Hill Is 1991

VOLUME 66, No.
4 THE QUARTERLY RE VIEW OF BIOLOGY DECEMBER 1991
RIBOSOMAL DNA: MOLECULAR EVOLUTION

AND PHYLOGENETIC INFERENCE
DAVID M. HILLIS AND MICHAEL T. DIXON
Departmentof Zoology, The Universityof Texas

Austin, Texas 78712 USA
ABSTRACT
Ribosomal DNA (rDNA) sequenceshave beenaligned and comparedin a numberof living
organisms, and this approachhas provideda wealth of informationaboutphylogeneticrelation-
ships. Studies of rDNA sequenceshave beenused to inferphylogenetichistoryacrossa verybroad
spectrum,from studiesamongthebasal lineagesof life to relationshipsamongcloselyrelatedspecies
and populations. The reasonsfor the systematicversatilityof rDNA include the numerousrates
of evolutionamongdifferentregionsof rDNA (bothamongand within genes), thepresenceof many
copiesof mostrDNA sequencespergenome,and thepatternof concertedevolutionthat occursamong
repeatedcopies. Thesefeaturesfacilitatethe analysis of rDNA by directRNA sequencing,DNA
sequencing(eitherby cloning or amplification), and restrictionenzymemethodologies.Constraints
imposedbysecondarystructureof rRNA and concertedevolutionneedto beconsideredinphylogenetic
analyses, but these constraintsdo not appear to impedeseriously the usefulnessof rDNA.
An analysis of alignedsequencesofthefour nuclearand two mitochondrialrRNA genesidentified
regionsof thesegenes that are likely to be useful to addressphylogeneticproblemsovera wide range
of levels of divergence.In general, the small subunit nuclear sequencesappear to be bestfor
elucidatingPrecambriandivergences,the largesubunit nuclearsequencesfor Paleozoic and Meso-
zoic divergences,and the organellarsequencesof both subunitsfor Cenozoicdivergences.Primer
sequenceswere designedfor use in amplifying the entire nuclear rDNA array in 15 sections by
use of the polymerasechain reaction; these "universal" primers complementpreviously described
primersfor the mitochondrialrRNA genes. Pairs of primers can be selectedin conjunctionwith
theanalysis of divergenceof therRNA genesto addresssystematicproblemsthroughoutthehierarchy
of life.
INTRODUCTION viously considered intractable by morpholo-

gists (Hillis, 1987; Patterson, 1987). For
DURING THE PAST three-decades,the instance, there are very few homologous mor-
field of systematic biology has under- phological characters that can be compared
gone several simultaneous revolutions. The among all living organisms. In contrast, a
three most significant changes have been in number of genes with fundamental biochemi-
the development and refinement of system- cal functions are found in all species and they
atic theory, the technical refinement of data can be sequenced, aligned, and analysed to
analysis brought on by the development of study phylogenetic relationships at the deep-
computers, and the introduction of molecular est part of the tree of life. Other genes can be
analysis. Although molecular biology is not a used to study relationships among morpho-
panacea for systematics, molecular system- logically indistinguishable but otherwise dis-
atists can approach many problems pre- tinct species (Hillis and Moritz, 1990). This
The Quarterly
Reviewof Biology,December 1991, Vol. 66, No. 4
Copyright ( 1991 by The University of Chicago. All rights reserved.
0033-5770/91/6604-0002$01 .00
411
This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM
All use subject to University of Chicago Press Terms and Conditions (http://www.journals.uchicago.edu/t-and-c).
412 REVIEW OP BIOLOGY
THE QUAARTERLY VOLUME 66
ITS-1 ITS-2
NTS ETS 18S \ 5.8S/ 28S
1 1213214 151 6 17 181 9 |h 1_1 |12 11141151
18e 18j 18d 5.8d 28y 28dd 28ee 2811 28v 28ii
---v v --I ---- ---- ---IV
- ---.
18f 18h 18b 5.8c 28kk 28ff 28mm 2899 28w 28aa
y- p-' -. q w
vp --P
w-w
18i 18g 28u 28z 28hh 28x
18k 28cc 28jj
1 kb ,
FIG. 1. THE rDNA ARRAY OF A EUKARYOTE.
The entire array can be amplified in sections (1-15) through the use of the primers indicated by arrows
in polymerase chain reactions (primers are shown in Fig. 2).
entire range of applications, from the origin to 40 (eukaryotes) ribosomal proteins. A sin-
of life to relatively recent evolutionary events, gle copy of each of the proteins is present per
has been addressed by studying the ribosomal ribosome. Because protein synthesis is a pre-
RNA (rRNA) genes and their associated requisite for life as we know it, ribosomes (and
spacer regions, collectively called ribosomal hence rRNAs) are universally present in liv-
DNA (Appels and Honeycutt, 1986; Mindell ing systems.
and Honeycutt, 1990). The rDNA array of a eukaryote nuclear
This review is concerned with the inference genome typically consists of several hundred
of phylogenetic relationships from interspe- tandemly repeated copies of the transcription
cific comparison of rDNA sequences. Some unit and nontranscribed spacer shown in Fig-
properties of rDNA are so sufficiently distinct ure 1 (see Long and Dawid, 1980, for a re-
from other molecular sequences that a num- view). The number of copies of this transcrip-
ber of special considerations are necessary or tion unit, however, may be as few as one (as
desirable when considering the use of rDNA in Tetrahymena,Yao and Gall, 1977), or as
in systematic studies. In addition, we will re- many as several thousand (e.g., see Appels et
view the range of systematic problems to al., 1980). In prokaryotes there are one to
which studies of rDNA have been applied. several copies of the rRNA genes, and the
The processes of rDNA evolution have been genes may be organized in a single operon (in
reviewed elsewhere (Gerbi, 1985, 1986), so which they are usually separated by tRNA
these processes will be considered here only genes), or they may be dispersed throughout
as they relate to phylogenetic inference. the genome (Hofman et al., 1979; Brosius et
Several distinct rRNAs combine with ribo- al., 1981; Morgan, 1982). There are usually
somal proteins to form ribosomes, the organ- three or four distinct nonorganellar rRNAs
elles that direct protein synthesis from mes- in a species (Long and Dawid, 1980; Gerbi,
senger RNA. Ribosomes are composed of two 1986). These rRNAs are often characterized
major subunits, each with distinct rRNAs in sedimentation velocity units (S, for Sved-
and ribosomal proteins. The small ribosomal burg) (1) a large subunit rRNA, which ranges
subunit contains a single type of rRNA and in size from 16S [ 1500 nucleotides (nt)] in
about 20 proteins in prokaryotes or 30 pro- vertebrate mitochondria to 23S (_2900 nt) in
teins in eukaryotes. The large ribosomal sub- most prokaryote genomes, and up to 28S
unit contains two (prokaryotes) or three (eu- (over 4000 nt) in eukaryote nuclear genomes
karyotes) rRNAs and about 30 (prokaryotes) (see Gutell and Fox, 1988, and Gutell et al.,

DECEMBER 1991 RIBOSOMALDNA 413
1990, for compilations of known sequences); (e.g., Bobrova et al., 1987; Spencer et al.,
(2) a 5.8S rRNA (_160 nt) in eukaryotes, 1987). The large and small subunit rRNA
which is derived from a part of the 23S rRNA genes of chloroplasts and mitochondria are
of prokaryotes (Cox and Kelly, 1981; Jacq, more like those of their prokaryote ancestors
1981; Walker, 1981; Clark and Gerbi, 1982) than those of their eukaryote hosts (Schwarz
and is still structurally and functionally and Kossel, 1980; Kiintzel and Kochel, 1981;
closely related to the large rRNA; (3) a small Grant and Lambowitz, 1982; Spencer et al.,
subunit rRNA, which ranges from 12S ( 900 1984; Palmer, 1985a,b; Evrard et al., 1990).
nt) in vertebrate mitochondria to 16S (~ 1500 In eukaryotes, two internal transcribed
nt) in prokaryotes and up to 18S (_ 1800 nt) in spacers (ITS-1 and ITS-2) separate the 18S,
eukaryotes (see Huysmans and DeWachter, 5.8S and 28S genes (or their homologs), and
1987; Dams et al., 1988; Neefs et al., 1990); an external transcribed spacer (ETS) is lo-
and (4) a 5S rRNA (~ 120 nt), the gene of which cated upstream of the 18S gene (Fig. 1). The
is closely associated with the other rRNA transcribed spacers contain signals for pro-
genes in many prokaryotes but is found else- cessing the rRNA transcript. Adjacent copies
where in the nuclear genome of most eukary- of the rDNA repeat unit are separated by a
otes (see Wolters and Erdmann, 1989). Al- nontranscribed spacer (NTS), also called an
though these are the most common themes, intergenic spacer by some workers. This re-
numerous variations have been discovered gion contains subrepeating elements that
5 8c (5 8d) [85-109] 18) (18k) [1231.1259] 28y (28cc) [67-96)

Mammal GTGCGTTCGAAGTGTCGATGATCAA ManIsra GCCTGCGGCTTAATTTGACTCAACACGGG3Mammnal CTAACCAGGATTCCCTCAGTAACGGCGAGT
Frog ............ . ... Frog ................. Frog ..C........ .......
Loach.............. . Fruitfly............ ..... Urchin ...... . .C....G.....
Urchin.......A....... . Nexatode . .T............... Fruitfly ...A ....TT. .T ..G ....
Silkworm ...... A.....T.... Rice.Nerstode .... AA...... T.......
Rice T.....A...AC ....G.TC. Yeast . -CRice ..T..G......CT .......
Protist -..G.T ........... Yeast C.......... G...T .......
18b [1640-1 6701 28u (28kk) [69-901 28z (28dd) [1129-11541

Mammal AGGAATTCCCAGTAAGTGCGGGTCATAAGCT Manmal CGTTACTGAGGGAATCCTGGT Mammnal AGACTCCTTGGTCCGTGTTTCAAGAC
Frog ................. Frog......G...... Frog .............
Urchin ?? ...c..... C..A...C.. Urchin - .C.S..G...... Fruitfly..............
Fruitfly T..........T.A....T.A. Fruitfly .G ...T. .TT....A. Nematode GC....GCAA ........
Nematode..... G.T .....T.A....C.. Nemiatode......A .....TT. Rice .............
Rice ... .
G.T . C... A...Ik...C. . Rice ........ . . C. Yeast .............
Yeast......T ....C. A ....C.. Yeast .. A... A..C ... -. Protist T.............
18d (18g) [1700-17221 28v (28gg) [3429.34521 28aa (28jj) [4200-42181

Marmmal CACACCGCCCGTCGCTACTACCGATTG Manmml AAGGTAGCCAAATGCCTCGTCATC Manmml AGGTTAGTTTTACCCTACT
Frog ...... ....I..... Frog ............... Frog ..........
Urchin ............... Fruitfly.............. Fruitfly ..........
Fruitfly.............. . Nezmatode.............T Nematode ..........
Nematode .......... ..... GGAC Rice .......I....... Rice ..........
Rice ........I..C...... Yeast .............. Yeast ..........
Yeast.......... G..... Frotist............T. Protist ...G.......
Protist ........T.GT.T ....
18e (18f) [5-23] 28w (28hh) [3565-35881 28ee (28ff) [1795-18231

Mammal CTGGTTGATCCTGCCAGT Manmml CCTGTTGAGCTTGACTCTAGTCTG Ma.fl5a ATCCGCTAAGGAGTGTGTAACAACTCACC
Frog ..........Frog .......I.... ....Frog ...............
Urchin ..........Fruitfly ...T T........A .. Fruitfly ...............
Fruitfly ..........Nematode........... . T. Nemiatode ...............
Rice ..........Rice ... .. ........C. Rice .... ...........
Yeast ..........Yeast ........... . T. Yeast .... ...........
Protist ..... T .....Frotist......T.....C ....Frotist ...............
18h (18i) [420.4511 28x (28i1) [4106.4137] 2811 (28mm) [2616.26451

Manmml AGGGTTCGATTCCGGAGAGGGAGCCTGAGAAA Manmml GTGAATTCTGCTTCACAATGATAGGAAGAGCC Mammal GATCCGTAACTTCGGGATAAGGATTGGCTC
Frog.................. Frog ...... ............ Frog ...............
Fruitfly .................Fruitfly.....T .............Fruitfly................
Nemiatode ..... C.........T....Nematode .C.......G..........Nemiatocle..........A.......
Rice.. ............I... Rice ...... .. ....I.... Rice..........A.......
Yeast ....... .. ....Yeast . ........T.........Yeast
Protist ..F.............. rotist .C.TC ....GG.G.T.G.T ....... rotist . G G......C
FIG. 2. PRIMERS FOR USE IN POLYMERASE To AMPLIFYSIECTIONSOF rDNA ARRAYS

CHAINREACTIONS
SHOWNIN FIGURE1.
These sequences can also be used as probes in Southern blotting experiments (see text), A dot indicates
the nucleotide is the same as in the first sequence listed for the particular primer. The primer named
in parentheses is the complement of the primer shown. Primers 18b and 28x contain the EcoRI sites
in the 18S and 28S genes, and can be used to amplify a 5-6 kb fragment (sections 5-14) that is easily
cloned into vectors with EcoRI cloning sites.

414 THE QUARTERLY REVIEW OF BIOLOGY VOLUME 66
0
rrFn n-rn n-rn n-rn rn-n n-rn n-rn rn-
U21-
*0
-8 ~~~~~~~~~~~~~~~~~~~~~
4.) 7~-Q,>-) ~, C
0~~~~~ U z

serve as enhancers of transcription (Flavell Although there are no absolute rules, we

and O'Dell, 1979; Kohorn and Rae, 1982, have found that alignments are often ambigu-
1983; Reeder et al., 1983; Reeder, 1984). ous when paired sequences differ by more
than about 30 percent in any given region.
STRUCTURE AND EVOLUTION OF rDNA: Therefore, regions of DNA that are best for
IMPLICATIONS FOR PHYLOGENETIC ANALYSIS phylogenetic studies are those that are greater
than about 70 percent but less than 100 per-
Rates of Evolution cent similar. We have aligned the complete
One of the reasons why rDNA is useful for sequences of the four nuclear rRNA genes
phylogenetic analysis is that different regions and the two mitochondrial rRNA genes
of the rDNA repeat unit evolve at very differ- among a number of taxa of varying propin-
ent rates. Thus regions of rDNA arrays that quity of relationship in order to identify the
are particularly likely to yield informative regions most useful for studies at a given level
data for almost any systematic question can of divergence (Figs. 3-8). These figures can
be selected for analysis. In addition, the is- be used as a rough guide for choosing appro-
lands of highly conserved sequences within priate regions for phylogenetic analysis.
most rRNA genes are very useful for con- The most studied rRNA is the small sub-
structing "universal" primers that can be used unit nuclear gene, 16-18S rRNA (Fig. 3).
for sequencing either rRNA or rDNA from This gene has been studied most extensively
many species, for amplifying regions of inter- because it is among the slowest evolving se-
est by use of the polymerase chain reaction, quences found throughout living organisms,
or for use as probes in restriction enzyme and has therefore been very useful for exam-
analyses (Kocher et al., 1989; Hillis et al., ining ancient evolutionary events. In addition,
1990; Simon et al., 1990; Fig. 2). Although the slow rate of change permits the construc-
intraindividual length heterogeneity causes tion of many nearly universal primers, which
problems for direct sequencing of amplified facilitates sequencing efforts from groups that
DNA in some regions of the repeat, the ampli- have not been studied previously. As one can
fied DNA can be cloned and sequenced rela- see from Figure 3, aligned sequences of the
tively easily. small subunit gene provide relatively few
The process of choosing a region that is variable sites even as far back as the diver-
likely to be appropriate for a particular sys- gence of mammals and amphibians, between
tematic question is perhaps the most critical 300 and 400 MYA. If the comparisons among
step in any phylogenetic analysis. If the region mammals in Figure 3 are representative, this
chosen is evolutionarily too conserved (i.e., gene provides virtually no useful regions for
the sequences are nearly the same in all study comparisons involving taxa that diverged
taxa), then considerable time will be wasted since the Cretaceous. Much of the gene is
collecting invariant data. On the other hand, useful for comparisons among phyla of eu-
regions that differ among taxa to the extent karyotes, however, and some comparisons
that alignments are difficult or questionable among eukaryotes and prokaryotes are possi-
also are unlikely to yield robust phylogenies ble (Fig. 3). It has been used most successfully
(Swofford and Olsen, 1990). There are two for reconstructing phylogenetic events from
reasons highly divergent sequences yield less the Precambrian (see the Appendix and
robust results: (1) the level of homoplasy (par- below).
allelisms, convergences and reversals) in- The large subunit (23-28S) nuclear rRNA
creases as the probability for change at each gene is larger and shows more variation in
position increases, and (2) the number of pos- rates of evolution of its different domains than
sible alignments that are nearly equally good does the small subunit (Fig. 4). Although an-
becomes prohibitively large. Since alignment cient comparisons are also possible with this
of positional homologs is an assumption of gene (Lake, 1989a; Schleifer and Ludwig,
any phylogenetic analysis, it is best to delete 1989; Gouy and Li, 1989a), it primarily has
from analyses any regions where the align- been used to examine evolutionary events
ment is questionable (Swofford and Olsen, through the Paleozoic and Mesozoic (e. g.,
1990). Guadet et al., 1989; Hillis and Dixon, 1989;

S s g ; l
L& .j o
mmn mmT mm mmrr mm m m C)M
000
cC
v ts
ho0
=~~~~r 0) i aSt Qnmt?X>
< w co C,~
< > ?r jC :OgO^g2 S
CN C'S~~~~~~~~~~~
0 5 ~~~~~~~~~~5-
~~~~~~~~.
-~ C5
, c)
1Z

Larson and Wilson, 1989; Zimmer et al., Allard and Honeycutt, 1991; Baker et al., in
1989; de Sa' and Hillis, 1990; Hillis, Dixon, press). These studies have shown that the
and Ammerman, 1991). The large subunit spacer regions can be used to infer phylogeny
rRNA gene has many divergent domains or among closely related taxa (taxa that have di-
expansion segments (Hassouna et al., 1984), verged within the last 50 million years). In
so the size of the gene varies considerably addition, variation in the spacer regions has
among phyla (Gutell and Fox, 1988). These been used to identify species or strains, to
divergent domains are useful for recon- study hybridization, and as markers in popu-
structing relatively recent events (into the Ce- lation genetic studies (Toivonen et al., 1983;
nozoic), although regions for study must be Saghai-Maroof et al., 1984; Rogers et al.,
chosen carefully if the taxa have recently di- 1986; Learn and Schaal, 1987; Schaal et al.,
verged (Fig. 4). 1987; Baker et al., 1989; King and Schaal,
The 5.8S rRNA gene of eukaryotes (and 1989; Sites and Davis, 1989; Hillis, Moritz,
the corresponding region of the large subunit Porter, and Baker, 1991). Among the spac-
gene of prokaryotes) is similar to the small ers, the NTS evolves most rapidly (Hoshi-
subunit gene in its useful phylogenetic range kawa et al., 1983), and the transcribed spacers
(Fig. 5), although the shortness of the se- are somewhat more conserved (Appels and
quence limits its effectiveness in inferring Dvorak, 1982a,b; Furlong and Maden,
phylogeny across great time scales. It shows 1983). Amplification of the two internal tran-
very little variation in comparisons of taxa scribed spacers via the polymerase chain reac-
that diverged after the Paleozoic (Nazar et tion is facilitated by conserved flanking re-
al., 1976; Fig. 5). The 5S gene shows similar gions of the 18S, 5.8S and 28S genes (Figs. 1
levels of variation, but it is even shorter than and 2), so the use of these spacers in studies
the 5.8S sequence (Fig. 6; Sankoff et al., involving closely related species is increasing
1973). The shortness of the sequence greatly (Appendix).
restricts its phylogenetic usefulness (Halan-
ych, 1991; Steele et al., 1991). ConcertedEvolution
The mitochondrial rRNA genes evolve As nuclear rRNA genes began to be studied
much more rapidly than the nuclear rRNA in detail, it became clear that the multiple
genes, and they can be used for most Ceno- copies were not evolving independently, but
zoic comparisons (Figs. 7 and 8). They are in concert (Arnheim et al., 1980; Dover and
easily amplified through use of the polymer- Coen, 1981; Krystal et al., 1981; Coen, Stra-
ase chain reaction (Kocher et al., 1989; Si- chan, and Dover, 1982; Coen, Thoday, and
mon et al., 1991). Even comparisons among Dover, 1982; Arnheim, 1983). In other words,
taxa that have diverged within the past twenty each copy of an rRNA array is usually very
million years (e.g., Mus versus Rattus in Figs. similar to the other copies within individuals
7 and 8) are likely to show many changes. and species, although differences among spe-
Studies that have successfully used the mito- cies accumulate rapidly in parts of the array.
chondrial rRNA genes for phylogenetic re- The differences among arrays within individ-
construction are concentrated on vertebrates uals are mostly length variation within the
(Appendix), but studies on other groups are NTS (Wellauer, Dawid, Brown, and Reeder,
beginning to appear (see Simon et al., 1991). 1976; Wellauer, Reeder, Dawid, and Brown,
The spacer regions of rDNA arrays have 1976; Stambrook, 1978; Arnheim et al., 1982;
been used less frequently for phylogenetic Cooper and Schmidtke, 1984; Yakura et al.,
studies (Verbeet et al., 1984; McIntyre et al., 1984; Williams and Strobeck, 1985; Williams
1988; Yokota et al., 1989; Gonzalez et al., et al., 1985; Spencer et al., 1987), although
1990; Kjems and Garrett, 1990), except in smaller amounts of length variation also occur
restriction analyses of entire rDNA arrays within individuals among the multiple copies
(e.g., Nelkin et al., 1980; Wilson et al., 1984; of the genes (Gonzales et al., 1985). Nonethe-
Sytsma and Schaal, 1985; Hillis and Davis, less, the low variation among rDNA arrays
1986; Cracraft and Mindell, 1989; Mindell within individuals (and throughout species)
and Honeycutt, 1989; Sites and Davis, 1989; indicates that the multiple copies are homoge-

418 THE QUARTERLYREVIEW OF BIOLOGY VOLUME 66
1 0
0 ooo
001
000
a uc ci0)
B u" 4''
o
co 0~~~~~,C
07
z ;gtg 0 z -$4
co: v
t-w
0) 7 o coi53E
~
o
- 0) Z U
F-4 +j 0 Lr) 0 u~~~~~~ 40
CO"
LI-; 1)
6~~~~~~~~~~Cd - om>.

nized, among both homologous and nonho- unequal crossovers in favor of the SM6 geno-
mologous chromosomes containing rDNA type.
clusters. This phenomenon of homogeniza- Whatever the mechanisms that account for
tion is called concerted evolution (Arnheim et the observed concerted evolution of rDNA
al., 1980). arrays, the phenomenon has several effects on
Several processes appear to be responsible phylogenetic analyses. The ideal phyloge-
for concerted evolution, but the most im- netic marker would evolve within species, but
portant appear to be unequal crossing over show little intraspecific variation compared to
(Smith, 1973, 1976; Perelson and Bell, 1977; interspecific variation. For most single-copy
Petes, 1980; Szostak and Wu, 1980) and gene genes, high levels of variation among species
conversion (Nagylaki and Petes, 1982; Nagy- typically are accompanied by high variation
laki, 1984; Enea and Corredor, 1991). The within species, so that extensive sampling
relative contribution of these two mechanisms (among individuals and populations) is neces-
is debated (Dover, 1982a,b), although rela- sary to characterize a species. Among the
tively few empirical data have been collected rDNA genes, although intraspecific variation
that discriminate between the possibilities. obviously occurs, it is greatly reduced com-
Seperack et al. (1988) argued that unequal pared to what would be expected based on
crossing over is likely to be far more important observation of interspecific variation (be-
because it can result in duplication or elimina- cause of concerted evolution). Thus, although
tion of many repeats at once, whereas gene some intraspecific sampling is still advisable
conversion events are thought to affect only in studies of closely related species, particu-
one or a few repeats. In addition, the number larly studies involving the nontranscribed
of rDNA repeats is known to vary widely spacer (Williams et al., 1988), it is possible to
among individuals within species that have use small sample sizes in most phylogenetic
been studied (e.g., Henderson et al., 1976), studies of rDNA (Hillis and Davis, 1988; Bav-
a pattern that would be expected if unequal erstock and Moritz, 1990).
crossing over is common. Although Coen and A second advantage of a homogenized,
Dover (1983) showed that unequal crossing multiple-copy gene family is ease of analysis.
over probably is responsible for the coevolu- Since rRNA is so abundant and uniform, it
tion of rRNA arrays on the X and Y chromo- can be sequenced directly using reverse tran-
somes of Drosophila melanogaster,Coen, Tho- scriptase (Lane, Pace, Olsen, Stahl, Sogin,
day, and Dover (1982) argued that rates of and Pace, 1985). Multiple copies and con-
unequal crossing over are insufficient to ac- served restriction sites also aid in rapidly clon-
count for patterns of concerted evolution seen ing rDNA repeats (Hillis and Dixon, 1989)
among closely related species of Drosophila. or in amplifying regions of rDNA using the
Lassner and Dvorak (1986) reported that the polymerase chain reaction (Medlin et al.,
distribution of mutations within the subre- 1988; Sogin, 1990). For restriction analyses,
peats of the nontranscribed spacer support Southern blotting is greatly facilitated by the
gene conversion as the operative mechanism large number of relatively uniform fragments
of homogenization. Hillis, Moritz, Porter, (Dowling et al., 1990).
and Baker (1991) studied triploid parthenoge- Concerted evolution, however, undoubtedly
netic lines of lizards formed through multiple imposes limitations on phylogenetic analyses
hybridization events of two sexual species, as well. Evidence now exists that homogeniza-
designated as SM6 and CA6. Homogeniza- tion can also occur within, as well as among,
tion of the rDNA arrays always proceeded rDNA repeats (Hancock and Dover, 1988).
in the same direction, with fixation of SM6 Hancock and Dover (1988) found that se-
rDNA on CA6 chromosomes, even if two of quence similarity among divergent domains
the three chromosomes bearing rRNA genes within the large subunit rRNA gene is often
were of CA6 ancestry. They argued that these higher than is expected if the regions were
data were consistent with biased gene conver- evolving independently. If these regions are
sion as the operative mechanism; if unequal coevolving, then sequence positions within
crossing over was responsible, then a mecha- the regions cannot be treated as independent
nism must exist that consistently biases the characters in a phylogenetic analysis (see the

