USGS DEFUSE 2021 006245 Combined Records Redacted

United States Department of the Interior
U. S. GEOLOGICAL SURVEY
12201 Sunrise Valley Drive
Reston, Virginia 20192-0002
In Reply Refer To: December 5, 2023

U.S. Geological Survey
Attention: Judy Cearley
Post Office Box 66783
Albuquerque, New Mexico 87193
Ms. Emily Anne Kopp

U.S. Right to Know
Washington, DC 20012
[email protected]
Re: U.S. Geological Survey (USGS) Freedom of Information Act (FOIA) Tracking #
DOI-USGS-2023-000257 – Response
Dear Ms. Kopp:
This letter is our response to your FOIA request submitted on October 14, 2022, in which you
requested the following information:
Records maintained by U.S. Geological Survey by Tonie Rocke ([email protected]), a

research epidemiologist at the National Wildlife Health Center.
1. We request communications between Dr. Rocke and email addresses from the
following domains: @ecohealthalliance.org, @wh.iov.cn.
2. We request communications that include the key term “Wuhan Institute of Virology.”
We also request communications that include the terms “PREEMPT” and “DEFUSE,”
but only those communications where all of the letters in each of these terms is
capitalized.
The time period for this request is March 24, 2017 to the present. Please narrow the
search results to exclude any published papers, organizational newsletters or other widely
available published materials.
We are releasing, in part, one Portable Document Format (PDF) file, consisting of 1,412 pages.
We reasonably foresee that disclosure would harm an interest protected by one or more of the
nine exemptions to the FOIA’s general rule of disclosure and disclosure would be prohibited by
law; therefore, portions of these materials are being withheld under the following FOIA
exemptions:
Ms. Emily Anne Kopp 2
Exemption 3
Exemption 3 allows the withholding of information protected by a nondisclosure provision in a

federal statute other than the FOIA. Specifically, 41 U.S.C. § 4702 (b)-(c) prohibits the release
of contractor proposals unless they have been set forth or incorporated by reference in a final
contract. Here, the proposals of the unsuccessful submitters are not releasable under FOIA
because they were not set forth or incorporated by reference into the final contract. Therefore,
we are withholding the proposal in full under Exemption 3. Approximately 175 pages contain
redactions pursuant to Exemption 3.
Exemption 4
Exemption 4 protects “trade secrets and commercial or financial information obtained from a
person [that is] privileged or confidential.” The withheld information is commercial or financial
information. The company that supplied this information (the submitter) is considered a person,
because the term “person,” under the FOIA, includes a wide range of entities including
“corporations.” Additionally, the submitter does not customarily release this information to the
public, so the information is confidential for the purposes of Exemption 4. Approximately 183
pages contain redactions pursuant to Exemption 4.
Exemption 5
Exemption 5 allows an agency to withhold “inter-agency or intra-agency memorandums or

letters which would not be available by law to a party … in litigation with the agency.” 5 U.S.C.
§ 552(b)(5). Exemption 5 therefore incorporates the privileges that protect materials from
discovery in litigation, including the deliberative process, attorney work-product, attorney-client,
and commercial information privileges. Two pages contain redactions under Exemption 5
because they qualify to be withheld under the following privilege:
Deliberative Process Privilege
The deliberative process privilege protects the decision-making process of government agencies
and encourages the frank exchange of ideas on legal or policy matters by ensuring agencies are
not forced to operate in a fish bowl. A number of policy purposes have been attributed to the
deliberative process privilege, such us: (1) assuring that subordinates will feel free to provide the
decisionmaker with their uninhibited opinions and recommendations; (2) protecting against
premature disclosure of proposed policies; and (3) protecting against confusing the issues and
misleading the public.
The deliberative process privilege protects materials that are both predecisional and deliberative.
The privilege covers records that reflect the give-and-take of the consultative process and may
include recommendations, draft documents, proposals, suggestions, and other subjective
documents which reflect the personal opinions of the writer rather than the policy of the agency.
The materials that have been withheld under the deliberative process privilege of Exemption 5
are both predecisional and deliberative. They do not contain or represent formal or informal
agency policies or decisions. They are the result of frank and open discussions among agency
officials and their consultants. Their contents have been held confidential by all parties and
public dissemination of the information would have a chilling effect on the agency’s deliberative
processes; expose the agency’s decision-making process in such a way as to discourage candid
discussion within the agency, and thereby undermine its ability to perform its mandated
functions.
The deliberative process privilege does not apply to records created 25 years or more before the
date on which the records were requested.
Exemption 6
Exemption 6 allows an agency to withhold “personnel and medical files and similar files the
disclosure of which would constitute a clearly unwarranted invasion of personal privacy.” 5
U.S.C. § 552(b)(6).
The phrase “similar files” covers any agency records containing information about a particular
individual that can be identified as applying to that individual. To determine whether releasing
records containing information about a particular individual would constitute a clearly
unwarranted invasion of personal privacy, we are required to balance the privacy interest that
would be affected by disclosure against any public interest in the information.
Under the FOIA, the only relevant public interest to consider under the exemption is the extent to
which the information sought would shed light on agency’s performance of its statutory duties or
otherwise let citizens ‘know what their government is up to.’ The burden is on the requester to
establish that disclosure would serve the public interest. When the privacy interest at stake and
the public interest in disclosure have been determined, the two competing interests must be
weighed against one another to determine which is the greater result of disclosure: the harm to
personal privacy or the benefit to the public. The purposes for which the request for information
is made do not impact this balancing test, as a release of information requested under the FOIA
constitutes a release to the general public.
Approximately 281 pages contain redactions pursuant to Exemption 6. The information that has
been withheld under Exemption 6 consists of personal home phone numbers, personal mobile
phone numbers, non-public phone numbers of EcoHealth Alliance personnel, personal email
addresses, names of unsuccessful bidders, user access information, and other personal matters.
We have determined that the individuals to whom this information pertains have a substantial
privacy interest in withholding it. Additionally, you have not provided information that explains
a relevant public interest under the FOIA in the disclosure of this personal information and we
have determined that the disclosure of this information would shed little or no light on the
performance of the agency’s statutory duties. Because the harm to personal privacy is greater
than whatever public interest may be served by disclosure, release of the information would
constitute a clearly unwarranted invasion of the privacy of these individuals, and we are
withholding the information under Exemption 6.
Please note that some pages contain redactions pursuant to more than one exemption. Judy
Cearley, Government Information Specialist, is responsible for this partial denial. Jonathan
Fleshner, with the U.S. Department of the Interior Office of the Solicitor, was consulted on this
response. The Defense Advanced Research Projects Agency, a component of the U.S.
Department of Defense, was also consulted regarding its equities in the responsive
records.
On November 1, 2022, we approved your request for a fee waiver. Therefore, there is no billable
fee for the processing of this request.
You may appeal this response to the Department of the Interior’s FOIA/Privacy Act Appeals
Officer. If you choose to appeal, the FOIA/Privacy Act Appeals Officer must receive your FOIA
appeal no later than 90 workdays from the date of this letter. Appeals arriving or delivered
after 5 p.m. Eastern Time, Monday through Friday, will be deemed received on the next
workday.
Your appeal must be made in writing. You may submit your appeal and accompanying
materials to the FOIA/Privacy Act Appeals Officer by mail, courier service, fax, or email. All
communications concerning your appeal should be clearly marked with the words: "FREEDOM
OF INFORMATION APPEAL." You must include an explanation of why you believe the
USGS’s response is in error. You must also include with your appeal copies of all
correspondence between you and USGS concerning your FOIA request, including your original
FOIA request and USGS's response. Failure to include with your appeal all correspondence
between you and USGS will result in the Department's rejection of your appeal, unless the
FOIA/Privacy Act Appeals Officer determines (in the FOIA/Privacy Act Appeals Officer’s sole
discretion) that good cause exists to accept the defective appeal.
Please include your name and daytime telephone number (or the name and telephone number of
an appropriate contact), email address and fax number (if available) in case the FOIA/Privacy
Act Appeals Officer needs additional information or clarification of your appeal.
DOI FOIA/Privacy Act Appeals Office Contact Information
Department of the Interior

Office of the Solicitor
1849 C Street, Northwest
MS-6556 MIB
Washington, DC 20240
Attn: FOIA/Privacy Act Appeals Office
Telephone: (202) 208-5339
Fax: (202) 208-6677
Email: [email protected]
The 2007 FOIA amendments created the Office of Government Information Services (OGIS) to
offer mediation services to resolve disputes between FOIA requesters and Federal agencies as a
non-exclusive alternative to litigation. Using OGIS services does not affect your right to pursue
litigation. You may contact OGIS in any of the following ways:
Office of Government Information Services

National Archives and Records Administration
8601 Adelphi Road – OGIS
College Park, Maryland 20740-6001

Telephone: (202) 741-5770
Fax: (202) 741-5769
Toll-free: 1-877-684-6448
E-mail: [email protected]
Web: https://www.archives.gov/ogis
Please note that using OGIS services does not affect the timing of filing an appeal with the
Department’s FOIA & Privacy Act Appeals Officer. Contact information for the Department’s
FOIA Public Liaison, who you may also seek dispute resolution services from, is available at
https://www.doi.gov/foia/foiacenters.
This completes our response to your request. If you have any questions about our response to
your request, please contact me by phone at (650) 329-4035 or by email at [email protected].
Sincerely,
Judy Cearley
Government Information Specialist
Enclosure:
2021-006245 - Combined Records_Redacted.pdf (1,412 pages)
10/8/21, 11:00 AM Mail - Richgels, Katherine L - Outlook
Re: Form 9-3090 - EcoHealth Alliance

Meicher, Lisa K <[email protected]>
Tue 5/29/2018 1:47 PM
To: Richgels, Katherine L <[email protected]>
Wow! That was quick. I will get the remaining signatures too.
Lisa K. Meicher
Budget Analyst
USGS National Wildlife Health Center
6006 Schroeder Rd
Madison, WI 53711
608-270-2410
fax 608-270-2415
[email protected]
On Tue, May 29, 2018 at 1:42 PM, Richgels, Katherine <[email protected]> wrote:
Ok, great. We need this form to then go to Jonathan and on to Leon (I believe). Can you usher it through the process for me?
Thanks,
Katie
On Tue, May 29, 2018 at 1:40 PM, Ethics Office, GS-O <[email protected]> wrote:
Hello,
Please find the signed form attached.
Please let me know if you need anything else.
Thanks,
Liz
USGS Ethics Office
~~~~~~~~~~~~
https://outlook.office365.com/mail/id/AAMkADhiNzQ4MTAyLWU2OWYtNDZiMi04YWQ4LTkwMjYxMjIwZDU3MwBGAAAAAADUZu9K9h4rQJeL%2FM4BbYGwBwAbOFsLP%2BOFSZSmnCBcAmWVAA… 1/2
12210 Sunrise Valley Drive, MS 603

Reston, VA 20192
[email protected]
USGS Ethics Office website: www2.usgs.gov/quality_integrity/ethics
On Tue, May 29, 2018 at 2:20 PM, Meicher, Lisa <[email protected]> wrote:
Please review and sign the attached Form 9-3090.
Thanks!
Lisa
Lisa K. Meicher
Budget Analyst
6006 Schroeder Rd
Madison, WI 53711
608-270-2410
fax 608-270-2415
[email protected]
--
Katherine L. D. Richgels, Ph.D.
Branch Chief, Applied Wildlife Health Research
Responsible Official, Federal Select Agent Program
6006 Schroeder Rd
Madison, WI 53711
(608) 270 - 2450 (office)
(608) 381 - 2492 (cell)
(608) 270 - 2415 (fax)
[email protected]
www.nwhc.usgs.gov
Form 9-3090 - EcoHealth Alliance

Meicher, Lisa K <[email protected]>
Tue 5/29/2018 1:20 PM
To: Ethics Office, GS-O <[email protected]>
Cc: Richgels, Katherine L <[email protected]>
Please review and sign the attached Form 9-3090.
Thanks!
Lisa
Lisa K. Meicher
Budget Analyst
6006 Schroeder Rd
Madison, WI 53711
608-270-2410
fax 608-270-2415
[email protected]
10/5/21, 4:41 PM Mail - Rocke, Tonie E - Outlook
Re: [EXTERNAL] RE: DEFUSE documents as submitted

Richgels, Katherine L <[email protected]>
Wed 3/28/2018 1:01 PM
To: Rocke, Tonie E <[email protected]>
Thanks Tonie, I appreciate the support. I can't find a final proposal email from Luke, can you
forward it when you get a chance?
Katie
Sent from my Verizon, Samsung Galaxy smartphone
-------- Original message --------
From: "Rocke, Tonie" <[email protected]>
Date: 3/28/18 1:47 PM (GMT-05:00)
To: Katherine Richgels <[email protected]>
Subject: Re: [EXTERNAL] RE: DEFUSE documents as submitted
I believe Luke Hamel sent you all the documents including our budget. By
the way, thanks for your letter; it was thoughtful of you, and rest assured, I
am very supportive of you in this position (despite my initial hesitance
which I now regret). I have had 3 branch chiefs during my term here, and
you are by far the best! Keep up the good work. It will get easier. Best -
Tonie
On Wed, Mar 28, 2018 at 12:30 PM, Katherine Richgels <[email protected]> wrote:
Congrats! Can you send me a copy if the submitted proposal?
Thanks,
Katie

Date: 3/28/18 1:18 PM (GMT-05:00)
To: Peter Daszak <[email protected]>
Cc: Luke Hamel <[email protected]>, Alison Andre <[email protected]>,
Rachel Abbott <[email protected]>, "Richgels, Katherine" <[email protected]>
Subject: Re: [EXTERNAL] RE: DEFUSE documents as submitted
My pleasure - your team did an amazing job getting all the information
together in a very short time! Best -Tonie
On Wed, Mar 28, 2018 at 12:07 PM, Peter Daszak <[email protected]> wrote:
..also want to add my thanks for your help getting this together Tonie!
https://outlook.office365.com/mail/id/AAMkADUyODI5Y2E0LWY5MmEtNGNjNi04YmQ3LWVkZmU3ZWRkMTllZgBGAAAAAAAd8uDAoslFQa0tKxNiQj80… 1/3
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
460 West 34th Street – 17th Floor
New York, NY 10001
Tel. +1 212-380-4474
www.ecohealthalliance.org
@PeterDaszak
@EcoHealthNYC
EcoHealth Alliance leads cutting-edge research into the critical connections between human and wildlife
health and delicate ecosystems. With this science we develop solutions that prevent pandemics and promote
conservation.
From: Luke Hamel [mailto:[email protected]]

Sent: Wednesday, March 28, 2018 1:00 PM
To: Rocke, Tonie
Cc: Peter Daszak; Alison Andre; Rachel Abbott; Richgels, Katherine
Subject: DEFUSE documents as submitted
Hi Tonie,
Peter had asked me to send these files to you. They are the final versions of our DEFUSE
proposal, as submitted yesterday.
Attached files include:

Technical and Management Proposal (Vol. I)
Executive Summary Slide
NWHC budget packet
NWHC budget justification
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
460 West 34th Street – 17th floor
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
EcoHealth Alliance leads cutting-edge scientific research into the critical connections between human and wildlife health and
delicate ecosystems. With this science, we develop solutions that prevent pandemics and promote conservation.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Fwd: [EXTERNAL] DEFUSE documents as submitted

Wed 3/28/2018 1:10 PM
To: Sleeman, Jonathan M <[email protected]>; Center Director, GS-MWA-NWHC <[email protected]>
4 attachments (7 MB)
PREEMPT Volume 1 no ESS HR001118S0017 EcoHealthAlliance DEFUSE.pdf; Executive Slide HR001118S0017 EcoHealthAlliance DEFUSE.pptx; NWHC budget packet
HR001118S0017 EcoHealthAlliance DEFUSE.xlsx; NWHC budget Justification HR001118S0017 EcoHealthAlliance DEFUSE.pdf;
FYI Tonie has submitted the PREEMPT grant.
Katie

Date: 3/28/18 2:07 PM (GMT-05:00)
To: "Richgels, Katherine" <[email protected]>
Subject: Fwd: [EXTERNAL] DEFUSE documents as submitted
---------- Forwarded message ----------

From: Luke Hamel <[email protected]>
Date: Wed, Mar 28, 2018 at 11:59 AM
Subject: [EXTERNAL] DEFUSE documents as submitted
To: "Rocke, Tonie" <[email protected]>
Cc: "Dr. Peter Daszak" <[email protected]>, Alison Andre <[email protected]>, Rachel Abbott
<[email protected]>, "Richgels, Katherine" <[email protected]>
Hi Tonie,
Peter had asked me to send these files to you. They are the final versions of our DEFUSE proposal, as submitted yesterday.

NWHC budget packet
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
EcoHealth Alliance leads cutting-edge scientific research into the critical connections between human and wildlife health and delicate ecosystems. With this science, we develop
solutions that prevent pandemics and promote conservation.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c)) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
((b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B):41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
ARC - aerosols
William B. Karesh
Fri 2/2/2018 12:34 PM
(b) (6) @gmail.com>
To: Rocke, Tonie E <[email protected]>; Peter Daszak <[email protected]>
Cc: Luke Hamel <[email protected]>
1 attachments (438 KB)
PARC.pdf;
3333 Coyote Hill Road
Palo Alto, CA 94304 USA
+1 650 812 4000
[email protected]
www.parc.com
Project Overview
• PARC developed a unique spray technology for large area and high throughput aerosol delivery of
highly viscous and concentrated fluids. These fluids can include a range of solutions, e.g., bioactive
formulations. This technology has a potential application in large area inoculation of
animals/humans with bioengineered formulations for pre-emptive reduction of disease transfer.
• PARC has expertise in fluid/aerosol delivery, leveraging the unique spray method that can
aerosolize fluids independent of viscosity or bioactive concentration. This technique enables
partners in the biological space to deliver bioactive formulations to animal models with improved
chance of efficacy/bioavailability. Potential technical challenges to overcome will be systems
integration with rapid development/preparation of pre-emptive agents (potentially with on-
demand concentration and composition) and in testing the biological response with animal
models.
• PARC can have significant involvement in Technical Area 2 of a PRE-EMPT project: development
of a scalable aerosol delivery method for wide-scale inoculation of animal models.
Teaming Overview and Objectives
• PARC has worked with both commercial and university partners for applications of this
technology.
• PARC has expertise in fluid delivery, droplet generation, and device and systems integration
drawing on our long history with developing printing systems (ink-on-paper). PARC will leverage
both previous and on-going work and our related IP portfolio on fluid delivery using platform
technologies (spray, transdermal delivery) to meet the PRE-EMPT program objectives.
• PARC has the institutional assets to develop and fabricate new systems for spraying, as well as the
background to help improve spray formulation for uptake in mucosal and other targeted
membranes.
• PARC is well-positioned to advance its unique spray technology for the PRE-EMPT program, given
its demonstrated scalability and wide applicability across different fluids (ranging from low to very
high viscosity and independent of bioactive concentration/loading). PARC is looking for
collaborators who will investigate disease transmission across animal species and develop the
necessary pre-emptive biologicals to prevent such transmission. These engineered biologicals can
then be delivered to animal models using the spray technology with maximum chance for efficacy
and bioavailability.
Contact Information
Dr. Jerome Unidad; email: [email protected]; telephone: 650-812-4209

First (rough) draft of the DARPA abstract - Project DEFUSE

Peter Daszak <[email protected]>
Wed 2/7/2018 8:51 PM
To: Ralph Baric ([email protected]) <[email protected]>; Wang Linfa <[email protected]>; Zhengli
Shi ([email protected]) <[email protected]>; William B. Karesh <[email protected]>; Rocke, Tonie E
<[email protected]>
Cc: Luke Hamel <[email protected]>; Jonathon Musser <[email protected]>; Anna Willoughby
<[email protected]>; Kevin Olival, PhD <[email protected]>; Jon Epstein
<[email protected]>; Noam Ross <[email protected]>; Aleksei Chmura
<[email protected]>; Anna Willoughby <[email protected]>; Hongying Li
<[email protected]>
Dear All,
I’ve attached a first rough draft of the DARPA abstract. Apologies for the delay. Unfortunately, edits to my Science
paper came through on Friday and took many hours to do, so this delayed me. I’m right now in Geneva in my
hotel at 3 am finishing these off before flying back to NYC from a WHO meeting.
Some important points:
1) Zhengli, Linfa, Ralph – Billy and I spoke with Tonie Rocke on Friday. Tonie is at the National Wildlife Health
Center, Madison USA, and has worked on wildlife vaccines: plague in prairie dogs, rabies in Jamaican fruit
bats, white nose syndrome in US bats. We needed someone with expertise in delivery of
molecules/vaccines to wildlife because DARPA specifically lay that out. As you’ll see, Tonie is perfect for
our project and will be able to do work at USGS NWHC and with Zhengli in China to help with TA2
2) Zhengli and Linfa – After I spoke with you both, I had a great conversation with Ralph Baric. He proposed
to work on recombinant chimeric spike proteins as a second line of attack. I think that is a perfect fit
because 1) it’s his expertise and he has published on it, 2) it will act as an alternative to the blue-sky and
risky immune boosting work that Linfa/Peng have proposed. I hope you agree!
3) Ralph, Zhengli, Linfa, Tonie – as you can see, I have mangled the language/technical details for most of
your sections. Pardon my lack of knowledge, and please draft a couple of paragraphs each to make your
sections look correct. Thanks to Peng for giving me some text anyway – very useful, but please check
what I’ve done with it.
4) All – please add some names and details on the team part so we get clarity in this on what staff you will
need to do the work.
5) Please don’t worry about keeping this to the 8 page limit. Just add text here and there, references, and
edit to make what I’ve written correct, and more exciting. I will work on this on Saturday, Sunday and
Monday to bring it down to 8 pages of very crisp, super-exciting text. I also want as many of your good
ideas in here, so that I can use this draft to build on for the full proposal.
6) Finally – please edit rapidly using tracked changes in word. If you don’t want to mess up endnote, please
just insert references as comment boxes and we’ll pull them off the web.
Aleksei and Anna: please read the draft and work on some draft image designs that sum up the project flow. I’ll
call you Thursday afternoon to discuss so you can finish them off.
Luke – please have a go at a first draft of the executive summary slide. I’ll pick up from what you’ve done once
you send it to me.
Thanks again to all of you for agreeing to collaborate on this proposal. From what I know of the competition, what
DARPA wants, and what we’re offering, I think we have an extremely strong team, so I’m looking forward to
getting the full proposal together and winning this contract!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
EcoHealth Alliance leads cutting-edge research into the critical connections between human and wildlife health
and delicate ecosystems. With this science we develop solutions that prevent pandemics and promote
conservation.
DARPA – PREEMPT – HR001118S0017
Abstract Submission Requirements:

**8 pages with 12 point font or higher (smaller font may be used for figures, tables
and charts)
**Page limit includes all figures, tables, charts and the Executive Summary Slide
**Copies of all documents submitted must be clearly labeled with the following:
-DARPA BAA number
-Proposer Organization
-Proposal title/Proposal short title
-Submission letter is optional and does not count towards page limit
A. Cover Sheet (does not count towards page limit):

Include the administrative and technical points of contact (name, address, phone, fax,
email, lead organization). Also include the BAA number, title of the proposed project,
primary subcontractors, estimated cost, duration of project, and the label “ABSTRACT.”
B. Executive Summary Slide:

Provide a one slide summary in PowerPoint that effectively and succinctly conveys the
main objective, key innovations, expected impact, and other unique aspects of the
proposed project. Use the slide template provided at http://www.fbo.gov.
**See slide template at bottom of document.
PROJECT DEFUSE
C. Goals and Impact:
Clearly describe what is being proposed and what difference it will make (qualitatively
and quantitatively), including brief answers to the following questions:
1. What is the proposed work attempting to accomplish or do?

We aim to defuse the potential for emergence of novel bat-origin high-zoonotic risk
SARS-related coronaviruses in Southeast Asia. We envisage a scenario whereby the US
warfighter is called on to intervene in a security hotspot in SE Asia for a period of 3-6
months. As planners begin choosing sites for the mission, they will use an app we will
design to assess the background risk of a site harboring dangerous zoonotic viruses. If
there is no alternative to a high-risk site, a tactical forward team will deploy automated
delivery technology we will develop in caves that harbor bats carrying these viruses.
These devices will release immune boosting molecules and chimeric polyvalent spike
protein immune priming inocula to lower viral shedding from bats at the site for a few
weeks or months, allowing our warfighters to execute the operation at lowered risk for
spillover.
2. How is it done today? And what are the limitations?

Currently, there is no available technology to reduce the risk of exposure to novel
coronaviruses from bats, other than avoid the regions where bats harbor these viruses.
This includes large areas of southeast Asia where SARS-related CoVs are endemic in
bats, which roost in caves during the day, but forage over wide areas at night, shedding
virus in their feces and urine. The limitations of this lack of capacity are significant – we
have shown evidence of recent spillover of SARS-related CoVs into people in southern
China, and have identified viruses in this region that are capable of producing SARS-like
illness in humanized mice, with no available vaccines or countermeasures. These viruses
are a clear-and-present danger to our military personnel, and to global health security.
3. What is innovative in your approach and how does it compare to current

practice and state-of-the-art (SOA)?
**Note: DARPA wants to know, “how the proposed project is revolutionary
and how it significantly rises above the current state of the art
Our group has shown that bats harbor the highest proportion of potential zoonoses of
any mammal group, and that they are able to live with high viral loads due to unique
damping of their immune systems, likely as an evolutionary adaptation to flight. We will
use this to design strategies to upregulate their immune response in their cave roosts,
down-regulate viral replication, and reduce the risk of viral shedding and spillover
(immune boosting strategy). At the same time, we will inoculate bats with novel
chimeric polyvalent recombinant spike proteins to enhance their immune response
against replication of specific, high-risk viruses (immune priming strategy). We will use
our innovative modeling to design apps that identify the likelihood of any region
harboring high-risk bat viruses. We will design novel, automated approaches to deliver
both types of inoculum remotely into caves to reduce exposure risk during
decontamination.
4. What are the key technical challenges in your approach and how do you plan to
overcome these?
Decide which of following parts to talk about:
Modeling bat suitability
Inventory of caves
Sampling/testing
Reverse engineering, binding assays, mouse expts
Modeling viral risk of evolution and spillover
Modeling inoculation/defusing strategy
Immune modulation
Immune Booster recombinant production
Gain-of-function issue.
Inoculum delivery
Mesocosm expts
Cave expts
5. Who will care and what will the impact be if you are successful?
This will have direct relevance to the warfighter. The potential for deployment to the
region in which bat hosts of SARS-related CoVs exist is high – countries include security
hotspots (Myanmar, Bangladesh, Pakistan, Lao, Korea). The ability to decontaminate
and defuse these viruses will be useful in preventing potentially devastating illness.
Furthermore, these technologies, if successful, can be adapted to hosts of other bat-
origin CoVs (MERS, SADS), and potentially other zoonotic bat-origin viruses (Hendra,
Nipah, EBOV). Finally, our approach is directly applicable to public health measures in
the region to reduce the risk of spillover into the general population, as well as for food
security by reducing the risk of viruses like SADS-CoV spilling over from bats into
intensive pig farms, and devastating and industry, leading to potential civil unrest.
6. How much will it cost and how long will it take?

Will insert this later after calculating and brainstorming.
46 months Commented [PD1]: Check on the duration of
PREEMPT
D. Technical Plan:
Outline and address all technical challenges inherent in the approach and possible
solutions for overcoming potential problems. This section should provide appropriate
specific milestones (quantitative, if possible) at intermediate stages of the project to
demonstrate progress and a brief plan for accomplishment of the milestones.
**Note: “The technical plan should demonstrate a deep understanding of the
technical challenges and present a credible (even if risky) plan to achieve
the program goal”
Key Terms/Aspects to Emphasize in Abstract
● IACUC/IRB
○ DARPA wants to know who has experience w/ ACURO IACUC work.
■ EHA has multiple ACURO IACUC proposals (either approved or
undergoing approval)
■ IRB also in place, just has to be modified
Overview Commented [PD2]: I know this is too long. I’ll edit

later this weekend, but want to keep this text for the full
Rationale for the SE Asian SARS-related CoV – Rhinolophus bat target system, and proposal
immune priming/boosting: 1) Our group has shown that bats harbor a higher proportion
of potentially zoonotic viruses than any other mammalian group (1), so that proof-of-
concept for blocking viral spillover from this host group may lead to a bigger impact on
global health security; 2) The Rhinolophus bats that harbor SARS like-CoVs are
insectivorous and roost in dense colonies at a fixed, known location, yet disperse each
night over wide distances from these sites. Defusing the risk of viral shedding in the
roost will also defuse the risk of viral shedding over the population range. This would be
difficult for rodent or primate reservoirs; 3) Bats are mammalian hosts, therefore
immune modulating drugs trialed out in people may also work on bats. This would be
less likely for an insect vector; 4) Members of our collaborative group has worked
together on bats and their viruses for over 15 years, with a total of >100 yrs experience
focused on bat-origin zoonoses among the key personnel. We have published much of
the seminal work on the bat origins of SARS, Nipah, Hendra, and MERS viruses, and have
opened new boundaries in studies of bat host-viral relationships ecologically,
immunologically and virologically; 5) The South and Southeast Asian region where these
bats occur is a security hotspot, with active political and ethnic conflicts, and displaced
populations in Bangladesh, Pakistan, Myanmar, Thailand, Indonesia, Philippines and
other countries. This is a likely potential site for US warfighter deployment; 6) We have
worked for over 10 years on the SARS-related CoV – Rhinolophus bat system in China,
demonstrating the origin of SARS-CoV within this host, the presence of SARSr-CoVs with
remarkable sequence identity in the spike protein to SARS-CoV, their isolation and
characterization of their ability to bind with human cells. We have demonstrated that
chimeric SARS-CoV backbone with spike protein from SARSr-CoVs from our cave sites in
Yunnan Province can infect a humanized mouse model and cause SARS-like illness, and
that clinical signs are not reduced with SARS monoclonal therapy or vaccination. Finally,
we have demonstrated that people living up to 6 kilometers from our cave site have
evidence of SARSr-CoV antibodies (3% seroprevalence in 200+ cohort), suggesting active
spillover, and marking these viruses as a clear-and-present danger of a new SARS-like
pandemic; 7) SARSr-CoVs are transmitted among bats via fecal-oral route, making
sampling relatively easy (collection of fresh fecal pellets) and molecule or vaccine
approaches feasible; 8) Proof-of-concept in this system may be rapidly scalable to other
bat-coronavirus systems, e.g. MERS-CoV, SADS-CoV, and to other cave bat origin viruses.
Other important bat-origin zoonotic viruses (e.g. filoviruses, henipaviruses) have
very rare spillover events - usually to a single index case, which makes validated
prevention of spillover challenging. These viruses also show little strain diversity which
makes modeling which evolutionary lines will be more high-risk, a challenge. SARSr-CoVs
are diverse, with recombinants regularly identified in the field and lab. Furthermore, we
have identified a single cave in Yunnan that harbors every gene from the SARS-CoV in a
diversity of SARSr-CoVs within the bat population, making it an ideal evolutionary soup
to target for intervention.
Finally, we believe that alternative approaches to transmission blocking, e.g.
CRISPER-Cas are likely to be far less effective in bats because most bats are long-lived
relative to their small size, with long inter-generational periods (2-5 years). Gene drives
would likely take many decades to run through a population, so that proof-of-concept of
transmission blocking in the DARPA time scale wouldn’t be possible. Furthermore, many
bat species’ populations mix readily or migrate which would disperse the impact of gene
drives, whereas targeting a small number of caves in a region for molecule or vaccine
delivery would cover a very large dispersal area.
TA1: Develop and validate integrated, multiscale models that quantify the likelihood a
human-capable virus will emerge from an animal reservoir residing in a “hot spot”
geographic region
The DEFUSE modeling and analytics team will develop models to evaluate the likelihood
of bat caves harboring high-risk SARSr-CoVs, evaluate the probability of specific SARS-
related CoV spillover, and identify the most effective strategy for inoculation of immune
boosting molecules and chimeric spike protein immune priming inocula.
We will collect specific data to inform our model building, validate assumptions
and refine predictions. At the start of Yr 1, we will conduct a full inventory of host and
virus distribution within our field sites, two caves in Yunnan Province, China. This builds
on 8 years of surveillance in these caves and includes a cave in which we have identified
all the genetic components of SARS-CoV distributed across a bat population. Two other
caves will act as controls/comparison sites, in that we have not yet identified the high-
risk SARSr-CoVs in that cave. We will assess: the population density, distribution and
segregation of individual bats; changes in these daily, weekly and by season; viral
prevalence and intensity in individuals; distribution of low- and high-risk SARSr-CoV
strains, and how readily these are transmitted among bat species, age classes, genders;
and using mark-recapture to assess metapopulation structure. To assess geographic
distribution of bat hosts, we have access to biological inventory data on all bat caves in
Southern China, as well as information on species distributions across SE Asia from the
literature and museum records. We will use radio- and satellite telemetry to identify the
home range of each species of bat in the caves, to assess how widely the viral ‘plume’
could contaminate surrounding regions, and therefore how wide the risk zone is for the
warfighter positioned close to bat caves. Commented [PD3]: Could add “ We will continue
monitoring the human population proximal to these
We will build environmental niche models using the data above, and caves to assess the rates of viral spillover, and ground-
environmental and ecological correlates, and traits of cave species communities (eg. truth which specific CoVs are able to infect people
phylogenetic and functional diversity), to predict the species composition of bat caves
across Southern China, South and SE Asia. We will validate these with data from the
current project and data from PREDICT sampling in Thailand, Indonesia, Malaysia and
other SE Asian countries. We will then use our unique database of bat host-viral
relationships updated from our recent Nature paper (1) to assess the likelihood of low-
or high-risk SARSr-CoVs being present in a cave at any site across the region. At the end
of Yr 1, we will use these analyses to produce a prototype app for the warfighter that
identifies the likelihood of bats harboring dangerous viral pathogens based on these
analyses. The ‘high-risk bats near me’ app will be updated as new host-viral
surveillance data comes on line from our project and others, to ground-truth and fine-
tune its predictive capacity. Specifically, our telemetry data on bat movement will be
used to assess how often bats from high-risk caves migrate to other colonies and
potentially spread their high-risk strains.
The Wuhan Institute of Virology team will conduct viral testing on samples from
all bat species in the caves as part of this inventory. Fecal, oral, blood and urogenital
samples will be collected from bats using standard capture techniques as we have done
for the last decade. In addition, tarps will be laid down in caves to assess the feasibility
of surveys using pooled fresh fecal and urine samples. Assays will be designed to
correlate viral load in an individual with viral shedding in a fecal sample. Once this is
complete, surveys will continue largely on fecal samples so as not to disturb bat colonies
and undermine longitudinal sampling capacity. Samples will be tested by PCR and spike
proteins of all SARS-related CoVs sequenced. Analyses of phylogeny, recombination
events, and further characterization of high-risk viruses (those with spike proteins close
to SARS-CoV) will be carried out (REF). Isolation will be attempted on a subset of
samples with novel SARSr-CoVs. Prof. Ralph Baric, UNC, will reverse engineer spike Commented [PD4]: Ralph, Zhengli. If we win this
contract, I do not propose that all of this work will
proteins in his lab to conduct binding assays to human ACE2 (the SARS-CoV receptor). necessarily be conducted by Ralph, but I do want to
Proteins that bind will then be inserted into SARS-CoV backbones, and inoculated into stress the US side of this proposal so that DARPA are
comfortable with our team. Once we get the funds, we
humanized mice to assess their capacity to cause SARS-like disease, and their ability to can then allocate who does what exact work, and I
be blocked by monoclonal therapies, or vaccines against SARS-CoV (REF). believe that a lot of these assays can be done in Wuhan as
well…
The modeling team will use these data to build models of 1) risk of viral
evolution and spillover, and 2) strategies to maximize inoculation strategy.
Data on the diversity of bat spike proteins, prevalence of recombinant CoVs, ability to
bind and infect human cells, degree of clinical signs in mouse models, will be used to
estimate evolutionary rates, rates of recombination, and capacity to generate novel
strains capable of human infection. Using dynamic metapopulation models, we will
estimate the flow of genes within each bat cave, based on the known host and viral
assemblages. This will inform how rapidly new CoV strains with distinct phenotypic
characteristics evolve. Because of our unique collaboration among world-class
modelers, and coronavirologists, we will be able to test model predictions of viral
capacity for spillover by conducting spike protein-based binding and cell culture
experiments. The BSL-2 nature of work on SARSr-CoVs makes our system highly cost-
effective relative to other bat-virus systems (e.g. Ebola, Marburg, Hendra, Nipah), which
require BSL-4 level facilities for cell culture.
We will use modeling approaches, the data above, and other biological and
ecological data to estimate how rapidly high-risk SARSr-CoVs will re-colonize a bat
population following immune boosting or priming. We will obtain model estimates of
the frequency of inoculation required for both approaches, what proportion of a
population needs to be reached to have effective viral dampening, and whether specific
seasons, or locations within a cave would be more effective to treat. We will then model
the efficacy of different delivery methods (spray, swab, cave mouth automated delivery,
deliver to specific sections of a cave).
TA2: Develop scalable approaches that target and suppress the animal virus in its
reservoir(s) and/or vector(s), to reduce the likelihood of virus transmission into
humans.
Our goal is to use two approaches to defuse the potential for SARS-related CoVs to
emerge in people: 1) Immune Boosting: using the unique immunological features of
bats that our group has discovered, we will inoculate live bats in cave mesocosms with
immune modulators to up-regulate their naïve immunity to suppress viral replication
and shedding; 2) Immune Priming: building on preliminary development of polyvalent
chimeric recombinant molecules targeting diverse spike proteins from bat SARS-related
CoVs, we will produce, and trial inoculation of live bats to suppress the replication and
shedding of a broad range of dangerous SARS-related CoVs. Both lines of work will begin
in Yr 1 and run parallel throughout the project.
Prof. Linfa Wang (Duke-NUS) will lead the work on immune boosting work,
building on his pioneering work on bat immunity (2). This work provides evidence that
that the long-term coexistence of bats and their viruses has led to an equilibrium
between viral replication and host immunity, whereby bats have specifically down-
regulated their innate immune system as part of the fitness cost of flight (the only true
flying mammals) (2). The nature of the weakened but not entirely lost functionality of
bat innate immunity factors like STING, a central DNA-interferon (IFN) sensing molecule,
may have profound impact for bats to maintain the balanced state of “effective
response”, but not “over response” against viruses (3). A similar finding was also
observed in bat IFNA studies, which is less abundant but was constitutively expressed
without stimulation (4). Given native levels of SARSr-CoVs in individual bats with
damped immunity, we propose to suppress bat SARSr-CoV by boosting bat innate
immunity through the IFN pathway, and breaking the natural host-virus equilibrium.
One of the potential problems with this approach is that it can lead to severe
inflammation. However, this is unlikely to occur in bats, because they also have a
naturally dampened inflammation response (5).
Previous work has shown that aerosol spraying or intranasal inoculation of IFN or
other small molecules has led to reduce viral loads in humans, ferrets and mouse
models (12-14). We will therefore initially trial inoculation of live bats with synthetic
double-stranded RNA (Poly I:C) and assay for reduced viral loads (DETAILS, CITATION).
We will generate universal bat interferon and apply to bats in the lab. Interferon has
been used extensively clinically if no viral-specific drugs are available, e.g. against
filoviruses (11). Secondly, bat replication of SARSr-CoV is sensitive to interferon
treatments, as has been shown in our previous work (12). We will attempt to boost bat
IFN by blocking bat-specific IFN negative regulator. Bat IFNA is naturally constitutively
expressed but cannot be induced to a high level (4). This is unique to bats. We think
there should be a negative regulatory factor in the bat interferon production pathway.
We propose using CRISPRi to find out that negative regulator and then screen for
chemicals targeting at this gene. We will attempt to boost bat IFN by activating
dampened bat-specific IFN production pathways which include DNA-STING-dependent
and ssRNA-TLR7 dependent pathways. These changes have been proved to bat-specific,
suggesting that they are important in viruses/bats coexistence, and supported by our
own work showing that a mutant bat STING restores antiviral functionality (3). By
identifying small molecules to directly activate downstream of STING, we have chance
to activate bat interferon and then help bats to clear viruses. Similar strategy applies to
ssRNA-TLR7 dependent pathways. We will also attempt to boost bat IFN by activating
functional bat IFN production pathways. We will investigate if there are other IFN
production pathways in bats. We then boost bat immune responses by ligands
specifically to these pathways, e.g. polyIC to TLR3-IFN pathway or 5’ppp-dsRNA to RIG-I-
IFN pathway. A similar strategy has been tested successful in mouse model for SARS-
CoV, IAV or HBV (6, 7). We believe treating wild bats with IFN-modulating small
molecules by spraying is superior to other invasive strategies that might be considered
by DARPA, including genome editing (CRISPR or RNAi), vaccination or DIP bats, in terms
of its deployability and scalability. Finally, we will inoculate bats with fragments of non-
bat Coronavirus (DETAILS).
Prof. Ralph Baric (UNC) will lead the immune priming work, building on his track
record in reverse-engineering and manipulating SARS-CoV, MERS-CoV and other virus
spike proteins over the last two decades . He will develop recombinant chimeric spike-
proteins (8) based on SARSr-CoVs we have already identified, and those we will discover
and characterize during project DEFUSE. RALPH – clearly I didn’t really understand the
details of your approach. Can you add a couple of paragraphs here and some citations
please!
While there are clear advantages to working with fixed populations of cave-
dwelling bats, molecule or vaccine delivery is technically challenging. Dr. Tonie Rocke,
who developed, trialed, field-tested and rolled out the prairie dog plague vaccine (9),
and is currently working on vaccines to bat rabies (10, 11) and white-nose syndrome,
will manage a series of experiments in the lab and field to perfect a delivery system for
both arms of TA2.
We will conduct initial experiments on a lab colony of wild-caught Rhinolophus
sinicus bats at Wuhan Institute of Zoology. We (Prof. Wang) have previous experience
conducting infection experiments on this bat genus …(details and citation if possible).
First, we will use our recently proven technology to design LIPS assays to the specific
high zoonotic-risk SARSr-CoVs (12). We will conduct serological analysis on bats
captured for infection experiments, to assess prior exposure to specific strains. These
LIPS assays will be made available for use in people to assess exposure of the general
population around bat caves in China, and for potential use by the warfighter to assess
exposure to SARSr-CoVs during combat missions.
Finally, work on a delivery method will be overseen by Dr. Tonie Rocke at the
National Wildlife Health Center who has proven capacity to develop and take animal
vaccines through to licensure (9). Using her captive Jamaican fruitbat colony (10, 11), Dr.
Rocke will trial out the following strategies for delivery of the molecules, inocula
proposed above: 1) aerosolization; 2) transdermally applied nanoparticles; 3) sticky
edible spray that bats will groom from each other; 4) automated spray triggered by
timers and movement detectors at critical cave entry points.. (Details and ideas please
Tonie!). These approaches will then be trialed out on live bats in our three cave sites in
Yunnan Province. Fieldwork will be conducted under the auspices of Dr. Rocke, EHA field
staff, and Dr. Yunzhi Zhang (Yunnan CDC, Consultant with EcoHealth Alliance). Sections
of bat caves will be cordoned off and different application methods trialed out. A small
number of bats will be captured and assayed for viral load after treatment, but so as not
to disturb the colony, most viral load work will be conducted on fresh fecal pellets
collected daily on the cave floor. EHA has unique access to these sites in Yunnan
Province, with our field teams conducting surveillance there for around 10 years, under
the guidance of Drs. Shi and Zhang. In year 1 of project DEFUSE, we will seek permission
for these experimental inoculations in cave sites in Yunnan from the Provincial Forestry
Department. We do not envisage problems getting permission, as we have worked with
the Forestry Department collaboratively for the last few years, we have the support of
the Yunnan CDC, and we are releasing molecules that are not dangerous to people or
wildlife.
E. Capabilities:
A brief summary of expertise of the team, including subcontractors and key personnel. A
principal investigator for the project must be identified, and a description of the team’s
organization. Include a description of the team’s organization including roles and
responsibilities. Describe the organizational experience in this area, existing intellectual
property required to complete the project, and any specialized facilities to be used as
part of the project. List Government furnished materials or data assumed to be
available.
**Note: While only the proposal requires an organization chart, it may be
helpful to include in the abstract if we have the space.
• This organization chart would include (as applicable): (1) the
programmatic relationship of team members; (2) the unique capabilities
of team members; (3) the task responsibilities of team members; (4) the
teaming strategy among the team members; (5) key personnel with the
amount of effort to be expended by each person during each year.
The lead institution for Project DEFUSE is EcoHealth Alliance, New York, an international
research non-profit focused on emerging zoonotic diseases. The project will be led by PI
Dr. Peter Daszak, who has 20+ years’ experience managing lab, field and modeling
research projects on emerging zoonoses, including as EHA institutional lead, Head of
Modeling and Analytics, and member of the Executive Committee for the $130 million
USAID EPT/PREDICT. Dr. Daszak will oversee and coordinate all project activities, as well
as lead the modeling and analytic work for TA1. Dr. Billy Karesh, who has 40+ years’
experience managing wildlife disease and zoonotic disease projects, will manage
partnership activities and relationships and outreach. Dr. Jon Epstein, who has 15 years’
experience working with bats and emerging zoonoses will coordinate work on bat
immune priming and boosting trials. Dr. Kevin Olival and Dr. Noam Ross will manage
and conduct the modeling and analytical approaches for this project.
Team:
Lead Organization: EcoHealth Alliance, New York
PI: Peter Daszak Ph.D., President & Chief Scientist, EcoHealth Alliance, 3 months/year
Key Personnel:
Billy Karesh DVM, Executive VP for Policy & Health, 1 month/year
Kevin J. Olival Ph.D, VP for Scientific Research, 1 month/year
Jonathan H. Epstein DVM Ph.D., VP for Science & Outreach, 0.5 months/year
Carlos Zambrana-Torrelio Ph.D., Assoc. VP for Conservation & Health, 1 month/year
Noam Ross Ph.D., Senior Research Scientist, 2 months/year
Evan Eskew, Research Scientist, 2 months/year
Hongying Li, Program Coordinator, China Programs, 3 months/year
TBD Postdoctoral Researcher modeling and analysis, 12 months/year
TBD Research Assistant, 12 months/year
TBD Program Assistant, 12 months/year
Guangjian Zhu Ph.D., Consultant Field Lead, China Programs, 6 months/year
Yunzhi Zhang Ph.D., Consultant, Yunnan CDC, China, 2 months/year
Subcontract #1: University of North Carolina Medical School

Organizational Lead: Prof. Ralph Baric Ph.D., 2 months/year
XXX
Subcontract #2: USGS National Wildlife Health Center

Organizational Lead: Tonie Rocke Ph.D., 2 months/year, no salary requested
TBD Research Technician, 9 months/year
Subcontract #3: Duke NUS, Singapore

Organizational Lead: Prof. Linfa Wang Ph.D., 2 months/year
XXX
XXX
Subcontract #4: Wuhan Institute of Virology, China

Organizational Lead: Prof Zhengli Shi Ph.D., 2 months/year
Peng Zhou Ph.D., 2 months/year
F. If desired, include a brief bibliography
Links to relevant papers, reports, or resumes of key performers. Commented [PD5]: I’m planning to use my resume
and Ralph’s. Linfa/Zhengli, I realize your resumes are
Do not include more than two resumes as part of the abstract. also very impressive, but I am trying to downplay the
**Resumes count against the abstract page limit. non-US focus of this proposal so that DARPA doesn’t see
this as a negative.
Dr. Peter Daszak is President and Chief Scientist of EcoHealth Alliance, a US-based
organization that conducts research and outreach programs on emerging zoonotic
diseases. He has published over 300 scientific papers, including the first global map of
EID hotspots, strategies to estimate unknown viral diversity in wildlife, predictive
models of virus-host relationships, and evidence of the bat origin of SARS-CoV and other
emerging viruses. Dr Daszak is Chair of the National Academy of Sciences, Engineering
and Medicine’s Forum on Microbial Threats and is a member of the Executive
Committee and the EHA institutional lead for USAID-EPT-PREDICT. He serves on the NRC
Advisory Committee to the USGCRP, the DHS CEEZAD External Advisory Board, and the
WHO R&D Blueprint Pathogen Prioritization expert group, and has advised the Director
for Medical Preparedness Policy on the White House National Security Staff on global
health issues. Dr Daszak won the 2000 CSIRO medal for collaborative research.
Prof. Ralph Baric is a UNC Lineberger Comprehensive Cancer Center member and
Professor in the UNC-Chapel Hill Department of Epidemiology. His work focuses on
coronaviruses as models to study the genetics of RNA virus transcription, replication,
persistence, and cross species transmission. His work crosses the boundaries of
microbiology, virology, immunology and epidemiology, looking especially at the
population genetics of viruses to find the molecular building blocks for more effective
vaccines.
**General Notes:
• DARPA will evaluate proposals using the following criteria, listed in
descending order of importance:
1) 5.1.1. Overall Scientific and Technical Merit

The proposed technical approach is innovative, feasible, achievable, and complete.
Task descriptions and associated technical elements provided are complete and in a
logical sequence with all proposed deliverables clearly defined such that a final outcome
that achieves the goal can be expected as a result of award. The proposal identifies
major technical risks and planned mitigation efforts are clearly defined and feasible. The
proposed PREEMPT Risk Mitigation Plan effectively provides the following: an
assessment of potential risks; proposed guidelines to ensure maximal biosafety and
biosecurity; a risk management plan for responsible communications; and a plan to
address how input from the Government and community stakeholders will be
considered regarding communication and publication of potentially sensitive dual-use
information.
2) 5.1.2. Potential Contribution and Relevance to the DARPA Mission

The potential contributions of the proposed effort are relevant to the national
technology base. Specifically, DARPA’s mission is to make pivotal early technology
investments that create or prevent strategic surprise for U.S. National Security. The
proposer clearly demonstrates its capability to transition the technology to the research,
industrial, and/or operational military communities in such a way as to enhance U.S.
defense. In
addition, the evaluation will take into consideration the extent to which the proposed
intellectual property (IP) rights will potentially impact the Government’s ability to
transition the technology.
3) 5.1.3. Cost Realism

The proposed costs are realistic for the technical and management approach and
accurately reflect the technical goals and objectives of the solicitation. The proposed
costs are consistent with the proposer's Statement of Work and reflect a sufficient
understanding of the costs and level of effort needed to successfully accomplish the
proposed technical approach. The costs for the prime proposer and proposed
subawardees are substantiated by the details provided in the proposal (e.g., the type
and number of labor hours proposed per task, the types and quantities of materials,
equipment and fabrication costs, travel and any other applicable costs and the basis for
the estimates).
It is expected that the effort will leverage all available relevant prior research in order to
obtain the maximum benefit from the available funding. For efforts with a likelihood of
commercial application, appropriate direct cost sharing may be a positive factor in the
evaluation. DARPA recognizes that undue emphasis on cost may motivate proposers to
offer low-risk ideas with minimum uncertainty and to staff the effort with junior
personnel in order to be in a more competitive posture. DARPA discourages such cost
strategies. Commented [EA6]: Please note
Attachment 1: Executive Summary Slide template
Citations
1. K. J. Olival et al., Host and viral traits predict zoonotic spillover from
mammals. Nature 546, 646-650 (2017).
2. G. Zhang et al., Comparative analysis of bat genomes provides insight into the
evolution of flight and immunity. Science 339, 456-460 (2013).
3. J. Xie et al., Dampened STING-Dependent Interferon Activation in Bats. Cell
host & microbe, (2018).
4. P. Zhou et al., Contraction of the type I IFN locus and unusual constitutive
expression of IFN-αin bats. Proceedings of the National Academy of Sciences of
the United States of America, 201518240-201518246 (2016).
5. M. Ahn, J. Cui, A. T. Irving, L.-F. Wang, Unique Loss of the PYHIN Gene Family
in Bats Amongst Mammals: Implications for Inflammasome Sensing. Scientific
Reports 6, (2016).
6. J. Zhao et al., Intranasal Treatment with Poly(I.C) Protects Aged Mice from
Lethal Respiratory Virus Infections. Journal of Virology 86, 11416-11424
(2012).
7. J. Wu et al., Poly(I:C) Treatment Leads to Interferon-Dependent Clearance of
Hepatitis B Virus in a Hydrodynamic Injection Mouse Model. Journal of
Virology 88, 10421-10431 (2014).
8. X. F. Deng et al., A Chimeric Virus-Mouse Model System for Evaluating the
Function and Inhibition of Papain-Like Proteases of Emerging Coronaviruses.
Journal of Virology 88, 11825-11833 (2014).
9. T. E. Rocke et al., Sylvatic Plague Vaccine Partially Protects Prairie Dogs
(Cynomys spp.) in Field Trials. Ecohealth 14, 438-450 (2017).
10. B. Stading et al., Protection of bats (Eptesicus fuscus) against rabies following
topical or oronasal exposure to a recombinant raccoon poxvirus vaccine. Plos
Neglect. Trop. Dis. 11, (2017).
11. B. R. Stading et al., Infectivity of attenuated poxvirus vaccine vectors and
immunogenicity of a raccoonpox vectored rabies vaccine in the Brazilian
Free-tailed bat (Tadarida brasiliensis). Vaccine 34, 5352-5358 (2016).
12. P. Zhou et al., Fatal Swine Acute Diarrhea Syndrome caused by an HKU2-
related Coronavirus of Bat Origin. Nature In press, (2018
).
RE: First (rough) draft of the DARPA abstract - Project DEFUSE

Wang Linfa <[email protected]>
Thu 2/8/2018 6:24 AM
To: Peter Daszak <[email protected]>; Ralph Baric ([email protected]) <[email protected]>;
Zhengli Shi ([email protected]) <[email protected]>; William B. Karesh <[email protected]>; Rocke, Tonie E
<[email protected]>
<[email protected]>
See my brief notes/edits in the attached.
I am working on a large grant here in SG and won’t be able to spend too much time until next week.
LF
Linfa (Lin-Fa) WANG, PhD FTSE

Professor & Director
Programme in Emerging Infectious Disease
Duke-NUS Medical School,
8 College Road, Singapore 169857
Tel: +65 6516 8397
From: Peter Daszak [mailto:[email protected]]

Sent: Thursday, 8 February, 2018 10:51 AM
To: Ralph Baric ([email protected]); Wang Linfa; Zhengli Shi ([email protected]); William B. Karesh; Rocke,
Tonie
Cc: Luke Hamel; Jonathon Musser; Anna Willoughby; Kevin Olival, PhD; Jon Epstein; Noam Ross; Aleksei Chmura;
Anna Willoughby; Hongying Li
Subject: First (rough) draft of the DARPA abstract - Project DEFUSE
Importance: High
Dear All,
you send it to me.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
Important: This email is confidential and may be privileged. If you are not the
intended recipient, please delete it and notify us immediately; you should not copy or
use it for any purpose, nor disclose its contents to any other person. Thank you.

and charts)
-DARPA BAA number


PROJECT DEFUSE

spillover.

Currently, there is no available technology to reduce the risk of exposure to novel Commented [L1]: My understanding is that the project
will have two parts: A) better risk assessment and
coronaviruses from bats, other than avoid the regions where bats harbor these viruses. modeling and B) risk defusing.
Do we need to say anything about A here?!

any mammal group, and that they are able to live with the host without causing Deleted: high viral loads
diseases due to unique damping of certain pathways in their immune systems, likely as Deleted: their
an evolutionary adaptation to flight. We will use this new finding to design strategies to
upregulate their immune response in their cave roosts, down-regulate viral replication,
and reduce the risk of viral shedding and spillover (broad immune boosting strategy). At Commented [L2]: This will become important late:
while we are specifically targeting SARS-realted CoVS,
the same time, we will inoculate bats with novel chimeric polyvalent recombinant spike this strategy will be applicable to ALL bat-borne viruses
proteins to enhance their immune response against replication of specific, high-risk in future
viruses (targeted immune priming strategy). We will use our innovative modeling to
design apps that identify the likelihood of any region harboring high-risk bat viruses. We
will design novel, automated approaches to deliver both types of inoculum remotely
into caves to reduce exposure risk during decontamination.
overcome these?
Modeling bat suitability Commented [L3]: I have highlighted the ones which
are most challenging and novel for this proposal
Inventory of caves
Formatted: Highlight
Sampling/testing
Modeling inoculation/defusing strategy Formatted: Highlight
Immune modulation Formatted: Highlight
Inoculum delivery Formatted: Highlight
Mesocosm expts
Cave expts Formatted: Highlight

PREEMPT
D. Technical Plan:
the program goal”
● IACUC/IRB

delivery would cover a very large dispersal area. Commented [L6]: We need to provide background
info about bat immunity and the track record of this
group in the field
TA1: Develop and validate integrated, multiscale models that quantify the likelihood a Commented [L7]: Peng: I am working on an
human-capable virus will emerge from an animal reservoir residing in a “hot spot” important grant here in Singapore. Can you add a few
points here? Thanks
geographic region
be blocked by monoclonal therapies, or vaccines against SARS-CoV (REF). believe that a lot of these assays can be done in Wuhan as
well…
humans.
please!
both arms of TA2.
We have found that the immune dampening features are highly conserved in all
bat species tested so far. Duke-NUS has established a breeding colony of cave nectar
bats for experimental use (one of very few experimental bat breeding colonies in the
world and the only one in SE Asia!). So our initial proof of concept test can be done in
this experimental colony. We will then extend the test to a small group of wild-caught Deleted: We will conduct initial experiments on a lab
colony of wild-caught
Rhinolophus sinicus bats at Wuhan Institute of Zoology. We (Prof. Wang) have previous
experience conducting SARS-CoV infection experiments with bat species from the same Deleted: on this bat
genus in the BSL4 facility at the Australian Animal Health Laboratory in Australia
(L.Wang, unpublished results). First, we will use our recently proven technology to Deleted: …(details and citation if possible).
design LIPS assays to the specific high zoonotic-risk SARSr-CoVs (12). We will conduct
serological analysis on bats captured for infection experiments, to assess prior exposure
to specific strains. These LIPS assays will be made available for use in people to assess
exposure of the general population around bat caves in China, and for potential use by
the warfighter to assess exposure to SARSr-CoVs during combat missions.
wildlife.
E. Capabilities:
available.
Team:
Key Personnel:

XXX


XXX
XXX

this as a negative.
vaccines.
**General Notes:
information.

defense. In

the estimates).
Citations
mammals. Nature 546, 646-650 (2017).
Reports 6, (2016).
(2012).
Virology 88, 10421-10431 (2014).
).
RE: First (rough) draft of the DARPA abstract - Project DEFUSE

Baric, Ralph S <[email protected]>
Thu 2/8/2018 10:22 AM
To: Wang Linfa <[email protected]>; Peter Daszak <[email protected]>; Zhengli Shi
([email protected]) <[email protected]>; William B. Karesh <[email protected]>; Rocke, Tonie E
<[email protected]>
<[email protected]>
I have built in my comments atop of Linfa’s comments. ralph
From: Wang Linfa [mailto:[email protected]]

Sent: Thursday, February 8, 2018 7:25 AM
To: Peter Daszak <[email protected]>; Baric, Ralph S <[email protected]>; Zhengli Shi
([email protected]) <[email protected]>; William B. Karesh <[email protected]>; Rocke, Tonie
<[email protected]>
Cc: Luke Hamel <[email protected]>; Jonathon Musser <[email protected]>; Anna
Willoughby <[email protected]>; Kevin Olival, PhD <[email protected]>; Jon Epstein
<[email protected]>
Subject: RE: First (rough) draft of the DARPA abstract - Project DEFUSE
LF

Tel: +65 6516 8397

Tonie
Cc: Luke Hamel; Jonathon Musser; Anna Willoughby; Kevin Olival, PhD; Jon Epstein; Noam Ross; Aleksei Chmura;
Anna Willoughby; Hongying Li
Importance: High
Dear All,
you send it to me.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
Important: This email is confidential and may be privileged. If you are not the intended recipient, please delete it and notify us immediately; you should not
copy or use it for any purpose, nor disclose its contents to any other person. Thank you.

and charts)
-DARPA BAA number


PROJECT DEFUSE

spillover.


diseases due to unique damping of certain pathways in their immune systems, likely in Deleted: their
part as an evolutionary adaptation to flight. We will use this new finding to design
strategies like small molecule Rig like receptor (RLR) or Toll like receptor (TLR) agonists
to upregulate their immune response in their cave roosts, down-regulate viral
replication, and reduce the risk of viral shedding and spillover (broad immune boosting
strategy). At the same time, we will inoculate bats with novel chimeric polyvalent Commented [L2]: This will become important late:
recombinant spike proteins to enhance their immune response against replication of this strategy will be applicable to ALL bat-borne viruses
specific, high-risk viruses (targeted immune priming strategy). We will use our in future
innovative modeling to design apps that identify the likelihood of any region harboring Commented [BRS3]: I thought we were also going to
use innate immune antagonists to boost baseline
high-risk bat viruses. We will design novel, automated approaches to deliver both types immunity, which should attenuate virus burden in
animals?
of inoculum remotely into caves to reduce exposure risk during decontamination.
Isn’t this supposed to be a two pronged approach that are
complementary, e.g., in that innate immune agonists will
4. What are the key technical challenges in your approach and how do you plan to also boost immunity to recombinant spike vaccines.
overcome these?
Inventory of caves
Sampling/testing
Mesocosm expts
hotspots (Myanmar, Bangladesh, Pakistan, Lao, Korea, Vietnam and Cambodia?). The
ability to decontaminate and defuse these viruses will be useful in preventing
potentially devastating illness. Furthermore, these technologies, if successful, can be
adapted to hosts of other bat-origin CoVs (MERS, SARS and related prepandemic Deleted: D
zoonotic strains), and potentially other zoonotic bat-origin viruses (Hendra, Nipah,
EBOV). Finally, our approach is directly applicable to public health measures in the
region to reduce the risk of spillover into the general population, as well as for food

PREEMPT
D. Technical Plan:
the program goal”
● IACUC/IRB

of potentially highly heterogeneous zoonotic viruses than any other mammalian group
(1), so that proof-of-concept for blocking viral spillover from this host group may lead to
a bigger impact on global health security; 2) The Rhinolophus bats that harbor SARS
like-CoVs are insectivorous and roost in dense colonies at fixed, known locations, yet Deleted: a
disperse each night over wide distances from these sites. Defusing the risk of viral
shedding in the roost will also defuse the risk of viral shedding over the population
range. This would be difficult for rodent or primate reservoirs; 3) Bats are mammalian
hosts, therefore immune modulating drugs evaluated in people and rodents may also Deleted: trialed out
work on bats. This would be less likely for an insect vector; 4) Members of our
collaborative group has worked together on bats and their viruses for over 15 years,
with a total of >100 yrs experience focused on bat-origin zoonoses among the key
personnel. We have published much of the seminal work on the bat origins of SARS,
Nipah, Hendra, and MERS viruses, and have opened new boundaries in studies of bat
host-viral relationships ecologically, immunologically and virologically; 5) The South and
Southeast Asian region where these bats occur is a security hotspot, with active political
and ethnic conflicts, and displaced populations in Bangladesh, Pakistan, Myanmar,
Thailand, Indonesia, Philippines and other countries. This is a likely potential site for US Commented [BRS7]: About 90,000 of the 550,000
deployed US military are in se asian, mostly japan and
warfighter deployment; 6) We have worked for over 10 years on the SARS-related CoV – south korea.
Rhinolophus bat system in China, demonstrating the origin of SARS-CoV within this host,
the presence of SARSr-CoVs with remarkable sequence identity in the spike protein to Commented [BRS8]: What abbreviation mean
SARS-CoV, their isolation and characterization of their ability to bind and replicate
efficiently in primary human lung airway cells. We have demonstrated that chimeric Deleted: bind
SARS-CoV backbone with spike protein from SARSr-CoVs from our cave sites in Yunnan Deleted: with
Province can infect a humanized mouse model and cause SARS-like illness, and that
clinical signs are not reduced with SARS monoclonal therapy or vaccination. Finally, we
have demonstrated that people living up to 6 kilometers from our cave site have
bat-coronavirus systems, e.g. MERS-CoV, SADS-CoV, and to other cave bat origin viruses. Commented [BRS9]: These viruses can either be
cultured and/or recovered using reverse genetic
Other important bat-origin zoonotic viruses (e.g. filoviruses, henipaviruses) have strategies.
makes modeling which evolutionary lines will be more high-risk, a challenge. SARSr-CoVs Commented [BRS10]: Filoviruses pretty diverse,
although not anywhere near as diverse as cov. Is this a
are diverse, with recombinants regularly identified in the field and lab. Furthermore, we sampling thing or not likely remains unclear?
have identified SARS-like strains in a single cave in Yunnan that harbor every gene found Deleted: s
in the human SARS-CoV strains detected during the 2002-2003 epidemic. Within this bat Deleted: from the
population, an ideal evolutionary soup exists which can produce new human strains by Deleted: in a diversity of SARSr-CoVs w
high frequency RNA recombination and presents a perfect target for 21st generation Deleted: e
intervention strategies. Deleted: making it
Finally, we believe that alternative approaches to transmission blocking, e.g. Deleted: to
CRISPER-Cas gene drives that are likely to be far less effective in bats because most bats Formatted: Superscript
are long-lived relative to their small size, long inter-generational periods (2-5 yrs) and Deleted: with
low progeny (~1-2 pups). Gene drives would likely take many decades to run through a Commented [BRS11]: Is this correct?
population, so that proof-of-concept of transmission blocking in the DARPA time scale Deleted: 2-5 years
wouldn’t be possible. Furthermore, many bat species’ populations mix readily or
migrate which would disperse the impact of gene drives, whereas targeting a small
number of caves in a region for molecule or vaccine delivery would cover a very large
dispersal area. Commented [L12]: We need to provide background
info about bat immunity and the track record of this
group in the field
TA1: Develop and validate integrated, multiscale models that quantify the likelihood a Commented [L13]: Peng: I am working on an
human-capable virus will emerge from an animal reservoir residing in a “hot spot” important grant here in Singapore. Can you add a few
points here? Thanks
geographic region
all the genetic components of the 2002-2003 epidemic SARS-CoV distributed across a
bat population. Two other caves will act as controls/comparison sites, in that we have
not yet identified the high-risk SARSr-CoVs in that cave. We will assess: the population Commented [BRS14]: Is surveillance in these other
caves equally robust over the past 8 yrs?
density, distribution and segregation of individual bats; changes in these daily, weekly
and by season; viral prevalence and intensity in individuals; distribution of low- and
high-risk SARSr-CoV strains, and how readily these are transmitted among bat species,
age classes, genders; and using mark-recapture to assess metapopulation structure. To
assess geographic distribution of bat hosts, we have access to biological inventory data
on all bat caves in Southern China, as well as information on species distributions across
SE Asia from the literature and museum records. We will use radio- and satellite
telemetry to identify the home range of each species of bat in the caves, to assess how
widely the viral ‘plume’ could contaminate surrounding regions, and therefore how
wide the risk zone is for the warfighter positioned close to bat caves. Commented [PD15]: Could add “ We will continue
Their group have also devised new strategies to culture SARS-like bat coronaviruses, stress the US side of this proposal so that DARPA are
allowing biological characterization of both high risk strains that can replicate in primary can then allocate who does what exact work, and I
believe that a lot of these assays can be done in Wuhan as
human cells and low risk strains that can only replicate in the presence of exogenous
well…
enhancers. Viral spike glycoproteins that bind receptor will then be inserted into SARS- Deleted: P
CoV backbones, and inoculated into human cells and humanized mice to assess their
capacity to cause SARS-like disease, and their ability to be blocked by monoclonal
therapies, or vaccines against SARS-CoV ((PMC5798318, PMC5567817, PMC5380844,
PMC5578707, PMC4801244, PMC4797993). The Baric group has also demonstrated that Deleted: REF)
a nucleoside analogue inhibitor, GS-5734 (Gilead Inc), blocks epidemic, preepidemic and
zoonotic SARS-CoV and SARS-like bat coronavirus replication in primary human airway
cells and in mice (PMC5567817). Consequently, they will evaluate the ability of this drug
to block replication of newly disovered pre-epidemic and zoonotic high risk strains. As
the drug has been used to effectively treat Ebola virus infected patients (PMC4967715,
PMC5583641) as well and has potent activity against Nipha and Hendra viruses
(PMC5338263), an alternative intervention for military personnel is prophylactic
treatment treatment prior to deployment into high risk settings.
require BSL-4 level facilities for cell culture. Commented [BRS17]: IN the US, these recombinant
SARS CoV are studied under BSL3, not BSL2, especially
We will use modeling approaches, the data above, and other biological and important for those that are able to bind and replicate in
ecological data to estimate how rapidly high-risk SARSr-CoVs will re-colonize a bat primary human cells.
In china, might be growin these virus under bsl2. US
population following immune boosting or priming. We will obtain model estimates of reseachers will likely freak out.
humans.
immune modulators to up-regulate their naïve immunity to suppress viral replication Commented [BRS18]: Like what
One of the potential problems with this approach is that it can lead to severe Commented [BRS19]: Transient low level Chronic
inflammation sounds better
chemicals targeting at this gene. We will attempt to boost bat IFN by activating Commented [BRS20]: This could easily take longer
than 3 years. Poly ic, IFN or any type of TLR agonist might
dampened bat-specific IFN production pathways which include DNA-STING-dependent be more robust. Might want to test in captive bats
and ssRNA-TLR7 dependent pathways. These changes have been proved to bat-specific, infected with SARS or select SARS like viruses, like
SHC014, which we could provide.
production pathways in bats. We then boost bat immune responses by ligands Commented [BRS21]: We have several papers
specifically to these pathways, e.g. polyIC to TLR3-IFN pathway or 5’ppp-dsRNA to RIG-I- showing importance of TLR3 and TLR4 signaling in
control of SARS pathogenesis. PMC4447251,
IFN pathway. A similar strategy has been tested successful in mouse model for SARS- PMC5473747
Commented [BRS22]: Don’t attack the other arm of
molecules by spraying is superior to other invasive strategies that might be considered the program. And I disagree that its superior to
by DARPA, including genome editing (CRISPR or RNAi), vaccination or DIP bats, in terms vaccination, which potentially provides long-term
immunity.
Commented [BRS23]: The structure of the SARS-CoV
Prof. Ralph Baric (UNC) will lead the immune priming work, building on his track spike glycoprotein has been solved and the addition of
two proline residues at positions V1060P and L1061P
record in reverse-engineering and manipulating SARS-CoV, MERS-CoV and other virus stabilize the prefusion state of the trimer, including key
spike proteins over the last two decades . He will develop recombinant chimeric spike- neutralizing epitopes in the receptor binding domain
(PMC5584442). In parallel, the spike trimers or the
proteins (8) based on SARSr-CoVs we have already identified, and those we will discover receptor binding domain can be incorporated into
and characterize during project DEFUSE. RALPH – clearly I didn’t really understand the alphavirus vectored or nanoparticle vaccines for delivery,
either as aerosols, in baits, or as large droplet delivery
details of your approach. Can you add a couple of paragraphs here and some citations vehicles (PMC4058772, PMC5423355, PMC2883479,
PMC5578707, PMC3014161). Initially, we will test
please! various delivery vehicles in controlled conditions in bats
While there are clear advantages to working with fixed populations of cave- in a laboratory setting, taking the best candidate forward
for testing in the field.
dwelling bats, molecule or vaccine delivery is technically challenging. Dr. Tonie Rocke, The Baric laboratory has built recombinant S pike
who developed, trialed, field-tested and rolled out the prairie dog plague vaccine (9), glycoproteins harboring structurally defined domains
from SARS epidemic strains, pre-epidemic strains like
and is currently working on vaccines to bat rabies (10, 11) and white-nose syndrome, SCH014 and zoonotic strains like HKU3. It is anticipated
that recombinant S glycoprotein based vaccines
will manage a series of experiments in the lab and field to perfect a delivery system for harboring immunogenic blocks across the group 2B
both arms of TA2. coronaviruses will induce broad based immune
responses that simultaneously reduce genetically
We have found that the immune dampening features are highly conserved in all heterogeneous virus burdens in bats, thereby reducing
bat species tested so far. Duke-NUS has established a breeding colony of cave nectar disease risk in these animals for multiple years
(PMC3977350,
bats for experimental use (one of very few experimental bat breeding colonies in the PMC2588415).
this experimental colony. We will then extend the test to a small group of wild-caught Deleted: We will conduct initial experiments on a lab
colony of …
wildlife.
E. Capabilities:
available.
Team:
Key Personnel:

Dr. Tim Sheahan (6 months/yr)
Dr. Amy Sims (4 months/yr)
Sarah Leist, Postdoctoral fellow (4 months/yr) Deleted: XXX
Boyd Yount, Research Analyst, 12 months/year Deleted: TBD
Trevor Scobey, Research Technician, 6 months/yr Deleted: ssistant


XXX
XXX


this as a negative.
Professor in the UNC-Chapel Hill Department of Epidemiology and Department of
Microbiology and Immunology . His work focuses on coronaviruses as models to study
the genetics of RNA virus transcription, replication, persistence, and cross species
transmission and pathogenesis. Dr. Baric and his group have developed a platform
strategy to access the potential “preepidemic” risk associated with zoonotic virus cross
species transmission potential and evaluation of countermeasure potential to control
future outbreaks of disease (PMC5798318, PMC5567817, PMC5380844, PMC5578707, Formatted: Font: (Default) Arial, 11 pt, Font color:
Accent 1
PMC4801244, PMC4797993). His work crosses the boundaries of microbiology,
virology, immunology and epidemiology, looking especially at the population genetics of
viruses to find the molecular building blocks for more effective vaccines.
**General Notes:

information.
defense. In addition, the evaluation will take into consideration the extent to which the Deleted: ¶
proposed intellectual property (IP) rights will potentially impact the Government’s
ability to transition the technology.

the estimates).
Citations
mammals. Nature 546, 646-650 (2017).
Reports 6, (2016).
(2012).
Virology 88, 10421-10431 (2014).
).
From: Rocke, Tonie <[email protected]>
To: Baric, Ralph S
Cc: Wang Linfa; Peter Daszak; Zhengli Shi ([email protected]); William B. Karesh; Luke Hamel;
Jonathon Musser; Anna Willoughby; Kevin Olival, PhD; Jon Epstein; Noam Ross; Aleksei
Chmura; Hongying Li
Subject: Re: First (rough) draft of the DARPA abstract - Project DEFUSE
Attachments: DARPA (PREEMPT) Abstract EcoHealth Alliance DEFUSE 1st Draft-LW180208-rsb-
ter.docx
Likewise, I added my comments to Ralph's document. I added some detail, but not too much, so let me know
if you want more. Best -Tonie
On Thu, Feb 8, 2018 at 10:22 AM, Baric, Ralph S <[email protected]> wrote:

To: Peter Daszak <[email protected]>; Baric, Ralph S <[email protected]>; Zhengli Shi
([email protected]) <[email protected]>; William B. Karesh <[email protected]>; Rocke, Tonie
<[email protected]>
<[email protected]>
LF
1
Tel: +65 6516 8397

To: Ralph Baric ([email protected]); Wang Linfa; Zhengli Shi ([email protected]); William B. Karesh; Rocke, Tonie
Cc: Luke Hamel; Jonathon Musser; Anna Willoughby; Kevin Olival, PhD; Jon Epstein; Noam Ross; Aleksei Chmura; Anna
Willoughby; Hongying Li
Importance: High
Dear All,
paper came through on Friday and took many hours to do, so this delayed me. I’m right now in Geneva in my hotel at 3
am finishing these off before flying back to NYC from a WHO meeting.
1) Zhengli, Linfa, Ralph – Billy and I spoke with Tonie Rocke on Friday. Tonie is at the National Wildlife Health Center,
Madison USA, and has worked on wildlife vaccines: plague in prairie dogs, rabies in Jamaican fruit bats, white nose
syndrome in US bats. We needed someone with expertise in delivery of molecules/vaccines to wildlife because DARPA
specifically lay that out. As you’ll see, Tonie is perfect for our project and will be able to do work at USGS NWHC and
with Zhengli in China to help with TA2
2) Zhengli and Linfa – After I spoke with you both, I had a great conversation with Ralph Baric. He proposed to work
on recombinant chimeric spike proteins as a second line of attack. I think that is a perfect fit because 1) it’s his
expertise and he has published on it, 2) it will act as an alternative to the blue-sk y and risky immune boosting work that
Linfa/Peng have proposed. I hope you agree!
2
3) Ralph, Zhengli, Linfa, Tonie – as you can see, I have mangled the language/technical details for most of your
sections. Pardon my lack of knowledge, and please draft a couple of paragraphs each to make your sections look
correct. Thanks to Peng for giving me some text anyway – very useful, but please check what I’ve done with it.
4) All – please add some names and details on the team part so we get clarity in this on what staff you will need to do
the work.
5) Please don’t worry about keeping this to the 8 page limit. Just add text here and there, references, and edit to
make what I’ve written correct, and more exciting. I will work on this on Saturday, Sunday and Monday to bring it
down to 8 pages of very crisp, super-exciting text. I also want as many of your good ideas in here, so that I can use this
draft to build on for the full proposal.
6) Finally – please edit rapidly using tracked changes in word. If you don’t want to mess up endnote, please just insert
references as comment boxes and we’ll pull them off the web.
Aleksei and Anna: please read the draft and work on some draft image designs that sum up the project flow. I’ll call
you Thursday afternoon to discuss so you can finish them off.
Luke – please have a go at a first draft of the executive summary slide. I’ll pick up from what you’ve done once you
send it to me.
DARPA wants, and what we’re offering, I think we have an extremely strong team, so I’m looking forward to getting the
full proposal together and winning this contract!
Cheers,
Peter
3

and charts)
-DARPA BAA number


PROJECT DEFUSE

spillover.


any mammal group, and that they are able to live with the host without causing
diseases due to unique damping of certain pathways in their immune systems, likely in
strategies, like small molecule Rig like receptor (RLR) or Toll like receptor (TLR) agonists,
strategy). At the same time, we will inoculate bats with novel chimeric polyvalent
recombinant spike proteins to enhance their immune response against replication of
specific, high-risk viruses (targeted immune priming strategy). We will use our
innovative modeling to design apps that identify the likelihood of any region harboring
high-risk bat viruses. We will design novel, automated approaches to deliver both types
overcome these?
Inventory of caves
Sampling/testing
Immune modulation
Inoculum delivery
Mesocosm expts
Cave expts
adapted to hosts of other bat-origin CoVs (MERS, SARS and related prepandemic
intensive pig farms and devastating the industry, leading to potential civil unrest.

46 months
D. Technical Plan:
the program goal”
● IACUC/IRB
Overview
Rationale for the SE Asian SARS-related CoV – Rhinolophus bat target system, and
like-CoVs are insectivorous and roost in dense colonies at fixed, known locations, yet
disperse each night over wide distances from these sites. Defusing the risk of viral
shedding in the roost will also defuse the risk of viral shedding over the population
range. This would be difficult for rodent or primate reservoirs; 3) Bats are mammalian
hosts, therefore immune modulating drugs evaluated in people and rodents may also
work on bats. This would be less likely for an insect vector; 4) Members of our
collaborative group has worked together on bats and their viruses for over 15 years,
with a total of >100 yrs experience focused on bat-origin zoonoses among the key
personnel. We have published much of the seminal work on the bat origins of SARS,
Nipah, Hendra, and MERS viruses, and have opened new boundaries in studies of bat
host-viral relationships ecologically, immunologically and virologically; 5) The South and
Southeast Asian region where these bats occur is a security hotspot, with active political
and ethnic conflicts, and displaced populations in Bangladesh, Pakistan, Myanmar,
Thailand, Indonesia, Philippines and other countries. This is a likely potential site for US
warfighter deployment; 6) We have worked for over 10 years on the SARS-related CoV –
Rhinolophus bat system in China, demonstrating the origin of SARS-CoV within this host,
the presence of SARSr-CoVs with remarkable sequence identity in the spike protein to
SARS-CoV, their isolation and characterization of their ability to bind and replicate
efficiently in primary human lung airway cells. We have demonstrated that chimeric
SARS-CoV backbone with spike protein from SARSr-CoVs from our cave sites in Yunnan
Province can infect a humanized mouse model and cause SARS-like illness, and that
clinical signs are not reduced with SARS monoclonal therapy or vaccination. Finally, we
have demonstrated that people living up to 6 kilometers from our cave site have
very rare spillover events - usually to a single index case- making validated prevention of
spillover challenging. These viruses also show little strain diversity ,which also makes it
more difficult to model which evolutionary lines are high-risk. Conversely, SARSr-CoVs
have identified SARS-like strains in a single cave in Yunnan that harbor every gene found
in the human SARS-CoV strains detected during the 2002-2003 epidemic. Within this bat
population, an ideal evolutionary soup exists that could produce new human strains by
high frequency RNA recombination, and thus, it presents a perfect target for 21st
generation intervention strategies.
CRISPER-Cas gene drives that are likely to be far less effective in bats because most bats
are long-lived relative to their small size, have long inter-generational periods (2-5 yrs)
and low progeny (~1-2 pups). Gene drives would likely take many decades to run
through a population, so that proof-of-concept of transmission blocking in the DARPA
time scale wouldn’t be possible. Furthermore, many bat species’ populations mix readily
or migrate which would disperse the impact of gene drives, whereas targeting a small
dispersal area.
geographic region
not yet identified the high-risk SARSr-CoVs in that cave. We will assess: the population
wide the risk zone is for the warfighter positioned close to bat caves.
We will build environmental niche models using the data above, environmental
and ecological correlates, and traits of cave species communities (eg. phylogenetic and
functional diversity), to predict the species composition of bat caves across Southern
China, South and SE Asia. We will validate these with data from the current project and
data from PREDICT sampling in Thailand, Indonesia, Malaysia and other SE Asian
countries. We will then use our unique database of bat host-viral relationships updated
from our recent Nature paper (1) to assess the likelihood of low- or high-risk SARSr-
CoVs being present in a cave at any site across the region. At the end of Yr 1, we will use
these analyses to produce a prototype app for the warfighter that identifies the
likelihood of bats harboring dangerous viral pathogens based on these analyses. The
‘high-risk bats near me’ app will be updated as new host-viral surveillance data comes
on line from our project and others, to ground-truth and fine-tune its predictive
capacity. Specifically, our telemetry data on bat movement will be used to assess how
often bats from high-risk caves migrate to other colonies and potentially spread their
high-risk strains.
samples with novel SARSr-CoVs. Prof. Ralph Baric, UNC, will reverse engineer spike
proteins in his lab to conduct binding assays to human ACE2 (the SARS-CoV receptor).
Their group have also devised new strategies to culture SARS-like bat coronaviruses,
allowing biological characterization of both high risk strains that can replicate in primary
human cells and low risk strains that can only replicate in the presence of exogenous
enhancers. Viral spike glycoproteins that bind receptor will then be inserted into SARS-
CoV backbones, and inoculated into human cells and humanized mice to assess their
capacity to cause SARS-like disease, and their ability to be blocked by monoclonal
therapies, or vaccines against SARS-CoV ((PMC5798318, PMC5567817, PMC5380844,
PMC5578707, PMC4801244, PMC4797993). The Baric group has also demonstrated that
a nucleoside analogue inhibitor, GS-5734 (Gilead Inc), blocks epidemic, preepidemic and
zoonotic SARS-CoV and SARS-like bat coronavirus replication in primary human airway
cells and in mice (PMC5567817). Consequently, they will evaluate the ability of this drug
to block replication of newly disovered pre-epidemic and zoonotic high risk strains. As
the drug has been used to effectively treat Ebola virus infected patients (PMC4967715,
PMC5583641) as well and has potent activity against Nipha and Hendra viruses
(PMC5338263), an alternative intervention for military personnel is prophylactic
treatment treatment prior to deployment into high risk settings.
characteristics evolve. Because of our unique collaboration among world-class modelers
and coronavirologists, we will be able to test model predictions of viral capacity for
spillover by conducting spike protein-based binding and cell culture experiments. The
BSL-2 nature of work on SARSr-CoVs makes our system highly cost-effective relative to
other bat-virus systems (e.g. Ebola, Marburg, Hendra, Nipah), which require BSL-4 level
facilities for cell culture.
humans.
Our goal is to test? two approaches to defuse the potential for SARS-related CoVs to
immune modulators designed to up-regulate their naïve immunity and assess their
ability to suppress viral replication and shedding; 2) Immune Priming: building on
preliminary development of polyvalent chimeric recombinant molecules targeting
diverse spike proteins from bat SARS-related CoVs, we will conduct inoculation trials
with live bats to assess suppression of replication and shedding of a broad range of
dangerous SARS-related CoVs. Both lines of work will begin in Yr 1 and run parallel
throughout the project.
please!
both arms of TA2.
bat species tested so far. Duke-NUS has established a breeding colony of cave nectar
bats for experimental use (one of very few experimental bat breeding colonies in the
this experimental colony. We will then extend the test to a small group of wild-caught
experience conducting SARS-CoV infection experiments with bat species from the same
(L.Wang, unpublished results). First, we will use our recently proven technology to
Finally, work on a delivery method will be overseen by Dr. Tonie Rocke at the US
Geological Survey, National Wildlife Health Center, who has proven capacity to develop
and take animal vaccines through to licensure (9). Using locally acquired insectiverous
bats like Tadarida brasiliensis or Eptesicus fuscus (10, 11) as proxies, Dr. Rocke will
further develop and assess delivery vehices (mediums) and methods of delivery for the
molecules, inocula proposed above, including: 1) transdermally applied nanoparticles; 2)
sticky edible gels that bats will groom from themselves and each other; 3) aerosolization
via spayers that could be used in cave settings; and 4) automated sprays triggered by
timers and movement detectors at critical cave entry points. Simple gels have already
been used to vaccinate big brown bats against rabies (11) in a laboratory setting, and
hand delivery of these gels containing biomarkers (no vaccine) to vampire bats
(Desmodus rotundus) in Peru and Mexico have shown they are readily consumed and
transferred between bats. Methods to improve uptake (different gels, nanoparticles)
and mechanize delivery methods (aerosolization) will be tested first in a laboratry
setting, and secondly in local field settings using the biomarker, rhodamine B (which
marks hair and whiskers upon consumption) to assess uptake by bats. The most optimal
approaches will then be tested on live bats in our three cave sites in Yunnan Province
with the most successful immunomodulators developed in TA1?. Fieldwork will be
conducted under the auspices of Dr. Rocke, EHA field staff, and Dr. Yunzhi Zhang
(Yunnan CDC, Consultant with EcoHealth Alliance). Sections of bat caves will be
cordoned off and different application methods tested. A small number of bats will be
captured and assayed for viral load after treatment, but so as not to disturb the colony,
most viral load work will be conducted on fresh fecal pellets collected daily on the cave
floor. EHA has unique access to these sites in Yunnan Province, with our field teams
conducting surveillance there for around 10 years, under the guidance of Drs. Shi and
Zhang. In year 1 of project DEFUSE, we will seek permission for these experimental
inoculations in cave sites in Yunnan from the Provincial Forestry Department. We do
not envisage problems getting permission, as we have worked with the Forestry
Department collaboratively for the last few years, we have the support of the Yunnan
CDC, and we are releasing molecules that are not dangerous to people or wildlife.
E. Capabilities:
available.
Team:
Key Personnel:

Sarah Leist, Postdoctoral fellow (4 months/yr)
Boyd Yount, Research Analyst, 12 months/year
Trevor Scobey, Research Technician, 6 months/yr


XXX
XXX


Links to relevant papers, reports, or resumes of key performers.
Do not include more than two resumes as part of the abstract.
**Resumes count against the abstract page limit.
future outbreaks of disease (PMC5798318, PMC5567817, PMC5380844, PMC5578707,
**General Notes:

information.

defense. In addition, the evaluation will take into consideration the extent to which the

the estimates).
strategies.
Citations
mammals. Nature 546, 646-650 (2017).
Reports 6, (2016).
(2012).
Virology 88, 10421-10431 (2014).
).
Re: First (rough) draft of the DARPA abstract - Project DEFUSE

Noam Ross <[email protected]>
Thu 2/8/2018 11:24 AM
To: Baric, Ralph S <[email protected]>
Cc: Wang Linfa <[email protected]>; Peter Daszak <[email protected]>; Zhengli Shi
([email protected]) <[email protected]>; William B. Karesh <[email protected]>; Rocke, Tonie E
<[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser <[email protected]>;
Anna Willoughby <[email protected]>; Kevin Olival, PhD <[email protected]>; Jon Epstein
<[email protected]>; Aleksei Chmura <[email protected]>; Hongying Li
<[email protected]>
My changes and comments attached. They primarily
1) Clarify the the modeling components (genotype-phenotype, evolutionary, ecological)
2) Emphasize validation against actual spillover events in the human population
These changes are on Peter's original draft but shouldn't conflict with Linfa and Ralph's.
Noam
On Thu, Feb 8, 2018 at 11:22 AM Baric, Ralph S <[email protected]> wrote:

To: Peter Daszak <[email protected]>; Baric, Ralph S <[email protected]>;
Zhengli Shi ([email protected]) <[email protected]>; William B. Karesh
<[email protected]>; Rocke, Tonie <[email protected]>
Cc: Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>; Anna Willoughby <[email protected]>; Kevin
Olival, PhD <[email protected]>; Jon Epstein <[email protected]>; Noam
Ross <[email protected]>; Aleksei Chmura <[email protected]>; Anna
Willoughby <[email protected]>; Hongying Li <[email protected]>
I am working on a large grant here in SG and won’t be able to spend too much time until next
week.
LF


Tel: +65 6516 8397

Tonie
Cc: Luke Hamel; Jonathon Musser; Anna Willoughby; Kevin Olival, PhD; Jon Epstein; Noam Ross; Aleksei
Chmura; Anna Willoughby; Hongying Li
Importance: High
Dear All,
I’ve attached a first rough draft of the DARPA abstract. Apologies for the delay. Unfortunately,
edits to my Science paper came through on Friday and took many hours to do, so this delayed
me. I’m right now in Geneva in my hotel at 3 am finishing these off before flying back to NYC
from a WHO meeting.
1) Zhengli, Linfa, Ralph – Billy and I spoke with Tonie Rocke on Friday. Tonie is at the National
Wildlife Health Center, Madison USA, and has worked on wildlife vaccines: plague in prairie dogs,
rabies in Jamaican fruit bats, white nose syndrome in US bats. We needed someone with
expertise in delivery of molecules/vaccines to wildlife because DARPA specifically lay that out.
As you’ll see, Tonie is perfect for our project and will be able to do work at USGS NWHC and with
Zhengli in China to help with TA2
2) Zhengli and Linfa – After I spoke with you both, I had a great conversation with Ralph Baric.
He proposed to work on recombinant chimeric spike proteins as a second line of attack. I think
that is a perfect fit because 1) it’s his expertise and he has published on it, 2) it will act as an
alternative to the blue-sky and risky immune boosting work that Linfa/Peng have proposed. I
hope you agree!
3) Ralph, Zhengli, Linfa, Tonie – as you can see, I have mangled the language/technical details
for most of your sections. Pardon my lack of knowledge, and please draft a couple of
paragraphs each to make your sections look correct. Thanks to Peng for giving me some text
anyway – very useful, but please check what I’ve done with it.
4) All – please add some names and details on the team part so we get clarity in this on what
staff you will need to do the work.
5) Please don’t worry about keeping this to the 8 page limit. Just add text here and there,
references, and edit to make what I’ve written correct, and more exciting. I will work on this on
Saturday, Sunday and Monday to bring it down to 8 pages of very crisp, super-exciting text. I
also want as many of your good ideas in here, so that I can use this draft to build on for the full
proposal.
6) Finally – please edit rapidly using tracked changes in word. If you don’t want to mess up
endnote, please just insert references as comment boxes and we’ll pull them off the web.
Aleksei and Anna: please read the draft and work on some draft image designs that sum up the
project flow. I’ll call you Thursday afternoon to discuss so you can finish them off.
Luke – please have a go at a first draft of the executive summary slide. I’ll pick up from what
you’ve done once you send it to me.
Thanks again to all of you for agreeing to collaborate on this proposal. From what I know of the
competition, what DARPA wants, and what we’re offering, I think we have an extremely strong
team, so I’m looking forward to getting the full proposal together and winning this contract!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
EcoHealth Alliance leads cutting-edge research into the critical connections between human and
wildlife health and delicate ecosystems. With this science we develop solutions that prevent
pandemics and promote conservation.
Important: This email is confidential and may be privileged. If you are not the intended recipient, please delete it and notify us immediately; you should
not copy or use it for any purpose, nor disclose its contents to any other person. Thank you.
--
Dr. Noam Ross
Senior Research Scientist
EcoHealth Alliance
New York, NY 10001
+1.212.380.4471 (direct)
+1.212.380.4465 (fax)
@noamross (twitter)
EcoHealth Alliance leads cutting-edge scientific research into the critical

connections between human and wildlife health and delicate ecosystems.
With this science, we develop solutions that prevent pandemics
and promote conservation.

and charts)
-DARPA BAA number


PROJECT DEFUSE

spillover.


decontamination.
overcome these?
Inventory of caves
Sampling/testing
Immune modulation
Inoculum delivery
Mesocosm expts
Cave expts
Model validation
Nipah, EBOV). In the region directly surrounding our study site, these bat hosts
currently roost in unoccupied military bases that may be used by troops at a future
time. Finally, our approach is directly applicable to public health measures in the region
to reduce the risk of spillover into the general population, as well as for food security by
reducing the risk of viruses like SADS-CoV spilling over from bats into intensive pig
farms, and devastating and industry, leading to potential civil unrest.

42 months. Deleted: 46 months
D. Technical Plan:
the program goal”
● IACUC/IRB

pandemic. This also gives us the unique ability to validate our models on a significant
number of actual spillover events, not only experimental infections; 7) SARSr-CoVs are
transmitted among bats via fecal-oral route, making sampling relatively easy (collection
of fresh fecal pellets) and molecule or vaccine approaches feasible; 8) Proof-of-concept
in this system may be rapidly scalable to other bat-coronavirus systems, e.g. MERS-CoV,
SADS-CoV, and to other cave bat origin viruses.
geographic region
on 8 years of surveillance in these caves and the surrounding region and includes a cave
in which we have identified all the genetic components of SARS-CoV distributed across a
not yet identified the high-risk SARSr-CoVs in those caves. We will assess: the population Deleted: that
wide the risk zone is for the warfighter positioned close to bat caves. Commented [PD4]: Could add “ We will continue
and undermine longitudinal sampling capacity. Samples will be tested by PCR and spike Commented [PD5]: Ralph, Zhengli. If we win this
proteins of all SARS-related CoVs sequenced. Analyses of phylogeny, recombination contract, I do not propose that all of this work will
necessarily be conducted by Ralph, but I do want to
events, and further characterization of high-risk viruses (those with spike proteins close stress the US side of this proposal so that DARPA are
to SARS-CoV) will be carried out (REF). Isolation will be attempted on a subset of comfortable with our team. Once we get the funds, we
can then allocate who does what exact work, and I
samples with novel SARSr-CoVs. Prof. Ralph Baric, UNC, will reverse engineer spike believe that a lot of these assays can be done in Wuhan as
well…
proteins in his lab to conduct binding assays to human ACE2 (the SARS-CoV receptor).
Proteins that bind will then be inserted into SARS-CoV backbones, and inoculated into
humanized mice to assess their capacity to cause SARS-like disease, and their ability to
be blocked by monoclonal therapies, or vaccines against SARS-CoV (REF).
Using both samples from our previous work and new sampling of the human Formatted: Indent: First line: 0.5"
population in the region surrounding our sites, we will determine which viral strains in
addition to SARS-CoV have successfully jumped into humans.
First, based on binding and infection assays in mouse models, we will develop genotype-
to-phenotype models to predict viral ability to infect host cells based on genetic traits.
Secondly, data on diversity of bat spike proteins, prevalence of recombinant CoVs, and
flow of genes within each bat cave via bat movement and migration, will be used to
strains capable of human infection. Finally, ecological data, including viral host species
and species home ranges will be used to estimate the likelihood of spillover into human
populations. Deleted: Data on the diversity of bat spike proteins,
prevalence of recombinant CoVs, ability to bind and infect
Because of our unique collaboration among world-class modelers, and human cells, degree of clinical signs in mouse models, will
coronavirologists, we will be able to test model predictions of viral capacity for spillover be used to estimate evolutionary rates, rates of
recombination, and capacity to generate novel strains
by conducting spike protein-based binding and cell culture experiments. The BSL-2 capable of human infection. Using dynamic metapopulation
models, we will estimate the flow of genes within each bat
nature of work on SARSr-CoVs makes our system highly cost-effective relative to other cave, based on the known host and viral assemblages. This
bat-virus systems (e.g. Ebola, Marburg, Hendra, Nipah), which require BSL-4 level will inform how rapidly new CoV strains with distinct
phenotypic characteristics evolve.
facilities for cell culture. In addition, the high frequency of SARSr-CoV spillover events
Deleted:
into the human population in this region gives us the allows us to validate models to a
Deleted: , the data above,
degree not possible in systems where spillover events are extremely rare.
Deleted: and
We will use stochastic simulation modeling approaches to characterize the
Deleted: to estimate how rapidly high-risk SARSr-CoVs will
dynamics of viral circulation in these bat populations using the data above and other re-colonize a bat population following immune boosting or
biological and ecological data. Using this model, we will estimate the frequency, priming.
efficacy, and population coverage required for our intervention approaches to Deleted: We will
effectively suppress the viral population. We will determine the seasons, locations Deleted: obtain model estimates of the
within a cave, and different delivery methods (spray, swab, cave mouth automated) that Deleted:
will be most effective. Finally we will determine the time frame the treatment will be Deleted: of inoculation required for both approaches
effective until re-colonization or evolution will cause a return of a high-risk SARSr-CoV to Deleted: , what proportion of a population needs to be
reached to have effective viral dampening, and whether
the population. specific
Deleted: or
TA2: Develop scalable approaches that target and suppress the animal virus in its Deleted: within a cave would be more effective to treat.
We will then model the efficacy of
Deleted: delivery, deliver to specific sections of a cave
humans.
Deleted: .
please!
both arms of TA2.
wildlife.
E. Capabilities:
available.
Team:
Key Personnel:

XXX


XXX
XXX


this as a negative.
vaccines.
**General Notes:

information.

defense. In

the estimates).
Citations
mammals. Nature 546, 646-650 (2017).
Reports 6, (2016).
(2012).
Virology 88, 10421-10431 (2014).
).

Jon Epstein <[email protected]>
Thu 2/8/2018 1:46 PM
Cc: Baric, Ralph S <[email protected]>; Wang Linfa <[email protected]>; Peter Daszak
<[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; William B. Karesh
<[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>; Anna Willoughby <[email protected]>; Kevin Olival, PhD
<[email protected]>; Hongying Li <[email protected]>
Attached are my comments.
Cheers,
Jon
On Thu, Feb 8, 2018 at 1:00 PM, Rocke, Tonie <[email protected]> wrote:
Likewise, I added my comments to Ralph's document. I added some
detail, but not too much, so let me know if you want more. Best -Tonie

<[email protected]>; Anna Willoughby <[email protected]>;
Kevin Olival, PhD <[email protected]>; Jon Epstein <[email protected]
>; Noam Ross <[email protected]>; Aleksei Chmura
Hongying Li <[email protected]>
week.
LF

Tel: +65 6516 8397

Tonie
Importance: High
Dear All,
from a WHO meeting.
Wildlife Health Center, Madison USA, and has worked on wildlife vaccines: plague in prairie
dogs, rabies in Jamaican fruit bats, white nose syndrome in US bats. We needed someone
with expertise in delivery of molecules/vaccines to wildlife because DARPA specifically lay that
out. As you’ll see, Tonie is perfect for our project and will be able to do work at USGS NWHC
and with Zhengli in China to help with TA2
2) Zhengli and Linfa – After I spoke with you both, I had a great conversation with Ralph
Baric. He proposed to work on recombinant chimeric spike proteins as a second line of
attack. I think that is a perfect fit because 1) it’s his expertise and he has published on it, 2) it
will act as an alternative to the blue-sky and risky immune boosting work that Linfa/Peng have
proposed. I hope you agree!
3) Ralph, Zhengli, Linfa, Tonie – as you can see, I have mangled the language/technical
details for most of your sections. Pardon my lack of knowledge, and please draft a couple of
proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
EcoHealth Alliance leads cutting-edge research into the critical connections between human
and wildlife health and delicate ecosystems. With this science we develop solutions that
prevent pandemics and promote conservation.
Important: This email is confidential and may be privileged. If you are not the intended recipient, please delete it and notify us immediately; you
should not copy or use it for any purpose, nor disclose its contents to any other person. Thank you.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Jonathan H. Epstein DVM, MPH, PhD
Vice President for Science and Outreach
EcoHealth Alliance
New York, NY 10001
1 7 (direct)
(b) (6) (mobile)
web: ecohealthalliance.org
Twitter: @epsteinjon


and charts)
-DARPA BAA number


PROJECT DEFUSE

spillover.


diseases due to unique damping of certain pathways in their immune systems, likely in Deleted: their
strategies like small molecule Rig like receptor (RLR) or Toll like receptor (TLR) agonists
strategy). At the same time, we will inoculate bats with novel chimeric polyvalent Commented [L2]: This will become important late:
recombinant spike proteins to enhance their immune response against replication of this strategy will be applicable to ALL bat-borne viruses
specific, high-risk viruses (targeted immune priming strategy). We will use our in future
innovative modeling to design apps that identify the likelihood of any region harboring Commented [BRS3]: I thought we were also going to
use innate immune antagonists to boost baseline
high-risk bat viruses. We will design novel, automated approaches to deliver both types immunity, which should attenuate virus burden in
animals?
Isn’t this supposed to be a two pronged approach that are
complementary, e.g., in that innate immune agonists will
4. What are the key technical challenges in your approach and how do you plan to also boost immunity to recombinant spike vaccines.
overcome these?
Inventory of caves
Sampling/testing
Mesocosm expts
adapted to hosts of other bat-origin CoVs (MERS, SARS and related prepandemic Deleted: D
security by reducing the risk of viruses like Severe Acute Diarrheal Syndrome CoV spilling Deleted: -
over from bats into intensive pig farms, and devastating and industry, leading to
potential civil unrest.

PREEMPT
D. Technical Plan:
the program goal”
● IACUC/IRB
○ EHA has more than 50 years experience with IACUC (Jon, Billy, Linfa, & Formatted
Ralph combined, including free-ranging and captive bat species)
proposals and currently we have 3 DoD funded projects approved or
undergoing ACURO review.

like-CoVs are insectivorous, common, have a broad geographic range throughout
Asia;roost in dense colonies at fixed, known locations, yet disperse each night over wide Deleted: and
distances from these sites. Defusing the risk of viral shedding in the roost will also Deleted: a
defuse the risk of viral shedding over the population range. This would be difficult for
rodent or primate reservoirs; 3) Bats are mammalian hosts, therefore immune
modulating drugs evaluated in people and rodents may also work on bats. This would be Deleted: trialed out
less likely for an insect vector; 4) Members of our collaborative group have worked Deleted: s
Commented [BRS7]: About 90,000 of the 550,000
other countries. This is a likely potential site for US warfighter deployment; 6) We have deployed US military are in se asian, mostly japan and
worked for 15 years on the SARS-related CoV – Rhinolophus bat system in China, south korea.
