Journal of Polymer Research (2018) 25: 49

https://doi.org/10.1007/s10965-018-1448-z

ORIGINAL PAPER

Efficacy of Bletilla striata polysaccharide on hydrogen peroxide-induced

apoptosis of osteoarthritic chondrocytes
Yen-Liang Lai 1,2 & Yu-Ying Lin 1,2 & Subramaniam Sadhasivam 3,4 & Che-Yung Kuan 1,2 & Chih-ying Chi 1,2 &
Guo-Chung Dong 2 & Feng-Huei Lin 2,5

Received: 2 August 2017 / Accepted: 8 January 2018 / Published online: 22 January 2018
# Springer Science+Business Media B.V., part of Springer Nature 2018

Abstract
Osteoarthritis (OA) is a degenerative joint disease affecting millions of peoples worldwide. Though the etiology of OA includes
joint injury, obesity, aging, and heredity, oxidative stress is majorly considered as the hallmark of OA initiation and clinical
progression. Traditional pharmacologic therapies such as acetaminophen, non-steroidal anti-inflammatory drugs, and opioids are
effective only against relieving pain and not capable of reverting damaged cartilage. Bletilla striata is a chinese herb majorly
reported for its wound healing and anti-inflammatory property. The objective of this study is to demonstrate the potential of
Bletilla striata polysaccharide (BSP) as a biomaterial for oxidative stress induced cartilage tissue repair. The polysaccharide
extracted and purified from B. striata was characterized by Fourier-Transform Infrared (FT-IR) Spectrometer and 1H, 13C Nuclear
Magnetic Resonance (NMR) Spectrometer. Rheological measurements of BSP hydrogel were performed using a rheometer
under the frequency sweep model. The BSP also showed antioxidant effects by ABTS antioxidant activity assay. The biocom-
patibility and cytotoxicity of BSP was demonstrated by WST-1 and LDH assay. H2O2 induced oxidative stress was selected to
generate osteoarthritic chondrocytes and its detrimental effect was demonstrated by live/dead staining. Finally, the quantitative
gene expression of ECM-related genes was studied by RT-PCR in BSP treated and non-treated groups. The outcome of this study
has revealed that the down-regulation of catabolic gene expression by BSP treatment may open-up the development of new
therapeutic approaches in OA.

Keywords Bletilla striata . Osteoarthritis . Polysaccharide hydrogel . Chondrocytes . Cartilage

Introduction which results in significant movement disability and pain. The

other physiological changes due to the imbalance in extracel-
Osteoarthritis or OA is a prominent musculoskeletal disorder lular matrix (ECM) homeostasis include osteophyte forma-
affect the lives of million people worldwide and is mainly tion, synovial inflammation, subchondral bone sclerosis and
developed due to the gradual articular cartilage degradation reduction in joint space. It has been forecast that 25% of the
adult population, or more than 50 million people in the US,
will be affected by this disease by the year 2020 [1]. In
* Feng-Huei Lin
[email protected]
Taiwan, musculoskeletal disease is the second commonest
cause of chronic illness in elderly people, and the most com-
1
Ph.D. Program in Tissue Engineering and Regenerative Medicine, mon type of musculoskeletal disease is OA. The current inci-
National Chung Hsing University, Taichung, Taiwan dence of OA among elderly people in Taiwan is about 37% in
2
Institute of Biomedical Engineering and Nanomedicine, National individuals 50 years of age or older [2]. The OA prevalence
Health Research Institutes, Miaoli, Taiwan was significantly higher among women than men and in-
3
Department of Microbial Biotechnology, Bharathiar University, creased significantly with age [3, 4]. Worldwide estimates
Coimbatore, India are that 9.6% of men and 18.0% of women aged over 60 years
4
Department of Extension and Career Guidance, Bharathiar have symptomatic OA. 80% of those with OA will have lim-
University, Coimbatore, India itations in movement, and 25% cannot perform their major
5
Institute of Biomedical Engineering, College of Medicine and daily activities of life. Aging, obesity, low-grade inflammation
College of Engineering, National Taiwan University, Taipei, Taiwan and genetic are some of the key factors for the initiation,
49 Page 2 of 10 J Polym Res (2018) 25: 49

