JVI Accepts, published online ahead of print on 31 December 2014

J. Virol. doi:10.1128/JVI.02420-14
Copyright © 2014, American Society for Microbiology. All Rights Reserved.

1 JVI02420-14R1 second revision

2 Discovery of a novel coronavirus, China Rattus coronavirus HKU24, from Norway

3 rats supports murine origin of Betacoronavirus 1 with implications on the ancestor

4 of Betacoronavirus lineage A

6 Susanna K. P. Lau,a,b,c,d† Patrick C. Y. Woo,a,b,c,d† Kenneth S. M. Li,d† Alan K. L. Tsang,d Rachel

7 Y. Y. Fan,d Hayes K. H. Luk,d Jian-Piao Cai,d Kwok-Hung Chan,d Bo-Jian Zheng,a,b,c,d Ming

8 Wang,e Kwok-Yung Yuena,b,c,d*

10 State Key Laboratory of Emerging Infectious Diseases,a Research Centre of Infection and

11 Immunology,b Carol Yu Centre for Infection,c Department of Microbiology,d The University of

12 Hong Kong, Hong Kong; Guangzhou Center for Disease Control and Prevention, Guangzhou;e

13 China

14

15 Running title: China Rattus coronavirus HKU24

16
†
17 These authors contributed the same to the manuscript.

18 *Corresponding author. Mailing address: State Key Laboratory of Emerging Infectious

19 Diseases, Department of Microbiology, The University of Hong Kong, University Pathology

20 Building, Queen Mary Hospital, Hong Kong. Phone: (852) 22554892. Fax: (852) 28551241. E-

21 mail: [email protected]

22

1
23 ABSTRACT

24 We discovered a novel Betacoronavirus lineage A coronavirus, China Rattus coronavirus

25 HKU24 (ChRCoV HKU24), from Norway rats in China. ChRCoV HKU24 occupied a deep

26 branch at the root of members of Betacoronavirus 1, being distinct from murine coronavirus and

27 HCoV HKU1. Its unique putative cleavage sites at nsp1/2 and S, and low sequence identities to

28 other lineage A βCoVs in conserved replicase domains, support ChRCoV HKU24 as a separate

29 species. ChRCoV HKU24 possessed genome features that resemble both Betacoronavirus 1 and

30 murine coronavirus, being closer to Betacoronavirus 1 in most predicted proteins, but closer to

31 murine coronavirus by G+C content, a single NS4 and absent TRS for E. Its N-terminal domain

32 (NTD) demonstrated higher sequence identity to BCoV than to MHV NTDs, with three of four

33 critical sugar-binding residues in BCoV and two of 14 contact residues at MHV

34 NTD/mCEACAM1a interface being conserved. Molecular clock analysis dated the tMRCA of

35 ChRCoV HKU24, Betacoronavirus 1 and RbCoV HKU14 to ~1400. Cross reactivities were

36 demonstrated between other lineage A and B βCoVs and ChRCoV HKU24 nucleocapsid but not

37 spike polypeptide. Using the spike polypeptide-based western blot, we showed that only Norway

38 rats and two Oriental house rats from Guangzhou were infected by ChRCoV HKU24. Other rats,

39 including Norway rats from Hong Kong, only possessed antibodies against N protein but not

40 spike, suggesting infection by βCoVs different from ChRCoV HKU24. ChRCoV HKU24 may

41 represent the murine origin of Betacoronavirus 1 and rodents are likely an important reservoir

42 for ancestors of lineage A βCoVs.

43

2
44 IMPORTANCE

45 While bats and birds are hosts for ancestors of most coronaviruses (CoVs), lineage A βCoVs

46 have never been found in these animals and the origin of Betacoronavirus lineage A remains

47 obscure. We discovered a novel lineage A βCoV, China Rattus coronavirus HKU24 (ChRCoV

48 HKU24), from Norway rats in China, with a high seroprevalence. The unique genome features

49 and phylogenetic analysis supported that ChRCoV HKU24 represents a novel CoV species,

50 occupying a deep branch at the root of members of Betacoronavirus 1 and distinct from murine

51 coronavirus. Nevertheless, ChRCoV HKU24 possessed genome characteristics that resemble

52 both Betacoronavirus 1 and murine coronavirus. Our data suggest that ChRCoV HKU24

53 represents the murine origin of Betacoronavirus 1, with interspecies transmission from rodents to

54 other mammals having occurred centuries ago before the emergence of HCoV OC43 in late

55 1800s. Rodents may be an important reservoir for ancestors of lineage A βCoVs.

56

3
57 INTRODUCTION

58 Coronaviruses (CoVs) infect a wide variety of animals including humans, causing respiratory,

59 enteric, hepatic and neurological diseases of varying severity. Based on genotypic and

60 serological characterization, CoVs were traditionally classified into three distinct groups (1, 2).

61 Recently, the Coronavirus Study Group of the International Committee for Taxonomy of Viruses

62 (ICTV) has revised the nomenclature and taxonomy to re-classify the three CoV groups into

63 three genera, Alphacoronavirus, Betacoronavirus and Gammacoronavirus (3). Novel CoVs,

64 which represented a novel genus, Deltacoronavirus, have also been identified (4-6). As a result

65 of the ability to use a variety of host receptors and evolve rapidly through mutation and

66 recombination, CoVs are capable to adapt to new hosts and ecological niches, causing wide

67 spectra of diseases (2, 7-12).

68 The severe acute respiratory syndrome (SARS) epidemic and identification of SARS-

69 CoV-like viruses from palm civet and horseshoe bats in China has boosted interests in the

70 discovery of novel CoVs in both humans and animals (13-20). It is now known that CoVs from

71 all four genera can be found in mammals. Historically, alphacoronaviruses (αCoVs) and

72 betacoronaviruses (βCoVs) are found in mammals while gammacoronaviruses (γCoVs) were

73 found in birds. However, recent findings suggested the presence of γCoVs also in mammals (5,

74 21, 22). Although deltacoronaviruses (δCoVs) were also mainly found in birds, potential

75 mammalian δCoVs have been reported (4, 23). In particular, a δCoVs closely related to sparrow

76 CoV HKU17, porcine CoV HKU15, has been identified in pigs, which suggested avian-to-

77 mammalian transmission (4). Based on current findings, a model for CoV evolution was

78 proposed, where bat CoVs are likely the gene source of Alphacoronavirus and Betacoronavirus,

4
 79 and avian CoVs are the gene source of Gammacoronavirus and Deltacoronavirus (4). However,

80 one notable exception to this model is Betacoronavirus lineage A.

81 The genus Betacoronavirus consists of four lineages, A to D. While human coronavirus

82 OC43 (HCoV OC43) and human coronavirus HKU1 (HCoV HKU1) belong to Betacoronavirus

83 lineage A (20, 24-27), SARS coronavirus (SARS-CoV) belongs to Betacoronavirus lineage B

84 and the recently emerged, Middle East Respiratory syndrome coronavirus (MERS-CoV) belongs

85 to Betacoronavirus lineage C. No human CoV has yet been identified from Betacoronavirus

86 lineage D. On the other hand, besides Alphacoronavirus, diverse bat CoVs have been found in

87 Betacoronavirus lineage B (e.g. SARS-related Rhinolophus bat CoVs), lineage C (e.g.

88 Tylonycteris bat CoV HKU4 and Pipistrellus bat CoV HKU5) and lineage D (e.g. Rousettus bat

89 CoV HKU9) (8, 14, 15, 28-37), supporting that bat CoVs are likely the ancestral origin of other

90 mammalian CoVs in these lineages. However, no bat CoVs belonging to Betacoronavirus

91 lineage A have yet been identified, despite the numerous surveillance studies on bat CoVs

92 conducted in various countries over the years (38). Therefore, the ancestral origin of the

93 mammalian lineage A βCoVs, such as HCoV OC43 and HCoV HKU1, remains obscure.

94 While HCoV OC43 is likely to have originated from zoonotic transmission, sharing a

95 common ancestor with bovine coronavirus (BCoV) dated back to 1890 (27, 30, 39), closely

96 related CoVs belonging to the same species, Betacoronavirus 1, have also been found in various

97 mammals including pigs, horses, dogs, waterbucks, sable antelope, deer, giraffes, alpaca and

98 dromedary camels, suggesting a common ancestor in mammals with subsequent frequent

99 interspecies transmission (40-47). Although no zoonotic origin of HCoV HKU1 has been

100 identified, the virus is most closely related to mouse hepatitis virus (MHV) and rat coronavirus

101 (RCoV) which, together, are now classified as murine coronavirus (3, 20, 42). We therefore

5
102 hypothesize that rodent CoVs are the ancestral origin of Betacoronavirus lineage A. In this study,

103 we tested samples from various rodent species in Hong Kong and southern China for the

104 presence of lineage A βCoVs. A novel CoV, China Rattus coronavirus HKU24 (ChRCoV

105 HKU24), was discovered from Norway rats in Guangzhou. Complete genome analysis showed

106 that ChRCoV HKU24 represents a novel species within Betacoronavirus lineage A, but

107 possessed features that resemble both Betacoronavirus 1 and murine coronavirus. High

108 seroprevalence was also demonstrated among Norway rats from Guangzhou using western blot

109 analysis against ChRCoV HKU24 recombinant N protein and spike polypeptide. The present

110 results suggest that ChRCoV HKU24 likely represents the murine origin of Betacoronavirus 1

111 and provides insights on the ancestor of Betacoronavirus lineage A.

112

6
113 MATERIALS AND METHODS

114 Sample collection. All rodent samples were collected from January 2010 to August 2012 using

115 procedures described previously (5, 14). Samples from southern China were collected from

116 animal markets or restaurants. Samples from Hong Kong were collected from wild and street

117 rodents by the Agriculture, Fisheries and Conservation Department, and Food and

118 Environmental Hygiene Department of the Hong Kong Special Administrative Region (HKSAR)

119 respectively. Alimentary samples were placed in viral transport medium containing Earle's

120 balanced salt solution (Invitrogen, New York, United States), 20% glucose, 4.4% NaHCO3, 5%

121 bovine albumin, 50000 ug/ml vancomycin, 50000 ug/ml amikacin, 10000 units/ml nystatin,

122 before transportation to the laboratory for RNA extraction. The study was approved by the

123 Committee on the Use of Live Animals for Teaching and Research, The University of Hong

124 Kong.

125 RNA extraction. Viral RNA was extracted from the samples using QIAamp Viral RNA

126 Mini Kit (Qiagen, Hilden, Germany). The RNA was eluted in 60 l of Buffer AVE and was used

127 as the template for RT-PCR.

128 RT-PCR of RdRp gene of CoVs using conserved primers and DNA sequencing.

129 Initial CoV screening was performed by amplifying a 440-bp fragment of the RNA-dependent

130 RNA polymerase (RdRp) gene of CoVs using conserved primers (5’-

131 GGTTGGGACTATCCTAAGTGTGA-3’ and 5’-CCATCATCAGATAGAATCATCATA-3’)

132 designed by multiple alignments of the nucleotide (nt) sequences of available RdRp genes of

133 known CoVs (14, 20). Reverse transcription was performed using SuperScript III kit (Invitrogen,

134 San Diego, CA, USA). The PCR mixture (25 l) contained cDNA, PCR buffer (10 mM Tris-HCl

135 pH 8.3, 50 mM KCl, 2 mM MgCl2 and 0.01% gelatin), 200 M of each dNTPs and 1.0 U Taq

7
136 polymerase (Applied Biosystems, Foster City, CA, USA). The mixtures were amplified in 60

137 cycles of 94C for 1 min, 50C for 1 min and 72C for 1 min and a final extension at 72C for 10

138 min in an automated thermal cycler (Applied Biosystems, Foster City, CA, USA). Standard

139 precautions were taken to avoid PCR contamination and no false-positive was observed in

140 negative controls.