Deleted: over
Deleted: 0
Commented [BRS8]: What abbreviation mean
characterization of their ability to bind and replicate efficiently in primary human lung Deleted: bind
airway cells. We have demonstrated that chimeric SARS-CoV backbone with spike Deleted: with
protein from SARSr-CoVs from our cave sites in Yunnan Province can infect a humanized
mouse model and cause SARS-like illness, and that clinical signs are not reduced with
SARS monoclonal therapy or vaccination. Finally, we have demonstrated that people
living up to 6 kilometers from our cave site have evidence of SARSr-CoV antibodies (3%
seroprevalence in 200+ cohort), suggesting active spillover, and marking these viruses as
a clear-and-present danger of a new SARS-like pandemic; 7) SARSr-CoVs are transmitted
among bats via fecal-oral route, making sampling relatively easy (collection of fresh fecal
pellets) and molecule or vaccine approaches feasible; 8) Proof-of-concept in this system
may be rapidly scalable to other bat-coronavirus systems, e.g. MERS-CoV, SADS-CoV,
and to other cave bat origin viruses. Commented [BRS9]: These viruses can either be
cultured and/or recovered using reverse genetic
Other important bat-origin zoonotic viruses (e.g. filoviruses, henipaviruses) have strategies.
prevention of spillover challenging. These viruses also show little strain diversity which Commented [J10]: However, we may want to
highlight that our approach of immune modulation may
makes modeling which evolutionary lines will be more high-risk, a challenge. SARSr-CoVs also reduce the viral load of filoviruses and henipaviruses
are diverse, with recombinants regularly identified in the field and lab. Furthermore, we in cave bat populations. Our work has found Ebola
Reston in cave bats in the Philippines (Mineopterus spp.)
have identified SARS-like strains in a single cave in Yunnan that harbor every gene found and henipaviruses and filoviruses have been identified in
insectivorous bats in China.
in the human SARS-CoV strains detected during the 2002-2003 epidemic. Within this bat
Commented [BRS11]: Filoviruses pretty diverse,
population, an ideal evolutionary soup exists which can produce new human strains by although not anywhere near as diverse as cov. Is this a
high frequency RNA recombination and presents a perfect target for 21st generation sampling thing or not likely remains unclear?
intervention strategies. Deleted: s
Finally, we believe that alternative approaches to transmission blocking, e.g. Deleted: from the
CRISPER-Cas gene drives that are likely to be far less effective in bats because most bats Deleted: in a diversity of SARSr-CoVs w
are long-lived relative to their small size, long inter-generational periods (2-5 yrs) and Deleted: e
low progeny (~1-2 pups per year). Gene drives would likely take many decades to run Deleted: making it
through a population, so that proof-of-concept of transmission blocking in the DARPA Deleted: to
time scale wouldn’t be possible. Furthermore, many bat species’ populations mix readily Formatted: Superscript
or migrate which would disperse the impact of gene drives, whereas targeting a small Deleted: with
Commented [BRS12]: Is this correct?
Commented [J13]: Yes, correct
dispersal area.
Deleted: 2-5 years
Commented [L14]: We need to provide background
TA1: Develop and validate integrated, multiscale models that quantify the likelihood a info about bat immunity and the track record of this
human-capable virus will emerge from an animal reservoir residing in a “hot spot” group in the field
geographic region Commented [L15]: Peng: I am working on an

important grant here in Singapore. Can you add a few
The DEFUSE modeling and analytics team will develop models to evaluate the likelihood points here? Thanks
not yet identified the high-risk SARSr-CoVs in these caves. We will assess: the population Commented [BRS16]: Is surveillance in these other
caves equally robust over the past 8 yrs?
Deleted: at
and by season; viral prevalence and intensity in individuals; distribution and seasonal
shedding of low- and high-risk SARSr-CoV strains, and how readily these are transmitted
among bat species, age classes, genders; and using mark-recapture to assess
metapopulation structure. To assess geographic distribution of bat hosts, we have
access to biological inventory data on all bat caves in Southern China, as well as
information on species distributions across SE Asia from the literature and museum
records. We will use radio- GPStelemetry to identify the home range of each species of Deleted: and satellite
bat in the caves, to identify additional roost sites; to assess how widely the viral ‘plume’
We will build ecological niche models using the data above, and environmental caves to assess the rates of viral spillover, and ground-
and ecological correlates, and traits of cave species communities (eg. phylogenetic and truth which specific CoVs are able to infect people
functional diversity), to predict the species composition of bat caves across Southern Deleted: environmental
China, South and SE Asia. We will validate these with data from the current project and
data from PREDICT sampling in Thailand, Indonesia, Malaysia and other SE Asian
countries. We will then use our unique database of bat host-viral relationships updated
from our recent Nature paper (1) to assess the likelihood of low- or high-risk SARS-CoVs Deleted: r
being present in a cave at any site across the region. At the end of Yr 1, we will use these
analyses to produce a prototype app for the warfighter that identifies the likelihood of
bats harboring dangerous viral pathogens based on these analyses. The ‘high-risk bats
near me’ app will be updated as new host-viral surveillance data comes on line from our
project and others, to ground-truth and fine-tune its predictive capacity. Specifically,
our telemetry data on bat movement will be used to assess how often and how far bats
from high-risk caves migrate to other colonies and potentially spread their high-risk
strains.
Deleted: assess the feasibility
for the last decade. In addition, tarps will be laid down in caves to collect fresh fecal and
Deleted: of surveys using pooled
urine samples. Assays will be designed to correlate viral load in an individual with viral
shedding in a fecal sample. Once this is complete, surveys will continue largely on fecal
samples so as not to disturb bat colonies and undermine longitudinal sampling capacity.
Samples will be tested by PCR and spike proteins of all SARS-related CoVs sequenced.
Analyses of phylogeny, recombination events, and further characterization of high-risk
viruses (those with spike proteins close to SARS-CoV) will be carried out (REF). Isolation
will be attempted on a subset of samples with novel SARSr-CoVs. Prof. Ralph Baric, UNC, Commented [PD18]: Ralph, Zhengli. If we win this
will reverse engineer spike proteins in his lab to conduct binding assays to human ACE2 necessarily be conducted by Ralph, but I do want to
(the SARS-CoV receptor). Their group have also devised new strategies to culture SARS- stress the US side of this proposal so that DARPA are
like bat coronaviruses, allowing biological characterization of both high risk strains that can then allocate who does what exact work, and I
can replicate in primary human cells and low risk strains that can only replicate in the believe that a lot of these assays can be done in Wuhan as
well…
presence of exogenous enhancers. Viral spike glycoproteins that bind receptor will then Commented [J19]: Can we culture any bat
be inserted into SARS-CoV backbones, and inoculated into human cells and humanized coronaviruses? It might be good to broaden this so we
can include novel beta CoVs that we may discover which
mice to assess their capacity to cause SARS-like disease, and their ability to be blocked look like they may be transmissible to people
by monoclonal therapies, or vaccines against SARS-CoV ((PMC5798318, PMC5567817, Deleted: P
PMC5380844, PMC5578707, PMC4801244, PMC4797993). The Baric group has also Deleted: REF)
demonstrated that a nucleoside analogue inhibitor, GS-5734 (Gilead Inc), blocks
epidemic, preepidemic and zoonotic SARS-CoV and SARS-like bat coronavirus replication
in primary human airway cells and in mice (PMC5567817). Consequently, they will
evaluate the ability of this drug to block replication of newly discovered pre-epidemic
and zoonotic high risk strains. As the drug has been used to effectively treat Ebola virus
infected patients (PMC4967715, PMC5583641) as well and has potent activity against
Nipah and Hendra viruses (PMC5338263), an alternative intervention for military Deleted: h
personnel is prophylactic treatment treatment prior to deployment into high risk
settings.
modelers, and virologists with coronavirus expertise, we will be able to test model Deleted: corona
predictions of viral capacity for spillover by conducting spike protein-based binding and
cell culture experiments. The BSL-3 nature of work on SARSr-CoVs makes our system Deleted: 2
highly cost-effective relative to other bat-virus systems (e.g. Ebola, Marburg, Hendra,
Nipah), which require BSL-4 level facilities for cell culture. Commented [BRS20]: IN the US, these recombinant
SARS CoV are studied under BSL3, not BSL2, especially
We will use modeling approaches informed by field and experimental data important for those that are able to bind and replicate in
including the data above and other biological and ecological data, to estimate how primary human cells.
In china, might be growin these virus under bsl2. US
rapidly high-risk SARSr-CoVs will re-colonize a bat population following immune reseachers will likely freak out.
boosting or priming. We will obtain model estimates of the frequency of inoculation Deleted: ,
required for both approaches, what proportion of a population needs to be reached to Deleted: ,
have effective viral dampening, and whether specific seasons, or locations within a cave
would be most effective to treat. We will then model the efficacy of different delivery Deleted: re
methods (spray, swab, cave mouth automated delivery, deliver to specific sections of a
cave).
humans.
immune modulators to up-regulate their naïve immunity to suppress viral replication Commented [BRS21]: Like what
response”, but not “over response” against viruses (3). A similar finding was also Commented [J22]: Linfa: Do we know if these findings
from Pteropus also apply to Rhinolophus? If not, we
observed in bat IFNA studies, which is less abundant but was constitutively expressed should be careful with the assertions we make…
without stimulation (4). Given native levels of SARSr-CoVs in individual bats with We can make the argument that these two families of
bats are more closely related than to other
One of the potential problems with this approach is that it can lead to severe Commented [BRS23]: Transient low level Chronic
inflammation sounds better
double-stranded RNA (Poly I:C) and assay for reduced viral loads (DETAILS, CITATION). Commented [BRS24]: This could easily take longer
than 3 years. Poly ic, IFN or any type of TLR agonist might
We will generate universal bat interferon and apply to bats in the lab. Interferon has be more robust. Might want to test in captive bats
been used extensively clinically if no viral-specific drugs are available, e.g. against infected with SARS or select SARS like viruses, like
SHC014, which we could provide.
Commented [J25]: If we’re proposing experimental
treatments, as has been shown in our previous work (12). We will attempt to boost bat work with bats, we should spcify that we’ll use SARS-CoV
& SADS-CoV host species (Rhinolophus) which can be
IFN by blocking bat-specific IFN negative regulator. Bat IFNA is naturally constitutively readily obtained by our Chinese colleagues at WIV
expressed but cannot be induced to a high level (4). This is unique to bats. We think Commented [BRS26]: We have several papers
there should be a negative regulatory factor in the bat interferon production pathway. showing importance of TLR3 and TLR4 signaling in
control of SARS pathogenesis. PMC4447251,
We propose using CRISPRi to find out that negative regulator and then screen for PMC5473747
dampened bat-specific IFN production pathways which include DNA-STING-dependent Commented [BRS27]: Don’t attack the other arm of
the program. And I disagree that its superior to
and ssRNA-TLR7 dependent pathways. These changes have been proved to be bat- vaccination, which potentially provides long-term
immunity.
specific, suggesting that they are important in viruses/bats coexistence, and supported
Commented [J28]: Agree with Ralph – and this
by our own work showing that a mutant bat STING restores antiviral functionality (3). By mechanism of delivery would probably be the same for
identifying small molecules to directly activate downstream of STING, we have chance vaccination attempts(intranasal or oral via grooming
droplets from fur).
Commented [BRS29]: The structure of the SARS-CoV
functional bat IFN production pathways. We will investigate if there are other IFN spike glycoprotein has been solved and the addition of
two proline residues at positions V1060P and L1061P
production pathways in bats. We then boost bat immune responses by ligands stabilize the prefusion state of the trimer, including key
specifically to these pathways, e.g. polyIC to TLR3-IFN pathway or 5’ppp-dsRNA to RIG-I- neutralizing epitopes in the receptor binding domain
(PMC5584442). In parallel, the spike trimers or the
IFN pathway. A similar strategy has been tested successful in mouse model for SARS- receptor binding domain can be incorporated into
CoV, IAV or HBV (6, 7). We believe treating wild bats with IFN-modulating small alphavirus vectored or nanoparticle vaccines for delivery,
either as aerosols, in baits, or as large droplet delivery
molecules by spraying is superior to other invasive strategies that might be considered vehicles (PMC4058772, PMC5423355, PMC2883479,
PMC5578707, PMC3014161). Initially, we will test
by DARPA, including genome editing (CRISPR or RNAi), vaccination or DIP bats, in terms various delivery vehicles in controlled conditions in bats
of its deployability and scalability. Finally, we will inoculate bats with fragments of non- in a laboratory setting, taking the best candidate forward
for testing in the field.
bat Coronavirus (DETAILS). The Baric laboratory has built recombinant S pike
Prof. Ralph Baric (UNC) will lead the immune priming work, building on his track glycoproteins harboring structurally defined domains
from SARS epidemic strains, pre-epidemic strains like
record in reverse-engineering and manipulating SARS-CoV, MERS-CoV and other virus SCH014 and zoonotic strains like HKU3. It is anticipated
that recombinant S glycoprotein based vaccines
spike proteins over the last two decades . He will develop recombinant chimeric spike- harboring immunogenic blocks across the group 2B
proteins (8) based on SARSr-CoVs we have already identified, and those we will discover coronaviruses will induce broad based immune
responses that simultaneously reduce genetically
and characterize during project DEFUSE. RALPH – clearly I didn’t really understand the heterogeneous virus burdens in bats, thereby reducing
details of your approach. Can you add a couple of paragraphs here and some citations disease risk (and transmission risk to people) in these
animals for multiple years (PMC3977350,
please! PMC2588415).
both arms of TA2.
bat species tested so far. Duke-NUS has established a breeding colony of cave nectar Commented [J30]: Eonycterus and Pteropus are
evolutionarily related to Rhinolophus – we may want to
bats for experimental use (one of very few experimental bat breeding colonies in the have some language asserting our confidence that what
world and the only one in SE Asia!). So our initial proof of concept test can be done in we know about bat immunity so far will apply to SARS
CoV reservoir species.
this experimental colony. We will then extend the test to a small group of wild-caught
Deleted: We will conduct initial experiments on a lab
Rhinolophus sinicus bats at Wuhan Institute of Zoology. We (Prof. Wang) have previous colony of …
Finally, work on a delivery method for immunological countermeasures will be
overseen by Dr. Tonie Rocke at the National Wildlife Health Center who has proven
capacity to develop and take animal vaccines through to licensure (9). Using her captive Commented [J31]: We should be clear as to whether
we’re deploying a vaccine or an immune-modulator that
Jamaican fruitbat colony (10, 11), Dr. Rocke will trial out the following strategies for promotes innate immunity. When we mention Tonie’s
delivery of the molecules, inocula proposed above: 1) aerosolization; 2) transdermally experience with vaccine deployment it looks like that
what we’re planning.
applied nanoparticles; 3) sticky edible spray that bats will groom from each other; 4)
automated spray triggered by timers and movement detectors at critical cave entry
points.. (Details and ideas please Tonie!). These approaches will then be tested on wild Deleted: trialed out
bats in our three cave sites in Yunnan Province. Fieldwork will be conducted under the Deleted: live
auspices of Dr. Rocke, EHA field staff, and Dr. Yunzhi Zhang (Yunnan CDC, Consultant
with EcoHealth Alliance). Sections of bat caves will be cordoned off and different
application methods trialed out. A small number of bats will be captured and assayed Commented [J32]: This probably won’t work as bats
may move throughout the cave – mixing application
for viral load and immune function after treatment, but so as not to disturb the colony, techniques. It would be more practical to use a different
most viral load work will be conducted on fresh fecal pellets collected daily on the cave technique on each cave.
floor. EHA has unique access to these sites in Yunnan Province, with our field teams
conducting surveillance there for around 10 years, under the guidance of Drs. Shi and
Zhang. In year 1 of project DEFUSE, we will seek permission for these experimental
inoculations in cave sites in Yunnan from the Provincial Forestry Department. We do
not envisage problems getting permission, as we have worked with the Forestry
Department collaboratively for the last few years, we have the support of the Yunnan
CDC, and we are releasing molecules that are not dangerous to people or wildlife.
E. Capabilities:
available.
experience working with bats and emerging zoonoses, including SARSr-CoVs and MERS-
CoV, will coordinate work on bat immune priming and boosting trials. Dr. Kevin Olival
and Dr. Noam Ross will manage and conduct the modeling and analytical approaches for
this project. The EHA team has extensive experience working with the other team
members on previous and current research including Dr. Wang (15+ years); Dr. Shi (15+
years); Dr. Baric (5+ years) and Dr. Rocke (15+ years) Commented [J33]: [via CCM-NWHC partnership]
Team:
Key Personnel:

Sarah Leist, Postdoctoral fellow (4 months/yr) Deleted: XXX
Boyd Yount, Research Analyst, 12 months/year Deleted: TBD
Trevor Scobey, Research Technician, 6 months/yr Deleted: ssistant


XXX
XXX

this as a negative.
future outbreaks of disease (PMC5798318, PMC5567817, PMC5380844, PMC5578707, Formatted: Font: (Default) Arial, 11 pt, Font color:
Accent 1
**General Notes:
information.

defense. In addition, the evaluation will take into consideration the extent to which the Deleted: ¶

the estimates).
Citations
mammals. Nature 546, 646-650 (2017).
Reports 6, (2016).
(2012).
Virology 88, 10421-10431 (2014).
).
Commented [J36]: Is this reference correct? I
couldn’t find it online.
To: Richgels, Katherine; Jonathan M Sleeman
Subject: Fwd: First (rough) draft of the DARPA abstract - Project DEFUSE
Attachments: DARPA (PREEMPT) Abstract EcoHealth Alliance DEFUSE 1st Draft.docx
Hi Katie: As I mentioned to you by phone, I have been asked to collaborate on a proposal to DARPA with
EcoHealth Alliance. I am forwarding you and Jonathan the first draft I received to keep you in the loop so you
know what is going on. There is alot here I need to correct (i.e. we don't have a captive Jamaican fruit bat
colony but we are thinking of setting up a vampire bat colony at UW) and I will be working on editing the draft
proposal.
Also, I have been asked to collaborate on a second proposal by another group (BU emerging infectious
disease unit) for the same RFA that involves morbillivirus and rabies in vampire bat s in Latin America, although
I haven't seen a draft of that proposal yet.
At this point, I plan to participate in both proposals as there is no restriction in that regard, but let me know
soon if you have any questions/concerns. Due date for abstracts is approaching very rapidly - Feb 13. No
guarantee of funding of course, but just the fact that we are being asked to collaborate on these proposals
should be taken as evidence of the relevance of the NWHC research branch, which seems to be in question
lately. -Tonie

From: Peter Daszak <[email protected]>
Date: Wed, Feb 7, 2018 at 8:51 PM
To: "Ralph Baric ([email protected])" <[email protected]>, Wang Linfa <[email protected]>, "Zhengli
Shi ([email protected])" <[email protected]>, "William B. Karesh" <[email protected]>, "Rocke, Tonie"
<[email protected]>
Cc: Luke Hamel <[email protected]>, Jonathon Musser <[email protected]>, Anna Willoughby
<[email protected]>, "Kevin Olival, PhD" <[email protected]>, Jon Epstein
<[email protected]>, Noam Ross <[email protected]>, Aleksei Chmura
<[email protected]>, Hongying Li <[email protected]>
Dear All,
paper came through on Friday and took many hours to do, so this delayed me. I’m right now in Geneva in my hotel at 3
am finishing these off before flying back to NYC from a WHO meeting.
1
1) Zhengli, Linfa, Ralph – Billy and I spoke with Tonie Rocke on Friday. Tonie is at the National Wildlife Health Center,
Madison USA, and has worked on wildlife vaccines: plague in prairie dogs, rabies in Jamaican fruit bats, white nose
syndrome in US bats. We needed someone with expertise in delivery of molecules/vaccines to wildlife because DARPA
specifically lay that out. As you’ll see, Tonie is perfect for our project and will be able to do work at USGS NWHC and
with Zhengli in China to help with TA2
2) Zhengli and Linfa – After I spoke with you both, I had a great conversation with Ralph Baric. He proposed to work on
recombinant chimeric spike proteins as a second line of attack. I think that is a perfect fit because 1) it’s his expertise
and he has published on it, 2) it will act as an alternative to the blue- sky and risky immune boosting work that Linfa/Peng
have proposed. I hope you agree!
3) Ralph, Zhengli, Linfa, Tonie – as you can see, I have mangled the language/technical details for most of your
sections. Pardon my lack of knowledge, and please draft a couple of paragraphs each to make your sections look
correct. Thanks to Peng for giving me some text anyway – very useful, but please check what I’ve done with it.
4) All – please add some names and details on the team part so we get clarity in this on what staff you will need to do
the work.
5) Please don’t worry about keeping this to the 8 page limit. Just add text here and there, references, and edit to
make what I’ve written correct, and more exciting. I will work on this on Saturday, Sunday and Monday to bring it down
to 8 pages of very crisp, super-exciting text. I also want as many of your good ideas in here, so that I can use this draft to
build on for the full proposal.
6) Finally – please edit rapidly using tracked changes in word. If you don’t want to mess up endnote, please just insert
references as comment boxes and we’ll pull them off the web.
Aleksei and Anna: please read the draft and work on some draft image designs that sum up the project flow. I’ll call you
Thursday afternoon to discuss so you can finish them off.
Luke – please have a go at a first draft of the executive summary slide. I’ll pick up from what you’ve done once you send
it to me.
2
DARPA wants, and what we’re offering, I think we have an extremely strong team, so I’m looking forward to getting the
full proposal together and winning this contract!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
EcoHealth Alliance leads cutting-edge research into the critical connections between human and wildlife health and
delicate ecosystems. With this science we develop solutions that prevent pandemics and promote conservation.
--
Tonie E. Rocke
3
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
4

and charts)
-DARPA BAA number


PROJECT DEFUSE

spillover.


decontamination.
overcome these?
Inventory of caves
Sampling/testing
Immune modulation
Inoculum delivery
Mesocosm expts
Cave expts

46 months Commented [PD1]: Check on the duration of PREEMPT
D. Technical Plan:
the program goal”
● IACUC/IRB
Overview Commented [PD2]: I know this is too long. I’ll edit later
this weekend, but want to keep this text for the full
geographic region
believe that a lot of these assays can be done in Wuhan as
be blocked by monoclonal therapies, or vaccines against SARS-CoV (REF). well…
humans.
please!
both arms of TA2.
wildlife.
E. Capabilities:
available.
Team:
Key Personnel:

XXX


XXX
XXX

Links to relevant papers, reports, or resumes of key performers. Commented [PD5]: I’m planning to use my resume and
Ralph’s. Linfa/Zhengli, I realize your resumes are also
Do not include more than two resumes as part of the abstract. very impressive, but I am trying to downplay the non-US
**Resumes count against the abstract page limit. focus of this proposal so that DARPA doesn’t see this as a
negative.
vaccines.
**General Notes:

information.

defense. In

the estimates).
Citations
mammals. Nature 546, 646-650 (2017).
Reports 6, (2016).
(2012).
Virology 88, 10421-10431 (2014).
).

Sleeman, Jonathan M <[email protected]>
Fri 2/9/2018 5:42 AM
Hi Tonie,
If Katie concurs I am supportive. Peter always has crazy ideas. I would
also like to talk to you about the vampire bat colony when we are both in
the office.
By the way, no one at the NWHC questions the value of the Research
Branch. In fact, it is quite the contrary,
Best wishes,
Jonathan
On Thu, Feb 8, 2018 at 8:27 AM, Rocke, Tonie <[email protected]> wrote:
Hi Katie: As I mentioned to you by phone, I have been asked to
collaborate on a proposal to DARPA with EcoHealth Alliance. I am
forwarding you and Jonathan the first draft I received to keep you in the
loop so you know what is going on. There is alot here I need to correct
(i.e. we don't have a captive Jamaican fruit bat colony but we are
thinking of setting up a vampire bat colony at UW) and I will be working
on editing the draft proposal.
Also, I have been asked to collaborate on a second proposal by another
group (BU emerging infectious disease unit) for the same RFA that
involves morbillivirus and rabies in vampire bats in Latin America,
although I haven't seen a draft of that proposal yet.
At this point, I plan to participate in both proposals as there is no
restriction in that regard, but let me know soon if you have any
questions/concerns. Due date for abstracts is approaching very rapidly
- Feb 13. No guarantee of funding of course, but just the fact that we
are being asked to collaborate on these proposals should be taken as
evidence of the relevance of the NWHC research branch, which seems
to be in question lately. -Tonie

To: "Ralph Baric ([email protected])" <[email protected]>, Wang Linfa
<[email protected]>, "Zhengli Shi ([email protected])" <[email protected]>, "William B.
Karesh" <[email protected]>, "Rocke, Tonie" <[email protected]>
Cc: Luke Hamel <[email protected]>, Jonathon Musser
<[email protected]>, Anna Willoughby <[email protected]>, "Kevin
Olival, PhD" <[email protected]>, Jon Epstein <[email protected]>,
Noam Ross <[email protected]>, Aleksei Chmura <[email protected]>,
Dear All,
from a WHO meeting.
Wildlife Health Center, Madison USA, and has worked on wildlife vaccines: plague in prairie dogs,
rabies in Jamaican fruit bats, white nose syndrome in US bats. We needed someone with
expertise in delivery of molecules/vaccines to wildlife because DARPA specifically lay that out.
As you’ll see, Tonie is perfect for our project and will be able to do work at USGS NWHC and with
Zhengli in China to help with TA2
2) Zhengli and Linfa – After I spoke with you both, I had a great conversation with Ralph Baric.
He proposed to work on recombinant chimeric spike proteins as a second line of attack. I think
that is a perfect fit because 1) it’s his expertise and he has published on it, 2) it will act as an
alternative to the blue-sky and risky immune boosting work that Linfa/Peng have proposed. I
hope you agree!
3) Ralph, Zhengli, Linfa, Tonie – as you can see, I have mangled the language/technical details
for most of your sections. Pardon my lack of knowledge, and please draft a couple of
proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance

New York, NY 10001
Tel. +1 212-380-4473
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Jonathan Sleeman, MA, VetMB, Dipl. ACZM, Dipl. ECZM, MRCVS
Center Director
USGS, National Wildlife Health Center
6006 Schroeder Road
Madison, WI 53711
Tel: (608) 270 2401
Fax: (608) 270 2415
The USGS National Wildlife Health Center's mission is to safeguard wildlife and ecosystem
health through dynamic partnerships and exceptional science
OIE Collaborating Centre for Research, Diagnosis and Surveillance of Wildlife Pathogens

Fri 2/9/2018 8:55 PM
To: Jon Epstein <[email protected]>
Cc: Rocke, Tonie E <[email protected]>; Baric, Ralph S <[email protected]>; Wang Linfa <linfa.wang@duke-
nus.edu.sg>; Peter Daszak <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; William
B. Karesh <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>; Anna Willoughby <[email protected]>; Kevin Olival, PhD
<[email protected]>; 周鹏 <[email protected]>
Dear All,
Attached please find comments from Zhengli and Peng. Peng is also helping address the
comments from Linfa regarding bat immunity.
Best,
Hongying
Hongying Li, MPH 李泓萤

China Program Coordinator
EcoHealth Alliance
New York, NY 10001
1.917.573.2178 (U.S. mobile)

86.130.4112.0837 (China mobile)
Hongying Li (Skype)
756614210 (WeChat)

On Thu, Feb 8, 2018 at 2:46 PM, Jon Epstein <[email protected]> wrote:

Attached are my comments.
Cheers,
Jon
On Thu, Feb 8, 2018 at 1:00 PM, Rocke, Tonie <[email protected]> wrote:
Likewise, I added my comments to Ralph's document. I added some
detail, but not too much, so let me know if you want more. Best -Tonie

Kevin Olival, PhD <[email protected]>; Jon Epstein
<[email protected]>; Noam Ross <[email protected]>; Aleksei
Chmura <[email protected]>; Anna Willoughby
<[email protected]>; Hongying Li <[email protected]>
week.
LF

Tel: +65 6516 8397

To: Ralph Baric ([email protected]); Wang Linfa; Zhengli Shi ([email protected]); William B. Karesh;
Rocke, Tonie
Importance: High
Dear All,
I’ve attached a first rough draft of the DARPA abstract. Apologies for the delay.
Unfortunately, edits to my Science paper came through on Friday and took many hours to
do, so this delayed me. I’m right now in Geneva in my hotel at 3 am finishing these off
before flying back to NYC from a WHO meeting.
1) Zhengli, Linfa, Ralph – Billy and I spoke with Tonie Rocke on Friday. Tonie is at the
National Wildlife Health Center, Madison USA, and has worked on wildlife vaccines: plague in
prairie dogs, rabies in Jamaican fruit bats, white nose syndrome in US bats. We needed
someone with expertise in delivery of molecules/vaccines to wildlife because DARPA
specifically lay that out. As you’ll see, Tonie is perfect for our project and will be able to do
work at USGS NWHC and with Zhengli in China to help with TA2
attack. I think that is a perfect fit because 1) it’s his expertise and he has published on it, 2)
it will act as an alternative to the blue-sky and risky immune boosting work that Linfa/Peng
have proposed. I hope you agree!
paragraphs each to make your sections look correct. Thanks to Peng for giving me some
text anyway – very useful, but please check what I’ve done with it.
4) All – please add some names and details on the team part so we get clarity in this on
what staff you will need to do the work.
references, and edit to make what I’ve written correct, and more exciting. I will work on this
on Saturday, Sunday and Monday to bring it down to 8 pages of very crisp, super-exciting
text. I also want as many of your good ideas in here, so that I can use this draft to build on
for the full proposal.
Aleksei and Anna: please read the draft and work on some draft image designs that sum up
the project flow. I’ll call you Thursday afternoon to discuss so you can finish them off.
Thanks again to all of you for agreeing to collaborate on this proposal. From what I know of
the competition, what DARPA wants, and what we’re offering, I think we have an extremely
strong team, so I’m looking forward to getting the full proposal together and winning this
contract!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
Important: This email is confidential and may be privileged. If you are not the intended recipient, please delete it and notify us immediately; you
should not copy or use it for any purpose, nor disclose its contents to any other person. Thank you.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Jonathan H. Epstein DVM, MPH, PhD
Vice President for Science and Outreach
EcoHealth Alliance
New York, NY 10001
(direct)
(b) (6) (mobile)
web: ecohealthalliance.org
Twitter: @epsteinjon


and charts)
-DARPA BAA number


PROJECT DEFUSE

protein immune priming inocula to lower viral shedding from bats at the site for a few Commented [p1]: so far all evidences point out that
bat WON”T generate high Ab titer, whether under
weeks or months, allowing our warfighters to execute the operation at lowered risk for naturally or experimental infection. This is very unique
spillover. compared to other mammals. We hypothesis this is
because of a dampened bat antibody response. Thus I
suggest a pre-exposure using immune boosting to bats,
2. How is it done today? And what are the limitations? and a post-exposure using spike to HUMAN!


any mammal group, and that they are able to coexist and spillover viruses due to unique Deleted: live with high viral loads
features of their immune systems, likely as an evolutionary adaptation to flight. We will Deleted: damping
against replication of specific, high-risk viruses (immune priming strategy). We will use Commented [p2]: same comment as above
decontamination.
Commented [p3]: sampling and testing might be

4. What are the key technical challenges in your approach and how do you plan to challenging as we haven’t done a thorough analysis in a
overcome these? certain region. We probably need to sequencing full
genome, which is costly as well. I guess we mention the
Decide which of following parts to talk about: issue that need more money but not revolutionary
technique…
Modeling bat suitability Formatted: Highlight
Inventory of caves
Sampling/testing
Reverse engineering, binding assays, mouse expts Formatted: Highlight
Modeling viral risk of evolution and spillover Formatted: Highlight
Immune modulation
Immune Booster recombinant production Formatted: Highlight
Mesocosm expts Formatted: Highlight

PREEMPT
D. Technical Plan:
the program goal”
● IACUC/IRB

Other important bat-origin zoonotic viruses (e.g. filoviruses, henipaviruses) have Commented [p6]: this contradict to previous
comments that our model can apply to EBOV bats
are diverse, with recombinants regularly identified in the field and lab. Furthermore, we Commented [p7]: caution that too frequent
recombination can also make modeling difficult
transmission blocking in the DARPA time scale wouldn’t be possible (same to rodents
and primates). Furthermore, many bat species’ populations mix readily or migrate which
would disperse the impact of gene drives, whereas targeting a small number of caves in
a region for molecule or vaccine delivery would cover a very large dispersal area.
geographic region
all the genetic components of SARS-CoV distributed across a bat population . Two Commented [D8]: Ge et al., Nature, 2013; Yang et al.,
Journal of Virology; Hu et al., PLoS pathogens, 2017
other caves will act as controls/comparison sites, in that we have not yet identified the
high-risk SARSr-CoVs in that cave. We will assess: the population density, distribution
and segregation of individual bats; changes in these daily, weekly and by season; viral
Commented [D10]: Ge et al., Nature, 2013; Yang et al.,
and undermine longitudinal sampling capacity. Samples will be tested by PCR and spike Journal of Virology; Hu et al., PLoS pathogens, 2017
proteins of all SARS-related CoVs sequenced. Analyses of phylogeny, recombination Commented [D11]: Bat serum samples will be tested
events, and further characterization of high-risk viruses (those with spike proteins close for antibody (particularly neutralization antibody)
against the SARSr-CoV to evaluate the prevalence and
to SARS-CoV) will be carried out (REF). Isolation will be attempted on a subset of lifetime of antibody in bats. Human samples will be
collected from people living around cave and tested for
samples with novel SARSr-CoVs. Prof. Ralph Baric, UNC, will reverse engineer spike SARSr-CoV infection (Wang et al., Virologica Sinica, 2018).
proteins in his lab to conduct binding assays to human ACE2 (the SARS-CoV receptor). Commented [PD12]: Ralph, Zhengli. If we win this
Proteins that bind will then be inserted into SARS-CoV backbones, and inoculated into contract, I do not propose that all of this work will
necessarily be conducted by Ralph, but I do want to
humanized mice to assess their capacity to cause SARS-like disease, and their ability to stress the US side of this proposal so that DARPA are
be blocked by monoclonal therapies, or vaccines against SARS-CoV (REF). comfortable with our team. Once we get the funds, we
can then allocate who does what exact work, and I
The modeling team will use these data to build models of 1) risk of viral believe that a lot of these assays can be done in Wuhan as
well…
humans.
Commented [p13]: Sorry Peter I rearranged this part
flying mammals) (2). The nature of the weakened but not entirely lost functionality of in a logical order: interferon first, then modulate unique
bat interferon pathways, then modulate usual interferon
bat innate immunity factors like STING, a central DNA-interferon (IFN) sensing molecule, pathways. I tried not to put polyI:C first, as which is not
may have profound impact for bats to maintain the balanced state of “effective bat unique.
response”, but not “over response” against viruses (3). A similar finding was also Moved (insertion) [1]
observed in bat IFNA studies, which is less abundant but was constitutively expressed Deleted: Secondly, bat r
without stimulation (4). Given native levels of SARSr-CoVs in individual bats with Moved (insertion) [2]
damped immunity, we propose to suppress bat SARSr-CoV by boosting bat innate Deleted: W
immunity through the IFN pathway, and breaking the natural host-virus equilibrium. Deleted: gene.
Moved (insertion) [3]
Deleted: We will therefore initially trial inoculation of live
inflammation. However, this is unlikely to occur in bats, because they also have a bats with synthetic double-stranded RNA (Poly I:C) and
naturally dampened inflammation response (5). assay for reduced viral loads (DETAILS, CITATION). We will
generate universal bat interferon and apply to bats in the
Previous work has shown that aerosol spraying or intranasal inoculation of IFN or lab. Interferon has been used extensively clinically if no
other small molecules has led to reduce viral loads in humans, ferrets and mouse viral-specific drugs are available, e.g. against filoviruses (11).
Secondly, bat replication of SARSr-CoV is sensitive to
models (12-14). Thus, bat interferon would be our first choice. Firstly, we will generate interferon treatments, as has been shown in our previous
universal bat interferon and apply to bats in the lab. Interferon has been used work (12). We will attempt to boost bat IFN by blocking
bat-specific IFN negative regulator. Bat IFNA is naturally
extensively clinically if no viral-specific drugs are available, e.g. against filoviruses (11). constitutively expressed but cannot be induced to a high
Replication of SARSr-CoV is sensitive to interferon treatments, as has been shown in our level (4). This is unique to bats. We think there should be a
negative regulatory factor in the bat interferon production
previous work (12). Secondly, we will also attempt to boost bat IFN by blocking bat- pathway. We propose using CRISPRi to find out that
specific IFN negative regulator. Bat IFNA is naturally constitutively expressed but cannot negative regulator and then screen for chemicals targeting
at this gene. We will attempt to boost bat IFN by activating
be induced to a high level (4). This is unique to bats. We think there should be a dampened bat-specific IFN production pathways which
negative regulatory factor in the bat interferon production pathway. We propose using include DNA-STING-dependent and ssRNA-TLR7 dependent
pathways. These changes have been proved to bat-specific,
CRISPRi to find out that negative regulator and then screen for chemicals targeting at suggesting that they are important in viruses/bats
coexistence, and supported by our own work showing that a
this gene. Thirdly, We will attempt to boost bat IFN by activating dampened bat-specific
mutant bat STING restores antiviral functionality (3). By
IFN production pathways which include DNA-STING-dependent and ssRNA-TLR7 identifying small molecules to directly activate downstream
of STING, we have chance to activate bat interferon and
dependent pathways. These changes have been proved to bat-specific, suggesting that then help bats to clear viruses. Similar strategy applies to
they are important in viruses/bats coexistence, and supported by our own work showing ssRNA-TLR7 dependent pathways. We will also attempt to
boost bat IFN by activating functional bat IFN production ... [1]
that a mutant bat STING restores antiviral functionality (3). By identifying small
Moved up [1]: generate universal bat interferon and
molecules to directly activate downstream of STING, we have chance to activate bat apply to bats in the lab. Interferon has been used
interferon and then help bats to clear viruses. Similar strategy applies to ssRNA-TLR7 extensively clinically if no viral-specific drugs are available,
dependent pathways. Fourthly, We will also attempt to boost bat IFN by activating Moved up [2]: We will attempt to boost bat IFN by
blocking bat-specific IFN negative regulator. Bat IFNA is
functional bat IFN production pathways, e.g. polyIC to TLR3-IFN pathway or 5’ppp- naturally constitutively expressed but cannot be induced to
dsRNA to RIG-I-IFN pathway and assay for reduced viral loads. A similar strategy has Moved up [3]: We will attempt to boost bat IFN by
been tested successful in mouse model for SARS-CoV, IAV or HBV (6, 7). Lastly, we activating dampened bat-specific IFN production pathways
which include DNA-STING-dependent and ssRNA-TLR7
believe treating wild bats with IFN-modulating small molecules by spraying is superior to
Deleted: W
other invasive strategies that might be considered by DARPA, including genome editing
Commented [p14]: same comment as above, I think it
(CRISPR or RNAi), vaccination or DIP bats, in terms of its deployability and scalability. should be a backup post-exposure to human but not to
bats
Finally, we will inoculate bats with fragments of non-bat Coronavirus (DETAILS).
Commented [石15]: why with non-bat coronavirus?
please!
both arms of TA2.
wildlife.
E. Capabilities:
available.
Team:
Key Personnel:

XXX


XXX
XXX

F. If desired, include a brief bibliography Commented [PD16]: I’m planning to use my resume
Links to relevant papers, reports, or resumes of key performers. and Ralph’s. Linfa/Zhengli, I realize your resumes are
also very impressive, but I am trying to downplay the
Do not include more than two resumes as part of the abstract. non-US focus of this proposal so that DARPA doesn’t see
this as a negative.
**Resumes count against the abstract page limit.
vaccines.
**General Notes:

information.

defense. In

the estimates).
Citations
mammals. Nature 546, 646-650 (2017).
Reports 6, (2016).
(2012).
Virology 88, 10421-10431 (2014).
).
Page 8: [1] Deleted peterzhou 2/8/18 4:40:00 PM
Final draft DARPA abstract

Mon 2/12/2018 11:23 PM
To: Luke Hamel <[email protected]>; Jonathon Musser <[email protected]>
Cc: William B. Karesh <[email protected]>; Noam Ross <[email protected]>; Ralph Baric
([email protected]) <[email protected]>; wang linfa <[email protected]>; 周鹏
([email protected]) <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; Alison Andre
<[email protected]>; Aleksei Chmura <[email protected]>; Anna Willoughby
<[email protected]>; Rocke, Tonie E <[email protected]>
Luke, attached is the DARPA abstract.
First thing tomorrow, can you go through the references, and create links to the papers on NCBI. Just turn each
reference citation: “(1)” for example, into a live link to the paper on NCBI. We only have 2 spare lines, so no room
to turn each of these into a PMC numbered ref, as Ralph did for his, but please make sure the citation in
parentheses is blue, so it’s clear it’s a live link on the final pdf.
Ralph, Lina, Peng, Zhengli, Tonie – please give this a quick read to make sure I’ve not said anything completely
wrong. I’ve had to reduce the text a lot to hit the page limit, but I still think it’s a great proposal.
I’ll finish off the exec summary slide and <500 wd abstract now.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
DARPA – PREEMPT – HR001118S0017- PROJECT DEFUSE

We will defuse the potential for emergence of novel bat-origin high-zoonotic risk
SARS-related coronaviruses. We envisage a scenario whereby the US warfighter is
deployed to a security hotspot in SE Asia. As planners choose sites for the mission, they
will use an app we will design based on machine-learning models of the ecological and
evolutionary potential of bat viruses to spillover. This will allow rapid assessment of the
background risk of a site harboring dangerous zoonotic viruses. If there is no alternative
site, a tactical forward team will deploy automated delivery technology we will develop
in caves that harbor bats carrying these viruses. These devices will release broadscale
immune boosting molecules and chimeric polyvalent spike protein targeted immune
priming inocula to upregulate the naturally damped innate immune response of bats,
and lower viral shedding from bats at the site for a few weeks or months, allowing our
warfighters to execute the operation at lowered risk for spillover.

There is no available current technology to reduce the risk of exposure to novel
coronaviruses from bats. Models of bat host capacity to harbor viruses, of ecological and
environmental drivers of their emergence, and of the evolutionary potential of different
strains to spillover are rudimentary. No vaccines, or therapeutics exist for SARSr-CoVs,
and exposure mitigation strategis are non-existent. SARSr-CoVs are endemic in Asian,
African (1), and European bats (2) that roost in caves but forage widely at night,
shedding virus in their feces and urine. The limitations of this lack of capacity are
significant – we have shown evidence of recent spillover of SARSr-CoVs into people in
China, and have isolated strains capable of producing SARS-like illness in humanized
mice that doesn’t respond to antibody treatment or vaccination. These viruses are a
clear-and-present danger to our military, and to global health security.

Our group leads the world in predictive models of viral emergence. We will build on our
hotspots, machine-learning, ecological niche and genotype-phenotype modeling by
incorporating unique datasets to validate and refine hotspot risk maps of viral emergene
in SE Asia and beyond. Our group has shown that bats coexist with lethal viruses by
damping innate immunity pathways, likely as an evolutionary adaptation to flight. We
will use this insight to design strategies, like small molecule Rig like receptor (RLR) or
Toll like receptor (TLR) agonists, to upregulate bat immunity in their cave roosts, down-
regulate viral replication, and reduce the risk of viral shedding and spillover (broadscale
immune boosting strategy). We will complement this by inoculating bats with novel
against specific, high-risk viruses (targeted immune priming strategy), especially when
their immune response is boosted as above. We will design novel methods to deliver
these inocula remotely to reduce exposure risk during decontamination.
overcome these?
Modeling: Previous models have suffered from a lack of data to validate them. We have
access to unique datasets that will allow us to validate our approach, including
biodiversity surveys of bat caves across S. China, 10+ years of bat viral testing data in
China, and 10 other countries (from NIAID and USAID EPT PREDICT work). Uniquely, we
will validate our models of viral evolution/spillover risk using serology (based on LIPS
assays) in local populations, who have high (~3%) serology to bat SARSr-CoVs.
Identifying Immune boosting and priming inocula: Some of our approaches are novel
and challenging (e.g. using CRISPRi to find the negative regulator for bat interferon
production), and others are unproven in bats (e.g. Poly IC). We will begin all immune
boosting and priming experiments at the beginning of the project, running them
simultaneously and competitively, so that we field trial only the most efficient, cost-
effective and scalable approaches.
This will have direct relevance to the warfighter. Potential deployment to regions where
SARSr-CoVs exist is high – countries include security hotspots in Asia (e.g. Myanmar,
Bangladesh, Pakistan, Korea, Vietnam), Africa and Eastern Europe. The ability to
decontaminate and defuse these viruses may prevent potentially devastating illness.
These technologies could be adapted to hosts of other bat-origin CoVs (e.g. MERS-CoV,
SADS-CoV), and potentially other zoonotic bat-origin viruses (Hendra, Nipah, EBOV),
with benefits to livestock production, food security and global public health.

Aleksei/Luke to fill out
SPACE
SPACE
SPACE
D. Technical Plan:
Overview
The SARSr-CoV-bat system, and immune modulation focus: Our group’s 15 yrs work on
the SARSr-CoV – Rhinolophus bat system in China has identified and isolated SARSr-CoVs
with remarkable sequence identity in the spike protein to SARS-CoV (e.g. SCH014 &
WIV-1). We have shown they bind and replicate efficiently in primary human lung
airway cells and that chimeras with SARSr-CoV spike proteins in a SARS-CoV backbone
cause SARS-like illness in humanized mice, with clinical signs that are not reduced by
SARS monoclonal therapy or vaccination. We have identified a single cave site in Yunnan
Province where bat SARSr-CoVs contain all the genetic components of epidemic SARS-
CoV (7-9). We have now shown that people living up to 6 kilometers from this cave have
SARSr-CoV antibodies (3% seroprevalence in 200+ cohort), suggesting active spillover,
and marking these viruses as a clear-and-present danger of a new SARS-like pandemic.
Our work on bat immunology suggests that bats’ unique flying ability has led to
downregulated innate immune genes, and their ability to coexist with viruses such as
SARSr-CoVs, henipa- and filoviruses that are lethal in many other mammals (3). We have
identified bat-specific constitutively expressed bat interferon, a dampened STING-
interferon production pathway (4, 5), and have identified a series of other innate
immunity factors that are dampened in bats (6).
Our bat-CoV system has significant advantages for experiment and intervention.
Firstly, these viruses are fecal-orally transmitted within bat populations, so sampling can
be achieved from fresh fecal pellet collection. They are BSL-3, not -4, agents, so that
experimental manipulation and infection is simpler. They have frequent spillover events,
making it possible to validate predictive models of spillover by sampling people. They
are diverse, with frequent recombination and different strains exhibiting differential
host cell binding and spillover potential. Finally, we have identified SARSr-CoV strains in
a single cave in Yunnan that harbor all of the epidemic SARS-CoV genes. This specific bat
population harbors an ideal evolutionary soup that could produce new human strains by
high frequency RNA recombination, and thus, it presents a perfect target for next
generation, technology-forward intervention strategies.
geographic region
The DEFUSE modeling and analytics team led by Drs Daszak, Ross, Olival, EHA, will build
ecological niche models of environmental and ecological correlates, and traits of cave
bat communities to predict species composition of bat caves across Southern China,
South and SE Asia. We will then use a series of datasets we have built to produce host-
virus risk models for the region. These include our unique database of bat host-viral
relationships (7); biological inventory data on all bat caves in Southern China; and
modeled species distribution data for all bats. We will parameterize the model with data
from three cave sites in Yunnan, China (one with high-risk SARSr-CoVs, two other
control/comparison sites), including: radio- and GPS-telemetry to identify home range
and additional roost sites for each bat species; inventory of bat population density,
distribution and segregation and their daily, weekly and seasonal changes; viral
prevalence and individual viral load; shedding of low- and high-risk SARSr-CoV strains
among bat species, age classes, genders; and telemetry and mark-recapture data to
assess metapopulation structure and inter-cave connectivity. We will test and validate
model predictions of a cave’s viral spillover potential with data from prior PREDICT
sampling in 7 other Asian countries. At the end of Yr 1, we will produce a prototype app
for the warfighter that identifies the likelihood of bats harboring dangerous viral
pathogens in a region. The ‘high-risk bats near me’ app will be updated real-time with
surveillance data (e.g. field-deployable iphone and android compatible echolocation
data) from our project and others, to ground-truth and fine-tune its predictive capacity.
The Wuhan Institute of Virology team will test bat fecal, oral, blood and
urogenital samples for SARSr-CoVs. We will correlate viral load data from these samples
with fresh fecal pellets from individuals and from tarps laid on cave floors. We will
rapidly move to fecal pellet assays to reduce roost disturbance. SARSr-CoV spike
proteins will be sequenced, analyzed phylogenetically, for recombination events, and
high-risk viruses (spike proteins close to SARS-CoV) characterized and isolated. The UNC
team will reverse engineer spike proteins to conduct binding assays to human ACE2 (the
SARS-CoV receptor). They will culture SARS-like bat coronaviruses to distinguish high risk
strains that can replicate in primary human cells and low risk strains that require
exogenous enhancers. Viral spike glycoproteins that bind receptors will be inserted into
SARS-CoV backbones, inoculated into human cells and humanized mice to assess
capacity to cause SARS-like disease, and to be blocked by monoclonal therapies, the
nucleoside analogue inhibitor GS-5734 (8) or vaccines against SARS-CoV (8-13).
The EHA modeling team will use these data to build models of risk of viral
evolution and spillover. These genotype-to-phenotype machine-learning models will
predict viral ability to infect host cells based on genetic traits and results of receptor
binding and mouse infection assays. Using data on diversity of spike proteins,
recombinant CoVs, and flow of genes within each bat cave via bat movement and
migration, we will estimate evolutionary rates, rates of recombination, and capacity to
generate novel strains capable of human infection. Finally, virus-host relationship and
bat home range data will be used to estimate spillover potential - extending models well
beyond our field sites. We will then validate model predictions of viral spillover risk by
1) conducting spike protein-based binding and cell culture experiments, and 2)
identifying spillover strains in people near our bat cave sites. Our preliminary work on
this shows ~3% serology to SARSr-CoVs, using a specific ELISA (14). We will design LIPS
assays to the specific high- and low- zoonotic-risk SARSr-CoVs identified in this project as
we have done previously (15). We will use banked and newly collected human sera from
these populations to test for presence of antibodies to the high- and low-risk SARSr-
CoVs identified by our modeling. We will then model optimal strategies to maximize
inoculation efficacy for TA2, using machine-learning stochastic simulation modeling
informed by field and experimental data to characterize viral circulation dynamics in
bats. We will estimate frequency and population coverage required for our intervention
approaches to suppress viral spillover. We will determine the seasons, locations within a
cave, and delivery methods (spray, swab, or automated cave mouth or drone) that will
be most effective. Finally we will determine the time period treatment will be effective
for, until re-colonization or evolution leads to return of a high-risk SARSr-CoV.
humans.
We will evaluate two approaches to defuse SARS-related CoV spillover potential: 1)
Broadscale Immune Boosting: using the unique immune damping in bats that our group
has discovered, we will inoculate live bats with immune modulators like bat interferon
designed to up-regulate their naïve immunity and then assess their ability to suppress
viral replication and shedding; 2) Targeted Immune Priming: building on preliminary
development of polyvalent chimeric recombinant SARSr-CoV spike proteins, we will
conduct inoculation trials with live bats to assess suppression of replication and
shedding of a broad range of dangerous SARS-related CoVs.
Both lines of work will begin in Yr 1 and run parallel. Prof. Linfa Wang (Duke-
NUS) will lead the immune boosting work, building on his pioneering work on bat
immunity (3) which shows that the long-term coexistence of bats and their viruses has
led to equilibrium between viral replication and host immunity. This is likely due to
down-regulation of their innate immune system as a fitness cost of flight (3). The
weakened functionality of bat innate immunity factors like STING, a central DNA-
interferon (IFN) sensing molecule, may allow bats to maintain an effective, but not over-
response to viruses (4). A similar finding was observed for bat IFNA, which is less
abundant but constitutively expressed without stimulation (5). Given high native SARSr-
CoV load in bats, we aim to boost bat innate immunity through the IFN pathway, break
the host-virus equilibrium to suppress bat SARSr-CoV replication and shedding.
We will trial the following concurrently and competitively for efficiency, cost and
scalability: i) Universal bat interferon. Aerosol spraying or intranasal inoculation of IFN
or other small molecules reduces viral loads in humans, ferrets and mouse models (16,
17). Interferon has been used clinically when antiviral drugs are unavailable, e.g. against
filoviruses (18). Replication of SARSr-CoV is sensitive to interferon treatments, as shown
in our previous work (16); ii) Boosting bat IFN by blocking bat-specific IFN negative
regulators. Uniquely, bat IFNA is naturally constitutively expressed but cannot be
induced to a high level (5), indicating a negative regulatory factor in the bat interferon
production pathway. We will use CRISPRi to identify the negative regulator and then
screen for compounds targeting this gene; iii) Activating dampened bat-specific IFN
production pathways which include DNA-STING-dependent and ssRNA-TLR7-dependent
pathways. Our work showing that mutant bat STING restores antiviral functionality
suggests these pathways are important in bat-viral coexistence (4). By identifying small
molecules to directly activate downstream of STING, we will activate bat interferon and
promote viral clearance. A similar strategy will be applied to ssRNA-TLR7-dependent
pathways; iv) Activating functional bat IFN production pathways, e.g. polyIC to TLR3-IFN
pathway or 5’ppp-dsRNA to RIG-I-IFN pathway. A similar strategy has been
demonstrated in a mouse model for SARS-CoV, IAV and HBV (17, 19); v) Inoculating
crude coronavirus fragments to upregulate innate immune responses to specific CoVs –
a partial step towards the targeted immune priming work below.
Prof. Ralph Baric (UNC) will lead the immune priming work. He will develop
recombinant chimeric spike-proteins (20) from our known SARSr-CoVs, and those we
characterize during project DEFUSE. The structure of the SARS-CoV spike glycoprotein
has been solved and the addition of two proline residues at positions V1060P and
L1061P stabilize the prefusion state of the trimer, including key neutralizing epitopes in
the receptor binding domain (21). In parallel, the spike trimers or the receptor binding
domain can be incorporated into alphavirus vectored or nanoparticle vaccines for
delivery, either as aerosols, in baits, or as large droplet delivery vehicles (11, 22-25). We
will test these in controlled lab conditions, taking the best candidate forward for testing
in the field. We have built recombinant spike glycoproteins harboring structurally
defined domains from SARS epidemic strains, pre-epidemic strains like SCH014 and
zoonotic strains like HKU3. It is anticipated that recombinant S glycoprotein based
vaccines harboring immunogenic blocks across the group 2B coronaviruses will induce
broadscale immune responses that simultaneously reduce genetically heterogeneous
virus burdens in bats, potentially reducing disease risk (and transmission risk to people)
in these animals for longer periods (26, 27).
The immune dampening features are highly conserved in all bat species tested so
far. Duke-NUS has established the only experimental breeding colony of cave bats
(Eonycteris spelaea) in SE Asia. This genus is evolutionarily closely related to Rhinolophus
spp. (the hosts of SARSr-CoVs), so we have confidence that results will be transferable.
Our initial proof-of-concept tests will be in this experimental colony, extended to a small
group of wild-caught Rhinolophus sinicus bats at Wuhan Institute of Zoology. We (Prof.
Wang) have previous experience conducting SARS-CoV infection experiments with
Rhinolophus sp. bats in the BSL-4 facility at CSIRO, AAHL (L.Wang, unpublished results).
Finally, work on a delivery method for our immune boosting and priming
molecules will be overseen by Dr. Tonie Rocke at the USGS, National Wildlife Health
Center who has previously developed animal vaccines through to licensure (28). Using
locally acquired insectivorous bats (29, 30) we will assess delivery vehicles and methods
including: 1) transdermally applied nanoparticles; 2) series of sticky edible gels that bats
will groom from themselves and each other; 3) aerosolization via sprayers that could be
used in cave settings; 4) automated sprays triggered by timers and movement detectors
at critical cave entry points; 5) sprays delivered by remote controlled drone. We have
already used simple gels to vaccinate bats against rabies in the lab (29), and hand
delivered these containing biomarkers to vampire bats in Peru and Mexico to show they
are readily consumed and transferred among bats. In our bat colony, we will trial
delivery vehicles using the biomarker rhodamine B (which marks hair and whiskers upon
consumption) to assess uptake. The most optimal approaches will then be tested on
wild bats in our three cave sites in Yunnan Province with the most successful
immunomodulators from TA2. Fieldwork will be conducted under the auspices of Dr.
Yunzhi Zhang (Yunnan CDC, Consultant at EcoHealth Alliance). A small number of bats
will be captured and assayed for viral load and immune function after treatment, but so
as not to disturb the colony, most viral load work will be conducted on fresh fecal
pellets collected daily on the cave floor. EHA has had unique access to these sites for
around 10 years, under the guidance of Drs. Shi and Zhang. In year 1 of project DEFUSE,
we will seek permission for experimental inoculations from the Provincial Forestry
Department. We expect to be successful, as we have worked with the Forestry
Department collaboratively for 10 years, with support of the Yunnan CDC, and we are
releasing molecules that are not dangerous to people or wildlife. EHA has a proven track
record of rapidly obtaining IACUC and DoD ACURO approval for bat research.
E. Capabilities:
research organization focused on emerging zoonotic diseases. The PI, Dr. Peter Daszak,
has 25+ years’ experience managing lab, field and modeling research projects on
emerging zoonoses. Dr. Daszak will commit 3 months annually to oversee and
coordinate all project activities, and lead modeling and analytic work for TA1. Dr. Billy
Karesh has 40+ years’ experience leading zoonotic and wildlife disease projects, and will
commit 1 month annually to manage partnership activities and outreach. Dr. Jon
Epstein, with 15 years’ experience working emerging bat zoonoses will coordinate
animal trials. Dr. Kevin Olival and Dr. Noam Ross will manage and conduct the modeling
and analytical approaches for this project. Support staff include field surveillance teams,
modeling analysts, and consultants based in Yunnan Province, China, to oversee field
trials. The EHA team has worked extensively with all other collaborators: Prof. Wang
(15+ years); Dr. Shi (15+ years); Prof. Baric (5+ years) and Dr. Rocke (15+ years).
Subcontracts: #1 to Prof. Ralph Baric, UNC, to oversee reverse engineering of
SARSr-CoVs, BSL-3 humanized mouse experimental infections, design and testing of
immune priming inocula based on recombinant spike proteins. Assisted by senior
personnel Dr. Tim Sheahan, Dr. Amy Sims, and support staff; #2 to Prof. Linfa Wang,
Duke NUS, to oversee the immune boosting approach, captive bat experiments, and
analyze immunological and virological responses to immune boosting inocula; #3 to Dr.
Zhengli Shi, Wuhan Institute of Virology, to conduct PCR testing, viral discovery and
isolation from bat samples collected in China, spike protein binding assays, and some
humanized mouse work, as well as experimental inoculation of Rhinolophus bats. Her
team will include Dr. Peng Zhou and support staff; #4 to Dr. Tonie Rocke, USGS National
Wildlife Health Center, to refine delivery mechanisms for both immune boosting and
immune priming treatments. With a research technician, Dr. Rocke will use a captive
colony of bats at NWHC for initial trials, and oversee cave experiments in China.
F. Links to published papers, resume of two key performers

research organization focused on emerging zoonotic diseases. His >300 scientific papers
include the first global map of EID hotspots (31, 32), estimates of unknown viral
diversity (33), predictive models of virus-host relationships (7), and evidence of the bat
origin of SARS-CoV (34, 35) and other emerging viruses (36-39). He is Chair of the
NASEM Forum on Microbial Threats, and is a member of the Executive Committee and
the EHA institutional lead for the $130 million USAID-EPT-PREDICT. He serves on the
NRC Advisory Committee to the USGCRP, the DHS CEEZAD External Advisory Board, the
Professor in the UNC-Chapel Hill Dept. of Epidemiology and Dept. of Microbiology &
Immunology. His work focuses on coronaviruses as models to study the genetics of RNA
virus transcription, replication, persistence, cross species transmission and
pathogenesis. His group has developed a platform strategy to access the potential “pre-
epidemic” risk associated with zoonotic virus cross species transmission potential and
evaluation of countermeasure potential to control future outbreaks of disease (8-13).
Citations
1. P. L. Quan et al., Identification of a Severe Acute Respiratory Syndrome
Coronavirus-Like Virus in a Leaf-Nosed Bat in Nigeria. Mbio 1, (2010).
2. J. F. Drexler et al., Genomic Characterization of Severe Acute Respiratory
Syndrome-Related Coronavirus in European Bats and Classification of
Coronaviruses Based on Partial RNA-Dependent RNA Polymerase Gene
Sequences. Journal of Virology 84, 11336-11349 (2010).
4. J. Xie et al., Dampened STING-Dependent Interferon Activation in Bats. Cell host
& microbe, (2018).
6. M. Ahn, J. Cui, A. T. Irving, L.-F. Wang, Unique Loss of the PYHIN Gene Family in
Bats Amongst Mammals: Implications for Inflammasome Sensing. Scientific
Reports 6, (2016).
7. K. J. Olival et al., Host and viral traits predict zoonotic spillover from mammals.
Nature 546, 646-650 (2017).
8. T. P. Sheahan et al., Broad-spectrum antiviral GS-5734 inhibits both epidemic
and zoonotic coronaviruses. Sci Transl Med 9, (2017).
9. V. D. Menachery et al., MERS-CoV and H5N1 influenza virus antagonize antigen
presentation by altering the epigenetic landscape. Proc Natl Acad Sci U S A 115,
E1012-E1021 (2018).
10. S. J. Anthony et al., Further Evidence for Bats as the Evolutionary Source of
Middle East Respiratory Syndrome Coronavirus. MBio 8, (2017).
11. A. S. Cockrell et al., A mouse model for MERS coronavirus-induced acute
respiratory distress syndrome. Nat Microbiol 2, 16226 (2016).
12. V. D. Menachery et al., SARS-like WIV1-CoV poised for human emergence. Proc
Natl Acad Sci U S A 113, 3048-3053 (2016).
13. V. D. Menachery et al., A SARS-like cluster of circulating bat coronaviruses shows
potential for human emergence. Nat Med 21, 1508-1513 (2015).
14. N. Wang et al., Serological evidence of bat SARS-related coronavirus infection in
humans, China. Virologica Sinica In press, (2018).
15. P. Zhou et al., Fatal Swine Acute Diarrhea Syndrome caused by an HKU2-related
Coronavirus of Bat Origin. Nature In press, (2018).
16. B. M. Farr, J. M. Gwaltney, Jr., K. F. Adams, F. G. Hayden, Intranasal interferon-
alpha 2 for prevention of natural rhinovirus colds. Antimicrob Agents Chemother
26, 31-34 (1984).
17. D. Kugel et al., Intranasal Administration of Alpha Interferon Reduces Seasonal
Influenza A Virus Morbidity in Ferrets. Journal of Virology 83, 3843-3851 (2009).
18. L. M. Smith et al., Interferon-beta Therapy Prolongs Survival in Rhesus Macaque
Models of Ebola and Marburg Hemorrhagic Fever. Journal of Infectious Diseases
208, 310-318 (2013).
19. J. Zhao et al., Intranasal Treatment with Poly(I.C) Protects Aged Mice from Lethal
Respiratory Virus Infections. Journal of Virology 86, 11416-11424 (2012).
21. J. Pallesen et al., Immunogenicity and structures of a rationally designed
prefusion MERS-CoV spike antigen. Proc Natl Acad Sci U S A 114, E7348-E7357
(2017).
22. C. M. Coleman et al., Purified coronavirus spike protein nanoparticles induce
coronavirus neutralizing antibodies in mice. Vaccine 32, 3169-3174 (2014).
23. C. M. Coleman et al., MERS-CoV spike nanoparticles protect mice from MERS-
CoV infection. Vaccine 35, 1586-1589 (2017).
24. L. Du et al., A 219-mer CHO-expressing receptor-binding domain of SARS-CoV S
protein induces potent immune responses and protective immunity. Viral
immunology 23, 211-219 (2010).
25. T. Sheahan et al., Successful vaccination strategies that protect aged mice from
lethal challenge from influenza virus and heterologous severe acute respiratory
syndrome coronavirus. J Virol 85, 217-230 (2011).
26. S. Agnihothram et al., A mouse model for Betacoronavirus subgroup 2c using a
bat coronavirus strain HKU5 variant. MBio 5, e00047-00014 (2014).
27. M. M. Becker et al., Synthetic recombinant bat SARS-like coronavirus is
infectious in cultured cells and in mice. Proc Natl Acad Sci U S A 105, 19944-
19949 (2008).
28. T. E. Rocke et al., Sylvatic Plague Vaccine Partially Protects Prairie Dogs (Cynomys
spp.) in Field Trials. Ecohealth 14, 438-450 (2017).
immunogenicity of a raccoonpox vectored rabies vaccine in the Brazilian Free-
tailed bat (Tadarida brasiliensis). Vaccine 34, 5352-5358 (2016).
31. K. E. Jones et al., Global trends in emerging infectious diseases. Nature 451, 990-
993 (2008).
32. T. Allen et al., Global hotspots and correlates of emerging zoonotic diseases. Nat
Commun 8, 1124 (2017).
33. S. J. Anthony et al., A Strategy to Estimate Unknown Viral Diversity in Mammals.
mBio 4, (2013).
34. X. Y. Ge et al., Isolation and characterization of a bat SARS-like coronavirus that
uses the ACE2 receptor. Nature 503, 535-538 (2013).
35. W. Li et al., Bats are natural reservoirs of SARS-like coronaviruses. Science 310,
676-679 (2005).
36. A. N. Alagaili et al., Middle East respiratory syndrome coronavirus infection in
dromedary camels in saudi arabia. MBio 5, (2014).
37. N. Homaira et al., Nipah virus outbreak with person-to-person transmission in a
district of Bangladesh, 2007. Epidemiology and Infection 138, 1630-1636 (2010).
38. M. S. Islam et al., Nipah Virus Transmission from Bats to Humans Associated with
Drinking Traditional Liquor Made from Date Palm Sap, Bangladesh, 2011–2014.
Emerging Infectious Disease journal 22, 664 (2016).
39. K. J. Olival et al., Ebola virus antibodies in fruit bats, bangladesh. Emerg Infect Dis
19, 270-273 (2013).
 Inbox   Luke Hamel    Meet NowRE
  New message  Reply all   Delete  Move to    

 Print  Cancel
Salton Sea

 RE: Final draft RE:
DARPA
Final500 wdDARPA
draft summary
500 wd
Starred 6
summary

WDA  This message was sent with High importance.
Tue 2/13/2018 12:03 AM
 New folder Peter Daszak To: Luke Hamel <[email protected]>;
    
PD <daszak@ecohealthalliance.
Jonathon Musser <[email protected]>
 In-Place Archiv… org> Cc: William B. Karesh <[email protected]>;

Tue 2/13/2018 12:03 Noam
AM Ross <[email protected]>; Ralph Baric
([email protected]) <[email protected]>;
To: Luke Hamel <[email protected]>; wang
Jonathon Musser <muss
Archive 1 linfa <[email protected]>; 周鹏
Cc: William B. Karesh <[email protected]>; Noam Ross <ross@
Zhengli Shi ([email protected]) <[email protected]>; Alison
 Archives PREEMPT_Abstract_Sum…
Andre <[email protected]>;
 Aleksei Chmura
20 KB
<[email protected]>; Anna Willoughby
Deleted It… 372 <[email protected]>; Rocke, Tonie E
<[email protected]>
Drafts It’s 497 words now.
It’s 497 words now.
Important 4820
Inbox 41762
press contacts Cheers,

Cheers,
reviews Peter
Peter
RGEG
Sent Items 195 Peter Daszak

President Peter Daszak
President
Starred 35
EcoHealth Alliance
EcoHealth Alliance
New folder 460 West 34th Street – 17th Floor
New York, NY 10001460 West 34th Street – 17th Floor
New York, NY 10001
 Groups Tel. +1 212-380-4473
Tel. +1 212-380-4473
Rocke Lab 2
EcoHealth Alliance leads cutting-edge research into the critical
EcoHealth
connections between human Alliance leads
and wildlife cutting-edge
health research
and delicate
RGE Women'… 7
into the critical connections between
ecosystems. With this science we develop solutions that human and
wildlife health and delicate
prevent pandemics and promote conservation. ecosystems. With this
Invasive Sp… 47
science we develop solutions that prevent
Discover groups From: Peter Daszak
Sent: Tuesday, February 13, 2018 12:23 AM
Manage groups From: Peter Daszak
To: Luke Hamel ([email protected]); Jonathon
Musser
To: Luke Hamel ([email protected]);
Cc: William B Karesh; Noam Ross; Ralph Baric
Technical Approach: Our goal is to defuse the potential for spillover of novel bat-origin
high-zoonotic risk SARS-related coronaviruses in Southeast Asia. In TA1 we will develop
host-pathogen ecological niche models to predict the species composition of bat caves
across Southeast Asia. We will parameterize this with a full inventory of host and virus
distribution at our field sites, three caves in Yunnan Province, China and a series of
unique datasets on bat host-viral relationships. By the end of Y1, we will use these to
create a prototype app for the warfighter that identifies the likelihood of bats harboring
dangerous viral pathogens at any site across Asia. We will intensively sample bats at our
field sites to sequence SARSr-CoV spike proteins, reverse engineer them to conduct
binding assays, and insert them into SARS-CoV backbones to infect humanized mice to
assess capacity to cause SARS-like disease. Our modeling team will use these data to
build machine-learning genotype-phenotype models of viral evolution and spillover
risk. We will uniquely validate these with human serology data through LIPS assays
designed to assess which spike proteins allow spillover into people.
In TA2, we will evaluate two approaches to reduce SARSr-CoV shedding in cave
bats: (1) Broadscale Immune Boosting, in which we will inoculate bats with immune
modulators to upregulate their innate immune response and downregulate viral
replication; (2) Targeted Immune Priming, in which we will inoculate bats with novel
chimeric polyvalent recombinant spike proteins to enhance innate immunity against
specific, high-risk viruses. We will trial inoculum delivery methods on captive bats
including automated aerosolization, transdermal nanoparticle application and edible,
adhesive gels. We will use stochastic simulation modeling informed by field and
experimental data to characterize viral dynamics in our cave sites, to maximize timing,
inoculation protocol, delivery method and efficacy of viral suppression. The most
effective delivery method and immune modulating treatments will be trialed in our
experimental cave sites in Yunnan Province, with reduction in viral shedding as proof-of-
concept.
Management Approach: Members of our collaborative group have worked together on

bats and their viruses for over 15 years. The lead organization, EcoHealth Alliance, will
oversee all modeling, lab, and fieldwork. EHA staff will develop models to evaluate the
probability of specific SARS-related CoV spillover, and identify the most effective
strategy for delivery of both immune boosting and immune targeting inocula. Specific
work will be subcontracted to the following organizations:
1) Prof. Ralph Baric, UNC, will lead the immune priming work, building on his track
record in reverse-engineering and manipulating SARS-CoV, MERS-CoV and other
virus spike proteins over the last two decades.
2) Prof. Linfa Wang, Duke-NUS, will lead work on immune boosting, building from
his groups’ pioneering work on bat immunity.
3) Dr. Zhengli Shi, Wuhan Institute of Virology will conduct viral testing on all
collected samples, binding assays and some humanized mouse work.
4) Dr. Tonie Rocke, USGS National Wildlife Health Center will develop a delivery
method for immunological countermeasures, following from her work on
vaccine delivery in wildlife, including bats.
RE: Final DARPA Exec Summary slide

Tue 2/13/2018 12:03 AM
([email protected]) <[email protected]>; wang linfa <[email protected]>; 周鹏
Hi Luke and Jonathon.
Here’s the edited, final summary slide.
Please insert the re-drawn figure, and the budget numbers from Aleksei tomorrow before you submit
NB –there are other things to check on the Abstract, including budget numbers, timeline, the references, and then
please do a final check on the compliance with DARPA instructions for all!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
From: Peter Daszak

To: Luke Hamel ([email protected]); Jonathon Musser
Cc: William B. Karesh; Noam Ross; Ralph Baric ([email protected]); wang linfa; 周鹏 ([email protected]);
Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura ([email protected]); 'Anna Willoughby
([email protected])'; Rocke, Tonie
Subject: Final draft DARPA abstract
Importance: High
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
Executive Summary: Proposal Title
EcoHealth Alliance; Dr. Peter Daszak
CONCEPT APPROACH
Provide graphic. Describe new ideas.
IMPACT CONTEXT
Describe need and problem being addressed.
Describe existing approaches; compare to state of
Describe goal.
the art.
Phase I Phase II Total
Proposed $- $- $-
xHuman Use/ x Animal Use HR001118S0017 PREEMPT

1
Executive Summary: DEFUSE
CONCEPT Pathogen Prediction: APPROACH
• Host-Pathogen Ecology: Develop host-pathogen ecological niche models based on unique bat and viral data, to
estimate likelihood of spillover of SARS-related CoVs into human populations. Doing so will enhance predictive ability
of models beyond sampling sites in China to cover all Asia.
• Mobile Application: Create ‘Reservoirs Near Me’ mobile application, to assess background risk of disease spillover for
any site across Southeast Asia.
• Binding and Humanized mouse asssays: Utilize team’s unique collaboration between world-class modelers and
virologists with CoV expertise to conduct spike protein-based binding and humanized mice experiments.
• Use results to test machine-learning genotype-to-phenotype model predictions of viral spillover risk.
• Genotype-Phenotype Models: Develop models to estimate evolutionary rates, rates of recombination, and capacity to
generate novel strains capable of human infection. Inputs to include: Diversity of bat spike proteins, prevalence of
recombinant CoVs, and flow of genes within each bat cave via bat movement and migration.
• Validation with Human Sera: Analyze new and existing human serum samples to validate model outputs. Given
frequent SARSr-CoV spillover events into local human populations, this can be done to a degree not possible in
systems where spillover events are rare.
Intervention Development: (2 parallel approaches)

• (1) Broadscale Immune Boosting Strategy: Inoculate bats with immune modulators to upregulate innate immune
response and downregulate viral replication, transiently reducing risk of viral shedding and spillover.
• (2) Targeted Immune Priming Strategy: Inoculate bats with novel chimeric polyvalent recombinant spike proteins to
enhance innate immune response against specific, high-risk viruses.
• Viral Dynamics: Develop stochastic simulation models to estimate the frequency, efficacy, and population coverage
required for intervention approaches to effectively suppress the viral population.
• Field Deployment and Testing: Uilize team’s expertise in wildlife vaccine delivery to assess and deploy effective
molecule delivery methods, including: automated aerosolization technology that inoculates bats as they leave cave
roost; remote controlled drone technology; transdermal nanoparticle application; and application of edible, adhesive
gels that bats ingest when grooming fur of self and others.
IMPACT CONTEXT
• Recent and ongoing security concerns within South and SE Asia make the region a likely deployment site • No technology currently exists to reduce the risk of exposure to novel bat Coronaviruses.
for US warfighters. Troops deployed to the region face increased disease risk from SARS and related bat
viruses, as bats shed these pathogens through urine and feces while foraging over large areas at night.
• Our team has conducted pioneering research on modeling disease emergence, understanding Coronavirus
virology, bat immunity, and wildlife vaccine delivery. Our previous work provides proof-of-concept for: (1)
• Our work in Yunnan Province, China has shown that (1) SARSr-CoVs are capable of producing SARS-like predictive ‘hotspot’ modeling; (2) upregulating bat immune response through the STING IFN pathway, (2)
illness in humanized mice that are not affected by monoclonal or vaccine treatment, and (2) that spillover developing recombinant chimeric spike-proteins from SARS and SARSr-CoVs and (3) delivering
into local human populations is frequent. With no available vaccine or alternative method to counter these immunological countermeasures to wildlife (including multiple bat species).
SARS-related viruses, US defense forces and national security are placed at risk.
• The DEFUSE approach is broadly effective, scalable, economical and achievable in the allotted time frame.
• Our goal is to “DEFUSE” the potential for emergence of novel bat-origin high zoonotic risk SARSr-CoVs in It also poses little environmental risk, and presents no threat to local livestock or human populations.
Southeast Asia. In doing so, we will not only safeguard the US warfighter, but also reduce SARSr-CoV
exposure for local communities and their livestock, improving food security Global Health Security.
• While CRISPR-Cas9 gene drives are being considered for many disease research applications, the
technique is unlikely to be effective in suppressing viral transmission in bat hosts. Bats are relatively long-
• If successful, our strategy can be adapted to hosts of other bat-origin CoVs (MERS-CoV in the Middle East lived, highly mobile, and have long inter-generational periods (2-5 years) with low progeny (1-2 pups).
and other SARS-related pre-pandemic zoonotic strains in Africa, e.g. Nigeria), and potentially other Furthermore, gene drive technology could have far-reaching, negative ecological consequences and its
zoonotic bat-origin viruses (Hendra, Nipah, Ebola viruses). effectiveness cannot be evaluated within the defined Period of Performance.

Proposed $- $- $-
xHuman Use/ x Animal Use HR001118S0017 PREEMPT 2

RE: Final draft DARPA abstract

Tue 2/13/2018 12:09 AM
To: Peter Daszak <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>
([email protected]) <[email protected]>; 周鹏 ([email protected]) <[email protected]>; Zhengli Shi
([email protected]) <[email protected]>; Alison Andre <[email protected]>; Aleksei Chmura
<[email protected]>; Anna Willoughby <[email protected]>; Rocke, Tonie E
<[email protected]>
Hi Peer,
It actually reads well now and I hope the selection committee will “buy in” our brave ideas!
Nothing to add a or change, other than an English question: we used “dampened immunity of bats” in most
places, but you use the expression of “damping innate immunity pathways” on page 1. Is there a difference
between “damping” and “dampening”?
Thanks
LF
Linfa (Lin-Fa) Wang, PhD FTSE

Programme in Emerging Infectious Diseases
Duke-NUS Medical School
Tel: +65 65168397

Sent: Tuesday, 13 February 2018 1:23 PM
([email protected]) <[email protected]>; Wang Linfa <[email protected]>; 周鹏
Importance: High
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
RE: Final draft DARPA 500 wd summary

Tue 2/13/2018 12:15 AM
To: Peter Daszak <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>
<[email protected]>
Dear Peter,
Another English questions (sorry, I seem to have all these English questions today!): you have used “inoculate” to
cover all of the proposed approaches in this proposal. If we decide to “spray” chemicals for bats to breath in, can
we still consider this as “inoculate”?! Or shall we be more general and used “apply” instead, by stating that “we
will apply immune modulators and vaccine to bats”?!
Thanks

Tel: +65 65168397

Subject: RE: Final draft DARPA 500 wd summary
Importance: High
It’s 497 words now.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
From: Peter Daszak

Importance: High
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
Re: Final draft abstract

peng.zhou <[email protected]>
Tue 2/13/2018 1:26 AM
Cc: Luke Hamel <[email protected]>; Jonathon Musser <[email protected]>; William B. Karesh
<[email protected]>; Noam Ross <[email protected]>; Ralph Baric ([email protected])
<[email protected]>; wang linfa <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>;
Alison Andre <[email protected]>; Aleksei Chmura <[email protected]>; Anna Willoughby
Hi, Peter ,
It was really great proposal ! Just a couple of minor issues :
1, at 3, you used "spike protein", for the immune part. But you used "CoV fragments" for
immunization in the actual ta2 part. Please be consistent. Also be consistent if we use CoV
fragments to immunize bats or just "inoculate " (bat or human ).
2, last paragraph : Duke-Nus but not Duke Nus. Prof. Zhengli Shi, rather than Dr. ?
All good for other parts!

Best wishes ,
Peng
周鹏
邮箱：[email protected]
签名由网易邮箱大师定制
在2018年02月13日 13:23，Peter Daszak 写道：

Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
Sent: Monday, February 12, 2018 11:48 PM
To: Peter Daszak
Cc: Luke Hamel; Jonathon Musser; William B. Karesh; Noam Ross; Ralph Baric
([email protected]); wang linfa; 周鹏 ([email protected]); Zhengli Shi
([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby
Subject: Re: Final draft DARPA abstract
Attachments: DARPA PREEMPT DEFUSE abstract 3_TRedits.docx
Just minor edits. Looks good. -Tonie
On Mon, Feb 12, 2018 at 11:23 PM, Peter Daszak <[email protected]> wrote:
reference citation: “(1)” for example, into a live link to the paper on NCBI. We only have 2 spare lines, so no room to
turn each of these into a PMC numbered ref, as Ralph did for his, but please make sure the citation in parentheses is
blue, so it’s clear it’s a live link on the final pdf.
Cheers,
Peter
1
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
EcoHealth Alliance leads cutting-edge research into the critical connections between human and wildlife health and
delicate ecosystems. With this science we develop solutions that prevent pandemics and promote conservation.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
2


strains to spillover are rudimentary. No vaccines or therapeutics exist for SARSr-CoVs,
and exposure mitigation strategies are non-existent. SARSr-CoVs are endemic in Asian,
China and have isolated strains capable of producing SARS-like illness in humanized mice
that don’t respond to antibody treatment or vaccination. These viruses are a clear-and-
present danger to our military and to global health security.

hotspots, machine-learning, ecological niche and genotype-phenotype modeling by
incorporating unique datasets to validate and refine hotspot risk maps of viral emergene
in SE Asia and beyond. Our group has shown that bats coexist with lethal viruses by
damping innate immunity pathways, likely as an evolutionary adaptation to flight. We
will use this insight to design strategies, like small molecule Rig like receptor (RLR) or
Toll like receptor (TLR) agonists, to upregulate bat immunity in their cave roosts, down-
regulate viral replication, and reduce the risk of viral shedding and spillover (broadscale
immune boosting strategy). We will complement this by inoculating bats with novel
against specific, high-risk viruses (targeted immune priming strategy), especially when
their immune response is boosted as above. We will design novel methods to deliver
these inocula remotely to reduce exposure risk during decontamination.
overcome these?
assays) in local populations that have high (~3%) seroprevelance to bat SARSr-CoVs.
Identifying Immune boosting and priming inocula: Some of our approaches are novel
SADS-CoV) and potentially other zoonotic bat-origin viruses (Hendra, Nipah, EBOV), with
benefits to livestock production, food security and global public health.

SPACE
SPACE
SPACE
D. Technical Plan:
Overview
Our bat-CoV system has significant advantages for experimentation and
intervention. Firstly, these viruses are fecal-orally transmitted within bat populations, so
sampling can be achieved from fresh fecal pellet collection. They are BSL-3, not -4,
agents, so that experimental manipulation and infection is simpler. They have frequent
spillover events, making it possible to validate predictive models of spillover by sampling
people. They are diverse, with frequent recombination and different strains exhibiting
differential host cell binding and spillover potential. Finally, we have identified SARSr-
CoV strains in a single cave in Yunnan that harbor all of the epidemic SARS-CoV genes.
This specific bat population harbors an ideal evolutionary soup that could produce new
human strains by high frequency RNA recombination, and thus, it presents a perfect
target for next generation, technology-forward intervention strategies.
geographic region
The DEFUSE modeling and analytics team, led by Drs Daszak, Ross, Olival, EHA, will build
ecological niche models of environmental and ecological correlates and traits of cave
proteins will be sequenced, analyzed phylogenetically for recombination events, and
team will reverse-engineer spike proteins to conduct binding assays to human ACE2 (the
this shows ~3% seroprevalence to SARSr-CoVs, using a specific ELISA (14). We will design
LIPS assays to the specific high- and low- zoonotic-risk SARSr-CoVs identified in this
project as we have done previously (15). We will use banked and newly collected human
sera from these populations to test for presence of antibodies to the high- and low-risk
SARSr-CoVs identified by our modeling. We will then model optimal strategies to
maximize inoculation efficacy for TA2, using machine-learning stochastic simulation
modeling informed by field and experimental data to characterize viral circulation
dynamics in bats. We will estimate frequency and population coverage required for our
intervention approaches to suppress viral spillover. We will determine the seasons,
locations within a cave, and delivery methods (spray, swab, or automated cave mouth
or drone) that will be most effective. Finally we will determine the time period
treatment will be effective for, until re-colonization or evolution leads to return of a
high-risk SARSr-CoV.
humans.
We will trial the following, concurrently and competitively, for efficiency, cost
and scalability: i) Universal bat interferon. Aerosol spraying or intranasal inoculation of
IFN or other small molecules reduces viral loads in humans, ferrets and mouse models
(16, 17). Interferon has been used clinically when antiviral drugs are unavailable, e.g.
against filoviruses (18). Replication of SARSr-CoV is sensitive to interferon treatments, as
shown in our previous work (16); ii) Boosting bat IFN by blocking bat-specific IFN
negative regulators. Uniquely, bat IFNA is naturally constitutively expressed but cannot
be induced to a high level (5), indicating a negative regulatory factor in the bat
interferon production pathway. We will use CRISPRi to identify the negative regulator
and then screen for compounds targeting this gene; iii) Activating dampened bat-
specific IFN production pathways which include DNA-STING-dependent and ssRNA-TLR7-
dependent pathways. Our work showing that mutant bat STING restores antiviral
functionality suggests these pathways are important in bat-viral coexistence (4). By
identifying small molecules to directly activate downstream of STING, we will activate
bat interferon and promote viral clearance. A similar strategy will be applied to ssRNA-
TLR7-dependent pathways; iv) Activating functional bat IFN production pathways, e.g.
polyIC to TLR3-IFN pathway or 5’ppp-dsRNA to RIG-I-IFN pathway. A similar strategy has
been demonstrated in a mouse model for SARS-CoV, IAV and HBV (17, 19); v)
Inoculating crude coronavirus fragments to upregulate innate immune responses to
specific CoVs – a partial step towards the targeted immune priming work below.
E. Capabilities:

Citations
& microbe, (2018).
Reports 6, (2016).
Nature 546, 646-650 (2017).
E1012-E1021 (2018).
Natl Acad Sci U S A 113, 3048-3053 (2016).
26, 31-34 (1984).
208, 310-318 (2013).
(2017).
immunology 23, 211-219 (2010).
19949 (2008).
993 (2008).
Commun 8, 1124 (2017).
mBio 4, (2013).
676-679 (2005).
19, 270-273 (2013).
Re: Final draft DARPA abstract

Noam Ross <[email protected]>
Tue 2/13/2018 5:22 AM
To: Peter Daszak <[email protected]>; Luke Hamel <[email protected]>
Cc: Jonathon Musser <[email protected]>; William B. Karesh <[email protected]>; Ralph Baric
([email protected]) <[email protected]>; wang linfa <[email protected]>; Rocke, Tonie E
<[email protected]>; 周鹏 ([email protected]) <[email protected]>; Zhengli Shi ([email protected])
<[email protected]>; Alison Andre <[email protected]>; Aleksei Chmura <[email protected]>;
Anna Willoughby <[email protected]>
Added just a couple of small edits on modeling phrasing, done on top of Tonie's edits.
On Tue, Feb 13, 2018 at 2:47 AM Rocke, Tonie <[email protected]> wrote:
First thing tomorrow, can you go through the references, and create links to the papers on
NCBI. Just turn each reference citation: “(1)” for example, into a live link to the paper on
NCBI. We only have 2 spare lines, so no room to turn each of these into a PMC numbered ref,
as Ralph did for his, but please make sure the citation in parentheses is blue, so it’s clear it’s a
live link on the final pdf.
Ralph, Lina, Peng, Zhengli, Tonie – please give this a quick read to make sure I’ve not said
anything completely wrong. I’ve had to reduce the text a lot to hit the page limit, but I still think
it’s a great proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Dr. Noam Ross
EcoHealth Alliance
New York, NY 10001
+1.212.380.4471 (direct)
+1.212.380.4465 (fax)
@noamross (twitter)



strains to spillover are rudimentary. No vaccines or therapeutics exist for SARSr-CoVs, Deleted: ,
China and have isolated strains capable of producing SARS-like illness in humanized mice Deleted: ,
that don’t respond to antibody treatment or vaccination. These viruses are a clear-and- Deleted: es
present danger to our military and to global health security. Deleted: ,

machine-learning models of spillover hotspots, host-pathogen ecological niches and Deleted: , machine-learning
genotype-phenotype mapping by incorporating unique datasets to validate and refine Deleted: modeling
hotspot risk maps of viral emergence in SE Asia and beyond. Our group has shown that
bats coexist with lethal viruses by damping innate immunity pathways, likely as an
evolutionary adaptation to flight. We will use this insight to design strategies, like small
molecule Rig like receptor (RLR) or Toll like receptor (TLR) agonists, to upregulate bat
immunity in their cave roosts, down-regulate viral replication, and reduce the risk of
viral shedding and spillover (broadscale immune boosting strategy). We will
complement this by inoculating bats with novel chimeric polyvalent recombinant spike
proteins to enhance their immune response against specific, high-risk viruses (targeted
immune priming strategy), especially when their immune response is boosted as above.
We will design novel methods to deliver these inocula remotely to reduce exposure risk
during decontamination.
overcome these?
assays) in local populations that have high (~3%) seroprevelance to bat SARSr-CoVs. Deleted: , who
Identifying Immune boosting and priming inocula: Some of our approaches are novel Deleted: serology
SADS-CoV) and potentially other zoonotic bat-origin viruses (Hendra, Nipah, EBOV), with Deleted: ,

SPACE
SPACE
SPACE
D. Technical Plan:
Overview
geographic region
ecological niche models of environmental and ecological correlates and traits of cave Deleted: ,
proteins will be sequenced, analyzed phylogenetically for recombination events, and Deleted: ,
team will reverse-engineer spike proteins to conduct binding assays to human ACE2 (the Deleted:
this shows ~3% seroprevalence to SARSr-CoVs, using a specific ELISA (14). We will design Deleted: logy
maximize inoculation efficacy for TA2, using stochastic simulation modeling informed Deleted: machine-learning
by field and experimental data to characterize viral circulation dynamics in bats. We will
estimate frequency and population coverage required for our intervention approaches
to suppress viral spillover. We will determine the seasons, locations within a cave, and
delivery methods (spray, swab, or automated cave mouth or drone) that will be most
effective. Finally we will determine the time period treatment will be effective for, until
re-colonization or evolution leads to return of a high-risk SARSr-CoV.
humans.
and scalability: i) Universal bat interferon. Aerosol spraying or intranasal inoculation of
E. Capabilities:

Citations
& microbe, (2018).
Reports 6, (2016).
Nature 546, 646-650 (2017).
E1012-E1021 (2018).
Natl Acad Sci U S A 113, 3048-3053 (2016).
26, 31-34 (1984).
208, 310-318 (2013).
(2017).
immunology 23, 211-219 (2010).
19949 (2008).
993 (2008).
Commun 8, 1124 (2017).
mBio 4, (2013).
676-679 (2005).
19, 270-273 (2013).

Tue 2/13/2018 7:21 AM
To: Wang Linfa <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>
<[email protected]>
Good point Linfa – changed to ‘treatment’ or ‘application’ throughout.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

To: Peter Daszak; Luke Hamel; Jonathon Musser
Cc: William B. Karesh; Noam Ross; Ralph Baric ([email protected]); 周鹏 ([email protected]); Zhengli Shi
([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby; Rocke, Tonie
Subject: RE: Final draft DARPA abstract
Hi Peer,
Thanks
LF

Tel: +65 65168397

Importance: High
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
RE: Final draft abstract

Tue 2/13/2018 7:21 AM
To: peng.zhou <[email protected]>
<[email protected]>; wang linfa <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>;
Alison Andre <[email protected]>; Aleksei Chmura <[email protected]>; Anna Willoughby
Thanks Peng – made the changes now.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
From: peng.zhou [mailto:[email protected]]

To: Peter Daszak
Cc: Luke Hamel; Jonathon Musser; William B. Karesh; Noam Ross; Ralph Baric ([email protected]); wang linfa;
Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby; Rocke, Tonie
Subject: Re: Final draft abstract
Hi, Peter ,
It was really great proposal ! Just a couple of minor issues :
1, at 3, you used "spike protein", for the immune part. But you used "CoV fragments" for
immunization in the actual ta2 part. Please be consistent. Also be consistent if we use CoV
fragments to immunize bats or just "inoculate " (bat or human ).
2, last paragraph : Duke-Nus but not Duke Nus. Prof. Zhengli Shi, rather than Dr. ?
All good for other parts!

Best wishes ,
Peng
周鹏
邮箱：[email protected]
签名由网易邮箱大师定制
在2018年02月13日 13:23，Peter Daszak 写道：
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

Tue 2/13/2018 7:21 AM
<[email protected]>; wang linfa <[email protected]>; 周鹏 ([email protected])
<[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; Alison Andre
<[email protected]>
Great – thanks Tonie and Noam – all changes made now..
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
From: Rocke, Tonie [mailto:[email protected]]

To: Peter Daszak
Cc: Luke Hamel; Jonathon Musser; William B. Karesh; Noam Ross; Ralph Baric ([email protected]); wang linfa;
周鹏 ([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby
First thing tomorrow, can you go through the references, and create links to the papers on NCBI. Just
turn each reference citation: “(1)” for example, into a live link to the paper on NCBI. We only have 2
spare lines, so no room to turn each of these into a PMC numbered ref, as Ralph did for his, but please
make sure the citation in parentheses is blue, so it’s clear it’s a live link on the final pdf.
Ralph, Lina, Peng, Zhengli, Tonie – please give this a quick read to make sure I’ve not said anything
completely wrong. I’ve had to reduce the text a lot to hit the page limit, but I still think it’s a great
proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
health and delicate ecosystems. With this science we develop solutions that prevent pandemics and
promote conservation.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Tue 2/13/2018 7:21 AM
To: Noam Ross <[email protected]>; Luke Hamel <[email protected]>
([email protected]) <[email protected]>; wang linfa <[email protected]>; Rocke, Tonie E
Here’s the Abstract version 4 for your files.
Luke – please do the following ASAP today:
1. Fix the references – remove the endnote links, and use the format: “(1,2)”, but making these blue, and an
embedded hyperlink to the NCBI paper
2. Insert the corrected figure
3. Make sure we have the right format throughout – including grant number etc. at the top
4. Insert the timeline and budget
5. Send it in!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
From: Noam Ross [mailto:[email protected]]

To: Peter Daszak; Luke Hamel
Cc: Jonathon Musser; William B. Karesh; Ralph Baric ([email protected]); wang linfa; Rocke, Tonie; 周鹏
([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby
proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
wildlife health and delicate ecosystems. With this science we develop solutions that prevent pandemics
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Dr. Noam Ross
EcoHealth Alliance

New York, NY 10001
+1.212.380.4471 (direct)
+1.212.380.4465 (fax)
@noamross (twitter)
EcoHealth Alliance leads cutting-edge scientific research into the critical connections between human and wildlife health and delicate
ecosystems. With this science, we develop solutions that prevent pandemics and promote conservation.

priming treatments to upregulate the naturally damped innate immune response of
bats, and lower viral shedding from bats at the site for a few weeks or months, allowing
our warfighters to execute the operation at lowered risk for spillover.

strains to spillover are rudimentary. No vaccines or therapeutics exist for SARSr-CoVs,
China and have isolated strains capable of producing SARS-like illness in humanized mice
that don’t respond to antibody treatment or vaccination. These viruses are a clear-and-
present danger to our military and to global health security.

machine-learning models of spillover hotspots, host-pathogen ecological niches and
genotype-phenotype mapping by incorporating unique datasets to validate and refine
hotspot risk maps of viral emergence in SE Asia and beyond. Our group has shown that
bats coexist with lethal viruses by damping innate immunity pathways, likely as an
evolutionary adaptation to flight. We will use this insight to design strategies, like small
molecule Rig like receptor (RLR) or Toll like receptor (TLR) agonists, to upregulate bat
immunity in their cave roosts, down-regulate viral replication, and reduce the risk of
viral shedding and spillover (broadscale immune boosting strategy). We will
complement this by treating bats with novel chimeric polyvalent recombinant spike
proteins to enhance their immune response against specific, high-risk viruses (targeted
immune priming strategy), especially when their immune response is boosted as above.
We will design novel methods to deliver these applications remotely to reduce exposure
risk during decontamination.
overcome these?
assays) in local populations that have high (~3%) seroprevelance to bat SARSr-CoVs.
Identifying Immune boosting and priming treatments: Some of our approaches are novel
SADS-CoV) and potentially other zoonotic bat-origin viruses (Hendra, Nipah, EBOV), with

SPACE
SPACE
SPACE
D. Technical Plan:
Overview
geographic region
ecological niche models of environmental and ecological correlates and traits of cave
proteins will be sequenced, analyzed phylogenetically for recombination events, and
team will reverse-engineer spike proteins to conduct binding assays to human ACE2 (the
this shows ~3% seroprevalence to SARSr-CoVs, using a specific ELISA (14). We will design
maximize treatment efficacy for TA2, using stochastic simulation modeling informed by
field and experimental data to characterize viral circulation dynamics in bats. We will
estimate frequency and population coverage required for our intervention approaches
to suppress viral spillover. We will determine the seasons, locations within a cave, and
delivery methods (spray, swab, or automated cave mouth or drone) that will be most
effective. Finally we will determine the time period treatment will be effective for, until
re-colonization or evolution leads to return of a high-risk SARSr-CoV.
humans.
has discovered, we will apply immune modulators like bat interferon to live bats, to up-
regulate their naïve immunity and then assess their ability to suppress viral replication
and shedding; 2) Targeted Immune Priming: building on preliminary development of
polyvalent chimeric recombinant SARSr-CoV spike proteins, we will conduct application
trials with live bats to assess suppression of replication and shedding of a broad range of
dangerous SARS-related CoVs.
and scalability: i) Universal bat interferon. Aerosol spraying or intranasal application of
we will seek permission for experimental trials from the Provincial Forestry Department.
We expect to be successful, as we have worked with the Forestry Department
collaboratively for 10 years, with support of the Yunnan CDC, and we are releasing
molecules that are not dangerous to people or wildlife. EHA has a proven track record of
rapidly obtaining IACUC and DoD ACURO approval for bat research.
E. Capabilities:
immune priming treatments based on recombinant spike proteins. Assisted by senior
analyze immunological and virological responses to immune boosting treatments; #3 to
Dr. Zhengli Shi, Wuhan Institute of Virology, to conduct PCR testing, viral discovery and
humanized mouse work, as well as experimental trials on Rhinolophus bats. Her team
will include Dr. Peng Zhou and support staff; #4 to Dr. Tonie Rocke, USGS National

Citations
& microbe, (2018).
Reports 6, (2016).
Nature 546, 646-650 (2017).
E1012-E1021 (2018).
Natl Acad Sci U S A 113, 3048-3053 (2016).
26, 31-34 (1984).
208, 310-318 (2013).
(2017).
immunology 23, 211-219 (2010).
19949 (2008).
993 (2008).
Commun 8, 1124 (2017).
mBio 4, (2013).
676-679 (2005).
19, 270-273 (2013).

Tue 2/13/2018 7:59 AM
To: Peter Daszak <[email protected]>; Noam Ross <[email protected]>; Luke Hamel
<[email protected]>
([email protected]) <[email protected]>; Rocke, Tonie E <[email protected]>; 周鹏 ([email protected])
<[email protected]>
Thanks Peter.
Dear Luke,
It will be good if you can circulate the final/submitted version to us all as well.
Fingers crossed.
LF

Tel: +65 6516 8397

Sent: Tuesday, 13 February, 2018 9:21 PM
To: Noam Ross; Luke Hamel
Cc: Jonathon Musser; William B. Karesh; Ralph Baric ([email protected]); Wang Linfa; Rocke, Tonie; 周鹏
Importance: High
5. Send it in!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.


proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance

New York, NY 10001
Tel. +1 212-380-4473
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Dr. Noam Ross
EcoHealth Alliance
New York, NY 10001
+1.212.380.4471 (direct)
+1.212.380.4465 (fax)
@noamross (twitter)
Re: Final DARPA Exec Summary slide

Luke Hamel <[email protected]>
Tue 2/13/2018 8:19 AM
Cc: Jonathon Musser <[email protected]>; William B. Karesh <[email protected]>; Noam Ross
<[email protected]>; Ralph Baric ([email protected]) <[email protected]>; wang linfa
Anna Willoughby <[email protected]>; Rocke, Tonie E <[email protected]>
Hi Peter,
Jonathon and I will be sure to do a final check on everything. Also, I'm not seeing the final summary
slide. Could you please reattach it?
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Tue, Feb 13, 2018 at 1:03 AM, Peter Daszak <[email protected]> wrote:
Please insert the re-drawn figure, and the budget numbers from Aleksei tomorrow before you
submit
NB –there are other things to check on the Abstract, including budget numbers, timeline, the
references, and then please do a final check on the compliance with DARPA instructions for all!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
From: Peter Daszak

Cc: William B. Karesh; Noam Ross; Ralph Baric ([email protected]); wang linfa; 周鹏
([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura
([email protected]); 'Anna Willoughby ([email protected])'; Rocke, Tonie
Importance: High
First thing tomorrow, can you go through the references, and create links to the papers on NCBI.
Just turn each reference citation: “(1)” for example, into a live link to the paper on NCBI. We
only have 2 spare lines, so no room to turn each of these into a PMC numbered ref, as Ralph did
for his, but please make sure the citation in parentheses is blue, so it’s clear it’s a live link on the
final pdf.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473

Tue 2/13/2018 8:23 AM
Cc: Noam Ross <[email protected]>; Jonathon Musser <[email protected]>; William B. Karesh
<[email protected]>; Rocke, Tonie E <[email protected]>; 周鹏 ([email protected])
<[email protected]>
Absolutely. I'll start on these items right away, Peter.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
5. Send it in!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Dr. Noam Ross
EcoHealth Alliance
New York, NY 10001
+1.212.380.4471 (direct)
+1.212.380.4465 (fax)
@noamross (twitter)

Tue 2/13/2018 8:26 AM
To: Wang Linfa <[email protected]>
Cc: Peter Daszak <[email protected]>; Noam Ross <[email protected]>; Jonathon Musser
<[email protected]>; William B. Karesh <[email protected]>; Ralph Baric
<[email protected]>
Hi Linfa,
I'll be sure to send around the final version once it's complete.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Tue, Feb 13, 2018 at 8:59 AM, Wang Linfa <[email protected]> wrote:
Thanks Peter.
Dear Luke,
Fingers crossed.
LF
Tel: +65 6516 8397

Importance: High
5. Send it in!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Dr. Noam Ross
EcoHealth Alliance
New York, NY 10001
+1.212.380.4471 (direct)
+1.212.380.4465 (fax)
@noamross (twitter)
intended recipient, please delete it and notify us immediately; you should not copy
or use it for any purpose, nor disclose its contents to any other person. Thank you.

Tue 2/13/2018 8:28 AM
To: Luke Hamel <[email protected]>
Cc: Peter Daszak <[email protected]>; Noam Ross <[email protected]>; Jonathon Musser
<[email protected]>; William B. Karesh <[email protected]>; Ralph Baric
<[email protected]>
Thanks

Tel: +65 6516 8397

To: Wang Linfa
Cc: Peter Daszak; Noam Ross; Jonathon Musser; William B. Karesh; Ralph Baric ([email protected]); Rocke,
Tonie; 周鹏 ([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby
Hi Linfa,
I'll be sure to send around the final version once it's complete.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6)
(mobile)
On Tue, Feb 13, 2018 at 8:59 AM, Wang Linfa <[email protected]> wrote:
Thanks Peter.