development and clinical progression of OA. In addition var- treatment of osteoarthritis and accounted for its significance
ious biochemical pathways and chondrocyte phenotypic [23]. Therefore, the present study is aimed to demonstrate the
change also lead to cartilage tissue degradation. Cartilage is gel forming ability and anti-inflammatory activity of Bletilla
a type of soft and firm connective tissue which consists of striata polysaccharide (BSP) to target H2O2 induced oxidative
extracellular matrix synthesized by the resident chondrocytes stress in porcine chondrocytes. To the best of our knowledge
and a healthy chondrocyte survival is more important for this is first report of BSP in cartilage tissue engineering.
proper ECM maintenance.
One of the most common risk factors for OA is aging and
people over the age of 65 were diagnosed with radiographic Materials and methods
changes in one or more joints [5]. In addition to increased
biomechanical loading on the knee joint, obesity is thought BSP extraction, purification and structural analysis
to contribute to low-grade systemic inflammation through se-
cretion of adipose tissue-derived cytokines, called adipokines Dry Bletilla striata was homogenized and dispersed in 80 °C
[6]. In aging and diabetic patients, conventional inflammatory double distilled water for 4 h, and then filtered to remove impu-
factors, such as interlrukin-1β (IL-1β) and TNF-α, as well as rities. The crude extracts were precipitated by addition of three
chemokines, were reported to contribute to the systemic in- vol. 95% (v/v) ethanol and left to stand overnight. The resultant
flammation that leads to activation of nuclear factor - κB precipitate was collected by centrifugation. Repeat the last two
(NF-κB) signaling in both synovial cells and chondrocytes steps and then resuspended in double distilled water.
[7]. Studies using articular chondrocytes and other cells sug- Deproteinization was done by adding 1/3 vol. Sevage reagent
gest that aging cells show elevated oxidative stress that pro- (chloroform/n-butanol 4:1) to the solution and stirred overnight
motes cell senescence and alters mitochondrial function [8, 9]. then aqueous phase was collected by centrifugation at 3500 rpm
Despite a high prevalence, no therapies to prevent or slow for 10 min. The collected aqueous phase was vacuum-dried and
disease progression are currently available. According to the lyophilized to prepare Bletilla striata polysaccharide (BSP). The
Osteoarthritis Research Society International (OARSI) and structural confirmation of BSP was done by FTIR spectral anal-
the American Academy of Orthopaedic Surgeons (AAOS), ysis, 13C NMR and 1H NMR spectra measurements.
the mainstay of OA treatments includes physical measures
[10], drug therapy, surgery [11, 12] and weight loss can adjust Molecular weight, total sugar content and rheology
the imbalanced mechanical stress, lessen joint pain, and reduce of BSP
OA risks [13] .Arthroscopic irrigation can provide a certain
degree of pain relief but are not beneficial for long-term recov- The molecular weight of the polysaccharide fractions were
ery [14]. Total joint replacement/arthroplasty is regarded as the determined by gel permeation chromatography (GPC). The
best orthopaedic surgery for advanced OA but it is not recom- samples were dissolved in 0.1 M NaNO3 solution, loaded into
mended for young patients, as the artificial implant has a finite a Viscotek GPC System equipped with TSK-G3000PWXL
lifespan [15]. Intra articular (IA) injection of corticosteroids has column, eluted with 0.1 M NaNO3 solution at a flow rate of
rare side effects and the corticosteroids injections decrease 0.7 ml/min and detected by 270 LS Laser Light Scattering
acute episodes of pain and increase joint mobility [16]. Detector and Shodex 71 Refractive Index Detector (RID).
Traditional Chinese Medicine (TCM) is having range of Dextran standards with different molecular weights were used
applications viz., it arrests bleeding, reduce swelling and pro- to calibrate the column and establish a standard curve. The
moting tissue regeneration, thus it could be effectively applied total sugar content was determined using the phenol/sulfuric
in the treatment of hematemesis, hemoptysis, traumatic bleed- acid method as described in the previous report [24].
ing, and ulcerative carbuncle [17]. Numerous studies have Rheological measurements of BSP hydrogel were performed
been documented the efficacy of Chinese herbal medicine using a rheometer (Discovery HR-1, TA Instruments, USA)
against ROS-mediated degenerative diseases [18–20]. under the frequency sweep model. Three viscoelastic param-
Similarly, Bletilla striata (Thunb.) Reichb. f. (Orchidaceae), eters, storage modulus (G′), loss modulus (G″), and angular
is a medicinal plant having more biomedical properties. BSP frequency (ω) were recorded as functions of angular frequen-
obtained from Bletilla striata have been fabricated into wound cy in the range of 1 to 100 rad/s at 37 °C.
dressings in varying shapes and sizes with outstanding bio-
compatible, biodegradable, and gelling properties, and mean- Antioxidant activity assays of BSP
while has been demonstrated to be convenient for processing
and modification [21]. Besides, BSP hydrogel also was report- The ABTS antioxidant activity assay was carried out accord-
ed to be able to promote higher expression of epidermal ing to the previously reported method [25] with few modifi-
growth factor which contributed to epidermal closure [22]. cations. Briefly, the ABTS+ stock solution was prepared by
Carbohydrate polymer hydrogels are prominently used in the reacting 7 mM ABTS and 2.45 mM potassium persulfate in a
J Polym Res (2018) 25: 49 Page 3 of 10 49

