles (heat-loving microbes) – 50-60⁰C.
d. hyperthermophiles - have an optimum growth temperature of 80°C or
higher.
e. extreme thermophiles – 121⁰C and above.
2. pH – refer to acidity or alkalinity of a solution.

- Most bacteria grow best in a narrow pH range near neutrality, between \
pH 6.5 and 7.5.
- Very few bacteria grow at an acidic pH below about pH 4. This is why a
number of foods, such as sauerkraut, pickles, and many cheeses, are
preserved from spoilage by acids produced by bacterial fermentation.
- Acidophiles are bacteria that loves acids environment.
3. Osmotic pressure - require water for growth, and their composition is 80–90%
water.
- High osmotic pressures have the effect of removing necessary water from
a cell.
- Hypertonic - whose concentration of solutes is higher than in the cell.
- Plasmolysis – shrinkage of cell cytoplasm.
Types of Halophiles:
a. Extreme Halophiles – require high salt concentration
b. Obligate Halophiles – require 30% of salt for growth.
c. Facultative Halophiles – requires 15% of salt for growth
II. Chemical Requirements:

1. Carbon
2. Sulfur, Nitrogen and Phosphorus
3. Trace elements such as iron, copper, molybdenum, and zinc
4. Organic Growth factors
5. Oxygen
a. aerobes – microbes that use molecular oxygen
b. anaerobes - microbes that do not use oxygen.
Types of Oxygen Requirement:

1. Obligate aerobe - organisms that require oxygen to live
e.g. Pseudomonas aeruginosa (Gram negative)
Mycobacterium tuberculosis (acid-fast)
Bacillus (Gram-positive).
2. Facultative anaerobe - ability to continue growing in the absence of
oxygen
e.g. E. coli and yeast
3. Obligate anaerobe - bacteria that are unable to use molecular oxygen
for energy-yielding reactions
e.g. Clostridium
4. Aerotolerant anaerobes - cannot use oxygen for growth, but they
tolerate it fairly well.
e.g. Lactobacilli

5. Microaerophile - they are aerobic; they do require oxygen. They grow

only in oxygen concentrations lower than those in air.
e.g. Borrelia burgdorferi, a species of
spirochaete bacteria that causes Lyme disease in humans,
Helicobacter pylori, a species of proteobacteria that
has been linked to peptic ulcers and some types of gastritis
Cell Division
Two Types of Asexual Reproduction in Microbes
1. Binary fission - forms a totally new daughter cell, with the mother cell retaining its
original identity.
2. Budding division - forms a totally new daughter cell, with the mother cell retaining its
original identity.
Generation time - When one cell eventually separates to form two cells, we say that
one generation has occurred.
- During one generation, all cellular constituents increase proportionally.
- Each daughter cell receives a copy of the chromosome(s) and sufficient copies of
ribosomes and all other macromolecular complexes, monomers, and inorganic
ions to begin life as an independent entity.
*Biofilms- an attached polysaccharide matrix containing embedded bacterial cells.
Microbial Growth and Quantification
Growth - an increase in the number of cells.
Culture medium or growth medium is a liquid or gel designed to support the growth of
microorganisms. Laboratory cultures of microorganisms are grown in culture media
Two broad classes of culture media:

1. Defined media are prepared by adding precise amounts of pure inorganic or
organic chemicals to distilled water. Exact composition is known.
2. Complex media are made from digests of microbial, animal, or plant products.
Microbial Growth Cycle
Four Phases of Growth:

a. lag phase - growth begins only after a period of time
b. exponential or log phase - cell population doubles at regular intervals
c. stationary phase – cells in the population grow while others die
d. death phase - growth ceases
Exponential growth is a repetitive pattern where the number of cells doubles in a

constant time interval.
- As one cell divides to become two cells, we express this as 20 -> 21. As two cells
become four, we express this as 21 -> 22 and so on.

- Bacteria grow quickly in batch culture (enclosed vessel), and cell numbers
increase dramatically in a short period of time.
- By measuring the rate of cell population increase over time, the growth depicts a
certain “growth curve”.
- In order to control both specific growth rate and cell density independently,
continuous culture, a type of an open system must be done.
- The most common type of continuous culture is the chemostat.
- In the continuous culture growth vessel, a known volume of sterile medium is
added at a constant rate while an equal volume of spent culture medium (which
also contains cells) is removed at the same rate.
Measuring Number of Microbes

• Microscopic counting is a quick and easy way of estimating microbial cell
numbers.
• Microscopic counts can be performed either on samples dried on slides or on liquid
samples.
a. Stained samples to increase contrast between cells and their
background
b. Liquid samples, counting chambers consisting of a grid with squares
of known area etched on the surface of a glass slide are used.
A. Direct Measurement of Microbial Growth

1. Plate count - most frequently used method of measuring bacterial populations.
Often reported as colony-forming units (CFU).
A viable cell is one that is able to divide and form offspring, and in most
cell-counting situations.
Methods of Viable Plate Count:

a. spread plate method - a volume (usually 0.1 ml or less) of an appropriately
diluted culture is spread over the surface of an agar plate using a sterile
glass spreader.
- positions all the colonies on the surface and avoids contact
between the cells and melted agar.
b. pour plate method – a known volume (usually 0.1-1.0 ml) of culture is
pipetted into a sterile Petri plate. (Refer to Figure 5.14 of the book).
- colonies will grow within the nutrient agar (from cells suspended
in the nutrient medium as the agar solidifies) as well as on the
surface of the agar plate.
2. Serial Dilution - to ensure that some colony counts will be within this range, the
original inoculum is diluted several times in a process. Refer to Figure 6.16.
3. Filtration - applied frequently to detection and enumeration of coliform bacteria,
which are indicators of fecal contamination of food or water.
4. Most Probable Number (MPN) method - the greater the number of bacteria in a
sample, the more dilution is needed to reduce the density to the point at which no
bacteria are left to grow in the tubes in a dilution series.
Uses of MPN:

a. microbes being counted will not grow on solid media (such as the
chemoautotrophic nitrifying bacteria).
b. useful when the growth of bacteria in a liquid differential medium is
used to identify the microbes (such as coliform bacteria, which selectively
ferment lactose to acid, in water testing).
5. Direct Microscopic Count - a measured volume of a bacterial suspension is
placed within a defined area on a microscope slide.
Petroff-Hausser cell counter – used for direct microscopic counting.
Coulter counter – used for electronic cell counters.
B. Indirect Methods by Estimating Bacterial Numbers

1. Turbidity - As bacteria multiply in a liquid medium, the medium becomes turbid,
or cloudy with cells.
2. Spectrophotometer (or colorimeter) - instrument used to measure turbidity.
3. Metabolic Activity - assumes that the amount of a certain metabolic product, such
as acid or CO2, is in direct proportion to the number of bacteria present.
4. Dry Weight - the fungus is removed from the growth medium, filtered to remove
extraneous material, and dried in a desiccator. It is then weighed.
Activities / Assessments:
1. Compare and contrast the physical requirement in microbial growth.
2. Discuss the method of viable plate count.
Grading System:
In question No. 1, there will be a 10 points per physical requirement.
In question No. 2, there will be a 10 points per viable plate count.

5 4 3 2 1
the question
Total Score = _________ / 10 x 100 = _________%
References:

• Madigan, M.T. et.al. Brock Biology of Microorganisms 15th ed. (2019). Pearson Education,
Inc.
• Tortora, Funk and Case. Microbiology: An Introduction. (2013). 11th ed. Pearson
Education, Inc.
MODULE 6: MICROBIAL METABOLISM
Overview:
• Metabolism is the series of biochemical reactions by which the cell breaks down or
biosynthesizes various metabolites.
• In order to grow, cells must incorporate nutrients from the environment, transform them
into precursor molecules, and then use them to construct a new cell.
• Because the metabolic capacities of microbes differ, their nutrient requirements also differ.
Learning Outcomes:
1. differentiate macronutrients and micronutrients;
2. learn different microbial transport system.
3. discuss the glycolytic pathway
Course Material:
Microbial Nutrients
Cell are primarily composed of elements C, H, O, N, P, and S. These chemical elements
are predominant in the cell:
1. C is needed in the largest amount (50% of a cell’s dry weight)
2. O and H are next (combined, 25% of dry weight)
3. N follows (13%).
4. P, S, K, Mg, and Se combine for less than 5% of a cell’s dry weight.
All microbes require a core set of nutrients.
Macronutrients are required in large amounts
Micronutrients are required in minute amounts.
e.g. Trace elements as co-factor of certain enzymes

Vitamins as growth factors(organic micronutrient)

Iron (Fe) plays a major role in cellular respiration
Transporting Nutrients into the Cell
- The active transport of nutrients into the cell is an energy requiring process driven by
ATP (or some other energy-rich compound) or by the proton motive force.
- Three classes of transport systems: simple, group translocation, and ABC systems.
Each functions to accumulate solutes against the concentration gradient.
1. Simple transport reactions are driven by the energy inherent in the proton
motive force.
Major transport:
a. symport reactions (where a solute and a proton are cotransported in
one direction)
b. antiport reactions (where a solute and a proton are transported in
opposite directions)
2. Group translocation differs from simple transport in two important ways:
(1) the transported substance is chemically modified during the transport
process, and
(2) an energy-rich organic compound (rather than the proton motive force)
drives the transport event.
3. ABC transport systems
- “ABC” standing for ATP-binding cassette- a structural feature of
proteins that bind ATP.
- transport systems that employ a periplasmic binding protein along with
transmembrane and ATP-hydrolyzing components.
Energy Classes of Microorganism
Classification by Carbon and Energy Source
 All microorganisms conserve energy from either the oxidation of chemicals or from
light.
- Chemotrophs - organisms that conserve energy from chemicals.
- Chemoorganotrophs use organic chemicals as their electron donors,
while chemolithotrophs use inorganic chemicals.
- Phototrophic organisms convert light energy into chemical energy (ATP)
and include both oxygenic and anoxygenic species.
- Heterotroph, its cell carbon is obtained from one or another organic
compound. An autotroph, by contrast, uses carbon dioxide (CO2) as its
carbon source.
 Most chemolithotrophs and phototrophs are autotrophs. Autotrophs are also called
primary producers because they synthesize new organic matter from inorganic
carbon (CO2).
 Calvin cycle is the major biochemical pathway by which phototrophic organisms
incorporate CO2 into cell material.

Source: https://microbenotes.com/classification-of-bacteria-on-the-basis-of-nutrition/
Enzymes
 Enzymes are protein catalysts that increase the rate of biochemical reactions by activating
the substrates that bind to their active site.
 Enzymes are highly specific in the reactions they catalyze, and this specificity resides in
the three-dimensional structures of the polypeptide(s) that make up the protein(s).
Redox
 Chemical reactions in the cell are accompanied by changes in energy, expressed in
kilojoules. Reactions either release or consume free energy.
 ∆G0 is a measure of the energy released or consumed in a reaction under standard
conditions and reveals which reactions can be used by an organism to conserve energy.
 Oxidation–reduction reactions require electron donors and electron acceptors. The
tendency of a compound to accept or release electrons is expressed by its reduction
potential (E0’).
 The substance oxidized (H2) as the electron donor, and the substance reduced (O2) as
the electron acceptor.
 Redox reactions in a cell often employ redox coenzymes such as NAD+/NADH as electron
shuttles.
 The energy released in redox reactions is conserved in compounds that contain energy-
rich phosphate or sulfur bonds.
• ATP -the prime energy carrier in the cell. Consists of the ribonucleoside adenosine to
which three phosphate molecules are bonded in series.
Catabolism: Fermentation and Respiration
 Metabolism – pertains to all chemical reactions and physical workings of the cell.

Two Categories of Metabolism

a. Anabolism – any process that results in synthesis of cell molecules and
structures.
- a building and bond making process that forms larger macromolecules
from smaller ones.
- consumes energy
b. Catabolism – breaks the bonds of larger molecules into smaller molecules.
- releases energy
 universal pathway for the catabolism of glucose is the Embden–Meyerhof–Parnas
pathway, better known as glycolysis.
 The glycolytic pathway is used to break down glucose to pyruvate and is a widespread
mechanism for energy conservation by fermentative anaerobes that employ substrate-
level phosphorylation.
 The pathway releases a small amount of ATP (2–3/glucose) and large amounts of
fermentation products. Besides glucose, the fermentation of other sugars, amino acids,
nucleotides and polymeric compounds is possible.
Respiration:
Respiration offers an energy yield much greater than that of fermentation.
 The citric acid cycle generates CO2 and electrons for the electron transport chain.
The pathway by which pyruvate is oxidized to CO2.
 The glyoxylate cycle is necessary for the catabolism of two-carbon electron
donors, such as acetate.
Electron transport chains are composed of membrane associated redox proteins that
are arranged in order of their increasing E0’ values.
 The electron transport chain functions in a concerted fashion to carry electrons
from the primary electron donor to the terminal electron acceptor, which is O2 in
aerobic respiration.
Biosyntheses
- Polysaccharides are important structural components of cells and are biosynthesized
from activated forms of their monomers.
- Gluconeogenesis is the production of glucose from non-sugar precursors.
- Amino acids are formed from carbon skeletons to which ammonia is added from
glutamate, glutamine, or a few other amino acids.
- Nucleotides are biosynthesized using carbon skeletons from several different sources.
- Fatty acids are synthesized from the three-carbon precursor malonyl-ACP, and fully
formed fatty acids are attached to glycerol to form lipids. Only the lipids of Bacteria and
Eukarya contain fatty acids.
Activity/Assessment:
1. Which four of the chemical elements make up the bulk of a cell’s dry weight? Why?

2. Differentiate between trace elements and growth factors. Cite examples.

3. Explain how are trace elements and growth factors are used by the cell?
Grading System:
Scoring for Nos.:
1. 10 points
2. 5 points for the trace elements and 5 points for the growth factors.
3. 10 points

5 4 3 2 1
the question
Total Score = _________ / 10 x 100 = _________%
Reference:

• Madigan. M. T. Brock Biology of Microorganisms 15th (2019) ed. Pearson Educ. Inc.
• https://wccs.instructure.com

MODULE 7: MICROBIAL GENETICS

by Kiara Nicole D. Rodriguez
Overview:
 Microbial Genetics is the study of the mechanisms of heritable information in
microorganisms (bacteria, archaea, viruses and some protozoa and fungi).
 This also involves the study of the genotype of microbial species and also the expression
system in the form of phenotypes.
 The Central Dogma of Molecular Biology mainly involves the conversion of DNA encoded
information into RNA, that is then essential to form proteins.
 The Central Dogma of Molecular Biology is therefore divided into three major events: DNA
replication, mRNA Transcription, and protein Translation.
 Mutation is any heritable alteration in the base sequence of the genetic material.
 Gene transfer mechanisms in prokaryotes can either be via vertical gene transfer
(movement of genetic material by descent) or horizontal gene transfer (movement of
genes between cells that are not direct descendants of one another).
Learning Outcomes:
After successful completion of this module, you should be able to:
1. Differentiate the structures of DNA and RNA.
2. Discuss the Central Dogma of Molecular Biology
3. Define Mutation
4. Determine the different types of genetic transfer.
Course Material:
Nucleic acids

- Structural units of nucleic acids are the nucleotides.

 Each nucleotide has 3 parts:
 a nitrogen-containing base
o adenine (A), thymine (T), cytosine (C), guanine (G), and
uracil (U).
o A and G – purines
o C, T, and U - pyrimidines
 a pentose (five-carbon) sugar
o either deoxyribose or ribose
 a phosphate group (phosphoric acid)
Structure of DNA
- A molecule of DNA consists of two strands that form a double helix structure.
- Each DNA strand is composed of nucleotides—units made up of a sugar
(deoxyribose), a phosphate group, and a nitrogenous base.
- The sequences of nitrogenous bases on the two strands of a DNA molecule are
complementary.
- The nitrogenous base pairs are joined by hydrogen bonds.
- The two strands of DNA are antiparallel.
Structure of RNA
- RNA, like DNA, is made up of nucleotide consisting of a 5-carbon sugar ribose, a
phosphate group, and a nitrogenous base.
- three main differences between DNA and RNA:
- RNA uses the sugar ribose instead of deoxyribose.
- RNA is generally single-stranded.
- RNA contains uracil in place of thymine.
- RNA has 3 types:
a. mRNA (messenger RNA) – type of RNA generated from
transcribing DNA. Carries information for the translation of a
particular protein.
b. rRNA (ribosomal RNA) – structural component of ribosomes.
c. tRNA (transfer RNA) – carries amino acids to the ribosome during
translation to help build an amino acid chain.
DNA vs. RNA

photograph by Roland Mattern, distributed under a CC-BY 4.0 International license.
Central Dogma of Molecular Biology

(Replication, Transcription, Translation)
- DNA contains the complete genetic information that defines the structure and
function of an organism.
- Proteins are formed using the genetic code of the DNA.
- Conversion of DNA encoded information to RNA is essential to form proteins.
Thus, within most cells, the genetic information flows from –
 Genotype – the organism’s genetic makeup - all its DNA—the information that
codes for all the particular characteristics of the organism.
 Phenotype – refers to actual, expressed properties (proteins).
Example: Chromobacterium violaceum has the vioC gene
Expression of vioC gene
Leads to the production of violacein pigment
I. DNA replication is the process by which DNA makes a copy of itself during cell
division.
A. Universal Features of DNA replication

a.) semi-conservative mode
 resulting daughter molecules each have one parental (old) strand
and one newly synthesized strand
b.) Watson and Crick base pairing maintained
c.) DNA is synthesized in the 5' to 3' direction
d.) A primer is needed for initiation
 stretch of DNA or RNA nucleotides that provide 3' OH end

e.) A complex process involving several enzymes and proteins
B. Stages in DNA Replication

1.) Initiation
 Origin of Replication - sequence of DNA at which replication is initiated
on a chromosome, plasmid or virus.
 In prokaryotes and viruses – begins at a defined chromosomal locus
(usually unique) ~300 nuc.
Ex. ori C in E. coli
 In eukaryotes – begins at various replication origins; faster replication
Ex. In Drosophila embryos
- DNA replicates in three minutes
- 100x more DNA but 6x faster compared to E. coli
 DNA gyrase and topoisomerases relaxes supercoiling ahead of the
replication fork.
 Replication fork - The point at which replication actively
occurs.
 The two strands of parental DNA are unwound by helicase.
 Primers signal the starting point of DNA replication
 Synthesized by primase
2.) Elongation
 During elongation, a primer sequence is added with complementary
RNA nucleotides, which are then replaced by DNA nucleotides.
During elongation the leading strand is made continuously, while the
lagging strand is made in pieces called Okazaki fragments.
 Both parental strands serve as template for the DNA replication.
 DNA polymerase synthesizes only at the 5’ to 3’ direction.
 DNA replication is bi-redirectional.
 Leading strand- continuous, one primer, DNA polymerase ; 5' to
3’
 Lagging strand –synthesized opposite to the fork movement;
discontinuous, several primers, DNA polymerase; 5' to 3', Okazaki
fragments
photograph by NHS National Genetics and Genomics Education Centre, distributed under
a CC-BY 2.0 Generic license.

3.) Termination
 Termination of DNA replication occurs when two replication forks meet on
the same stretch of DNA, during which the following events occur,
although not necessarily in this order:
 forks converge until all intervening DNA is unwound
 any remaining gaps are filled and ligated (DNA ligase)
 replication proteins are unloaded
II. Transcription
 the synthesis of a complementary strand of RNA from a DNA template.
 Recall the Central Dogma:
 a strand of mRNA is synthesized using a specific portion of the cell’s DNA as a

template.
Steps:
1. RNA polymerase binds to the DNA at a site called the promoter.
Only one of the two DNA strands serves as the template for RNA
synthesis for a given gene.
2. RNA polymerase synthesize mRNA in the 5’ – 3’ direction
3. RNA synthesis continues until RNA polymerase reaches a site on the

DNA called the terminator.
photograph by NHS National Genetics and Genomics Education Centre,

distributed under a CC-BY 2.0 Generic license.
III. Translation
- Also known as protein synthesis.

- From mRNA to protein.

- The language of mRNA is in the form of codons.
 groups of 3 nucleotides, such as AUG, GGC, or AAA
- The sequence of codons on an mRNA molecule determines the sequence of
amino acids that will be in the protein being synthesized.
 Each codon “codes” for a particular amino acid.
The Genetic Code

- there are 61 possible codons but only 20 amino acids.
- this means that most amino acids are signaled by several alternative
codons.
Codons for same amino acid usually differ in 3rd position only
- Third Base Degeneracy / Wobble Hypothesis
photograph by Sarah Greenwood, distributed under a CC-BY 4.0 International license.
Key points:
 usually a number of ribosomes are attached to a single mRNA, all at various
stages of protein synthesis.
 In prokaryotic cells, the translation of mRNA into protein can begin even before
transcription is complete.
 Co-transcription translation

photograph by Sarah Greenwood, distributed under a CC-BY 4.0 International license.
Steps in Translation:
1. The ribosome binds to mRNA at a specific area.
2. The ribosome starts matching tRNA anticodon sequences to the mRNA
codon sequence.
3. Each time a new tRNA comes into the ribosome, the amino acid that it was
carrying gets added to the elongating polypeptide chain.
4. The ribosome continues until it hits a stop sequence, then it releases the
polypeptide and the mRNA.
5. The polypeptide forms into its native shape and starts acting as a functional
protein in the cell.
Mutation
- any heritable alteration in the base sequence of the genetic material
- appear suddenly without any transitional stage between the initial and final states of the
organisms.
- when established, mutation may be permanently present whether or not the conditions of
development of the mutated organism allow their detection.
- can either be spontaneous or induced.
a. Spontaneous mutation
- occur without external intervention, and most result from occasional errors
in the pairing of bases by DNA polymerase during DNA replication.
b. Induced mutation

- caused by agents in the environment and include mutations made

deliberately by humans.
- result from exposure to natural radiation that alters the structure of bases
in the DNA, or from a variety of chemicals that chemically modify DNA
Types of Mutation:
A. Base Substitution / Point Mutation
- a single base at one point in the DNA sequence is replaced with a different
base during replication.
- can either be:
Transition
Purine to purine or pyrimidine to pyrimidine
Transversion
Purine to pyrimidine or vice versa
photograph by Emmanuel Douzery, distributed under a CC-BY 4.0 International license.
photograph by Jonathan Froehlich, distributed under a CC-BY 4.0 International license.
Consequences of Base Pair changes

1. Missense mutation
- changes a codon for one amino acid to a codon for another
amino acid
- results in an amino acid substitution in the protein product.

2. Nonsense mutation
- changes a codon for an amino acid with a codon for chain
termination (UAG, UAA, UGA)
3. Silent mutation
- a change in codon composition that has no effect on the
resulting polypeptide
B. Frameshift Mutation
- adds or deletes one or two bases (or any non-multiple of 3) from a coding
sequence in a DNA, so that the genetic code is read out-of-phase.
Consequence:
 incorrect amino acid or premature termination
 severe phenotypic effects
C. Deletion
 mutation in which a region of the DNA has been eliminated.
D. Insertion
 occurs when new bases are added to the DNA
Mutagens
- physical or chemical agents that changes the genetic material.
- Physical Mutagens
 high energy radiations
 penetrate living cells
 2 types:
a. Electromagnetic radiations
b. Particulate radiations
A. Physical Mutagens
1. Electromagnetic radiations
- Gamma rays, X-rays and ultraviolet rays
- penetration power is inversely proportional to their wavelength
Result:
Gamma Rays and X-rays (ionizing radiation)
a. Direct effect: single or double stranded breaks in the DNA
molecules.
b. Indirect effect: free radicals created
 form compounds, hydrogen peroxide - initiate harmful
chemical reactions within the cells.
 Can lead to cell death
Result:
Ultraviolet rays (non-ionizing radiation)
Formation of pyrimidine dimers
 Most are immediately repaired, but some escape repair
and inhibit replication and transcription.