Dear Luke,
Fingers crossed.
LF

Tel: +65 6516 8397

Importance: High
5. Send it in!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.


proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Dr. Noam Ross
EcoHealth Alliance
New York, NY 10001
+1.212.380.4471 (direct)
+1.212.380.4465 (fax)
@noamross (twitter)
RE: Final DARPA Exec Summary slide

Tue 2/13/2018 10:28 AM
Cc: Jonathon Musser <[email protected]>; William B. Karesh <[email protected]>; Noam Ross
Anna Willoughby <[email protected]>; Rocke, Tonie E <[email protected]>
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

To: Peter Daszak
Cc: Jonathon Musser; William B. Karesh; Noam Ross; Ralph Baric ([email protected]); wang linfa; 周鹏
([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby; Rocke,
Tonie
Subject: Re: Final DARPA Exec Summary slide
Hi Peter,
Jonathon and I will be sure to do a final check on everything. Also, I'm not seeing the final summary
slide. Could you please reattach it?
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Please insert the re-drawn figure, and the budget numbers from Aleksei tomorrow before you submit
NB –there are other things to check on the Abstract, including budget numbers, timeline, the references,
and then please do a final check on the compliance with DARPA instructions for all!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
From: Peter Daszak

Importance: High
proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
Executive Summary: Proposal Title
CONCEPT APPROACH
Provide graphic. Describe new ideas.
IMPACT CONTEXT
Describe need and problem being addressed.
Describe existing approaches; compare to state of
Describe goal.
the art.
Proposed $- $- $-
xHuman Use/ x Animal Use HR001118S0017 PREEMPT

1
CONCEPT Pathogen Prediction: APPROACH
• Host-Pathogen Ecology: Develop host-pathogen ecological niche models based on unique bat and viral data, to
• Binding and Humanized mouse asssays: Utilize team’s unique collaboration between world-class modelers and
recombinant CoVs, and flow of genes within each bat cave via bat movement and migration.
• Validation with Human Sera: Analyze new and existing human serum samples to validate model outputs. Given
Intervention Development: (2 parallel approaches)

• Viral Dynamics: Develop stochastic simulation models to estimate the frequency, efficacy, and population coverage
required for intervention approaches to effectively suppress the viral population.
• Field Deployment and Testing: Uilize team’s expertise in wildlife vaccine delivery to assess and deploy effective
IMPACT CONTEXT
exposure for local communities and their livestock, improving food security Global Health Security.
and other SARS-related pre-pandemic zoonotic strains in Africa, e.g. Nigeria), and potentially other Furthermore, gene drive technology could have far-reaching, negative ecological consequences and its
zoonotic bat-origin viruses (Hendra, Nipah, Ebola viruses). effectiveness cannot be evaluated within the defined Period of Performance.

Proposed $- $- $-
xHuman Use/ x Animal Use HR001118S0017 PREEMPT 2


Thu 2/15/2018 9:05 AM
To: Sleeman, Jonathan M <[email protected]>
Cc: Rocke, Tonie E <[email protected]>
Hi Tonie,
I am fully supportive of this. The proposal is risky and exciting, and would align quite nicely with
your ongoing bat work.
As you stated yesterday in our branch meeting, I agree that we need to be looking for new outside
funding and DARPA is certainly one of those opportunities.
Katie
On Fri, Feb 9, 2018 at 5:42 AM, Sleeman, Jonathan <[email protected]> wrote:
Hi Tonie,
If Katie concurs I am supportive. Peter always has crazy ideas. I would
also like to talk to you about the vampire bat colony when we are both in
the office.
By the way, no one at the NWHC questions the value of the Research
Branch. In fact, it is quite the contrary,
Best wishes,
Jonathan
On Thu, Feb 8, 2018 at 8:27 AM, Rocke, Tonie <[email protected]> wrote:
Hi Katie: As I mentioned to you by phone, I have been asked to
collaborate on a proposal to DARPA with EcoHealth Alliance. I am
forwarding you and Jonathan the first draft I received to keep you in
the loop so you know what is going on. There is alot here I need to
correct (i.e. we don't have a captive Jamaican fruit bat colony but we
are thinking of setting up a vampire bat colony at UW) and I will be
working on editing the draft proposal.
Also, I have been asked to collaborate on a second proposal by
another group (BU emerging infectious disease unit) for the same RFA
that involves morbillivirus and rabies in vampire bats in Latin America,
although I haven't seen a draft of that proposal yet.

At this point, I plan to participate in both proposals as there is no
restriction in that regard, but let me know soon if you have any
questions/concerns. Due date for abstracts is approaching very
rapidly - Feb 13. No guarantee of funding of course, but just the fact
that we are being asked to collaborate on these proposals should be
taken as evidence of the relevance of the NWHC research branch,
which seems to be in question lately. -Tonie
To: "Ralph Baric ([email protected])" <[email protected]>, Wang Linfa
<[email protected]>, "Zhengli Shi ([email protected])" <[email protected]>, "William B.
Karesh" <[email protected]>, "Rocke, Tonie" <[email protected]>
Cc: Luke Hamel <[email protected]>, Jonathon Musser
<[email protected]>, Anna Willoughby <[email protected]>,
"Kevin Olival, PhD" <[email protected]>, Jon Epstein
<[email protected]>, Noam Ross <[email protected]>, Aleksei Chmura
<[email protected]>, Hongying Li <[email protected]>
Dear All,
from a WHO meeting.
Wildlife Health Center, Madison USA, and has worked on wildlife vaccines: plague in prairie
dogs, rabies in Jamaican fruit bats, white nose syndrome in US bats. We needed someone
with expertise in delivery of molecules/vaccines to wildlife because DARPA specifically lay that
out. As you’ll see, Tonie is perfect for our project and will be able to do work at USGS NWHC
and with Zhengli in China to help with TA2
attack. I think that is a perfect fit because 1) it’s his expertise and he has published on it, 2) it
will act as an alternative to the blue-sky and risky immune boosting work that Linfa/Peng have
proposed. I hope you agree!
proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Center Director
6006 Schroeder Road
Madison, WI 53711
Tel: (608) 270 2401
Fax: (608) 270 2415
--
6006 Schroeder Rd
Madison, WI 53711
(608) 270 - 2450 (office)
(608) 381 - 2492 (cell)
(608) 270 - 2415 (fax)
[email protected]
www.nwhc.usgs.gov
Re: RE: Final DARPA Exec Summary slide

石正丽 <[email protected]>
Thu 2/15/2018 8:52 PM
<[email protected]>; wang linfa <[email protected]>; 周鹏 ([email protected])
<[email protected]>; Alison Andre <[email protected]>; Aleksei Chmura
<[email protected]>
Thanks.
-----原始邮件-----
发件人:"Peter Daszak" <[email protected]>
发送时间:2018-02-14 00:28:21 (星期三)
收件人: "Luke Hamel" <[email protected]>
抄送: "Jonathon Musser" <[email protected]>, "William B. Karesh"
<[email protected]>, "Noam Ross" <[email protected]>, "Ralph Baric
([email protected])" <[email protected]>, "wang linfa" <[email protected]>,
"周鹏 ([email protected])" <[email protected]>, "Zhengli Shi ([email protected])"
<[email protected]>, "Alison Andre" <[email protected]>, "Aleksei Chmura"
<[email protected]>, "Anna Willoughby" <[email protected]>,
"Rocke, Tonie" <[email protected]>
主题: RE: Final DARPA Exec Summary slide
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

To: Peter Daszak
Cc: Jonathon Musser; William B. Karesh; Noam Ross; Ralph Baric ([email protected]); wang linfa; 周鹏
([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby; Rocke,
Tonie
Subject: Re: Final DARPA Exec Summary slide
Hi Peter,
Jonathon and I will be sure to do a final check on everything. Also, I'm not seeing the final
summary slide. Could you please reattach it?
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
(b) (6) (mobile)

Please insert the re-drawn figure, and the budget numbers from Aleksei tomorrow before you
submit
NB –there are other things to check on the Abstract, including budget numbers, timeline, the
references, and then please do a final check on the compliance with DARPA instructions for all!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
From: Peter Daszak

Cc: William B. Karesh; Noam Ross; Ralph Baric ([email protected]); wang linfa; 周鹏
([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura
([email protected]); 'Anna Willoughby ([email protected])'; Rocke, Tonie
Importance: High
Just turn each reference citation: “(1)” for example, into a live link to the paper on NCBI. We only
have 2 spare lines, so no room to turn each of these into a PMC numbered ref, as Ralph did for
his, but please make sure the citation in parentheses is blue, so it’s clear it’s a live link on the final
pdf.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
RE: Final draft DARPA abstract, and next steps...

Tue 2/20/2018 3:47 PM
To: Wang Linfa <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>
<[email protected]>
Dear All,
Apologies – forgot to send you the final versions of the abstract and the executive summary slide for your
records…
Re. the total budget – please don’t view that as final – they’re planning to give out $40 million over the 3.5 years
total to anything from 1 to 6 projects. Given that there were probably 3 or 4 other viable teams in the room at the
proposer’s conference, I think that $14.8 million is probably the maximum they would give any project, and it’s
more likely that they’ll fund three or four at 8 million and two or three smaller projects. They’ll hopefully give
some clearer guidance as we move towards a full proposal.
The due date for proposals is March 27th, 4pm EST (NY time). That means we need to start honing in on our plans
for the full proposal. I’m meeting with our team here on Thursday to start working on the next steps, and it would
be good to have calls with all of you this week to start refining the ideas and building out the proposal. Luke will
follow up with times that work for phone calls.
Thanks again for your openness and clever ideas, and I look forward to working with you all to get the best
possible full proposal submitted on time!!!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
From: Peter Daszak

To: 'Wang Linfa'; Luke Hamel; Jonathon Musser
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

Hi Peer,
Thanks
LF

Tel: +65 65168397

Importance: High
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.
ABSTRACT - COVER PAGE
TITLE: PROJECT DEFUSE
FUNDER AND BAA: DARPA – PREEMPT (HR001118S0017)
TECHNICAL & LEAD POINT OF ADMINISTRATIVE POINT OF CONTACT:

CONTACT:
MR. LUKE HAMEL
DR. PETER DASZAK ECOHEALTH ALLIANCE
ECOHEALTH ALLIANCE 460 WEST 34TH STREET
460 WEST 34TH STREET 17TH FLOOR
17TH FLOOR NEW YORK, NY 10001
NEW YORK, NY 10001 Phone: +(b) (6)
Phone: +1.212.380.4474 Fax: +1.212.380.4465
Fax: +1.212.380.4465 (e) [email protected]
(e) [email protected]
LEAD ORGANIZATION: EcoHealth Alliance
PRIMARY SUBCONTRACTORS:
Duke-National University Singapore Medical School

National Wildlife Health Center, United States Geological Survey
University of North Carolina, School of Medicine
Wuhan Institute of Virology
ESTIMATED COST: $14,799,998.00
PROJECT DURATION: 3.5 Years
1

We will defuse the potential for emergence of novel bat-origin high-zoonotic risk SARS-
related coronaviruses. We envisage a scenario whereby the US warfighter is deployed to a
security hotspot in SE Asia. As planners choose sites for the mission, they will use an app we will
design based on machine-learning models of the ecological and evolutionary potential of bat
viruses to spillover. This will allow rapid assessment of the background risk of a site harboring
dangerous zoonotic viruses. If there is no alternative site, a tactical forward team will deploy
automated delivery technology we will develop in caves that harbor bats carrying these viruses.
These devices will release broadscale immune boosting molecules and chimeric polyvalent
spike protein targeted immune priming treatments to upregulate the naturally damped innate
immune response of bats, and lower viral shedding from bats at the site for a few weeks or
months, allowing

Other than PPE, there is no available current technology to reduce the risk of exposure to novel
environmental drivers of their emergence, and of the evolutionary potential of different strains
to spillover are rudimentary. No vaccines or therapeutics exist for SARSr-CoVs, and exposure
mitigation strategies are non-existent. SARSr-CoVs are endemic in Asian, African (1), and
European bats (2) that roost in caves but forage widely at night, shedding virus in their feces
and urine. The limitations of this lack of capacity are significant – we have shown evidence of
recent spillover of SARSr-CoVs into people in China and have isolated strains capable of
producing SARS-like illness in humanized mice that don’t respond to antibody treatment or
vaccination. These viruses are a clear-and-present danger to our military and to global health
security.
3. What is innovative in your approach and how does it compare to current practice and state-
of-the-art (SOA)?
machine-learning models of spillover hotspots, host-pathogen ecological niches and genotype-
phenotype mapping by incorporating unique datasets to validate and refine hotspot risk maps
of viral emergence in SE Asia and beyond. Our group has shown that bats coexist with lethal
viruses by damping innate immunity pathways, likely as an evolutionary adaptation to flight.
We will use this insight to design strategies, like small molecule Rig like receptor (RLR) or Toll
like receptor (TLR) agonists, to upregulate bat immunity in their cave roosts, down-regulate
viral replication, and reduce the risk of viral shedding and spillover (broadscale immune
boosting strategy). We will complement this by treating bats with novel chimeric polyvalent
recombinant spike proteins to enhance their immune response against specific, high-risk
viruses (targeted immune priming strategy), especially when their immune response is boosted
as above. We will design novel methods to deliver these applications remotely to reduce
exposure risk during decontamination.
2
overcome these?
Modeling: Previous models have suffered from a lack of data to validate them. We have access
to unique datasets that will allow us to validate our approach, including biodiversity surveys of
bat caves across S. China, 10+ years of bat viral testing data in China, and 10 other countries
(from NIH-NIAID and USAID EPT PREDICT work). Uniquely, we will validate our models of viral
evolution/spillover risk using human serology (based on LIPS assays) in local populations that
have high (~3%) seroprevalence to bat SARSr-CoVs. Identifying Immune boosting and priming
treatments: Some of our approaches are novel and challenging (e.g. using CRISPRi to find the
negative regulator for bat interferon production), and others are unproven in bats (e.g. Poly IC).
We will begin all immune boosting and priming experiments at the beginning of the project,
running them simultaneously and competitively, so that we field trial only the most efficient,
cost-effective and scalable approaches.
This will have direct relevance to the warfighter. Potential deployment to regions where SARSr-
CoVs exist is high – countries include security hotspots in Asia (e.g. Myanmar, Bangladesh,
Pakistan, Korea, Vietnam), Africa and Eastern Europe. The ability to decontaminate and defuse
these viruses may prevent potentially devastating illness. These technologies could be adapted
to hosts of other bat-origin CoVs (e.g. MERS-CoV, SADS-CoV) and potentially other zoonotic bat-
origin viruses (Hendra, Nipah, EBOV), with benefits to livestock production, food security and
global public health.

Phase I Phase II
Total
(24 months) (18 months)
Proposed $8,414,104 $6,385,894 $14,799,998
D. Technical Plan:
Overview
The SARSr-CoV-bat system, and immune modulation focus: Our group’s 15 yrs work on the
SARSr-CoV – Rhinolophus bat system in China has identified and isolated SARSr-CoVs with
remarkable sequence identity in the spike protein to SARS-CoV (e.g. SCH014 & WIV-1). We have
shown they bind and replicate efficiently in primary human lung airway cells and that chimeras
with SARSr-CoV spike proteins in a SARS-CoV backbone cause SARS-like illness in humanized
mice, with clinical signs that are not reduced by SARS monoclonal therapy or vaccination. We
have identified a single cave site in Yunnan Province where bat SARSr-CoVs contain all the
genetic components of epidemic SARS-CoV (7,8,9). We have now shown that people living up to
6 kilometers from this cave have SARSr-CoV antibodies (3% seroprevalence in 200+ cohort),
suggesting active spillover, and marking these viruses as a clear-and-present danger of a new
SARS-like pandemic. Our work on bat immunology suggests that bats’ unique flying ability has
led to downregulated innate immune genes, and their ability to coexist with viruses such as
3
identified bat-specific constitutively expressed bat interferon, a dampened STING-interferon
production pathway (4, 5), and have identified a series of other innate immunity factors that
are dampened in bats (6).
Our bat-CoV system has significant advantages for experimentation and intervention.
Firstly, these viruses are fecal-orally transmitted within bat populations, so sampling can be
achieved from fresh fecal pellet collection. They are BSL-3, not -4, agents, so that experimental
manipulation and infection is simpler. They have frequent spillover events, making it possible to
validate predictive models of spillover by sampling people. They are diverse, with frequent
recombination and different strains exhibiting differential host cell binding and spillover
potential. Finally, we have identified SARSr-CoV strains in a single cave in Yunnan that harbor all
of the epidemic SARS-CoV genes. This specific bat population harbors an ideal evolutionary
soup that could produce new human strains by high frequency RNA recombination, and thus, it
presents a perfect target for next generation, technology-forward intervention strategies.
human-capable virus will emerge from an animal reservoir residing in a “hot spot” geographic
region
The DEFUSE modeling and analytics team, led by Drs. Daszak, Ross, Olival, EHA, will build
ecological niche models of environmental and ecological correlates and traits of cave bat
communities to predict species composition of bat caves across Southern China, South and SE
Asia. We will then use a series of datasets we have built to produce host-virus risk models for
the region. These include our unique database of bat host-viral relationships (7); biological
inventory data on all bat caves in Southern China; and modeled species distribution data for all
bats. We will parameterize the model with data from three cave sites in Yunnan, China (one
with high-risk SARSr-CoVs, two other control/comparison sites), including: radio- and GPS-
telemetry to identify home range and additional roost sites for each bat species; inventory of
bat population density, distribution and segregation and their daily, weekly and seasonal
changes; viral prevalence and individual viral load; shedding of low- and high-risk SARSr-CoV
strains among bat species, age classes, genders; and telemetry and mark-recapture data to
assess metapopulation structure and inter-cave connectivity. We will test and validate model
predictions of a cave’s viral spillover potential with data from prior PREDICT sampling in 7 other
Asian countries. At the end of Yr 1, we will produce a prototype app for the warfighter that
identifies the likelihood of bats harboring dangerous viral pathogens in a region. The ‘high-risk
bats near me’ app will be updated real-time with surveillance data (e.g. field-deployable iPhone
and android compatible echolocation data) from our project and others, to ground-truth and
fine-tune its predictive capacity.
The Wuhan Institute of Virology team will test bat fecal, oral, blood and urogenital
samples for SARSr-CoVs. We will correlate viral load data from these samples with fresh fecal
pellets from individuals and from tarps laid on cave floors. We will rapidly move to fecal pellet
assays to reduce roost disturbance. SARSr-CoV spike proteins will be sequenced, analyzed
phylogenetically for recombination events, and high-risk viruses (spike proteins close to SARS-
CoV) characterized and isolated. The UNC team will reverse-engineer spike proteins to conduct
4
binding assays to human ACE2 (the SARS-CoV receptor). They will culture SARS-like bat
coronaviruses to distinguish high-risk strains that can replicate in primary human cells and low
risk strains that require exogenous enhancers. Viral spike glycoproteins that bind receptors will
be inserted into SARS-CoV backbones, inoculated into human cells and humanized mice to
assess capacity to cause SARS-like disease, and to be blocked by monoclonal therapies, the
nucleoside analogue inhibitor GS-5734(8) or vaccines against SARS-CoV (8,9,10,11,12,13).
The EHA modeling team will use these data to build models of risk of viral evolution
and spillover. These genotype-to-phenotype machine-learning models will predict viral ability
to infect host cells based on genetic traits and results of receptor binding and mouse infection
assays. Using data on diversity of spike proteins, recombinant CoVs, and flow of genes within
each bat cave via bat movement and migration, we will estimate evolutionary rates, rates of
recombination, and capacity to generate novel strains capable of human infection. Finally,
virus-host relationship and bat home range data will be used to estimate spillover potential -
extending models well beyond our field sites. We will then validate model predictions of viral
spillover risk by 1) conducting spike protein-based binding and cell culture experiments, and 2)
identifying spillover strains in people near our bat cave sites. Our preliminary work on this
shows ~3% seroprevalence to SARSr-CoVs, using a specific ELISA (14). We will design LIPS assays
to the specific high- and low- zoonotic-risk SARSr-CoVs identified in this project as we have
done previously (15). We will use banked and newly collected human sera from these
populations to test for presence of antibodies to the high- and low-risk SARSr-CoVs identified by
our modeling. We will then model optimal strategies to maximize treatment efficacy for TA2,
using stochastic simulation modeling informed by field and experimental data to characterize
viral circulation dynamics in bats. We will estimate frequency and population coverage required
for our intervention approaches to suppress viral spillover. We will determine the seasons,
locations within a cave, and delivery methods (spray, swab, or automated cave mouth or drone)
that will be most effective. Finally we will determine the time period treatment will be effective
TA2: Develop scalable approaches that target and suppress the animal virus in its reservoir(s)
and/or vector(s), to reduce the likelihood of virus transmission into humans.
We will evaluate two approaches to defuse SARS-related CoV spillover potential: 1) Broadscale
Immune Boosting: using the unique immune damping in bats that our group has discovered,
we will apply immune modulators like bat interferon to live bats, to up-regulate their naïve
immunity and then assess their ability to suppress viral replication and shedding; 2) Targeted
Immune Priming: building on preliminary development of polyvalent chimeric recombinant
SARSr-CoV spike proteins, we will conduct application trials with live bats to assess suppression
of replication and shedding of a broad range of dangerous SARS-related CoVs.
Both lines of work will begin in Yr 1 and run parallel. Prof. Linfa Wang (Duke-NUS) will
lead the immune boosting work, building on his pioneering work on bat immunity (3) which
shows that the long-term coexistence of bats and their viruses has led to equilibrium between
viral replication and host immunity. This is likely due to down-regulation of their innate immune
system as a fitness cost of flight (3). The weakened functionality of bat innate immunity factors
like STING, a central DNA-interferon (IFN) sensing molecule, may allow bats to maintain an
5
effective, but not over-response to viruses (4). A similar finding was observed for bat IFNA,
which is less abundant but constitutively expressed without stimulation (5). Given high native
SARSr-CoV load in bats, we aim to boost bat innate immunity through the IFN pathway, break
We will trial the following, concurrently and competitively, for efficiency, cost and
scalability: i) Universal bat interferon. Aerosol spraying or intranasal application of IFN or other
small molecules reduces viral loads in humans, ferrets and mouse models (16, 17). Interferon
has been used clinically when antiviral drugs are unavailable, e.g. against filoviruses (18).
Replication of SARSr-CoV is sensitive to interferon treatments, as shown in our previous work
(16); ii) Boosting bat IFN by blocking bat-specific IFN negative regulators. Uniquely, bat IFNA is
naturally constitutively expressed but cannot be induced to a high level (5), indicating a
negative regulatory factor in the bat interferon production pathway. We will use CRISPRi to
identify the negative regulator and then screen for compounds targeting this gene; iii)
Activating dampened bat-specific IFN production pathways which include DNA-STING-
dependent and ssRNA-TLR7-dependent pathways. Our work showing that mutant bat STING
restores antiviral functionality suggests these pathways are important in bat-viral coexistence
(4). By identifying small molecules to directly activate downstream of STING, we will activate
bat interferon and promote viral clearance. A similar strategy will be applied to ssRNA-TLR7-
dependent pathways; iv) Activating functional bat IFN production pathways, e.g. polyIC to TLR3-
IFN pathway or 5’ppp-dsRNA to RIG-I-IFN pathway. A similar strategy has been demonstrated in
a mouse model for SARS-CoV, IAV and HBV (17, 19); v) Inoculating crude coronavirus fragments
to upregulate innate immune responses to specific CoVs – a partial step towards the targeted
immune priming work below.
Prof. Ralph Baric (UNC) will lead the immune priming work. He will develop recombinant
chimeric spike-proteins (20) from our known SARSr-CoVs, and those we characterize during
project DEFUSE. The structure of the SARS-CoV spike glycoprotein has been solved and the
addition of two proline residues at positions V1060P and L1061P stabilize the prefusion state of
the trimer, including key neutralizing epitopes in the receptor binding domain (21). In parallel,
the spike trimers or the receptor binding domain can be incorporated into alphavirus vectored
or nanoparticle vaccines for delivery, either as aerosols, in baits, or as large droplet delivery
vehicles (11, 22,23,24,25). We will test these in controlled lab conditions, taking the best
candidate forward for testing in the field. We have built recombinant spike glycoproteins
harboring structurally defined domains from SARS epidemic strains, pre-epidemic strains like
SCH014 and zoonotic strains like HKU3. It is anticipated that recombinant S glycoprotein based
vaccines harboring immunogenic blocks across the group 2B coronaviruses will induce broad
scale immune responses that simultaneously reduce genetically heterogeneous virus burdens in
bats, potentially reducing disease risk (and transmission risk to people) in these animals for
longer periods (26, 27).
The immune dampening features are highly conserved in all bat species tested so far.
Duke-NUS has established the only experimental breeding colony of cave bats (Eonycteris
spelaea) in SE Asia. This genus is evolutionarily related to Rhinolophus spp. (the hosts of SARSr-
CoVs), so we have confidence that results will be transferable. Our initial proof-of-concept tests
will be in this experimental colony, extended to a small group of wild-caught Rhinolophus
6
conducting SARS-CoV infection experiments with Rhinolophus sp. bats in the BSL-4 facility at
CSIRO, AAHL (L.Wang, unpublished results).
Finally, work on a delivery method for our immune boosting and priming molecules will
be overseen by Dr. Tonie Rocke at the USGS, National Wildlife Health Center who has
previously developed animal vaccines through to licensure (28). Using locally acquired
insectivorous bats (29, 30) we will assess delivery vehicles and methods including: 1)
transdermally applied nanoparticles; 2) series of sticky edible gels that bats will groom from
themselves and each other; 3) aerosolization via sprayers that could be used in cave settings; 4)
automated sprays triggered by timers and movement detectors at critical cave entry points,
and 5) sprays delivered by remote controlled drone. We have already used simple gels to
vaccinate bats against rabies in the lab (29), and hand delivered these containing biomarkers to
vampire bats in Peru and Mexico to show they are readily consumed and transferred among
bats. In our bat colony, we will trial delivery vehicles using the biomarker rhodamine B (which
marks hair and whiskers upon consumption) to assess uptake. The most optimal approaches
will then be tested on wild bats in our three cave sites in Yunnan Province with the most
successful immunomodulators from TA2. Fieldwork will be conducted under the auspices of Dr.
Yunzhi Zhang (Yunnan CDC, Consultant at EcoHealth Alliance). A small number of bats will be
captured and assayed for viral load and immune function after treatment, but so as not to
disturb the colony, most viral load work will be conducted on fresh fecal pellets collected daily
on the cave floor. EHA has had unique access to these sites for around 10 years, under the
guidance of Drs. Shi and Zhang. In year 1 of project DEFUSE, we will seek permission for
experimental trials from the Provincial Forestry Department. We expect to be successful, as we
have worked with the Forestry Department collaboratively for 10 years, with support of the
Yunnan CDC, and we are releasing molecules that are not dangerous to people or wildlife. EHA
has a proven track record of rapidly obtaining IACUC and DoD ACURO approval for bat research.
E. Capabilities:
research organization focused on emerging zoonotic diseases. The PI, Dr. Peter Daszak, has 25+
years’ experience managing lab, field and modeling research projects on emerging zoonoses.
Dr. Daszak will commit 3 months annually to oversee and coordinate all project activities, and
lead modeling and analytic work for TA1. Dr. Billy Karesh has 40+ years’ experience leading
zoonotic and wildlife disease projects, and will commit 1 month annually to manage
partnership activities and outreach. Dr. Jon Epstein, with 15 years’ experience working
emerging bat zoonoses will coordinate animal trials. Dr. Kevin Olival and Dr. Noam Ross will
manage and conduct the modeling and analytical approaches for this project. Support staff
include field surveillance teams, modeling analysts, and consultants based in Yunnan Province,
China, to oversee field trials. The EHA team has worked extensively with all other collaborators:
Prof. Wang (15+ years); Dr. Shi (15+ years); Prof. Baric (5+ years) and Dr. Rocke (15+ years).
Subcontracts: #1 to Prof. Ralph Baric, UNC, to oversee reverse engineering of SARSr-
CoVs, BSL-3 humanized mouse experimental infections, design and testing of immune priming
treatments based on recombinant spike proteins. Assisted by senior personnel Dr. Tim
7
Sheahan, Dr. Amy Sims, and support staff; #2 to Prof. Linfa Wang, Duke NUS, to oversee the
immune boosting approach, captive bat experiments, and analyze immunological and
virological responses to immune boosting treatments; #3 to Dr. Zhengli Shi, Wuhan Institute of
Virology, to conduct PCR testing, viral discovery and isolation from bat samples collected in
China, spike protein binding assays, and some humanized mouse work, as well as experimental
trials on Rhinolophus bats. Her team will include Dr. Peng Zhou and support staff; #4 to Dr.
Tonie Rocke, USGS National Wildlife Health Center, to refine delivery mechanisms for both
immune boosting and immune priming treatments. With a research technician, Dr. Rocke will
use a captive colony of bats at NWHC for initial trials, and oversee cave experiments in China.

Dr. Peter Daszak is President and Chief Scientist of EcoHealth Alliance, a US-based research
organization focused on emerging zoonotic diseases. His >300 scientific papers include the first
global map of EID hotspots (31, 32), estimates of unknown viral diversity (33), predictive models
of virus-host relationships (7), and evidence of the bat origin of SARS-CoV (34, 35) and other
emerging viruses (36,37,38,39). He is Chair of the NASEM Forum on Microbial Threats, and is a
member of the Executive Committee and the EHA institutional lead for the $130 million USAID-
EPT-PREDICT. He serves on the NRC Advisory Committee to the USGCRP, the DHS CEEZAD
External Advisory Board, the WHO R&D Blueprint Pathogen Prioritization expert group, and has
advised the Director for Medical Preparedness Policy on the White House National Security
Staff on global health issues. Dr. Daszak won the 2000 CSIRO medal for collaborative research.
Prof. Ralph Baric is a UNC Lineberger Comprehensive Cancer Center member and Professor in
the UNC-Chapel Hill Dept. of Epidemiology and Dept. of Microbiology & Immunology. His work
focuses on coronaviruses as models to study the genetics of RNA virus transcription, replication,
persistence, cross species transmission and pathogenesis. His group has developed a platform
strategy to access the potential “pre-epidemic” risk associated with zoonotic virus cross species
transmission potential and evaluation of countermeasure potential to control future outbreaks
of disease (8,9,10,11,12,13).
8
CONCEPT
Host-Pathogen Prediction
Intervention Development Host-Pathogen Prediction: APPROACH
Host-Pathogen Niche Modeling Immune boosting • Host-Pathogen Ecology: Develop host-pathogen ecological niche models based on unique bat and viral data, to
Assays in humanized mice Immune priming • Binding and Humanized mouse assays: Utilize team’s unique collaboration between world-class modelers and
Machine learning genotype-phenotype Captive experiments recombinant CoVs, and flow of genes within each bat cave via bat movement and migration.
mapping • Validation with Human Sera: Analyze new and existing human serum samples to validate model outputs. Given
Modeling recombination and evolution Simulating host-viral dynamics Intervention Development: (2 parallel approaches)
Validate models using human Field testing and deployment • Viral Dynamics: Develop stochastic simulation models to estimate the frequency, efficacy, and population coverage
serology required for intervention approaches to effectively suppress the viral population.
• Field Deployment and Testing: Utilize team’s expertise in wildlife vaccine delivery to assess and deploy effective
IMPACT CONTEXT
exposure for local communities and their livestock, improving food security and Global Health Security.
and other SARS-related pre-pandemic zoonotic strains in Africa, e.g. Nigeria), and potentially other zoonotic Furthermore, gene drive technology could have far-reaching, negative ecological consequences and its
bat-origin viruses (Hendra, Nipah, Ebola viruses). effectiveness cannot be evaluated within the defined Period of Performance.
Proposed $8,414,104 $6,385,894 $14,799,998
xHuman Use/ x Animal Use

HR001118S0017 PREEMPT 1
Re: RE: Final draft DARPA abstract, and next steps...

石正丽 <[email protected]>
Tue 2/20/2018 8:55 PM
Cc: Wang Linfa <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>; William B. Karesh <[email protected]>; Noam Ross
<[email protected]>; Ralph Baric ([email protected]) <[email protected]>; 周鹏
<[email protected]>
Thanks, fingers crossed.
-----原始邮件-----
发送时间:2018-02-21 05:47:14 (星期三)
收件人: "Wang Linfa" <[email protected]>, "Luke Hamel"
<[email protected]>, "Jonathon Musser" <[email protected]>
抄送: "William B. Karesh" <[email protected]>, "Noam Ross"
<[email protected]>, "Ralph Baric ([email protected])" <[email protected]>,
主题: RE: Final draft DARPA abstract, and next steps...
Dear All,
Apologies – forgot to send you the final versions of the abstract and the executive summary slide
for your records…
Re. the total budget – please don’t view that as final – they’re planning to give out $40 million
over the 3.5 years total to anything from 1 to 6 projects. Given that there were probably 3 or 4
other viable teams in the room at the proposer’s conference, I think that $14.8 million is probably
the maximum they would give any project, and it’s more likely that they’ll fund three or four at 8
million and two or three smaller projects. They’ll hopefully give some clearer guidance as we
move towards a full proposal.
The due date for proposals is March 27th, 4pm EST (NY time). That means we need to start
honing in on our plans for the full proposal. I’m meeting with our team here on Thursday to start
working on the next steps, and it would be good to have calls with all of you this week to start
refining the ideas and building out the proposal. Luke will follow up with times that work for
phone calls.
Thanks again for your openness and clever ideas, and I look forward to working with you all to get
the best possible full proposal submitted on time!!!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
From: Peter Daszak

Cc: William B. Karesh; Noam Ross; Ralph Baric ([email protected]); 周鹏 ([email protected]); Zhengli
Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna Willoughby; Rocke, Tonie

Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473

Hi Peer,
Nothing to add a or change, other than an English question: we used “dampened immunity of
bats” in most places, but you use the expression of “damping innate immunity pathways” on page
1. Is there a difference between “damping” and “dampening”?
Thanks
LF

Tel: +65 65168397

To: Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>
Cc: William B. Karesh <[email protected]>; Noam Ross
<[email protected]>; Ralph Baric ([email protected]) <[email protected]>;
Wang Linfa <[email protected]>; 周鹏 ([email protected])
<[email protected]>; Aleksei Chmura <[email protected]>; Anna
Willoughby <[email protected]>; Rocke, Tonie <[email protected]>
Importance: High
pdf.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
Re: Final draft DARPA abstract, and next steps...

Tue 2/20/2018 9:10 PM
To: Peter Daszak <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser <[email protected]>
Cc: William B. Karesh <[email protected]>; Noam Ross <[email protected]>; Ralph Baric ([email protected]) <[email protected]>; 周鹏
([email protected]) <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; Alison Andre <[email protected]>; Aleksei Chmura
<[email protected]>; Anna Willoughby <[email protected]>; Rocke, Tonie E <[email protected]>
Thanks and fingers crossed!

Tel: +65 65168397

Date: Wednesday, 21 February 2018 at 5:47 AM
To: Wang Linfa <[email protected]>, Luke Hamel <[email protected]>, Jonathon Musser <[email protected]>
Cc: William Karesh <[email protected]>, Noam Ross <[email protected]>, Ralph Baric <[email protected]>, 周鹏
<[email protected]>, zlshi <[email protected]>, Alison Andre <[email protected]>, Aleksei Chmura <[email protected]>, Anna
Willoughby <[email protected]>, Tonie Rocke <[email protected]>
Subject: RE: Final draft DARPA abstract, and next steps...
Dear All,
Apologies – forgot to send you the final versions of the abstract and the executive summary slide for your records…
Re. the total budget – please don’t view that as final – they’re planning to give out $40 million over the 3.5 years total to anything from 1 to 6 projects. Given that there were
probably 3 or 4 other viable teams in the room at the proposer’s conference, I think that $14.8 million is probably the maximum they would give any project, and it’s more likely
that they’ll fund three or four at 8 million and two or three smaller projects. They’ll hopefully give some clearer guidance as we move towards a full proposal.
The due date for proposals is March 27th, 4pm EST (NY time). That means we need to start honing in on our plans for the full proposal. I’m meeting with our team here on
Thursday to start working on the next steps, and it would be good to have calls with all of you this week to start refining the ideas and building out the proposal. Luke will follow
up with times that work for phone calls.
Thanks again for your openness and clever ideas, and I look forward to working with you all to get the best possible full proposal submitted on time!!!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
EcoHealth Alliance leads cutting-edge research into the critical connections between human and wildlife health and delicate ecosystems. With this science we develop solutions
that prevent pandemics and promote conservation.
From: Peter Daszak

Cc: William B. Karesh; Noam Ross; Ralph Baric ([email protected]); 周鹏 ([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna
Willoughby; Rocke, Tonie
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473

Cc: William B. Karesh; Noam Ross; Ralph Baric ([email protected]); 周鹏 ([email protected]); Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura; Anna
Willoughby; Rocke, Tonie
Hi Peer,
Nothing to add a or change, other than an English question: we used “dampened immunity of bats” in most places, but you use the expression of “damping innate immunity
pathways” on page 1. Is there a difference between “damping” and “dampening”?
Thanks
LF

Tel: +65 65168397

Cc: William B. Karesh <[email protected]>; Noam Ross <[email protected]>; Ralph Baric ([email protected]) <[email protected]>; Wang Linfa
<[email protected]>; 周鹏 ([email protected]) <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; Alison Andre
<[email protected]>; Aleksei Chmura <[email protected]>; Anna Willoughby <[email protected]>; Rocke, Tonie <[email protected]>
Importance: High
First thing tomorrow, can you go through the references, and create links to the papers on NCBI. Just turn each reference citation: “(1)” for example, into a live link to the paper
on NCBI. We only have 2 spare lines, so no room to turn each of these into a PMC numbered ref, as Ralph did for his, but please make sure the citation in parentheses is blue, so
it’s clear it’s a live link on the final pdf.
Ralph, Lina, Peng, Zhengli, Tonie – please give this a quick read to make sure I’ve not said anything completely wrong. I’ve had to reduce the text a lot to hit the page limit, but I
still think it’s a great proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
Important: This email is confidential and may be privileged. If you are not the intended recipient, please delete it and notify us immediately; you should not copy or use it for any purpose, nor disclose its contents to any other person. Thank
you.
Important: This email is confidential and may be privileged. If you are not the intended recipient, please delete it and notify us
immediately; you should not copy or use it for any purpose, nor disclose its contents to any other person. Thank you.
Re: RE: Final draft DARPA abstract, and next steps...

周鹏 <[email protected]>
Wed 2/21/2018 1:29 AM
Cc: Wang Linfa <[email protected]>; Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>; William B. Karesh <[email protected]>; Noam Ross
<[email protected]>; Ralph Baric ([email protected]) <[email protected]>; Zhengli Shi
<[email protected]>
Thanks and fingers crossed!
By the way, there is a tiny mistake on the first line of page

7: "sinicus bats at Wuhan Institute of Zoology", should be
Wuhan institute of virology. Hope this won't affect too
much...
Cheers,
Peng
-----原始邮件-----
发送时间:2018-02-21 05:47:14 (星期三)
收件人: "Wang Linfa" <[email protected]>, "Luke Hamel"
<[email protected]>, "Jonathon Musser" <[email protected]>
抄送: "William B. Karesh" <[email protected]>, "Noam Ross"
<[email protected]>, "Ralph Baric ([email protected])" <[email protected]>,
主题: RE: Final draft DARPA abstract, and next steps...
Dear All,
Apologies – forgot to send you the final versions of the abstract and the executive summary slide
for your records…
Re. the total budget – please don’t view that as final – they’re planning to give out $40 million
over the 3.5 years total to anything from 1 to 6 projects. Given that there were probably 3 or 4
other viable teams in the room at the proposer’s conference, I think that $14.8 million is probably
the maximum they would give any project, and it’s more likely that they’ll fund three or four at 8
million and two or three smaller projects. They’ll hopefully give some clearer guidance as we
move towards a full proposal.
The due date for proposals is March 27th, 4pm EST (NY time). That means we need to start
honing in on our plans for the full proposal. I’m meeting with our team here on Thursday to start
working on the next steps, and it would be good to have calls with all of you this week to start
refining the ideas and building out the proposal. Luke will follow up with times that work for
phone calls.
Thanks again for your openness and clever ideas, and I look forward to working with you all to get
the best possible full proposal submitted on time!!!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
From: Peter Daszak

Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473

Hi Peer,
Nothing to add a or change, other than an English question: we used “dampened immunity of
bats” in most places, but you use the expression of “damping innate immunity pathways” on page
1. Is there a difference between “damping” and “dampening”?
Thanks
LF

Tel: +65 65168397

To: Luke Hamel <[email protected]>; Jonathon Musser
<[email protected]>
Cc: William B. Karesh <[email protected]>; Noam Ross
<[email protected]>; Ralph Baric ([email protected]) <[email protected]>;
Wang Linfa <[email protected]>; 周鹏 ([email protected])

<[email protected]>; Aleksei Chmura <[email protected]>; Anna
Willoughby <[email protected]>; Rocke, Tonie <[email protected]>
Importance: High
pdf.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
 Inbox   Luke Hamel    Meet NowRE

Salton Sea

 RE: RE: Final draft DARPA
RE: RE: Finalabstract, and next
draft DARPA steps...
abstract,
Starred 6
and next steps...

WDA  This message was sent with High importance.
Wed 2/21/2018 11:01 AM
 New folder
PD
Peter Daszak To: 周鹏
<[email protected]>
     
<daszak@ecohealthalliance.
Cc: Wang Linfa <[email protected]>; Luke
 In-Place Archiv… org> Hamel <[email protected]>; Jonathon

Wed 2/21/2018 11:01Musser
AM <[email protected]>; William B.
To: 周鹏 Karesh <[email protected]>; Noam Ross
<[email protected]>
Archive 1 <[email protected]>;
Cc: Wang Linfa <[email protected]>; Luke Ralph
HamelBaric
<hamel@eco
 Archives Ouch – great that you spotted
Zhengli that mistake and
Shi ([email protected]) I’ll definitely Alison
<[email protected]>;
Andre <[email protected]>;
change that in the full proposal! Aleksei Chmura
<[email protected]>; Anna Willoughby
Deleted It… 372 <[email protected]>; Rocke, Tonie E
<[email protected]>
Drafts Ouch – great that you spotted that mistake and
I’ll definitely change that in the full proposal!
Important 4820
Cheers,
Inbox 41762
Peter
press contacts
Cheers,
reviews
Peter Daszak
President Peter
RGEG
Sent Items 195 EcoHealth Alliance

Peter Daszak
Starred 35 New York, NY 10001
President
New folder Tel. +1 212-380-4473
EcoHealth Alliance
 Groups EcoHealth AllianceNew
leadsYork, NY 10001research into the critical
cutting-edge
connections between human and wildlife health and delicate
Tel. science
ecosystems. With this +1 212-380-4473
we develop solutions that
Rocke Lab 2
RGE Women'… 7
EcoHealth Alliance leads cutting-edge research
From: 周鹏 [mailto:[email protected]]
Invasive Sp… 47 Sent: Wednesday,into the critical
February connections
21, 2018 2:30 AMbetween human and
To: Peter Daszak wildlife health and delicate ecosystems. With this
science
Cc: Wang Linfa; Luke we develop
Hamel; Jonathonsolutions
Musser; that prevent
William B.
Discover groups
Karesh; Noam Ross; pandemics and([email protected]);
Ralph Baric promote conservation.
Manage groups Zhengli Shi ([email protected]); Alison Andre; Aleksei Chmura;
周鹏 [mailto:[email protected]]
From: Tonie
Anna Willoughby; Rocke,
Sent: Wednesday, February 21, 2018 2:30 AM
PREEMPT call with Peter

Mon 2/26/2018 9:05 AM
Hi Tonie,
My name is Luke Hamel and I am a Program Assistant at EcoHealth Alliance, helping to coordinate
efforts for DARPA PREEMPT. As the full project proposal is due March 27th, Peter was hoping to
speak with you in order to discuss further details of the proposal and establish a timeline for
moving forward.
While I know this is very short notice, would you be free this Tue. 2/27 @ 9 AM (OR) 1 PM (ET) to
speak with Peter? If you are not available, could you please let me know when a convenient time
would be for you? Thank you very much.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6)
(mobile)
For our DARPA PREEMPT conversations this week: HR001118S0017-PREEMPT-PA-

001 Proposal Abstract Status
Peter Daszak
Tue 2/27/2018 1:13 PM
<[email protected]>
To: Zhengli Shi ([email protected]) <[email protected]>; Ralph Baric ([email protected]) <[email protected]>; 周鹏
([email protected]) <[email protected]>; Wang Linfa <[email protected]>; Rocke, Tonie E
<[email protected]>
Cc: Danielle Anderson ([email protected]) <[email protected]>;
[email protected] <[email protected]>; [email protected]
<[email protected]>; [email protected] <[email protected]>; Luke Hamel
<[email protected]>
Dear All,
Good news from DARPA - they like our abstract and we're officially invited for a full proposal. From
the attached letter, it looks like they've got a lot of proposals asking for too much $$$, but there are
some clear ways we can hedge against any possible cuts. We can talk further about this, and about
fleshing out the technical details on our calls this week.
I'm working on scheduling a call with the DARPA team for Thursday of Friday this week - 15 mins to
go through how these bullets in the letter above will affect our full proposal. It'll just be me and Luke,
but we can think about key questions to ask them..
Re. the full proposal. Luke has taken the abstract text and started populating the full proposal
framework (attached), to give us an idea of what we need to write. It's not a huge effort, but it'll have
to be technically sound, but still tell the overall 'story' that DARPA want to hear - i.e. we can provide
proof-of-concept of blocking spillover based on this novel and interesting approach.
Look forward to talking with all of you.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
-----Original Message-----
From: PREEMPT [mailto:[email protected]]
Sen 8:51 AM
To: (b) (6)
Cc: (b) (6)

Subject: HR001118S0017-PREEMPT-PA-001 Proposal Abstract Status
(b) (6) :
Thank you for your interest in the Biological Technologies Office's PREventing EMerging Pathogenic
Threats (PREEMPT) program. Please find your proposal abstract status attached.
Regards,
BAA Coordinator
Contractor Support to DARPA/BTO
[email protected]
(b) (4), (b) (5), (b) (6)
(b) (4), (b) (5), (b) (6)
DARPA – PREEMPT PROPOSAL OUTLINE
NOTE: 36 pages max - 12 pt. font or higher (font can be smaller for tables, charts, figures)
VOLUME I – Technical and Management Proposal
Section I – Administrative
A) Cover Page (labeled “Proposal: Volume I”)
B) Official Transmittal Letter
Section II – Detailed Proposal Information
A) Executive Summary (questions/answers below from abstract). Commented [EA1]: Perhaps some of the more
detailed information in this section could be moved to the
‘Goals and Impacts’ section
1) What is the proposed work attempting to accomplish or do?
months, allowing
2) How is it done today, and what are the limitations?
security.
3) What is innovative in your approach?
4) What are the key technical challenges in your approach and how do you plan to overcome
these?
5) Who or what will be affected and what will be the impact?
B) Executive Summary Slide (must use provided template)
C) Goals and Impact Commented [EA2]: Detailed text from the ‘Executive
Summary’ section may be better suited here
• Clearly describe what the team is trying to achieve and the difference it will make
(qualitatively and quantitatively) if successful.
• Describe the innovative aspects of the project in the context of existing capabilities and
approaches, clearly delineating the uniqueness and benefits of this project in the context of
the state of the art, alternative approaches, and other projects from the past and present.
• Describe how the proposed project is revolutionary and how it significantly rises above the
current state of the art.
• Describe the deliverables associated with the proposed project and any plans to
commercialize the technology, transition it to a customer, or further the work.
Overview
remarkable sequence identity in the spike protein to SARS-CoV (e.g. SCH014 & WIV-1). We
have shown they bind and replicate efficiently in primary human lung airway cells and that
chimeras with SARSr-CoV spike proteins in a SARS-CoV backbone cause SARS-like illness in
humanized mice, with clinical signs that are not reduced by SARS monoclonal therapy or
vaccination. We have identified a single cave site in Yunnan Province where bat SARSr-CoVs
contain all the genetic components of epidemic SARS-CoV (7,8,9). We have now shown that
people living up to 6 kilometers from this cave have SARSr-CoV antibodies (3% seroprevalence
in 200+ cohort), suggesting active spillover, and marking these viruses as a clear-and-present
danger of a new SARS-like pandemic. Our work on bat immunology suggests that bats’
unique flying ability has led to downregulated innate immune genes, and their ability to coexist
with viruses such as SARSr-CoVs, henipa- and filoviruses that are lethal in many other
mammals (3). We have identified bat-specific constitutively expressed bat interferon, a
dampened STING-interferon production pathway (4, 5), and have identified a series of other
innate immunity factors that are dampened in bats (6).
Our bat-CoV system has significant advantages for experimentation and intervention. Firstly,
these viruses are fecal-orally transmitted within bat populations, so sampling can be achieved
from fresh fecal pellet collection. They are BSL-3, not -4, agents, so that experimental
potential. Finally, we have identified SARSr-CoV strains in a single cave in Yunnan that harbor
all of the epidemic SARS-CoV genes. This specific bat population harbors an ideal evolutionary
D) Technical Plan
• Outline and address technical challenges inherent in the approach and possible solutions for
overcoming potential problems.
• Provide appropriate measurable milestones (quantitative if possible) and program metrics
(see “metrics” attachment) at intermediate stages of the program to demonstrate progress,
and a plan for achieving the milestones.
• Demonstrate a deep understanding of the technical challenges.
• Present a credible (even if risky) plan to achieve the program goal.
• Discuss mitigation of technical risk.
• Address TA1 and TA2 proposal content requirements (see “objectives” attachment)
geographic region
The DEFUSE modeling and analytics team, led by Drs. Daszak, Ross, Olival, EHA, will
build ecological niche models of environmental and ecological correlates and traits of cave bat
Asia. We will then use a series of datasets we have built to produce host-virus risk models for the
region. These include our unique database of bat host-viral relationships (7); biological inventory
data on all bat caves in Southern China; and modeled species distribution data for all bats. We
will parameterize the model with data from three cave sites in Yunnan, China (one with high-risk
SARSr-CoVs, two other control/comparison sites), including: radio- and GPS-telemetry to
identify home range and additional roost sites for each bat species; inventory of bat population
density, distribution and segregation and their daily, weekly and seasonal changes; viral
prevalence and individual viral load; shedding of low- and high-risk SARSr-CoV strains among
bat species, age classes, genders; and telemetry and mark-recapture data to assess
metapopulation structure and inter-cave connectivity. We will test and validate model predictions
of a cave’s viral spillover potential with data from prior PREDICT sampling in 7 other Asian
countries. At the end of Yr 1, we will produce a prototype app for the warfighter that identifies
the likelihood of bats harboring dangerous viral pathogens in a region. The ‘high-risk bats near
me’ app will be updated real-time with surveillance data (e.g. field-deployable iPhone and
android compatible echolocation data) from our project and others, to ground-truth and fine-tune
its predictive capacity.
The Wuhan Institute of Virology team will test bat fecal, oral, blood and urogenital samples
for SARSr-CoVs. We will correlate viral load data from these samples with fresh fecal pellets
from individuals and from tarps laid on cave floors. We will rapidly move to fecal pellet assays
to reduce roost disturbance. SARSr-CoV spike proteins will be sequenced, analyzed
binding assay to human ACE2 (the SARS-CoV receptor). They will culture SARS-like bat
nucleoside analogue inhibitor GS-5734(8)or vaccines against SARS-CoV(8,9,10,11,12,13).
The EHA modeling team will use these data to build models of risk of viral evolution and
spillover. These genotype-to-phenotype machine-learning models will predict viral ability to
infect host cells based on genetic traits and results of receptor binding and mouse infection
recombination, and capacity to generate novel strains capable of human infection. Finally, virus-
host relationship and bat home range data will be used to estimate spillover potential-extending
models well beyond our field sites. We will then validate model predictions of viral spillover
risk by 1) conducting spike protein-based binding and cell culture experiments, and 2)
shows ~3% seroprevalence to SARSr-CoVs, using a specific ELISA (14).We will design LIPS
assays to the specific high-and low-zoonotic-risk SARSr-CoVs identified in this project as we
have done previously(15).We will use banked and newly collected human sera from these
populations to test for presence of antibodies to the high-and low-risk SARSr-CoVs identified by
our modeling. We will then model optimal strategies to maximize treatment efficacy for
TA2,using stochastic simulation modeling informed by field and experimental data to
characterize viral circulation dynamics in bats. We will estimate frequency and population
coverage required for our intervention approaches to suppress viral spillover. We will determine
the seasons, locations within a cave, and delivery methods (spray, swab, or automated cave
mouth or drone)that will be most effective. Finally we will determine the time period treatment
will be effective for, until re-colonization or evolution leads to return of a high-risk SARSr-CoV.
reservoir(s)and/or vector(s), to reduce the likelihood of virus transmission into humans.
Broadscale Immune Boosting: using the unique immune damping in bat that our group has
discovered, we will apply immune modulators like bat interferon to live bats, to up-regulate their
naïve immunity and then assess their ability to suppress viral replication and shedding;2)
Targeted Immune Priming: building on preliminary development of polyvalent chimeric
recombinant SARSr-CoV spike proteins, we will conduct application trials with live bats to
assess suppression of replication and shedding of abroad range of dangerous SARS-related
CoVs.
Both lines of work will begin in Yr 1and run parallel. Prof. Linfa Wang (Duke-NUS) will
small molecules reduces viral loads in humans, ferrets and mouse models (16, 17). Interferon has
been used clinically when antiviral drugs are unavailable, e.g. against filoviruses (18).
(16); ii) Boosting bat IFN by blocking bat-specific IFN negative regulators. Uniquely, bat IFNA
is naturally constitutively expressed but cannot be induced to a high level (5), indicating a
identify the negative regulator and then screen for compounds targeting this gene; iii) Activating
dampened bat-specific IFN production pathways which include DNA-STING-dependent and
ssRNA-TLR7-dependent pathways. Our work showing that mutant bat STING restores antiviral
functionality suggests these pathways are important in bat-viral coexistence (4). By identifying
small molecules to directly activate downstream of STING, we will activate bat interferon and
promote viral clearance. A similar strategy will be applied to ssRNA-TLR7-dependent pathways;
iv) Activating functional bat IFN production pathways, e.g. polyIC to TLR3-IFN pathway or
5’ppp-dsRNA to RIG-I-IFN pathway. A similar strategy has been demonstrated in a mouse
model for SARS-CoV, IAV and HBV (17, 19); v) Inoculating crude coronavirus fragments to
upregulate innate immune responses to specific CoVs – a partial step towards the targeted
the spike trimers or the receptor binding domain can be incorporated into alphavirus vectored or
nanoparticle vaccines for delivery, either as aerosols, in baits, or as large droplet delivery
The immune dampening features are highly conserved in all bat species tested so far. Duke-
NUS has established the only experimental breeding colony of cave bats (Eonycteris spelaea) in
SE Asia. This genus is evolutionarily related to Rhinolophus spp. (the hosts of SARSr-CoVs), so
we have confidence that results will be transferable. Our initial proof-of-concept tests will be in
this experimental colony, extended to a small group of wild-caught Rhinolophus sinicus bats at
Wuhan Institute of Zoology. We (Prof. Wang) have previous experience conducting SARS-CoV
infection experiments with Rhinolophus sp. bats in the BSL-4 facility at CSIRO, AAHL (L.Wang,
unpublished results).
Finally, work on a delivery method for our immune boosting and priming molecules will be
overseen by Dr. Tonie Rocke at the USGS, National Wildlife Health Center who has previously
developed animal vaccines through to licensure (28). Using locally acquired insectivorous bats
(29, 30) we will assess delivery vehicles and methods including: 1) transdermally applied
nanoparticles; 2) series of sticky edible gels that bats will groom from themselves and each
other; 3) aerosolization via sprayers that could be used in cave settings; 4) automated sprays
triggered by timers and movement detectors at critical cave entry points, and 5) sprays
delivered by remote controlled drone. We have already used simple gels to vaccinate bats
against rabies in the lab (29), and hand delivered these containing biomarkers to vampire bats
in Peru and Mexico to show they are readily consumed and transferred among bats. In our bat
colony, we will trial delivery vehicles using the biomarker rhodamine B (which marks hair and
whiskers upon consumption) to assess uptake. The most optimal approaches will then be
tested on wild bats in our three cave sites in Yunnan Province with the most successful
immunomodulators from TA2. Fieldwork will be conducted under the auspices of Dr. Yunzhi
Zhang (Yunnan CDC, Consultant at EcoHealth Alliance). A small number of bats will be captured
and assayed for viral load and immune function after treatment, but so as not to disturb the
colony, most viral load work will be conducted on fresh fecal pellets collected daily on the cave
floor. EHA has had unique access to these sites for around 10 years, under the guidance of Drs.
Shi and Zhang. In year 1 of project DEFUSE, we will seek permission for experimental trials
from the Provincial Forestry Department. We expect to be successful, as we have worked with
the Forestry Department collaboratively for 10 years, with support of the Yunnan CDC, and we
are releasing molecules that are not dangerous to people or wildlife. EHA has a proven track
E) Management Plan
• Provide a summary of expertise of the team, including any subcontractors, and key personnel
who will be doing the work. Resumes count against the page count.
• Identify a principal investigator for the project.
• Provide a clear description of the team’s organization
• Include an organization chart with the following information, as applicable:

A) Programmatic relationship of team members
B) Unique capabilities of team members
C) Task responsibilities of team members
D) Teaming strategy among the team members
E) Key personnel with amount of effort to be expended by each during each year
• Provide a detailed plan for coordination including explicit guidelines for interaction among
collaborators/subcontractors of the proposed effort.
• Include risk management approaches.
• Describe any formal teaming agreements that are required to execute this program.
Subcontracts: #1 to Prof. Ralph Baric, UNC, to oversee reverse engineering of SARSr-CoVs,
BSL-3 humanized mouse experimental infections, design and testing of immune priming
treatments based on recombinant spike proteins. Assisted by senior personnel Dr. Tim
Sheahan, Dr. Amy Sims, and support staff; #2 to Prof. Linfa Wang, Duke NUS, to oversee the
immune boosting approach, captive bat experiments, and analyze immunological and
virological responses to immune boosting treatments; #3 to Dr. Zhengli Shi, Wuhan
Institute of Virology, to conduct PCR testing, viral discovery and isolation from bat samples
collected in China, spike protein binding assays, and some humanized mouse work, as well
as experimental trials on Rhinolophus bats. Her team will include Dr. Peng Zhou and
support staff; #4 to Dr. Tonie Rocke, USGS National Wildlife Health Center, to refine
delivery mechanisms for both immune boosting and immune priming treatments. With a
research technician, Dr. Rocke will use a captive colony of bats at NWHC for initial trials,
and oversee cave experiments in China.
of disease (8,9,10,11,12,13).
F) Capabilities
• Describe organizational experience in relevant subject area(s), existing intellectual property,
specialized facilities, and any Government-furnished materials or information.
• Discuss any work in closely related research areas and previous accomplishments.
(The following information was taken from the ‘Goals and Impact’ section of the document).
the SARSr-CoV – Rhinolophus bat system in China has identified and isolated SARSr-CoVs with
remarkable sequence identity in the spike protein to SARS-CoV (e.g. SCH014 & WIV-1). We
have shown they bind and replicate efficiently in primary human lung airway cells and that
chimeras with SARSr-CoV spike proteins in a SARS-CoV backbone cause SARS-like illness in
humanized mice, with clinical signs that are not reduced by SARS monoclonal therapy or
vaccination. We have identified a single cave site in Yunnan Province where bat SARSr-CoVs
contain all the genetic components of epidemic SARS-CoV (7,8,9). We have now shown that
people living up to 6 kilometers from this cave have SARSr-CoV antibodies (3% seroprevalence
in 200+ cohort), suggesting active spillover, and marking these viruses as a clear-and-present
danger of a new SARS-like pandemic. Our work on bat immunology suggests that bats’
unique flying ability has led to downregulated innate immune genes, and their ability to coexist
with viruses such as SARSr-CoVs, henipa- and filoviruses that are lethal in many other
mammals (3). We have identified bat-specific constitutively expressed bat interferon, a
dampened STING-interferon production pathway (4, 5), and have identified a series of other
innate immunity factors that are dampened in bats (6).
G) Statement of Work (SOW)

• Provide a detailed task breakdown, citing specific tasks and their connection to the interim
milestones and program metrics.
• Each phase of the program (Phase I base and Phase II option) should be separately defined in
the SOW and each task should be identified by TA (1 or 2).
NOTE: The SOW must not include proprietary information.
• For each task/subtask, provide:
o A detailed description of the approach to be taken to accomplish each defined

task/subtask.
o Identification of the primary organization responsible for task execution (prime

contractor, subcontractor(s), consultant(s), by name).
o A measurable milestone, i.e., a deliverable, demonstration, or other event/activity

that marks task completion. Include quantitative metrics.
o A definition of all deliverables (e.g., data, reports, software) to be provided to the

Government in support of the proposed tasks/subtasks.
Phase I: Commented [EA3]: I’ve taken tasks from the

(TA1) Task 1: Collect ecological and environmental data from Yunnan Province cave sites. ‘Technical Plan’ section above, but these tasks may need
to be reorganized according to Phase (I or II).
Description and execution:
Also, feel free to alter names of tasks, as well as
task/subtask classifications
Preliminary Data:
Organization leading task:
Progress Metrics:
Deliverable(s):
(TA1) Task 2: Construct niche models to predict species composition of bat caves across
South and Southeast Asia
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Subtask 2.1: Construct host-pathogen risk models

Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Subtask 2.2: Develop prototype app for the warfighter

Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Task 3: Analyze bat samples for SARSr-CoVs
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Subtask 3.1 Develop recombinant chimeric spike proteins from characterized
SARSr-CoVs
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Subtask 3.2 Conduct assays in humanized mice to identify high-risk

SARSr-CoV strains
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA2) Task 4: Trial experimental approaches aimed towards ‘Broadscale Immune Commented [EA4]: This task may carry over into
Boosting’ using experimental bat colonies Phase II. Might want to break up between Phases I and II.
Preliminary Data:

Progress Metrics:
Deliverable(s):
(TA2) Task 5: Trial experimental approaches aimed towards ‘Immune Targeting’ Commented [EA5]: This task may carry over into
using experimental bat colonies Phase II. Might want to break up between Phases I and II.
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA2) Task 6: Develop and assess delivery methods for immune boosting and priming
molecules
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Task 7: Construct genotype-to-phenotype machine learning models to predict risk of

viral evolution and spillover
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA2) Subtask 7.1: Validate model predictions of viral spillover risk

Preliminary Data:
Progress Metrics:
Deliverable(s):
Phase II:
(TA1) Task 1: Design LIPS assays to specific high- and low- zoonotic risk SARSr-CoVs
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Task 2: Construct models to maximize efficacy of intervention approaches

Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA2) Task 3: Deploy most effective molecule delivery methods on bat colonies of Yunnan
Province caves
Preliminary Data:
Progress Metrics:
Deliverable(s):
H) Schedule and Milestones

• Provide a detailed schedule showing tasks (task name, duration, work breakdown
structure element as applicable, performing organization), milestones, and the
interrelationships among tasks.
NOTE: Task structure must be consistent with that in the SOW.
• Measurable milestones should be clearly articulated and defined in time relative to the
start of the project.
I) PREEMPT Transition Plan Commented [EA6]: Description from the BAA:

• Indicate the types of partners (e.g., government, private industry, non-profit) PREEMPT Transition Plan
Proposers must include a PREEMPT Technology Transition
• Submit a timeline with incremental milestones toward successful engagement. Plan. Proposers must indicate the types of partners (e.g.,
government, private industry, non-profit) they plan to pursue
NOTE: begin transition activities during the early stages of the program (Phase I). and submit a timeline with incremental milestones toward
successful engagement. Proposers should begin transition
• Describe any potential DARPA roles. activities during the early stages of the program (Phase I).
Awardees must include
DARPA in the development of transition relationships. If the
J) PREEMPT Risk Mitigation Plan transition plan includes a start-up company, a business
• Provide the following: development strategy must be included as well. The extent
by which the proposed intellectual property (IP) rights will
impede the Government’s ability to transition thetechnology
o An assessment of potential risks to public health, agriculture, plants, animals, the will be considered in the proposal evaluation.
environment, and national security.
o Guidelines the proposer will follow to ensure maximal biosafety and biosecurity.
o A communication plan that addresses content, timing, and the extent of

distribution of potentially sensitive dual-use information. The plan must also
address how input from DARPA, other government, and community stakeholders
will be taken into account in decisions regarding communication and publication
of potentially sensitive dual-use information.
K) Ethical, Legal, Societal Implications (ELSI)

• Address potential ethical, legal, and societal implications of the proposed technology.
Section III – Additional Information (doesn’t count against 36 pg. limit)

A) Brief Bibliography (no page limit indicated – can be published/unpublished)
B) Up to 3 relevant papers attached (optional)
Re: Email to Tonie Rocke (PREEMPT)

Brian Baker <[email protected]>
Wed 2/28/2018 8:35 AM
Sure! That works great.
I believe you’ll be using EHA’s Domestic Line to call in, number and passcode below for your
convenience:
1 (719) 785-9461
97848#
I’ll let you know if anything changes.
Thanks again,
Brian
On Feb 27, 2018, at 10:28 PM, Rocke, Tonie <[email protected]> wrote:
Could we do it at 3 PM my time? I have another meeting early
afternoon. Thanks -Tonie
On Tue, Feb 27, 2018 at 3:25 PM, Brian Baker <[email protected]> wrote:
Yes, Friday works great. How about 3pm EST (2pm your time)?
—Brian Baker
Assistant Managing Editor, EcoHealth
460 West 34th Street, 17th Floor
New York, NY 10001
1.212.380.4498 (direct)
brian.hartman.baker (Skype)
Website: www.ecohealth.net
Submissions and Log-in: https://mc.manuscriptcentral.com/ecohealth
Author Instructions: http://www.ecohealth.net/submit.php
On Feb 27, 2018, at 3:46 PM, Rocke, Tonie <[email protected]> wrote:

HI Brian: I'm out until Thursday evening. Friday
afternoon would be OK if that works for you. -Tonie
On Tue, Feb 27, 2018 at 2:39 PM, Brian Baker <[email protected]>
wrote:
Hi Tonie,
Sorry for the double email!
My coworker Luke (cc’d here) asked if I could pass along his note to
you regarding scheduling a call with Peter for later this week. Apologies
if we’re being pushy.
Safe travels and thanks,
Brian
—
Brian Baker
New York, NY 10001
1.212.380.4498 (direct)
Begin forwarded message:

Subject: Email to Tonie Rocke (PREEMPT)
Date: February 27, 2018 at 3:25:22 PM EST
To: Brian Baker <[email protected]>
Subject Title: PREEMPT call with Peter
Hi Tonie,
My name is Luke Hamel and I am a Program Assistant at EcoHealth Alliance,

helping to coordinate efforts for DARPA PREEMPT.
As the full project proposal is due March 27th, Peter was hoping to speak
with you in order to discuss further details of the proposal and establish a
timeline for moving forward.
If you are available, Peter would like to speak with you on either of the
following dates:
Thu. 3/1 between 11:30 AM - 3:00 PM (ET)
Fri. 3/2 between 1:00 PM - 5:00 PM (ET)
Could you please respond with a time that works for you, or provide an
alternative date/time that is more convenient? Thank you very much.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
(b) (6) (mobile)

EcoHealth Alliance leads cutting-edge
scientific research into the critical
connections between human and wildlife
health and delicate ecosystems. With this
science, we develop solutions that prevent
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
RE: For our DARPA PREEMPT conversations this week: HR001118S0017-PREEMPT-

PA-001 Proposal Abstract Status
Peter Daszak
Thu 3/1/2018 12:00 AM
<[email protected]>
<[email protected]>
[email protected] <[email protected]>; Baric, Toni C <[email protected]>;
[email protected] <[email protected]>; Luke Hamel <[email protected]>; William B. Karesh
<[email protected]>
Dear All,
Please see attached, a revised template for the PREEMPT Full Proposal. For the moment, please focus your
attention on Section G (Statement of Work), as this is where technical information for all tasks and subtasks must
be detailed. The other sections can remain as they are for now – I’ll edit these.
Please start drafting your sections as indicated to expand the details of the prelim data, work plans etc. to fill out
the tasks/subtasks for which your institution has been highlighted. Duke-NUS and Wuhan (Peng and Zhengli) – I’m
assuming you’re going to draft things together as possible, so I’ve put the names of both together. If this isn’t
correct – please arrange among yourselves to decide who will lead which part.
Regarding the writing of each section, keep in mind the following:

1. If you want to add a subtask, or change the titles, please feel free, but make a note (comment box) so we
know that you changed it – no need to use ‘track changes’
2. Include as much detailed, technical information as necessary. Don't worry about the page limit. I can
remove text as needed, later on.
3. For each task/subtask that you write, be sure to include preliminary data if applicable (e.g. no. of caves
sampled, no. of samples collected, etc.)
4. Include any relevant figures, tables or charts – the more the better, we can always delete/edit/shrink
down later on
5. We think the ‘Description and execution’ bullet is DARPA-speak for ‘Research Plan’ or ‘Plan of work’, i.e.
where you lay out the strategy, the rationale, and the technical details of how you are going to achieve
each goal.
6. Please put in some ideas for the bullets on ‘Progress metrics’ and ‘deliverables’. We’ll make sure we go
back to these after the first drafts are collated, so that we write this in a uniform way that will appeal to
DARPA.
7. Be sure to include any relevant references. Please use EndNote if possible; otherwise send list of
references to me (Peter), cc’ing Luke Hamel. Note that some of the references are embedded as links to
Pubmed webpages. I’ll be converting these back to Endnote later on, so ignore for now. We can insert as
many references as we like because they’re not included in the page length.
8. Please send drafts back to me by Wed. 3rd March (Eastern time – NYC time). Earlier if possible! As soon
as they start coming in, I’ll be incorporating text, editing and adding to different sections so we have a
good draft by the end of that week.
Additionally, please send me a list of all personnel you plan to include on your team, as soon as you are able.
Along with names, please provide (1) Number of months to be committed to project, and (2) % effort for each
member of your team (including yourself). This can be approximate right now and don’t worry about this
affecting budget – it won’t - we’re going to keep that level as suggested previously…
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
From: Peter Daszak
Sent: Tuesday, February 27, 2018 2:14 PM
To: Zhengli Shi ([email protected]); Ralph Baric ([email protected]); 周鹏 ([email protected]); 'Wang Linfa';
Rocke, Tonie
Cc: Danielle Anderson ([email protected]); '[email protected]';
'[email protected]'; '[email protected]'; Luke Hamel ([email protected])
Subject: For our DARPA PREEMPT conversations this week: HR001118S0017-PREEMPT-PA-001 Proposal Abstract
Status
Importance: High
Dear All,
Good news from DARPA - they like our abstract and we're officially invited for a full proposal. From the attached
letter, it looks like they've got a lot of proposals asking for too much $$$, but there are some clear ways we can
hedge against any possible cuts. We can talk further about this, and about fleshing out the technical details on our
calls this week.
I'm working on scheduling a call with the DARPA team for Thursday of Friday this week - 15 mins to go through
how these bullets in the letter above will affect our full proposal. It'll just be me and Luke, but we can think about
key questions to ask them..
Re. the full proposal. Luke has taken the abstract text and started populating the full proposal framework
(attached), to give us an idea of what we need to write. It's not a huge effort, but it'll have to be technically
sound, but still tell the overall 'story' that DARPA want to hear - i.e. we can provide proof-of-concept of blocking
spillover based on this novel and interesting approach.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
To: (b) (6)
Cc: (b) (6)
(b) (6)
Thank you for your interest in the Biological Technologies Office's PREventing EMerging Pathogenic Threats
(PREEMPT) program. Please find your proposal abstract status attached.
Regards,
BAA Coordinator
[email protected]
(b) (6)
DARPA – PREEMPT PROPOSAL OUTLINE
NOTE: 36 pages max - 12 pt. font or higher (font can be smaller for tables, charts, figures)
VOLUME I – Technical and Management Proposal
Section I – Administrative
A) Cover Page (labeled “Proposal: Volume I”)
B) Official Transmittal Letter
Section II – Detailed Proposal Information
A) Executive Summary (questions/answers below from abstract). Commented [EA1]: Perhaps some of the more
detailed information in this section could be moved to the
‘Goals and Impacts’ section
months, allowing our warfighters to execute the operation at lowered risk for spillover.

security.
3) What is innovative in your approach?
4) What are the key technical challenges in your approach and how do you plan to overcome
these?
5) Who or what will be affected and what will be the impact?

B) Executive Summary Slide (must use provided template)
C) Goals and Impact Commented [EA2]: Detailed text from the ‘Executive
Summary’ section may be better suited here
• Clearly describe what the team is trying to achieve and the difference it will make
(qualitatively and quantitatively) if successful.
• Describe the innovative aspects of the project in the context of existing capabilities and
approaches, clearly delineating the uniqueness and benefits of this project in the context of
the state of the art, alternative approaches, and other projects from the past and present.
• Describe how the proposed project is revolutionary and how it significantly rises above the
current state of the art.
• Describe the deliverables associated with the proposed project and any plans to
commercialize the technology, transition it to a customer, or further the work.
Overview
Our bat-CoV system has significant advantages for experimentation and intervention.
Firstly, these viruses are fecal-orally transmitted within bat populations, so sampling can be
achieved from fresh fecal pellet collection. They are BSL-3, not -4, agents, so that experimental
potential. Finally, we have identified SARSr-CoV strains in a single cave in Yunnan that harbor all
of the epidemic SARS-CoV genes. This specific bat population harbors an ideal evolutionary
D) Technical Plan
• Outline and address technical challenges inherent in the approach and possible solutions for
overcoming potential problems.
• Provide appropriate measurable milestones (quantitative if possible) and program metrics
(see “metrics” attachment) at intermediate stages of the program to demonstrate progress,
and a plan for achieving the milestones.
• Demonstrate a deep understanding of the technical challenges.
• Present a credible (even if risky) plan to achieve the program goal.
• Discuss mitigation of technical risk.
• Address TA1 and TA2 proposal content requirements (see “objectives” attachment)
human-capable virus will emerge from an animal reservoir residing in a “hot spot” geographic
region
The DEFUSE modeling and analytics team, led by Drs. Daszak, Ross, Olival, EHA, will build
ecological niche models of environmental and ecological correlates and traits of cave bat
Asia. We will then use a series of datasets we have built to produce host-virus risk models for
the region. These include our unique database of bat host-viral relationships (7); biological
inventory data on all bat caves in Southern China; and modeled species distribution data for all
bats. We will parameterize the model with data from three cave sites in Yunnan, China (one
with high-risk SARSr-CoVs, two other control/comparison sites), including: radio- and GPS-
telemetry to identify home range and additional roost sites for each bat species; inventory of
bat population density, distribution and segregation and their daily, weekly and seasonal
changes; viral prevalence and individual viral load; shedding of low- and high-risk SARSr-CoV
strains among bat species, age classes, genders; and telemetry and mark-recapture data to
assess metapopulation structure and inter-cave connectivity. We will test and validate model
identifies the likelihood of bats harboring dangerous viral pathogens in a region. The ‘high-risk
bats near me’ app will be updated real-time with surveillance data (e.g. field-deployable iPhone Commented [EA3]: SDM with additional set of
variables (Carlos thinks this will work)
and android compatible echolocation data) from our project and others, to ground-truth and
fine-tune its predictive capacity.
The Wuhan Institute of Virology team will test bat fecal, oral, blood and urogenital samples
for SARSr-CoVs. We will correlate viral load data from these samples with fresh fecal pellets
from individuals and from tarps laid on cave floors. We will rapidly move to fecal pellet assays
to reduce roost disturbance. SARSr-CoV spike proteins will be sequenced, analyzed
binding assay to human ACE2 (the SARS-CoV receptor). They will culture SARS-like bat
nucleoside analogue inhibitor GS-5734 (8) or vaccines against SARS-CoV (8,9,10,11,12,13).
The EHA modeling team will use these data to build models of risk of viral evolution
and spillover. These genotype-to-phenotype machine-learning models will predict viral ability
to infect host cells based on genetic traits and results of receptor binding and mouse infection
recombination, and capacity to generate novel strains capable of human infection. Finally,
virus-host relationship and bat home range data will be used to estimate spillover potential -
extending models well beyond our field sites. We will then validate model predictions of viral
spillover risk by 1) conducting spike protein-based binding and cell culture experiments, and 2)
shows ~3% seroprevalence to SARSr-CoVs, using a specific ELISA (14). We will design LIPS assays
to the specific high- and low- zoonotic-risk SARSr-CoVs identified in this project as we have
done previously (15). We will use banked and newly collected human sera from these
populations to test for presence of antibodies to the high- and low-risk SARSr-CoVs identified by
our modeling. We will then model optimal strategies to maximize treatment efficacy for TA2,
using stochastic simulation modeling informed by field and experimental data to characterize
viral circulation dynamics in bats. We will estimate frequency and population coverage required
for our intervention approaches to suppress viral spillover. We will determine the seasons,
locations within a cave, and delivery methods (spray, swab, or automated cave mouth or drone)
that will be most effective. Finally we will determine the time period treatment will be effective
small molecules reduces viral loads in humans, ferrets and mouse models (16, 17). Interferon
has been used clinically when antiviral drugs are unavailable, e.g. against filoviruses (18).
(16); ii) Boosting bat IFN by blocking bat-specific IFN negative regulators. Uniquely, bat IFNA is
naturally constitutively expressed but cannot be induced to a high level (5), indicating a
identify the negative regulator and then screen for compounds targeting this gene; iii)
Activating dampened bat-specific IFN production pathways which include DNA-STING-
dependent and ssRNA-TLR7-dependent pathways. Our work showing that mutant bat STING
restores antiviral functionality suggests these pathways are important in bat-viral coexistence
(4). By identifying small molecules to directly activate downstream of STING, we will activate
bat interferon and promote viral clearance. A similar strategy will be applied to ssRNA-TLR7-
dependent pathways; iv) Activating functional bat IFN production pathways, e.g. polyIC to TLR3-
IFN pathway or 5’ppp-dsRNA to RIG-I-IFN pathway. A similar strategy has been demonstrated in
a mouse model for SARS-CoV, IAV and HBV (17, 19); v) Inoculating crude coronavirus fragments
to upregulate innate immune responses to specific CoVs – a partial step towards the targeted
the spike trimers or the receptor binding domain can be incorporated into alphavirus vectored
or nanoparticle vaccines for delivery, either as aerosols, in baits, or as large droplet delivery
be overseen by Dr. Tonie Rocke at the USGS, National Wildlife Health Center who has
previously developed animal vaccines through to licensure (28). Using locally acquired
insectivorous bats (29, 30) we will assess delivery vehicles and methods including: 1)
transdermally applied nanoparticles; 2) series of sticky edible gels that bats will groom from
themselves and each other; 3) aerosolization via sprayers that could be used in cave settings; 4)
automated sprays triggered by timers and movement detectors at critical cave entry points,
and 5) sprays delivered by remote controlled drone. We have already used simple gels to
vaccinate bats against rabies in the lab (29), and hand delivered these containing biomarkers to
vampire bats in Peru and Mexico to show they are readily consumed and transferred among
bats. In our bat colony, we will trial delivery vehicles using the biomarker rhodamine B (which
marks hair and whiskers upon consumption) to assess uptake. The most optimal approaches
will then be tested on wild bats in our three cave sites in Yunnan Province with the most
successful immunomodulators from TA2. Fieldwork will be conducted under the auspices of Dr.
Yunzhi Zhang (Yunnan CDC, Consultant at EcoHealth Alliance). A small number of bats will be
captured and assayed for viral load and immune function after treatment, but so as not to
disturb the colony, most viral load work will be conducted on fresh fecal pellets collected daily
on the cave floor. EHA has had unique access to these sites for around 10 years, under the
guidance of Drs. Shi and Zhang. In year 1 of project DEFUSE, we will seek permission for
experimental trials from the Provincial Forestry Department. We expect to be successful, as we
have worked with the Forestry Department collaboratively for 10 years, with support of the
Yunnan CDC, and we are releasing molecules that are not dangerous to people or wildlife. EHA
has a proven track record of rapidly obtaining IACUC and DoD ACURO approval for bat research.
E) Management Plan
• Provide a summary of expertise of the team, including any subcontractors, and key
personnel who will be doing the work. Resumes count against the page count.
• Identify a principal investigator for the project.
• Provide a clear description of the team’s organization
• Include an organization chart with the following information, as applicable:

• Provide a detailed plan for coordination including explicit guidelines for interaction among
• Include risk management approaches.
• Describe any formal teaming agreements that are required to execute this program.
Subcontracts: #1 to Prof. Ralph Baric, UNC, to oversee reverse engineering of SARSr-CoVs, BSL-
3 humanized mouse experimental infections, design and testing of immune priming treatments
based on recombinant spike proteins. Assisted by senior personnel Dr. Tim Sheahan, Dr. Amy
Sims, and support staff; #2 to Prof. Linfa Wang, Duke NUS, to oversee the immune boosting
approach, captive bat experiments, and analyze immunological and virological responses to
immune boosting treatments; #3 to Dr. Zhengli Shi, Wuhan Institute of Virology, to conduct PCR
testing, viral discovery and isolation from bat samples collected in China, spike protein binding
assays, and some humanized mouse work, as well as experimental trials on Rhinolophus bats.
Her team will include Dr. Peng Zhou and support staff; #4 to Dr. Tonie Rocke, USGS National
Wildlife Health Center, to refine delivery mechanisms for both immune boosting and immune
priming treatments. With a research technician, Dr. Rocke will use a captive colony of bats at
NWHC for initial trials, and oversee cave experiments in China.
of disease (8,9,10,11,12,13).
Prof. Linfa Wang is a
Prof. Zhengli Shi has over xx years experience….

Dr. Tonie Rocke is a
Dr. Peng Zhou is a
Dr. Danielle Anderson is a
Please follow the same format and create Bios for all other personnel with Ph.D and higher.
Peter Daszak will then work out how much space we have and decide who to include…
F) Capabilities
• Describe organizational experience in relevant subject area(s), existing intellectual property,
• Discuss any work in closely related research areas and previous accomplishments.
(The following information was taken from the ‘Goals and Impact’ section of the abstract we
submitted).
G) Statement of Work (SOW)

• Provide a detailed task breakdown, citing specific tasks and their connection to the interim
• Each phase of the program (Phase I base and Phase II option) should be separately defined
in the SOW and each task should be identified by TA (1 or 2).
• For each task/subtask, provide:

task/subtask.

o A measurable milestone, i.e., a deliverable, demonstration, or other

event/activity that marks task completion. Include quantitative metrics.
o A definition of all deliverables (e.g., data, reports, software) to be provided to

the Government in support of the proposed tasks/subtasks.
Phase I:
(TA1) Task 1: Collect ecological and environmental data from Yunnan Province cave sites.
Preliminary Data:
Organization leading task: EcoHealth Alliance
Progress Metrics:
Deliverable(s):
(TA1) Task 2: Construct niche models to predict species composition of bat caves across
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Subtask 2.1: Construct, test and validate host-pathogen risk models
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Subtask 2.2: Develop prototype app for the warfighter

Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Task 3: Analyze bat samples for SARSr-CoVs

Preliminary Data:
Organization leading task: Wuhan Institute of Virology, Duke-NUS
Progress Metrics:
Deliverable(s):
(TA1) Subtask 3.1: Characterize and isolate high-risk SARSr-CoV quasispecies

Preliminary Data:

Progress Metrics:
Deliverable(s):
(TA1) Task 4: Develop recombinant chimeric spike proteins from characterized

SARSr-CoVs
Preliminary Data:
Organization leading task: University of North Carolina
Progress Metrics:
Deliverable(s):
(TA2) Task 5: Trial experimental approaches aimed towards ‘Broadscale Immune

Boosting’ using experimental bat colonies
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA2) Task 6: Trial experimental approaches aimed towards ‘Immune Targeting’

using experimental bat colonies
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA2) Task 7: Develop and assess delivery methods for immune boosting and priming
molecules
Preliminary Data:
Organization leading task: USGS National Wildlife Health Center
Progress Metrics:
Deliverable(s):
(TA1) Task 8: Construct genotype-to-phenotype machine learning models to predict risk of

viral evolution and spillover
Preliminary Data:
Progress Metrics:
Deliverable(s):
Phase II:
(TA1) Task 9: Design LIPS assays to specific high- and low- zoonotic risk SARSr-CoVs
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Task 10: Validate model predictions of viral spillover risk using data from LIPS
assays and banked human sera
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Task 11: Test efficacy of intervention approaches on wild-caught

Rhinolophus bats
Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA1) Task 12: Construct models to maximize efficacy of intervention approaches

Preliminary Data:
Progress Metrics:
Deliverable(s):
(TA2) Task 13: Deploy most effective molecule delivery methods on bat colonies of Yunnan
Province caves
Preliminary Data:
Progress Metrics:
Deliverable(s):
H) Schedule and Milestones

• Provide a detailed schedule showing tasks (task name, duration, work breakdown
• Measurable milestones should be clearly articulated and defined in time relative to the
I) PREEMPT Transition Plan Commented [EA4]: Description from the BAA:

• Indicate the types of partners (e.g., government, private industry, non-profit) PREEMPT Transition Plan
Proposers must include a PREEMPT Technology Transition
• Submit a timeline with incremental milestones toward successful engagement. Plan. Proposers must indicate the types of partners (e.g.,
government, private industry, non-profit) they plan to pursue
NOTE: begin transition activities during the early stages of the program (Phase I). and submit a timeline with incremental milestones toward
successful engagement. Proposers should begin transition
activities during the early stages of the program (Phase I).
• Describe any potential DARPA roles. Awardees must include
DARPA in the development of transition relationships. If the
transition plan includes a start-up company, a business
J) PREEMPT Risk Mitigation Plan development strategy must be included as well. The extent
• Provide the following: by which the proposed intellectual property (IP) rights will
impede the Government’s ability to transition the technology
will be considered in the proposal evaluation.
o An assessment of potential risks to public health, agriculture, plants, animals, the

K) Ethical, Legal, Societal Implications (ELSI)

• Address potential ethical, legal, and societal implications of the proposed technology.
Section III – Additional Information (doesn’t count against 36 pg. limit)

回复: RE: For our DARPA PREEMPT conversations this week: HR001118S0017-
PREEMPT-PA-001 Proposal Abstract Status
zlshi <[email protected]>
Thu 3/1/2018 12:19 AM
To: Peter Daszak <[email protected]>; rbaric <[email protected]>; 周鹏 <[email protected]>;
[email protected] <[email protected]>; Rocke, Tonie E <[email protected]>
Cc: Danielle Anderson <[email protected]>; Aaron Trent Irving <[email protected]>;
Baric, Toni C <[email protected]>; Sims, Amy C <[email protected]>; Luke Hamel
<[email protected]>; William B. Karesh, D.V.M <[email protected]>
Great! Thanks.
SHI Zhengli, Ph. D

Senior Scientist & Professor
Wuhan Institute of Virology, Chinese Academy of Sciences
44 Xiao Hong Shan
430071 Wuhan, Hubei
China
Tel & Fax: (0086) 27 87197240
发件人： Peter Daszak

发送时间： 2018-03-01 14:00
收件人： Zhengli Shi ([email protected]); Ralph Baric ([email protected]); 周鹏 ([email protected]); Wang
Linfa; Rocke, Tonie
抄送： Danielle Anderson ([email protected]); [email protected]; Baric, Toni C;
[email protected]; Luke Hamel; William B. Karesh
主题： RE: For our DARPA PREEMPT conversations this week: HR001118S0017-PREEMPT-PA-001 Proposal Abstract
Status
Dear All,
Please see attached, a revised template for the PREEMPT Full Proposal. For the moment, please focus
your attention on Section G (Statement of Work), as this is where technical information for all tasks and
subtasks must be detailed. The other sections can remain as they are for now – I’ll edit these.
Please start drafting your sections as indicated to expand the details of the prelim data, work plans etc. to
fill out the tasks/subtasks for which your institution has been highlighted. Duke-NUS and Wuhan (Peng
and Zhengli) – I’m assuming you’re going to draft things together as possible, so I’ve put the names of
both together. If this isn’t correct – please arrange among yourselves to decide who will lead which part.

down later on
each goal.
DARPA.
Additionally, please send me a list of all personnel you plan to include on your team, as soon as you are
able. Along with names, please provide (1) Number of months to be committed to project, and (2) %
effort for each member of your team (including yourself). This can be approximate right now and don’t
worry about this affecting budget – it won’t - we’re going to keep that level as suggested previously…
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
From: Peter Daszak
To: Zhengli Shi ([email protected]); Ralph Baric ([email protected]); 周鹏 ([email protected]);
'Wang Linfa'; Rocke, Tonie
Subject: For our DARPA PREEMPT conversations this week: HR001118S0017-PREEMPT-PA-001 Proposal
Abstract Status
Importance: High
Dear All,
Good news from DARPA - they like our abstract and we're officially invited for a full proposal. From the
attached letter, it looks like they've got a lot of proposals asking for too much $$$, but there are some
clear ways we can hedge against any possible cuts. We can talk further about this, and about fleshing out
the technical details on our calls this week.
I'm working on scheduling a call with the DARPA team for Thursday of Friday this week - 15 mins to go
through how these bullets in the letter above will affect our full proposal. It'll just be me and Luke, but we
can think about key questions to ask them..
(attached), to give us an idea of what we need to write. It's not a huge effort, but it'll have to be
technically sound, but still tell the overall 'story' that DARPA want to hear - i.e. we can provide proof-of-
concept of blocking spillover based on this novel and interesting approach.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
To: (b) (6)
Cc: (b) (6)
(b) (6)
Thank you for your interest in the Biological Technologies Office's PREventing EMerging Pathogenic
Threats (PREEMPT) program. Please find your proposal abstract status attached.
Regards,
BAA Coordinator
[email protected]

Thu 3/1/2018 12:25 AM
To: Peter Daszak <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; Ralph Baric
([email protected]) <[email protected]>; 周鹏 ([email protected]) <[email protected]>; Rocke, Tonie E
<[email protected]>
Cc: Danielle Anderson <[email protected]>; Aaron Trent Irving <[email protected]>;
Baric, Toni C <[email protected]>; [email protected] <[email protected]>; Luke Hamel
<[email protected]>; William B. Karesh <[email protected]>
Thanks
Will start work on this from weekend. In London for the WHO NiV meeting now.
LF

Tel: +65 6516 8397

Sent: Thursday, 1 March, 2018 2:01 PM
To: Zhengli Shi ([email protected]); Ralph Baric ([email protected]); 周鹏 ([email protected]); Wang Linfa;
Rocke, Tonie
Cc: Danielle Anderson; Aaron Trent Irving; Baric, Toni C; [email protected]; Luke Hamel; William B. Karesh
Subject: RE: For our DARPA PREEMPT conversations this week: HR001118S0017-PREEMPT-PA-001 Proposal
Abstract Status
Importance: High
Dear All,

down later on
each goal.
DARPA.
8. Please send drafts back to me by Wed. 3rd March (Eastern time – NYC time). Earlier if possible! As soon as
they start coming in, I’ll be incorporating text, editing and adding to different sections so we have a good
draft by the end of that week.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
From: Peter Daszak
Rocke, Tonie
Status
Importance: High
Dear All,
calls this week.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
To: (b) (6)
Cc: (b) (6)
(b) (6)
Regards,
BAA Coordinator
[email protected]

Baric, Ralph
Fri 3/2/2018 10:38 AM
S <[email protected]>
To: Peter Daszak <[email protected]>; Zhengli Shi ([email protected]) <[email protected]>; 周鹏
<[email protected]>; Sheahan, Timothy Patrick <[email protected]>
[email protected] <[email protected]>; Baric, Toni C <[email protected]>; Sims,
Amy C <[email protected]>; Luke Hamel <[email protected]>; William B. Karesh
<[email protected]>
I have included Tim in the email chain. Ralph

Sent: Thursday, March 1, 2018 1:01 AM
To: Zhengli Shi ([email protected]) <[email protected]>; Baric, Ralph S <[email protected]>; 周鹏
([email protected]) <[email protected]>; Wang Linfa <[email protected]>; Rocke, Tonie
<[email protected]>
[email protected]; Baric, Toni C <[email protected]>; Sims, Amy C
<[email protected]>; Luke Hamel <[email protected]>; William B. Karesh
<[email protected]>
Subject: RE: For our DARPA PREEMPT conversations this week: HR001118S0017-PREEMPT-PA-001 Proposal
Abstract Status
Importance: High
Dear All,

down later on
each goal.
DARPA.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
From: Peter Daszak
Rocke, Tonie
Status
Importance: High
Dear All,
calls this week.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
To: (b) (6)
Cc: (b) (6)
(b) (6)
Regards,
BAA Coordinator
[email protected]
PREEMPT meeting notes (Week of 26 Feb - 2 Mar)

Fri 3/2/2018 8:44 PM
To: Zhengli Shi ([email protected]) <[email protected]>; 周鹏 ([email protected]) <[email protected]>; wang linfa
<[email protected]>; Aaron Trent Irving <[email protected]>; danielle.anderson@duke-
nus.edu.sg <[email protected]>; Ralph Baric ([email protected]) <[email protected]>; Sims,
Amy C <[email protected]>; Rocke, Tonie E <[email protected]>; Abbott, Rachel (Contractor) C
<[email protected]>; William B. Karesh <[email protected]>; Jon Epstein
<[email protected]>; Kevin Olival, PhD <[email protected]>; Noam Ross
<[email protected]>; Alice Latinne <[email protected]>; Anna Willoughby
<[email protected]>; Carlos Zambrana-Torrelio <[email protected]>; Hongying Li
<[email protected]>; [email protected] <[email protected]>
Cc: Dr. Peter Daszak <[email protected]>; Alison Andre <[email protected]>; Aleksei Chmura
<[email protected]>; Baric, Toni C <[email protected]>; Jonathon Musser
<[email protected]>
Hi all,
I wanted to provide you with the latest notes from various PREEMPT calls that took place this
week (listed below). Meeting notes from the call between EHA and Wuhan + Duke-NUS are the
same as those sent earlier this week.
1) Tue. 27 Feb. (Call between EHA staff and staff from Wuhan + Duke-NUS)
2) Fri. 2 March (Call between Peter and Jim Gimlett from DARPA)
3) Fri. 2 March (Call between EHA staff and Ralph + Tim @ UNC)
4) Fri. 2 March (Call between EHA staff and Tonie @ USGS NWHC)
Below, I've listed the 'Action Items' that correspond to each call. These action items are also listed
at the top of each document
Call between EHA & Wuhan/Duke-NUS
**Action Items:
PD to have weekly calls w/ collaborators
LH to organize these calls
LH to send an email confirming: DUNS nos., addresses and phone numbers of each
collaborating institution.
The email will also provide instructions for how to sign up on Grants.gov (required for Key
Personnel of each collaborating organization)
PD to sit down with KJO, JHE and LH to determine who will be responsible for each section of
the proposal. Will send to collaborators by Thu. 3/1
Collaborators to then write their respective sections and return to PD by Wed. 3/7
Peng to include section about how both Immune Boosting and Immune Targeting
approaches are better than vaccination (without explicitly criticizing vaccination approach)
PD to speak with YunZhi regarding consultant field work in/around Yunnan cave
Collaborators to determine if any additional personnel required for their work (e.g. technicians,
field support staff, etc.)
Collaborators to let PD know if they think anyone else should be brought on to the team
-PD to determine which aspects of full proposal are baseline tasks, and which are add-ons
(by mid to late March)
Call between EHA & Ralph/Tim (UNC)

**Action Items:
RB and team to draft their section and return to PD by Wed. 3/7
RB to include section stating how our project won’t drive viral evolution in negative way
PD to complete quality first draft by end of next week, Fri. 3/9
Jonathon Musser (EHA) and Amy Sims (UNC) to work together on UNC budget
-Once EHA has drafted modeling section of proposal, RB to provide input
Call between EHA & Tonie (NWHC)

**Action Items:
Tonie Rocke (TR) to begin work on her section of the full proposal (and send to PD by Wed. 3/7)
TR to cite literature referring to use of transdermal vaccine application
TR to begin drafting budget for NWHC
- TR to check with folks from F&WS to learn about their work using automatic sprayers for
WNS
As always, please let me know if you have any questions.

Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
PREEMPT call (Peter, Jim Gimlett of DARPA) - 2 March 2018
● Re: Issue of human subjects/samples

○ For the full proposal, we have to explicitly state that any human samples we use
will only come from previous studies, and that we have full access to these
samples
■ PREEMPT will NOT fund any human sampling efforts
○ When referencing previously collected human samples (which we could have
1000s of), mention how we will triage samples to determine priority for testing, as
well as how we plan to ship samples out
● Re: Number and size of DARPA awards

○ According to Jim Gimlett (Program Manager for PREEMPT), DARPA has
received many promising abstracts, and likely won’t be able to fund all of them
(or at least won’t be able to fund every aspect of each project)
■ Jim is contacting other DARPA personnel to try and get additional funding
for later stages of accepted proposals
● In the meantime, it’s important that we separate tasks/subtasks
into ‘baseline’ tasks and ‘add-on’ tasks (as add-ons may be cut
from proposed projects)
● Re: EHA collaboration with Wuhan

○ PD mentioned our existing collaboration with Wuhan, to Jim.
■ PD mentioned our standard operating procedure, and that our
collaboration with Wuhan involves complete access to information and
leads to research with quickly produced results
○ Jim checked in with higher ups at DARPA, and they’ve mentioned that there are
no current political issues about us working in China
■ This is great news as we’ll be able to move ahead with our proposal as
planned
■ Also, the fact that Jim inquired about our collaboration with Wuhan is a
good sign that he’s interested in our proposal and wants to fund it.
● Re: Jim Gimlett’s response about riskiness of our proposal

○ PD asked Jim if anything about our proposal seemed too risky, or not risky
enough
■ Jim didn’t have anything to say specifically, so we should be on the right
track.
● He did mention, however, that we should show how we’ll validate
everything
○ i.e. Show that immune modulation works at every step, and
show validation through modeling approaches
● Re: Concerns about host response to inocula

○ One DARPA employee mentioned the possibility of bats reacting negatively to
our inocula.
■ So we MUST show preliminary data when we write about this in our
proposal
● Show how our team has demonstrated the effectiveness of our
proposed intervention approaches - how we can reduce viral load
by upregulating the immune response
○ Provide additional detail for interferon work specifically
● Some additional comments from Billy Karesh (BK):

○ The modeling approaches that we list in the proposal must be tied directly to
what the lab and field work are attempting to accomplish. In other words, we
can’t just expand our modeling efforts in order to address questions from the data
that we find interesting.
■ Rather, our modeling must be ‘utilitarian’. Modeling is strictly to inform our
lab and field teams on how to create a more effective intervention
approach (e.g. Use modeling to predict which high-risk viral strains to
target in the lab)
PREEMPT call (EHA, Ralph + Time of UNC) - 2 March 2018
**Action Items:
● RB and team to draft their section and return to PD by Wed. 3/7
○ RB to include section stating how our project won’t drive viral evolution in
negative way
● PD to complete quality first draft by end of next week, Fri. 3/9
● Jonathon Musser (EHA) and Amy Sims (UNC) to work together on UNC budget
● Once EHA has drafted modeling section of proposal, RB to provide input
● Re: Ralph Baric and team

○ Tim Sheahan (Research assistant professor at UNC)
■ Tremendous amount of experience working w/ CoV reverse genetics/
synthetic reconstruction of CoVs
■ Genetics expert. Has been looking into Lineage D BetaCoVs, in terms of Commented [1]: Ralph/Tim- Please confirm this
trying to find strains that can replicate in human cells
○ Amy Sims (Research associate professor)
■ Great deal of experience working w/ primary human cells and artificial
construction of SARSr-CoVs to test binding to human cells. Lots of drug
testing + vaccine work against SARS and MERS
■ Can also help with the subaward budget.
● Re: UNC subcontract budget

○ It will take roughly 7-10 days for RB and his team to review/get approval for the
budget.
○ Jonathon Musser (EHA) and Amy Sims (UNC) to work together on UNC budget
● Re: Modeling approaches

○ Noam Ross (NR) would like to be able to look at inputs of both sequence data as
well as ecological/host data for viruses, and make predictions about which virus
traits we see when they’re in infected mice, as well as the degree to which they
show up in nearby human populations
■ To understand this, it’d be helpful to know how many different viral strains
(and of what risk), we’d put through the humanized mouse process in
order to get an understanding of their ability to infect mice (as well as
what the viral growth in those models are).
● NR interested to hear Ralph Baric’s (RB) thoughts on how many
different strains we’d test over the course of project. A small
handful? Dozens?
■ Ralph says it’s very budget dependent. We could look at pseudotyped
viruses to see which spikes drive entry.
● For SARSr-CoVs, we know there are strains ranging from
epidemic strains to those w/ 10-12% variation in spike protein, that
still can infect human cells and humanized mice.
○ Within this 10-12% range, RB has tested one strain w/ 8%
variation and one w/ 3%.
■ So the goal when looking for strains w/ novel
variance, is to look for those w/ relatively conserved
receptor binding domains (RBDs) but other
variation of the spike that’s w/in the 10-12%
window. 2 or 3 strains perhaps.
■ Once you have strains with greater spike variation
(10-20%), there’s a reduction in capacity of viruses
to grow in human cells or use human ACE2
receptor (unless RBD is conserved).
● Through recombination, it’s possible that the
correct RBD could be dropped into a strain
w/ 25% variation, and allow the virus to
enter human cell and replicate
○ Given a 42-month time period, we’d probably screen 15-16
viruses to determine which strains we’d like to focus in on
(given spike proteins), likely leaving us with 7 or 8.
● Peter (PD) thinks Noam’s modeling could involve:

○ An initial prediction of virus binding to ACE2 receptor
○ Then whether virus can replicate in human cells
○ Then focus on humanized mice and whether disease is caused in humanized
mice that looks like SARSr-CoV (This is gold standard in the end)
● Ralph thinks there are probably 5 viruses to be used as baselines - viruses that we know
can replicate and use human receptor (SARS, Raccoon dog isolate, WIV16, WIV1,
SCH014). These 5 capture range of 1% -12% variation in spike.
○ If you look at WIV16, WIV1 and SCH014, the RBDs that engage the receptor are
fairly well conserved and can be modeled.
■ Want to model RBD, ACE2 interaction (3D protein modeling)
● RB has people who can help w/ this. Ultimately, we’re looking for
strains that conserve some sort of RBD integrity. We’re not
interested in strains w/ loss of contact interface sites or deletion of
RBD.
○ Knowing this will help guide modeling efforts
● We also need to model using information on protease cleavage site.

○ For SARSr-CoVs, there’s a two-step entry process.