volume ratio of 1:1 in the dark condition at room temperature oxidative stress, BSP hydrogel (100 μg/ml) was then
for 16 h. The ABTS+ working solution was adjusted by dilu- added in 24-well plates and then incubated with H2O2-
tion of the stock solution with phosphate-buffered saline damaged cells for 3 days.
(PBS, pH 7.4) to an absorbance of 0.70 ± 0.02 at 734 nm.
Various concentrations (1–15 mg/ml) of the extracts were Protective efficacy of BSP hydrogel against H2O2
mixed with 0.2 ml of the ABTS+ working solution at room induced apoptosis of chondrocytes
temperature for 20 min. The absorbance was measured at
734 nm. Ascorbic acid was used as a reference standard. The H 2O 2 induced apoptosis of chondrocytes treated
with BSP hydrogel was evaluated by Live/Dead staining
Chondrocytes isolation kit (Molecular Probes # L3224, Eugene, Oregon, USA)
and images were documented using NIS Element soft-
Fresh porcine stifles were purchased from a traditional ware. The chondrocytes subjected to induce oxidative
market and kept integrated till chondrocytes were isolat- damage and post-treatment with BSP hydrogel (100 μg/
ed under aseptic conditions. In brief, full-thickness por- ml) are described in the above section. In this assay, the
cine articular cartilages were minced and washed three live cells will emit green fluorescence (excitation/emis-
times in sterile PBS containing 200 units/ml penicillin, sion maxima 495 nm/515 nm) and dead cells will emit
and 200 mg/ml streptomycin followed by digestion with red fluorescence at 528 nm/617 nm.
0.2% collagenase in Dulbecco’s Modified Eagle’s
Medium (DMEM) supplemented with 10% of FBS,
100 mg/ml streptomycin, and 100 U/ml penicillin for Real-time quantitative polymerase chain reaction
16 h incubation at 37 °C in a 5% CO2 incubator. The (RT-qPCR)
isolated chondrocytes were cultured in dishes and the
medium was changed twice a week. Total RNA was extracted using the RNAeasy mini kit
(Invitrogen, Carlsbad, CA) and the total RNA yield was
Cytotoxicity by lactate dehydrogenase (LDH) assay quantified by the GE NanoVue Plus spectrophotometer
and the ratio of 260/280 nm of samples were between
The 96-well culture plates were seeded with 1 × 10 4 1.8 and 2.0. RNA was treated in RNase-free water and
chondrocytes and incubated overnight at 37 °C. The culture stored in −80 °C for reverse transcription polymerase
medium was then removed and replaced with medium con- chain reaction (RT-PCR) assay. The first strand of com-
taining different concentrations of BSP (50, 100, 500 and plementary DNA (cDNA) was synthesized using the
1000 μg/ml) or medium only (control group). The amount SuperScript III First-strand Synthesis kit (Invitrogen).
of LDH released from the cells in supernatants for 1 and 3 days Quantitative PCR was performed with power SYBR
were measured with CytoTox 96 ® Non-Radioactive green PCR master mix (ABI, USA) according to manu-
Cytotoxicity Assay (Promega, CA). facturer’s instructions. The primers for IL-1β, TNF-α,
COX-2, iNOS, TIMP-1, TGF-β1, MMP-1, MMP-13,
Cell viability by WST-1 assay and SOX-9 were purchased from SYBR green Gene
Expression Assays (Applied Biosystems, CA); the for-
Cell viability assays were performed with WST-1 reagent ward and reverse primer sequences of the corresponding
(BioVision, CA) according to the manufacturer’s protocol. primers are listed in Table 1. The amplifications were
Briefly, 1x104chondrocyteswere cultured in 96-well plates performed using the 7900HT Fast Real-Time PCR
and treated with 50, 100, 500 and 1000 μg/ml of BSP for 1 System (Applied Biosystems). The glyceraldehyde-3-
and 3 days. The plates were incubated for 2 h at 37 °C after phosphate dehydrogenase (GAPDH) was used as endog-
adding 200 μL WST-1 reagent to each well. The WST- enous housekeeping gene. The relative expression of
1conversion was determined at 450 nm. each target gene was examined by 2−△△Ct method. A list
of ECM related genes used and its corresponding primer
Oxidative stress induction and post-treatment of BSP sequence was given in Table 1.
hydrogel
Statistical analysis
Chondrocytes were seeded in the 24-well cell culture
plates with the density of 1 × 104 cells per well and in- Statistical analysis of data presented in the results was ana-
cubated for 1 day. After incubated for 1 day, cells were lyzed by one-way ANOVA. The differences between treat-
washed with PBS, oxidative stress on cells was induced ment groups were considered significant when the p value
by 100 μM H 2 O 2 for 30 min. Post-H 2 O 2 induced was <0.05 and expressed as mean ± standard deviation (SD).
49 Page 4 of 10 J Polym Res (2018) 25: 49

