Materials Science & Engineering C 105 (2019) 110071

Contents lists available at ScienceDirect

Materials Science & Engineering C

journal homepage: www.elsevier.com/locate/msec

Biological evaluation of porous nanocomposite scaffolds based on strontium T

substituted β-TCP and bioactive glass: An in vitro and in vivo study
⁎
Mansure Kazemia, Mohammad Mehdi Dehghanb, Mahmoud Azamia,
a
Department of Tissue Engineering and Applied Cell Sciences, School of Advanced Technologies in Medicine, Tehran University of Medical Sciences, Tehran, Iran
b
Department of Surgery and Radiology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran

A R T I C LE I N FO A B S T R A C T

Keywords: In the current study, in vitro analysis of the osteogenic potential of different scaffolds based on strontium-sub-
Tricalcium phosphate stituted β-TCP (Sr-TCP) and bioactive glass (BG) ceramics was conducted using rabbit bone marrow-derived
Bioactive glass mesenchymal stem cells (rBMSCs) and the osteogenic ability of the prepared Sr-TCP and BG scaffold was
Nanocomposite evaluated through alkaline phosphatase activity, mineral deposition by Alizarin red staining, and osteoblastic
Strontium
gene expression experiments. The obtained in vitro results revealed that among experimental Sr-TCP/BG na-
Bone marrow-derived mesenchymal stem cells
nocomposite scaffold samples with the composition of Sr-TCP/BG: 100/0, 50/50, 75/25, and 25/75, the 50Sr-
TCP/50BG sample presented better osteoinductive properties. Therefore, the optimized 50Sr-TCP/50BG nano-
composite scaffold was chosen for further in vivo experiments. In vivo implantation of 50Sr-TCP/50BG scaffold
and hydroxyapatite (HA)/TCP granules in a rabbit calvarial defect model showed slow degradation of 50Sr-TCP/
50BG scaffold and high resorption rate of HA/TCP granules at 5 months' post-surgery. However, the 50Sr-TCP/
50BG scaffolds loaded by mesenchymal stem cells (MSCs) were mainly replaced with new bone even at 2 months
post-implantation. Based on the obtained engineering and biological results, 50Sr-TCP/50BG nanocomposite
scaffold containing MSCs could be considered as a promising alternative substitute even for load-bearing bone
tissue engineering applications.

1. Introduction substitute material because of its high biocompatibility, good osteo-

conductivity, and biodegradability [9–11]. Although, there are some
Repair and reconstruction of large or non-union bone defects caused concerns with the use of β-TCP including lack of osteostimulatory effect
by congenital anomalies, traumatic events or degenerative conditions and intrinsic brittleness which is a common feature shared by most of
have remained a major challenge in the orthopedic arena [1,2]. Re- the bioceramic materials [12,13]. The incorporation of an appropriate
garding the limitations associated with the conventional treatments bioactive ceramic phase into calcium phosphate (CaP) matrix re-
such as the limited sources of autografts or the possibility of im- presents a promising strategy that can effectively modify the physio-
munoreactions and disease transmission of allografts, there's a growing chemical and biological characteristics of the final product. In this re-
demand of engineering biomaterials aimed at healing and restoring gard, most of the research focuses on the application of bioactive glass
bone injuries [3,4]. Bone tissue engineering aims to mimics the biolo- (BG) materials as a reinforcing phase [14] or as the second phase [15]
gical process of bone repair by applying three-dimensional biodegrad- in a composite structure. 45S5, the first bioactive glass discovered by
able scaffolds as a temporary extracellular matrix and appropriate cells Larry Hench in late 1969, is a biodegradable, osteoinductive and os-
in the defect area. An ideal bone scaffold should be biodegradable, teoconductive glass with osteogenic and angiogenic effects, which is
osteoinductive and osteoconductive, as well as having an inter- able to lunch a tenacious chemical bond with various tissues [16].
connected porous structure with appropriate mechanical properties Sintering of β-TCP with a glassy phase modulate the dissolution rate of
[5,6]. Designing and optimization of synthetic scaffold materials are the final construct and improve the biological response of the composite
extensively implicated to guide and facilitate new bone growth [7,8]. scaffold due to the combined effect of two bioactive phases. Further-
β-Tricalcium phosphate (β-TCP) as a single bioceramic or in com- more, by providing a liquid phase, bioglass nanoparticles may enhance
posite with polymers is a suitable candidate for application as a bone β-TCP matrix densification and promote the bonding strength between

⁎
Corresponding author at: Department of Tissue Engineering and Applied Cell Sciences, School of Advanced Technologies in Medicine, Tehran University of
Medical Sciences, 88, 10th floor, Italia Str., Keshavarz Blvd., Tehran, Iran.
E-mail address: [email protected] (M. Azami).

https://doi.org/10.1016/j.msec.2019.110071
Received 17 June 2019; Received in revised form 28 July 2019; Accepted 9 August 2019
Available online 10 August 2019
0928-4931/ © 2019 Elsevier B.V. All rights reserved.
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