~~~~cZz~~~~~~~Q Zz
0~~~~~~~~~~~-
0~~~~~~~~~~~~~~-
00
C.)Z~~~~~~
C .o
00
X3._
0 04 u~~~~~~~~~~
C's
S-.4 V C's v ~~~~~~~~~~~

0-.
Z cn *
u 0
Zcf2U t E ea 0 '
0 0
~~~~~0
c~~~~QZ0
6 6 U ' ~~~~~~
-~~~~~~~~~;3

discussion of weighting characters to account al., 1984; Klein et al., 1984), most estimates
for nonindependence under SecondaryStruc- of the secondary structure of rRNAs are based
ture,below). In addition, if biases in gene con- on comparative analysis (Nishikawa and Ta-
version events are found to be sequence spe- kemura, 1974; Fox and Woese, 1975). These
cific, then the possibility of parallel changes in models of secondary structure have been pro-
multiple lineages will have to be considered. duced for all the rRNAs, both nuclear and
It is important to recognize that although organellar, for a wide diversity of organisms
gene homogenization appears to be the rule, (e.g., Mankin and Kopylov, 1981; Chan et
intragenomic variation is known. The most al., 1983, 1984; Maly and Brimacombe, 1983;
important cases seem to be growth-stage- Clark et al., 1984; Hadjiolov et al., 1984;
specific rRNAs. This was first recognized in Nelles et al., 1984; Gorski et al., 1987; Cum-
the existence of oocyte-specific 5S rRNA se- mings, Domenico, and Nelson, 1989; Cum-
quences (Wegnez et al., 1972; Mashkova et mings, Domenico, Nelson, and Sogin, 1989).
al., 1981). More recently, some Plasmodium These studies have shown that major features
species have been found to possess life-stage- of rRNA secondary structure are highly con-
specific small subunit rRNAs (Gunderson, served throughout life (Zweib et al., 1981;
Sogin, Wollett, Hollingdale, de la Cruz, Wa- Michot et al., 1984; Dunon-Bluteau and
ters, and McCutchan, 1987; McCutchan et Brun, 1986; Michot and Bachellerie, 1987;
al., 1988). Although the number of sequence Gutell et al., 1990). This maintenance of sec-
differences is substantial, they are concen- ondary structure occurs despite the continued
trated in regions of rapid change, and are un- evolution of the primary sequence, because
likely to interfere with the inference of distant compensatory mutations occur between the
relationships. paired nucleotides (Ebel et al., 1983; Michel
Given the number of unknowns associated and Dujon, 1983; Curtiss and Vournakis,
with the processes responsible for concerted 1984; Torres et al., 1990).
evolution of rDNA, some degree of caution Wheeler and Honeycutt (1988) examined
probably is warranted in using rDNA for phy- 5S and 5.8S rRNA sequences from a wide di-
logenetic analysis (Rothschild et al., 1986). versity of organisms, and showed that phylo-
Results of phylogenetic studies based on genetic analyses of nucleotide positions in-
rDNA, however, are generally consistent volved in base pairing produced different
with those based on other sources of data in results than analyses based on unpaired posi-
studies that involve multiple comparisons tions. Furthermore, their analyses of unpaired
(Hillis, 1987), so it is likely that methods of positions produced results that were more like
phylogenetic inference are sufficiently robust traditional hypotheses of relationships based
to effectively handle the complexities of on morphological data. Wheeler and Honey-
rDNA evolution. As new information be- cutt (1988) concluded that the constraints of
comes available on the constraints of con- secondary structure were more likely to pro-
certed evolution, this information can be in- duce spurious phylogenetic conclusions in
corporated into phylogenetic analyses (e.g., analyses of paired bases, and they recom-
through differential weighting of characters) mended eliminating paired positions, or at
for potentially increased resolution (see Swof- least assigning them one-half weight to ac-
ford and Olsen, 1990). count for their nonindependence. In contrast,
Smith (1989) suggested that paired nucleo-
SecondaryStructure tides produced more reliable results than did
To function properly within a ribosome, unpaired positions (compared to well-estab-
rRNA molecules must fold into a secondary lished morphological phylogenies) in a study
structure that is directly dependent on the pri- of 18S rRNA sequences in echinoderms.
mary sequence (Noller, 1984). Although some We conducted an analysis similar to those
secondary structure models are based on or of Wheeler and Honeycutt (1988) and Smith
tested with experimental evidence (e. g., (1989) for 28S gene sequences of vertebrates
Glotz and Brimacombe, 1980; Noller and (Dixon and Hillis, unpub.). We found that
Woese, 1981; Noller et al., 1981; Atmadja et the analysis of paired positions produced a

a .1A L
1. A - M-- Strongyiocentrotus
* I| -_ * ? _~.i.. ? A Xenopus
2k11 i~& &AIdEIIEJA _Horo
Percent
similarity
1 * Ro/u
70-79 Fattus
(70
0 200 400 600 800 1000

FIG. 7. SIMILARITY COMPARISONS OF THE 12S MITOCHONDRIAL rRNA GENE.
All sequences were aligned with the Mus musculus (house mouse) sequence reported by Bibb et al.,
1981. The scale on the horizontal axis shows the Mus nucleotide positions. The other sequences are from
purpuratus, a sea urchin); Roe et al., 1985 (Xenopus laevis, African
Jacobs et al., 1988 (Strongylocentrotus
clawed frog); Anderson et al., 1981 (Homosapiens,human); and Kobayashi et al., 1981 (Rattusnorvegicus,
Norway rat). Analysis was as described for Figure 3.
~~~~a- I mmll MA 61 A6. - Strong.ylocentrotus
1A&.mL a 1 I, I iL* Xenopus
]. I
kmmiAi 2 im ? Homo
100
Percent so-ga I .I RdllUS

(70
400 800 1200 1600
FIG. 8. SIMILARITY COMPARISONS OF THE 16S MITOCHONDRIAL rRNA GENE.

The aligned taxa, sources, and analysis are the same as in Figure 7 except that the Rattus sequence
is from Saccone et al., 1981.

Stem bases
-Mus
Loop bases compensationwere perfect)would be to elimi-
nate half of the paired sites from phylogenetic
Rattus analysis. Compensation is far from perfect,
-Homo however, and different taxa may show differ-
ent compensatory changes (RNA pairing is
Rhineura
slightlymore complicatedthan DNA pairing,
Xenopus because uracil can pair with either guanine or
Latimeria adenine). Therefore, calculations of weights
for paired versus unpaired bases should be
Cyprinella based on observed levels of compensation,
Outgroup rather than on assumptions of perfect com-
pensation. Analyses of vertebratedata sets in-
FIG. 9. RESULTS OF PHYLOGENETIC ANALYSIS
dicate that the appropriatelevel of weighting
OF NUCLEOTIDES THAT ARE PAIRED
for paired positions is closer to one than to
VERSUS UNPAIRED IN SECONDARY
STRUCTURAL MODELS OF 28S RNA
one-half (Dixon and Hillis, unpub.).
(SEE TABLE 1).
The tree on the left (based on the paired bases) STUDIES OF PHYLOGENY
is the same as in the analysis of the complete data

set, and is also the commonly accepted tree based
Methodsof Data Collection
on morphology. There are four primary classes of data on
rDNA arrays that have been used to infer
phylogenetic relationships. The first two
result that was better resolved than that ob- methods to be used, oligonucleotide catalogs
tained from analysis of unpaired positions (e. g., Sogin et al., 1972; Bonen and Doolittle,
(Fig. 9). Furthermore, the result from paired 1975; Zablen et al., 1975; Woese and Fox,
positions was identical to the result from the 1977; Kossel et al., 1983) and hybridization
full data set, and also the same as the usually studies (e.g., Pace and Campbell, 1971a,b;
accepted tree from morphology. The percent- Palleroni et al., 1973; Johnson and Francis,
age of phylogenetically informative charac- 1975; de Smedt and de Ley, 1977; Moore,
ters that were paired positions is approxi- 1977; Stackebrandtet al., 1981), were largely
mately the same as the percentage of paired
positions in the total analysis (Table 1). The
main difference between our analysis and that
of Smith (1989) on the one hand, and the
TABLE 1
Thedistribution of chordate 28S rDNA sequence
study by Wheeler and Honeycutt (1988) on dataanalysedin Figure9, categorized
the other hand, is the size of data sets. The by secondary structure
results from analysis of the larger data sets, Information on the complete gene is from the
18S. sequences (Smith, 1989) and 28S se- Xenopuslaevissequence (Ware et al., 1983). The
quences (our data) indicate that paired posi- other columns are from the analysis of secondary
tions should not be eliminated from phyloge- structureof Dixon and Hillis (unpub.) based upon
netic analyses-indeed, paired regions may the data set of Hillis, Dixon and Ammerman(1991).
contain most of the informative positions for Variable positions are homologousnucleotidesthat
some kinds of analyses. vary in at least one taxon and informative charac-
ters are those that can affect tree topology in a
The weighting scheme suggested by Wheeler
parsimonyanalysis. Secondarystructurewas based
and Honeycutt (1988)-assigning all paired on the model for Xenopusby Clark et al. (1984).
bases one-half weight - assumes that compen-
satory changes to maintain secondary struc- Complete Aligned Variable Informative
gene bases positions characters
ture are perfect. In other words, if nearly every
mutation immediately resulted in a compen- Unpaired 1,866 907 221 53
satory mutation within paired regions, then (45.4%) (45.6%) (44.4%) (47.7%)
adjusting the weighting in this manner would Stems 2,244 1,082 277 58
be a reasonable course of action. A simpler (54.6%) (54.4%) (55.6%) (52.3%)
solution that would have the same effect (if Total 4,110 1,989 498 111

replaced by sequencing studies as methods for and in the long run, cloning usually requires
sequencing became increasingly easier. The less time. For small-scalesequencingprojects,
fourth type of study, restriction site analysis, on the other hand, PCR is highly time and
is especially useful in population studies or cost effective.
studies of closely related species where large Restriction analysis of rDNA is straightfor-
numbers of individuals must be sampled ward. Southernblots of rDNA can be screened
(Dowling et al., 1990). using heterologous probes of cloned rDNA
Among rDNA sequencing studies, three arrays(or partsthereof).If heterologousclones
methods are commonly used to collect nucleo- are used and length or sequenceheterogeneity
tide sequences. The first method to be used is present within individuals, mapping of re-
regularly in comparative studies was direct striction sites can be difficult (Hillis and
RNA sequencing using reverse transcriptase Davis, 1988; Williams et al., 1988). An effec-
(Lane, Pace, Olsen, Stahl, Sogin, and Pace, tive method for avoiding these problems is
1985; Hillis et al., 1990). The primary advan- to use the oligonucleotide primers shown in
tages of this method are ease of analysis (no Figure 2 as sequential probes on Southern
cloning is required) and the obtainment of blots. This has the advantage of reducing the
consensus sequences (if several nucleotides region of comparison and thereby simplifying
are present at a given position in different gel interpretation. Fine-scale restrictionmaps
copies of the target gene, the most common of regions of the repeat (the ITS regions, for
will likely be recorded). Only one strand can instance) can be obtained by amplifying the
be sequenced, however, so two-strand verifi- regions using one biotinylated or radioac-
cation is not possible, and analyses are limited tively labeled primer, followed by partial di-
to transcribed portions of the array. In addi- gestion and gel electrophoresis. The frag-
tion, the lack of a cloned sequence means that ments so obtained immediately indicate the
further studies require newly isolated RNA, distance of each restriction site from the la-
and differences between studies may be the beled primer, so restriction maps are rela-
result of either errors or differences in the tively easy to construct.
source RNA. Restriction mapping studies are useful not
The more traditional approach of cloning only for studying the phylogeny of relatively
and sequencing rDNA eliminates the disad- closely related species (Appendix), but also
vantages of direct RNA sequencing at the ex- for any study in which many individuals need
pense of greater effort per nucleotide. Also, to be examined for a limited number of mark-
each sequence obtained represents a single ers. For instance, restrictionstudies of rDNA
repeat rather than a consensus of the whole have been used to study mechanisms of con-
array. The ease of cloning multiple copy certed evolution of ribosomal arrays (Hillis,
genes such as the rRNA genes greatly reduces Moritz, Porter, and Baker, 1991), interspe-
the relative difficulty of the cloning approach cific hybridzation (Baker et al., 1989; Sites
(Hillis and Dixon, 1989). and Davis, 1989), population dynamics and
The third method of obtaining sequence gene flow (Learn and Schaal, 1987; Schaal et
data is amplification via the polymerase chain al., 1987; King and Schaal, 1989), and typing
reaction, or PCR (Medlin et al., 1988; Sogin, of strainsof fungi (Lachance, 1990). The chief
1990). The amplified product can either be advantages restriction site mapping studies
sequenced directly or cloned and then se- have over sequencing studies are that many
quenced. This method is easily adaptable for individuals can be examined and scored
comparative studies in which a particular re- quickly, the cost for these analyses is much
gion of one of the rRNA genes is to be targeted less than for sequencing, and a much greater
(see Fig. 1). For sequencing large regions of portion of the genome can be surveyed with
rDNA, however, it is less expensive and less less effort (albeit with less detail).
time-consuming to clone, because amplifica-
tion of an entire repeat at one time is not SmallSubunitrRNA
practical. The cost of repeated amplifications The small subunit (16-18S) rRNA gene
of many different small regions is high com- (nuclear version in eukaryotes)has been stud-
pared to the cost of cloning the entire repeat, ied more extensively than any other rDNA

sequence (Appendix). The primary reason been one of the most controversial studies of
for the extensive attention on this gene is that phylogeny ever conducted, and has stimu-
it is the most slowly evolving of the rDNAs lated numerous reanalyses of the relevant
(Fig. 3), and therefore it is useful for ad- data (e.g., Ghiselin, 1989; Lake, 1989b; Pat-
dressing questions about ancient evolution- terson, 1989; Lake 1990). The most surpris-
ary events. Studies on the earliest branchings ing conclusion of Field et al. (1988) was that
of life have focused on the small subunit, and multicellular animals are polyphyletic, with
these studies have documented the extensive coelenterates more closely related to plants
phylogenetic diversity present among the pro- and fungi than to other metazoans. This con-
karyotes (see references under "Major lin- clusion, however, was not well supported
eages of life," Appendix). As a result of these (Field et al., 1989), and reanalyses of these
studies, it is now generally recognized that the data (e. g., Patterson, 1989) support the more
"prokaryotes" do not form a natural group. traditional arrangement of a monophyletic
Considerable controversy, however, still ex- Animalia.
ists about the content and relationships of the
primary lines of descent. One group supports Large Subunit rRNA
the position that prokarotes consist of two lin- The large subunit rRNA is the largest of
eages, the Archaebacteria and Eubacteria the rRNAs, and contains regions that evolve
(e.g., Woese and Fox, 1977; Woese, 1987; more rapidly than the small subunit rRNA as
Gouy and Li, 1989a). Under this system, well as some regions that evolve as slowly as
Archaeabacteria include the highly thermo- those in the small subunit (Fig. 4). Thus a
philic, sulphur-dependent eocytes, as well as large subunit rRNA sequence can be used
methanogens and halobacteria. In contrast, successfully to infer phylogenetic relation-
Lake (1988, 1989a) considers the eocytes to ships among more closely related organisms
be more closely related to eukaryotes and the (within eukaryote phyla, for instance). Fewer
halobacteria to be more closely related to Eu- comparative studies of this gene have been
bacteria. The results are somewhat depen- conducted than for the small subunit gene,
dent on the molecule selected for analysis, the but it is beginning to be studied fairly exten-
method of analysis, and the method of align- sively among the vertebrates (Appendix).
ment of the sequences (Gouy and Li, 1989a). Most of these studies are in fairly close agree-
Small subunit rDNA sequences have also ment with traditional ideas about vertebrate
been extremely important for elucidating phylogeny, although some differences do ex-
higher relationships within Archaebacteria ist. For instance, the relationships of salaman-
and Eubacteria, as well as among the basal ders supported by 28S sequences are vastly
eukaryotes (see references under these head- different from those supported by morphol-
ings in the Appendix). Until the widespread ogy (Larson and Wilson, 1989; Hillis, 1991;
study of these sequences, there was little basis Larson, 1991), and the resolution of relation-
for ordering the diversity of prokaryotes or ships among the major clades of amniotes is
unicellular eukaryotes. As more rDNA se- poor (Hillis and Dixon, 1989; Hedges et al.,
quences have become available for protists, 1990). Large subunit sequences, however,
the tremendous phylogenetic diversity of this have been useful for distinguishing among a
paraphyletic assemblage has become increas- number of proposed alternatives at various
ingly clear (e.g., see Sogin, Edman, and El- levels of the vertebrate tree, such as the rela-
wood, 1989; Sogin, Gunderson, Elwood, tionships within the pipid frogs (de Sa and
Alonso, and Peattie, 1989). Hillis, 1990), among orders of amphibians
Most studies of phylogeny using small sub- (Larson and Wilson, 1989), or among the
unit rDNA sequences among the multicellu- basal sarcopterygians (Hillis, Dixon, and
lar eukaryotes have concerned higher level Ammerman, 1991).
relationships of phyla and classes (Appendix).
For instance, seed plant relationships have 5S and 5.8S rRNAs
been studied by Zimmer et al. (1989), and a The 5S and 5.8S rRNA genes are very
major study of metazoans has been conducted short (Figs. 5 and 6), so the number of phylo-
by Field et al. (1988). The latter study has genetically informative sites is quite limited

426 THE QUARTERLY RE VIEW OF BIOLOGY VOLUME 66
for most studies (Halanych, 1991; Steele et One might assume from seeing such a long list
al., 1991). Nonetheless, some success has of studies that analysis of rDNA has become
been obtained in using these sequences to ex- mundane, and that there are no more real
amine relationships within major phyla of eu- questions about the processesof rDNA evolu-
karyotes (e. g., Hendriks et al., 1986; Wheeler tion, just considerablecataloging ahead. This
and Honeycutt, 1988; Steele et al., 1991) and assumption is incorrect. The processes re-
occasionally at higher levels (e.g., Ohama et sponsible for concerted evolution of rDNA
al., 1984). Comparisons across a wide spec- arrays (or other repeated sequences) are still
trum of life (Figs. 5 and 6) reveal that at least poorly known or documented, and the com-
some regions evolve quite slowly and can be plexities of patterns of self-similarityare just
aligned throughout living organisms. As ar- beginning to be evaluated. Much work needs
gued by Halanych (1991), however, these se- to be conducted on the rationale of weighting
quences usually are too short to be used by positions based on considerations of second-
themselves to produce robust phylogenetic re- ary structure, within-gene homogenization,
sults. subrepeatswithin repeats, and probability of
change. Moreover, the spacer regions have
OrganellarrRNAs received much less attention than the gene
The rRNA genes of mitochondria and chlo- sequences, so the usefulness of comparative
roplasts have been critical for inferring the studies of rDNA spacers for investigations of
origins of endosymbiosis of these organelles closely related species and populations needs
(Bonen and Doolittle, 1975, 1976; Kiintzel further evaluation.
and Kochel, 1981; Spencer et al., 1981; Studies of rDNA sequences have changed
Yang, Oyaizu, Oyaizu, Olsen, and Woese, the way we view organismal diversity. They
1985; Evrard et al., 1990). In addition, these have had the greatest systematic impact to
sequences can be studied within a particular date at the deepest levels of the tree of life,
group to elucidate phylogenies of more closely and for groupsin which morphologiesprovide
related taxa. The mitochondrial rRNA genes little information (e. g., unicellular organ-
are particularly useful for looking at relation- isms). They are also useful, however, at most
ships with eukaryote groups that have di- other levels of phylogenetic divergence, from
verged in the Cenozoic (Appendix), which the Precambrian(small subunit), throughthe
makes them largely complementary to the nu- Paleozoic and Mesozoic (large subunit), to
clear rRNA genes. For instance, they have the Cenozoic (organellar genes and spacers
been sequenced for numerous species of regions). Thus, rRNA genes and their associ-
mammals, and used to infer the phylogeny of ated spacers are among the most versatile se-
groups within marsupials, artiodactyls, and quences for phylogenetic analysis of the his-
primates (Hixson and Brown, 1986; Miya- tory of life.
moto et al., 1989, 1990; Thomas et al., 1989).
Phylogenetic study of mitochondrial rDNA
ACKNOWLEDGMENTS
sequences, including the construction of ap-
propriate primers for amplification, was re- We thank Loren Ammerman, Paul Chippin-
cently reviewed by Simon et al. (1991). dale, John Huelsenbeck, Gary Olsen, and Todd
Reeder for reading and commenting on the manu-
script, and Phong Nguyen for assistancewith liter-
THE FUTURE OF rDNA STUDIES
ature and figures. Our work on ribosomal DNA
The Appendix documents the great range evolution has been supported by NSF grants
and utility of phylogenetic analyses of rDNA. BSR-8657640 and BSR-8796293.