Table 1 A list of ECM related genes used and its corresponding have indicated the non-anomeric ring protons. For better elu-
primer sequence
cidation, 13C NMR spectra the C-1/H-1 signal at δ 102.33/
Name Sequences 4.40 and 100.08/4.64 has predicted the β-Glucopyranose and
α-Mannopyranose repeating units in BSP (Fig. 2). The chem-
GAPDH 5′- GTCATCCATGACAACTTCGG −3′ ical shifts found in 13C NMR were also confirm the anomeric
5′- GCCACAGTTTCCCAGAGG −3′ carbon. 13C NMR chemical shifts between 70 ~ 76 ppm have
TIMP-1 5′- AACCAGACCGCCTCGTACA −3′ indicated the least % of open chain forms of glucose. The 1H
5′- GGCGTAGATGAACCGGATG −3′ NMR and 13C NMR chemical shifts were typically similar to
MMP-1 5′- CGTGCCATTGAGAAAGCCTT −3′ that of ion exchange chromatography purified BSP [26].
5′- GTCTGCTTGACCCTCGGAGA −3′
Sox9 5’-ACCTGAAGAAGGAGAGC-3′ FT-IR spectrometric analysis
5’-CACCGGCATGGGTACCA-3′
IL-1β 5′- ACCTCAGCCCTCTGGGAGA −3′ FT-IR spectroscopy is an authoritative analytical technique for
5′- CCTCCTTTGCCACAATCAC -3’ the identification of characteristic organic groups in polysac-
TGF-β1 5′- GCACGTGGAGCTATACCAGA −3’ charides. The FT-IR spectra of BSP were scanned to identify
5′- ACAACTCCGGTGACATCAAA −3’ the distinct peaks in the range of 4000–400 cm−1 (Fig. 3). The
MMP-13 5′- CCAAAGGCTACAACTTGTTTCTTG −3’ following characteristic absorption peaks were recorded at
5′- TGGGTCCTTGGAGTGGTCAA −3’ 3995, 1082, 1027, 873 and 807 cm−1. The anomeric region
TNF-α 5′- TCCTCACTCACACCATCAGC -3’ (950–750 cm−1) has confirmed three characteristic absorption
5′- TAGTCGGGCAGGTTGATCTC -3’ bands at 807 cm−1 and 873 cm−1 that was stand for α-
COX-2 5′- AGATCAGAAGCGAGGACCAG −3’ mannose and β-glucose, respectively. A sharp band at
5′- GTGTGAGGCGGGTAGATCAT −3’ 1027 cm−1 is a characteristic of pyranose ring. A strong and
broad peak at approximately 3995 cm−1 arises from hydroxyl-
group stretching vibrations, which is common to all polysac-
Results and discussion charide [27]. The absorption peaks found at 3420, 2920, 1620,
1400 and 1100 cm−1 were the typical characteristic peaks for
Structural confirmation of BSP by NMR polysaccharides [28]. A strong extensive absorption in the
region from 1000 to 1200 cm−1 indicate the stretching vibra-
After the extraction and purification process of dry Bletilla tions of C−O−H side groups, and C−O−C glycosidic band
striata, 7.1 g (17.2%) of polysaccharide was obtained from vibrations were observed in the spectra [29]. All of these ab-
40 g of dry B. striata. The scanning range of 200–400 nm has sorption bands are characteristic of polysaccharides.
confirmed the BSP is free of proteins and nucleic acids. The
structural elucidation of BSP was analyzed by 1H and 13C Molecular weight, total sugar content and rheology
NMR spectroscopy. The 1H NMR spectra has showed two of BSP
main peaks at δ 4.70 and 4.41 ppm (Fig. 1) and the chemical
shifts of carbohydrate indicates the signals for anomeric pro- BSP gave a single symmetrical peak when GPC was
tons. The uncharacteristic peaks found between 3 ~ 4 ppm performed. According to the GPC software (OmniSEC),

Fig. 1 1H NMR spectrum of BSP

J Polym Res (2018) 25: 49 Page 5 of 10 49

13
Fig. 2 C NMR spectrum of
BSP

it had a molecular weight of 1.98 × 105 Da by gel per- Antioxidant activity assays of BSP
meation chromatography. The purified polysaccharide
contained 68.0% (w/w) of total sugar. Evaluation of the The ABTS cation radical is generated by the oxidation of
elastic-viscous properties of BSP was carried out by ABTS by potassium persulfate [30]. When an antioxidant is
using a rheometer under the frequency sweep model at added, the group is converted into its non-radical form. ABTS
+
37 °C. Comparison of the magnitudes of frequency at radical scavenging activity was reached to 97.96% with a
10 rad/s, the results of storage modulus of 3% BSP, BSP concentration of 15 mg/mL, and the activities are dose
2% BSP and 1% BSP under were 0.040, 0.058, and dependent, as shown in Fig. 5. The result of ABTS radical
0.042, respectively. The results of loss modulus of 3% scavenging activity indicated a higher concentration of BSP
BSP, 2% BSP and 1% BSP under were 0.162, 0.071, and was required to achieve a similar scavenge rate of free-radical
0.024, respectively (Fig. 4). These modulus were ob- to ascorbic acid. This could be due to the purity of the BSP
served to have a significant increase when the BSP con- (known as 3.3). Therefore, further studies would focus on
centration from 1% to 3%, these result showing the BSP purification.
elastic-viscous properties were depend in concertation.
Moreover, the loss modulus is larger than storage mod-
LDH cytotoxicity assay
ulus, suggesting the BSP display a predominantly fluid-
like behavior.
The cytotoxicity of different concentrations of BSP on
chondrocytes was measured by LDH assay on day 1 and 3.
Data are expressed as mean ± SD and are expressed as per-
centage. (n = 6, *P < 0.05 versus control). As it can be seen
from Fig. 6, when chondrocytes were treated with different
concentrations of BSP (5 μg/ml to 1000 μg/ml) for 1 day,
cytotoxicity of BSP was not affected. However, the
chondrocytes treated with 10, 50 and 500 μg/ml BSP have
resulted in lower OD value compared with the control group
on day 3. The two different forms of cell death are classified as
apoptosis and necrosis in normal as well as diseased state.
LDH release measurement is a direct indication of cell death
by necrosis [31]. Further necrosis is characterized by swelling
and rupture of intracellular organelles and the necrotic cell
death evokes inflammatory responses and is closely associat-
ed with inflammatory diseases [32]. The non-cytotoxic effect
of BSP towards different cells might be explained by the stim-
Fig. 3 FTIR spectrum of BSP ulation of proinflammatory cytokine levels [33].
49 Page 6 of 10 J Polym Res (2018) 25: 49