adjacent grains which result in improved mechanical performance the scaffold were analyzed by scanning electron microscopy (SEM-
[15,17]. Philips XL30). For cell attachment analysis, MG-63 cells were used.
The biological and physicochemical properties of β-TCP could be Following cell seeding and culturing for 72 h, cell-seeded scaffolds were
modified by the incorporation of trace elements such as strontium (Sr) washed twice with PBS and then fixed with 2.5% glutaraldehyde for
which partially substitute the Ca2+ sites in the crystalline structure of 1 h, then by 1% osmium tetroxide aqueous solution (15 min) and finally
β-TCP [15]. Different studies have shown that Sr2+ ions enhance bone dehydrated in a graded ethanol series [33]. Samples were then freeze-
formation through stimulation of proliferation and osteogenic differ- dried and prepared for being observed by SEM. Mechanical properties
entiation of mesenchymal stem cells [19–21]. It also shifts the bone of the prepared scaffold were measured using a universal testing ma-
formation-resorption balance toward formation by increasing the os- chine (SANTAM, STM50, Iran) under compressive loading at the rate of
teoblast proliferation and suppression of osteoclasts differentiation 0.5 mm/min. The stress-strain curve was drawn for each sample and
[22,23]. So, the substitution of Sr2+ in the CaP lattice improve the mechanical indices such as compressive strength were extracted.
bioactivity and osteoinductivity of the scaffold and provide a slow and
steady release of these ions from the resorbable β-TCP which can ef- 2.2. Bone marrow-derived mesenchymal stem cell (BM-MSC) isolation and
fectively increase bone regeneration in the defect area. cultivation
Regenerative medicine tries to design biodegradable scaffolds along
with the use of living cells to ameliorate healing potential of the en- The adult MSCs were isolated and expanded from the bone marrow
gineered construct after being implanted in the body [24–27]. Me- (BM) of a New Zealand White rabbit by a method described previously
senchymal stem cells (MSCs) have been considered as a practical cell [34]. Briefly, BM sample was extracted from the humerus of rabbit in
source for bone tissue engineering applications due to their high self- aseptic surgical condition. After 30 min of centrifugation (400 rcf),
renewal potential and osteogenic differentiation potential in addition to mononuclear cells were collected from the interphase, the cell pellet
advantages such as availability in adult tissues including bone marrow was suspended in 5 mL of complete media (high-glucose DMEM (Dul-
[28,29]. Several studies have shown that MSCs may release endocrine becco's Modified Eagle Medium) containing 20% FBS, 2% penicillin/
factors which promote several key biological activities [30]. Mean- streptomycin) and transferred into 25 cm2 culture flasks and incubated
while, MSCs possess a unique immunomodulatory capability to regulate at 37 °C in a humid atmosphere with 5% CO2. After 48 h, cells were
and suppress both innate and adaptive immune responses which makes changed to fresh media containing 15% FBS and afterward, the medium
them a suitable candidate for allogeneic stem cell transplantation [31]. was replaced every two days. The adherence of mesenchymal stem
In our previously published research [32], highly porous nano- cells, as well as their growth, was carefully monitored, and non-ad-
composite scaffolds based on strontium doped β-TCP (Sr-TCP) and 45S5 herent cells (hematopoietic cells) were removed from the culture by a
bioglass were fabricated by foam replication method. For this purpose, series of media replacing and washing the adherent cells with PBS.
on the scaffolds made from four proportions of CaP/BG (100/0, 75/25, When the primary cultured cells reached about 90% confluence, MSCs
50/50, and 25/75), different heat treatment conditions were applied were sub-cultured to achieve purification and expansion.
and the optimal heat treatment condition was determined for each
composition to obtain a dense and mechanically competent nano- 2.3. Further in vitro study
composite. Following our previous investigation, in this study, further
engineering and biological characterization were done to find the op- The osteogenic potential of the selected scaffolds was investigated
timum composition and heat treatment as a scaffold for bone tissue along with bone marrow-derived MSCs after a 21-day period of culture.
engineering. Finally, the optimum scaffold was prepared for in vivo MSCs of passage 3 were used for all experiments. To assess the effect of
study to be implanted in a critical-sized calvarial defect of a rabbit Sr ion in cellular activity, in these tests, Sr containing scaffolds were
model. Bone regeneration was evaluated by radiological and computed compared with Sr-free scaffolds.
tomography (CT) examination, histological (Hematoxylin & Eosin and
Masson Trichrome staining), immunohistochemical, and histomorpho- 2.3.1. Alkaline phosphatase (ALP) activity
metric analysis. Alkaline phosphatase activity was measured using a colorimetric
ALP assay kit (Abcam). Briefly, supernatants from the cells cultured on
2. Materials and methods the different scaffolds for 7 and 14 days were collected. 80 μL of each
sample was incubated with 50 μL of p-nitrophenyl phosphate (pNPP,
2.1. Nanocomposite scaffolds fabrication and characterization 5 mM) solution at 37 °C for 1 h in the dark. Following the incubation
time, enzyme activity was stopped by adding stop solution and the
Highly porous nanocomposite scaffolds were prepared through resulting absorbance was measured at 405 nm using a microplate
foam replication method according to our previous report [32]. In brief, reader.
the ceramic slurry was prepared by dissolving 4% w/v polyvinyl al-
cohol (PVA) in deionized water at 80 °C, followed by adding different 2.3.2. Bone nodule-like formation
proportion of Sr.TCP and BG nanopowders (Sr.TCP/BG: 100/0, 75/25, Alizarin red staining was performed to detect extracellular calcium
50/50, and 25/75) to the PVA solution up to a concentration of 40 wt%. deposition by differentiated osteoblasts on day 21 of culture. Since
Polyurethane (PU) foams were impregnated in the slurry, compressed calcium is present in the scaffold substrate and makes it difficult to
to remove extra uptake, and allowed to dry in an oven at 60 °C over- distinguish true positive staining, MSCs were cultured at 20,000 cells/
night. For heat treatment, the samples were heated up to 350 °C and well in 24-well cell culture plate in the presence of conditioned media
maintain for 30 min to decompose PU foams, and then heated up to an (complete DMEM media containing 0.1 mg/mL of each scaffold) for
elevated temperature with a proper dwelling time to sinter and densify 21 days. After that, the treated cells were washed with PBS, fixed with a
the ceramic network. Based on the results obtained from our previous 4% paraformaldehyde solution for 45 min at 4 °C, and stained with
comprehensive study [32], the optimal sintering condition was de- Alizarin red solution (pH: 4.1–4.3) for 30 min with gentle shaking.
termined to be 1250 °C-1 h for scaffolds with the composition of Then, stained cells were extremely washed with distilled water and
(Sr.TCP/BG: 100/0), (Sr.TCP/BG: 50/50) and 1250 °C without soaking viewed under an inverted optical microscope (IX83, Olympus Life
time for (Sr.TCP/BG: 75/25) and (Sr.TCP/BG:25/75). The heating rate Science Solutions-Japan).
was adjusted on 5 °C/min and after the sintering process completion,
the samples were left to be cooled slowly inside the furnace. 2.3.3. RNA isolation and gene expression evaluation
Porous morphology, microstructure and cells attachment seeded on To evaluate the expression level of osteogenic-related genes of the

2
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Table 1
Primer sequences used for real time PCR reactions.
Target gene Forward primer Reverse primer

COL-I GAGGCCCTAGTGGTCCACAAG CACCATGTTGACCAGCGAGAC

ALP ACACGGACAAGAAACCCTTCAC TGGTAGTTGTTGTGAGCGTAGTCC
OPN TCGTCGGAGTGGTGAGAG GTGGATGATATTGATGAGGATGAG
OCN TCACTCTTGTCGCCCTGCTG CCTGCCCGTCGATCAGTTG
GAPDH GTAGTGGAGGTCAATGAATGG ATGGTGAAGGTCGGAGTG

Col-I: Collagen-I, ALP: Alkaline phosphatase, OPN: Osteopontin, OCN: Osteocalcin, GAPDH: Glyceraldehyde-3-phosphate de-
hydrogenase.

MSCs seeded on each scaffold for 21 days, a real-time polymerase chain inhalation and the specimens were collected by excising the implanted
reaction (RT-PCR) analysis was performed. After the incubation times, grafts together with the adjacent bone for subsequent evaluations. To
total RNA from each group's cells was extracted using an RNeasy Plus evaluate new bone regeneration, the extracted specimens were im-
Mini Kit (Qiagen, CA, USA) according to the product manual. The total mediately radiographed using Shimadzo radiography system (Japan)
RNA concentration and purity (OD260/280) were detected by a and scanned by CT imaging (Siemens Medical Solutions, Knoxville, TN,
Nanodrop Spectrometer (Tecan M200). For performing quantitative USA) at 130 kV and 30 mA.
PCR (qPCR), single strand cDNA was synthesized from the isolated RNA
using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, 2.5.3. Tissue processing and staining
USA). The specific primer sequences for the target genes including COL- All harvested specimens were fixed in the 10% neutral buffered
I (collagen type I), ALP, OPN (osteopontin), and OCN (osteonectin) are formalin (NBF, PH. 7.26) for 48 h, decalcified in 19% EDTA, dehy-
listed in Table 1. Real-time PCR reactions were performed using the drated in an ascending grade of ethanol solutions (70, 90 and 100%),
Rotor-Gene SYBER Green PCR Kit (Qiagen, USA). The thermal cycling cleared in zylol and embedded in paraffin wax. Paraffin-embedded
conditions comprised an initial denaturation step at 95 °C for 10 min, sections were sequentially sliced at the thickness of 5 μm and stained
followed by 40 cycles at 95 °C for 30 s, 60 °C for 30 s and 72 °C for 30 s. with Hematoxylin & Eosin (H&E, Sigma Aldrich-USA) and Masson's
All the experiments were repeated in triplicate for each sample. The trichrome (MT, Sigma Aldrich-USA). Masson's trichrome stains the
expression levels of each target gene were normalized with GAPDH collagen fibers in blue and the mature bone in red color.
(glyceraldehyde-3- phosphate dehydrogenase) as a housekeeping gene To evaluate newly formed bone in the defect sites, im-
and relative gene expression was calculated by 2−ΔΔCt method. munohistochemical staining was carried out against OCN as a late os-
teogenic marker. Briefly, histological sections were deparaffinized, re-
2.4. Ion release of selected scaffold hydrated, and incubated in citrate buffer (Dako, Glostrup, Denmark)
solution to increase the accessibility of antigens. The sections were then
With regard to the results obtained from in vitro tests, the sample treated with 1% hydrogen peroxide in methanol (Sigma-Aldrich, St
containing Sr.TCP/BG: 50/50 was selected as the optimum scaffold for Louis, MO, USA) to inactivate endogenous peroxidase, incubated with
in vivo study. To study the ions released from the target sample, scaf- 1% bovine serum albumin (BSA) to block non-specific binding, and
folds were immersed in DMEM media at a ratio of 0.1 mg/mL and in- subsequently incubated with primary antibodies (OCN: ab13420,
cubated at 37 °C and 5% CO2 for 3, 7, 14 and 21 days. At each time Abcam, MA, USA) at 4 °C overnight. The color reaction was developed
point, elemental concentrations of calcium (Ca), phosphorus (P), silicon using chromogenic substrate 3,3′-Diaminobenzidine (Dako liquid DAB).
(Si), and strontium (Sr) were determined using inductively coupled Finally, samples were counterstained with hematoxylin to reveal the
plasma optical emission spectrometry (ICP-OES 730-ES; Varian). cell nuclei and the results were visualized by a light microscope
(Olympus BX51; Olympus, Tokyo, Japan).
2.5. In vivo bone regeneration
2.5.4. Histomorphometric analysis
2.5.1. Implantation procedures
The amount of the newly formed bone (NB), fibrous connective
Ten male New Zealand white rabbits with an average weight of
tissue (FCT), as well as the residual scaffolds (RS) in the defects area
2.5 kg and age of 5–6 months were used in this study. All experimental
were quantified by blinded histomorphometric analyses of random
procedures were carried out according to protocols approved by the
hematoxylin and eosin (H&E) images using computer software Image-
Committee on Animal Care at Faculty of Veterinary Medicine at the
Pro Plus® V.6 (Media Cybernetics, Inc., Silver Spring, USA). Percentages
University of Tehran. Following applying general anesthesia (ketamine
of the above-mentioned values in the different experimental groups
35 mg/kg and xylazine 5 mg/kg) for each animal, four 8.0-mm dia-
were calculated in relation to the total defect area as follows [35]:
meter symmetrical full-thickness defects were created across the sa-
gittal suture, which were assigned to the four experimental groups in- (NB/FCT/RS) area
NB/FCT/RS (%) = × 100
cluding bare scaffold, cell-loaded scaffold (1 × 106 cell/scaffold), original total defect area (1)
commercial sample (TRI-CALCIT®HACP, TEXTILE HI-TEC: composed of
60% HA and 40% β-TCP) and untreated control group. The treatment In addition, the number of cells including fibroblasts, fibrocytes,
modalities were randomly allocated to the first animal and thereafter osteoblasts, osteocytes, osteoclasts, and osteons were blindly counted
rotating them in a clockwise manner for other animals. After im- (at 400× magnification) and analyzed.
plantation, the subcutaneous and skin incisions were closed with PGA
and nylon 3–0 sutures, respectively. Post-surgical pain and distress 2.6. Statistical analysis
were managed by subcutaneous administration of tramadol (0.5 mg/
kg). All quantitative data were presented as the mean ± standard de-
viation. Statistical differences were evaluated by one-way analysis of
2.5.2. Radiological and CT examination variance (ANOVA) followed by Tukey's HSD test using the GraphPad
Two and five months after implantation, the rabbits were sacrificed Prism software, Version 6.00 (GraphPad Prism, Inc., San Diego, CA).
(five animals per time point) by an overdose of carbon dioxide (CO2) p < 0.05 was considered to be statistically significant.