REFERENCES
Abele, L. G., W. Kim, and B. E. Felgenhauer. (eds.), Evolution of Genesand Proteins, pp. 38-61.
1989. Molecular evidence for the inclusion of Sinauer, Sunderland.
the phylum Pentastomida in the Crustacea. Arnheim, N., D. Treco, B. Taylor, and E. Eicher.
Mol. Biol. Evol., 6:685-691. 1982. Distribution of ribosomal gene length
Achenbach-Richter, L., K. 0. Stetter, and C. R. variants among mouse chromosomes. Proc.
Woese. 1987. A possible biochemical missing Natl. Acad. Sci. USA, 79:4677-4680.
link among archaebacteria. Nature, 327:348- Arnheim, N., M. Krystal, R. Schmickel, G. Wil-
349. son, 0. Ryder, and E. Zimmer. 1980. Molecu-
Achenbach-Richter, L., R. Gupta, K. 0. Stetter, lar evidence for genetic exchanges among ribo-
and C. R. Woese. 1987. Were the original eu- somal genes on nonhomologous chromosomes
bacteria thermophiles? Syst. Appl. Microbiol., 9: in man and ape. Proc. Natl. Acad. Sci. USA, 77:
34-39. 7323-7327.
Achenbach-Richter, L., R. Gupta, W. Zillig, and Atmadja, J., R. Brimacombe, and B. E. H. Ma-
C. R. Woese. 1988. Rooting the archaebacte- den. 1984. Xenopus laevis 18S ribosomal RNA:
rial tree: the pivotal role of Therococcusceler in experimental determination of secondary
archaebacterial evolution. Syst. Appl. Micro- structure elements and locations of methyl
biol., 10:231-240. groups in the secondary structure model. Nu-
Albrecht, W., A. Fischer,J. Smida, and E. Stacke- cleic Acids Res., 12:2649-2667.
brandt. 1987. Verrucomicrobium spinosum, a eu- Auling, G., J. Busse, M. Hahn, H. Hennecke,
bacterium representing an ancient line of de- R.-M. Kroppenstedt, A. Probst, and E.
scent. Syst. Appl. Microbiol., 10:57-62. Stackebrandt. 1988. Phylogenetic heterogene-
Allard, M. W., and R. L. Honeycutt. 1991. Ribo- ity and chemotaxonomic properties of certain
somal DNA variation within and between spe- Gram-negative aerobic carboxydobacteria.
cies of rodents, with emphasis on the genus Syst. Appl. Microbiol., 10:264-272.
Onychomys.Mol. Biol. Evol., 8:71-84. Baker, R. J., R. L. Honeycutt, R. A. Van Den
Anderson, J., W. Andresini, and N. Delihas. Bussche. 1991. Examination of monophyly of
1982. On the phylogeny of Phycomycesblakesleea- bats: restriction map of the ribosomal DNA
nus. J. Biol. Chem., 257:9114-9118. cistron. Bull. Am. Mus. Nat. Hist., 206: 42-53.
Anderson, S., A. T. Bankier, B. G. Barrell, Baker, R. J., S. K. Davis, R. D. Bradley, M. J.
M. H. L. de Bruijn, A. R. Coulson,J. Drouin, Hamilton, and R. A. Van Den Bussche. 1989.
I. C. Eperon, D. P. Nierlich, B. A. Roe, Ribosomal-DNA, mitochondrial-DNA, chro-
F. Sanger, P. H. Schreier, A. J. H. Smith, mosomal, and allozymic studies on a contact
R. Staden, and I. G. Young. 1981. Sequence zone in the pocket gopher, Geomys. Evolution,
and organization of the human mitochondrial 43:63-75.
genome. Nature, 290:457-465. Balch, W. E., G. E. Fox, L. J. Magrum, C. R.
Appels, R., andJ. Dvora'k. 1982a. The wheat ri- Woese, and R. S. Wolfe. 1979. Methanogens:
bosomal DNA spacer region: its structure and reevaluation of a unique biological group. Mi-
variation in populations and among species. crobiol. Rev., 43:260-296.
Theor. Appl. Genet., 63:337-348. Balch, W. E., L. J. Magrum, G. E. Fox, R. S.
, and . 1982b. Relative rates of di- Wolfe, and C. R. Woese. 1977. An ancient
vergence of spacer and gene sequences within divergence among the bacteria. J. Mol. Evol.,
the rDNA region of species in the Triticeae:im- 9:305-311.
plications for the maintenance of homogeneity Baroin, A., R. Perasso, L.-H. Qu, G. Brugerolle,
of a repeated gene family. Theor. Appl. Genet., J.-P. Bachellerie, and A. Adoutte. 1988. Par-
63:361-365. tial phylogeny of the unicellular eukaryotes
Appels, R., and R. L. Honeycutt. 1986. rDNA based on rapid sequencing of a portion of 28S
evolution over a billion years. In S. K. Dutta ribosomal RNA. Proc. Natl. Acad. Sci. USA, 85:
(ed.), DNA Systematics,pp. 81-135. CRC Press, 3474-3478.
Boca Raton. Barta, J. R., M. C. Jenkins, and H. D. Danforth.
Appels, R., W. L. Gerlach, E. S. Dennis, H. Swift, 1991. Evolutionary relationships of avian Ei-
and W. J. Peacock. 1980. Molecular and chro- meriaspecies among other apicomplexan proto-
mosomal organization of DNA sequences cod- zoa: Monophyly of the Apicomplexa is sup-
ing for the ribosomal RNAs in cereals. Chro- ported. Mol. Biol. Evol., 8:345-355.
mosoma, 78:293-31 1. Bateson, M. M., K. Thibault, and D. M. Ward.
Arnheim, N. 1983. Concerted evolution of multi- 1990. Comparative analysis of partial 16S ribo-
gene families. In M. Nei and R. K. Koehn somal RNA sequences of Thermusspecies. Syst.

Appl. Microbiol., 13:8-13. and chloroplast origin based on 16S rRNA oli-
Bateson, M. M., J. Wiegel, and D. M. Ward. gonucleotide catalogues. J. Evol. Biol., 2:13-
1989. Comparative analysis of 16S ribosomal 30.
RNA sequences of thermophilic fermentative Brosius, J., T. J. Dull, and H. F. Noller. 1980.
bacteria isolated from hot spring cyanobacteria Complete nucleotide sequence of a 23S ribo-
mats. Syst. Appl. Microbiol., 12:1-7. somal RNA gene from Escherichia coli. Proc.
Baverstock, P. R., and C. Moritz. 1990. Sampling Natl. Acad. Sci. USA, 77:201-204.
design. In D. M. Hillis and C. Moritz (eds.), Brosius, J., T. J. Dull, D. D. Sleeter, and H. F.
MolecularSystematics,pp. 13-24. Sinauer Associ- Noller. 1981. Gene organization and primary
ates, Sunderland. structure of a ribosomal RNA operon from
Baverstock, P. R., S. Illana, P. E. Christy, B. S. Escherichiacoli. J Mol. Biol., 148:107-127.
Robinson, and A. M. Johnson. 1989. srRNA Brosius, J., M. L. Palmer, P. J. Kennedy, and
evolution and phylogenetic relationships of the H. F. Noller. 1978. Complete nucleotide se-
genus Naegleria (Protista: Rhizopoda). Mol. quence of a 16S ribosomal RNA gene from
Biol. Evol., 6:243-257. Escherichia coli. Proc. Natl. Acad. Sci. USA, 75:
Bellarosa, R., V. Delre, B. Schirone, and F. Mag- 4801-4805.
gini. 1990. Ribosomal RNA genes in Quercus Bulygina, E. S., V. F. Galchenko, N. I. Govoruk-
spp. (Fagaceae). Plant Syst. Evol., 172:127-139. hina, A. I. Netrusov, D. I. Nikitin, Y. A. Trot-
Bibb, M. J., R. A. Van Etten, C. T. Wright, senko, and K. M. Chumakov. 1990. Taxo-
M. W. Walberg, and D. A. Clayton. 1981. nomic studies of methylotrophic bacteria by 5S
Sequence and gene organization of mouse ribosomal RNA sequencing.J Gen. Microbiol.,
mitochondrial DNA. Cell, 26:167-180. 136:441-446.
Blair, D., and D. P. McManus. 1989. Restriction Butler, M. H., S. M. Wall, K. R. Luehrsen,
enzyme mapping of ribosomal DNA can distin- G. E. Fox, and R. M. Hecht. 1981. Molecular
guish between fasciolid (liver fluke) species. relationships between closely related strains
Mol. Biochem. Parasitol., 36:201-208. and species of nematodes. J. Mol. Evol., 18:18-
Blanz, P. A., and M. Gottschalk. 1986. Systematic 23.
position of Septobasidium, Graphiola and other Catlin, B. W. 1991. Branhamaceaefam. nov., apro-
basidiomycetes as deduced on the basis of their posed family to accommodate the genera Bran-
5S ribosomal RNA nucleotide sequences. Syst. hamellaand Moraxella.Int.J. Syst.Bacteriol.,41:
Appl. Microbiol., 8:121-127. 320-323.
Bobrova, V. K., A. V. Troitsky, A. G. Ponoma- Cedergren, R., M. W. Gray, Y. Abel, and D. San-
rev, and A. S. Antonov. 1987. Low-molecu- koff. 1988. The evolutionary relationships
lar-weight rRNAs sequences and plant phylog- among known life forms. J. Mol. Evol., 28:98-
eny reconstruction: nucleotide sequences of 112.
chloroplast 4.5S rRNAs from Acorus calamus Chan, Y.-L., J. Olvera, and I. G. Wool. 1983.
(Araceae) and Ligularia calthifolia (Asteraceae). The structure of rat 28S ribosomal ribonucleic
Plant Syst. Evol., 156:13-27. acid inferred from the sequence of nucleotides
Bomar, D., S. Giovannoni, and E. Stackebrandt. in a gene. Nucleic Acids Res., 11:7819-7831.
1988. A unique type of eubacterial 5S rRNA in Chan, Y.-L., R. Gutell, H. F. Noller, and I. G.
members of the order Planctomycetales.J Mol. Wool. 1984. The nucleotide sequence of a rat
Evol., 27:121-125. 18S ribosomal ribonucleic acid gene and a pro-
Bonen, L., and W. F. Doolittle. 1975. On the posal for the secondary structure of 18S ribo-
prokaryotic nature of red algal chloroplasts. somal ribonucleic acid.J. Biol. Chem., 259:224-
Proc. Nat. Acad. Sci. USA, 72:2310-2314. 230.
, and . 1976. Partial sequence of 16S Chen, M.-W., J. Anne, G. Volckaert, E. Huys-
rRNA and the phylogeny of blue-green algae mans, A. Vandenberghe, and R. de Wachter.
and chloroplasts. Nature, 261:669-673. 1984. The nucleotide sequences of the 5S
, and . 1978. Ribosomal RNA ho- rRNAs of seven molds and a yeast and their use
mologies and the evolution of the filamentous in studying ascomycete phylogeny. NucleicAcids
blue-green bacteria.J. Mol. Evol., 10:283-291. Res., 12:4881-4892.
Brayton, P. R., R. B. Bode, R. R. Colwell, Christen, R., A. Ratto, A. Baroin, R. Perasso,
M. T. MacDonell, H. L. Hall, D. J. Grimes, K. G. Grell, and A. Adoutte. 1991. An analysis
P. A. West, and T. N. Bryant. 1986. Vibrio of the origin of metazoans, using comparisons
cincinnatiensissp. nov., a new human pathogen. of partial sequences of the 28S RNA, reveals
J. Clin. Microbiol., 23:104-108. an early emergence of triploblasts. EMBO (Eur.
Bremer, B., and K. Bremer. 1989. Cladistic analy- Mol. Biol. Organ.)J., 10:499-503.
sis of blue-green procaryote interrelationships Chuba, P. J., R. Bock, G. Graf, T. Adam, and

U. Gobel. 1988. Comparison of 16S rRNA se- ence Publishers (Biomedical Division), Am-
quences from the family Pasteurellaceae: phy- sterdam.
logenetic relatedness by cluster analysis.J. Gen. Cummings, D. J., J. M. Domenico, and J. Nel-
Microbiol., 134:1923-1930. son. 1989. DNA sequence and the secondary
Clark, C. G., and G. A. M. Cross. 1988. Small structures of the large subunit rRNA coding
subunit ribosomal RNA sequence from Nae- regions and its two class I introns of mitochon-
gleria gruberisupports the polyphyletic origin of drial DNA from Podospora anserina. J. Mol.
amoebas. Mol. Biol. Evol., 5:512-518. Evol., 28:242-255.
Clark, C. G., and S. A. Gerbi. 1982. Ribosomal Cummings, D. J., J. M. Domenico, J. Nelson,
RNA evolution by fragmentation of the 23S and M. L. Sogin. 1989. DNA sequence, struc-
progenitor: Maturation pathway parallels evo- ture, and phylogenetic relationship of the small
lutionary emergence. J. Mol. Evol., 18:329- subunit rRNA coding region of mitochondrial
336. DNA from Podosporaanserina.J. Mol. Evol., 28:
Clark, C. G., B. W. Tague, V. C. Ware, and 232-241.
S. A. Gerbi. 1984. Xenopus laevis 28S ribosomal Curtiss, W. C., andJ. N. Vournakis. 1984. Quan-
RNA: a secondary structure model and its evo- titation of base substitutions in eukaryotic 5S
lutionary and functional implications. Nucleic rRNA: selection for the maintenance of RNA
Acids Res., 12:6197-6220. secondary structure.J Mol. Evol., 20:351-361.
Coen, E. S., and G. A. Dover. 1983. Unequal Dams, E., E. Huysmans, A. Vandenberghe, and
exchanges and the coevolution of X and Y R. de Wachter. 1987. Structure of Clostridial
rDNA arrays in Drosophila melanogaster.Cell, 33: 5 S ribosomal RNAs and bacterial evolution.
849-855. Syst. Appl. Microbiol., 9:54-61.
Coen, E. S., T. Strachan, and G. A. Dover. 1982. Dams, E., L. Hendriks, Y. Van de Peer, J.-M.
Dynamics of concerted evolution of ribosomal Neefs, G. Smits, I. Vandenbempt, and R. de
DNA and histone gene families in the melanogas- Wachter. 1988. Compilation of small ribo-
terspecies subgroup of Drosophila.J. Mol. Biol., somal subunit RNA sequences. Nucleic Acids
158:17-35. Res., 16:r87-r173.
Coen, E. S., J. M. Thoday, and G. A. Dover. Dekio, S., R. Yamasaki, J. Jidoi, H. Hori, and
1982. The rate of turnover of structural vari- S. Osawa. 1984. Secondary structure and phy-
ants in the ribosomal gene family of Drosophila logeny of Staphylococcus and Micrococcus 5S
melanogaster.Nature, 295:564-568 rRNAs.J. Bacteriol., 159:233-237.
Collins, M. D., S. Wallbanks, D.J. Lane,J. Shah, de Ley, J., P. Segers, and M. Gillis. 1978. Intra-
R. Nietupski, J. Smida, M. Dorsch, and and intergeneric similarities of Chromobacterium
E. Stackebrandt. 1991. Phylogenetic analysis and Janthinobacterium ribosomal ribonucleic
of the genus Listeria based on reverse tran- acid cistrons. Int.J. Syst.Bacteriol.,28:154-168.
scriptase sequencing of 16S rRNA. Int.J. Syst. Delihas, N., J. Anderson, W. Andresini, L. Kauf-
Bacteriol., 41:240-246. man, and H. Lyman. 1981. The 5S ribosomal
Cooper, D. N., and J. Schmidtke. 1984. DNA RNA of Euglena gracilis cytoplasmic ribosomes
restriction fragment length polymorphisms and is closely homologous to the 5S RNA of the
heterozygosity in the human genome. Hum. trypanosomatid protozoa. Nucleic Acids Res., 9:
Genet., 66:1-16. 6627-6633.
Cox, R. A., andJ. M. Kelly. 1981. Mature 23 S Demharter, W., R. Hensel, J. Smida, and
rRNA of prokaryotes appears homologous with E. Stackebrandt. 1989. Sphaerobacter thermophilus
the precursor of 25-28 S rRNA of eukaryotes: gen, nov., sp. nov. a deeply rooting member
comments on the evolution of 23-28 S rRNA. of the actinomycetes subdivision isolated from
FEBSLett., 130:1-6. thermophilically treated sewage sludge. Syst.
Coyne, V. E., C. J. Pillidge, D. D, Sledjeski, Appl. Microbiol., 11:261-266.
H. Hori, B. A. Ortiz-Conde, D. G. Muir, Deming, J. W., H. Hada, R. R. Colwell, K. R.
R. M. Wiener, and R. R. Colwell. 1989. Re- Luehrsen, and G. E. Fox. 1984. The ribonucle-
classification of Alteromonascolwelliana to the ge- otide sequence of 5S rRNA from two strains of
nus Shewanella by DNA-DNA hybridization, deep-sea barophilic bacteria. J. Gen. Microbiol.,
serology and 5 S ribosomal RNA sequence data. 130:1911-1920.
Syst. Appl. Microbiol., 12:275-279. Deming, J. W., L. K. Somers, W. L. Straube,
Cracraft, J., and D. P. Mindell. 1989. The early D. G. Swartz, and M. T. MacDonell. 1988.
history of modern birds: a comparison of mo- Isolation of an obligately barophilic bacterium
lecular and morphological evidence. In B. and description of a new genus, Colwellia gen.
Fernholm, K. Bremer, and H. Jornval (eds.), nov. Syst. Appl. Microbiol., 10:152-160.
The Hierarchyof Life, pp. 389-403. Elsevier Sci- de Sa, R. O., and D. M. Hillis. 1990. Phylogenetic

relationships of the pipid frogs Xenopus and Si- D6pfer, H., E. Stackebrandt, and F. Fiedler.
lurana: an integration of ribosomal DNA and 1982. Nucleic acid hybridization studies on Mi-
morphology. Mol. Biol. Evol., 7:365-376. crobacterium, Curtobacterium,Agromyces and re-
DeSalle, R., T. Freedman, E. M. Prager, and lated taxa. J. Gen. Microbiol., 128:1687-1708.
A. C. Wilson. 1987. Tempo and mode of se- Dorfman, D. M., M. J. Lenardo, L. V. Reddy,
quence evolution in mitochondrial DNA of Ha- L. H. T. Van der Ploeg, and J. E. Donelson.
waiian Drosophila. j Mol. Evol., 26:157-164. 1985. The 5.8S ribosomal RNA gene of
de Smedt, J., and J. de Ley. 1977. Intra- and Trypanosoma brucei: structural and transcrip-
intergeneric similarities of Agrobacteriumribo- tional studies. NucleicAcids Res., 13:3533-3549.
somal ribonucleic acid cistrons. Int.J. Syst.Bac- Dover, G. 1982a. A molecular drive through evo-
teriol., 27:222-240. lution. BioScience, 32:526-533.
de Smedt, J., M. Bauwens, R. Tytgat, and J. de . 1982b. Molecular drive: a cohesive mode
Ley. 1980. Intra- and intergeneric similarities of species evolution. Nature, 299:111-117.
of ribosomal ribonucleic acid cistrons of free- Dover, G., and E. Coen. 1981. Springcleaning
living, nitrogen-fixing bacteria. Int.J. Syst.Bac- ribosomal DNA: a model for multigene evolu-
teriol., 30:106-122. tion? Nature, 290:731-732.
Devereux, R., A. R. Loeblich III, and G. E. Fox. Dowling, T. E., C. Moritz, and J. D. Palmer.
1990. Higher plant origins and the phylogeny 1990. Nucleic acids II: restriction site analysis.
of green algae. J. Mol. Evol., 31:18-24. In D. M. Hillis and C. Moritz (eds.), Molecular
Devereux, R., M. Delaney, F. Widdel, and Systematics, pp. 250-317. Sinauer Associates,
D. A. Stahl. 1989. Natural relationships among Sunderland.
sulfate-reducing eubacteria. J. Bacteriol., 171: Dunon-Bluteau, D., and G. Brun. 1986. The sec-
6689-6695. ondary structures of the Xenopus laevis and hu-
Devereux, R., S.-H. He, C. L. Doyle, S. Ork- man mitochondrial small ribosomal subunit are
land, D. A. Stahl, J. LeGall, and W. B. Whit- similar. FEBS Lett., 198:333-338.
man. 1990. Diversity and origin of Desulfovibrio Ebel, J.-P., C. Branlant, P. Carbon, B. Ehres-
species: phylogenetic definition of a family. J. mann, C. Ehresmann, A. Krol, and P. Stieg-
Bacteriol., 172:3609-3619. ler. 1983. Sequence and secondary structure
Dewhirst, F. E., B. J. Paster, and P. L. Bright. conservation in ribosomal RNAs in the course
1989. Chromobacterium,Eikenella, Kingella, Neis- of evolution. In B. Pullman and J. Jortner
seria, Sirnonsiella, and Vitreoscilla species com- (eds.), Nucleic Acids: The Vectorsof Life, pp. 387-
prise a major branch of the beta group Proteo- 401. D. Reidel, Dordrecht.
bacteria by 16S ribosomal ribonucleic acid Eden, P. A., T. M. Schmidt, R. P. Blakemore,
sequence comparison: transfer of Eikenella and and N. R. Pace. 1991. Phylogenetic analysis of
Simonsiella to the family Neisseriaceae(emend.). Aquaspirillum magnetotacticumusing polymerase
Int. J. Syst. Bacteriol., 39:258-266. chain reaction-amplified 16S rRNA-specific
Dewhirst, F. E., B. J. Paster, S. La Fontaine, and DNA. Int. J. Syst. Bacteriol., 41:324-325.
J. I. Rood. 1990. Transfer of Kingella indologenes Edman, J. C., J. A. Kovaks, H. Masur, D. V.
(Snell and Lapage 1976) to the genus Suttonella Santi, H. J. Elwood, and M. L. Sogin. 1988.
gen. nov. as Suttonella indologenescomb. nov.; Ribosomal RNA sequence shows Pneumocystis
transfer of Bacteroidesnodosus (Beveridge 1941) carinii to be a member of the Fungi. Nature, 334:
to the genus Dichelobactergen. nov. as Dichelo- 519-522.
bacternodosuscomb. nov.; and assignment of the Ehlers, R.-U., U. Wyss, and E. Stackebrandt.
genera Cardiobacterium,Dichelobacter,and Sutto- 1988. 16S rRNA cataloguing and the phyloge-
nella to Cardiobacteriaceaefam. nov. in the netic position of the genus Xenorhabdus. Syst.
Gamma division of Proteobacteriaon the basis of Appl. Microbiol., 10: 121-125.
16S rRNA sequence comparisons. Int. J. Syst. Ellis, R. E., J. E. Sulston, and A. R. Coulson.
Bacteriol., 40:426-433. 1986. The rDNA of C. elegans: sequence and
Distel, D. L., D. J. Lane, G. J. Olsen, S. J. Gio- structure. Nucleic Acids Res., 14:2345-2367.
vannoni, B. Pace, N. R. Pace, D. A. Stahl, and Elwood, H. J., G. J. Olsen, and M. L. Sogin.
H. Felbeck. 1988. Sulfur-oxidizing bacterial 1985. The small-subunit ribosomal RNA gene
endosymbionts: analysis of phylogeny and sequences from the hypotrichous ciliates Oxytri-
specificity by 16S rRNA sequences. J Bacte- cha nova and Stylonychia pustulata. Mol. Biol.
riol., 170:2506-2510. Evol., 2:399-410.
Doolittle, W. F., C. R. Woese, M. L. Sogin, Embley, M. T., J. Smida, and E. Stackebrandt.
L. Bonen, and D. Stahl. 1975. Sequence stud- 1988a. The phylogeny of Mycolate-less wall
ies on 16S ribosomal RNA from blue green chemotype IV actinomycetes and description of
alga.J. Mol. Evol., 4:307-315. Pseudocardiaceaefam. nov. Syst. Appl. Microbiol.,

11:44-52. Fox, G. E., K. R. Pechman, and C. R. Woese.