Fig. 4 Storage modulus (G’) and

loss modulus (G^) for BSP at
different concentrations (1 ~
3 wt%)

WST-1 cell proliferation assay tetrazolium salt to a soluble violet formazan product by viable
cells. Similarly, the biocompatibility of an iridoid glycoside,
The effect of various concentration of BSP (5 μg/ml to aucubin was tested against the hydrogen peroxide induced
1000 μg/ml) on chondrocytes was demonstrated by WST-1 osteoarthritic chondrocyte model by WST-1 assay [20] and
cell proliferation assay on day 1 and day 3 (Fig. 7). When found that the cell proliferation of chondrocytes was well reg-
compared with control group, the tested concentrations of ulated. Our study has also confirmed the biocompatibility and
BSP did not have any significant effect on cell proliferation protective nature of BSP against the hydrogen peroxide in-
on both day 1 and 3. The results further showed that the BSP duced osteoarthritic chondrocytes.
neither toxic nor induce any damage to the cell. The increase
in OD value on day 3 as compared to day 1 was explained by Live/dead staining
the increased cell population. To ensure the biocompatibility
or cytocompatibility, the desired cells were embedded in hy- The live/dead assay was used to identify the effect of
drogel and incubated for 1 or 3 days and the cell proliferation H 2O2 induced apoptosis in chondrocytes (30 min) vs.
in the hydrogel was analyzed using WST-1 assay after 1 and BSP treated chondrocytes (H2O2 treated chondrocytes for
3 days [34], which is based on the reduction of a stable 30 min). The quantitative cell viability measured by

Fig. 5 ABTS radical scavenging

activities
J Polym Res (2018) 25: 49 Page 7 of 10 49

Fig. 6 Evaluation of Cytotoxicity

by LDH Assay

live/dead fluorescent staining between the control, H2O2 apoptosis to reduce osteoarthritis [37, 38]. Recent studies have
treated and BSP treated chondrocytes was presented in shown that anti-oxidative ability of BSP was demonstrated
Fig. 8. The results of live/dead staining have shown that through free radical-scavenging activity assays and inhibit
though there was prominent difference between the ratio the generation of reactive oxygen species [39, 40].
of viable/dead cells in control and H 2 O 2 treatment,
moreover in H2O2 group clear and distinct morphologi- Gene expression analysis by real-time PCR
cal characteristics of apoptosis such as cell shrinkage
was observed. Whereas, the chondrocytes have under- The selected ECM related gene expressions were studied for
gone BSP treatment has shown reduction in cell apopto- chondrocytes treated with H2O2 (induced) and post-treated
sis, possibly due to the anti-oxidative property of BSP. with Bletilla striata polymer (BSP) groups. The gene expres-
While the cells undergoing apoptosis it shows a characteristic sions were quantified by real-time PCR assay and normalized
morphological features such as cell shrinkage, chromatin con- to a reference housekeeping gene (GADPH). The real-time
densation, DNA fragmentation, plasma membrane blebbing PCR analysis was conducted to demonstrate the protective
and the formation of apoptotic bodies [35]. Oxidative stress efficacy of BSP against H2O2 induced oxidative damage
has been reported by many as triggering event in the initiation (Fig. 9). For IL-1β gene expression, chondrocytes subjected
of various chronic and inflammatory diseases. Even in osteo- to oxidative stress has showed significant up-regulation;
arthritis, oxidative stress plays a vital role in cartilage whereas IL-1β expression was substantially down-regulated
destruction and promotes the transition of cartilage dam- after BSP treatment. A similar trend was also observed for
age into apparent OA [36]. Hence many studies have TNF-α gene expression and about 2.5 fold decrease was ob-
been reported to target oxidative stress or chondrocytes served for BSP treated group as compared with H2O2. In case

Fig. 7 Cell proliferation

assessment by WST-1 Assay
49 Page 8 of 10 J Polym Res (2018) 25: 49

Fig. 8 Live and dead staining (a: Control; b: 30 min H2O2 induced oxidative damage and c: H2O2 induced oxidative damage treated by BSP)

of COX-2 gene expression, though BSP treatment has shown SOX-9 was considerably reduced in H2O2 treatment. An in-
significant down-regulation, the differences between the two creased expression of cytokines such as IL-1β and tumor ne-
groups were <1-fold. Similarly, in iNOS expression, the crosis factor-alpha (TNF-α) have stimulatory effect or radical
mRNA levels were relatively decreased in BSP than the up-regulate of matrix metalloproteinases (MMPs) expression
H2O2 induced group. TIMP-1 expression in H2O2 induced in articular chondrocytes [41]. TGF-β is an important proin-
group had a sharp decrease of around 7-fold against the BSP flammatory factor in degenerative joint disease and it effec-
group. For transforming growth factor-beta 1 (TGF-β1) ex- tively controls the chondrocytes metabolism via extracellular
pression, a slight up-regulatory gene expression was detected matrix homeostasis [42]. It was reported that the elevated ex-
in BSP group vs. H2O2. The transcriptional regulation of the pression of MMP-1 and MMP-13 is strongly associated with
catabolic genes of matrix metalloproteinases (MMP-1 and increased IL-1 and tumor necrosis factor-α, which was ob-
MMP-13) were elevated in H2O2 and the expression of these served in arthritic tissues [43]. The SOX-9 up regulation after
interstitial collagenases were well controlled in chondrocytes BSP treatment has suggested that SOX-9 is necessary for car-
treated with BSP. An expression level of SOX-9 mRNA was tilage formation and also regulate collagen II transcription
significantly up regulated in BSP and the mRNA level of [44]. The gene expression profiles suggested protective effi-
cacy of BSP by down-regulating inflammatory related genes
on H2O2 induced chondrocyte.