2. Particulate radiations
- are in the form of sub-atomic particles emitted from the atoms with high energy
Alpha particles, beta particles and neutrons
penetrating power: Beta particles > alpha particles because of its
smaller size
Neutrons: extremely penetrant, and can cause severe damage to the

living tissues as well as genetic material
Result:
- single strand or double-strand breaks in the DNA
B. Chemical Mutagens
- classified into 4 major groups: on the basis of their specific reaction with DNA.
1. Deaminating agents - cause the loss of the amino group.

e.g. nitric oxide, nitrous acid, or N-nitrosoindoles
2. Base Analogs - structurally resemble purines and pyrimidines and may be

incorporated into DNA in place of the normal bases during DNA replication.
They induce mutations because they often have different base-pairing rules
than the bases they replace.
3. Alkylating Agents - chemicals that donate alkly groups (methyl, ethyl) to
other molecules. The alkylated base may then degrade to yield a baseless
site, which is mutagenic and recombinogenic, or mispair to result in
mutations upon DNA replication.
e.g. methylmethane sulphonate (MMS), ethyl methane sulfonate
(EMS),N-methyl-N’-nitro-N-nitrosoguanidine (MNNG)
4. Intercalating Agents- molecules that may insert between bases in DNA,

causing frameshift mutation during replication.
e.g. acridine derivatives (acridine orange, proflavine, acriflavine),
nitrogen mustards ethidium bromide
Gene Transfer Mechanisms in Prokaryotes

Vertical Gene Transfer
- movement of genetic material by descent where information travels through the
generations as the cell divides.
e.g. antibiotic resistance due to spontaneous mutation transferred directly to
all the bacteria's progeny during DNA replication
Horizontal Gene Transfer (HGT)

- movement of genes between cells that are not direct descendants of one another.

- 3 mechanisms: Transformation, Conjugation, and Transduction

- “10,000 unique genes flowing via HGT among 2,235 bacterial genomes," providing
the bacteria with genetic information they didn't inherit from their parent cells.
- multiple drug resistance
photograph by OpenStax Biology, distributed under a CC-BY 4.0 International license.
Recombination
- the physical exchange of DNA between genetic elements
- Horizontally-transferred DNA from a donor should undergo recombination
with the recipient’s DNA in order to be retained in the recipient.
- Not necessarily for plasmids
 Can replicate itself
Transformation
- the uptake of exogenous DNA from the environment.
- involves recombination and integration in the recipient’s genome.
- sources of exogenous DNA:
 native bacterial chromosome fragments
 plasmid
 bacteriophage DNA
- cell-cell contact is not required
Conjugation
- plasmid-encoded mechanism that can mediate DNA transfer between
bacterial cells.
- requires cell-to-cell contact (mating)
- Occurs via a conjugal/membrane pore
- DNA transfer occurs in one direction - from donor (contains F plasmid) to
recipient not vice versa.
- F plasmid (“F” stands for Fertility)
- Found in donor cells which are designated as F+ cells.
- Encode genes that allow conjugative transfer of genes.
F - encoded (sex) pilus
- Allow specific pairing of donor (F+) and recipient cells (F-)
Transduction
- the transfer of genetic information between cells through the mediation of

a virus (phage) particle

- does not require cell to cell contact.
Two ways:
1. Generalized transduction
 DNA derived from virtually any portion of the host genome is
packaged inside the mature virion in place of the virus genome
 the bacterial donor genes cannot replicate independently and are not
part of a viral genome
2. Specialized transduction
 DNA from a specific region of the host chromosome is integrated
directly into the virus genome—usually replacing some of the virus
genes.
Activity/ Assessment:
In a separate sheet of paper, write the name, section, module number, title and questions. Then
briefly discuss the following questions:
1.) Shown below is the DNA (a hypothetical segment of vioC gene) that encodes for the
pigment violacein in the bacteria Chromobacterium violaceum. Transcribe this DNA into
an mRNA transcript.
a. Indicate which will be the template strand and which is the coding strand
b. Indicate where is the 5’ and 3’ position in the generated mRNA transcript
5’ ATGACTCCAAACGAGGGGCGTTTTAGCTGTGCGGAACTTAGGTGATCCATAGTAACGCAT 3’
3’ TACTGAGGTTTGCTCCCCGCAAAATCGACACGCCTTGAATCCACTAGGTATCATTGCGTA 5’
2.) Translate the mRNA transcript for violacein that you were able to generate in the
previous question into a protein. After that, answer the ff. questions:
a.) How many amino acids does the protein have?
b.) What is the amino acid that is encoded by the codon before the stop codon in
the polypeptide chain?
c.) What is the first amino acid in the protein?

Reference:
• Brock Biology of Microorganisms (2019) 15th ed. Pearson Educ. Inc.
MODULE 8: VIRAL GENOMES AND DIVERSITY
Overview:
• Viruses are too small to be seen with light microscope and cannot be cultured outside their
hosts.
• Viruses are found as parasites in all types of organisms. Although viruses must live inside
a host cell, not all of them cause a disease.
Learning Outcomes:
1. identify the different structural components of virion
2. categorize the characteristics of viral genome;
3. discuss the viral growth curve.
Course Material:
I. Nature of Virus
Virus – obligate intracellular parasite
Virion
- complete, fully developed, infectious viral particle

- composed of nucleic acid and surrounded by a protein

coat.
- most viruses are smaller than prokaryotic cells
- 0.02 to 0.3 μm (20–300 nanometers, nm)
A. Components of Structure:
1. Nucleic Acid – either DNA or RNA
2. Capsid – nucleic acid surrounded by a protein coat
Capsomere- each capsid is composed of protein sub units.
Nucleocapsid - a unit of viral structure, consisting of a capsid with the
enclosed nucleic acid.
3. Envelope- one that covers the capsid
Non-enveloped or naked virus - those not covered
- composed of combination of lipid, protein and carbohydrates.
- may or may not be covered by spikes
B. General Morphology:
1. Helical Viruses
- long rods that may be rigid or flexible. The nucleic acid is found within
hollow, cylindrical capsid that has a helical structure.
e.g. rabies, ebola
2. Polyhedral Viruses
- animal, plant and bacterial viruses are polyhedral.
- The capsid is in the shape of icosahedron (20 triangular faces and 12
corners).
- Capsomeres are equilateral triangle.
e.g. adenovirus and poliovirus
3. Enveloped Viruses – roughly spherical.
enveloped helical virus - helical virus enclosed with an envelope
e.g. Influenza virus
enveloped polyhedral virus – polyhedral virus enclosed with an envelope
e.g. Herpes simplex virus
4. Complex viruses – bacterial viruses have complicated structures.
e.g. bacteriophage
Viral Symmetry
a. Helical symmetry – rod shaped viruses
e.g. Tobacco Mosaic Virus (TMV)
b. Icosahedral – spherical shaped viruses
II. Viral Genome

- consist either DNA or RNA
- single or double stranded
- can either be linear or circular
Base sequence:
- the single stranded genome + sense or – sense
- The plus (+) configuration have the exact same base sequence
as that of the viral mRNA that will be translated to form viral
proteins.

- The minus (-) configuration is complementary in base

sequence to viral mRNA.
Characteristics of Viral Genome

1. Living characteristics of viruses
a. They reproduce at a fantastic rate, but only in living host cells.
b. They can mutate.
2. Non-living characteristics of viruses
a. They are acellular, that is, they contain no cytoplasm or cellular organelles.
b. They carry out no metabolism on their own and must replicate using the
host cell's metabolic machinery.
c. either DNA or RNA
III. Taxonomy of Viruses:

- International Committee on the Taxonomy of Viruses (ICTV) has been grouping the
viruses into families based on:
1. Nucleic acid type
2. Strategy for replication
3. morphology
- The suffixes:
Order names end in –ales.
Family names end in –viridae;
Genus names -virus;
- Viral species is a group of viruses sharing the same genetic information and
ecological niche. Specific epithets for viruses are not used.
e.g. HIV, with subspecies designated by a number HIV-1
Isolation, Cultivation and Identification of Viruses

-Viruses cannot multiply outside a living host cell complicates their detection,
enumeration, and identification .
-Viruses must be provided with living cells instead of a fairly simple chemical
medium.
-Living plants and animals are difficult and expensive to maintain.
-Pathogenic viruses that grow only in higher primates and human host can cause
additional complications.
-Bacteriophage easily grown on bacterial cultures.
-Viral multiplication has come from bacteriophage.
Viral Identification
1. Western Blotting – the serological test that is commonly used in identifying
viruses
2. Restriction Fragment Length Polymorphisms (RFLP)
3. Polymerase Chain Reaction (PCR)
IV. Viral Replication

- Viruses do not contain enzymes for energy production of protein synthesis.
- For a virus to multiply, it must invade a host cell and direct the host’s metabolic
machinery to produce vital enzymes and components.

Bacteriophage
- viruses that infect bacteria obligate intracellular pathogens they must enter
the bacterial cell to replicate.
2 Primary Types of Bacteriophage

A. Virulent phages – also known as the LYTIC CYCLE
Bacteriophages that replicate through the lytic life cycle are called lytic
bacteriophages, and are so named because they lyse the host bacterium as a
normal part of their life cycle, which ends with the destruction (lysis) of the
bacterial cell.
B. Temperate phages - known as the LYSOGENIC CYCLE
Do not immediately initiate the lytic cycle, but rather, their DNA remains
integrated into the bacterial cell chromosomes, generation after generation,
and become a noninfectious prophage.
Growing of Bacteriophage
- grown either in suspension of bacteria in liquid media or bacterial
cultures of solid media.
Plaque Assay method – used for detecting viruses in solid media
Growing of Animal Viruses
Methods used in culturing animal viruses

a. Living animals
b. Embryonated eggs
c. Cell cultures
V. Viral Infection – a process where the viruses cannot replicate or reproduce unless the
virion itself (or its genome, in the case of bacterial viruses) has gained entry into a suitable
growing host cell.
Virulent Lytic Infection
- The virus may replicate and destroy the host
- In a lytic infection, the virus redirects the host cell’s metabolism from growth
to support virus replication and the assembly of new virions.
- New virions are released, and the process can repeat itself with new host
cells.
Latent Viral Infection

- virus remain in the host cell for long periods without producing the
infection.
e.g. cold sores, shingles
Persistent Viral Infection

-disease processes that occur over a long period and generally are fatal.
-caused by conventional viruses; viruses that accumulate over a long
period.
Virus Lytic Cycle

1. Attachment (adsorption) of the virion to the host cell
2. Penetration (entry, injection) of the virion nucleic acid into the host cell
3. Synthesis of virus nucleic acid and protein by host cell machinery as redirected
by the virus
4. Assembly of capsids and packaging of viral genomes into new virions
5. Release of new virions from the cell.
Lysogenic Cycle of Bacteriophage λ in E. coli
Basic differences between the lytic and lysogenic cycles of a viral infection

In lytic cycle, the viral DNA destroys cell DNA, takes over cell functions and
destroys the cell.
In lysogenic cycle, the viral DNA merges with cell DNA and does not destroy cell.
In lytic cycle, the virus replicates and produces progeny phages.

In lysogenic cycle, the virus does not produce progeny.
In lytic cycle, there are symptoms of viral infection.

In lysogenic cycle, there are no symptoms of viral infection.
Virulent viral replication takes place by lytic cycle.

Temperate viral replication takes place by lysogenic cycle.
Viruses and Cancer

- Several types of cancer are know known to be caused by viruses.
- Molecular biological research shows that the mechanisms of the disease are
similar, even when a virus does not cause the cancer.
- The viral cause of cancer can often go unrecognized for several reasons.
- First, most of the particles of some viruses infect cells but do
not induce cancer.
- Second, might not develop until long after viral infection.
- Third, cancers do not seem to be contagious, as viral diseases
usually are.
Prions, Plant Viruses and Viroids
Prions
- Prions are infectious proteins
- Disease such as Creutzfeldt Jakob Disease (CJD) and mad cow
disease are involved in the degeneration of brain tissue.
- Prion disease are the result of an altered protein.
Plant Viruses
- Must enter plant hosts through wounds or with invasive parasites such as
insects.
- Some plant viruses also multiply in insect cells.
Viroids
- Infectious pieces of RNA that cause some plant diseases such as potato
spindle tuber viroid disease.
Activities / Assessment:

1. Why does viruses are considered as obligate intracellular parasites? (10 points)
2. Draw and explain the growth curve of virus replication (10 points)
3. Differentiate the following:
a. lytic from lysogenic cycle (10 points)
b. latent from persistent viral infection (10 points)
4. Discuss what happened to the brain tissue of a cow infected with prions. (10 points)
Grading System:
Each question is equivalent to 10 points per number:

5 4 3 2 1
the question
Total Score = _________ / 10 x 100 = _________%
Reference:
Brock Biology of Microorganisms (2019) 15th ed. Pearson Educ. Inc.
Tortora, G. et al.. Microbiology: An Introduction (2013) 11th ed. Pearson Educ. Inc.
Module 9: BIORISK, BIOSAFETY AND BIOSECURITY
A. BIORISK AND BIORISK MANAGEMENT

by Mark Joseph B. Cano
Overview:
- In applying biosafety and biosecurity measures, one must be able to assess the severity
of the risk.
- Here we will discuss biorisk and biorisk management covering the AMP model in
handling hazards.
Learning Outcomes:
After completing this module, you should be able to:
1. Define Biorisk
2. Differentiate Biosafety from Biosecurity Risk
3. Identify control measures in Biorisk Mitigation

Course Material:
BIOSAFETY+BIOSECURITY= BIORISK
Biorisk
Effect of uncertainty/ies; combination of event and consequences
Biosafety Risk
Risk of accidental exposure/release of pathogen
Biosecurity Risk
Risk of intentional removal or theft of biological material
Biorisk Management
- System/process to control safety and security risks associated with handling biological
agents in laboratories and facilities`
Goal:
To provide the highest protection and the lowest practical exposure
Steps:
1. Assessment - identification of hazard and evaluation of risk the hazard may impose.
Hazard- Source of harm
Risk- event or consequence
Severity/ Slightly Harmful Extremely Harmful

Likelihood Harmful
Tolerable
Highly Unlikely Trivial Risk Moderate Risk
Risk
Moderate
Unlikely Tolerable Risk Substantial Risk
Risk
Substantial
Likely Moderate Risk Intolerable Risk
Risk
Legend:
Likelihood- probability of risk to happen
Highly Unlikely- risk will not occur
Unlikely- low chance that risk may occur
Likely- higher chance that risk may occur
Severity- is the outcome/impact of risk if it occurs
Slightly Harmful- low impact but curable/treatable

Harmful- the impact is severe but curable/treatable

Extremely Harmful- the impact is severe and treatment or cure may
or may not be available
For example: A rabid dog.

The hazard is the virus brought by the dog.
The risk is the dog may attack and infect people
- In risk assessment, the adequacy of existing protocols is taken into

account to estimate the level of risk. The likelihood of the risk that the dog may
attack and infect is “likely” but anti-rabies drug is existing so the consequence is
“harmful”.
- By plotting the likelihood and consequence we can assess that a rabid
dog falls under “Substantial risk”. However if the rabid dog is sought to be caged,
the risk lessen due to the existence of safety procedure. The likelihood that the
dog may attack now falls under “highly unlikely” and the consequence of being
bitten still falls under “harmful” the new risk assessment of the caged rabid dog
now falls under “Tolerable Risk”.
2. Mitigation
- Actions or protocols that are put into place to reduce or eliminate the risk
associated with biological agents or toxins.
Control Measures for Biorisk Mitigation

a. Elimination - removing the hazard
b. Substitution - replacing the material with something less dangerous
c. Engineering Control
- restricted access to some important parts of the laboratory
- placement of equipment
e.g. Biosafety cabinets, ventilators and anterooms
d. Administrative Control- policies and guidelines used to control risk
e. Practices and Procedures - processes and activities that show effectiveness
of safely handling the biological material
f. Proper Protective Equipment - Completeness of PPE and Proper Donning
and Doffing
3. Performance
Improving biorisk management by recording, measuring, and evaluating
organizational actions and outcomes to reduce biorisk.
Answer the questions:

Are the control measures effectively followed?
What went wrong?

What needs improvement?
Assessment:
1. Using the Likelihood/severity plot, assess the risk of the following scenario. Discuss
your answer.
a. Spoiled milk in an unlabeled container on the dining table
b. SARS-COV2 in your city/barangay (describe the situation of your locality)
2. What are the control measures for Biorisk mitigation? Discuss briefly.
3. In terms of assessment, how can you differentiate hazard from risk?
Grading System:

5 4 3 2 1
the question
Total Score = _________ / 10 x 100 = _________%
Reference:
Further Readings: Read the Biorisk Assessment Methodology pp 20-40 from Laboratory Biosafety and
Biosecurity Risk Assessment Technical Guidance Document: https://www.aam.org.ar/descarga-
archivos/Laboratory-Biosafety-Biosecurity-Guidance.pdf
B. BIOSAFETY PRINCIPLES AND BIOSAFETY LEVEL

by Mark Joseph B. Cano
Overview:
• Handling hazardous agents/microbes requires exhaustive safety measures so it will not

be released and infect/damage personnel and the environment
• Hazards can cause different level of harm thus must be categorized and be approached
uniquely.
Learning Outcomes:
After completing this module, the learner should be able to:
1. Define Biosafety
2. Understand the principles of biosafety
3. Classify a hazard to a risk group and identify its appropriate biosafety level
Course Material:
Definition of Terms:

Biological Agent- Microbial entity capable of replication or transferring of genetic material

that may provoke infection, allergy, toxicity or any adverse effect in human, plant or animal
Biohazard- Potential source of harm caused by biological material
Biosafety-Containment principle; prevent the unintentional or accidental
release/exposure of pathogen or toxin to the environment
Biosafety
– Principles of containment; prevents the unintentional or accidental harm caused by
a biological agent or material. It includes:
– Protection of laboratory personnel against exposure to toxin or pathogen
– Protection of community against unintentional release of the toxin or pathogen
from laboratory facilities
– Protection of nature by the unintentional release of agent or material that may
damage water systems, forests
– and other natural habitat or infect animals and plants.
– It includes practices, equipment and facilities and proactive policies to address the
ever-changing risk pose by present and emerging diseases.
Principles of Biosafety
1. Practice and Procedures

Standard practices and routines performed and observed in the lab to
prevent exposure and/or release of agent/s.
Example: microbial techniques, handling and storage of reagents,
and waste disposal
2. Safety Equipment
Primary Safety Barrier; these are equipment that directly protects the
handler from the hazard by minimizing exposure.
Examples: Proper Protective Equipment (PPE), Biosafety cabinets,
covered and ventilated animal cages
3. Design and Construction
 Secondary Safety Barrier; includes installation and positioning of certain
equipment in the lab to minimize exposure to hazards. It also includes
partitioning of areas in the laboratory to control the spread of the
pathogen if accidental release happens.
 It protects both the laboratory personnel and the environment.
Examples:
- Ventilations control the airflow in the lab thus control the
spread of airborne pathogen if release occurs.
- Anteroom between laboratory sections with different hazard
level.
- Installation of autoclaves for decontamination of microbial
wastes before disposal.
4. Increasing level of Protection
 Since different hazards pose different type of risks, biosafety is
categorized into levels and established protocols and policies for each
biosafety level match requirement for each risk group.
Biosafety Levels

- Procedures or practices focusing on the manipulation of the agent

- Also known as Containment Level
Table 1. Brief Safety Guidelines for Biosafety level addressing each risk groups
Risk groups are categorized based on:

1. Pathogenicity
Severity of infection
Rate of infection
2. Mode of transmission; host range
 How can it be transmitted?
- Through air, food, soil, physical contact
 What does it infect?
- Specific to human, specific to plants or animals, originated from
plants or animals but can also be transmitted to human
3. Availability of preventive measures
Existing vaccine, anti-serum, antidote or treatment
4. Pathogen Safety Data Sheet (PSDS)

Technical documents that describe existing pathogen; PSDS details the
hazardous properties of the pathogen and provide recommendation in handling
and disposing them.
Other properties inherent to biological materials:

Disease severity
Infectivity
Host range
Potential of survival./dissemination
Availability and effectiveness of prophylactic measures
*Note: Risk Groups CORRELATE but DOES NOT EQUATE to Biosafety Levels.
Risk Groups
1. Risk Group 1: No or low risk- do not cause disease in healthy adult human
2. Risk Group 2: Low but curable risk- can cause less serious disease but is treatable
or preventable
3. Risk Group 3: High individual risk; low community risk (severe infection but low
transmission) - can cause serious disease but treatment and vaccines exists to control
spread

4. Risk Group 4: High individual-community risk- can cause deadly disease in humans
and easily travels from one person to another; no existing treatment or vaccine
Table 2. Examples of Risk Groups
Risk Group 1 Risk Group 2 Risk Group 3 Risk Group 4

E. coli K-12 Streptococcus Yersinia pestis (black plague) Ebola Virus
Yeast (S. cerevisiae) Herpes Virus HIV Marburg Virus
Lactobacillus sp. Most mammalian cell lines SARS virus Lassa Virus
Activity:
Case study: Read the following scenarios and answer the questions that follow
1. You decided to conduct a study on the synergistic effect of lactic acid bacteria by fermenting
cookie dough for your special project in Microbiology. You decided to seek help from Food
Laboratory facilities to conduct your experiment. The laboratory agrees to collaborate with
you given that you will be interviewed and answer the following:
 Identify the biohazard in your study?

 Which risk group this biohazard belongs to?
 What biosafety level is required for your study?
2. You have successfully graduated from your undergraduate degree and was
immediately offered with a job as a Research Specialist for an on-going research
project, self-funded by the head researcher, on the effect of a particular plant extract
against an unknown pathogen. You were given the following details about their
laboratory routine:
 The laboratory is not committed to the identification and characterization of the
pathogen to minimize laboratory expenditure.
 All activities will be performed in bench-tops as no biosafety cabinets are
available.
 You will be provided with laboratory gowns, face masks and goggles.
*Question: Are you going to accept the job offer? Explain your answer.
Assessment:
1. Give at least 3 practices or procedure in the laboratory by which protection/safety is
carried upon:
 Laboratory personnel
 Environment
2. At which risk group do you think SARS-COV 2 belong? Considering its pathogenicity,
mode of transmission and availability of treatment. Defend your answer (100 words)

Reference:
• Further Readings: Read Chapter 1-5 of the World Health Organization Laboratory
Biosafety Manual
https://www.who.int/csr/resources/publications/biosafety/Biosafety7.pdf?ua=1
C. BIOSECURITY
By Mark Joseph B. Cano
Overview:
• While hazards can be manipulated and controlled by increasing biosafety levels;
protection from people with harmful intent must also be considered in handing biohazards.
• Biosafety and Biosecurity complement one another as both aims to protect people and
environment from harmful agents or material whether intentional or unintentional.
Learning Outcomes:
After completing this module, the learner should be able to:
1. Define Biosecurity
2. Differentiate biosecurity from biosafety
3. Identify some measures in securing hazard
from potential theft or diversion
Course Material:
Biosecurity
- In lay man’s term, if biosafety protects the people from bad agents, biosecurity protects
these bad agents from bad people. One crucial responsibility of the scientific community
in handling biological agents/materials is to prevent it from theft or diversion which can
result to intentional release to the community (i.e. bioterrorism)
- Security measures; prevent the loss, theft, misuse, diversion or intentional release of
pathogen to the environment.
Controls of Biosecurity
1. Physical Security
- Assurance of safety from physical intrusion
- Graded protection; increasing security from outside to inside
A. Principle of Physical Security:

- Detection e.g. CCTV’s
- Response
- Security force/personnel

- Delay
- Encryption of data
- Access control
2. Transport Security
- Standardized process of handling the material from the laboratory to
transportation
- Documenting transfer the sample/s:
- Description
- Date and Time
- Receipt of material
- Person involved
3. Personnel Management
- Access of personnel to biological materials
- Intrusion can happen by:
- Insider- with authorized access (i.e. spy)
- Outsider- without authorized access
- Effective personnel management entails:
- Awareness of what’s in the laboratory
- Complete and timely knowledge
- What material/s, where are these materials located
- Who is accountable for them
4. Information Security
- Important information is protected from theft or diversion
- Level of protection must be consistent with the level of risk it poses
- Limited distribution
- Restrict method of communication
- Implement network/desktop security
Dual Use Research of Concern

- Subset of researches that are useful, reasonably anticipated to provide knowledge
or technology but has the potential to be misused and misapplied that may pose significant
harm.
Assessment:
1. To which biosecurity control does the following scenario belong:

a. Documented transfer of blood samples from lab to courier
b. Installation of CCTV’s along the hallway of culture collection facilities
c. List of reagents is uploaded in a secured cloud; only research specialists and
admin can access the said cloud
d. Each wing of the laboratory houses a specific group of microorganism; each
wing is assigned to a senior research specialist.
e. A “confirmation of receipt” slip is signed by a medical technologist upon receipt
of sample record
f. All the janitors and housekeepers know that the facility they are working at

houses corrosive reagents.

g. Security personnel are assigned to each floor of the building
2. In a very brief statement, what is the difference of biosafety and biosecurity? (30 words)
Reference:
• Further Readings: Read Chapters 1, 2 and 6 of Biorisk Management: Laboratory Security

Guidance of the World Health Organization:
https://www.who.int/csr/resources/publications/biosafety/WHO_CDS_EPR_2006_6.pdf

MODULE 10: MICROBIAL CONTROL
Overview:
- Microbial control is essential in order to prevent the unwanted microbial contamination,

transmission of diseases and infection, stop decomposition and spoilage of food.
- The effects of microorganisms can often be controlled by simply limiting or inhibiting
growth. Microorganisms are controlled by means of physical agents and chemical agents.
- Sterilization is one of the example of physical agent. It is the killing or removal of all
microorganisms (including viruses). On this lesson, it will teach us on how to properly kill
or control the spread of microorganisms.
Learning Outcomes:
1. Identify the different method of microbial control
2. Differentiate the three classes of physical control
3. Describe the relationship of time and temperature
Course Material:
General Principles:
Sterilization - the removal or destruction of all living microorganisms.
Decontamination – the treatment of an object or surface to make it safe to handle. As a
result, it needs wiping off to remove fragments before using.
Disinfection- a process that directly targets pathogens although it may not eliminate all
microorganisms. It requires agents called disinfectants that actually kill microorganisms or
severely inhibit their growth.
Microbial control means to kill or to inhibit the growth of microorganisms.
Heating is the most common method used for killing microbes, including the most resistant
forms, such as endospores. Liquids or gases can be sterilized by filtration.
2 Method in Microbial Control:
I. Physical Method - used extensively in industry, medicine, and the home
3 Classes of Physical Control
A. Heat - the most widely used method of physically treating an object or substance
to render it sterile.
To determines the effectiveness of heat sterilization there are 2 factors of Heat
1. Temperature
2. Time
*Higher temperature and shorter time re required to kill pathogens.