■ 1) Virus-receptor interaction
■ 2) Either extracellular protease or Intracellular protease have to
clip protein once or twice so that virus can fuse to cell membrane
● Virus can’t enter cell w/o protease. In the lab, if protease is
added exogenously, strains that otherwise would not enter
cell are now able
● So these are the 2 major modeling processes (the 2 screening components)

○ You screen (1) on the spike and (2) on the protease
● Some steps that RB says modeling could incorporate:
○ (1) Very conserved RBD
○ (2) Sequence variance around RBD
○ (3) Protease cleavage site
○ (4) What RBD looks like in relation to conformity to binding sites
○ (5) Overall spike variation
○ (6) RNA recombinance (maybe RBD that is capable of interfacing w/
human receptor, but has very different genetic background of the whole
spike)
● Model these to show progressively lower risk that virus could bind to and infect
cells)
● NR knows that in terms of the viruses being tested/screened, there’s a small set taken
all the way to humanized mice.
○ But in terms of screening assays, are we conducting one assay to screen for
spike binding, and another to screen for protease? In other words, are we testing
the 2 components independently, and then based on the success of both, making
a decision of how to move forward to test in our model?
■ Ralph says that the easiest way to approach this, is either w/
pseudotyped viruses or chimera viruses w/ full length spike.
● First look at receptor binding on cells, then look at virus ability to
get into cells (remembering that getting into cell requires
protease).
○ You’ll have spikes that bind to surface but can’t get in, and
the basic approach here is to add exogenous protease to
chimera virus system or pseudotyped virus to see if it can
get in
● Need to make sure that RB reads the EHA modeling approach to make sure we have
the right approach.
○ What we need to do is determine exactly what NR will model
■ Ralph thinks modeling is 5-step process
● (1) Find where viral sequence fits within phylogenetic tree,
especially in relationship to 5 baseline viruses (SARS, raccoon
dog isolate, WIV1, WIV16, SCH014
● (2) Focus on RBDs and models that predict whether viruses
interact w/ mouse or human ACE2 molecules (Human would be
priority, but could do mouse)
● (3) From those models, determine:
○ Where is variation?
○ How many contact residues retained?
○ Are there deletions?
■ If so, these strains get deprioritized
● (4) Look for protease cleavage sites in strains w/ SARS like spikes
○ Are sequence signatures present?
■ If yes, that’s a plus
● (5) Look at overall spike variation (recombinant molecule that’s
picked up favorable RBD and dropped into variable spike protein)
○ This will predict which 8-16 strains we’ll synthesize
■ $1000/spike. So $16k?
● DARPA wants machine learning (ML) to be incorporated. They want some cool
modeling approach that tells you the following:
○ When a warfighter goes to a region…
■ 1) Is it a place w/ Ebola and/or other high-risk strains that spill into
humans?
■ 2) Can we predict which species carry these viruses?
○ So we just need to make sure we include the following:
■ The species of bats that are likely to harbor viral strains very similar to
SARS virus
■ The species assemblages that are likely to drive evolution of those
strains.
○ Then all other stuff comes in when we try to validate models. We don’t need
super technical details now. DARPA just wants to make sure we have preliminary
data to do the work, and that later on we can validate models and immune
modulation approaches.
■ This shouldn’t be a problem as we all have preliminary data (RB,
Linfa/Zhengli, TR, EHA)
● So RB thinks it will be reiterative process.

○ First look at sequences, prioritize the top 4, then test them and use the data to
refine models (perhaps using ML)
○ Then reassess the top candidates, then do another 4 (i.e. stepwise modeling),
then take 5 or 6 criterium and figure out how to prioritize which ones weight most
heavily on predictive success
■ NR agrees but thinks scale is a challenge
● Due to fact that statistical strength will come from linking viral
sequence to its success binding and infecting cells, we won’t
really have a large dataset to work with.
○ RB says there must be 100+ spike protein variants that
have been sequenced (at least). We also know rough
boundaries that determine virus potential to replicate
efficiently and use human receptors. So we can use these
boundaries in our models as well.
■ NR thinks that even if we have enough sequences
(input), our output (and ability to statistically
validate models) still requires data on viruses that
can successfully bind to and infect human cells.
And we likely won’t find that many strains that are
successful
● So we have to lean more heavily on
mechanistic approach (emphasizing
knowledge of RBD variation into predictive
model itself), b/c we have limited set of
iterations we can do
● PD says that ultimately, our final proposal is all about utilitarian modeling.
○ i.e. Modeling is strictly to inform our lab and field teams on how to create a more
effective intervention approach (e.g. use modeling to predict which high-risk viral
strains to target in the lab)
○ Also, we MUST make it clear in proposal that our approach won’t drive evolution
the wrong way (e.g. drive evolution of more virulent strain that then becomes
pandemic
■ This needs to be explained in detail (RB will draft this section)
● Re: ‘Immune Priming’ approach

○ Essentially, the approach is to upregulate both acquired and innate immunity
against viral spikes
○ Most juvenile bats have SARSr-CoVs, but titers drop in older adults
■ Use recombinant protein vaccine paired w/ some sort of adjuvant mixture
to stimulate innate immunity and knock down titer (this should reduce
virus burden in cave)
● In full proposal, stress that we’re designing simple, straightforward
approach that plays on bat immunity and offers transient
protection from viral spillover
● Re: Delivery method of inoculum

○ How will the recombinant spike proteins be administered?
■ RB thinks intranasal administration most effective. Perhaps as
aerosolized spray
● Dextran microparticle that can be formulated either as
microparticle-based vaccine or nanoparticle (so could be delivered
by spray)
○ The antigen is interlaced inside matrix and can be
delivered as spray.
■ Large particles go directly to macrophage for
vaccine delivery. Small ones go to dendritic cells.
● Never been applied to populations like this.
○ So potentially some risk here
● Idea is to propose ‘Immune Boosting’ and ‘Immune Priming’
methods as concurrent approaches
○ Start both approaches at the beginning of the project, then
have friendly competition between the two
■ Some things will work, some won’t. Focus on what
works, so by end of project we have spray that
warfighter sends into bat cave to transiently reduce
risk of spillover
● Could be mixture of molecules (Poly IC plus
RB’s recombinants, intranasal + sticky gel,
etc.)
● Re: PREEMPT Transition Plan, translation plan

○ DARPA wants us to determine who a potential customer/recipient of our work
could be, to take research to next stage or apply it in way that’s useful to them
■ Potentially US Army, to use in order to reduce spillover risk to troops
■ DARPA (unlike US Army, DTRA, etc.) isn’t an end-user. They fund
projects but don’t end up using the final product
○ If we’re designing treatment, will it be publicly available? Handed over to DoD?
○ RB has some experience with this. Is working on commercial vaccine for
flavivirus, and also doing collaborative work for drugs on emerging CoV infection.
○ Some potential translation ideas for our proposal:
■ Panel of new viruses that sets DoD up to prepare for breadth of viruses,
allowing for creation of vaccines.
■ Animal models that can be used to evaluate therapeutics.
■ ML programs designed to take specific features in a virus family and do a
reiterative prediction about pre-pandemic potential.
● Model will be CoV but should be able to translate, transition into
other systems where you know the surface protein (major species
specificity factor) all of these proteases, etc. Also variation in RBD
is known.
○ Bats that we’ll sequence will provide massive amounts of
these variations that can be modeled onto ACE2 bat
molecule, to see how virus has caused species to
coevolve, or try to escape virus pressure.
■ i.e. interface site of ACE2 moledule in bat will show
most variation, b/c virus will put selective pressure
on animals, and bats w/ ability to escape, will be
ones that are maintained in the population.
● This will drive variation in RBD and ability to
use human receptor.
■ Another idea is...if you build chimera that broadly reduces heterogeneous
pop. of SARSr-CoVs in bat cage, this might be something you’d want to
develop for humans.
● RB has already generated SARS-like chimeras w/ RBD from
group of bat viruses called 293 (for S1), which is 20% different
than epidemic strains, and S2 region from HK3 which is 20% diff.
○ Can drive broad-based rsponese for large no. of family
members (but we can test those)
○ Detailed sequence analysis could be used to engineer
broad -based vaccinations for humans
● Re: Intentional wording w/in the proposal

○ In technical sections of full proposal, be careful not to confuse the reviewers (e.g.
using ‘vaccine’, ‘immune modulation’, ‘viral suppression’
■ Just talk about transiently reducing spillover, through modulation of bat
immune response
● Then when talking about translational plan, we can mention
potential vaccines for human application
■ We just want to be careful that we’re not sounding overly ambitious (e.g.
that we’ll try 6 different treatment as well as vaccines)
● Ensure that the terminology we use reflects a project that can be
completed in a 42-month period
● Re: Nanoparticle delivery method

○ Ensure that RB and TR come together when discussing potential nanoparticle
delivery of inocula.
PREEMPT call (EHA, Wuhan, Duke-NUS) - 27 Feb 2018
**Action Items:
● PD to have weekly calls w/ collaborators
○ LH to organize these calls
● LH to send an email confirming: DUNS nos., addresses and phone numbers of each
○ The email will also provide instructions for how to sign up on Grants.gov
(required for Key Personnel of each collaborating organization)
● PD to sit down with KJO, JHE and LH to determine who will be responsible for each
section of the proposal. Will send to collaborators by Thu. 3/1
○ Collaborators to then write their respective sections and return to PD by Wed. 3/7
○ Peng to include section about how both Immune Boosting and Immune Targeting
approaches are better than vaccination (without explicitly criticizing vaccination
approach)
● PD to speak with YunZhi regarding consultant field work in/around Yunnan cave
● Collaborators to determine if any additional personnel required for their work (e.g.
technicians, field support staff, etc.)
○ Collaborators to let PD know if they think anyone else should be brought on to
the team
● PD to determine which aspects of full proposal are baseline tasks, and which are add-
ons (by mid to late March)
● Re: Timeline
○ PD sends collaborators full proposal template with assigned sections, by Thu.
3/1
○ Collaborators complete their sections and return to PD by Wed. 3/7
○ Quality first draft of full proposal, completed by Mon. 3/12
○ Send out draft budget to collaborators by Mon. 3/19 at latest
■ Budget turnarounds for each collaborating institution:
● Duke-NUS: 1-2 days
● Wuhan Univ.: 1-2 days
● UNC (Ralph): PD to ask on call
● NWHC (Tonie): PD to ask on call
○ By mid to late March, PD is going to go thru proposal, thinking carefully about
timeline and budget. He’ll make sure each collaborator is doing both baseline
work and additional work
● Re: Writing the full proposal

○ PD will work with KJO, JHE and LH to determine which section of the proposal
each collaborator will write
■ The plan is for each group to work on the technical aspects they’re
experts on, rather than PD writing a draft of each section first
○ By Thu. 3/1, PD to send around the proposal w/ names attached to which parts
we need flushing out.
○ Then, over 5-day period, collaborators can draft out their sections and return to
PD by Wed. 3/7
■ PD would rather have more detailed, technical language than less. PD
has no problem cutting down info.
● For each task/subtask, provide any preliminary data (e.g. no. of
caves we’ve visited, no. of samples we’ve collected, data
describing our work w/ Rhinolophus, etc.).
○ Include any relevant references, numbers, figures, charts
■ Please use EndNote for references, or send references as text (can be
fixed later)
■ When writing your section(s), don’t separate tasks into baseline tasks vs.
add-ons (PD will decide this)
● Re: The proposed budget

○ DARPA to fund 0-6 projects ($40 million total)
○ We have to be careful and ensure we’ve justified the money we’re asking for
■ We need to distinguish between ‘baseline’ tasks and ‘add-ons’
● This will give DARPA clear tasks to cut if funding is limited
● Given that we have a strong team, the goal is to make sure that
each collaborator is responsible for both baseline tasks and add-
ons
○ This way if our proposed budget is reduced, each
collaborator is still able to contribute to the project
● We may need to reconsider carrying out lab work at 4 different
collaborator institutions.
○ DARPA might not fund lab work at all 4
● By mid to late March, PD is going to go thru proposal, thinking
carefully about timeline and budget. He’ll make sure each
collaborator is doing both baseline work and additional work
● Re: Distinguishing our approach from vaccination approach

○ Ralph Baric’s approach is not vaccination. Rather his approach aims to boost the
immune response against specific viral proteins (potentially to include innate
immune response)
■ Vaccination in bats not likely to work.
● Very limited antibodies from natural viral infection in bats
● Viruses already common in bat population - not likely to challenge
bat immune response with a vaccine
■ Peng to write section about how both Immune Boosting and Immune
Targeting approaches are better than vaccination (without explicitly
criticizing vaccination approach)
● Our aim is to show DARPA that we will...Develop and test a
technology that’s not guaranteed to work (but is ambitious and has
great potential) that allows us to reduce risk of spillover (even if
only temporarily)
Re: PREEMPT meeting notes (Week of 26 Feb - 2 Mar)

Tue 3/6/2018 2:35 PM
Cc: Jonathon Musser <[email protected]>
Hi Tonie,
Friday will be fine - we hope you feel better! Also, I am working with Jonathon Musser of EHA (cc'd
here) to create a budget template that we will send to you.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Tue, Mar 6, 2018 at 10:20 AM, Rocke, Tonie <[email protected]> wrote:

Hi Luke: Can you please send me your projected budget for my task?
Also, I thought we had agreed to a final draft due on Friday, 3/9, not
Wednesday. Full disclosure, I have contracted the flu and I'm pretty out
of it. I've been working on it, but I probably won't get my draft done until
Friday, Thanks -Tonie
On Fri, Mar 2, 2018 at 8:44 PM, Luke Hamel <[email protected]> wrote:
Hi all,
I wanted to provide you with the latest notes from various PREEMPT calls that took
place this week (listed below). Meeting notes from the call between EHA and Wuhan + Duke-
NUS are the same as those sent earlier this week.
1) Tue. 27 Feb. (Call between EHA staff and staff from Wuhan + Duke-NUS)
2) Fri. 2 March (Call between Peter and Jim Gimlett from DARPA)
3) Fri. 2 March (Call between EHA staff and Ralph + Tim @ UNC)
4) Fri. 2 March (Call between EHA staff and Tonie @ USGS NWHC)
Below, I've listed the 'Action Items' that correspond to each call. These action items are also
listed at the top of each document
Call between EHA & Wuhan/Duke-NUS
**Action Items:
PD to have weekly calls w/ collaborators
LH to organize these calls
LH to send an email confirming: DUNS nos., addresses and phone numbers of each
The email will also provide instructions for how to sign up on Grants.gov (required for
Key Personnel of each collaborating organization)
PD to sit down with KJO, JHE and LH to determine who will be responsible for each section
of the proposal. Will send to collaborators by Thu. 3/1
Collaborators to then write their respective sections and return to PD by Wed. 3/7
Peng to include section about how both Immune Boosting and Immune Targeting
approaches are better than vaccination (without explicitly criticizing vaccination
approach)
PD to speak with YunZhi regarding consultant field work in/around Yunnan cave
Collaborators to determine if any additional personnel required for their work (e.g.
technicians, field support staff, etc.)
Collaborators to let PD know if they think anyone else should be brought on to the
team
-PD to determine which aspects of full proposal are baseline tasks, and which are add-ons
(by mid to late March)
Call between EHA & Ralph/Tim (UNC)

**Action Items:
RB and team to draft their section and return to PD by Wed. 3/7
RB to include section stating how our project won’t drive viral evolution in negative
way
PD to complete quality first draft by end of next week, Fri. 3/9
Jonathon Musser (EHA) and Amy Sims (UNC) to work together on UNC budget
-Once EHA has drafted modeling section of proposal, RB to provide input
Call between EHA & Tonie (NWHC)

**Action Items:
Tonie Rocke (TR) to begin work on her section of the full proposal (and send to PD by Wed.
3/7)
TR to cite literature referring to use of transdermal vaccine application
TR to begin drafting budget for NWHC
- TR to check with folks from F&WS to learn about their work using automatic sprayers for
WNS
As always, please let me know if you have any questions.

Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
EcoHealth Alliance leads cutting-edge scientific research into the
critical connections between human and wildlife health and delicate
ecosystems. With this science, we develop solutions that prevent
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Scheduling upcoming calls with Peter (PREEMPT)

Tue 3/6/2018 2:38 PM
Cc: Abbott, Rachel (Contractor) C <[email protected]>; Aleksei Chmura <[email protected]>;
Alison Andre <[email protected]>; Dr. Peter Daszak <[email protected]>
Hi Tonie,
Peter is hoping to arrange weekly calls with you, to ensure that we stay on track with the full proposal.
Please use this link to select the date(s)/time(s) you are available to speak with Peter (select as
many as you are available for). The goal is to have one call each week, on either Thursday or
Friday. Below, I've listed the dates/times that appear in the Doodle Poll link above. Please note that
all times are in Eastern Time
Week 1:
Thu. 3/8 (11 AM - 5 PM ET)
Thu. 3/9 (11 AM - 5 PM ET)
Week 2:
Thu. 3/15 (11 AM - 5 PM ET)
Fri. 3/16 (11 AM - 5 PM ET)
Week 3:
Thu. 3/22 (11 AM - 5 PM ET)
Fri. 3/23 (11 AM - 5 PM ET)
Please let me know if you have any questions.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Re: Scheduling upcoming calls with Peter (PREEMPT)

Wed 3/7/2018 1:32 PM
Thank you for letting me know, Tonie. Hope you're feeling better today!
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Wed, Mar 7, 2018 at 2:24 PM, Rocke, Tonie <[email protected]> wrote:

Hi Luke: I signed up for calls this Friday and next, but I will be out of the
country on Mar 22-23. I am available instead on Wednesday March 21.
-Tonie
On Tue, Mar 6, 2018 at 2:38 PM, Luke Hamel <[email protected]> wrote:
Hi Tonie,
Please use this link to select the date(s)/time(s) you are available to speak with Peter
(select as many as you are available for). The goal is to have one call each week, on either
Thursday or Friday. Below, I've listed the dates/times that appear in the Doodle Poll link above.
Please note that all times are in Eastern Time
Week 1:
Thu. 3/8 (11 AM - 5 PM ET)
Thu. 3/9 (11 AM - 5 PM ET)
Week 2:
Thu. 3/15 (11 AM - 5 PM ET)

Fri. 3/16 (11 AM - 5 PM ET)
Week 3:
Thu. 3/22 (11 AM - 5 PM ET)
Fri. 3/23 (11 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
PREEMPT budget template and details

Wed 3/7/2018 4:03 PM
Evelyn Luciano <[email protected]>; Jonathon Musser <[email protected]>; Alison Andre
<[email protected]>; Dr. Peter Daszak <[email protected]>
Hi Tonie,
Please see attached, a PREEMPT budget template for you to complete. Although this template lacks specific
detail that will be required later, it will allow both you and our staff at EHA to determine a general budget
breakdown for your institution.
At the moment, please focus your attention on sections A-K, and fill out these sections as completely as possible.
Section L (Budget justification) can be addressed at a later time, and I will be sure to provide you with additional
instructions within the upcoming week.
To assist you in completing the budget template, I have included the proposed disbursement schedule for
the EHA-NWHC subcontract.
Year Amount
Y1 $304,500.00
Y2 $304,500.00
OY1 $304,500.00
OY .5 $152,250.00
Total $1,065,750.00
Lastly, please keep in mind the following items as you begin to determine specific aspects of your budget.
Although this level of detail isn't needed for you to complete the attached budget template, it will be required for
the final budget submission.
Please let me know if you have any questions. EHA staff will gladly assist you in procuring the necessary
items, as required below.
1) Regarding 'Indirect Costs':
If available, provide current Forward Pricing Rate Agreement or Forward Pricing Rate Proposal. If not
available, provide 2 years historical data to include pool and expense costs used to generate the rates. For
academia, provide DHHS or ONR negotiated rate package, or, if calculated by other than a rate, provide University
documentation identifying G&A and fringe costs by position.
2) Regarding 'Travel':
Provide the purpose of the trip, number of trips, number of days per trip, departure and arrival destinations,
number of people, estimated rental car and airfare costs, and prevailing per diem rates as determined by gsa.gov, etc.;
Quotes must be supported by screenshots from travel websites.
3) Regarding 'Equipment Purchases'

Itemization with individual and total costs, including quantities, unit prices, proposed vendors (if known), and the
basis of estimate (e.g., quotes, prior purchases, catalog price lists, etc.); any item that exceeds $5,000 must be
supported with back-up documentation such as a copy of catalog price lists or quotes prior to purchase (NOTE: For
equipment purchases, include a letter stating why the proposer cannot provide the requested resources from its own
funding.
4) Regarding 'Materials'
Itemization with costs, including quantities, unit prices, proposed vendors (if known), and the basis of estimate
(e.g., quotes, prior purchases, catalog price lists, etc.); any item that exceeds $5,000 must be supported with back-
up documentation such as a copy of catalog price lists or quotes prior to purchase.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
WORKSPACE FORM 1-800-518-4726
[email protected]
This Workspace form is one of the forms you need to complete prior to submitting your Application Package. This form can be completed in its entirety offline using
Adobe Reader. You can save your form by clicking the "Save" button and see any errors by clicking the “Check For Errors” button. In-progress and completed forms
can be uploaded at any time to Grants.gov using the Workspace feature.
When you open a form, required fields are highlighted in yellow with a red border. Optional fields and completed fields are displayed in white. If you enter invalid or
incomplete information in a field, you will receive an error message. Additional instructions and FAQs about the Application Package can be found in the Grants.gov
Applicants tab.
OPPORTUNITY & PACKAGE DETAILS:
Opportunity Number: HR001118S0017
Opportunity Title: PREventing EMerging Pathogenic Threats
Opportunity Package ID: PKG00237724
CFDA Number: 12.910
CFDA Description: Research and Technology Development
Competition ID:
Competition Title:
Opening Date: 01/19/2018
Closing Date: 03/27/2018
Agency: DARPA - Biological Technologies Office
Contact Information: BAA Coordinator

[email protected]
APPLICANT & WORKSPACE DETAILS:

Workspace ID: WS00094394
Application Filing Name: Project DEFUSE
DUNS: 0770900660000
Organization: ECOHEALTH ALLIANCE INC.
Form Name: R & R Subaward Budget 10 YR Subform
Form Version: 1.4
Subform Name: USGS Ntl. Wildlife Health Cen
Requirement: Optional
Download Date/Time: Mar 06, 2018 05:28:38 PM EST
Form State: Error(s)

FORM ACTIONS:
RESEARCH & RELATED BUDGET - Budget Period 1 OMB Number: 4040-0001
Expiration Date: 10/31/2019
ORGANIZATIONAL DUNS: Enter name of Organization: USGS National Wildlife Health Center
Budget Type: Project Subaward/Consortium Budget Period: 1 Start Date: End Date:
A. Senior/Key Person
Months Requested Fringe Funds
Prefix First Middle Last Suffix Base Salary ($) Cal. Acad. Sum. Salary ($) Benefits ($) Requested ($)
Tonie Rocke
Project Role: Co-Investigator
Total Funds requested for all Senior

Additional Senior Key Persons: Add Attachment Delete Attachment View Attachment Key Persons in the attached file
Total Senior/Key Person
B. Other Personnel
Number of Months Requested Fringe Funds

Personnel Project Role Cal. Acad. Sum. Salary ($) Benefits ($) Requested ($)
Post Doctoral Associates
Graduate Students
Undergraduate Students
Secretarial/Clerical
Total Number Other Personnel Total Other Personnel
Total Salary, Wages and Fringe Benefits (A+B)

C. Equipment Description
List items and dollar amount for each item exceeding $5,000
Equipment item Funds Requested ($)
Additional Equipment: Add Attachment Delete Attachment View Attachment
Total funds requested for all equipment listed in the attached file
Total Equipment
D. Travel Funds Requested ($)

1. Domestic Travel Costs ( Incl. Canada, Mexico and U.S. Possessions)
2. Foreign Travel Costs
Total Travel Cost
E. Participant/Trainee Support Costs Funds Requested ($)
1. Tuition/Fees/Health Insurance
2. Stipends
3. Travel
4. Subsistence
5. Other
Number of Participants/Trainees Total Participant/Trainee Support Costs

F. Other Direct Costs Funds Requested ($)
1. Materials and Supplies
2. Publication Costs
3. Consultant Services
4. ADP/Computer Services
5. Subawards/Consortium/Contractual Costs
6. Equipment or Facility Rental/User Fees
7. Alterations and Renovations
8.
9.
10.
Total Other Direct Costs
G. Direct Costs Funds Requested ($)

Total Direct Costs (A thru F)
H. Indirect Costs
Indirect Cost Type Indirect Cost Rate (%) Indirect Cost Base ($) Funds Requested ($)
Total Indirect Costs

Cognizant Federal Agency
(Agency Name, POC Name, and
POC Phone Number)
I. Total Direct and Indirect Costs Funds Requested ($)

Total Direct and Indirect Institutional Costs (G + H)
J. Fee Funds Requested ($)
K. Total Costs and Fee Funds Requested ($)

Total Costs and Fee (I + J)
L. Budget Justification
(Only attach one file.) Add Attachment Delete Attachment View Attachment
RESEARCH & RELATED BUDGET - Cumulative Budget
Totals ($)
Section A, Senior/Key Person
Section B, Other Personnel
Total Number Other Personnel
Section C, Equipment
Section D, Travel
1. Domestic
2. Foreign
Section E, Participant/Trainee Support Costs
2. Stipends
3. Travel
4. Subsistence
5. Other
6. Number of Participants/Trainees
Section F, Other Direct Costs
8. Other 1
9. Other 2
10. Other 3
Section G, Direct Costs (A thru F)
Section H, Indirect Costs

Section I, Total Direct and Indirect Costs (G + H)
Section J, Fee
Section K, Total Costs and Fee (I + J)
Re: Scheduling upcoming calls with Peter (PREEMPT)

Wed 3/7/2018 4:14 PM
Hi Tonie,
Peter won't have cellphone reception on Fri., 3/9, so we are looking to reschedule our call to next
week, either Tuesday (3/13) or Wednesday (3/14). I will send out another Doodle Poll link within the
week, so please be on the lookout for that email.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Wed, Mar 7, 2018 at 2:32 PM, Luke Hamel <[email protected]> wrote:

Thank you for letting me know, Tonie. Hope you're feeling better today!
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)


Hi Luke: I signed up for calls this Friday and next, but I will be out of
the country on Mar 22-23. I am available instead on Wednesday
March 21. -Tonie
Hi Tonie,
Please use this link to select the date(s)/time(s) you are available to speak with Peter
(select as many as you are available for). The goal is to have one call each week, on either
Thursday or Friday. Below, I've listed the dates/times that appear in the Doodle Poll link
above. Please note that all times are in Eastern Time
Week 1:
Thu. 3/8 (11 AM - 5 PM ET)
Thu. 3/9 (11 AM - 5 PM ET)
Week 2:
Thu. 3/15 (11 AM - 5 PM ET)
Fri. 3/16 (11 AM - 5 PM ET)
Week 3:
Thu. 3/22 (11 AM - 5 PM ET)
Fri. 3/23 (11 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Confirming dates for PREEMPT calls

Fri 3/9/2018 4:21 PM
Hi Tonie,
Based on the availability that you and Peter have listed, I've scheduled calls for the following dates:
Wed. 3/14 @ 10 AM ET
Wed. 3/21 @ 10 AM ET
Please use the domestic conference line for each call (details below).
Phone: 1-719-785-9461
Password: 9784#
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Re: PREEMPT budget template and details

Fri 3/9/2018 6:03 PM
Evelyn Luciano <[email protected]>; Jonathon Musser <[email protected]>; Alison Andre
<[email protected]>; Dr. Peter Daszak <[email protected]>
Hi Tonie,
Other than the existing salary restrictions set by USGS NWHC, there are no additional restrictions
listed within the PREEMPT Broad Agency Announcement (BAA).
Please keep in mind, however, the following requirement for all government agencies:
"Government entities must clearly demonstrate that the work [they will perform] is not otherwise
available from the private sector and provide written documentation citing the specific statutory
authority and contractual authority, if relevant, establishing their ability to propose to Government
solicitations.” See BAA, page 18.
Essentially, this means that we will require the following items from you:
1. A document signed by either the NWHC director or by you (on behalf of the NWHC), stating that
the NWHC has the 'contractual authority to collaborate/partner/etc. with EcoHealth Alliance in
the PREEMPT proposal titled, 'Project DEFUSE.'
2. A statement (within the same document) describing that NWHC is the only public or private
sector laboratory with the necessary skills, equipment, resources, etc...to perform the tasks
listed within the full proposal. (This language should match, more or less, what you will have
already listed within your technical section).
Next week, I will provide you with a template for this document. In the meantime, please communicate
this requirement to your director and notify her or him that a signature will be required.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)


Hi Luke: Sometimes government grants restrict certain expenditures by
other government agencies, particularly federal salaries. Do you know if
there are any restrictions in this case? Thanks -Tonie
Hi Tonie,
Please see attached, a PREEMPT budget template for you to complete. Although this template lacks
specific detail that will be required later, it will allow both you and our staff at EHA to determine a general
budget breakdown for your institution.
At the moment, please focus your attention on sections A-K, and fill out these sections as completely as
possible. Section L (Budget justification) can be addressed at a later time, and I will be sure to provide you
with additional instructions within the upcoming week.
Year Amount
Y1 $304,500.00
Y2 $304,500.00
OY1 $304,500.00
OY .5 $152,250.00
Total $1,065,750.00
Although this level of detail isn't needed for you to complete the attached budget template, it will be
required for the final budget submission.
academia, provide DHHS or ONR negotiated rate package, or, if calculated by other than a rate, provide
University documentation identifying G&A and fringe costs by position.
number of people, estimated rental car and airfare costs, and prevailing per diem rates as determined by gsa.gov,
etc.; Quotes must be supported by screenshots from travel websites.

Itemization with individual and total costs, including quantities, unit prices, proposed vendors (if known), and
the basis of estimate (e.g., quotes, prior purchases, catalog price lists, etc.); any item that exceeds $5,000 must be
supported with back-up documentation such as a copy of catalog price lists or quotes prior to purchase (NOTE:
For equipment purchases, include a letter stating why the proposer cannot provide the requested resources from
its own funding.
Itemization with costs, including quantities, unit prices, proposed vendors (if known), and the basis of
estimate (e.g., quotes, prior purchases, catalog price lists, etc.); any item that exceeds $5,000 must be supported
with back-up documentation such as a copy of catalog price lists or quotes prior to purchase.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
b) (6)
(direct)
(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
PREEMPT budget (follow-up)

Fri 3/9/2018 6:23 PM
Evelyn Luciano <[email protected]>; Jonathon Musser <[email protected]>
Hi Tonie,
As you are filling out your PREEMPT budget, there are a few additional comments I'd like to make:
Regarding Section L, 'Budget Justification': Please begin drafting a budget justification, if
you have not done so already. This document must provide explanation for each line item
within your detailed budget. If you have any questions regarding this section, I'd be happy to
provide you with additional information.
Adding budget periods: If you refer to the budget template I sent to you earlier this week,
you'll see that the top of page 2 reads, 'Research and Related Budget- Budget Period 1'.
This 'Budget Period 1' refers only to the first year of the proposed project. In order to
list expenses for subsequent years (i.e. Year 2, Year 3, Option Year 1 and Option Year
.5), you will have to click the 'Add Period' button at the bottom of page 4 (just after
Section L).
You will then see a page that is titled, 'Research & Related Budget- Budget Period
2', with accompanying sections (A-L) that are identical to those in Budget Period
1. Fill out this second budget period (copy over information from Budget Period 1
or edit as needed). You'll notice that the page titled, 'Research & Related Budget -
Cumulative budget' updates as you add information to 'Budget Period 2.'
Repeat this process, adding periods for Year 3, Option Year 1 and Option Year .5
Attached to this email is a screenshot of the budget template document, highlighting
where the 'Add Period' button can be found within the document.
Budget 'Point of Contact': Please let me know who is responsible for managing the
PREEMPT budget at your institution. We feel it will be easiest to communicate with this
individual directly, to ensure nothing is lost when discussing budget-related items. If this
individual is someone from another department at your institution, we will be sure to copy you
on all emails.
Lastly, please return your budget (with all five 'budget periods' included) by Wed. 3/14, Eastern
Time. We anticipate that you may have questions regarding certain aspects of the budget, so
please do not hesitate to ask. We will try to resolve any issue as quickly as possible.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

Sent: Friday, March 9, 2018 3:08 PM
To: Rocke, Tonie
Cc: Rachel Abbott; Aleksei Chmura; Dr. Peter Daszak; Alison Andre; Baric, Ralph S
Subject: Re: Rescheduling upcoming calls with Peter (PREEMPT)
Thank you, Tonie! Have an excellent weekend as well.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
On Fri, Mar 9, 2018 at 4:21 PM, Rocke, Tonie <[email protected]> wrote:

Hello Luke and Peter: Attached is my first draft of Task 7. Ralph Baric (copied here) and I had a good chat
today about viral vectors and nanoparticles. We realized much of the delivery methods would depend on his
work first, so there are some gaps here and the narrative will probably change after I see what Ralph has
written. At any rate, this is something to at least start with. Have a good weekend! -Tonie
On Thu, Mar 8, 2018 at 12:58 PM, Luke Hamel <[email protected]> wrote:

Hi Tonie,
Once again, please use this link, to select which date(s)/time(s) you are available to speak with Peter (select as many as you are
available for). The goal is to have one call each week, on either Tuesday or Wednesday. Below, I've listed the dates/times that appear in
the Doodle Poll link above. Please note that all times listed are in Eastern Time.
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
1
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
2
To: Luke Hamel
Cc: Rachel Abbott; Aleksei Chmura; Dr. Peter Daszak; Alison Andre; Baric, Ralph S
Attachments: PREEMPT TR task 7 first draft.docx
Hello Luke and Peter: Attached is my first draft of Task 7. Ralph Baric (copied here) and I had a good chat
today about viral vectors and nanoparticles. We realized much of the delivery methods would depend on his
work first, so there are some gaps here and the narrative will probably change after I see what Ralph has
written. At any rate, this is something to at least start with. Have a good weekend! -Tonie

Hi Tonie,
Once again, please use this link, to select which date(s)/time(s) you are available to speak with Peter (select as many as you are
available for). The goal is to have one call each week, on either Tuesday or Wednesday. Below, I've listed the dates/times that appear in
the Doodle Poll link above. Please note that all times listed are in Eastern Time.
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6)
(mobile)
--
Tonie E. Rocke
1
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
2
Task 7: Develop and assess delivery methods to bats for immune boosting and
priming molecules
Description and execution: While work is proceeding to identify and optimize

immunomodulating agents to manage SARS-Coronaviruses, we will concurrently
develop and test mediums, routes, and methods of delivery to large colonies of bats.
Several different approaches or combinations of approaches will be assessed to determine
the most feasible and simplest method of delivery that achieves high uptake by bats, is
safe for humans as well as target and non-target species, and minimizes disturbance to the
colony. Sticky edible gels or pastes that bats groom from themselves and each other have
been used previously to deliver pharmaceuticals to bats orally and are currently being
tested as a medium for delivery of vaccines against rabies and other diseases in wild bats
(see preliminary data). These may also be useful for delivering immune modulators and
recombinant SARSr-CoV spike proteins to Rhinolophus bats, but may need to be
combined with viral vectors (like poxvirus or adenovirus) or
nanoparticles/nanoemulsions that enhance uptake through mucous membranes or
transdermally after topical application.
Poxviruses in particular have been demonstrated to be effective viral vectors for
delivering vaccines to wildlife (Slate et al., 2009) Freuling et al., 2013; Rocke et al.,
2017). Recent laboratory studies in bats have shown that poxviruses can replicate safely
at high levels in bats after oronasal administration (Stading et al., 2016)m and poxvirus
vectored vaccines are immunogenic, protecting bats from rabies challenge (Stading et al
2017; see preliminary data). Poxviruses are highly safe, having been tested in a wide
variety of wild and domestic animals, they allow for large inserts of foreign DNA, and
they have a proven record of success. Poxviruses are good candidates for this project, but
we will also consider others.
In addition to viral vectors, we will also consider methods to achieve
transcutaneous delivery of the immune boosting proteins without the use of live agents.
Recent advances in methods to achieve transdermal or transcutaneous delivery of drugs
and vaccines have been reported. (Roberts et al., 2017). However, a major impediment to
this route of vaccination is the stratum corneum, the outermost barrier layer of the skin
that protects underlying layers from infection and damage. Numerous approaches have
relied on mechanical methods to compromise the stratum corneum to allow the drug or
vaccine to penetrate into the skin (Roberts et al., 2017). Innovations in nanotechnology
show promise in being able to deliver drugs and vaccines into the deeper layers of the
skin without the need for damage to the stratum corneum (Mishra et al., 2013), an
important consideration. Dendritic cells and Langerhans cells, antigen-presenting cells
which reside in the dermis and epidermis, can take up these transdermally delivered
proteins and generate an immune response. We are currently testing poly lactic-co-
glycolic acid (PLGA) as a nanoparticle to encapsulate rabies glycoprotein as a method of
transcutaneous delivery of vaccine to bats. PLGA has been used previously to deliver
both toll-like receptor agonists and antigens simultaneously to mice (Ebrahimian, 2017).
This and other products (outlined above in Task ?) could potentially be useful with
SARSr-CoV glycoproteins. Adjuvants can also be incorporated into nanoemulsions and
nanoparticles to amplify the natural immune response to the vaccine antigens (Karande
and Mitragotri, 2010). With SARS-CoV spike proteins, the adjuvant Matrix M1
(Isconova, Sweden) has been shown to significantly enhance the immune response in
mice (Coleman et al. 2014)
In collaboration with Dr. Baric and others, we will determine the most likely
immunomodulating formulations based on the results of TA2, previous animal studies
and other available data and then use both laboratory and field studies to assess and
optimize delivery vehicles and methods for wild bats. To reduce costs, initial studies will
be conducted with locally acquired insectivorous bats (Eptesicus fuscus--big brown bats).
We have successfully maintained and housed big brown bats and other insectivorous
species for several experiments at our facility previously (Stading et al., 2016, 2017). We
will treat bats via topical application with various test formulations that include the
biomarker Rhodamine B (RB), co-house them with untreated bats, and monitor transfer
between bats by collecting hair and whiskers for biomarker analysis. Rhodamine B is
detectable within the hair of animals within 24 hours of consumption using a
fluorescence microscope, and we have considerable experience using this biomarker for
similar studies (see preliminary data).
Once we have confirmed uptake in laboratory studies, we will then assess mass
delivery methods in local caves and hibernacula (using biomarker-labeled mediums but
without immunomodulatory substances). We will test several different approaches
including aerosolization via sprayers that could be used in cave settings and automated
sprays triggered by timers and movement detectors at critical cave entry points. Within
one week of application, bats will be trapped at the cave entrace using mist nets or Harp
traps and hair will be collected to assess the rate of uptake via biomarker analysis. The
bats will be released immediately afterward. The procedures will be tested at several
different locations as it will likely take some manipulation to determine appropriate
dosages for maximum uptake. After we have determined the most optimal approaches
for mass delivery, we will then test them on wild bats in our three cave sites in Yunnan
Province. Again, biomarker will be used to assess rates of uptake and this data can then
be used in modeling studies to help determine the optimal rates of application of
immunomodulating agents. Biomarker studies can also be used to assess uptake by non-
target species, an important consideration in evaluating safety. Fieldwork will be
conducted in collaboration with Dr. Yunzhi Zhang (Yunnan CDC, Consultant at
EcoHealth Alliance).
Preliminary Data: Rocke and colleagues have developed oral vaccines and delivery
methods to manage disease in free-ranging wildlife for many years, including a sylvatic
plague vaccine for prairie dogs (Rocke et al., 2017), and more recently, vaccines against
rabies (Stading et al., 2017) and white-nose syndrome for bats (Rocke, unpublished data).
In addition to developing, testing and registering vaccines for experimental field use,
vaccine delivery methods and uptake by the target species were optimized using
biomarker studies prior to deployment; biomarker studies were also used to assess uptake
and safety in non-target hosts (Tripp et al., 2015). A similar approach will be used to
develop, test and optimize delivery methods to Rhinolophus bats in SE Asia.
To manage plague caused by Yersinia pestis in prairie dogs, a raccoon poxvirus
vectored vaccine expressing plague antigens was incorporated into a peanut-butter
flavored bait matrix. Rhodamine B (RB), a biomarker that dyes hair, whiskers and feces
and is visible within 24 hours of consumption by animals, was included in the baits in
order to assess uptake by both target and non-target species (Figure 1). When viewed
under a UV microscope at a specific wavelength, the biomarker is visible until the hair
grows out (approximately 50 days in prairie dogs). Biomarker studies were initially used
to assess palatability and acceptance of the bait matrix by wild prairie dogs (Tripp et al.,
2014) and also used to assess bait ingestion by non-target rodents (Tripp et al., 2015).
After safety was confirmed in non-targets and with the approval of USDA Center for
Veterinary Biologics, a large field trial was conducted over a 3-year period that
demonstrated vaccine effectiveness in four species of prairie dogs in seven western states
(Rocke et al., 2017). Using biomarker analysis, we then assessed site- and individual
host-level factors related to bait consumption in prairie dogs to determine those most
related to increased bait consumption, including age, weight, and the availability of green
vegetation. Identifying the factors that maximize the likelihood of expedient bait uptake
by targeted individuals is important for developing strategies to optimize vaccine
effectiveness. This will also be important in developing disease management strategies
for bats.
a. b. c. d.
Figure 1. Prairie dog hair and whisker samples viewed under fluorescence microscope
(excitation wavelength: 540 nm, emission wavelength: 625 nm) to determine uptake of
baits containing Rhodamine B. a) whiskers positive for RB uptake 20 days after bait
distribution, b) hair sample positive for RB uptake 16 days after bait distribution, c and d)
whiskers and hair negative for RB uptake 20 days after bait distribution (note natural dull
fluorescence).
In recent years, our research team has been developing and testing vaccines and
delivery methods for use in free-ranging bats. First we tested two commonly used viral
vectors, modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN), for their safety
and replication in bats using in vivo biophotonic imaging. (Stading et al. 2017). RCN
replicated to higher levels in bats than MVA, even via the oral route, and was found to be
highly safe for bats (Figure 2). We then used raccoon poxvirus as a viral vector to
express a novel rabies glycoprotein (mosaic or MoG) and tested the protective efficacy of
this construct in bats after both oronasal and topical administration (Stading et al 2017).
Both methods of application were successful, protecting nearly all of the immunized and
challenged bats (Figure 3), work is now progressing to develop methods of vaccine
delivery to vampire bats, one of the primary reservoirs of rabies for both humans and
animals, primarily cattle, in several Latin American countries. We are also using a
similar approach to develop vaccines for white-nose syndrome in bats, a devastating
disease that has killed millions of insectivorous bats in North America.
MVA-luc given Days Post RCN-luc given
Infection
Figure 2. Luminescence, indicative of viral replication of modified vaccinia Ankara

(MVA) and raccoon poxvirus RCN) in Tadarida brasiliensis on days 1, 3 and 5 post-
inoculation via the oronasal route.
RCN-MoG ON
RCN-MoG Topical
RCN-G ON
RCN-luc
Figure 3. Results of vaccine efficacy and rabies challenge trials in Epstesicus fuscus
immunized with raccoon poxvirus expressing a mosaic G protein (RCN-MoG) either
oronasally (ON) or topically in comparison to RCN expressing typical G protein and
RCN expressing luciferase (a negative control).
For bats a different approach is required for vaccine delivery, as in general, they
are not attracted to baits. Bats, especially vampire bats, are known to practice self and
mutual grooming at a high rate, and this behavior has been exploited to cull vampire bats
using poisons like warfarin. The poison is applied topically to a number of bats that are
released. When they return to their roost, the poison is transferred to roost-mates by
contact and mutual grooming. We are exploiting this same behavior for vaccine
application. Preliminary biomarker studies (without vaccine) are being conducted in
vampire bats in both Mexico and Peru and also in insectivorous bats in Wisconsin. In a
pilot study in Peru, we treated 50 bats from a single cave with RB-labelled glycerin jelly.
Based on capture-recapture data, we estimated the population at ~200 bats, so ~25% of
bats were initially marked. Upon trapping of this population a few days later, 64 bats
were captured, including 19 originally marked bats (Table 1 – could be made into a figure
instead). Hair was collected and examined for RB marking under a fluorescence
microscope. All treated bats were positive for RB marking in addition to 39% of newly
captured bats, indicating a rate of transfer of about 1.3 bats for every bat marked.
Additional trials have been conducted, with transfer rates of up to 2.8 bats for every bat
treated achieved at least once. These trials are being analyzed to assess factors associated
with rates of transfer, e.g. sex and age of initially treated bats, time of day, etc. This data
is then being used to model the rate of vaccination and impact on rabies transmission
with different rates of application, prior to actual deployment of vaccine in the field.
Table 1. Marking of vampire bats a few days after application of glycerin jelly
containing Rhodamine B.
Number Positive Negative Inconclusive % positive
captured (w/o inc)
All bats 64 34 25 5 58
Recaptured
19 18 0 1 100
marked bats
New bat captures 45 16 25 4 39
For insectivorous bats, we are trying other approaches. Instead of hand applying the jelly
to bats, we applied RB marked glycerin jelly to the entry of bat houses used by little
brown bats (Myotis lucifugus). The bats became covered as they entered the houses and
then consumed the material during self and mutual grooming. One week later, bats were
trapped at the houses to determine the rate of uptake. Of 29 bats trapped one week post-
application, 59% (17) were positive for biomarker indicating they had eaten the jelly.
Thus, with additional optimization, application of vaccine to bat houses or other
structures (small cave entrances) could also be a viable method of delivery. In addition,
we are considering different spray applications directly to roosting bats in caves and
through motion-sensing sprayers at cave entrances. Whatever the means of application,
effective treatment relies on ingestion by bats, and that is easily confirmed with the use of
the biomarker, RB.
Progress Metrics: Not sure exactly what format to use here
Deliverable(s):
Medium and methods to deliver immunomodulatory agents to bats.
Data on uptake in insectivorous bats.
Reports, manuscripts, presentations.
Coleman CM, Liu YV, Mu H, Taylor JK, Massare M, Flyer DC, Smith GE, Frieman MB.
2014. Purified coronavirus spike protein nanoparticles induce coronavirus
neutralizing antibodies in mice. Vaccine 32:3169-3174.
Ebrahimian M, Hashemi M, Maleki M, Hashemitabar G, Abnous K, Ramezani M,

Haghparast A. 2017. Co-delivery of dual toll-like receptor agaonists and antigen in
poly(lactic-co-glycolic) acid/polyethylenimine cationic hybrid nanoparticles promote
efficient in vivo immune responses. Front Immunol 8:1077.
Freuling CM, Hampson K, Selhorst T, Schro¨der R, Meslin FX, Mettenleiter TC, Mu¨ller
T (2013) The elimination of fox rabies from Europe: determinants of success and
lessons for the future. Philosophical Transactions of the Royal Society London B
Biological Sciences 368(1623):20120142 (DOI: 10.1098/rstb.2012. 0142)
Karande P, Mitragotri S. 2010. Transcutaneous immunization: an overview of

advantages, disease targets, vaccines, and delivery technologies. Annu Rev Chem
Biomol Eng 1:175-201.
Mishra DK, Dhote V, Mishra PK. 2013. Transdermal immunization: biological

framework and translational perspectives. Expert Opin Drug Deliv 10:183-200.
Roberts MS, Mohammed Y, Pastore MN, Namjoshi S, Yousef S, Alinaghi A, Haridass

IN, Abd E, Leite-Silva VR, Benson HAE, Grice JE. 2017. Topical and cutaneous
delivery using nanosystems. J Control Release 247:86-105.
Rocke TE, Tripp DW, Russell RE, Abbott RC, Richgels KLD, Matchett MR, Biggins
DE, Griebel R, Schroeder G, Grassel SM, Pipkin DR, Cordova J, Kavalunas A,
Maxfield B, Boulerice J, Miller MW. 2017. Sylvatic plague vaccine partially protects
prairie dogs (Cynomys spp.) in field trials. EcoHealth DOI: 10.1007/s10393-017-
1253-x.
Slate D, Algeo TP, Nelson KM, Chipman RB, Donovan D, Blanton JD, Niezgoda M,
Rupprecht CE (2009) Oral rabies vaccination in North America: opportunities,
complexities, and challenges. PLoS Neglected Tropical Diseases 22
3(12):e549.doi:10.1371/journal.pntd.0000549
Stading BR, Osorio JE, Velasco-Villa A, Smotherman M, Kingstad-Bakke B, Rocke TE.

Infectivity of attenuated poxvirus vaccine vectors and immunogenicity of a
raccoonpox vectored rabies vaccine in the Brazilian Free-tailed bat (Tadarida
brasiliensis). Vaccine. 2016;34: 5352–5358. doi:10.1016/j.vaccine.2016.08.088
Stading B, Ellison JA, Carson WC, Panayampalli SS, Rocke TE, Osorio JE. Protection of
bats (Eptesicus fuscus) against rabies following topical or oronasal exporue to a
recombinant raccoon poxvirus vaccine. PLoS Negl Trop Dis 11:e0005958.
Tripp DW, Rocke TE, Streich SP, Brown NL, Fernandez JR-R, Miller MW. 2014.
Season and application rates affect vaccine bait consumption by prairie dogs in
Colorado and Utah, USA. J Wildlife Dis 20:
Tripp DW, Rocke TE, Streich SP, Abbott RC, Osorio JE, Miller MW. 2015. Apparent
field safety of a raccoon poxvirus-vectored plague vaccine in free-ranging prairie
dogs, Colorado, USA. J Wildlife Dis 51:
RE: Rescheduling upcoming calls with Peter (PREEMPT)

Sun 3/11/2018 7:52 PM
Its rough, but here’s a draft. One section not included yet. Ralph

Cc: Rachel Abbott <[email protected]>; Aleksei Chmura <[email protected]>; Dr. Peter Daszak
<[email protected]>; Alison Andre <[email protected]>; Baric, Ralph S
<[email protected]>
Hello Luke and Peter: Attached is my first draft of Task 7. Ralph Baric (copied here) and I had a good
chat today about viral vectors and nanoparticles. We realized much of the delivery methods would
depend on his work first, so there are some gaps here and the narrative will probably change after I see
what Ralph has written. At any rate, this is something to at least start with. Have a good weekend! -
Tonie
Hi Tonie,
Once again, please use this link, to select which date(s)/time(s) you are available to speak with Peter (select as many as you
are available for). The goal is to have one call each week, on either Tuesday or Wednesday. Below, I've listed the dates/times that
appear in the Doodle Poll link above. Please note that all times listed are in Eastern Time.
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
(TA1) Task 4: Develop recombinant chimeric spike proteins from characterized SARSr-CoVs
TA1.a. Description and execution: Our international team’s 15 yrs work experience on the SARSr-CoV –
Rhinolophus bat system in China has identified and isolated SARSr-CoVs with remarkable sequence identity in
the spike protein to SARS-CoV (e.g. SCH014, WIV-1, WIV-16). The pre-epidemic potential of these SARSr-
CoVs is high, as our groups have shown these SARS-like bat viruses use human, bat and civet angiotensin-1
converting enzyme 2 receptors (ACE2) for entry, and importantly, bind and replicate efficiently in primary human
lung airway cells, like epidemic SARS-CoV (PMC4801244, PMC4797993). Moreover, chimeras (recombinants)
with SARSr-CoV spike proteins in a SARS-CoV backbone, as well as synthetically reconstructed full length
SCHO14 and WIV-1 SARS-like bat viruses cause SARS-like illness in humanized mice (express human ACE2
receptor), with clinical signs that are not reduced by SARS monoclonal therapy or vaccination (PMC4801244,
PMC4797993). We have identified a single cave site in Yunnan Province where bat SARSr-CoVs contain all the
genetic components of epidemic SARS-CoV
Figure A. SARSr-CoV Spike Selection. (A) Virus S glycoprotein
gene sequences will be phylogenetically placed into the group 2b (7,8,9). We have now shown that people living up
SARS-like CoV. (B): S amino acid variation is then annotated onto to 6 kilometers from this cave have SARSr-CoV
the S structure and compared with the existing panel of live SARSr- antibodies (3% seroprevalence in 200+ cohort)
CoV-predicting antigenically dissimilar strains for prioritization. (C- (PMID:29500691), suggesting active spillover, and
D) ACE2-S RBD interface residues are reviewed and structural
modeling is used to predict virus-receptor interactions, noting the
marking these viruses as a clear-and-present
lack of robust HKU3 S RBD interaction with hACE2. Using the danger of a new SARS-like pandemic.
RNAseq data, modeling will also identify rare quasispecies variant
TA1.b. SARSr-CoV Sample Collection and CoV
strains that encode mutations in the population, which improve RBD-
Species Specificity. The Wuhan Institute of
ACE2 interaction networks and potential potential to infect humans.
Virology team will continue to collect biodiversity
surveys from SARSr-CoV viruses of bat caves
across S. China. They have large, but incomplete
collections of SARSr-CoVs sequences, most of
which have not been evaluated for pre-epidemic
potential. SARS-CoV cross species transmission is
heavily regulated by S glycoprotein receptor
binding domain interaction with the angiotensin 1
converting enzyme 2 receptor (ACE2). The
structure of the SARS trimer prefusion spike has
been solved as well as the bound SARS S RBD-
ACE2 complex (PMC5223232, PMC4860016, )
Mutations in the RBD regulate SARSr-CoV
capacity to replicate in human, civet, mouse and
bat cell lines and animals (PMC2588415,
PMC2258931, PMID:16166518, PMC2446986). In fact, human-optimized RBD residues (Phe-442, Phe-472,
Asn-479, Asp-480, and Thr-487) bind hACE2 best while civet-optimized RBD (Tyr-442, Pro-472, Arg-479, Gly-
480, and Thr-487) bind cACE2 best but also hACE2 (PMC3308800). In addition, recent data demonstrate that
host proteases and S glycoprotein proteolytic processing also regulates entry and cross species transmission
efficiency (PMID:16339146, PMC4151778, PMC5552337). If mismatches occur in the S-RBD-ACE2 molecules
or in S proteoloytic processing, SARSr-CoV will not enter and hence cannot replicate in cells, unless this RBD-
ACE2 interface is repaired by reverse genetics or mutation (PMC2588415, PMC2258931). Importantly, CoV
species specific restriction events are limited after entry, as this same viral genome is replication competent
when delivered by transfection or electroporation (PMC2588415, PMC2258931).Consequently, entry functions
represent the key first step to evaluating the disease potential of SARSr-CoV.
Using RNAseq and Sanger sequencing methods, our groups have collected full length genome and S
glycoprotein gene sequences over time and analyzed S genes analyzed phylogenetically for recombination
events, and high-risk viruses by our group and others in the program (e.g., RBD-ACE2 structure modeling,
receptor binding domain (RBD) sequence conservation, spike glycoprotein similarity to SARS-CoV, and Commented [BRS1]: Need linkage to modeling group.
protease cleavage site bioavailability, etc.). From in silico data and risk assessment modeling platforms, the
primary goals in Task4 are to: i) model and down-select strains for recovery and analyses, ii) identify S
glycoprotein genes which program infection in vitro using pseudotyped and chimeric viruses, iv) synthetically
reconstruct a panel of high risk full length SARSr-CoV strains, v) characterize virus growth phenotypes in primary
human airway cultures and vi) perform in vivo pathogenesis studies using human ACE2 transgenic mice.
TA1.c. Preliminary Data: The Baric laboratory pioneered many of the strategic approaches (i-vi) and the SARSr-
CoV reverse genetic platforms used for coronaviruses, including the use of synthetic genome design to
reconstruct and recovery full length or S chimeric recombinant viruses from in silico sequence database
(PMC4801244, PMC4797993, PMC2588415, PMC2258931). An example of full length recombinant SARSr-CoV
reconstructed using reverse genetics in the Baric laboratory is shown in Fig A, Panel B and include human
epidemic strains, civet and raccoon dog SARS-CoV strains, as well as SARSr-CoV strains (WIV16, WIV1,
SHC014 and HKU3-SRBD {repaired RBD interface)}. These strains are immediately available for use in
assessment of broadscale approaches to reduce population burdens of SARSr-CoV in bat cells available in the
Baric, Shi and Wang laboratories (PMC2258931, PMC4801244, PMC4797993, PMC2588415, PMC4801244,
PMC4797993).
TA1.d. Novel SARSr-CoV Virus Recovery. Chimeric Viruses. Our approach for testing the pre-epidemic
potential of novel SARS-rCoV strains identified by sequence analyses is shown in Figure B. First, we will
commercially synthesize selected SARSr-CoV S glycoprotein genes, designed for direct insertion into our full
length SCH014 or WIV16 molecular clones (BSL3, not select agent, pathogenic in hACE2 transgenic mice),
noting that these two SARSr-CoV are 88 and 97% identical to epidemic SARS-Urbani in the S glycoprotein. As
the S gene interacts with the M glycoprotein, E protein and N protein in assembly/release, different backbone
strains provide increased opportunities for recovery of viable viruses, as well as to identify potential barriers for
RNA recombination between strains (PMC5708621). The chimeric viruses will be recovered in Vero cells, or in
mouse cells over-expressing human, bat and civet ACE2 receptors, as receptor over-expression may support
cultivation of viruses having weak RBD-ACE2 interfaces and sequence verified. Viruses will then evaluated for:
i) human, civet and bat ACE2 receptor usage in vitro, ii) growth in primary human airway epithelial cells, iii)
sensitivity to broadly cross neutralizing human monoclonal antibodies S215.17, S109.8, S227.14 and S230.15
and a mouse antibody (435) that recognize unique epitopes in the RBD (PMC2826557, PMID:29134417) and
iv) in vivo pathogenesis studies in hACE2 transgenic
mice, using well established approaches in our Figure B. Experimental Design. S genes of interest will be
inserted into WIV16 and/or SCH014 full length molecular clones
laboratory (). A limited number of human SARS serum and chimeric virus rowth evaluated in primary human cells and
samples from the Toronto outbreak in 2003 are also cell lines constitutively expressing bat, civet, human and mouse
available to evaluate cross neutralizing profiles using ACE2 receptors. In vivo pathogenesis, hmAB cross
polyclonal serum (n=10), should some isolates prove neutralization assays and therapeutic intervention studies in vivo
highly resistant to our panel of mAB. Chimeric viruses will prioritize strains for recovery of full-length SARSr-CoV.
that encode novel S genes with pre-epidemic potential
(e.g., growth in HAE, use of multiple species ACE2
receptor for entry, antigenic variation, etc.) will be used
to identify SARSr-CoV strains for recovery as full
genome length viable viruses. We anticipate testing
~20 S genes/yr. Commented [BRS2]: Modeling team, how many you
need; 60+ provide much help for modeling. I note that if we
TA1e. Recovery of Full length SARSr-CoV. To validate 1, half-a dozen additional strains with slight
recover full length viruses, we will first compile the sequence variation also will fall in the “pre-epidemic” high
sequence/RNAseq data from a panel of closely related risk categories so multiplies will get you into the 100’s or
strains (e.g,<5% nucleotide variation) and compare 1000’s of strains.
the full length genome sequences, scanning for unique
SNPs which might represent sequenceing errors as
previously described by our groups (PMC3497669,
PMC2583659, PMC3791741). We will identify the best consensus candidate and synthesize the genome using
commercial vendors (e.g., BioBasic, etc.), as six contiguous cDNA pieces linked by unique restriction
endonuclease sites that do not disturb the coding sequence, but allow for full length genome assembly. Full
length genomes will be transcribed into RNA and electoration is used to recovery full length recombinant viruses
(PMC3977350, PMC240733). Using the full length genomes, we will re-evaluate virus growth in primary human
airway epithelial cells at low and high multiplicity of infections and in vivo in hACE2 transgenic mice, testing
whether backbone genome sequence alters full length SARSr-CoV pre-epidemic or pathogenic potential in
models of human infection. All experiments are performed in triplicate and the data provided to the Modeling
Team for the development of risk assessment models, warfighter apps, and models to evaluate potential
intervention outcomes. We anticipate recoverying 2-5 full length genomes/yr, reflecting strain differences in
antigenicity, receptor usage, growth in human cells and pathogenesis.
TA1.f. In vivo Pathogenesis Studies. To generate a mouse model more relevant to humans, we generated a
mouse that expresses human ACE2 receptor under control of HFH4, a lung ciliated epithelial cell promoter
(PMC4801244). Infection of this model with wildtype SARS-CoV and WIV1 resulted in lethal disease outcomes
with SARS-CoV, but minimal disease with WIV1. These data argue that WIV1 is less likely efficient at using the
hACE2 receptor in vivo and hence less likely to produce severe disease outcomes in an outbreak setting. Of
note, microvariation in the SARs-CoV RBD of related strains could dramatically alter these phenotypes, hence
the need to evaluate the impact of low abundant, high consequence microvaration in the RBD. Briefly, groups of
10 animals will be infected intranasally with 1.0 x 104 PFU of each virus. Clinical disease (e.g., weight loss,
respiratory function by Buxco plethysmography, mortality) will be followed for 6 days. One half the animals will
be sacrificed at day 2 and 6 postnfection for virologic determinations, histopathology and immunohistochemistry
in the lung and for 22-parameter complete blood count (CBC) in blood and BAL using the Vetscan HM5.
TA1.g. Evaluating 2ary S gene Markers for SARSr-CoV Pre-epidemic Potential. 1) Identification of high
risk/low abundant variants. RNAseq will identify low abundant quasispecies variants that encode mutations in
the RBD and/or residues that bind ACE2 receptor (Fig A). Low abundant mutations, especially in RBD residues
that interface with ACE2 receptors, would alter risk assessment calculations as strains identified as low risk,
might actually encode high risk, but low abundant
Figure C. Additional Markers for High/Low Risk Strain
Identification. (A). Clade 2, but not Clade 1 SARSr-CoV encode variants. To test this hypothesis, we will closely with
programmed deletions which likely impact ACE2 receptor the modeling core and Dr. Shi’s laboratory to identify
usage. (B) Proteolytic and N-glycosylation sites of interest. highly variable residue changes in the SARSr-CoV S
RBD, and use commercial gene blocks to introduce
these changes singly and then in combination into the
S glycoprotein gene of the parental low risk, high
abundant strain parent. We will evaluate the ability of
these low abundant chimeric viruses to use human,
bat, civet and mouse ACE2 receptors, and more
importantly, replicate efficiently in human primary
cells. 2) Impact of RBD deletions on Pre-epidemic
Risk Assessment. SARSr-CoV RBD sequences fall
into two larger clades, heavily defined by the
presence of small deletions between residues 432-
437 and 458-472, which leave the key RBD-ACE2
interface residues intact. (Fig C). To improve risk assessment, we will molecularly analyze the functional
consequences of these deletions on SARSr-CoV human ACE2 receptor usage, growth in primary cells and in
vivo pathogenesis. First, we will delete these regions, sequentially and then in combination, in SCH014,
anticipating that the introduction of both deletions will prevent SCH014 growth in Vero and human cells. We also
hypothesize that the smaller deletion may be tolerated, given it location in the RBD structure. In parallel, we will
evaluate the ability of targeted recombination between high and low risk strains to restore pre-epidemic features
to low risk viruses. To test this hypothesis, we will synthesize full length rs4237, a highly variable SARSr-CoV
that encodes the SHC014 RBD contact interface residues at 442, 487 and 491 but also encodes mutation at 479
(N479S) and has the 432-437 and 458-472 deletions and hence, is not recoverable in vitro. Using the SCH014
backbone sequence, we will first sequentially and then in tandem repair the 432-437, 458-472 deletions in the
presence and absence of the S479N. We anticipate that the S479N mutation is critical given its key role in
establishing the RBD-ACE2 interface, and that restoration of the RBD deletions will significantly enhance virus
recognition of hACE2 receptors and growth in Vero and HAE cultures in vitro. Together, these data will directly
inform risk assessment SARSr-CoV population genetic structure obtained from difference cave ecologies. 3) S2
Proteolytic Cleave and Glycosylation Sites. In some instances, recombinant chimeric viruses may be
predicted to replicate efficiently because of matched RBD-ACE2 interfaces, yet fail to replicate. After receptor
binding, cell surface or endosomal proteases cleave the SARS S glycoprotein to activation fusion mediated entry
(PMC4151778). Massive changes in Spike structure occur to mediate membrane fusion and entry
(PMC5651768). The absence of S cleavage prevents SARS-coV entry (PMC5457962). A variety of proteases,
including TMPRSS2, TMPRSS11a, HAT, trypsin and cathepsin L carry out these processes on the SARS S
glycoprotein (PMC3233180, PMC3889862, PMC5479546, PMID:26206723)(Fig C). In some instances, tissue
culture adaptations introduce a furin cleavage site, which can direct entry processes as well, usually by cleaving
S at positions 757 and 900 in S2 of other coronaviruses, but not SARS (PMID:26206723). For SARS-CoV, a
variety key cleavage sites in S have been identified including R667/S668, R678/M679 for trypsin and cathepsin
L, respectively, R667 and R792 (and other unidentified sites) for TMPRSS2, and R667 for HAT. Therefore, all
SARSr-CoV S gene sequences will be analyzed for the presence of these appropriately conserved proteolytic
cleavage sites in S2 and for the presence of potential furin cleavage sites (R-X-[K/R]-R↓) and which can be
predicted computationally (PMC3281273) . Importantly, SARr-
CoV with mismatches in proteolytic cleavage sites can be
activated by exogenous trypsin or cathepsin L (Fig D), providing
another strategy to recover non-cultivatable viruses. In instances
where clear mismatches occur in these S2 proteolytic cleavage
sites of SARSr-CoV, we will introduce the appropriate human-
specific cleavage sites and evaluate growth potential in Vero and
Figure D. Exogenous Trypsin Restores SARSr-
HAE cultures. In SARS-CoV, we will ablate several of these sites CoV Growth.
based on pseudotype particle studies and evaluate the impact of
select SARSr-CoV changes on virus replication and pathogenesis (e.g., R667, R678, R797). Experimental
outcomes from these studies will be incorporated into risk management models to identify high and low risk
SARS-like CoV.
SARS S has 23 potential N-linked glycosylation sites N-linked glycosylation sites (NX(S/T; X is anything but
proline) and 13 of these have been confirmed using biochemical approaches (e.g., positions: 118, 119, 227, 269,
318, 330, 357, 783, 1056, 1080, 1140, 1155, and 1176). Importantly, several N-linked glycosylation sites regulate
SARS particle binding DC-SIGN/L-SIGN, alternative entry receptors for SARS-CoV infections (positions: N109,
N118, N119, and especially N227, N699)( PMC1641789, PMC2168787, PMC2168787) and may protect critical
sites for antibody neutralization(PMC5515730). Importantly, the emergence of human SARS-CoV from civet and
raccoon dog reservoir strains was associated with the evolution of mutations that introduced two N-linked
glycosylation sites that promote DC-SIGN/L-SIGN binding (N227, N699), suggesting a role in the expanding
human 2003 epidemic (PMC2168787). Interesting, these N-linked glycosylation sites are absent from civet,
raccoon dog strains and clade 2 SARSr-CoV, but are present in WIV1, WIV16 and SCH014 as well as human
epidemic strains, supporting a potential role in host jumping (Fig C). To evaluate the role of these mutations in
cross species transmission and pathogenesis, we will sequentially introduce clade 2 residues at positions N227
and N699 of SARS-CoV and SCH014 and evaluate virus growth in Vero, Huh7 cells (nonpermissive) expressing
ectopically expressed DC-SIGN and HAE cultures, anticipating reduced virus growth efficiency. Using the clade
2 rs4237 molecular clone described above, we will introduce the clade I mutations that introduce N-linked
glycosylation sites at positons 227 and N699 and in rs4237 RBD deletion repaired strains, evaluating virus growth
efficiency on Vero, HAE or Hela cells ± ectopically expressing DC-Sign (PMC2168787). In vivo, we will evaluate
pathogenesis in transgenic ACE2 mice. Experimental outcomes from these studies will be incorporated into risk
management models to identify high and low risk SARS-like CoV.
Progress Metrics: Not sure how to do this.
Deliverable(s):
1. Methods to Produce Synthetic SARSr-CoV Virus Molecular Clones and Reverse Genetics.
a. Preliminary Data: Molecular Clones for SARSr-CoV WIV1, WIV16, SCH014 and HKU3-SRBD exist.
We have demonstrated in the preliminary data that these reagents are already available.
b. Target Goals: We will generate molecular constructs for 20+ chimeric SARSr-CoV encoding
different S glycoprotein genes/yr
c. Target Goals: We will generate 2-5 full length molecular clones of SARSr-CoV.
2. Methods of Recombinant virus Recovery and Characterization
a. Preliminary Data: Demonstrated recovery recombinant chimeric SARSr-CoV WIV1, WIV16,
SCH014, HKU3-SRBD, including full length recombinant viruses of WIV1, WIV16, SCH014 and
HKU3-SRBD.
b. Target Goals: We will isolate 20+ chimeric SARSr-CoV encoding novel S glycoprotein genes
c. Target Goals: We will isolate 2-5 full length SARSr-CoV/year/
i. Key Deliverables for Program-wide Success: These two key reagents position us for
immediate testing of the antiviral effects of broadscale immune boosting molecules +/-
immunogens on virus growth in vitro and in vivo, and on virus levels in models of
chronic SARS-CoV infection in mice.
3. Virus Phenotyping: Receptor Interactions and In Vitro Growth.
a. Preliminary Data: Cell lines encoding bat, human, civet and mouse ACE2 receptors exist and
have been validated. We have demonstrated the use of primary human airway epithelial
cultures to characterize SARSr-CoV pre-epidemic potential.
b. Target Goals: We will characterize SARSr-CoV recombinant virus growth in Vero cells,
nonpermissive cells encoding the civet, bat and human ACE2 receptors.
4. Virus Pathogenic Potential in Humans:
a. Preliminary Data: We also have transgenic human ACE2 mouse models to compare the
pathogenic potential of SARSr-CoV
b. Target Goals: We will evaluate SARSr-CoV pathogenic outcomes in hACE2 transgenic mice.
5. Virus Antigenic Variation:
a. Preliminary Data: We have robust panels of broadly cross reactive human monoclonal
antibodies against SARS and related viruses and mouse models to evaluate protection against
SARSr-CoV replication and pathogenesis.
b. We will evaluate SARS-vaccine performance against a select subset of SARSr-CoV (10), chosen
based on the overall percent of antigenic variation, coupled with distribution across the S
glycoprotein structure.
6. Low Abundant High Consequence Sequence Variants:
a. We will identify the presence of low abundant, high risk SARSr-CoV, based on deep sequencing
data
7. Proteolytic Processing and Pre-epidemic Potential.
a. We will evaluate the role of proteolytic cleavage site variation on SARSr-CoV cross species
transmission and pathogenesis in vivo.
TA2.a. Description and execution: There is no available current technology to reduce the risk of exposure to novel
coronaviruses from bats which carry zoonotic precursors to many emerging viruses including filoviruses (Ebola),
Coronaviruses (SARS-CoV, MERS-CoV, etc.), paramyxoviruses (Nipha/Hendra), rhabdoviruses (rabies) and others.
Unfortunately, models of bat host capacity to harbor viruses, of ecological and environmental drivers of their
emergence, and of the evolutionary potential of different strains to spillover are rudimentary. No vaccines or
therapeutics exist for emerging coronaviruses, filoviruses and paramyxoviruses and exposure mitigation strategies are
non-existent. Using emerging coronaviruses (SARSr-CoV) as models, we will apply broadscale immune boosting
strategies alone (Prof. Linfa Wang (Duke-NUS) or in the presence and absence of chimeric immunogens (targeted
immune boosting strategy), designed to upregulate bat immunity in the cave roosts, down-regulate viral replication and Commented [BRS3]: Broadscale immune boost +
boost adaptive immunity to high risk strains. We will use small molecule Rig like receptor (RLR) or Toll like receptor (TLR) chimeric immunogen
agonists coupled with novel chimeric polyvalent recombinant spike proteins in microparticle encapsidated gels and
powders for oral delivery and/or virus adjuvanted immune boosting strategies where chimeric recombinant SARSr-CoV
spikes are expressed from raccoon poxvirus, which has been used extensively to devlier rabies immunogens in bats and
other animals. We will design novel methods to deliver these applications remotely to reduce exposure risk during
decontamination.
The Baric group has developed novel group 2b SARSr-CoV chimeric S glycoproteins that encode neutralizing domains
from phylogenetically distant strains (e.g., Urbani, HKU3, BtCoV 279), which differ by ~25%. The chimeric spike programs
efficient expression when introduced in the HKU3 backbone full length genome, and elicit protective immunity against
multiple group 2b strains (see preliminary data). We will use this platform as a broadscale immune boosting strategy.
First, we will develop robust expression systems to express SARSr-CoV chimeric spikes using ectopic expression in vitro.
Then, we work with Dr. Ainslie (UNC-Pharmacy) who has developed novel microparticle delivery systems and dry
powders for aerosol release, and which encapsidate recombinant proteins and adjuvants (innate immune agonists) that
will be used for parrellel broadscale immune boosting strategies ± chimeric immungens. In parallel, we will introduce
chimeric and wildtype spikes in raccoon poxvirus (RCN), in
Figure E. Chimeric SARSr-CoV S Glycoprotein
Immunogens. (A) A chimeric S glycoprotein was collaboration with Dr. Rocke and confirm recombinant protein
synthesized which contained HKU3, SARS-CoV and expression, first in vitro and then in bats in collaboration with Dr.
BtCoV/279/04. (B) Recombinant viruses encoding Shi and Dr. Wang, who have bat colonies. The goal of this aim is to
the HKU3-Smix gene were viable and grew to ~108
PFU/ml in Vero Cells. (C) VRP vaccines encoding develop a suite of reagents to remotely reduce exposure risk in high
the SARS-S, BtCoV 279-S and HKU3-S protect risk environmental settings.
against HKU3-Smix challenge. (D) VRP-HKU3-Smix
vaccine protect against SARS-CoV lethal challenge. TA2.b. Preliminary Data: Chimeric SARSr-CoV Spike Immunogens.
Coronaviruses evolve quickly by mutation and RNA recombination,
the latter provides a strategy to rapidly exchange functional motifs
within the S glycoprotein and generate viruses with novel properties
in terms of host range and pathogenesis (PMC237188,
PMC5708621). Coronaviruses also encode neutralizing epitopes in
the NTD, RBD and S2 portion of the S glycoprotein (PMID:29514901,
PMC2826557, PMC2268459, PMC3256278). Given the breadth of
SARSr-CoV circulating in natural settings, chimeric immunogens
were designed to increase the breadth of neutralizing epitopes
across the group 2b phylogenetic subgroup (PMC5708621). Using
synthetic genome design and structure guided design, we fused the
n-terminal NTD domain of HKU3 (1-319) with the SARS-CoV RBD
(320-510) with the remaining BtCoV 279/04 S glycoprotein molecule
(511-1255), introduced the chimeric S glycoprotein gene into the
HKU3 genome backbone (25% different than SARS-CoV, clade 2 virus) and recovered viable viruses (HKU3-Smix) that
could replicate to titers of about 108 PFU/ml on Vero cells (Fig E). HKU3-Smix is fully neutralized by monoclonal
antibodies that specifically target the SARS RBD (data not shown). In parallel, we inserted the HKU3mix S glycoprotein
gene into Venezuelan equine encephalitis virus replicon vectors (VRP-Schimera) and demonstrated that VRP vaccines
protect against wildtype SARS-CoV challenge and virus growth. In addition, VRP-SHKU3 and VRP-S279 both protect
against HKU3mix challenge and growth in vivo (Fig E), demonstrating that neutralizing epitopes in the HKU3mix S
glycoprotein are appropriately presented and provide broad cross protection
Figure F. Particle Delivery Systems.
against multiple SARSr-CoV. In addition to using these immuogens as a Broadscale immune boosting
targeted broad-based boosting strategy in bats, we will also produce a strategies include (A) Dextran
chimeric SCH014/SARS-CoV/HKU3 S gene for more focused immune targeting microparticles or (B) Dry Powders.
on known high risk strains.
In parallel, we will work with the Protein Expression Core at UNC
(https://www.med.unc.edu/csb/pep)to produce codon optimized, stabilized
and purified prefusion SARS-CoV glycoprotein ectodomains as described
by Pallesen J et al., PNAS 2016. Briefly, the chimeric S ectodomain will be
linked to a C-terminal T4 fibritin trimerization domain, an HRV3c cleavage
site, an 8xHis-Tag and a Twin-Strep-tag, and after transfection, mg quantities
will be produced in 0.5–1 L FreeStyle 293-F cells treated with kifunensine (5
μM final concentration) for 6 d. The chimeric S trimer protein will be purified
Strep-Tactin resin (IBA), treated withHRV3C protease overnight at 4 °C and
the products purified using a Superose 6 16/70 column (GE Healthcare
Biosciences) (PMC5584442). Purified recombinant protein will be used by Dr.
Rocke and Dr. Ainslie for inclusion in delivery matrices (e.g., purified
powders, dextran beads, gels) with broadscale immune agonists (adjuvants-Dr. Wang) like poly IC, TLR4 and Sting
agonists and can be fine-tuned for regulated delivery by programmed degradation for time-ordered delivery (Fig F).
These particles can be aerosolized, or delivered in sprays or gels to bat populations, providing new modalities for
zoonotic virus disease control in wildlife populations (PMID: 28032507, PMC4267924).
TA2.c. 2nd Generation Chimeric S glycoprotein Design and Testing. Using the approach discussed above, we will also
produce a chimeric SCH014 NTD/SARS-CoV-RBD/HKU3 S C terminal and generate recombinant HKU3 encoding the
trimer spike (HKU3-SS014), for more focused immune targeting on known high risk strains with pre-epidemic potential.
After sequence variation, we will evaluate virus growth in Vero and HAE cultures and the ability of SARS RBD monoclonal
antibodies (S227, S230, S109) to neutralize chimeric virus infectivity (PMC2268459, PMC2826557). We will also evaluate
in vivo pathogenesis in C57BL/6 mice and hACE2 transgenic mice. The recombinant HKU3-SS014 S genes will be
introduced into VRP vectors and sent to Dr. Rocke for insertion into the raccoon poxvirus vaccine vector,
characterization of S expression and then provided to Drs. Wang and Shi for immune boosting of bats. Recombinant
HKU3-SS014 glycoprotein expression will be validated by Western blot and by vaccination of mice, allowing us to
determine if the recombinant protein elicits neutralizing antibodies that protect against lethal SARS-CoV, HKU3-Smix and
SCH014 challenge. In parallel, we will survey the RNAseq data for evidence of complex S glycoprotein gene RNA
recombinants in the cave SARSr-CoV population genetic structure. We will synthesize 2-3 interesting recombinant S
genes, insert these genes into SCHO14 or HKU3 genome backbones and VRP and characterize the viability and
replicative properties of these viruses in cell culture and in mice and the VRP for S glycoprotein expression and vaccine
outcomes.
TA2.d. Microparticle Performance Metrics in vitro and in Rodents and Bats.
Progress Metrics:
Deliverable(s):
Re: PREEMPT budget template and details

Mon 3/12/2018 4:58 PM
Hi Tonie,
The overhead calculation spreadsheet is attached.
Katie
On Mon, Mar 12, 2018 at 4:20 PM, Rocke, Tonie <[email protected]> wrote:
Here's the budget template. Can you check the intranet and tell me the
overhead rate? Thanks -Tonie
Date: Wed, Mar 7, 2018 at 4:03 PM
Subject: PREEMPT budget template and details
Cc: Rachel Abbott <[email protected]>, Aleksei Chmura <[email protected]>,
Evelyn Luciano <[email protected]>, Jonathon Musser
<[email protected]>, Alison Andre <[email protected]>, "Dr. Peter
Daszak" <[email protected]>
Hi Tonie,
Please see attached, a PREEMPT budget template for you to complete. Although this template lacks specific
detail that will be required later, it will allow both you and our staff at EHA to determine a general budget
breakdown for your institution.
At the moment, please focus your attention on sections A-K, and fill out these sections as completely as
possible. Section L (Budget justification) can be addressed at a later time, and I will be sure to provide you with
additional instructions within the upcoming week.
Year Amount
Y1 $304,500.00
Y2 $304,500.00
OY1 $304,500.00
OY .5 $152,250.00
Total $1,065,750.00
Although this level of detail isn't needed for you to complete the attached budget template, it will be required
for the final budget submission.
academia, provide DHHS or ONR negotiated rate package, or, if calculated by other than a rate, provide
University documentation identifying G&A and fringe costs by position.
number of people, estimated rental car and airfare costs, and prevailing per diem rates as determined by gsa.gov,
etc.; Quotes must be supported by screenshots from travel websites.

Itemization with individual and total costs, including quantities, unit prices, proposed vendors (if known), and
the basis of estimate (e.g., quotes, prior purchases, catalog price lists, etc.); any item that exceeds $5,000 must be
supported with back-up documentation such as a copy of catalog price lists or quotes prior to purchase (NOTE: For
equipment purchases, include a letter stating why the proposer cannot provide the requested resources from its own
funding.
Itemization with costs, including quantities, unit prices, proposed vendors (if known), and the basis of estimate
(e.g., quotes, prior purchases, catalog price lists, etc.); any item that exceeds $5,000 must be supported with back-
up documentation such as a copy of catalog price lists or quotes prior to purchase.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--

6006 Schroeder Rd
Madison, WI 53711
(608) 270 - 2450 (office)
(608) 381 - 2492 (cell)
(608) 270 - 2415 (fax)
[email protected]
www.nwhc.usgs.gov
GROSS FUNDING $78,030.00
64.543% 46.017% 20.000% 17.919%
NET $47,422.25 $53,438.98 $65,025.00 $66,172.54
COM $8,497.59 $4,007.92 $4,876.88 $11,857.46
FAC $13,749.61 $15,494.10 $3,039.27 $0.00
BUREAU $8,360.33 $5,089.09 $5,089.10 $0.00
TOTAL BURDEN
$30,607.54 $24,591.12 $13,005.25 $11,857.46
COSTS
TOTAL COM FAC

NET FUNDING
GROSS
COM
FAC
BUREAU
TOTAL BURDEN
COSTS
BUR
Re: PREEMPT budget (follow-up)

Tue 3/13/2018 10:26 AM
Evelyn Luciano <[email protected]>; Jonathon Musser <[email protected]>
Hi Tonie,
There was a typo in my previous email. When I referred to 'Adding budget periods' to the budget
template, I spoke of a 'Year 3' for the project and said there were five budget periods. This is
incorrect. There are only 4 periods for the project and they are as follows: 'Year 1', 'Year 2',
'Option Year 1', 'Option Year .5'. I apologize for the mistake.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)

Hi Tonie,
As you are filling out your PREEMPT budget, there are a few additional comments I'd like to make:
Regarding Section L, 'Budget Justification': Please begin drafting a budget justification, if
you have not done so already. This document must provide explanation for each line item
within your detailed budget. If you have any questions regarding this section, I'd be happy
to provide you with additional information.
Adding budget periods: If you refer to the budget template I sent to you earlier this week,
you'll see that the top of page 2 reads, 'Research and Related Budget- Budget Period 1'.
This 'Budget Period 1' refers only to the first year of the proposed project. In order to
list expenses for subsequent years (i.e. Year 2, Year 3, Option Year 1 and Option
Year .5), you will have to click the 'Add Period' button at the bottom of page 4 (just
after Section L).
You will then see a page that is titled, 'Research & Related Budget- Budget
Period 2', with accompanying sections (A-L) that are identical to those in
Budget Period 1. Fill out this second budget period (copy over information from
Budget Period 1 or edit as needed). You'll notice that the page titled, 'Research
& Related Budget - Cumulative budget' updates as you add information to
'Budget Period 2.'
Attached to this email is a screenshot of the budget template document, highlighting
where the 'Add Period' button can be found within the document.
PREEMPT budget at your institution. We feel it will be easiest to communicate with this
individual directly, to ensure nothing is lost when discussing budget-related items. If this
individual is someone from another department at your institution, we will be sure to copy
you on all emails.
Lastly, please return your budget (with all five 'budget periods' included) by Wed. 3/14, Eastern
Time. We anticipate that you may have questions regarding certain aspects of the budget, so
please do not hesitate to ask. We will try to resolve any issue as quickly as possible.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
Re: PREEMPT budget (follow-up)

Tue 3/13/2018 1:01 PM
Hi Tonie,
Yes, please include 'Indirect Costs' within Section H of the budget template. Also please note, that
the total subcontract amount includes all costs (direct and indirect).
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Tue, Mar 13, 2018 at 12:45 PM, Rocke, Tonie <[email protected]> wrote:
Thanks Luke: Were you expecting that our indirect costs were included
in the proposed budget figures you gave me? Thanks -Tonie
On Tue, Mar 13, 2018 at 10:26 AM, Luke Hamel <[email protected]> wrote:
Hi Tonie,
There was a typo in my previous email. When I referred to 'Adding budget periods' to the
budget template, I spoke of a 'Year 3' for the project and said there were five budget periods.
This is incorrect. There are only 4 periods for the project and they are as follows: 'Year 1',
'Year 2', 'Option Year 1', 'Option Year .5'. I apologize for the mistake.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)

Hi Tonie,
As you are filling out your PREEMPT budget, there are a few additional comments I'd like to
make:
Regarding Section L, 'Budget Justification': Please begin drafting a budget
justification, if you have not done so already. This document must provide explanation
for each line item within your detailed budget. If you have any questions regarding this
section, I'd be happy to provide you with additional information.
Adding budget periods: If you refer to the budget template I sent to you earlier this
week, you'll see that the top of page 2 reads, 'Research and Related Budget- Budget
Period 1'.
This 'Budget Period 1' refers only to the first year of the proposed project. In
order to list expenses for subsequent years (i.e. Year 2, Year 3, Option Year 1
and Option Year .5), you will have to click the 'Add Period' button at the
bottom of page 4 (just after Section L).
You will then see a page that is titled, 'Research & Related Budget- Budget
Period 2', with accompanying sections (A-L) that are identical to those in
Budget Period 1. Fill out this second budget period (copy over information
from Budget Period 1 or edit as needed). You'll notice that the page titled,
'Research & Related Budget - Cumulative budget' updates as you add
information to 'Budget Period 2.'
Attached to this email is a screenshot of the budget template document,
highlighting where the 'Add Period' button can be found within the document.
PREEMPT budget at your institution. We feel it will be easiest to communicate with
this individual directly, to ensure nothing is lost when discussing budget-related items.
If this individual is someone from another department at your institution, we will be
sure to copy you on all emails.
Lastly, please return your budget (with all five 'budget periods' included) by Wed. 3/14,
Eastern Time. We anticipate that you may have questions regarding certain aspects of the
budget, so please do not hesitate to ask. We will try to resolve any issue as quickly as
possible.
Best,
Feedback on PREEMPT graphic

Wed 3/14/2018 8:14 AM
Cc: Abbott, Rachel (Contractor) C <[email protected]>; Dr. Peter Daszak <[email protected]>;
Aleksei Chmura <[email protected]>; Alison Andre <[email protected]>
Hi Tonie,
As part of the PREEMPT proposal, we are required to include a graphic that illustrates our team's proposed
technical approach. Below, I've attached a working draft of this graphic.
In our call today, we're hoping to briefly hear your thoughts about this image (especially in regards to the 'Field
Testing and Deployment' panel). We will describe the graphic as it currently stands, then allow for your feedback.
Also, just a reminder that our call today is at 10 AM (ET):
Phone: 1-719-785-9461
Password: 9784#
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6)
(mobile)
Host-Pathogen Prediction Intervention Development
Host-Pathogen
Niche Modeling Immune boosting
Assays in
humanized mice Immune priming
Machine learning
genotype-phenotype
mapping Captive experiments
Modeling
recombination Simulating host-viral
and evolution dynamics
Validate models
using human serology
Field testing
and deployment
Sent: Tuesday, March 13, 2018 12:29 PM
To: Luke Hamel; Daszak Peter
Subject: Fwd: PARC FEA
Attachments: PARC_whitepaper_Biotech_v3_final.pdf
Hi Luke/Peter: In anticipation of our call tomorrow, take a look at the attached white paper and video on the
link below. I think this looks like a great option for a spray device for bats, and it sounds like the material I
have been working with already would work perfectly with this system. I haven't yet been able to pin them
down on a price for a subcontract, but I'd like to talk to you tomorrow about this and some other budget
details I am struggling with. Thanks -Tonie
From: <[email protected]>
Date: Tue, Mar 13, 2018 at 1:53 PM
Subject: Re: PARC FEA
To: [email protected]
Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you are curious about how the spray might actually
look like, you can check out a video here -- https://www.parc.com/services/focus-area/amds/
We would really be interested in working with your proposal team on this. If possible, it will be more value-generating
for us to be a subcontractor and to contribute more to tailoring our spray technology for the intended use case. I’d also
like to mention that another aspect we could bring to the table is in transitioning out the technology into a reality,
particularly towards commercialization, because we have a good history on this – particularly on the device side but
also, and increasingly, in the biomedical space through other commercial partners.
Please let me know how this might turn out.
Thanks,
Jerome

Date: Tuesday, March 13, 2018 at 5:11 AM
To: "Unidad, Jerome <[email protected]>" <[email protected]>
Subject: Re:
1
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however, so can I call you? Is this number
good? 650-812-4209. Thanks -Tonie
On Mon, Mar 12, 2018 at 8:34 PM, <[email protected]> wrote:
Sorry, I mixed up the schedule. I actually do have a meeting in the 1-2PM PST slot, how about 11AM-12PM PST (1-2PM
CT)?
Thanks,
Jerome

Date: Monday, March 12, 2018 at 5:25 PM
Subject: <no subject>
Hi Jerome: I have been working on developing vaccines for use in managing disease in wild bats - e.g. rabies
in vampire bats and white-nose syndrome in insectiverous bats. I am also collaborating on a PREEMPT
proposal and one of my collaborators passed on your contact information and description regarding PARC's
spray technology for possible application in this field. Would you have time to chat tomorrow? I'll be
available anytime after noon CT. Thanks much! -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
2
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
3
Innovative Solutions for Biotechnology @ PARC
Leveraging on our long history in fluid and particle manipulation and roll-to-roll processes for printing
applications, the PARC hardware laboratories are currently developing innovative device solutions with
potential applications in biomedicine and biotechnology at-large.
Filament Extension Atomizer (FEA)
PARC is developing a novel spray technology called the Filament Extension Atomizer (FEA) that can generate
aerosol from fluids that are notoriously difficult to aerosolize due to the inherent viscosity limit with most conventional
spray methods. FEA can spray fluids of a wide range of viscosities: from 1 mPa-s (the viscosity of water) up to 1000
Pa-s (the viscosity of peanut butter) – this range includes fluids or dispersions with significant (bio)macromolecular
content. This macromolecular content (long chain polymers) often impart an additional resistance to aerosol/spray
generation due to strain hardening or the increase of fluid viscosity as a function of extension.
To generate aerosol from such strain

hardening fluids, FEA harnesses a well-
known elasto-capillary instability that
generates beads-on-a-string formation (Fig.
1A) when a fluid is held in extension. As the
filaments are sufficiently thinned out, droplet
break-up occurs and generates free
droplets (aerosol). The FEA technology
implements similar mechanics in a roll-to-
roll process (Fig. 1B) to massively
parallelize the filament formation and break-
up and continuously generate droplets. To
date, we have applied this on multiple
viscoelastic fluids which include polymer
solutions, polymer melts, particle
Fig. 1 – A. Beads-on-a-string structures in a viscoelastic fluid in extension
dispersions and other complex systems (McKinley and Olivera, 2005), B. Multiple beads-on-a-string formations in
with biomolecules (Figs. 1C-E). counter-rotating rollers (FEA), FEA spraying of PEO solution (C.),
hyaluronic acid (D.) and sunscreen (E.)
The FEA technology is inherently scalable – it can

work with small rollers for consumer scale
applications, tailored for precision fluid dispensing,
or with large rollers for industrial scale, high
throughput aerosol generation for coatings or for
powder production via spray drying. Since the FEA
technology applies to wide range of fluids of virtually
any viscosity or composition, it allows nearly
formulation-independent fluid delivery. This can
have a huge impact in biomedicine and
Consumer Scale Industrial Scale
• Portable devices • Large rollers (up to 100mm)
biotechnology at-large: fluids can be formulated for
• Small rollers (down to 10mm) • High throughput bio-efficacy and not for delivery with no limits on
• Low throughput • Unit operation in a bioactive loading, even with high viscosity
• Precision fluid delivery (e.g. manufacturing line biomacromolecules that are notoriously hard to
bioactive doses) • Particle creation (e.g. spray deliver in a controlled, reliable manner. FEA can also
• Smart, connected devices drying), large area coatings allow the creation of specialized particles for drug
Fig. 2 – FEA Technology at Different Scales and Applications
delivery with a wide range of material set and control
over the particle morphology.
PARC, 3333 Coyote Hill Road, Palo Alto, California 94304 USA +1 650 812 4000 | [email protected] | www.parc.com
Technical Contact:
Jerome Unidad ([email protected]), Member of Research Staff
A global center for commercial innovation, PARC, a Xerox company, works closely with enterprises,
entrepreneurs, government program partners and other clients to discover, develop, and deliver new business
opportunities. PARC was incorporated in 2002 as a wholly owned subsidiary of Xerox Corporation (NYSE: XRX).
Copyright © 2018 Palo Alto Research Center Incorporated.

All Rights Reserved. PARC, the PARC Logo are trademarks of Palo Alto Research Center Incorporated.
PARC, 3333 Coyote Hill Road, Palo Alto, California 94304 USA +1 650 812 4000 | [email protected] | www.parc.com | page 2
From: [email protected]
Sent: Tuesday, March 13, 2018 11:54 AM
Attachments: PARC_whitepaper_Biotech_v3_final.pdf
Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you are curious about how the spray might actually
look like, you can check out a video here -- https://www.parc.com/services/focus-area/amds/
We would really be interested in working with your proposal team on this. If possible, it will be more value-generating
for us to be a subcontractor and to contribute more to tailoring our spray technology for the intended use case. I’d also
like to mention that another aspect we could bring to the table is in transitioning out the technology into a reality,
particularly towards commercialization, because we have a good history on this – particularly on the device side but
also, and increasingly, in the biomedical space through other commercial partners.
Thanks,
Jerome

Subject: Re:
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however, so can I call you? Is this number
good? 650-812-4209. Thanks -Tonie
Sorry, I mixed up the schedule. I actually do have a meeting in the 1-2PM PST slot, how about 11AM-12PM PST (1-2PM
CT)?
Thanks,
Jerome

1
Hi Jerome: I have been working on developing vaccines for use in managing disease in wild bats - e.g. rabies
in vampire bats and white-nose syndrome in insectiverous bats. I am also collaborating on a PREEMPT
proposal and one of my collaborators passed on your contact information and description regarding PARC's
spray technology for possible application in this field. Would you have time to chat tomorrow? I'll be
available anytime after noon CT. Thanks much! -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
2
Innovative Solutions for Biotechnology @ PARC
Leveraging on our long history in fluid and particle manipulation and roll-to-roll processes for printing
applications, the PARC hardware laboratories are currently developing innovative device solutions with
potential applications in biomedicine and biotechnology at-large.
Filament Extension Atomizer (FEA)
PARC is developing a novel spray technology called the Filament Extension Atomizer (FEA) that can generate
aerosol from fluids that are notoriously difficult to aerosolize due to the inherent viscosity limit with most conventional
spray methods. FEA can spray fluids of a wide range of viscosities: from 1 mPa-s (the viscosity of water) up to 1000
Pa-s (the viscosity of peanut butter) – this range includes fluids or dispersions with significant (bio)macromolecular
content. This macromolecular content (long chain polymers) often impart an additional resistance to aerosol/spray
generation due to strain hardening or the increase of fluid viscosity as a function of extension.
To generate aerosol from such strain

hardening fluids, FEA harnesses a well-
known elasto-capillary instability that
generates beads-on-a-string formation (Fig.
1A) when a fluid is held in extension. As the
filaments are sufficiently thinned out, droplet
break-up occurs and generates free
droplets (aerosol). The FEA technology
implements similar mechanics in a roll-to-
roll process (Fig. 1B) to massively
parallelize the filament formation and break-
up and continuously generate droplets. To
date, we have applied this on multiple
viscoelastic fluids which include polymer
solutions, polymer melts, particle
Fig. 1 – A. Beads-on-a-string structures in a viscoelastic fluid in extension
dispersions and other complex systems (McKinley and Olivera, 2005), B. Multiple beads-on-a-string formations in
with biomolecules (Figs. 1C-E). counter-rotating rollers (FEA), FEA spraying of PEO solution (C.),
hyaluronic acid (D.) and sunscreen (E.)
The FEA technology is inherently scalable – it can

work with small rollers for consumer scale
applications, tailored for precision fluid dispensing,
or with large rollers for industrial scale, high
throughput aerosol generation for coatings or for
powder production via spray drying. Since the FEA
technology applies to wide range of fluids of virtually
any viscosity or composition, it allows nearly
formulation-independent fluid delivery. This can
have a huge impact in biomedicine and
Consumer Scale Industrial Scale
• Portable devices • Large rollers (up to 100mm)
biotechnology at-large: fluids can be formulated for
• Small rollers (down to 10mm) • High throughput bio-efficacy and not for delivery with no limits on
• Low throughput • Unit operation in a bioactive loading, even with high viscosity
• Precision fluid delivery (e.g. manufacturing line biomacromolecules that are notoriously hard to
bioactive doses) • Particle creation (e.g. spray deliver in a controlled, reliable manner. FEA can also
• Smart, connected devices drying), large area coatings allow the creation of specialized particles for drug
Fig. 2 – FEA Technology at Different Scales and Applications
delivery with a wide range of material set and control
over the particle morphology.
PARC, 3333 Coyote Hill Road, Palo Alto, California 94304 USA +1 650 812 4000 | [email protected] | www.parc.com
Technical Contact:
Jerome Unidad ([email protected]), Member of Research Staff
A global center for commercial innovation, PARC, a Xerox company, works closely with enterprises,
entrepreneurs, government program partners and other clients to discover, develop, and deliver new business
opportunities. PARC was incorporated in 2002 as a wholly owned subsidiary of Xerox Corporation (NYSE: XRX).
Copyright © 2018 Palo Alto Research Center Incorporated.

All Rights Reserved. PARC, the PARC Logo are trademarks of Palo Alto Research Center Incorporated.
PARC, 3333 Coyote Hill Road, Palo Alto, California 94304 USA +1 650 812 4000 | [email protected] | www.parc.com | page 2
Re: PARC FEA

William B. Karesh
Wed 3/14/2018 10:39 AM
<(b) (6) @gmail.com>
Thanks,
DARPA may also require EHA to get three quotes, though we can probably justify a sole-source
agreement. But, in any case, it may be faster and easier for us to do it than the NWHC.
I’ll flag that to Luke so he can make sure it ends up in the budget in the right place before
submission.
BK
On Mar 14, 2018, at 10:42 AM, Rocke, Tonie <[email protected]> wrote:

Here's the video we were talking about. I just had another
thought after we hung up, that as a government agency, I would
probably have to put the subcontract out for bid (unless I can
write a really strong sole-source justification). But I suppose we
can worry about all that and shift budget around if we get
funding. Might be easier for EcoHealth Alliance to write the
subcontract. I'll see what price I can get them down to. Best -
Tonie
To: Luke Hamel <[email protected]>, Daszak Peter
<[email protected]>
Hi Luke/Peter: In anticipation of our call tomorrow, take a look at
the attached white paper and video on the link below. I think this
looks like a great option for a spray device for bats, and it sounds
like the material I have been working with already would work
perfectly with this system. I haven't yet been able to pin them
down on a price for a subcontract, but I'd like to talk to you
tomorrow about this and some other budget details I am
struggling with. Thanks -Tonie

Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you are curious
about how the spray might actually look like, you can check out a video here --
https://www.parc.com/services/focus-area/amds/
We would really be interested in working with your proposal team on this. If possible, it
will be more value-generating for us to be a subcontractor and to contribute more to
tailoring our spray technology for the intended use case. I’d also like to mention that
another aspect we could bring to the table is in transitioning out the technology into a
reality, particularly towards commercialization, because we have a good history on this
– particularly on the device side but also, and increasingly, in the biomedical space
through other commercial partners.
Thanks,
Jerome

Subject: Re:
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however, so can I call
you? Is this number good? 650-812-4209. Thanks -Tonie

Sorry, I mixed up the schedule. I actually do have a meeting in the 1-2PM PST slot,
how about 11AM-12PM PST (1-2PM CT)?
Thanks,
Jerome

To: "Unidad, Jerome <[email protected]>"
<[email protected]>
Hi Jerome: I have been working on developing vaccines for use in managing

disease in wild bats - e.g. rabies in vampire bats and white-nose syndrome in
insectiverous bats. I am also collaborating on a PREEMPT proposal and one of
my collaborators passed on your contact information and description regarding
PARC's spray technology for possible application in this field. Would you have
time to chat tomorrow? I'll be available anytime after noon CT. Thanks much! -
Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
<PARC_whitepaper_Biotech_v3_final.pdf>
Re: PARC FEA

William B. Karesh
Wed 3/14/2018 10:43 AM
great video.
B

Here's the video we were talking about. I just had another
thought after we hung up, that as a government agency, I would
probably have to put the subcontract out for bid (unless I can
write a really strong sole-source justification). But I suppose we
can worry about all that and shift budget around if we get
funding. Might be easier for EcoHealth Alliance to write the
subcontract. I'll see what price I can get them down to. Best -
Tonie
<[email protected]>
Hi Luke/Peter: In anticipation of our call tomorrow, take a look at
the attached white paper and video on the link below. I think this
looks like a great option for a spray device for bats, and it sounds
like the material I have been working with already would work
perfectly with this system. I haven't yet been able to pin them
down on a price for a subcontract, but I'd like to talk to you
tomorrow about this and some other budget details I am
struggling with. Thanks -Tonie
Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you are curious
about how the spray might actually look like, you can check out a video here --
We would really be interested in working with your proposal team on this. If possible, it
will be more value-generating for us to be a subcontractor and to contribute more to
tailoring our spray technology for the intended use case. I’d also like to mention that
another aspect we could bring to the table is in transitioning out the technology into a
reality, particularly towards commercialization, because we have a good history on this
– particularly on the device side but also, and increasingly, in the biomedical space
through other commercial partners.
Thanks,
Jerome

Subject: Re:
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however, so can I call
you? Is this number good? 650-812-4209. Thanks -Tonie

Sorry, I mixed up the schedule. I actually do have a meeting in the 1-2PM PST slot,
how about 11AM-12PM PST (1-2PM CT)?
Thanks,
Jerome

<[email protected]>
Hi Jerome: I have been working on developing vaccines for use in managing

disease in wild bats - e.g. rabies in vampire bats and white-nose syndrome in
insectiverous bats. I am also collaborating on a PREEMPT proposal and one of
my collaborators passed on your contact information and description regarding
PARC's spray technology for possible application in this field. Would you have
time to chat tomorrow? I'll be available anytime after noon CT. Thanks much! -
Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: PARC FEA

William B. Karesh
Wed 3/14/2018 12:28 PM
Just so you know for future thinking or planning in case Peter didn’t already explain it.
Our NICRA rate is 31.5% this year, but for sub-awards like to you, it only applies to the first $25,000
and then 0% for the rest of the money in that contract (normally annual).
I’m not sure how it would apply for a large purchase order if we went that way with PARC. They
may be okay with a sub-award, in which case the 25K limit would save us all money.