Summary

Development of new therapeutic strategies and biomaterials are

always on-demand for cell therapy or regenerative medicine. A
new polysaccharide polymer extracted from a traditional chinese
medicine, Bletilla striata has shown variety of healing properties
including the anti-inflammatory and anti-oxidative but the thera-
peutic effect of BSP on osteoarthritis is never explored. In this
study the BSP was extracted, purified and characterized by FT-IR
and NMR. The NMR spectroscopy studies have confirmed the
presence of α-D-mannopyranose and β-D-glucopyranose resi-
dues, which are the backbone of BSP. Follow the extraction
procedure we developed, we obtained the BSP had average mo-
lecular weight of 1.98 × 105 Da, and the total sugar contained
was 68% approximately. The BSP also showed antioxidant ef-
fects. The cell proliferation and cytotoxicity studies have demon-
strated the exceptional biocompatibility of BSP. The anti-
oxidative property of BSP against H2O2 induced oxidative stress
was evident from live/dead staining. In addition, a detailed quan-
titative gene expression analysis of ECM related gene marker by
real-time PCR have reported a significant down-regulation of
Fig. 9 Effect of BSP on ECM-related gene expression by RT-PCR inflammatory markers viz., L-1β, TNF-α, COX-2 and iNOS
J Polym Res (2018) 25: 49 Page 9 of 10 49