, and . 1988b. Reverse 1977. Comparative cataloging of 16S ribo-
transcriptase sequencing of 16S ribosomal somal ribonucleic acid: molecular approach to
RNA from Faenia rectivirgula,Pseudonocardiather- procaryotic systematics. Int. j Syst. Bacteriol.,
mophila and Saccharopolysporahirsuta, three wall 27:44-57.
type IV actinomycetes which lack mycolic Fox, G. E., L. J. Magrum, W. E. Balch, R. S.
acids. J. Gen. Microbiol., 134:961-966. Wolfe, and C. R. Woese. 1977. Classification
Enea, V., and V. Corredor. 1991. The evolution of methanogenic bacteria by 16S ribosomal
of plasmodial stage specific rRNA genes is RNA characterization. Proc. Natl. Acad. Sci.
dominated by gene conversion. J. Mol. Evol., USA, 74:4537-4541.
32:183-186. Fox, G. E., E. Stackebrandt, R. B. Hespell, J. Gib-
Erdmann, V. A., J. Wolters, E. Huysmans, and son, J. Maniloff, T. A. Dyer, R. S. Wolfe,
R. de Wachter. 1985. Collection of published W. E. Balch, R. S. Tanner, L. J. Magrum,
5S, 5.8S and 4.5 S ribosomal RNA sequences. L. B. Zablen, R. Blakemore, R. Gupta,
Nucleic Acids Res., 9:r105-r153. L. Bonen, B. J. Lewis, D. A. Stahl, K. R.
Erwin, D. H. 1991. Metazoan phylogeny and the Luehrsen, K. N. Chen, and C. R. Woese.
Cambrian radiation. Trends Ecol. & Evol., 6: 1980. The phylogeny of prokaryotes. Science,
131-134. 209:457-463.
Eschbach, S.,J. Wolters, and P. Sitte. 1991. Pri- Fox, K. F., and A. Brown. 1989. Partial sequence
mary and secondary structure of the nuclear analysis of the 16S-rRNA of Legionellae: taxo-
small subunit ribosomal RNA of the cryptomo- nomic implications. Syst. Appl. Microbiol., 11:
nad Pyrenomonassalina as inferred from the gene 135-139.
sequence: evolutionary implications. J. Mol. Fox, K. F., A. Brown, A. Fox, and G. Schnitzer.
Evol., 32:247-252. 1991. Tatlockia, a genetically and chemically
Evrard, J. L., M. Kuntz, andJ. H. Weil. 1990. distinct group of bacteria. Proposal to transfer
The nucleotide sequence of five ribosomal pro- Legionella maceachernii(Brenner et al.) to the ge-
tein genes from the Cyanophoraparadoxa: impli- nus Tatlockia, as Tatlockia maceacherniicomb.
cations concerning the phylogenetic relation- nov. Syst. Appl. Microbiol., 14:52-56.
ship between Cyanellesand chloroplasts. J. Mol. Franzmann, P. D., U. Wehmeyer, and E. Stacke-
Evol., 30:16-25. brandt. 1988. Halomonadaceaefam. nov., a new
Field, K. G., G. J. Olsen, S. J. Giovannoni, family of the class Proteobacteriato accommodate
E. C. Raff, N. R. Pace, and R. A. Raff. 1989. the genera Halomonas and Deleya. Syst. Appl. Mi-
Response to comments on Field et al., 1988. crobiol., 11: 16-19.
Science, 243:550-551. Franzmann, P. D., E. Stackebrandt, K. Sand-
Field, K. G., G. J. Olsen, D. J. Lane, S. J. Gio- erson, J. K. Volkman, D. E. Cameron, P. L.
vannoni, M. T. Ghiselin, E. C. Raff, N. R. Stevenson, T. A. McMeekin, and H. R. Bur-
Pace, and R. A. Raff. 1988. Molecular phylog- ton. 1988. Halobacteriumlacusprofundisp. nov., a
eny of the animal kingdom. Science, 239:748- halophilic bacterium isolated from Deep Lake,
753. Antarctica. Syst. Appl. Microbiol., 11:20-27.
Flavell, R. B., and M. O'Dell. 1979. The genetic Furlong, J. C., and B. E. H. Maden. 1983. Pat-
control of nucleolus formation in wheat. Chro- terns of major divergence between the internal
mosoma, 71:135-152. transcribed spacers of ribosomal DNA in Xeno-
Forget, B. G., and S. M. Weissman. 1969. The pus borealis and Xenopus laevis, and of minimal
nucleotide sequence of ribosomal 5 S ribo- divergence within ribosomal coding regions.
nucleic acid from KB cells. J. Biol. Chem., 244: EMBO (Eur. Mol. Biol. Organ.)J., 2:443-448.
3148-3165. Georgiev, 0. I., N. Nikolaev, A. A. Hadjiolov,
Fowler, V. J., N. Pfennig, W. Schubert, and K. G. Skryabin, V. M. Zakharyev, and A. A.
E. Stackebrandt. 1984. Towards a phylogeny Bayev. 1981. The structure of the ribosomal
of phototrophic purple sulfur bacteria- 16S RNA genes. 4. Complete sequence of the 25 S
rRNA oligonucleotide cataloguing of 11 species rRNA gene from Saccharomycescerevisiae.Nucleic
of Chromatiaceae. Arch. Microbiol., 139:382- Acids Res., 9:6953-6958.
387. Gerbi, S. A. 1985. Evolution of ribosomal DNA.
Fox, G. E., and C. R. Woese. 1975. 5S RNA In R. J. MacIntyre (ed.), MolecularEvolutionary
secondary structure. Nature, 256:505-507. Genetics, pp. 419-517. Plenum Press, New
Fox, G. E., K. R. Leuhrsen, and C. R. Woese. York.
1982. Archaebacterial 5 S ribosomal RNA. Zen- . 1986. The evolution of eukaryotic ribo-
tralbl. Bakteriol. Mikrobiol. Hyg. Abt. 1 Orig., C3: somal DNA. BioSystems, 19:247-258.
330-345. Ghiselin, M. T. 1988. The origin of molluscs in

light of molecular evidence. Oxf. Surv. Evol. Nature, 339:145-147.

Biol., 5:66-95. , and . 1989b. Molecular phylogeny
. 1989. Summary of our present knowledge of the kingdoms Animalia, Plantae and Fungi.
of metazoan phylogeny. In B. Fernholm, Mol. Biol. Evol., 6:109-122.
K. Bremer, and H. Jornvall (eds.), The Hier- Grant, D. M., andA. M. Lambowitz. 1982. Mito-
archyofLife, pp. 261-272. Elsevier Science Pub- chondrial ribosomal RNA genes. In H. Busch
lishers (Biomedical Division), Amsterdam. and L. Rothblum (eds.), The Cell Nucleus:
Gibson, J., W. Ludwig, E. Stackebrandt, and rDNA, Vol. X, Part A, pp. 387-408. Academic
C. R. Woese. 1985. The phylogeny of the green Press, New York.
photosynthetic bacteria: absence of a close rela- Gray, M. W., and D. F. Spencer. 1981. Is wheat
tionship between Chlorobium and Chloroflexus. mitochondrial 5S ribosomal RNA prokaryotic
Syst. Appl. Microbiol., 6:152-156. in nature? Nucleic Acids Res., 95:3523-3529.
Gibson, J., E. Stackebrandt, L. B. Zablen, Gray, M. W., D. Sankoff, and R. J. Cedergren.
R. Gupta, and C. R. Woese, 1979. A phyloge- 1984. On the evolutionary descent of organisms
netic analysis of the purple photosynthetic bac- and organelles: a global phylogeny based on a
teria. Curr. Microbiol., 3:59-64. highly conserved structural core in small sub-
Gillis, M., andJ. de Ley. 1980, Intra- and interge- unit ribosomal RNA. Nucleic Acids Res., 12:
neric similarities of the ribosomal ribonucleic 5837-5852.
acid cistrons of Acetobacterand Gluconobacter.Int. Guadet, J., J. Julien, J. F. Lafay, and Y. Brygoo.
J. Syst. Bacteriol., 30:7-27. 1989. Phylogeny of some Fusarium species, as
Giovannoni, S. J., S. Turner, G. J. Olsen, S. Barns, determined by large-subunit rRNA sequence
D. J. Lane, and N. R. Pace. 1988. Evolution- comparison. Mol. Biol. Evol., 6:227-242.
ary relationships among cyanobacteria and Gueho, E., C. P. Kurtzman, and S. W. Peterson.
green chloroplasts. J Bacteriol., 170:3584-3592. 1990. Phylogenetic relationships among spe-
Glotz, C., and R. Brimacombe. 1980. An experi- cies of Sterigmatomycesand Fellomyces as deter-
mentally-derived model for the secondary mined from partial rRNA sequences. Int. J
structure of the 16S ribosomal RNA from Esche- Syst. Bacteriol., 40:60-65.
richia coli. Nucleic Acids Res., 8:2377-2395. Gunderson, J. H., T. F. McCutchan, and M. L.
Gomez, E., A. M. Valdes, D. Pifiero, and R. Her- Sogin. 1986. Sequence of the small subunit ri-
nandez. 1991. What is a genus in the Trypano- bosomal RNA gene expressed in the blood-
somatidae family? Phylogenetic analysis of two stream stages of Plasmodium berghei:evolution-
small rRNA sequences. Mol. Bio. Evol., 8:254- ary implications. J. Protozool., 33:525-529.
259. Gunderson,J. H., H. Elwood, A. Ingold, K. Kin-
Gonzalez, I. L., J, E. Sylvester, T. F. Smith, dle, and M. L. Sogin. 1987. Phylogenetic rela-
D, Stambolian, and R. D. Schmickel. 1990. tionships between chlorophytes, chrysophytes,
Ribosomal RNA gene sequences and hominoid and oomycetes. Proc. Natl. Acad. Sci. USA, 84:
phylogeny. Mol. Biol. Evol., 7:203-219. 5823-5827.
Gonzalez, I. L., J. L. Gorski, T. J. Campen, D. J. Gunderson, J. H., M. L. Sogin, G. Wollett,
Dorney, J. M. Erickson, J. E. Sylvester, and M. Hollingdale, V. F. de la Cruz, A. P. Wa-
R. D. Schmickel. 1985. Variation among hu- ters, and T. F. McCutchan, 1987. Structurally
man 28S ribosomal RNA genes. Proc. Natl. distinct, stage-specific ribosomes occur in Plas-
Acad. Sci. USA, 82:7666-7670. modium. Science, 238:933-937.
Gorski, J. L., I. L. Gonzalez, and R. D. Schmickel. Gupta, R.,J. M. Lanter, and C. R. Woese. 1983.
1987. The secondary structure of human 28S Sequence of the 16S ribosomal RNA from Halo-
rRNA: the structure and evolution of a mosaic bacteriumvolcanii, an archaebacterium. Science,
rRNA gene. J. Mol. Evol., 24:236-25-1. 221:656-659.
Gottschalk, M., and P. A. Blanz. 1984. Highly Gutell, R. R., and G. E. Fox. 1988. A compilation
conserved 5S ribosomal RNA sequences in four of large subunit RNA sequences presented in
rust fungi and atypical 5S rRNA secondary a structural format. NucleicAcids Res., 16:rl 75-
structure in Microstromajuglandis. Nucleic Acids r269.
Res., 12:3951-3958. Gutell, R. R., M. N. Schnare, and M. W. Gray.
, and . 1985. Untersuchungen und 1990. A compilation of large subunit (23S-like)
5S ribosomalen ribonukleinsaeuren als beitrag ribosomal RNA sequences presented in a sec-
zur klaerung von systematik und phylogenic ondary structure format. NucleicAcids Res., 18s:
der basidiomyceten. Z. Mykol., 51:205-255. 2319-2330.
Gouy, M., and W.-H. Li. 1989a. Phylogenetic Hadjiolov, A. A., 0. I. Georgiev, V. V. Nosikov,
analysis based on rRNA sequences supports and L. P. Yavachev. 1984. Primary and sec-
the archaebacterial rather than the eocyte tree. ondary structure of rat 28S ribosomal RNA.

Nucleic Acids Res., 12:3677-3693. K. C. Atwood. 1976. Variations in RNA gene

Hahn, D., M. P. Lechevalier, A. Fischer, and number in mouse chromosomes. Cytogenet.Cell
E. Stackebrandt. 1989. Evidence for a close Genet., 17:307-316.
phylogenetic relationship between members of Hendriks, L., E. Huysmans, A. Vandenberghe,
the genera Frankia, Geodermatophilus,and "Blas- and R. de Wachter. 1986. Primary structures
tococcus"and emdendation of the family Frankia- of the 5S ribosomal RNAs of 11 arthropods
ceae. Syst. Appl. Microbiol., 11:236-242. and applicability of 5S RNA to the study of
Halanych, K. M. 1991. 5S ribosomal RNA se- metazoan evolution.J. Mol. Evol., 24:103-109.
quences inappropriate for phylogenetic recon- Hendriks, L., R. de Baere, Y. Van De Peer, J.
struction. Mol. Biol. Evol., 8:249-253. Neefs, and A. Goris. 1991. The evolutionary
Hall, L. M. C., and B. E. H. Maden. 1980. Nucle- position of the rhodophyte Porphyraumbilicalis
otide sequence through the 18S-28S intergene and the basidiomycete Leucosporidium scottii
region of a vertebrate ribosomal transcription among other eucaryotes as deduced from com-
unit. Nucleic Acids Res., 8:5993-6005. plete sequences of small ribosomal subunit
Hamby, R. K., and E. A. Zimmer. 1988. Ribo- RNA.J. Mol. Evol., 32:167-177.
somal RNA sequences for inferring phylogeny Hendriks, L., C. Van Broeckhoven, A. Vanden-
within the grass family (Poaceae). Plant Syst. berghe, Y. Van De Peer, and R. de Wachter.
Evol., 160:29-37. 1988. Primary and secondary structure of the
Hancock, J. M., and G. A. Dover. 1988. Molecu- 18S ribosomal RNA of the bird spider Eury-
lar coevolution among cryptically simple expan- pelma californica and evolutionary relationships
sion segments of eukaryotic 26S/28S rRNAs. among eukaryotic phyla. Eur. J. Biochem., 177:
Mol. Biol. Evol., 5:377-391. 15-20.
Hancock, J. M., D. Tautz, and G. A. Dover. Herzog, M., and L. Maroteaux. 1986. Dinoflagel-
1988. Evolution of the secondary structures and late 17 S rRNA sequence inferred from the gene
compensatory mutations of the ribosomal RNAs sequence: evolutionary implications. Proc.
of Drosophila melanogaster.Mol. Biol. Evol., 5: Natl. Acad. Sci. USA, 83:8644-8648.
393-414. Hespell, R. B., B. J. Paster, T. J. Macke, and
Hariharan, N., andJ. D. Padayatty. 1987. Ribo- C. R. Woese. 1984. The origin and phylogeny
somal RNA gene repeat units in rice embryos. of the bdellovibrios. Syst. Appl. Microbiol., 5:
Indian j Biochem. Biophys., 24:157-164. 196-203.
Hariharan, N., P. S. Reddy, andJ. D. Padayatty. Hillis, D. M. 1987. Molecular versus morphologi-
1987. 5S-rRNA genes in rice embryos. Plant cal approaches to systematics. Annu. Rev. Ecol.
Mol. Biol., 9:443-451. Syst., 18:23-42.
Hart, R. P., and W. R. Folk. 1982. Structure and . 1991. The phylogeny of amphibians: cur-
organization of a mammalian 5 S gene cluster. rent knowledge and the role of cytogenetics. In
J Biol. Chem., 257:11706-11711. D. M. Green and S. K. Sessions (eds.), Amphib-
Hartmann, R. K., J. Wolters, B. Kr6ger, ian Cytogeneticsand Evolution, pp. 7-31. Aca-
S. Schultze, T. Specht, and V. A. Erdmann. demic Press, New York.
1989. Does Thermusrepresent another deep eu- Hillis, D. M., and S. K. Davis. 1986. Evolution of
bacterial branching? Syst. Appl. Microbiol., 11: ribosomal DNA: fifty million years of recorded
243-249. history in the frog genus Rana. Evolution, 40:
Hasegawa, M., Y. lida, T. Yano, F. Takaiwa, 1275-1288.
and M. Iwabuchi. 1985. Phylogenetic relation- , and . 1987. Evolution of the 28S
ships among eukaryotic kingdoms inferred ribosomal RNA gene in anurans: regions of
from ribosomal RNA sequences. J. Mol. Evol., variability and their phylogenetic implications.
22:32-38. Mol. Biol. Evol., 4:117-125.
Hassouna, N., B. Michot, and J.-P. Bachellerie. , and . 1988. Ribosomal DNA: in-
1984. The complete nucleotide sequence of traspecific polymorphism, concerted evolu-
mouse 28S rRNA gene. Implications for the tion, and phylogeny reconstruction. Syst. Zool.,
process of size increase of the large subunit 37:63-66.
rRNA in higher eukaryotes. Nucleic Acids Res., Hillis, D. M., and M. T. Dixon. 1989. Vertebrate
12:3563-3583. phylogeny: evidence from 28S ribosomal DNA
Hedges, S. B., K. D. Moberg, and L. R. Maxson. sequences. In B. Fernholm, K. Bremer, and
1990. Tetrapod phylogeny inferred from 18S H. Jornvall (eds.), The Hierarchy of Life, pp.
and 28S ribosomal RNA sequences and a re- 355-367. Elsevier Science Publishers (Biomed-
view of the evidence for amniote relationships. ical Division), Amsterdam.
Mol. Biol. Evol., 7:607-633. Hillis, D. M., and C. Moritz. 1990. An overview
Henderson, A. S., E. M. Eicher, M. T. Yu, and of applications of molecular systematics. In