BK

I suspect your OH rate is not as high as ours either. -T
On Wed, Mar 14, 2018 at 10:39 AM, William B. Karesh <(b) (6) @gmail.com> wrote:
Thanks,
DARPA may also require EHA to get three quotes, though we can probably justify a
sole-source agreement. But, in any case, it may be faster and easier for us to do it
than the NWHC.
I’ll flag that to Luke so he can make sure it ends up in the budget in the right place
before submission.
BK

Here's the video we were talking about. I just had
another thought after we hung up, that as a
government agency, I would probably have to put the
subcontract out for bid (unless I can write a really
strong sole-source justification). But I suppose we can
worry about all that and shift budget around if we get
funding. Might be easier for EcoHealth Alliance to
write the subcontract. I'll see what price I can get them
down to. Best -Tonie

<[email protected]>
Hi Luke/Peter: In anticipation of our call tomorrow,
take a look at the attached white paper and video on
the link below. I think this looks like a great option for a
spray device for bats, and it sounds like the material I
have been working with already would work perfectly
with this system. I haven't yet been able to pin them
down on a price for a subcontract, but I'd like to talk to
you tomorrow about this and some other budget
details I am struggling with. Thanks -Tonie
Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you
are curious about how the spray might actually look like, you can check
out a video here -- https://www.parc.com/services/focus-area/amds/
We would really be interested in working with your proposal team on this.
If possible, it will be more value-generating for us to be a subcontractor
and to contribute more to tailoring our spray technology for the intended
use case. I’d also like to mention that another aspect we could bring to
the table is in transitioning out the technology into a reality, particularly
towards commercialization, because we have a good history on this –
particularly on the device side but also, and increasingly, in the
biomedical space through other commercial partners.
Thanks,
Jerome

<[email protected]>
Subject: Re:
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however,

so can I call you? Is this number good? 650-812-4209. Thanks -
Tonie

Sorry, I mixed up the schedule. I actually do have a meeting in the 1-
2PM PST slot, how about 11AM-12PM PST (1-2PM CT)?
Thanks,
Jerome

<[email protected]>
Hi Jerome: I have been working on developing vaccines for use in

managing disease in wild bats - e.g. rabies in vampire bats and
white-nose syndrome in insectiverous bats. I am also collaborating
on a PREEMPT proposal and one of my collaborators passed on
your contact information and description regarding PARC's spray
technology for possible application in this field. Would you have
time to chat tomorrow? I'll be available anytime after noon CT.
Thanks much! -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
RE: PARC FEA

Thu 3/15/2018 2:13 PM
To: Rocke, Tonie E <[email protected]>; Billy Karesh <(b) (6) @gmail.com>; Luke Hamel
<[email protected]>
Tonie – Thanks for all of this. Re. PARC – Billy and I would like to have a quick call with Jerome. Would you like to
join?
Either way, I’ll send him an email now and try to set up a time this afternoon or tomorrow (Friday).
Bottom line – this is expensive, and if we’re not exclusive with them, it’s prob better to go with the cheaper
option.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

To: Billy Karesh; Peter Daszak; Luke Hamel
A couple of other questions/comments. Are you proposing for co-PIs to meet periodically, perhaps at
EHA? or elsewhere? Should we include that in our travel budgets? I think I heard yesterday someone
from your shop was going to provide a budget for trips to China as well. Finally, just a heads up, I
currently have a DOD SERDP grant and was caught by surprise how often they require the PI to travel to
DC for progress reports and symposium (3 x last year, 2 x this year and the registration fee for each
symposium is $1000), so be sure to include funds in your budget for that. Best -Tonie
Hi all: Here's PARC's proposed "lean" budget ($(b) (4) ) and it may be too expensive for us at this point
(although to be honest I don't think it is overpriced). I tried to sell it as a way to illustrate the value of
their technology, but it sounds like they already have a relationship with DARPA. Perhaps I just didn't
sell it well enough. If either of you would like to try negotiating with them, feel free (bargaining is not
one of my strong suits!). One option might be to just get through #3 on their list for a total of $(b) (4) and
then use the prototype developed for lab testing in the field (I'm assuming this will be a hand held
device), and leave the field deployable unit for another grant; or maybe at that point DARPA would fund
them directly. I can discuss this idea with him tomorrow. As Billy and I discussed today in any case, the
subcontract should not come from USGS as it would be charged exorbitant overhead costs. If we decide
to go this route, we can reduce the NWHC budget somewhat. Let me know what you think. Thanks! -
Tonie

Hi Tonie,
I agree based on our discussion that I think there’s a lot of interesting space for our technology for
wildlife health management that we can work on together. We are certainly interested in exploring these
other funding opportunities with you, particularly the WNS one which seems to be in the intermediate
term.
Regarding PRE-EMPT, we understand that coming in this late that you guys probably have already
fleshed out the project direction and tasks with equivalent budget and there might not be a lot of
flexibility. In our proposed involvement, we would not want to change anything that you already just
fleshed but rather supplement it with our spray technology. Based on preliminary estimation on how this
involvement might be like, I came up with the following tasks and a lean estimate of the associated cost:
Phase I
1. Development of a prototype FEA system for lab testing (Year 1) - $(b) (4)
2. Optimization of FEA spray conditions for PRE-EMPT fluids (Year 1) - $(b) (4)
3. Refinements of FEA delivery system (setup, fluid formulation, general aerosol delivery scheme)
based on preliminary lab testing (Year 2) - $(b) (4)
4. Preliminary design of a field-deployable FEA system (Year 2) - $(b) (4)
Phase II
5. Fabrication and testing of field-deployable FEA systems (Year 3) - $(b) (4)

6. Project management and communication - $(b) (4)
The cost of the entire involvement as drafted is $(b) (4) over the full period of 3.5 years (Phase I and II).
Some of the tasks proposed above (example task 3) are included to ensure that we refine our technology
continually to meet the requirements of the application at hand. We have a good working relationship
with DARPA on various projects that we would want to maintain and, at the same time, we would like to
take this chance to work with institutions such as yours on something with broad impact.
Please let me know what your thoughts are and whether this might work. I can make myself available for
a phone call tomorrow, as needed. Also, feel free to loop in your project PI/prime in the discussion in case
it might be helpful.
Thanks,
Jerome

Date: Wednesday, March 14, 2018 at 10:45 AM
Hi Jerome: I had a good conversation with my colleagues and shared your material and video link with
them. They agreed this looks like a great option for us, so we'd like to further explore how to move
forward. Our PREEMPT proposal encompasses a wide variety of aims related to understanding and
managing disease in bats in SE Asia, primarily in relation to SARS/coronaviruses. So a big part of the
project is testing and developing the appropriate immune boosting agents. At the same time, we'd like to
start developing the methods for delivery to bats via technology like your FEA you've described, first
testing in laboratories and small caves - stateside, with the ultimate goal of conducting a field trial in a
single cave system in China as proof of concept. So given that, what kind of budget do you think you
might need to be involved, or alternatively, could you break things down for me by task, so we can see
how we might structure this in stages? Honestly, we don't have alot of flexibility in the budget at the
moment, but we see a ton of applications of this technology for your company in the future in managing
wildlife health issues, not only with DARPA, but also DOI (white nose syndrome), USDA (bat rabies),
and other government agencies, both foreign and domestic, so perhaps your company might view this as a
good opportunity to test and illustrate the value of your technology. There is also another funding
opportunity I am looking at for WNS that we might be able to partner on if you are interested. Let me
know what you think. Also, with your permission, we'd like to include the link to the video in our
proposal and perhaps pull an illustration or two for the text of the proposal with credits of course. Best
regards -Tonie
On Tue, Mar 13, 2018 at 6:48 PM, <[email protected]> wrote:

Yes, certainly split over 2-3 years. We can be very flexible on the workflow and I’d say we can
structure it for maximal benefit of the project. This could mean developing an initial benchtop
prototype quickly with some optimization as early as possible so that we can transition the setup to the
corresponding partners (e.g. your group) to initiate the lab testing as soon as possible, and then spend
the succeeding work on refining various aspects (fluid formulation for targeted spreading or
bioefficacy, etc.) and maybe later on developing a field-deployable version, with motion-actuation (or
timed-actuation, whatever case maybe), for Phase 2. We should be able to flesh it out very quickly
depending on whatever structure you guys already have in mind.
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

Advanced Manufacturing and Deposition Systems
Hardware Systems Laboratory
PARC, A Xerox Company

To: Unidad, Jerome <[email protected]> <[email protected]>
Thanks Jerome. That is just what i need. The video is awesome. I'll talk things over with the PI
tomorrow. In terms of a subcontract, do you think we could split it over 2-3 years? Best -Tonie

Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you are curious about how the
spray might actually look like, you can check out a video here --
We would really be interested in working with your proposal team on this. If possible, it will be more
value-generating for us to be a subcontractor and to contribute more to tailoring our spray
technology for the intended use case. I’d also like to mention that another aspect we could bring to
the table is in transitioning out the technology into a reality, particularly towards commercialization,
because we have a good history on this – particularly on the device side but also, and increasingly, in
the biomedical space through other commercial partners.
Thanks,
Jerome

Subject: Re:
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however, so can I call you? Is this
number good? 650-812-4209. Thanks -Tonie

Sorry, I mixed up the schedule. I actually do have a meeting in the 1-2PM PST slot, how about
11AM-12PM PST (1-2PM CT)?
Thanks,
Jerome

Hi Jerome: I have been working on developing vaccines for use in managing disease in wild bats
- e.g. rabies in vampire bats and white-nose syndrome in insectiverous bats. I am also
collaborating on a PREEMPT proposal and one of my collaborators passed on your contact
information and description regarding PARC's spray technology for possible application in this
field. Would you have time to chat tomorrow? I'll be available anytime after noon CT. Thanks
much! -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Travel for DARPA

Thu 3/15/2018 2:14 PM
<[email protected]>
Cc: Anna Willoughby <[email protected]>
Re. the travel – we’re working out how many trips etc., but this needs to come out of your budget. We’ll send info
along to you v. soon.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

Tonie

Hi Tonie,
term.
Phase I
Phase II

Thanks,
Jerome

Hi Jerome: I had a good conversation with my colleagues and shared your material and video link with
them. They agreed this looks like a great option for us, so we'd like to further explore how to move
forward. Our PREEMPT proposal encompasses a wide variety of aims related to understanding and
managing disease in bats in SE Asia, primarily in relation to SARS/coronaviruses. So a big part of the
project is testing and developing the appropriate immune boosting agents. At the same time, we'd like to
start developing the methods for delivery to bats via technology like your FEA you've described, first
testing in laboratories and small caves - stateside, with the ultimate goal of conducting a field trial in a
single cave system in China as proof of concept. So given that, what kind of budget do you think you
might need to be involved, or alternatively, could you break things down for me by task, so we can see
how we might structure this in stages? Honestly, we don't have alot of flexibility in the budget at the
moment, but we see a ton of applications of this technology for your company in the future in managing
wildlife health issues, not only with DARPA, but also DOI (white nose syndrome), USDA (bat rabies),
and other government agencies, both foreign and domestic, so perhaps your company might view this as a
good opportunity to test and illustrate the value of your technology. There is also another funding
opportunity I am looking at for WNS that we might be able to partner on if you are interested. Let me
know what you think. Also, with your permission, we'd like to include the link to the video in our
proposal and perhaps pull an illustration or two for the text of the proposal with credits of course. Best
regards -Tonie

prototype quickly with some optimization as early as possible so that we can transition the setup to the
corresponding partners (e.g. your group) to initiate the lab testing as soon as possible, and then spend
the succeeding work on refining various aspects (fluid formulation for targeted spreading or
bioefficacy, etc.) and maybe later on developing a field-deployable version, with motion-actuation (or
timed-actuation, whatever case maybe), for Phase 2. We should be able to flesh it out very quickly
depending on whatever structure you guys already have in mind.
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Thanks Jerome. That is just what i need. The video is awesome. I'll talk things over with the PI
tomorrow. In terms of a subcontract, do you think we could split it over 2-3 years? Best -Tonie

Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you are curious about how the
spray might actually look like, you can check out a video here --
We would really be interested in working with your proposal team on this. If possible, it will be more
value-generating for us to be a subcontractor and to contribute more to tailoring our spray
technology for the intended use case. I’d also like to mention that another aspect we could bring to
the table is in transitioning out the technology into a reality, particularly towards commercialization,
because we have a good history on this – particularly on the device side but also, and increasingly, in
the biomedical space through other commercial partners.
Thanks,
Jerome

Subject: Re:
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however, so can I call you? Is this
number good? 650-812-4209. Thanks -Tonie

Sorry, I mixed up the schedule. I actually do have a meeting in the 1-2PM PST slot, how about
11AM-12PM PST (1-2PM CT)?
Thanks,
Jerome

Hi Jerome: I have been working on developing vaccines for use in managing disease in wild bats
- e.g. rabies in vampire bats and white-nose syndrome in insectiverous bats. I am also
collaborating on a PREEMPT proposal and one of my collaborators passed on your contact
information and description regarding PARC's spray technology for possible application in this
field. Would you have time to chat tomorrow? I'll be available anytime after noon CT. Thanks
much! -Tonie
--
Tonie E. Rocke

6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
RE: PARC FEA

Thu 3/15/2018 2:14 PM
<[email protected]>
Tonie – re. the PARC budget, we’ll put this in our central budget, so we reduce the overhead costs as you say
below. If you can reduce your NWHC budget by $50K per year, to cover us for some of the costs.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

Tonie

Hi Tonie,
term.
Phase I
Phase II

Thanks,

Thu 3/15/2018 3:31 PM
Hi Tonie, I think I misunderstood RCN is the Raccoon poxvirus? Ralph

Hi Ralph: Thanks for sending me your narrative. Just to clarify, are you proposing challenge trials in
vaccinated bats at UNC? I think we should just subcontract with UW to engineer the RCN constructs.
They are really skilled at it. We typically then produce the master seeds in my lab. I'm assuming those
seeds would then go back to yours for challenge trials. Does that make sense? I'm trying to figure out
how to prepare the budget. Same question I guess about the nanoparticles. Will you be constructing
these in your lab and then testing them in bats? Thanks! -Tonie
On Sun, Mar 11, 2018 at 7:52 PM, Baric, Ralph S <[email protected]> wrote:

<[email protected]>
Tonie

Hi Tonie,
Once again, please use this link, to select which date(s)/time(s) you are available to speak with Peter (select as many as
you are available for). The goal is to have one call each week, on either Tuesday or Wednesday. Below, I've listed the
dates/times that appear in the Doodle Poll link above. Please note that all times listed are in Eastern Time.
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6)
(mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Thu 3/15/2018 3:39 PM
Cc: Ainslie, Kristy <[email protected]>
Hi Tonie, might be beneficial for you and Kristy to talk-who has nano/micro particle based delivery systems. I’ve
included her email. Ralph


<[email protected]>
Tonie

Hi Tonie,
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Thu 3/15/2018 3:50 PM
Okay, Peter said you should set up the subcontract through your section. Sorry for being dense. ralph

Sent: Thursday, March 15, 2018 4:33 PM
Yes it is. -T
On Thu, Mar 15, 2018 at 3:31 PM, Baric, Ralph S <[email protected]> wrote:


<[email protected]>
Hello Luke and Peter: Attached is my first draft of Task 7. Ralph Baric (copied here) and I had a
good chat today about viral vectors and nanoparticles. We realized much of the delivery methods
would depend on his work first, so there are some gaps here and the narrative will probably change
after I see what Ralph has written. At any rate, this is something to at least start with. Have a good
weekend! -Tonie

Hi Tonie,
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke

6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Thu 3/15/2018 6:45 PM
(b) (6) . morning is okay after 9am est.

To: Ainslie, Kristy <[email protected]>
Cc: Baric, Ralph S <[email protected]>
Tomorrow would probably work best for me as I need to get my part of this finished up soon. I will be
heading out of the country on 3/22. If you give me a number I can call you. Thanks -Tonie
On Thu, Mar 15, 2018 at 5:14 PM, Ainslie, Kristy <[email protected]> wrote:
Great! We could talk Friday 3/16 11-1, 3/19 8-1, or 3/21 8-2 all EST. Let me know a time that works
for you.
Thanks
K

I am open to suggestions and actually would prefer you guys take that on. The project I mentioned is
one I already have funded and I should have data by the time the funding for this would ever come in if
it does. So we can always decide later. -T
Tonie-
Probably something similar. We can use PLGA, we often use our polymer acetalated dextran (works
better outside the cold chain, acid-sensitive so better for immune cell uptake, better degradation
properties, no acidic byproduct to degrade antigen etc.). Probably similar particles. Do you want to
chat about this over the phone or are you going with the UW person?
Thanks
K

Hi Kristy: We have not tested anything in bats yet but will be soon. We are working with an
engineer at UW, using PLGA to encapsulate rabies glycoprotein. What are you thinking of. -Tonie
Hi Tonie, might be beneficial for you and Kristy to talk-who has nano/micro particle based
delivery systems. I’ve included her email. Ralph

Hi Ralph: Thanks for sending me your narrative. Just to clarify, are you proposing challenge
trials in vaccinated bats at UNC? I think we should just subcontract with UW to engineer the
RCN constructs. They are really skilled at it. We typically then produce the master seeds in my
lab. I'm assuming those seeds would then go back to yours for challenge trials. Does that make
sense? I'm trying to figure out how to prepare the budget. Same question I guess about the
nanoparticles. Will you be constructing these in your lab and then testing them in bats? Thanks! -
Tonie

Cc: Rachel Abbott <[email protected]>; Aleksei Chmura <[email protected]>;
Dr. Peter Daszak <[email protected]>; Alison Andre
<[email protected]>; Baric, Ralph S <[email protected]>
Hello Luke and Peter: Attached is my first draft of Task 7. Ralph Baric (copied here) and I had
a good chat today about viral vectors and nanoparticles. We realized much of the delivery
methods would depend on his work first, so there are some gaps here and the narrative will
probably change after I see what Ralph has written. At any rate, this is something to at least
start with. Have a good weekend! -Tonie

Hi Tonie,
Once again, please use this link, to select which date(s)/time(s) you are available to speak with Peter (select as
many as you are available for). The goal is to have one call each week, on either Tuesday or Wednesday. Below, I've
listed the dates/times that appear in the Doodle Poll link above. Please note that all times listed are in Eastern Time.
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)

Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
EcoHealth Alliance leads cutting-edge scientific research into the critical connections between human and wildlife
health and delicate ecosystems. With this science, we develop solutions that prevent pandemics and promote
conservation.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke

6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Fri 3/16/2018 8:44 AM
Lets us talk whenever your ready. I’m at (b) (6) . ralph

Sent: Friday, March 16, 2018 2:27 AM
Hi Ralph: I can chat anytime before noon CT, and it is fine if Kristy joins us at the same time. It's really
up to you. Best -Tonie
Hi Tonie, I was definitely planning on testing whatever I could in mice, nanoparticles no problem but my
understanding was that RCN doesn’t work well in mice. I have no bat colony, no way for me to do the
experiment-which I definitely think needs to be done or we have no credibility. My understanding another bat
colony exists in China, but not sure who is doing what. Batized mice may be very expensive and limited in
numbers, I have no details but thik they use immune deficient mice, must repopulate immune cells with
primary bat immune cells derived from live bats…bet they can’t get to many batized mice/bat, but I’m not sure.
Its very limited when you humanize mice, 12=15 animals/donor. If he has genetically engineered batized mice,
then more might be available.
Was Kristy going to be part of our call tomorrow? If so, I can set up a conference number, but need to know
times. If its just us, no need to set this up. let me know.

Yeah, I'm figuring my budget out now, and I think I may be able to horsetrade with Jorge a little. He
wants to contract with me to do a plague challenge, so I think he might be willing to make a single
construct for us no charge (more than that I'm not sure) and it will be a wash and easier for everybody
not to exchange $. What I am more worried about right now is which animal studies we are doing.
Peter suggested the other day that we do all the bat studies. That's what I'd like to chat with you about.
Once the RCN construct is made and the nanoparticles are produced, who is testing them for their
efficacy in bats to determine the most likely products to use. Or is that all just being done in mice?
(One possibility might be to do it in batized mice- that would be a hell of a lot cheaper than bats!)
Most of my budget is going to testing the medium and methods of delivery to bats; assessing uptake in
bats with biomarker studies, and contracting with a company to design a prototype machine for
spraying the bats. Maybe it is clear in your mind and I have just been out of the loop, but in any case,
we can discuss all that tomorrow morning. Have a good night. -Tonie
I’d just flat out tell Peter that you need X more dollars in the budget. How much money do you imagine this
will cost? Ralph

I'm not certain I am going to have enough funding for that in my budget, but I'll try to figure it out.
My biggest problem is our facility has a ridiculous overhead rate that would even apply to
subcontracts. -T
Okay, Peter said you should set up the subcontract through your section. Sorry for being dense. ralph

Yes it is. -T

Hi Ralph: Thanks for sending me your narrative. Just to clarify, are you proposing challenge
trials in vaccinated bats at UNC? I think we should just subcontract with UW to engineer the
RCN constructs. They are really skilled at it. We typically then produce the master seeds in my
lab. I'm assuming those seeds would then go back to yours for challenge trials. Does that make
sense? I'm trying to figure out how to prepare the budget. Same question I guess about the
nanoparticles. Will you be constructing these in your lab and then testing them in bats?
Thanks! -Tonie

Cc: Rachel Abbott <[email protected]>; Aleksei Chmura <[email protected]>; Dr. Peter
Daszak <[email protected]>; Alison Andre <[email protected]>; Baric, Ralph
S <[email protected]>
Hello Luke and Peter: Attached is my first draft of Task 7. Ralph Baric (copied here) and I
had a good chat today about viral vectors and nanoparticles. We realized much of the
delivery methods would depend on his work first, so there are some gaps here and the
narrative will probably change after I see what Ralph has written. At any rate, this is
something to at least start with. Have a good weekend! -Tonie

Hi Tonie,
Once again, please use this link, to select which date(s)/time(s) you are available to speak with Peter (select as
many as you are available for). The goal is to have one call each week, on either Tuesday or Wednesday. Below,
I've listed the dates/times that appear in the Doodle Poll link above. Please note that all times listed are in Eastern
Time.
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
conservation.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Ainslie, Kristy <[email protected]>
Fri 3/16/2018 10:03 AM
T-
Here is the wiki article: https://en.wikipedia.org/wiki/Acetalated_dextran
Thanks
K

Ha, I can relate. OK, I'll call in about 5 minutes or so (I need another cup of coffee!) -Tonie
On Fri, Mar 16, 2018 at 9:26 AM, Ainslie, Kristy <[email protected]> wrote:
T-
Yeah you can call any time, but my husband took my cell (long story). Can you call me on my work phone 919-
962-4556.
Thanks
K

Hi Kristy: I can talk to you anytime it is convenient before 11 CT. Just let me know what works best for
you, and I'll give you a ring. Ralph and I just had a chat. Thanks -Tonie
Sure, my cell is(b) (6) . If you could give me an approximate time that would be helpful so
I'm not off somewhere away from my phone.
sent via phone.

Website: ainslielab.web.unc.edu

Sent: Thursday, March 15, 2018 7:27:40 PM
To: Ainslie, Kristy
Cc: Baric, Ralph S
Tomorrow would probably work best for me as I need to get my part of this finished up soon. I will
be heading out of the country on 3/22. If you give me a number I can call you. Thanks -Tonie
Great! We could talk Friday 3/16 11-1, 3/19 8-1, or 3/21 8-2 all EST. Let me know a time that works for
you.
Thanks
K

I am open to suggestions and actually would prefer you guys take that on. The project I
mentioned is one I already have funded and I should have data by the time the funding for this
would ever come in if it does. So we can always decide later. -T
Tonie-
Probably something similar. We can use PLGA, we often use our polymer acetalated dextran (works
better outside the cold chain, acid-sensitive so better for immune cell uptake, better degradation
properties, no acidic byproduct to degrade antigen etc.). Probably similar particles. Do you want to
chat about this over the phone or are you going with the UW person?
Thanks
K

Hi Kristy: We have not tested anything in bats yet but will be soon. We are working with an
engineer at UW, using PLGA to encapsulate rabies glycoprotein. What are you thinking of. -
Tonie
Hi Tonie, might be beneficial for you and Kristy to talk-who has nano/micro particle based delivery
systems. I’ve included her email. Ralph

vaccinated bats at UNC? I think we should just subcontract with UW to engineer the RCN
constructs. They are really skilled at it. We typically then produce the master seeds in my lab. I'm
assuming those seeds would then go back to yours for challenge trials. Does that make sense? I'm
trying to figure out how to prepare the budget. Same question I guess about the nanoparticles. Will
you be constructing these in your lab and then testing them in bats? Thanks! -Tonie

Cc: Rachel Abbott <[email protected]>; Aleksei Chmura <[email protected]>; Dr.
Peter Daszak <[email protected]>; Alison Andre <[email protected]>;
Hello Luke and Peter: Attached is my first draft of Task 7. Ralph Baric (copied here) and I had a
good chat today about viral vectors and nanoparticles. We realized much of the delivery methods
would depend on his work first, so there are some gaps here and the narrative will probably
change after I see what Ralph has written. At any rate, this is something to at least start with.
Have a good weekend! -Tonie

Hi Tonie,
Once again, please use this link, to select which date(s)/time(s) you are available to speak with Peter (select
as many as you are available for). The goal is to have one call each week, on either Tuesday or Wednesday.
Below, I've listed the dates/times that appear in the Doodle Poll link above. Please note that all times listed are
in Eastern Time.
Week 1:
Thu. 3/13 (9 AM - 5 PM ET)
Thu. 3/14 (9 AM - 5 PM ET)
Week 2:
Thu. 3/20 (9 AM - 5 PM ET)
Thu. 3/21 (9 AM - 5 PM ET)
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
(b) (6) (mobile)
EcoHealth Alliance leads cutting-edge scientific research into the critical connections between human and
wildlife health and delicate ecosystems. With this science, we develop solutions that prevent pandemics
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: DARPA PRE-EMPT

[email protected] <[email protected]>
Fri 3/16/2018 12:01 PM
To: [email protected] <[email protected]>
Cc: Rocke, Tonie E <[email protected]>; [email protected] <[email protected]>;
<[email protected]>; [email protected] <[email protected]>;
<[email protected]>
Clarification to everyone:
Our call in line is: 1-719-785-9461

Passcode: 9784#
we’re using EcoHealth’s call-in line.
Thanks,
Jerome
From: "William B. Karesh" <[email protected]>

Date: Thursday, March 15, 2018 at 4:13 PM
Cc: "Rocke, Tonie" <[email protected]>, "Johnson, David <[email protected]>"
<[email protected]>, Peter Daszak <[email protected]>, Luke Hamel
<[email protected]>, Anna Willoughby <[email protected]>, Alison Andre
<[email protected]>, Amanda Andre <[email protected]>
Subject: Re: DARPA PRE-EMPT

Passcode: 9784#
Re: DARPA PRE-EMPT

Fri 3/16/2018 2:12 PM
Cc: William B. Karesh <[email protected]>; Peter Daszak <[email protected]>; Rocke, Tonie E
<[email protected]>; Luke Hamel <[email protected]>; Alison Andre <[email protected]>;
Amanda Fuchs <[email protected]>; [email protected] <[email protected]>
Thanks for these details, Jerome. Attached are my notes from the call. Action items include:
- Jerome to send more detailed scope of work with paragraphs and revised budget by early next
week
- EHA will send PARC the NWHC section of the proposal on Monday
- EHA will send the format of letter of support for PARC
- EHA to follow up with Kateri with requested information
For your question on collaborating with other institutes, it is likely that all
organizations involved may have insight into the aerosol-bat interaction.
I believe this topic would be covered during the Annual Meeting
between all partners, as well as during relevant cross-partner trips, in
addition to monthly conference calls.
Please let us know if you have further questions.
Best,
Anna
On Fri, Mar 16, 2018 at 2:57 PM, <[email protected]> wrote:

An additional point for Peter, Tonie (and everyone),
For the spray technology, refinement of the details with respect to aerosol-bat interaction (i.e. the preliminary
field testing to see how bats react to the aerosol) and eventual field-deployment in China, will the technical
lead for coordinating this segment of the project be USGS – National Wildlife Center? Or should we also expect
to work/coordinate with other institutes who would give feedback and insights on how this works?
Thanks. This is just for our information.
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

From: Unidad, Jerome <[email protected]>

To: 'William B. Karesh' <[email protected]>; 'Peter Daszak' <[email protected]>
Cc: 'Luke Hamel' <[email protected]>; 'Anna Willoughby' <[email protected]>;
'Alison Andre' <[email protected]>; 'Amanda Andre' <[email protected]>;
'Rocke, Tonie' <[email protected]>; Paul, Kateri <[email protected]> <[email protected]>
Subject: RE: DARPA PRE-EMPT
Peter and team,
I’m currently working on putting together a revised budget and equivalent statement of work (tasks breakdown)
for PARC’s involvement with the project. You can expect this about early next week – approximately Monday.
Officially, for the submission, our capture manager, Kateri Paul, who takes care of the other things would need
the following things from your equivalent to facilitate our parts of the submission.
1. Request for Proposal that we can respond to with what they need for their package to DARPA
2. Start date of the proposed effort
3. Contract or a Grant/Other Transaction
Once we have finalized the scope of work and the budget, Kateri will be in touch for these other aspects. Her
contact information can be found below.
Kateri E. Paul
Capture Manager, Public Sector
Global Business Development
Palo Alto Research Center (PARC)

Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


To: 'Rocke, Tonie' <[email protected]>; William B. Karesh <[email protected]>; Johnson, David
<[email protected]> <[email protected]>
Cc: Peter Daszak <[email protected]>; Luke Hamel <[email protected]>; Anna
Willoughby <[email protected]>; Alison Andre <[email protected]>; Amanda Andre
<[email protected]>
Dear all,
10AM-11AM PST (12PM-1PM CT, 1PM-2PM ET) should work for us. I shall setup a WebEx meeting for this, given
the number of participants.
Let me know if this timeslot will work.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


To: William B. Karesh <[email protected]>
Cc: Unidad, Jerome <[email protected]> <[email protected]>; Peter Daszak
<[email protected]>; Luke Hamel <[email protected]>; Anna Willoughby
<[email protected]>; Alison Andre <[email protected]>; Amanda Andre
<[email protected]>
I assume that is ET? -T
On Thu, Mar 15, 2018 at 4:14 PM, William B. Karesh <[email protected]> wrote:
Tonie and Jerome,
We would still like to speak. Anytime on Friday between 11:00 AM and 2:00 PM would be
great.
BK
William B. Karesh, D.V.M
Executive Vice President for Health and Policy
EcoHealth Alliance
460 West 34th Street - 17th Floor
New York, NY 10001 USA
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)
President, OIE Working Group on Wildlife
Co-chair, IUCN Species Survival Commission - Wildlife Health Specialist Group
EPT Partners Liaison, USAID Emerging Pandemic Threats - PREDICT-2 Program
EcoHealth Alliance leads cutting-edge research into the critical connections between
human and wildlife health and delicate ecosystems. With this science we develop
solutions that promote conservation and prevent pandemics.
On Mar 15, 2018, at 4:55 PM, Rocke, Tonie <[email protected]> wrote:
Hi all: Since we didn't hear back from EcoHealth Alliance, Jerome and I went ahead
with a short call we had been planning anyway regarding some technical details. I
told him our concerns about the proposed budget and we think we have a pretty
good plan to reduce the scope of work to the funds we have available. PARC is
very unique in developing this technology and their technology fits very well with
other work I am doing, so we both feel pretty confident we can work something
out. If you still wish to have a discussion among all of us, we can schedule that for
tomorrow, as I believe Jerome had another meeting to run off to for the rest of the
day. I'm available the rest of the day if you wish to chat about this in person. Best
-Tonie
On Thu, Mar 15, 2018 at 3:42 PM, Peter Daszak <[email protected]>

wrote:
Actually – can we do a phone call – I’ll be driving. 5.15pm would be perfect (NYC time),
Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
From: [email protected] [mailto:[email protected]]

Cc: William B. Karesh; Peter Daszak; Luke Hamel
I can setup a WebEx quickly if we will have multiple parties.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Cc: William B. Karesh <[email protected]>; Daszak Peter
<[email protected]>; Luke Hamel <[email protected]>
I'm available as well. Billy, do you have a call in number? -Tonie
On Thu, Mar 15, 2018 at 3:20 PM, <[email protected]> wrote:

Dear all,
Sorry for the late response – yes, I will be available for a phone call now. Up to 2PM.
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

From: William B. Karesh [mailto:[email protected]]

Cc: Rocke, Tonie <[email protected]>; Peter Daszak <[email protected]>; Luke
Hamel <[email protected]>
Subject: DARPA PRE-EMPT
Dear Dr. Unidad,
Thanks for your quick responses to Dr. Rocke. Would you be available for a
short call with Dr. Daszak, Dr. Rocke and me this afternoon or Friday.
We’re on tight timeline so we thought a phone call might be save quite a bit of
time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

ecosystems. With this science we develop solutions that promote
conservation and prevent pandemics.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
https://outlook.office365.com/mail/id/AAMkADUyODI5Y2E0LWY5MmEtNGNjNi04YmQ3LWVkZmU3ZWRkMTllZgBGAAAAAAAd8uDAoslFQa0tKxNiQj… 10/11
Visit our blog: http://blog.ecohealthalliance.org/updates

March 15, 2018, 1pm EST
EHA: Billy Karesh, Peter Daszak, Anna WIlloughby
NWHC: Tonie Rocke
PARC: Jerome Unidad and David Johnson
Project DEFUSE, PI Peter Daszak
Budget
● Current budget is 580k for all tasks in original scope (360k development; 220 field
prototype: 3-4 copies)
● EHA: Budget is currently too expensive. Avenues for reduction:
○ Reduce scope/trim intermediate steps? (not preferable)
● Original estimate is lean for prototype for scale: 2-3 bats at a time, generating aerosol for
significant amount of space
● PARC may be able to make less expensive (for beginning scope of work)
● DARPA may have further, add-on support after program has begun
● Include some travel: PARC will need a cross-partner visit with EHA (or vice versa), will
attend annual meeting, Y2 China visit, visit to TR captive colony in Y1.
Collaboration
● Exclusive partnership between EHA and PARC for DARPA application
Scope of Work (EHA needs more details, paragraph per item)

● Goals for EHA are to have engagement from PARC for duration of project and for
deployment trials
● PARC sent white paper, should insert relevant info into proposal
● PARC want time to optimize correctly, (eg spray quality, fluid consistency)
● For DARPA purposes: proof of concept that you can interfere and disrupt v.
transmission. Large scale intervention not necessary.
● Y1: Creating initial product, modifying existing fixtures; deploy biomarker in captive
species, each captive bat experiment is ~32k (TR)
● Y2: Refining prototype for field use, deploy biomarker in field species stateside (TR)
○ Bats will be sampled for biomarker spread
● EHA add link to video in proposal
Deployment Details
● For Chinese bat caves: we would go to minor entrances/side pocket. (smaller scale,
could then be scaled up after the project)
● PARC: How big are caves? EHA: Volume 2 ft by 2 ft, similar to furniture size, Not going
to cave with 10,000 bats. This is simply a field trial.
● EHA: Deploy for 2-3 days at one site for field trial in China. Have at least 2 prototypes
● EHA: Will not manufacture large-scale spray material as too expensive
● Deploy Biomarker Study: Captive Bats (NWHC) -> Field (US) -> Field (China)
● Deploy Mesocosm Study: Captive Bats (Duke-NUS) -> Field (China)
-
Re: DARPA PRE-EMPT

Fri 3/16/2018 4:09 PM
Hi Kateri,
Yes, if possible we would appreciate a rapid return of the cost proposal. Monday is ideal, but
Tuesday would be fine. Please find templates for materials and travel (which also outlines
prospective travel). Did you receive the main budget template? If not, I am attaching a fresh one as
well. Please let me know if you have any questions.
Thanks,
Anna
Hello Anna,
Could you please let me know your target deadline for our cost proposal? I understand it will be tight with the
full proposal due 3/27.
Thanks!
Kateri
From: Anna Willoughby [mailto:[email protected]]

Cc: William B. Karesh <[email protected]>; Peter Daszak <[email protected]>;
[email protected]; Luke Hamel <[email protected]>; Alison Andre <[email protected]>;
Amanda Fuchs <[email protected]>; Paul, Kateri <[email protected]>
<[email protected]>
week
For your question on collaborating with other institutes, it is likely that all organizations involved may
have insight into the aerosol-bat interaction. I believe this topic would be covered during the Annual
Meeting between all partners, as well as during relevant cross-partner trips, in addition to monthly
conference calls.
Best,
Anna

For the spray technology, refinement of the details with respect to aerosol-bat interaction (i.e. the
preliminary field testing to see how bats react to the aerosol) and eventual field-deployment in China, will
the technical lead for coordinating this segment of the project be USGS – National Wildlife Center? Or should
we also expect to work/coordinate with other institutes who would give feedback and insights on how this
works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD



Peter and team,
I’m currently working on putting together a revised budget and equivalent statement of work (tasks
breakdown) for PARC’s involvement with the project. You can expect this about early next week –
approximately Monday. Officially, for the submission, our capture manager, Kateri Paul, who takes care of the
other things would need the following things from your equivalent to facilitate our parts of the submission.
1. Request for Proposal that we can respond to with what they need for their package to
DARPA
Kateri E. Paul
Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


Willoughby <[email protected]>; Alison Andre <[email protected]>; Amanda
Andre <[email protected]>
Dear all,
10AM-11AM PST (12PM-1PM CT, 1PM-2PM ET) should work for us. I shall setup a WebEx meeting for this,
given the number of participants.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


<[email protected]>
Tonie and Jerome,
great.
BK
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)
Hi all: Since we didn't hear back from EcoHealth Alliance, Jerome and I went
ahead with a short call we had been planning anyway regarding some technical
details. I told him our concerns about the proposed budget and we think we
have a pretty good plan to reduce the scope of work to the funds we have
available. PARC is very unique in developing this technology and their
technology fits very well with other work I am doing, so we both feel pretty
confident we can work something out. If you still wish to have a discussion
among all of us, we can schedule that for tomorrow, as I believe Jerome had
another meeting to run off to for the rest of the day. I'm available the rest of the
day if you wish to chat about this in person. Best -Tonie
On Thu, Mar 15, 2018 at 3:42 PM, Peter Daszak

<[email protected]> wrote:
Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
human and wildlife health and delicate ecosystems. With this science we develop solutions

Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD



Dear all,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Cc: Rocke, Tonie <[email protected]>; Peter Daszak <[email protected]>;
Dear Dr. Unidad,
We’re on tight timeline so we thought a phone call might be save quite a bit
of time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)


--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
1.212.380.4465 (fax)
(b) (6) (cell)
MATER
Item Manufacturer Part Number
Computers Apple 13-inch MacBook Air
Monitors Apple Thunderbolt Display
Note:
Consumables may be listed as a lump sum if no individual item is over $5,000. For those items that are over $5,000, list
MATERIALS/EQUIPMENT
Unit Price Quantity Total Price Contract Period
$1,981 2 $3,962 Base Period
$ 1,098.00 3 $3,294 Base Period
$7,256
e items that are over $5,000, list separately from the rest of consumable pricing.
Additional Information
Current price on apple.com, including upgraded CPU, memory, and storage (http://store.apple.com/us/buy-mac/macboo
Current price on apple.com (http://store.apple.com/us/product/MC914LL/B/apple-thunderbolt-display-27-inch?fnode=53
able pricing.
tp://store.apple.com/us/buy-mac/macbook-air) Part #Z0P0
le-thunderbolt-display-27-inch?fnode=53) Part # MC914LL/B
OTHER DIRECT COST
Description Total Price Contract Period
$0
OTHER DIRECT COSTS
TRAVEL
Trip #: 1 Location: Madison, WI
Purpose: Partner Visit to National Wildlife Health Center
Days # of People Airfare Per Diem Lodging
3 2
Itemized Expenses for "Other"
Description Amount
Transportation to/from airport and in Madison $120.00
Total: $120.00
Trip #: 2 Location: New York, NY
Purpose: Annual Meeting
3 1
Description Amount
Transportation to/from airport and in New York
Total: $0.00
Trip #: 3 Location: Wuhan, China
Purpose: Site Visit at Field Site
6 2
Description Amount
Transportation to/from airport and in Wuhan
Total: $0.00
3 1
Description Amount
Transportation to/from airport and in Wuhan
Total: $0.00
3 1
Description Amount
Total: $0.00
3 1
Description Amount
Total: $0.00
Contract Period
Base Period
Other Total
Contract Period
Base Period
Other Total
Contract Period
Base Period
Other Total
$0.00
Contract Period
Base Period
Other Total
Contract Period
Option I
Other Total
$0.00
Contract Period
Option II
Other Total
[email protected]
Applicants tab.
CFDA Number: 12.910
Competition ID:
Competition Title:

[email protected]

DUNS: 0770900660000
Form Version: 1.4
Subform Name: Guangjian Zhu (consultant)
Download Date/Time: Mar 15, 2018 05:50:37 PM EDT

FORM ACTIONS:
ORGANIZATIONAL DUNS: 0000000000000 Enter name of Organization: PARC (consultant)
Budget Type: Project Subaward/Consortium Budget Period: 1 Start Date: 12/01/2018 End Date: 11/30/2020
Project Role: PD/PI

B. Other Personnel

Graduate Students

Total Equipment

Total Travel Cost
2. Stipends
3. Travel
4. Subsistence
5. Other

8.
9.
10.

H. Indirect Costs
Total Direct Costs

POC Phone Number)


ORGANIZATIONAL DUNS: 0000000000000 Enter name of Organization: PARC (consultant)
Project Role: PD/PI

B. Other Personnel

Graduate Students

Total Equipment

Total Travel Cost
2. Stipends
3. Travel
4. Subsistence
5. Other

8.
9.
10.

H. Indirect Costs
Total Direct Costs

POC Phone Number)


Totals ($)
Section A, Senior/Key Person
Section D, Travel
1. Domestic
2. Foreign
2. Stipends
3. Travel
4. Subsistence
5. Other
8. Other 1
9. Other 2
10. Other 3
Section G, Direct Costs (A thru F)
Section H, Indirect Costs

Section I, Total Direct and Indirect Costs (G + H)
Section J, Fee
Re: DARPA PRE-EMPT

Mon 3/19/2018 1:43 PM
Hi Tonie,
Screenshots from travel websites (with approximate dates) should be just fine. As for local ground
transport, I will check to see how we should move forward with that. I also doubt there will be any
car rental.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
Arrgh - I didn't realize I needed screen shots. I have just been using
expedia to estimate flight costs since I don't have real dates. I guess I'll
have to do something different. Also I am guessing at transportation
costs. I wasn't anticipating renting a car in China. I assumed we'd be
travelling as a group, correct?
On Mon, Mar 19, 2018 at 1:27 PM, Luke Hamel <[email protected]> wrote:
Thanks, Anna.
And just a reminder Tonie, that quotes for any travel-related expenses (e.g. airfare, rental car,
etc.) must be supported by screenshots, so please forward these and CC our Grants manager,
Evelyn Luciano ([email protected]).
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
b) (6)
(direct)
(b) (6) b) (6)
(mobile)
On Mon, Mar 19, 2018 at 2:15 PM, Anna Willoughby <[email protected]>

wrote:
Hi Tonie,
I would plan for all your travel to be flying out of Madison. You should have 2 trips to the field
sites in Kunming, Yunnan, China (sorry for the typo!), one site visit in Y1 and one deployment
visit in Option Year 1. Please remove any x for the Wuhan trip, and enter your needed
airfare/lodging. You can use the current federal per diem: $147 for lodging and $115 for
meals (for both Wuhan and Kunming). For flights to NYC I would use Laguardia, NYC, though
all the NYC airports are equidistance (Newark, Laguardia, or JFK).
Let me know if you have any further questions.
Best,
Anna
Hi Anna: Can you clarify something for me? You have 2 trips listed
to Kunning (is that KunMing?) China in year 1. Did you intend for
that to be just 1 trip? Also, will that be right after the Arlington
meeting (so flying from Arlington), or not and I will be flying there
from Madison. Also noticed an x for airfare and lodging for the trip
to Wuhan. Does that mean those are covered? Just need this info
to complete the sheets. Last, what is the closest airport to the
meeting location in New York? Thanks -Tonie
On Fri, Mar 16, 2018 at 4:49 PM, Anna Willoughby <[email protected]>
wrote:
Hi Tonie,
Sure thing. Please find attached. I believe this encompasses what we've discussed. We
also have in PARC's travel for them to come visit you in Y1 and for some EHA staff (likely
Jon Epstein and a Modeling person) to visit Madison once a year.
Please let me know if you have any questions or edits.
Have a great weekend,
Anna
Hi Anna: Can you send me a template for travel, etc? Hadn't
received that yet. Thanks -Tonie
On Fri, Mar 16, 2018 at 4:09 PM, Anna Willoughby <willoughby@ecohealthalliance.
org> wrote:
Hi Kateri,
Yes, if possible we would appreciate a rapid return of the cost proposal. Monday is
ideal, but Tuesday would be fine. Please find templates for materials and travel
(which also outlines prospective travel). Did you receive the main budget template?
If not, I am attaching a fresh one as well. Please let me know if you have any
questions.
Thanks,
Anna
Hello Anna,
Could you please let me know your target deadline for our cost proposal? I understand it will
be tight with the full proposal due 3/27.
Thanks!
Kateri

Cc: William B. Karesh <[email protected]>; Peter Daszak
<[email protected]>; [email protected]; Luke Hamel
<[email protected]>; Alison Andre <[email protected]>; Amanda
Fuchs <[email protected]>; Paul, Kateri <[email protected]>
<[email protected]>
Thanks for these details, Jerome. Attached are my notes from the call. Action
items include:
- Jerome to send more detailed scope of work with paragraphs and revised
budget by early next week
organizations involved may have insight into the aerosol-bat interaction. I believe
this topic would be covered during the Annual Meeting between all partners, as well
as during relevant cross-partner trips, in addition to monthly conference calls.
Best,
Anna

For the spray technology, refinement of the details with respect to aerosol-bat interaction
(i.e. the preliminary field testing to see how bats react to the aerosol) and eventual field-
deployment in China, will the technical lead for coordinating this segment of the project be
USGS – National Wildlife Center? Or should we also expect to work/coordinate with other
institutes who would give feedback and insights on how this works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


To: 'William B. Karesh' <[email protected]>; 'Peter Daszak'
<[email protected]>
Cc: 'Luke Hamel' <[email protected]>; 'Anna Willoughby'
<[email protected]>; 'Alison Andre' <[email protected]>;
'Amanda Andre' <[email protected]>; 'Rocke, Tonie'
<[email protected]>; Paul, Kateri <[email protected]> <[email protected]>
Peter and team,
I’m currently working on putting together a revised budget and equivalent statement of
work (tasks breakdown) for PARC’s involvement with the project. You can expect this about
early next week – approximately Monday. Officially, for the submission, our capture
manager, Kateri Paul, who takes care of the other things would need the following things
from your equivalent to facilitate our parts of the submission.
1. Request for Proposal that we can respond to with what they need for their
package to DARPA
Once we have finalized the scope of work and the budget, Kateri will be in touch for these
other aspects. Her contact information can be found below.
Kateri E. Paul
Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


To: 'Rocke, Tonie' <[email protected]>; William B. Karesh <[email protected]>;
Johnson, David <[email protected]> <[email protected]>
Cc: Peter Daszak <[email protected]>; Luke Hamel
Alison Andre <[email protected]>; Amanda Andre
<[email protected]>
Dear all,
10AM-11AM PST (12PM-1PM CT, 1PM-2PM ET) should work for us. I shall setup a WebEx
meeting for this, given the number of participants.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Cc: Unidad, Jerome <[email protected]> <[email protected]>; Peter
Daszak <[email protected]>; Luke Hamel <[email protected]>;

Anna Willoughby <[email protected]>; Alison Andre
<[email protected]>; Amanda Andre <[email protected]>
On Thu, Mar 15, 2018 at 4:14 PM, William B. Karesh

Tonie and Jerome,
We would still like to speak. Anytime on Friday between 11:00 AM and 2:00
PM would be great.
BK
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

On Mar 15, 2018, at 4:55 PM, Rocke, Tonie <[email protected]>

wrote:
Hi all: Since we didn't hear back from EcoHealth Alliance,

Jerome and I went ahead with a short call we had been planning
anyway regarding some technical details. I told him our
concerns about the proposed budget and we think we have a
pretty good plan to reduce the scope of work to the funds we
have available. PARC is very unique in developing this
technology and their technology fits very well with other work I
am doing, so we both feel pretty confident we can work
something out. If you still wish to have a discussion among all of
us, we can schedule that for tomorrow, as I believe Jerome had
another meeting to run off to for the rest of the day. I'm available
the rest of the day if you wish to chat about this in person. Best -
Tonie

Actually – can we do a phone call – I’ll be driving. 5.15pm would be
perfect (NYC time), Today Thursday.
Is that possible?

Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC

ecosystems. With this science we develop solutions that prevent

Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


To: Unidad, Jerome <[email protected]>
<[email protected]>
<[email protected]>; Luke Hamel
<[email protected]>
On Thu, Mar 15, 2018 at 3:20 PM,

Dear all,
Sorry for the late response – yes, I will be available for a phone call
now. Up to 2PM.
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


<[email protected]>
Cc: Rocke, Tonie <[email protected]>; Peter Daszak
<[email protected]>
Dear Dr. Unidad,
Thanks for your quick responses to Dr. Rocke. Would you

be available for a short call with Dr. Daszak, Dr. Rocke and
me this afternoon or Friday.
We’re on tight timeline so we thought a phone call might be

save quite a bit of time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)
Co-chair, IUCN Species Survival Commission - Wildlife Health

Specialist Group
EPT Partners Liaison, USAID Emerging Pandemic Threats - PREDICT-2

Program
EcoHealth Alliance leads cutting-edge research into the

critical connections between human and wildlife health
and delicate ecosystems. With this science we develop
solutions that promote conservation and prevent
pandemics.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
EcoHealth Alliance leads cutting-edge scientific research into the critical connections between human and
wildlife health and delicate ecosystems. With this science, we develop solutions that prevent pandemics
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
EcoHealth Alliance leads cutting-edge scientific research into
the critical connections between human and wildlife health
and delicate ecosystems. With this science, we develop
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
critical connections between human and wildlife health and
delicate ecosystems. With this science, we develop solutions that
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: DARPA PRE-EMPT

Mon 3/19/2018 1:54 PM
Cc: Luke Hamel <[email protected]>
Hi Tonie,
Yes, please add/edit as you feel necessary. You make a good point for the Wuhan trip, please
modify to 4 days.
Anna
OK thanks for the clarification. Is the trip to Wuhan really only 3 days?
Seems like a fast trip considering it takes 24 hours to fly there and back.
Also, I am adding trips to local field sites in my area. I am just going to
add those at the bottom. Hopefully that is not too confusing. Thanks -
Tonie
On Mon, Mar 19, 2018 at 1:15 PM, Anna Willoughby <[email protected]> wrote:
Hi Tonie,
I would plan for all your travel to be flying out of Madison. You should have 2 trips to the field
sites in Kunming, Yunnan, China (sorry for the typo!), one site visit in Y1 and one deployment
visit in Option Year 1. Please remove any x for the Wuhan trip, and enter your needed
airfare/lodging. You can use the current federal per diem: $147 for lodging and $115 for meals
(for both Wuhan and Kunming). For flights to NYC I would use Laguardia, NYC, though all the
NYC airports are equidistance (Newark, Laguardia, or JFK).
Let me know if you have any further questions.
Best,
Anna
Hi Anna: Can you clarify something for me? You have 2 trips listed
to Kunning (is that KunMing?) China in year 1. Did you intend for that
to be just 1 trip? Also, will that be right after the Arlington meeting
(so flying from Arlington), or not and I will be flying there from
Madison. Also noticed an x for airfare and lodging for the trip to
Wuhan. Does that mean those are covered? Just need this info to
complete the sheets. Last, what is the closest airport to the meeting
location in New York? Thanks -Tonie
wrote:
Hi Tonie,
Sure thing. Please find attached. I believe this encompasses what we've discussed. We
also have in PARC's travel for them to come visit you in Y1 and for some EHA staff (likely
Jon Epstein and a Modeling person) to visit Madison once a year.
Please let me know if you have any questions or edits.
Have a great weekend,
Anna
Hi Anna: Can you send me a template for travel, etc? Hadn't
received that yet. Thanks -Tonie
wrote:
Hi Kateri,
Yes, if possible we would appreciate a rapid return of the cost proposal. Monday is
ideal, but Tuesday would be fine. Please find templates for materials and travel (which
also outlines prospective travel). Did you receive the main budget template? If not, I
am attaching a fresh one as well. Please let me know if you have any questions.
Thanks,
Anna
Hello Anna,
Could you please let me know your target deadline for our cost proposal? I understand it will be
tight with the full proposal due 3/27.
Thanks!
Kateri

Cc: William B. Karesh <[email protected]>; Peter Daszak
<[email protected]>; [email protected]; Luke Hamel
<[email protected]>; Alison Andre <[email protected]>; Amanda Fuchs
<[email protected]>; Paul, Kateri <[email protected]>
<[email protected]>
Thanks for these details, Jerome. Attached are my notes from the call. Action items
include:
- Jerome to send more detailed scope of work with paragraphs and revised budget
by early next week
For your question on collaborating with other institutes, it is likely that all organizations
involved may have insight into the aerosol-bat interaction. I believe this topic would be
covered during the Annual Meeting between all partners, as well as during relevant
cross-partner trips, in addition to monthly conference calls.
Best,
Anna

For the spray technology, refinement of the details with respect to aerosol-bat interaction (i.e.
the preliminary field testing to see how bats react to the aerosol) and eventual field-
deployment in China, will the technical lead for coordinating this segment of the project be
USGS – National Wildlife Center? Or should we also expect to work/coordinate with other
institutes who would give feedback and insights on how this works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


To: 'William B. Karesh' <[email protected]>; 'Peter Daszak'
<[email protected]>
Cc: 'Luke Hamel' <[email protected]>; 'Anna Willoughby'
<[email protected]>; 'Alison Andre' <[email protected]>;
'Amanda Andre' <[email protected]>; 'Rocke, Tonie' <[email protected]>;
Paul, Kateri <[email protected]> <[email protected]>
Peter and team,
I’m currently working on putting together a revised budget and equivalent statement of work
(tasks breakdown) for PARC’s involvement with the project. You can expect this about early
next week – approximately Monday. Officially, for the submission, our capture manager,
Kateri Paul, who takes care of the other things would need the following things from your
equivalent to facilitate our parts of the submission.
1. Request for Proposal that we can respond to with what they need for their
package to DARPA
Once we have finalized the scope of work and the budget, Kateri will be in touch for these
other aspects. Her contact information can be found below.
Kateri E. Paul
Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
<[email protected]>; Luke Hamel <[email protected]>; Anna

Willoughby <[email protected]>; Alison Andre
<[email protected]>; Amanda Andre <[email protected]>
On Thu, Mar 15, 2018 at 4:14 PM, William B. Karesh

Tonie and Jerome,
We would still like to speak. Anytime on Friday between 11:00 AM and 2:00 PM
would be great.
BK
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

With this science we develop solutions that promote conservation and
prevent pandemics.
On Mar 15, 2018, at 4:55 PM, Rocke, Tonie <[email protected]>

wrote:
Hi all: Since we didn't hear back from EcoHealth Alliance, Jerome

and I went ahead with a short call we had been planning anyway
regarding some technical details. I told him our concerns about
the proposed budget and we think we have a pretty good plan to
reduce the scope of work to the funds we have available. PARC is
very unique in developing this technology and their technology fits
very well with other work I am doing, so we both feel pretty
confident we can work something out. If you still wish to have a
discussion among all of us, we can schedule that for tomorrow, as I
believe Jerome had another meeting to run off to for the rest of the
day. I'm available the rest of the day if you wish to chat about this
in person. Best -Tonie

Actually – can we do a phone call – I’ll be driving. 5.15pm would be
perfect (NYC time), Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
EcoHealth Alliance leads cutting-edge research into the critical connections

between human and wildlife health and delicate ecosystems. With this
science we develop solutions that prevent pandemics and promote
conservation.
---------------------------------------------------------------------
Jerome Unidad, PhD


<[email protected]>
<[email protected]>
Dear Dr. Unidad,
Thanks for your quick responses to Dr. Rocke. Would you be

available for a short call with Dr. Daszak, Dr. Rocke and me this
afternoon or Friday.
We’re on tight timeline so we thought a phone call might be

save quite a bit of time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)
EcoHealth Alliance leads cutting-edge research into the

critical connections between human and wildlife health
and delicate ecosystems. With this science we develop
solutions that promote conservation and prevent
pandemics.
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
1.212.380.4465 (fax)
(b) (6) (cell)
conservation.
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
delicate ecosystems. With this science, we develop solutions
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
Re: NWHC budget documents

Tue 3/20/2018 9:07 AM
Cc: Anna Willoughby <[email protected]>; Daszak Peter <[email protected]>
Excellent. Thank you, Tonie! My apologies for the delay in regards to the support letter. I will work
to get that to you as soon as possible today.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello Luke and Anna: Attached are my completed budget, justification,
and screen shots for airfare for DARPA. Please let me know what else
you need from me. (Note the airfare to Wuhan was totally ridiculous ~7K
but if I have to provide screenshots, then I have to use the government
travel agency website; we have ways to reduce that cost once we
actually make the reservation). None of our supplies cost >5K per item,
so I just used lump sum method. I am still waiting on the statement you
need signed (NWHC director is in the office today, so it would be helpful
to get that as soon as possible) and to update my narrative from Peter.
Hope all is going well on your end. Best -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: [RESCHEDULED] Call to discuss PREEMPT proposal

Tue 3/20/2018 10:04 AM
Wonderful. Thank you so much, Tonie.
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Yes that would work fine. -Tonie
Would you be available for a call this Wednesday, around 6 PM (ET)?
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

No actually I return on Sunday the 25th and could be available on the
26th if necessary. -Tonie
Thank you for letting me know, Tonie. May I ask when you'll be returning from your trip?
Presumably, not before the 27th of March.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
HI Luke: I will be on my way to Mexico on 3/22 so that doesn't
work for -sorry! -Tonie
Hi Tonie,
I apologize for the short notice, but we will have to reschedule the PREEMPT call to
Thursday of this week (3/22). This will allow us more time to clean up the proposal,
and ensure that our discussion on Thursday is as fruitful as possible.
Please use this link to select the time(s) you are on available on Thu. (3/22) to discuss
the proposal. We expect to send you a completed proposal draft by Wednesday night
(3/21).
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Tue 3/20/2018 10:23 AM
Cc: Daszak Peter <[email protected]>; Luke Hamel <[email protected]>
Hi Tonie,
Thanks for this information. I have some follow-up questions.
- We should go ahead and use the ~7K airfare for China to can match our quote
screenshots. These funds could be redistributed later to other travel as
needed.
- We will need materials to be further broken down by item, I am attaching an example. Even for
animal per diem, would be nice to have specifics (cage maintenance, etc) We do not need quotes
for these items as they are <$5,000 and not considered equipment.
- Do you want Dr. Abbott to attend the Annual Meetings? There seems room in your budget to add
this and is standard for subcontract key personnel.
- Could you please provide a small bio for you and Dr. Abbott, here is an example from Peter:
Dr. Peter Daszak is President and Chief Scientist of EcoHealth Alliance, a US-based research organization
focused on emerging zoonotic diseases. His >300 scientific papers include the first global map of EID
hotspots (31, 32), estimates of unknown viral diversity (33), predictive models of virus-host relationships
(7), and evidence of the bat origin of SARS-CoV (34, 35) and other emerging viruses (36,37,38,39). He is
Chair of the NASEM Forum on Microbial Threats, and is a member of the Executive Committee and the
EHA institutional lead for the $130 million USAID-EPT-PREDICT. He serves on the NRC Advisory
Committee to the USGCRP, the DHS CEEZAD External Advisory Board, the WHO R&D Blueprint Pathogen
Prioritization expert group, and has advised the Director for Medical Preparedness Policy on the White
House National Security Staff on global health issues. Dr. Daszak won the 2000 CSIRO medal for
collaborative research.
We will save any other questions for the phone call with Peter this
week. Please let me know if you have any further questions.
Best,
Anna
Excellent. Thank you, Tonie! My apologies for the delay in regards to the support letter. I will work
to get that to you as soon as possible today.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
Hello Luke and Anna: Attached are my completed budget,
justification, and screen shots for airfare for DARPA. Please let me
know what else you need from me. (Note the airfare to Wuhan was
totally ridiculous ~7K but if I have to provide screenshots, then I have
to use the government travel agency website; we have ways to reduce
that cost once we actually make the reservation). None of our supplies
cost >5K per item, so I just used lump sum method. I am still waiting
on the statement you need signed (NWHC director is in the office
today, so it would be helpful to get that as soon as possible) and to
update my narrative from Peter. Hope all is going well on your end.
Best -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
MATERIALS/EQUIPMENT
Item ManufacturerPart Number/Description
Unit Price
Restriction Enzymes small tubes NE BIO LABS R0580S $72.00
Restriction Enzymes large tubes NE BIO LABS R0580L $292.00
SuperScript™ III Reverse Transcriptase FISHER 18-080-051 $460.00
T4 DNA Polymerase - 750 units NE BIO LABS M0203L $268.00
Antarctic DNA Phosphatase - 1000 units NE BIO LABS M0289S $68.00
T4 DNA Ligase NE BIO LABS M0202L $256.00
GLOVES PF NITRILE SM (100/pk 10 pk/cs) FISHER 19-130-1597B $249.48
GLOVES PF NITRILE MED (100/pk 10 pk/cs) FISHER 19-130-1597C $249.48
GLOVES PF NITRILE LG (100/pk 10 pk/cs) FISHER 19-130-1597D $249.48
GLOVES PF NITRILE XL (100/pk 10 pk/cs) FISHER 19-130-1597E $249.48
DMEM with L-Glutamine, 4.5g/L Glucose and SodiumFISHER
Pyruvate (6x500
MT10013CV
mL) $141.20
Animal per diem for breeder cagesUNC Department of Compartive Medicine
hot wash micro cages
4.2
Animal per diem for experimental UNC
cagesDepartment of Compartive Medicine
hot wash micro cages
8.4
MATERIALS/EQUIPMENT
Quantity Total Price Contract Period
8 $576 Annually, all years
5 $1,460 Annually, all years
Current price on neb.com
Current price on fishersci.com
Current UNC DCM rates $0.6 a day per cage for 365 days
Current UNC DCM rates $0.6 a day per cage for 357 days

Tue 3/20/2018 11:29 AM
Yes, the Y2 all partner annual meeting is planned for Wuhan, China. All other years the all-partner
annual meeting (1, OY1 and OY0.5) is planned for New York. Thanks for your hard work on this.
Best,
Anna
Hi Anna: OK, I'm revising again, but I noticed you did not include a Y2
meeting in New York. Is that correct? -Tonie
On Tue, Mar 20, 2018 at 10:23 AM, Anna Willoughby <[email protected]> wrote:
Hi Tonie,
Thanks for this information. I have some follow-up questions.
- We should go ahead and use the ~7K airfare for China to can match our
quote screenshots. These funds could be redistributed later to
other travel as needed.
- We will need materials to be further broken down by item, I am attaching an example. Even
for animal per diem, would be nice to have specifics (cage maintenance, etc) We do not need
quotes for these items as they are <$5,000 and not considered equipment.
- Do you want Dr. Abbott to attend the Annual Meetings? There seems room in your budget to
add this and is standard for subcontract key personnel.
- Could you please provide a small bio for you and Dr. Abbott, here is an example from Peter:
global map of EID hotspots (31, 32), estimates of unknown viral diversity (33), predictive models of
virus-host relationships (7), and evidence of the bat origin of SARS-CoV (34, 35) and other emerging
viruses (36,37,38,39). He is Chair of the NASEM Forum on Microbial Threats, and is a member of the
Executive Committee and the EHA institutional lead for the $130 million USAID-EPT-PREDICT. He
serves on the NRC Advisory Committee to the USGCRP, the DHS CEEZAD External Advisory Board,
the WHO R&D Blueprint Pathogen Prioritization expert group, and has advised the Director for
Medical Preparedness Policy on the White House National Security Staff on global health issues. Dr.
Daszak won the 2000 CSIRO medal for collaborative research.
We will save any other questions for the phone call with Peter this
week. Please let me know if you have any further questions.
Best,
Anna
Excellent. Thank you, Tonie! My apologies for the delay in regards to the support letter. I will
work to get that to you as soon as possible today.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello Luke and Anna: Attached are my completed budget,
justification, and screen shots for airfare for DARPA. Please let me
know what else you need from me. (Note the airfare to Wuhan was
totally ridiculous ~7K but if I have to provide screenshots, then I
have to use the government travel agency website; we have ways
to reduce that cost once we actually make the reservation). None of
our supplies cost >5K per item, so I just used lump sum method. I
am still waiting on the statement you need signed (NWHC director
is in the office today, so it would be helpful to get that as soon as
possible) and to update my narrative from Peter. Hope all is going
well on your end. Best -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
Support letter (PREEMPT)

Tue 3/20/2018 12:26 PM
Cc: Abbott, Rachel (Contractor) C <[email protected]>; Jonathon Musser <[email protected]>;
Evelyn Luciano <[email protected]>
Hi Tonie,
Please see the required collaborator support letter (attached) and comments within. Thank
you for your patience and please let me know if you have any questions.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
20 March 2018 Commented [EA1]: Please insert official letterhead at
top of document
Dr. Peter Daszak

President
EcoHealth Alliance
460 West 34th Street
New York, NY 10001
Dear Dr. Daszak:
In regards to the DARPA BAA, PREventing EMerging Pathogenic Threats (PREEMPT),

Ref. #: HR001118S0017-PREEMPT-PA-001, PROJECT DEFUSE, the National Wildlife
Health Center (NWHC) will be pleased to collaborate with EcoHealth Alliance (EHA) in
the implementation of the DEFUSE project should the team be chosen by DARPA to
conduct the work.
In our discussions, we have agreed to participate in activities that aim to defuse the
potential for spillover and emergence of novel bat-origin high-impact SARS-related
coronaviruses from bats to people. Our assistance would include developing and
implementing a delivery method for the immune boosting and priming molecules that
serve to defuse the potential of disease spillover.
I would also like to confirm that the NWHC has the statutory authority to propose to
Government solicitations, such as PREEMPT (please see documentation below). NWHC is Commented [2]:
Tonie,
a world leader in the development of oral vaccines and delivery methods to manage disease
in bats and other free-ranging wildlife. For this reason, and given the 15+ years of **Please note the following information from the BAA
(pp. 18-19). After reviewing the information and link
collaborative research between the NWHC and EHA, I believe that the NWHC is uniquely
below, please edit the language within this
capable of addressing the technical challenges listed under PREEMPT. document to correctly describe NWHC’s
authority/eligibility as it relates to this project. If it’s
Furthermore, the NWHC to the best of my knowledge, does not have any conflict of interest necessary to attach additional documentation,
please do so.
with EcoHealth Alliance, nor its collaborators on this project.
"Authority and Eligibility -
At the present time, DARPA does not consider 15
On behalf of the NWHC, please list us as a partner in your DEFUSE project proposal. I U.S.C. § 3710a to be sufficient legal authority
look forward to working on DEFUSE with EcoHealth Alliance and its partners in this to show eligibility. While 10 U.S.C.§ 2539b may be the
critically important endeavor. appropriate statutory starting point for some entities,
specific supporting regulatory guidance, together with
evidence of agency approval, will still be required to
Sincerely, fully establish eligibility. DARPA will consider FFRDC
and Government entity eligibility submissions on a
case-by-case basis; however, the burden to prove
eligibility for all team members rests solely with the
proposer." See link:
https://www.nsf.gov/statistics/ffrdclist/
Commented [3]: Tonie, please include director's
signature + printed name here
Identification of pricing assumptions (PREEMPT)

Tue 3/20/2018 3:59 PM
Hi Tonie,
Please see below, an additional item that we will need to address. Please forward this text to
whomever you have been speaking with at NWHC regarding financial guidance for the subaward.
They should have a good idea of what this entails for your institution, and this is information that, if
relevant, we will need to include within your budget justification.
Taken from p. 27 of the PREEMPT BAA:
"(7) Identification of pricing assumptions of which may require incorporation into the resulting
award instrument (e.g., use of Government Furnished Property/Facilities/Information,
access to Government Subject Matter Expert/s, etc.)"
Please let me know if you have any questions regarding this matter.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
Re: Support letter (PREEMPT)

Tue 3/20/2018 4:01 PM
Excellent. Thank you very much, Tonie. Please don't hesitate to reach out if any additional concerns
arise.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Luke: OK, we are working on it. We have gotten money from DOD
SERDP, so I don' t believe there should be an issue, but it might take
awhile to figure out the right language. Katie Richgels (my boss) is
taking care of this and will send it on to you when it is finished and
signed. Best -Tonie
Hi Tonie,
I apologize that the link did not provide helpful guidance. I've spoken with fellow staff at EHA
and they recommend speaking with either: (1) The director or other representative of NWHC's
grant department (if your institution has such a department), or (2) Someone in NWHC's
Operations or Finance department.
My colleague does not think DARPA will give additional guidance regarding this matter. Please
let me know if this information helps.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) b) (6)
(mobile)
Hi Luke: I have no idea how to respond about the eligibility. Is there
someone we can call at DARPA. The link you provided was no help
at all and in fact includes no DOI agencies. -Tonie
Hi Tonie,
Please see the required collaborator support letter (attached) and comments
within. Thank you for your patience and please let me know if you have any questions.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: DARPA PRE-EMPT

Tue 3/20/2018 4:15 PM
Dear all,
Please find the NWHC section of the proposal. Peter is currently working on an updated draft, but
this should be sufficient for composing your budget and particular task. Please let me know if you
have any questions. If needed, I am also attaching the original BAA for the program, with PARC's
focus being TA2.
When can we expect the revised budget and scope of work?
Best,
Anna
On Fri, Mar 16, 2018 at 3:12 PM, Anna Willoughby <[email protected]> wrote:
week
For your question on collaborating with other institutes, it is likely that

all organizations involved may have insight into the aerosol-bat
interaction. I believe this topic would be covered during the Annual
Meeting between all partners, as well as during relevant cross-partner
trips, in addition to monthly conference calls.
Best,
Anna

works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Peter and team,
DARPA

Kateri E. Paul
Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


Dear all,
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


<[email protected]>
Tonie and Jerome,
great.
BK
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC

Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD




Dear all,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Dear Dr. Unidad,
of time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

--
Tonie E. Rocke

6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
priming molecules

for bats.
a. b. c. d.
fluorescence).
O.N. Infection O.N.

RCN-MoG ON
RCN-MoG Topical
RCN-G ON
RCN-luc
ON
captured (w/o inc)
All bats 64 34 25 5 58
Recaptured
19 18 0 1 100
marked bats
the biomarker, RB.
Deliverable(s):




1253-x.

Broad Agency Announcement
PREventing EMerging Pathogenic Threats (PREEMPT)
BIOLOGICAL TECHNOLOGIES OFFICE
HR001118S0017
January 19, 2018
HR001118S0017, PREEMPT
TABLE OF CONTENTS
PART I: OVERVIEW INFORMATION ....................................................................................3

PART II: FULL TEXT OF ANNOUNCEMENT .......................................................................4
1. Funding Opportunity Description.....................................................................................4
1.1. Program Overview ......................................................................................................4
1.2. Program Metrics........................................................................................................12
1.3. Ethical, Legal, and Societal Implications (ELSI) ...................................................15
1.4. Protection of Sensitive Information .........................................................................15
2. Award Information...........................................................................................................16
2.1. General award information ......................................................................................16
2.2. Fundamental Research .............................................................................................17
3. Eligibility Information......................................................................................................18
3.1. Eligible Applicants ....................................................................................................18
3.2. Organizational Conflicts of Interest ........................................................................19
3.3. Cost Sharing/Matching .............................................................................................20
4. Application and Submission Information ......................................................................20
4.1. Address to Request Application Package................................................................20
4.2. Content and Form of Application Submission .......................................................20
4.3. Funding Restrictions .................................................................................................31
4.4. Other Submission Requirements .............................................................................31
5. Application Review Information .....................................................................................31
5.1. Evaluation Criteria....................................................................................................31
5.2. Review of Proposals...................................................................................................32
6. Award Administration Information ...............................................................................33
6.1. Selection Notices ........................................................................................................33
6.2. Administrative and Policy Requirements ...............................................................34
6.3. Reporting....................................................................................................................35
6.4. Electronic Systems.....................................................................................................35
7. Agency Contacts................................................................................................................35
8. Other Information ............................................................................................................35
9. Appendix 1 – Volume II checklist ...................................................................................37
2
PART I: OVERVIEW INFORMATION
 Federal Agency Name – Defense Advanced Research Projects Agency (DARPA),

Biological Technologies Office
 Funding Opportunity Title – PREventing EMerging Pathogenic Threats
 Announcement Type – Initial
 Funding Opportunity Number – HR001118S0017
 Catalog of Federal Domestic Assistance Numbers (CFDA) – 12.910 Research
and Technology Development
 Dates
o Posting Date – January 19, 2018
o Proposal Abstract Due Date and Time – February 13, 2018 4:00 ET
o Proposal Due Date and Time – March 27, 2018 4:00 ET
o BAA Closing Date – March 27, 2018
o Proposers’ Day – January 30, 2018
https://www.fbo.gov/spg/ODA/DARPA/CMO/DARPA-SN-18-18/listing.html
 Concise description of the funding opportunity – DARPA is soliciting innovative

proposals to develop novel and scalable approaches to preempt viral spillover
and transmission from animals or vectors into humans.
 Anticipated individual awards - Multiple awards are anticipated.

 Types of instruments that may be awarded - Procurement contract, cooperative
agreement or other transaction.
 Any cost sharing requirements - Cost sharing may be required under applicable
statutory regulations for other transactions for prototype projects awarded under the
authority of 10 U.S.C. § 2371b.
 Agency contact
o Points of Contact
James Gimlett, Ph.D. Program Manager
Biological Technologies Office
The BAA Coordinator for this effort may be reached at:

[email protected]
DARPA/BTO
ATTN: HR001118S0017
675 North Randolph Street
3
PART II: FULL TEXT OF ANNOUNCEMENT
1. Funding Opportunity Description
This publication constitutes a Broad Agency Announcement (BAA) as contemplated in Federal

Acquisition Regulation (FAR) 6.102(d)(2) and 35.016 and 2 CFR § 200.203. Any resultant
award negotiations will follow all pertinent law and regulation, and any negotiations and/or
awards for procurement contracts will use procedures under FAR 15.4, Contract Pricing, as
specified in the BAA.
DARPA is soliciting innovative proposals for research to develop new tools and models to
quantify the likelihood of a virus to jump from an animal host into humans, and to develop and
validate new scalable technologies to target potential human-capable viral pathogens in wild
reservoirs and/or mosquito vectors to prevent transmission to humans.
1.1. PROGRAM OVERVIEW

Introduction
During U.S. international operations, military forces are deployed to remote locations around the
globe, often in areas where endemic and emerging diseases are prevalent1. Most of these
emerging and re-emerging diseases originate in animal reservoirs and then jump into humans.
Numerous trends, including the increased interactions between human, animal and insect
populations due to increased population densities, globalization, densification of livestock
production, and rising human encroachment into animal habitats, have increased the risks of new
viral outbreaks in those regions where Department of Defense (DoD) personnel are typically
deployed. Often, DoD personnel are among the first responders in outbreak situations. Emerging
infectious diseases, for which few medical countermeasures are available, represent a major
threat to the warfighter and national security and could have devastating impacts on U.S. public
health.
Despite biosurveillance efforts around the globe, new viral outbreaks continue to outpace
preparedness efforts and show no signs of abating. During the first three quarters of 2017
outbreaks of avian influenza A (H7N9), Chikungunya, MERS coronavirus, Ebola, Seoul virus,
Hepatitis E, Hepatitis A, Yellow Fever, Lassa, and Zika viruses were recorded2. While current
biosurveillance strategies focus on detection of known pathogens within the human population
following an infectious outbreak event, there is a dearth of research and surveillance on sentinel
or reservoir animals3. Animal-specific viruses that have the potential to infect humans (namely
“human-capable” pathogens), but have not yet spilled over into human populations, are rarely
considered. As a result, infectious agents are detected only after an outbreak—that is, after an
animal pathogen has adapted to become capable of infecting humans. Consequently, the outbreak
response is largely reactive and not initiated until after an epidemic has already begun. The
PREEMPT program represents a radical departure from current practice, aiming to target viral
1 Halliday Jo E.B. et al. (2017). Driving improvements in emerging disease surveillance through locally relevant
capacity strengthening. Science.

2 World Health Organization (2017). http://www.who.int/csr/don/archive/year/2017/en/.
3 Metcalf, J.E. and Lessler, J. (2017). Opportunities and challenges in modeling emerging infectious diseases.
Science.
4
biothreats within the animal reservoirs where they originate and preempt their entry into human
populations before an outbreak occurs.
Recently, the scientific community has advanced its understanding of host-pathogen genetics and
mechanisms of adaptation across hosts4,5, developed analytic tools to predict animal hosts of new
and potential human-transmissible viruses, and learned how to identify “hot spot” geographic
regions where an animal-to-human virus jump is imminent6,7. This understanding is empowered
by new high-throughput data generation capabilities and sophisticated analytic and
computational tools. Together, this new understanding and capability hold great promise for the
development of advanced integrated models that can assess and likely provide guidance for
action that prevents human virus emergence before the virus gains entry to the human
population. The PREEMPT program aims to develop new tools and models to quantify the
likelihood of a virus quasispecies (QS) to jump from an animal host into humans. In parallel,
PREEMPT seeks to develop and validate new scalable technologies that prevent transmission of
viral pathogens in wild reservoirs and/or mosquito vectors to humans or to bridge animals that
serve as intermediary hosts prior to virus jump into humans.
Research Objectives
PREEMPT research objectives are structured along two Technical Areas (TAs). Both Technical
Areas must be performed in parallel by vertically integrated, interdisciplinary teams. Proposers
must present a plan to address both Technical Areas and meet key milestone decision points that
occur at the end of year 2.
1) TA1: Develop and validate integrated, multiscale models that quantify the likelihood a
geographic region.
2) TA2: Develop scalable approaches that target and suppress the animal virus in its
reservoir(s) and/or vector(s), to reduce the likelihood of virus transmission into humans.
Technical Area 1 (TA1)
4 Lloyd-Smith, J.O. (2010). Identifying genetic markers of adaptation for surveillance of viral host jumps. Nature
Reviews Microbiology.
5 Plowright, R.K. et al. (2017). Pathways to zoonotic spillover. Nature Reviews Microbiology.
6 Olival, K.J. et al. (2017). Host and viral traits predict zoonotic spillover from mammals. Nature.
7 Han, B.A. et al. (2016). Undiscovered Bat Hosts of Filoviruses. PLoS Negl Trop Dis.
5
Studies within TA1 must produce and validate models that: (a) quantify the likelihood of a virus
to jump into a new animal species and/or humans, (b) identify opportunities for proactive
intervention, and (c) determine likely efficacy, scalability, and sustainability of prevention
strategies.
Proposers are expected to leverage high-throughput virus screening methods, metagenomics,

ecological surveillance, and advanced modeling tools to generate risk models for species jump
that will enable near real-time data analysis and identification of potential risks and risk factors.
This far-forward biosurveillance system should also identify opportunities for preemptive
intervention, assessing likely efficacy, scalability, safety, and sustainability of preemptive
strategies to target viral threats in animal reservoirs and/or vectors before they enter the human
population.
TA1 Components
Proposers should address, at minimum, the following aspects:
1) Selection of zoonotic or vector-borne viral pathogen(s) (multiple viruses within the same
family may be addressed if they share a common animal reservoir and/or vector)
2) Field data collection
3) Multi-species field samples studied in a controlled laboratory setting
4) Data analysis, integration, and model development
5) Real-time data sharing and analysis
6) Model outputs
7) Experimental validation of model predictions in a controlled, environment-simulated
laboratory setting
1. Selection of zoonotic or vector-borne viral pathogen
This BAA only will consider proposals focused on zoonotic and/or vector-borne viruses.
Microorganisms other than viruses are not responsive to this announcement. A rationale for the
viruses selected is required. Virus selection may be based on, but is not limited to, the following
factors: high frequency of re-emergence (e.g. avian influenza virus), patterns of virus host range
or host breadth (predicted zoonotic potential), potential for rapid spread due to vector-mediated
transmissibility, severity of disease pathology, and likelihood of pandemic threat.
2. Field data collection
Proposers must identify and justify suitable geographic “hotspots” within which they will collect
field data. Proposers must consider all of the following criteria when selecting geographic hot
spots for field data collection:
1) Previous evidence of geographic distribution of zoonotic reservoirs and/or vectors for

known or unknown human viruses; these maps may be based on epidemiological,
phylogenetic, ecological, biogeographic, socio-economic data, or other;
2) Evidence of past species jump events in or near the selected geographic location;
6
3) Demonstrated capabilities and infrastructure to perform research in the selected

geographic region and/or collaboration with an established DoD or Department of Health
and Human Services (DHHS) partner (e.g., a Naval Medical Research Unit site, Armed
Forces Research Institute of Medical Sciences, or Centers for Disease Control), such that
the performer can coordinate far-forward surveillance activities and access local lab and
analytics capabilities;
4) Appropriate levels of in-country government approval, cooperation, infrastructure and
logistical support where samples will be collected and analyzed; and
5) Rationale for reservoirs/species to be sampled.
Where applicable, proposers must consider seasonal distribution (e.g., wet-dry seasons for
mosquito), temporal ecological factors (e.g., time of fruiting for fruit bats), and temporal
behavioral traits (e.g., sexual maturation) of zoonotic species for field sampling. Potential
geographic areas may include, but are not limited to, endemic regions; those undergoing
ecological shifts (thus increasing risk for spillover due to changes in animal-human interactions);
those harboring host species with high zoonotic potential that are in proximity to human
populations and “bridge” animal hosts (e.g., human-bat-swine ecosystems); and prior sites of
spillover events or outbreaks. The selection of geographic areas of common military deployment
that also meet the above criteria is strongly encouraged. Proposers should describe feasible
approaches to increase the probability of detecting viruses within animal reservoirs and/or
vectors—residing in selected geographic areas—that have the potential to become human-
capable. Proposers should describe sample collection methods in detail, being sure to include
longitudinal sampling frequency. Development of novel and rapid sampling approaches for the
real-time continuous screening of emerging or re-emerging pathogens at the human-animal
interface is encouraged. Proposers are encouraged to identify field samples that were collected
during past outbreak events, or field data already generated, that could be accessed for
retrospective analyses. In such cases, proposers should describe how and where the data were
collected, and establish quality control methods for data evaluation and use. Although human use
research will not be funded by PREEMPT, the use of human samples or data from prior
outbreaks obtained through other programs may be included in the research plan as long as
samples are appropriately de-identified (see, for example, https://humansubjects.nih.gov/human-
specimens-cell-lines-data).
3. Multi-species laboratory testing of field samples
Proposers should discuss protocols to determine and quantify the virus population QS diversity
from the vector or reservoir at the time of sample collection (t=0) in a manner that minimizes QS
alterations, which commonly result from cell line passaging. Proposers should assess the need
for longitudinal collection of samples to understand viral QS temporal dynamics (temporal
changes in sequence and fitness landscapes) in field virus populations. The initial viral QS
isolated from a field sample (t=0) will be hereon annotated as “QS0”. Proposers must describe in
vitro and/or in vivo experiments to assess jump potential of the QS0 population to a relevant new
host. Experimental approaches to monitor viral species jump may include, but are not limited to:
changes in viral population QS during cell line passaging between relevant species; infection of
appropriate animal models; infection of natural animal hosts; and controlled, multi-species
laboratory ecosystems.
7
Lab testing should determine the key parameters influencing the probability of a viral QS0 to
jump and adapt to a new host species. Potential parameters across different host animals or
vectors may include, but are not limited to:
1) QS diversity profiles
2) Rates of virus infection and amplification
3) Virus incubation period
4) Viremia and viral shedding
5) Transmission bottlenecks
6) Animal host evolutionary and immune pressures
The data generated should enable the development of genotype-to-phenotype maps and the
determination of mutation(s) associated with virus jump to a new host.
4. Data analysis, integration, and model development
Proposers should identify the relevant data needed for developing integrated models of risk
assessment. Proposers should discuss the development of probabilistic models of virus jump
using advanced computational methods and tools, including both model-driven and data-driven
approaches. Models should integrate multi-scale and cross-host species data, including but not
limited to, field and experimental data (e.g., QS dynamics), ecological data (e.g., demographic,
socio-economic, epidemiological, biogeographical, and other metadata), and other relevant data
available, especially that generated from past spillover events. Models should consider all factors
associated with pathogen emergence and transmission, particularly multi-host immunological
landscapes. Models should also capture viral evolutionary trajectories, fitness landscapes in
zoonotic and/or vector species, and quantify the transmission dynamics underlying species jump.
5. Real-time data sharing and analysis
The PREEMPT program is expected to generate significant amounts of data, primarily from next
generation sequencing (NGS) of viral populations and analysis of host molecular signatures.
Proposers should identify methods for near-real-time data sharing and analysis.
6. Model outputs
Proposers should explain how they will develop probabilistic models and machine learning
techniques that integrate multi-scale and cross-species data (e.g., molecular signatures,
demographic, ecological, socio-economic, epidemiological, weather, climate, and other
metadata) to quantify a pathogen’s likelihood to cross species barriers and infect humans.
Models should capture viral evolutionary trajectories and mutations that govern species jump.
Models should quantify transmission dynamics, accounting for the diversity of viral QS. Models
should identify key parameters of the pathogen, host species, vector dynamics, and ecological
interactions contributing to species jump, and should inform a preemption strategy by identifying
optimal pressure points (e.g., jump-enabling mutations, stochastic transmission bottlenecks, and
viral amplification requirements) that can be targeted to reduce the likelihood of species jump.
For proposals addressing vector-borne viruses, proposers should describe methods to quantify
8
the likelihood of virus adaptation to a new vector and propose experimental methods to validate
these predictions. Proposers should discuss metrics for grading model accuracy, sensitivity, and
specificity. Models should be able to receive dynamic biosurveillance inputs and accommodate
virus QS changes.
7. Experimental validation of model predictions
Proposers must describe in detail a plan to establish relevant in vivo, multi-species experimental
approaches to validate model outputs. Experimental testing may closely resemble or recapitulate
real-life settings (e.g., climate, phylogenetically adjacent host species, and vector “biting”
patterns) to enable the quantification of the probability of spillover and/or transmission events in
a controlled manner. Approaches that closely recapitulate real-life ecosystems and natural hosts
are strongly encouraged. To improve model accuracy, sensitivity, and specificity, performers
must iterate both theoretical and empirical experiments.
TA1 Key Outputs

The key outputs for TA1 must include the following:
1) Integrated models that quantify likelihood of virus jump and can be easily adapted to
receive dynamic surveillance and virus data input.
2) Stochastic models quantifying bottlenecks (e.g., transmission, cell entry, and infection
rates) and mutational fitness maps (e.g., enabler mutations and their frequency).
3) Identification and assessment of potential preemptive intervention targets to preempt
virus jump from the reservoir and/or vector.
Technical Area 2 (TA2)

Studies within this technical area aim to develop deployable and scalable methods to preempt
viral jump across species.
TA2 Components
Technical Area 2 aims to develop deployable and scalable methods to preempt viral jump to
other species. Proposers must address, at minimum, all of the following aspects:
1) Proof-of-concept preemption approaches;

2) Scalable delivery methods;
3) Analysis of long-term sustainability; and
4) Experimental validation.
1. Proof-of-concept preemption approaches
Proposers should describe how the output of TA1 in silico models will guide preventive method
design, and how quantitative information of virus-host species barriers and transmission
bottlenecks will be used to develop strategies to preempt emergence of human-capable viruses.
Models should guide the selection of: host species to be treated (e.g., wild animals, “bridge”
9
animals, vectors, and livestock); potential molecular targets (e.g., key mutation(s) enabling
receptor binding in a new host); targets associated with transmission cycle dynamics (e.g.,
reduction of viral load within the reservoir and/or vector that would preclude transmission); and
other relevant factors identified by the models. Proposers should describe the preemptive
methods that address different model outputs. Examples of preemptive approaches include but
are not limited to:
1) Specific disruption of jump-capable genes from virus QS in reservoirs and/or vectors

using small interfering RNAs or CRISPR/Cas-based targeted deletions.
2) Suppression of virus jump to a new host through antibody-mediated virus neutralization.
3) Suppressed reservoir and/or vector viremia using virus defective interfering particles
(DIPs) to outcompete virus replication.
4) Suppressed transmission among animal reservoirs through induced immunity (e.g.,
vaccinate the animal).
5) Alternative methods informed by experimental and theoretical models. The development
of novel preemptive approaches are strongly encouraged.
2. Scalable delivery methods
Proposers must describe scalable approaches to deliver the preemptive therapeutic to achieve
animal and/or vector population-level control of the targeted virus, including strategies for
reaching less accessible animal reservoirs (e.g., rodents or non-human primates). Approaches
that enable host-to-host therapeutic distribution (i.e., do not require individual treatment) that are
self-limiting, only activate when the viral pathogen target is present, and/or have a controllable
“on/off-switch” are encouraged. Potential scalable methods of inoculation may include, but are
not limited to:
1) Self-disseminating treatments or preventives (e.g., transmissible recombinant vaccines,

therapeutic interfering particles, or self-spreading antiviral therapies).
2) Bait vaccination or treatment of wild or domestic animals.
3) Spray-based methods.
Approaches that utilize genetic modifications of vectors (e.g., engineered mitochondrial DNA)
are acceptable. The proposed method of inoculation must be justified. The proposer must
describe strategies for closely controlling preemptive delivery and spread.
3. Analysis of long-term safety and efficacy
Proposers must establish initial methods to assess the long-term safety and efficacy of
preemptive approaches (e.g., determine the mechanism by which species specificity of a vaccine
is maintained, and assess evolutionary stability and ecological safety).
4. Experimental validation
10
Proposers must describe approaches to validate preemptive methods of choice in controlled

experimental models. Multi-species experimental platforms that closely recapitulate real-life
ecosystems and use natural hosts are strongly encouraged.
TA2 Key Outputs

The key outputs of TA2 must include the validation of new “block-before-jump” preemption
technologies for one of the following:
1) Validate suppression of virus jump from wild animal reservoir to humans and/or an
intermediate animal carrier (e.g., domestic livestock).
2) Validate suppression of virus jump or transmission from wild reservoir to vector, vector
to a different vector species, and/or from vector to human.
Period of Performance
DARPA anticipates that the PREEMPT program will provide up to three and a half years of
funding for research and development to be performed over Phase I (base) and II (option)
periods of 24 and 18 months, respectively.
Timeline
PREEMPT spans a 42-month effort with a 24-month Phase I (base) and an 18-month Phase II
(option). In general, Phase I should provide early validation of zoonosis risk models, and Phase
II should establish efficacy and scalability of zoonosis prevention approaches.
Phase I (Base period)

Phase I efforts aim to develop experimental and mathematical models to quantify the likelihood a
virus will jump from one host species to another, identify potential targets for spillover
preemption, and develop scalable methods of preemption. During Phase I, performer teams will:
1) Identify the genetic adaptations that enable species jump.

2) Develop mathematical models to quantify the likelihood of species jump based on:
a. Molecular data (e.g., viral QS data from deep sequencing) and
b. Ecological data (e.g., immune state of the host population before pathogen
emergence, species relatedness, etc.).
3) Identify bottlenecks for intervention (e.g.. transmission, cell entry, viral amplification,
infection rate, and other mechanisms associated with viral cross-species compatibility).
4) Develop initial scalable platforms that target viruses in reservoirs and/or vectors to
prevent viral jump into other animals or humans.
By the end of year 1 (Phase I) performers will be expected to have:

1) Identified signatures of fitness and spillover potential of a pathogen between two species.
2) Quantified the genetic and transmission factors requirements of viral QS to jump to a new
host (e.g., develop genotype-to-phenotype maps, identify specific mutations, etc.) using
far-forward biosurveillance data from selected high-risk regions.
By the end of year 2 (Phase I) performers will be expected to have:
11
1) Initially demonstrated that models can quantify the probability of human-capable virus
pathogens to jump from one species to another species.
2) Demonstrated proof of concept methods for targeting human-capable virus pathogens in
the reservoirs and/or vectors to reduce the probability of virus jump.
3) Provided initial strategies to scale up preemption methods.
Phase II (Option period)

Phase II efforts aim to develop probabilistic models for intra- and inter-species viral
amplification and transmission dynamics, integrated models for risk assessment, and
experimental validation of new approaches to preempt species jump. During Phase II, performer
teams will extend Phase I modeling efforts to:
1) Quantify intra- and inter-species viral amplification dynamics and transmission.

2) Develop integrated models that quantify the probability of a virus QS to jump to bridge
animal species or to humans.
3) Experimentally validate scalable methods for their ability to preempt zoonotic spillover.
By the end of year 3.5 (Phase II) performers will be expected to:
1) Demonstrate accuracy of risk assessment and preemption models in a relevant multi-

species experimental setting.
2) Demonstrate the ability to suppress viral jump to a new species in controlled
experimental settings.
It is recognized that appropriate milestones and metrics may depend upon the type of virus, the
reservoir, the mechanisms of species jump, and the proposed preemption methods. Proposers
must offer quantitative milestones and metrics (see Tables 1 and 2 below for notional metrics)
for their proposed proof-of-principle use case. Proposers must demonstrate relevant research
experience in the required technical areas. Proposals involving multiple teams and/or
experimental approaches should be structured as unified efforts that address the program
Technical Areas in parallel, in an integrated manner.
1.2. PROGRAM METRICS

In order for the Government to evaluate the effectiveness of a proposed solution in achieving the
stated program objectives, proposers should note that the Government hereby promulgates the
following program metrics that may serve as a guideline for assessing program progress, risk and
impact. Although the following program metrics are provided, proposers should note that the
Government has identified these goals with the intention of bounding the scope of effort while
affording the maximum flexibility, creativity, and innovation in proposing solutions to the stated
problem. Proposers should offer more appropriate and specific metrics for their particular use
case and technical approach, including intermediate metrics (i.e. every 6 months, or sooner) to
help further evaluate progress. Final metrics are to be negotiated at the time of contracting.
Table 1: Notional Milestones, Deliverables, and Program Metrics for TA1
12
Phase Milestones and Deliverables Program Metric

I Collected field surveillance data: Quantitative measures of:
 Virus QS molecular data (e.g. from  Longitudinal viral population QS (QSt=0,
deep sequencing) and metadata QSt=6 months, QSt=12 months,..) diversity in
from longitudinal samples (e.g. selected high-risk areas (e.g. frequency of
obtained from selected high-risk mutations, evolutionary trajectories) (6
areas (e.g. bat cave) and/or from months)
prior outbreak event  Viral QS diversity in samples obtained
 Host species immune molecular data from animal, vector, and/or human from
prior outbreak event (e.g. frequency of
species-specific mutations) (9 months)
 Immune molecular signatures from host
reservoir or intermediate reservoir
species (12 months)
Multi-species lab test data: Quantitative measures of:
 Virus QS genotype-phenotype maps  Cell entry and adaptation across species
for at least 2 relevant host species in vitro and/or in vivo (e.g. QS diversity
during passage across species) (18
months)
Initial mathematical models that assess risk Model capability to describe/predict:
of virus jump  Virus QS evolutionary trajectories
between 2 relevant species (9 months)
 Key molecular factors that could be
targeted to prevent virus jump in vitro
and/or in vivo (e.g. signatures of fitness
of a pathogen between two relevant host
species) (18 months)
 Molecular targets for preemption (24
months)
Established testbeds for validation of model Testbeds mimic natural environment as
predictions quantified by performer-defined parameters (24
months)
II Multi-species lab test data Quantitative measures of:
 Quantify virus QS transmission factors  Virus amplification and transmission
between two species in vivo dynamics (e.g. rate of infection vs.
viremia, amplification rates, and
incubation time) (30 months)
Advanced mathematical models that assess Models predict:
risk of virus jump  Intra- and inter-species transmission
 Integration of molecular data and virus dynamics (36 months)
amplification/transmission dynamics  Probability of spillover (risk assessment)
 Integration of host immune evolutionary (42 months)
pressures and virus QS dynamics  Top 2 targets to reduce probability of
transmission between two species to
13

inform TA2 (42 months)
Further validation of model prediction in Validated model prediction accuracy in
established testbeds multispecies environment (42 months)
Table 2: Notional Milestones, Deliverables, and Program Metrics for TA2

I Proof-of-concept demonstration of Quantitative validation of preemptive approach
preemptive approach that reduces either as established by performer (24 months)
the probability of virus jump or the Examples:
frequency of virus QS variants at high risk for
 Frequency of high-risk mutation within
species jump
virus QS in reservoir reduced >3X
 Virus incubation period in vector
extended >3X
 Virus amplification rate in reservoir or
vector reduced >3X
 Viremia in host or vector reduced >5X
II Demonstrated efficacy of preemption Reduced probability of transmission between two
method species by >5X in vivo for top 2 targets (36
months)
Demonstrated scalability of preemption Quantitative scalability as established by
method performer (42 months)
Data Sharing
Proposers must ensure all technical data items (including experimental findings, processed data,
methods of processing, research reports, and publications) and software (source code and
executables) generated from PREEMPT program funding are made available to DARPA.
Regularly submitted reports (e.g., monthly or quarterly) should contain all relevant project data,
including (but not limited to) raw and analyzed data and any necessary annotations and
interpretation. Data and/or samples collected from de-identified human volunteers/patients from
previous outbreak events must include associated anonymized metadata (e.g., signs/symptoms,
diagnostic test results, interventions, clinical observations, and outcomes). All raw data and
metadata should be recorded according to approved experimental standards.
To gain enhanced scientific value from open collaboration in fundamental research, DARPA
may seek permission to share some or all program-generated data with the broader research
community as open data (including the possibility of accessing, reusing, and redistributing under
appropriate licensing terms) to the extent permitted by applicable laws and regulations (e.g.,
privacy, security, and export control).
DARPA anticipates that a large amount of data will be generated under this program by each
performer and that the analyses and validation will be strengthened by compiling and integrating
14
information across all performers. Performers are strongly encouraged to establish the
appropriate agreements to enable collaboration and data sharing. DARPA encourages sharing of
pre-existing data, including those generated through funding by other sources, although this is
not a requirement of the program.
As feasible, DARPA intends to share data within the PREEMPT performer community to
promote program goals. To facilitate sharing and exchange of data items, performers will be
required to enter an Associate Contractor Agreement (ACA); an ACA clause will be included in
the contract or agreement awarded.
PREEMPT Transition Plan

Proposers must include a PREEMPT Technology Transition Plan. Proposers must indicate the
types of partners (e.g., government, private industry, non-profit) they plan to pursue and submit a
timeline with incremental milestones toward successful engagement. Proposers should begin
transition activities during the early stages of the program (Phase I). Awardees must include
DARPA in the development of transition relationships. If the transition plan includes a start-up
company, a business development strategy must be included as well. The extent by which the
proposed intellectual property (IP) rights will impede the Government’s ability to transition the
technology will be considered in the proposal evaluation.
1.3. ETHICAL, LEGAL, AND SOCIETAL IMPLICATIONS (ELSI)

DARPA is committed to ensuring that efforts funded under this BAA adhere to ethical and legal
regulations currently in place for federally and DoD-funded research. Program developments
will be discussed with a panel of expert external advisors with expertise in bioethical and
biosafety issues that may emerge as a consequence of advances in biomedical science and
technology. Proposers to this BAA should address potential ethical, legal, and societal
implications of the proposed technology.
1.4. PROTECTION OF SENSITIVE INFORMATION

PREEMPT is a 6.1 fundamental research program aimed at enhanced biosurveillance and novel
approaches to preempt viral pathogens in animal reservoirs from jumping into human
populations. DARPA follows current DoD policy for contracted fundamental research. DARPA
recognizes, however, that PREEMPT program components aimed at understanding and
quantifying mechanisms for viral zoonotic spillover could potentially generate sensitive
information that could be misused. Since this is a fundamental research program, the risk of
misuse currently cannot be reasonably evaluated. However, proposers are notified that during
proposal evaluation and/or program performance, when such a risk reasonably can be evaluated,
DARPA may determine that risk of misuse creates exceptional circumstances, compelling
reasons, and/or national security reasons under current DoD policy for contracted fundamental
research. DARPA therefore expects that proposers to this program understand and will comply
with various government guidance regarding potential gain-of-function research of concern
(GOFROC)8 and dual use research of concern (DURC)9,10,11,12,13. See
https://www.phe.gov/s3/dualuse/Pages/default.aspx for further information.
8Gain-of-Function Research (GOFROC) refers to studies with the potential to generate pathogens with pandemic
potential exhibiting high transmissibility and high virulence.
15
DARPA requires that proposals include a Risk Mitigation Plan that will be incorporated into any
resulting agreements or contracts and includes the following information:
1) An assessment of potential risks to public health, agriculture, plants, animals, the

2) Proposed guidelines that the proposer will follow to ensure maximal biosafety and
biosecurity during the course of the research.
3) A communication plan that addresses content, timing, and the extent of distribution of
potentially sensitive dual-use information. The plan must also address how input from
DARPA, other government, and community stakeholders will be taken into account in
decisions regarding communication and publication of potentially sensitive dual-use
information.
2. Award Information
2.1. GENERAL AWARD INFORMATION
Multiple awards are possible. The amount of resources made available under this BAA will
depend on the quality of the proposals received and the availability of funds.
The Government reserves the right to select for negotiation all, some, one, or none of the
proposals received in response to this solicitation and to make awards without discussions with
proposers. The Government also reserves the right to conduct discussions if it is later
determined to be necessary. If warranted, portions of resulting awards may be segregated into
pre-priced options. Additionally, DARPA reserves the right to accept proposals in their entirety
or to select only portions of proposals for award. In the event that DARPA desires to award only
portions of a proposal, negotiations may be opened with that proposer. The Government
reserves the right to fund proposals in phases with options for continued work, as applicable.
The Government reserves the right to fund a Phase II option based on funding availability, an
9 Dual Use Research of Concern (DURC) refers to life sciences research that can be reasonably anticipated to
provide knowledge, information, products or technology that could be directly misapplied to pose a significant threat
with broad potential consequences to public health and safety, agricultural crops and other plants, animals, the
environment, materiel, or national security.
10 Proposed framework for the oversight of dual use life sciences research: strategies for minimizing the potential
misuse of research information, National Science Advisory Board for Biosecurity (NSABB). June 2007.
11 Recommendations for the evaluation and oversight of proposed gain-of-function research by the National Science
Advisory Board for Biosecurity (NSABB). May 2016.

12 Tools for the Identification, Assessment, Management, and Responsible Communication of Dual Use Research of
Concern: A Companion Guide to the United States Government Polices for Oversight of Life Sciences Dual Use
Research of Concern. NIH. September 2014.