3
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Fig. 1. (a) Macrostructure, microstructure and cellular response (MG-63 cell line, following 72 h of incubation) of optimized scaffolds were evaluated by SEM
imaging. (b) Compressive stress-strain curves (left) and compressive strength (right) of developed scaffolds revealed a remarkable improvement by the incorporation
of BG into the β-TCP matrix.

3. Results and discussion a glassy phase to the ceramic composition can be an alternative way.
During the sintering process, the glassy ceramic part is partially molten
3.1. Scaffolds fabrication and characterization and fills out the spaces between ceramics particles. This phenomenon
improves the mechanical properties of sintered bodies. It is expected
The macrostructure, microstructure, and cellular adhesion, as well that by increasing the BG content in the β-TCP bodies, the mechanical
as the stress-strain curve and compressive strength of the nanocompo- properties of nanocomposite scaffolds are improved. As can be seen in
site scaffolds, are presented in Fig. 1. Morphological examination of the Fig. 1a, by increasing the BG content, in the case of 50Sr-TCP/50BG and
scaffolds by SEM revealed the highly interconnected porous structure 25Sr-TCP/75BG samples, a large amount of BG is melted and bigger
having pores with the diameter in the range of 100–500 μm (Fig. 1a). agglomerated particles are formed. This phenomenon results in chan-
Fig. 1a shows the high-resolution SEM micrographs of sintered ging the morphology and microstructure of sintered scaffolds. The re-
scaffolds. One of the main limitations of using ceramic bodies like sults of evaluating of the microstructure of sintered scaffolds and
calcium silicate and calcium phosphate ceramics is their poor me- changing of compressive strength of Sr-TCP scaffold with increasing the
chanical properties which limit their load bearing. Adding a glassy BG content meet each other perfectly. It is notable that precocious
phase to the ceramic composition can be an alternative way. During the crystallization of 45S5 bioglass at about 610 °C retards its densification
sintering process, the glassy ceramic part is partially molten and fills during sintering process which leads to the retaining micropores even at
out the spaces between ceramics particles. This phenomenon improves elevated sintering temperature [12]. As can be seen, by increasing BG
the mechanical properties of sintered bodies. It is expected that by in- content, the liquid BG phase is increased and results in improving the
creasing the BG content in the β-TCP bodies, the mechanical properties compressive strength (Fig. 1b). The results obtained by this study for
of nanocomposite scaffolds be improved. the measured compressive strength of the prepared scaffolds with the
Fig. 1a shows the high-resolution SEM micrographs of sintered porosity in the range of 68–74% meet the results reported by Kaura
scaffolds. One of the main limitations of using ceramic bodies like et al. [36], perfectly. Another interesting point from Fig. 1b is the
calcium silicate and calcium phosphate ceramics is their poor me- presence of valleys and peaks which is related to the progressive
chanical properties which limit their load bearing applications. Adding breaking down of the highly-porous scaffold structure [36].

4
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Fig. 2. (a) Alkaline phosphatase (ALP) activity of BM-MSCs cultured on selected scaffolds for 7 and 14 days. (b) Alizarin red staining of BM-MSCs cultured in
conditioned media from selected scaffolds after 21 days of incubation. The obtained results indicated a significantly higher amount of calcium mineralization in the
Sr.TCP/BG: 50/50 sample in comparison to other groups.

In vitro MG63 cells seeding on the scaffold and evaluating their at- greater amount of strontium ion available in nanocomposite containing
tachment using SEM (Fig. 1a), proved that all nanocomposite scaffolds, 75% Sr-TCP not only showed a more convenient release of effective ions
particularly 50Sr-TCP/50 BG, could support cellular adhesion well. In but also induce osteogenesis in MSCs. In addition, MSCs respond better
the case of 50Sr-TCP/50BG, the whole surface of the scaffold covered in a stiffer substrate [38] and 50Sr-TCP/50BG nanocomposite offered a
by a dense layer of cells indicating that the scaffold provides a favorable more favorable microenvironment for cultivated cells to adhere, pro-
surface for seeded cells. liferate, and encourage their cellular activity including elevated ALP
production.
3.2. Further in vitro studies
3.2.2. Matrix mineralization
3.2.1. Alkaline phosphatase activity Extracellular matrix mineralization is the ultimate osteogenic dif-
ALP is secreted by osteogenic-committed MSCs in the early stages of ferentiation step of MSCs and always considered as a definitive hall-
the bone formation process and is known as an early interim osteogenic mark of progressive differentiation of stem cells into mature bone cells
differentiation marker. This enzyme is involved at the beginning of [39]. To assess the amount of extracellular matrix mineralization, Ali-
matrix calcification through increasing the free phosphate ions level zarin Red-S (ARS) staining which binds selectively to calcium cations
which afterward interacts with Ca2+ cations to precipitate the initial was used. ARS staining indicated a significantly higher amount of cal-
amorphous CaP clusters [37]. To verify the early differentiation of cium mineralization in the 50Sr-TCP/50BG sample in comparison to
MSCs grown on the selected scaffolds toward bone-forming cells, the other groups (Fig. 2b). MSCs cultured in 75Sr-TCP/25BG conditioned
extracellular ALP activity was assessed at days 7 and 14 of culture. media also demonstrated small red nodules dispersed throughout the
Fig. 2a shows the ALP activities of osteogenic-induced MSCs on dif- well surface, while in other groups only interspersed reddish areas were
ferent scaffolds at 7 and 14 days. The activity of ALP was elevated in all evident. These results show that 50Sr-TCP/50BG could better promote
experimental groups and gradually increased over time. Also, the ALP the in vitro formation of mineralized calcium nodules and guide the
level in cells treated with Sr containing scaffolds was higher compared MSCs toward the fully differentiated osteoblast.
with the same Sr-free compositions. However, among all types of
scaffolds studied, the 50Sr-TCP/50BG sample showed the highest level 3.2.3. Real time PCR (RT-PCR)
of ALP activity at both time points. It seems that the total released ions Osteogenic differentiation of MSCs consists of cell proliferation,
(Ca, Sr, and Si) during the dissolution of nanocomposite scaffold could matrix maturation, and mineralization phases. During different phases,
effectively stimulate osteogenic differentiation of MSCs. Also, the the expression level of osteogenic-related genes reveals characteristic