D. M. Hillis and C. Moritz (eds.), Molecular Res., 11:1725-1734.

Systematics, pp. 502-515. Sinauer Associates, Huss, V. A. R., and M. L. Sogin. 1990. Phyloge-
Sunderland. netic position of some Chlorella species within
Hillis, D. M., M. T. Dixon, and L. K. Ammer- the Chloroccales based upon complete small
man. 1991. The relationships of the coelacanth subunit ribosomal RNA sequences. J. Mol.
Latimeriachalumnae:evidence from sequences of Evol., 31:432-442.
vertebrate 28S ribosomal RNA genes. Envir. Huysmans, E., and R. de Wachter. 1987. Compi-
Biol. Fishes, 32:119-130. lation of small ribosomal subunit RNA se-
Hillis, D. M., A. Larson, S. K. Davis, and E. A. quences. Nucleic Acids Res., 14s:r73-rl 18.
Zimmer. 1990. Nucleic Acids III: sequencing. Huysmans, E., E. Dams, A. Vandenberghe, and
In D. M. Hillis and C. Moritz (eds.), Molecular R. de Wachter. 1983. The nucleotide se-
Systematics, pp. 318-370. Sinauer Associates, quences of the 5S rRNAs of four mushrooms
Sunderland. and their use in studying the phylogenetic posi-
Hillis, D. M., C. Moritz, C. A. Porter, and R. J. tion of basidiomycetes among the eukaryotes.
Baker. 1991. Evidence for biased gene conver- Nucleic Acids Res., 11:2871-2880.
sion in concerted evolution of ribosomal DNA. Jacobs, H. T., D. J. Elliott, V. B. Math, and
Science, 251:308-310. A. Farquharson. 1988. Nucleotide sequence
Hinnebusch, A. G., L. C. Klotz, R. L. Blanken, and gene organization of sea urchin mitochon-
and A. R. Loeblich III. 1981. An evaluation of drial DNA.J. Mol. Biol., 202:185-217.
the phylogenetic position of the dinoflagellate Jacq, B. 1981. Sequence homologies between eu-
Crypthecodiniumcohnii based on 5S rRNA char- karyotic 5.8S rRNA and the 5' end of prokary-
acterization. J. Mol. Evol., 17:334-347. otic 23S rRNA: evidences for a common evolu-
Hixson, J. E., and W. M. Brown. 1986. A com- tionary origin. Nucleic Acids Res., 9:29 13-2932.
parison of the small ribosomal RNA genes from Jarsch, M., and A. B6ck. 1985. Sequence of the
the mitochondrial DNA of the great apes and 16S ribosomal RNA gene from Methanococcus
humans: sequence, structure, evolution, and vannielii: evolutionary implications. Syst. Appl.
phylogenetic implications. Mol. Biol. Evol., 3: Microbiol., 6:54-59.
1-18. Johansen, T., S. Johansen, and F. B. Haugli.
Hofman, J. D., R. H. Lau, and W. F. Doolittle. 1988. Nucleotide sequence of the Physarumpoly-
1979. The number, physical organization and cephalum small subunit ribosomal RNA as in-
transcription of ribosomal RNA cistrons in an ferred from the gene sequence: secondary struc-
archaebacterium: Halobacterium halobium. Nu- ture and evolutionary implications. Curr.
cleic Acids Res., 7:1321-1333. Genet., 14:265-273.
Hori, H., and S. Osawa. 1979. Evolutionary Johnson, A. M., S. Illana, P. Hakendorf, and
change in 5S RNA secondary structure and a P. R. Baverstock. 1988. The phylogenetic rela-
phylogenetic tree of 54 5S RNA species. Proc. tionships of the apicocomplexan protist Saro-
Natl. Acad. Sci. USA, 76:381-385. cystis as determined by small subunit ribosomal
, and . 1986. Evolutionary change RNA comparison. J. Parasitol., 74:847-860.
in 5S rRNA secondary structure and a phyloge- Johnson, A. M., P.J. Murray, S. Illana, and P. R.
netic tree of 352 5S RNA species. BioSystems, Baverstock. 1987. Rapid nucleotide sequence
19: 163-172. analysis of the small subunit ribosomal RNA of
, and . 1987. Origin and evolution Toxoplasmagondii: evolutionary implications for
of organisms as deduced from 5S ribosomal the Apicomplexa. Mol. Biochem. Parasitol., 25:
RNA sequences. Mol. Biol. Evol., 4:445-472. 239-246.
Hori, H., B.-L. Lim, and S. Osawa. 1985. Evolu- Johnson, A. M., A. Thanou, P. F. L. Boreham,
tion of green plants as deduced from 5S rRNA and P. R. Baverstock. 1989. Blastocystishominis:
sequences. Proc. Natl. Acad. Sci. USA, 82:820- phylogenetic affinities determined by rRNA se-
823. quence comparison. Exp. Parasitol., 68:283-
Hori, H., S. Osawa, F. Takaiwa, and M. Sugiura. 288.
1984. The nucleotide sequence of 5S rRNAs Johnson, J. L., and B. S. Francis. 1975. Taxon-
from a fern Dryopterisacuminata and a horsetail omy of the Clostridia: ribosomal ribonucleic
Equisetum arvense. Nucleic Acids Res., 12:1573- acid homologies among the species.J Gen. Mi-
1576. crobiol., 88:229-244.
Hoshikawa, Y., Y. lida, and M. Iwabuchi. 1983. Jupe, E. R., R. L. Chapman, and E. A. Zimmer.
Nucleotide sequence of the transcriptional initi- 1988. Nuclear ribosomal RNA genes and algal
ation region of Dictyostelium discoideum rRNA phylogeny-the Chlamydomonasexample. Bio-
gene and comparison of the initiation regions Systems, 21:223-230.
of three lower eukaryotes' genes. Nucleic Acids Katoh, K., H. Hori, and S. Osawa. 1983. The

nucleotide sequences of 5S ribosomal RNAs , and . 1983. Localization of DNA

from four bryophyta-species. Nucleic Acids Res., sequences promoting RNA polymerase I activ-
11:5671-5674. ity in Drosophila. Proc. Natl. Acad. Sci. USA, 80:
Kim, W., and L. G. Abele. 1990. Molecular phy- 3265-3268.
logeny of selected decapod crustaceans based Komiya, H., and S. Takemura. 1981. The nucleo-
on 18S rRNA nucleotide sequences. J. Crusta- tide sequence of 5S ribosomal RNA from slime
cean Biol., 10: 1- 13. mold Physarum polycephalum. J. Biochem., 90:
Kimura, M., and T. Ohta. 1973. Eukaryotes- 1577-1581.
prokaryotes divergence estimated by 5.8S ribo- Komiya, H., M. Hasegawa, and S. Takemura.
somal RNA sequences. Nature New Biol., 243: 1983. Nucleotide sequences of 5S rRNAs from
199-200. sponge Halichondriajaponica and tunicate Halo-
King, L. M., and B. A. Schaal. 1989. Ribosomal- cynthia roretziand their phylogenetic positions.
DNA variation and distribution in Rudbeckia Nucleic Acids Res., 11: 1969-1974.
missouriensis. Evolution, 43:1117-1119. Komiya, H., N. Shimizu, M. Kawakami, and
Kistler, H. C., P. W. Bosland, U. Benny, S. Leong, S. Takemura. 1980. Nucleotide sequence of 5 S
and P. H. Williams. 1987. Relatedness of ribosomal RNA from Lingula anatina. J. Bio-
strains of Fusarium oxysporum from crucifers chem., 88:1449-1456.
measured by examination of mitochondrial and Kossel, H., K. Edwards, E. Fritzsche, W. Koch,
ribosomal DNA. Genetics, 77:1289-1293. and Z. Schwarz. 1983. Phylogenetic significance
Kjems, J., and R. A. Garrett. 1990. Secondary of nucleotide sequence analysis. In U. Jensen
structural elements exclusive to the sequences and D. E. Fairbrothers (eds.), ProteinandNucleic
flanking ribosomal RNAs lend support to the Acids in Plant Systematics, pp. 36-57. Springer-
monophyletic nature of the archaebacteria. J. Verlag, Berlin.
Mol. Evol., 31:25-32. Kraus, F., and M. M. Miyamoto. 1991. Rapid
Kjems, J., R. A. Garrett, and W. Ansorge. 1987. cladogenesis among the pecoran ruminants: ev-
The sequence of the 16S RNA gene and its idence from mitochondrial DNA sequences.
flanking region from the archaebacterium De- Syst. Zool., 40:117-130.
sulfurococcusmobilis. Syst. Appl. Microbiol., 9:22- Krishnan, S., S. Barnabas, andJ. Barnabas. 1990.
28. Interrelationships among major protistan groups
Klein, B. K., P. Forman, Y. Shiomi, and D. Schles- based on a parsimony network of 5S rRNA
singer. 1984. Electron microscopy of secondary sequences. BioSystems, 24:135-144.
structure in partially denatured Escherichiacoli Krystal, M., P. D'Eustachio, F. H. Ruddle, and
16S rRNA and 30S subunits. Biochemistry,23: N. Arnheim. 1981. Human nucleolus organiz-
3927-3933. ers on nonhomologous chromosomes can share
Klenk, H.-P., B. Haas, V. Schwass, and W. Zil- the same ribosomal gene variants. Proc. Natl.
lig. 1986. Hybridization homology: a new pa- Acad. Sci. USA, 78:5744-5748.
rameter for the analysis of phylogenetic rela- Kumazaki, T., H. Hori, and S. Osawa. 1983.
tions, demonstrated with the urkingdom of the Phylogeny of protozoa deduced from 5S rRNA
archaebacteria. J. Mol. Evol., 24:167-173. sequences. J. Mol. Evol., 19:411-419.
Kobayashi, M., T. Seki, K. Yaginuma, and Kumazaki, T., H. Hori, S. Osawa, N. Ishii, and
K. Koike. 1981. Nucleotide sequences of small K. Suzuki. 1982. The nucleotide sequence of
ribosomal RNA and adjacent transfer RNA 5S rRNAs from a rotifer, Brachionusplicatilis,
genes in rat mitochondrial DNA. Gene, 16:297- and two nematodes, Rhabditis tokai and Caeno-
307. rhabditis elegans. Nucleic Acids Res., 10:7001-
Kochel, H. G., and H. Kuintzel. 1982. Mitochon- 7004.
drial L-rRNA from Aspergillus nidulans: poten- Kumazaki, T., H. Hori, S. Osawa, T. Mita, and
tial secondary structure and evolution. Nucleic T. Higashinakagawa. 1982. The nucleotide se-
Acids Res., 10:4795-4801. quences of 5S rRNAs from three ciliated proto-
Kocher, T. D., W. K. Thomas, A. Meyer, S. V. zoa. Nucleic Acids Res., 10:4409-4412.
Edwards, S. Paabo, F. X. Villablanca, and Kuintzel, H., and H. G. K6chel. 1981. Evolution
A. C. Wilson. 1989. Dynamics of mitochon- of rRNA and origin of mitochondria. Nature,
drial DNA evolution in animals: amplification 293:751-755.
and sequencing with conserved primers. Proc. Kiuntzel, H., B. Piechulla, and U. Hahn. 1983.
Natl. Acad. Sci. USA, 86:6196-6200. Consensus structure and evolution of 5S rRNA.
Kohorn, B. D., and P. M. M. Rae. 1982. Non- Nucleic Acids Res., 11:893-900.
transcribed spacer sequences promote in vitro Kupriyanova, N. S., T. I. Serenkova, A. M.
transcription of Drosophilaribosomal DNA. Nu- Mazo, and M. Y. Timofeeva. 1985. Investiga-
cleic Acids Res., 10:6879-6886. tion of a cloned portion of the ribosomal operon

coding the 5.8S rRNA of the loach Misgurnus Larson, A., and A. C. Wilson. 1989. Patterns of
fossilis L. Mol. Biol., 18:1126-1134. ribosomal RNA evolution in salamanders. Mol.
Laaser, G., E. M6ller, K.-D. Jahnke, G. Bahn- Biol. Evol., 6:131-154.
weg, H. Prillinger, H. H. Prell. 1989. Ribo- Lassner, M., and J. Dvorak. 1986. Preferential
somal DNA restriction fragment analysis as a homogenization between adjacent and alter-
taxonomic tool in separating physiologically nate subrepeats in wheat rDNA. Nucleic Acids
similar basidiomycetous yeasts. Syst. Appl. Mi- Res., 14:5499-5512.
crobiol., 11:170-175. Lazar, E., B. Haendler, and M. Jacob. 1983. Two
Lachance, M.-A. 1990. Ribosomal DNA spacer 5S genes are expressed in chicken somatic cells.
variation in the cactophilic yeast Clavispora Nucleic Acids Res., 11:7735-7741.
opuntiae. Mol. Biol. Evol., 7:78-193. Le, H. L. V., R. Perasso, and R. Billard. 1989.
La Fontaine, S., and J. I. Rood. 1990. Evidence Phylogenie moleculaire preliminaire des <<pois-
that Bacteroides nodosus belongs in subgroup sons>> basee sur l'analyse de sequences d'ARN
Gamma of the class Proteobacteria,not in the ribosomique 28S. C. R. Acad. Sci. Paris, 309:
genus Bacteroides:partial sequence analysis of a 493-498.
B. nodosus16S rRNA gene. Int. J. Syst. Bacte- Learn, G. H.,Jr., and 3. A. Schaal. 1987. Popula-
riol., 40:154-159. tion subdivision for ribosomal DNA repeat
Lake, J. A. 1987. Prokaryotes and archaebacteria variants in Clematisfremontii.Evolution, 41:433-
are not monophyletic: Rate invariant analysis 438.
of rRNA genes indicates that eukaryotes and Lechner, K., G. Wich, and A. Bbck. 1985. The
eocytes form a monophyletic taxon. Cold Spring nucleotide sequence of the 16S rRNA gene and
Harbor Symp. Quant. Biol., 52:839-846. flanking regions from Methanobacterium formici-
. 1988. Origin of the eukaryotic nucleus cum: the phylogenetic relationship between
determined by rate-invariant analysis of rRNA methanogenic and halophilic Archaebacteria.
sequences. Nature, 331:184-186. Syst. Appl. Microbiol., 6:157-163.
. 1989a. Origin of the eukaryotic nucleus Leffers, H., J. Kjems, L. Ostergaard, N. Larsen,
determined by rate-invariant analyses of ribo- and R. A. Garrett. 1987. Evolutionary rela-
somal RNA genes. In B. Fernholm, K. Bremer, tionships amongst Archaebacteria. A compara-
and H. Jornvall (eds.), The Hierarchyof Life, pp. tive study of 23S ribosomal RNAs of a sulphur-
87-101. Elsevier Science Publishers (Biomedi- dependent extreme thermophile, an extreme
cal Division), Amsterdam. halophile and a thermophilic methanogen. J.
. 1989b. Origin of the multicellular ani- Mol. Biol., 195:43-61.
mals. In B. Femholm, K. Bremer, and H. Jorn- Leinfelder, W., M. Jarsch, and A. Bock. 1985.
vall (eds.), The Hierarchy of Life, pp. 273-278. The phylogenetic position of the sulfur-depen-
Elsevier Science Publishers (Biomedical Divi- dent Archaebacterium Thermoproteustenax: se-
sion), Amsterdam. quence of the 16S rRNA gene. Syst. Appl. Micro-
1990. Origin of the Metazoa. Proc. Natl. biol., 6:164-170.
Acad. Sci. USA, 87:763-766. Lenaers, G., L. Maroteaux, B. Michot, and
Lake, J. A., V. F. de la Cruz, P. C. G. Ferreira, M. Herzog. 1989. Dinoflagellates in evolution:
C. Morel, and L. Simpson. 1988. Evolution a molecular phylogenetic analysis of large sub-
of parasitism: kinetoplastid protozoan history unit ribosomal RNA. J. Mol. Evol., 29:40-51.
reconstructed from mitochondrial rRNA gene Lenaers, G., H. Nielsen,J. Engberg, and M. Her-
sequences. Proc. Natl. Acad. Sci. USA, 85:4779- zog. 1988. The secondary structure of large-
4783. subunit rRNA divergent domains, a marker for
Lane, D.J., D. A. Stahl, G.J. Olsen, D.J. Heller, protist evolution. BioSystems, 21:215-222.
and N. R. Pace. 1985. A phylogenetic analysis Lenaers, G., C. Scholin, Y. Bhaud, D. St. Hilaire,
of the genera Thiobacillus and Thiomicrospiraby and M. Herzog. 1991. A molecular phylogeny
5S rRNA sequences. J. Bacteriol., 163:75-81. of dinoflagellate protists (Pyrrhophyta) in-
Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, ferred from the sequence of the 24S rRNA di-
M. L. Sogin, and N. R. Pace. 1985. Rapid vergent domains DI and D8.J. Mol. Evol., 32:
determination of 16S ribosomal RNA se- 53-56.
quences for phylogenetic analyses. Proc. Natl. Liebl, W., M. Ehrmann, W. Ludwig, and K. H.
Acad. Sci. USA, 82:6955-6959. Schleifer. 1991. Transfer of Brevibacteriumdivar-
Larson, A. 1991. A molecular perspective on the icatum DSM 20297T, "Brevibacteriumflavum"
evolutionary relationships of the salamander DSM 2041 1, "Brevibacterium lactofermentum"DSM
families. In M. K. Hecht, B. Wallace, and R. J. 20412 and DSM 1412, and Corynebacterium lil-
Macintyre (eds.), EvolutionaryBiology, Vol. 25, ium DSM 2013 7T to Corynebacterium glutamicum
pp. 211-277. Plenum Press, New York. and their distinction by rRNA gene restriction

patterns. Int. J. Syst. Bacteriol.,41:255-260. T. A. Avdonina, M. Ya. Timofeyeva, and

Lim, B.-L., H. Kawai, H. Hori, and S. Osawa. L. L. Kisselev. 1981. The primary structure of
1986. Molecular evolution of 5S ribosomal oocyte and somatic 5S rRNAs from the loach
RNA from red and brown algae. Jpn. J. Genet., Misgurnus fossilis. Nucleic Acids Res., 9:2141-
61: 169-176. 2151.
Lim, P.-O., and B. B. Sears. 1989. 16S rRNA McCarroll, R., G. J. Olsen, Y. D. Stahl, C. R.
sequence indicates that plant-pathogenic myco- Woese, and M. L. Sogin. 1983. Nucleotide se-
plasma-like organisms are evolutionarily dis- quence of the Dictyostelium discoideum small-
tinct from animal mycoplasmas. J. Bacteriol., subunit ribosomal ribonucleic acid inferred
171:5901-5906. from the gene sequence: evolutionary implica-
Long, E. O., and I. B. Dawid. 1980. Repeated tions. Biochemistry, 22:5858-5868.
genes in eukaryotes. Annu. Rev. Biochem., 49: McCutchan, T. F., V. F. de la Cruz, A. A. Lal,
727-764. J. H. Gunderson, H. J. Elwood, and M. L.
Ludwig, W., K.-H. Schleifer, H. Reichenbach, Sogin. 1988. The primary sequences of the
and E. Stackebrandt. 1983. A phylogenetic small subunit ribosomal RNA genes from Plas-
analysis of the myxobacteria Myxococcusfulvus, modiumfalciparum. Mol. Biochem. Parasitol., 28:
Stigmatellaaurantiaca,Cystobacterfuscus,Sorangium 63-68.
cellulosum and Nannocystis exedens. Arch. Micro- McGill, T. J., J. Jurka, J. M. Sobieski, M. H.
biol., 135:58-62. Pickett, C. R. Woese, and G. E. Fox. 1986.
Ludwig, W., K.-H. Schleifer, G. E. Fox, E. See- Characteristic archaebacterial 16S rRNA oli-
waldt, and E. Stackebrandt. 1981. A phylo- gonucleotides. Syst. Appl. Microbiol., 7:194-
genetic analysis of staphylococci, Peptococcussac- 197.
charolyticusand Micrococcusmucilaginosus.J. Gen. McIntyre, C. L., B. C. Clarke, and R. Appels.
Microbiol., 125:357-366. 1988. DNA sequence analyses of the ribosomal
Lynn, D. H., and M. L. Sogin. 1988. Assessment spacer regions in the Triticeae.Plant Syst. Evol.,
of phylogenetic relationships among ciliated 160:91-104.
protists using partial ribosomal RNA se- Medlin, L., H. J. Elwood, S. Stickel, and M. L.
quences derived from reverse transcripts. Bio- Sogin. 1988. The characterization of enzymati-
Systems, 21:249-254. cally amplified eukaryotic 16S-like rRNA-
MacDonell, M. T., and R. R. Colwell. 1985a. coding regions. Gene, 71:491-499.
Phylogeny of the Vibrionaceae, and recom- Meyer, A., and A. C. Wilson. 1990. Origin of
mendation for two new genera, Listonella and tetrapods inferred from their mitochondrial
Shewanella. Syst. Appl. Microbiol., 6:171-182. DNA affiliation to lungfish. J. Mol. Evol., 3 1:
, and . 1985b. Phylogeny of the Vib- 359-364.
rionaceae. Ukr. Biokhim. Zh., 6:171-182. Michel, F., and B. Dujon. 1983. Conservation of
MacKay, R. M, andW. F. Doolittle. 1981. Nucle- RNA secondary structures in two intron fami-
otide sequences of Acanthamoebacastellanii 5S lies including mitochondrial-, chloroplast-, and
and 5.8S ribosomal ribonucleic acids: phyloge- nuclear-encoded members. EMBO (Eur. Mol.
netic and comparative structural analyses. Nu- Biol. Organ.)J., 2:33-38.
cleic Acids Res., 9:3321-3334. Michot, B., andJ.-P. Bachellerie. 1987. Compari-
MacKay, R. M., M. W. Gray, and W. F. Doolit- sons of large subunit rRNAs reveal some
tle. 1980. Nucleotide sequence of Crithidiafasci- eukaryote-specific elements of secondary struc-
culata cytosol 5S ribosomal ribonucleic acid. ture. Biochimie, 69:11-23.
Nucleic Acids Res., 8:4911-4917. Michot, B., N. Hassouna, andJ.-P. Bachellerie.
Maly, P., and R. Brimacombe. 1983. Refined sec- 1984. Secondary structure of mouse 28S rRNA
ondary structure models for the 16S and 23S and general model for the folding of the large
ribosomal RNA of Escherichiacoli. Nucleic Acids rRNA in eukaryotes. Nucleic Acids Res., 12:
Res., 11:7263-7286. 4259-4279.
Mankin, A. S., and A. M. Kopylov. 1981. A sec- Mindell, D. P., and R. L. Honeycutt. 1989. Vari-
ondary model for mitochondrial 12S rRNA: ability in transcribed regions of ribosomal
an example of economy in rRNA structure. DNA and early divergences in birds. Auk, 106:
Biochem.Int., 3:587-593. 539-548.
Maroteaux, L., M. Herzog, and M.-O. Soyer- , and . 1990. Ribosomal RNA in
Gobillard. 1985. Molecular organization of di- vertebrates: evolution and phylogenetic appli-
noflagellate ribosomal DNA: evolutionary im- cations. Annu. Rev. Ecol. Syst., 21:541-566.
plications of the deduced 5.8S rRNA secondary Miyamoto, M. M., and S. M. Boyle. 1989. The
structure. BioSystems, 18:307-319. potential importance of mitochondrial DNA se-
Mashkova, T. D., T. I. Serenkova, A. M. Mazo, quence data to eutherian mammal phylogeny.