141 PCR products were gel-purified using the QIAquick gel extraction kit (Qiagen, Hilden,

142 Germany). Both strands of the PCR products were sequenced twice with an ABI Prism 3700

143 DNA Analyzer (Applied Biosystems, Foster City, CA, USA), using the two PCR primers. The

144 sequences of the PCR products were compared with known sequences of the RdRp genes of

145 CoVs in the GenBank database.

146 Viral culture. The three rodent samples positive for ChRCoV HKU24 by RT-PCR were

147 subject to virus isolation in Huh-7.5 (human hepatoma), Vero E6 (African green monkey

148 kidney), HRT-18G (human rectum epithelial), BSC-1 (African green monkey renal epithelial),

149 RK13 (rabbit kidney), MDBK (bovine kidney), NIH/3T3 (mouse embryonic fibroblast), J774

150 (mouse macrophage), BHK-21 (baby hamster kidney) and RK3E (rat kidney), RMC (rat kidney

151 mesangial), RAW264.7 (mouse macrophage) and primary SD rat lung cells as described

152 previously (48, 49).

153 Real-time RT-PCR quantitation. Real-time RT-PCR was performed on rodent samples

154 positive for ChRCoV HKU24 by RT-PCR using previously described procedures (14). Reverse

155 transcription was performed using the SuperScript III kit with random primers (Invitrogen, San

156 Diego, CA, USA). cDNA was amplified in Lightcycler instrument with a FastStart DNA Master

157 SYBR Green I Mix reagent kit (Roche Diagnostics GmbH, Mannheim, Germany) using specific

158 primers 5’-ACAGGTTCTCCCTTTATAGATGAT-3’) and (5’-

8
159 TCTCCTGTATAGTAGCAGAAGCAT-3’) targeting the RdRp gene of ChRCoV HKU24 using

160 procedures described previously (14, 50). For quantitation, a reference standard was prepared

161 using pCRII-TOPO vector (Invitrogen, San Diego, CA, USA) containing the target sequence.

162 Tenfold dilutions equivalent to 3.77 to 3.77×109 copies per reaction were prepared to generate

163 concomitant calibration curves. At the end of the assay, PCR products (133-bp fragment of

164 RdRp) were subjected to melting curve analysis (65–95°C, 0.1°C/s) to confirm the specificity of

165 the assay. The detection limit of this assay was 3.77 copies per reaction.

166 Complete genome sequencing. Three complete genomes of ChRCoV HKU24 were

167 amplified and sequenced using the RNA extracted from the original alimentary samples as

168 templates. The RNA was converted to cDNA by a combined random-priming and oligo(dT)

169 priming strategy. The cDNA was amplified by degenerate primers designed by multiple

170 alignments of the genomes of other CoVs with complete genomes available, using strategies

171 described in our previous publications (14, 20, 35, 49) and the CoV database, CoVDB (51), for

172 sequence retrieval. Additional primers were designed from the results of the first and subsequent

173 rounds of sequencing. These primer sequences are available on request. The 5’ ends of the viral

174 genomes were confirmed by rapid amplification of cDNA ends using the 5'/3' RACE kit (Roche

175 Diagnostics GmbH, Mannheim, Germany). Sequences were assembled and manually edited to

176 produce final sequences of the viral genomes.

177 Genome analysis. The nt sequences of the genomes and the deduced amino acid (aa)

178 sequences of the open reading frames (ORFs) were compared to those of other CoVs with

179 available complete genomes using the CoVDB (51). Phylogenetic tree construction was

180 performed using maximum likelihood method using PhyML, with bootstrap values calculated

181 from 100 trees. Protein family analysis was performed using PFAM and InterProScan (52, 53).

9
182 Prediction of transmembrane domains was performed using TMHMM (54). The structure of

183 ChRCoV HKU24 N-terminal domain (NTD) was predicted using a web-based homology-

184 modelling server, SWISS-MODEL. BLASTp search was performed against Protein Data Bank

185 (PDB) with the default parameters to find suitable templates for homology modelling. Based on

186 the higher sequence identity, QMEAN Z-score, coverage and lower e-value, crystal structure of

187 the BCoV NTD (PDB code: 4h14) was selected as template. The predicted structure was

188 visualized using Jmol.

189 Estimation of divergence dates. Divergence time was calculated based on complete

190 RdRp and HE gene sequence data using a Bayesian Markov Chain Monte Carlo (MCMC)

191 approach as implemented in BEAST (version 1.8.0) as described previously (49, 55, 56). One

192 parametric model (Constant Size) and one nonparametric model (Bayesian Skyline) tree priors

193 were used for inference. Analyses were performed under SRD06 model, and using both a strict

194 and a relaxed molecular clock. MCMC run was 2 × 108 steps long with sampling every 1,000

195 steps. Convergence was assessed on the basis of effective sampling size after a 10% burn-in

196 using Tracer software, version 1.5 (55). The mean time of the most recent common ancestor

197 (tMRCA) and the highest posterior density regions at 95% (HPDs) were calculated, and the best-

198 fitting models were selected by a Bayes factor using marginal likelihoods implemented in Tracer

199 (56). Bayesian skyline under a relaxed-clock model with an uncorrelated exponential distribution

200 was adopted for making inferences, as Bayes factor analysis for the RdRp and HE genes

201 indicated that this model fitted the data better than other models tested. The tree was summarized

202 in a target tree by the Tree Annotator program included in the BEAST package by choosing the

203 tree with the maximum sum of posterior probabilities (maximum clade credibility) after a 10%

204 burn-in.

10
205 Cloning and purification of (His)6-tagged recombinant ChRCoV HKU24

206 nucleocapsid protein and spike polypeptide. To produce fusion plasmids for protein

207 purification, primers 5’-CTAGCTAGCATGTCTCATACGCCA-3’ and 5’-

208 CTAGCTAGCTTATATTTCTGAGCTTCCC -3’, and 5’-

209 CTAGCTAGCCAACCAATAGCAGATGTGTA-3’ and 5’-

210 CTAGCTAGCTTATCTCTTGGCTCGCCATGT-3’, were used to amplify the nucleocapsid

211 gene and a partial S1 fragment encoding amino acid residues 317 to 763 of the spike protein of

212 ChRCoV HKU24 respectively as described previously (31, 49, 57, 58). The sequences, coding

213 for a total of 443 aa and 447 aa residues respectively, were amplified and cloned into the NheI

214 site of expression vector pET-28b(+) (Merck, KGaA, Darmstadt, Germany) in frame and

215 downstream of the series of six histidine residues. The (His)6-tagged recombinant nucleocapsid

216 protein and spike polypeptide were expressed and purified using the Ni-NTA affinity

217 chromatography (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

218 Western blot analysis. To detect the presence of antibodies against ChRCoV HKU24 N

219 protein and spike polypeptide in rodent sera and to test for possible cross antigenicity between

220 ChRCoV HKU24 and other βCoVs, 600 ng of purified (His)6-tagged recombinant N protein or

221 spike polypeptide of ChRCoV HKU24 was loaded into the well of a sodium dodecyl sulfate

222 (SDS)–10% polyacrylamide gel and subsequently electroblotted onto a nitrocellulose membrane

223 (Bio-Rad, Hercules, CA, USA). The blot was cut into strips and the strips were incubated

224 separately with 1:2000, 1:4000 or 1:8000 dilutions of sera collected from rodents with serum

225 samples available, human sera from two patients with HCoV OC43 infection, sera from two

226 rabbits with RbCoV HKU14 and human sera from two patients with SARS-CoV infection

227 respectively. Antigen-antibody interaction was detected with 1:4000 horse radish peroxidase-

11
228 conjugated anti-rat IgG, anti-human IgG or anti-rabbit IgG (Zymed) and ECL fluorescence

229 system (GE Healthcare Life Sciences, Little Chalfont, UK) as described previously (14, 58).

230 Nucleotide sequence accession numbers. The nt sequences of the three genomes of

231 ChRCoV HKU24 have been lodged within the GenBank sequence database under accession no.

232 KM349742-KM349744.

233

12
234 RESULTS

235 Identification of a novel CoV from Norway rats in China. Of 91 alimentary samples from

236 rodents in China, RT-PCR for a 440-bp fragment in the RdRp gene of CoVs was positive for a

237 potentially novel CoV in three samples from Norway rats (Rattus norvegicus) from a restaurant

238 in Guangzhou (Table 1). None of the 573 alimentary samples from rodents in Hong Kong,

239 including those from Norway rats, was positive for CoVs. Sequencing results suggested that the

240 potentially novel virus was most closely related to MHV with ≤85% nt identities, and members

241 of the species Betacoronavirus 1 including HCoV OC43, BCoV, equine coronavirus (ECoV) and

242 porcine hemagglutinating encephalomyelitis virus with ≤84% nt identities. Quantitative RT-PCR

243 showed that the viral load in the positive samples ranged from 1.2×103 to 1.3×106 copies/g.

244 Attempts to stably passage ChRCoV HKU24 in cell cultures were unsuccessful, with no

245 cytopathic effect or viral replication being detected.

246 Genome organization and coding potential of ChRCoV HKU24. Complete genome

247 sequence data of three strains of ChRCoV HKU24 were obtained by assembly of the sequences

248 of RT-PCR products from the RNA directly extracted from the corresponding individual

249 specimens. The three genomes shared >99% nt sequence similarity. Their genome size was

250 31234 bases, with the G + C content (40%) closer to that of murine coronavirus than to that of

251 Betacoronavirus 1 (Table 2). The genome organization is similar to that of other lineage A

252 βCoVs, with the characteristic gene order 5’-replicase ORF1ab, haemagglutinin-esterase (HE),

253 spike (S), envelope (E), membrane (M), nucleocapsid (N)-3’ (Table 2 and Fig. 1). Moreover,

254 additional ORFs coding for non-structural proteins, NS2a, NS4, NS5 and N2, are found. A

255 putative transcription regulatory sequence (TRS) motif, 5’-CUAAAC-3’, similar to that of

256 αCoVs and the motif, 5’-UCUAAAC-3’, in other lineage A βCoVs, was identified at the 3’ end

13
257 of the leader sequence and precedes each ORF except NS4, E and N2 genes (Table 3) (26, 49,

258 59-61). However, there were base mismatches for HE and NS5, with an alternative TRS motif,

259 5’-CUGAAC-3’ and 5’-GUAAAC-3’ respectively.

260 The coding potential and characteristics of putative non-structural proteins (nsps) of

261 ORF1 of ChRCoV HKU24 were shown in Tables 3 and 4. The ORF1 polyprotein possessed

262 68.6-75.0% aa identities to the polyproteins of other lineage A βCoVs. It possessed a unique

263 putative cleavage site, G/L, between nsp1 and nsp2, in contrast to G/V found in other lineage A

264 βCoVs except HCoV HKU1 with G/I (Table 4 and Fig. 1). Other predicted cleavage sites were

265 mostly conserved between ChRCoV HKU24 and other lineage A βCoVs. However, the lengths

266 of nsp1, nsp2, nsp3, nsp13, nsp15 and nsp16 in ChRCoV HKU24 differed from those of

267 corresponding nsps in members of Betacoronavirus 1 and murine coronavirus, as a result of

268 deletions or insertions.

269 All lineage A βCoVs, except HCoV HKU1, possess NS2a gene between ORF1ab and HE.

270 Unlike RbCoV HKU14 with the NS2a broken into several small ORFs (49), ChRCoV HKU24 is

271 predicted to possess a single NS2a protein as in other lineage A βCoVs. This NS2a protein

272 displayed 43.7-62.0% aa identities to those of Betacoronavirus 1 and 45.7-47.3% aa identities to

273 those of murine coronavirus. Although the βCoV-specific NS2 protein has been shown to be

274 non-essential for in vitro viral replication (62), cyclic phosphodiesterase domains have been

275 predicted in the NS2 proteins of some CoVs and toroviruses, and a possible role in viral

276 pathogenicity has been suggested in MHV (63, 64). In contrast to MHV and RCoV, such domain

277 was not found in ChRCoV HKU24.

278 Similar to other CoV S protein, the S of ChRCoV HKU24 is predicted to be a type I

279 membrane glycoprotein, with most of the protein (residues 16-1302) exposed on the outside of

14
280 the virus and with a transmembrane domain (residues 1303-1325) at the C terminus (Fig. 2).