13 United States Government Policy for Oversight of Life Sciences Dual Use Research of Concern. DURC Policy.
March 2012.
16
assessment of Phase I research results, and a determination that awarding the option is in the best
interests of the Government. The Government reserves the right to request any additional,
necessary documentation once it makes the award instrument determination. Such additional
information may include but is not limited to Representations and Certifications (see Section
VI.B.2., “Representations and Certifications”). The Government reserves the right to remove
proposers from award consideration should the parties fail to reach agreement on award terms,
conditions, and/or cost/price within a reasonable time, and the proposer fails to timely provide
requested additional information. Proposals identified for negotiation may result in a
procurement contract, grant, cooperative agreement, or other transaction, depending upon the
nature of the work proposed, the required degree of interaction between parties, whether or not
the research is classified as Fundamental Research, and other factors.
Proposers looking for innovative, commercial-like contractual arrangements are encouraged to

consider requesting Other Transactions. To understand the flexibility and options associated
with Other Transactions, consult http://www.darpa.mil/work-with-us/contract-
management#OtherTransactions.
In all cases, the Government contracting officer shall have sole discretion to select award
instrument type, regardless of instrument type proposed, and to negotiate all instrument terms
and conditions with selectees. DARPA will apply publication or other restrictions, as necessary,
if it determines that the research resulting from the proposed effort will present a high likelihood
of disclosing performance characteristics of military systems or manufacturing technologies that
are unique and critical to defense. Any award resulting from such a determination will include a
requirement for DARPA permission before publishing any information or results on the
program. For more information on publication restrictions, see the section below on
Fundamental Research.
2.2. FUNDAMENTAL RESEARCH
It is DoD policy that the publication of products of fundamental research will remain unrestricted
to the maximum extent possible. National Security Decision Directive (NSDD) 189 defines
fundamental research as follows:
‘Fundamental research’ means basic and applied research in science and engineering, the
results of which ordinarily are published and shared broadly within the scientific
community, as distinguished from proprietary research and from industrial development,
design, production, and product utilization, the results of which ordinarily are restricted
for proprietary or national security reasons.
As of the date of publication of this BAA, the Government expects that program goals as
described herein may be met by proposers intending to perform fundamental research and
proposers not intending to perform fundamental research or the proposed research may present a
high likelihood of disclosing performance characteristics of military systems or manufacturing
technologies that are unique and critical to defense. Based on the nature of the performer and the
nature of the work, the Government anticipates that some awards will include restrictions on the
resultant research that will require the awardee to seek DARPA permission before publishing
any information or results relative to the program.
17
Proposers should indicate in their proposal whether they believe the scope of the research
included in their proposal is fundamental or not. While proposers should clearly explain the
intended results of their research, the Government shall have sole discretion to select award
instrument type and to negotiate all instrument terms and conditions with selectees. Appropriate
clauses will be included in resultant awards for non-fundamental research to prescribe
publication requirements and other restrictions, as appropriate. This clause can be found at
http://www.darpa.mil/work-with-us/additional-baa.
For certain research projects, it may be possible that although the research being performed by
the awardee is restricted research, a subawardee may be conducting fundamental research. In
those cases, it is the awardee’s responsibility to explain in their proposal why its subawardee’s
effort is fundamental research
3. Eligibility Information
3.1. ELIGIBLE APPLICANTS
All responsible sources capable of satisfying the Government’s needs may submit a proposal that
shall be considered by DARPA.
3.1.1. Federally Funded Research and Development Centers (FFRDCs) and Government
Entities
FFRDCs
FFRDCs are subject to applicable direct competition limitations and cannot propose to this BAA
in any capacity unless they meet the following conditions: (1) FFRDCs must clearly
demonstrate that the proposed work is not otherwise available from the private sector. (2)
FFRDCs must provide a letter on official letterhead from their sponsoring organization citing
the specific authority establishing their eligibility to propose to Government solicitations and
compete with industry, and their compliance with the associated FFRDC sponsor agreement’s
terms and conditions. This information is required for FFRDCs proposing to be awardees or
subawardees.
Government Entities
Government Entities (e.g., Government/National laboratories, military educational institutions,
etc.) are subject to applicable direct competition limitations. Government entities must clearly
demonstrate that the work is not otherwise available from the private sector and provide written
documentation citing the specific statutory authority and contractual authority, if relevant,
establishing their ability to propose to Government solicitations.
Authority and Eligibility

At the present time, DARPA does not consider 15 U.S.C. § 3710a to be sufficient legal authority
to show eligibility. While 10 U.S.C.§ 2539b may be the appropriate statutory starting point for
some entities, specific supporting regulatory guidance, together with evidence of agency
approval, will still be required to fully establish eligibility. DARPA will consider FFRDC and
18
Government entity eligibility submissions on a case-by-case basis; however, the burden to prove
eligibility for all team members rests solely with the proposer.
3.1.2. Non-U.S. Organizations

Non-U.S. organizations and/or individuals may participate to the extent that such participants
comply with any necessary nondisclosure agreements, security regulations, export control laws,
and other governing statutes applicable under the circumstances.
3.2. ORGANIZATIONAL CONFLICTS OF INTEREST

FAR 9.5 Requirements
In accordance with FAR 9.5, proposers are required to identify and disclose all facts relevant to
potential OCIs involving the proposer’s organization and any proposed team member
(subawardee, consultant). Under this Section, the proposer is responsible for providing this
disclosure with each proposal submitted to the BAA. The disclosure must include the
proposer’s, and as applicable, proposed team member’s OCI mitigation plan. The OCI
mitigation plan must include a description of the actions the proposer has taken, or intends to
take, to prevent the existence of conflicting roles that might bias the proposer’s judgment and to
prevent the proposer from having unfair competitive advantage. The OCI mitigation plan will
specifically discuss the disclosed OCI in the context of each of the OCI limitations outlined in
FAR 9.505-1 through FAR 9.505-4.
Agency Supplemental OCI Policy

In addition, DARPA has a supplemental OCI policy that prohibits contractors/performers from
concurrently providing Scientific Engineering Technical Assistance (SETA), Advisory and
Assistance Services (A&AS) or similar support services and being a technical performer.
Therefore, as part of the FAR 9.5 disclosure requirement above, a proposer must affirm whether
the proposer or any proposed team member (subawardee, consultant) is providing SETA, A&AS,
or similar support to any DARPA office(s) under: (a) a current award or subaward; or (b) a past
award or subaward that ended within one calendar year prior to the proposal’s submission date.
If SETA, A&AS, or similar support is being or was provided to any DARPA office(s), the
proposal must include:
 The name of the DARPA office receiving the support;

 The prime contract number;
 Identification of proposed team member (subawardee, consultant) providing the support; and
 An OCI mitigation plan in accordance with FAR 9.5.
Government Procedures
In accordance with FAR 9.503, 9.504 and 9.506, the Government will evaluate OCI mitigation
plans to avoid, neutralize or mitigate potential OCI issues before award and to determine whether
it is in the Government’s interest to grant a waiver. The Government will only evaluate OCI
mitigation plans for proposals that are determined selectable under the BAA evaluation criteria
and funding availability.
19
The Government may require proposers to provide additional information to assist the
Government in evaluating the proposer’s OCI mitigation plan.
If the Government determines that a proposer failed to fully disclose an OCI; or failed to provide
the affirmation of DARPA support as described above; or failed to reasonably provide additional
information requested by the Government to assist in evaluating the proposer’s OCI mitigation
plan, the Government may reject the proposal and withdraw it from consideration for award.
3.3. COST SHARING/MATCHING

Cost sharing is not required; however, it will be carefully considered where there is an applicable
statutory condition relating to the selected funding instrument. Cost sharing is encouraged where
there is a reasonable probability of a potential commercial application related to the proposed
research and development effort.
For more information on potential cost sharing requirements for Other Transactions for
Prototype, see http://www.darpa.mil/work-with-us/contract-management#OtherTransactions
4. Application and Submission Information

4.1. ADDRESS TO REQUEST APPLICATION PACKAGE
This announcement, any attachments, and any references to external websites herein constitute
the total solicitation. If proposers cannot access the referenced material posted in the
announcement found at http://www.darpa.mil, contact the administrative contact listed herein.
4.2. CONTENT AND FORM OF APPLICATION SUBMISSION

All submissions, including abstracts and proposals must be written in English with type not
smaller than 12 point font. Smaller font may be used for figures, tables, and charts. Copies of
all documents submitted must be clearly labeled with the DARPA BAA number, proposer
organization, and proposal title/proposal short title.
4.2.1. Proposal Abstract Format

Proposers are strongly encouraged to submit an abstract in advance of a proposal to minimize
effort and reduce the potential expense of preparing an out of scope proposal. The abstract is a
concise version of the proposal comprising a maximum of 8 pages including all figures, tables,
charts, and the Executive Summary slide. The (optional) submission letter is not included in the
page count. All pages shall be formatted for printing on 8-1/2 by 11-inch paper with font size
not smaller than 12 point. Smaller font sizes may be used for figures, tables, and charts.
Submissions must be written in English.
Abstracts must include the following components:
A. Cover Sheet (does not count towards page limit): Include the administrative and
technical points of contact (name, address, phone, fax, email, lead organization). Also
20
include the BAA number, title of the proposed project, primary subcontractors,
estimated cost, duration of the project, and the label “ABSTRACT.”
B. Executive Summary Slide: Provide a one slide summary in PowerPoint that

effectively and succinctly conveys the main objective, key innovations, expected
impact, and other unique aspects of the proposed project. Proposers should use the slide
template provided as Attachment 1 to the BAA posted at http://www.fbo.gov.
C. Goals and Impact: Clearly describe what is being proposed and what difference it
will make (qualitatively and quantitatively), including brief answers to the following
questions:
overcome these?
D. Technical Plan: Outline and address all technical challenges inherent in the
approach and possible solutions for overcoming potential problems. This section
should provide appropriate specific milestones (quantitative, if possible) at intermediate
stages of the project to demonstrate progress and a brief plan for accomplishment of the
milestones.
E. Capabilities: Provide a brief summary of expertise of the team, including

subcontractors and key personnel. A principal investigator for the project must be
identified, and a description of the team’s organization. Include a description of the
team’s organization including roles and responsibilities. Describe the organizational
experience in this area, existing intellectual property required to complete the project,
and any specialized facilities to be used as part of the project. List Government-
furnished materials or data assumed to be available. If desired, include a brief
bibliography with links to relevant papers, reports, or resumes of key performers. Do
not include more than two resumes as part of the abstract. Resumes count against the
abstract page limit.
4.2.2. Proposal Format

All full proposals must be in the format given below. Proposals shall consist of two volumes: 1)
Volume I, Technical and Management Proposal, and 2) Volume II, Cost Proposal. All
pages shall be printed on 8-1/2 by 11-inch paper with type not smaller than 12 point. Smaller
font may be used for figures, tables and charts. The page limitation for full proposals includes
all figures, tables, and charts. Volume I, Technical and Management Proposal, may include an
attached bibliography of relevant technical papers or research notes (published and unpublished)
which document the technical ideas and approach upon which the proposal is based. Copies of
not more than three (3) relevant papers may be included with the submission. The bibliography
21
and attached papers are not included in the page counts given below. The submission of other
supporting materials along with the proposals is strongly discouraged and will not be considered
for review. The maximum page count for Volume 1 is 36 pages. A submission letter is
optional and is not included in the page count. Volume I should include the following
components:
NOTE: Non-conforming submissions that do not follow the instructions herein may be
rejected without further review.
a. Volume I, Technical and Management Proposal
Section I. Administrative
A. Cover Sheet (LABELED “PROPOSAL: VOLUME I”):
1. BAA number (HR001118S0017);

2. Lead organization submitting proposal (prime contractor);
3. Type of organization, selected from among the following categories: “LARGE
BUSINESS,” “SMALL DISADVANTAGED BUSINESS,” “OTHER SMALL
BUSINESS,” “HBCU,” “MI,” “OTHER EDUCATIONAL,” OR “OTHER
NONPROFIT”;
4. Proposer’s reference number (if any);
5. Other team members (if applicable) and type of business for each;
6. Proposal title;
7. Technical point of contact (Program Manager or Principle Investigator) to include:
salutation, last name, first name, street address, city, state, zip code, telephone, fax, e-
mail;
8. Administrative point of contact (Contracting Officer or Grant Officer) to include:
salutation, last name, first name, street address, city, state, zip code, telephone, fax, e-
mail;
9. Award instrument requested: cost-plus-fixed-free (CPFF), cost-contract—no fee, firm-
fixed-price, grant, cooperative agreement, other transaction, or other type (specify);
10. Place(s) and period(s) of performance ;
11. Proposal validity period;
12. Total funds requested from DARPA, and the amount of cost share (if any); AND
13. Date proposal was submitted.
Information on award instruments is available at http://www.darpa.mil/work-with-us/contract-

management.
B. Official Transmittal Letter.
Section II. Detailed Proposal Information
22
A. Executive Summary: Provide a synopsis of the proposed project, including answers to

the following questions:
 What is the proposed work attempting to accomplish or do?

 How is it done today, and what are the limitations?
 What is innovative in your approach?
 What are the key technical challenges in your approach and how do you plan to
overcome these?
 Who or what will be affected and what will be the impact if the work is successful?
 How much will it cost, and how long will it take?
B. Executive Summary Slide: Provide a one slide summary in PowerPoint that effectively
and succinctly conveys the main objective, key innovations, expected impact, and other
unique aspects of the proposed project. Proposers should use the slide template
provided as Attachment 1 to the BAA posted at https://www.fbo.gov.
C. Goals and Impact: Clearly describe what the team is trying to achieve and the
difference it will make (qualitatively and quantitatively) if successful. Describe the
innovative aspects of the project in the context of existing capabilities and approaches,
clearly delineating the uniqueness and benefits of this project in the context of the state
of the art, alternative approaches, and other projects from the past and present.
Describe how the proposed project is revolutionary and how it significantly rises above
the current state of the art. Describe the deliverables associated with the proposed
project and any plans to commercialize the technology, transition it to a customer, or
further the work.
D. Technical Plan: Outline and address technical challenges inherent in the approach and
possible solutions for overcoming potential problems. This section should provide
appropriate measurable milestones (quantitative if possible) and program metrics (see
Section 1.2) at intermediate stages of the program to demonstrate progress, and a plan
for achieving the milestones. The technical plan should demonstrate a deep
understanding of the technical challenges and present a credible (even if risky) plan to
achieve the program goal. Discuss mitigation of technical risk. The technical plan
should address the TA1 and TA2 proposal content requirements detailed in Section 1.1.
E. Management Plan: Provide a summary of expertise of the team, including any

subcontractors, and key personnel who will be doing the work. Resumes count against
the proposal page count. Identify a principal investigator for the project. Provide a
clear description of the team’s organization including an organization chart that
includes, as applicable: the programmatic relationship of team members; the unique
23
capabilities of team members; the task responsibilities of team members, the teaming
strategy among the team members; and key personnel with the amount of effort to be
expended by each person during each year. Provide a detailed plan for coordination
including explicit guidelines for interaction among collaborators/subcontractors of the
proposed effort. Include risk management approaches. Describe any formal teaming
agreements that are required to execute this program.
F. Capabilities: Describe organizational experience in relevant subject area(s), existing

intellectual property, specialized facilities, and any Government-furnished materials or
information. Discuss any work in closely related research areas and previous
accomplishments.
G. Statement of Work (SOW): The SOW should provide a detailed task breakdown, citing
specific tasks and their connection to the interim milestones and program metrics. Each
phase of the program (Phase I base and Phase II option) should be separately defined in
the SOW and each task should be identified by TA (1 or 2). The SOW must not include
proprietary information.
For each task/subtask, provide:
 A detailed description of the approach to be taken to accomplish each defined
task/subtask.
 Identification of the primary organization responsible for task execution (prime
 A measurable milestone, i.e., a deliverable, demonstration, or other event/activity
that marks task completion. Include quantitative metrics.
 A definition of all deliverables (e.g., data, reports, software) to be provided to the
H. Schedule and Milestones: Provide a detailed schedule showing tasks (task name,
duration, work breakdown structure element as applicable, performing organization),
milestones, and the interrelationships among tasks. The task structure must be
consistent with that in the SOW. Measurable milestones should be clearly articulated
and defined in time relative to the start of the project.
I. PREEMPT Transition Plan (see Section 1.2): Proposers must indicate the types of
partners (e.g., government, private industry, non-profit) they plan to pursue and submit
a timeline with incremental milestones toward successful engagement. Proposers
should begin transition activities during the early stages of the program (Phase I). The
plan should describe any potential DARPA roles. If the plan includes a start-up
company, a business development strategy must be included as well.
24
J. PREEMPT Risk Mitigation Plan (see Section 1.4): Proposers must provide a risk
mitigation plan that addresses the following:
 An assessment of potential risks to public health, agriculture, plants, animals, the
 Proposed guidelines that the proposer will follow to ensure maximal biosafety and
biosecurity during the course of the research.
 A communication plan that addresses content, timing, and the extent of
K. Ethical, Legal, and Societal Implications (ELSI) (see Section 1.3): Proposers should
address potential ethical, legal, and societal implications of the proposed technology.
Section III. Additional Information (Note: Does not count towards page limit)
A brief bibliography of relevant technical papers and research notes (published and unpublished)
which document the technical ideas upon which the proposal is based. Copies of not more than
three (3) relevant papers can be included in the submission.
a. Volume II, Cost Management Proposal
Cover Sheet (LABELED “PROPOSAL: VOLUME II”):
1. BAA number;
2. Lead Organization Submitting proposal;
3. Type of organization, selected among the following categories: “LARGE BUSINESS”,
“SMALL DISADVANTAGED BUSINESS”, “OTHER SMALL BUSINESS”,
“HBCU”, “MI”, “OTHER EDUCATIONAL”, OR “OTHER NONPROFIT”;
4. Proposer’s reference number (if any);
5. Other team members (if applicable), CAGE Code(s), and type of business for each;
6. Proposal title;
7. Technical point of contact (Program Manager or Principal Investigator) to include:
salutation, last name, first name, street address, city, state, zip code, telephone, fax (if
available), electronic mail (if available);
8. Administrative point of contact (Contracting Officer or Grant Officer) to include:
salutation, last name, first name, street address, city, state, zip code, telephone, fax (if
available), and electronic mail (if available);
25
9. Award instrument requested: cost-plus-fixed-free (CPFF), cost-contract—no fee, cost

sharing contract – no fee, or other type of procurement contract (specify), grant,
cooperative agreement, or other transaction;
10. Place(s) and period(s) of performance;
11. Total proposed cost separated by basic award and option(s) (if any);
12. Name, address, and telephone number of the proposer’s cognizant Defense Contract
Management Agency (DCMA) administration office (if known);
13. Name, address, and telephone number of the proposer’s cognizant Defense Contract
Audit Agency (DCAA) audit office (if known);
14. Date proposal was prepared;
15. DUNS number (http://www.dnb.com/get-a-duns-number.html);
16. Taxpayer ID number (https://www.irs.gov/Individuals/International-
Taxpayers/Taxpayer-Identification-Numbers-TIN);
17. CAGE code (https://www.dlis.dla.mil/bincs/FAQ.aspx);
18. Proposal validity period
Note that nonconforming proposals may be rejected without review.
Proposers that do not have a Cost Accounting Standards (CAS) complaint accounting
system considered adequate for determining accurate costs that are negotiating a cost- type
procurement contract must complete an SF 1408. For more information on CAS compliance,
see http://www.dcaa.mil/cas.html. To facilitate this process, proposers should complete the SF
1408 found at http://www.gsa.gov/portal/forms/download/115778 and submit the completed
form with the proposal. To complete the form, check the boxes on the second page, then provide
a narrative explanation of your accounting system to supplement the checklist on page one. For
more information, see
(http://www.dcaa.mil/preaward_accounting_system_adequacy_checklist.html).
The Government strongly encourages that tables included in the cost proposal also be provided
in an editable (e.g., MS Excel) format with calculation formulas intact to allow traceability of the
cost proposal numbers across the prime and subcontractors.
The Government requires that the proposer provide a detailed cost breakdown to include:
(1) Total program cost broken down by Phase I (Base) and Phase II (Option) in Contractor
Fiscal Year to include:
i. Direct Labor – Including individual labor categories with associated labor hours and
direct labor rates. If selected for award, be prepared to submit supporting
documentation to justify labor rates. (i.e., screenshots of HR databases, comparison
to NIH or other web-based salary database);
ii. Consultants – If consultants are to be used, proposer must provide a copy of the
consultant’s proposed SOW as well as a signed consultant agreement or other
document which verifies the proposed loaded daily / hourly rate, hours and any
other proposed consultant costs (e.g., travel);
26
iii. Indirect Costs – Including Fringe Benefits, Overhead, General and Administrative
Expense, Cost of Money, Fee, etc. (must show base amount and rate), if available,
provide current Forward Pricing Rate Agreement or Forward Pricing Rate Proposal.
If not available, provide 2 years historical data to include pool and expense costs
used to generate the rates. For academia, provide DHHS or ONR negotiated rate
package or, if calculated by other than a rate, provide University documentation
identifying G&A and fringe costs by position;
iv. Travel – Provide the purpose of the trip, number of trips, number of days per trip,
departure and arrival destinations, number of people, estimated rental car and
airfare costs, and prevailing per diem rates as determined by gsa.gov, etc.; Quotes
must be supported by screenshots from travel websites;
v. Other Direct Costs – Itemized with costs including tuition remission, animal per diem
rates, health insurance/fee; back-up documentation is to be submitted to support
proposed costs;
vi. Equipment Purchases – Itemization with individual and total costs, including
quantities, unit prices, proposed vendors (if known), and the basis of estimate (e.g.,
quotes, prior purchases, catalog price lists, etc.); any item that exceeds $5,000 must
be supported with back-up documentation such as a copy of catalog price lists or
quotes prior to purchase (NOTE: For equipment purchases, include a letter stating
why the proposer cannot provide the requested resources from its own funding),
and;
vii. Materials – Itemization with costs, including quantities, unit prices, proposed vendors
(if known), and the basis of estimate (e.g., quotes, prior purchases, catalog price
lists, etc.); any item that exceeds $5,000 must be supported with back-up
documentation such as a copy of catalog price lists or quotes prior to purchase.
(2) A summary of total program costs by major task;
(3) A summary of projected funding requirements by month;
(4) An itemization of any information technology (IT) purchase (including a letter stating why
the proposer cannot provide the requested resources from its own funding), as defined in
FAR Part 2.101;
(5) An itemization of Subcontracts. All subcontractor cost proposal documentation must be
prepared at the same level of detail as that required of the prime. Subcontractor
proposals should include Interdivisional Work Transfer Agreements (IWTA) or evidence
of similar arrangements (an IWTA is an agreement between multiple divisions of the same
organization);
(6) The source, nature, and amount of any industry cost-sharing. Where the effort consists of
multiple portions which could reasonably be partitioned for purposes of funding, these
should be identified as options with separate cost estimates for each;
(7) Identification of pricing assumptions of which may require incorporation into the resulting
access to Government Subject Matter Expert/s, etc.);
(8) Any Forward Pricing Rate Agreement, DHHS rate agreement, other such approved rate
information, or such documentation that may assist in expediting negotiations (if
available); and
(9) Proposers with a Government acceptable accounting system who are proposing a cost-type
contract must submit the DCAA document approving the cost accounting system.
27
4.2.3. Additional Proposal Information
Proprietary Markings
Proposers are responsible for clearly identifying proprietary information. Submissions
containing proprietary information must have the cover page and each page containing such
information clearly marked with a label such as “Proprietary” or “Company Proprietary.”
NOTE: “Confidential” is a classification marking used to control the dissemination of U.S.
Government National Security Information as dictated in Executive Order 13526 and should not
be used to identify proprietary business information.
Unclassified Submissions
DARPA anticipates that submissions received under this BAA will be unclassified. However,
should a proposer wish to submit classified information, an unclassified email must be sent to the
BAA mailbox requesting submission instructions from the Technical Office PSO. If a
determination is made that the award instrument may result in access to classified information, a
SCG and/or DD Form 254 will be issued by DARPA and attached as part of the award.
Human Research Subjects/Animal Use
Proposers that anticipate involving Human Research Subjects or Animal Use must comply with
the approval procedures detailed at http://www.darpa.mil/work-with-us/additional-baa.
Small Business Subcontracting Plan

Pursuant to Section 8(d) of the Small Business Act (15 U.S.C. § 637(d)) and FAR 19.702(a)(1),
each proposer who submits a contract proposal and includes subcontractors might be required to
submit a subcontracting plan with their proposal. The plan format is outlined in FAR 19.704.
Section 508 of the Rehabilitation Act (29 U.S.C. § 749d)/FAR 39.2

All electronic and information technology acquired or created through this BAA must satisfy the
accessibility requirements of Section 508 of the Rehabilitation Act (29 U.S.C. § 749d)/FAR 39.2.
Intellectual Property
All proposers must provide a good faith representation that the proposer either owns or possesses
the appropriate licensing rights to all intellectual property that will be utilized under the proposed
effort.
For Procurement Contracts
Proposers responding to this BAA requesting procurement contracts will need to complete the
certifications at DFARS 252.227-7017. See http://www.darpa.mil/work-with-us/additional-baa
for further information. If no restrictions are intended, the proposer should state “NONE.”
The table below captures the requested information:
Technical Data Summary of Basis for Asserted Rights Name of Person
28
Computer Intended Use in Assertion Category Asserting

Software To be the Conduct of Restrictions
Furnished With the Research
Restrictions
(LIST) (NARRATIVE) (LIST) (LIST) (LIST)
For All Non-Procurement Contracts
Proposers responding to this BAA requesting a Grant, Cooperative Agreement, Technology

Investment Agreement, or Other Transaction for Prototypes shall follow the applicable rules and
regulations governing these various award instruments, but, in all cases, should appropriately
identify any potential restrictions on the Government’s use of any Intellectual Property
contemplated under the award instrument in question. This includes both Noncommercial Items
and Commercial Items. Proposers are encouraged to use a format similar to that described in the
section above. If no restrictions are intended, then the proposer should state “NONE.”
System for Award Management (SAM) and Universal Identifier Requirements

All proposers must be registered in SAM unless exempt per FAR 4.1102. FAR 52.204-7,
“System for Award Management” and FAR 52.204-13, “System for Award Management
Maintenance” are incorporated into this BAA. See http://www.darpa.mil/work-with-
us/additional-baa for further information.
4.2.4. Submission Information
DARPA will acknowledge receipt of all submissions and assign an identifying control number
that should be used in all further correspondence regarding the submission. DARPA intends to
use electronic mail correspondence regarding HR001118S0017. Submissions may not be
submitted by fax or e-mail; any so sent will be disregarded.
Submissions will not be returned. An electronic copy of each submission received will be
retained at DARPA and all other non-required copies destroyed. A certification of destruction
may be requested, provided the formal request is received by DARPA within 5 days after
notification that a proposal was not selected.
For (abstract and) proposal submission dates, see Part I., Overview Information. Submissions
received after these dates and times may not be reviewed.
For Proposers Submitting Proposal Abstracts or Full Proposals as Hard Copies/On CD-
ROM:
Proposers must submit an original hardcopy and one (1) electronic copy of the abstract or
proposal in PDF (preferred) on a CD-ROM to the mailing address listed in Part I. Each copy
must be clearly labeled with HR001118S0017, proposer organization, technical point of contact,
and proposal title (short title recommended).
29
Please note that submitters via hardcopy/CD-ROM will still need to visit https://baa.darpa.mil to
register their organization concurrently to ensure the BAA office can verify and finalize their
submission.
For Proposers Submitting Proposal Abstracts or Full Proposals Requesting Procurement

Contracts or OTs through DARPA’s BAA Submission Portal:
Abstracts and Full Proposals sent in response to HR001118S0017 may be submitted via
DARPA’s BAA Website (https://baa.darpa.mil). Visit the website to complete the two-step
registration process. Submitters will need to register for an Extranet account (via the form at the
URL listed above) and wait for two separate e-mails containing a username and temporary
password. After accessing the Extranet, submitters may then create an account for the DARPA
BAA website (via the “Register your Organization” link along the left side of the homepage),
view submission instructions, and upload/finalize the abstract. Proposers using the DARPA
BAA Website may encounter heavy traffic on the submission deadline date; it is highly advised
that submission process be started as early as possible.
All unclassified concepts submitted electronically through DARPA’s BAA Website must be
uploaded as zip files (.zip or .zipx extension). The final zip file should be no greater than 50 MB
in size. Only one zip file will be accepted per submission. Classified submissions and proposals
requesting assistance instruments (grants or cooperative agreements) should NOT be submitted
through DARPA’s BAA Website (https://baa.darpa.mil), though proposers will likely still need
to visit https://baa.darpa.mil to register their organization (or verify an existing registration) to
ensure the BAA office can verify and finalize their submission.
Technical support for BAA Website may be reached at [email protected], and is

typically available during regular business hours, (9:00 AM- 5:00 PM EST Monday – Friday).
Proposers using the DARPA BAA Website may encounter heavy traffic on the submission
deadline date; it is highly advised that submission process be started as early as possible.
For Full Proposals Requesting Cooperative Agreements:
Proposers requesting cooperative agreements may submit proposals through one of the following
methods: (1) hard copy mailed directly to DARPA; or (2) electronic upload per the instructions
at http://www.grants.gov/applicants/apply-for-grants.html. Cooperative agreement proposals
may not be submitted through any other means. If proposers intend to use Grants.gov as their
means of submission, then they must submit their entire proposal through Grants.gov;
applications cannot be submitted in part to Grants.gov and in part as a hard-copy. Proposers
using the Grants.gov do not submit paper proposals in addition to the Grants.gov electronic
submission.
Grants.gov Submissions: Grants.gov requires proposers to complete a one-time registration

process before a proposal can be electronically submitted. First time registration can take
between three business days and four weeks. For more information about registering for
Grants.gov, see http://www.darpa.mil/work-with-us/additional-baa.
30
Hard-copy Submissions: Proposers electing to submit grant or cooperative agreement proposals

as hard copies must complete the SF 424 R&R form (Application for Federal Assistance,)
available on the Grants.gov website
http://aaply07.grants.gov/apply/forms/sample/RR_SF424_2_0-V2.0.pdf.
Failure to comply with the submission procedures may result in the submission not being
evaluated. DARPA will acknowledge receipt of complete submissions via email and assign
control numbers that should be used in all further correspondence regarding proposals.
4.2.5. Disclosure of Information and Compliance with Safeguarding Covered Defense

Information Controls
The following provisions and clause apply to all solicitations and contracts; however, the
definition of “controlled technical information” clearly exempts work considered fundamental
research and therefore, even though included in the contract, will not apply if the work is
fundamental research.
DFARS 252.204-7000, “Disclosure of Information”

DFARS 252.204-7008, “Compliance with Safeguarding Covered Defense Information Controls”
DFARS 252.204-7012, “Safeguarding Covered Defense Information and Cyber Incident
Reporting”
The full text of the above solicitation provision and contract clauses can be found at
http://www.darpa.mil/work-with-us/additional-baa#NPRPAC.
Compliance with the above requirements includes the mandate for proposers to implement the
security requirements specified by National Institute of Standards and Technology (NIST)
Special Publication (SP) 800-171, “Protecting Controlled Unclassified Information in Nonfederal
Information Systems and Organizations” (see https://doi.org/10.6028/NIST.SP.800-171r1) that
are in effect at the time the BAA is issued, or as authorized by the Contracting Officer, not later
than December 31, 2017.
For awards where the work is considered fundamental research, the contractor will not have to
implement the aforementioned requirements and safeguards; however, should the nature of the
work change during performance of the award, work not considered fundamental research will
be subject to these requirements.
4.3. FUNDING RESTRICTIONS

Not Applicable.
4.4. OTHER SUBMISSION REQUIREMENTS

Not Applicable.
5. Application Review Information

5.1. EVALUATION CRITERIA
31
Proposals will be evaluated using the following criteria, listed in descending order of importance:
5.1.1 Overall Scientific and Technical Merit; 5.1.2 Potential Contribution and Relevance to the
DARPA Mission; and 5.1.3 Cost Realism.
5.1.1. Overall Scientific and Technical Merit

Task descriptions and associated technical elements provided are complete and in a logical
sequence with all proposed deliverables clearly defined such that a final outcome that achieves
the goal can be expected as a result of award. The proposal identifies major technical risks and
planned mitigation efforts are clearly defined and feasible. The proposed PREEMPT Risk
Mitigation Plan effectively provides the following: an assessment of potential risks; proposed
guidelines to ensure maximal biosafety and biosecurity; a risk management plan for responsible
communications; and a plan to address how input from the Government and community
stakeholders will be considered regarding communication and publication of potentially sensitive
dual-use information.
5.1.2. Potential Contribution and Relevance to the DARPA Mission

The potential contributions of the proposed effort are relevant to the national technology base.
Specifically, DARPA’s mission is to make pivotal early technology investments that create or
prevent strategic surprise for U.S. National Security.
The proposer clearly demonstrates its capability to transition the technology to the research,
industrial, and/or operational military communities in such a way as to enhance U.S. defense. In
addition, the evaluation will take into consideration the extent to which the proposed intellectual
property (IP) rights will potentially impact the Government’s ability to transition the technology.
5.1.3. Cost Realism

The proposed costs are realistic for the technical and management approach and accurately
reflect the technical goals and objectives of the solicitation. The proposed costs are consistent
with the proposer's Statement of Work and reflect a sufficient understanding of the costs and
level of effort needed to successfully accomplish the proposed technical approach. The costs for
the prime proposer and proposed subawardees are substantiated by the details provided in the
proposal (e.g., the type and number of labor hours proposed per task, the types and quantities of
materials, equipment and fabrication costs, travel and any other applicable costs and the basis for
the estimates).
It is expected that the effort will leverage all available relevant prior research in order to obtain
the maximum benefit from the available funding. For efforts with a likelihood of commercial
application, appropriate direct cost sharing may be a positive factor in the evaluation. DARPA
recognizes that undue emphasis on cost may motivate proposers to offer low-risk ideas with
minimum uncertainty and to staff the effort with junior personnel in order to be in a more
competitive posture. DARPA discourages such cost strategies.
5.2. REVIEW OF PROPOSALS
32
Review Process
It is the policy of DARPA to ensure impartial, equitable, comprehensive proposal evaluations
based on the evaluation criteria listed in Section V.A. and to select the source (or sources) whose
offer meets the Government's technical, policy, and programmatic goals.
DARPA will conduct a scientific/technical review of each conforming proposal. Conforming

proposals comply with all requirements detailed in this BAA; proposals that fail to do so may be
deemed non-conforming and may be removed from consideration. Proposals will not be
evaluated against each other since they are not submitted in accordance with a common work
statement. DARPA’s intent is to review proposals as soon as possible after they arrive; however,
proposals may be reviewed periodically for administrative reasons
Award(s) will be made to proposers whose proposals are determined to be the most
advantageous to the Government, consistent with instructions and evaluation criteria specified
in the BAA herein, and availability of funding.
Handling of Source Selection Information
DARPA policy is to treat all submissions as source selection information (see FAR 2.101 and
3.104), and to disclose their contents only for the purpose of evaluation. Restrictive notices
notwithstanding, during the evaluation process, submissions may be handled by support
contractors for administrative purposes and/or to assist with technical evaluation. All DARPA
support contractors performing this role are expressly prohibited from performing DARPA-
sponsored technical research and are bound by appropriate nondisclosure agreements.
Subject to the restrictions set forth in FAR 37.203(d), input on technical aspects of the proposals
may be solicited by DARPA from non-Government consultants/experts who are strictly bound
by the appropriate non-disclosure requirements.
Federal Awardee Performance and Integrity Information (FAPIIS)

Per 41 U.S.C. 2313, as implemented by FAR 9.103 and 2 CFR § 200.205, prior to making an
award above the simplified acquisition threshold, DARPA is required to review and consider any
information available through the designated integrity and performance system (currently
FAPIIS). Awardees have the opportunity to comment on any information about themselves
entered in the database, and DARPA will consider any comments, along with other information
in FAPIIS or other systems prior to making an award.
6. Award Administration Information

6.1. SELECTION NOTICES
As soon as the evaluation of a proposal is complete, the proposers will be notified that 1) the
proposal has been selected for funding pending contract negotiations, or 2) the proposal has not
been selected. These official notifications will be sent via email to the Technical POC identified
on the proposal coversheet.
33
6.1.1. Proposal Abstracts

DARPA will respond to abstracts with a statement as to whether DARPA is interested in the
idea. If DARPA does not recommend the proposer submit a full proposal, DARPA will provide
feedback to the proposer regarding the rationale for this decision. Regardless of DARPA’s
response to an abstract, proposers may submit a full proposal. DARPA will review all full
proposals submitted using the published evaluation criteria and without regard to any comments
resulting from the review of an abstract.
6.1.2. Full Proposals

As soon as the evaluation of a proposal is complete, the proposer will be notified that (1) the
proposal has been selected for funding pending award negotiations, in whole or in part, or (2) the
proposal has not been selected. These official notifications will be sent via e-mail to the
Technical POC and/or Administrative POC identified on the proposal coversheet.
6.2. ADMINISTRATIVE AND POLICY REQUIREMENTS
6.2.1. Meeting and Travel Requirements

There will be a program kickoff meeting in the Arlington, VA vicinity and all key participants
are required to attend. Performers should also anticipate regular program-wide PI meetings and
periodic site visits at the Program Manager’s discretion to the Arlington, VA vicinity.
Proposers shall include within the content of their proposal details and costs of any travel or
meetings they deem to be necessary throughout the course of the effort, to include periodic status
reviews by the government.
6.2.1. FAR and DFARS Clauses

Solicitation clauses in the FAR and DFARS relevant to procurement contracts and FAR and
DFARS clauses that may be included in any resultant procurement contracts are incorporated
herein and can be found at http://www.darpa.mil/work-with-us/additional-baa.
6.2.2. Controlled Unclassified Information (CUI) on Non-DoD Information Systems

Further information on Controlled Unclassified Information on Non-DoD Information Systems is
incorporated herein can be found at http://www.darpa.mil/work-with-us/additional-baa.
6.2.3. Representations and Certifications

If a procurement contract is contemplated, prospective awardees will need to be registered in the
SAM database prior to award and complete electronic annual representations and certifications
consistent with FAR guidance at 4.1102 and 4.1201; the representations and certifications can be
found at www.sam.gov. Supplementary representations and certifications can be found at
http://www.darpa.mil/work-with-us/additional-baa.
.
34
6.2.4. Terms and Conditions

A link to the DoD General Research Terms and Conditions for Grants and Cooperative
Agreements and supplemental agency terms and conditions can be found at
http://www.darpa.mil/work-with-us/contract-management#GrantsCooperativeAgreements.
6.3. REPORTING
The number and types of reports will be specified in the award document, but will include as a
minimum monthly financial status reports and quarterly technical status reports. The reports
shall be prepared and submitted in accordance with the procedures contained in the award
document and mutually agreed on before award. Reports and briefing material will also be
required as appropriate to document progress in accomplishing program metrics. A Final Report
that summarizes the project and tasks will be required at the conclusion of the performance
period for the award, notwithstanding the fact that the research may be continued under a follow-
on vehicle.
6.4. ELECTRONIC SYSTEMS
6.4.1. Wide Area Work Flow (WAWF)

Performers will be required to submit invoices for payment directly to https://wawf.eb.mil,
unless an exception applies. Performers must register in WAWF prior to any award under this
BAA.
6.4.2. i-EDISON
The award document for each proposal selected for funding will contain a mandatory
requirement for patent reports and notifications to be submitted electronically through i-Edison
(http://public.era.nih.gov/iedison).
7. Agency Contacts
Communication via e-mail is preferred.
Points of Contact
The BAA Coordinator for this effort may be reached at:
[email protected]
DARPA/BTO
ATTN: HR001118S0017
675 North Randolph Street
Arlington, VA 22203-2114
For information concerning agency level protests see http://www.darpa.mil/work-with-

us/additional-baa#NPRPAC.
8. Other Information
DARPA will host a Proposers Day in support of the PREEMPT program on January 30, 2018,
at the Executive Conference Center in Arlington, VA. The purpose is to provide potential
35
proposers with information on the PREEMPT program, promote additional discussion on this
topic, address questions, provide a forum to present their capabilities, and to encourage team
formation.
Interested proposers are not required to attend to respond to the PREEMPT BAA, and relevant
information and materials discussed at Proposers Day will be made available to all potential
proposers in the form of a FAQ posted on the DARPA Opportunities Page. The event will be
webcast for those who would like to participate remotely.
DARPA will not provide cost reimbursement for interested proposers in attendance.
An online registration form and various other meeting details can be found at the registration
website, https://events.sa-meetings.com/PREEMPTProposersDay.
To encourage team formation, interested proposers are encouraged to submit information to be

shared with all potential proposers through the Proposers Day website and the DARPA
Opportunities Page. This information may include contact information, relevant publications,
and a slide or poster to summarize the proposer’s interests.
Participants are required to register no later than January 23, 2018, for physical attendance, and
January 26, 2018, for the webcast. This event is not open to the Press. The Proposers Day will
be open to members of the public who have registered in advance for the event; there will be no
onsite registration.
All foreign nationals, including permanent residents, must complete and submit a DARPA Form
60 “Foreign National Visit Request,” which will be provided in the registration confirmation
email.
Proposers Day Point of Contact: [email protected].
36
9. Appendix 1 – Volume II checklist
37
Volume II, Cost Proposal

Checklist and Sample Templates
The following checklist and sample templates are provided to assist the proposer in
developing a complete and responsive cost volume. Full instructions appear in Section
4.2.2 beginning on Page 25 of HR001118S0017. This worksheet must be included with
the coversheet of the Cost Proposal.
1. Are all items from Section 4.2.2 (Volume II, Cost Proposal) of HR001118S0017 included on your
Cost Proposal cover sheet?
○ YES ○ NO Appears on Page(s) [Type text]
If reply is “No”, please explain:
2. Does your Cost Proposal include (1) a summary cost buildup by Phase, (2) a summary cost buildup
by Year, and (3) a detailed cost buildup of for each Phase that breaks out each task and shows the cost
per month?
3. Does your cost proposal (detailed cost buildup #3 above in item 2) show a breakdown of the major
cost items listed below:
Direct Labor (Labor Categories, Hours, Rates)
Indirect Costs/Rates (i.e., overhead charges, fringe benefits, G&A)

Materials and/or Equipment

Subcontracts/Consultants
Other Direct Costs

Travel
4. Have you provided documentation for proposed costs related to travel, to include purpose of trips,
departure and arrival destinations and sample airfare?
38
5. Does your cost proposal include a complete itemized list of all material and equipment items to be
purchased (a priced bill-of-materials (BOM))?
6. Does your cost proposal include vendor quotes or written engineering estimates (basis of estimate) for
all material and equipment with a unit price exceeding $5000?
7. Does your cost proposal include a clear justification for the cost of labor (written labor basis-of-
estimate (BOE)) providing rationale for the labor categories and hours proposed for each task?
8. Do you have subcontractors/consultants? If YES, continue to question 9. If NO, skip to question 13.
9. Does your cost proposal include copies of all subcontractor/consultant technical (to include Statement
of Work) and cost proposals?
10. Do all subcontract proposals include the required summary buildup, detailed cost buildup, and
supporting documentation (SOW, Bill-of-Materials, Basis-of-Estimate, Vendor Quotes, etc.)?
11. Does your cost proposal include copies of consultant agreements, if available?
12. If requesting a FAR-based contract, does your cost proposal include a tech/cost analysis for all
proposed subcontractors?
39
13. Have all team members (prime and subcontractors) who are considered a Federally Funded
Research & Development Center (FFRDC), included documentation that clearly demonstrates work
is not otherwise available from the private sector AND provided a letter on letterhead from the
sponsoring organization citing the specific authority establishing their eligibility to propose to
government solicitations and compete with industry, and compliance with the associated FFRDC
sponsor agreement and terms and conditions.
14. Does your proposal include a response regarding Organizational Conflicts of Interest?
15. Does your proposal include a completed Data Rights Assertions table/certification?
40
Re: Support letter (PREEMPT)

Sleeman, Jonathan M <[email protected]>
Tue 3/20/2018 4:25 PM
Hi Tonie,
The authority we should cite is 31 U.S.C 1535A Economy Act. If you
wanted to finalize the letter I will sign it.
FYI, Lisa Meicher researched this for us.
Best wishes,
Jonathan
This is all the response I got regarding
my eligibility question. -Tonie
Subject: Re: Support letter (PREEMPT)
Hi Tonie,
I apologize that the link did not provide helpful guidance. I've spoken with fellow staff at EHA and
they recommend speaking with either: (1) The director or other representative of NWHC's grant
department (if your institution has such a department), or (2) Someone in NWHC's Operations or
Finance department.
My colleague does not think DARPA will give additional guidance regarding this matter. Please let
me know if this information helps.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6)
(mobile)
Hi Luke: I have no idea how to respond about the eligibility. Is there
someone we can call at DARPA. The link you provided was no help at
all and in fact includes no DOI agencies. -Tonie
Hi Tonie,
Please see the required collaborator support letter (attached) and comments
within. Thank you for your patience and please let me know if you have any questions.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Center Director
6006 Schroeder Road
Madison, WI 53711
Tel: (608) 270 2401
Fax: (608) 270 2415
Re: DARPA PRE-EMPT

Tue 3/20/2018 7:51 PM
Hi Tonie,
Thanks for these bios, they are great. I would wait to add detailed edits until the updated draft.
Peter has been dedicating this week to writing and editing, so things may have been reformatted in
the new draft. If you have important items that need editing/adding that you'd like to address
before your travel, feel free to send as a separate note or we can discuss on the call tomorrow. I
apologize if this is unclear, Peter will have good advice on this tomorrow.
Best,
Anna
Hi Anna: Should I wait for Peter's updated draft before I make revisions?
Also, attached is a file containing bios for both Rachel Abbott and
myself. Please let me know if you think they are sufficient. Best -Tonie
On Tue, Mar 20, 2018 at 4:15 PM, Anna Willoughby <[email protected]> wrote:
Dear all,
Please find the NWHC section of the proposal. Peter is currently working on an updated draft,
but this should be sufficient for composing your budget and particular task. Please let me
know if you have any questions. If needed, I am also attaching the original BAA for the
program, with PARC's focus being TA2.
Best,
Anna
- Jerome to send more detailed scope of work with paragraphs and revised budget by early
next week
For your question on collaborating with other institutes, it is likely

that all organizations involved may have insight into the aerosol-
bat interaction. I believe this topic would be covered during the
Annual Meeting between all partners, as well as during relevant

cross-partner trips, in addition to monthly conference calls.
Best,
Anna

preliminary field testing to see how bats react to the aerosol) and eventual field-deployment in China,
will the technical lead for coordinating this segment of the project be USGS – National Wildlife Center?
Or should we also expect to work/coordinate with other institutes who would give feedback and
insights on how this works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Cc: 'Luke Hamel' <[email protected]>; 'Anna Willoughby' <willoughby@ecohealthalliance.
org>; 'Alison Andre' <[email protected]>; 'Amanda Andre'
<[email protected]>; 'Rocke, Tonie' <[email protected]>; Paul, Kateri
Peter and team,
approximately Monday. Officially, for the submission, our capture manager, Kateri Paul, who takes care
of the other things would need the following things from your equivalent to facilitate our parts of the
submission.
DARPA
Once we have finalized the scope of work and the budget, Kateri will be in touch for these other
aspects. Her contact information can be found below.
Kateri E. Paul
Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


To: 'Rocke, Tonie' <[email protected]>; William B. Karesh <[email protected]>; Johnson,
David <[email protected]> <[email protected]>
Willoughby <[email protected]>; Alison Andre <[email protected]>;
Amanda Andre <[email protected]>
Dear all,
10AM-11AM PST (12PM-1PM CT, 1PM-2PM ET) should work for us. I shall setup a WebEx meeting for
this, given the number of participants.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


<[email protected]>
On Thu, Mar 15, 2018 at 4:14 PM, William B. Karesh <[email protected]>

wrote:
Tonie and Jerome,
We would still like to speak. Anytime on Friday between 11:00 AM and 2:00 PM would
be great.
BK
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

between human and wildlife health and delicate ecosystems. With this science we
develop solutions that promote conservation and prevent pandemics.
ahead with a short call we had been planning anyway regarding some
technical details. I told him our concerns about the proposed budget and
we think we have a pretty good plan to reduce the scope of work to the
funds we have available. PARC is very unique in developing this technology
and their technology fits very well with other work I am doing, so we both
feel pretty confident we can work something out. If you still wish to have a
discussion among all of us, we can schedule that for tomorrow, as I believe
Jerome had another meeting to run off to for the rest of the day. I'm
available the rest of the day if you wish to chat about this in person. Best -
Tonie

Actually – can we do a phone call – I’ll be driving. 5.15pm would be perfect (NYC
time), Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC

Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD



Dear all,
Sorry for the late response – yes, I will be available for a phone call now. Up to
2PM.
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Dear Dr. Unidad,
Thanks for your quick responses to Dr. Rocke. Would you be available
for a short call with Dr. Daszak, Dr. Rocke and me this afternoon or
Friday.
We’re on tight timeline so we thought a phone call might be save quite a

bit of time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Anna Willoughby
Research Assistant
EcoHealth Alliance

New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)

PREEMPT budget - Local ground travel

Wed 3/21/2018 10:43 AM
Cc: Abbott, Rachel (Contractor) C <[email protected]>; Jonathon Musser <[email protected]>;
Hi Tonie,
Previously, you asked me about how to estimate costs for local ground transportation in China. For
this, we typically estimate the cost of a local taxi fare from the airport to either: (1) a hotel or (2) the
meeting venue (which in this case would be the Wuhan Institute of Virology).
We have found that the following website, is very helpful for estimating local taxi fares. For the
departure point, you can use 'Wuhan Tianhe International Airport' and for the destination, 'Wuhan
Institute of Virology.' You may also need to enter 'Beijing, China' into the top field that reads, Find
your taxi calculator.
Lastly, we typically assume that one taxi will accommodate up to 3 passengers. So if there are 1 or
2 others traveling with you from NWHC to China, there is no need to account for additional taxi
fares.
Please forward this information along to the travel coordinator who has been assisting you, and let
me know if you experience any difficulties with the site.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Re: Identification of pricing assumptions (PREEMPT)

Wed 3/21/2018 10:45 AM
Cc: Meicher, Lisa K <[email protected]>; Richgels, Katherine L <[email protected]>
Hi Tonie,
Great to hear about the status of the support letter! I will look into additional information for the
'pricing assumptions' and get back to you as soon as possible.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Wed, Mar 21, 2018 at 10:16 AM, Rocke, Tonie <[email protected]> wrote:
We're not exactly sure what "identification of pricing assumptions"
means. Do you have any other information? On the plus side, we did
figure out the eligibility question and the letter you requested will be on
its way to you shortly. -Tonie
From: Meicher, Lisa <[email protected]>
Date: Wed, Mar 21, 2018 at 8:53 AM
Subject: Re: Identification of pricing assumptions (PREEMPT)
Cc: "Richgels, Katherine" <[email protected]>
Tonie,
To be honest, I'm not exactly sure. If they mean costs related to facilities, that is normally covered
by the burden fee. I would need future clarification.
Lisa K. Meicher
Budget Analyst
6006 Schroeder Rd
Madison, WI 53711
608-270-2410
fax 608-270-2415
[email protected]
Hi Lisa: Do you know what they are talking about below and do we
need to address this? Thanks -Tonie
Subject: Identification of pricing assumptions (PREEMPT)
Hi Tonie,
Please see below, an additional item that we will need to address. Please forward this text to
whomever you have been speaking with at NWHC regarding financial guidance for the
subaward. They should have a good idea of what this entails for your institution, and this is
information that, if relevant, we will need to include within your budget justification.
Taken from p. 27 of the PREEMPT BAA:
"(7) Identification of pricing assumptions of which may require incorporation into the resulting
access to Government Subject Matter Expert/s, etc.)"
Please let me know if you have any questions regarding this matter.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
b) (6)
(direct)
(b) (6) (mobile)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: PREEMPT - Registering on Grants.gov

Wed 3/21/2018 1:03 PM
Great. Thank you, Tonie.
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Wed, Mar 21, 2018 at 1:06 PM, Rocke, Tonie <trocke ov> wrote:
I already have an account. Username: (b) (6)
On Wed, Mar 21, 2018 at 11:43 AM, Luke Hamel <[email protected]> wrote:
Hi Tonie,
In order to submit our PREEMPT proposal, any individual listed as 'Key Personnel' on our project must create
an account on Grants.gov (the website that we will use for submission).
As you are considered 'Key Personnel' for our proposal, I ask that you create an account as soon as
possible, using this link.
This should be quick and easy to do, as applicants are only required to provide the following information:
NAME
EMAIL
PHONE NUMBER
USERNAME
PASSWORD
SECURITY QUESTION
Please note that if you have previously created an account on Grants.gov, there is no need to register
again. In either case however, I will need you to share your username with me so that I can add you to
our team profile on the Grants.gov website.
Best,
Re: [Reminder] Call today @ 6 PM (ET)

Wed 3/21/2018 4:25 PM
Cc: Abbott, Rachel (Contractor) C <[email protected]>; Luke Hamel <[email protected]>; Dr.
Peter Daszak <[email protected]>; Alison Andre <[email protected]>; Jonathon Musser
<[email protected]>
Hi Tonie,
In advance of our call, please find updated budget files (pdf form and excel breakdown). Overall
numbers haven't changed much, an increase of ~$10,000. New changes are 1) Updated your time
slightly to match travel, 2) Updated travel break down to include per diems per person and
formulas, and 3) added materials by year formulas. I am also attaching a performance schedule
that shows when (approximately) you would be traveling and hosting partners (to justify your time).
I will be on the call to clarify all these items and answer any questions you may have.
Best,
Anna
Hi Tonie,
This is just a reminder that we have a PREEMPT call scheduled today at 6 PM (ET)/5 PM (CT).
Please use the following number and password to join the call:
Phone: 1-719-785-9461
Password: 9784#
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
Lead Purpose Personnel Phase I Phase II
Month
1 2 3 4 5 6 7 8 9 # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # #
DARPA meeting Dr. Rocke KO
Annual meeting Dr. Rocke; Dr. Abbott (Y1,3,OY2) NY CN NY NY
NWHC US site visit Dr. Rocke; 2 Students
China site visit Dr. Rocke
EHA Partner Visit to NWHC Dr. Epstein; Dr. Ross
PARC Partner Visit to NWHC PARC
[email protected]
Applicants tab.
CFDA Number: 12.910
Competition ID:
Competition Title:

[email protected]

DUNS: 0770900660000
Form Version: 1.4

FORM ACTIONS:
ORGANIZATIONAL DUNS: 0389759340000 Enter name of Organization: USGS National Wildlife Health Center
Dr. Tonie Rocke 129,590.00 0.85 9,179.00 2,475.00 11,654.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00
Project Role: Associate Scientist

Total Senior/Key Person 88,630.00
B. Other Personnel

Graduate Students
3 Undergraduate Students 3.00 24,782.00 0.00 24,782.00

3 Total Number Other Personnel Total Other Personnel 24,782.00
Total Salary, Wages and Fringe Benefits (A+B) 113,412.00

Total Equipment

1. Domestic Travel Costs ( Incl. Canada, Mexico and U.S. Possessions) 7,689.00
2. Foreign Travel Costs 3,384.00
Total Travel Cost 11,073.00
2. Stipends
3. Travel
4. Subsistence
5. Other

1. Materials and Supplies 21,982.52
8. Animal care 12,600.00
9. Rabies prophylaxis 4,020.00
10.
Total Other Direct Costs 38,602.52

Total Direct Costs (A thru F) 163,087.52
H. Indirect Costs
Total direct costs 64.54 163,087.52 105,256.69
Total Indirect Costs 105,256.69

POC Phone Number)

Total Direct and Indirect Institutional Costs (G + H) 268,344.21

Total Costs and Fee (I + J) 268,344.21
Dr. Tonie Rocke 129,590.00 0.60 6,479.00 1,747.00 8,226.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.80 8,639.00 2,329.00 10,968.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.40 4,319.00 1,165.00 5,484.00
Dr. Rachel Abbott 61,006.00 6.00 30,502.00 7,986.00 38,488.00

B. Other Personnel

Graduate Students

Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

2. Publication Costs 6,000.00
8.
9.
10.

H. Indirect Costs

POC Phone Number)


Totals ($)
Section A, Senior/Key Person 305,748.00
74,346.00
9
380,094.00
Section D, Travel
35,303.50
1. Domestic
20,290.00
2. Foreign
15,013.50
2. Stipends
3. Travel
4. Subsistence
5. Other
115,958.99
60,098.99
6,000.00
8. Other 1
37,800.00
9. Other 2
12,060.00
10. Other 3
Section G, Direct Costs (A thru F) 531,356.49

Section H, Indirect Costs 342,937.05
Section I, Total Direct and Indirect Costs (G + H) 874,293.54
Section J, Fee
874,293.54
TRAVEL
Trip #: 1 Location: Arlington, VA, USA Contract Period
Purpose: DARPA Kickoff Meeting Base 1
Days # of People Airfare Meals & Incidental per diem Lodging per diem Other Total
1.75 1 $333.00 $69.00 $250.00 $120.00 $1,011.25
Description Amount
Parking $20.00
Transportation to/from airport and in Arlington $100.00
Total: $120.00
Trip #: 2 Location: Kunming, Yunnan, China Contract Period
Purpose: China Cave Site Visit Base 1
7 1 $1,370.00 $115.00 $147.00 $180.00 $3,384.00
Description Amount
Parking $80.00
Total: $180.00
Trip #: 3 Location: Upper Peninsula Michagan Contract Period

Purpose: US Cave Site Visit Base 1
4 3 $0.00 $51.00 $93.00 $588.00 $2,316.00
Description Amount
Gas $120.00
Government Car Use $468.00
Total: $588.00
Trip #: 4 Location: New York, NY, USA Contract Period
Purpose: Annual Meeting (Rocke + Abbott) Base 1
3 2 $666.00 $74.00 $291.00 $140.00 $4,362.00
Description Amount
Parking $40.00
Transportation to/from airport and in New York $100.00
Total: $140.00
Trip #: 5 Location: Upper Peninsula, Michigan, USA Contract Period

4 3 $0.00 $51.00 $93.00 $588.00 $2,316.00
Description Amount
Gas $120.00
Total: $588.00
Trip #: 6 Location: Wuhan, China Contract Period
Purpose: Annual Meeting (Rocke) Base 2
4.75 1 $6,861.00 $115.00 $147.00 $140.00 $8,245.50
Description Amount
Parking $40.00
Transportation to/from airport in Wuhan $100.00
Total: $140.00

Purpose: US Cave Site Visit Option I
4 3 $0.00 $51.00 $93.00 $588.00 $2,316.00
Description Amount
Gas $120.00
Total: $588.00
Purpose: Deployment Visit Option I
7 1 $1,370.00 $115.00 $147.00 $180.00 $3,384.00
Description Amount
Parking $80.00
Transportation to/from airport and in Kunming $100.00
Total: $180.00
Purpose: Annual Meeting (Rocke + Abbott) Option I
3 2 $666.00 $74.00 $291.00 $140.00 $3,802.00
Description Amount
Parking $40.00
Transportation to/from airport $100.00
Total: $140.00
Purpose: Annual Meeting (Rocke + Abbott) Option II
4 1 $666.00 $74.00 $291.00 $140.00 $2,266.00
3 1 $666.00 $74.00 $291.00 $140.00 $1,901.00
Description Amount
Parking $40.00
Total: $140.00
MATERIALS/EQUIPMENT
Item Manufacturer Part Number Unit Price Quantity Total Price Contract Period Additional Information
Harp Trap Bat conservation and management $2,003 2 $4,006.00 Y1
Mealworms Rainbow mealworms $100/20,000 12 $1,200.00 Y1-Y3
bat caging materials various $500/cage 9 $4,500.00 Y1-Y3 custom made
bat wing bands Porzana $596/box 9 $4,768.00 Y1-Y3
Cut resistant gloves Varied $15/pr 30 $450.00 Y1-Y3
Tyvek suits DuPOnt EV29135313 $306/case 15 $4,590.00 Y1-Y3
Tyvek aprons Lakeland 6EHH7 $58/case 15 $870.00 Y1-Y3
N95 respirators 3M 9511 $20/box 45 $900.00 Y1-Y3
PAPRs replacement covers 3M $96/3 units 45 $4,320.00 Y1-Y3
cell culture flasks Corning 430641U 415/case 5 $2,075.00 Y1-Y3
cell culture flasks Corning 431080 425/case 10 $4,250.00 Y1-Y3
Nunc cell factories Nunc 140250 $370/case 12 $4,440.00 Y1-Y3
fetal bovine serum GE Hyclone SH30071.03 $600/bottle 8 $4,800.00 Y1-Y3
DMEM medium GE Hyclone SH30021.02 $30/l 10 $300.00 Y1-Y3
Selamectin Zoetis $250 $250.00 Y1-Y3
glycerin jelly Carolina Biological Supply $43 bottle 50 $2,150.00 Y1-Y3
rhodamine B Sigma $56/100g 6 $336.00 Y1-Y3
hair collection bags U-line $75/box 10 $750.00 Y1-Y3
96 well plates Corning 3599 $600/case 8 $4,800.00 Y1-Y3.5
pipette tips Fisher 13-676-10 $100/case 50 $5,000.00 Y1-Y3.5
Consumables miscellaneous $5,344.00 Y1-Y3.5 needles, syringes,whirl paks, plastic bags, other disposables, all <5K
Total $60,099.00
Y1 Total $21,982.52
Y2 Total $17,976.52
Y3 Total $17,976.52
Y3.5 Total $2,163.43
OTHER DIRECT COSTS
Description Total Price Contract Period Additional Information
up to 60 bats for 120 days at $105/day in BSL3 animal facility, includes
daily husbandry, gut-loading meal worms, cleaning cages, feeding bats,
animal perdiem costs $12,600 Base 1 veterinary services and daily surcharge for rom use,
up to 60 bats for 120 days at $105/day in BSL3 animal facility (ame as
Base 2
animal perdiem costs $12,600 above)
up to 60 bats for 120 days at $105/day in BSL3 animal facility (same as
Option 1
animal perdiem costs $12,600 above)
all animal care and technical staff must be vaccinated against rabies to work
rabies prphylactic shots $4,020 Base 1
with bats. 1005/person
rabies prphylactic shots $4,020 Option 1
Total $49,860
Re: [Reminder] Call today @ 6 PM (ET)

Wed 3/21/2018 4:47 PM
Yes, I updated this in the budget as well. We are planning 12/1/18.
Hi Anna: Just out of curiosity, what is the projected start date for the
project? I was using 10/1/18. -T
On Wed, Mar 21, 2018 at 4:25 PM, Anna Willoughby <[email protected]> wrote:
Hi Tonie,
In advance of our call, please find updated budget files (pdf form and excel breakdown).
Overall numbers haven't changed much, an increase of ~$10,000. New changes are 1)
Updated your time slightly to match travel, 2) Updated travel break down to include per diems
per person and formulas, and 3) added materials by year formulas. I am also attaching a
performance schedule that shows when (approximately) you would be traveling and hosting
partners (to justify your time). I will be on the call to clarify all these items and answer any
questions you may have.
Best,
Anna
Hi Tonie,
This is just a reminder that we have a PREEMPT call scheduled today at 6 PM (ET)/5 PM
(CT).
Phone: 1-719-785-9461
Password: 9784#
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
(b) (6) (mobile)

--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
Re: letter for Jonathan to sign

Wed 3/21/2018 10:15 PM
Cc: Abbott, Rachel (Contractor) C <[email protected]>; Richgels, Katherine L <[email protected]>
Thank you, Tonie. I hope you enjoy your trip!
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
OK thanks, since I will be out of the office until Monday, if you need
something before then, either contact Rachel or Katie (both copied
here). -Tonie
Wonderful. Thank you, Tonie. Regarding the 'pricing agreement', we have reached out to
DARPA staff for further clarification and will contact you once we've received a response.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
(b) (6) b) (6)
(mobile)
Here's the letter you need. -Tonie
From: Schroeder, Rebecca <[email protected]>
Subject: Re: letter for Jonathan to sign
Here you go.
Becky Schroeder
Executive Assistant to the Director's Office
6006 Schroeder Rd.
Madison, WI 53711
Phone: (608) 270-2402
[email protected]
Email: R
Hi Rebecca: Can you put this draft letter on our letterhead, add
Jonathan's credentials as he likes to use, and get his signature? If
you send the signed letter back to me, I'll pass it on. Thanks much!
-Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Subject: Re: Task 7 Text, PARC inclusion
Thanks Jerome. I'll take a look. Still haven't seen Peter's updates yet so I imagine this will change at least
slightly. Best -Tonie
Tonie,
In reference to my previous email, I’ve made the changes highlighted in cyan/light blue to include PARC. Let me know if
this is sufficient. If you feel like we need further data/figures regarding the aerosol technology, for example, we could
also include something like Fig. 1 from our white paper. But I don’t think it’s necessary – let me know your thoughts on
this.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
1
Subject: Task 7 Text, PARC inclusion
Attachments: PREEMPT TR task 7 first draft_JU.docx; PARC_whitepaper_Biotech_v3_final.pdf
Tonie,
this.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

1
priming molecules

without immunomodulatory substances). In collaboration with Dr. Jerome Unidad of Palo
Alto Research Center, we will explore the use of innovative aerosol technology that could
be used in cave settings in the form of a field-deployable spray device triggered by timers
and movement detectors at critical cave entry points. The PARC technology called
Filament Extension Atomization (FEA) can spray fluids with a wide-range of viscosities
ranging from 1mPa-s to 100Pa-s using a roll-to-roll misting process (further details in the
PARC website). This will make it compatible with all the fluid formulations mentioned
earlier including the immunomodulating formulations from TA2, gels and creams for
topical delivery and Poxvirus formulations, making it a universal platform for inoculating
the bats. Within one week of application, bats will be trapped at the cave entrace using
mist nets or Harp traps and hair will be collected to assess the rate of uptake via
biomarker analysis. The bats will be released immediately afterward. The procedures
will be tested at several different locations as it will likely take some manipulation to
determine appropriate dosages for maximum uptake. After we have determined the most
optimal approaches for mass delivery, we will then test them on wild bats in our three
cave sites in Yunnan Province. Again, biomarker will be used to assess rates of uptake
and this data can then be used in modeling studies to help determine the optimal rates of
application of immunomodulating agents. Biomarker studies can also be used to assess
uptake by non-target species, an important consideration in evaluating safety. Fieldwork
will be conducted in collaboration with Dr. Yunzhi Zhang (Yunnan CDC, Consultant at

Infection



PARC Website: Advanced Manufacturing and Deposition Systems Group –


1253-x.

Re: Task 7 Text, PARC inclusion

Wed 3/21/2018 10:19 PM
Cc: Daszak Peter <[email protected]>; Anna Willoughby <[email protected]>
Thank you for sending this, Tonie.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Subject: RE: Task 7 Text, PARC inclusion
Here’s the version with an added figure. This should be ok, I’ll withhold further edits until we get the full
technical volume.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD



Hi Jerome: That looks good to me. If you have a photograph or figure you want to include we
could do that; it might entice them to look at the video link. Best -Tonie

Tonie,
In reference to my previous email, I’ve made the changes highlighted in cyan/light blue to
include PARC. Let me know if this is sufficient. If you feel like we need further data/figures
regarding the aerosol technology, for example, we could also include something like Fig. 1 from
our white paper. But I don’t think it’s necessary – let me know your thoughts on this.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
To: Daszak Peter; Luke Hamel; Anna Willoughby
Subject: Fwd: Task 7 Text, PARC inclusion
Attachments: PREEMPT TR task 7 first draft_JU_with_figure.docx

Here’s the version with an added figure. This should be ok, I’ll withhold further edits until we get the full technical
volume.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Hi Jerome: That looks good to me. If you have a photograph or figure you want to include we could do that; it might
entice them to look at the video link. Best -Tonie
1
Tonie,
this.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
2
Madison, WI 53711
608-270-2451
[email protected]
3
priming molecules

for bats.
a. b. c. d.
fluorescence).

Infection

RCN-MoG ON
RCN-MoG Topical
RCN-G ON
RCN-luc
captured (w/o inc)
All bats 64 34 25 5 58
Recaptured
19 18 0 1 100
marked bats
the biomarker, RB.
PARC will develop the FEA aerosol technology wide-scale inoculation of bats in PRE-
EMPT. Fig.4 shows the basic principle of the technology and the resulting spray from
representative fluids (aqueous polymer solutions, consumer formulations). FEA
technology can be used for the full range of fluids of interest to the program including
gels and creams for topical application and aqueous/non-aqueous vaccine formulations.
Further details can be found in the PARC website (see references).
Figure 4. FEA technology: A. Beads-on-a-string formation in viscoelastic fluids in
extension (Oliveira and McKinley, 2005), B. Roll-to-roll parallelization of filament
formation and break-up in FEA, C.-E. Examples of fluids sprayed with FEA including
polyethylene oxide in water-glycerol (C.), hyaluronic acid in water (D.) and sunscreen
(E.)

Participating organizations: Palo Alto Research Center (PARC)
Deliverable(s):



Oliveira MSN, McKinley GH. 2005. Iterated stretching and multiple beads-on-a-string
phenomena in dilute solutions of highly extensible flexible polymers. Physics of
Fluids 17: 071704.


1253-x.

Sent: Wednesday, March 21, 2018 11:08 AM
OK looks good to me. -Tonie
On Wed, Mar 21, 2018 at 1:00 PM, <[email protected]> wrote:
volume.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Hi Jerome: That looks good to me. If you have a photograph or figure you want to include we could do that; it might
entice them to look at the video link. Best -Tonie
Tonie,
In reference to my previous email, I’ve made the changes highlighted in cyan/light blue to include PARC. Let me know
if this is sufficient. If you feel like we need further data/figures regarding the aerosol technology, for example, we
could also include something like Fig. 1 from our white paper. But I don’t think it’s necessary – let me know your
1
thoughts on this.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
2
Sent: Wednesday, March 21, 2018 11:01 AM
Attachments: PREEMPT TR task 7 first draft_JU_with_figure.docx
volume.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Hi Jerome: That looks good to me. If you have a photograph or figure you want to include we could do that; it
might entice them to look at the video link. Best -Tonie
Tonie,
In reference to my previous email, I’ve made the changes highlighted in cyan/light blue to include PARC. Let
me know if this is sufficient. If you feel like we need further data/figures regarding the aerosol technology, for
example, we could also include something like Fig. 1 from our white paper. But I don’t think it’s necessary –
let me know your thoughts on this.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD
1
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
2
priming molecules

for bats.
a. b. c. d.
fluorescence).

Infection

RCN-MoG ON
RCN-MoG Topical
RCN-G ON
RCN-luc
captured (w/o inc)
All bats 64 34 25 5 58
Recaptured
19 18 0 1 100
marked bats
the biomarker, RB.
technology can be used for the full range of fluids of interest to the program including
gels and creams for topical application and aqueous/non-aqueous vaccine formulations.
Further details can be found in the PARC website (see references).
polyethylene oxide in water-glycerol (C.), hyaluronic acid in water (D.) and sunscreen
(E.)

Deliverable(s):



phenomena in dilute solutions of highly extensible flexible polymers. Physics of
Fluids 17: 071704.


1253-x.

DARPA DEFUSE draft v2 - Technical Comment

Thu 3/22/2018 12:53 AM
<[email protected]>; [email protected] <[email protected]>; Luke Hamel
<[email protected]>; Noam Ross <[email protected]>; Kevin Olival, PhD
<[email protected]>; Jon Epstein <[email protected]>; William B. Karesh
<[email protected]>; Hongying Li <[email protected]>; Anna Willoughby
<[email protected]>
Dear all,
Apologies for the delay - here's the draft Technical Plan for our proposal with everyone's section incorporated,
edited and shortened.
Please ignore all other sections – these are being worked on by others. We’re only editing the Technical Plan right
now.
Can each of you go through your respective section and, with one of you acting as the point person to coordinate
edits and responses from your teams:
1. Answer any questions in comment boxes
2. Insert any missing references – please just cut and paste the ref as a word doc into a comment box rather
than inserting the endnote reference at this point
3. Read through your sections and suggest edits. Best if you use lots of comment boxes, but also OK if you
start editing using ‘track changes’. NB – we need to reduce the length probably by one third, so any
suggestions and cuts would be most appreciated! Also, please just keep this as a Word doc for now –
there are formatting issues when converting backwards and forwards into Google docs and Word.
4. Ralph and team – please provide higher res images for all those in this draft, and please make sure
they’re editable – i.e. we can take out the text and alter each icon within each image
5. All – please check the language I’ve used and correct any glaring errors.
6. Can you get edits back to me, cc’d to Luke and Anna by Saturday 9am Eastern (New York) time, at which
point I’ll start trimming it back into the page limit and incorporating all the other sections.
While you’re working on these sections, I’ll be editing the rest of the proposal with Luke, Anna and others.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
From: Peter Daszak
Rocke, Tonie
Status
Importance: High
Dear All,
calls this week.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
To: (b) (6)
Cc: (b) (6) )
(b) (6)
Regards,
BAA Coordinator
[email protected]
1
A. EXECUTIVE SUMMARY
Technical Approach: Our goal is to defuse the potential for spillover of novel bat-origin high-
zoonotic risk SARS-related coronaviruses in Southeast Asia. In TA1 we will develop host-
pathogen ecological niche models to predict the species composition of bat caves across
Southeast Asia. We will parameterize this with a full inventory of host and virus distribution at
our field sites, three caves in Yunnan Province, China and a series of unique datasets on bat
host-viral relationships. By the end of Y1, we will use these to create a prototype app for the
warfighter that identifies the likelihood of bats harboring dangerous viral pathogens at any site
across Asia. We will intensively sample bats at our field sites to sequence SARSr-CoV spike
proteins, reverse engineer them to conduct binding assays, and insert them into SARS-CoV
backbones to infect humanized mice to assess capacity to cause SARS-like disease. Our
modeling team will use these data to build machine-learning genotype-phenotype models of
viral evolution and spillover risk. We will uniquely validate these with human serology data
through LIPS assays designed to assess which spike proteins allow spillover into people.
In TA2, we will evaluate two approaches to reduce SARSr-CoV shedding in cave bats: (1)
Broadscale Immune Boosting, in which we will inoculate bats with immune modulators to
upregulate their innate immune response and downregulate viral replication; (2) Targeted
Immune Priming, in which we will inoculate bats with novel chimeric polyvalent recombinant
spike proteins to enhance innate immunity against specific, high-risk viruses. We will trial
inoculum delivery methods on captive bats including automated aerosolization, transdermal
nanoparticle application and edible, adhesive gels. We will use stochastic simulation modeling
informed by field and experimental data to characterize viral dynamics in our cave sites, to
maximize timing, inoculation protocol, delivery method and efficacy of viral suppression. The
most effective delivery method and treatments will be trialed in our experimental cave sites in
Yunnan Province, with reduction in viral shedding as proof-of-concept.
Management Approach: Members of our collaborative group have worked together on bats
and their viruses for over 15 years. The lead organization, EcoHealth Alliance, will oversee all
modeling, lab, and fieldwork. EHA staff will develop models to evaluate the probability of
specific SARS-related CoV spillover, and identify the most effective strategy for delivery of both
immune boosting and immune targeting inocula. Specific work will be subcontracted to the
following organizations:
• Prof. Ralph Baric, UNC, will lead the immune priming work, building on his track record in
reverse-engineering and manipulating SARS-CoV, MERS-CoV and other virus spike proteins
over the last two decades.
• Prof. Linfa Wang, Duke-NUS, will lead work on immune boosting, building from his groups’
pioneering work on bat immunity.
2
• Dr. Zhengli Shi, Wuhan Institute of Virology will conduct viral testing on all collected
samples, binding assays and some humanized mouse work.
• Dr. Tonie Rocke, USGS National Wildlife Health Center will develop a delivery method for
immunological countermeasures, following from her work on vaccine delivery in wildlife,
including bats.
• XXX, PARC – Leading development of novel delivery mechanism
B. EXECUTIVE SUMMARY SLIDE
;lkj;lkj;lkj;lkj;lkj
;klj;lkj;lk
;lj;lkj;lkj
;lkj;lkj
;lkj;lkj
C. GOALS AND IMPACT

Overview
The overarching goals of DEFUSE are:
• Identify and model the spillover risk of novel SARS-related CoVs in South and SE Asia
• Design and demonstrate proof-of-concept that interventions to upregulate the naturally
low innate immunity of bats to viruses (immune boosting) and to high risk SARSr-CoVs
in particular (immune priming) will transiently reduce spillover risk.
We will analyze, design and field-test a novel strategy to reduce risk of viral emergence from
bats that will help protect the warfighter within SACOM and SEACOM, and will be scalable to Commented [PD1]: Check on correct DoD names for
these regions
other systems including Ebola virus, rabies and other bat-origin pathogens.
Innovation and uniqueness:

Bats harbor more emerging zoonoses than any other group of mammals, and are ubiquitous,
3
abundant, wide-ranging and often overlooked. Despite this, other than PPE, there is no
available current technology to reduce the risk of exposure to novel coronaviruses from bats.
Models of bats’ capacity to harbor viruses, of ecological and environmental drivers of their
emergence, and of the evolutionary potential of different strains to spillover are rudimentary.
No vaccines or therapeutics exist for SARSr-CoVs, and exposure mitigation strategies are non-
existent. SARSr-CoVs are enzootic in Asian, African1, and European bats2 that roost in caves but Commented [PD2]: There’s a new ref that I tweeted
about recently - http://coronavirus.fr/publications/
forage widely at night, shedding virus in their feces and urine. The limitations of this lack of
capacity are significant – we have recently shown evidence of spillover of SARSr-CoVs into
people in China, unrelated to the original SARS pandemic, and have isolated strains capable of
producing SARS-like disease in humanized mice that don’t respond to antibody treatment or
security because of their continuous circulation and evolution in bats and periodic spillover into
humans in locations where surveillance is virtually nonexistent.
EcoHealth Alliance leads the world in predictive models of viral emergence. We will
build on our machine-learning models of spillover hotspots, host-pathogen ecological niche and
genotype-phenotype mapping by incorporating unique datasets to validate and refine hotspot
risk maps of viral emergence in SE Asia and beyond. We have shown that bats are able to carry
otherwise lethal viruses by virtue of dampened innate immunity (e.g. inflammatory) pathways,
which likely evolved as an adaptation to the physiologic stress of flight. We will use this insight
to design strategies, like small molecule Rig-like receptor (RLR) or Toll-like receptor (TLR)
agonists, to upregulate bat immunity and down-regulate viral replication in their cave roosts,
thereby significantly reducing the frequency and magnitude of viral shedding and spillover
(broadscale immune boosting strategy). We will complement this by treating bats with novel
chimeric polyvalent recombinant spike proteins to enhance their adaptive immune response
against specific, high-risk coronaviruses (targeted immune priming strategy), especially when
their innate immune response is boosted as above. We will design novel automated application
methods, based on our previous work delivering wildlife vaccines, to apply these interventions
in a way that eliminates the need for a person to enter a cave and potentially get exposed to
bat borne viruses or other hazards.
Technical Area 1
Our strategy to reduce spillover risk of bat SARS-related CoVs begins with modeling to
predictively assess spillover risk across South and SE Asia using baseline genotype-phenotype
analysis of host and strain diversity from the literature, from surveillance in our designated
model caves in China, and across the region in other projects. In TA1, the DEFUSE modeling and
analytics team, will build joint species distribution models (JSDM) of environmental and
ecological correlates and traits of cave bat communities to predict species composition of bat
caves across Southern China, South and SE Asia. Dr. Epstein at EHA will coordinate animal
4
experimental work with the teams at NWHC, Duke-NUS and Wuhan and radio telemetry studies
with the field surveillance team. We will then use a series of datasets we have built to produce
host-virus risk models for the region. These include our comprehensive database of bat host-
viral relationships and estimates of zoonotic viral richness per bat species3; biological inventory
will parameterize the model with data from three cave sites in Yunnan, China (one with high-
risk SARSr-CoVs, two other control/comparison sites), including: radio- and GPS-telemetry to Commented [3]: Are we saying only one cave site
has SARSr-CoVs, or does one site have a higher
identify home range and additional roost sites for each bat species; inventory of bat population prevalence of these compared to controls? Should
density, distribution and segregation and their daily, weekly and seasonal changes; viral validate this with our prelim data if possible. Are 3 sites
sufficient?
metapopulation structure and inter-cave connectivity. We will test and validate model
identifies the likelihood of bats harboring dangerous viral pathogens in a region. The ‘Spatial
viral spillover risk’ app will be updated real-time with surveillance data (e.g. field-deployable
iPhone and android compatible echolocation data) from our project and others, to ground-
truth and fine-tune its predictive capacity.
The Wuhan Institute of Virology team will test bat fecal, oral, and blood samples for SARSr- Commented [4]: no need for urogenital samples and
these bats are too small to collect those anyway. Fecal
CoVs. We will collect viral load data using fresh fecal pellets from individually sampled bats and and oral are key. Blood is also important for serolgy
from tarps laid on cave floors deployed where necessary to reduce roost disturbance. SARSr- Commented [5]: Edited this slightly, but we could just
CoV spike proteins will be sequenced, analyzed phylogenetically for recombination events, and go with individually sampled bats, should be easy
enough to say we'll sample ~200 individually trapped
high-risk viruses (spike proteins close to SARS-CoV) characterized and isolated. The UNC team bats on a monthly basis at cave entrances using harp
trap, if we want to do away with tarp sampling.
will reverse-engineer spike proteins to conduct binding assay to human ACE2 (the SARS-CoV Alternatively we could leave both and justify the use of
receptor). They will culture SARS-like bat coronaviruses to distinguish high-risk strains that can tarps and that we'll use high-resolution photos of bats
roosting in caves to estimate population size from
replicate in primary human cells and low risk strains that require exogenous enhancers. Viral populations sampled non-invasively using tarp
collection.
spike glycoproteins that bind receptors will be inserted into SARS-CoV backbones, inoculated
into human cells and humanized mice to assess capacity to cause SARS-like disease, and to be
blocked by monoclonal therapies, the nucleoside analogue inhibitor GS-57344 or vaccines
against SARS-CoV4-8.
infect human host cells based on genetic traits and results of receptor binding and mouse
infection assays. Using data on diversity of spike proteins, recombinant CoVs, and flow of genes
within each bat cave via bat movement and migration, we will estimate evolutionary rates,
rates of recombination, and capacity to generate novel strains capable of human infection.
Finally, virus-host relationship and bat home range data will be used to estimate spillover
potential - extending models well beyond our field sites. We will then validate model
5
predictions of viral spillover risk by 1) conducting spike protein-based binding and cell culture
experiments, and 2) identifying spillover strains in people near our bat cave sites. Our
preliminary work on this shows ~3% seroprevalence to SARSr-CoVs, using a specific ELISA [REF].
We will design LIPS assays to the specific high- and low- zoonotic-risk SARSr-CoVs identified in
this project as we have done previously [REF]. We will use previously collected and newly
collected human sera from these populations to test for presence of antibodies to the high- and
low-risk SARSr-CoVs identified by our modeling. We will then model optimal strategies to
maximize treatment efficacy for TA2, using stochastic simulation modeling informed by field
and experimental data to characterize viral circulation dynamics in bats. We will estimate
frequency and population coverage required for our intervention approaches to suppress viral
spillover. We will determine the seasons, locations within a cave, and delivery methods (spray,
swab, or automated cave mouth or drone) that will be most effective. Finally we will determine
the time period treatment will be effective for, until re-colonization or evolution leads to return
of a high-risk SARSr-CoV.
Technical Area 2
In TA2, we will develop scalable approaches that target and suppress the animal virus in its
lead the immune boosting work, building on his pioneering work on bat immunity9 which shows
that the long-term coexistence of bats and their viruses has led to equilibrium between viral
replication and host immunity. This is likely due to down-regulation of their innate immune
system as a fitness cost of flight9. The weakened functionality of bat innate immunity factors
effective, but not over-response to viruses10. A similar finding was observed for bat IFNA, which
is less abundant but constitutively expressed without stimulation11. Given high native SARSr-
CoV load in bats, we aim to boost bat innate immunity through the IFN pathway, break the
host-virus equilibrium to suppress bat SARSr-CoV replication and shedding.
small molecules reduces viral loads in humans, ferrets and mouse models12,13. Interferon has
6
been used clinically when antiviral drugs are unavailable, e.g. against filoviruses14. Replication
of SARSr-CoV is sensitive to interferon treatments, as shown in our previous work13 ; ii) Commented [AW6]: Is this our work? ref may be
wrong
Boosting bat IFN by blocking bat-specific IFN negative regulators. Uniquely, bat IFNA is naturally
constitutively expressed but cannot be induced to a high level11, indicating a negative
regulatory factor in the bat interferon production pathway. We will use CRISPRi to identify the
negative regulator and then screen for compounds targeting this gene; iii) Activating dampened
bat-specific IFN production pathways which include DNA-STING-dependent and ssRNA-TLR7-
dependent pathways. Our work showing that mutant bat STING restores antiviral functionality
suggests these pathways are important in bat-viral coexistence10. By identifying small molecules
to directly activate downstream of STING, we will activate bat interferon and promote viral
clearance. A similar strategy will be applied to ssRNA-TLR7-dependent pathways; iv) Activating
functional bat IFN production pathways, e.g. polyIC to TLR3-IFN pathway or 5’ppp-dsRNA to
RIG-I-IFN pathway. A similar strategy has been demonstrated in a mouse model for SARS-CoV,
IAV and HBV12,15; v) Inoculating crude coronavirus fragments to upregulate innate immune
responses to specific CoVs – a partial step towards the targeted immune priming work below.
chimeric spike-proteins16from our known SARSr-CoVs, and those we characterize during project
DEFUSE. The structure of the SARS-CoV spike glycoprotein has been solved and the addition of
two proline residues at positions V1060P and L1061P stabilize the prefusion state of the trimer,
including key neutralizing epitopes in the receptor binding domain17. In parallel, the spike
trimers or the receptor binding domain can be incorporated into alphavirus vectored or
vehicles6,18-21. We will test these in controlled lab conditions, taking the best candidate forward
for testing in the field. We have built recombinant spike glycoproteins harboring structurally
defined domains from SARS epidemic strains, pre-epidemic strains like SCH014 and zoonotic
strains like HKU3. It is anticipated that recombinant S glycoprotein based vaccines harboring
immunogenic blocks across the group 2B coronaviruses will induce broad scale immune
responses that simultaneously reduce genetically heterogeneous virus burdens in bats,
potentially reducing disease risk (and transmission risk to people) in these animals for longer
periods22,23.
7
be developed and implemented by Dr. Tonie Rocke at the USGS, National Wildlife Health Center
who has previously developed animal vaccines through to licensure24. Using locally acquired
insectivorous bats25,26, we will assess delivery vehicles and methods including: 1) transdermally
applied nanoparticles; 2) series of sticky edible gels that bats will groom from themselves and
each other; 3) aerosolization via sprayers that could be used in cave settings; 4) automated
sprays triggered by timers and movement detectors at critical cave entry points, and 5) sprays
against rabies in the lab25, and hand delivered these containing biomarkers to vampire bats in
Peru and Mexico to show they are readily consumed and transferred among bats. In our bat
Shi and Zhang. In year 1 of project DEFUSE, we will seek permission for experimental trials from
the Provincial Forestry Department. We expect to be successful, as we have worked with the
Forestry Department collaboratively for 10 years, with support of the Yunnan CDC, and we are
releasing molecules that are not dangerous to people or wildlife. EHA has a proven track record
of rapidly obtaining IACUC and DoD ACURO approval for bat research.
Deliverables:
• App identifying geographical risk of spillover for novel SARSr-CoVs in SE Asia
• Identified indicators (modeled and validated) of spillover capacity for different viral
strains.
• Proven mechanistic approach to modulating bat innate immunity to reduce viral
shedding
• Tested and validated delivery mechanism for bat cave usage including vaccines in other
bat host-pathogen systems (e.g. rabies, WNS).
• Proof-of-concept approach to transiently reducing viral shedding in wild bats that can be
adapted for other systems including Ebola virus.
D. TECHNICAL PLAN
Commented [PD7]: It originally said ‘Phase 1’ – is this
Technical Area I: correct?
8
Choice of site and model host-virus system. For the past 14 years, our team has conducted
coronavirus surveillance in bat populations across Southern China, resulting in <150 CoV
identifications in ~10,000 samples27-29. Bat SARSr-CoVs are genetically diverse, especially in the
S gene, and most are highly divergent from SARS-CoV. However, in a cave site complex in
Yunnan Province, we have found bat SARSr-
CoVs with S genes extremely similar to SARS-
CoV, and which, as a quasispecies population
assemblage contain all the genetic Commented [PD8]: DARPA were v. interested in the
phrase ‘quasispecies’ and ‘machine learning’, so we’re
components of epidemic SARS-CoV30. trying to insert them appropriately – please correct if
wrong!
Fig. 1: Alignment of amino acid sequence of

the receptor-binding motif in the spike
protein of SARSr-CoVs and SARS-CoV30. Numbered amino acid is the key residues which is
responsible for SARS-CoV S and human ACE2 interaction31.
We have isolated three strains at this site (WIV1, WIV16 and SHC014) that unlike other SARSr-
CoVs, do not contain two deletions in the receptor-binding domain (RBD) of the spike, and
share substantially higher sequence identity to
SARS-CoV (Fig. 1). These viruses have been
demonstrated to use human ACE-2 receptor for
cell entry as SARS-CoV does (Fig. 2), and
replicate efficiently in various animal and human
cells27,29,30,32,33 including primary human lung
airway cells, similar to epidemic SARS-CoV7,8.
Fig. 2: Bat SARSr-CoV WIV1 replicates efficiently
in HeLa cells expressing human, civet and bat
ACE229.
Chimeras (recombinants) with these SARSr-CoV S genes inserted into a SARS-CoV backbone, as
well as synthetically reconstructed full length SHCO14 and WIV-1 bat viruses cause SARS-like
illness in humanized mice (a model that expresses human ACE2 receptor), with clinical signs
that are not reduced by SARS-CoV monoclonal antibody therapy or vaccination7,8. We have now
shown that people living up to 6 kilometers from this cave have SARSr-CoV antibodies (3%
seroprevalence in 200+ cohort)34, suggesting
active spillover. These data, phylogeographic
analysis of SARSr-CoVs (Fig. 3), and Commented [PD9]: This is the phylogeographic map
w/ blue network overlaid on SW China. Please correct
coevoutionary analysis of bats and their CoVs figure to remove fig description.
(unpubl. data), suggest that bat caves in SW
China, and Rhinolophus spp. bats are the likely
origin of the SARS-CoV clade, and therefore a
9
clear-and-present danger for the re-emergence of SARS-CoV or a similar pathogenic virus. The
Rhinolophus spp. bats that harbor these viruses occur throughout SE Asia, across S. and W. Asia.
Thus, the geographic focus of DEFUSE is to use our research at this site to reduce the risk for
the warfighter of these viruses spilling over across the region (West, South and SE Asia).
Spatial models of bat origin high-risk viruses across S and SE Asia. We will build models that Commented [PD10]: We’ve not used ‘machine
learning’ in the text now. Noam - please insert
predict regional-scale bat and viral diversity in cave sites across South and SE Asia to enable appropriately, or not….
warfighters and planners to estimate regional-scale risk from viral spillover based on locations.
This will provide preliminary assessments for areas requiring greater on-the ground risk
characterization to target deployment of viral suppression technologies. These regional-scale
joint species distribution models (JSDM) will predict the composition of bat communities in
caves in South Southern China, South and SE Asia. JSDMs use environmental and habitat data to
predict the distributions of many species simultaneously, producing more accurate predictions
than individual, separate species predictions by explicitly modeling positive and negative
interactions between species and hidden factors such as shared habitat preferences. We will
use a stochastic feedforward neural network to implement JSDMs that has proven effective at
making predictions across multiple scales, with incomplete observations (as occurs for bats and
their viruses), and explicitly accounting for bat species co-occurrence driven by shared
environmental responses or evolutionary processes35. We will fit our JSDM to biological
inventory data on over 200 caves in the region36, using a combination of climatic and
topographic variables including physiologically relevant bioclimatic variables (BIOCLIM) drawn
from public, open source data sets37, as well as proxies for subterranean habitat such as
ruggedness and habitat heterogeneity. We will refine these models using regional-scale
environmental variables (land-use, distance to roads, forest cover, degree of human
disturbance etc.) and cave-specific variables (cave length, availability of roosting area, entrance
dimensions, cave complexity, microclimate etc.). Our previous work has shown that these
factors are predictors of bat species presence/absence at a given site38. Remote-sensing data
and physical models will be used to estimate cave structures and microclimates where they are
not available from biological inventory studies. We will validate our regional-scale species
models using independent occurrence estimates and observations39,40, including our extensive
database on bat species occurrence in Southeast Asia [REF].
We will extend our predictions of bat communities to predictions of zoonotic disease
risk using our unique species-level database of all known bat host-viral relationships3 (Fig. 4);
our >1800 viral detections from >20,000 individual bat samples in China and 7 other Asian
countries (NIAID and USAID PREDICT); and results as they become available from a new 5-year
DTRA-CBEP grant for field and lab investigations to characterize bat CoV diversity in Western
Asia (Turkey, Jordan, Georgia, Pakistan, and Arabian Peninsula – EHA, Olival) to extend the
geographic scope of our predictive models. We will use two strategies to predict presence of
10
viruses at sites. Firstly, as a base case, we will assume that species have equal probability of
carrying their known viral species across their range. Second, we will include viral species as
additional outputs in our JSDM. We will fit this host-viral JSDM using data restricted to a smaller
set of sites where both host species composition and viral detections are available. Based on
performance of both models on hold-out data, we will determine which provides the best
predictive power. For species composition and viral presence predictions, we will validate our
models against a 20% validation subset of data that is held out for model validation, as well as
data collected at our field sites in Task 3.
Fig. 4: Predictive global map of total (known and unknown) Commented [PD11]: This map doesn’t help our case –
superficial glance suggests we should be working in L.
viral diversity in bats (Chiroptera species). Based on EHA’s Am. I know this is incorrect, but I think we’d be better
unique database of all known mammal virus-host served putting in a map that highlights SW China as a
hotspot… Could you just recreate this map only for Asia?.
relationships3. Can we also show a hotspot map of host distribution as
well.
Prototype app for the warfighter. Drawing on experience

building applications for data collection and analysis (e.g. https://flirt.eha.io/, https://eidr-
connect.eha.io/, https://mantle.io/grrs), we will produce a prototype app for the warfighter
that identifies the likelihood of dangerous viral pathogens spilling over from bats at a site. The
‘Viral spillover risk’ app will use outputs from our spatial risk modeling, data from EHA’s
extensive host-pathogen database, open-source species and pathogen ontologies, and app-
directed crowd-sourced ultrasonic audio recordings to ground-truth and fine-tune its predictive
capacity. This app will be updated in Y2 and Y3 to incorporate additional information on bat
species-specific risk based on assays of host-virus binding and surveys of CoV prevalence. We
will use risk-ranking algorithms developed by EHA (https://ibis.eha.io/) that use geolocation
features, recency of information, and host and pathogen characteristics to display critical areas
of high risk. The app will collect user GPS location data and preload bat species distribution and
community composition estimates from our JSDMs. These will be refined with real-time
surveillance data collected without the need to enter cave sites using field-deployable high-
frequency microphones for bat detection41. We will combine reference acoustic calls from all
bat species captured during proposed field work with existing data from bat call libraries
globally to train species identification algorithms using bat echolocation call signatures. New
algorithms using deep learning methods (e.g. convolutional neural networks42) will be
developed, or adapted and externally validated on samples collected by the application to
characterize bat species based on trained audio features. These models will be deployed on the
mobile platform as they become available42. Bat species directly identified or estimated to
occur within a scalable distance from the user will be automatically linked with viral diversity
data from EHA’s extensive host-pathogen database and with CoV sequence data from this
project to deliver high-risk pathogen lists. The application will have 3 primary views; pathogens-
centric, bat-centric and map-centric. The pathogen-centric view will show a ranked list of likely
11
pathogens in the user’s current or selected location. The bat-centric view will show a ranked list
of bat species for the user’s location. The map-centric view will allow users to select a location
for the other rank views, and will display a variety of map layers of interest, including heat map
or distribution map layers profiling modeled or collected species occurrences around the user.
Elements of the interface will be interactive, presenting popovers with more details when
selected and displaying other map elements as appropriate. Alerts and notifications will give
users a flexible way to monitor the app data passively, with the app proactively reaching out
when critical information is received. The application will also offer a data collection module
and accompanying interface elements to collect samples in the field and integrate collected
data into the application database. The schemas, APIs, and protocols developed as part of this
effort will be designed with principles of simplicity, interoperability, and usability in mind,
including using RESTful URL schemes, and standardized data types and ontologies. Datasets will
be hosted via cloud services from which the app will download updated information. Build and
deployment processes will be reproducible, auditable, and transparent. All code modules will
be continually available on EHA’s GitHub page (LINK), be documented via README files in root
directory of code repositories, and .zip archives containing code, datasets, and instructions for
deployment will be made available. This will pave the way future incorporation of new
structured biosurveillance data feeds and new species, viral, or host ontologies. This app will be
designed for remote use (desktop platform) to assess specific sites in advance of personnel
deployment on the ground, or in the field via mobile systems. This technology will improve
overall situational awareness of existing and novel infectious agents found in bats, allowing
DoD personnel to quickly identify areas that may pose the most significant risk for zoonotic
spillover and rapidly deploy resources to respond to and mitigate their impact preemptively
when necessary. The ‘viral spillover risk’ app will then be available to adapt for viral threats
from other wildlife host species (e.g. rodents, primates) and ultimately for global use.
Full inventory of bat SARSr-CoV quasispecies at our cave test sites, Yunnan, China.
DEFUSE fieldwork will focus on three model cave test sites within a cave complex in Yunnan
Province, SW China (MAP), where we have previously identified and isolated high-risk SARSr-
CoVs able to infect human cells and cause SARS-like illness in mice7,27,29,30. At these sites, we will
determine the baseline risk of SARSr-CoV spillover, prior to, during, and after our proof-of-
concept field trials to reduce that risk. We will conduct longitudinal surveillance of bat
populations to detect and isolate SARSr-CoVs, determine changes in viral prevalence over time,
measure bat population demographics and movement patterns, to definitively characterize
their SARSr-CoV host-viral dynamics. We will sample Rhinolophus, Hipposideros, and Myotis
species, all of which carry SARSr-CoVs, and co-roost in the same caves3,36. Surveillance will be
conducted before, during, and after deployment of our intervention field trial (Task X) to
establish baseline viral shedding detection rates and measure the impact of treatment on
12
these. Field data will allow us to test the accuracy of our model predictions and compare the
efficacy of laboratory trials in animal models with in-the-field trials.
Our test caves near Kunming, Yunnan Province, contain multiple co-roosting
Rhinolophus, Hipposideros, and Myotis spp., although our preliminary data demonstrate that R. Commented [12]: If desired, I can provide a figure
showing prevalence rates across the relevant sites
sinicus and R. ferrumequinum (which co-roost at our sites) are the SARSr-CoV primary reservoir, over time, but not until next week as the data is still
with Hipposideros and Myotis playing an insignificant role in viral dynamics. We will capture being cleaned.
bats using harp traps and mist nets during evening flyout. Rectal, oral, and whole blood samples Commented [PD13]: OK – let’s look at it when it’s
ready – maybe can go joint with the map
(×2 per bat) will be collected for viral discovery using sterile technique to avoid cross-
contamination. 2-mm wing tissue punch biopsies will be collected from each bat for host DNA
bar-coding, sequencing of host ACE-2 receptor genes (interface site), and cophylogeny analyses.
Standard morphological and physiological data will be collected for each bat (age class, sex,
body weight, reproductive status etc.). In Phase I we will sample 60 Rhinolophus sinicus and 60
R. ferrumequinum, our primary target species, (120 bats total) every three months for non-
lethal viral specimen collection over an 18 month period of the project from all three cave sites. Commented [14]: 3 cave sites will be the same
across the entire project, one cave will later be
Given the average prevalence of SARSr-CoV in these species in our previous investigations in S. experimental cave for intervention with 2 control caves.
China (~6-9%, n=3304 Rhinolophus spp.), this sample size would enable to detect changes of If there aren't enough bats in any given cave, we can
add additional cave sites to get our target sample
10% fluctuation in prevalence between sampling periods. Early in the sampling we will trial the sizes, e.g. 2 adjacent caves sampled instead of one to
get 120 bats per event.
efficacy of tarp collection of fresh feces and urine as a way of collecting viral dynamics data
while reducing roost disturbance (REFS). To identify seasonal or reproductive cycle variation in Commented [PD15]: Need references please
viral dynamics, we will conduct repeated sampling of individuals and of tarps placed under the
same roost site portion of a cave and examine roost-site fidelity (see below) to measure how
well tarp-collected samples will track the general population. Rhinolophus species have a 7-
week gestation period and generally give birth in the spring. Colony composition may change
over the year, with bats aggregating during mating periods. These changes will affect viral
dynamics and our sampling strategy will allow us to collect data over two mating and gestation
periods and assess changes in viral prevalence. Additionally, we will conduct pre-intervention
(3 months prior to deployment) and post-intervention (3 months following deployment) CoV
monitoring from these sites in Phase II (see Fig. X -Gantt chart) to assess efficacy of our field
intervention deployment. During months without physical bat trapping (2 months each quarter
of sampling), fresh fecal pellets will be collected by placing clean polyethylene sheets
measuring 2.0m x 2.0m beneath roosting bats. We will use infrared spotlights and digital
infrared imaging to record the number and species of individuals above each plastic sheet.
Fecal pellets may also be genetically barcoded to confirm species identification43 as we
routinely do for other bat surveillance projects. All specimens will be preserved in viral
transport medium and immediately frozen in liquid nitrogen dry shippers in the field, then
transported to partner laboratories with maintained cold chain and strict adherence to
biosafety protocols. Each bat will be marked with a subcutaneous microchip (PIT tag) containing
a unique ID number (see below). Study caves and bat roosts will be surveyed using portable
13
LiDAR technology44-46, to give a 3-D image of the roost area which will provide data on species
composition and volume/surface area that needs to be covered when applying the immune
treatments in TA2 (Fig. XX). We will adjust individual sampling quotas per species to optimize Commented [PD16]: From Kendra’s email
viral detection based on host-specific prevalence of previous and ongoing host-pathogen
models, as well as ongoing lab results from bat sampling.
Our team has more than 30 years of collective experience in safe and humane handling
of bats for biological sampling. This project will operate under appropriate IACUC/ACURO and
PPE guidelines. EHA has several ongoing DTRA-supported projects and is familiar with the
process of obtaining ACURO approval for animal research from the DoD. The EHA team also
currently maintains IACUC protocols through Tufts University (via inter-institutional agreement) Commented [PD17]: Need to check on this
and will obtain IACUC approval through this mechanism for DEFUSE.