In B. Fernholm, K. Bremer, and H. Jornvall gene and secondary structure of eukaryotic

(eds.), The Hierarchyof Life, pp. 43 7-450. Else- small subunit ribosomal RNAs. NucleicAcids
vier Science Publishers (Biomedical Division), Res., 12:8749-8768.
Amsterdam. Nelson, D. W., and B. M. Honda. 1985. Genes
Miyamoto, M. M., F. Kraus, and 0. A. Ryder. coding for 5S ribosomal RNA of the nematode
1990. Phylogeny and evolution of antlered deer Caenorhabditiselegans. Gene, 38:245-251.
determined from mitochondrial DNA se- Nevo, E., and A. Beiles. 1988. Ribosomal DNA
quences. Proc. Natl. Acad. Sci. USA, 87:6127- non-transcribed spacer polymorphism in sub-
6131. terraneanmole rats:genetic differentiation,en-
Miyamoto, M. M., S. M. Tanhauser, and P. J. vironmental correlates and phylogenetic rela-
Laipis. 1989. Systematic relationships in the tionships. Evol. Ecol., 2:139-156.
artiodactyl tribe Bovini (family Bovidae) as de- Nickrent, D. L., and C. R. Franchina. 1990. Phy-
termined from mitochondrial DNA sequences. logenetic relationshipsof the Santalalesand rel-
Syst. Zool., 38:342-349. atives. J. Mol. Evol., 31:294-301
Montgomery, L., B. Flesher, and D. Stahl. 1988. Nishikawa, K., and S. Takemura. 1974. Nucleo-
Transfer of Bacteroidessuccinogenes(Hungate) to tide sequence of 5 S RNA from Torulopsis utilis.
Fibrobactergen. nov. as Fibrobactersuccinogenes FEBS Lett., 40:106-109.
comb. nov. and description of Fibrobacterintesti- Noller, H. F. 1984. Structure of ribosomal RNA.
nalis sp. nov. Int. J. Syst. Bacteriol., 38:430-435. Annu. Rev. Biochem., 53:119-162.
Moore, R. L. 1977. Ribosomal ribonucleic acid Noller, H. F., and C. R. Woese. 1981. Secondary
cistron homologies among Hyphomicrobiumand structure of 16S ribosomal RNA. Science,212:
various other bacteria. Can. J. Microbiol., 23: 403-411.
478-481. Noller, H. F., J. Kop, V. Wheaton, J. Brosius,
Mordarski, M., M. Goodfellow, A. Tkacz, G. Pul- R. R. Gutell, A. M. Kopylov, F. Dohme,
verer, and K. P. Schaal. 1980. Ribosomal ribo- W. Herr, D. A. Stahl, R. Gupta, and C. R.
nucleic acid similarities in the classification of Woese. 1981. Secondary structure model for
Rhodococcusand related taxa. J. Gen. Microbiol., 23S ribosomal RNA. NucleicAcids Res., 9:6167-
118:313-319. 6189.
Morgan, E. A. 1982. Ribosomal RNA genes in Ohama, T., H. Hori, and S. Osawa. 1983. The
Escherichiacoli. In H. Busch and L. Rothblum nucleotide sequence of 5S rRNAs from a sea-
(eds.), The Cell Nucleus: rDNA, Vol. X, Part A, cucumber, a starfish and a sea-urchin. Nucleic
pp. 1-29. Academic Press, New York. Acids Res., 11:5181-5184.
Nagylaki, T. 1984. Evolution of multigene fami- Ohama, T., T. Kumazaki,H. Hori, and S. Osawa.
lies under interchromosomal gene conversion. 1984. Evolution of multicellularanimals as de-
Proc. Natl. Acad. Sci. USA, 81:3796-3800. duced from 5S rRNA sequences: a possible
Nagylaki, T., and T. D. Petes. 1982. Intrachro- early emergence of the Mesozoa. NucleicAcids
mosomal gene conversion and the maintenance Res., 12:5101-5108.
of sequence homogeneity among repeated Ohama, T., T. Kumazaki, H. Hori, S. Osawa,
genes. Genetics, 100:315-337. and M. Takai. 1983. Fresh-waterplanariasand
Nairn, C. J., and R. J. Ferl. 1988. The complete a marine planaria are relatively dissimilar in
nucleotide sequence of the small-subunit ribo- the 5S rRNA sequences. Nucleic Acids Res., 11:
somal RNA coding region for the cycad Zamia 473-476.
pumila: phylogenetic implications. J. Mol. Ohkubo, S., H. Iwasaki, H. Hori, and S. Osawa.
Evol., 27:133-141. 1986. Evolutionary relationshipof denitrifying
Nazar, R. N., T. 0. Sitz, and H. Busch. 1976. bacteria as deduced from 5S rRNA sequences.
Sequence homologies in mammalian 5.8S ribo- J. Biochem.,100:1261-1267.
somal RNA. Biochemistry, 15:505-508. Olsen, G.J. 1987. Earliestphylogeneticbranchings:
Neefs, J.-M., Y. Van de Peer, L. Hendriks, and comparing rRNA-based evolutionary trees in-
R. de Wachter. 1990. Compilation of small ri- ferredwith various techniques. ColdSpringHar-
bosomal subunit RNA sequences. Nucleic Acids bor Symp. Quant. Biol., 52:825-837.
Res., 18s:2237-2318. Olsen, G. J., and M. L. Sogin. 1982. Nucleotide
Nelkin, B., D. Strayer, and B. Vogelstein. 1980. sequence of Dictyostelium discoideum 5.8S ribo-
Divergence of primate ribosomal RNA genes somal ribonucleic acid: evolutionary and sec-
as assayed by restriction enzyme analysis. Gene, ondary structural implications. Biochemistry,
11:89-96. 21:2335-2343.
Nelles, L., B.-L. Fang, G. Volckaert, A. Vanden- Olsen, G. J., N. R. Pace, M. Nuell, B. P. Kaine,
berghe, and R. de Wachter. 1984. Nucleotide R. Gupta, and C. R. Woese. 1985. Sequence of
sequence of a crustacean 18S ribosomal RNA the 16S rRNA gene from the thermoacidophilic

archaebacterium Sulfolobus solfataricus and its of Helicobacterfelissp. nov., Helicobactermustelae,

evolutionary implications. J. Mol. Evol., 22: and related bacteria. Int.J. Syst. Bacteriol.,41:
301-307. 3 1-38.
O stergaard, L., N. Larsen, H. Leffers, J. Kjems, Patterson, C. (ed.) 1987. Molecules and Morphology
and R. Garrett. 1987. A ribosomal RNA op- in Evolution: Conflict or Compromise?Cambridge
eron and its flanking region from the archae- University Press, Cambridge.
bacterium Methanobacteriumthermoautotrophicum, . 1989. Phylogenetic relations of major
Marburg strain: transcription signals, RNA groups: conclusions and prospects. In B. Fern-
structure and evolutionary implications. Syst. holm, K. Bremer, and H. Jornvall (eds.), The
Appl. Microbiol., 9:199-209. Hierarchyof Life, pp. 47 1-488. Elsevier Science
Oyaizu, H., and C. R. Woese. 1985. Phylogenetic Publishers (Biomedical Division), Amsterdam.
relationships among the sulfate-reducing bacte- 1990. Reassessing relationships. Nature,
ria, myxobacteria and purple bacteria. Syst. 344:199-200.
Appl. Microbiol., 6:257-263. Pavlakis, G. N., B. R. Jordan, R. M. Wurst, and
Oyaizu, H., B. Debrunner-Vossbrinck, L. Man- J. N. Vournakis. 1979. Sequence and second-
delco, J. A. Studier, and C. R. Woese. 1987. ary structure of Drosophila melanogaster5.8S and
The green non-sulfur bacteria: a deep branching 2S rRNAs and of the processing site between
in the eubacterial line of descent. Syst. Appl. them. Nucleic Acids Res., 7:2213-2338.
Microbiol., 9:47-53. Pechman, K. J., B. J. Lewis, and C. R. Woese.
Pace, B., and L. L. Campbell. 1971a. Homology 1976. Phylogenetic status of Sporosarcinaureae.
of ribosomal ribonucleic acid of Desulfovibrio Int. J. Syst. Bacteriol., 26:305-310.
species with Desulfovibrio vulgaris. J. Bacteriol., Perasso, R., A. Baroin, L. H. Qu, J.-P. Bachel-
106:717-719. lerie, and A. Adoutte. 1989. Origin of the al-
, and . 1971b. Homology of ribo- gae. Nature, 339:142-144.
somal ribonucleic acid of diverse bacterial spe- Perelson, A. S., and G. I. Bell. 1977. Mathemati-
cies with Escherichia coli and Bacillus stearother- cal models for the evolution of multigene fami-
mophilus.J. Bacteriol., 107:543-547. lies by unequal crossing over. Nature, 265:304-
Pace, N. R., G. J. Olsen, and C. R. Woese. 1986. 310.
Ribosomal RNA phylogeny and the primary Peterson, R. C., J. L. Doering, and D. D. Brown.
lines of evolutionary descent. Cell, 45:325-326. 1980. Characterization of two Xenopus somatic
Palleroni, N. J., R. Kunisawa, R. Contopoulou, 5S DNAs and one minor oocyte-specific 5S
and M. Doudoroff. 1973. Nucleic acid homolo- DNA. Cell, 20:131-141.
gies in the genus Pseudomonas.Int. J. Syst. Bacte- Petes, T. D. 1980. Unequal meiotic recombina-
riol., 23:333-339. tion within tandem arrays of yeast ribosomal
Palmer, J. D. 1985a. Evolution of chloroplast and DNA genes. Cell, 19:765-774.
mitochondrial DNA in plants and algae. In Qi, G.-R., G.-J. Cao, P. Jiang, X.-L. Feng, and
R. J. MacIntyre (ed.), MolecularEvolutionaryGe- X. -R. Gu. 1988. Studies on the sites expressing
netics, pp. 131-240. Plenum Press, New York. evolutionary changes in the structure of eukar-
.1985b. Comparative organization of chlo- yotic 5S ribosomal RNA.J. Mol. Evol., 27:336-
roplast genomes. Annu. Rev. Genet., 19:325- 340.
354. Qu, L.-H., M. Nicoloso, and J.-P. Bachellerie.
Park, Y.-H., H. Hori, K.-I. Suzuki, S. Osawa, 1988. Phylogenetic calibration of the 5' termi-
and K. Komagata. 1987. Phylogenetic analysis nal domain of large rRNA achieved by de-
of the coryneform bacteria by 5S rRNA se- termining twenty eucaryotic sequences. J. Mol.
quences. J. Bacteriol., 169:1801-1806. Evol., 28:113-124.
Paster, B. J., E. Stackebrandt, R. B. Hespell, Qu, L.-H., N. Hardman, L. Gill, L. Chappell,
C. M. Hahn, and C. R. Woese. 1984. The M. Nicoloso, andJ. -P. Bachellerie. 1986. Phy-
phylogeny of the spirochetes. Syst. Appl. Micro- logeny of helminths determined by rRNA se-
biol., 5:337-351. quence comparison. Mol. Biochem. Parasitol.,
Paster, B. J., W. Ludwig, W. G. Weisburg, 20:93-99.
E. Stackebrandt, R. B. Hespell, C. M. H. Rei- Qu, L.-H., R. Perasso, A. Baroin, G. Brugerolle,
chenbach, K. 0. Stetter, and C. R. Woese. J.-P. Bachellerie, and A. Adoutte. 1988. Mo-
1985. A phylogenetic grouping of the Bacte- lecular evolution of the 5-terminal domain of
roides, Cytophagas,and certain Flavobacteria.Syst. large-subunit rRNA from lower eukaryotes. A
Appl. Microbiol., 6:34-42. broad phylogeny covering photosynthetic and
Paster, B. J., A. Lee, J. G. Fox, F. E. Dewhirst, non-photosynthetic protists. BioSystems, 2 1:
L. A. Tordoff, G. J. Fraser, J. L. O'Rourke, 203-208.
N. S. Taylor, and R. Ferrero. 1991. Phylogeny Raff, R. A., K. G. Field, G. J. Olsen, S. J. Gio-

vannoni, D. J. Lane, M. T. Ghiselin, N. R. RNA cistron similarities among Hyphomicro-

Pace, and E. C. Raff. 1989. Metazoan phylog- bium species and several other hyphal, budding
eny based on analysis of 18S ribosomal RNA. bacteria. Syst. Appl. Microbiol., 11:140-147.
In B. Fernholm, K. Bremer, and H. Jornvall Romaniuk, P. J., B. Zoltowska, T. J. Trust, D. J.
(eds.), The Hierarchyof Life, pp. 247-260. Else- Lane, G. J. Olsen, N. R. Pace, and D. A.
vier Science Publishers (Biomedical Division), Stahl. 1987. Campylobacterpylori,the spiral bac-
Amsterdamn. terium associated with human gastritis, is not
Raff, R. A., K. G. Field, M. T. Ghiselin, D. J. a true Campylobactersp. J. Bacteriol., 169:2 137-
Lane, G. J. Olsen, A. L. Parks, B. A. Parr, 2141.
N. R. Pace, and E. C. Raff. 1988. Molecular Rossau, R., A. Van Landschoot, M. Gillis, and
analysis of distant phylogenetic relationships in J. De Ley. 1991. Taxonomy of Moraxellaceae
echinoderms. In C. R. C. Paul and A. B. Smith fam. nov., a new bacterial family to accommo-
(eds.), EchinodermPhylogenyandEvolutionaryBiol- date the genera Moraxella, Acinetobacter, and
ogy, pp. 29-41. Oxford University Press, Ox- Psychrobacterand related organisms. Int.J. Syst.
ford. Bacteriol., 41:310-319.
Ragan, M. A. 1988. Ribosomal RNA and the Rothschild, L. J., M. A. Ragan, A. W. Coleman,
major lines of evolution: a perspective. BioSys- P. Heywood, and S. A. Gerbi. 1986. Are rRNA
tems, 21:177-188. sequence comparisons the Rosetta Stone of
Rausch, H., N. Larsen, and R. Schmitt. 1989. phylogenetics? Cell, 47:640.
Phylogenetic relationships of the green alga Vol- Rowan, R., and D. A. Powers. 1991. A molecular
vox carteri deduced from small-subunit ribo- genetic classification of zooxanthellae and the
somal RNA comparisons. J. Mol. Evol., 29: evolution of animal-algal symbioses. Science,
255-265. 251:1348-1351.
Raynal, F., B. Michot, and J.-P. Bachellerie. Rubstov, P. M., M. M. Musakhanov, V. M.
1984. Complete nucleotide sequence of mouse Zakharyev, A. S. Krayev, K. G. Skryabin, and
18S rRNA gene: comparison with other avail- A. A. Bayev. 1980. The structure of the yeast
able homologs. FEBS Lett., 167:263-268. ribosomal RNA genes. I. The complete nucleo-
Reddy, P., R. Appels, and B. R. Baum. 1990. tide sequence of the 18S ribosomal RNA gene
Ribosornal DNA spacer-length variation in Se- from Saccharomycescerevisiae. Nucleic Acids Res.,
cale spp. (Poaceae). Plant Syst. Evol., 171:205- 8:5779-5794.
220. Saccone, C., P. Cantatore, G. Gadaleta, R. Gal-
Reeder, R. H. 1984. Enhancers and ribosomal lerani, C. Lanave, G. Pepe, and A. M. Kroon.
gene spacers. Cell, 38:349-351. 1981. The nucleotide sequence of the large ri-
Reeder, R. H., J. G. Roan, and M. Dunaway. bosomal RNA gene and the adjacent tRNA
1983. Spacer regulation of Xenopus ribosomal genes from rat mitochondria. Nucleic Acids Res.,
gene transcription: competition in oocytes. 9:4139-4147.
Cell, 35:449-456. Saghai-Maroof, M. A., K. M. Soliman, R. A.
Roe, B. A., D.-P. Ma, R. K. Wilson, andJ. F.-H. Jorgensen, and R. W. Allard. 1984. Ribosomal
Wong. 1985. The complete nucleotide se- DNA spacer length polymorphisms in barley:
quence of the Xenopus laevis mitochondrial ge- Mendelian inheritance, chromosomal location,
nome. J. Biol. Chem., 260:9759-9774. and population dynamics. Proc. Natl. Acad. Sci.
Rogall, T., J. Wolters, T. Flohr, and E. Bottger. USA, 81:8014-8018.
1990. Towards a phylogeny and definition of Salim, M., and B. E. H. Maden. 1981. Nucleotide
species at the molecular level within the genus sequence of Xenopus laevis 18S ribosomal RNA
Mycobacterium. Int. J. Syst. Bacteriol., 40:323- inferred from gene sequence. Nature, 291 :205-
330. 208.
Rogers, S. O., S. Honda, andA.J. Bendich. 1986. Sankoff, D., C. Morel, and R. J. Cedergren.
Variation in the ribosomal RNA genes among 1973. Evolution of 5S RNA and the non-
individuals of Viciafaba. PlantMol. Biol., 6:339- randomness of base replacement. Nature New
345. Biology, 245:232-234.
Rogers, M.J.,J. Simmons, R. T. Walker, W. G. Sasaki, T., T. Okazaki, M. Muramatsu, and
Weisburg, C. R. Woese, R. S. Tanner, I. M. R. Kominami. 1987. Variation among mouse
Robinson, D. A. Stahl, G. Olsen, R. H. Leach, ribosomal RNA genes within and between
andJ. Maniloff. 1985. Construction of the my- chromosomes. Mol. Biol. Evol., 4:594-601.
coplasma evolutionary tree from 5S rRNA se- Schaal, B. A., W.J. Leverich, andJ. Nieto-Sotelo.
quence data. Proc. Natl. Acad. Sci. USA, 82: 1987. Ribosomal DNA variation in the native
1160-1164. plant Phlox divaricata. Mol. Biol. Evol., 4:61 1-
Roggentin, T., and P. Hirsch. 1989. Ribosomal 621.

Schlegel, M., H. J. Elwood, and M. L. Sogin. genetic reconstruction: testing the limits of its
1991. Molecular evolution in hypotrichous cili- resolution. Cladistics, 5:321-344.
ates: sequence of the small subunit ribosomal Smith, G. P. 1973. Unequal crossover and the
RNA genes from Onychodromusquadricornutus evolution of multigene families. Cold Spring
and Oxytrichagraulifera (Oxytrichidae, Hypo- Harbor Symp. Quant. Biol., 38:507-513.
trichida, Ciliophora).J. Mol. Evol., 32:64-69. . 1976. Evolution of repeated DNA se-
Schleifer, K. H., and W. Ludwig. 1989. Phyloge- quences by unequal cross overs. Science, 191:
netic relationships among bacteria. In B. Fern- 528-534.
holm, K. Bremer, and H. Jornvall (eds.), The Sogin, M. L. 1989. Evolution of eukaryotic micro-
Hierarchyof Life, pp. 103-117. Elsevier Science organisms and their small subunit ribosomal
Publishers (Biomedical Division), Amsterdam. RNAs. Am. Zool., 29:487-499.
Schnare, M. N., J. C. Collings, and M. W. Gray. * 1990. Amplification of ribosomal RNA
1986. Structure and evolution of the small sub- genes for molecular evolution studies. In M. A.
unit ribosomal RNA gene of Crithidiafasciculata. Innis, D. H. Gelfand, J. J. Sninsky, and T. J.
Curr. Genet., 10:405-410. White (eds.), PCR Protocols:A Guide to Methods
Schwartz, R. M., and M. 0. Dayhoff. 1978. Ori- andApplications, pp. 307-314. Academic Press,
gins of prokaryotes, eukaryotes, mitochondria San Diego.
and chloroplasts. Science, 199:395-403. Sogin, M. L., and H. J. Elwood. 1986. Primary
Schwarz, Z., and H. Kossel. 1980. The primary structure of the Paramecium tetraurelia small-
structure of 16S rDNA from Zea mays chloro- subunit rRNA coding region: phylogenetic re-
plast is homologous to E. coli 16S rRNA. Nature, lationships within the ciliophora. J. Mol. Evol.,
283:739-742. 23:53-60.
Scoles, G. J., B. S. Gill, Z.-Y. Xin, B. C. Clarke, Sogin, M. L., andJ. H. Gunderson. 1987. Struc-
C. L. McIntyre, C. Chapman, and R. Appels. tural diversity of eukaryotic small subunit ribo-
1988. Frequent duplication and deletion events somal RNAs: evolutionary implications. Ann.
in the 5S RNA genes and the associated spacer NYAcad. Sci., 503:125-139.
regions of the Triticeae. Plant Syst. Evol., 160: Sogin, M. L., U. Edman, and H. Elwood. 1989.
105-122. A single kingdom of eukaryotes. In B. Fern-
Seewaldt, E., and E. Stackenbrandt. 1982. Partial holm, K. Bremer, and H. Jornvall (eds.), The
sequence of 16S ribosomal RNA and the phy- Hierarchyof Life, pp. 133-143. Elsevier Science
logeny of Prochloron.Nature, 295:618-620. Publishers (Biomedical Division), Amsterdam.
Seperack, P., M. Slatkin, and N. Arnheim. 1988. Sogin, M. L., H. J. Elwood, andJ. H. Gunder-
Linkage disequilibrium in human ribosomal son. 1986. Evolutionary diversity of eukaryotic
genes: implications for multigene family evolu- small-subunit rRNA genes. Proc. Natl. Acad.
tion. Genetics, 119:943-949. Sci. USA, 83:1383-1387.
Simon, C., A. Franke, and A. Martin. 1991. The Sogin, M. L., M. T. Swanton, J. H. Gunderson,
polymerase chain reaction: DNA extraction and H. J. Elwood. 1986. Sequence of the small
and amplification. In G. M. Hewitt, A. W. B. subunit ribosomal RNA gene from the hypotri-
Johnston, and J. P. W. Young (eds.), Molecular chous ciliate Euplotes aediculatus. J. Protozool.,
Techniquesin Taxonomy,pp. 329-355. Springer- 33: 26-29.
Verlag, Berlin. Sogin, M. L., J. H. Gunderson, H. J. Elwood,
Simon, C., S. Paabo, T. D. Kocher, and A. C. R. A. Alonso, and D. A. Peattie. 1989. Phylo-
Wilson. 1990. Evolution of mitochondrial ribo- genetic meaning of the kingdom concept: an
somal RNA in insects as shown by the polymer- unusual ribosomal RNA from Giardia lamblia.
ase chain reaction. In M. Clegg and S. O'Brien Science, 243:75-77.
(eds.), MolecularEvolution, UCLA Symposia on Sogin, M. L., A. Ingold, M. Karlok, H. Nielsen,
Molecular and Cellular Biology, New Series, J. Enberg. 1986. Phylogenetic evidence for the
Vol. 122, pp. 235-244. Wiley-Liss, New York. acquisition of ribosomal RNA introns subse-
Simpson, R. T., and D. W. Stafford. 1983. Struc- quent to the divergence of some of the major
tural features of a phased nucleosome core par- Tetrahymenagroups. EMBO (Eur. Mol. Biol. Or-
ticle. Proc. Natl. Acad. Sci. USA, 80:51-55. gan.)J., 5:3625-3630.
Sites, J. W., and S. K. Davis. 1989. Phylogenetic Sogin, S.J., M. L. Sogin, and C. R. Woese. 1972.
relationships and molecular variability within Phylogenetic measurement in procaryotes by
and among six chromosome races of Sceloporus primary structural characterization. J. Mol.
grammicus (Sauria, Iguanidae), based on nu- Evol., 1:173-184.
clear and mitochondrial markers. Evolution, 43: Spencer, D. F., L. Bonen, and M. W. Gray. 1981.
296-317. Primary sequence of wheat mitochodrial 5S ri-
Smith, A. B. 1989. RNA sequence data in phylo- bosomal ribonucleic acid: functional and evolu-

tionary implications. Biochemistry, 20:4022- T. M.Schmidt, and N. R. Pace. 1985. A phylo-