281 Two heptad repeats (HR), important for membrane fusion and viral entry, were located at

282 residues 1045-1079 (HR1) and 1253-1285 (HR2). The S protein of ChRCoV HKU24 possessed

283 66.7-69.6% aa identities to those of members of Betacoronavirus 1 and 62.4-64.3% identities to

284 those of members of murine coronavirus. The aa sequence identity between the ChRCoV

285 HKU24 NTD and BCoV and MHV NTDs was 61 and 56%, respectively. BCoV and HCoV

286 OC43 utilize N-acetyl-9-O acetyl neuramic acid as receptor for initiation of infection (65, 66). In

287 contrast, MHV utilizes carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1)

288 as receptor and its receptor-binding domain does not bind sugars (10, 67, 68). Recent structural

289 studies showed that, among the four critical sugar-binding residues in BoV, a Glu→Gly

290 substitution was found in one residue in MHV, which may explain the reduction in sugar-

291 binding affinity. In ChRCoV HKU24, a Glu→Ser substitution is found at this position (Fig. 2).

292 Comparison of the aa sequences between the S proteins of ChRCoV HKU24 and MHV showed

293 that ChRCoV HKU24 possessed many aa substitutions in the region corresponding to the MHV

294 NTD (Fig. 2). In particular, 12 of the 14 important contact residues at the MHV

295 NTD/mCEACAM1a interface were not conserved between ChRCoV HKU24 and MHV. Similar

296 to the MHV and BCoV NTDs, the ChRCoV HKU24 NTD is also predicted to contain a core

297 structure with β-sandwich fold as human galectins (galactose-binding lectins) using homology

298 modelling (10). Modelling showed that the β-sandwich core structure of ChRCoV HKU24

299 consists of one six-stranded β-sheet and one seven-stranded β-sheet that are stacked together

300 through hydrophobic interactions (Fig. 2). In addition, the S of ChRCoV HKU24 possessed a

301 unique predicted cleavage site, RAKR, among lineage A βCoVs.

15
302 Other predicted domains in HE, S, NS4, NS5, E, M and N proteins of ChRCoV HKU24

303 are summarized in Table 3 and Fig. 1. The NS4 of ChRCoV HKU24 shared 37-42% aa identity

304 to the NS4 proteins of murine coronavirus. In most members of Betacoronavirus 1, the NS4 is

305 split into smaller proteins. The NS5 of ChRCoV HKU24 is homologous to the NS5/NS5a of

306 members of Betacoronavirus 1 with 47.7% to 51.4% aa identities, but to the NS5 of MHV with

307 only 39.5% aa identity. Interestingly, NS5 is not found in the genome of RCoV. The absence of a

308 preceding TRS upstream of the E of ChRCoV HKU24 suggests that the translation of this E

309 protein may be cap-independent, via an internal ribosomal entry site (IRES), as demonstrated in

310 MHV (69). Similarly, the E of RCoV and HCoV HKU1 was also not preceded by TRS. This is

311 in contrast to members of Betacoronavirus 1 which possess a preceding TRS upstream of their E

312 proteins (49, 61). Downstream to N gene, the 3’-untranslated region contains a predicted bulged

313 stem-loop structure of 69 nt (nt position 30944-31012) that is conserved in βCoVs (70).

314 Overlapping with the bulged stem-loop structure by 5 nt, a conserved pseudoknot structure (nt

315 position 31008–31059) that is important for CoV replication is found. Since non-structural

316 proteins in CoVs may possess unique function for replication and virulence (71, 72), further

317 studies are warranted to understand the potential function of the nsps and NS proteins in

318 ChRCoV HKU24.

319 Phylogenetic analyses. Phylogenetic trees constructed using the aa sequences of RdRp,

320 S and N proteins of ChRCoV HKU24 and other CoVs are shown in Fig. 3, and the

321 corresponding pairwise aa identities shown in Table 2. For all three genes, the three ChRCoV

322 HKU24 strains formed a distinct cluster among lineage A βCoVs, occupying a deep branch at the

323 root of and being most closely related to members of the species Betacoronavirus 1. Comparison

324 of the aa sequences of the seven conserved replicase domains, ADRP, nsp5 (3CLpro), nsp12

16
325 (RdRp), nsp13 (Hel), nsp14 (ExoN), nsp15 (NendoU) and nsp16 (O-MT), for CoV species

326 demarcation (3) showed that ChRCoV HKU24 possessed 69.5-81.7%, 82.2-86.8%, 88.1-92.6%,

327 88.9-94.8%, 80.2-88.7%, 70.1-79.5% and 83.8-89.7% aa identities to other lineage A βCoVs

328 respectively (Table 5). Based on the present results, we propose a novel species, ChRCoV

329 HKU24, to describe this virus under Betacoronavirus lineage A and distinguish it from RCoV.

330 HE proteins are glycoproteins that mediate reversible attachment to O-acetylated sialic

331 acids by acting as both lectins and receptor-destroying enzymes which aid viral detachment from

332 sugars on infected cells (68, 73). Related HEs have been found in influenza C viruses,

333 toroviruses and lineage A βCoVs, but not other CoVs. It has been suggested that HEs of lineage

334 A βCoVs have arisen from an influenza C-like HE fusion protein, likely as a result of relatively

335 recent lateral gene transfer events (73). Phylogenetic analysis of the HE proteins of lineage A

336 βCoVs, toroviruses and influenza C viruses showed that they fell into three separate clusters (Fig.

337 3). The HE of ChRCoV HKU24 also forms a deep branch at the root of members of the species

338 Betacoronavirus 1 except ECoV and is distinct from members of murine coronavirus. Previous

339 studies have demonstrated heterogeneity of gene expression of HE proteins among different

340 MHV strains (74). Since the HE of ChRCoV HKU24 is not preceded by a perfectly matched

341 TRS, further studies are required if it is expressed and functional.

342 Estimation of divergence dates. Using the uncorrelated relaxed clock model on

343 complete RdRp gene sequences, the date of tMRCA of ChRCoV HKU24, members of

344 Betacoronavirus 1 and RbCoV HKU14 was estimated to be 1402 (HPDs, 918.05 to 1749.91)

345 (Fig. 4). The date of divergence between HCoV OC43 and BCoV was estimated to be 1897

346 (HPDs, 1826.15 to 1950.05), consistent with results from previous molecular clock studies (27).

347 Using the uncorrelated relaxed clock model on complete HE gene sequences, the date of tMRCA

17
348 of ChRCoV HKU24, members of Betacoronavirus 1 and RbCoV HKU14 was estimated to be

349 1337 (HPDs, 724.59 to 1776.78) (Fig. 4). The date of divergence between HCoV OC43 and

350 BCoV was estimated to be 1871 (HPDs, 1764.55 to 1944.37). The estimated mean substitution

351 rates of the RdRp and HE data set were 1.877×10-4 and 4.016×10-4 substitution per site per year

352 respectively, which are comparable to previous estimation in other lineage A βCoVs (26, 27, 39).

353 Serological studies. Western blot analysis using recombinant ChRCoV HKU24 N

354 protein was performed using sera from 144 rodents with serum samples available, human sera

355 from two patients with HCoV OC43 infection, sera from two rabbits with RbCoV HKU14 and

356 human sera from two patients with SARS-CoV infection. Among tested sera from 74 Norway

357 rats from Guangzhou with serum samples available, 60 (81.1%) were positive for antibody

358 against recombinant ChRCoV HKU24 N protein with prominent immunoreactive bands of about

359 50 kDa (Table 1 and Fig. 5). These 60 positive samples include three serum samples collected

360 from the three Norway rats positive for ChRCoV HKU24 in their alimentary samples. In

361 addition, 15 (48.4%) of 31 Norway rats from Hong Kong were also positive for antibody against

362 recombinant ChRCoV HKU24 N protein, although the virus was not detected in alimentary

363 samples from these rats. Moreover, seven (77.8%) of nine oriental house rats but only four

364 (0.13%) of 30 black rats were positive for antibody against recombinant ChRCoV HKU24 N

365 protein. Possible cross antigenicity between ChRCoV HKU24 and other βCoVs, including

366 lineage A and B βCoVs, was found. Human sera from two patients with HCoV OC43 infection,

367 sera from two rabbits with RbCoV HKU14 infection and human sera from two patients with

368 SARS-CoV infection were also positive for antibody against recombinant ChRCoV HKU24 N

369 protein by western blot assay (Fig. 5).

18
370 Western blot analysis using recombinant ChRCoV HKU24 spike polypeptide was

371 performed to verify the specificity of antibodies against ChRCoV HKU24 N protein using

372 positive rodent sera and human sera from two patients with HCoV OC43 infection, sera from

373 two rabbits with RbCoV HKU14 and human sera from two patients with SARS-CoV infection.

374 Among sera from the 60 Norway rats with positive antibodies against ChRCoV HKU24 N

375 protein, 21 were positive for antibodies against ChRCoV HKU24 spike polypeptide with

376 prominent immunoreactive bands of about 50 kDa (Table 1 and Fig. 5). However, serum samples

377 from the three Norway rats positive for ChRCoV HKU24 in their alimentary samples were

378 negative for anti-ChRCoV HKU24 spike polypeptide antibody. Of the seven oriental house rats

379 with positive antibodies against ChRCoV HKU24 N protein, two were positive for antibodies

380 against ChRCoV HKU24 spike polypeptide. However, serum samples from the four black rats

381 and 15 Norway rats from Hong Kong with positive antibodies against ChRCoV HKU24 N

382 protein were negative for antibodies against ChRCoV HKU24 spike polypeptide. In contrast to N

383 protein, no cross antigenicity was detected between ChRCoV HKU24 spike polypeptide and

384 positive sera against other βCoVs, including lineage A and B βCoVs. Human sera from two

385 patients with HCoV OC43 infection, sera from two rabbits with RbCoV HKU14 infection and

386 human sera from two patients with SARS-CoV infection were all negative for antibody against

387 recombinant ChRCoV HKU24 spike polypeptide by western blot assay (Fig. 5).

388

389

390

391

19
392 DISCUSSION

393 We discovered a novel lineage A βCoV, ChRCoV HKU24, from Norway rats in southern China.

394 Betacoronavirus lineage A comprises the traditional “group 2 CoVs” including members of

395 murine coronavirus and Betacoronavirus 1, HCoV HKU1 and RbCoV HKU14. ChRCoV

396 HKU24 possessed <90% aa identities to all other lineage A βCoVs in five of the seven conserved

397 replicase domains for CoV species demarcation by ICTV (3), supporting that ChRCoV HKU24

398 belongs to a separate species. The genome of ChRCoV HKU24 also possesses features distinct

399 from those of other lineage A βCoVs, including a unique putative nsp1/nsp2 cleavage site and a

400 unique putative cleavage site in S protein. Phylogenetically, its position at the root of

401 Betacoronavirus 1, being distinct from murine coronavirus and HCoV HKU1, suggested that

402 ChRCoV HKU24 may represent the murine ancestor for Betacoronavirus 1, after branching off

403 from the common ancestor of murine coronavirus and HCoV HKU1. Interestingly, the genome

404 of ChRCoV HKU24 possessed features that resemble both Betacoronavirus 1 and murine

405 coronavirus. It is more similar to Betacoronavirus 1 than murine coronavirus by the higher

406 sequence identities in most predicted proteins including NS2a, NS5 and S. On the other hand, it

407 is more similar to murine coronavirus than to Betacoronavirus 1 in terms of its G + C content,

408 the presence of a single NS4 and absence of TRS upstream of E gene. Therefore, it is most likely

409 that ChRCoV has evolved from the ancestor of murine coronavirus to infect other mammals,

410 resulting in the generation of Betacoronavirus 1 with the acquisition of TRS for E gene. The

411 tMRCA of ChRCoV HKU24, members of Betacoronavirus 1 and RbCoV HKU14 was estimated

412 to be 1402 (HPDs, 918.05 to 1749.91) and 1337 (HPDs, 724.59 to 1776.78) using complete

413 RdRp and HE gene analysis respectively, suggesting that interspecies transmission from rodents

20
414 to other mammals occurred at least several centuries ago before the emergence of HCoV OC43

415 in humans at approximately1890s .