5
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Fig. 3. (c) mRNA expression level of early (Col-I and ALP) and late (OPN and OCN) osteoblastic genes in BM-MSCs cultured on the different scaffolds at day 21. The
expression level of GAPDH gene was used as an internal control. Expression of mineralization specific markers by the osteo-differentiated BM-MSCs was greater in
Sr.TCP/BG: 50/50 sample (*p < 0.05, **p < 0.01, and ***p < 0.001).

variation which may be key markers in osteodifferentiation of MSCs. 10 mol% of Sr into calcium silicate ceramic results in a higher osteos-
ALP and Col-I are considered as early differentiation markers which up- timulatory effect on MSCs of ovariectomized rats due to the combined
regulate at the initial phase of osteogenesis while OPN and OCN are effect of Si and Sr ions on osteogenesis process [41]. The highest ex-
known as late osteogenic markers and express by mature osteoblast pression level of OPN and OCN as mature osteogenic markers is asso-
[37]. Osteogenic differentiation of MSCs was followed by evaluating ciated with 50Sr-TCP/50BG nanocomposite, indicating that this scaf-
mRNA expression levels of COL-I, ALP, OPN, and OCN. The results of fold possesses the most capable compound for inducing and
RT-PCR showed that the above-mentioned osteogenesis gene markers accelerating the osteo-differentiation of MSCs among selected scaffolds.
were up-regulated in the MSCs cultured in all experimental groups
compared to cells cultured in only DMEM medium at day 21 (Fig. 3).
Analysis of data revealed that strontium substitution relatively affected 3.3. Ion release evaluation
the gene expression of cells grown on the samples containing Sr2+
compared to those cultivated on the undoped scaffolds. However, the With regard to the obtained results, 50Sr-TCP/50BG nanocomposite
mRNA expression level of COL-I was significantly higher in 100Sr-TCP/ was selected as the optimum scaffold for in vivo evaluation. Before the
0BG and 25Sr-TCP/75BG scaffold samples compared to others. The animal study, the ionic releases of the chosen scaffold were monitored
highest expression level of ALP was also observed in the 100Sr-TCP/ using ICP-OES for up to 21 days in DMEM culture medium (Fig. 4). As
0BG scaffold. Moreover, greater up-regulation of mineralization-spe- can be seen in this figure, there is an incremental trend of Ca and Sr ions
cific genes; OPN and OCN was evident in cells cultured on the 50Sr- release from day 3 to 14 which gradually reach a plateau by day 21.
TCP/50BG and 75Sr-TCP/25BG scaffolds, compared to other composi- Moreover, the measured amount of phosphorous ion was significantly
tions. lower and was released more slowly than other elements at each time
According to the obtained results, all selected scaffolds could in- points of immersion. Apart from the different content of these ions in
crease the expression of targeted genes. The higher expression level of the structure of the scaffold, which leads to the different levels of re-
analyzed genes in the scaffolds containing Sr ion represented the ef- lease, leached Ca and Sr ions may incorporate with P ions and redeposit
fective role of Sr2+ in osteogenesis process. No YJ et al. showed that in the form of apatite which also results in decreasing the level of de-
incorporation of Sr into calcium silicate based ceramic at a concentra- tected phosphate ions in the media. However, the values of Ca and Sr
tion of 2 mol% increased the expression level of early and late osteo- were in the range of 39–89 ppm and 5–17 ppm, respectively which can
genic genes compared to un-doped bioceramic [40]. In another study induce stimulatory effects on MSCs activities. As can be seen in Fig. 4,
performed by Lin et al., it was demonstrated that incorporation of the silicon release curve shows a mild increasing trend over the in-
cubation time with the concentration in the range of 68–94 ppm. Si

6
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

biomineralization and inducing the deposition of CaP crystals from

electrolyte solutions in the later stages [18]. The percentage of the
abovementioned ions in the different selected scaffolds is an important
factor which influences the osteogenic differentiation of BM-MSCs.

3.4. In vivo study

The in vivo experiments was carried out using a critical-sized rabbit

calvarial defect (Fig. 5) model to evaluate the osteogenic potential of
the final optimal scaffold (50Sr-TCP/50BG) along with the MSCs. The
bare scaffold was used as primary implant material whereas nano-
composite scaffold containing MSCs was employed as the biological
engineered construct. Commercial HA/TCP granules were used as a
criterion which is known to be bioresorbable and bioactive. Bone re-
generation was assessed at 2 and 5 months' post-surgery using con-
ventional radiography to investigate defect closure, histological (H&E
and MT staining), immunohistochemical (OCN), and histomorphome-
trical analysis to pursue the regeneration and healing of created defects.

Fig. 4. (d) Ionic concentrations of Ca, P, Si, and Sr released into DMEM medium
3.4.1. Radiological and CT analysis
from the Sr.TCP/BG: 50/50 nanocomposite, at 3, 7, 14 and 21 days post cul-
turing.
Fig. 5b represents the radiographic and CT images of calvarial bones
of sacrificed rabbits at 2 and 5 months post-operation. While the un-
treated defects in control group demonstrate a radiolucent zone at 2
concentration, up to 103 ppm has been reported to be cytocompatible and 5 months' time points, a high-dense radio-opaque area was ob-
and promote osteogenic and angiogenic processes [42]. served at the defect site in both bare and cell-loaded TCP/BG scaffold
Numerous researches have shown that MSCs proliferation and dif- groups with no obvious distinction between the regenerated bone and
ferentiation toward osteogenic lineage, as well as the rate of develop- the remnants of the glass-ceramic scaffold. Also, there are radiolucent
ment and mineralization of extracellular matrix (ECM), are augmented gaps evident in the radio-dense mass in the free scaffolds. Defects
by the presence of Sr ions, in the range of 8.7–87 ppm [19,43]. More- treated with HA/TCP granules indicate sporadic low-density radio-
over, it is well-known that extracellular calcium (the most abundant paque areas at 2-month post-implantation though there was an increase
mineral in the natural bone), in the range of 80–400 ppm has great in radiodensity in five-month samples. As expected, quantification
effects on the chemoattraction, proliferation, and differentiation of analysis (Fig. 5c) indicated greater radiopacity in the defects treated
endogenous MSCs and osteoblast cells [44,45]. Silicon (Si) also pos- with cell-free scaffolds in comparison with other samples. Fig. 5b also
sesses osteostimulative behavior and stimulates osteogenesis and an- shows the CT images of the calvarial defects which are treated with
giogenesis processes [43,46]. Different studies have shown that Si ion different bioceramic implants after 2 and 5 months which were in
hastens the rate of ECM formation and mineralization by stimulating agreement with radiological observations. While untreated control
Col-I synthesis and its stabilization in the initial phases of group revealed peripheral bone formation, in both bare scaffolds and

Fig. 5. (a) Four critical-sized defects (8-mm in diameter) were made in the parietal bone of rabbits using a trephine bur. The created defects were assigned into four
different groups including bare scaffold, MSCs-loaded scaffold, HA/TCP granules as the commercial sample, and untreated defects as the negative control. (b) X-ray
images of the experimental groups at 2 and 5 months post operation. C: control group, S: scaffold, CS: cell-loaded scaffold, and G: HA/TCP granules. (c) Comparison
of radiopacity on created defects in different group at 2 and 5 months. Radiopacity in only scaffold group were higher than other group.

7
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Fig. 6. Histological analysis (H&E and MT staining) of new bone formation in different experimental groups at 2 months post implantation. FT: fibrous tissue, F: Fat
tissue, LACT: loose areolar connective tissue, OB: old bone, NB: new bone, BM: bone marrow, SC: scaffold, Ag: angiogenesis, MNIC: mononuclear inflammatory cells,
GC: giant cells, Asteroid: inflammatory cells.