How to quantify and characterize the Heat sensitivity of Organism

a. Decimal Reduction Time- quantified by the time required for a 10-fold
reduction in the viability of a microbial population at a given temperature.
- heat killing proceeds more rapidly as the temperature rises.
- The relationship between time (D) and temperature is exponential, as the
logarithm of D plotted against temperature yields a straight line.
Interpretation: time and temperature are directly proportional with each
other.
b. Thermal Death Time- the time it takes to kill all cells at a given temperature.
- greatly affected by population size
- The longer time is required to kill all cells in a large population than in a
small one.
Type of Heat:
1. Moist Heat - has more penetrating power and inhibits growth or kills cells more
quickly than does dry heat.
a. Autoclave - sealed heating device that uses steam under pressure to

kill microorganisms.
Principle: Steam under a pressure of 1.1 kg/cm2 (15 lb/in2), which

yields a temperature of 121°C for 15 mins.
*Note: It is not the pressure inside the autoclave that kills the
microorganisms but the high temperatures that are achieved when
steam is placed under pressure.
b. Pasteurization - uses heat to significantly reduce rather than totally

eliminate the microorganisms found in liquids, such as milk.
b.1 Flash Pasteurization - 71°C for 15 seconds (or even higher

temperatures for shorter time periods; see Figure 5.30), after which
it is rapidly cooled.
b.2 Ultrahigh-temperature (UHT) pasteurization of milk requires

heat treatment at 135°C for 1–2 sec and actually sterilizes the milk
such that it can be stored at room temperature for long periods
without spoilage.

2. Dry Heat - effective sterilization of metals, glasswares, some powders, oils and
waxes.
a. Incineration (burning)
- effective means of destroying contaminated disposable
materials
- Intense heat ignites and reduces microbes to ashes and
gas
- Limited to metals and heat-resistant glass materials
b. Flaming
- accomplished by holding the end of the loop or forceps in
the yellow portion of the gas flame.
- flaming the surface metal forcep and wire bacteriologic
loops is an effective way to kill microorganisms.
B. Radiation:
1. UV Radiation - useful for disinfecting surfaces and air.
- widely used to decontaminate and disinfect the work surface of
laboratory laminar flow hoods equipped with a “germicidal” UV
light, air circulating in hospital and food preparation rooms.
- It has very poor penetrating power, limiting its use to the
disinfection of exposed surfaces or air rather than bulk objects
such as canned foods or surgical clothing.
2. Ionizing radiation - electromagnetic radiation of sufficient energy to
produce ions and other reactive molecular species from molecules
with which the radiation particles collide.
C. Filtration - used to separate cells, larger viruses, bacteria, certain microbes from
liquids or gases in which they are suspended.
- Cotton plug in test tube, flask, pipette is a good filter for preventing the
entry of microbes
- Dry gauze and paper mask prevent the outward passage of microbes from
the mouth and nose, protects from inhaling airborne pathogens and
foreign particles that could damage the lungs
Types of Filters:
a. depth filter -Depth filters are important in biosafety applications
such as in a biological safety cabinet.
eg. HEPA filter (does not ensure sterilization)
b. membrane filter - most common filters used for liquid sterilization.
c. nucleopore filter - commonly used to isolate specimens for
scanning electron microscopy
II. Chemical Method – routinely used to control microbial growth, it may be a solid, liquid or
gases.
- Antimicrobial agent - is a natural or synthetic chemical that kills or inhibits the
growth of microorganisms.
- -cidal agents - Agents that actually kill microbes. The prefix indicating the type
of microorganism killed. (bactericidal, fungicidal, viricidal)
- -static agents -Agents that do not kill but only inhibit growth (bacteriotatic,
fungistatic, viristatic)

Chemical Antimicrobial Agent:

1. sterilants
e.g. ethylene oxide or aldehydes such as formaldehyde or
glutaraldehyde
2. disinfectants
e.g. phenol and cationic detergents
Sanitizers, by contrast, are less harsh than disinfectants
and reduce microbial numbers but do not sterilize.
3. Antiseptics or germicides
-chemicals that kill or inhibit the growth of microorganisms but are
sufficiently nontoxic to animals to be applied to living tissues. Most
germicides are used for hand washing or for treating surface
wounds.
Activity/ Assessment:
In a separate sheet of paper, write the name, section, module number, title and
questions. Then briefly discuss the following questions:
1. Explain the principle of autoclaving. (10 points)
2. In the two types of heat, which do you think is the most effective in controlling the growth
of microorganism. Why? (20 points)
3. Discuss the importance and relationship of time and temperature in controlling the
microbes in the laboratory. (20 points)
4. Elaborate the use of cotton plug in sterilizing the culture media. (10 points)
Grading System:

5 4 3 2 1
the question
Total Score = _________ / 10 x 100 = _________%
Reference:
Madigan, M. T. et. al. Brock Biology of Microorganisms. (2019) 15th ed. Pearson Education, Inc.

MODULE 11: MICROBIAL APPLICATIONS IN THE INDUSTRY

By Kiara Nicole Rodriguez
Overview:
 Industrial microbiology makes use of different species of microorganisms in order to

produce commercial products or to carry out vital chemical reactions / transformations.
 Specific metabolic pathways in a given species are enhanced to overproduce a product
of interest. These products include beer, wine, pharmaceuticals, food additives, enzymes,
and other chemicals.
 The actual reactions carried out by microorganisms in industrial microbiology is termed as
biocatalysis.
Learning Outcomes:
1. Identify the difference between primary and secondary metabolites;
2. Describe the features of microorganism that make them useful in various industrial
processes;
3. Discuss how microorganisms are utilized in the industrial production of different
pharmaceutical, food, beverage, etc. products.
Course Material:
A. Properties of Microorganisms that is Useful for the Industry
- Not all microbial species are suitable to be used in a variety of industrial

applications. The following features must be taken into consideration in using
microorganisms for industrial processes:
- The microorganism should have a short generation time (grows rapidly) and
produce the desired product in a relatively short period of time. The nutritional
requirements of the microorganism should be simple; thus, it is capable of growing in an
inexpensive liquid culture media.
- The microorganism should not be pathogenic to humans, plants, or animals. The

microorganism could be genetically-manipulated easily. In some processes, increasing
the yield of the desired product is attained by means of mutation and selection, thus
genetic manipulation is often done.
B. Primary vs. Secondary Metabolites

There are two types of metabolites that microorganisms produce – the primary and
secondary metabolites.
a. Primary metabolites are formed during the growth phase of the organism;
thus, these products are linked to the primary metabolism of the
microorganism.

b. Secondary metabolites are the compounds produced at or near the

stationary phase or the end of the growth phase. Therefore, these compounds
are not vital for the growth and reproduction of the organism.
C. Major Products for Health Industry
Antibiotics are secondary metabolites typically produced by filamentous fungi and

bacterial species of the actinomycete group.
Antibiotic Producing Microorganism

Bacitracin Bacillus licheniformi
Cephalosphorin Cephalosphorium
Cycloheximide Streptomyces griseus
Erythromycin Streptomyces erythreus
Kanamycin Streptomyces kanamyceticus
Penicillin Penicillium chrysogenum
Polymyxin B Bacillus polymyxa
Streptomycin Streptomyces griseus
Tetracycline Streptomyces rimosus
Likewise, vitamins and amino acids are also important products of industrial
microbiology. These are growth factors that are often used as food additives or in
pharmaceutical products
Amino acid Uses Purpose

L-glutamate Various foods Meat-tenderizer,
(monosodium glutamate, flavorenhancer
MSG)
L-aspartate and Fruit juices “round off taste”
alanine
Glycine Sweetened Improves flavor,
foods starting point for
organic syntheses
L-cysteine Bread Improves quality
Fruit juices Antioxidant
L-tryptophan + L- Various Antioxidant, prevents
histidine foods, dried rancidity, nutritive
milk additives

Aspartame (made Soft drinks, Low-calorie

from L- chewing gum, sweetener
phenylalanine + L- many other
aspartate “sugar free”
products
DL-methionine Soy products, Nutritive additive
feed additives
L-lysine Bread Nutritive additive
(Japan), feed
additives
Several enzymes from bacteria and fungi are also produced industrially in
large quantities.
Extremozymes are enzymes isolated from extremophilic microorganisms.

One notable example is the Taq DNA polymerase from Thermus aquaticus that is used
in Polymerase Chain Reaction.
D. Major Industrial Products for Food and Beverage Industries
The industry for production of alcoholic beverages primarily involves fermentation

by a variety of yeast species.
Wine is a result of fermentation of fruit juice, which is often performed by the

cultivated wine yeast Saccharomyces ellipsoideus.
The Traditional Method of Red Wine Fermentation

(https://search.creativecommons.org/photos/3063237d-6cb3-4593-aedd-f835cc9633a0)
Beer, together with ale, porter, and stout are produced from the fermentation of malted
grains.
Brewing of beer usually involves the yeast Saccharomyces carlsbergensis.

Saccharomyces cerevisiae is used in the brewing of ales.

Homemade Beer Fermenting

(https://search.creativecommons.org/photos/bbc9e857-c873-400e-b31a-b660ffba3a3e)
Vinegar is generated from the conversion of ethanol to acetic acid by the acetic acid
bacteria. This includes species under the genera Gluconobacter and Acetobacter.
Yeast cells are also grown for use in the food and baking industries. Baker’s yeast is
important for the rising of dough. Nutritional yeast is marketed as a food supplement.
Active Dry Yeast

(https://search.creativecommons.org/photos/fc73ffce-0afb-4fce-afee-851ff14c6b04
Activities and Assessment:

1. Compare and contrast primary and secondary metabolites and give an example of
each. List at least two molecular explanations why some metabolites are secondary rather than
primary. (10 points)
2. Describe the features of microorganisms that are significant for use in the industry. (5
points).
3. Create a schematic diagram for the production of the extremozyme Taq DNA
polymerase in large quantities in the industry (Note: you should take into consideration the
features of microorganisms that are useful in the industry) (20 points).

Reference:
• Madigan, M. T. et. al. Brock Biology of Microorganisms. (2019) 15th ed.
Pearson Education, Inc.

GENERAL
MICROBIOLOGY
Laboratory Module
Department of Biology
College of Science
Polytechnic University of the Philippines
TABLE OF CONTENTS
Page No.
Title Page
Table of Contents
Activity 1 – Microscopy 80
Activity 2 – Aseptic Technique 90
Activity 3 – Culture Media Preparation 93
Activity 4 – Wet Mount and Hanging-Drop Method 95
Activity 5 – Gram Staining 101
Activity 6 – Microbial Growth 108
Activity 7 – Microbial Metabolism: Cellular Respiration in Yeast 113
Activity 8 – Microbial Metabolism: Spoilage and Preservation of Food 121
Activity 9 – Microbial Metabolism: Effects of Light on Photosynthetic Microbes 129
Activity 10 – Fermentation: Apple Cider Vinegar Making 134
Activity 11 – Inoculation of Microorganism 137
Activity 12 – Streaking a Plate for Isolation 141
Activity 13 – Applied Microbiology: Isolating Microbes from Diverse Sources 144
Activity 14 – Understanding Acellular Infectious Agents 148
Activity 15 – Biosafety 153
Activity 16 – Moist Heat Sterilization 158
Activity 17 – Kimchi Making 161
References 165
ACTIVITY 1 – Microscopy
Adapted from Cappuccino and Sherman (2014)
LEARNING OUTCOMES
At the end of the activity, the students should be able to:
1. Determine the parts of the light microscope and their functions;

2. Demonstrate the principles on proper use and care of a light microscope; and
3. Perform microscopic measurement and calibration using micrometry.
COURSE MATERIALS
Learning Intervention
This Laboratory Activity, including its assessments can be performed by the student either by any
or all, or combinations of following learning methods and materials:
a) Critical Reading – The activity is fitted to be performed by students through mental

visualization and thought experiment. The module itself is
sufficient for students who have no access on actual laboratory,
internet or other relevant instructional materials.
b) Virtual Experiment – Students who have internet access can further learn by visiting
the virtual laboratory sites about Microscopy, as follows:
- https://www1.udel.edu/biology/ketcham/microscope/sco
pe.html
- https://www.ncbionetwork.org/educational-
resources/elearning/interactive-elearning-tools/virtual-
microscope
- https://www.biologycorner.com/worksheets/microscope-
virtual.html
c) Actual Experiment – The activity can be actually performed in the laboratory or home.
d) Audiovisual clips – The student can watch any audio-video clips about Microscopy,
but especially the following links below:
- https://www.youtube.com/watch?v=eZX9U15F5Q8
- https://www.youtube.com/watch?v=zzamomqlwxU
- https://www.youtube.com/watch?v=b4WOsYktdn4
Principles behind Microscopy
The ability to magnify specimens has been around since 1000 B.C. The first simple compound
microscope that utilized two lenses was not invented until the late 16th Century. It was the
invention and modification of this microscope that changed the way scientists studied living
organisms. It allowed scientists to study the structure of a living organism and to discover
numerous species that were not visible to the unaided eye.
General Microbiology Laboratory Module

The light microscope (see Figure 1) is able to magnify and then focus visible light energy by using
lenses. The compound light microscope that is used in this lab allows you to see small, eukaryotic
organisms or thinly sliced sections of tissues under magnification. Because there are 2 sets of
lenses (ocular and objective) it is named the “compound” microscope. It is sometimes necessary
to stain an image with a dye in order to see it under the microscope.
How to use the microscope:
• Always carry the microscope with both hands. These are fragile, easily damaged
instruments. Don’t let the cord drag on the floor.
• Clean the ocular and objective lenses with lens paper only.
• Plug the scope in and make sure the light works.
• Report any problems or malfunctions to the instructor.
• You should begin your focusing exercises with the microscope set on low power. When
finished, you should also return your microscope on the low power setting.
• Do not tile the microscope. It may disturb the slide position you are focusing on.
Some important parts of the Microscope defined:
• Ocular lens (aka eye pieces): note if your microscope is monocular or binocular.
• Body tube: holds nosepiece and eye piece. Conducts light rays.
•Nosepiece: revolves and contains objective lenses.
• Coarse Adjustment Knob: use only under low power initially to focus.
• Fine adjustment knob: brings image into more precise, final focus.
• Condenser: lens system below the stage to focus the light beam onto the object being
viewed.
• Diaphragm: controls the amount of light used to view the object
• Base: the flat surface of the microscope that rests on the table top.
• Stage: hold and support the slide assisted by stage clips.
• Mechanical stage control knobs: can move the stage left/right or forward/back.

Figure 1. Anatomy of the compound light microscope
Determination of microbial size is not as simple as you might assume. Before an accurate
measurement of cells can be made, the diameter of the microscopic field must be established by
means of optic devices, namely, an ocular micrometer and a stage micrometer. The ocular
micrometer (see Figure 2) which is placed on a circular shelf inside the eyepiece, is a glass disc
with graduations etched on its surface. The distance between these graduations will vary
depending on the objective being used, which determines the size of the field. This distance is
determined by using a stage micrometer (see Figure 2), a special glass slide with etched
graduations that are 0.01 mm, or 10 micrometers (mm), apart. The calibration procedure for the
ocular micrometer requires that the graduations on both micrometers be superimposed on each
other (see Figure 2). This is accomplished by rotating the ocular lens. A determination is then
made of the number of ocular divisions per known distance on the stage micrometer. Finally, the
calibration factor for one ocular division is calculated as follows: µ

Example: If 13 ocular divisions coincide with two stage divisions (2 x 0.01 mm = known distance
of 0.02 mm), then:
Figure 2. Calibration using ocular micrometer.
Once the ocular micrometer is calibrated, the size of a microorganism can easily be determined,
first by counting the number of spaces occupied by the organism (see Figure 2) and second by
multiplying this number by the calculated calibration factor for one ocular division.
Example: If an organism occupies five spaces on the ocular micrometer, then:
Today there are numerous types of microscopes available to scientists that provide greater
magnification and superior detail (resolution). Enlargement, or magnification, of a specimen is
the function of a two-lens system; the ocular lens is found in the eyepiece, and the objective
lens is situated in a revolving nosepiece. These lenses are separated by the body tube. The
objective lens is nearer the specimen and magnifies it, producing the real image that is projected

up into the focal plane and then magnified by the ocular lens to produce the final image. Although
magnification is important, you must be aware that unlimited enlargement is not possible by
merely increasing the magnifying power of the lenses or by using additional lenses, because
lenses are limited by a property called resolving power. By definition, resolving power is how far
apart two adjacent objects must be before a given lens shows them as discrete entities. When a
lens cannot discriminate, that is, when the two objects appear as one, it has lost resolution.
Increased magnification will not rectify the loss and will, in fact, blur the object. The resolving
power of a lens is dependent on the wavelength of light used and the numerical aperture, which
is a characteristic of each lens and imprinted on each objective. The numerical aperture is defined
as a function of the diameter of the objective lens in relation to its focal length. It is doubled by
use of the substage condenser, which illuminates the object with rays of light that pass through
the specimen obliquely as well as directly.
Besides magnifying and resolving an object, the microscope also provides the contrast that is
needed to distinguish detail between adjacent objects. Microscopes used in most biology
laboratories magnify up to 1000x with a resolving power of 0.2 µm. The microscopes in this
laboratory are compound, light microscopes. The light is transmitted through the specimen on
the stage and through two lenses before it reaches the user.
Objective Lenses (fixed) Ocular Lens (examples) Total Magnification

Scanning 4x 20x 80x
Low-power 10x 10x 100x
High-power 40x 10x 400x
Oil-immersion 100x 20x 2000x
ACTIVITY
CRITICAL READING – Read and analyze the passages about the actual step-by-step
laboratory of Gram Staining. Then thoroughly and concisely answer the guide questions
provided after. Use the information provided by or suggested in the passage.
Materials:
 Compound Microscope
 Ocular micrometer
 Stage micrometer
 Cedar oil
 Cell sample
Procedure:
Operating and using a Compound Microscope
1) Remove the microscope from the scopes cabinet and return to your work area.
2) Make sure that you use both hands to support the microscope (arm and base).

3) Place the base securely on the lab bench with the arm towards you.
4) Identify the following parts of the microscope:
a. Ocular lens: a usually 10X lens which is at the upper end of the tube. The scopes
that you are using are binocular; it has two eyepieces.
b. Revolving nosepiece: the objective lenses are attached below the nosepiece. It
allows the user to change the magnification.
c. Objective lenses: our scopes will either have 3 or 4 objective lenses attached to a
revolving nosepiece. The magnification is inscribed on each lens. The powers
that you will use are: scanning (4X), low (10X) and high dry (43X). Some scopes
(Swift) will have the oil immersion lens (100X).
d. Stage and stage clamp: the slide will rest on the stage and will be held in place
with the stage clamp. The moveable portion of the stage clamp should only be
touching one corner of the slide.
e. Iris diaphragm lever: on the front edge beneath the stage is a small lever that is
used to adjust the contrast by regulating the amount of light.
f. Condenser and adjustment knob: the condenser condenses the light rays into a
stronger beam. Use the adjustment knob located below and to the side of the
stage to increase or decrease the light intensity.
g. Coarse Adjustment Knob: On each side of the scope is a large knob use to move
the stage up and down to focus the image. This knob is to be only used with the
scanning and low power objective lenses.
h. Fine Adjustment Knob: Located by the coarse adjustment knob, this knob allows
for very small changes to the height of the stage. This knob is used to increase
the sharp focus of an image and is the only knob to be used with high power.
i. Slide Movement Knobs: To one side of the stage, there are two black or silver
knobs that you will use to move the slide. One knob will move the slide to the left
and right. The other knob will move slide towards and away from you. The scopes
are parfocal. This means that when you have the object centered in the field of
view on a lower power and then change to a higher power, the image will remain
in the center of the field of view.
j. On/Off Knob/Switch: Located on side of the microscope or the top of the base in
the front end of the microscope.
Determining the Magnifying Power:
The compound microscope utilizes two different sets of lenses to magnify an object. These
lenses are the ocular and objective lenses.
1) Determine the magnification for each of the following lenses by looking for the
engraved magnification.
2) Calculate the total magnification of object being viewed by multiplying the
magnification of the ocular lens and objective lens.

Calibrating measurement using ocular micrometer, and measuring microorganism
1) With the assistance of a laboratory instructor, carefully place the ocular micrometer into
the eyepiece.
2) Place the stage micrometer on the microscope stage and center it over the illumination
source.
3) With the stage micrometer in clear focus under the low-power objective, slowly rotate
the eyepiece to superimpose the ocular micrometer graduations over those of the stage
micrometer.
4) Add a drop of immersion oil to the stage micrometer, bring the oil-immersion objective
into position, and focus, if necessary, with the fine-adjustment knob only.
5) Move the mechanical stage so that a line on the stage micrometer coincides with a line
on the ocular micrometer at one end. Find another line on the ocular micrometer that
coincides with a line on the stage micrometer. Determine the distance on the stage
micrometer (number of divisions x 0.01 mm) and the corresponding number of divisions
on the ocular micrometer.
6) Determine the value of the calibration factor for the oil-immersion objective.
7) Remove the stage micrometer from the stage.
8) To determine the size of the microbe cell in on the prepared slides under the oil-
immersion objective, do the following:
a. Calculate the number of ocular divisions occupied by each of cell sample. Record
the data in the readings columns of the first observation chart in the Lab Report.
b. Determine and record the average of the three measurements.
c. Determine the size by multiplying the average by your calculated calibration factor,
and record this value.
9) Determine and record the size of the other microorganisms by observing the remaining
prepared slides under oil immersion as outlined in Step 8. Since these organisms are
not round, both length and width measurements are required.
10) Check that your observations are complete in the Lab Report.
ASSESSMENT
Part 1 – Guide Questions. Concisely answer the guide questions provided after. Use the
information provided by or suggested in the passage. (3 points each)
1. What is the difference between magnification and resolution? Explain why they are both
important to be accounted in microscopy.
2. Aside from other control and adjustment knobs, why it is equally important to adjust the
iris diaphragm and condenser while observing specimens under the microscope?
3. How the total magnifying power of the lenses in the microscope is determined? Give some
examples.
4. Why are the lengths of the cells usually approximated when we record their values for
length?
5. Do the calibration factor computed varies according to different magnification (objective
lenses being used)? Explain.