416 Western blot assays based on recombinant ChRCoV HKU24 N protein and spike

417 polypeptide showed a high seroprevalence of ChRCoV HKU24 infection among Norway rats

418 from Guangzhou. We evaluated cross reactivities of both N protein and spike polypeptide assays

419 using sera from infections by other lineage A βCoVs, HCoV OC43 in humans and RbCoV

420 HKU14 in rabbits, as well as SARS-CoV, a lineage B βCoV. Cross-reacting antibodies against N

421 proteins were observed, which is in line with previous findings on cross-reactivity between N

422 proteins of different βCoVs (49, 57). In contrast, no cross reactivities were detected against spike

423 polypeptide, supporting the specificity of CoV spike polypeptide-based assays and their ability to

424 rectify cross reactivities (57, 58). Using the present assays, 60 of 74 Norway rats from

425 Guangzhou were positive for antibodies against ChRCoV HKU24 N protein, among which 21

426 were positive for antibodies ChRCoV HKU24 spike polypeptide, supporting past infections by

427 ChRCoV HKU24 in these 21 rats. Interestingly, the three Norway rats positive for ChRCoV

428 HKU24 in their alimentary samples were positive for antibodies against ChRCoV HKU24 N

429 protein but negative for antibodies against ChRCoV HKU24 spike polypeptide. This is likely due

430 to delay in mounting neutralizing antibodies against spike protein during acute infection in these

431 three rats, while antibodies against N protein may rise earlier as a result of the high abundance

432 and antigenicity of CoV N proteins or may be a result of cross-reactions from other βCoVs. The

433 finding is also in keeping with previous findings on SARS-related Rhinolophus bat CoV that

434 negative correlation was observed between viral load and neutralizing antibody (14). Besides

435 Norway rats, antibodies against ChRCoV HKU24 N protein and spike polypeptide were also

436 detected in two oriental house rats from Guangzhou, although antibodies against spike

21
437 polypeptide were relatively weak. This suggests possible cross-species infection of ChRCoV

438 HKU24 or cross reactivity from a very close lineage A βCoV. Four black rats and 15 Norway

439 rats in Hong Kong were also positive for antibodies against ChRCoV HKU24 N protein but not

440 spike polypeptide. This suggests possible past infection by other βCoV(s) with cross-reactivities

441 between their N proteins and that of ChRCoV HKU24. More studies on diverse rodent species

442 from China and other countries are required to determine the natural reservoir and host range of

443 ChRCoV HKU24 and other murine lineage A βCoVs.

444 The present results extend our knowledge on the evolutionary origin of CoVs. While

445 birds are important sources for γCoVs and δCoVs, bats host diverse αCoVs and βCoVs that may

446 be the ancestral origins of various mammalian CoVs including human CoVs. For human αCoVs,

447 both HCoV NL63 and HCoV 229E were likely to be originated from bat CoVs. HCoV NL63 has

448 been shown to share common ancestry with αCoVs from North American tricolored bat, with the

449 most recent common ancestor between these viruses occurring approximately 563 to 822 years

450 ago (75). Moreover, immortalized lung cell lines derived from this bat species allowed

451 replication of HCoV NL63, supporting potential zoonotic-reverse zoonotic transmission cycles

452 between bats and humans. HCoV 229E also shared a common ancestor with diverse αCoVs from

453 leaf-nosed bats in Ghana, with the most recent common ancestor dated to 1686-1800 (76).

454 However, no complete genomes are available for the putative bat ancestors of HCoV NL63 and

455 HCoV-229E. For human βCoVs, SARS-CoV and MERS-CoV are also known to share common

456 ancestors with bat CoVs. Soon after the SARS epidemic, horseshoe bats in China were found to

457 be the reservoir for SARS-CoV-like viruses, which were postulated to have jumped from bats to

458 civet and later humans (8, 14, 15). A recent study also reported the isolation of a SARS-like bat

459 CoV in Vero E6 cells, and the ability of this bat virus to use the angiotensin-converting enzyme 2

22
460 (ACE2) from humans, civets and Chinese horseshoe bats for cell entry (77). MERS-CoV belongs

461 to Betacoronavirus lineage C which was only known to consist of two bat viruses, Tylonycteris

462 bat CoV HKU4 and Pipistrellus bat CoV HKU5, before the MERS epidemic (35-37). This has

463 led to the speculation that bats may be the zoonotic origin of MERS-CoV. However, recent

464 evidence supported dromedary camels as the immediate source of human MERS-CoV (78-80).

465 Nevertheless, a conspecific virus from a South African Neoromicia capensis bat has been found

466 to share 85% nt identity to MERS-CoV genome, suggesting acquisition of MERS-CoV by

467 camels from bats in Sub-Saharan Africa from where camels on the Arabian peninsula are

468 imported (81). In contrast, there has been no evidence for bats as the origin of human lineage A

469 βCoVs such as HCoV OC43 and HCoV HKU1. HCoV OC43, being closely related to BCoV, is

470 believed to have emerged relatively recently from bovine-to-human transmission at around 1890

471 (27, 30, 39). Both viruses belonged to the promiscuous CoV species, Betacoronavirus 1, which

472 consists of many closely related mammalian CoVs, implying a low threshold for cross-

473 mammalian species transmission and a complex evolutionary history among these viruses (40-47,

474 49). However, the ancestral origin of members of Betacoronavirus 1 remains elusive. As for

475 HCoV HKU1, no recent zoonotic ancestor has yet been identified, although the virus is most

476 closely related to members of murine coronavirus (20, 42). Although rodents constitute

477 approximately 40% of all mammalian species, murine coronavirus has been the only CoV

478 species known to exist in rodents. This is in contrast to the large diversity of CoVs found in bats

479 which make up another 20% of all species of mammals (6, 33, 36). The present results suggest

480 that rodents may be an important reservoir for lineage A βCoVs and may harbor other ancestral

481 viruses of Betacoronavirus 1 and HCoV HKU1 (Fig. 6). Nevertheless, many mysteries remain

482 unresolved in the evolution of lineage A βCoVs, such as the origin of their HE proteins. For

23
483 example, both toroviruses and influenza C viruses can be found in bovine and porcine samples.

484 Further studies are required to determine if the HE of potential rodent CoV ancestors of

485 Betacoronavirus lineage A may have been acquired from cattle or pigs.

486 The potential pathogenicity and tissue tropism of ChRCoV HKU24 remains to be

487 determined. While CoVs are associated with a wide spectrum of diseases in animals, some CoVs,

488 especially those from bats, were detected in apparently healthy individuals without obvious signs

489 of disease (8, 14, 15, 31, 33). The detection of ChRCoV HKU24 in the alimentary samples of

490 Norway rats suggested possible enteric tropism. However, the three positive rats did not show

491 obvious diseases. MHV, the prototype CoV most extensively studied before the SARS epidemic,

492 can cause a variety of neurological, hepatic, gastrointestinal and respiratory diseases in mice,

493 depending on the strain tropism and route of inoculation. The virus, originally isolated from a

494 mouse with spontaneous encephalomyelitis, causes disseminated encephalomyelitis with

495 extensive destruction of myelin and focal necrosis of the liver in experimentally infected mice

496 (82-84). Strain MHV-A59 is primarily hepatotropic, while strain MHV-JHM is neurotropic.

497 Enterotropic strains can spread quickly as a result of high level of excretion in feces and cause

498 significant environmental contamination in animal houses. Respiratory-tropic or polytropic

499 strains, although uncommon, are the strains that commonly contaminate cell lines. As for RCoV,

500 it causes diseases primarily in the respiratory tract, with strain sialodacryoadenitis (SDAV) being

501 more associated with upper respiratory tract, salivary and lacrimal gland, and eye infections, and

502 strain RCoV-Parker causing pneumonia in experimentally infected rats (85, 86). Further

503 investigations are required to study the tissue tropism and pathogenicity of ChRCoV HKU24 in

504 Norway rats and other potential rodent reservoirs.

24
505 Elucidating the receptor of ChRCoV HKU24 will be important to understand the

506 mechanism of host adaptation and interspecies transmission from rodents to other mammals. The

507 higher sequence identity to Betacoronavirus 1 than to murine coronavirus in the S protein and

508 NTD of ChRCoV HKU24 is in line with other regions of the genome. Homology modelling

509 showed that the conformation of the sugar binding loop in BCoV NTD is conserved in ChRCoV

510 HKU24 NTD. Moreover, three of the four critical sugar-binding residues in BCoV but only two

511 of the 14 contact residues at the MHV NTD/mCEACAM1a interface are conserved in ChRCoV

512 HKU24. While it remains to be ascertained if ChRCoV HKU24 may utilize sugar or CEACAM1

513 as receptor, its predicted NTD appears to resemble that of BCoV more than that of MHV. Based

514 on the presence of β-sandwich fold in the NTDs of MHV and BCoV, it has been proposed that

515 CoV NTDs may have originated from a host galectin with sugar-binding functions, but evolved

516 new structural features in MHV for binding to CEACMA1 (10, 87). If rodents are indeed the

517 host origin for Betacoronavirus lineage A including Betacoronavirus 1, it would be interesting to

518 study the sugar-binding activity of NTDs of different rodent βCoVs to understand their

519 evolutionary history. Although some lineage A βCoVs, such as Betacoronavirus 1 and MHV,

520 can replicate in cell lines such as BSC-1 and HRT-18 cells, attempts to isolate ChRCoV HKU24

521 from the three positive samples were unsuccessful. Future studies to isolate the virus from more

522 rodent samples will allow characterization of its receptor usage and pathogenicity.

523

25
524 ACKNOWLEDGEMENTS

525 We thank Dr. Wing-Man Ko, Secretary for Food and Health Bureau; Ms. Vivian Lau, Mr.

526 Kwok-Hau Sin and Mr. M. C. Yuen of the FEHD and Mr. Alan C. K. Wong, Dr. Siu-Fai Leung,

527 Thomas Hon-Chung Sit and Howard Kai-Hay Wong, Chung-Tong Shek and Joseph W. K. So of

528 the AFCD for facilitation and assistance on sample collection. Views expressed in this paper are

529 those of the authors only, and may not represent the opinion of the FEHD, AFCD or the

530 Government of the HKSAR. We are grateful to the generous support of Mrs. Carol Yu, Professor

531 Richard Yu, Mr. Hui Hoy and Mr. Hui Ming in the genomic sequencing platform. This work is

532 partly supported by the Research Grant Council Grant, University Grant Council; Committee for

533 Research and Conference Grant, Strategic Research Theme Fund, and University Development

534 Fund, The University of Hong Kong; Health and Medical Research Fund of the Food and Health

535 Bureau of HKSAR; and Consultancy Service for Enhancing Laboratory Surveillance of

536 Emerging Infectious Disease for the HKSAR Department of Health.

537

26
538 REFERENCES

539 1. Brian DA, Baric RS. 2005. Coronavirus genome structure and replication. Curr. Top.

540 Microbiol. Immunol. 287:1-30.

541 2. Lai MM, Cavanagh D. 1997. The molecular biology of coronaviruses. Adv. Virus. Res.

542 48:1-100.