MSCs-loaded scaffolds groups, the created defect had been completely scaffold. Although the signs of degradation were evident in radiography
closed, without detectable distinction among regenerated bone and imaging, the presence of stiff glass-ceramic scaffold prevents further
scaffold remnants, at both time points. In HA/TCP granules treated growth of new bone tissue. Macrophage infiltration to the defect site is
group gap closure occurred in 5 months following new bone growth. a part of the initial acute inflammatory reaction to the biomaterial
However, to confirm the nature of the filling materials in different implantation [47]. However, the presence of a dense accumulation of
groups, histological evaluation is required as will be discussed in the the macrophages and lymphocytes after 2 months implantation, in-
next sections. dicate the transition to the chronic inflammatory (CI) condition in re-
sponse to the non-degrading biomaterial. Following CI reaction, bone
3.4.2. Histological and immunohistochemical observations regeneration may be hampered and shift to a fibrotic function [48]. The
Fig. 6 shows the H&E and MT staining images of the different groups MT staining reveals the penetration of fibrous connective tissue into the
at 2 months post-implantation. Histological analysis revealed a sig- porous structure.
nificant difference in the amount of newly formed bone tissue among In the defects filled by cell-loaded scaffolds, the major part of the
the various applied treatments. The untreated defects were filled with scaffold was resorbed and replaced with new bone tissue and ECM
fibrous connective tissue (FCT) and slight bone formation occurred only formed both at the peripheral and central part of the defect at 2 months
around the margin of the defect. post-implantation. Although several giant cells were observed at the
In cell-free scaffold group, the main part of the scaffold defect site, the number of infiltrated inflammatory cells reduced sig-
(80.0 ± 4.2%) remained relatively intact which was surrounded by nificantly compared to other groups. Also, the cell-loaded construct was
FCT. The newly formed bone was predominantly observed in the cen- entirely integrated into the newly organized bone matrix and neo-
tral region of the defect. The dense accumulation of inflammatory vascularization was detectable in this group. These observations in-
mononuclear cells including macrophages and lymphocytes was also dicate that besides the high stiffness, the nanocomposite scaffold has
evident in the implant site. Due to the invasion of periosteal osteo- provided a suitable environment for cell growth and differentiation
progenitor cells to the damaged site, new bone was formed at the which explicitly resulted in the enhanced new bone formation and
peripheral areas of the defect as well as on the surface of the implanted scaffold bio-resorption.

8
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Fig. 7. Histological analysis (H&E and MT staining) of new bone formation in different experimental groups at 5 months post implantation. FT: fibrous tissue, F: Fat
tissue, MB: muscle bundle, OB: old bone, NB: new bone, MB: mature bone, BM: bone marrow, BB: bone bridge, HC: hyaline cartilage, SC: scaffold, Ag: angiogenesis,
Asteroid: inflammatory cells.

It is notable that in the physiological environment (in vivo), the β-TCP as a soluble phase which gradually dissolves in vivo and promotes
dissolution of the nanocomposite scaffold and cell-mediated degrada- bone formation due to the release of Ca and P ions. The histopatholo-
tion (Giant cells, osteoclasts, and metabolic activity of osteogenically gical evaluation of the defect filled by commercial sample (CS) showed
differentiated MSCs) are two important processes that influence the that the HA/TCP granules were replaced by FCT at 2 months post-sur-
biodegradation rate of the implanted scaffold [49]. The fast in vivo gery. However, a small number of granules were remained intact in the
degradation of nanocomposite scaffold, on one hand, leads to the re- defect area. Angiogenesis and infiltration of numerous mononuclear
lease of a high amount of ionic products and on the other hand provide inflammatory cells (macrophages) were also observed in this group.
more void space for new bone ingrowth. The inflammatory reaction Furthermore, MT staining shows a dense layer of collagen fibers at the
consists of multinucleated giant cells, the fused morphologic variant of top of the defect which can be associated with the osteoid formation.
macrophages, which are the end-stage response to biomaterial im- After 5 months of implantation (Fig. 7), a dense FCT had filled the
plantation and continue to exist at the defect site for the lifetime of the blank defects in the untreated group and new bone formation was
implant [50]. In comparison to the free scaffold group, the subsidence limited to the periphery of the native bone. For the bare scaffold, with
of inflammatory response can be assigned to the immunomodulatory increasing implantation time for up to 5 months, the nanocomposite
effects of MSCs as well as the elimination of scaffold resistance to de- was further degraded and new bone formation took place mainly from
gradation and removal of implanted material from the defect area. Also, the periphery of the defect as well as on the surface of the scaffold.
osteoclasts were detected in conjunction with this experimental group. Plenty of epithelioid macrophages and lymphocytes were detected in
Both giant cells and osteoclast are involved in scaffold degradation. the implantation site. Moreover, angiogenesis had occurred around the
In the CS group, HA/TCP granules (TRI-CALCIT®HACP 550) were implanted material vivid by the presence of new capillaries and vessels.
used as the commercial sample to compare its biological performance Five-month post-implantation, in the cell-loaded scaffold group, the
with the prepared nanocomposite scaffold. HACP 550 is an absorbable engineered tissue construct was almost resorbed and replaced with new
and bioactive synthetic bone substitute which is designed for ortho- bone and the bone marrow was successfully reformed (Fig. 7). Miner-
pedic and traumatological surgery needs as bone filling. This homo- alization of the osteoids apparently occurred at this time and new bone
genous composite is composed of 60% HA as the stable phase and 40% tissue bridged the defect surface. Although it seems that the newly

9
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Fig. 8. (a) Immunohistochemical staining against osteocalcin (brown color) produced by osteoblasts within different experimental groups at 2 and 5 months post
implantation. (b) A significantly higher degree of positive osteocalcin was detected in the cell-loaded scaffold group at both time points. (For interpretation of the
references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 9. The percentage of new bone and fibrous connective tissue formation in different experimental groups at 2 and 5 months post implantation which are
expressed as the ratio of the neoformative bone or connective tissue area to the original total defect area (*p < 0.05, **p < 0.01, and ***p < 0.001).

regenerated bone in this group was shaped via intramembranous ossi- As can be seen in Fig. 7, in the CS treated samples 5 months after
fication, in some area, the endochondral ossification was evident as implantation, it seems that all of the HA/TCP granules were resorbed or
well. The amount of newly formed bone in defects treated with MSC- incorporated into the formation of a new osseous matrix which bridged
loaded scaffolds was considerably higher in comparison to other ex- the defect surface. Furthermore, hyaline cartilage was detected in these
perimental groups. In this group, the in-grown FCT could be easily samples which is the sign of the endochondral ossification process oc-
identified from the red-colored mature bone (Fig. 7). curring in the non-vascularized environment and encourages vascular

10
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

Table 2
Histomorphometric findings of the repaired defects at 2 and 5 months post-implantation.
Valuable Control Scaffold MSCs-scaffold Granule

2 Months
Fibroblast + fibrocyte 114.8 ± 25.64a 85.7 ± 9.25a 54.3 ± 4.63b 92.2 ± 12.78a
Osteoblast + osteocyte 9.5 ± 1.63a 25.6 ± 6.77b 88.5 ± 13.41c 12.6 ± 1.42a
Osteoclast 0a 0a 4.4 ± 1.31b 0a
Osteon 2.1 ± 0.75a 8.3 ± 2.25c 25.6 ± 4.89d 4.7 ± 1.36b

5 Months
Fibroblast + fibrocyte 197.6 ± 14.7a 83.2 ± 7.8b 34.3 ± 8.7c 76.5 ± 10.4b
Osteoblast + osteocyte 15.5 ± 3.1a 53.2 ± 6.6b 153 ± 14.3c 92.4 ± 11.5d
Osteoclast 0a 0a 6.3 ± 1.2b 1.5 ± 0.7a
Osteon 3.2 ± 1.5a 7.7 ± 2.1a 48.9 ± 4.1b 24.4 ± 3.21c

a
One way ANOVA followed by Tukey post-hoc test.
b
P < 0.05 (2 vs. 1, 3 and 4).
c
P < 0.05 (2 vs. 1, 3, and 4).
d
P < 0.05 (2 vs. 1, 3, and 4).