Part 2 – Problem-Solving. Based on the results of using Hanging-drop method in Figure 2

(Image from exploringtheinvisible.com, 2014), accurately illustrate and describe five (5)
microorganisms that can be observed. (2 points each item)
PROBLEM #1
a) A commercial stage micrometer has a total length of 1000 µm and is divide into 100 equal
divisions. What is the length of each stage division in millimeters? Show your solution.
b) Twelve (14) ocular divisions coincide with three stage divisions. Assuming that the
graduations of the stage micrometer are spaced 10 µm, what is the known distance
between the three stage divisions in millimeters? Show your solution.
c) With the same given information on b), what would be the distance of one ocular division?
Show your solution.
PROBLEM #2
d) Base on the image,

how many ocular
divisions and stage
divisions respectively it
takes for them to
exactly and accurately
coincide with each
other?
e) Base on a certain
magnification the image
was observed, if one
stage division
corresponds to 0.1 mm
distance, what would
be distance of each
ocular division?
PROBLEM #3
f) What is the size of the nucleus in micrometers?

g) What is the size of the cell in micrometers?

PROBLEM #4
h) Based on your microscopic

observation, how many individual
cell thus the string is comprised of?
i) What is approximate combine cell
length of the cells?
Remember: Always measure the cell

length base on the widest/longest
midsection of the cell!
PROBLEM #5
Given:
 The used ocular objective while

taking this image, has magnifying
power of 6x
 The used objective while taking this image, has a magnifying power of 100x
 The used stage micrometer has spaces graduation of 0.01 mm each
 Ten (10) graduations pn the
ocular micrometer conincided
with two (2) graduations on the
stage micrometer
j) What is the total magnification of

the image under microscope?
Show your solution.
k) What is the distance of one
ocular division? Show your
solution.
l) What is approximate cell length
of Cell A?
m) What is approximate cell length
of Cell B?
n) What is approximate cell length
of Cell C?
o) What is approximate combine
cell length of Cell A and Cell B?
Show your solution.
Remember: Always measure the cell length on the longest middle section of the cell!

GRADING SYSTEM
 For Assessment – Part 1, which is a constructed-response assessment, the following

rubric shall be used to evaluate the answers in each items:
3 points 2 points 0 – 1 point

The answer is characterized The answer is characterized The answer is characterized
as: as: as:
 Having complete, correct  Having incomplete, yet  Incorrect and inaccurate;
idea/thought required by correct idea/thought  Irrelevant response; and
the question required by the question;  Unintelligible and cannot
 Concise and direct-to-the-  Not concise response be understand
point response  Grammar construction and
 Having syntax like somewhat obscures
construction and like which the response
doesn’t affect effective
communication
Each item consists of 3 points, thus the total maximum score creditable is 15 points.
 For Assessment – Part 2, which is an objective, selected-response assessment, where

each item has a definite correct answer, thus each item corresponds to 3 points.
Therefore, the total maximum score creditable is 30 points.
2 points 1 points 0 point

as: as: as:
idea/thought required by correct idea/thought  Irrelevant solution and
 Complete solution  Incomplete solution be understand
 Having syntax  Grammar construction and
construction and like which like somewhat obscures
doesn’t affect effective the response
communication
 In all the assessment total points together with miscellaneous 5 points (credits for
neatness of the paper and full compliance of the activity) are tallied as follows:
Part 1 – 15 points
Miscellaneous – 05 points
--------------
TOTAL – 50 points

ACTIVITY 2 – Aseptic Techniques
Prepared by Prof. Mark Joseph B. Cano
INTRODUCTION
Aseptic techniques are important microbial techniques being carried to avoid contamination of the
workplace, samples and even the person. Aseptic techniques basically include proper
handwashing, disinfecting your workplace before and after use and wearing of appropriate PPE.
Streak-plate method is a microbial technique used in bacterial isolate subculture and purification.
It is the actual transfer of bacterial inoculum from one medium to another. In this experiment,
aseptic technique and streak plate method will be simulated using some household items and
culture media prepared from last week (Week 2)
LEARNING OUTCOMES
At the end of the experiment the learner must be able to:
1) Understand the concept of aseptic technique

2) Prepare cotton plug and inoculating loop/needle
3) Identify in controlling ways in contamination
COURSE MATERIALS

the virtual laboratory sites about Aseptic Technique and Streak
Plate, as follows:
- https://www.scienceprofonline.org/microbiology/aseptic-
sterile-technique-microbiology.html
- http://learn.chm.msu.edu/vibl/
- https://vlab.amrita.edu/?sub=3&brch=73&sim=212&cnt
=1
d) Audiovisual clips – The student can watch any audio-video clips about about
Aseptic Technique and Streak Plate, but especially the following
links below:
- https://www.youtube.com/watch?v=bRadiLXkqoU
- https://www.youtube.com/watch?v=0heifCiMbfY

Materials:
 Cotton and gauze

 Small glass tube container or bottle with small amount of boiled distilled water (this will
serve as the microbial culture)
 Candle and matchstick
 Alcohol and tissue
 2 Aluminum Wires (7-10 inches)
Important: This experiment will use candle as source of fire. Make sure that your workplace is
away from curtain or any material that may catch fire. Ask for assistance.
Methodology:
1) Cut two 7-10 inches aluminum wires. Wrap the end of the wires with rubber, cloth or
anything that will serve as the handle and will provide insulation. Using a pliers, bend the
other end of one wire to make a loop.
2) Make a lump of cotton that will fit in the mouth of the small glass bottle/tube container with
water. Ensure that the cotton will serve as a plug and will not fall out. Cover the cotton
plug with gauze and sew it close. The cotton plug will serve as the cover lid of the glass
container.
3) Disinfect workplace with alcohol and tissue. Make sure that hands are thoroughly washed
with soap and water prior to this experiment.
4) Light a candle and place it in the middle of the workplace. Flame-sterilize your loop or
needle by placing it over the flame and allow it to turn hot-red. Allow the loop/needle to
cool down but DO NOT put it down, blow on it, wave it or touch the flamed part. Just hold
on to the handle for a few minutes.
5) With the glass container on your other hand, use the pinky and ring finger of the hand
holding the loop, to grip the cotton plug and open the glass container near the flame. Swirl
the mouth part of the container near the flame for 3 seconds.
6) Dip the inoculating loop in the container and allow the loop to touch the water inside.
7) If you hear a sizzle, it means your loop is still hot. In actual experiment, you already killed
your microbial isolates and you have to repeat from the start.
8) Gently shake the loop while pulling out to remove the excess water. Excess water may
flood your culture and may result to bad streaking.
9) Pass the mouth of the glass container over the flame and cover it with the cotton plug.
10) At this point, you have bacterial microbial inoculum in your loop, make sure not to touch
it, put it down or touch any surfaces.
11) Open partially the lid of the culture media (made from last week experiment) near the
flame.
12) Gently brush the loop on the surface of the agar (make sure not to stab/scrape the agar)
in a zigzag motion covering the entire surface of the agar.
13) Close the inoculated culture media. Flame sterilize the loop as instructed earlier.

Decontamination of experiment materials
After the experiment, pour bleach solution inside the culture media and let it sit for 1 hour. Scrape
off the agar using inoculating loop in transfer it in a plastic bag. Add more bleach. Wrap it tightly
and put it in the trash bin
Soak the container used for the culture media in bleach solution for 1 hour. Wash it with detergent
and if possible sterilize it with hot water. Make sure to flame sterilize the inoculating loop after
using. Disinfect your workplace with alcohol and wash your hands with soap and water.
ACTIVITY / ASSESSMENT
1) What are the aseptic techniques covered in the experiment? (5 points)

2) What aseptic techniques do you practice in your home? (5 points)
3) What aseptic techniques do you practice in handling food and preparation of meals? (5
points)
4) What is the importance of a flame source in the experiment? (5 points)
5) Why is it necessary to flame-sterilize the inoculating loop/needle before and after use? (5
points)
6) Illustrate the following (2.5 points each):
a. inoculating loop and inoculating needle
b. cotton plug

ACTIVITY 3 – Preparation of Culture Media
INTRODUCTION
Culture medium/media are semi-solid media used to support the growth of microorganisms.
These contained essential nutrition to allow growth of the organism. Its gel structure allows
absorption of nutrients and supports formation of microbial colony. In this experiment, improvised
culture media will be prepared. This does not contain the actual nutrition requirement of microbes
but is enough to support colony growth.
LEARNING OUTCOMES
1) determine the methods of preparing culture media;

2) identify the basic ingredients of culture medium; and
3) demonstrate proper ways disinfecting the culture medium.
COURSE MATERIAL

the virtual laboratory sites about Culture Media, as follows:
=1
- https://www.scienceprofonline.org/vmc/vmc-lab/vmc-
laboratory-differential-selective-bacterial-growth-
media.html
d) Audiovisual clips – The student can watch any audio-video clips about Culture
Media, but especially the following links below:
- https://www.youtube.com/watch?v=cneascR3OEc
- https://www.youtube.com/watch?v=fzk_-O2SDos

Materials:
 Small Glass/plastic container with lid

 Agar powder (commercial gelatin powder; colorless/flavorless)
 Potato
 Distilled water
 Bleach (zonrox)
 Gauze
Methodology:
Surface-Disinfection of container
Disinfect glass/plastic container and lid by soaking them with bleach solution (1 cap bleach:
100mL water) for 10 minutes. Dry the container by placing them over a clean tissue. Cover the
container with lid without touching the inner part of the container and bottom part of the lid. Ensure
that hands are thoroughly washed with soap and water, or if available, gloves are used while
performing this part of the experiment. The container must remain tightly closed until needed.
Preparation of Agar media
Cut a potato in half and boil it in 100mL distilled water for 15 minutes (use plastic bottles with
indicated volume to measure water). Remove the potato and filter the water using clean cloth or
gauze. Add a teaspoon of agar powder and completely dissolve it by boiling. Add small amount
of distilled water if the volume decreases due to evaporation. Cover the pot while boiling.
Pour-plating
Ask for assistance for this part of the experiment. Quickly pass the circumference of the
container/lid area over a flamed candle. Open the lid of the container partially and pour the media
inside. Fill about half or ¾ of the container. Tightly close the container and wait for the media to
solidify. Wiggle gently, but do not open the container, occasionally to check if the media has
successfully solidified. Invert the container.
*If refrigerator is available, the media can be stored but must be placed in inverted position. Or
the learner can proceed to the next experiment.
1) Illustrate the step by step method of preparing culture media
2) Research the significance of the following:

a. Soaking the container in bleach
b. Keeping the container closed except when pouring the medium; partially opening
the container during pour-plating
c. Use of potato in the experiment
d. Inverting the container after the media had solidified

ACTIVITY 4 – Wet Mount and Hanging-Drop Method
INTRODUCTION
In their natural state, most of the cells and microorganisms that we observe under the microscope
lack color and contrast. This makes it difficult, if not impossible, to detect important cellular
structures and their distinguishing characteristics without artificially treating specimens. We have
already alluded to certain techniques involving stains and fluorescent dyes, and in this section we
will discuss specific techniques for sample preparation in greater detail. Indeed, numerous
methods have been developed to identify specific microbes, cellular structures, DNA sequences,
or indicators of infection in tissue samples, under the microscope.
LEARNING OUTCOMES
1) Demonstrate principles behind wet mount and hanging drop method;

2) Observe the microbial cells in their living, unstained state, from a natural or naturalized
source; and,
3) Determine the variability and limitation of observing different living microorganisms from a
source.
COURSE MATERIALS

the virtual laboratory sites about Wet Mounting and Hanging-
Drop Method, as follows:
=1
- https://microbeonline.com/procedure-hanging-drop-
method-test-bacterial-motility/
d) Audiovisual clips – The student can watch any audio-video clips about Wet
Mounting and Hanging-Drop Method, but especially the
following links below:
- https://www.youtube.com/watch?v=6-Rko46HDDM

- https://www.youtube.com/watch?v=N1780tJTk90
- https://www.youtube.com/watch?v=ujzSmsmg7ok
Principles behind Wet Mount and Hanging Drop Method
Bacteria, microscopic algae, microscopic fungi, and protozoans because of their small size and a
refractive index that closely approximates that of water, do not lend themselves readily to
microscopic examination living microorganisms in a living, unstained state. Examination of is
useful, however, to do the following:
1) Observe cell activities such as motility and binary fission.

2) Observe the natural sizes and shapes of the cells, considering that heat fixation (the rapid
passage of the smear over the Bunsen burner flame) and exposure to chemicals during
staining cause some degree of distortion.
You will observe the preparation(s) microscopically for differences in the sizes and shapes of the
cells, as well as for motility, a self-directed movement. It is essential to differentiate between actual
motility and Brownian movement, a vibratory movement of the cells due to their bombardment
by water molecules in the suspension. Hanging-drop preparations and wet mounts make the
movement of microorganisms easier to see because they slow down the movement of water
molecules.
Some microorganisms are difficult or unable to be stained. One such bacteria is Treponema
pallidum, the causative agent for syphilis. Special stains must be used to stain this bacterium;
however, it can be viewed unstained and alive using a darkfield microscope. Under those
conditions, its characteristic shape and motility can be observed, leading to a diagnosis of syphilis.
ACTIVITY
CRITICAL READING – Read and analyze the passages about the actual step-by-step laboratory
of Gram Staining. Then thoroughly and concisely answer the guide questions provided after. Use
the information provided by or suggested in the passage.
Materials:
 Bunsen burner
 Inoculating loop
 Depression slides
 Glass slides
 Coverslips
 Microscope
 Petroleum jelly
 Cotton swabs
 Water sample from pond (undisturbed rain puddle, canal, or lake)

Procedures:
Hanging-Drop Preparation
Perform the following steps for each culture provided in this experiment (see Figure 1).
1) With a cotton swab, apply a ring of petroleum jelly around the concavity of the depression
slide.
2) Using aseptic technique, place a loopful of the culture in the center of a clean coverslip.
3) Place the depression slide, with the concave surface facing down, over the coverslip so
that the depression covers the drop of culture. Press the slide gently to form a seal
between the slide and the coverslip.
4) Quickly turn the slide right side up so that the drop continues to adhere to the inner surface
of the coverslip.
5) For microscopic examination, first focus on the drop culture under the low-power objective
(10x) and reduce the light source by adjusting the Abbé condenser. Repeat using the high-
power objective (40x).
6) Examine the hanging-drop preparation and record your observations in the Lab Report.
Wet Mount
A wet mount may be substituted for the hanging-drop preparation using a similar procedure:
Figure 1. Procedure of performing the hanging drop method (Image from Cappuccino, 2014)

1) With a cotton swab apply a thin layer of petroleum jelly along the edge of the four sides of
a coverslip.
2) Using aseptic technique, place a loopful of the culture in the center of a clean coverslip.
3) Place a clean glass slide over the coverslip and press the slide gently to form a seal
between the slide and the coverslip.
4) Follow Steps 4 and 5 in the hanging-drop procedure.
5) Examine the wet-mount preparation and record your observations in the Lab Report.
Figure 2. Microscopic observation of a drop water from a pond using the Hanging Drop Method.
Observed under low-power objective. (Image by Simon sublime from exploring the invisible.
com, 2014)

ASSESSMENT
1) What are the primary limitations imposed by using Hanging-drop method (or Wet mount)
to observe microorganisms? State at least two (2) accounts with brief explanation.
2) What are the primary benefits of using Hanging-drop method (or Wet mount) to observe
microbes? State at least two (2) accounts with brief explanation.
3) Based on the results of using Hanging-drop method in Figure 2, what microorganisms can
you find? State or identify all microbes you can see, and briefly described each of them.
4) If you are going to actually observe and compare microscopically, the samples from a
lake, canal/sewage, and tap water (from faucet), what possible microorganisms are
common in all samples? State at least one (1) microbe briefly explain why.
5) Why it is very important to have regular microbiological test of water performed on natural
bodies of water (river, spring, lakes etc.), water treatment plants, industrial and residential
tap water supply? Explain concisely your answer.
Part 2 – Illustration. Based on the results of using Hanging-drop method in Figure 2 (Image from
exploringtheinvisible.com, 2014), accurately illustrate and describe five (5) microorganisms that
can be observed. (2 points each field)
GRADING SYSTEM

3 points 2 points 0 – 1 point

as: as: as:
communication
 For Assessment – Part 2, which is an objective, constructed-response assessment, where

each item has a definite correct answer, thus each field corresponds to 2 points. Therefore,
the total maximum score creditable is 20 points.

Pointing system
Fields
2 points 1 point 0 point
The illustration is The illustration is The illustration is
characterized as: characterized as: characterized as:
 Having complete,  Having incomplete, yet  Incorrect and
Drawing correct idea/thought correct idea/thought inaccurate; and
appropriate to the appropriate to the  Unintelligible and
actual observation actual observation cannot be
understand
The answer is The answer is The answer is
correct idea/thought correct idea/thought inaccurate;
required by the required by the  Irrelevant response;
question question; and
 Concise and direct-  Not concise response  Unintelligible and
Description
to-the-point  Grammar construction cannot be
response and like somewhat understand
 Having syntax obscures the response
construction and like
which doesn’t affect
effective
communication
--------------
TOTAL – 40 points

ACTIVITY 5 – Gram Staining
Adapted from Amrita Vishwa Vidyapeetham (vlab.amrita.edu)
INTRODUCTION
Visualization of microorganisms in the living state is quite difficult, not only because they are
minute, but also because they are transparent and practically colorless when suspended in an
aqueous medium. To study their properties and to divide microorganisms into specific groups for
diagnostic purposes, biological stains and staining procedures in conjunction with light
microscopy have become major tools in microbiology.
LEARNING OUTCOMES
1) Demonstrate principles behind the examination of microorganisms by using Gram

staining;
2) Differentiate between the two major categories of bacteria: Gram positive and Gram
negative.
3) Determine how the Gram stain reaction affects Gram positive and Gram negative bacteria
based on the biochemical and structural differences of their cell walls.
COURSE MATERIALS

the virtual laboratory sites about Gram Staining, as follows:
=1
- http://learn.chm.msu.edu/vibl/content/gramstain.html
d) Audiovisual clips – The student can watch any audio-video clips about Gram
Staining, but especially the following links below:
- https://www.youtube.com/watch?v=sxa46xKfIOY
- https://www.youtube.com/watch?v=FgsgpoFhleA

Principles behind Gram Staining
The Gram staining procedure enables bacteria to retain color of the stains, based on the
differences in the chemical and physical properties of the cell wall. Gram positive (Gram+)
bacteria are stained dark purple due to retaining the primary dye called Crystal Violet in their cell
wall. Examples of Gram+ bacteria are the Staphylococcus aureus (see Figure 1, left image) which
can cause acne, Streptococcus pyogenes which can cause “Strep throat” and “Rheumatic fever”,
and Listeria monocytogenes which can cause the food-borne infection “Listeriosis”. On the other
hand, Gram negative (Gram-) bacteria are stained red or pink due to retaining the counter
staining dye called Safranin. Examples of Gram- bacteria are the Escherichia coli (see Figure 1,
right image) which is a normal inhabitants of our intestines (some strains can cause food
poisoning), Treponema pallidum which causes the sexually transmitted disease “Syphilis”, and
Yersenia pestis which can cause the “Bubonic plague”.
Figure 1. The illustration of Gram staining of bacteria as can be viewed if actually observed under
the light microscope. (Image from vlab.amrita.edu, 2011)
The Gram stain is a very important preliminary step in the initial characterization and classification
of bacteria. It is also a key procedure in the identification of bacteria based on staining
characteristics, enabling the bacteria to be examined using a light microscope. The bacteria
present in an unstained smear are invisible when viewed using a light microscope. Once stained,
the morphology and arrangement of the bacteria may be observed as well (see Figure 2). Here
are the summaries for each crucial mechanism of Gram staining as follows:
Application of the primary stain Crystal Violet (CV) to a heat-fixed smear of bacterial culture. CV
dissociates in aqueous solutions into CV+ and Cl – ions. These two ions then penetrate through
the cell wall and cell membrane of both Gram-positive and Gram-negative cells. The CV+ ions
later interacts with negatively charged bacterial components and stains the bacterial cells purple.
Iodine acts as a mordant, meaning as a trapping agent for the dye to increase binding to the cell

component being stained. A mordant is a substance that increases the affinity of the cell wall for
a stain by binding to the primary stain, thus forming an insoluble complex which gets trapped in
the cell wall. In the Gram stain reaction, the crystal violet and iodine form an insoluble complex
(CV-I) which serves to turn the smear a dark purple color. At this stage, all cells will turn purple.
The underlying mechanism of Gram staining is rooted on the basic morphological structure and
properties of the bacteria’s cell wall (see Figure 2). In a Gram-negative bacteria, the cell wall have
a thinner layer of peptidoglycan (10% of the cell wall) and lose the crystal violet-iodine complex
during decolorization with the alcohol rinse, but retain the counter stain Safranin, thus appearing
reddish or pink. They also have an additional outer membrane which contains lipids, which is
separated from the cell wall by means of periplasmic space. Meanwhile, Gram-positive bacteria
have a thick mesh-like cell wall which is made up of peptidoglycan (50-90% of cell wall), which
stains purple. Peptidoglycan is mainly a polysaccharide composed of two subunits called N-
acetyl glucosamine and N-acetyl muramic acid. As adjacent layers of peptidoglycan are formed,
they are cross linked by short chains of peptides by means of a transpeptidase enzyme, resulting
in the shape and rigidity of the cell wall. The thick peptidoglycan layer of Gram-positive organisms
allows these organisms to retain the crystal violet-iodine complex and stains the cells as purple.
Lipoteichoic acid (LTA) is another major constituent of the cell wall of Gram-positive bacteria
which is embedded in the peptidoglycan layer. It consists of teichoic acids which are long chains
of ribitol phosphate anchored to the lipid bilayer via a glyceride. It acts as regulator of autolytic
wall enzymes (muramidases: Bacterial enzymes located in the cell wall that cause disintegration
of the cell following injury or death.).
Figure 2. The underlying mechanism of Gram staining is rooted on the basic morphological
structure and properties of the bacteria’s cell wall. (A) Gram- bacteria have cell wall composed of
thick peptidoglycan layers with teichoic acids which is colored red with Safranin. (B) Gram+
bacteria have a thick lipid membranes sandwiching the thinner peptidoglycan layer. The lipid layer
retains the crystal-violet dye after being subjected to decolorization and counterstaining giving the
Gram+ a bluish purple color. (Image from vlab.amrita.edu, 2011)

ACTIVITY
CRITICAL READING – Read and analyse the passages about the actual step-by-step laboratory
Materials:
 Clean glass slides

 Inoculating loop
 Bunsen burner
 Bibulous paper
 Microscope
 Lens paper and lens cleaner
 Immersion oil
 Distilled water
 18 to 24 hour cultures of organisms
 Crystal Violet
 Grams Iodine
 Ethyl Alcohol
 Safranin
Procedure:
Step 1 – Preparation of the glass microscopic slide
Grease or oil free slides are essential for the preparation of microbial smears. Grease or oil from
the fingers on the slides is removed by washing the slides with soap and water. Wipe the slides
with spirit or alcohol. After cleaning, dry the slides and place them on laboratory towels until ready
for use.
Step 2 – Labeling of the slides
Drawing a circle on the underside of the slide using a glassware-marking pen may be helpful to
clearly designate the area in which you will prepare the smear. You may also label the slide with
the initials of the name of the organism on the edge of the slide. Care should be taken that the
label should not be in contact with the staining reagents.
Step 3 – Preparation of the smear
It is very important to prevent preparing thick, dense smears which contain an excess of the
bacterial sample. A very thick smear diminishes the amount of light that can pass through, thus
making it difficult to visualize the morphology of single cells. Smears typically require only a small
amount of bacterial culture. An effective smear appears as a thin whitish layer or film after heat-
fixing (see Figure 4).