4029. genetic analysis of certain sulfur-oxidizing and
Spencer, D. F., M. N. Schnare, and M. W. Gray. related morphologically conspicuous bacteria
1984. Pronounced structural similarities be- by 5S ribosomal RNA sequences. Int. j Syst.
tween the small ribosomal RNA genes of wheat Bacteriol., 37:116-122.
mitochondria and Escherichia coli. Proc. Natl. Stambrook, P. J. 1978. Heterogeneity in Chinese
Acad. Sci. USA, 81:493-497. hamster ribosomal DNA. Chromosoma,65:153-
Spencer, D. F., J. C. Collings, M. N. Schnare, 159.
and M. W. Gray. 1987. Multiple spacer se- Stanton, T. B., N. S. Jenson, T. A. Casey, L. A.
quences in the nuclear large subunit ribosomal Tordoff, F. E. Dewhirst, and B. J. Paster.
RNA gene of Crithidiafasciculata. EMBO (Eur. 1991. Reclassification of Treponemahyodysenter-
Mol. Biol. Organ.) J., 6:1063-1071. iae and Treponemainnocensin a new genus, Ser-
Stackebrandt, E., and 0. Charfreitag. 1990. Par- pula gen. nov., as Serpula hyodysenteriaecomb.
tial 16S rRNA primary structure of five Actino- nov. and Serpulainnocenscomb. nov. Int. J Syst.
myces species: phylogenetic implications and Bacteriol., 41:50-58.
development of an Actinomyces israelii-specific Steele, K. P., K. E. Holsinger, R. K. Jansen, and
oligonucleotide probe. J. Gen. Microbiol., 136: D. W. Taylor. 1991. Assessing the reliability
37-43. of 5S rRNA sequence data for phylogenetic
Stackebrandt, E., and C. R. Woese. 1981. The evo- analysis in green plants. Mol. Biol. Evol., 8:
lution of prokaryotes. In M. J. Carlile, J. R. 240-248.
Collins, and B. E. B. Mosely (eds.), Molecular Stock, D. W., K. D. Moberg, G. S. Whitt, and
and CellularAspects of Microbial Evolution, pp. 1- L. R. Maxson. 1991. Phylogenetic implica-
31. Cambridge University Press, Cambridge. tions of the 18S ribosomal RNA sequence of the
Stackebrandt, E., U. Wehmeyer, and B. Schink. coelacanth Latimeria chalumnae (Smith), Envir.
1989. The phylogenetic status of Pelobacteracidi- Biol. Fishes, 32:99-117.
gallici, Pelobactervenetianus, and Pelobactercarbi- St6cklein, L., W. Ludwig, K. H. Schleifer, and
nolicus. Syst. Appl. Microbiol., 11:257-260. E. Stackebrandt. 1983. Comparative oligonu-
Stackebrandt, E., V. J. Fowler, F. Fiedler, and cleotide cataloguing of 18S ribosomal RNA in
H. Seiler. 1983. Taxonomic studies on Arthro- phylogenetic studies of eukaryotes. In U. Jen-
bacternicotianaeand related taxa: description of sen and D. E. Fairbrothers (eds.), Protein and
Arthrobacteruratoxydanssp. nov. and Arthrobacter Nucleic Acids in Plant Systematics, pp. 58-62.
sulfureus sp. nov. and reclassification of Brevi- Springer-Verlag, Berlin.
bacteriumprotophormiaeas Arthrobacterprotophor- Subrahmanyam, C. S., B. Cassidy, H. Busch, and
miae comb. nov. Syst. Appl. Microbiol., 4:470- L. I. Rothblum. 1982. Nucleotide sequence of
486. the region between the 18S rRNA sequence and
Stackebrandt, E., B. Wunner-Fiissl, V. J. Fowler, the 28S rRNA sequence of rat ribosomal DNA.
and K.-H. Schleifer. 1981. Deoxyribonucleic Nucleic Acids Res., 10:3667-3680.
acid homologies and ribosomal ribonucleic acid Suzuki, H., K. Moriwaki, and E. Nevo. 1987.
similarities among sporeforming members of Ribosomal DNA (rDNA) spacer polymor-
the order Actinomycetales.Int. J. Syst. Bacteriol., phism in mole rats. Mol. Biol. Evol., 4:602-610.
31:420-431. Suzuki, H., N. Miyashita, K. Moriwaki, R. Kom-
Stackebrandt, E., H. Pohla, R. Kroppenstedt, inami, M. Muramatsu, T. Kanehisa, F. Bon-
H. Hippe, and C. R. Woese. 1985. 16S rRNA homme, M. L. Petras, Z. Yu, and D. Lu. 1986.
analysis of Sporomusa, Selenomonas, and Mega- Evolutionary implication of heterogeneity of
sphaera: on the phylogenetic origin of gram- the nontranscribed spacer region of ribosomal
positive eubacteria. Arch. Microbiol., 143:270- DNA repeating units in various subspecies of
276. Mus musculus. Mol. Biol. Evol., 3:126-137.
Stackebrandt, E., W. Ludwig, W. Schubert, Swings, J., M. Gillis, K. Kersters, P. de Vos,
F. Klink, H. Schlensner, T. Roggentin, and F. Gossele, and J. de Ley. 1980. Frateuria, a
P. Hirsch. 1984. Molecular genetic evidence new genus for "Acetobacter aurantius."Int.J. Syst.
for early evolutionary origin of budding pep- Bacteriol., 30:547-556.
tidoglycan-less eubacteria. Nature, 307:735- Swofford, D. L., and G. J. Olsen. 1990. Phylog-
737. eny reconstruction. In D. M. Hillis and C. Mo-
Stahl, D. A., andJ. W. Urbance. 1990. The divi- ritz (eds.), Molecular Systematics, pp. 411-501.
sion between fast- and slow-growing species Sinauer Associates, Sunderland.
corresponds to natural relationships among Sytsma, K. J., and B. A. Schaal. 1985. Phyloge-
mycobacteria. J. Bacteriol., 172:116-124. netics of the Lisianthius skinneri (Gentianaceae)
Stahl, D. A., D.J. Lane, G.J. Olsen, D.J. Heller, species complex in Panama utilizing DNA re-

striction fragment analysis. Evolution, 39:594- Drosophilamelanogaster.NucleicAcids Res., 8:441-

608. 451.
Szostak, J. W., and R. Wu. 1980. Unequal cross- Tsuji, K., H. C. Tsien, R. S. Hanson, S. R. De-
ing over in the ribosomal DNA of Saccharomyces Palma, R. Scholtz, and S. LaRoche. 1989. 16S
cerevisiae.Nature, 284:426-430. ribosomal RNA sequence analysis for determi-
Takaiwa, F., K. Oono, and M. Sugiura. 1984. nation of phylogenetic relationship among
The complete nucleotide sequence of a rice 17S methylotrophs. J. Gen. Microbiol., 136:1-10.
rRNA gene. NucleicAcids Res., 125:5441-5448. Tu, J., D. Prangishvilli, H. Huber, G. Wild-
Takaiwa, F., M. Kusuda, N. Saga, and M. Sugi- gruber, W. Zillig, and K. 0. Stetter. 1982.
ura. 1982. The nucleotide sequence of 5S Taxonomic relations between archaebacteria
rRNA from a red alga, Porphyrayezoensis.Nucleic including 6 novel genera examined by cross
Acids Res., 10:6037-6040. hybridization of DNAs and 16S rRNAs.J. Mol.
Takaiwa, F., K. Oono, Y. Iida, and M. Sugiura. Evol., 18:109-114.
1985. The complete nucleotide sequence of a Turner, S., T. Burger-Wiersma, S. J. Giovan-
rice 25S*rRNA gene. Gene, 37:255-259. noni, L. R. Mur, and N. R. Pace. 1989. The
Tanhauser, S. M., W. W. Hauswirth, and P. J. relationship of a prochlorophyte Prochlorothrix
Laipis. 1986. Conserved restriction sites within hollandica to green chloroplasts. Nature, 337:
the ribosomal RNA genes of vertebrates. Bio- 380-382.
chim. Biophys. Acta, 866:19-25. Ulbrich, N., M. Digweed, and V. A. Erdmann.
Tanner, R. S., E. Stackebrandt, G. E. Fox, and 1984. The nucleotide sequence of the cyto-
C. R. Woese. 1981. A phylogenetic analysis of plasmic 5S rRNA from the horsetail, Equisetum
Acetobacteriumwoodii, Clostridiumbarkeri,Clostrid- arvense. Nucleic Acids Res., 12:1577-1580.
ium butyricum, Clostridium lituseburense,Eubacte- Vandamme, P., E. Falsen, R. Rossau, B. Hoste,
rium limosum, and Eubacteriumtenue. Curr.Micro- P. Segers, R. Tytgat, and J. de Ley. 1991.
biol., 5:35-38. Revision of Campylobacter,Helicobacter,and Wol-
Tautz, D.,J. M. Hancock, D. A. Webb, C. Tautz, inella taxonomy: emendation of generic descrip-
and G. A. Dover. 1988. Complete sequences of tions and proposal of Arcobactergen. nov. Int. J.
the rRNA genes of Drosophila melanogaster.Mol. Syst. Bacteriol., 41:88-103.
Biol. Evol., 5:366-376. Vandenberghe, A., A. Wassink, P. Raeymaekers,
Thomas, R. H., W. Schaffner, A. C. Wilson, and R. de Baere, E. Huysmans, and R. de
S. Paibo. 1989. DNA phylogeny of the extinct Wachter. 1985. Nucleotide sequence, second-
marsupial wolf. Nature, 340:465-467. ary structure and evolution of the 5S ribosomal
Toivonen, L. A., D. T. Crowe, R. J. Detrick, RNA from five bacterial species. Eur. J. Bio-
S. W. Klemann, andJ. C. Vaughn. 1983. Ri- chem., 149:537-542.
bosomal RNA gene number and sequence di- Vandenberghe, A., M.-W. Chen, E. Dams, R. de
vergence in the diploid-tetraploid species pair Baere, E. de Roeck, E. Huysmans, and R. de
of North American hylid tree frogs. Biochem. Wachter. 1984. The corrected nucleotide se-
Genet., 21:299-308. quences of 5S RNAs from six angiosperms with
Torczynski, R., A. P. Bollon, and M. Fuke. 1983. some notes on 5S RNA secondary structure and
The complete nucleotide sequence of the rat molecular evolution. FEBS Lett., 171:17-23.
18S ribosomal RNA gene and comparison with Van Den Bussche. In press. Phylogenetic analysis
the respective yeast and frog genes. NucleicAcids of restriction site variation in the ribosomal
Res., 11:4879-4890. DNA complex of New World leaf-nosed bat
Torczynski, R., M. Fuke, and A. P. Bollon. 1985. genera. Syst. Zool.
Cloning and sequencing of a human 18S ribo- Van den Eynde, H., Y. Van de Peer, J. Perry,
somal RNA gene. DNA, 4:283-291. and R. de Wachter. 1990. 5S rRNA sequences
Torres, R. A., M. Ganal, and V. Hemleben. of representatives of the genera Chlorobium,
1990. GC balance in the internal transcribed Prosthecochloris,Thermomicrobium,Cytophaga,Fla-
spacers ITS 1 and ITS 2 of nuclear ribosomal vobacterium,Flexibacterand Saprospiraand a dis-
RNA genes. J Mol. Evol., 30:170-181. cussion of the evolution of eubacteria in gen-
Troitsky, A. V., and V. K. Bobrova. 1986. 23S eral. J. Gen. Microbiol., 136:11-18.
rRNA-derived small ribosomal RNAs: their Van den Eynde, H., Y. Van de Peer, H. Vandena-
structure and evolution with references to plant beele, M. Van Bogaert, and R. de Wachter.
phylogeny. In S. K. Dutta (ed.), DNA Systemat- 1990. 5S rRNA sequences of myxobacteria and
ics, Vol. II, pp. 81-135. CRC Press, Boca radioresistant bacteria and implications for eu-
Raton. bacterial evolution. Int. J Syst. Bacteriol., 40:
Tschudi, C., and V. Pirrotta. 1980. Sequence and 399-404.
heterogeneity in the 5S RNA gene cluster of Van de Peer, Y., J. M. Neefs, and R. de Wachter.

1990. Small ribosomal subunit RNA se- tic acid bacteria and description of Vagococcus
quences, evolutionary relationships among dif- salmoninarum sp. nov. Int.J. Syst.Bacteriol.,40:
ferent life forms, and mitochondrial origins.J. 224-230.
Mol. Evol., 30:463-476. Ware, V. C., B. W. Tague, C. G. Clark, R. L.
Van de Peer, Y., R. de Baere, J. Cauwenberghs, Gourse, R. C. Brand, and S. A. Gerbi. 1983.
and R. de Wachter. 1990. Evolution of green Sequence analysis of 28S ribosomalDNA from
plants and their relationship with other photo- the amphibianXenopus laevis. Nucleic Acids Res.,
synthetic eukaryotes as deduced from 5S ribo- 11:7795-7817.
somal RNA sequences. Plant Syst. Evol., 170: Watanabe, J.-I., H. Hori, K. Tanabe, and
85-96. Y. Nakamura. 1989. Phylogenetic association
Verbeet, M. P., H. van Heerikhuizen, J. Kloot- of Pneumocystiscariniiwith the 'Rhizopoda/Myx-
wijk, R. D. Fontijn, and R. J. Planta. 1984. omycota/Zygomycota group'indicatedby com-
Evolution of yeast ribosomal DNA: molecular parison of 5S ribosomal RNA sequences. Mol.
cloning of the rDNA units of Kluyveromyceslactis Biochem. Parasitol., 32:163-167.
and Hansenula wingei and their comparison with Wegnez, M., R. Monier, and H. Denis. 1972.
the rDNA units of other Saccharomycetoideae. Sequence heterogeneity of 5 S rRNA in Xenopus
Mol. Gen. Genet.,195:116-125. laevis. FEBSLett., 25:13-20.
Vossbrinck, C. R., J. V. Maddox, S. Friedman, Weisburg, W. G., S. J. Giovannoni, and C. R.
B. A. Debrunner-Vossbrinck, and C. R. Woese. 1989. The Deinococcus-Thermusphylum
Woese. 1987. Ribosomal RNA sequence sug- and the effect of rRNA composition on phylo-
gests microsporidia are extremely ancient eu- genetic tree construction. Syst. Appl. Microbiol.,
karyotes. Nature, 326:411-414. 11:128-134.
Walker, T. A., Y. Endo, W. H. Wheat, I. G. Weisburg, W. G., T. P. Hatch, and C. R. Woese.
Wool, and N. R. Pace. 1983. Location of 5.8 1986. Eubacterialorigin of chlamydiae.J. Bac-
S rRNA contact sites in 28 S rRNA and the teriol., 167:570-574.
effect of a-sarcin on the association of 5.8 S Weisburg, W. G., S. M. Barns, D. A. Pelletier,
rRNA with 28 S rRNA. J. Biol. Chem., 258: and D. J. Lane. 1991. 16S ribosomal DNA
333-338. amplification for phylogenetic study. J Bacte-
Walker, W. F. 1981. Proposed sequence homology riol., 173:697-703.
between the 5-end regions of prokaryotic 23 S Weisburg, W. G., Y. Oyaizu, H. Oyaizu, and
rRNA and eukaryotic 28 S rRNA: relevance to C. R. Woese. 1985. Natural relationship be-
the hypothesis that 5.8S rRNA is homologous tween Bacteroides and Flavobacteria.J Bacte-
to the 5-end region of 23 S rRNA. FEBS Lett., riol., 164:230-236.
126:150-151. Weisburg, W. G., C. R. Woese, M. E. Dobson,
. 1984a. 5S rRNA sequences from Atrac- and E. Weiss. 1985. A common origin of Rick-
tiellales, and basidiomycetous yeasts and fungi ettsiae and certain plant pathogens. Science,
imperfecti. Syst. Appl. Microbiol., 5:352-359. 230:556-558.
* 1984b. 5S ribosomal RNA sequences Weisburg, W. G., M. E. Dobson, J. E. Samuel,
from Zygomycotina and evolutionary implica- G. A. Dasch, L. P. Mallavia, L. Mandelco,
tions. Syst. Appl. Microbiol., 5:448-456. J. E. Sechrest, E. Weiss, and C. R. Woese.
. 1985. 5S and 5.8S ribosomal RNA se- 1989. Phylogenetic diversity of the Rickettsiae.
quences and protist phylogenies. BioSystems, J. Bacteriol., 171:4202-4206.
18:269-278. Weisburg, W. G., J. G. Tully, D. L. Rose, J. P.
Walker, W. F., andW. F. Doolittle. 1982. Nucleo- Petzel, H. Oyaizu, D. Yang, L. Mandelco,
tide sequences of 5S ribosomal RNA from four J. Sechrest, T. G. Lawrence, J. Van Etten,
oomycete and chytrid water molds. NucleicAcids J. Maniloff, and C. R. Woese. 1989. A phylo-
Res., 10:5717-5721. genetic analysis of the mycoplasmas: basis for
and . 1983a. 5S rRNA sequences their classification. J. Bacteriol., 171:6455-
from four marine invertebrates and implica- 6467.
tions for base pairing models of metazoan se- Wellauer, P. K., I. B. Dawid, D. D. Brown, and
quences. NucleicAcidsRes., 11:5159-5164. R. Reeder. 1976. The molecular basis for
,and . 1983b. 5S rRNA sequences length heterogeneity in ribosomal DNA from
from eight basidiomycetes and fungi imper- Xenopus laevis. J. Mol. Biol., 105:461-486.
fecti. NucleicAcidsRes., 11:7625-7630. Wellauer, P. K., R. H. Reeder, I. B. Dawid, and
Wallbanks, S., A. J. Martinez-Murcia, J. L. D. D. Brown. 1976. The arrangementof length
Fryer, B. A. Phillips, and M. D. Collins. 1990. heterogeneity in repeating units of amplified
16S rRNA sequence determination for mem- and chromosomal ribosomal DNA from Xeno-
bers of the genus Carnobacterium and related lac- pus laevis. J. Mol. Biol., 105:487-505.

Wells, J. M., B. C. Raju, H.-Y. Hung, W. G. Woese, C. R., P. Blanz, and C. M. Hahn. 1984.
Weisburg, L. Mandelco-Paul, and D. J. Bren- What isn't a Pseudomonad: the importance of
ner, 1987. Xylellafastidiosagen. nov., sp. nov: nomenclature in bacterial classification. Syst.
gram-negative, xylem-limited, fastidious plant Appl. Microbiol.,5:179-195.
bacteria related to Xanthomonasspp. Int.J. Syst. Woese, C. R., J. Maniloff, and L. B. Zablen.
Bacteriol., 37:136-143. 1980. Phylogenetic analysis of the mycoplas-
Wheeler, W. C. 1989. The sytematics of insect mas. Proc.Natl. Acad. Sci. USA, 77:494-498.
ribosomal DNA. In B. Fernholm, K. Bremer, Woese, C. R., E. Stackebrandt, and W. Ludwig.
and H. Jornvall (eds.), The Hierarchyof Life, pp. 1985. What are Mycoplasmas: the relationship
307-321. Elsevier Science Publishers(Biomed- of tempo and mode in bacterial evolution. J.
ical Division), Amsterdam. Mol. Evol., 21:305-316.
Wheeler, W. C., and R. L. Honeycutt. 1988. Woese, C. R., P. Blanz, R. B. Hespell, and C. M.
Paired sequencedifferencein ribosomalRNAs: Hahn. 1982. Phylogenetic relationshipsamong
evolutionary and phylogenetic implications. various helical bacteria. Curr.Microbiol.,7:119-
Mol. Biol. Evol., 5:90-96. 124.
Willekens, P., E. Huysmans, A. Vandenberghe, Woese, C. R., E. Stackebrandt,T. J. Macke, and
and R. de Wachter. 1986. Archaebacterial5 S G. E. Fox. 1985. A phylogenetic definition of
ribosomal RNA: nucleotide sequence in two the major eubacterial taxa. Syst. Appl. Micro-
methanogen species, secondary structuremod- biol., 6:143-151,
els, and molecular evolution. Syst.Appl.Micro- Woese, C. R., B. A. Debrunner-Vossbrinck,
biol., 7:151-159. H. Oyaizu, E. Stackebrandt,and W. Ludwig.
Willems, A., M. Gillis, and J. de Ley. 1991. 1985. Gram-positive bacteria: possible photo-
Transfer of Rhodocyclusgelatinosus to Rubrivivax synthetic ancestry. Science,229:762-765.
gelatinosus gen. nov., comb. nov., and phyloge- Woese, C. R., R. Gupta, G. M. Hahn, W. Zillig,
netic relationships with Leptothrix, Sphaerotilus and J. Tu. 1984. The phylogenetic relation-
natans, Pseudomonassaccharophila,and Alcaligenes ships of three sulfur-dependent Archaebacte-
latus.Int. J. Syst. Bacteriol.,41:65-73. ria. Syst.Appl. Microbiol.,5:97-105.
Williams, S. M., and C. Strobeck. 1985. Sister Woese, C. R., M. Sogin, D. Stahl, B. J. Lewis,
chromatidexchange and the evolution of rDNA and L. Bonen. 1976. A comparison of the 16S
spacer length. J. Theor.Biol., 116:625-636. ribosomal RNAs from mesophilic and thermo-
Williams, S. M., R. W. DeBry, andJ. L. Feder. philic bacilli: some modifications in the Sanger
1988. A commentary on the use of ribosomal method for RNA sequencing.]. Mol. Evol., 7:
DNA in systematic studies. Syst. Zool., 37:60- 197-213.
62. Woese, C. R., W. G. Weisburg, C. M. Hahn,
Williams, S. M., R. DeSalle, and C. Strobeck. B. J. Paster, L. B. Zablen, B. J. Lewis,
1985. Homogenization of geographical vari- T. J. Macke, W. Ludwig, and E. Stacke-
ants at the nontranscribed spacer of rDNA in brandt. 1985. The phylogeny of purple bacte-
Drosophila mercatorum.Mol. Biol. Evol., 2:338- ria: the gamma subdivision. Syst.Appl. Micro-
346. biol., 6:25-33.
Wilson, G. N., M. Knoller, R. D. Schmickel, and Woese, C. R., W. G. Weisburg, B. J. Paster,
L. L. Szura. 1984. Individual and evolutionary C. M. Hahn, R. S. Tanner, N. R. Krieg,
variation of primate ribosomal DNA transcrip- H. -P. Koops, H. Harms, and E. Stackebrandt.
tion initiation regions. Mol. Biol. Evol., 1:221- 1984. The phylogeny of purple bacteria: the
237. beta subdivision. Syst.Appl. Microbiol.,5:327-
Woese, C. R. 1987. Bacterialevolution. Microbiol. 336.
Rev., 51:221-271. Woese, C. R., L. J. Magrum, R. Gupta, R. B.
. 1989. Archaebacteria and the nature of Siegel, D. A. Stahl, J. Kop, N. Crawford,
their evolution. In B. Fernholm, K. Bremer, J. Brosius,R. Gutell,J. J. Hogan, and H. F.
and H. Jornvall (eds.), The Hierarchyof Life, pp. Noller. 1980. Secondary structure model for
119-130. Elsevier Science Publishers(Biomed- bacterial 16S-like ribosomal RNA: phyloge-
ical Division), Amsterdam. netic, enzymatic, and chemical evidence. Nu-
Woese, C. R., and G. E. Fox. 1977. Phylogenetic cleicAcidsRes., 8:2275-2293.
structure of the prokaryotic domain: the pri- Woese, C. R., E. Stackebrandt,W. G. Weisburg,
mary kingdoms. Proc. Natl. Acad. Sci. USA, 74: B. J. Paster, M. T. Madigan, V. J. Fowler,
5088-5090. C. M. Hahn, P. Blanz, R. Gupta, K. H. Neal-
Woese, C. R., and G. J. Olsen. 1986. Archaebac- son, and G. E. Fox. 1984. The phylogeny of
terial phylogeny: perspectives on the urking- purple bacteria: the alpha subdivision. Syst.
doms. Syst. Appl. Microbiol., 7:161-177. Appl. Microbiol.,5:315-326.