543 3. de Groot RJ, Baker SC, Baric R, Enjuanes L, Gorbalenya A, Holmes KV, Perlman

544 S, Poon L, Rottier PJ, Talbot PJ, Woo PC, Ziebuhr J. 2011. Coronaviridae. In: Virus

545 Taxonomy, Classification and Nomenclature of Viruses, Ninth Report of the International

546 Committee on Taxonomy of Viruses, International Union of Microbiological Societies,

547 Virology Division, King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ, eds. Elsevier

548 Academic Press, pp. 806-828.

549 4. Woo PC, Lau SK, Lam CS, Lau CC, Tsang AK, Lau JH, Bai R, Teng JL, Tsang CC,

550 Wang M, Zheng BJ, Chan KH, Yuen KY. 2012. Discovery of seven novel mammalian

551 and avian coronaviruses in Deltacoronavirus supports bat coronaviruses as the gene

552 source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene

553 source of Gammacoronavirus and Deltacoronavirus. J. Virol. 86:3995-4008

554 5. Woo PC, Lau SK, Lam CS, Lai KK, Huang Y, Lee P, Luk GS, Dyrting KC, Chan

555 KH, Yuen KY. 2009. Comparative analysis of complete genome sequences of three

556 avian coronaviruses reveals a novel group 3c coronavirus. J. Virol. 83:908-917.

557 6. Woo PC, Lau SK, Huang Y, Yuen KY. 2009. Coronavirus diversity, phylogeny and

558 interspecies jumping. Exp. Biol. Med. (Maywood) 234:1117-1127.

27
559 7. Herrewegh AA, Smeenk I, Horzinek MC, Rottier PJ, de Groot RJ. 1998. Feline

560 coronavirus type II strains 79-1683 and 79-1146 originate from a double recombination

561 between feline coronavirus type I and canine coronavirus. J. Virol. 72:4508-4514.

562 8. Lau SK, Li KS, Huang Y, Shek CT, Tse H, Wang M, Choi GK, Xu H, Lam CS, Guo

563 R, Chan KH, Zheng BJ, Woo PC, Yuen KY. 2010. Ecoepidemiology and complete

564 genome comparison of different strains of severe acute respiratory syndrome-related

565 Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting

566 infection that allows recombination events. J. Virol. 84:2808-2819.

567 9. Woo PC, Lau SK, Yip CC, Huang Y, Tsoi HW, Chan KH, Yuen KY. 2006.

568 Comparative analysis of 22 coronavirus HKU1 genomes reveals a novel genotype and

569 evidence of natural recombination in coronavirus HKU1. J. Virol. 80:7136-7145.

570 10. Peng G, Sun D, Rajashankar KR, Qian Z, Holmes KV, Li F. 2011. Crystal structure

571 of mouse coronavirus receptor-binding domain complexed with its murine receptor. Proc.

572 Natl. Acad. Sci. U. S. A. 108:10696-10701.

573 11. Yang Y, Du L, Liu C, Wang L, Ma C, Tang J, Baric RS, Jiang S, Li F. 2014.

574 Receptor usage and cell entry of bat coronavirus HKU4 provide insight into bat-to-human

575 transmission of MERS coronavirus. Proc. Natl. Acad. Sci. U. S. A. pii:201405889. [Epub

576 ahead of print]

577 12. Yeh SH, Wang HY, Tsai CY, Kao CL, Yang JY, Liu HW, Su IJ, Tsai SF, Chen DS,

578 Chen PJ; National Taiwan University SARS Research Team. 2004. Characterization

579 of severe acute respiratory syndrome coronavirus genomes in Taiwan: molecular

580 epidemiology and genome evolution. Proc. Natl. Acad. Sci. U. S. A. 101:2542-2547.

28
581 13. Guan Y, Zheng BJ, Y. Q. He, X. L. Liu, Z. X. Zhuang, C. L. Cheung, S. W. Luo, P.

582 H. Li, L. J. Zhang, Y. J. Guan, K. M. Butt, K. L. Wong, K. W. Chan, W. Lim, K. F.

583 Shortridge, K. Y. Yuen, J. S. Peiris, and L. L. Poon. 2003. Isolation and

584 characterization of viruses related to the SARS coronavirus from animals in southern

585 China. Science 302:276-278.

586 14. Lau SK, Woo PC, Li KS, Huang Y, Tsoi HW, Wong BH, Wong SS, Leung SY, Chan

587 KH, Yuen KY. 2005. Severe acute respiratory syndrome coronavirus-like virus in

588 Chinese horseshoe bats. Proc. Natl. Acad. Sci. U. S. A. 102:14040-14045.

589 15. Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, Wang H, Crameri G, Hu Z,

590 Zhang H, Zhang J, McEachern J, Field H, Daszak P, Eaton BT, Zhang S, Wang LF.

591 2005. Bats are natural reservoirs of SARS-like coronaviruses. Science 310:676-679.

592 16. Peiris JS, Lai ST, Poon LL, Guan Y, Yam LY, Lim W, Nicholls J, Yee WK, Yan

593 WW, Cheung MT, Cheng VC, Chan KH, Tsang DN, Yung RW, Ng TK, Yuen KY.

594 2003. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet

595 361:1319-1325.

596 17. Rota PA, Oberste MS, Monroe SS, Nix WA, Campagnoli R, Icenogle JP, Penaranda

597 S, Bankamp B, Maher K, Chen MH, Tong S, Tamin A, Lowe L, Frace M, DeRisi JL,

598 Chen Q, Wang D, Erdman DD, Peret TC, Burns C, Ksiazek TG, Rollin PE, Sanchez

599 A, Liffick S, Holloway B, Limor J, McCaustland K, Olsen-Rasmussen M, Fouchier

600 R, Gunther S, Osterhaus AD, Drosten C, Pallansch MA, Anderson LJ, Bellini WJ.

601 2003. Characterization of a novel coronavirus associated with severe acute respiratory

602 syndrome. Science 300:1394-1399.

29
603 18. Fouchier RA, Hartwig NG, Bestebroer TM, Niemeyer B, de Jong JC, Simon JH,

604 Osterhaus AD. 2004. A previously undescribed coronavirus associated with respiratory

605 disease in humans. Proc. Natl. Acad. Sci. U S A. 101:6212-6216.

606 19. van der Hoek L, Pyrc K, Jebbink MF, Vermeulen-Oost W, Berkhout RJ, Wolthers

607 KC, Wertheim-van Dillen PM, Kaandorp J, Spaargaren J, Berkhout B. 2004.

608 Identification of a new human coronavirus. Nat. Med. 10:368-373.

609 20. Woo PC, Lau SK, Chu CM, Chan KH, Tsoi HW, Huang Y, Wong BH, Poon RW,

610 Cai JJ, Luk WK, Poon LL, Wong SS, Guan Y, Peiris JS, Yuen KY. 2005.

611 Characterization and complete genome sequence of a novel coronavirus, coronavirus

612 HKU1, from patients with pneumonia. J. Virol. 79:884-895.

613 21. Jonassen CM, Kofstad T, Larsen IL, Lovland A, Handeland K, Follestad A,

614 Lillehaug A. 2005. Molecular identification and characterization of novel coronaviruses

615 infecting graylag geese (Anser anser), feral pigeons (Columbia livia) and mallards (Anas

616 platyrhynchos). J. Gen. Virol. 86:1597-1607.

617 22. Mihindukulasuriya KA, Wu G, St Leger J, Nordhausen RW, Wang D. 2008.

618 Identification of a novel coronavirus from a beluga whale by using a panviral microarray.

619 J. Virol. 82:5084-5088.

620 23. Dong BQ, Liu W, Fan XH, Vijaykrishna D, Tang XC, Gao F, Li LF, Li GJ, Zhang

621 JX, Yang LQ, Poon LL, Zhang SY, Peiris JS, Smith GJ, Chen H, Guan Y. 2007.

622 Detection of a novel and highly divergent coronavirus from Asian leopard cats and

623 Chinese ferret badgers in Southern China. J. Virol. 81:6920-6926.

30
624 24. Lau SK, Woo PC, Yip CC, Tse H, Tsoi HW, Cheng VC, Lee P, Tang BS, Cheung

625 CH, Lee RA, So LY, Lau YL, Chan KH, Yuen KY. 2006. Coronavirus HKU1 and

626 other coronavirus infections in Hong Kong. J. Clin. Microbiol. 44:2063-2071.

627 25. Woo PC, Lau SK, Tsoi HW, Huang Y, Poon RW, Chu CM, Lee RA, Luk WK,

628 Wong GK, Wong BH, Cheng VC, Tang BS, Wu AK, Yung RW, Chen H, Guan Y,

629 Chan KH, Yuen KY. 2005. Clinical and molecular epidemiological features of

630 coronavirus HKU1-associated community-acquired pneumonia. J. Infect. Dis. 192:1898-

631 1907.

632 26. Lau SK, Lee P, Tsang AKL, Yip CCY, Tse H, Lee RA, So LY, Lau YL, Chan KH,

633 Woo PCY, Yuen KY. 2011. Molecular epidemiology of human coronavirus OC43

634 reveals evolution of different genotypes over time and recent emergence of a novel

635 genotype due to natural recombination. J. Virol. 85:11325-11337.

636 27. Vijgen L, Keyaerts E, Moës E, Thoelen I, Wollants E, Lemey P, Vandamme AM,

637 Van Ranst M. 2005. Complete genomic sequence of human coronavirus OC43:

638 molecular clock analysis suggests a relatively recent zoonotic coronavirus transmission

639 event. J. Virol. 79:1595-1604.

640 28. Dominguez SR, O'Shea TJ, Oko LM, Holmes KV. 2007. Detection of group 1

641 coronaviruses in bats in North America. Emerg. Infect. Dis. 13:1295-1300.

642 29. Gloza-Rausch F, Ipsen A, Seebens A, Göttsche M, Panning M, Felix Drexler J,

643 Petersen N, Annan A, Grywna K, Müller M, Pfefferle S, Drosten C. 2008. Detection

644 and prevalence patterns of group I coronaviruses in bats, northern Germany. Emerg.

645 Infect. Dis. 14:626-631.

31
646 30. Lau SK, Woo PC, Li KS, Huang Y, Wang M, Lam CS, Xu H, Guo R, Chan KH,

647 Zheng BJ, Yuen KY. 2007. Complete genome sequence of bat coronavirus HKU2 from

648 Chinese horseshoe bats revealed a much smaller spike gene with a different evolutionary

649 lineage from the rest of the genome. Virology 367:428-439.

650 31. Lau SK, Poon RWS, Wong BHL, Wang M, Huang Y, Xu H, Guo R, Li KSM, Gao K,

651 Chan KH, Zheng BJ, Woo PCY, Yuen KY. 2010. Coexistence of different genotypes

652 in the same bat and serological characterization of Rousettus bat coronavirus HKU9

653 belonging to a novel Betacoronavirus subgroup. J. Virol. 84:11385-11394.

654 32. Poon LL, Chu DK., Chan KH, Wong OK, Ellis TM, Leung YH, Lau SK, Woo PC,

655 Suen KY, Yuen KY, Guan Y, Peiris JS. 2005. Identification of a novel coronavirus in

656 bats. J. Virol. 79:2001-2009.

657 33. Tang XC, Zhang JX, Zhang SY, Wang P, Fan XH, Li LF, Li G, Dong BQ, Liu W,

658 Cheung CL, Xu KM, Song WJ, Vijaykrishna D, Poon LL, Peiris JS, Smith GJ,

659 Chen H, Guan Y. 2006. Prevalence and genetic diversity of coronaviruses in bats from

660 China. J. Virol. 80:7481-7490.

661 34. Tong S, Conrardy C, Ruone S, Kuzmin IV, Guo X, Tao Y, Niezgoda M, Haynes L,

662 Agwanda B, Breiman RF, Anderson LJ, Rupprecht CE. 2009. Detection of novel

663 SARS-like and other coronaviruses in bats from Kenya. Emerg. Infect. Dis. 15:482-485.

664 35. Woo PC, Wang M, Lau SK, Xu H, Poon RW, Guo R, Wong BH, Gao K, Tsoi HW,

665 Huang Y, Li KS, Lam CS, Chan KH, Zheng BJ, Yuen KY. 2007. Comparative

666 analysis of twelve genomes of three novel group 2c and group 2d coronaviruses reveals

667 unique group and subgroup features. J. Virol. 81:1574-1585.

32
668 36. Woo PC, Lau SK, Li KS, Poon RW, Wong BH, Tsoi HW, Yip BC, Huang Y, Chan

669 KH, Yuen KY. 2006. Molecular diversity of coronaviruses in bats. Virology 351:180-

670 187.