 Bacterial suspensions in broth: With a sterile cooled loop, place a loopful of the broth
culture on the slide. Spread by means of circular motion of the inoculating loop to about
one centimeter in diameter. Excessive spreading may result in disruption of cellular
arrangement. A satisfactory smear will allow examination of the typical cellular
arrangement and isolated cells.
 Bacterial plate cultures: With a sterile cooled loop, place a drop of sterile water or saline
solution on the slide. Sterilize and cool the loop again and pick up a very small sample of
a bacterial colony and gently stir into the drop of water/saline on the slide to create an
emulsion.
Part 4 – Heat Fixing
Heat fixing kills the bacteria in the smear, firmly adheres the smear to the slide, and allows the
sample to more readily take up stains. Take care to prevent overheating the slide because
proteins in the specimen can coagulate causing cellular morphology to appear distorted (see
Figure 4).
 Allow the smear to air dry.

 After the smear has air-dried, hold the slide at one end and pass the entire slide through
the flame of a Bunsen burner two to three times with the smear-side up.
 Now the smear is ready to be stained.
Part 5 – Gram Staining Procedure
1. Place slide with heat fixed smear on staining tray.

2. Gently flood smear with crystal violet and let stand for 1 minute.
3. Tilt the slide slightly and gently rinse with tap water or distilled water using a wash bottle.
4. Gently flood the smear with Gram’s iodine and let stand for 1 minute.
The smear will appear as a purple circle on the slide.
6. Decolorize using 95% ethyl alcohol or acetone. Tilt the slide slightly and apply the alcohol
drop by drop for 5 to 10 seconds until the alcohol runs almost clear. Be careful not to over-
decolorize.
7. Immediately rinse with water.
8. Gently flood with Safranin to counter-stain and let stand for 45 seconds.
10. Blot dry the slide with bibulous paper.
11. View the smear using a light-microscope under oil-immersion.

Figure 4. Preparation of bacterial smear. (Image from Cappuccino, 1999)
ASSESSMENT
Guide Questions. Concisely answer the guide questions provided after. Use the
1) What is the theory about the mechanism of the Gram-stain reaction?

2) Which step is the most crucial or most likely to cause poor results in the Gram stain? Why?
3) Why must young cultures be used when doing a Gram stain?
4) What part of the bacterial cell is most involved with Gram staining, and why?
5) What is the function of the iodine solution in the Gram stain? If it were omitted, how would
staining results be affected?

6) What is the purpose of the alcohol solution in the Gram stain?

7) What counterstain is used? Why is it necessary? Could colors other than red be used?
8) What would be the function of heat-fixing in the preparation of smear?
9) What do you think would be easier to prepare bacterial smear from, liquid or solid culture?
10) Aside from bacteria, do you think that Gram staining can be used with microbes such as
fungi? Explain briefly your answer.
GRADING SYSTEM
 For the Assessment, which is a constructed-response assessment, the following rubric

shall be used to evaluate the answers in each items:
3 points 2 point 1-0 point

as: as: as:
point response  Grammar construction
 Having syntax and like somewhat
construction and like obscures the response
effective communication
Assessment – 30 points
--------------
TOTAL – 35 points

ACTIVITY 6 – Microbial Growth
INTRODUCTION
When grown on a variety of media, microorganisms will exhibit differences in the macroscopic
appearance of their growth. These differences, called cultural characteristics, are used as a basis
for separating microorganisms into taxonomic groups. The cultural characteristics for all known
microorganisms are contained in Bergey’s Manual of Systematic Bacteriology. They are
determined by culturing the organisms on nutrient agar slants and plates, in nutrient broth, and in
nutrient gelatin.
LEARNING OUTCOMES
1) Demonstrate understanding about microbial growth by observing a microbial colony; and,

2) Determine the cultural characteristics of microorganisms as an aid in identifying and classifying organisms
into taxonomic groups.
COURSE MATERIALS

the virtual laboratory sites about Microbial Colony Morphology,
as follows:
- https://microbiologysociety.org/why-microbiology-
matters/what-is-microbiology/bacteria/observing-
bacteria-in-a-petri-dish.html
- http://vlab.amrita.edu/?sub=3&brch=278&sim=1484&cn
t=1
d) Audiovisual clips – The student can watch any audio-video clips about Microbial
Colony Morphology, but especially the following links below:
- https://youtu.be/4JZAFUPckUg
- https://youtu.be/SrfgQTzPU4w

ACTIVITY
CRITICAL READING – Read and analyse the passages about the actual step-by-step laboratory
Image #1 from:
https://d279m997dpfwgl.cloudfront.net/wp/2017/10/Chimileski_Kolter_Fig01_23-edited.jpg

Image from: https://thumbs-prod.si-cdn.com/6xl6w6nejtNkabDGUhg0GiwVDd4=/fit-

in/1600x0/filters:focal(1320x1019:1321x1020)/https://public-media.si-
cdn.com/filer/61/45/61457b25-54a9-4bb2-b5b1-30ce1ab40dbc/img_6288.jpg

ASSESSMENT
Choose five colonies on Image #1 and describe fully the colonial morphology of the colonies
shown above. A full description will include texture, transparency, color, and form (size, overall
shape, margin, and elevation).
Colony 1
Colony 2
Colony 3
Colony 4
Colony 5

Now describe the colonial morphology of Micrococcus luteus and Escherichia coli using the TSA
plate culture of this bacterium provided to your (see Image #2) as follows:
Micrococcus luteus Escherichia coli
Size
Texture
Transparency
Pigmentation
Form (shape,
margin,
elevation)

ACTIVITY 7 – Microbial Metabolism: Cellular Respiration in Yeast
INTRODUCTION
The cellular organelle mitochondrion (plural mitochondria) virtually accomplishes all of the
oxidation energy processes (cellular respiration) in eukaryotes, extracting chemical energy from
the foodstuffs and many metabolic substances to produce constant amount of adenosine
triphosphate (ATP) available inside the cell for the performance of its life processes. In
prokaryotes, like the bacteria, the bacterial cell itself is analogous to the mitochondria with almost
the same cellular machinery and ATP molecules is also considered the cells “energy currency”:
even though relatively a simple molecule of adenosine and three (3) phosphate groups, yet ATP
is quite manageable, efficient and convenient molecular energy (heat) provider for activation and
operation of many enzymatic and metabolic activities inside the cell.
LEARNING OUTCOMES
3) Demonstrate principles behind microbial metabolism of cellular respiration;

4) Observe factors that affect the rate of microbes’ cellular respiration such as availability of
substrates, and temperature; and,
5) Expound the understanding about how microorganisms perform cellular respiration.
COURSE MATERIALS

the virtual laboratory sites about microbial metabolism of
Cellular Respiration, as follows:
- http://www.bch.cuhk.edu.hk/vlab2/animation/fermentati
on/index.html
- https://www.scientistcindy.com/lab-10-fermentation-
aerobic-cellular-respiration-and-associated-major-
organ-systems.html
d) Audiovisual clips – The student can watch any audio-video clips about microbial
metabolism of Cellular Respiration, but especially the following
links below:
- https://www.youtube.com/watch?v=Cngt2HmJuSo

- https://www.youtube.com/watch?v=h3dQ_H0ueN4
Principles behind Cellular respiration
Figure 1. The cellular respiration mechanism is almost exactly analogous to the eukaryotes’
organelle, mitochondrion (upper image) and prokaryotic bacteria (lower image). The cellular
structure of mitochondrion is analogous to the cell body of a bacterium. (Image from brainly.com,
2020)
The mitochondrion is double-membrane bounded, namely the outer and inner membrane, as
analogous to the cell wall and plasma membrane of bacteria. The outer membrane

compartmentalizes the mitochondrion from the cell’s cytoplasm. Between the outer membrane
and inner membrane is the intermembrane space. The inner membrane then envelopes the
internal space (matrix) within, filled with fluid, jelly-like mixture of enzymes, nucleotides, and other
organic and inorganic substances needed for the chemical pathways of cellular respiration. Also
situated inside the matrix, the mitochondrion has its own small ribosomes (mitochondrial
ribosomes), matrix granules and circular DNA (mitochondrial DNA). Another observable features
about the inner membrane is that it is folded along within the mitochondrion, thus the inner
membrane appears to be creased and wavy extending inward the matrix. This convolution and
appearance of the inner membrane is called cristae. This over-all set-up of the mitochondrion’s
structure and appearance is directly related to its function and execution of cellular respiration, by
providing the “scaffold” or “framework” for the protein enzymes, metabolites, and chemical
substances to react and produce ATP. Additionally, the mitochondrion helps to process many
organic and inorganic molecules (via oxidation-reduction pathways of cellular respiration), to
produce many important chemical substances needed in other cellular processes.
Initially, cellular respiration can be traced to the cell’s cytoplasm where starting with one (1)
glucose molecule (6-carbon molecule), is split by different enzymes to produce the desired end-
product, two (2) pyruvate molecules (a pyruvate molecule is 3-carbon molecule); and, pyruvate
are the one needed to proceed further to the next steps of cellular respiration. This initial process
of cellular respiration is called glycolysis. To elaborate further, glycolysis doesn’t require any
oxygen (anaerobic): yet the process begins by actions of certain set of enzymes and needed
2ATP to effectively split one (1) glucose molecule: 2ATP  2ADP + 2PO43- + energy (heat),
where the 2PO43- and energy are transformed with the glucose hence splitting it. After initial
splitting process of the glucose, other set of enzymes enters to advance processing of the split
glucose-intermediates with help of two (2) nicotinamide adenine dinucleotide (NAD) molecules
and another two (2) PO43- (free phosphate ions, not from ATP).
NAD is a carrier of hydrogen to effectively remove two (2) excess H from the split glucose-
intermediates thus transforming 2NAD+ + 2H  2NADH; while the needed 2PO43- ions are
transformed with the intermediates, to effectively process it. After that, processed intermediates
are managed again by different sets enzymes, removing two (2) H2O from the intermediates and
at the same time with the help of four (4) adenosine diphosphate (ADP), removing excess
4PO43- from the intermediates, producing 4ATP (4ADP + 4PO43- (from the intermediates) 
4ATP): finally converting the intermediates to the target product 2 pyruvates.
Before going to the next step of the cellular respiration, transition stage the pyruvates are then
transported by special protein transporter to the mitochondrion, specifically in the matrix where it
will be oxidized by a specific mitochondrial enzyme with the help of CoenzymeA (CoA), NAD+ as
H acceptor, so that CO2 is removed, a H from pyruvate is removed, and transformed to
Acetyl-CoenzymeA (Acetyl-CoA). This transformation is needed to be able to make pyruvate
into a usable form for Citric acid cycle.
In order to understand if better, a single Acetyl-CoA molecule will be considered here: then Acetyl-
CoA undergoes series of oxidation-reduction reactions in the matrix by set of enzymes involved
in the Krebs cycle or also known as Citric acid cycle (CAC). CAC is a cyclic process, meaning
that in order to oxidized Acetyl-CoA, the metabolites from a previous cycle round of CAC,
particularly the oxaloacetate is needed. During the start of the cycle, oxaloacetate from the
previous cycle round are then combined with Acetyl-CoA with a specific enzyme, removing the

CoA (to be recycled again), thus transforming it to citrate (that is why called citric acid cycle).
After these essential step, citrate is transformed to many CAC intermediates (another 8 chemical
reactions will take place, with 8 different intermediates) by specific enzymes (different enzymes
for each transformation), thus effectively removing 3CO2 (as wastes).
These series of chemical transformation is very important in order to extract H (atleast 5 H) which
will be accepted by 3NAD+ and one (1) flavin adenine dinucleotide (FAD), which is another form
of H acceptor molecule. Since an NAD+ can only accept one H forming NADH, an FAD can accept
2H thus forming FADH2. Also, one (1) GTP (guanosine triphosphate) or one (1) ATP are created
as a consequence of one specific CAC intermediate transformed to another form. Ultimately, at
the end of the cyclic round, oxaloacetate is formed which shall then be used again to start a new
cycle round with a fresh supply of Acetyl-CoA. Also 3H2O is needed in the intermediate
transformations per cycle while 1H2O is the by-product every cycle.
In order to summarize CAC, since there are two (2) Acetyl-CoA from the two (2) pyruvates of
glycolysis, meaning also two (2) cycle rounds of CCA since only one (1) Acetyl-CoA is processed
at the time; hence summing it up as follows:
Ultimately, most of the NADH and FADH2 in the matrix are then goes to Electron Transport
Chain process situated in the cristae-inner membrane portion of the mitochondrion. Here proteins
complexes (association of many proteins) embedded in the cristae, facilitates the movement of
electrons and H (as released H+), as carried and released by NADH and FADH2, with assistance
of other electron transporter proteins at the site. The electrons travels along the membrane
proteins in an orderly and continuous fashion, travelling from one protein to other, therefore
causing the released H+ in the matrix to move along the proteins (due to charge difference
attraction), from the matrix to the intermembrane spaces. H+ builds-up (this build-up of H+ is known
as proton gradient) in the intermembrane space. The so-called proton gradient, causes a specific
enzyme in the cristae, called ATP synthase, to harness this energy build-up to efficiently
synthesize ATP (from ADP and free ionic PO43- in the matrix). Thus, H+ from the intermembrane
space forcefully enters through the ATP synthase (causes it to drive the ATP production
analogous to a water turbine) going back to the matrix. Also, the electrons transported from the
proteins are ultimately, accepted by O2 as the final electron acceptor, reacting with 4H+ in the
matrix, forming the H2O, as the final by-product of the cellular respiration. In order to
understand how ATP is efficiently produced in ETC, from 1 glucose molecule producing NADH
and FADH2, refer to the following below:
1 NADH ---------> yields more or less 3 ATPs

1 FADH2 ---------> yields more or less 2 ATPs
6 NADH (from CAC)  yields more or less 18 ATPs

2 FADH2 (from CAC)  yields more or less 4 ATPs
2 NADH (from Transition stage)  yields more or less 6 ATPs
2 NADH (from Glycolysis)  yields more or less 6 ATPs

ACTIVITY
Materials:
 Active dry yeast powder

 White table sugar
 Zip lock bags (only choose one size from 6x8 inch. to 9x12 inch.) Substitute: Translucent
food plastic wrapper like the Calypso Plastic brand used in carinderia or bakery
 Ice-cold pure water
 Room temperature pure water (approximately 26°C to 32°C)
 Lukewarm pure water (43°C to 46°C)
 Permanent marker pen
 Scotch tape
Procedure:
Cellular Respiration Experiment Part 1 – Amount of Sugar
1. Prepare 4 zip lock bags or food plastic wrapper (same sizes) and label each bag as it
follows:
BAG LABEL
Bag 1 Control
Bag 2 1S
Bag 3 2S
Bag 4 4S
2. Then fill each bag with 1 cup full of lukewarm pure water.
3. Completely dissolve in each bag according to the corresponding teaspoons of sugar as it
follows:
BAG SUGAR
Control 0 tsp.
1S 1 tsp.
2S 2 tsp.
4S 4 tsp.
4. Then at each bag, completely dissolve 1 teaspoon of active dry yeast.

5. Carefully and completely dissolve the yeast by swirling. Then, immediately seal the zip-
lock bags. Make sure to completely remove air inside the bag before sealing it completely.
6. Lay down the sealed zip lock bags at the table.
7. Observe and record the time and degree of inflation of the bag (0 as no inflation observed,
to 5 fully inflated or burst) as a gas is liberated inside the sealed bags, as follows:

Cellular Respiration Experiment Part 2 – Temperature
1. Prepare 3 zip lock bags or food plastic wrapper (same sizes) and label each bag as it
follows:
BAG LABEL
Bag 2 Ice-cold
Bag 3 Room Temp
Bag 4 Lukewarm
2. Then fill each bags with pure water of different temperature as it follows:
BAG WATER TEMPERATURE

Ice-cold Ice-cold water (below 5°C)
Room Temp Room temperature water (26°C to 32°C)
Lukewarm Lukewarm water (43°C to 46°C)
3. Immediately, pour inside each zip lock bags with the prepared cup of water of different
temperatures, according to the given correct label.
4. After that, put each bag with 3 teaspoons of sugar. Then carefully swirl the bags until the
sugar are completely dissolved.
5. Put 1 teaspoon of yeast for each bag except the Control.
6. Quickly but carefully mix (by swirling) the bags to completely dissolve the yeast.
7. Then, immediately seal the zip-lock bags. Make sure to completely remove air inside the
bag before sealing it completely.
8. Lay down the sealed zip lock bags at the table.
9. Observe and record the time and degree of inflation of the bag (0 as no inflation observed,
to 5 fully inflated or burst) as a gas is liberated inside the sealed bags, as follows:
ASSESSMENT
Part 1 – Observation. Record your observation in the provided tables. (10 points each table)
Table 1. Amount of substrate (sugar) and the rate of cellular respiration yeasts.
DEGREE OF INFLATION
BAG
0 minute 5 minutes 10 minutes 40 minutes 80 minutes
Control A
1S
2S
4S

Table 2. Effect of temperature on the rate of cellular respiration of yeasts.
DEGREE OF INFLATION
BAG
0 minute 5 minutes 10 minutes 40 minutes 80 minutes
Ice-cold
Room Temp
Lukewarm
1) What do you think is the substance which makes up the air inside the inflated bag? Give
a short explanation why is that so?
2) Give at least two (2) observations did you saw that are the same to all the bags except
the Control.
3) Is there any inflation (and other observed changes) that happened in Control? Give your
explanation why is that so.
4) What is your over-all conclusion on the relationship between amount of sugar and cellular
respiration of yeasts?
5) Why do you think it is necessary for an experiment to have a “control set-up”?
6) Are there any observation did you saw that are the same to all the bags while performing
the activity about the potential effect of temperature on the rate of cellular respiration of
yeasts? Explain your answer concisely.
7) What noticeable differences you have observed while performing the activity about the
potential effect of temperature on the rate of cellular respiration of yeasts? Give at least 2
observations and briefly explain it.
8) What is your over-all conclusion on the relationship between temperature and cellular
respiration of yeasts?
9) Concisely explain the process of cellular respiration, in-terms of the substrates and by-
products involved.
10) Why is it important for microbes to perform cellular respiration? Explain your answer.
GRADING SYSTEM

rubric shall be used to evaluate the fields in each table:
10 points 9-7 points 6-4 points 3-2 points 1-0 point

The answer is The answer is The answer is The answer is The answer is
characterized as: characterized as: characterized characterized characterized as:
 Having all the  Having few as: as:  No results at
expected missing all;

results results, or few  Having  Having few  Incorrect and

leading to errors in many results, inaccurate
complete, idea/thought missing leading to results;
correct required or results, the  Irrelevant
idea/thought expected by which can inconclusive response; and
required or the activity lead to idea/thought  Unintelligible
expected by significant required or and cannot be
the activity errors in expected by understand
idea/thought the activity
required or
expected by
the activity
Each table consists max 10 points, thus the total maximum score creditable is 20 points.


as: as: as:
--------------
TOTAL – 45 points

Activity 8 – Microbial Metabolism: Spoilage and Preservation of Food
Adapted from UK Microbiology Society (2017)
INTRODUCTION
A thorough understanding of the physiological responses of microorganisms to stresses imposed

during food preservation is essential if novel combination systems based on mild food processing
procedures are to be developed effectively. The influences of intrinsic characteristics as well as
external factors such as water activity, temperature, preservatives, composition of the gaseous
atmosphere, etc. on the stress response of microorganisms are discussed. The interaction of
spoilage organisms with each other as well as with food pathogens and the ultimate
consequences for food safety and quality are also explored here (Roller, 1999).
LEARNING OUTCOMES
1) Demonstrate principles behind the role of microbial metabolism in food spoilage;

2) Control microbial growth aiding to food preservation; and,
3) Perform different methods of food preservation.
COURSE MATERIALS

b) Actual Experiment – The activity can be actually performed in the laboratory or home.
c) Audiovisual clips – The student can watch any audio-video clips about the role of
microbial metabolism of Food spoilage, preservation, and
storage, but especially the following links below:
- https://www.youtube.com/watch?v=18vbNJuzhx8
- https://www.youtube.com/watch?v=BlKP35bct2o
- https://www.youtube.com/watch?v=tUi4wgQVQ-I
Principles behind Food spoilage
Microbes like other living organisms, utilizes metabolic processes mainly the cellular respiration
to extract energy and useful matter from food stuffs. Biomolecules like amino acids,
monosaccharides, fatty acids, sterols, and nucleotides are essential to microbial metabolism.

Also, important organic compounds primarily vitamins are also very important in the enzymes
system of microorganisms, together with inorganic substances like metals (iron, magnesium,
potassium, copper, etc.) and non-metals (chlorine, phosphorus, etc.). Also, with the same weight,
water (H2O) is indispensable by providing aqueous environment inside the cell aiding almost all
metabolic pathways. Another consideration in understanding microbial metabolism, is that like
other living organisms, microbes are also affected by the same physical and chemical factors like
temperature, pH (acidity or basicity), presence of oxygen, amount of substrates (food source),
toxins, and presence of other competing microbes (see Table 1). The various methods of food
preservation aim to prevent or delay microbial and other forms of spoilage, and to guard against
food poisoning (see Table 2). Such methods therefore help the product to retain its nutritional
value, extend its shelf-life and keep it safe for consumption. Preservation techniques include
refrigeration, packaging, acidity, chemicals (such as nitrite or metabisulfate), and heat treatment.
Most of the food we buy contains small numbers of microbes. These are usually harmless and do
not spoil the food. If they multiply, however, they may cause the food to ‘go off’. You are going to
investigate various methods of preserving food (see Table 3).
Table 1. Profile of factors utilizes by typical spoilage organisms of food products (Gram et al.,
2002)
Water Temp
Typical spoilage Typical Atmos
Substrate conte e- pH
organism product -phere
nt rature
Shewanella,
Fish Amino acids High Low Aerobic High
Pseudomonas
Photobacterium, Non-
Fish Amino acids High Low High
Shewanella aerobic
LAB,
Smoked Non-
Enterobacteriaceae, Amino acids Low Low High
fish aerobic
Photobacterium
Amino acids,
Marinated Non-
LAB, yeasts Carbohydrates Low Low Low
fish aerobic
(simple CHO)
Amino acids,
Pseudomonas Meat Carbohydrates High Low Aerobic Low
(simple CHO)
Lactic acid cocci
(LAC), Amino acids,
Non-
Enterobacteriaceae, Meat Carbohydrates High Low Low
aerobic
Brocothrix, (simple CHO)
Clostridium
LAC, Amino acids,
Meat Non-
Enterobacteriaceae, Carbohydrates Low Low Low
products aerobic
Brochotrix (simple CHO)
Pseudomonas, Carbohydrates
Milk High Low Aerobic High
Bacillus (simple CHO)

Raw Carbohydrates
Erwinia,
vegetable (complex High High Aerobic High
Pseudomonas, fungi
s CHO)
Pseudomonas, Non-
Eggs Amino acids High High High
Enterobacteriaceae aerobic
Carbohydrates
Yeasts, filamentous
Fruits (simple and High High Aerobic Low
fungi
complex CHO)
Mayonnai Carbohydrates Non-
Yeasts, LAB Low Low Low
se salads (simple CHO) aerobic
Carbohydrates Non-
LAB, yeasts Beer High High Low
(simple CHO) aerobic
Carbohydrates Non-
LAB, yeasts Wine High High Low
(simple CHO) aerobic
Carbohydrates
Filamentous fungi Cereals (complex Low High Aerobic High
CHO)
Carbohydrates
Filamentous fungi Nuts (complex Low High Aerobic High
CHO)
Table 2. Examples of typical microbial substrates and spoilage metabolites found in

microbiologically spoiled foods (Grams et al., 2002)
Sensory Spoilage Spoilage Specific spoilage

Food product
impression product substrate organism
Slime dextran sucrose kimchi, turkey Lueconostoc spp.
breast
sugars wine Pediococcus damnosus
sugars bread Bacillus spp.
hydrolyzed pectin vegetables Erwinia spp.,
polymer and fruits Pseudomonas spp.
Fishy off- trimethylamine trimethylamine fish Shewanella putrefaciens
odor oxide
Ammonia- NH3 amino acids protein-rich Many microorganisms
like, putrid (ammonia) foods
odor
Biogenic amino acids meat Enterobacteriaceae and
amines Lactic acid bacilli (LAB)
fish Enterobacteriaceae, LAB,
Photobacterium
phosphoreum
Rotten egg H2S cysteine fish, meat Shewanella putrefaciens,
like or (amino acid) Enterobacteriaceae
sulfur-like
off-odor
Sulfhydryl Methionine fish, meat Shewanella putrefaciens
compounds (amino acid)

like
mercaptans
and thiols
Greening H2S cysteine meat Lactobacillus plantarum
(amino acid)
Acid off- acetic acid, glucose, meat LAB
odour lactic acid ribose, and
other
aldehydes
(CHO)
“Sweet Proteins and phospholipid milk Bacillus cereus
curdling” fat particles
Cheesy off- Acetoin, glucose meat Bacillus thermosphacta,
odor diacetyl, 3- Enterobacteriaceae, LAB
methylbutanoyl
Table 3. Examples of major stresses encountered by spoilage microorganisms in foods (Roller,

1999)
Food preservation technique Stress imposed on microorganisms

Refrigeration and freezing Low temperature and dehydration
Fermentation (production of organic Low pH, Low pH, ethanol damage
ethanol damage acids and ethanol)
Drying, salting, preserving with sugar Osmotic stress, dehydration
Addition of synthetic food preservatives Direct attack on cell structures: membranes,
cell walls, etc.
Storage in controlled or modified Shortage of oxygen, carbon
atmospheres
ACTIVITY
the information provided by or suggested in the passages.
Materials:
 24 pieces of any beans like peas, mongo, or bitsuelas

 8 test tubes or small transparent glass or plastic cups or bottle (or any like) that can hold
at least 150 ml
 Distilled water
 Salt (sodium chloride)
 Sugar
 Vinegar
 Salitre (sodium nitrate)
 Permanent marker cup
 Teaspoon
 Tablespoon

 Cotton plug or any improvised cover or lid for the 8 tubes as long as they are clean and
fit closing the opening
Procedure:
1) Submerge the 24 pieces of beans in clean water for 1 hour.