and up-regulation of pro-inflammatory cytokines like TIMP-1 hip and knee osteoarthritis, part II: OARSI evidence-based, expert
consensus guidelines. Osteoarthr Cartil 16(2):137–162. https://doi.
and TGF-β1. Hence it may be concluded that the anti-
org/10.1016/j.joca.2007.12.013
inflammatory properties of BSP are involved in the regulation 13. Christensen R, Astrup A, Bliddal H (2005) Weight loss: the treatment
of oxidative stress induced osteoarthritis. of choice for knee osteoarthritis? A randomized trial. Osteoarthr Cartil
13(1):20–27. https://doi.org/10.1016/j.joca.2004.10.008
Acknowledgments The authors would like to thank all colleagues and 14. Dervin GF, Stiell IG, Rody K, Grabowski J (2003) Effect of arthro-
students who contributed to this study. Yen-Liang Lai carried out his scopic debridement for osteoarthritis of the knee on health-related
thesis research under the auspices of the Ph.D. Program in Tissue quality of life. J Bone Joint Surg Am 85a(1):10–19
Engineering and Regenerative Medicine, National Chung Hsing 15. Grayson CW, Decker RC (2012) Total joint Arthroplasty for per-
University and National Health Research Institutes. We would like to sons with osteoarthritis. PM R 4(5):S97–S103. https://doi.org/10.
thank reviewers and the editor for their comments. 1016/j.pmrj.2012.02.018
16. Rozental TD, Sculco TP (2000) Intra-articular corticosteroids: an
updated overview. Am J Orthop (Belle Mead NJ) 29(1):18–23
17. Hsiao CY, Hung CY, Tsai TH, Chak KF (2012) A study of the
References wound healing mechanism of a traditional Chinese medicine,
Angelica Sinensis, Using a Proteomic Approach. Evid Based
1. Helmick CG, Felson DT, Lawrence RC, Gabriel S, Hirsch R, Kwoh Compl Alt. https://doi.org/10.1155/2012/467531
CK, Liang MH, Kremers HM, Mayes MD, Merkel PA, Pillemer 18. Lin WY, Sadhasivam S, Lin FH (2009) The dose dependent effects
SR, Reveille JD, Stone JH, National Arthritis Data W (2008) of betulin on porcine chondrocytes. Process Biochem 44(6):678–
Estimates of the prevalence of arthritis and other rheumatic condi- 684. https://doi.org/10.1016/j.procbio.2009.02.008
tions in the United States. Part I. Arthritis Rheum 58(1):15–25. 19. Lin WY, Lin FH, Sadhasivam S, Savitha S (2010) Antioxidant
https://doi.org/10.1002/art.23177 effects of betulin on porcine chondrocyte behavior in gelatin/C6S/
2. Kao MH, Tsai YF (2012) Living experiences of middle-aged adults C4S/HA modified tricopolymer scaffold. Mat Sci Eng C Mater
with early knee osteoarthritis in prediagnostic phase. Disabil Rehabil 30(4):597–604. https://doi.org/10.1016/j.msec.2010.02.010
34(21):1827–1834. https://doi.org/10.3109/09638288.2012.665127 20. Young IC, Chuang ST, Hsu CH, Sun YJ, Liu HC, Chen YS,
3. Grotle M, Hagen KB, Natvig B, Dahl FA, Kvien TK (2008) Lin FH (2017) Protective effects of aucubin on osteoarthritic
Prevalence and burden of osteoarthritis: results from a population chondrocyte model induced by hydrogen peroxide and me-
survey in Norway. J Rheumatol 35(4):677–684 chanical stimulus. BMC Complement Altern Med 17. https://
4. Andrianakos AA, Kontelis LK, Karamitsos DG, Aslanidis SI, doi.org/10.1186/s12906-017-1581-y
Georgountzos AI, Kaziolas GO, Pantelidou KV, Vafiadou EV, Dantis 21. Wang Y, Liu JJ, Li Q, Wang YT, Wang CM (2015) Two natural
PC (2006) Prevalence of symptomatic knee, hand, and hip osteoarthri- glucomannan polymers, from Konjac and Bletilla, as bioactive ma-
tis in Greece. The ESORDIG study. J Rheumatol 33(12):2507–2514 terials for pharmaceutical applications. Biotechnol Lett 37(1):1–8.
5. Felson DT, Naimark A, Anderson J, Kazis L, Castelli W, Meenan https://doi.org/10.1007/s10529-014-1647-6
RF (1987) The prevalence of knee osteoarthritis in the elderly - the 22. Luo Y, Diao HJ, Xia SH, Dong L, Chen JN, Zhang JF (2010)
Framingham osteoarthritis study. Arthritis Rheum 30(8):914–918. A physiologically active polysaccharide hydrogel promotes
https://doi.org/10.1002/art.1780300811 wound healing. J Biomed Mater Res A 94a(1):193–204.
6. Conde J, Scotece M, Gomez R, Lopez V, Gomez-Reino JJ, Gualillo https://doi.org/10.1002/jbm.a.32711
O (2011) Adipokines and osteoarthritis: novel molecules involved 23. Kim DY, Park H, Kim SW, Lee JW, Lee KY (2017) Injectable
in the pathogenesis and progression of disease. Arthritis 2011: hydrogels prepared from partially oxidized hyaluronate and glycol
203901. https://doi.org/10.1155/2011/203901 chitosan for chondrocyte encapsulation. Carbohydr Polym 157:
7. van Lent PLEM, Blom AB, Schelbergen RFP, Sloetjes A, Lafeber 1281–1287. https://doi.org/10.1016/j.carbpol.2016.11.002
FPJG, Lems WF, Cats H, Vogl T, Roth J, van den Berg WB (2012) 24. Chaplin MF, Kennedy JF (1994) Carbohydrate analysis: a practical
Active involvement of alarmins S100A8 and S100A9 in the regu- approach2nd edn. IRL Press Ltd, Oxford
lation of synovial activation and joint destruction during mouse and 25. Re R, Pellegrini N, Proteggente A, Pannala A, Yang M, Rice-Evans C
human osteoarthritis. Arthritis Rheum 64(5):1466–1476. https:// (1999) Antioxidant activity applying an improved ABTS radical cation
doi.org/10.1002/art.34315 decolorization assay. Free Radic Biol Med 26(9–10):1231–1237
8. Loeser RF (2011) Aging and osteoarthritis. Curr Opin Rheumatol 26. Wang Y, Liu D, Chen SJ, Wang Y, Jiang HX, Yin HP (2014) A new
23(5):492–496. https://doi.org/10.1097/BOR.0b013e3283494005 glucomannan from Bletilla Striata: structural and anti-fibrosis effects.
9. Naik E, Dixit VM (2011) Mitochondrial reactive oxygen species Fitoterapia 92:72–78. https://doi.org/10.1016/j.fitote.2013.10.008
drive proinflammatory cytokine production. J Exp Med 208(3): 27. Miao M, Bai AJ, Jiang B, Song Y, Cui SW, Zhang T (2014)
417–420. https://doi.org/10.1084/jem.20110367 Characterisation of a novel water-soluble polysaccharide from
10. Hunter DJ, Felson DT (2006) Osteoarthritis. BMJ 332(7542):639– Leuconostoc citreum SK24.002. Food Hydrocoll 36:265–272.
642. https://doi.org/10.1136/bmj.332.7542.639 https://doi.org/10.1016/j.foodhyd.2013.10.014
11. Jevsevar DS, Brown GA, Jones DL, Matzkin EG, Manner PA, 28. Li Q, Yu NW, Wang YP, Sun YP, Lu KP, Guan WL (2013)
Mooar P, Schousboe JT, Stovitz S, Sanders JO, Bozic KJ, Extraction optimization of Bruguiera Gymnorrhiza polysaccharides
Goldberg MJ, Martin 3rd WR, Cummins DS, Donnelly P, with radical scavenging activities. Carbohydr Polym 96(1):148–
Woznica A, Gross L, American Academy of Orthopaedic S 155. https://doi.org/10.1016/j.carbpol.2013.03.054
(2013) The American Academy of Orthopaedic surgeons 29. Kacurakova M, Capek P, Sasinkova V, Wellner N, Ebringerova A
evidence-based guideline on: treatment of osteoarthritis of the knee, (2000) FT-IR study of plant cell wall model compounds: pectic
2nd edition. J Bone Joint Surg Am 95(20):1885–1886 polysaccharides and hemicelluloses. Carbohydr Polym 43(2):195–
12. Zhang W, Moskowitz RW, Nuki G, Abramson S, Altman RD, 203. https://doi.org/10.1016/S0144-8617(00)00151-X
Arden N, Bierma-Zeinstra S, Brandt KD, Croft P, Doherty M, 30. Fu R, Zhang YT, Guo YR, Huang QL, Peng T, Xu Y, Tang
Dougados M, Hochberg M, Hunter DJ, Kwoh K, Lohmander LS, L, Chen F (2013) Antioxidant and anti-inflammatory activi-
Tugwell P (2008) OARSI recommendations for the management of ties of the phenolic extracts of Sapium Sebiferum (L.) Roxb.
49 Page 10 of 10 J Polym Res (2018) 25: 49