671 37. Lau SK, Li KS, Tsang AK, Lam CS, Ahmed S, Chen H, Chan KH, Woo PC, Yuen

672 KY. 2013. Genetic characterization of Betacoronavirus lineage C viruses in bats reveals

673 marked sequence divergence in the spike protein of Pipistrellus bat coronavirus HKU5 in

674 Japanese pipistrelle: implications for the origin of the novel Middle East respiratory

675 syndrome coronavirus. J. Virol. 87:8638-8650.

676 38. Drexler JF, Corman VM, Drosten C. 2014. Ecology, evolution and classification of bat

677 coronaviruses in the aftermath of SARS. Antiviral Res. 101:45-56.

678 39. Vijgen L, Keyaerts E, Lemey P, Maes P, Van Reeth K, Nauwynck H, Pensaert M,

679 Van Ranst M. 2006. Evolutionary history of the closely related group 2 coronaviruses:

680 porcine hemagglutinating encephalomyelitis virus, bovine coronavirus, and human

681 coronavirus OC43. J. Virol. 80:7270-7274.

682 40. Alekseev KP, Vlasova AN, Jung K, Hasoksuz M, Zhang X, Halpin R, Wang S,

683 Ghedin E, Spiro D, Saif LJ. 2008. Bovine-like coronaviruses isolated from four species

684 of captive wild ruminants are homologous to bovine coronaviruses, based on complete

685 genomic sequences. J. Virol. 82:12422-12431.

686 41. Hasoksuz M, Alekseev K, Vlasova A, Zhang X, Spiro D, Halpin R, Wang S, Ghedin

687 E, Saif LJ. 2007. Biologic, antigenic, and full-length genomic characterization of a

688 bovine-like coronavirus isolated from a giraffe. J. Virol. 81:4981-4990.

33
689 42. Woo PC, Lau SK, Wernery U, Wong EY, Tsang AK, Johnson B, Yip CC, Lau CC,

690 Sivakumar S, Cai JP, Fan RY, Chan KH, Mareena R, Yuen KY. 2014. Novel

691 betacoronavirus in dromedaries of the Middle East, 2013. Emerg. Infect. Dis. 20:560-572.

692 43. Guy JS, Breslin JJ, Breuhaus B, Vivrette S, Smith LG. 2000. Characterization of a

693 coronavirus isolated from a diarrheic foal. J. Clin. Microbiol. 38:4523-4526

694 44. Erles K, Toomey C, Brooks HW, Brownlie J. 2003. Detection of a group 2 coronavirus

695 in dogs with canine infectious respiratory disease. Virology 310:216-223.

696 45. Tsunemitsu H, el-Kanawati ZR, Smith DR, Reed HH, Saif LJ. 1995. Isolation of

697 coronaviruses antigenically indistinguishable from bovine coronavirus from wild

698 ruminants with diarrhea. J. Clin. Microbiol. 33:3264-3269

699 46. Mengeling WL, Boothe AD, Ritchie AE. 1972. Characteristics of a coronavirus (strain

700 67N) of pigs. Am. J. Vet. Res. 33:297-308.

701 47. Jin L, Cebra CK, Baker RJ, Mattson DE, Cohen SA, Alvarado DE, Rohrmann GF.

702 2007. Analysis of the genome sequence of an alpaca coronavirus. Virology 365:198-203.

703 48. Li IW, Chan KH, To KW, Wong SS, Ho PL, Lau SK, Woo PC, Tsoi HW, Chan JF,

704 Cheng VC, Zheng BJ, Chen H, Yuen KY. 2009. Differential susceptibility of different

705 cell lines to swine-origin influenza A H1N1, seasonal human influenza A H1N1, and

706 avian influenza A H5N1 viruses. J. Clin. Virol. 46:325-330.

707 49. Lau SK, Woo PC, Yip CC, Fan RY, Huang Y, Wang M, Guo R, Lam CS, Tsang AK,

708 Lai KK, Chan KH, Che XY, Zheng BJ, Yuen KY. 2012. Isolation and characterization

709 of a novel Betacoronavirus subgroup A coronavirus, rabbit coronavirus HKU14, from

710 domestic rabbits. J. Virol. 86:5481-5496.

34
711 50. Lau SK, Chan KH, Yip CCY, Ng TK, Tsang OTY, Woo PCY, Yuen KY. 2009.

712 Confirmation of the first Hong Kong case of human infection by novel swine-origin

713 influenza A (H1N1) virus diagnosed using ultrarapid, real-time reverse transcriptase PCR.

714 J. Clin. Microbiol. 47:2344-2346.

715 51. Huang Y, Lau SK, Woo PC, Yuen KY. 2008. CoVDB: a comprehensive database for

716 comparative analysis of coronavirus genes and genomes. Nucleic Acids Res. 36:D504-

717 511.

718 52. Apweiler R, Attwood TK, Bairoch A, Bateman A, Birney E, Biswas M, Bucher P,

719 Cerutti L, Corpet F, Croning MD, Durbin R, Falquet L, Fleischmann W, Gouzy J,

720 Hermjakob H, Hulo N, Jonassen I, Kahn D, Kanapin A, Karavidopoulou Y, Lopez

721 R, Marx B, Mulder NJ, Oinn TM, Pagni M, Servant F, Sigrist CJ, Zdobnov EM.

722 2001. The InterPro database, an integrated documentation resource for protein families,

723 domains and functional sites. Nucleic Acids Res. 29:37-40.

724 53. Bateman A, Birney E, Cerruti L, Durbin R, Etwiller L, Eddy SR, Griffiths-Jones S,

725 Howe KL, Marshall M, Sonnhammer EL. 2002. The Pfam protein families database.

726 Nucleic Acids Res. 30:276-280.

727 54. Sonnhammer EL, von Heijne G, Krogh A. 1998. A hidden Markov model for

728 predicting transmembrane helices in protein sequences. Proc. Int. Conf. Intell. Syst. Mol.

729 Biol. 6:175-182.

730 55. Drummond AJ, Rambaut A. 2007. BEAST: Bayesian evolutionary analysis by

731 sampling trees. BMC Evol. Biol. 7:214.

732 56. Suchard MA, Weiss RE, Sinsheimer JS. 2001. Bayesian selection of continuous-time

733 Markov chain evolutionary models. Mol. Biol. Evol. 18:1001-1013.

35
734 57. Woo PC, Lau SK, Wong BHL, Chan KH, Hui WT, Kwan GSW, Peiris JSM, Couch

735 RB, Yuen KY. 2004. False positive results in a recombinant Severe Acute Respiratory

736 Syndrome-Associated Coronavirus (SARS-CoV) nucleocapsid enzyme-linked

737 immunosorbent assay due to HCoV-OC43 and HCoV-229E rectified by western blotting

738 with recombinant SARS-CoV spike polyprotein. J. Clin. Microbiol. 42:5885-5888.

739 58. Woo PC, Lau SK, Tsoi HW, Chan KH, Wong BH, Che XY, Tam VK, Tam SC,

740 Cheng VC, Hung IF, Wong SS, Zheng BJ, Guan Y, Yuen KY. 2004. Relative rates of

741 non-pneumonic SARS coronavirus infection and SARS coronavirus pneumonia. Lancet

742 363:841-845.

743 59. Jeong YS, Repass JF, Kim YN, Hwang SM, Makino S. 1996. Coronavirus

744 transcription mediated by sequences flanking the transcription consensus sequence.

745 Virology 217:311-322.

746 60. Wu HY, Ozdarendeli A, Brian DA. 2006. Bovine coronavirus 5'-proximal genomic

747 acceptor hotspot for discontinuous transcription is 65 nucleotides wide. J. Virol. 80:2183-

748 2193.

749 61. Zhang J, Guy JS, Snijder EJ, Denniston DA, Timoney PJ, Balasuriya UB. 2007.

750 Genomic characterization of equine coronavirus. Virology 369:92-104.

751 62. Schwarz B, Routledge E, Siddell SG. 1990. Murine coronavirus nonstructural protein

752 ns2 is not essential for virus replication in transformed cells. J. Virol. 64:4784-4791.

753 63. de Haan CA, Masters PS, Shen X, Weiss S, Rottier PJ. 2002. The group-specific

754 murine coronavirus genes are not essential, but their deletion, by reverse genetics, is

755 attenuating in the natural host. Virology 296:177-189.

36
756 64. Snijder EJ, Bredenbeek PJ, Dobbe JC, Thiel V, Ziebuhr J, Poon LL, Guan Y,

757 Rozanov M, Spaan WJ, Gorbalenya AE. 2003. Unique and conserved features of

758 genome and proteome of SARS-coronavirus, an early split-off from the coronavirus

759 group 2 lineage. J. Mol. Biol. 331:991-1004.

760 65. Schultze B, Herrler G. 1992. Bovine coronavirus uses N-acetyl-9-O-acetylneuraminic

761 acid as a receptor determinant to initiate the infection of cultured cells. J. Gen. Virol.

762 73:901-906.

763 66. Vlasak R, Luytjes W, Spaan W, Palese P. 1988. Human and bovine coronaviruses

764 recognize sialic acid-containing receptors similar to those of influenza C viruses. Proc.

765 Natl. Acad. Sci. U. S. A. 85:4526-4529.

766 67. Williams RK, Jiang GS, Holmes KV. 1991. Receptor for mouse hepatitis virus is a

767 member of the carcinoembryonic antigen family of glycoproteins. Proc. Natl. Acad. Sci.

768 U. S. A. 88:5533-5536.

769 68. Langereis MA, van Vliet AL, Boot W, de Groot RJ. 2010. Attachment of mouse

770 hepatitis virus to O-acetylated sialic acid is mediated by hemagglutinin-esterase and not

771 by the spike protein. J. Virol. 84:8970-8974.

772 69. Thiel V, Siddell SG. 1994. Internal ribosome entry in the coding region of murine

773 hepatitis virus mRNA 5. J. Gen. Virol. 75:3041-3046.

774 70. Goebel SJ, Hsue B, Dombrowski TF, Masters PS. 2004. Characterization of the RNA

775 components of a putative molecular switch in the 3' untranslated region of the murine

776 coronavirus genome. J. Virol. 78:669-682.

777 71. Netland J, Ferraro D, Pewe L, Olivares H, Gallagher T, Perlman S. 2007.

778 Enhancement of murine coronavirus replication by severe acute respiratory syndrome

37
779 coronavirus protein 6 requires the N-terminal hydrophobic region but not C-terminal

780 sorting motifs. J. Virol. 81:11520-11525.

781 72. Brockway SM, Lu XT, Peters TR, Dermody TS, Denison MR. 2004. Intracellular

782 localization and protein interactions of the gene 1 protein p28 during mouse hepatitis

783 virus replication. J. Virol. 78:11551-11562.

784 73. Zeng Q, Langereis MA, van Vliet AL, Huizinga EG, de Groot RJ. 2008. Structure of

785 coronavirus hemagglutinin-esterase offers insight into corona and influenza virus

786 evolution. Proc. Natl. Acad. Sci. U. S. A. 105:9065-9069.

787 74. Yokomori K, Banner LR, Lai MM. 1991. Heterogeneity of gene expression of the

788 hemagglutinin-esterase (HE) protein of murine coronaviruses. Virology 183:647-657.

789 75. Huynh J, Li S, Yount B, Smith A, Sturges L, Olsen JC, Nagel J, Johnson JB,

790 Agnihothram S, Gates JE, Frieman MB, Baric RS, Donaldson EF. 2012. Evidence

791 supporting a zoonotic origin of human coronavirus strain NL63. J. Virol. 86:12816-

792 12825.

793 76. Pfefferle S, Oppong S, Drexler JF, Gloza-Rausch F, Ipsen A, Seebens A, Müller MA,

794 Annan A, Vallo P, Adu-Sarkodie Y, Kruppa TF, Drosten C. 2009. Distant relatives of

795 severe acute respiratory syndrome coronavirus and close relatives of human coronavirus

796 229E in bats, Ghana. Emerg. Infect. Dis. 15:1377-1384.