2) Label the cups and prepare the solution by dissolving the following in clean water (distilled
or purified) in each cups as it follows:
Tube /
Content Water (tbsp. or ml) Material
Cup
A None None None
B None None None
C Water 8 tbsp. ~ 120 ml None
D Dilute salt solution 7 tbsp. ~ 100 ml ½ teaspoon salt
Concentrated salt
E 7 tbsp. ~ 120 ml 2 teaspoon salt
solution
F Sugar solution 7 tbsp. ~ 120 ml 2 teaspoon sugar
G Vinegar 4 tbsp. ~ 120 ml 4 tbsp vinegar
Salitre (sodium nitrate) ½ teaspoon salitre (sodium
H 7 tbsp. ~ 120 ml
solution nitrate)
3) Put the solutions in each cup making sure the cups are filled not more than the ¾ of the
container capacity.
4) Using a clean forceps, put three (3) beans in each tube. Make sure the beans is fully
submerged, sinking down the bottom of the tube.
5) Cover all of the tubes with a cotton plug, or any applicable cover or lid as long as it is clean
and totally closed the opening.
6) Put the Tube A in the innermost part of the refrigerator (or coldest part of your house if
there is no refrigerator). Tube B – H should be incubated at room temperature for at 72
hours.
7) The turbidity produced in the tubes is caused by microbes (mainly bacteria) already
present on the peas, growing on the nutrients of the vegetable. Very dense turbidity
indicates around 109 microbes per ml and turbidity just visible to the naked eye about 106
per ml.
8) When considering the preservatives used, it is interesting to compare the peas with bacon.
The latter contains 3–6 % NaCl and small quantities (parts per million) of nitrite. Nitrite
content is limited by law because of possible health dangers, but its antimicrobial action
is enhanced in the presence of NaCl, in heat-treated foods and at acid pH values of 5–6.
As an extension activity, students could experiment with combinations of preservatives in
the tubes

ASSESSMENT
Part 1 – Observation. Record your observation in the provided tables. (1 point each field)
PRESENCE OF
TUBE APPEARANCE AND OTHER OBSERVATIONS
TURBIDITY

1) Why is food in shops marked with a ‘use-by’ or “expiration” date?

2) What causes food to go off?
3) How does vinegar act as a preservative?
4) What other methods of preservation are being used in this investigation? How do they
work?
5) Some foods are preserved by vacuum-packing. How does this affect the growth of
microbes?
6) How daing, dilis, tuyo, tapa etc. are are preserved?
7) How was meat preserved before refrigerators were invented?
8) What methods are used to preserve fish?
9) How do you keep food fresh at home?
10) How do you expect the liquid and/or beans in each tube to appear next lesson? Explain
your answers.
11) Describe the appearance of the beans and liquid in each tube. Why has the liquid
sometimes gone cloudy?
12) Do your results confirm your predictions? If not, suggest reasons for any differences.
13) From your results, describe the effect of temperature on the growth of microbes.
14) Why microbes do causes spoilage of foods? Give your plausible explanation.
15) What is your conclusion about the role of microbial metabolism in food preservation and
storage?
16) What diseases or disorder can possibly one get from eating spoiled foods? Give at least
three (3) examples.
17) Give three different (3) examples of definite food preservation methods and foods/meals
you can perform at your home or business.
GRADING SYSTEM

rubric shall be used to evaluate the fields in each table:
10 points 9-7 points 6-4 points 3-2 points 1-0 point

The answer is The answer is The answer is The answer is The answer is
characterized as: characterized as: characterized characterized characterized as:
 Having all the  Having few as: as:  No results at
expected missing  Having  Having few all;
results results, or few many results,  Incorrect and
leading to errors in missing leading to inaccurate
complete, idea/thought results, the results;
correct required or which can inconclusive  Irrelevant
idea/thought expected by lead to idea/thought response; and
required or the activity significant required or  Unintelligible
expected by errors in expected by and cannot be
the activity idea/thought the activity understand
required or
expected by
the activity

Each field amounts to 1 point, thus the total maximum score creditable is 20 points.


as: as: as:
--------------
TOTAL – 55 points

ACTIVITY 9 – Microbial Metabolism: Effects of Light on Photosynthetic Microbes
INTRODUCTION
The ultimate source of energy for majority of living organisms is the light coming from the sun.
The survival of these organisms is affected by several interrelated processes in the ecosystem.
Photosynthetic organisms like plants and algae utilize light energy to convert inorganic molecules
such as carbon dioxide and water in the form of sugars which is a complex, organic molecule.
During the process, the oxygen released in the environment during photosynthesis can be used
by animals for cellular respiration. Unlike photosynthesis, cellular respiration does not require light
energy from the sun. It involves the breakdown of complex, organic molecules for energy
production and the release of carbon dioxide and water as by-products.
LEARNING OUTCOMES
1) Demonstrate principles behind role of microbial photosynthesis in the habits of

photosynthetic microbes;
2) Analyze the effect of light on photosynthetic microbial cells found in natural water sources;
and,
3) Appreciate the importance of photosynthetic microorganism’s role in the ecosystem.
COURSE MATERIALS

b) Actual Experiment – The activity can be actually performed in the laboratory or home.
c) Audiovisual clips – The student can watch any audio-video clips about the role of
microbial metabolism of Photosynthesis, but especially the
- https://www.youtube.com/watch?v=GDCmzzigBZY
- https://www.youtube.com/watch?v=LeOgD266jXw
- https://www.youtube.com/watch?v=fJHZ747K7YI
Principles behind microbial photosynthesis
In general, photosynthesis converts solar energy into usable chemical energy by anabolic
pathways. There are two (2) main stages of photosynthesis: light-dependent reaction, aims to

capture solar energy and transform it to usable chemical energy; and Calvin cycle (light-
independent reaction) utilizes the usable chemical energy to transform CO2 to usable organic
substances for the sustenance of life processes. All of these photosynthetic reactions occurs in
the chloroplast organelle of an autotrophic eukaryotic cells, while also photosynthetic
prokaryotes utilize their own cellular machinery comparable with a chloroplast. The green pigment
in chloroplast is called chlorophyll. Chlorophyll molecules is the one primary responsible, acting
like an antenna to capture needed discrete amounts of light energy (photons) from the sun, which
will drive the whole photosynthetic machinery. Also, chloroplasts is double-membrane bounded,
and have its distinct features: stroma and thylakoids. The stroma is the interior space containing
jelly-like fluid surrounding the thylakoids. Thylakoids are interconnected sacs inside the
chloroplast, with their own membrane (thylakoid membrane). The thylakoids are interconnected,
forming columns stacks called grana (singular granum, single column stack). The space inside
the thylakoids is called thylakoid space (also called thylakoid lumen).
Figure 1. The photosynthesis mechanism is almost exactly analogous to the eukaryote’s

chloroplast and prokaryotic cyanobacteria. The cellular structure of chloroplast is analogous to
the cell body of a bacterium. (Image from brainly.com, 2020)
The thylakoid membrane together with thylakoid lumen, are set-up with chlorophyll receptors,
special proteins complexes, and enzymes needed to capture light energy to extract electrons and
H+ from H2O, and direct their flow which will be needed for the production energy rich molecules:

adenine triphosphate (ATP) and nicotinamide adenine dinucleotide phosphate hydrogen

(NADPH). On the other hand, the chloroplast stroma also contains a lot of special proteins,
enzymes, nucleotides, and other molecules needed for facilitating and transforming CO2 to usable
organic substances (primarily sugars) needed by the plants.
Virtually, we cannot sum up the total ATP and NADPH produce during the light-dependent
reaction but it will give us a clue that autotrophs have many adaptation and means to maximize
their use of sunlight energy, CO2, and H2O. Thus a lot of ATP and NADPH is effectively and
efficiently can be produce to sustain the Calvin cycle and even reaching in surplus to be used as
ready energy source by the cell. Nevertheless, we can trace the net reaction based on the ratio
of substrate CO2, H2O to the product sucrose sugar and O2. To sum up the net reaction of
photosynthesis, ideally:
12 CO2 + 11 H2O + Light Energy -----------> C12H22O11 (sucrose) + 12 O2
Photosynthesis is important not only to the energy production in autotrophic organisms. It has a
very important Cyanobacteria also performs photosynthetic processes since their cell body itself
contains the photosystem complexes and enzymes similar with those found in the chloroplasts of
higher algae and plants.
ACTIVITY
CRITICAL READING – Read and analyze the passages about the actual step-by-step laboratory.
Then thoroughly and concisely answer the guide questions provided after. Use the information
provided by or suggested in the passages.
Materials:
 Scissors
 Masking tape
 Marker pen
 Black Cartolina paper
 One 1, 1.5, or 2 liter transparent colorless bottle with cap.
 Water sample from pond (undisturbed rain puddle, or lake), preferably the greenish
water
Procedure:
1) Get a water sample from pond (undisturbed rain puddle, or lake), preferably the greenish
water one, and filling-up 1 L transparent colorless bottle and cap it tightly.
2) Then cut two holes the size of not larger than 5 cents coin in the black Cartolina paper.
The whole must be vertically aligned with each other, with preferable distance of at least
4 inches from each other (see Figure 1).
3) Then fully cover the bottle with the Cartolina paper with the holes positioned in the body
of the bottle (see Figure 1). Make sure your bottle is tightly covered and fully covered with
the paper.

4) Then the bottle should be exposed to bright light, with the holes facing the light directly for
16-24 hours (lower image). During this time don’t agitate or disturb the content inside. It is
very important to ensure that no light enters the tube except via the ‘holes’.
5) After the time exposure, carefully remove the back portion of the cartolina paper (not the
one with holes). REMEMBER NOT TO AGITATE OR SHAKE THE BOTTLE.
6) Observe the water inside the bottle, specially the water portion near the two holes expose
to light.
7) Record your observation such as the appearance, turbidity, particles and movement inside
the water. You can use your light source and the cartolina as contrasting background to
easily examine and spot any changes.
Figure 1. Procedure for covering the bottle with black Cartolina with holes (above image). Then
the bottle, with the holes exposed to direct bright light for 16-24 hours (lower image).
ASSESSMENT
Part 1 – Illustration. Accurately illustrate and describe the results you have observed
changes in after the duration of light exposure, particularly the water inside the bottle. (5
points each field)
Part 2 – Guide Questions. Answer the guide questions provided after. Use the information
provided by or suggested in the passage. (5 points each item)
1) Comparing the light exposed part of the water to unexposed portions? What differences
you have observed? Explain why is that so?
2) Do you think that light has an effect on the results of your experiment? Explain why is that
so?
3) Give your conclusion on the effect of light in microbes found in your water sample?
GRADING SYSTEM
 For Assessment – Part 1, which is an objective, constructed-response assessment, where

each field is 5 points. Therefore, the total maximum score creditable is 10 points.

Pointing system
Fields
5-4 points 3-2 points 1-0 point
The illustration is The illustration is The illustration is
Drawing correct idea/thought correct idea/thought inaccurate; and
appropriate to the appropriate to the  Unintelligible and
actual observation actual observation cannot be
understand
The answer is The answer is The answer is
correct idea/thought correct idea/thought inaccurate;
required by the required by the  Irrelevant response;
question question; and
 Concise and direct-  Not concise response  Unintelligible and
Description
to-the-point  Grammar construction cannot be
response and like somewhat understand
 Having syntax obscures the response
construction and like
effective
communication


as: as: as:
communication
--------------
TOTAL – 35 points

ACTIVITY 10 – Apple Cider Vinegar Making
INTRODUCTION
Vinegar, sour liquid taste made by the process of fermentation of any of dilute alcoholic liquids
into a liquid containing acetic acid. Vinegar may be produced from a variety of fruits: apples or
grapes (wine or cider vinegar); malted barley or oats (malt vinegar); and industrial alcohol
(distilled white vinegar). There are also vinegars made from beer, sugars, rice, and other
substances. As a commercial product, however, vinegar was probably first made from wine.
LEARNING OUTCOMES
1. Define what fermentation is

2. Demonstrate on how to make apple cider vinegar
3. Identify the health benefits of apple cider
COURSE MATERIAL
Vinegar is a liquid made up of water and acetic acid. Adding yeast turns the sugar in the juice
into alcohol. This is a process called fermentation. It involves a two-step process of fermentation
from a carbohydrate to an alcohol to an acetic acid. In the first stage, yeast convert sugars into
ethanol anaerobically, while in the second ethanol is oxidized to acetic (ethanoic) acid aerobically
by bacteria of the genera Acetobacter and Gluconobacter.
Vinegar bacteria, also called acetic acid bacteria, are members of the genus Acetobacter and
characterized by their ability to convert ethyl alcohol, C2H5OH, into acetic acid, CH3CO2H, by
oxidation as shown below;
Anaerobic Aerobic
2C2H5OH 2CH3CHO 2CH3CO2H + 2H2O
Most bacteria strains derived from vinegar factories are able to oxidize acetic acid to CO 2 and
H2O (over-oxidation) and therefore are classified in the genus Acetobacter (De Ley et al 1984).
The sugar is converted into alcohol, which is then fermented into vinegar. The acetic acid in the
final product is derived by fermenting an alcoholic liquid or by diluting purified acetic acid. Not all
acetic acids are vinegar, although all vinegars are made from acetic acid.
When creating a fruit-based vinegar, wild yeasts are added to convert the sugars into alcohol.
Starch-based vinegars add an extra step, wherein the starch is converted into sugar first, a triple
fermentation process. Brewer's yeast is used for cereals, grains, and molasses. Wine yeasts are
used for fruit juices and honey. A sugar concentration in the range of 10-18 percent is considered
ideal for making vinegar stock. Alcohol concentrations at 9-12 percent are considered optimal for
vinegar production.

Apple cider vinegar is mostly apple juice, but Bacteria turn the alcohol into acetic acid. That’s what
gives vinegar its sour taste and strong smell.
Apple cider vinegar as a way to lose weight, improve heart health, and even treat dandruff. Japanese
scientists found that drinking vinegar might help fight obesity. In one small study found that vinegar
improved blood sugar and insulin levels in a group of people with type 2 diabetes.
Polyphenols as one of the chemical components of vinegar. It can help stop the cell damage that can
lead to other diseases, like cancer. But studies on whether vinegar actually lowers your chances of
having cancer are mixed.
ACTIVITY
MATERIALS
6 cups apples chopped pieces, cores, or peels from (preferably) a variety of apples
6 to 7 tablespoons sugar or honey 1 tablespoon for every 1 cup of water used
6 to 7 cups pure water warm, but not hot
PROCEDURE
1. Fill Mason jar(s) 3/4 of the way with apples or apple scraps.
2. Stir the sugar or honey into the warm water. Stir to dissolve.
3. Pour sweetened water over the apples. Leave 2 to 3 inches of room at the top of the jar.
4. Cover with cheesecloth, thin fabric or coffee filter and a rubber band or mason jar screw-
top lid.
5. Set in a warm dark place for 2 weeks. (Place on a warm surface, and cover with a tea
towel. The smell is wonderful during this process.)
6. After 2 weeks, strain out the solids, pressing on them gently to extract extra liquid. (Taste
the vinegar at this point. It is super delicious!! It's basically a fermented apple cider!)
7. With the solids removed, you will be able to ferment in a smaller jar. Cover with fresh
cheesecloth. Set the fermenting cider in a warm dark place for about 4 weeks.
8. The apple cider vinegar is complete when it has a strong apple cider vinegar smell and
taste. Allow to ferment longer, if not.
ASSESSMENT
Guide Questions. Answer the guide questions provided after. Use the information
1) What are the primary by-products of acidic fermentation?

2) Differentiate the two step process of fermentation
3) Give the chemical equation for fermentation
4) What is the primary difference between making a wine and making a vinegar?
 For the Assessment which is a constructed-response assessment, the following rubric



as: as: as:
communication
--------------
TOTAL – 25 points

ACTIVITY 11 – Inoculation of Microorganism
INTRODUCTION
Microorganisms are transferred from one medium to another by sub-culturing. This technique is
of basic importance and is used routinely in preparing and maintaining stock cultures, as well as
in microbiological test procedures. Microorganisms are always present in the air and on laboratory
surfaces, benches, and equipment. They can serve as a source of external contamination and
thus interfere with experimental results unless proper aseptic techniques are used during sub-
culturing.
LEARNING OUTCOMES
1) Apply the basic technique of aseptic technique in inoculation of microorganisms; and,

2) Perform transfer of microbial inoculates from a culture to another culture.
COURSE MATERIALS

the virtual laboratory sites about Inoculation of Microorganisms,
as follows:
- http://vlab.amrita.edu/?sub=3&brch=73&sim=212&cnt=
1
- http://learn.chm.msu.edu/vibl/content/streakplate.html
d) Audiovisual clips – The student can watch any audio-video clips about Inoculation
of Microorganisms, but especially the following links below:
- https://youtu.be/WDWj-CJ7SQw
- https://youtu.be/370xxVcujyg

ACTIVITY/ASSESSMENT
Inoculation of Microorganism
https://www.pinterest.ph/pin/155303887175582143/

Agar Plate Inoculation

https://www.carlsonstockart.com/photo/agar-plate-aseptic-inoculation-streaking-technique/

Guide Questions. Answer the guide questions provided after. Use the information
1) Describe the main purposes of the inoculation procedure.

2) Describe the main purposes of using aseptic technique during inoculation procedure.
3) Why it is necessary to perform inoculation procedure in isolation of microorganisms from a
culture sample?
4) Base on the procedures stated, can you use it to prepare a pure culture of a microbe from a
mixed culture media? Explain and justify your answer, citing some examples.
5) Can inoculation of microorganisms be done also on living organisms, aside from using
culture media? Explain and justify your answer, citing some examples.

ACTIVITY 12 – Streak Plate Method
INTRODUCTION
Aseptic techniques are important microbial techniques being carried to avoid contamination of the
workplace, samples and even the person. Aseptic techniques basically include proper
handwashing, disinfecting your workplace before and after use and wearing of appropriate PPE.
Streak-plate method is a microbial technique used in bacterial isolate subculture and purification.
It is the actual transfer of bacterial inoculum from one medium to another. In this experiment,
aseptic technique and streak plate method will be simulated using some household items and
culture media prepared from last week (Week 2)
LEARNING OUTCOMES
1) Understand the concept of aseptic technique

2) Prepare cotton plug and inoculating loop/needle
3) Perform streak-plate method
COURSE MATERIALS

the virtual laboratory sites about Aseptic Technique and Streak
Plate, as follows:
- https://www.scienceprofonline.org/microbiology/aseptic-
sterile-technique-microbiology.html
=1
d) Audiovisual clips – The student can watch any audio-video clips about about
Aseptic Technique and Streak Plate, but especially the following
links below:
- https://www.youtube.com/watch?v=bRadiLXkqoU
- https://www.youtube.com/watch?v=0heifCiMbfY

Materials:
 Cotton and gauze

 Small glass tube container or bottle with small amount of boiled distilled water (this will
serve as the microbial culture)
 Candle and matchstick
 Alcohol and tissue
 2 Aluminum Wires (7-10 inches)
 Culture media from week 2
Important: This experiment will use candle as source of fire. Make sure that your workplace is
away from curtain or any material that may catch fire. Ask for assistance.
Methodology:
Preparation of Inoculating loop/needle and cotton plug
Cut two 7-10 inches aluminum wires. Wrap the end of the wires with rubber, cloth or anything that
will serve as the handle and will provide insulation. Using a pliers, bend the other end of one wire
to make a loop.
Make a lump of cotton that will fit in the mouth of the small glass bottle/tube container with water.
Ensure that the cotton will serve as a plug and will not fall out. Cover the cotton plug with gauze
and sew it close. The cotton plug will serve as the cover lid of the glass container.
Streak-Plate Method
Disinfect workplace with alcohol and tissue. Make sure that hands are thoroughly washed with
soap and water prior to this experiment. Light a candle and place it in the middle of the workplace.
Flame-sterilize your loop or needle by placing it over the flame and allow it to turn hot-red. Allow
the loop/needle to cool down but DO NOT put it down, blow on it, wave it or touch the flamed part.
Just hold on to the handle for a few minutes.
With the glass container on your other hand, use the pinky and ring finger of the hand holding the
loop, to grip the cotton plug and open the glass container near the flame. Swirl the mouth part of
the container near the flame for 3 seconds. Dip the inoculating loop in the container and allow
the loop to touch the water inside.
If you hear a sizzle, it means your loop is still hot. In actual experiment, you already killed your
microbial isolates and you have to repeat from the start. Gently shake the loop while pulling out
to remove the excess water. Excess water may flood your culture and may result to bad streaking.
Pass the mouth of the glass container over the flame and cover it with the cotton plug.
At this point, you have bacterial microbial inoculum in your loop, make sure not to touch it, put it
down or touch any surfaces.