ingrowth into the engineered constructs. properties. Among the solutions being considered, the adding of a
Histological observations were confirmed by immunohistochemical sintering aid such as BG has been attracted a lot of attention, in the
staining of osteocalcin. Fig. 8a clearly showed the different levels of recent years, to enhance sinterability and subsequently mechanical
OCN deposition among four experimental groups. Immunostaining of properties of β-TCP constructs [12,54].
OCN in the cell-free scaffolds showed sporadic bony islands extended In our previous study [32], we reported fabrication and character-
across the non-degradable scaffold. While, in the cell-loaded scaffolds ization of highly bioactive nanocomposite scaffolds based on Sr-doped
group, a dense deposition of OCN was observed homogenously β-TCP and 45S5 BG using foam replication method. We developed Sr-
throughout the defect area, which is indicative of a heavily mineralized TCP/BG composite scaffold with four different composition of Sr-TCP/
ECM. In CS treated group, OCN was detected in the region associated BG: 100/0, 75/25, 50/50, and 25/75. Total porosity values for Sr-TCP/
with osteoid and confirmed that HA/TCP granules guided new bone BG: 75/25, 50/50, and 25/75 scaffolds were measured to be about 74,
formation on the surface of the implanted materials. Thus, the obtained 72, and 68%, respectively [28]. In order to enhance the osteogenic
result indicates higher OCN deposition throughout the defects re- differentiation of BM-MSCs, Sr2+ ions were doped in the β-TCP struc-
generated with MSCs-loaded constructs when compared to cell-free ture at a concentration of 5 mol%. In order to develop fabricated scaf-
scaffolds or CS treated groups. Quantitative results (Fig. 8b) also con- folds in bone tissue engineering applications, more in vitro and in vivo
firm that the density of the positive stained OCN in the MSC-loaded experiments were necessary to be conducted.
scaffolds is remarkably higher than other groups at month 2 and 5 post- In the current study, we assessed the osteogenic potential of our
surgery. previously developed scaffolds along with bone-marrow derived MSCs
Altogether, these results emphasize the important role of the cells as by in vitro experiments, and on the basis of the obtained results, the best
the biologically functional components of the tissue-engineered con- scaffold was chosen for further in vivo study in the rabbit model. The
struct [51,52]. The observed results also demonstrate the importance of advantageous properties of MSCs including osteogenic differentiation
porous structure and the proper degradation rate of the scaffold for potential, low immunogenicity, immunomodulatory effects and their
appropriate bone growth. While the bare scaffold in this study could be easy available resource such as bone marrow make them a suitable
considered as an appropriate bone alternative for long-term treatments, candidate for cell-based bone tissue engineering strategies [55]. Based
MSCs loaded construct not only provided an appropriate mechanical on our obtained in vitro and in vivo results, our suggested osteogenic
strength as a bone substitute but also promoted bone regeneration in an construct is 50Sr-TCP/50BG containing MSCs which meet necessary
efficient and fast way. requirements for bone substitutes.

3.4.3. Histomorphometric analysis 4. Conclusion

The quantitative evaluation of NB and FCT percentage, as well as
the number of fibroblasts, fibrocytes, osteoblasts, osteocytes, osteo- In the current study, we first investigated the osteogenic potential of
clasts, and osteon, were carried out in all experimental groups at 2 and different nanocomposite scaffolds based on strontium substituted β-TCP
5 months post-implantation, and the results are shown in Fig. 9 and and 45S5 bioactive glasses (Sr-TCP/BG: 100/0, 75/25, 50/50, and 25/
Table. 2. Based on the presented data, the amount of regenerated bone 75) along with bone marrow-derived MSCs in vitro. The functional
tissue increased in all groups and consequently, the amount of fibrous evaluation of treated cells in terms of alkaline phosphatase enzyme
connective tissue was decreased over time. The percentage of the new activity, matrix mineralization and bone-specific protein expression at
bone area within the total defect region was significantly higher in the the mRNA level (Col-I, ALP, OPN, and OCN) and protein level (Col-I
cell-loaded scaffolds group at both time points. Also, the density of FCT and OCN) revealed the osteogenic potential of developed scaffolds.
and the number of fibroblasts and fibrocytes were considerably higher However, Sr-TCP/BG: 50/50 nanocomposite possessed the most cap-
in the control (untreated defects) and CS-treated groups compared with able compound for inducing and accelerating the osteodifferentiation of
scaffold-treated bone defects at 2 months' post-surgery. The notable MSCs. Therefore, this nanocomposite was nominated as the most fa-
point was the replacing of FCT with new bone in the CS-treated group vorable scaffold for in vivo study. Histological and im-
after 5 months implantation. munohistochemical observations showed that MSCs loaded construct
Calcium phosphate ceramics, particularly β-TCP, have received not only provided an appropriate mechanical strength as a bone sub-
significant attention for hard tissue engineering applications, due to stitute but also promoted bone regeneration in an efficient and fast way.
their remarkable chemical analogy to the mineral phase of the natural While the low degradation rate of bare scaffold or high resorption rate
bone and its osteoconduction properties [9,53]. However, many efforts of HA/TCP granules resulted in a delay of new bone formation and
have been made to eliminate its disadvantages, such as poor mechanical healing processes. So the bare scaffold could be considered as an