797 77. Ge XY, Li JL, Yang XL, Chmura AA, Zhu G, Epstein JH, Mazet JK, Hu B, Zhang

798 W, Peng C, Zhang YJ, Luo CM, Tan B, Wang N, Zhu Y, Crameri G, Zhang SY,

799 Wang LF, Daszak P, Shi ZL. 2013. Isolation and characterization of a bat SARS-like

800 coronavirus that uses the ACE2 receptor. Nature 503:535-538.

38
801 78. Haagmans BL, Al Dhahiry SH, Reusken CB, Raj VS, Galiano M, Myers R, Godeke

802 GJ, Jonges M, Farag E, Diab A, Ghobashy H, Alhajri F, Al-Thani M, Al-Marri SA,

803 Al Romaihi HE, Al Khal A, Bermingham A, Osterhaus AD, AlHajri MM,

804 Koopmans MP. 2014. Middle East respiratory syndrome coronavirus in dromedary

805 camels: an outbreak investigation. Lancet Infect. Dis. 14:140-145.

806 79. Reusken CB, Haagmans BL, Müller MA, Gutierrez C, Godeke GJ, Meyer B, Muth

807 D, Raj VS, Smits-De Vries L, Corman VM, Drexler JF, Smits SL, El Tahir YE, De

808 Sousa R, van Beek J, Nowotny N, van Maanen K, Hidalgo-Hermoso E, Bosch BJ,

809 Rottier P, Osterhaus A, Gortázar-Schmidt C, Drosten C, Koopmans MP. 2013.

810 Middle East respiratory syndrome coronavirus neutralising serum antibodies in

811 dromedary camels: a comparative serological study. Lancet Infect Dis. 13:859-866.

812 80. Azhar EI, El-Kafrawy SA, Farraj SA, Hassan AM, Al-Saeed MS, Hashem AM,

813 Madani TA. 2014. Evidence for camel-to-human transmission of MERS coronavirus. N.

814 Engl. J. Med. 370:2499-2505.

815 81. Corman VM, Ithete NL, Richards LR, Schoeman MC, Preiser W, Drosten C,

816 Drexler JF. 2014. Rooting the phylogenetic tree of MERS-Coronavirus by

817 characterization of a conspecific virus from an African Bat. J. Virol. pii:JVI.01498-14.

818 [Epub ahead of print]

819 82. Bailey OT, Pappenheimer AM, Cheerer FS, Daniels JB. 1949. A murine virus (JHM)

820 causing disseminated encephalomyelitis with extensive destruction of myelin: II.

821 Pathology. J. Exp. Med. 90:195-212.

39
822 83. Cheever FS, Daniels JB, Pappenheimer AM, Bailey OT. 1949. A murine virus (JHM)

823 causing disseminated encephalomyelitis with extensive destruction of myelin. J. Exp.

824 Med. 90:181-194.

825 84. Sun N, Perlman S. 1995. Spread of a neurotropic coronavirus to spinal cord white matter

826 via neurons and astrocytes. J. Virol. 69:633-641.

827 85. Miura TA, Wang J. 2007. Rat coronaviruses infect rat alveolar type I epithelial cells and

828 induce expression of CXC chemokines. Virology 369:288-298.

829 86. Bhatt PN, Percy DH, Jonas AM. 1972. Characterization of the virus of

830 sialodacryoadenitis of rats: a member of the coronavirus group. J. Infect. Dis. 126:123-

831 130.

832 87. Peng G, Xu L, Lin YL, Chen L, Pasquarella JR, Holmes KV, Li F. 2012. Crystal

833 structure of bovine coronavirus spike protein lectin domain. J. Biol. Chem. 287:41931-

834 41938.

835

40
836 LEGENDS TO FIGURES

837 FIG 1 Comparison of genome organizations of ChRCoV HKU24, MHV, HCoV OC43 and

838 HCoV HKU1. Papain-like proteases (PL1pro and PL2pro) are represented by orange boxes. The

839 residues at the cleavage site are indicated above or below the boundary of each nonstructural

840 protein. Unique cleavage site in ChRCoV HKU24 is in bold.

841 FIG 2 Predicted model of ChRCoV HKU24 spike protein and NTD using Swiss-Model tool. (A)

842 Predicted domain structure of ChRCoV HKU24 spike protein. NTD, N-terminal domain; RBD,

843 receptor-binding domain; HR, heptad-repeat; TM, transmembrane anchor. The signal peptide

844 corresponds to residues 1–15 and is cleaved during molecular maturation. (B) Sequence

845 alignment of ChRCoV HKU24 NTD with BCoV, HCoV-OC43 and MHV NTD, performed

846 using PROMALS3D. The three strains of ChRCoV HKU24 characterized in this study are

847 bolded. Beta strands are shown as yellow arrows, and the alpha helix is shown as a coiled ribbon.

848 Loop 10-11 is boxed. The 14 contact residues at the MHV NTD/mCEACAM1a interface are

849 highlighted in blue, the four BCoV critical sugar-binding residues are highlighted in brown, and

850 BCoV non-critical sugar-binding residues are highlighted in yellow. Location of residue

851 substitution that might decrease the sugar-binding affinity of BCoV NTD is marked by inverted

852 triangle. Asterisks indicate positions that have fully conserved residues. Colons indicate

853 positions that have strongly conserved residues. Periods indicate positions that have weakly

854 conserved residues. (C) Predicted structure of the ChRCoV HKU24 NTD constructed through

855 homology modelling from BCoV NTD (4h14) and close-up of the pocket above the β-sandwich

856 core. The Global Model Quality Estimation score of 0.83 and QMEAN4 Z-score of -1.82

857 indicated reliable overall model quality.

41
858 FIG 3 Phylogenetic analyses of RdRp, S, N and HE proteins of ChRCoV HKU24. The trees

859 were constructed by the maximum likelihood method using WAG+I+G substitution model and

860 bootstrap values calculated from 100 trees. Bootstrap values below 70% are not shown. Nine

861 hundred and twenty-eight, 1358, 443 and 425 aa positions in RdRp, S, N and HE, respectively,

862 were included in the analyses. The scale bar represents 0.3 substitutions per site. The three

863 strains of ChRCoV HKU24 characterized in this study are bolded.

864 FIG 4 Estimation of tMRCA of ChRCoV HKU24 strains, BCoV/HCoV-OC43, and ChRCoV

865 HKU24/members of Betacoronavirus 1/RbCoV HKU14 based on the complete RdRp and HE

866 genes. The mean estimated dates (above the branch) and Bayesian posterior probabilities (below

867 the branch) are labeled and are represented by gray squares. The taxa are labeled with their

868 sampling dates.

869 FIG 5 Western blot analysis for antibodies against purified (His)6–tagged recombinant ChRCoV

870 HKU24 N protein (~50kDa) (A) and spike polypeptide (~50kDa) (B) in rodent serum samples

871 and serum samples from other animals or humans infected by different βCoVs including HCoV

872 OC43 (Betacoronavirus lineage A), RbCoV HKU14 (Betacoronavirus lineage A) and SARS-

873 CoV (Betacoronavirus lineage B). Lanes: 1, negative control; 2, oriental house rat serum sample

874 negative for antibody against ChRCoV HKU24 N protein and spike polypeptide; 3, Norway rat

875 serum sample negative for antibody against ChRCoV HKU24 N protein and spike polypeptide; 4,

876 oriental house rat serum sample positive for antibody against ChRCoV HKU24 N protein and

877 spike polypeptide; 5, Norway rat serum sample positive for antibody against ChRCoV HKU24 N

878 protein and spike polypeptide; 6 and 7, serum samples from rabbits infected by RbCoV HKU14;

879 8 and 9, serum samples from patients with HCoV-OC43 infection; 10 and 11, serum samples

880 from patients with SARS-CoV infection; 12, positive control (anti-His antibody).

42
881 FIG 6 Evolution of CoVs from their ancestors in bat, bird and rodent hosts to virus species that

882 infect other animals. The dashed arrows indicate possible routes of transmission from bats or

883 birds to rodents before establishment of Betacoronavirus lineage A.

43
884 Table 1. Detection of ChRCoV HKU24 in rodents by RT-PCR and serological studies by Western blot analysis
Scientific name Common name No. of rodents tested No. (%) of rodents No. (%) of rodents No. (%) of rodents
positive for ChRCoV positive for ChRCoV positive for ChRCoV
HKU24 in alimentary HKU24 antibody by N- HKU24 antibody by
samples by RT-PCR Western blot analysis S1-Western blot
analysis
Crocidura attenuata Asian gray shrew 5 0/5 (0%) NA NA
Niviventer fulvescens Chestnut white-bellied 97 0/97 (0%) NA NA
rat
Rattus andamanensis Indochinese forest rat 170 0/170 (0%) NA NA
Rattus norvegicusa Norway rat 82 3/82 (3.6%) 60/74 (81.1%) 21/60 (35%)
Rattus norvegicusb Norway rat 308 0/277 (0%) 15/31 (48.4%) 0/15 (0%)
Rattus rattus Black rat 54 0/24 (0%) 4/30 (0.13%) 0/4 (0%)
Rattus tanezumi Oriental house rat 9 0/9 (0%) 7/9 (77.8%) 2/7 (2.9%)
a
885 Norway rats from Guangzhou
b
886 Norway rats from Hong Kong

44
887 Table 2. Comparison of genomic features of ChRCoV HKU24 and other CoVs with complete
888 genome sequences available and aa identities between the predicted chymotrypsin-like protease
889 (3CLpro), RNA dependent RNA polymerase (RdRp), helicase (Hel), haemagglutinin-esterase
890 (HE), spike (S), envelope (E), membrane (M) and nucleocapsid (N) proteins of ChRCoV HKU24
891 and the corresponding proteins of other CoVs
Coronavirusesa Genome features Pairwise amino acid identity (%)
Size G+C ChRCoV HKU24-R05005I
(bases) content 3CLpro RdRp Hel HE S E M N
Alphacoronavirus
TGEV 28586 0.38 45.5 58.3 59.1 26.1 22.4 36.4 27.1
MCoV 28894 0.38 46.5 59.3 57.2 25.8 24.7 32.0 27.6
CCoV 29363 0.38 44.6 58.3 58.7 26.3 23.5 36.4 27.6
FIPV 29355 0.38 45.2 58.4 58.7 25.6 22.4 33.8 26.1
PRCV 27550 0.37 45.5 58.3 58.9 26.7 23.5 35.7 27.8
HCoV-229E 27317 0.38 44.4 56.3 57.7 26.9 26.5 32.5 26.9
HCoV-NL63 27553 0.34 42.8 56.5 57.6 25.8 31.0 32.8 25.4
PEDV 28033 0.42 42.4 59.1 58.7 25.6 30.1 38.5 21.6
Rh-BatCoV HKU2 27165 0.39 43.6 57.6 55.8 24.6 30.6 35.9 26.4
Mi-BatCoV 1A 28326 0.38 42.4 58.0 58.4 25.1 31.3 32.9 26.9
Mi-BatCoV HKU8 28773 0.42 43.1 58.8 56.1 25.5 29.3 35.1 26.5
Sc-BatCoV 512 28203 0.40 41.1 58.3 58.1 25.2 26.8 38.0 24.9
Ro-BatCoV HKU10 28494 0.39 43.1 56.9 57.1 26.6 34.5 36.2 26.4
Hi-BatCoV HKU10 28492 0.38 43.1 56.7 57.0 25.8 34.5 35.7 25.6
Betacoronavirus lineage A
Betacoronavirus 1
HCoV-OC43 30738 0.37 85.8 91.8 93.5 70.1 67.1 78.6 88.7 74.0
BCoV 31028 0.37 86.8 92.6 93.7 69.6 68.0 78.6 89.2 74.9
PHEV 30480 0.37 86.5 92.0 93.7 68.9 67.0 77.4 89.2 74.0
ECoV 30992 0.37 86.8 92.6 94.7 66.2 69.5 76.2 85.7 73.1
SACoV 30995 0.37 86.8 92.6 93.7 69.6 68.2 80.5 89.6 74.9
CRCoV 31028 0.37 86.5 92.3 93.5 69.9 67.6 77.4 90.0 74.7
GiCoV 30979 0.37 86.8 92.6 93.7 69.6 68.4 78.6 89.6 74.9
DcCoV UAE-HKU23 31036 0.37 86.8 92.6 93.4 69.6 68.1 77.4 90.5 74.4
Murine coronavirus
MHV 31357 0.42 82.8 90.3 90.5 39.9 63.8 63.9 82.7 67.9
RCoV 31250 0.41 82.5 90.3 90.5 59.3 63.3 62.5 80.5 67.5
HCoV-HKU1 29926 0.32 82.2 88.1 88.9 50.1 60.4 53.0 78.4 62.8
RbCoV HKU14 31084 0.38 86.8 92.5 94.7 69.9 67.9 74.2 91.3 73.9
ChRCoV HKU24-R05009I 31234 0.40 100 100 99.8 99.8 100 100 100 100
ChRCoV HKU24-R05010I 31324 0.40 100 100 100 99.8 100 100 100 100
Betacoronavirus lineage B
SARS-CoV 29751 0.41 49.0 66.8 68.6 29.9 26.5 37.7 34.3
SARSr-Rh-BatCoV HKU3 29728 0.41 48.4 66.7 68.8 29.5 26.5 38.1 34.1
Betacoronavirus lineage C
Ty-BatCoV HKU4 30286 0.38 52.3 68.6 68.6 33.0 25.6 42.4 36.7
Pi-BatCoV HKU5 30488 0.43 52.0 68.6 67.1 31.4 25.6 42.9 35.9
MERS-CoV 30107 0.41 53.3 68.7 67.1 31.9 29.3 43.3 37.7
Betacoronavirus lineage D
Ro-BatCoV HKU9 29114 0.41 46.9 67.1 68.4 28.6 25.6 42.4 33.3
Gammacoronavirus
IBV 27608 0.38 43.9 62.0 59.8 27.2 21.6 31.5 27.6
BWCoV SW1 31686 0.39 44.3 60.2 57.7 25.4 24.7 26.7 29.2
BdCoV HKU22 31759 0.39 44.3 60.6 57.9 25.2 23.1 25.1 29.2