Open partially the lid of the culture media (made from last week experiment) near the flame.
Gently brush the loop on the surface of the agar (make sure not to stab/scrape the agar) in a
zigzag motion covering the
entire surface of the agar. Close
the inoculated culture media.
Flame sterilize the loop as
instructed earlier.
Normally, the inoculated culture media will be stored in a room temperature for 18 to 24 hours to
allow the microbes to grow and form colonies on the zigzag pattern created by streaking. But
since water is used in the experiment, no microbial growth is expected.
Decontamination of experiment materials
After the experiment, pour bleach solution inside the culture media and let it sit for 1 hour. Scrape
off the agar using inoculating loop in transfer it in a plastic bag. Add more bleach. Wrap it tightly
and put it in the trash bin
Soak the container used for the culture media in bleach solution for 1 hour. Wash it with detergent
and if possible sterilize it with hot water. Make sure to flame sterilize the inoculating loop after
using. Disinfect your workplace with alcohol and wash your hands with soap and water.
1) What are the aseptic techniques covered in the experiment (2 points each)
2) What aseptic techniques were carried out from last week’s experiment? (2 points each)
3) What aseptic techniques do you practice in your home? (2 points each)
4) What is the importance of a flame source in the experiment? (5 points)
5) Why is it necessary to flame-sterilize the inoculating loop/needle before and after use? (5
points)
6) Why is it necessary to create a zigzag pattern in streaking the inoculum to the culture
media? (5 points)
7) Illustrate the following (3 points each):
c. inoculating loop and inoculating needle
d. cotton plug
e. streak-plate method

ACTIVITY 13 – Applied Microbiology: Isolating Microbes from Diverse Sources
INTRODUCTION
Microbes are found almost everywhere, but they are mostly far too small to be seen by the naked
eye. When microbes grow, they multiply and form colonies that can be seen easily. You are going
to grow microbes from different places by supplying them with suitable growth conditions.
LEARNING OUTCOMES
1) Demonstrate principles of microbiology in action to applied sciences;

2) Understand the ubiquity and variety of microbes in the environment; and,
3) Prove that microorganisms’ population varies from different places.
COURSE MATERIALS

the virtual laboratory sites, as follows:
- https://www.scienceprofonline.com/virtual-micro-
main.html
d) Audiovisual clips – The student can watch any audio-video clips about Applied
Microbiology, but especially the following links below:
- https://www.youtube.com/watch?v=B2cMznri-pc
- https://www.youtube.com/watch?v=9dagKpg1P0g
- https://www.youtube.com/watch?v=7vLbcWtAIpE
As you have learned after weeks of studying and performing experiments in microbiology, it is an
imperative and logical to think about the indispensable importance and role of microorganisms in
virtually all of the Earth’s biosphere. Microbes such as, bacteria, fungi, microalgae, protists, and
even viruses, are important part of the ecosystem, making their potential use and applications
noteworthy to be studied by humans. From ecology and environmental sciences, to fields of
medicine, genetic engineering and biotechnology, and also the food sector and industries.

ACTIVITY
CRITICAL READING – Read and analyze the passages about the actual step-by-step laboratory.
Then thoroughly and concisely answer the guide questions provided after. Use the information
provided by or suggested in the passage.
Materials:
Nutrient mix ingredients for the agar plate:
 ½ cup of mashed boiled potatoes (just peel, wash, and boil 1 medium-sized potato until
soft; remove water then mash it)
 2 tablespoon of mashed boiled mongo beans (just boil 4 tablespoon of mongo bean
semisoft; remove water then mash it)
 1 tablespoon full of sugar
 ½ teaspoon salt
 Enough water needed in preparing 2 cups of agar-agar or gelatin mix (follow the
instruction in your brand package)
Equipment and reagent:
 Katya (cheesecloth), paper towel, coffee filter or like (would be used as strainer)
 Enough agar-agar or gelatin mix for 2 cups (no color or any flavor - follow the instruction
in your brand package)
 3 small flat plastic container (preferably clear, transparent) - make sure the containers
are cleaned and disinfected with boiling water before use (ALTERNATIVE: liyanera
(leche flan pan) or other plastic container with clear, transparent cover or lid (3 clear
transparent plastic cover, as an alternative lid/cover if the containers have no lid/cover)
 Medicine dropper
 3 sterile cotton-tipped applicator stick (available in Mercury drugstore) or 3 sterile cotton
buds (just wrapped 3 buds in 1 clean bond paper and then put it inside 2 plastic
wrappers, removing any air inside before to be tightly sealed. Then steam it in boiling
water for 30 minutes. After that, cool it down but don’t open yet until it will be used)
 Masking tape
 Face mask
 Hand gloves
 Any disinfectant like alcohol
 Hand washing soap
Procedure:
IMPORTANT: Always wear face masks, hand gloves, and use disinfectant regularly. Always wash
your hands after handling any materials related to the experiment.

Preparation of Agar plate
1) Mix all the ingredients of the Nutrient mix. Make sure all are uniformly and thoroughly
dissolved.
2) Then, using the strainer provided, filter the Nutrient mix. Use spoon to agitate the
solution above to speed up the filtration process. Be careful not to pierce the filter.
3) Then use the filtrate (the liquid filtered) to prepare the agar/gelatin as instructed in the
Brand package. The filtrate is supposed to be enough for preparing 2 cups of
agar/gelatin. Only 2 cups will be needed in the experiment.
4) After cooking, cool-down the agar/gelatin for a while.
5) Before it solidifies, transfer the agar/gelatin solution in the 3 liyaneras (or like) equally.
Make sure the liyaneras are uniformly filled with the agar/gelatin solution.
6) Then totally cool-down to solidify the agar/gelatin in liyaneras at room temperature,
partially covered inside the Calypso plastic cover (or if the container has its own
lid/cover) for the moisture to escape, yet protected from contaminants.
7) After, make sure to fully cover the agar/gelatin plates with its lid/cover until to be used.
Microbial sampling, inoculation, culturing
6) Take one agar plate. Choose a suitable place to leave it open to the air. Label the plate
as AIR and put also the date. Take the lid off the dish and keep it open for 6 hours. After,
put the lid/cover again.
7) Using the medical dropper, get a water sample from a body of water in your area (like a
pond, canal, river, stream, or any water reservoir).
8) Take another agar plate to be labeled as your water source (example CANAL, RIVER,
STREAM, etc.), and the date. Then carefully lift the lid/cover of your agar and put 3 or 4
drops on to the surface of the agar. Use your sterile cotton bud (or applicator stick) to
spread the water drop in your agar plate. Cover the plate again. Dispose the disposables
properly. Do not forget to use disinfect you hand.
9) Then get the 3rd agar plate to be label as MOUTH, and the date.
10) Using another sterile cotton bud (or applicator stick), get an ample swab inside your
mouth, such as the teeth, tongue, inner cheeks, and little saliva.
11) Then swab the cotton bud from your mouth to the agar surface. Make sure to swab the
half area of the agar surface 3-4 times.
12) Use the last sterile cotton swab and repeat 5) and 6) with again the other half area of
the agar. Cover the plate again. Dispose the cotton bud properly. Do not forget to use
disinfect you hand.
13) Seal the plates with the provided cover. Place your agar plates at room temperature, in
a safe place it cannot be disturbed.
14) Don’t forget to observe sanitation, so disinfect you work place and yourself.
15) The incubation will be commence until 2-3 days. Then check the results and record your
observation. DO NOT OPEN THE LID!
IMPORTANT: After the experiment. Submerged all your used plates and cover in water with
detergent, and bleach solution (Zonrox) for 60 minutes. Then clean it as usual as the containers
can be used again. Properly dispose those that are disposables.

ASSESSMENT
Guide Questions. Answer the guide questions provided after. Use the information provided
by or suggested in the passage. (5 points each item)
1) Where do you think microbes may be found?

2) Is a single microbial cell visible to the naked eye?
3) What conditions do you think would encourage the growth of microbes?
4) What different kinds of microbes exist?
5) Do you expect any difference between the malt agar plates and the nutrient agar plates?
If so, why?
6) What is the purpose of the ‘control’ plate?
7) Describe the appearance of each of your plates. Do they all look the same?
8) Which plate shows most microbial growth? Can you suggest any reasons for this?
9) Do your plates look the same as those from other groups, using a different kind of growth
medium? If not, suggest a reason why.
10) Write down any ideas you have about how microbes might be important in the places you
have investigated.
GRADING SYSTEM
 For the Assessment, which is a constructed-response assessment, the following rubric


as: as: as:
communication
--------------
TOTAL – 55 points

ACTIVITY 14 – Understanding Acellular Infectious Agents
Adapted from Parker, et al., 2016.
INTRODUCTION
Until the late 1930s and the advent of the electron microscope, no one had seen a virus. Yet
treatments for preventing nor curing viral infections were used and developed long before that.
Historical records suggest that by the 17th century, and perhaps earlier, inoculation (also known
as variolation) was being used to prevent the viral disease smallpox in various parts of the world.
By the late 18th century, Englishman Edward Jenner was inoculating patients with cowpox to
prevent smallpox, a technique he coined vaccination. Today, the structure and genetics of viruses
are well defined, yet new discoveries continue to reveal their complexities. We will learn about
the structure, classification, and cultivation of viruses, and how they impact their hosts. In addition,
we will learn about other infective particles such as viroids and prions.
LEARNING OUTCOMES
1) Observe the difference of acellular infectious agents from cellular microorganisms;

2) Understand some major techniques in testing and identifying virus infections in living
organisms; and,
3) Appreciate the basic differences of viruses, viroids, virusoids, and prions from each other.
COURSE MATERIALS

b) Audiovisual clips – The student can watch any audio-video clips on basic concepts
of viruses, viroids, virusoids, and prions, but especially the
- https://www.youtube.com/watch?v=chTU792DWas
- https://www.youtube.com/watch?v=4kIKySxUYuk
- https://www.youtube.com/watch?v=qmsWOrQtj4w
Viruses are generally ultramicroscopic, typically from 20 nm to 900 nm in length. Some large
viruses’ haven been found. Virions are acellular and consist of a nucleic acid, DNA or RNA, but
not both, surrounded by a protein capsid. There may also be a phospholipid membrane
surrounding the capsid. Viruses are obligate intracellular parasites and are known to infect various

types of cells found in plants, animals, fungi, protists, bacteria, and archaea. Viruses typically
have limited host ranges and infect specific cell types. Viruses may have helical, polyhedral, or
complex shapes. Classification of viruses is based on morphology, type of nucleic acid, host
range, cell specificity, and enzymes carried within the virion. Like other diseases, viral diseases
are classified using ICD codes.
Figure 1. a) The naked adenovirus uses spikes made of glycoproteins from its capsid to bind to
host cells. b) The enveloped human immunodeficiency virus uses spikes made of glycoproteins
embedded in its envelope to bind to host cells. (Image below right) A bacteriophage (a virus that
infects bacteria) is dwarfed by the bacterial cell it infects. A bacteriophage is a complex virus
(credit a: modification of work by U.S. Department of Energy, Office of Science, LBL, PBD).
Figure 2. Viral capsids can be (a) helical, (b) polyhedral, or (c) have a complex shape. (credit a
“micrograph”: modification of work by USDA ARS; credit b “micrograph”: modification of work by
U.S. Department of Energy)

Many viruses target specific hosts or tissues. Some may have more than one host. Many viruses
follow several stages to infect host cells. These stages include attachment, penetration,
uncoating, biosynthesis, maturation, and release. Bacteriophages have a lytic or lysogenic
cycle. The lytic cycle leads to the death of the host, whereas the lysogenic cycle leads to
integration of phage into the host genome. Bacteriophages inject DNA into the host cell, whereas
animal viruses enter by endocytosis or membrane fusion. Animal viruses can undergo latency,
similar to lysogeny for a bacteriophage. The majority of plant viruses are positive-strand ssRNA
and can undergo latency, chronic, or lytic infection, as observed for animal viruses. The growth
curve of bacteriophage populations is a one-step multiplication curve and not a sigmoidal
curve, as compared to the bacterial growth curve. Bacteriophages transfer genetic information
between hosts using either generalized or specialized transduction.
Figure 3. In
influenza virus
infection, viral
glycoproteins
attach the
virus to a host
epithelial cell.
As a result, the
virus is
engulfed. Viral
RNA and viral
proteins are
made and
assembled
into new
virions that are
released by
budding.
Viral cultivation requires the presence of some form of host cell (whole organism, embryo, or cell
culture). Viruses can be isolated from samples by filtration. Viral filtrate is a rich source of released
virions. Bacteriophages are detected by presence of clear plaques on bacterial lawn. Animal and
plant viruses are detected by cytopathic effects (CPEs), molecular techniques (PCR, RT-PCR),
enzyme immunoassays, and serological assays (hemagglutination assay, hemagglutination
inhibition assay). Cytopathic effects are distinct observable cell abnormalities due to viral
infection. CPEs can include changes in cell shape from flat to round, shrinkage of the nucleus,
vacuoles in the cytoplasm, complete cell lysis and others. A serological assay is used to detect
the presence of certain types of viruses in patient serum. Serum is the straw-colored liquid fraction

of blood plasma from which clotting factors have been removed. Serum can be used in a direct
assay called a hemagglutination assay to detect specific types of viruses in the patient’s sample.
Hemagglutination is the agglutination (clumping) together of erythrocytes (red blood cells). Many
viruses produce surface proteins or spikes called hemagglutinins that can bind to receptors on
the membranes of erythrocytes and cause the cells to agglutinate. Hemagglutination is
observable without using the microscope, but this method does not always differentiate between
infectious and noninfectious viral particles, since both can agglutinate erythrocytes. Molecular
techniques like nucleic acid amplification tests (NAAT) are used in molecular biology to detect
unique nucleic acid sequences of viruses in patient samples. Polymerase chain reaction (PCR)
is an NAAT used to detect the presence of viral DNA in a patient’s tissue or body fluid sample.
PCR is a technique that amplifies (i.e., synthesizes many copies) of a viral DNA segment of
interest. Using PCR, short nucleotide sequences called primers bind to specific sequences of viral
DNA, enabling identification of the virus. Reverse transcriptase-PCR (RT-PCR) is an NAAT used
to detect the presence of RNA viruses. RT-PCR differs from PCR in that the enzyme reverse
transcriptase (RT) is used to make a cDNA from the small amount of viral RNA in the specimen.
The cDNA can then be amplified by PCR. Both PCR and RT-PCR are used to detect and confirm
the presence of the viral nucleic acid in patient specimens.
Viroids consist of small, naked ssRNAs that cause diseases in plants and they are capable of
self-replication. Unlike viruses, viroids do not have a protein coat to protect their genetic
information. Viroids can result in devastating losses of commercially important agricultural food
crops grown in fields and orchards. Viroids, in general,can be dispersed mechanically during crop
maintenance or harvesting, vegetative reproduction, and possibly via seeds and insects, resulting
in a severe drop in food availability and devastating economic consequences. Virusoids are
ssRNAs that require other helper viruses to establish an infection. Virusoids are subviral particles
best described as non–self-replicating ssRNAs. RNA replication of virusoids is similar to that of
viroids but, unlike viroids, virusoids require that the cell also be infected with a specific “helper”
virus. There are currently only five described types of virusoids and their associated helper
viruses. The virusoid genomes are small, only 220 to 388 nucleotides long. A virusoid genome
does not code for any proteins, but instead serves only to replicate virusoid RNA. Virusoids belong
to a larger group of infectious agents called satellite RNAs, which are similar pathogenic RNAs
found in animals. Unlike the plant virusoids, satellite RNAs may encode for proteins; however,
like plant virusoids, satellite RNAs must coinfect with a helper virus to replicate. One satellite RNA
that infects humans and that has been described by some scientists as a virusoid is the hepatitis
delta virus (HDV), which, by some reports, is also called hepatitis delta virusoid. Much larger than
a plant virusoid, HDV has a circular, ssRNA genome of 1,700 nucleotides and can direct the
biosynthesis of HDV-associated proteins. The HDV helper virus is the hepatitis B virus (HBV).
A prion is a misfolded rogue form of a normal protein (PrPc) found in the cell. This rogue prion
protein (PrPsc), which may be caused by a genetic mutation or occur spontaneously, can be
infectious, stimulating other endogenous normal proteins to become misfolded, forming plaques
(see Figure 4). Today, prions are known to cause various forms of transmissible spongiform
encephalopathy (TSE) in human and animals. TSE is a rare degenerative disorder that affects
the brain and nervous system. The accumulation of rogue proteins causes the brain tissue to
become sponge-like, killing brain cells and forming holes in the tissue, leading to brain damage,
loss of motor coordination, and dementia. Infected individuals are mentally impaired and become
unable to move or speak. There is no cure, and the disease progresses rapidly, eventually leading
to death within a few months or years.

Figure 5. Endogenous normal prion protein (PrPc) is converted into the disease-causing form
(PrPsc) when it encounters this variant form of the protein. PrPsc may arise spontaneously in
brain tissue, especially if a mutant form of the protein is present, or it may originate from misfolded
prions consumed in food that eventually find their way into brain tissue. (Image right by USDA)
ACTIVITY
CRITICAL READING – Read and analyze the given passages about acellular pathogens, as it
was stated above. Then thoroughly and concisely answer the questions provided after. Use the
information provided by or suggested in the passages, and proceed in the ASSESSMENT part.
ASSESSMENT
Part 1 – Guide Questions. Concisely answer the questions being asked. (5 points each)
1) Discuss the geometric differences among helical, polyhedral, and complex viruses.
2) Differentiate between lytic and lysogenic cycles.
3) What are the differences between a virus, viroids, virusoids, and prions?
4) What is the similarity between a virus, viroids, virusoids, and prions?
5) Explain the primary reason why prions is a special acellular pathogen.
6) Why it is very important to use living organisms to culture viruses? Explain concisely.

ACTIVITY 15 – Biosafety and Biosecurity
INTRODUCTION
It is imperative to understand that microbiological agents such as bacteria, fungi, protozoans,

microalgae, and acellular microbes such as viruses, viroids, virusoids, and prions, have distinct
their biological, physical, and ecological attributes. Therefore it is also a must to understand that
aside form these are naturally part of the Earth’s ecosystem, these microbial agents have their
risks and threats brought primarily by human interferences and mishandling of them. Thus
“biological safety” or simply “Biosafety”, and “biological security” or simply “Biosecurity” are a
crucial part of Microbiology subject where the concepts, procedures, and protocols are being
studied and implemented to avoid contamination and hazards of microbes to the environment and
human society.
LEARNING OUTCOMES
1) Appreciate the basic concepts of biological safety and biological security; and,
2) Apply the principles of biosafety and biosecurity in laboratory and even daily life.
ACTIVITY/ASSESSMENT
Figure 1. The universal sign of “biohazard”, about biosafety and biosecurity issues (left). The
biosafety level (BSL) is categorized from 1 to 4, where BSL-1 are microbes which posed the
lowest health and ecological risks, while BSL-1 posed the highest risks to public health and
ecosystem. (Image from US-CDC).
It is imperative for students who studies microbiology to follow basic aseptic and decontamination
procedures not only in the laboratory but also in workplace, homes, etc. So the students must be

familiar with the basic concepts of biosafety and biosecurity. Biosafety focus on the study of
microbiological, ecological, technological and medical concepts and principles, and their
applications in practices and technologies, to prevent accidental release of pathogens and toxins
to the environment and human society. Meanwhile, Biosecurity focuses on protection and
controlling measures and protocols of individuals in involved facilities and establishments, to
prevent mishandling and potential deliberate release of microbial agents.
Table 1. Biosafety level microbes and risks (Biosafety in Microbiological and Biomedical
Laboratories, 5th Edition).
Biosafety level Risks of infection or

Example of Microbes
(BSL) contamination
Minimal potential hazard
microbes like Saccharomyces These microbes do not cause any
BSL 1 cerevisiae, non-pathogenic disease in immunocompetent and
strains of Escherichia coli, healthy individuals
Bacillus subtilis
These microbes causes infection
Pathogenic strains of Escherichia
and disease, classified as BSL 2 as
coli, Salmonella enterica
they are manageable and can be
(Salmonellosis), Hepatitis viruses
treated. Transmission via
(A,B, and C), Human
aerosol/droplets with microbes’
BSL 2 immunodeficiency virus (HIV-
inhalation/ingestion, fluid contact
AIDS), Candida albicans (fungi),
with mucous membrane (eyes,
Plasmodium sp. (Malaria),
mouth etc.), wounds (puncture,
Infectious Prions (Mad Cow
lacerations from contaminated
disease etc.)
objects etc.)
SARS-CoV-2 (COVID-19),
These microbes causes very severe
Rabies virus (Rabies),
infection and disease. Like in BSL 2,
Mycobacterium tuberculosis
but the most concern is the risks
BSL 3 (tuberculosis), Yersinia pestis
due to transmission via
(plague), Histoplasma
aerosol/droplets with microbes’
capsulatum (fungi causing
inhalation/ingestion.
Histoplasmosis)
Marburg virus (Marburg virus These microbes causes very

disease), Lassa virus (Lassa virulent and lethal infection and
BSL 4 hemorrhagic fever), Ebola virus disease. Like in BSL 3, but the most
(Ebola virus disease), Reston concern is the risks due to aerosols
ebolavirus (deadly to primates) and air-borne transmission.
Table 2. Relation of risks groups to biosafety levels, practices and equipment. (Adapted from
Mwebia, et al. 2014.)

Minimum
Biosafety Basic safety and security
Laboratory type laboratory
level (BSL) materials/equipment
practices (LP)
Standard cleaning with
Handwashing,
disinfectants (soap, bleach,
Basic teaching, Aseptic technique,
alcohol); Open bench work;
Basic – BSL 1 research (civilian or Good
Workers performing must be
military facility) microbiological
supervised by a trained and
techniques (GMT)
competent personnel
LP in BSL 1 plus
protective clothing,
Open bench plus Biosafety
biohazard sign,
Cabinet (BSC) for potential
special waste
Primary health aerosols (microbes carried by
disposal; controlled
services, fine droplets that can be
handling of
diagnostic carried by air);
Basic – BSL 2 microbial agents as
services, research decontamination tools
needed only in the
(civilian or military (autoclave); Authorized
procedures;
facility) persons with proper training
relevant
under the supervision of a
decontamination
competent personnel
procedures
enforced
BSL 2 plus special Class III BSC and/or other
Special health and
protective clothing, primary devices/tools as in
diagnostic
Containment – directional airflow, ; BSL 2; confined room with its
services, research
BSL 3 controlled access own highly efficient filtration
(civilian or military
(ID and system; Strict control of access
facility)
authorization) of authorized personnel
BSL 3 plus airlock

Class III BSC; Positive
Dangerous entry, exit showers;
Maximum Pressure Suits; double-ended
pathogen units strict
containment – autoclaved (through the wall);
(civilian or military implementation of
BSL 4 highest biosecurity measures
facility) all decontamination
are established
procedures

CONCEPT 1- Direction: Fill out the table below with appropriate “Laboratory types” and
“Practices and Procedures” describing each Biosafety levels.
Biosafety Risk Laboratory Type Practice and Procedure
level Group
1 1 Basic Teaching 5. ___________________;
1. ___________________ 6. ___________________
2 2 Good Microbial Technique

2. ___________________;
7.___________________;
3. ___________________;
8.___________________;
Research
Biosafety cabinet for potential
aerosol
3 3 4. ___________________ BS Level 2 +
9. ___________________;
Research
10. ___________________
11. ___________________
4 4 Dangerous Pathogen Units BS Level 3 +

12. ___________________;
13. ____________________;
14. ____________________;
15. ____________________;
16. ____________________;
17. ____________________;
18. _____________________
“Risk Groups 19.____________ BUT 20._______________________________________”

CONCEPT 2 - Direction: Write “BIOSAFE” if the stated procedure or scenario describes

Biosafety; write “BIOSEC” if the stated procedure or scenario describes Biosecurity or
write “BOTH” if the given procedure or scenario describe both Biosafety and Biosecurity
1) Proper Donning and Doffing of PPE
2) Access ID’s are provided to scientists
3) Biometrics implementation and records
4) Terrorists released Anthrax spores to the public via using postal mail services
5) Container of pathogen was tampered during transport
6) Installation of autoclaves for decontamination of laboratory waste
7) Sensitive laboratory data are encrypted in a cloud
8) Production, purification and selling of Clostridium botulinum toxin in the black market
9) Facilities offering services for molecular analysis always dispose the samples submitted
to them right after each analysis
10) Availability of eyewash station and anteroom in the laboratory
11) Laboratory is located far from communities
12) Wearing face masks and face shield in a public area during a pandemic
13) Used Rapid test kits and syringes are disposed properly and decontaminated
14) Total lockdown of a zone in the city due to confirmed outbreak of an infectious disease
15) Contact tracing of individuals exposed to a confirmed infected person