11
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

appropriate bone alternative for long-term treatments. differentiation of mesenchymal stem cells and in vivo bone formation by activating
wnt/catenin signaling, Stem Cells 29 (2011) 981–991, https://doi.org/10.1002/
stem.646.
Declaration of competing interest [20] S. Peng, G. Zhou, K.D. Luk, K.M. Cheung, Z. Li, W.M. Lam, Z. Zhou, W.W. Lu,
Strontium promotes osteogenic differentiation of mesenchymal stem cells through
The authors declare that they have no conflict of interest. the ras/MAPK signaling pathway, Cell. Physiol. Biochem. 23 (2009) 165–174,
https://doi.org/10.1159/000204105.
[21] S. Kargozar, N. Lotfibakhshaiesh, J. Ai, M. Mozafari, P. Brouki Milan, S. Hamzehlou,
Acknowledgments M. Barati, F. Baino, R.G. Hill, M.T. Joghataei, Strontium- and cobalt-substituted
bioactive glasses seeded with human umbilical cord perivascular cells to promote
bone regeneration via enhanced osteogenic and angiogenic activities, Acta
This project was financially supported by Iran National Science Biomater. 58 (2017) 502–514 https://doi https://doi.org/10.1016/j.actbio.2017.
Foundation (INSF) grant number 94806660. 06.021.
[22] M.G. Raucci, D. Giugliano, M. Alvarez-Perez, L. Ambrosio, Effects on growth and
osteogenic differentiation of mesenchymal stem cells by the strontium-added
References
sol–gel hydroxyapatite gel materials, J. Mater. Sci. Mater. Med. 26 (2015) 90,
https://doi.org/10.1007/s10856-015-5436-0.
[1] C. Schlundt, C.H. Bucher, S. Tsitsilonis, H. Schell, G.N. Duda, K. Schmidt-Bleek, [23] K. Glenske, P. Donkiewicz, A. Köwitsch, N. Milosevic-Oljaca, P. Rider, S. Rofall,
Clinical and research approaches to treat non-union fracture, Curr Osteoporos Rep J. Franke, O. Jung, R. Smeets, R. Schnettler, Applications of metals for bone re-
16 (2018) 155–168, https://doi.org/10.1007/s11914-018-0432-1. generation, Int. J. Mol. Sci. 19 (2018) 826 https://doi https://doi.org/10.3390/
[2] S. Tavakol, M. Azami, A. Khoshzaban, I. Ragerdi Kashani, B. Tavakol, E. Hoveizi, ijms19030826.
S.M. Rezayat Sorkhabadi, Effect of laminated hydroxyapatite/gelatin nanocompo- [24] M. T Langhans, S. Yu, R. S Tuan, Stem cells in skeletal tissue engineering: tech-
site scaffold structure on osteogenesis using unrestricted somatic stem cells in rat, nologies and models, Curr. Stem Cell Res. Ther. 11 (2016) 453–474 (26423296).
Cell Biol. Int. 37 (2013) 1181–1189, https://doi.org/10.1002/cbin.10143. [25] M. Azami, J. Ai, S. Ebrahimi-Barough, M. Farokhi, S.E. Fard, In vitro evaluation of
[3] K.S. Griffin, K.M. Davis, T.O. McKinley, J.O. Anglen, T.-M.G. Chu, J.D. Boerckel, biomimetic nanocomposite scaffold using endometrial stem cell derived osteoblast-
M.A. Kacena, Evolution of bone grafting: bone grafts and tissue engineering stra- like cells, Tissue&Cell 45 (2013) 328–337, https://doi.org/10.1016/j.tice.2013.05.
tegies for vascularized bone regeneration, Clin. Rev Bone Miner. Metab. 13 (2015) 002.
232–244, https://doi.org/10.1007/s12018-015-9194-9. [26] A. Shamosi, D. Mehrabani, M. Azami, S. Ebrahimi-Barough, V. Siavashi,
[4] J. Stanovici, L.-R. Le Nail, M. Brennan, L. Vidal, V. Trichet, P. Rosset, P. Layrolle, H. Ghanbari, E. Sharifi, R. Roozafzoon, J. Ai, Differentiation of human endometrial
Bone regeneration strategies with bone marrow stromal cells in orthopaedic sur- stem cells into endothelial-like cells on gelatin/chitosan/bioglass nanofibrous
gery, Curr Res Transl Med 64 (2016) 83–90, https://doi.org/10.1016/j.retram. scaffolds, Artif. Cells, Nanomed., Biotechnol. 45 (2017) 163–173, https://doi.org/
2016.04.006. 10.3109/21691401.2016.1138493.
[5] A. Ehterami, M. Kazemi, B. Nazari, P. Saraeian, M. Azami, Fabrication and char- [27] S. Kargozar, S.J. Hashemian, M. Soleimani, P.B. Milan, M. Askari, V. Khalaj,
acterization of highly porous barium titanate based scaffold coated by gel/HA na- A. Samadikuchaksaraie, S. Hamzehlou, A.R. Katebi, N. Latifi, M. Mozafari, F. Baino,
nocomposite with high piezoelectric coefficient for bone tissue engineering appli- Acceleration of bone regeneration in bioactive glass/gelatin composite scaffolds
cations, J. Mech. Behav. Biomed. Mater. 79 (2018) 195–202, https://doi.org/10. seeded with bone marrow-derived mesenchymal stem cells over-expressing bone
1016/j.jmbbm.2017.12.034. morphogenetic protein-7, Mater. Sci. Eng. C 75 (2017) 688–698, https://doi.org/
[6] A. Wubneh, E. Tsekoura, C. Ayranci, H. Uludag, Current state of fabrication tech- 10.1016/j.msec.2017.02.097.
nologies and materials for bone tissue engineering, Acta Biomater. 80 (2018) 1–30, [28] A. Oryan, A. Kamali, A. Moshiri, M.B. Eslaminejad, Role of mesenchymal stem cells
https://doi.org/10.1016/j.actbio.2018.09.031. in bone regenerative medicine: what is the evidence? Cells Tissues Organs 204
[7] D. Tang, R.S. Tare, L.-Y. Yang, D.F. Williams, K.-L. Ou, R.O. Oreffo, Biofabrication (2017) 59–83 https://doi https://doi.org/10.1159/000469704.
of bone tissue: approaches, challenges and translation for bone regeneration, [29] J. Lin, J. Shao, L. Juan, W. Yu, X. Song, P. Liu, W. Weng, J. Xu, C. Mehl, Enhancing
Biomaterials 83 (2016) 363–382, https://doi.org/10.1016/j.biomaterials.2016.01. bone regeneration by combining mesenchymal stem cell sheets with ß-TCP/COL-I
024. scaffolds, J. Biomed. Mater. Res., Part B. 106 (2018) 2037–2045 https://doi
[8] M. Salehi, M. Naseri Nosar, A. Amani, M. Azami, S. Tavakol, H. Ghanbari, https://doi.org/10.1002/jbm.b.34003.
Preparation of pure PLLA, pure chitosan, and PLLA/chitosan blend porous tissue [30] J. Ma, S.K. Both, F. Yang, F.-Z. Cui, J. Pan, G.J. Meijer, J.A. Jansen, J.J. van den
engineering scaffolds by thermally induced phase separation method and evalua- Beucken, Concise review: cell-based strategies in bone tissue engineering and re-
tion of the corresponding mechanical and biological properties, Int. J. Polym. generative medicine, Stem Cells Transl. Med. 3 (2014) 98–107, https://doi.org/10.
Mater. Polym. Biomater. 64 (2015) 675–682, https://doi.org/10.1080/00914037. 5966/sctm.2013-0126.
2014.1002093. [31] V.J. Coulson-Thomas, Y.M. Coulson-Thomas, T.F. Gesteira, W.W.-Y. Kao, Extrinsic
[9] P. Gao, H. Zhang, Y. Liu, B. Fan, X. Li, X. Xiao, P. Lan, M. Li, L. Geng, D. Liu, Beta- and intrinsic mechanisms by which mesenchymal stem cells suppress the immune
tricalcium phosphate granules improve osteogenesis in vitro and establish in- system, Ocul Surf 14 (2016) 121–134, https://doi.org/10.1016/j.jtos.2015.11.004.
novative osteo-regenerators for bone tissue engineering in vivo, Sci. Rep. 6 (2016) [32] M. Kazemi, B. Nazari, J. Ai, N. Lotfibakhshaiesh, A. Samadikuchaksaraei,
23367, , https://doi.org/10.1038/srep23367. S.M. Tavangar, M. Azami, Preparation and characterization of highly porous
[10] P. Feng, P. Wu, C. Gao, Y. Yang, W. Guo, W. Yang, A multimaterial scaffold with ceramic-based nanocomposite scaffolds with improved mechanical properties using
tunable properties: toward bone tissue repair, Adv Sci 5 (2018) 1700817, , https:// the liquid phase-assisted sintering method, Proc. Inst. Mech. Eng., Part L. (2018),
doi.org/10.1002/advs.201700817. https://doi.org/10.1177/1464420718795186 (1464420718795186).
[11] P. Feng, J. He, S. Peng, C. Gao, Z. Zhao, S. Xiong, C. Shuai, Characterizations and [33] S. Ali Poursamar, Alexander N. Lehner, Mahmoud Azami, Somayeh Ebrahimi-
interfacial reinforcement mechanisms of multicomponent biopolymer based scaf- Barough, Ali Samadikuchaksaraei, A. Paula M Antunes, The effects of crosslinkers
fold, Mater. Sci. Eng. C. 100 (2019) 809–825, https://doi.org/10.1016/j.msec. on physical, mechanical, and cytotoxic properties of gelatin sponge prepared via in-
2019.03.030. situ gas foaming method as a tissue engineering scaffold, Mater. Sci. Eng. C 63
[12] D. Bellucci, A. Sola, A. Anesi, R. Salvatori, L. Chiarini, V. Cannillo, Bioactive glass/ (2016) 1–9, https://doi.org/10.1016/j.msec.2016.02.034.
hydroxyapatite composites: mechanical properties and biological evaluation, [34] M.R.M. Dezfouli, M.J. Fakhr, S.S. Chaleshtori, M.M. Dehghan, A. Vajhi,
Mater. Sci. Eng. C Mater. Biol. Appl. 51 (2015) 196–205, https://doi.org/10.1016/j. R. Mokhtari, Intrapulmonary autologous transplant of bone marrow-derived me-
msec.2015.02.041. senchymal stromal cells improves lipopolysaccharide-induced acute respiratory
[13] C. Shuai, P. Li, J. Liu, S. Peng, Optimization of TCP/HAP ratio for better properties distress syndrome in rabbit, Crit. Care 22 (2018) 353, https://doi.org/10.1186/
of calcium phosphate scaffold via selective laser sintering, Mater. Charact. 77 s13054-018-2272-x.
(2013) 23–31, https://doi.org/10.1016/j.matchar.2012.12.009. [35] B. Johari, M. Ahmadzadehzarajabad, M. Azami, M. Kazemi, M. Soleimani,
[14] C. Shuai, Y. Xu, P. Feng, G. Wang, S. Xiong, S. Peng, Antibacterial polymer scaffold S. Kargozar, S. Hajighasemlou, M.M. Farajollahi, A. Samadikuchaksaraei, Repair of
based on mesoporous bioactive glass loaded with in situ grown silver, Chem. Eng. J. rat critical size calvarial defect using osteoblast-like and umbilical vein endothelial
374 (2019) 304–315, https://doi.org/10.1016/j.cej.2019.03.273. cells seeded in gelatin/hydroxyapatite scaffolds, J. Biomed. Mater. Res., Part A. 104
[15] D. Bellucci, A. Sola, V. Cannillo, Hydroxyapatite and tricalcium phosphate com- (2016) 1770–1778, https://doi.org/10.1002/jbm.a.35710.
posites with bioactive glass as second phase: state of the art and current applica- [36] G. Kaura, V. Kumar, F. Baino, J.C. Mauro, G. Pickrell, I. Evans, O. Bretcanu,
tions, J. Biomed. Mater. Res., Part A. 104 (2016) 1030–1056, https://doi.org/10. Mechanical properties of bioactive glasses, ceramics, glass-ceramics and compo-
1002/jbm.a.35619. sites: state-of-the-art review and future challenges, Mater. Sci. Eng. C. 104 (2019)
[16] M. Rizwan, M. Hamdi, W. Basirun, Bioglass® 45S5-based composites for bone tissue 109895, https://doi.org/10.1016/j.msec.2019.109895.
engineering and functional applications, J. Biomed. Mater. Res., Part A. 105 (2017) [37] P. Gupta, M. Adhikary, M. Kumar, N. Bhardwaj, B.B. Mandal, Biomimetic, osteo-
3197–3223, https://doi.org/10.1002/jbm.a.36156. conductive non-mulberry silk fiber reinforced tricomposite scaffolds for bone tissue
[17] S. Duan, P. Feng, C. Gao, T. Xiao, K. Yu, C. Shuai, S. Peng, Microstructure evolution engineering, ACS Appl. Mater. Interfaces 8 (2016) 30797–30810 https://doi
and mechanical properties improvement in liquid-phase-sintered hydroxyapatite by https://doi.org/10.1021/acsami.6b11366.
laser sintering, Materials 8 (2015) 1162–1175, https://doi.org/10.3390/ [38] L. Ghasemi-Mobarakeh, M.P. Prabhakaran, L. Tian, E. Shamirzaei-Jeshvaghani,
ma8031162. L. Dehghani, S. Ramakrishna, Structural properties of scaffolds: crucial parameters
[18] S. Bose, G. Fielding, S. Tarafder, A. Bandyopadhyay, Understanding of dopant-in- towards stem cells differentiation, World j Stem Cells 7 (2015) 728–744, https://
duced osteogenesis and angiogenesis in calcium phosphate ceramics, Trends doi.org/10.4252/wjsc.v7.i4.728.
Biotechnol. 31 (2013) 594–605, https://doi.org/10.1016/j.tibtech.2013.06.005. [39] J.-M. Lee, M.-G. Kim, J.-H. Byun, G.-C. Kim, J.-H. Ro, D.-S. Hwang, B.-B. Choi, G.-
[19] F. Yang, D. Yang, J. Tu, Q. Zheng, L. Cai, L. Wang, Strontium enhances osteogenic C. Park, U.-K. Kim, The effect of biomechanical stimulation on osteoblast