Commented [PD18]: Correct the abbreviated text for

Sept yr 4
Bats are highly mobile and little is known of inter-cave migration/emigration rates. To monitor
bat roost fidelity and movement we will mark Rhinolophid bats with individual Passive
Integrated Transponder (PIT) tags to track individual bats’ entry and exit from roost caves. Tags
will be inserted subcutaneously between the bats’ scapulae by trained personnel. The identities
of individually tagged bats inhabiting roost caves will be recorded using radio frequency
identification (RFID) data loggers and antennae at the roost entrances. Time-stamped data from
individual bats collected by data loggers will be downloaded every 3 days to examine temporal Commented [19]: Why not just monthly when we're
doing our trapping?
roost site fidelity and rates of inter-cave immigration/emigration. Infrared video cameras will
Commented [PD20]: Assume because this will allow
record the total number of bats flying out each night. Recapture data will be collected us to see how often bats travel among caves within that 3
continuously throughout the project. We will attach radio transmitters (1.2g, Advanced month period
Telemetry Systems, MN USA), to the back of 20 individual Rhinolophus sinicus and Rhinolophus
ferrumequinum from each study roost (60 total) to determine nightly foraging patterns and
local dispersal patterns. Telemetry data and PIT tag data will be used to calculate home range,
to determine the degree of mixing among our three sites, and parameterize our dynamic
models. We will use fine scale data on roost fidelity to determine the population mix at the
specific roost sites (e.g. a side pocket of a cave where only one species roosts) for our
intervention. Radio transmitters that weigh <3% of bat body weight will be attached to the fur
14
on the back using a veterinary dermatological adhesive (Vet Bond 3M, USA). We will collect
location data from 60 bats (30 males, 30 females) every day for 10 days, 3 times per year for
the 18 months of Phase 1. This will provide seasonal data to assess movement, including mating
and gestation periods when higher levels of mixing and aggregation in the caves are expected.
High-risk SARSr-CoV quasispecies discovery, isolation and S. gene characterization. We will

screen samples for SARSr-CoV nucleic acid using our pan-coronavirus consensus one-step hemi-
nested RT-PCR (Invitrogen) assay targeting a 440-nt fragment in the RNA-dependent RNA
polymerase gene (RdRp) of all known alpha- and betacoronaviruses assay47,48, as well as specific
assays for known SARSr-CoVs27-30. PCR products will be gel purified and sequenced with an ABI
Prism 3730 DNA analyzer and quantitative PCR will be performed on SARSr-CoV-positive
samples to determine viral load. Full-length genome of all detected SARSr-CoVs will be
sequenced by high throughput sequencing method followed by genome walking. The
sequencing libraries are constructed using NEBNext Ultra II DNA Library Prep Kit for Illumina
and sequenced on a MiSeq sequencer, with PCR and Sanger sequencing used to fill gaps in the
genome29,30,32. We will build phylogenetic trees using the Maximum Likelihood algorithm in the
PhyML software, then scan for recombination events using Recombination Detection Program
(RDP), confirmed using similarity plot and bootscan analyses in Simplot. We will analyze the S
gene (which encodes the spike protein and determines receptor binding and cross-species
transmission) of each sequence to identify a virus’ potential to use human molecule ACE2 as a
receptor. SARSr-CoVs with high similarity with SARS-CoV in full-length genomic sequences or
with S proteins likely able to use human ACE2 as receptor will be identified as potential high-
risk strains. We will then attempt isolation, cell culture, and infectious clone construction for
further study in vivo and in vitro analysis. We have had success isolating and culturing SARSr-
CoVs using Vero E6 monolayers in DMEM medium with 10% FCS, confirmed by RT-PCR and
electron microscopy29. For SARSr-CoVs which we are not able to culture, we will construct
recombinant viruses with the S gene of new bat SARSr-CoVs and the backbone of the infectious
clone of SARSr-CoV WIV1 or of SARS-CoV, using the reverse genetic system described
previously, and detailed below28. Initial assays of receptor usage and cell tropism will use
various cell lines expressing human ACE2 incubated with isolated bat SARSr-CoVs or
pseudotype viruses as previously shown29.
Approach to predicting bat SARSr-CoV spillover risk. Our approach is to combine state-of-the-
art genotype-phenotype modeling with detailed step-wise experimental characterization of
each bat SARSr-CoV we identify at our test cave sites.
Flow chart here:
Sample testing/screening/Isolation – phylogenetic analysis/ACE2 binding modeling – ACE2
binding assays (all from Fig A) – chimera production – mouse model – SARS vaccines protect -
15
cross neut humAB – full length recovery ( all from Fig b)-) – Data into predictive modeling
(additional box)
This flow chart should use some elements of Ralph’s figures A and B as indicated. Ask Ralph to
send you Figs A and B in editable format so you can fuse them in the way above (a chimera!),
and without the text. The flow chart needs to have less detail so the flow is visible when shrunk
down.
Our models will be parameterized with the experimental data from a series of assays on the S
genes of bat SARSr-CoVs, with experimental and modeling work flowing together in iterative
steps. The Baric laboratory pioneered many of the experimental approaches, the SARSr-CoV
reverse genetic platforms, and full length S chimeric recombinant virus recovery from in silico
sequence databases7,8,23,49. Full length recombinant strains reconstructed using reverse genetics
in our lab include human epidemic strains, civet and raccoon dog SARS-CoV strains, and bat
SARSr-CoVs (WIV16, WIV1, SHC014 and HKU3-SRBD repaired RBD interface). These strains will
be used in the Baric, Shi and Wang laboratories for initial work on immune boosting and
priming, and act as baseline data to parameterize the spillover risk modeling7,8,23,49. They will
be supplemented by viruses we isolate under DEFUSE (worked on in the Shi lab) and
approximately 15-20 bat SARSr-CoV spike proteins/year from DEFUSE (Baric, Shi labs). Most of
the ~150 bat SARSr-CoV strains sequenced by us in prior work have not yet been examined for
spillover potential and these will also be assessed in the following pipeline:
Experimental assays of SARSr-CoV spillover potential: Ability to enter human cells: Viral entry
represents the key first step to evaluating the disease potential of SARSr-CoVs, with CoV
species-specific restriction occurring primarily at entry23,49. To assess this we first will use
structural modeling of SARSr-CoV S protein to ACE2 receptors. The structure of the SARS trimer
prefusion S and the bound SARS-CoV S RBD to human and civet ACE2 have been solved,
providing a platform for structural modeling and mapping hot spots of antigenic variation50,51.
Mutations in the RBD23,49,52,53, and host proteases and S glycoprotein proteolytic processing54-56,
regulate SARSr-CoV cell entry and cross-species infectivity. Mismatches in the S-RBD-ACE2
molecules or S proteolytic processing will prevent cell entry of SARS-CoV23,49. We will also
conduct in vitro pseudovirus binding assays, as we have done previously for WIV1 and others29,
16
as well as live virus binding assays for strains we are able to isolate. This work will be done in
China (Shi lab), to prevent delays and unnecessary dissemination of viral cultures.
Novel SARSr-CoV Virus Recovery: We will commercially synthesize select SARSr-CoV S
glycoprotein genes, designed for insertion into our SHC014 or WIV16 molecular clone
backbones (these viruses are 88% and 97% identical to epidemic SARS-Urbani in the S
glycoprotein). These are BSL-3, not select agents, and pathogenic in hACE2 transgenic mice.
Different backbone strains provide increased opportunities for recovery of viable viruses, and
to identify potential barriers for RNA recombination-mediated gene transfer between strains30.
Chimeric viruses will be recovered in Vero cells, or in mouse cells over-expressing human, bat or
civet ACE2 receptors to support cultivation of viruses with a weaker RBD-human ACE2
interface. All chimeric viruses will be sequence verified and evaluated for: i) human, civet and
bat ACE2 receptor usage in vitro, ii) growth in primary HAE, iii) sensitivity to broadly cross
neutralizing human monoclonal antibodies (mAB) S215.17, S109.8, S227.14 and S230.15 and a
mouse antibody (435) that recognize unique epitopes in the RBD57,58 and iv) in vivo
pathogenesis studies in hACE2 transgenic mice, using our well established approaches7. Should
some isolates prove highly resistant to our mAB panel, we will evaluate cross neutralization
against a limited number of human SARS-CoV serum samples from the Toronto outbreak in
2003 (n=10). Chimeric viruses that encode novel S genes with spillover potential (e.g. growth in
HAE, use of multiple species ACE2 receptor for entry, antigenic variation) will be used to
identify SARSr-CoV strains for recovery as full genome length viable viruses. Recovery of Full
length SARSr-CoV: We will compile sequence/RNAseq data from a panel of closely related
strains (e.g.<5% nucleotide variation) and compare the full length genomes, scanning for
unique SNPs representing sequencing errors59-61. The genome of consensus candidates will be
synthesized commercially (e.g. BioBasic), as six contiguous cDNA pieces linked by unique
restriction endonuclease sites for full length genome assembly. Full length genomes will be
transcribed into genome-length RNA and electroporation used to recover recombinant
viruses22,62. We will re-evaluate virus growth in primary HAE cultures at low and high
multiplicity of infections and in vivo in hACE2 transgenic mice, testing whether backbone
genome sequence alters full length SARSr-CoV spillover potential. All experiments will be
performed in triplicate and data provided to the Modeling Team in real time. We anticipate
recovering ~3-5 full length genomes/yr, reflecting strain differences in antigenicity, receptor
usage, growth in human cells and pathogenesis. In vivo Pathogenesis: We generated a mouse
that expresses human ACE2 receptor under control of HFH4, a lung ciliated epithelial cell
promoter7. Infection of this model with wildtype SARS-CoV results in lethal disease, but
transient disease with bat SARSr-CoV WIV1, suggesting that WIV1 is less efficient at using
hACE2 in vivo and less likely to produce severe disease in people initially on spillover. However,
single amino acid variations in the SARS-CoV RBD of related strains could dramatically alter
these phenotypes, hence we will evaluate the impact of low abundant, high consequence
17
micro-variation in the RBD. Groups of 10 animals will be infected intranasally with 1.0 x 104 PFU
of each vSARSr-CoV, then clinical disease (weight loss, respiratory function by whole body
plethysmography, mortality, etc.) followed for
6 days p.i.. Animals will be sacrificed at day 2
or 6 p.i. for virologic analysis, histopathology
and immunohistochemistry of the lung and for
22-parameter complete blood count (CBC) and
bronchiolar alveolar lavage (BAL) using the
Vetscan HM5 (an instrument that measures
parameters used for human clinical
determination). Identification of high risk/low
abundant variants: We will use RNAseq to
identify low abundant quasispecies (QS)
variants encoding mutations in RBD and/or residues that bind ACE2. These would alter risk
assessment calculations as strains identified as low risk, might actually have low abundant, high
risk variants circulating in the QS. To test this the Shi and Baric lab will structurally model and
identify highly variable residue changes in the SARSr-CoV S RBD and use commercial gene
blocks to introduce these changes singly and then in combination into the S glycoprotein gene
of the low risk, highly abundant parental strain. We will examine the capacity of these low
abundance chimeric viruses to use human, bat, civet and mouse ACE2 receptors, and to
replicate in HAE cultures. RBD deletions: Small deletions at specific sites in the SARSr-CoV RBD
leave the key RBD-ACE2 interface residues intact, such that Clade 1 strains represent higher risk
of human infection (Fig. 5). We will analyze the functional consequences of these RBD deletions Commented [PD21]: This is Ralph’s Fig C
on SARSr-CoV hACE2 receptor usage, growth in HAE cultures and in vivo pathogenesis. First, we
will delete these regions, sequentially and then in combination, in SHC014 and SARS-CoV
Urbani, anticipating that the introduction of both deletions will prevent virus growth in Vero
cells and HAE. We hypothesize that the smaller deletion may be tolerated, given its location in
the RBD structure, so in vivo passage in the presence of receptor will restore growth, while
identifying 2nd site reversions that restore efficient hACE2 usage49. In parallel, we will evaluate
whether RBD deletion repair restores the ability of low risk strains to use human ACE2 and grow
in human cells. To test this we will synthesize full length rs4237, a highly variable SARSr-CoV
that encodes a few of the SHC014 RBD contact interface residues but also encodes a mutation
at 479 (N479S) and has two deletions and hence, is not recoverable in vitro. Using the SHC014
backbone sequence, we will sequentially and then in tandem repair the deletions in the
presence and absence of the S479N. We anticipate that the S479N mutation is critical given its
key role in establishing the RBD-ACE2 interface, and that restoration of the RBD deletions will
enhance virus recognition of hACE2 receptors and growth in Vero cells and HAE cultures S2
Proteolytic Cleave and Glycosylation Sites: After receptor binding, a variety of cell surface or
18
endosomal proteases63-66 cleave the SARS-CoV S glycoprotein causing massive changes in S
structure 67 and activating fusion-mediated entry55, which is prevented in the absence of S
cleavage68 (Fig. 5). Tissue culture adaptations sometimes introduce a furin cleavage site which Commented [PD22]: This is Ralph’s Fig. C
can direct entry processes, usually by cleaving S at positions 757 and 900 in S2 of other CoV, but
not SARS66. For SARS-CoV, a variety of key cleavage sites in S have also been identified and we
will analyze all SARSr-CoV S gene sequences for appropriately conserved proteolytic cleavage
sites in S2 and for the presence of potential furin cleavage sites69,70. SARSr-CoV S with
mismatches in proteolytic cleavage sites can be activated by exogenous trypsin or cathepsin L.
Where clear mismatches occur, we will introduce the appropriate human-specific cleavage sites
and evaluate growth potential in Vero cells and HAE cultures. In SARS-CoV, we will ablate
several of these sites based on pseudotyped particle studies and evaluate the impact of select
SARSr-CoV S changes on virus replication and pathogenesis (e.g. R667, R678, R797). We will also
review deep sequence data for low abundant high risk SARSr-CoV that encode functional
proteolytic cleavage sites, and if so, introduce these changes into the appropriate high
abundant, low risk parental strain. N-linked glycosylation: SARS-CoV S has 23 potential N-linked
glycosylation sites and 13 of these have been confirmed biochemically. Several of these
regulate SARS-CoV particle binding DC-SIGN/L-SIGN, alternative entry receptors for SARS-CoV
entry into macrophages/monocytes71,72. Mutations that introduced two new N-linked
glycosylation sites may have been involved in the emergence of human SARS-CoV from civet
and raccoon dogs72. While the sites are absent from civet and raccoon dog strains as well as
clade 2 SARSr-CoV, they are present in WIV1, WIV16 and SHC014, supporting a potential role
for these sites in host jumping. To evaluate this, we will sequentially introduce clade 2 residues
at positions N227 and N699 of SARS-CoV and SHC014 and evaluate virus growth in Vero cells,
nonpermissive cells ectopically expressing DC-SIGN and in HAE cultures, as well as in human
monocytes and macrophages anticipating reduced virus growth efficiency. Using the clade 2
rs4237 molecular clone, we will introduce the clade I mutations that result in N-linked
glycosylation sites at positions 227 and N699 and in rs4237 RBD deletion repaired strains,
evaluating virus growth efficiency in HAE, Vero cells, or nonpermissive cells ± ectopic DC-SIGN
expression72. In vivo, we will evaluate pathogenesis in transgenic ACE2 mice.
Models to predict viral spillover potential and evolution of high-risk SARSr-CoV strains. Commented [PD23]: We have no preliminary data to
show here. Is it possible to mock something up or run a
Structural equation model of spillover potential: We will use data from the experimental assays simulation so that we have some prelim. figure. Checkout
above to build genotype-phenotype models of bat SARSr-CoV spillover potential. We will use the abstract that Jim Desmond’s involved in – they show a
couple of prelim. simulations of a model and I think it
Bayesian Structural Equation Models (SEM), fit via MCMC methods73, to predict spillover would be good if we could…?
potential from the genetic traits of bat SARSr-CoVs and the ecological traits of hosts. SEMs have
successfully analyzed the drivers of, and predicted stochastic species interactions74,75. They will
enable us to integrate multiple, interrelated tests of strain spillover potential into a common
framework, while restricting relationships to plausible causal pathways. This prevents the over-
19
fitting associated with a black-box approach. A Bayesian approach allows fitting with
unbalanced and non-independent data, as per the larger number of cell-binding and cell-entry
assays we will run to determine candidates for a smaller number of humanized mouse trials and
LIPS assays (below). The viral traits derived from the experimental assays of spillover risk laid
out above will be our primary set of predictor variables: presence of deletions in the RBD
region, proteolytic binding sites, glycosylation sites, neutralization escape mutations,
indeterminate mutations at high-variation sites found in low-abundance strains. We will include
genetic similarity of each strain’s RBD to the reference pandemic SARS-CoV genomes to test
these aggregate measures as predictive proxies. To control for experimental conditions we will
include whether assays were performed on live viral isolates, full-genome or synthetic chimeric
viruses, and the molecular backbone used in the latter. These traits will be used as inputs to
SEM's causal graph, and used to predict latent variables representing the interconnected
processes that contribute to SARSr-CoV QS spillover potential: receptor binding, cell entry with
and without the presence of exogenous proteases, immune system interaction, and
intracellular growth, all measured by our laboratory assay. These, in turn will act as predictors
for the ultimate outcomes of host pathogenesis (Fig. 6). We will use previous work on these
genetic traits to put informative priors on strength and direction of interactions in the causal
graph. We will use prior-knowledge model simulations to select target sequences from our
sampling for characterization and genome-sequencing, to collect data that maximally
enhances the predictive power of our model. We will use regularizing priors to reduce over-
fitting and help select the most predictive variables in the final predictive model.
Evolutionary modeling and simulation to predict potential strains: Our SEM modeling will
generate estimates of the spillover potential of SARSr-CoV sequences from DEFUSE fieldwork
and prior work. To examine risk associated with the total viral population at our test sites, we
will model and simulate evolutionary processes to identify likely viral QS that our sampling has
not captured, as well as viral QS likely to arise in the future. By estimating the spillover
potential of these simulated QS, we can better characterize the risk associated with the total
viral population. We will use a large dataset of S protein sequences and full-length genomes
generated from prior work and DEFUSE fieldwork to estimate SARSr-CoV substitution rate and
its genome-wide variation using coalescent and molecular clock models within a Bayesian
MCMC framework76. We will then estimate SARSr-CoV recombination rates at the cave
population level using the same dataset and Bayesian inference77,78. We will apply various
methods (RDP79, similarity plots, bootscan) to identify recombination breakpoints and hotspots
within the SARSr-CoV genome. Using these estimates of substitution and recombination rates,
we will simulate the evolution of the SARSr-CoV QS virome using a forward-time approach
implemented in simulators that model specific RNA virus functions (e.g. VIRAPOPS80). This will
allow us to predict the rate at which new combinations of genetic traits can spread in viral
populations and compare recombination rates among caves and bat communities. Our forward-
20
simulated results will provide a pool of likely unknown and future QS species. Using these and
our SEM model for spillover risk, we will predict the QS that are most likely to arise and have
pathogenetic and spillover potential. We will use the evolutionary simulation results to
iteratively improve our SEM model results. The number of genetic traits of interest for
prediction of pathogenicity is potentially large, so we will perform variable reduction using tree-
based clustering, treating highly co-occurring traits as joint clusters for purposes of prediction.
We will generate these clusters from our full set of SARSr-COV sequences from DEFUSE
fieldwork and prior work. However, as trait clusters may be modified in future virus evolution
due to recombination, we will use our forward-evolutionary modeling to predict how well trait
clusters will be conserved, retaining only those trait clusters unlikely to arise in unknown or
future viral QS genomes. This will enable a good trade-off between increased predictive power
based on current samples and generalizability to future strains that have not yet evolved.
Figure 6: A simplified directed graph of a structural equation model representing the causal
relationships between predictors and measures of viral pandemic potential.
Validation by LIPS assay on previously-collected human sera: Following our proof-of-concept

field trial we will update these models to include not only pathogenesis but spillover probability
validated with data on viral QS antibodies found in the local human population detected via
Luciferase immunoprecipitation system (LIPS) assays on previously-collected human sera (NIAID
project, Daszak PI). This includes >2,000 samples collected from people living close to our test
cave sites in Yunnan Province, and is the basis of a recent paper demonstrating 2.7%
seropositivity to bat SARSr-CoVs in an initial sampling of this population34 (Fig. 7). In addition to
21
serum samples, extensive behavioral and wildlife contact data has been collected from this
population, under an IRB that can be easily extended to cover DEFUSE work. Commented [PD24]: Please check – I think this
already allows us to use the samples?
Fig. 7. Human sera were collection from villages

(red dots) near bat caves where CoV positive
samples have been isolated (Yanzi Cave and
Shitou Cave, triangle).
Our ability to extend and validate these models

with data on actual human contact and spillover
allows us to fit and test models of actual, not just
potential, spillover probability. Our previous work
has shown that both host and viral traits predict zoonotic spillover from models3, so in addition
to viral traits, we will include key ecological traits of the host bat species in which viral QS were
detected. These include flight ranges, foraging, roosting, demographic, and social behavior. To
will use the extensive data on each person’s behavioral exposure to wildlife, and their work,
travel and occupational history, to correct for varying human exposure to bat species. We will
design LIPS assays for specific high- and low-spillover risk SARSr-CoVs, to identify people who’ve
been exposed to them, and test our model’s validity. The LIPS uses viral antigens tagged with
luciferase, from crude lysate, thereby eliminating the requirement for antigen purification and
significantly reducing the time required for assay development and producing a more sensitive
test than traditional ELISA81. Prof. Zhengli Shi (Wuhan Institute of Virology) will lead the LIPS
serological work based on her 15 years SARSr-CoV human serological surveillance experience 82-
84
and the recent success in SADS-CoV zoonotic risk study using LIPS85. To establish SARSr-CoV
LIPS assays, we will: 1) Insert different high- and low-risk SARSr-CoV N genes into pREN-2 vector
(LIPS vector). We will first assess N gene similarity to determination their potential cross-
reactivity in a LIPS assay. From our previous experience, SARSr-CoV maintain 80% similarity in
the N protein, thus should be detectable using a universal SARSr-CoV N based LIPS assay; 2)
determine specificity of the LIPS assay by producing polyclonal sera via injection of recombinant
protein or attenuated virus into rabbits. Selected SARSr-CoV N proteins or viral particles will be
used as the immunogen for antibody production; 3) validate SARS-CoV, MERS-CoV and SADS-
CoV N protein LIPS assays by incubating antigens with their respective positive serum samples
and the antigen antibody complex eluted using protein A/G beads. Luminescence is measured
upon adding coelentrazine, a substrate of renilla luciferase. In a preliminary assay, LIPS
successfully detected high strong antibody titer in the positive control serum sample, while the
vector control did not show any response. Cut off was set as the average luminescence plus
three standard deviation from the control. We have used this to demonstrate efficacy for
MERS-CoV and SADS-CoV (Fig. 8); 4) validate LIPS positive sera results by spike protein based
22
LIPS and viral neutralization assay. Similarly, S gene from high/low risk SARSr-CoV will be
engineered into the pREN-2 vector and an S-LIPS assay produced, as above. As a confirmatory
test the positive samples from LIPS, will be validated by viral neutralization assay. The data from
LIPS and neutralization will be collected and analysis to validate the model.
Fig. 8. LIPS assay was tested successful for SARS, MERS and SADS coronavirus N or S antibodies.
Thematic Area 2
Immune modulation approach to reducing bat SARSr-CoV spillover risk. There is no available
technology to reduce the risk of exposure to novel CoVs from bats which carry zoonotic
precursors to many emerging viruses including filoviruses (Ebola), CoV (SARS-CoV, MERS-CoV,
etc.), paramyxoviruses (Nipah/Hendra), rhabdoviruses (rabies) and others. No vaccines or
therapeutics exist for emerging CoVs, filoviruses and paramyxoviruses and exposure mitigation
strategies are non-existent. We have shown that bats have unique immunological features that
may explain why they coexist with viruses and rarely show clinical signs of infection. Our long-
term studies demonstrate: a) bats maintain constitutively high expression of IFNα that may
respond to and thus restrict, viral infection immediately11; b) several bat interferon activation
pathways are dampened, e.g. STING (a central cytosolic DNA-sensor molecule to induce
interferon) dependent and TLR7 dependent pathways10; c) the NLRP3 dependent
inflammasome pathway is dampened, and some of the key inflammation response genes like
AIM2 have been lost in bats86,87. The dampened IFN and inflammasome response suggest bats
maintain a fine balance between IFN response and detrimental over-response. This is likely due
to an adaptation of their immune-sensing pathways as a fitness cost of flight9. We hypothesize
that the bat innate/adaptive immune responses are quite different from that of human and
mouse. Firstly, virus replication will likely be restricted quickly by constitutively expressed IFNα
in bats, resulting in lower B/T cell stimulation due to lower viral stimuli. Second, dampened
interferon and inflammasome responses will result in lower cytokine responses that are
required to trigger T/B cell dependent adaptive immunity (e.g. antibody response). The strong
innate immune response, due to the lack of an efficient antibody response, will clear the virus.
23
We and others have demonstrated proof-of-concept of this phenomenon: Experimental
Marburg virus infection of Egyptian fruits bats, a natural reservoir host, resulted in wide tissue
distribution yet low to moderate viral loads, brief viremia, low seroconversion and a low
antibody titer that waned quickly, suggesting no long-term protection is established88-90.
Similarly, poor neutralizing antibody responses occur after experimental infection of bats with
Tacaribe virus91 and in our studies with SARS-CoV experimentally infected bats (L-F Wang,
unpublished data). Indeed, we successfully showed bat interferon can inhibit bat SARSr-CoVs28.
We hypothesize that if we can use immune modulators that upregulate the naturally low innate
immunity of bats to their viruses, we will be able to transiently suppress viral replication and
shedding, reducing the risk of spillover. We will evaluate two immune modulation approaches
to defuse spillover of SARSr-CoVs from bats to humans: 1) Broadscale Immune Boosting
strategies (Wang, Duke-NUS): we will apply immune modulators like TLR-ligands, small
molecule Rig like receptor (RLR) agonists or bat interferon in live bats, to up-regulate their
innate immunity and assess suppression of viral replication and shedding; 2) Targeted Immune
Priming (Baric, UNC): the broadscale immune boosting approach will be applied in the presence
and absence of chimeric immunogens to boost clearance of high-risk SARSr-CoVs. Building on
preliminary development of polyvalent chimeric recombinant SARSr-CoV spike proteins, we will
use novel chimeric polyvalent recombinant S proteins in microparticle encapsidated gels and
powders for oral delivery and/or virus adjuvanted immune boosting strategies where chimeric
recombinant SARSr-CoV S are expressed from raccoon poxvirus, which has been used
extensively to deliver rabies immunogens in bats and other animals. We will conduct
application trials with live bats to assess suppression of replication and shedding of a broad
range of pathogenic SARS-related CoVs. Both lines of work will begin in Year 1 and run parallel,
be assessed competitively for efficiency, cost, and scalability, and successful candidates used in
our live bat trials at our test sites in Yunnan, China. We believe an immune boosting/priming
strategy is a superior approach for this challenge because solutions are likely to be broadly
applicable to many bat species, and across many viral families.
Broadscale immune boosting (led by Wang, Duke-NUS). We will work on the following key
leads to identify the most effective approach to up-regulate innate immunity an suppress viral
loads. Toll-like receptor (TLR)/Rig-I Like Receptor (RLR) ligands: We have begun profiling bat
innate immune activation in vivo, in response to various stimuli. Our work indicates a robust
response to TLR-stimuli like polyI:C when delivered in vivo, as measured by transcriptomics on
spleen tissue (Fig. 7). We have performed transcriptomics on spleen, liver, lung and lymph
node, with matched proteomics to characterize immune activation in vivo. These activation
profiles will be used to assess the bat immune response to different stimuli and direct the
response to favor those which lower the viral load in our experimental system at Duke-NUS
(below). In addition to the ligands already tested, we will stimulate the Rig-I pathway with
24
5’pppDSRNA, a mimetic of the natural RIG-I stimulant. These stimulants will activate functional
bat IFN production pathways, and a similar strategy has been demonstrated in a mouse model
for clearance of SARS-CoV, influenza A virus and Hepatitis B virus12,15.
Fig. 7. Pathway analyses from Ingenuity Pathway Analysis
(IPA) of whole spleen NGS after stimulation with either LPS
or polyI:C. Z-score increase over control bats is indicated as
per scale, and suggests strong activation of many pathways.
Universal bat interferon: To overcome any complications
arising from species-specificity, we will design a conserved
universal bat interferon protein sequence and produce
purified protein. Utilization of a universal IFN for bats will Commented [PD25]: Need to say how you will do this.
Just a couple of sentences and references
overcome species-dependent response to the ligand,
allowing the use of IFN throughout broad geographical and
ecological environments and across many bat species. As a
starting point, we have produced recombinant non-
universal, tagged, bat IFN that are effective at inducing
appropriate immune activation (Fig. 8). This ligand can be
delivered by aerosol or intranasal application as has been shown to reduce viral titers in
humans, ferrets and mouse models12,13,15. Interferon has been used clinically in humans as an
effective countermeasure when antiviral drugs are unavailable, e.g. against filoviruses14.
Replication of SARSr-CoV is sensitive to IFN treatments, as shown in our previous work28. The
successful delivery, immune activation and outcome on the host will be characterized
thoroughly to optimize rapid immune activation.
Fig. 8: Bat viruses are

sensitive to IFN treatments.
A) Recombinant bat SARS-
related coronavirus WIV1
replication was inhibited by
human IFN-β in a dose
dependent manner in Vero
cells. B) Bat reovirus PRV1NB replication was inhibited by recombinant bat IFNα3 in a dose
dependent manner in bat PakiT03 cells.
Boosting bat IFN by blocking bat-specific IFN negative regulators: Uniquely, bat IFNα is naturally
constitutively expressed but cannot be induced to a high level, indicating a negative regulatory
factor in the bat interferon production pathway92. To fast-track the identification of this target Commented [PD26]: Is this the right reference – I
inserted one here?
we will utilize a Pteropus alecto CRISPRi library pool that we have created covering multiple
RNA targets in every gene in the P. alecto genome. The library has already been produced and Commented [PD27]: Need a reference
25
genes affecting influenza replication in bat cells have been identified. Using CRISPRi we can
identify negative regulator genes and then screen for compounds targeting these genes to
boost the inducibility of the IFN system in a shorter time-frame. Based on previous work, it is Commented [PD28]: Can we cite a reference here?
highly likely this will be a conserved pathway throughout the order Chiroptera. Activating
dampened bat-specific innate immune pathways which include DNA-STING-dependent and TLR-
dependent pathways: Our work showing that mutant bat STING or reconstitution of AIM2 and
functional NLRP3 homologs restores antiviral functionality suggests these pathways are
important in bat-viral coexistence and that the majority of the pathway is preserved. By
identifying small molecules to directly activate pathways downstream of STING or TLR/RLRs,
such as TBK1 activation, we will activate bat innate defense by interferons and promote viral
clearance. We hypothesize that these small molecules we will be able to significantly reduce
viral load in bats. Validation in a bat-mouse model. Various CoVs show efficient infection and
replication inside the human host but exhibit defective entry and replication using mouse as a
host due in part to differences in DPP3 and ACE2 receptors. We have shown efficient
reconstitution of irradiated mice using bat bone marrow from multiple species, including E.
spelaea. Fig. 9 shows the efficient reconstitution of bat PBMC’s in the mouse, presence of
circulating bat cells and generation of bat-specific antibodies in mice incapable of producing an
antibody response. This ‘batized’ mouse model can be utilized for both circulating infection of
SARS/MERS CoV (in the immune compartment only) and as a model for generating bat-specific
antibodies against CoV proteins. Efficient validation of infection into bat cells will be used to
validate the infectivity of the viruses and generation of bat antibodies will facilitate validation of
the best proteins/peptide to elicit an effective immune response.
Fig. 9: A) Presence of bat-specific qPCR in reconstituted mice after 12 weeks. B) chimeric ratio of
bat-mouse cells in circulation after 24 weeks. C) Specific antibody response to a KLH-tetanus
antigen generated by bat-reconstituted mice.
Viral infection models in cave-nectar bat (Duke-NUS): To test and compare the efficacy of the
immune modulating approaches above, we will use our cave-nectar bat (Eonycteris spelaea)
breeding colony infected with Melaka virus (family Reoviridae) which is known to infect this
Commented [PD29]: I put this in – I wasn’t sure
species93,94. We will also use two coronaviruses (SARSr-CoV WIV1 and MERS-CoV in ABSL3. whether you’d use SARS-CoV or SARSr-CoVs?
26
Details of infection, housing, prior infection trials in the facility… Viral loads will be measured by Commented [PD30]: Need some more details to show
reviewers that we have already done some trials..
qPCR, titration of produced virus, NGS transcriptomics and nanostring probes added to the
immunoprofiling panel. Antibody responses will be measured by LIPS assay. This approach
allows us to test our immune-boosting strategies, in a safe and controlled environment, prior to
expanding to field-based evaluation. The analytical methods used for the E. spelaea colony will
be replicated to analyze the experimental infection of Rhinolophus in a wild-cave scenario.
Additionally, the versatility of the analysis should allow easy application to multiple species of
bats
Targeted Immune Priming (led by Baric, UNC). We have developed novel group 2b SARSr-CoV
chimeric S glycoproteins that encode neutralizing domains from phylogenetically distant strains
(e.g. Urbani, HKU3, BtCoV 279), which differ by ~25%. The chimeric S programs efficient
expression when introduced in the HKU3 backbone full length genome, and elicit protective
immunity against multiple group 2b strains. We will Commented [PD31]: In which model?
develop robust expression systems for SARSr-CoV
chimeric S using ectopic expression in vitro. Then, we
will work with Dr. Ainslie (UNC-Pharmacy) who has
developed novel microparticle delivery systems and
dry powders for aerosol release, and which
encapsidate recombinant proteins and adjuvants
(innate immune agonists) that will be used for
parallel broadscale immune boosting strategies ±
chimeric immungens. Simultaneously, we will
introduce chimeric and wildtype S in raccoon
poxvirus (RCN), in collaboration with Dr. Rocke and
confirm recombinant protein expression, first in vitro
and then in the Duke-NUS bat colony, prior to any
field trial. The goal of this aim is to develop a suite of
reagents to remotely reduce exposure risk in high
risk environmental settings.
Chimeric SARSr-CoV S Immunogens: CoV evolve quickly by mutation and RNA recombination,
the latter provides a strategy to rapidly exchange functional motifs within the S glycoprotein
and generate viruses with novel properties in terms of host range and pathogenesis30,95. CoV
also encode neutralizing epitopes in the amino terminal domain (NTD), RBD and S2 portion of
the S glycoprotein57,96,97, providing a strategy to build chimeric immunogens that induce
broadly cross reactive neutralizing antibodies. Given the breadth of SARSr-CoV circulating in
natural settings, chimeric immunogens will be designed to increase the breadth of neutralizing
epitopes across the group 2b phylogenetic subgroup40. Using synthetic genomes and structure
27
guided design, we fused the NTD of HKU3 (1-319) with the SARS-CoV RBD (320-510) with the
remaining BtCoV 279/04 S glycoprotein molecule (511-1255), introduced the chimeric S
glycoprotein gene into the HKU3 genome backbone (25% different than SARS-CoV, clade 2
virus) and recovered viable viruses (HKU3-Smix) that could replicate to titers of about 108
PFU/ml on Vero cells (Fig. 10). HKU3-Smix is fully neutralized by mAb that specifically target the Commented [PD32]: This is Ralph’s Fig. E
SARS RBD (data not shown). In parallel, we inserted the HKU3mix S glycoprotein gene into VEE
virus replicon vectors (VRP-Schimera) and demonstrated that VRP vaccines protect against lethal
SARS-CoV challenge and virus growth. In addition, VRP-SHKU3 and VRP-S279 both protect against
HKU3mix challenge and growth in vivo (Fig. 9), demonstrating that neutralizing epitopes in the
HKU3mix S glycoprotein are appropriately presented and provide broad cross protection against
multiple SARSr-CoV strains. In addition to using these immunogens as a targeted broad-based
boosting strategy in bats, we will also produce a chimeric SHC014/SARS-CoV/HKU3 S and a
SCH014/SARS-CoV/WIV-1 S gene for more focused immune targeting on known high risk
strains. In parallel, we will work with the Protein Expression Core at UNC
(https://www.med.unc.edu/csb/pep) to produce codon optimized, stabilized and purified
prefusion SARS-CoV glycoprotein ectodomains as published previously17. Purified recombinant
protein will be used by Drs. Rocke and Ainslie for inclusion in delivery matrices (e.g. purified
powders, dextran beads, gels – see below) with broadscale immune agonists (adjuvants-Dr.
Wang) like poly IC, TLR4 and Sting agonists.
2nd Generation Chimeric S glycoprotein Design and Testing: We will also produce a chimeric
SHC014 NTD/SARS-CoV-RBD/HKU3 S C terminal and generate recombinant HKU3 encoding the
trimer spike (HKU3-SS014), for more focused immune targeting on known high and low risk
strains designated from our experimental and modeling analyses. A second construct will be
synthesized with a SHC014 NTD domain, SARS-CoV RBD and WIV-1 C terminal domain (WIV-
SS014). After sequence variation, we will evaluate virus growth in Vero and HAE cultures and the
ability of SARS RBD monoclonal antibodies (S227, S230, S109) to neutralize chimeric virus
infectivity89,96. We will also evaluate in vivo pathogenesis in C57BL/6 mice and hACE2 transgenic
mice. The recombinant HKU3-SS014 S genes will be introduced into VRP vectors and sent to Dr.
Rocke for insertion into the raccoon poxvirus vaccine vector. Using established techniques, we
will characterize S expression and then provide virus vectors to Prof. Wang for immune
boosting trials at Duke-NUS, and ultimately if successful in the field (Prof. Shi). We will also
synthesize human codon optimized the HKU3-SS014, WIV-SS014 and HKU3-Smix chimeric spikes for
expression and purification by the UNC proteomics core, producing mg quantities for inclusion
in nanoparticle and microparticle carriers in collaboration with Dr. Ainslie. We will produce
enough material for in vivo testing in mice and in bats. Recombinant HKU3-SS014 and WIV-SS014
glycoprotein expression will be validated by Western blot and by vaccination of mice, allowing
us to determine if the recombinant protein elicits neutralizing antibodies that protect against
lethal SARS-CoV, HKU3-Smix and SHC014 challenge. In parallel, we will survey the RNAseq data
28
for evidence of complex S glycoprotein gene RNA recombinants in the SARSr-CoV population
genetic structure. If present, we will synthesize 2-3 interesting recombinant S genes, insert
these genes into SHCO14 or HKU3 genome backbones and VRP and characterize the viability
and replicative properties of these viruses in cell culture and in mice and the VRP for S
glycoprotein expression and vaccine outcomes. We will produce immunogens and evaluate
their ability to protect against infection.
Adjuvant and Immunogen Delivery Vehicles. Dr. Ainslie (UNC) and collaborators have
developed the biodegradable polymer acetalated dextran (Ac-DEX) for the delivery of antigens
and adjuvants in vaccine applications (Fig. 11). Ac-DEX has distinct advantages over other Commented [PD33]: This is Ralph’s Fig. F. We still
need this from Ralph to see if it’s possible to include, or
polymers for vaccine development: 1) synthesis is straightforward and scalable. An FDA- not..
approved water soluble dextran polysaccharide is modified and rendered insoluble in water by
a simple one-step modification of its hydroxyl groups with pendant acyclic or cyclic acetal
groups98-100. Unlike other dextran based vaccine materials, our material is acid sensitive, which
has been shown to greatly improve antigen presentation; 2) Ac-DEX microparticles (MPs) can
passively target antigen-presenting cells (APCs) based on their size (5-8µm), being Commented [PD34]: Previous draft just said (5-8).
Assume this is microns?
phagocytosed by DCs and traffic to the lymph node101. Furthermore, APCs have acidic
phagosomes that can result in triggered intracellular release due to the acid-sensitivity of Ace-
DEX; 3) Ac-DEX MPs and their hydrolytic byproducts are pH-neutral, biocompatible, and safe
compared to other commonly used polyesters have acidic hydrolytic byproducts (e.g. lactic and
glycolic acid, in the case of PLGA) that damage vaccine components such as protein antigens102.
The complete hydrolysis of Ac-DEX results in particle breakdown with release of the metabolic
side products. 4) Ac-DEX MPs are stable outside the cold-chain. MPs can be stored for at least 3
months at 45oC without any loss of integrity or encapsulated cargo bioactivity103. Other
common formulations (e.g. liposomes104, PLGA MPs103, squalene emulsions [FluadTM package
insert]) have limited shelf-life that requires the cold-chain. Ac-DEX MPs can be aerosolized, or Commented [PD35]: Please correct typing or insert
reference
delivered in sprays or gels to bat populations, providing new modalities for zoonotic virus
disease control in wildlife populations98,105. 5) We have previously encapsulated Poly (I:C)(1),
resiquimod101, and a STING agonist into
our novel MPs106. Figure F. Particle Delivery Systems. Broadscale immune
boosting strategies include (A) Dextran microparticles or
As seen in Fig. 10, encapsulation of Poly Dry nanoparticle powders. (B) Macrophages cultured with
(I:C) drastically enhances the activity of the either free poly (I:C) or poly (I:C) encapsulated into Ac-
DEX MPs produce significant TNFα. (C) Comparison of
TLR agonist. Additionally, encapsulation of (left) neutralizing titer and (right) viral load when ferrets are
adjuvants in MPs drastically enhances the vaccinated with Ac-DEX MPs. Day 0, 28, and 56 (prime,
boost, and challenge.)
activity of subunit vaccines. We have
displayed better efficacy than state-of-the-
art FDA-approved inactivated flu virus
(Fluarix) in a ferret model of influenza. The
29
ferret model is the ideal animal model for influenza because of their relatively small size and
they possess various clinical features associated with human influenza infection107. This
formulation used HA with encapsulated STING agonist cyclic [G(3',5')pA(3',5')p](16) Commented [PD36]: Is this a reference – if so please
paste into comment box
Microparticle Performance Metrics in vitro and in Rodents and Bats: MPs are designed for
aerosol delivery due to their relatively effective low aerodynamic diameter108, their low density
microporous nature which allows for efficient aerosol dispersal and deep penetration into the
lung, or deposition on the skin for oral uptake by grooming. We will encapsulate Poly (I:C),
resiquimod (TLR 7) or other innate immune agonists to enhance type I interferon production in
in consultation with Prof Wang. Agonist laden particles will be made separately or in
combination with recombinant SARS-CoV chimeric spike proteins, encapsulated into our
aerodynamic MPs as well as nanoparticles.
Delivery system development (Rocke, NWHC). We have previously developed, tested and
registered oral vaccines and delivery methods to manage disease in free-ranging wildlife
including a sylvatic plague vaccine for prairie dogs24, vaccines against bat rabies25 and white-
nose syndrome (unpubl. data). We have optimized vaccine delivery methods, uptake by the
target species and safety in non-target hosts using biomarkers prior to deployment109. We will
use a similar approach to develop, test and optimize delivery methods to Rhinolophus bats in SE
Asia. While work on immune modulating agents progresses, we will concurrently develop and
test mediums, routes, and methods of delivery to large colonies of bats. We will determine the
most feasible and simple method of delivery that achieves high uptake by bats, is safe for
humans as well as target and non-target species, and minimizes colony disturbance. Sticky
edible gels or pastes that bats groom from themselves and each other have been used
previously to deliver pharmaceuticals to bats orally and we are currently testing these for use in
rabies vaccine delivery. These may also be useful for delivering immune modulators and
recombinant SARSr-CoV spike proteins to Rhinolophus bats, but may need to be combined with
viral vectors (like poxvirus or adenovirus) or nanoparticles/nanoemulsions that enhance uptake
through mucous membranes or transdermally after topical application. Poxvirus vectors:
Poxviruses are effective viral vectors for delivering vaccines to wildlife 24,110,111, and can
replicate safely at high levels in bats after oronasal administration26. We have demonstrated
proof-of-concept in bats. We modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN)
vecotrs for safety and replication in bats using in vivo biophotonic imaging25. RCN replicated to
higher levels in bats than MVA, even via the oral route, and was found to be highly safe for bats
(Fig. 12). We used raccoon poxvirus-vectored novel rabies glycoprotein (mosaic or MoG) and
demonstrated protective efficacy in bats after oronasal and topical administration25 (Fig. 13).
We are currently developing vaccine delivery for vampire bats in several Latin American
countries, and vaccines for white-nose syndrome in bats, a devastating disease that has killed
millions of insectivorous bats in North America.
30
Fig. 12. Luminescence,
indicative of viral
replication of modified
vaccinia Ankara (MVA)
and raccoon poxvirus RCN)
in the bat Tadarida
brasiliensis on 1, 3 and 5
dpi via the oronasal route.
Figure 13. Vaccine efficacy

and rabies challenge in
Epstesicus fuscus immunized with raccoon
poxvirus expressing a mosaic G protein
(RCN-MoG) either oronasally (ON) or
topically in comparison to RCN expressing
typical G protein and RCN expressing
luciferase (negative control).
Poxviruses are safe in a wide variety of
wild and domestic animals, and allow for large inserts of foreign DNA. We have previously used
a raccoon poxvirus vectored vaccine expressing plague antigens was incorporated into a
peanut-butter flavored bait matrix to manage plague caused by Yersinia pestis in prairie dogs.
We incorporated the biomarker Rhodamine B (RB) into baits to assess uptake by target and
non-target species 109,112 (Fig. 14). RB is visible under a UV microscope until the hair grows out
(~50 days in prairie dogs). We have since conducted a large field trial (approved by USDA Center
for Veterinary Biologics) that demonstrated vaccine efficacy in four species of prairie dogs in
seven western states24. We used biomarker analysis to assess site- and individual host-specific
factors that increased bait consumption including age, weight, and the availability of green
vegetation.
Fig. 14. Prairie dog hair and whisker samples
under fluorescence microscope (excitation
wavelength: 540 nm, emission wavelength:
625 nm) to determine uptake of baits
containing Rhodamine B. a) 20 days after
bait distribution, b) 16 days after bait distribution, c) and d) controls (note natural dull
fluorescence).
Transcutaneous delivery: In addition to viral, we will also consider methods to achieve
31
Nanoparticles have been used to increase transcutaneous delivery efficiency113. However, the
impermeable stratum corneum provides a difficult barrier to breach. Mechanical approaches
have been used113 but are somewhat unethical and impractical for wildlife. We are currently
testing poly lactic-co-glycolic acid (PLGA) as a nanoparticle to encapsulate rabies glycoprotein as
a method of transcutaneous delivery of vaccine to bats via dendritic cell uptake114, as has been
shown for delivery of TLR agonists and antigens simultaneously to mice115. This approach will be
competitively trialed against ac-DEX to encapsulate and deliver SARSr-CoV glycoproteins, with
and without adjuvants116, e.g. Matrix M1 (Isconova, Sweden) which has been shown to
significantly enhance the immune response in mice to SARS-CoV spike proteins18. For efficiency
and to reduce costs, initial trials will be conducted in the USA with locally acquired
insectivorous big brown bats (Eptesicus fuscus) which we have maintained and housed for
several experiments at our facility previously25,26. We will treat bats via topical application with
various test formulations that include the biomarker Rhodamine B (RB), co-house them with
untreated bats, and monitor transfer between bats by collecting hair and whiskers for
biomarker analysis.
Initial field trials: Bat are not attracted to baits, so delivery in the field is challenging. The high
rates of self and mutual grooming observed in bats has previously been exploited to cull
vampire bats using poisons like warfarin, applied topically to a small number of bats. Once
released, contact and mutual grooming transfers the poison within the colony. We have
conducted preliminary biomarker studies in vampire bats in both Mexico and Peru and also in
insectivorous bats in Wisconsin. In Peru, we conducted trials with RB-labeled glycerin jelly.
Based on capture-recapture data, we estimated a rate of transfer from 1.3 – 2.8 bats for every
bat marked. We are analyzing factors associated with rates of transfer, e.g. sex and age of
initially treated bats, time of day, to model the rate of vaccination and impact on rabies
transmission with different rates of application, prior to actual deployment of vaccine in the
field. More recently, we applied RB marked glycerin jelly to the entry of bat houses used by
little brown bats (Myotis lucifugus). Of 29 bats trapped one week post-application, 59% were
positive for biomarker indicating they had eaten the jelly. We will conduct initial trials with each
of the delivery vehicles in caves in Wisconsin, targeting local US insectivorous bats. Within one
week of application, bats will be trapped at the cave entrance using mist nets or Harp traps and
hair will be collected to assess the rate of uptake via biomarker analysis. The bats will be
released immediately afterward. The procedures will be tested at several different locations as
it will likely take some manipulation to determine appropriate dosages for maximum uptake.
After we have determined the most optimal approaches for mass delivery, we will then test
them on wild bats in our three cave sites in Yunnan Province. Again, biomarker will be used to
assess rates of uptake and this data can then be used in modeling studies to help determine the
optimal rates of application of immunomodulating agents. Biomarker studies can also be used
32
to assess uptake by non-target species, an important consideration in evaluating safety.
Fieldwork will be conducted in collaboration with Dr. Yunzhi Zhang (Yunnan CDC, Consultant at
Prototype PARC FEA aerosolization platform: Once we have confirmed uptake in laboratory
studies, we will then assess mass delivery methods in local caves and hibernacula (using
biomarker-labeled mediums but without immunomodulatory substances). In collaboration with
Dr. Jerome Unidad of Palo Alto Research Center (PARC), we will adapt their innovative aerosol
technology to cave settings in the form of a field-deployable spray device triggered by timers
and movement detectors at critical cave entry points. PARC’s Filament Extension Atomization
(FEA) (Fig. 15) can spray fluids with a wide-range of viscosities ranging from 1mPa-s to 100Pa-s
using a roll-to-roll misting process (https://www.parc.com/services/focus-area/amds/). This will
make it compatible with all the fluid formulations above including the immune-modulating
formulations from TA2, gels and creams for topical delivery and Poxvirus formulations, making
it a universal platform for inoculating bats. We will subcontract to PARC to develop a prototype
FEA system for lab testing, optimize spray conditions for DEFUSE fluids, manipulate fluid
formulation for targeted spreading and bioefficacy, and design a prototype field-deployable
system. We will initially trial this on captive bats at NWHC, then on Wisconsin cave bats, then at
our test sites in Yunnan Province, China. The field-deployable system will be motion-actuated,
and on a timer so that bats will be targeted at fly-in and fly-out, and diurnal flying non-target
species (e.g. cave swiftlets) avoided.
33
Fig. 15: Beads-on-a-string structures in a viscoelastic fluid in extension, B. Multiple beads-on-a- Commented [PD37]: This is from the PARC pdf they
string formations in counter-rotating rollers (FEA), C. FEA spraying of PEO solution, D. hyaluronic sent to us. Can someone create a neat image please..
acid, and E. sunscreen. Inset roller technology and portable sprayer design.
Dynamic circulation modeling to optimize deployment strategy. To select amongst various

options for immune boosting, priming, and targeting, and multiple delivery options and
schedules, we will simulate deployment using a model of viral circulation in cave bat
populations. The model will be fit to data from our three-cave test system but designed to be
robust to be generalizable to other cases. We will simulate outcomes under a variety of
different deployment scenarios to produce conservative estimate of necessary application
under real-world conditions. Fit stochastic viral circulation models to longitudinal sampling
data: We will use longitudinal viral prevalence, mark-recapture estimates of bat populations,
radiotelemetry and infrared camera data collected during our field sampling to parameterize
and construct models of bat population dynamics and viral circulation in our test caves. We will
use a simple but robust stochastic SIR process model with immigration and emigration and
flexible, nonlinear contact rates between bats117. This model structure can capture a wide range
of viral dynamics from intermittent viral outbreaks to regular, endemic circulation with a
relatively small number of parameters. We will fit these models to our sampling data using the
partially observable markov process (pomp) framework118, allowing estimates of the
underlying latent dynamic disease transmission process, accounting for and separating the
natural stochasticity of viral circulation and observation error in sampling. We will validate our
models via temporal cross-validation: leaving out successive sections on longitudinal time-
series from our model fitting to test the model, and by testing the results of a fit from two cave
sites on data from a third. Simulate circulation under a set of plausible deployment scenarios.
Using the top performing sets of immune boosting and targeted immune priming molecules
from captive trials, and the delivery media and methods with the greatest uptake rates in cave
studies, we will use the stochastic SIR model to generate simulations of viral circulation under a
series of treatment deployments in our focal study caves. These scenarios will cover a range of
plausible intensities, frequencies, and combinations of suppression strategies. They will
incorporate uncertainty in the efficacy of each of the treatment strategies. From these
simulations, we will estimate the expected degree and time period of suppression of viral
circulation and shedding and the uncertainty in this expectations. We will determine the
optimal scenario for deployment in our focal study caves. Test robustness of deployment
strategies under broader conditions: We will use our simulation models to determine best
strategies for deployment under a variety of conditions covering likely environments. We
anticipate the deployment is likely to occur under (a) highly varied species population and
compositions, with uncertain estimates based on rough observations (b) varied uptake and
efficacy of immune boosting and targeting molecules due to different environmental
conditions, and (c) limited time or resources to deploy treatment. Thus, we will simulate
34
deployment under many potential conditions to determine how optimal deployment differs
according to condition, and determine deployment strategies which are conservative and
robust to these uncertainties and limitations.
Proof-of-concept deployment of immune modulation molecules in test caves in Yunnan

Province, China. Commented [PD38]: Kevin/Jon/Hongying: We need a
section on this, including how we will work initially on
captive R. sinicus or R. ferrumequinum, then trial out RB
in caves, then deploy. Just a paragraph, including how we
will cordon off side pockets, side entrances to deploy in
MANAGEMENT PLAN controlled volume, then how we would be able to scale
up from that. Need to give details of the number of bats
● Provide a summary of expertise of the team, including any subcontractors, and key we’ll target and how we’ll prove suppression of viral load
● Identify a principal investigator for the project.
● Provide a clear description of the team’s organization
● Include an organization chart with the following information, as applicable:

● Provide a detailed plan for coordination including explicit guidelines for interaction among
● Include risk management approaches.
● Describe any formal teaming agreements that are required to execute this program.
35
NWHC for initial trials, and oversee cave experiments in China.
global map of EID hotspots119,120, estimates of unknown viral diversity121, predictive models of
virus-host relationships3, and evidence of the bat origin of SARS-CoV29 and other emerging
viruses 122-125. He is Chair of the NASEM Forum on Microbial Threats, and is a member of the
Executive Committee and the EHA institutional lead for the $130 million USAID-EPT-PREDICT.
He serves on the NRC Advisory Committee to the USGCRP, the DHS CEEZAD External Advisory
Board, the WHO R&D Blueprint Pathogen Prioritization expert group, and has advised the
Director for Medical Preparedness Policy on the White House National Security Staff on global
health issues. Dr. Daszak won the 2000 CSIRO medal for collaborative research.
of disease (REFS).
36
Prof. Linfa Wang is Director, Programme in Emerging Infectious Diseases, Duke-NUS Medical
School, Singapore. His proven track record in the field includes identifying the bat origin of
SARS-CoV, pioneering work on Henipaviruses and many more. His work has shifted from
identifying the bat-origin of pathogens to understanding basic bat biology and the mechanisms
by which they can endure sustained virus infection. He has received multiple awards including
the 2014 Eureka Prize for Research in Infectious Diseases. He currently heads and administers a
Singapore National Research Foundation grant on “Learning from bats” for $9.7M SGD. He is an
advisory member of …. an Editor of multiple journals and current Editor-in-Chief for the Journal
Virology.
Dr. Danielle Anderson is the Scientific Director of the Duke-NUS ABSL3 laboratory and is an
expert in RNA virus replication. Dr Anderson has extensive experience in both molecular biology
and animal models and will lead the animal studies. Dr Anderson has established Zika, Influenza Commented [Ai39]: doi: 10.1038/s41598-018-
20185-8, doi: 10.1016/S1473-3099(17)30249-9 &
and Reovirus non-human primate (NHP) models in Singapore, using different inoculation routes Nature DOI if in time…
(such as mosquito inoculation), and has performed trials on over 30 NHPs.
Dr Aaron Irving is an experienced postdoctoral fellow in the field of innate immunity and viral
sensing with expertise focusing on host-pathogen interactions and intrinsic immunity. He Commented [Ai40]: PMID:24746552, PMID:
22633459, PMID: 27934903
oversees multiple projects on bat immune activation within Prof. Linfa Wang’s laboratory at
Duke-NUS Medical School and has experience in in vivo animal infection models.
Prof. Zhengli Shi: Dr. Shi is the director of the Center for Emerging Infectious Diseases of the
Wuhan Institute of Virology, Chinese Academy of Sciences. She got Ph.D training in Virology in
Montpellier University II from 1996 to 2000, biosafety training at Australian Animal Health
Laboratory in May 2006 and at Lyon P4 in October 2006. She is now in charge of the scientific
activity in BSL3 and BSL4 of the Institute. Her research focuses on viral pathogen discovery
through traditional and high-throughput sequencing techniques. She has been studying the
wildlife-borne viral pathogens, particularly bat-borne viruses since 2004. Her group has
discovered diverse novel viruses/virus antibodies in bats, included SARS-like coronaviruses,
adenoviruses, adeno-associated viruses, circoviruses, paramyxoviruses and filoviruses in China.
One of her great contributions is to uncover genetically diverse SARS-like coronaviruses in bats
with her international collaborators and provide unequivocal evidence that bats are natural
reservoir of SARS-CoV by isolation of one strain that is closely related to the SARS-CoV in 2002-
3. She has coauthored >100 publications on viral pathogen identification, diagnosis and
epidemiology.
Dr. Peng Zhou is a

Dr. Xinglou Yang
Dr. Ben Hu
37
Dr. Kevin Olival is VP for Research at EcoHealth Alliance. His research over the last 15 years has
focused on understanding the ecology and evolution of emerging zoonoses, with a focus on
developing analytical tools and modeling approaches to forecast and prioritize the discovery
and surveillance of viral zoonoses. This includes a recent large scale analysis identifying host
and viral predictors of spillover in mammals [REF, Nature]. He has led several international field
teams to investigate bat-borne viruses globally. Dr. Olival is the Modeling and Analytics
coordinator for the USAID PREDICT-2 project; co-PI on an NIH-NIAID project to investigate CoVs
in China; and PI on recent DTRA-CBEP grant to characterize CoVs from bats in Western Asia.
CAPABILITIES
● Describe organizational experience in relevant subject area(s), existing intellectual property,

● Discuss any work in closely related research areas and previous accomplishments.
submitted).
38
STATEMENT OF WORK
● Provide a detailed task breakdown, citing specific tasks and their connection to the interim
● Each phase of the program (Phase I base and Phase II option) should be separately defined
● For each task/subtask, provide:

task/subtask.


o A definition of all deliverables (e.g. data, reports, software) to be provided to the

Phase I: Commented [PD41]: Below is formatted like the
THUNDER proposal – need to follow that approach, with
the example below of the sort of length
TA-01 Task 1.1 Construct species distribution models to predict viral spillover risk in cave bats in
Sub-task 1.1.1.;lkj;lkj;klj
Sub-task 1.1.2.;lj;lkj;lkj
Deliverables: models capable of …..
TA-01 Task 2.5: Field studies to collect tolerant reservoir species. (EcoHealth Alliance, William
Karesh).
39
Sub-Task 2.5.1. Apply for and obtain IACUC approval and appropriate wildlife permits in
Bangladesh for sample collection. Collection of blood and urogenital, oropharyngeal and rectal swab
specimens from targeted bat, rodent and non-human primate species from Bangladesh (n = 1000
specimens). Collection of wing-punch dermal tissue biopsies from bats (n = 300).
Sub-Task 2.5.2. Field work is to be conducted by a trained field team using ethical, nondestructive
capture, restraint, and sample collection techniques (with IACUC and local government approval).
Samples are to be preserved in RNA later (or other preservative) to maintain cellular integrity and
frozen at the point of collection using a liquid nitrogen dry shipper and maintained in -80oC. All
samples are to be shipped with appropriate government permission and export permits.
Deliverables: 1000 field specimens (whole blood, nasal/rectal swabs) collected from reservoir bats,
rodents and non-human primates which have been obtained with all proper permits and
permissions are appropriately shipped for further analysis.
TA1:
Task 1.1
Sub-task 1.1.1. Models to predict bat community in caves across S. and SE Asia.
Sub-task 1.1.2. Models to predict presence of viruses with zoonotic potential in bats across S.
and SE Asia.
Progress Metrics:
● Joint species distribution model fit for Asian Bats
● Cave-level predictions of bat community composition
● Linear predictions of viral diversity in cave populations
● JSDM predictions of viral diversity in cave populations
● Prediction validations
Deliverable(s):
● Deployable spatial model software of bat community composition
● Deployable spatial model software of viral diversity in bat cave populations
Progress Metrics:
Deliverable(s):
40
Subtask 1.1.3: Develop prototype app for the warfighter

Preliminary Data:
Progress Metrics: Development of fully functional and user-friendly application. Use of
application in the field.
Deliverables:
Task 1.2: Determining baseline risk of SARSr-CoV emergence in Yunnan, China

Subtask 1.2.1. Longitudinal sampling of bats to determine virus prevalence and diversity in
Yunnan cave sites.
Subtask 1.2.2. Analyzing ability of CoVs to infect and emerge in people
(TA1) Subtask 5: Assay SARr-CoV quasispecies for spillover potential via assays for binding,
cell entry, and pathogenesis in mouse models.
Deliverable(s):
a. Preliminary Data: Molecular Clones for SARSr-CoV WIV1, WIV16, SHC014 and
HKU3-SRBD exist. We have demonstrated in the preliminary data that these
reagents are already available.
b. Target Goals: We will generate molecular constructs for 20+ chimeric SARSr-CoV
encoding different S glycoprotein genes/yr

a. Preliminary Data: Demonstrated recovery recombinant chimeric SARSr-CoV
WIV1, WIV16, SHC014, HKU3-SRBD, including full length recombinant viruses of
41
WIV1, WIV16, SHC014 and HKU3-SRBD.
b. Target Goals: We will isolate 20+ chimeric SARSr-CoV encoding novel S
glycoprotein genes
i. Key Deliverables for Program-wide Success: These two key reagents
position us for immediate testing of the antiviral effects of broadscale
immune boosting molecules +/- immunogens on virus growth in vitro
and in vivo, and on virus levels in models of chronic SARS-CoV infection in
mice.

a. Preliminary Data: Cell lines encoding bat, human, civet and mouse ACE2
receptors exist and have been validated. We have demonstrated the use of
primary human airway epithelial cultures to characterize SARSr-CoV pre-epidemic
potential.
b. Target Goals: We will characterize SARSr-CoV recombinant virus growth in Vero
cells, nonpermissive cells encoding the civet, bat and human ACE2 receptors.

a. Preliminary Data: We also have transgenic human ACE2 mouse models to
compare the pathogenic potential of SARSr-CoV
b. Target Goals: We will evaluate SARSr-CoV pathogenic outcomes in hACE2
transgenic mice.

a. Preliminary Data: We have robust panels of broadly cross reactive human
monoclonal antibodies against SARS and related viruses and mouse models to
evaluate protection against SARSr-CoV replication and pathogenesis.
b. We will evaluate SARS-vaccine performance against a select subset of SARSr-CoV
(10), chosen based on the overall percent of antigenic variation, coupled with
distribution across the S glycoprotein structure.

a. We will identify the presence of low abundant, high risk SARSr-CoV, based on
deep sequencing data

a. We will evaluate the role of proteolytic cleavage site variation on SARSr-CoV
42
cross species transmission and pathogenesis in vivo.
(TA1) Subtask 4: Build models to predict viral species spillover potential and evoluation
Progress Metrics:
● Development of prior-based pathogenicity predictions and sequence testing guidance
● Model fits from initial rounds of viral characterization
● Model fits from secondary rounds of viral characterization
● Predictions of spillover probability of sequenced viral QS
● Deployable predictive model
Deliverable(s):
● Fit models as reproducible, deployable software providing virus spillover potential
predictions and uncertainties based on input of host species and viral sequence data
● Ranking of potential pathogenicity of virus QS from both Task X sampling and previous
data.


Progress Metrics:
Deliverable(s):
1. Chimeric S-Glycoprotein Antigen Design, Recovery and Phenotyping for Immune
Boosting.
43
a. Preliminary Data: Demonstrated recovery recombinant chimeric HKU3-Smix,
demonstrating preservation of entry functions in the chimeric spike. Neutralizing
epitopes and in vivo pathogenesis phenotypes were also preserved. Chimeric
Spikes are biologically functional.
b. Target Goals: We will isolate chimeric HKU3-SS014 S and WIV-SS014 genes,
chimeric viruses and express the S glycoprotein from VRP and raccoon poxvirus
expression vectors.
c. Target Goals: We will synthesize 2-3 chimeric S glycoproteins, recover
recombinant viruses derived from natural recombinants in the population
genetic structure of SARSr-CoV. We will also characterized recombinant protein
expression from VRP and raccoon poxviruses.
d. Target Goals: We produce sufficient recombinant HKU3-SS014, WIV-SS014 and
HKU3-Smix S glycoproteins for inclusion in nanoparticle and microparticle delivery
vehicles.
immune boosting molecules +/- immunogens.
2. Virus Phenotyping: Receptor Interactions and Growth in vitro and in vivo.

a. Preliminary Data: We have well developed metrics for evaluating chimeric S
glycoprotein function in the context of whole virus, neutralization phenotypes
and expression as recombinant proteins vaccines for testing in mice.
b. Target Goals: Demonstrate chimeric S function in the context of virus infection in
Vero and HAE cells and susceptibility to neutralizing antibodies targeted the SARS
RBD.
c. Target Goals: Evaluate chimeric virus pathogenesis in hACE2 transgenic mice and
the ability of VRP vaccines encoding chimeric spikes to elicit protective immunity
against lethal SARS-CoV, HKU3-Smix and SCH014 challenge.
3. Production of Agonist (TLR4, dsRNA, Sting) and Chimeric S glycoprotein Nanoparticle

and Microparticle Suspensions for in vivo studies
a. Preliminary Data: Robust preliminary data exists on the production and
immunogenicity of nanoparticle and microparticle delivery systems.
b. Target Goals: Produce nanoparticle and microparticle delivery systems encoding
agonists, coupled with in vitro testing in vitro in bat and in other reporter cells,
mice and bats.
c. Target Goals: Inclusion of chimeric recombinant proteins and agonists in
nanoparticle and microparticle delivery vehicles, coupled with testing in vitro and
44
in vivo in mice and bats.
d. Target Goals: Perform in vivo testing in collaboration with Dr. Shi and Dr. Wang.
SCHEDULE AND MILESTONES
● Provide a detailed schedule showing tasks (task name, duration, work breakdown
● Measurable milestones should be clearly articulated and defined in time relative to the
PREEMPT TRANSITION PLAN Commented [PD42]: Description from the BAA:
● Indicate the types of partners (e.g. government, private industry, non-profit) PREEMPT Transition Plan
Proposers must include a PREEMPT Technology
Transition Plan. Proposers must indicate the types of
● Submit a timeline with incremental milestones toward successful engagement. partners (e.g. government, private industry, non-profit)
they plan to pursue and submit a timeline with
NOTE: begin transition activities during the early stages of the program (Phase I). incremental milestones toward successful engagement.
Proposers should begin transition activities during the
early stages of the program (Phase I). Awardees must
● Describe any potential DARPA roles. include
DARPA in the development of transition relationships.
If the transition plan includes a start-up company, a
business development strategy must be included as
PREEMPT RISK MITIGATION PLAN well. The extent by which the proposed intellectual
property (IP) rights will impede the Government’s ability
● Provide the following: to transition the technology will be considered in the
proposal evaluation.


45
ETHICAL, LEGAL, SOCIETAL IMPLICATIONS
● Address potential ethical, legal, and societal implications of the proposed technology.
BIBLIOGRAPHY
This and next part don’t count toward 36 page limit
RELEVANT PAPERS
Propose:
• Ge et al. Nature
• Menacherry et al.
• Zhou et al. SADS-CoV
1 Quan, P.-L. et al. Identification of a severe acute respiratory syndrome coronavirus-

like virus in a leaf-nosed bat in Nigeria. MBio 1, e00208-00210 (2010).
2 Drexler, J. F. et al. Genomic characterization of severe acute respiratory syndrome-
related coronavirus in European bats and classification of coronaviruses based on
partial RNA-dependent RNA polymerase gene sequences. J Virol 84,
doi:10.1128/jvi.00650-10 (2010).
3 Olival, K. J. et al. Host and viral traits predict zoonotic spillover from mammals.
Nature 546, 646-650 (2017).
4 Sheahan, T. P. et al. Broad-spectrum antiviral GS-5734 inhibits both epidemic and
zoonotic coronaviruses. Science translational medicine 9, eaal3653 (2017).
5 Anthony, S. et al. Further evidence for bats as the evolutionary source of Middle East
respiratory syndrome coronavirus. MBio 8, e00373-00317 (2017).
6 Cockrell, A. S. et al. A mouse model for MERS coronavirus-induced acute respiratory
distress syndrome. Nature microbiology 2, 16226 (2017).
7 Menachery, V. D. et al. SARS-like WIV1-CoV poised for human emergence.
Proceedings of the National Academy of Sciences of the United States of America 113,
3048-3053, doi:10.1073/pnas.1517719113 (2016).
8 Menachery, V. D. et al. A SARS-like cluster of circulating bat coronaviruses shows
potential for human emergence. Nature Medicine 21, 1508-1513,
doi:10.1038/nm.3985 (2015).
46
9 Zhang, G. et al. Comparative analysis of bat genomes provides insight into the
10 Xie, J. et al. Dampened STING-Dependent Interferon Activation in Bats. Cell host &
microbe (2018).
11 Zhou, P. et al. Contraction of the type I IFN locus and unusual constitutive expression
of IFN-α in bats. Proceedings of the National Academy of Sciences 113, 2696-2701
(2016).
12 Kugel, D. et al. Intranasal Administration of Alpha Interferon Reduces Seasonal
Influenza A Virus Morbidity in Ferrets. Journal of Virology 83, 3843-3851,
doi:10.1128/jvi.02453-08 (2009).
13 Farr, B., Gwaltney, J., Adams, K. & Hayden, F. Intranasal interferon-alpha 2 for
prevention of natural rhinovirus colds. Antimicrobial agents and chemotherapy 26,
31-34 (2009).
14 Smith, L. M. et al. Interferon-β therapy prolongs survival in rhesus macaque models
of Ebola and Marburg hemorrhagic fever. The Journal of infectious diseases 208, 310-
318 (2013).
15 Zhao, J. et al. Intranasal treatment with poly (I· C) protects aged mice from lethal
respiratory virus infections. Journal of virology 86, 11416-11424 (2012).
16 Deng, X. et al. A chimeric virus-mouse model system for evaluating the function and
inhibition of papain-like proteases of emerging coronaviruses. Journal of virology
88, 11825-11833 (2014).
17 Pallesen, J. et al. Immunogenicity and structures of a rationally designed prefusion
MERS-CoV spike antigen. Proceedings of the National Academy of Sciences 114,
E7348-E7357 (2017).
18 Coleman, C. M. et al. Purified coronavirus spike protein nanoparticles induce
19 Coleman, C. M. et al. MERS-CoV spike nanoparticles protect mice from MERS-CoV
infection. Vaccine 35, 1586-1589, doi:10.1016/j.vaccine.2017.02.012 (2017).
20 Du, L. et al. A 219-mer CHO-expressing receptor-binding domain of SARS-CoV S
immunology 23, 211-219 (2010).
21 Sheahan, T. et al. Successful vaccination strategies that protect aged mice from lethal
challenge from influenza virus and heterologous severe acute respiratory syndrome
coronavirus. Journal of virology 85, 217-230 (2011).
22 Agnihothram, S. et al. A mouse model for Betacoronavirus subgroup 2c using a bat
coronavirus strain HKU5 variant. MBio 5, e00047-00014 (2014).
23 Becker, M. M. et al. Synthetic recombinant bat SARS-like coronavirus is infectious in
cultured cells and in mice. Proc Natl Acad Sci U S A 105, 19944-19949 (2008).
24 Rocke, T. E. et al. Sylvatic plague vaccine partially protects prairie dogs (Cynomys
spp.) in field trials. Ecohealth 14, 438-450 (2017).
25 Stading, B. et al. Protection of bats (Eptesicus fuscus) against rabies following topical
or oronasal exposure to a recombinant raccoon poxvirus vaccine. Plos Neglect. Trop.
Dis. 11, doi:10.1371/journal.pntd.0005958 (2017).
26 Stading, B. R. et al. Infectivity of attenuated poxvirus vaccine vectors and
immunogenicity of a raccoonpox vectored rabies vaccine in the Brazilian Free-tailed
47
bat (Tadarida brasiliensis). Vaccine 34, 5352-5358,
doi:10.1016/j.vaccine.2016.08.088 (2016).
27 Yang, X. L. et al. Isolation and Characterization of a Novel Bat Coronavirus Closely
Related to the Direct Progenitor of Severe Acute Respiratory Syndrome Coronavirus.
Journal of Virology 90, 3253-3256, doi:10.1128/jvi.02582-15 (2016).
28 Zeng, L.-P. et al. Bat Severe Acute Respiratory Syndrome-Like Coronavirus WIV1
Encodes an Extra Accessory Protein, ORFX, Involved in Modulation of the Host
Immune Response. Journal of Virology 90, 6573-6582, doi:10.1128/jvi.03079-15
(2016).
29 Ge, X. Y. et al. Isolation and characterization of a bat SARS-like coronavirus that uses
the ACE2 receptor. Nature 503, 535-538, doi:10.1038/nature12711 (2013).
30 Hu, B. et al. Discovery of a rich gene pool of bat SARS-related coronaviruses provides
new insights into the origin of SARS coronavirus. PLoS pathogens 13, e1006698,
doi:10.1371/journal.ppat.1006698 (2017).
31 Li, W. et al. Angiotensin-converting enzyme 2 is a functional receptor for the SARS
coronavirus. Nature 426, 450 (2003).
32 Li, W. et al. Bats are natural reservoirs of SARS-like coronaviruses. Science 310, 676-
679 (2005).
33 Yuan, J. et al. Intraspecies diversity of SARS-like coronaviruses in Rhinolophus
sinicus and its implications for the origin of SARS coronaviruses in humans. Journal
of general virology 91, 1058-1062 (2010).
34 Wang, N. et al. Serological Evidence of Bat SARS-Related Coronavirus Infection in
Humans, China. Virologica Sinica, doi:10.1007/s12250-018-0012-7 (2018).
35 Harris, D. J. Generating realistic assemblages with a joint species distribution model.
Methods in Ecology and Evolution 6, 465-473 (2015).
36 Luo, J. et al. Bat conservation in China: should protection of subterranean habitats be
a priority? Oryx 47, 526-531 (2013).
37 Karger, D. N. et al. Climatologies at high resolution for the earth’s land surface areas.
Scientific data 4, 170122 (2017).
38 Phelps, K., Jose, R., Labonite, M. & Kingston, T. Correlates of cave-roosting bat
diversity as an effective tool to identify priority caves. Biological Conservation 201,
201-209 (2016).
39 IUCN. Vol. 2017-1 (2017).
40 GBIF.org. GBIF Occurrence Download.
41 Wildlife Acoustics. Wildlife Acoustics Bioacoustic Monitoring System,
<https://www.wildlifeacoustics.com/products/echo-meter-touch-
2?gclid=EAIaIQobChMI3qnOmK_o2QIVDlcNCh1KRwZuEAAYASAAEgJvVPD_BwE>
(2018).
42 Mac Aodha, O. et al. Bat Detective-Deep Learning Tools for Bat Acoustic Signal
Detection. bioRxiv, 156869 (2017).
43 Walker, F. M., Williamson, C. H., Sanchez, D. E., Sobek, C. J. & Chambers, C. L. Species
from feces: order-wide identification of Chiroptera from guano and other non-
invasive genetic samples. PloS one 11, e0162342 (2016).
44 Azmy, S. N. et al. Counting in the dark: Non-intrusive laser scanning for population
counting and identifying roosting bats. Scientific reports 2, 524 (2012).
48
45 Shazali, N. et al. Assessing Bat Roosts Using the LiDAR System at Wind Cave Nature
Reserve in Sarawak, Malaysian Borneo. Acta Chiropterologica 19, 199-210 (2017).
46 McFarlane, D. A. et al. Terrestrial LiDAR-based automated counting of swiftlet nests
in the caves of Gomantong, Sabah, Borneo. International Journal of Speleology 44,
191 (2015).
47 Anthony, S. J. et al. Coronaviruses in bats from Mexico. Journal of General Virology
94, 1028-1038 (2013).
48 Anthony, S. J. et al. Global patterns in coronavirus diversity. Virus Evolution 3,
doi:10.1093/ve/vex012 (2017).
49 Sheahan, T. et al. Mechanisms of zoonotic severe acute respiratory syndrome
coronavirus host range expansion in human airway epithelium. Journal of Virology
82, 2274-2285, doi:10.1128/jvi.02041-07 (2008).
50 Kirchdoerfer, R. N. et al. Pre-fusion structure of a human coronavirus spike protein.
Nature 531, 118-121, doi:10.1038/nature17200 (2016).
51 Gui, M. et al. Cryo-electron microscopy structures of the SARS-CoV spike
glycoprotein reveal a prerequisite conformational state for receptor binding. Cell
Res. 27, 119-129, doi:10.1038/cr.2016.152 (2017).
52 Li, F. Structural analysis of major species barriers between humans and palm civets
for severe acute respiratory syndrome coronavirus infections. Journal of Virology
82, 6984-6991, doi:10.1128/jvi.00442-08 (2008).
53 Li, F., Li, W. H., Farzan, M. & Harrison, S. C. Structure of SARS coronavirus spike
receptor-binding domain complexed with receptor. Science 309, 1864-1868,
doi:10.1126/science.1116480 (2005).
54 Huang, I. C. et al. SARS coronavirus, but not human coronavirus NL63, utilizes
cathepsin L to infect ACE2-expressing cells. Journal of Biological Chemistry 281,
3198-3203, doi:10.1074/jbc.M508381200 (2006).
55 Yang, Y. et al. Receptor usage and cell entry of bat coronavirus HKU4 provide insight
into bat-to-human transmission of MERS coronavirus. Proceedings of the National
Academy of Sciences of the United States of America 111, 12516-12521,
doi:10.1073/pnas.1405889111 (2014).
56 Earnest, J. T. et al. The tetraspanin CD9 facilitates MERS-coronavirus entry by
scaffolding host cell receptors and proteases. PLoS pathogens 13,
doi:10.1371/journal.ppat.1006546 (2017).
57 Rockx, B. et al. Escape from Human Monoclonal Antibody Neutralization Affects In
Vitro and In Vivo Fitness of Severe Acute Respiratory Syndrome Coronavirus.
Journal of Infectious Diseases 201, 946-955, doi:10.1086/651022 (2010).
58 Zeng, L. P. et al. Cross-neutralization of SARS coronavirus-specific antibodies against
bat SARS-like coronaviruses. Science China-Life Sciences 60, 1399-1402,
doi:10.1007/s11427-017-9189-3 (2017).
59 Huynh, J. et al. Evidence Supporting a Zoonotic Origin of Human Coronavirus Strain
NL63. Journal of Virology 86, 12816-12825, doi:10.1128/jvi.00906-12 (2012).
60 Donaldson, E. F. et al. Systematic Assembly of a Full-Length Infectious Clone of
Human Coronavirus NL63. Journal of Virology 82, 11948-11957,
doi:10.1128/jvi.01804-08 (2008).
61 Scobey, T. et al. Reverse genetics with a full-length infectious cDNA of the Middle
East respiratory syndrome coronavirus. Proceedings of the National Academy of
49
Sciences of the United States of America 110, 16157-16162,
doi:10.1073/pnas.1311542110 (2013).
62 Yount, B. et al. Reverse genetics with a full-length infectious cDNA of severe acute
respiratory syndrome coronavirus. Proceedings of the National Academy of Sciences
of the United States of America 100, 12995-13000, doi:10.1073/pnas.1735582100
(2003).
63 Bertram, S. et al. Cleavage and Activation of the Severe Acute Respiratory Syndrome
Coronavirus Spike Protein by Human Airway Trypsin-Like Protease. Journal of
Virology 85, 13363-13372, doi:10.1128/JVI.05300-11 (2011).
64 Simmons, G., Zmora, P., Gierer, S., Heurich, A. & Pöhlmann, S. Proteolytic activation
of the SARS-coronavirus spike protein: Cutting enzymes at the cutting edge of
antiviral research. Antiviral research 100, 605-614,
doi:10.1016/j.antiviral.2013.09.028 (2013).
65 Reinke, L. M. et al. Different residues in the SARS-CoV spike protein determine
cleavage and activation by the host cell protease TMPRSS2. PLoS ONE 12, e0179177,
doi:10.1371/journal.pone.0179177 (2017).
66 Lu, G. W., Wang, Q. H. & Gao, G. F. Bat-to-human: spike features determining 'host
jump' of coronaviruses SARS-CoV, MERS-CoV, and beyond. Trends in Microbiology
23, 468-478, doi:10.1016/j.tim.2015.06.003 (2015).
67 Walls, A. C. et al. Tectonic conformational changes of a coronavirus spike
glycoprotein promote membrane fusion. Proceedings of the National Academy of
doi:10.1073/pnas.1708727114 (2017).
68 Li, F. Structure, Function, and Evolution of Coronavirus Spike Proteins. Annual
review of virology 3, 237-261, doi:10.1146/annurev-virology-110615-042301
(2016).
69 Duckert, P., Brunak, S. & Blom, N. Prediction of proprotein convertase cleavage sites.
Protein Engineering Design & Selection 17, 107-112, doi:10.1093/protein/gzh013
(2004).
70 Tian, S., Huajun, W. & Wu, J. Computational prediction of furin cleavage sites by a
hybrid method and understanding mechanism underlying diseases. Scientific
Reports 2, 261, doi:10.1038/srep00261 (2012).
71 Shih, Y.-P. et al. Identifying Epitopes Responsible for Neutralizing Antibody and DC-
SIGN Binding on the Spike Glycoprotein of the Severe Acute Respiratory Syndrome
Coronavirus. Journal of Virology 80, 10315-10324, doi:10.1128/JVI.01138-06
(2006).
72 Han, D. P., Lohani, M. & Cho, M. W. Specific Asparagine-Linked Glycosylation Sites
Are Critical for DC-SIGN- and L-SIGN-Mediated Severe Acute Respiratory Syndrome
Coronavirus Entry. Journal of Virology 81, 12029-12039, doi:10.1128/JVI.00315-07
(2007).
73 Merkle, E. & Rossel, Y. blavaan: Bayesian Structural Equation Models via Parameter
Expansion. arXiv (2016).
74 Harrison, S., Safford, H. D., Grace, J. B., Viers, J. H. & Davies, K. F. Regional and local
species richness in an insular environment: serpentine plants in California.
Ecological Monographs 76, 41-56 (2006).
50
75 Johnson, P. T., Hoverman, J. T., McKenzie, V. J., Blaustein, A. R. & Richgels, K. L.
Urbanization and wetland communities: applying metacommunity theory to
understand the local and landscape effects. Journal of Applied Ecology 50, 34-42
(2013).
76 Drummond, A. J. & Rambaut, A. BEAST: Bayesian evolutionary analysis by sampling
trees. BMC Evolutionary Biology 7, 214 (2007).
77 McVean, G., Awadalla, P. & Fearnhead, P. A coalescent-based method for detecting
and estimating recombination from gene sequences. Genetics 160, 1231-1241
(2002).
78 Wilson, D. J. & McVean, G. Estimating diversifying selection and functional constraint
in the presence of recombination. Genetics 172, 1411-1425 (2006).
79 Martin, D. P., Murrell, B., Golden, M., Khoosal, A. & Muhire, B. RDP4: Detection and
analysis of recombination patterns in virus genomes. Virus evolution 1 (2015).
80 Petitjean, M. & Vanet, A. VIRAPOPS: a forward simulator dedicated to rapidly
evolved viral populations. Bioinformatics 30, 578-580 (2013).
81 Burbelo, P. D., Ching, K. H., Klimavicz, C. M. & Iadarola, M. J. Antibody profiling by
Luciferase Immunoprecipitation Systems (LIPS). Journal of visualized experiments :
JoVE, doi:10.3791/1549 (2009).
679, doi:10.1126/science.1118391 (2005).
83 Li, Y. et al. Antibodies to Nipah or Nipah-like viruses in bats, China. Emerging
infectious diseases 14, 1974-1976, doi:10.3201/eid1412.080359 (2008).
85 Zhou, P. et al. Fatal swine acute diarrhea syndrome caused by an HKU2-related
coronavirus of bat origin. Nature In press (2018).
86 Ahn, M., Cui, J., Irving, A. T. & Wang, L.-F. Unique Loss of the PYHIN Gene Family in
Bats Amongst Mammals: Implications for Inflammasome Sensing. Scientific Reports
6, doi:10.1038/srep21722 (2016).
87 Ahn, M., Irving, A. T. & Wang, L. F. Unusual regulation of inflammasome signaling in
bats. Cytokine 87, 156-156 (2016).
88 Paweska, J. T. et al. Lack of Marburg virus transmission from experimentally infected
to susceptible in-contact Egyptian fruit bats. The Journal of infectious diseases 212,
S109-S118 (2015).
89 Paweska, J. T. et al. Virological and serological findings in Rousettus aegyptiacus
experimentally inoculated with vero cells-adapted hogan strain of Marburg virus.
PloS one 7, e45479 (2012).
90 Schuh, A. J. et al. Modelling filovirus maintenance in nature by experimental
transmission of Marburg virus between Egyptian rousette bats. Nature
communications 8, 14446 (2017).
91 Cogswell-Hawkinson, A. et al. Tacaribe virus causes fatal infection of an ostensible
reservoir host, the Jamaican fruit bat. J Virol 86, 5791-5799, doi:10.1128/JVI.00201-
12 (2012).
92 Zhang, Q. et al. IFNAR2-dependent gene expression profile induced by IFN-α in
Pteropus alecto bat cells and impact of IFNAR2 knockout on virus infection. PLoS
ONE 12, e0182866, doi:10.1371/journal.pone.0182866 (2017).
51
93 Chua, K. B. et al. A previously unknown reovirus of bat origin is associated with an
acute respiratory disease in humans. Proc Natl Acad Sci U S A 104, 11424-11429,
doi:10.1073/pnas.0701372104 (2007).
94 Chua, K. B. et al. Investigation of a Potential Zoonotic Transmission of Orthoreovirus
Associated with Acute Influenza-Like Illness in an Adult Patient. Plos One 6,
doi:10.1371/journal.pone.0025434 (2011).
95 Fu, K. & Baric, R. S. Map locations of mouse hepatitis virus temperature-sensitive
mutants: confirmation of variable rates of recombination. Journal of Virology 68,
7458-7466 (1994).
96 Rockx, B. et al. Structural Basis for Potent Cross-Neutralizing Human Monoclonal
Antibody Protection against Lethal Human and Zoonotic Severe Acute Respiratory
Syndrome Coronavirus Challenge. Journal of Virology 82, 3220-3235,
doi:10.1128/JVI.02377-07 (2008).
97 Coughlin, M. M. & Prabhakar, B. S. Neutralizing Human Monoclonal Antibodies to
Severe Acute Respiratory Syndrome Coronavirus: Target, Mechanism of Action and
Therapeutic Potential. Reviews in Medical Virology 22, 2-17, doi:10.1002/rmv.706
(2012).
98 Bachelder, E. M., Beaudette, T. T., Broaders, K. E., Dashe, J. & Fréchet, J. M. Acetal-
derivatized dextran: an acid-responsive biodegradable material for therapeutic
applications. Journal of the American Chemical Society 130, 10494-10495 (2008).
99 Broaders, K. E., Cohen, J. A., Beaudette, T. T., Bachelder, E. M. & Fréchet, J. M.
Acetalated dextran is a chemically and biologically tunable material for particulate
immunotherapy. Proceedings of the National Academy of Sciences 106, 5497-5502
(2009).
100 Kauffman, K. J. et al. Synthesis and characterization of acetalated dextran polymer
and microparticles with ethanol as a degradation product. ACS applied materials &
interfaces 4, 4149-4155 (2012).
101 Chen, N. et al. Degradation of acetalated dextran can be broadly tuned based on
cyclic acetal coverage and molecular weight. International journal of pharmaceutics
512, 147-157 (2016).
102 Jiang, W., Gupta, R. K., Deshpande, M. C. & Schwendeman, S. P. Biodegradable poly
(lactic-co-glycolic acid) microparticles for injectable delivery of vaccine antigens.
Advanced drug delivery reviews 57, 391-410 (2005).
103 Kanthamneni, N. et al. Enhanced stability of horseradish peroxidase encapsulated in
acetalated dextran microparticles stored outside cold chain conditions. International
journal of pharmaceutics 431, 101-110 (2012).
104 Hanson, M. C. et al. Liposomal vaccines incorporating molecular adjuvants and
intrastructural T-cell help promote the immunogenicity of HIV membrane-proximal
external region peptides. Vaccine 33, 861-868 (2015).
105 Hoang, K. V. et al. Acetalated Dextran Encapsulated AR-12 as a Host-directed
Therapy to Control Salmonella Infection. International journal of pharmaceutics 477,
334-343, doi:10.1016/j.ijpharm.2014.10.022 (2014).
106 Junkins, R. D. et al. A robust microparticle platform for a STING-targeted adjuvant
that enhances both humoral and cellular immunity during vaccination. Journal of
Controlled Release 270, 1-13 (2018).
52
107 Belser, J. A., Katz, J. M. & Tumpey, T. M. The ferret as a model organism to study
influenza A virus infection. Disease models & mechanisms 4, 575-579 (2011).
108 Meenach, S. A. et al. Synthesis, optimization, and characterization of camptothecin-
loaded acetalated dextran porous microparticles for pulmonary delivery. Molecular
pharmaceutics 9, 290-298 (2012).
109 Tripp, D. W. et al. Apparent field safety of a raccoon poxvirus-vectored plague
vaccine in free-ranging prairie dogs (Cynomys spp.), Colorado, USA. Journal of
wildlife diseases 51, 401-410 (2015).
110 Slate, D. et al. Oral rabies vaccination in North America: opportunities, complexities,
and challenges. Plos Neglect. Trop. Dis. 3, e549 (2009).
111 Freuling, C. M. et al. The elimination of fox rabies from Europe: determinants of
success and lessons for the future. Phil. Trans. R. Soc. B 368, 20120142 (2013).
112 Tripp, D. W. et al. Season and application rates affect vaccine bait consumption by
prairie dogs in Colorado and Utah, USA. Journal of wildlife diseases 50, 224-234
(2014).
113 Roberts, M. et al. Topical and cutaneous delivery using nanosystems. Journal of
114 Mishra, D. K., Dhote, V. & Mishra, P. K. Transdermal immunization: biological
framework and translational perspectives. Expert opinion on drug delivery 10, 183-
200 (2013).
115 Ebrahimian, M. et al. Co-delivery of Dual Toll-Like Receptor Agonists and Antigen in
Poly (Lactic-Co-Glycolic) Acid/Polyethylenimine Cationic Hybrid Nanoparticles
Promote Efficient In Vivo Immune Responses. Frontiers in immunology 8, 1077
(2017).
116 Karande, P. & Mitragotri, S. Transcutaneous immunization: an overview of
advantages, disease targets, vaccines, and delivery technologies. Annual review of
chemical and biomolecular engineering 1, 175-201 (2010).
117 Borremans, B. et al. (Dryad Data Repository, 2016).
118 Ionides, E. L., Nguyen, D., Atchadé, Y., Stoev, S. & King, A. A. Inference for dynamic
and latent variable models via iterated, perturbed Bayes maps. Proceedings of the
National Academy of Sciences 112, 719-724 (2015).
119 Jones, K. E. et al. Global trends in emerging infectious diseases. Nature 451, 990-993,
doi:10.1038/nature06536 (2008).
120 Allen, T. et al. Global hotspots and correlates of emerging zoonotic diseases. Nature
Communications 8, 1124 (2017).
121 Anthony, S. J. et al. A strategy to estimate unknown viral diversity in mammals. MBio
4, e00598-00513 (2013).
122 Alagaili, A. N. et al. Middle East respiratory syndrome coronavirus infection in
dromedary camels in saudi arabia. MBio 5, doi:10.1128/mBio.00884-14 (2014).
123 Homaira, N. et al. Nipah virus outbreak with person-to-person transmission in a
district of Bangladesh, 2007. Epidemiology and Infection 138, 1630-1636,
doi:10.1017/s0950268810000695 (2010).
124 Islam, M. S. et al. Nipah Virus Transmission from Bats to Humans Associated with
Emerging Infectious Disease journal 22, 664, doi:10.3201/eid2204.151747 (2016).
53
125 Olival, K. J. et al. Ebola Virus Antibodies in Fruit Bats, Bangladesh. Emerging
Infectious Diseases 19, 270-273, doi:10.3201/eid1902.120524 (2013).
54
Please reply to this email - DARPA DEFUSE draft v2 - Technical Plan

Thu 3/22/2018 12:56 AM
[email protected] <[email protected]>; Baric, Toni C <[email protected]>;
[email protected] <[email protected]>; Luke Hamel <[email protected]>; Noam Ross
<[email protected]>; William B. Karesh <[email protected]>; Hongying Li
<[email protected]>; Anna Willoughby <[email protected]>
All – please don’t reply to the last email, I had Toni Baric’s wrong email address – corrected now!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
From: Peter Daszak

Rocke, Tonie; [email protected]
'[email protected]'; '[email protected]'; Luke Hamel ([email protected]); Noam
Ross; Kevin Olival, PhD ([email protected]); Jon Epstein; William B. Karesh; Hongying Li; 'Anna
Willoughby ([email protected])'
Subject: DARPA DEFUSE draft v2 - Technical Comment
Importance: High
Dear all,
Apologies for the delay - here's the draft Technical Plan for our proposal with everyone's section incorporated,
edited and shortened.
Please ignore all other sections – these are being worked on by others. We’re only editing the Technical Plan right
now.
Can each of you go through your respective section and, with one of you acting as the point person to coordinate
edits and responses from your teams:
1. Answer any questions in comment boxes
2. Insert any missing references – please just cut and paste the ref as a word doc into a comment box rather
than inserting the endnote reference at this point
3. Read through your sections and suggest edits. Best if you use lots of comment boxes, but also OK if you
start editing using ‘track changes’. NB – we need to reduce the length probably by one third, so any
suggestions and cuts would be most appreciated! Also, please just keep this as a Word doc for now –
there are formatting issues when converting backwards and forwards into Google docs and Word.
4. Ralph and team – please provide higher res images for all those in this draft, and please make sure
they’re editable – i.e. we can take out the text and alter each icon within each image
5. All – please check the language I’ve used and correct any glaring errors.
6. Can you get edits back to me, cc’d to Luke and Anna by Saturday 9am Eastern (New York) time, at which
point I’ll start trimming it back into the page limit and incorporating all the other sections.
While you’re working on these sections, I’ll be editing the rest of the proposal with Luke, Anna and others.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.
From: Peter Daszak
Rocke, Tonie
Status
Importance: High
Dear All,
calls this week.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

To: (b) (6)
Cc: (b) (6)
(b) (6)
Regards,
BAA Coordinator
[email protected]
[EXTERNAL] PREEMPT - A few important items

Fri 3/23/2018 1:45 PM
To: Abbott, Rachel (Contractor) C <[email protected]>; Richgels, Katherine L <[email protected]>
Cc: Rocke, Tonie E <[email protected]>; Jonathon Musser <[email protected]>; Evelyn Luciano
<[email protected]>
Hi Rachel and Katherine,
I wanted to address a few important PREEMPT items with you:
Regarding NWHC budget justification
If you have not already done so (and I apologize for not knowing the answer), could you
please send us your budget justification document? We are hoping to have all
collaborator budgets and budget justifications as soon as possible.
Regarding language on 'Long-term safety and efficacy'
In the PREEMPT proposal, we must state how we will establish methods to assess the
'long-term safety and efficacy of our preemptive approaches'
Given your field of work, do you have any existing language on how to address
potential negative impacts of intervention approaches on non-target species?
I have attached language from the BAA to provide you with further guidance on
what DARPA requires us to include.
This being said - Rachel and Katherine, could you please write-up a short section
(a paragraph or so), that addresses this issue 'long-term safety and efficacy'?
I apologize for the extremely short notice, but we would greatly
appreciate it if you could return this to us by tomorrow afternoon, Sat.
(3/24).
Regarding 'pricing assumptions' for NWHC facilities
Previously, we had asked you to identify any 'pricing assumptions' that may correspond
with use of government facilities. Due to confusion about what exactly was being asked
for, we reached out to DARPA staff, asking them to clarify the matter:
We asked: "EcoHealth Alliance has a USG entity listed as a subcontractor in our proposal. Is the
USG entity required to identify any pricing assumptions beyond those within their fully detailed and
documented budget?
To which they responded: "No"
Long story short...there is NO need for you to identify any additional pricing assumptions.
Thank you and please let me know if you have any questions. I will be available by email and phone (mobile number
listed below) over the weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

J. PREEMPT Risk Mitigation Plan (see Section 1.4): Proposers must provide a risk
mitigation plan that addresses the following:
1) An assessment of potential risks to public health, agriculture, plants, animals, the

2) Proposed guidelines that the proposer will follow to ensure maximal biosafety
and biosecurity during the course of the research.
3) A communication plan that addresses content, timing, and the extent of
TA2 Components:
Technical Area 2 aims to develop deployable and scalable methods to preempt viral jump
to other species. Proposers must address, at minimum, all of the following aspects:
1) Proof-of-concept preemption approaches;
2) Scalable delivery methods;
3) Analysis of long-term sustainability; and
4) Experimental validation.
3. Analysis of long-term safety and efficacy
Proposers must establish initial methods to assess the long-term safety and efficacy of
preemptive approaches (e.g., determine the mechanism by which species specificity of a
vaccine is maintained, and assess evolutionary stability and ecological safety).
Re: [EXTERNAL] PREEMPT - A few important items

Abbott, Rachel (Contractor) C <[email protected]>
Fri 3/23/2018 2:19 PM
Cc: Richgels, Katherine L <[email protected]>; Rocke, Tonie E <[email protected]>; Jonathon Musser
<[email protected]>; Evelyn Luciano <[email protected]>
Hi Luke,
I will write the paragraph on long-term safety and efficacy and send it to you later this afternoon (I'll
be on vacation for a few days starting tomorrow).
I don't know what the budget justification document is and only have budget files that Tonie has
already sent to you. I have attached them here. If it is a specific form we need to fill out, Katie
might be the best person to enter the required information.
--Rachel
If you have not already done so (and I apologize for not knowing the answer), could
you please send us your budget justification document? We are hoping to have all
In the PREEMPT proposal, we must state how we will establish methods to assess the
'long-term safety and efficacy of our preemptive approaches'
Given your field of work, do you have any existing language on how to address
potential negative impacts of intervention approaches on non-target species?
I have attached language from the BAA to provide you with further guidance on
what DARPA requires us to include.
This being said - Rachel and Katherine, could you please write-up a short
section (a paragraph or so), that addresses this issue 'long-term safety and
efficacy'?
appreciate it if you could return this to us by tomorrow afternoon,
Sat. (3/24).
Previously, we had asked you to identify any 'pricing assumptions' that may
correspond with use of government facilities. Due to confusion about what exactly
was being asked for, we reached out to DARPA staff, asking them to clarify the
matter:
We asked: "EcoHealth Alliance has a USG entity listed as a subcontractor in our proposal. Is the
USG entity required to identify any pricing assumptions beyond those within their fully detailed
and documented budget?
Long story short...there is NO need for you to identify any additional pricing assumptions.
Thank you and please let me know if you have any questions. I will be available by email and phone (mobile number
listed below) over the weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
priming molecules

immunomodulating agents to manage SARS-Coronaviruses, we will concurrently develop
and test mediums, routes, and methods of delivery to large colonies of bats. Several
different approaches or combinations of approaches will be assessed to determine the most
feasible and simplest method of delivery that achieves high uptake by bats, is safe for
humans as well as target and non-target species, and minimizes disturbance to the colony.
Sticky edible gels or pastes that bats groom from themselves and each other have been used
previously to deliver pharmaceuticals to bats orally and are currently being tested as a
medium for delivery of vaccines against rabies and other diseases in wild bats (see
preliminary data). These may also be useful for delivering immune modulators and
recombinant SARSr-CoV spike proteins to Rhinolophus bats, but may need to be combined
with viral vectors (like poxvirus or adenovirus) or nanoparticles/nanoemulsions that
enhance uptake through mucous membranes or transdermally after topical application.
delivering vaccines to wildlife (Slate et al., 2009) Freuling et al., 2013; Rocke et al., 2017).
Recent laboratory studies in bats have shown that poxviruses can replicate safely at high
levels in bats after oronasal administration (Stading et al., 2016)m and poxvirus vectored
vaccines are immunogenic, protecting bats from rabies challenge (Stading et al 2017; see
preliminary data). Poxviruses are highly safe, having been tested in a wide variety of wild
and domestic animals, they allow for large inserts of foreign DNA, and they have a proven
record of success. Poxviruses are good candidates for this project, but we will also consider
others.
In addition to viral vectors, we will also consider methods to achieve transcutaneous
delivery of the immune boosting proteins without the use of live agents. Recent advances
in methods to achieve transdermal or transcutaneous delivery of drugs and vaccines have
been reported. (Roberts et al., 2017). However, a major impediment to this route of
vaccination is the stratum corneum, the outermost barrier layer of the skin that protects
underlying layers from infection and damage. Numerous approaches have relied on
mechanical methods to compromise the stratum corneum to allow the drug or vaccine to
penetrate into the skin (Roberts et al., 2017). Innovations in nanotechnology show promise
in being able to deliver drugs and vaccines into the deeper layers of the skin without the
need for damage to the stratum corneum (Mishra et al., 2013), an important consideration.