Wolfe, K. H., M. Gouy, Y.-W. Yang, P. M. 5.8S rRNA gene and internal transcribed
Sharp, and W. -H. Li. 1989. Date of the mono- spacer regions in carrot and broad bean ribo-
cot-dicot divergence estimated from chloroplast somal DNA.J Mol. Evol., 29:294-301.
DNA sequence data. Proc.Natl. Acad.Sci. USA, Zablen, L. B., and C. R. Woese. 1975. Procaryote
86:6201-6205. phylogeny IV: concerning the phylogenetic sta-
Wolters, J., and V. A. Erdmann. 1986. Cladistic tus of a photosyntheticbacterium.j Mol. Evol.,
analysis of 5S rRNA and 16S rRNA secondary 5:25-34.
and primary structure- the evolution of eu- Zablen, L. B., M. S. Kissil, C. R. Woese, and
karyotes and their relation to Archaebacteria. D. E. Buetow. 1975. Phylogenetic origin of the
J. Mol. Evol., 24:152-166. chloroplast and prokaryotic nature of its ribo-
, and . 1989. Compilation of 5S somal RNA. Proc. Nat. Acad. Sci. USA, 72:
rRNA and 5S rDNA gene sequences. Nucleic 2418-2422.
AcidsRes., 16:1-74. Zellner,G., E. Stackebrandt,H. Kneifel, P. Mess-
Yakura, K., A. Kato, and S. Tanifuji. 1984. ner, U. B. Sleytr, E. C. De Macario, H.-P.
Length heterogeneity of the large spacerof Vicia Zabel, K. 0. Stetter, andJ. Winter. 1989. Iso-
faba rDNA is due to the differing number of a lation and characterization of a thermophilic,
325 bp repetitive sequence elements. Mol. Gen. sulfate reducingarchaebacterium,Archaeoglobus
Genet.,193:400-405. fulgidusStrain Z. Syst.Appl.Microbiol.,11:151-
Yamano, Y., K. Ohyama, and T. Komano. 1984. 160.
Nucleotide sequences of chloroplast 5S ribo- Zhao, H., D. Yang, C. R. Woese, and M. P.
somal RNA from cell suspension cultures of the Bryant. 1990. Assignment of Clostridium bryantii
liverwortsMarchantia polymorpha andJungerman- to Syntrophospora bryantiigen. nov., comb. nov.
nia subulata.NucleicAcidsRes., 12:4621-4624. on the basis of a 16S rRNA sequence analysis
Yang, D., and C. R. Woese. 1989. Phylogenetic of its crotonate-grownpure culture. Int.J. Syst.
structure of the "leuconostocs":an interesting Bacteriol.,40:40-44.
case of a rapidly evolving organism. Syst.Appl. Zimmer, E. A., R. K. Hamby, M. L. Arnold,
Microbiol.,12:145-149. D. A. Leblanc, and E. C. Theriot. 1989. Ribo-
Yang, D., B. F. Kaine, and C. R. Woese. 1985. somal RNA phylogenies and flowering plant
The phylogeny of archaebacteria. Syst. Appl. evolution. In B. Fernholm, K. Bremer, and
Microbiol.,6:251-256. H. Jornvall (eds.), The Hierarchyof Life, pp.
Yang, D., Y. Oyaizu, H. Oyaizu, G. J. Olsen, 205-214. Elsevier Science Publishers(Biomed-
and C. R. Woese. 1985. Mitochondrialorigins. ical Division), Amsterdam.
Proc.Natl. Acad. Sci. USA, 82:4443-4447. Zweib, C., C. Glotz, and R. Brimacombe. 1981.
Yao, M.-C., andJ. G. Gall. 1977. A single inte- Secondary structure comparisons between
grated gene for ribosomalRNA in a eucaryote, small subunit ribosomal RNA molecules from
Tetrahymena pyriformis.Cell, 12:121-132. six different species. NucleicAcidsRes., 9:362 1-
Yokota, Y., T. Kawata, Y. Iida, A. Kato, and 3640.
S. Tanifuji. 1989. Nucleotide sequences of the

APPENDIX
Phylogeneticstudiesof ribosomalDNA
Abbreviations:nL, nuclearlarge subunit;nS, nuclear small subunit;mtS, mitochondrialsmall subunit;
mtL, mitochondrial large subunit; cpS, chloroplast small subunit; cpL, chloroplast large subunit; H,
hybridization study; 0, oligonucleotide catalog; R, restriction enzyme analysis; S, sequence study.
Taxa nL nS 5.8S Spacers5S mtS mtL cpS cpL Reference
Major lineages of life - - - S - - - Kimura and Ohta, 1973
- - ? - ? ?Woese and Fox, 1977
- - - S Schwartz and Dayhoff, 1978
- - - S Hori and Osawa, 1979
0 - ? - ? ?Fox et al., 1980
- - - S Gray and Spencer, 1981
- - - S Spencer et al., 1981
S - - - S S - McCarroll et al., 1983
- - - - S - Kiintzel et al., 1983
S - S S - Gray et al., 1984
- - - - S - Vandenberghe et al., 1984
S ? ? ? ?- Jarsch and Bock, 1985
S - S S - Olsen et al., 1985
S - S S - Yang and Oyaizu et al., 1985
- - - - S - Hori and Osawa, 1986
S - S S - Pace et al., 1986
- - - - S - - - Willekens et al., 1986
S - S - - - Wolters and Erdmann, 1986
- - - - S - - - Hori and Osawa, 1987
S ??- - Lake, 1987
- S ?- - Olsen, 1987
- O'S O,S - - Woese, 1987
- S ?- - Lake, 1988
S S - S S S S Cedergren et al., 1988
- S ? ? ? ? ? Ragan, 1988
- 0 ? ? ? ? ? Bremer and Bremer, 1989
S S ? ? ? ? ? ?Gouy and Li, 1989a
- S ? ? ? ? ? Lake,1989a
S ? ? ? ? ? ? ? Schleifer and Ludwig, 1989
- S ? ? ? ? ? Woese, 1989
- S ? ? ? ? ? Van de Peer, Neefs and
de Wachter, 1990
- S ? ? ? ? ? Patterson, 1990
Archaebacteria - O --? ? Fox and Magram et al., 1977
- 0 ? ? ? ? ? Balch et al., 1979
- - - S - Fox et al., 1982
H - - - Tuetal., 1982
S - -
?Gupta - et al., 1983
- - -
?Woese - and Gupta et al., 1984
S - -
?Lechner - et al., 1985
S - -
?Leinfelder - et al., 1985
- - - - - - - - Yang, Kaine and Woese, 1985
H H H - H - - - - Klenk et al., 1986
- O - - - - - - - McGill et al., 1986
- S - - - - - - - Woese and Olsen, 1986
- S - - - - - - - Achenbach-Richter and Gupta
et al., 1987
- S - - - - - - - Kjems et al., 1987
S? ?? - - Leffers et al., 1987
- S ?- - 0stergaard et al., 1987

APPENDIX continuation
studiesof ribosomalDNA
Phylogenetic
- S - ? ? ? ? Achenbach-Richter et al., 1988
- 0 - ? ? ? ?Zellner et al., 1989
-- - S ?- - - - Kjems and Garrett, 1990
Eubacteria - - - - - Sogin et al., 1972
H H - - - - - Palleroni et al., 1973
- 0 - - Bonen and Doolittle, 1975
- S - - Doolittle et al., 1975
H - - - Johnson and Francis, 1975
- 0 - - Zablen and Woese, 1975
- 0 - - Zablen et al., 1975
- S - - Bonen and Doolittle, 1976
- 0 -Pechman - - et al., 1976
- 0 - - Woese et al., 1976
- 0 - - Balch et al., 1977
H H - - - - - - de Smedt and de Ley, 1977
- 0 - - Fox, Pechman and Woese, 1977
H H -- - Moore, 1977
- 0 - - Bonen and Doolittle, 1978
H H -- - de Ley et al., 1978
- 0 - - Gibson et al., 1979
H H -- - de Smedt et al., 1980
H H -- - Gillis and de Ley, 1980
H H -- - Mordarski et al., 1980
H H -- - Swings et al., 1980
- 0 - - Woese and Magrum et al., 1980
- 0 - - - - - Woese, Maniloff and Zablen, 1980
- 0 - - - - - - - Ludwig et al., 1981
- 0 - - - - - - Stackebrandt and Woese, 1981
H H - - - - - - - Stackebrandt et al., 1981
- 0 - - - - - - - Tanner et al., 1981
H H - - - - - - - Dopfer et al., 1982
- S - - - - - - - Seewaldt and Stackebrandt, 1982
-0 - - - - - - - Woese et al., 1982
- 0 - - - Ludwig et al., 1983
- 0 - ??? Stackebrandt et al., 1983
- - S - - - Dekio et al., 1984
- - S - - - Deming et al., 1984
- 0 - ??? Fowler et al., 1984
- 0 - ??? Hespell et al., 1984
- 0 - ??? Paster et al., 1984
- 0 - ??? Stackebrandt et al., 1984
R R R R,S ?Verbeet et al., 1984
- 0 - - Woese and Stackebrandt et al., 1984
- 0 - - Woese and Weisburg et al., 1984
- 0 - - Woese, Blanz and Hahn, 1984
- 0 - - Gibson et al., 1985
- - - S - - - - Lane and Stahl et al., 1985
- - - S - - - - MacDonell and Colwell, 1985a,b
- S - - - - - - - Oyaizu and Woese, 1985
- 0 - - - - - - - Paster et al., 1985
- - - S - - - - Rogers et al., 1985
- 0 - - - - Stackebrandt et al., 1985
- - - S - - - - Stahl et al., 1985
- - - S - - - - Vandenberghe et al., 1985

Phylogeneticstudies of ribosomalDNA
Taxa nL nS 5.8S Spacers 5S mtS mtL cpS cpL Reference
- S - - - - - - - Weisburg and Oyaizu et al., 1985
- S - - - - - - - Weisburg and Woese et al., 1985
- S - - - - - - - Woese and Debrunner-Vossbrinck
et al., 1985
- 0 - - -? -?Woese, Stackebrandt and Ludwig,
1985
- 0 - - - - - Woese, Stackebrandt, Macke and
Fox, 1985
- 0 - - - - - Woese and Weisburg et al., 1985
- - - S - Brayton et al., 1986
- - - S - - Ohkubo et al., 1986
- S - ?????? Welsburg et al., 1986
- S - - - ?Achenbach-Richter, - Stetter and
Woese, 1987
- 0 -?? - - Albrecht et al., 1987
- - S - -Dams et al., 1987
- S -?????- Oyaizu et al., 1987
- -- - S - - Park et al., 1987
- S -?????-?-?- - Romaniuk et al., 1987
- S -? ? ? ??- Wells et al., 1987
- 0 -?????- Auling et al., 1988
- - S - - Bomar et al., 1988
- S -? ? ? ? - Chuba et al., 1988
- -- - S - - Deming et al., 1988
- S -? ? ? ??- Distel et al., 1988
- 0 -? ? ?? - Ehlers et al., 1988
- S -?????- Embley et al., 1988a
- S -?????- Embley et al., 1988b
- S ?????Franzmann - and Stackebrandt
et al., 1988
- S - - Franzmann, Wehmeyer and Stacke-
brandt, 1988
- S - - S - Giovannoni et al., 1988
- S -?? - - Montgomery et al., 1988
- S -?? - - Bateson et al,, 1989
- -- - S - - Coyne et al., 1989
- S -? ? ?Demharter et al., 1989
- S - ? - ?Devereux
- et al., 1989
- S - ? - ?Dewhirst
- et al., 1989
- S -???????Fox and Brown, 1989
-0 -? -Hahn et al., 1989
- S -???????Hartmann et al., 1989
- S -???????Lim and Sears, 1989
H H -???????Roggentin and Hirsch, 1989
- 0 -? ? ? ? ? ? ?Stackebrandt et al., 1989
- S -? ? ? ? ? ? ?Tsuji et al., 1989
- S -???????Turner et al., 1989
- S -???????Weisburg and Dobson et al., 1989
- S -???????Weisburg, Giovanni and Woese,
1989
- S -??? ?? Weisburg and Tully et al., 1989
- S -???????Yang and Woese, 1989
- S -???????Bateson et al., 1990
- -- - S - - - - Bulygina et al., 1990

- S - - - - - - - Devereux and He et al., 1990

- S - - - - - - - Dewhirst et al., 1990
S S - - - - - - - Gueho et al., 1990
- S - - - - - - - La Fountaine and Rood, 1990
- S - - - - - - - Rogall et al., 1990
- S - - - - - - - Stackebrandt and Charfreitag, 1990
- S - - - - - - - Stahl and Urbance, 1990
- - - - S - - - - Van den Eynde, Van de Peer,
Perry and de Wachter, 1990
- - - - S - - - - Van den Eynde, Van de Peer,
Vandenabeele, Van Bogaert
and de Wachter, 1990
- S - - - - - - - Wallbanks et al., 1990
- S - - - - - - - Zhao et al., 1990
H H - - - - - - - Catlin, 1991
- S - - - - - - - Collins et al., 1991
- S - - - - - - - Eden et al., 1991
- S - - - - - - - Fox et al., 1991
R R - - - - - - - Liebl et al., 1991
- S - - - - - - - Paster et al., 1991
H H - - - - - - - Rossau et al., 1991
- S - - - - - - - Stanton et al., 1991
S?? - - - Vandamme et al., 1991
- S - - - Weisburg et al., 1991
H ? ?Willems - - - et al., 1991
Eukaryota S - - - - Komiya and Takemura, 1981
- S?? - - - - - - Olsen and Sogin, 1982
- - - - S - - - - Takaiwa et al., 1982
- - - - S - - - - Katoh et al., 1983
- - - - - - - - St6cklein et al., 1983
S S - - - - - - - Hasegawa et al., 1985
- S?? - - - - - - Maroteaux et al., 1985
- - - - S - - - - Lim et al., 1986
S - - - - - - - Medlin et al., 1988
- - - - S - - - - Qi et al., 1988
S - - - - - Qu, Nicoloso and Bachellerie, 1988
S S - - - - - Gouy and Li, 1989b
- S - - - - - Sogin, 1989
- S - - - - - Sogin, Edman and Elwood, 1989
- S - S - - - - Krishnan et al., 1990
Basal eukaryotes - -- S - - - - Delihas et al., 1981
- - S - S - - - - Hinnebusch et al., 1981
- - S - S - - - - MacKay and Doolittle, 1981
- - - - S - - - - Anderson et al., 1982
- - - - S - - - - Kumazaki, Hori, Osawa, Mita
and Higashinakagawa, 1982
- - - - S - - - - Walker and Doolittle, 1982
- - - - S - - - - Kumazaki et al., 1983
- - - - S - - - - Walker and Doolittle, 1983b
S - - - - Elwood et al., 1985
- S - S - - - - Walker, 1985
S - - - - - - Gunderson et al., 1986
S - - - - - - Herzog and Maroteaux, 1986
S ? ? ? ? ? ? ? Qu et al., 1986

Phylogenetic
studiesof ribosomal
DNA
S - - - - - - - Sogin and Elwood, 1986

S - - - - - - - Sogin, Elwood and Gunderson, 1986
S - - - - - - - Sogin and Ingold et al., 1986
S - - - - - - - Sogin and Swanton et al., 1986
- S - - - - - - Troitsky and Bobrova, 1986
S - - - - - - - Gunderson and Elwood et al., 1987
S - - - - - - - Johnson et al., 1987
S - - - - - - - Sogin and Gunderson, 1987
S - - - - - - - Vossbrinck et al., 1987
S? ? ?? - - Baroin et al., 1988
S - - - - - - - Clark and Cross, 1988
S - - - - - - - Johansen et al., 1988
S - - - - - - - Johnson et al., 1988
- - - - S S - - Lake et al., 1988
S? ? ?? - - Lenaers et al., 1988
S ? ?? - - Lynn and Sogin, 1988
S? ? ?? - - Qu and Perasso et al., 1988
S ? ?? - - Baverstock et al., 1989
S ? ?? - - Johnson et al., 1989
S -?- - - Lenaers et al., 1989
S - - - - - - - - Perasso et al., 1989
S - - - - - - - Sogin and Gunderson et al., 1989
S - - - - - - - Barta et al., 1991
S S - - - - - - Gomez et al., 1991
S - - - Hendricks et al., 1991
S?? - - - Lenaers et al., 1991
S - - - Schlegel et al., 1991
Fungi S - S - - Kochel and Kiintzel, 1982
- - - S - - - - Huysmans et al., 1983
- - - S - - - - Chen et al., 1984
- - - S - - - - Gottschalk and Blanz, 1984
- - - S - - - - Walker, 1984a
- - - S - - - - Walker, 1984b
- - - S - - - - Gottschalk and Blanz, 1985
- - - S - - - - Blanz and Gottschalk, 1986
R R R R - - - - Kistler et al., 1987
S - - - - Edman et al., 1988
? ? ? ? ? ? ??S - - - Cummings, Domenico and Nelson,
1989; Cummings, Domenico,
Nelson and Sogin, 1989
S - - - - Guadet et al., 1989
R R R R - - - - Laaser et al., 1989
- - - - - - Watanabe et al., 1989
R R R R - - - - Lachance, 1990
Plantae - - S - - - - Hori et al., 1984
- - - S - - - - Ulbrich et al., 1984
- - - S - - - - Yamano et al., 1984
- - - S - - - - Hori et al., 1985
S - - - - - - - Troitsky and Bobrova, 1986
S - - - - - - - Hamby and Zimmer, 1988
- -S - - - - Devereux, Loeblich III and Fox,
1990
- -S - - - - Steele et al., 1991

Green algae s S - -?? - Jupe et al., 1988

- S - - - - - - Rausch et al., 1989
- S - -??? Huss and Sogin, 1990
- - S -- - - Van de Peer and de Baere et al.,
1990
- S ? ? ? ? ? ? ? Eschbach et al., 1991
- R,S ???????Rowan and Powers, 1991
Seed plants - S ? ? ? ? ? ? ?Nairn and Ferl, 1988
S S ???????Zimmer et al., 1989
Angiosperms R R R R - - R R Sytsma and Schaal, 1985
- - - - S - S Bobrova et al., 1987
- -- S - McIntyre et al., 1988
- - - - S - Scoles et al., 1988
S S Wolfe et al., 1989
-- S S?-?-?-?-?-?Yokota et al., 1989
R R R R ? - ? ?Bellarosa et al., 1990
- S -?Nickrent and Franchina, 1990
R R R R ????? Reddy et al., 1990
Animalia - S - Komiya et al., 1980
- - - - S - - Butler et al., 1981
- - - - S - Kumazaki, Hori, Osawa, Ishii and
Suzuki, 1982
- - - - S - Komiyaetal., 1983
- - - - S - Ohama and Kumazaki et al., 1983
- - - - S - - - - Walker and Doolittle, 1983a
-- - - - S - Ohama et al., 1984
- - - - S - Hendriks et al., 1986
- S - - ? ? ?Field et al., 1988
- S - - Hendriks et al., 1988
- S - - ? ? ?Ghiselin, 1989
S- ???????Lake,1989b
- S - - ???Patterson, 1989
- S - - ???Raffetal., 1989
- S - - ???Lake,1990
S ? ? ? ? ? ? ? ? Christen et al., 1991
- S ???????Erwin, 1991
- - - - S - Halanych, 1991
Platyhelmithes R R R R ????? Blair and McManus, 1989
Mollusca - S - ? - ? Ghiselin, 1988
Arthropoda - S ? ? ? ? ? ? ?Abele et al., 1989
Crustacea - S ???????Kim and Abele, 1990
Insecta ? ? ? ? ? ?S DeSalle et al., 1987
S ? ? ? ? ? ? ?Hancock et al., 1988
- S S Wheeler and Honeycutt, 1988
R R,S R R ????? Wheeler, 1989
Echinoderms - S - Ohama, Hori and Osawa, 1983
- S -?Raffetal., 1988
- S ???????Smith, 1989
Chordata R R R R ????? Tanhauser et al., 1986
S ? - ?Le- - et al., 1989
S ??Hillis,
- - - Dixon and Ammerman,
1991
- S - - Stock et al., 1991

Phylogenetic
studiesof ribosomal
DNA
Tetrapoda S ??Hillis and Dixon, 1989
S S ?Hedges et al., 1990
- - ? -
?Meyer - S and Wilson, 1990
Amphibia S - ?Hillis, 1991
Anura R - ?Hillis and Davis, 1987
S - ?de Sa and Hillis, 1990
R R R R Hillis and Davis, 1986
Caudata S ???Larson and Wilson, 1989
S S ?? Larson, 1991
Amniota
Mammalia - S S - - Miyamoto and Boyle, 1989
Artiodactyls - S S - - Miyamoto et al., 1989
- - - -- S S - - Miyamoto et al., 1990
- - - -- S S - - Kraus and Miyamoto, 1991
Chiroptera R R R R - - - - - Baker et al., 1991
R R R R - - - - - Van Den Bussche, in press
Marsupials - S - - Thomas et al., 1989
Primates R R R R - - - - - Nelkin et al., 1980
R R R R - - - - - Wilson et al., 1984
- - - -- S S - - Hixson and Brown, 1986
S - S - - - - - Gonzalez et al., 1990
Rodents - R - - - - - Suzuki et al., 1986
- - S?? - - - - - Sasaki et al., 1987
- - - R - - - - - Suzuki et al., 1987
- - - R - - - - - Nevo and Beiles, 1988
R R R R - - - - - Allard and Honeycutt, 1991
Sauria
Lepidosauria R R R R - - - - - Sites and Davis, 1989
Aves R R R R - - - - - Mindell and Honeycutt, 1989
R R R R - - - - - Cracraft and Mindell, 1989


Hill Is 1991

Uploaded by

Copyright:

Available Formats

Hill Is 1991

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Hill Is 1991

Uploaded by

Copyright:

Available Formats

VOLUME 66, No.

4 THE QUARTERLY RE VIEW OF BIOLOGY DECEMBER 1991

RIBOSOMAL DNA: MOLECULAR EVOLUTION

DAVID M. HILLIS AND MICHAEL T. DIXON

Departmentof Zoology, The Universityof Texas

INTRODUCTION viously considered intractable by morpholo-

1 1213214 151 6 17 181 9 |h 1_1 |12 11141151

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

5 8c (5 8d) [85-109] 18) (18k) [1231.1259] 28y (28cc) [67-96)

18b [1640-1 6701 28u (28kk) [69-901 28z (28dd) [1129-11541

18d (18g) [1700-17221 28v (28gg) [3429.34521 28aa (28jj) [4200-42181

18e (18f) [5-23] 28w (28hh) [3565-35881 28ee (28ff) [1795-18231

18h (18i) [420.4511 28x (28i1) [4106.4137] 2811 (28mm) [2616.26451

FIG. 2. PRIMERS FOR USE IN POLYMERASE To AMPLIFYSIECTIONSOF rDNA ARRAYS

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

serve as enhancers of transcription (Flavell Although there are no absolute rules, we

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

mmn mmT mm mmrr mm m m C)M

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

S-.4 V C's v ~~~~~~~~~~~

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

2k11 i~& &AIdEIIEJA _Horo

0 200 400 600 800 1000

~~~~a- I mmll MA 61 A6. - Strong.ylocentrotus

1A&.mL a 1 I, I iL* Xenopus

Percent so-ga I .I RdllUS

400 800 1200 1600

FIG. 8. SIMILARITY COMPARISONS OF THE 16S MITOCHONDRIAL rRNA GENE.

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

is the same as in the analysis of the complete data

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

11:44-52. Fox, G. E., K. R. Pechman, and C. R. Woese.

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

light of molecular evidence. Oxf. Surv. Evol. Nature, 339:145-147.

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

Nucleic Acids Res., 12:3677-3693. K. C. Atwood. 1976. Variations in RNA gene

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

D. M. Hillis and C. Moritz (eds.), Molecular Res., 11:1725-1734.

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

nucleotide sequences of 5S ribosomal RNAs , and . 1983. Localization of DNA

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

patterns. Int. J. Syst. Bacteriol.,41:255-260. T. A. Avdonina, M. Ya. Timofeyeva, and

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

In B. Fernholm, K. Bremer, and H. Jornvall gene and secondary structure of eukaryotic

This content downloaded from 141.218.001.105 on August 12, 2016 06:40:19 AM

archaebacterium Sulfolobus solfataricus and its of Helicobacterfelissp. nov., Helicobactermustelae,