12
M. Kazemi, et al. Materials Science & Engineering C 105 (2019) 110071

differentiation of human jaw periosteum-derived stem cells, Maxillofacial Plastic 5671–5701, https://doi.org/10.3390/ma8095269.
and Reconstructive Surgery 39 (2017), https://doi.org/10.1186/s40902-017- [48] R.M. Boehler, J.G. Graham, L.D. Shea, Tissue engineering tools for modulation of
0104-6. the immune response, Biotechniques 51 (2011) 239, https://doi.org/10.2144/
[40] C. Wu, Y. Ramaswamy, D. Kwik, H. Zreiqat, The effect of strontium incorporation 000113754.
into CaSiO3 ceramics on their physical and biological properties, Biomaterials 28 [49] Y. Zhang, W. Yu, Z. Ba, S. Cui, J. Wei, H. Li, 3D-printed scaffolds of mesoporous
(2007) 3171–3181, https://doi.org/10.1016/j.biomaterials.2007.04.002. bioglass/gliadin/polycaprolactone ternary composite for enhancement of com-
[41] K. Lin, L. Xia, H. Li, X. Jiang, H. Pan, Y. Xu, W.W. Lu, Z. Zhang, J. Chang, Enhanced pressive strength, degradability, cell responses and new bone tissue ingrowth, Int. J.
osteoporotic bone regeneration by strontium-substituted calcium silicate bioactive Nanomedicine 13 (2018) 5433–5447, https://doi.org/10.2147/IJN.S164869.
ceramics, Biomaterials 34 (2013) 10028–10042, https://doi.org/10.1016/j. [50] J.M. Anderson, A. Rodriguez, D.T. Chang, Foreign body reaction to biomaterials,
biomaterials.2013.09.056. Semin. Immunol. 20 (2008) 86–100, https://doi.org/10.1016/j.smim.2007.11.004.
[42] S. Poursamar, M. Rabiee, A. Samadikuchaksaraei, M. Tahriri, M. Karimi, M. Azami, [51] M. Kazemi, M. Azami, B. Johari, M. Ahmadzadehzarajabad, B. Nazari, S. Kargozar,
Influence of the value of the pH on the preparation of nano hydroxyapatite poly- S. Hajighasemlou, M. Mozafari, M. Soleimani, A. Samadikuchaksaraei, Bone re-
vinyl alcohol composites, J. Ceram. Process. Res. 10 (2009) 679–682. generation in rat using a gelatin/bioactive glass nanocomposite scaffold along with
[43] E. O'Neill, G. Awale, L. Daneshmandi, O. Umerah, The roles of ions on bone re- endothelial cells (HUVECs), Int. J. Appl. Ceram. Technol. 15 (2018) 1427–1438,
generation, in: K.W.-H. Lo (Ed.), Drug Discovery Today, 23 2018, pp. 879–890, , https://doi.org/10.1111/ijac.12907.
https://doi.org/10.1016/j.drudis.2018.01.049. [52] A. Polymeri, W. Giannobile, D. Kaigler, Bone marrow stromal stem cells in tissue
[44] Y.C. Chai, A. Carlier, J. Bolander, S.J. Roberts, L. Geris, J. Schrooten, H. Van engineering and regenerative medicine, Horm. Metab. Res. 48 (2016) 700–713,
Oosterwyck, F.P. Luyten, Current views on calcium phosphate osteogenicity and the https://doi.org/10.1055/s-0042-118458.
translation into effective bone regeneration strategies, Acta Biomater. 8 (2012) [53] S.-I. Roohani-Esfahani, K.Y. Wong, Z. Lu, Y.J. Chen, J.J. Li, S. Gronthos,
3876–3887, https://doi.org/10.1016/j.actbio.2012.07.002. D. Menicanin, J. Shi, C. Dunstan, H. Zreiqat, Fabrication of a novel triphasic and
[45] R. Aquino-Martínez, N. Artigas, B. Gámez, J.L. Rosa, F. Ventura, Extracellular cal- bioactive ceramic and evaluation of its in vitro and in vivo cytocompatibility and
cium promotes bone formation from bone marrow mesenchymal stem cells by osteogenesis, J. Mater. Chem. B 2 (2014) 1866–1878 https://doi https://doi.org/
amplifying the effects of BMP-2 on SMAD signalling, PLoS One 12 (2017), https:// 10.1039/C3TB21504K.
doi.org/10.1371/journal.pone.0178158. [54] K. Schickle, K. Zurlinden, C. Bergmann, M. Lindner, A. Kirsten, M. Laub, R. Telle,
[46] K. Lin, Y. Liu, H. Huang, L. Chen, Z. Wang, J. Chang, Degradation and silicon ex- H. Jennissen, H. Fischer, Synthesis of novel tricalcium phosphate-bioactive glass
cretion of the calcium silicate bioactive ceramics during bone regeneration using composite and functionalization with rhBMP-2, J. Mater. Sci. Mater. Med. 22
rabbit femur defect model, J. Mater. Sci. Mater. Med. 26 (2015) 197, https://doi. (2011) 763–771 https://doi https://doi.org/10.1007/s10856-011-4252-4.
org/10.1007/s10856-015-5523-2. [55] G. Fernandes, S. Yang, Application of platelet-rich plasma with stem cells in bone
[47] Z. Sheikh, P. Brooks, O. Barzilay, N. Fine, M. Glogauer, Macrophages, foreign body and periodontal tissue engineering, Bone Res 4 (2016) 16036, , https://doi.org/10.
giant cells and their response to implantable biomaterials, Materials 8 (2015) 1038/boneres.2016.36.

13