ACTIVITY 16 – Physical Method of Sterilization: Moist Heat Sterilization
INTRODUCTION
Biosafety and biosecurity are a crucial part of Microbiology subject where the concepts,
procedures, and protocols are being studied and implemented to avoid contamination and
hazards of microbes to the environment and human society. In application, sterilization is an
important technique in microbiology which helps to remove or destroy microorganisms from
materials or surfaces. It is obtained when microorganisms are subjected to antimicrobial agents
for sufficient time and at optimum conditions. There are two methods of sterilization, physical and
chemical method. Physical method includes heat, radiation, and filtration. Chemical
methods involve using liquid and gaseous chemicals. One type of physical method is the heat
sterilization.
LEARNING OUTCOMES
1) Understand the basic principles behind decontamination procedure using moist heat;
2) Perform the sterilization method using moist heat;
3) Apply the basic concepts of biological safety and biological security;
COURSE MATERIALS
Heat sterilization is the most effective and widely used method of sterilization, where the
bactericidal activity results through the destruction of enzymes and other essential cell
constituents. There are two major methods of heat sterilization which are dry heat and moist heat.
The principle behind both of these methods is similar. Dry heat induces the denaturation of
protein, oxidative damage and toxic effect due to the high level of electrolytes. Moreover, the dry
heat can also damage the DNA of the microorganism. As a result, the microorganism got killed.
Moist Heat kills the microorganisms by denaturation and coagulation of proteins. There are
several factors that can influence the heat killing procedure these are the temperature and
duration, characteristics of the microorganisms and the type of material.
(1) Sterilizing with Moist Heat – Moist heat provided by an autoclave or pressure cooker is an
efficient way to sterilize most materials. At a pressure of 15 psi above atmospheric pressure,
water reaches a temperature of approximately 121⁰C before it boils. Most materials are effectively
sterilized by 15 minutes exposure to this temperature. If an autoclave is not available, an ordinary
household pressure cooker will effectively sterilize media supplies in small batches.
(2) Sterilizing With Dry Heat – Dry materials such as glass and metal may be sterilized in an oven,
but this requires higher temperature (160⁰C) and longer time (at least 2 hours) than an autoclave.
This is most practical for glassware when an oven controlled by an automatic timer is available
so that sterilization and cooling can occur overnight. Use of disposable, pre-sterilized, plastic ware
makes the oven less important.
(3) Sterilizing by Flaming – The flame from a gas burner effectively sterilizes small glass or metal
objects, such as inoculating loops, but one must avoid "frying" the yeast by contact with objects

heated in a flame. Dip glass spreaders in alcohol and then use the flame to ignite the alcohol.
Place metal tools such as loops in the flame until they are red hot. Cool hot tools by touching
them to the agar or inside of a sterile glass tube. However, since flames are dangerous this
method can and should be avoided whenever possible. We have found that flaming is really only
necessary to sterilize inoculating loops and small instruments. We have not been able to
demonstrate any value in flaming the openings of tubes, bottles, or flasks in these experiments.
ACTIVITY
How to Sterilize Glass Jars
Prepare all the materials needed. The actual sterilizing time should take about 25 minutes or so.
1) Place the empty jars right-side-up in the boiling water canner or large pot.
2) Completely cover the jars with hot (but not boiling) water—the water should be one inch
above the top of the jars.
3) Bring the water to a boil over high heat.
4) Once the water reaches a full rolling boil, begin timing. Boil the jars according to the time
suggested above for the altitude. At sea level, for example, boil the jars for at least 10
minutes.
5) Turn off the heat. If you are not quite ready to begin the canning recipe, you can leave
them in the hot water for up to one hour.
6) Remove the jars using jar lifters or tongs, drain well, and set aside to dry on a clean
surface.
Warning: Sterilizing your jars will be pointless if the surrounding area is not perfectly clean. Your
clean jars can easily pick up bacteria from surrounding areas that are contaminated. If you are
setting your jars on dish towels to dry, make sure they are freshly open and clean. Whenever
possible, proceed to can immediately upon finishing the sterilization of the jars. If you wait for more
than one hour, you should re-sterilize the jars before starting the canning recipe.
Cleaning the Lids and Rings
It is important NOT to boil the metal canning lids or their rings. The extreme heat of boiling water
can harm the rubber sealing rings on the lids, which can result in a broken seal and contamination
of the jar's contents. Instead, most experts suggest that you simply place the canning lids and their
rings into water that is simmering, but not boiling for 10 minutes to thoroughly clean them. You can
use the same water that was used to boil the jars once it has cooled slightly. Always follow the
manufacturer's recommendations. Some may specifically call for different methods for handling the
lids and rings.
ASSESSMENT
In a separate short white bond paper, write all the questions and answers with student
name, course, year and section, and title of the activity. Kindly write the questions given
then answer (5 points each).

1) Why do we need to sterilize the jars or bottle before we put in some food or beverages on
it?
2) Why is it that we need to remove the lid or rings before boiling or heating? Explain what will
happen.
3) Discuss the importance of aseptic technique in food preparation.

ACTIVITY 17 – Applied Microbiology: Bacterial Fermentation – Kimchi Making
INTRODUCTION
There are numerous fermented foods which are consumed around the world. Every culture or
country has its own types of fermented food, representing the staple diet and the raw ingredients
available in that particular place. In food production, two basic fermentations were involved: the
ethanol fermentation, such as in wine making and brewing, and the lactic acid fermentation, as in
milk-based cheese making or vegetable based pickle making or sauerkraut. The most common
of microorganisms involved in food fermentation were bacteria, yeasts and molds.
LEARNING OUTCOMES
1) Create a traditional fermented vegetable product, sauerkraut

2) Explain the role of different group of microbes in the production of sauerkraut
3) Describe the microbial succession that occurs during the sauerkraut fermentation and
the relationship to pH.
4) Explain the relationship between lactic acid bacteria, pH, and acid content in a
fermentation.
COURSE MATERIAL
There are numerous fermented foods which are consumed around the world. Every culture or
country has its own types of fermented food, representing the staple diet and the raw ingredients
available in that particular place. In food production, two basic fermentations were involved: the
ethanol fermentation, such as in wine making and brewing, and the lactic acid fermentation, as in
milk-based cheese making or vegetable based pickle making or sauerkraut. The most common
of microorganisms involved in food fermentation were bacteria, yeasts and molds.
The name sauerkraut means sour cabbage. The sauerkraut fermentation is considered as “wild
fermentation” which relies on the action of naturally present bacteria. The naturally present
bacteria are utilized for the fermentation, rather than a specific inoculum, this type of process is
also called a “spontaneous fermentation.” To start with, the first step is to slice the cabbage, mix
it with about 2.5% salt, and then pack it tightly and cover it to provide anaerobic conditions. The
salt’s osmotic pressure causes water and soluble nutrients to leave the vegetable tissue. This
provides the substrate for the growth of lactic acid bacteria (LAB). At average room temperature
(70⁰F/23⁰C), the fermentation will be completed in about three to four weeks. The temperature
and pH are considered factors for growth. At lower temperatures, the fermentation will take longer
or may not occur at all. While in higher temperatures, spoilage becomes a problem. Raw
vegetables contain Gram-negative bacteria, including some non-fecal coliforms that start the
initial fermentation and begin to lower the pH, by producing acid. Then, as the pH decreases to a
point prohibitive to the coliforms, the Gram-positive, the coccus, Leuconostoc mesenteroides,
continues the kraut fermentation. As the pH drops further, this bacterial population is succeeded
by Lactobacillus brevis, Pediococcus cerevisiae, and finally Lactobacillus plantarum. The

presence of L. mesenteroides is shown by its production of dextran slime from sucrose, a

characteristic that has been known to make it a troublesome contaminant in sugar processing.
MATERIAL
1 medium head napa cabbage (about 2 pounds)
1/4 cup iodine-free sea salt or kosher salt (see Recipe Notes)
Water, preferably distilled or filtered
1 tablespoon grated garlic (5 to 6 cloves)
1 teaspoon grated peeled fresh ginger
1 teaspoon granulated sugar
2 tablepoons fish sauce or salted shrimp paste, or 3 tablespoons water
1 to 5 tablespoons Korean red pepper flakes (gochugaru) or paprika powder
8 ounces Korean radish or daikon radish, peeled and cut into matchsticks
4 medium scallions, trimmed and cut into 1-inch pieces
EQUIPMENT
Cutting board and knife
Large bowl
Gloves (optional but highly recommended)
Plate and something to weigh the kimchi down, like a jar or can of beans
Colander
Clean 1-quart jar with canning lid or plastic lid
Bowl or plate to place under jar during fermentation
PROCEDURE
Cut the cabbage. Cut the cabbage lengthwise through the stem into quarters. Cut the cores from
each piece. Cut each quarter crosswise into 2-inch-wide strips.
Salt the cabbage. Place the cabbage in a large bowl and sprinkle with the salt. Using your hands,
massage the salt into the cabbage until it starts to soften a bit. Add enough water to cover the
cabbage. Put a plate on top of the cabbage and weigh it down with something heavy, like a jar or
can of beans. Let stand for 1 to 2 hours.
Rinse and drain the cabbage. Rinse the cabbage under cold water 3 times. Set aside to drain in
a colander for 15 to 20 minutes. Meanwhile, make the spice paste.

Make the spice paste. Rinse and dry the bowl you used for salting. Add the garlic, ginger, sugar,
and fish sauce, shrimp paste, or water and stir into a smooth paste. Stir in the gochugaru, using
1 tablespoon for mild and up to 5 tablespoons for spicy (I like about 3 1/2 tablespoons); set aside
until the cabbage is ready.
Combine the vegetables and spice paste. Gently squeeze any remaining water from the cabbage
and add it to the spice paste. Add the radish and scallions.
Mix thoroughly. Using your hands, gently work the paste into the vegetables until they are
thoroughly coated. The gloves are optional here but highly recommended to protect your hands
from stings, stains, and smells!
Pack the kimchi into the jar. Pack the kimchi into a 1-quart jar. Press down on the kimchi until the
brine (the liquid that comes out) rises to cover the vegetables, leaving at least 1 inch of space at
the top. Seal the jar.
Let it ferment for 1 to 5 days. Place a bowl or plate under the jar to help catch any overflow. Let
the jar stand at cool room temperature, out of direct sunlight, for 1 to 5 days. You may see bubbles
inside the jar and brine may seep out of the lid.
Check it daily and refrigerate when ready. Check the kimchi once a day, opening the jar and
pressing down on the vegetables with a clean finger or spoon to keep them submerged under the
brine. (This also releases gases produced during fermentation.) Taste a little at this point, too!
When the kimchi tastes ripe enough for your liking, transfer the jar to the refrigerator. You may
eat it right away, but it's best after another week or two.
RECIPE NOTES
Salt: Use salt that is free of iodine and anti-caking agents, which can inhibit fermentation.
Water: Chlorinated water can inhibit fermentation, so use spring, distilled, or filtered water if you
can.
Seafood flavor and vegetarian alternatives: Seafood gives kimchi an umami flavor. Different
regions and families may use fish sauce, salted shrimp paste, oysters, and other seafood. Use
about 2 tablespoons of fish sauce, salted shrimp paste, or a combination of the two. For
vegetarian kimchi, I like using 3/4 teaspoon kelp powder mixed with 3 tablespoons water, or simply
3 tablespoons of water.
Storage: Kimchi can be refrigerated for up to a few months. Use clean utensils each time to
extract the kimchi from the jar.
ASSESSMENT
In a separate short white bond paper, write all the questions and answers with student
name, course, year and section, and title of the activity. Kindly write the questions given
then answer (5 points each).
1) How did the sauerkraut appearance change over time? Did it end up spoiled? Why or why not?
2. How did the pH and lactic acid change over time?

a. What is the relationship between pH and lactic acid

3. How did the populations of microorganisms change over time? Which groups grew when?
Which groups died off?
a. How did these changes relate to pH?
b. What does this imply about the safety of the product?

REFERENCES
Virtual Laboratories and Audio-visual Clips
 Biology Corner. (2016, June 02). Introduction to the Light Microscope. Retrieved August
14, 2020, from https://www.biologycorner.com/worksheets/microscope-virtual.html
 Department of Biological Sciences. (2013, September 13). Microscopy Pre-lab Activites.
Retrieved August 14, 2020, from https://www1.udel.edu/biology/ketcham/microscope
 NCBIOnetwork. (2020, January 27). Virtual Microscope. Retrieved August 14, 2020,
from https://www.ncbionetwork.org/educational-resources/elearning/interactive-
elearning-tools/virtual-microscope
 BioNetwork. (2014, August 14). Microscope for Beginners - Questions and Answers -
YouTube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=eZX9U15F5Q8
 Dr. Joyce Patrick. (2019, January 26). Yogurt Microscope Experiment - YouTube.
Retrieved August 14, 2020, from https://www.youtube.com/watch?v=NSFDKKg3BZY
 Mr Pollock. (2013, October 13). Comparing Microscopes - YouTube. Retrieved August
14, 2020, from https://www.youtube.com/watch?v=b4WOsYktdn4
 Michigan State University. (2010, February 17). Virtual Interactive Bacteriology
Laboratory. Retrieved August 14, 2020, from http://learn.chm.msu.edu/vibl/
 Amrita Vishwa Vidyapeetham. (2020). Aseptic Technique and the Transfer of
Microorganisms. Retrieved August 14, 2020, from https://vlab.amrita.edu/?sub=3
 Science Prof Online. (2015, July). Bacterial Growth Media & Cultures Lab Materials.
Retrieved August 14, 2020, from https://www.scienceprofonline.org/vmc/vmc-lab/vmc-
laboratory-differential-selective-bacterial-growth-media.html
 BioNetwork. (2012, December 14). Media Prep - YouTube. Retrieved August 14, 2020,
from https://www.youtube.com/watch?v=cneascR3OEc
 Auxilab. (2019, September 17). Preparation of culture media - YouTube. Retrieved
August 14, 2020, from https://www.youtube.com/watch?v=fzk_-O2SDos
 Science Prof Online. (2015, July). Aseptic Technique Used to Reduce Contamination.
Retrieved August 14, 2020, from
https://www.scienceprofonline.org/microbiology/aseptic-sterile-technique-
microbiology.html
 Amrita Vishwa Vidyapeetham. (2020). Aseptic Technique and the Transfer of
Microorganisms. Retrieved August 14, 2020, from https://vlab.amrita.edu/?sub=3
 Bio-Rad Laboratories. (2012, October 17). Aseptic Technique - YouTube. Retrieved
August 14, 2020, from https://www.youtube.com/watch?v=bRadiLXkqoU
 Bio-Rad Laboratories. (2012, October 17). Making a Streak Plate - YouTube. Retrieved
August 14, 2020, from https://www.youtube.com/watch?v=0heifCiMbfY
 Sci- Inspi. (2017, July 20). How many living things are in a drop of dirty water? -
YouTube. Retrieved August 14, 2020, from https://www.youtube.com/watch?v=6-
Rko46HDDM
 MCCC Microbiology. (2015, August 25). How to Prepare a Wet Mount - MCCC
Microbiology - YouTube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=N1780tJTk90

 Amrita Vishwa Vidyapeetham. (2020). Motility Test. Retrieved August 14, 2020, from
https://vlab.amrita.edu/?sub=3
 Rao, S. (2010, June 11). Hanging drop for bacterial motility - YouTube. Retrieved August
14, 2020, from https://www.youtube.com/watch?v=ujzSmsmg7ok
 Amrita Vishwa Vidyapeetham. (2020). Gram Stain Technique. Retrieved August 14,
2020, from https://vlab.amrita.edu/?sub=3
 Bio-Rad Laboratories. (2012, October 17). Gram Staining - YouTube. Retrieved August
14, 2020, from https://www.youtube.com/watch?v=sxa46xKfIOY
 Khanacademymedicine. (2015, January 24). Bacterial characteristics - Gram staining -
https://www.youtube.com/watch?v=FgsgpoFhleA
 Chinese University of Hong Kong. (2017). Virtual Lab: Yeast Fermentation Experiment.
Retrieved August 14, 2020, from
http://www.bch.cuhk.edu.hk/vlab2/animation/fermentation/index.html
 Scientist Cindy. (2020). Lab 10 Fermentation, Aerobic Cellular Respiration and
Associated Major Organ Systems. Retrieved August 14, 2020, from
https://www.scientistcindy.com/lab-10-fermentation-aerobic-cellular-respiration-and-
associated-major-organ-systems.html
 OpenLearn from The Open University. (2014, October 29). Yeast Experiment:
Measuring respiration in yeast - Youtube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=Cngt2HmJuSo
 Biology Practicals and Revision Biology Tutor. (2016, September 02). Rate of
Respiration in Yeast - YouTube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=h3dQ_H0ueN4
 https://brainly.in/question/2361998
 Don’t Memorise. (2017). Food Poisoning | Food Preservation | Microorganisms –
https://www.youtube.com/watch?v=18vbNJuzhx8
 Amal S. (2015). Food Spoilage Microorganisms – YouTube. Retrieved August 14, 2020,
from https://www.youtube.com/watch?v=BlKP35bct2o
 Revisify (2015). Microorganisms and Food – YouTube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=tUi4wgQVQ-I
 Agri Buzz. (2018, July 08). How to do photosynthetic microorganisms PSB (liquit
fertilizer) – YouTube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=GDCmzzigBZY
 Walter Jahn (2017, December 26). 2 Very Different Photosynthetic Bacteria – YouTube
Retrieved August 14, 2020, from https://www.youtube.com/watch?v=LeOgD266jXw
 The ROC: A Strong Foundation. (2017, July 10). Study with me: Biology: Microbiology:
Photosynthesis Equation – YouTube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=fJHZ747K7YI
 Microbiology Easy Notes. (2019, August 19). Difference among virus, virion, viroids,
virusoids and prions – YouTube. Retrieved August 14, 2020, from
https://www.youtube.com/watch?v=chTU792DWas
 khanacademymedicine. (2015, January 21). Virus structure and classification –
https://www.youtube.com/watch?v=4kIKySxUYuk

 khanacademymedicine. (2015, January 21). Subviral particles: viroids and prions –

https://www.youtube.com/watch?v=qmsWOrQtj4w
 Lab Lulz (2020, February 18). Applied Microbiology: Brewing Kombucha – YouTube.
Retrieved August 14, 2020, from https://www.youtube.com/watch?v=B2cMznri-pc
 majarikanayakan. (2008, May 15). Bioethanol from Biowaste – YouTube. Retrieved
August 14, 2020, from https://www.youtube.com/watch?v=9dagKpg1P0g
 DrKimmitt. (2013, February 20). Overview of a medical microbiology laboratory –
https://www.youtube.com/watch?v=7vLbcWtAIpE
General Literatures
 Cappuccino G .James, Sherman Natalie, Microbiology A laboratory manual, seventh

edition, Pearson Education
 Brown E. Alfred, Benson’s Microbiological Applications, ninth edition, McGraw Hill
Publication
 Pelczar J. Michael, Chan E.C.S, Krieg R. Noel, Microbiology, fifth Edition, Tata McGraw-
Hill Publishing Company Limited
 Prescott M. Lansing, Harley P. John, Klein A. Donald, Microbiology, sixth edition,
McGraw-Hill Higher Education
 Ananthanarayanan R, Text book of microbiology, sixth edition, Longman Private Limited
 Simonsublime. (2014, September 15). In a Small Drop of Pond water. Retrieved August
08, 2020, from https://exploringtheinvisible.com/2014/09/05/in-a-small-drop-of-pond-
water/
 Grainger, J. & Hurst, J. (2016). Practical microbiology for secondary schools: a resource
for Key Stages 3, 4 & post-16 and the equivalent Scottish qualifications. Reading, U.K:
Society for General Microbiology.
 Gram, L., Ravn, L., Rasch, M., Bruhn, J. B., Christensen, A. B., & Givskov, M. (2002).
Food spoilage—interactions between food spoilage bacteria. International Journal of
Food Microbiology, 78(1–2), 79–97. https://doi.org/10.1016/s0168-1605(02)00233-7
 Roller, S. (1999). Physiology of food spoilage organisms. International Journal of Food
Microbiology, 50(1–2), 151–153. https://doi.org/10.1016/s0168-1605(99)00083-5
 Rahmayani, L., Mubarak, Z., I Nasution, A., & Bunjamin, P. (2017). Comparison of
Candida sp. Colonies in Gargling-volume Culture from Subject Wearers of Heat-cured and
Selfcured Acrylic Resin Removable Partial Dentures. World Journal of Dentistry, 8(6),
471–476. https://doi.org/10.5005/jp-journals-10015-1489
 Bundi, M., Miring’u, G., Inoue, S., Muriithi, B., Ashur, S., Wandera, E., Kathiiko, C.,
Odoyo, E., Narita, C., Kwalla, A., Galata, A., Makumi, A., Huka, S., Shah, M., Karama,
M., Shimada, M., Bii, C., Kariuki, S., Horio, M., & Ichinose, Y. (2014). BSL-3 Laboratory
User Training Program at NUITM-KEMRI. Tropical Medicine and Health, 42(4), 171–
176. https://doi.org/10.2149/tmh.2014-08
 https://www.thekitchn.com/how-to-make-easy-kimchi-at-home-189390
 https://www.popsci.com/diy/article/2008-12/making-vinegar-home/
 https://www.myfermentation.com/
 https://www.biologydiscussion.com/food-microbiology/fermentation-process-of-
vinegar-microbiology/59415
 https://www.webmd.com/diet/apple-cider-vinegar-and-your-health#1
 https://www.britannica.com/topic/vinegar

Ok - BIOL 30035 - General Microbiology For BS Biology

Uploaded by

Copyright:

Available Formats

Ok - BIOL 30035 - General Microbiology For BS Biology

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Ok - BIOL 30035 - General Microbiology For BS Biology

Uploaded by

Copyright:

Available Formats

General

Bautista, Cano, Reboa, Rodriguez

Photo Compliments to:

MODULE 2: MICROBIAL TAXONOMY

MODULE 3: MICROBIAL DIVERSITY

MODULE 4: MICROBIAL CELL STRUCTURE AND FUNCTION

MODULE 5: MICROBIAL GROWTH

MODULE 6: MICROBIAL METABOLISM

MODULE 7: MICROBIAL GENETICS

MODULE 8: VIRAL GENOMES AND DIVERSITY

MODULE 9: BIOSAFETY AND SECURITY

MODULE 10: MICROBIAL CONTROL AND DESTRUCTION

MODULE 1: HISTORY AND SCOPE OF MICROBIOLOGY

General Microbiology Lecture Module

General Microbiology Lecture Module

General Microbiology Lecture Module

RUBRICS FOR SCORING ESSAY QUESTION

Total Score = _________ / 10 x 100 = _________%

General Microbiology Lecture Module

MODULE 2: MICROBIAL TAXONOMY

Dichotomous Key- means of assigning an organism to a specific taxonomic category.

General Microbiology Lecture Module

 Kingdom (contains similar divisions or phyla; most inclusive taxa)

Major Taxonomic Characteristics:

- taxa are classify based on the similarities in phenotypic (phenetic) characteristics

b. Genotypic Classification System

General Microbiology Lecture Module

b. Serotype - a group of organisms within a species that have the

c. Genotype may be given to groups below the subspecies level that

b. Biovar (biotype) - strains that are differentiated by biochemical or

c. Morphovar (morphotype) - a strain which is differentiated on the

Strain Differentiation Methods- compare phenotypes and that, though useful,

General Microbiology Lecture Module

2. Nomenclature - branch of taxonomy concerned with the assignment of names to

Naming of Bacteria based on Cell Arrangement

a. Cocci – round c. Spiral

3. Identification - the process of determining a particular (organism) belongs to a

General Microbiology Lecture Module

Comparison between Genotype from Phenotype

Methods in Bacterial Identification

1. Microscopic morphology - Gram Staining, Shapes, arrangements, motility

General Microbiology Lecture Module

1. Phylogeny of domain Archaea

2. Phylogeny of domain Bacteria

General Microbiology Lecture Module

B. Gram Negative Enteric Bacteria

General Microbiology Lecture Module

1. Class I – Clostridia; includes genera Clostridium and

3. Phylogeny of domain Eucarya

1. Describe the genotypic from phenotypic characteristics.

2. Explain how important is the components of taxonomy in microbiology?

General Microbiology Lecture Module

3. Differentiate Systematics from Taxonomy?

Each question is equivalent to 10 points per number a total of 30 points.

RUBRICS FOR SCORING ESSAY QUESTION

Total Score = _________ / 10 x 100 = _________%

As a reading material, you will be needing a book or an e-book.

General Microbiology Lecture Module

MODULE 3: MICROBIAL DIVERSITY

Total Score = _ / 10 x 100 = _%

Total Score = _ / 10 x 100 = _%