Leaves. J Ethnopharmacol 147(2):517–524. https://doi.org/ chondrocytes under oxidative stress. Carbohydr Polym 173:17–
10.1016/j.jep.2013.03.058 27. https://doi.org/10.1016/j.carbpol.2017.05.069
31. Chan FK, Moriwaki K, De Rosa MJ (2013) Detection of necrosis 39. Jiang F, Li W, Huang Y, Chen Y, Jin B, Chen N, Ding Z, Ding X
by release of lactate dehydrogenase activity. Methods Mol Biol (2013) Antioxidant, antityrosinase and antitumor activity compari-
979:65–70. https://doi.org/10.1007/978-1-62703-290-2_7 son: the potential utilization of fibrous root part of Bletilla Striata
32. Kono H, Rock KL (2008) How dying cells alert the immune (Thunb.) Reichb.F. PLoS One 8(2):e58004. https://doi.org/10.
system to danger. Nat Rev Immunol 8(4):279–289. https:// 1371/journal.pone.0058004
doi.org/10.1038/nri2215 40. Liu K, Feng ZQ, Shan L, Yang TT, Qin M, Tang JB, Zhang WF
33. Diao HJ, Li X, Chen JM, Luo Y, Chen X, Dong L, Wang CM, (2017) Preparation, characterization, and antioxidative activity of
Zhang CY, Zhang JF (2008) Bletilla Striata polysaccharide stimu- Bletilla striata polysaccharide/chitosan microspheres for
lates inducible nitric oxide synthase and proinflammatory cytokine oligomericproanthocyanidins. Dry Technol 35(13):1629–1643.
expression in macrophages. J Biosci Bioeng 105(2):85–89. https:// https://doi.org/10.1080/07373937.2016.1269123
doi.org/10.1263/jbb.105.85 41. Fernandes JC, Martel-Pelletier J, Pelletier JP (2002) The role
34. Kim EJ, Choi JS, Kim JS, Choi YC, Cho YW (2016) of cytokines in osteoarthritis pathophysiology. Biorheology
Injectable and Thermosensitive soluble extracellular matrix 39(1–2):237–246
and methylcellulose hydrogels for stem cell delivery in skin 42. Wang L, Almqvist KF, Veys EM, Verbruggen G (2002) Control of
wounds. Biomacromolecules 17(1):4–11. https://doi.org/10. extracellular matrix homeostasis of normal cartilage by a TGFbeta
1021/acs.biomac.5b01566 autocrine pathway. Validation of flow cytometry as a tool to study
35. Hacker G (2000) The morphology of apoptosis. Cell Tissue Res chondrocyte metabolism in vitro. Osteoarthr Cartil 10(3):188–198.
301(1):5–17 https://doi.org/10.1053/joca.2001.0492
36. Ziskoven C, Jager M, Zilkens C, Bloch W, Brixius K, Krauspe R 43. Vincenti MP, Brinckerhoff CE (2002) Transcriptional regula-
(2010) Oxidative stress in secondary osteoarthritis: from cartilage tion of collagenase (MMP-1, MMP-13) genes in arthritis:
destruction to clinical presentation? Orthop Rev (Pavia) 2(2):e23. integration of complex signaling pathways for the recruit-
https://doi.org/10.4081/or.2010.e23 ment of gene-specific transcription factors. Arthritis Res
37. Poulet B, Beier F (2016) Targeting oxidative stress to reduce 4(3):157–164. https://doi.org/10.1186/ar401
osteoarthritis. Arthritis Res Ther 18. https://doi.org/10.1186/ 44. Brew CJ, Clegg PD, Boot-Handford RP, Andrew JG, Hardingham
s13075-015-0908-7 T (2010) Gene expression in human chondrocytes in late osteoar-
38. Cheng YH, Chavez E, Tsai KL, Yang KC, Kuo WT, Yang YP, thritis is changed in both fibrillated and intact cartilage without
Chiou SH, Lin FH (2017) Effects of thermosensitive chitosan- evidence of generalised chondrocyte hypertrophy. Ann Rheum
gelatin based hydrogel containing glutathione on Cisd2-deficient Dis 69(1):234–240. https://doi.org/10.1136/ard.2008.097139