45
 Deltacoroanvirus
BuCoV HKU11 26476 0.39 37.5 51.1 48.9 26.3 25.6 28.9 24.5
ThCoV HKU12 26396 0.38 38.0 51.8 48.4 26.2 23.6 30.6 22.1
MunCoV HKU13 26552 0.43 38.5 53.1 50.3 26.0 21.3 28.8 21.7
PorCoV HKU15 25421 0.43 40.4 52.2 49.0 25.6 25.3 26.9 24.2
WECoV HKU16 26027 0.40 39.1 51.9 49.3 25.6 23.3 28.2 22.2
SpCoV HKU17 26067 0.45 40.8 52.0 49.0 25.5 21.6 27.3 25.7
MRCoV HKU18 26674 0.47 38.8 51.9 49.3 26.1 22.5 28.9 23.7
NHCoV HKU19 26064 0.38 35.2 53.7 48.0 24.2 23.9 30.8 23.1
WiCoV HKU20 26211 0.39 36.9 51.6 48.8 26.8 28.6 27.8 23.2
CMCoV HKU21 26216 0.35 37.6 51.6 50.2 25.1 24.7 26.1 22.2
892 a
TGEV, porcine transmissible gastroenteritis virus; MCoV, mink coronavirus; CCoV, canine coronavirus; FIPV, feline infectious
893 peritonitis virus; PRCV, porcine respiratory coronavirus; HCoV-229E, human coronavirus 229E; HCoV-NL63, human
894 coronavirus NL63; PEDV, porcine epidemic diarrhea virus; Rh-BatCoV HKU2, Rhinolophus bat coronavirus HKU2; Mi-
895 BatCoV 1A, Miniopterus bat coronavirus 1A; Mi-BatCoV HKU8, Miniopterus bat coronavirus HKU8; Sc-BatCoV 512,
896 Scotophilus bat coronavirus 512; Ro-BatCoV HKU10, Rousettus bat coronavirus HKU10; Hi-BatCoV HKU10, Hipposideros bat
897 coronavirus HKU10; HCoV-OC43, human coronavirus OC43; BCoV, bovine coronavirus; PHEV, porcine hemagglutinating
898 encephalomyelitis virus; ECoV, equine coronavirus; SACoV, sable antelope CoV; CRCoV, canine respiratory coronavirus;
899 GiCoV, giraffe coronavirus; DcCoV UAE-HKU23, dromedary camel coronavirus UAE-HKU23; MHV, murine hepatitis virus;
900 RCoV, rat coronavirus; HCoV-HKU1, human coronavirus HKU1; SARS-CoV, SARS coronavirus; SARSr-Rh-BatCoV HKU3;
901 SARS-related Rhinolophus bat coronavirus HKU3; Ty-BatCoV HKU4, Tylonycteris bat coronavirus HKU4; Pi-BatCoV HKU5,
902 Pipistrellus bat coronavirus HKU5; MERS-CoV, middle east respiratory syndrome coronavirus; Ro-BatCoV HKU9, Rousettus
903 bat coronavirus HKU9; IBV, infectious bronchitis virus; BWCoV SW1, beluga whale coronavirus SW1; BdCoV HKU22,
904 bottlenose dolphin coronavirus HKU22; BuCoV HKU11, Bulbul coronavirus HKU11; ThCoV HKU12, Thrush coronavirus
905 HKU12; MunCoV HKU13, Munia coronavirus HKU13; PorCoV HKU15, porcine coronavirus HKU15; WECoV HKU16, white-
906 eye coronavirus HKU16; SpCoV HKU17, sparrow coronavirus HKU17; MRCoV HKU18, magpie robin coronavirus HKU18;
907 NHCoV HKU19, night heron coronavirus HKU19; WiCoV HKU20, wigeon coronavirus HKU20; CMCoV HKU21, common
908 moorhen coronavirus HKU21.

46
909 Table 3. Coding potential and predicted domains in different proteins of ChRCoV HKU24
ORFs Nucleotide No. of No. of Frame Putative function or domaina Positions (aa) Putative TRS
positions nucleotides amino
(start-end) acids
Nucleotide position in TRS sequence
genome (distance in bases to
AUG)b
1ab 213-21637 21425 7141 +3,+2 63 CUAAAC(144)AUG
nsp1 213-950 738 246 +3 Unknown 1-246
nsp2 951-2714 1764 588 +3 Unknown 247-834
nsp3 2715-8603 5889 1963 +3 Acidic domain, Hydrophobic domain, 835-2797
ADRP, Putative PLpro domain PL1pro,
PL2pro
nsp4 8604-10091 1488 496 +3 Hydrophobic domain 2798-3293
nsp5 10092-11000 909 303 +3 3CLpro 3294-3596
nsp6 11001-11861 861 287 +3 Hydrophobic domain 3597-3883
nsp7 11862-12128 267 89 +3 Unknown 3884-3972
nsp8 12129-12719 591 197 +3 Unknown 3973-4169
nsp9 12720-13049 330 110 +3 Unknown 4170-4279
nsp10 13050-13460 411 137 +3 Unknown 4280-4416
nsp11 13461-13505 45 14 +3 Unknown (short peptide at the end of 4417-4430
ORF1a)
nsp12 13461-16243 2783 928 +2 RdRp 4417-5344
nsp13 16244-18042 1797 599 +2 Hel 5345-5943
nsp14 18041-19603 1563 521 +2 ExoN, N7-MTase 5944-6464
nsp15 19604-20728 1125 375 +2 NendoU 6465-6839
nsp16 20729-21637 909 302 +2 O-MT 6840-7141
NS2a 21639-22469 831 276 +3 21629 CUAAAC(4)AUG
HE 22484-23761 1278 425 +2 Hemagglutinin domain 129-266 22466 CUGAAC(12)AUG
Cleavage site Between 1 and 18
Active site for neuraminate O-acetyl- 38-41
esterase activity, FGDS
S 23777-27853 4077 1358 +2 Type I membrane glycoprotein 23771 CUAAACAUG
N terminal domain 16-299
Cleavage site Between 763 and
764
2 heptad repeats 1045–1079 (HR1),
1253-1285 (HR2)

47
 Transmembrane domain 1303-1325
Cytoplasmic tail rich in cysteine residues
NS4 27946-28356 411 136 +1 Transmembrane domain 7-29
NS5 28338-28652 315 104 +3 28286 GUAAAC(46)AUG
E 28645-28893 249 82 +1 2 transmembrane domains 13-37 and 38-82
M 28908-29603 696 231 +3 3 transmembrane domains 26-45, 50-72 and 28899 CUAAAC(3)AUG
79-101
N2 29596-30288 693 230 +1
N 29613-30944 1332 443 +3 29600 CUAAAC(7)AUG
a
910 ADRP: adenosine diphosphate-ribose 1’’-phosphatase; PL1Pro, PL2Pro: Papain-like protease 1 and papain-like protease 2; 3CLpro: 3C-like protease;
911 RdRp: RNA-dependent RNA polymerase; Hel: Helicase; ExoN: 3’-to-5’ exonuclease; N7-MTase, (guanine-N7)-methyltransferase; NendoU,
912 nidoviral uridylate-specific endoribonuclease; O-MT: 2'-O-ribose methyltransferase.
b
913 Boldface indicates putative TRS sequences.

48
914 Table 4. Cleavage site used between nsps in lineage A betacoronaviruses
ChRCoV HKU24a Betacoronavirus 1 RbCoV HKU14 MHV RCoV HCoV-HKU1
nsp1|nsp2 G|L G|V G|V G|V G|V G|I
nsp2|nsp3 A|G A|G A|G A|G A|G A|G
nsp3|nsp4 G|A G|A G|A G|A G|A G|V
nsp4|nsp5 Q|S Q|S Q|S Q|S Q|S Q|S
nsp5|nsp6 Q|S Q|S Q|S Q|S Q|S Q|S
nsp6|nsp7 Q|S Q|S Q|S Q|S Q|S Q|S
nsp7|nsp8 Q|A Q|A Q|A Q|A H|A Q|A
nsp8|nsp9 Q|N Q|N Q|N Q|N Q|N Q|N
nsp9|nsp10 Q|A Q|A Q|A Q|A Q|A Q|A
nsp10|nsp12 Q|S Q|S Q|S Q|S Q|S Q|S
nsp12|nsp13 Q|S Q|S Q|S Q|S Q|S Q|S
nsp13|nsp14 Q|C Q|C Q|C Q|C Q|C H|C
nsp14|nsp15 Q|S Q|S Q|S Q|S Q|S Q|S
nsp15|nsp16 Q|A Q|A Q|A Q|A Q|A Q|A
a
915 Unique cleavage site in ChRCoV HKU24 is in bold.
916
917

49
918 Table 5. Pairwise comparisons of Coronaviridae-wide conserved domains in replicase
919 polyprotein 1ab between ChRCoV HKU24 and other lineage A betacoronaviruses
Pairwise amino acid identity of ChRCoV HKU24 (%)
Replicase polyprotein Betacoronavirus 1 RbCoV Murine HCoV-HKU1
domains HKU14 coronavirus
nsp3 (ADRP) 74.8-81.7 74.8 69.5-70.2 71
nsp5 (3CLpro) 85.8-86.8 86.8 82.5-82.8 82.2
nsp12 (RdRp) 91.8-92.6 92.5 90.3 88.1
nsp13 (Hel) 93.4-94.8 94.7-94.8 90.5-90.7 88.9-89.1
nsp14 (ExoN) 86.4-88.7 88.7 83.9-84.1 80.2
nsp15 (NendoU) 77.6-79.2 79.5 72.0-73.6 70.1
nsp16 (O-MT) 88.7-89.7 89.1 83.8-85.1 84.1
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
935
936
937
938
939
940
941
942
943
944

50