Dendritic cells and Langerhans cells, antigen-presenting cells which reside in the dermis
and epidermis, can take up these transdermally delivered proteins and generate an immune
response. We are currently testing poly lactic-co-glycolic acid (PLGA) as a nanoparticle
to encapsulate rabies glycoprotein as a method of transcutaneous delivery of vaccine to
bats. PLGA has been used previously to deliver both toll-like receptor agonists and
antigens simultaneously to mice (Ebrahimian, 2017). This and other products (outlined
above in Task ?) could potentially be useful with SARSr-CoV glycoproteins. Adjuvants
can also be incorporated into nanoemulsions and nanoparticles to amplify the natural
immune response to the vaccine antigens (Karande and Mitragotri, 2010). With SARS-
CoV spike proteins, the adjuvant Matrix M1 (Isconova, Sweden) has been shown to
significantly enhance the immune response in mice (Coleman et al. 2014)
immunomodulating formulations based on the results of TA2, previous animal studies and
other available data and then use both laboratory and field studies to assess and optimize
delivery vehicles and methods for wild bats. To reduce costs, initial studies will be
conducted with locally acquired insectivorous bats (Eptesicus fuscus--big brown bats). We
have successfully maintained and housed big brown bats and other insectivorous species
for several experiments at our facility previously (Stading et al., 2016, 2017). We will treat
bats via topical application with various test formulations that include the biomarker
Rhodamine B (RB), co-house them with untreated bats, and monitor transfer between bats
by collecting hair and whiskers for biomarker analysis. Rhodamine B is detectable within
the hair of animals within 24 hours of consumption using a fluorescence microscope, and
we have considerable experience using this biomarker for similar studies (see preliminary
data).
the bats. Within one week of application, bats will be trapped at the cave entrace using mist
nets or Harp traps and hair will be collected to assess the rate of uptake via biomarker
analysis. The bats will be released immediately afterward. The procedures will be tested
at several different locations as it will likely take some manipulation to determine
appropriate dosages for maximum uptake. After we have determined the most optimal
approaches for mass delivery, we will then test them on wild bats in our three cave sites in
Yunnan Province. Again, biomarker will be used to assess rates of uptake and this data
can then be used in modeling studies to help determine the optimal rates of application of
target species, an important consideration in evaluating safety. Fieldwork will be conducted
in collaboration with Dr. Yunzhi Zhang (Yunnan CDC, Consultant at EcoHealth Alliance).
vaccine delivery methods and uptake by the target species were optimized using biomarker
studies prior to deployment; biomarker studies were also used to assess uptake and safety
in non-target hosts (Tripp et al., 2015). A similar approach will be used to develop, test
and optimize delivery methods to Rhinolophus bats in SE Asia.
vectored vaccine expressing plague antigens was incorporated into a peanut-butter flavored
bait matrix. Rhodamine B (RB), a biomarker that dyes hair, whiskers and feces and is
visible within 24 hours of consumption by animals, was included in the baits in order to
assess uptake by both target and non-target species (Figure 1). When viewed under a UV
microscope at a specific wavelength, the biomarker is visible until the hair grows out
(approximately 50 days in prairie dogs). Biomarker studies were initially used to assess
palatability and acceptance of the bait matrix by wild prairie dogs (Tripp et al., 2014) and
also used to assess bait ingestion by non-target rodents (Tripp et al., 2015). After safety
was confirmed in non-targets and with the approval of USDA Center for Veterinary
Biologics, a large field trial was conducted over a 3-year period that demonstrated vaccine
effectiveness in four species of prairie dogs in seven western states (Rocke et al., 2017).
Using biomarker analysis, we then assessed site- and individual host-level factors related
to bait consumption in prairie dogs to determine those most related to increased bait
consumption, including age, weight, and the availability of green vegetation. Identifying
the factors that maximize the likelihood of expedient bait uptake by targeted individuals is
important for developing strategies to optimize vaccine effectiveness. This will also be
important in developing disease management strategies for bats.
a. b. c. d.
fluorescence).
highly safe for bats (Figure 2). We then used raccoon poxvirus as a viral vector to express
a novel rabies glycoprotein (mosaic or MoG) and tested the protective efficacy of this
construct in bats after both oronasal and topical administration (Stading et al 2017). Both
methods of application were successful, protecting nearly all of the immunized and
animals, primarily cattle, in several Latin American countries. We are also using a similar
approach to develop vaccines for white-nose syndrome in bats, a devastating disease that
has killed millions of insectivorous bats in North America.

O.N. Infection O.N.

RCN-MoG ON
RCN-MoG Topical
RCN-G ON
RCN-luc
ON
oronasally (ON) or topically in comparison to RCN expressing typical G protein and RCN
expressing luciferase (a negative control).
released. When they return to their roost, the poison is transferred to roost-mates by contact
and mutual grooming. We are exploiting this same behavior for vaccine application.
Preliminary biomarker studies (without vaccine) are being conducted in vampire bats in
both Mexico and Peru and also in insectivorous bats in Wisconsin. In a pilot study in Peru,
we treated 50 bats from a single cave with RB-labelled glycerin jelly. Based on capture-
recapture data, we estimated the population at ~200 bats, so ~25% of bats were initially
marked. Upon trapping of this population a few days later, 64 bats were captured, including
19 originally marked bats (Table 1 – could be made into a figure instead). Hair was
collected and examined for RB marking under a fluorescence microscope. All treated bats
were positive for RB marking in addition to 39% of newly captured bats, indicating a rate
of transfer of about 1.3 bats for every bat marked. Additional trials have been conducted,
with transfer rates of up to 2.8 bats for every bat treated achieved at least once. These trials
are being analyzed to assess factors associated with rates of transfer, e.g. sex and age of
initially treated bats, time of day, etc. This data is then being used to model the rate of
vaccination and impact on rabies transmission with different rates of application, prior to
actual deployment of vaccine in the field.
Table 1. Marking of vampire bats a few days after application of glycerin jelly containing
Rhodamine B.
captured (w/o inc)
All bats 64 34 25 5 58
Recaptured
19 18 0 1 100
marked bats
to bats, we applied RB marked glycerin jelly to the entry of bat houses used by little brown
bats (Myotis lucifugus). The bats became covered as they entered the houses and then
consumed the material during self and mutual grooming. One week later, bats were trapped
at the houses to determine the rate of uptake. Of 29 bats trapped one week post-application,
59% (17) were positive for biomarker indicating they had eaten the jelly. Thus, with
additional optimization, application of vaccine to bat houses or other structures (small cave
entrances) could also be a viable method of delivery. In addition, we are considering
different spray applications directly to roosting bats in caves and through motion-sensing
sprayers at cave entrances. Whatever the means of application, effective treatment relies
on ingestion by bats, and that is easily confirmed with the use of the biomarker, RB.
technology can be used for the full range of fluids of interest to the program including gels
and creams for topical application and aqueous/non-aqueous vaccine formulations. Further
details can be found in the PARC website (see references).
polyethylene oxide in water-glycerol (C.), hyaluronic acid in water (D.) and sunscreen (E.)

Deliverable(s):
2014. Purified coronavirus spike protein nanoparticles induce coronavirus neutralizing
antibodies in mice. Vaccine 32:3169-3174.

Karande P, Mitragotri S. 2010. Transcutaneous immunization: an overview of advantages,

disease targets, vaccines, and delivery technologies. Annu Rev Chem Biomol Eng
1:175-201.
Mishra DK, Dhote V, Mishra PK. 2013. Transdermal immunization: biological framework
and translational perspectives. Expert Opin Drug Deliv 10:183-200.
phenomena in dilute solutions of highly extensible flexible polymers. Physics of Fluids
17: 071704.

Roberts MS, Mohammed Y, Pastore MN, Namjoshi S, Yousef S, Alinaghi A, Haridass IN,
Abd E, Leite-Silva VR, Benson HAE, Grice JE. 2017. Topical and cutaneous delivery
using nanosystems. J Control Release 247:86-105.
Rocke TE, Tripp DW, Russell RE, Abbott RC, Richgels KLD, Matchett MR, Biggins DE,
Griebel R, Schroeder G, Grassel SM, Pipkin DR, Cordova J, Kavalunas A, Maxfield
B, Boulerice J, Miller MW. 2017. Sylvatic plague vaccine partially protects prairie
dogs (Cynomys spp.) in field trials. EcoHealth DOI: 10.1007/s10393-017-1253-x.

Infectivity of attenuated poxvirus vaccine vectors and immunogenicity of a raccoonpox
vectored rabies vaccine in the Brazilian Free-tailed bat (Tadarida brasiliensis). Vaccine.
2016;34: 5352–5358. doi:10.1016/j.vaccine.2016.08.088
Tripp DW, Rocke TE, Streich SP, Brown NL, Fernandez JR-R, Miller MW. 2014. Season
and application rates affect vaccine bait consumption by prairie dogs in Colorado and
Utah, USA. J Wildlife Dis 20:
Tripp DW, Rocke TE, Streich SP, Abbott RC, Osorio JE, Miller MW. 2015. Apparent field
safety of a raccoon poxvirus-vectored plague vaccine in free-ranging prairie dogs,
Colorado, USA. J Wildlife Dis 51:
[email protected]
Applicants tab.
CFDA Number: 12.910
Competition ID:
Competition Title:

[email protected]

DUNS: 0770900660000
Form Version: 1.4

FORM ACTIONS:
Dr. Tonie Rocke 129,590.00 0.85 9,179.00 2,475.00 11,654.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.60 6,479.00 1,747.00 8,226.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.80 8,639.00 2,329.00 10,968.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.40 4,319.00 1,165.00 5,484.00
Dr. Rachel Abbott 61,006.00 6.00 30,502.00 7,986.00 38,488.00

B. Other Personnel

Graduate Students

Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

8.
9.
10.

H. Indirect Costs

POC Phone Number)


Totals ($)
74,346.00
9
380,094.00
Section D, Travel
35,303.50
1. Domestic
20,290.00
2. Foreign
15,013.50
2. Stipends
3. Travel
4. Subsistence
5. Other
115,958.99
60,098.99
6,000.00
8. Other 1
37,800.00
9. Other 2
12,060.00
10. Other 3

Section J, Fee
874,293.54

Tonie Rocke
Fri 3/23/2018 3:46 PM
(b) (6) @gmail.com>
To: Abbott, Rachel (Contractor) C <[email protected]>
Cc: Luke Hamel <[email protected]>; Richgels, Katherine L <[email protected]>; Rocke, Tonie E
<[email protected]>; Jonathon Musser <[email protected]>; Evelyn Luciano
<[email protected]>
Hello all: I sent my budget justification to Ana several days ago. Thanks for addressing safety issues
Rachel!
Sent from my iPhone
On Mar 23, 2018, at 2:38 PM, Abbott, Rachel <[email protected]> wrote:
Hi Luke,
I have added some paragraphs to the page you sent. It just deals with safety of RCN,
so I hope that is enough. Most of the text came out of documents we have to write to
get approval to use our RCN vaccines in the field (risk analysis for USDA CVB and
environmental assessment for USGS). Unfortunately, as I said before, I'll be unavailable
until next Thursday, but Tonie should be back in her office on Monday.
--Rachel
If you have not already done so (and I apologize for not knowing the
answer), could you please send us your budget justification document?
We are hoping to have all collaborator budgets and budget justifications
as soon as possible.
In the PREEMPT proposal, we must state how we will establish methods
to assess the 'long-term safety and efficacy of our preemptive
approaches'
Given your field of work, do you have any existing language on how
to address potential negative impacts of intervention approaches
on non-target species?
I have attached language from the BAA to provide you with further
guidance on what DARPA requires us to include.
This being said - Rachel and Katherine, could you please write-up a
short section (a paragraph or so), that addresses this issue 'long-
term safety and efficacy'?
I apologize for the extremely short notice, but we would
greatly appreciate it if you could return this to us by
tomorrow afternoon, Sat. (3/24).
Previously, we had asked you to identify any 'pricing assumptions' that
may correspond with use of government facilities. Due to confusion about
what exactly was being asked for, we reached out to DARPA staff, asking
them to clarify the matter:
We asked: "EcoHealth Alliance has a USG entity listed as a subcontractor in our
proposal. Is the USG entity required to identify any pricing assumptions beyond
those within their fully detailed and documented budget?
Long story short...there is NO need for you to identify any additional pricing
assumptions.
Thank you and please let me know if you have any questions. I will be available by email and phone
(mobile number listed below) over the weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
the critical connections between human and wildlife health and
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
<PREEMPT_Eco_Impacts_Risk_Plan RCA.docx>

Fri 3/23/2018 3:51 PM
To: Abbott, Rachel (Contractor) C <[email protected]>
Cc: Richgels, Katherine L <[email protected]>; Rocke, Tonie E <[email protected]>; Jonathon Musser
Hi Rachel and Katie,
Thank you for agreeing to take on that section. Regarding the budget justification, I have attached
a template with appropriate headings and language that is already correctly formatted. I would just
ask you to insert the appropriate name/cost amount, substituting CAPITALIZED words and
filling in gaps (indicated by underscores).
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding section
in the budget justification (as shown in the template). Essentially, any line item that is listed in the
budget needs to be justified in the 'budget justification' document.
Whatever information you could fill in would be extremely helpful. If you feel unsure about
certain sections, or don't feel as though you have the time to complete the entire document, we are
happy to complete any remaining sections. We just ask that you send us whatever progress you've
made, by Sunday afternoon (3/25). My apologies for requesting this with the weekend fast
approaching.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Fri, Mar 23, 2018 at 3:19 PM, Abbott, Rachel <[email protected]> wrote:
Hi Luke,
I will write the paragraph on long-term safety and efficacy and send it to you later this afternoon
(I'll be on vacation for a few days starting tomorrow).
I don't know what the budget justification document is and only have budget files that Tonie has
already sent to you. I have attached them here. If it is a specific form we need to fill out, Katie
might be the best person to enter the required information.
--Rachel
If you have not already done so (and I apologize for not knowing the answer), could
you please send us your budget justification document? We are hoping to have all
In the PREEMPT proposal, we must state how we will establish methods to assess
the 'long-term safety and efficacy of our preemptive approaches'
Given your field of work, do you have any existing language on how to
address potential negative impacts of intervention approaches on non-target
species?
I have attached language from the BAA to provide you with further guidance
on what DARPA requires us to include.
This being said - Rachel and Katherine, could you please write-up a short
efficacy'?
appreciate it if you could return this to us by tomorrow afternoon,
Sat. (3/24).
Previously, we had asked you to identify any 'pricing assumptions' that may
matter:
We asked: "EcoHealth Alliance has a USG entity listed as a subcontractor in our proposal. Is
the USG entity required to identify any pricing assumptions beyond those within their fully
detailed and documented budget?
Long story short...there is NO need for you to identify any additional pricing
assumptions.
Thank you and please let me know if you have any questions. I will be available by email and phone (mobile
number listed below) over the weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)
(b) (6) (mobile)

--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
Budget Justification Template (Please follow the guidance in this template for each budget period)
PHASE 1
BASE PERIOD 1
A. Personnel ($Total)
• NAME, PhD, TITLE, will oversee all aspects….has in-depth knowledge and experience in…with
expertise in…. We request $AMOUNT p.a. salary for NAME, who will dedicate # months p.a. to
this project for phase ___ years ____.
• NAME, PhD, TITLE, will guide and advise…has worked with emerging zoonoses for over…. has
experience managing…. We request $AMOUNT p.a. salary for NAME who will dedicate # months
p.a. on this project for phase ____ years ____.
• Post-doctoral fellow (TBD), will help lead and coordinate all field and laboratory activities as
well as data analyses and will dedicate # months p.a. to this project. We request $AMOUNT p.a.
to cover stipend for a 3 year fellowship award.
B. Fringe ($Total)
Fringe benefits are calculated as per INSTITITION federally negotiated rate of ___% of base salary per
year.
C. Travel ($Total)
Domestic Travel ($Total): We are requesting $AMOUNT in phase___ year___ to support domestic
travel from ____to ____ for one (1) Co-PI/Co-I and one (1) research scientist to attend the _____
meeting. We calculate the expenses per person as follows: 2 economy, round-trip tickets (departure
location <> return location) at $AMOUNT/person, # nights in hotel at $AMOUNT/person, and a total per
diem allowance of $AMOUNT/person.
We are requesting $AMOUNT in the phase____year____ to support domestic travel from ____, to ____,
for one (1) Co-PI/Co-I and one (1) research scientist to attend ____ meeting. We calculate the expenses
per person as follows: 2 economy, round-trip tickets (departure <> return) at $AMOUNT/person, # nights
in hotel at $AMOUNT/person, and a total per diem allowance of $AMOUNT/person.
International Travel ($Total): We request $AMOUNT p.a. for phase____ years____ to support
international travel from Departure location to project study regions in LOCATION. We have budgeted for
either a) one (1) Co-PI and two (2) research scientist; or b) three (3) research scientists to travel three
times to each region for ____ with local partners. Expenses per person for each trip are calculated as
follows: 2 economy round trip tickets (ldeparture location<> return location) at $AMOUNT each, lodging at
$AMOUNT x # nights, a total per diem allowance of $AMOUNT. Total estimated travel expenses to
location per person per trip are $AMOUNT.
D. Field work ($Total)

Field team ($Total): We requesting $AMOUNT per year for phase____ years___ and $AMOUNT for
phase___ year____ to cover stipends for # field assistants to conduct biological sampling.
Field visits ($Total): We are requesting $AMOUNT p.a. for phase___ years____and $AMOUNT for
phase____ year____ to cover transportation to field sites.
E. Supplies and Materials ($Total)

We are requesting a total of $AMOUNT for supplies and materials across all phases and years.
Expenses are calculated as follows:
- Biological sampling supplies ($Total) We are requesting $AMOUNT for phase___ year____
and $AMOUNT for phase____ year____ to purchase necessary supplies for biological sampling
including (type, examples of) materials necessary for the collection (e.g. vials, swabs) and
transportation of biological samples, and microscopes.
- Computing devices ($Total) 2 laptop computers at $AMOUNT for research analyses.
- Office supplies ($Total): We are requesting $AMOUNT to purchase office supplies to record
biodiversity and laboratory data (notebooks, clipboards, pens, etc.).
- Database development ($Total): We request $AMOUNT for the development of an extensive,
comprehensive database to store all collected data.
- Publications ($Total): We are requesting $AMOUNT p.a. for phase____ years____ to support
journal publication costs of research results. We expect to produce ____ publications per year.
- Internet ($Total): Internet service for ___ months per year at $40.00 per month.
- Cellphone service ($Total): Cellphone service for ___ months per year at $AMOUNT per
month.
- Google apps for work ($Total): Google apps service for __ months per year at $AMOUNT per
month.
- Printing and Photocopying ($1,620): Printing and photocopying of survey instrument, survey
guide and training materials.
F. Equipment ($Total)
We request a total of $AMOUNT in phase____ year____ to purchase ____ at $AMOUNT and ____ at
$AMOUNT to preserve samples prior to shipment.
H. Indirect Costs ($Total)
We are requesting a federally negotiated indirect cost rate of ____% on all direct costs.
PHASE 1
BASE PERIOD 2
PHASE 2
OPTION PERIOD 1
PHASE 2
OPTION PERIOD 2
[EXTERNAL] Scheduling a PREEMPT call for Mon. (3/26)

Fri 3/23/2018 3:57 PM
Cc: Dr. Peter Daszak <[email protected]>; Rocke, Tonie E <[email protected]>; Alison Andre
<[email protected]>
Could you please look at Tonie's calendar and see if she is available for a PREEMPT call on Mon.
(3/26)? Please use this link to select which time(s) she is likely available.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
[EXTERNAL] Re: Project DEFUSE proposal

Sat 3/24/2018 9:43 AM
Cc: Rocke, Tonie E <[email protected]>; [email protected] <[email protected]>; Dr. Peter Daszak
<[email protected]>; William B. Karesh <[email protected]>
Excellent. Thank you very much, Jerome!
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

Peter, Luke and the rest of the EHA team (CC: Tonie Rocke),
Please find attached an edited version of the DEFUSE proposal that includes additional text from
PARC. I included an additional figure (Fig. 15, also included here in .pptx), two new references
marked with comments in our 2-3 paragraphs on the spray technology and inserted us in some
of the other relevant sections. I also included a paragraph discussing PARC’s commercialization
strategy for FEA. Feel free to incorporate this in a table/timeline form, as needed – to identify
clear milestones for Technology Transition.
If you need further details on any of these, I’d be happy to oblige.
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

Cc: [email protected]; [email protected]; [email protected];
[email protected]
Subject: [EXTERNAL] Project DEFUSE proposal
Attachments: fig15.pptx; DARPA PREEEMPT DEFUSE full v2 JU 032318.docx
Peter, Luke and the rest of the EHA team (CC: Tonie Rocke),
Please find attached an edited version of the DEFUSE proposal that includes additional text from PARC. I included an
additional figure (Fig. 15, also included here in .pptx), two new references marked with comments in our 2-3 paragraphs
on the spray technology and inserted us in some of the other relevant sections. I also included a paragraph discussing
PARC’s commercialization strategy for FEA. Feel free to incorporate this in a table/timeline form, as needed – to identify
clear milestones for Technology Transition.
If you need further details on any of these, I’d be happy to oblige.
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

1
A.
Filaments Droplets B.
F. Different
Form Factors for
FEA Prototype
C. 1 wt% PEO in Water-Glycerol D. Hyaluronic Acid in Water E. Sunscreen
1
2
including bats.
• Dr. Jerome Unidad, PARC will develop an innovative aerosol technology that could work
with a wide-range of formulations into a field-deployable device that can be used for large-
scale inoculation of bats.
;klj;lkj;lk
;lj;lkj;lkj
;lkj;lkj
;lkj;lkj
C. GOALS AND IMPACT

Overview
bats that will help protect the warfighter within SACOM and SEACOM, and will be scalable to
3
existent. SARSr-CoVs are enzootic in Asian, African1, and European bats2 that roost in caves but
Technical Area 1
4
risk SARSr-CoVs, two other control/comparison sites), including: radio- and GPS-telemetry to
identify home range and additional roost sites for each bat species; inventory of bat population
density, distribution and segregation and their daily, weekly and seasonal changes; viral
The Wuhan Institute of Virology team will test bat fecal, oral, and blood samples for SARSr-
CoVs. We will collect viral load data using fresh fecal pellets from individually sampled bats and
from tarps laid on cave floors deployed where necessary to reduce roost disturbance. SARSr-
CoV spike proteins will be sequenced, analyzed phylogenetically for recombination events, and
high-risk viruses (spike proteins close to SARS-CoV) characterized and isolated. The UNC team
will reverse-engineer spike proteins to conduct binding assay to human ACE2 (the SARS-CoV
receptor). They will culture SARS-like bat coronaviruses to distinguish high-risk strains that can
replicate in primary human cells and low risk strains that require exogenous enhancers. Viral
5
Technical Area 2
6
of SARSr-CoV is sensitive to interferon treatments, as shown in our previous work13 ; ii)
periods22,23.
7
against rabies in the lab25, and hand delivered these containing biomarkers to vampire bats in
Deliverables:
strains.
shedding
8
D. TECHNICAL PLAN
Technical Area I:
assemblage contain all the genetic
components of epidemic SARS-CoV30.

ACE229.
analysis of SARSr-CoVs (Fig. 3), and
coevoutionary analysis of bats and their CoVs
9
China, and Rhinolophus spp. bats are the likely origin of the SARS-CoV clade, and therefore a
Spatial models of bat origin high-risk viruses across S and SE Asia. We will build models that
predict regional-scale bat and viral diversity in cave sites across South and SE Asia to enable
10
Fig. 4: Predictive global map of total (known and unknown)
viral diversity in bats (Chiroptera species). Based on EHA’s
unique database of all known mammal virus-host
relationships3.

11
12
Rhinolophus, Hipposideros, and Myotis spp., although our preliminary data demonstrate that R.
sinicus and R. ferrumequinum (which co-roost at our sites) are the SARSr-CoV primary reservoir,
with Hipposideros and Myotis playing an insignificant role in viral dynamics. We will capture
bats using harp traps and mist nets during evening flyout. Rectal, oral, and whole blood samples
lethal viral specimen collection over an 18 month period of the project from all three cave sites.
Given the average prevalence of SARSr-CoV in these species in our previous investigations in S.
China (~6-9%, n=3304 Rhinolophus spp.), this sample size would enable to detect changes of
10% fluctuation in prevalence between sampling periods. Early in the sampling we will trial the
while reducing roost disturbance (REFS). To identify seasonal or reproductive cycle variation in
13
treatments in TA2 (Fig. XX). We will adjust individual sampling quotas per species to optimize
currently maintains IACUC protocols through Tufts University (via inter-institutional agreement)
individual bats collected by data loggers will be downloaded every 3 days to examine temporal
record the total number of bats flying out each night. Recapture data will be collected
continuously throughout the project. We will attach radio transmitters (1.2g, Advanced
14

Flow chart here:
15
(additional box)
down.
16
17
of each vSARSr-CoV, then clinical disease
(weight loss, respiratory function by whole
body plethysmography, mortality, etc.)
followed for 6 days p.i.. Animals will be
sacrificed at day 2 or 6 p.i. for virologic
analysis, histopathology and
immunohistochemistry of the lung and for 22-
parameter complete blood count (CBC) and
determination). Identification of high risk/low abundant variants: We will use RNAseq to
identify low abundant quasispecies (QS) variants encoding mutations in RBD and/or residues
that bind ACE2. These would alter risk assessment calculations as strains identified as low risk,
might actually have low abundant, high risk variants circulating in the QS. To test this the Shi
and Baric lab will structurally model and identify highly variable residue changes in the SARSr-
CoV S RBD and use commercial gene blocks to introduce these changes singly and then in
combination into the S glycoprotein gene of the low risk, highly abundant parental strain. We
will examine the capacity of these low abundance chimeric viruses to use human, bat, civet and
mouse ACE2 receptors, and to replicate in HAE cultures. RBD deletions: Small deletions at
specific sites in the SARSr-CoV RBD leave the key RBD-ACE2 interface residues intact, such that
Clade 1 strains represent higher risk of human infection (Fig. 5). We will analyze the functional
consequences of these RBD deletions on SARSr-CoV hACE2 receptor usage, growth in HAE
cultures and in vivo pathogenesis. First, we will delete these regions, sequentially and then in
combination, in SHC014 and SARS-CoV Urbani, anticipating that the introduction of both
deletions will prevent virus growth in Vero cells and HAE. We hypothesize that the smaller
deletion may be tolerated, given its location in the RBD structure, so in vivo passage in the
presence of receptor will restore growth, while identifying 2nd site reversions that restore
efficient hACE2 usage49. In parallel, we will evaluate whether RBD deletion repair restores the
ability of low risk strains to use human ACE2 and grow in human cells. To test this we will
synthesize full length rs4237, a highly variable SARSr-CoV that encodes a few of the SHC014
RBD contact interface residues but also encodes a mutation at 479 (N479S) and has two
deletions and hence, is not recoverable in vitro. Using the SHC014 backbone sequence, we will
sequentially and then in tandem repair the deletions in the presence and absence of the S479N.
We anticipate that the S479N mutation is critical given its key role in establishing the RBD-ACE2
interface, and that restoration of the RBD deletions will enhance virus recognition of hACE2
18
receptors and growth in Vero cells and HAE cultures S2 Proteolytic Cleave and Glycosylation
Sites: After receptor binding, a variety of cell surface or endosomal proteases63-66 cleave the
SARS-CoV S glycoprotein causing massive changes in S structure 67 and activating fusion-
mediated entry55, which is prevented in the absence of S cleavage68 (Fig. 5). Tissue culture
adaptations sometimes introduce a furin cleavage site which can direct entry processes, usually
by cleaving S at positions 757 and 900 in S2 of other CoV, but not SARS66. For SARS-CoV, a
variety of key cleavage sites in S have also been identified and we will analyze all SARSr-CoV S
gene sequences for appropriately conserved proteolytic cleavage sites in S2 and for the
presence of potential furin cleavage sites69,70. SARSr-CoV S with mismatches in proteolytic
cleavage sites can be activated by exogenous trypsin or cathepsin L. Where clear mismatches
occur, we will introduce the appropriate human-specific cleavage sites and evaluate growth
potential in Vero cells and HAE cultures. In SARS-CoV, we will ablate several of these sites based
on pseudotyped particle studies and evaluate the impact of select SARSr-CoV S changes on virus
replication and pathogenesis (e.g. R667, R678, R797). We will also review deep sequence data
for low abundant high risk SARSr-CoV that encode functional proteolytic cleavage sites, and if
so, introduce these changes into the appropriate high abundant, low risk parental strain. N-
linked glycosylation: SARS-CoV S has 23 potential N-linked glycosylation sites and 13 of these
have been confirmed biochemically. Several of these regulate SARS-CoV particle binding DC-
SIGN/L-SIGN, alternative entry receptors for SARS-CoV entry into macrophages/monocytes71,72.
Mutations that introduced two new N-linked glycosylation sites may have been involved in the
emergence of human SARS-CoV from civet and raccoon dogs72. While the sites are absent from
civet and raccoon dog strains as well as clade 2 SARSr-CoV, they are present in WIV1, WIV16
and SHC014, supporting a potential role for these sites in host jumping. To evaluate this, we will
sequentially introduce clade 2 residues at positions N227 and N699 of SARS-CoV and SHC014
and evaluate virus growth in Vero cells, nonpermissive cells ectopically expressing DC-SIGN and
in HAE cultures, as well as in human monocytes and macrophages anticipating reduced virus
growth efficiency. Using the clade 2 rs4237 molecular clone, we will introduce the clade I
mutations that result in N-linked glycosylation sites at positions 227 and N699 and in rs4237
RBD deletion repaired strains, evaluating virus growth efficiency in HAE, Vero cells, or
nonpermissive cells ± ectopic DC-SIGN expression72. In vivo, we will evaluate pathogenesis in
transgenic ACE2 mice.
Models to predict viral spillover potential and evolution of high-risk SARSr-CoV strains.
Structural equation model of spillover potential: We will use data from the experimental assays
above to build genotype-phenotype models of bat SARSr-CoV spillover potential. We will use
Bayesian Structural Equation Models (SEM), fit via MCMC methods73, to predict spillover
19
20

21
population, under an IRB that can be easily extended to cover DEFUSE work.


84 and the recent success in SADS-CoV zoonotic risk study using LIPS85. To establish SARSr-CoV
22
Thematic Area 2
23
recombinant SARSr-CoV S are expressed from raccoon poxvirus, which has been used
extensively to deliver rabies immunogens in bats and other animals. We will conduct
application trials with live bats to assess suppression of replication and shedding of a broad
range of pathogenic SARS-related CoVs. Both lines of work will begin in Year 1 and run parallel,
be assessed competitively for efficiency, cost, and scalability, and successful candidates used in
our live bat trials at our test sites in Yunnan, China. We believe an immune boosting/priming
strategy is a superior approach for this challenge because solutions are likely to be broadly
applicable to many bat species, and across many viral families.
24
purified protein. Utilization of a universal IFN for bats will

factor in the bat interferon production pathway92. To fast-track the identification of this target
25
RNA targets in every gene in the P. alecto genome. The library has already been produced and
boost the inducibility of the IFN system in a shorter time-frame. Based on previous work, it is
26
species93,94. We will also use two coronaviruses (SARSr-CoV WIV1 and MERS-CoV in ABSL3.
Details of infection, housing, prior infection trials in the facility… Viral loads will be measured by
qPCR, titration of produced virus, NGS transcriptomics and nanostring probes added to the
bats
immunity against multiple group 2b strains. We will
27
PFU/ml on Vero cells (Fig. 10). HKU3-Smix is fully neutralized by mAb that specifically target the
28
and adjuvants in vaccine applications (Fig. 11). Ac-DEX has distinct advantages over other
polymers for vaccine development: 1) synthesis is straightforward and scalable. An FDA-
passively target antigen-presenting cells (APCs) based on their size (5-8µm), being
insert]) have limited shelf-life that requires the cold-chain. Ac-DEX MPs can be aerosolized, or
disease control in wildlife populations98,105. Figure F. Particle Delivery Systems. Broadscale immune
5) We have previously encapsulated Poly boosting strategies include (A) Dextran microparticles or
Dry nanoparticle powders. (B) Macrophages cultured with
(I:C)(1), resiquimod101, and a STING agonist either free poly (I:C) or poly (I:C) encapsulated into Ac-
into our novel MPs106. DEX MPs produce significant TNFα. (C) Comparison of
(left) neutralizing titer and (right) viral load when ferrets are
As seen in Fig. 10, encapsulation of Poly vaccinated with Ac-DEX MPs. Day 0, 28, and 56 (prime,
(I:C) drastically enhances the activity of the boost, and challenge.)
TLR agonist. Additionally, encapsulation of

adjuvants in MPs drastically enhances the
29
displayed better efficacy than state-of-the-art FDA-approved inactivated flu virus (Fluarix) in a
ferret model of influenza. The ferret model is the ideal animal model for influenza because of
their relatively small size and they possess various clinical features associated with human
influenza infection107. This formulation used HA with encapsulated STING agonist cyclic
[G(3',5')pA(3',5')p](16)
proof-of-concept in bats. We modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN)
vecotrs for safety and replication in bats using in vivo biophotonic imaging25. RCN replicated to
higher levels in bats than MVA, even via the oral route, and was found to be highly safe for bats
(Fig. 12). We used raccoon poxvirus-vectored novel rabies glycoprotein (mosaic or MoG) and
demonstrated protective efficacy in bats after oronasal and topical administration25 (Fig. 13).
We are currently developing vaccine delivery for vampire bats in several Latin American
30
countries, and vaccines for white-nose syndrome in bats, a devastating disease that has killed
millions of insectivorous bats in North America.

indicative of viral
in the bat Tadarida

a raccoon poxvirus vectored vaccine expressing plague antigens was incorporated into a
vegetation.
31
fluorescence).
Transcutaneous delivery: In addition to viral, we will also consider methods to achieve
biomarker analysis.
positive for biomarker indicating they had eaten the jelly. We will conduct initial trials with each
32
Innovative Aerosol Approach to Bat Inoculation: Once we have confirmed uptake in laboratory
studies, we will then assess scalable delivery methods in local caves and hibernacula (using
Dr. Jerome Unidad of Palo Alto Research Center (PARC), we will develop an innovative aerosol
platform technology unique to PARC into a field-deployable prototype for use in cave settings.
The technology called Filament Extension Atomization (FEA) can spray fluids with a wide-range
of viscosities ranging from 1mPa-s (the viscosity of saliva and most aqueous vaccine
formulations) up to 600Pa-s (the viscosity of creams and gels for topical delivery) using a roll-to-
roll misting process (https://www.parc.com/services/focus-area/amds/) that results in
narrowly-dispersed droplets with tunable sizes from 5-500 microns. FEA technology is
compatible with all the formulations of interest to project DEFUSE, including aqueous
formulations intended for conventional spraying and the edible gels and creams intended for
topical delivery with no limit on bioactive ingredient loading. FEA can then be a universal
delivery platform for direct spraying onto bats with the formulation geared towards bio-
efficacy.
We will subcontract to PARC to develop a field-deployable FEA prototype, potential form

factors for which are shown in Fig. 15F, that can be used in cave settings. PARC will develop the
prototype in close collaboration with USGS-NWHC and will conduct the initial trials with them
on Wisconsin cave bats. After initial trials, PARC will develop the prototype to a form that will
be used for the proof-of-concept demonstration at the test sites in the Kunming bat caves,
Yunnan province, China. The field-deployable system will be motion-actuated, and on a timer
so that bats will be targeted at fly-in and fly-out but diurnal flying non-target species (e.g. cave
swiftlets) can be avoided.
33
Fig. 15: PARC FEA Technology – A. Beads-on-a-string structures in viscoelastic fluids, B.
Parallelization of filament formation and droplet break-up in an FEA roller system, C.-E. Images
from high speed videos of representative fluids sprayed with FEA (Polyethylene Oxide in Water-
Glycerol, Hyaluronic Acid and Sunscreen), F. Potential form factors of the field-deployable
prototype for Project DEFUSE (benchtop, handheld)
Dynamic circulation modeling to optimize deployment strategy. To select amongst various

options for immune boosting, priming, and targeting, and multiple delivery options and
schedules, we will simulate deployment using a model of viral circulation in cave bat
34

Province, China.
MANAGEMENT PLAN
● Provide a summary of expertise of the team, including any subcontractors, and key

35
NWHC for initial trials, and oversee cave experiments in China; #5 to Dr. Jerome Unidad, PARC,
to develop their innovative aerosol platform into a field-deployable device for large-scale
inoculation of the bats. Dr. Unidad will collaborate closely with Dr. Rocke in developing a field-
deployable prototype for both initial trials and cave experiments in China.
36
of disease (REFS).
Virology.
and animal models and will lead the animal studies. Dr Anderson has established Zika, Influenza
and Reovirus non-human primate (NHP) models in Singapore, using different inoculation routes
sensing with expertise focusing on host-pathogen interactions and intrinsic immunity. He
37
epidemiology.
Dr. Jerome Unidad is a Member of Research Staff at the Hardware Systems Laboratory at PARC.
His research interests revolve around novel fluid delivery systems (including aerosol delivery)
for high viscosity fluids, polymers and biomacromolecules. At PARC, he is the technical lead in
developing the FEA spray technology for consumer and biomedical applications, as well as
additive manufacturing. He has a PhD in Chemical Engineering, specializing in polymer science
and rheology, from the University of Naples “Federico II” in Naples, Italy and was a postdoctoral
researcher at Forschungszentrum Juelich in Munich, Germany.
Dr. Peng Zhou is a

Dr. Xinglou Yang
Dr. Ben Hu
Dr. Kevin Olival is VP for Research at EcoHealth Alliance. His research over the last 15 years has
focused on understanding the ecology and evolution of emerging zoonoses, with a focus on
38
CAPABILITIES

submitted).
STATEMENT OF WORK
39

task/subtask.



Phase I:
Karesh).
TA1:
Task 1.1
40
and SE Asia.
Progress Metrics:
Deliverable(s):
Progress Metrics:
Deliverable(s):

Preliminary Data:
Deliverables:

Yunnan cave sites.
41
Deliverable(s):

glycoprotein genes
mice.

potential.
42

transgenic mice.



Progress Metrics:
Deliverable(s):
43
data.


Progress Metrics:
Deliverable(s):
Boosting.
expression vectors.
vehicles.
44

RBD.

mice and bats.
45
PREEMPT TRANSITION PLAN
● Indicate the types of partners (e.g. government, private industry, non-profit)
● Submit a timeline with incremental milestones toward successful engagement.

NOTE: begin transition activities during the early stages of the program (Phase I).
● Describe any potential DARPA roles.
Project DEFUSE partners come from academic, government, private industry, private non-profit
institutions and will develop a coherent transition plan for research findings, data and any
technology developed in this work.
PARC as a private industry partner (large business) is a fully-owned subsidiary of Xerox

Corporation and is committed to commercializing the FEA technology through IP licensing for
different applications spaces to different commercial partners. In the context of project
DEFUSE, PARC has been and will continue to engage potential licensees (OEMs) in the
biotechnology and biomedical fields for eventual transitioning of targeted delivery technology
that might result in the project. PARC already has existing networks of business relations in the
biotechnology and biomedical space, both large companies (Fortune 500, Fortune 1000) and
small businesses and start-ups who could be transition partners for FEA as a wide-scale, large-
area drug delivery device. In addition, in collaboration with our extended network of DEFUSE
partners and with DARPA, we will further identify existing government needs for our delivery
technology, particularly in wildlife health management (in collaboration with EHA and USGS-
NWHC) as well as in suppression of emerging threats (in collaboration with government
agencies such as the CDC). PARC will leverage this knowledge in developing a needs-based
commercialization plan with potential partners.
PREEMPT RISK MITIGATION PLAN

● Provide the following:


46

BIBLIOGRAPHY
RELEVANT PAPERS
Propose:

doi:10.1128/jvi.00650-10 (2010).
Nature 546, 646-650 (2017).
3048-3053, doi:10.1073/pnas.1517719113 (2016).
47
doi:10.1038/nm.3985 (2015).
microbe (2018).
(2016).
doi:10.1128/jvi.02453-08 (2009).
31-34 (2009).
318 (2013).
88, 11825-11833 (2014).
E7348-E7357 (2017).
immunology 23, 211-219 (2010).
48
doi:10.1016/j.vaccine.2016.08.088 (2016).
(2016).
doi:10.1371/journal.ppat.1006698 (2017).
679 (2005).
a priority? Oryx 47, 526-531 (2013).
201-209 (2016).
39 IUCN. Vol. 2017-1 (2017).
(2018).
49
191 (2015).
94, 1028-1038 (2013).
doi:10.1093/ve/vex012 (2017).
82, 2274-2285, doi:10.1128/jvi.02041-07 (2008).
Res. 27, 119-129, doi:10.1038/cr.2016.152 (2017).
82, 6984-6991, doi:10.1128/jvi.00442-08 (2008).
doi:10.1126/science.1116480 (2005).
3198-3203, doi:10.1074/jbc.M508381200 (2006).
doi:10.1073/pnas.1405889111 (2014).
doi:10.1371/journal.ppat.1006546 (2017).
doi:10.1007/s11427-017-9189-3 (2017).
doi:10.1128/jvi.01804-08 (2008).
50
doi:10.1073/pnas.1311542110 (2013).
(2003).
Virology 85, 13363-13372, doi:10.1128/JVI.05300-11 (2011).
doi:10.1016/j.antiviral.2013.09.028 (2013).
doi:10.1371/journal.pone.0179177 (2017).
23, 468-478, doi:10.1016/j.tim.2015.06.003 (2015).
doi:10.1073/pnas.1708727114 (2017).
(2016).
(2004).
Reports 2, 261, doi:10.1038/srep00261 (2012).
(2006).
(2007).
51
(2013).
(2002).
JoVE, doi:10.3791/1549 (2009).
679, doi:10.1126/science.1118391 (2005).
6, doi:10.1038/srep21722 (2016).
bats. Cytokine 87, 156-156 (2016).
S109-S118 (2015).
PloS one 7, e45479 (2012).
12 (2012).
52
doi:10.1073/pnas.0701372104 (2007).
doi:10.1371/journal.pone.0025434 (2011).
7458-7466 (1994).
doi:10.1128/JVI.02377-07 (2008).
(2012).
(2009).
interfaces 4, 4149-4155 (2012).
512, 147-157 (2016).
334-343, doi:10.1016/j.ijpharm.2014.10.022 (2014).
53
(2014).
200 (2013).
(2017).
doi:10.1038/nature06536 (2008).
4, e00598-00513 (2013).
doi:10.1017/s0950268810000695 (2010).
54
55
[EXTERNAL] Important - response needed FW: PREEMPT - Language on

'Fundamental Research'
Peter Daszak
Sun 3/25/2018 10:46 AM
<[email protected]>
To: Ralph Baric ([email protected]) <[email protected]>; Wang Linfa <[email protected]>;
Cc: William B. Karesh <[email protected]>; Luke Hamel <[email protected]>; Anna Willoughby
<[email protected]>
Ralph, Linfa, Jerome, Tonie,
Please read the email below from Luke. We need to know if any of your part of the proposed work for DEFUSE
will be considered ‘proprietary’ or ‘restricted’. The definitions are in the attached doc, as per the email below.
Those of you who’ve had experience with DoD funding will likely know the answer for this, but please reply to all,
so that the others can follow your lead on this.
We do need responses ASAP, so we can get the correct language into the proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

Sent: Saturday, March 24, 2018 5:24 PM
To: Peter Daszak; William B. Karesh; Jon Epstein; Kevin Olival, PhD
Subject: PREEMPT - Language on 'Fundamental Research'
Hi all,
Within our proposal, we must mention whether we believe the scope of the research included in our
proposal is 'fundamental' or not.
I've attached a document with language from the BAA (pp. 17,18) that defines 'fundamental' research and
distinguishes it from 'proprietary/restricted' research.
We've discussed this topic before, but I'm not sure we ever reached a consensus on how we're defining
our work. If we believe some of our collaborators' research may be 'proprietary', this is something
we need to discuss with them immediately, as this is something we must address in the proposal.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
2.2. FUNDAMENTAL RESEARCH
It is DoD policy that the publication of products of fundamental research will remain
unrestricted to the maximum extent possible. National Security Decision Directive
(NSDD) 189 defines fundamental research as follows:
‘Fundamental research’ means basic and applied research in science and
engineering, the results of which ordinarily are published and shared broadly
within the scientific community, as distinguished from proprietary research and
from industrial development, design, production, and product utilization, the
results of which ordinarily are restricted for proprietary or national security
reasons.
As of the date of publication of this BAA, the Government expects that program goals as
described herein may be met by proposers intending to perform fundamental research and
proposers not intending to perform fundamental research or the proposed research may
present a high likelihood of disclosing performance characteristics of military systems or
manufacturing technologies that are unique and critical to defense. Based on the nature of
the performer and the nature of the work, the Government anticipates that some awards
will include restrictions on the resultant research that will require the awardee to seek
DARPA permission before publishing any information or results relative to the program.
Proposers should indicate in their proposal whether they believe the scope of the research
included in their proposal is fundamental or not. While proposers should clearly explain
the intended results of their research, the Government shall have sole discretion to select
award instrument type and to negotiate all instrument terms and conditions with
selectees. Appropriate clauses will be included in resultant awards for non-fundamental
research to prescribe publication requirements and other restrictions, as appropriate. This
clause can be found at http://www.darpa.mil/work-with-us/additional-baa.
For certain research projects, it may be possible that although the research being
performed by the awardee is restricted research, a subawardee may be conducting
fundamental research. In those cases, it is the awardee’s responsibility to explain in their
proposal why its subawardee’s effort is fundamental research
[EXTERNAL] PREEMPT - Facility information

Sun 3/25/2018 3:55 PM
Within the 'Capabilities' section of the PREEMPT proposal, we must include language about each of
our collaborator's facilities. I apologize if I've already requested this information from you, but in the
event that I haven't, could you please write-up a short paragraph for this section? I've attached a
template to this email for you to follow.
Please return this section to me as soon as you are able.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
*(Please use the text below as a template for describing your research facility).
Rocky Mountain Laboratories (RML); Hamilton, MT — The Integrated Research

Facility, which opened on the RML campus in 2008, houses BSL-4 laboratory space
for conducting research on viral agents requiring maximum containment. The BSL-4
lab is equipped with all items needed to perform classic virology, basic immunology,
and molecular biology, and the space is equipped for handling caged animals
including rodents, nonhuman primates, and small livestock animals such as pigs,
goats, and sheep. The Virus Ecology Unit (led by Dr. Munster) has field sites in Africa
and the Middle East to study the role of fruit bats in the ecology of EBOV and is
developing a bat colony on site at RML.
[EXTERNAL] RE: Important - response needed FW: PREEMPT - Language on

'Fundamental Research'
Sun 3/25/2018 4:37 PM
To: Peter Daszak <[email protected]>; Ralph Baric ([email protected]) <[email protected]>;
Cc: William B. Karesh <[email protected]>; Luke Hamel <[email protected]>; Anna Willoughby
<[email protected]>
Dear Peter,
At this stage, I don’t think we will have ‘proprietary’ or ‘restricted’ research as most of our work is published or to
be published soon.
Thanks
LF

Tel: +65 6516 8397

Sent: Sunday, 25 March, 2018 11:46 PM
To: Ralph Baric ([email protected]); Wang Linfa; [email protected]; Rocke, Tonie
Cc: William B. Karesh; Luke Hamel; Anna Willoughby
Subject: Important - response needed FW: PREEMPT - Language on 'Fundamental Research'
Importance: High
Ralph, Linfa, Jerome, Tonie,
Please read the email below from Luke. We need to know if any of your part of the proposed work for DEFUSE
will be considered ‘proprietary’ or ‘restricted’. The definitions are in the attached doc, as per the email below.
Those of you who’ve had experience with DoD funding will likely know the answer for this, but please reply to all,
so that the others can follow your lead on this.
We do need responses ASAP, so we can get the correct language into the proposal.
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

Sent: Saturday, March 24, 2018 5:24 PM
To: Peter Daszak; William B. Karesh; Jon Epstein; Kevin Olival, PhD
Subject: PREEMPT - Language on 'Fundamental Research'
Hi all,
Within our proposal, we must mention whether we believe the scope of the research included in our
proposal is 'fundamental' or not.
I've attached a document with language from the BAA (pp. 17,18) that defines 'fundamental' research and
distinguishes it from 'proprietary/restricted' research.
We've discussed this topic before, but I'm not sure we ever reached a consensus on how we're defining
our work. If we believe some of our collaborators' research may be 'proprietary', this is something
we need to discuss with them immediately, as this is something we must address in the proposal.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

Mon 3/26/2018 8:28 AM
Cc: Tonie Rocke (b) (6) @gmail.com>; Abbott, Rachel (Contractor) C <[email protected]>; Richgels,
Katherine L <[email protected]>; Jonathon Musser <[email protected]>; Evelyn Luciano
<[email protected]>
Hi Tonie,
I hope you had a great trip. If you are able to begin drafting a budget justification, that would be
very helpful. Whatever you cannot complete, we will be sure to get done.
Regarding the budget justification, I have reattached a template with appropriate headings and language that is
already correctly formatted. I would just ask you to insert the appropriate name/cost amount, substituting
CAPITALIZED words and filling in gaps (indicated by underscores).
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding section in the budget
justification (as shown in the template). Essentially, any line item that is listed in the budget needs to be justified
in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Mon, Mar 26, 2018 at 8:00 AM, Rocke, Tonie <[email protected]> wrote:
Hi Luke: I have returned from Mexico and just wading through email. Do
you still need me to prepare a budget justification in a word document
(everything was in the excel file) this AM? I'll get on it right away if it
hasn't already been done. Please advise. Best -Tonie
On Sat, Mar 24, 2018 at 1:29 PM, Luke Hamel <[email protected]> wrote:
Hi Tonie,
It looks as though we have a detailed budget from you, but we still will need a budget
justification (essentially a Word doc. that provides justification for each line item of the
budget).
Rachel and Katie - If you have time this weekend to get a start on the budget justification doc,
that would be very helpful. If you're not available, which I understand may very well be the
case, we will be happy to take this on. Please let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
On Fri, Mar 23, 2018 at 4:46 PM, Tonie Rocke <(b) (6) @gmail.com> wrote:
Hello all: I sent my budget justification to Ana several days ago. Thanks for addressing safety
issues Rachel!
Sent from my iPhone
Hi Luke,
I have added some paragraphs to the page you sent. It just deals with safety of
RCN, so I hope that is enough. Most of the text came out of documents we have
to write to get approval to use our RCN vaccines in the field (risk analysis for
USDA CVB and environmental assessment for USGS). Unfortunately, as I said
before, I'll be unavailable until next Thursday, but Tonie should be back in her
office on Monday.
--Rachel
On Fri, Mar 23, 2018 at 1:45 PM, Luke Hamel <[email protected]>
wrote:

If you have not already done so (and I apologize for not knowing
the answer), could you please send us your budget justification
document? We are hoping to have all collaborator budgets and
budget justifications as soon as possible.
In the PREEMPT proposal, we must state how we will establish
methods to assess the 'long-term safety and efficacy of our
preemptive approaches'
Given your field of work, do you have any existing language
on how to address potential negative impacts of intervention
approaches on non-target species?
I have attached language from the BAA to provide you with
further guidance on what DARPA requires us to include.
This being said - Rachel and Katherine, could you please
write-up a short section (a paragraph or so), that addresses
this issue 'long-term safety and efficacy'?
I apologize for the extremely short notice, but we
would greatly appreciate it if you could return this
to us by tomorrow afternoon, Sat. (3/24).
Previously, we had asked you to identify any 'pricing assumptions'
that may correspond with use of government facilities. Due to
confusion about what exactly was being asked for, we reached out
to DARPA staff, asking them to clarify the matter:
We asked: "EcoHealth Alliance has a USG entity listed as a subcontractor
in our proposal. Is the USG entity required to identify any pricing
assumptions beyond those within their fully detailed and documented
budget?
Long story short...there is NO need for you to identify any additional
pricing assumptions.
Thank you and please let me know if you have any questions. I will be available by email and
phone (mobile number listed below) over the weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
EcoHealth Alliance leads cutting-edge scientific research
into the critical connections between human and wildlife
health and delicate ecosystems. With this science, we
develop solutions that prevent pandemics and promote

conservation.
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
PHASE 1
BASE PERIOD 1
A. Personnel ($Total)
• NAME, PhD, TITLE, will oversee all aspects….has in-depth knowledge and experience in…with
expertise in…. We request $AMOUNT p.a. salary for NAME, who will dedicate # months p.a. to
this project for phase ___ years ____.
• NAME, PhD, TITLE, will guide and advise…has worked with emerging zoonoses for over…. has
experience managing…. We request $AMOUNT p.a. salary for NAME who will dedicate # months
p.a. on this project for phase ____ years ____.
• Post-doctoral fellow (TBD), will help lead and coordinate all field and laboratory activities as
well as data analyses and will dedicate # months p.a. to this project. We request $AMOUNT p.a.
to cover stipend for a 3 year fellowship award.
B. Fringe ($Total)
Fringe benefits are calculated as per INSTITITION federally negotiated rate of ___% of base salary per
year.
C. Travel ($Total)
Domestic Travel ($Total): We are requesting $AMOUNT in phase___ year___ to support domestic
travel from ____to ____ for one (1) Co-PI/Co-I and one (1) research scientist to attend the _____
meeting. We calculate the expenses per person as follows: 2 economy, round-trip tickets (departure
location <> return location) at $AMOUNT/person, # nights in hotel at $AMOUNT/person, and a total per
diem allowance of $AMOUNT/person.
We are requesting $AMOUNT in the phase____year____ to support domestic travel from ____, to ____,
for one (1) Co-PI/Co-I and one (1) research scientist to attend ____ meeting. We calculate the expenses
per person as follows: 2 economy, round-trip tickets (departure <> return) at $AMOUNT/person, # nights
in hotel at $AMOUNT/person, and a total per diem allowance of $AMOUNT/person.
International Travel ($Total): We request $AMOUNT p.a. for phase____ years____ to support
international travel from Departure location to project study regions in LOCATION. We have budgeted for
either a) one (1) Co-PI and two (2) research scientist; or b) three (3) research scientists to travel three
times to each region for ____ with local partners. Expenses per person for each trip are calculated as
follows: 2 economy round trip tickets (ldeparture location<> return location) at $AMOUNT each, lodging at
$AMOUNT x # nights, a total per diem allowance of $AMOUNT. Total estimated travel expenses to
location per person per trip are $AMOUNT.
D. Field work ($Total)

Field team ($Total): We requesting $AMOUNT per year for phase____ years___ and $AMOUNT for
phase___ year____ to cover stipends for # field assistants to conduct biological sampling.
Field visits ($Total): We are requesting $AMOUNT p.a. for phase___ years____and $AMOUNT for
phase____ year____ to cover transportation to field sites.
E. Supplies and Materials ($Total)

We are requesting a total of $AMOUNT for supplies and materials across all phases and years.
- Biological sampling supplies ($Total) We are requesting $AMOUNT for phase___ year____
and $AMOUNT for phase____ year____ to purchase necessary supplies for biological sampling
including (type, examples of) materials necessary for the collection (e.g. vials, swabs) and
transportation of biological samples, and microscopes.
- Computing devices ($Total) 2 laptop computers at $AMOUNT for research analyses.
- Office supplies ($Total): We are requesting $AMOUNT to purchase office supplies to record
biodiversity and laboratory data (notebooks, clipboards, pens, etc.).
- Database development ($Total): We request $AMOUNT for the development of an extensive,
comprehensive database to store all collected data.
- Publications ($Total): We are requesting $AMOUNT p.a. for phase____ years____ to support
journal publication costs of research results. We expect to produce ____ publications per year.
- Internet ($Total): Internet service for ___ months per year at $40.00 per month.
- Cellphone service ($Total): Cellphone service for ___ months per year at $AMOUNT per
month.
- Google apps for work ($Total): Google apps service for __ months per year at $AMOUNT per
month.
- Printing and Photocopying ($1,620): Printing and photocopying of survey instrument, survey
guide and training materials.
F. Equipment ($Total)
We request a total of $AMOUNT in phase____ year____ to purchase ____ at $AMOUNT and ____ at
$AMOUNT to preserve samples prior to shipment.
We are requesting a federally negotiated indirect cost rate of ____% on all direct costs.
PHASE 1
BASE PERIOD 2
PHASE 2
OPTION PERIOD 1
PHASE 2
OPTION PERIOD 2

Mon 3/26/2018 9:48 AM
Cc: Tonie Rocke <(b) (6) @gmail.com>; Abbott, Rachel (Contractor) C <[email protected]>; Richgels,
<[email protected]>
Thank you, Tonie! Let's setup a tentative call for 4 PM (ET)/3 PM (CT). We may not have any
need for the call, but best to have one scheduled just in case.
Phone: 1-719-785-9461
Password: 9784#
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Will do. I'll send a paragraph on facilities as well. Talk shortly. -Tonie
On Mon, Mar 26, 2018 at 8:28 AM, Luke Hamel <[email protected]> wrote:
Hi Tonie,
I hope you had a great trip. If you are able to begin drafting a budget justification, that would
be very helpful. Whatever you cannot complete, we will be sure to get done.
Regarding the budget justification, I have reattached a template with appropriate headings and language
that is already correctly formatted. I would just ask you to insert the appropriate name/cost amount,
substituting CAPITALIZED words and filling in gaps (indicated by underscores).
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding section in the
budget justification (as shown in the template). Essentially, any line item that is listed in the budget needs to
be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Luke: I have returned from Mexico and just wading through email.
Do you still need me to prepare a budget justification in a word
document (everything was in the excel file) this AM? I'll get on it right
away if it hasn't already been done. Please advise. Best -Tonie
Hi Tonie,
budget).
Rachel and Katie - If you have time this weekend to get a start on the budget justification
doc, that would be very helpful. If you're not available, which I understand may very well
be the case, we will be happy to take this on. Please let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6)
(direct)
(b) (6) (mobile)
On Fri, Mar 23, 2018 at 4:46 PM, Tonie Rocke (b) (6) @gmail.com> wrote:
Hello all: I sent my budget justification to Ana several days ago. Thanks for addressing
safety issues Rachel!
Sent from my iPhone
Hi Luke,
I have added some paragraphs to the page you sent. It just deals with
safety of RCN, so I hope that is enough. Most of the text came out of
documents we have to write to get approval to use our RCN vaccines in the
field (risk analysis for USDA CVB and environmental assessment for USGS).
Unfortunately, as I said before, I'll be unavailable until next Thursday, but
Tonie should be back in her office on Monday.
--Rachel
On Fri, Mar 23, 2018 at 1:45 PM, Luke Hamel
If you have not already done so (and I apologize for not
knowing the answer), could you please send us your budget
justification document? We are hoping to have all collaborator
budgets and budget justifications as soon as possible.
Given your field of work, do you have any existing
language on how to address potential negative impacts
of intervention approaches on non-target species?
I have attached language from the BAA to provide you
with further guidance on what DARPA requires us to
include.
write-up a short section (a paragraph or so), that
addresses this issue 'long-term safety and efficacy'?

would greatly appreciate it if you could return
this to us by tomorrow afternoon, Sat. (3/24).
Previously, we had asked you to identify any 'pricing
assumptions' that may correspond with use of government
facilities. Due to confusion about what exactly was being
asked for, we reached out to DARPA staff, asking them to
clarify the matter:
We asked: "EcoHealth Alliance has a USG entity listed as a
subcontractor in our proposal. Is the USG entity required to identify
any pricing assumptions beyond those within their fully detailed and
documented budget?
Long story short...there is NO need for you to identify any
additional pricing assumptions.
Thank you and please let me know if you have any questions. I will be available by email
and phone (mobile number listed below) over the weekend, should you need to contact
me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
EcoHealth Alliance leads cutting-edge scientific
research into the critical connections between human
and wildlife health and delicate ecosystems. With this
science, we develop solutions that prevent pandemics
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Sent: Monday, March 26, 2018 11:58 AM
To: Luke Hamel
Cc: Tonie Rocke; Abbott, Rachel; Richgels, Katherine; Jonathon Musser; Evelyn Luciano
Subject: Re: [EXTERNAL] PREEMPT - A few important items
Attachments: Budget Justification_rocke.docx; NWHC_BudgetBreakdown_26March2018-ter.xlsx;
USGS_DEFUSE_budget_26Mar_ter.pdf
Hello Luke: Attached is my budget justification (word and updated excel files) and my final budget. I found
several mistakes in the original budget (miscalculations in the travel budget) which I fixed and also when time
was added to my salary, the fringe was not adjusted. Thus the budget is slightly different but not by much. I
think I have caught everything and it all adds up now, but feel free to check. I will send facility description
along soon. Thanks -Tonie
Hi Tonie,
I hope you had a great trip. If you are able to begin drafting a budget justification, that would be very helpful. Whatever
you cannot complete, we will be sure to get done.
Regarding the budget justification, I have reattached a template with appropriate headings and language that is already correctly
formatted. I would just ask you to insert the appropriate name/cost amount, substituting CAPITALIZED words and filling in gaps
(indicated by underscores).
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding section in the budget justification (as shown in
the template). Essentially, any line item that is listed in the budget needs to be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Luke: I have returned from Mexico and just wading through email. Do you still need me to prepare a
budget justification in a word document (everything was in the excel file) this AM? I'll get on it right away if
it hasn't already been done. Please advise. Best -Tonie
1
Hi Tonie,
It looks as though we have a detailed budget from you, but we still will need a budget justification (essentially a Word
doc. that provides justification for each line item of the budget).
Rachel and Katie - If you have time this weekend to get a start on the budget justification doc, that would be very
helpful. If you're not available, which I understand may very well be the case, we will be happy to take this on. Please
let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello all: I sent my budget justification to Ana several days ago. Thanks for addressing safety issues Rachel!
Sent from my iPhone
Hi Luke,
I have added some paragraphs to the page you sent. It just deals with safety of RCN, so I hope that
is enough. Most of the text came out of documents we have to write to get approval to use our
RCN vaccines in the field (risk analysis for USDA CVB and environmental assessment for
USGS). Unfortunately, as I said before, I'll be unavailable until next Thursday, but Tonie should be
back in her office on Monday.
--Rachel
 Regarding NWHC budget justification

o If you have not already done so (and I apologize for not knowing the answer),
could you please send us your budget justification document? We are hoping to
have all collaborator budgets and budget justifications as soon as possible.
2
 Regarding language on 'Long-term safety and efficacy'
o In the PREEMPT proposal, we must state how we will establish methods to assess
the 'long-term safety and efficacy of our preemptive approaches'
 Given your field of work, do you have any existing language on how to
address potential negative impacts of intervention approaches on non-
target species?
 I have attached language from the BAA to provide you with further
guidance on what DARPA requires us to include.
 This being said - Rachel and Katherine, could you please write-up a short
efficacy'?
 I apologize for the extremely short notice, but we would greatly
appreciate it if you could return this to us by tomorrow
afternoon, Sat. (3/24).
 Regarding 'pricing assumptions' for NWHC facilities
o Previously, we had asked you to identify any 'pricing assumptions' that may
matter:
 We asked: "EcoHealth Alliance has a USG entity listed as a subcontractor in
our proposal. Is the USG entity required to identify any pricing assumptions
beyond those within their fully detailed and documented budget?
 To which they responded: "No"
 Long story short...there is NO need for you to identify any additional
pricing assumptions.
Thank you and please let me know if you have any questions. I will be available by email and phone
(mobile number listed below) over the weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
conservation.
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
3
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
4
PHASE 1
BASE PERIOD 1
A. Personnel ($94,967)
• Tonie E. Rocke, PhD, Research Microbiologist, will oversee all aspects of developing methods to
deliver immunomodulatory and immunoboosting agents to bats. Dr. Rocke has in-depth
knowledge and experience in developing oral vaccines for use in controlling disease in wild
animals, with particular expertise in developing vaccines for bats. We request $9,179 in salary for
Dr. Tonie Rocke, who will dedicate 0.85 months p.a. to this project for phase1, year 1. An
additional 1 month of Dr. Rocke’s time will be provided in-kind.
• Dr. Rachel Abbot, DVM, MS, Research Associate, will help coordinate all field and laboratory
activities as well as data compilation and analyses. Dr. Abbott has considerable experience in
managing several previous vaccine projects in wild rodents and bats. We request $61,006 in
salary for Dr. Abbott who will dedicate 12 months p.a. on this project for phase 1 year 1.
• Undergraduate student assistants: Three students will be hired for 3 to assist with bat feeding
and husbandry for a total of $24,782.
B. Fringe ($18,445)
Fringe benefits are calculated as per US Geological Survey federally negotiated rate of 30.84% of base
salary per year for Dr. Rocke and 26.35% for Dr. Abbott. Students receive an hourly wage but no fringe
benefits
C. Travel ($9707.25)
Domestic MeetingTravel ($4,007,25): We are requesting $1,011.25 in phase 1, year 1 to support
domestic travel from Madison, WI to Arlington, VA for one (1) Co-PI/Co-I to attend the DARPA Kickoff
Meeting. We calculate the expenses per person as follows: 1 economy, round-trip tickets (Madison, WI <>
Arlington Virginia) at $333, 2 nights in hotel at 437.50, plus $120 for parking and taxi and a total per diem
allowance of $120.75.
We are requesting $2,996 in the phase 1, year 1 to support domestic travel from Madison, WI, to New
York, New York for one (1) Co-PI/Co-I and one (1) research scientist to attend the annual meeting. We
calculate the expenses per person as follows: 2 economy, round-trip tickets (Madison, WI <> New York,
New York) at $333/person, 3 nights in hotel at $291/person, and a total per diem allowance of
$222/person, plus $140 for parking and taxi fare.
Domestic Field visit ($2316): We are requesting $2,316 in phase 1 year 1 to support domestic travel
form Madison, Wisconsin to a cave site in Upper Peninsula, Michigan for 3 people (1 co-PI, 2 technicians)
to test delivery methods in bats. We calculate the expenses per person as follows: 4 nights in a hotel at
$93/person, a total per diem allowance of $204/person, and gas and use of government vehicle at a cost
$588.
International Field visit ($3384)

We have budgeted for one Co-PI to travel for a cave site visit with local partners in China in phase 1,
year 1. Expenses are calculated as follows: 1 economy round trip ticket (Madison, WI<> Kunming,
Yunnan, China) for $1370, $1029 for lodging at $147 x 7 nights, a total per diem allowance of $805, plus
$180 for parking and taxi fare for each visit.
E. Supplies and Materials (21,982.52)

Animal Handling supplies ($11,288.67 Total): We are requesting $11,288.67 for phase 1, Year
1 for bat handling and supplies for both field and laboratory studies to include: a Harp trap for
collecting bats, bat caging materials, mealworms for feeding bats, bat wing bands, anti-parasite
medications, and PPE for handling bats (Cut resistant gloves, Tyvek suits, Tyvek aprons, N95
respirators, and PAPR replacement covers).
- Vaccine production and biological sampling supplies ($10,693.85 Total) We are requesting
$10,693.85 for phase 1, year 1 to purchase necessary supplies for vaccine production and
biological sampling including cell culture flasks, Nunc cell factories, fetal bovine serum, DMEM
medium, glycerin jelly, rhodamine B, hair collection bags, 96 well plates, pipette tips and other
consumables
F. Equipment (none requested)

G. Other direct costs
Animal Care ($12,600 Total) We are requesting $12,600 for phase 1, year 1. This amount
covers animal care and room costs for up to 60 bats for 120 days at $105/day in a BSL3 animal
facility, including daily husbandry, gut-loading meal worms, cleaning cages, veterinary services
and daily surcharge for room use.
Rabies prophylaxis shots ($4020) We are requesting $4020 for phase 1, year 1 to provide rabies
prophylactic vaccination for 4 animal care staff/year. Rabies vaccination is required of all staff
handling bats due to the high prevalence of rabies in bats.
We are requesting a federally negotiated indirect cost rate of 64.54% on all direct costs.
PHASE 1
BASE PERIOD 2
animals, with particular expertise in developing vaccines for bats. We request $6,479 salary for
Dr. Tonie Rocke, who will dedicate 0.6 months to this project for phase1, year 2. An additional 1
month of Dr. Rocke’s time will be provided in-kind.
salary for Dr. Abbott who will dedicate 12 months on this project for phase 1 year 2.
B. Fringe ($17,968)
benefits.
C. Travel ($10,561)
$588.
International Travel ($8245.50): We request $8,245.50 p.a. for phase 1, year 2 to support international
travel from Madison, WI location to Annual Meeting in Wuhan, China. We calculate the expenses as
follows: 1 economy, round trip ticket (Madison, WI<>Wuhan, China at $6,861, 5 nights hotel at $139.65,
and a total per diem allowance of 546.25, plus $140 for parking and taxi fare.
Animal Handling supplies ($7,282.67 Total): We are requesting $7,282.67 for phase 1, year 2
for bat handling and supplies for both field and laboratory studies to include bat caging materials,
mealworms for feeding bats, bat wing bands, anti-parasite medications, and PPE for handling
bats (Cut resistant gloves, Tyvek suits, Tyvek aprons, N95 respirators, and PAPR replacement
covers).
$19,311.85 for phase 1, year 1-2, and phase 2, year 3 to purchase necessary supplies for
vaccine production and biological sampling including cell culture flasks, Nunc cell factories, fetal
bovine serum, DMEM medium, glycerin jelly, rhodamine B, hair collection bags, 96 well plates,
pipette tips and other consumables

Rabies prophylaxis shots ($4020) We are requesting $4020 for phase 1, year 1 to provide
rabies prophylactic vaccination for 4 animal care staff/year. Rabies vaccination is required of all
staff handling bats due to the high prevalence of rabies in bats.

PHASE 2
OPTION PERIOD 1
Dr. Tonie Rocke, who will dedicate 0.8 months p.a. to this project for phase 2, option year 1. An
salary for Dr. Abbott who will dedicate 12 months p.a. on this project for phase 2, Option year 1
B. Fringe ($18,634)
benefits
C. Travel ($11,430)
Domestic MeetingTravel ($2996):
We are requesting $2,996 in the phase 2, option year 1 to support domestic travel from Madison, WI, to
New York, New York for one (1) Co-PI/Co-I and one (1) research scientist to attend the annual meeting.
We calculate the expenses per person as follows: 2 economy, round-trip tickets (Madison, WI <> New
York, New York) at $333/person, 3 nights in hotel at $291/person, and a total per diem allowance of
Domestic Field visit ($2316): We are requesting $2,316 in phase 2, option year 1 to support domestic
travel from Madison, Wisconsin to a cave site in Upper Peninsula, Michigan for 3 people (1 co-PI, 2
technicians) to test delivery methods in bats. We calculate the expenses per person as follows: 4 nights in
a hotel at $93/person, a total per diem allowance of $204/person, and gas and use of government vehicle
at a cost $588.

We have budgeted for one Co-PI and one research associate to travel for a cave site visit with local
partners in China in phase 2, option year1. Expenses per person are calculated as follows: 1 economy
round trip ticket (Madison, WI<> Kunming, Yunnan, China) for $1370, $1029 for lodging at $147 x 7
nights, a total per diem allowance of $805. An additional $180 is requested for parking and taxi fare.
E. Supplies and Materials ($17,976.52)

Animal Handling supplies ($7,282.67 Total): We are requesting $7,282.67 for phase 2, option
year 1 for bat handling and supplies for both field and laboratory studies to include: bat caging
materials, mealworms for feeding bats, bat wing bands, anti-parasite medications, and PPE for
handling bats (Cut resistant gloves, Tyvek suits, Tyvek aprons, N95 respirators, and PAPR
replacement covers).
$10,693.85 for phase 2, option year 1 to purchase necessary supplies for vaccine production and
consumables

Animal Care ($12,600 Total) We are requesting $12,600 for phase 2, option year 1. This
amount covers animal care and room costs for up to 60 bats for 120 days at $105/day in a BSL3
animal facility, including daily husbandry, gut-loading meal worms, cleaning cages, veterinary
services and daily surcharge for room use.
Rabies prophylaxis shots ($4020) We are requesting $4020 for phase 2, option year 1 to provide

PHASE 2
OPTION PERIOD 2
Dr. Tonie Rocke, who will dedicate 0.4 months to this project for phase 2, option period 2.
salary for Dr. Abbott who will dedicate 6 months. on this project for phase 2, option period 2.
B. Fringe ($9,318)
salary per year for Dr. Rocke and 26.35% for Dr. Abbott.
C. Travel ($3501)
We are requesting $3,501 in the phase 2, optional period 2 to support domestic travel from Madison, WI,
to New York, New York for one (1) Co-PI/Co-I and one (1) research scientist to attend the annual
meeting. We calculate the expenses per person as follows: 2 economy, round-trip tickets (Madison, WI <>
New York, New York) at $333/person, 4 nights in hotel at $291 and a total per diem allowance of $296,
plus $140 for parking and taxi fare for Co-PI and 3 nights in a hotel at $291 for research associate, total
per diem allowance of $222 and $140 for parking and taxi fare.

Biological sampling supplies ($2,163,43 Total) We are requesting $2,163,43 for phase 2,
option period 2 to purchase supplies to finish up biological sampling, including 96 well plates,
pipette tips and other consumables.

TRAVEL
Trip #: 1 Location: Arlington, VA, USA Contract Period
Purpose: DARPA Kickoff Meeting Base 1
1.75 1 $333.00 $69.00 $250.00 $120.00 $1,011.25
Itemized Expenses for Other
Description Amount
Parking $20.00
Total: $120.00
Purpose: China Cave Site Visit Base 1
7 1 $1,370.00 $115.00 $147.00 $180.00 $3,384.00
Description Amount
Parking $80.00
Total: $180.00
Trip #: 3 Location: Upper Peninsula Michagan Contract Period

4 3 $0.00 $51.00 $93.00 $588.00 $2,316.00
Description Amount
Gas $120.00
Total: $588.00
Purpose: Annual Meeting (Rocke + Abbott) Base 1
3 2 $333.00 $74.00 $291.00 $140.00 $2,996.00
Description Amount
Parking $40.00
Total: $140.00

4 3 $0.00 $51.00 $93.00 $588.00 $2,316.00
Description Amount
Gas $120.00
Total: $588.00
Trip #: 6 Location: Wuhan, China Contract Period
Purpose: Annual Meeting (Rocke) Base 2
4.75 1 $6,861.00 $115.00 $147.00 $140.00 $8,245.50
Description Amount
Parking $40.00
Total: $140.00

Purpose: US Cave Site Visit Option I
4 3 $0.00 $51.00 $93.00 $588.00 $2,316.00
Description Amount
Gas $120.00
Total: $588.00
Purpose: Deployment Visit Option I
7 2 $1 370.00 $115.00 $147.00 $180.00 $6 588.00
Description Amount
Parking $80.00
Total: $180.00
Purpose: Annual Meeting (Rocke + Abbott) Option I
3 2 $666.00 $74.00 $291.00 $140.00 $2,996.00
Description Amount
Parking $40.00
Total: $140.00
Purpose: Annual Meeting (Rocke + Abbott) Option II
4 1 $333.00 $74.00 $291.00 $140.00 $1,933.00
3 1 $333.00 $74.00 $291.00 $140.00 $1,568.00
Description Amount
Parking $40.00
Total: $140.00
MATERIALS/EQUIPMENT
Harp Trap Bat conservation and management $2,003 2 $4,006 00 Y1
Mealworms Rainbow mealworms $100/20,000 12 $1,200 00 Y1-Y3
bat caging materials various $500/cage 9 $4,500 00 Y1-Y3 custom made
bat wing bands Porzana $596/box 9 $4,768 00 Y1-Y3
Cut resistant gloves Varied $15/pr 30 $450 00 Y1-Y3
Tyvek suits DuPOnt EV29135313 $306/case 15 $4,590 00 Y1-Y3
Tyvek aprons Lakeland 6EHH7 $58/case 15 $870 00 Y1-Y3
N95 respirators 3M 9511 $20/box 45 $900 00 Y1-Y3
PAPRs replacement covers 3M $96/3 units 45 $4,320 00 Y1-Y3
Selamectin Zoetis $250 $250 00 Y1-Y3
cell culture flasks Corning 430641U 415/case 5 $2,075 00 Y1-Y3
cell culture flasks Corning 431080 425/case 10 $4,250 00 Y1-Y3
Nunc cell factories Nunc 140250 $370/case 12 $4,440 00 Y1-Y3
fetal bovine serum GE Hyclone SH30071 03 $600/bottle 8 $4,800 00 Y1-Y3
DMEM medium GE Hyclone SH30021 02 $30/l 10 $300 00 Y1-Y3
glycerin jelly Carolina Biological Supply $43 bottle 50 $2,150 00 Y1-Y3
rhodamine B Sigma $56/100g 6 $336 00 Y1-Y3
hair collection bags U-line $75/box 10 $750 00 Y1-Y3
96 well plates Corning 3599 $600/case 8 $4,800 00 Y1-Y3 5
pipette tips Fisher 13-676-10 $100/case 50 $5,000 00 Y1-Y3 5
Consumables miscellaneous $5,344 00 Y1-Y3 5 needles, syringes,whirl paks, plastic bags, other disposables, all <5K
Total $60,099 00
Y1 Total $25,854.00 $21,982 52
Y2 Total $17,976 52
Y3 Total $17,976 52
Y3 5 Total $2,163 43
$60,098.99
MATERIALS/EQUIPMENT
Harp Trap Bat conservation and management $2,003 2 $4,006 00 Y1
Mealworms Rainbow mealworms $100/20,000 12 $1,200 00 Y1-Y3
bat caging materials various $500/cage 9 $4,500 00 Y1-Y3 custom made
bat wing bands Porzana $596/box 9 $4,768 00 Y1-Y3
Cut resistant gloves Varied $15/pr 30 $450 00 Y1-Y3
Tyvek suits DuPOnt EV29135313 $306/case 15 $4,590 00 Y1-Y3
Tyvek aprons Lakeland 6EHH7 $58/case 15 $870 00 Y1-Y3
N95 respirators 3M 9511 $20/box 45 $900 00 Y1-Y3
PAPRs replacement covers 3M $96/3 units 45 $4,320 00 Y1-Y3
Selamectin Zoetis $250 $250 00 Y1-Y3
cell culture flasks Corning 430641U 415/case 5 $2,075 00 Y1-Y3
cell culture flasks Corning 431080 425/case 10 $4,250 00 Y1-Y3
Nunc cell factories Nunc 140250 $370/case 12 $4,440 00 Y1-Y3
fetal bovine serum GE Hyclone SH30071 03 $600/bottle 8 $4,800 00 Y1-Y3
DMEM medium GE Hyclone SH30021 02 $30/l 10 $300 00 Y1-Y3
glycerin jelly Carolina Biological Supply $43 bottle 50 $2,150 00 Y1-Y3
rhodamine B Sigma $56/100g 6 $336 00 Y1-Y3
hair collection bags U-line $75/box 10 $750 00 Y1-Y3
96 well plates Corning 3599 $600/case 8 $4,800 00 Y1-Y3 5
pipette tips Fisher 13-676-10 $100/case 50 $5,000 00 Y1-Y3 5
Consumables miscellaneous $5,344 00 Y1-Y3 5 needles, syringes,whirl paks, plastic bags, other disposables, all <5K
Total $60,099 00
Y1 Total $25,854.00 $21,982 52
Y2 Total $17,976 52
Y3 Total $17,976 52
Y3 5 Total $2,163 43
$60,098.99
[email protected]
Applicants tab.
CFDA Number: 12.910
Competition ID:
Competition Title:

[email protected]

DUNS: 0770900660000
Form Version: 1.4

FORM ACTIONS:
Totals ($)
Section B, Other Personnel 74,346.00
9
380,847.00
Section D, Travel
35,199.75
1. Domestic
17,452.25
2. Foreign
17,747.50
2. Stipends
3. Travel
4. Subsistence
5. Other
115,958.99
60,098.99
6,000.00
8. Other 1
37,800.00
9. Other 2
12,060.00
10. Other 3

Section J, Fee
874,716.56

Mon 3/26/2018 2:01 PM
Cc: Tonie Rocke <(b) (6) @gmail.com>; Abbott, Rachel (Contractor) C <[email protected]>; Richgels,
<[email protected]>
Excellent. Thank you for all of your work on this, Tonie! I will speak with Jonathon and address your
question regarding the DARPA kick-off meeting.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello Luke: Attached is my budget justification (word and updated excel
files) and my final budget. I found several mistakes in the original
budget (miscalculations in the travel budget) which I fixed and also
when time was added to my salary, the fringe was not adjusted. Thus
the budget is slightly different but not by much. I think I have caught
everything and it all adds up now, but feel free to check. I will send
facility description along soon. Thanks -Tonie
Hi Tonie,
budget justification (as shown in the template). Essentially, any line item that is listed in the budget needs to
be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Luke: I have returned from Mexico and just wading through email.
Do you still need me to prepare a budget justification in a word
document (everything was in the excel file) this AM? I'll get on it right
away if it hasn't already been done. Please advise. Best -Tonie
Hi Tonie,
budget).
Rachel and Katie - If you have time this weekend to get a start on the budget justification
doc, that would be very helpful. If you're not available, which I understand may very well
be the case, we will be happy to take this on. Please let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Sent from my iPhone
Hi Luke,
documents we have to write to get approval to use our RCN vaccines in the
field (risk analysis for USDA CVB and environmental assessment for USGS).
Unfortunately, as I said before, I'll be unavailable until next Thursday, but
Tonie should be back in her office on Monday.
--Rachel
justification document? We are hoping to have all collaborator
budgets and budget justifications as soon as possible.
language on how to address potential negative impacts
of intervention approaches on non-target species?
include.
write-up a short section (a paragraph or so), that
addresses this issue 'long-term safety and efficacy'?

would greatly appreciate it if you could return
this to us by tomorrow afternoon, Sat. (3/24).
clarify the matter:
subcontractor in our proposal. Is the USG entity required to identify
any pricing assumptions beyond those within their fully detailed and
documented budget?
Thank you and please let me know if you have any questions. I will be available by email
and phone (mobile number listed below) over the weekend, should you need to contact
me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Rocke, Tonie E <[email protected]>
Mon 3/26/2018 2:16 PM
To: Luke Hamel <[email protected]>; Daszak Peter <[email protected]>
Cc: Tonie Rocke <[email protected]>; Abbott, Rachel (Contractor) C <[email protected]>; Richgels,
<[email protected]>
Hello again Luke: Here is a brief description of our facility. Let me know if
this is sufficient. Also, will we be having a call or not? I have not yet had a
chance to review the technical proposal but will do so shortly.
Excellent. Thank you for all of your work on this, Tonie! I will speak with Jonathon and address
your question regarding the DARPA kick-off meeting.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello Luke: Attached is my budget justification (word and updated
excel files) and my final budget. I found several mistakes in the original
budget (miscalculations in the travel budget) which I fixed and also
when time was added to my salary, the fringe was not adjusted. Thus
the budget is slightly different but not by much. I think I have caught
everything and it all adds up now, but feel free to check. I will send
facility description along soon. Thanks -Tonie
Hi Tonie,
budget justification (as shown in the template). Essentially, any line item that is listed in the budget needs
to be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Luke: I have returned from Mexico and just wading through
email. Do you still need me to prepare a budget justification in a
word document (everything was in the excel file) this AM? I'll get
on it right away if it hasn't already been done. Please advise. Best
-Tonie
Hi Tonie,
budget).
Rachel and Katie - If you have time this weekend to get a start on the budget
justification doc, that would be very helpful. If you're not available, which I understand
may very well be the case, we will be happy to take this on. Please let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Sent from my iPhone
Hi Luke,
documents we have to write to get approval to use our RCN vaccines in
the field (risk analysis for USDA CVB and environmental assessment for
USGS). Unfortunately, as I said before, I'll be unavailable until next
Thursday, but Tonie should be back in her office on Monday.
--Rachel
justification document? We are hoping to have all
collaborator budgets and budget justifications as soon as
possible.
In the PREEMPT proposal, we must state how we

will establish methods to assess the 'long-term safety and
efficacy of our preemptive approaches'
language on how to address potential negative
impacts of intervention approaches on non-target
species?
include.
This being said - Rachel and Katherine, could you
please write-up a short section (a paragraph or so),
that addresses this issue 'long-term safety and
efficacy'?
I apologize for the extremely short notice, but
we would greatly appreciate it if you could
return this to us by tomorrow afternoon, Sat.
(3/24).
clarify the matter:
subcontractor in our proposal. Is the USG entity required to
identify any pricing assumptions beyond those within their fully
Thank you and please let me know if you have any questions. I will be available by
email and phone (mobile number listed below) over the weekend, should you need to
contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
The National Wildlife Center (NWHC) is located on 24 acres of Federal property in Madison,
Wisconsin. The facility was designed to meet all of the criteria set down by the National
Institutes of Health (NIH) and the Center for Disease Control for Biological Safety Level III
(BSL-III) research. The research building, of approximately 32,000 square feet, contains
specialized research laboratories and support areas, staff offices, and BSL-III biocontainment
animal research areas. Two, fully equipped laboratories in the research building are available at
all times for the proposed work. Each laboratory is equipped with an autoclave and has two
adjacent isolation rooms supplemented with biosafety cabinets for handling of specimens and
cultures. The laboratories and containment rooms are maintained under negative air pressure at
all times. Animal research involving infectious agents is performed within the NWHC’s BSL-
III biocontainment animal research area, or Animal Isolation Wing (AIW). Staff must go
through a complete clothing change to enter the AIW and are required to pass through an
automatically activated shower before leaving the containment area. The AIW is equipped with
pathology incineration and steam sterilization equipment, and an ultraviolet radiation chamber so
that all materials can be treated before leaving the biological containment area, and the area is
maintained under negative air pressure. Animal care staff is available and trained to maintain,
monitor and handle animals as required. A Veterinary Medical Officer is on site to address any
animal health issues, and the AIW is fully equipped for medical and surgical procedures.

Mon 3/26/2018 2:32 PM
Cc: Daszak Peter <[email protected]>; Tonie Rocke <(b) (6) @gmail.com>; Abbott, Rachel (Contractor) C
<[email protected]>; Richgels, Katherine L <[email protected]>; Jonathon Musser
Hi Tonie,
Thank you for the facility description. There won't be a need for us to have a call, but please review
the draft and look for ways to reduce the text of your technical section.
Additionally, I was hoping to confirm the following two points:
(1) Is NWHC's CAGE code the following? 52Y40
(2) Which of the following 'organization types', best describes NWHC?
- “LARGE BUSINESS”, “SMALL DISADVANTAGED BUSINESS”, “OTHER SMALL BUSINESS”, “HBCU”, “MI”,
“OTHER EDUCATIONAL”, OR “OTHER NONPROFIT”;
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello again Luke: Here is a brief description of our facility. Let me know
if this is sufficient. Also, will we be having a call or not? I have not yet
had a chance to review the technical proposal but will do so shortly.
Excellent. Thank you for all of your work on this, Tonie! I will speak with Jonathon and address
your question regarding the DARPA kick-off meeting.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
excel files) and my final budget. I found several mistakes in the
original budget (miscalculations in the travel budget) which I fixed
and also when time was added to my salary, the fringe was not
adjusted. Thus the budget is slightly different but not by much. I
think I have caught everything and it all adds up now, but feel free to
check. I will send facility description along soon. Thanks -Tonie
Hi Tonie,
I hope you had a great trip. If you are able to begin drafting a budget justification, that
would be very helpful. Whatever you cannot complete, we will be sure to get done.
Regarding the budget justification, I have reattached a template with appropriate headings and
language that is already correctly formatted. I would just ask you to insert the appropriate
name/cost amount, substituting CAPITALIZED words and filling in gaps (indicated by
underscores).
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding section in
the budget justification (as shown in the template). Essentially, any line item that is listed in the budget
needs to be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
word document (everything was in the excel file) this AM? I'll get
on it right away if it hasn't already been done. Please advise.
Best -Tonie
Hi Tonie,
justification (essentially a Word doc. that provides justification for each line item of
the budget).
justification doc, that would be very helpful. If you're not available, which I understand
may very well be the case, we will be happy to take this on. Please let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

Hello all: I sent my budget justification to Ana several days ago. Thanks for
addressing safety issues Rachel!
Sent from my iPhone
Hi Luke,
documents we have to write to get approval to use our RCN vaccines in
the field (risk analysis for USDA CVB and environmental assessment for
USGS). Unfortunately, as I said before, I'll be unavailable until next
Thursday, but Tonie should be back in her office on Monday.
--Rachel
knowing the answer), could you please send us your
budget justification document? We are hoping to have all
collaborator budgets and budget justifications as soon as
possible.
will establish methods to assess the 'long-term safety and
efficacy of our preemptive approaches'
species?
I have attached language from the BAA to provide
you with further guidance on what DARPA requires
us to include.
please write-up a short section (a paragraph or so),
that addresses this issue 'long-term safety and
efficacy'?
I apologize for the extremely short notice, but
we would greatly appreciate it if you could
return this to us by tomorrow afternoon,
Sat. (3/24).

assumptions' that may correspond with use of
government facilities. Due to confusion about what
exactly was being asked for, we reached out to DARPA
staff, asking them to clarify the matter:
identify any pricing assumptions beyond those within their fully
Long story short...there is NO need for you to identify
any additional pricing assumptions.
email and phone (mobile number listed below) over the weekend, should you need to
contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
research into the critical connections between
human and wildlife health and delicate ecosystems.
With this science, we develop solutions that prevent
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
[EXTERNAL] PREEMPT - 'Intellectual Property'

Mon 3/26/2018 5:20 PM
To: Zhengli Shi ([email protected]) <[email protected]>; 周鹏 ([email protected]) <[email protected]>; Ralph Baric
([email protected]) <[email protected]>; Sims, Amy C <[email protected]>; Sheahan, Timothy Patrick
<[email protected]>; wang linfa <[email protected]>; Danielle Anderson <danielle.anderson@duke-
nus.edu.sg>; Aaron Trent Irving <[email protected]>; Rocke, Tonie E <[email protected]>;
Cc: Abbott, Rachel (Contractor) C <[email protected]>; [email protected] <[email protected]>;
Richgels, Katherine L <[email protected]>; Baric, Toni C <[email protected]>; Evelyn Luciano
<[email protected]>; Jonathon Musser <[email protected]>
Hi all,
The PREEMPT BAA states that "All proposers must provide a good faith representation that the
proposer either owns or possesses the appropriate licensing rights to all intellectual property that will
be utilized under the proposed effort."
Could you please read through the attached document and fill in the table, as it applies to
your institution? Please return to me as soon as possible.
Thank you, and please let me know if you have any questions.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Intellectual Property
All proposers must provide a good faith representation that the proposer either owns or
possesses the appropriate licensing rights to all intellectual property that will be utilized
under the proposed effort.
For All Non-Procurement Contracts
Proposers responding to this BAA requesting a Grant, Cooperative Agreement,

Technology Investment Agreement, or Other Transaction for Prototypes shall follow the
applicable rules and regulations governing these various award instruments, but, in all
cases, should appropriately identify any potential restrictions on the Government’s
use of any Intellectual Property contemplated under the award instrument in
question. This includes both Noncommercial Items and Commercial Items. Proposers are
encouraged to use a format similar to that described in the section below. If no
restrictions are intended, then the proposer should state “NONE.”
Technical data computer Summary of intended Asserted Name of

software to be furnished use in the conduct of Basis for rights person
with restrictions research assertion category asserting rights
(LIST) (NARRATIVE) (LIST) (LIST) (LIST)
[EXTERNAL] Re: CAGE Code

Mon 3/26/2018 8:33 PM
Thank you, Tonie.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Here is what I learned about our CAGE Code; it's different than what you
had. -T
From: Hankins, Thomas <[email protected]>
Date: Mon, Mar 26, 2018 at 4:07 PM
Subject: CAGE Code
To: Tonie Rocke <[email protected]>
Cc: Lisa Meicher <[email protected]>
Tonie,
Per a 10/2017 listing I found, our CAGE Code is 3VXB0
main USGS is 1AW56
Tom Hankins
Administrative Officer
6006 Schroeder Rd
Madison, WI 53711
608-270-2412
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Tue 3/27/2018 6:38 AM
Hi Tonie,
HBCU stands for 'Historically Black College.University' but I am not sure what 'MI' stands for. I don't
believe it would apply to your institution, however.
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Do you know what HBCU or MI stands for? I did ask someone and they
thought none of these fit either. I'll ask again. -T
Hi Tonie,
Thank you for the information regarding the CAGE code. Unfortunately, there's no option listed
for 'federal government research facility', but someone from your finance department should
know which of these 'organization types' you fall under. I realize this answer may have to wait
until morning, but please let us know as soon as you find out.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
What is a CAGE code? None of those organization types describe
NWHC. We are a federal government research facility. Isn't there an
option for that? -T
Hi Tonie,
Thank you for the facility description. There won't be a need for us to have a call, but
please review the draft and look for ways to reduce the text of your technical section.
- “LARGE BUSINESS”, “SMALL DISADVANTAGED BUSINESS”, “OTHER SMALL BUSINESS”, “HBCU”,
“MI”, “OTHER EDUCATIONAL”, OR “OTHER NONPROFIT”;
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello again Luke: Here is a brief description of our facility. Let me
know if this is sufficient. Also, will we be having a call or not? I

have not yet had a chance to review the technical proposal but
will do so shortly.
Excellent. Thank you for all of your work on this, Tonie! I will speak with Jonathon and
address your question regarding the DARPA kick-off meeting.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello Luke: Attached is my budget justification (word and
updated excel files) and my final budget. I found several
mistakes in the original budget (miscalculations in the travel
budget) which I fixed and also when time was added to my
salary, the fringe was not adjusted. Thus the budget is slightly
different but not by much. I think I have caught everything and
it all adds up now, but feel free to check. I will send facility
description along soon. Thanks -Tonie
On Mon, Mar 26, 2018 at 8:28 AM, Luke Hamel <[email protected]>
wrote:
Hi Tonie,
I hope you had a great trip. If you are able to begin drafting a budget justification,
that would be very helpful. Whatever you cannot complete, we will be sure to get
done.
Regarding the budget justification, I have reattached a template with appropriate headings
and language that is already correctly formatted. I would just ask you to insert the
appropriate name/cost amount, substituting CAPITALIZED words and filling in gaps
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding
section in the budget justification (as shown in the template). Essentially, any line item that is
listed in the budget needs to be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Luke: I have returned from Mexico and just wading
through email. Do you still need me to prepare a budget
justification in a word document (everything was in the
excel file) this AM? I'll get on it right away if it hasn't
already been done. Please advise. Best -Tonie
On Sat, Mar 24, 2018 at 1:29 PM, Luke Hamel <[email protected]>
wrote:
Hi Tonie,
It looks as though we have a detailed budget from you, but we still will need a
budget justification (essentially a Word doc. that provides justification for
each line item of the budget).
justification doc, that would be very helpful. If you're not available, which I
understand may very well be the case, we will be happy to take this on.
Please let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
conservation.
Sent from my iPhone
Hi Luke,
I have added some paragraphs to the page you sent. It just
deals with safety of RCN, so I hope that is enough. Most of the
text came out of documents we have to write to get approval to
use our RCN vaccines in the field (risk analysis for USDA CVB
and environmental assessment for USGS). Unfortunately, as I
said before, I'll be unavailable until next Thursday, but Tonie
should be back in her office on Monday.
--Rachel
I wanted to address a few important PREEMPT items with
you:
If you have not already done so (and I apologize
for not knowing the answer), could you please
send us your budget justification document? We
are hoping to have all collaborator budgets and
Regarding language on 'Long-term safety and
efficacy'

will establish methods to assess the 'long-term
safety and efficacy of our preemptive
approaches'
Given your field of work, do you have any
existing language on how to address
potential negative impacts of intervention
I have attached language from the BAA to
provide you with further guidance on what
DARPA requires us to include.
This being said - Rachel and Katherine,
could you please write-up a short section
(a paragraph or so), that addresses this
issue 'long-term safety and efficacy'?
I apologize for the extremely short
notice, but we would greatly
appreciate it if you could return
this to us by tomorrow afternoon,
Sat. (3/24).
Previously, we had asked you to identify any
'pricing assumptions' that may correspond with
use of government facilities. Due to confusion
about what exactly was being asked for, we
reached out to DARPA staff, asking them to
clarify the matter:
We asked: "EcoHealth Alliance has a USG entity
listed as a subcontractor in our proposal. Is the USG
entity required to identify any pricing assumptions
beyond those within their fully detailed and
documented budget?
Long story short...there is NO need for you to
identify any additional pricing assumptions.
Thank you and please let me know if you have any questions. I will be
available by email and phone (mobile number listed below) over the
weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6)
(mobile)

--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]

Tue 3/27/2018 6:52 AM
Cc: Jonathon Musser <[email protected]>; Daszak Peter <[email protected]>; Tonie Rocke
<(b) (6) @gmail.com>; Abbott, Rachel (Contractor) C <[email protected]>; Richgels, Katherine L
Received. Thank you, Tonie!
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Jonathan: Our DUNS number is 038975934. -Tonie
On Tue, Mar 27, 2018 at 5:44 AM, Jonathon Musser <[email protected]> wrote:
Tonie, would you please confirm your DUNS number as soon as possible today?
Thanks!
Jonathon
Hi Luke: Attached are my comments on the full draft; I added my
comments to Jerome's draft. I corrected a few errors, deleted at
least one sentence in my section, and also added my deliverables for
Task 7. I'm not certain what you want for project metrics. A timeline
or something? Just repeating the deliverables doesn't seem
appropriate. Also, I have someone checking on the CAGE code. Let
me know if you need anything else. Thanks! -Tonie
Hi Tonie,
Thank you for the facility description. There won't be a need for us to have a call, but
please review the draft and look for ways to reduce the text of your technical section.
- “LARGE BUSINESS”, “SMALL DISADVANTAGED BUSINESS”, “OTHER SMALL BUSINESS”, “HBCU”,
“MI”, “OTHER EDUCATIONAL”, OR “OTHER NONPROFIT”;
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
know if this is sufficient. Also, will we be having a call or not? I
have not yet had a chance to review the technical proposal but
will do so shortly.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hello Luke: Attached is my budget justification (word and
updated excel files) and my final budget. I found several
mistakes in the original budget (miscalculations in the travel
budget) which I fixed and also when time was added to my
salary, the fringe was not adjusted. Thus the budget is slightly
different but not by much. I think I have caught everything and
it all adds up now, but feel free to check. I will send facility
description along soon. Thanks -Tonie
On Mon, Mar 26, 2018 at 8:28 AM, Luke Hamel <[email protected]>
wrote:
Hi Tonie,
I hope you had a great trip. If you are able to begin drafting a budget justification,
that would be very helpful. Whatever you cannot complete, we will be sure to get
done.
Regarding the budget justification, I have reattached a template with appropriate headings
and language that is already correctly formatted. I would just ask you to insert the
appropriate name/cost amount, substituting CAPITALIZED words and filling in gaps
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding
section in the budget justification (as shown in the template). Essentially, any line item that is
listed in the budget needs to be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Hi Luke: I have returned from Mexico and just wading
through email. Do you still need me to prepare a budget
justification in a word document (everything was in the
excel file) this AM? I'll get on it right away if it hasn't
already been done. Please advise. Best -Tonie
On Sat, Mar 24, 2018 at 1:29 PM, Luke Hamel <[email protected]>
wrote:
Hi Tonie,
budget justification (essentially a Word doc. that provides justification for
each line item of the budget).
understand may very well be the case, we will be happy to take this on.
Please let us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

conservation.
Sent from my iPhone
Hi Luke,
I have added some paragraphs to the page you sent. It just
deals with safety of RCN, so I hope that is enough. Most of the
text came out of documents we have to write to get approval to
use our RCN vaccines in the field (risk analysis for USDA CVB
and environmental assessment for USGS). Unfortunately, as I
said before, I'll be unavailable until next Thursday, but Tonie
should be back in her office on Monday.
--Rachel
I wanted to address a few important PREEMPT items with
you:
If you have not already done so (and I apologize
for not knowing the answer), could you please
send us your budget justification document? We
are hoping to have all collaborator budgets and
Regarding language on 'Long-term safety and
efficacy'
will establish methods to assess the 'long-term
safety and efficacy of our preemptive
approaches'
Given your field of work, do you have any
existing language on how to address
potential negative impacts of intervention
I have attached language from the BAA to
provide you with further guidance on what
DARPA requires us to include.
This being said - Rachel and Katherine,
could you please write-up a short section
(a paragraph or so), that addresses this
issue 'long-term safety and efficacy'?
I apologize for the extremely short

notice, but we would greatly
appreciate it if you could return
this to us by tomorrow afternoon,
Sat. (3/24).
Previously, we had asked you to identify any
'pricing assumptions' that may correspond with
use of government facilities. Due to confusion
about what exactly was being asked for, we
reached out to DARPA staff, asking them to
clarify the matter:
We asked: "EcoHealth Alliance has a USG entity
listed as a subcontractor in our proposal. Is the USG
entity required to identify any pricing assumptions
beyond those within their fully detailed and
documented budget?
Long story short...there is NO need for you to
identify any additional pricing assumptions.
Thank you and please let me know if you have any questions. I will be
available by email and phone (mobile number listed below) over the
weekend, should you need to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Jonathon Musser
PREDICT Program Assistant
EcoHealth Alliance Operations Team
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
1.212.380.4465 (fax)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: [EXTERNAL] IMPORTANT: DEFUSE grant proposal: indirect cost rate agreements
needed ASAP
Molly Turner
Tue 3/27/2018 8:41 AM
<[email protected]>
Yes, thanks!
I'm wondering if you have something addressing fringe rates?
Excellent! Thank you very much, Tonie.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Can't remember who asked for this, so I am sending it to both of you
(IDC memo). See attached.-Tonie
Date: Tue, Mar 27, 2018 at 8:30 AM
Subject: Re: [EXTERNAL] IMPORTANT: DEFUSE grant proposal: indirect cost rate agreements
needed ASAP
Cc: Thomas Hankins <[email protected]>
Morning Tonie,
I attached the memo. I address the memo to EcoHealth Alliance, please let me know if that is not
correct.
Lisa K. Meicher
Budget Analyst
6006 Schroeder Rd
Madison, WI 53711
608-270-2410
fax 608-270-2415
[email protected]
Do we have a document regarding our indirect costs that I can send
for a grant proposal. See request
below. Thanks -Tonie
From: Molly Turner <[email protected]>
Subject: [EXTERNAL] IMPORTANT: DEFUSE grant proposal: indirect cost rate agreements
needed ASAP
To: [email protected], [email protected], "Baric, Ralph S" <[email protected]>,
[email protected]
Cc: [email protected], [email protected], [email protected],
[email protected], [email protected], Peter Daszak
<[email protected]>, Evelyn Luciano <[email protected]>,
Dear DEFUSE team,
Can you please provide an indirect cost rate agreement (current Forward Pricing Rate
Agreement or Forward Pricing Rate Proposal if available, or if not available, 2 years historical
data to include pool and expense costs used to generate the rates; or, for academia: DHHS
or ONR negotiated rate package or, if calculated by other than a rate, provide University
documentation identifying G&A and fringe costs by position) for your respective institutions
ASAP (not later 4 pm EST tomorrow)?
Thanks in advance and best regards,
Molly Turner
--Molly Turner
Federal Grants Coordinator
EcoHealth Alliance Operations
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (cell)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Molly Turner
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (cell)
Re: [EXTERNAL] IMPORTANT: DEFUSE grant proposal: indirect cost rate agreements
needed ASAP
Tue 3/27/2018 9:04 AM
Unfortunately, the BAA states:
"Type of organization, selected from among the following categories: “LARGE
BUSINESS,” “SMALL DISADVANTAGED BUSINESS,” “OTHER SMALL
BUSINESS,” “HBCU,” “MI,” “OTHER EDUCATIONAL,” OR “OTHER
NONPROFIT”;"
So it appears as though we can only choose from those categories listed.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Still working on the "organization type". Can we put "none of the
above"?
Excellent! Thank you very much, Tonie.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Can't remember who asked for this, so I am sending it to both of you
(IDC memo). See attached.-Tonie
Date: Tue, Mar 27, 2018 at 8:30 AM
Subject: Re: [EXTERNAL] IMPORTANT: DEFUSE grant proposal: indirect cost rate
agreements needed ASAP
Cc: Thomas Hankins <[email protected]>
Morning Tonie,
I attached the memo. I address the memo to EcoHealth Alliance, please let me know if that is
not correct.
Lisa K. Meicher
Budget Analyst
6006 Schroeder Rd
Madison, WI 53711
608-270-2410
fax 608-270-2415
[email protected]
Do we have a document regarding our indirect costs that I can send
for a grant proposal. See request
below. Thanks -Tonie
From: Molly Turner <[email protected]>
Subject: [EXTERNAL] IMPORTANT: DEFUSE grant proposal: indirect cost rate agreements
needed ASAP
To: [email protected], [email protected], "Baric, Ralph S"
<[email protected]>, [email protected]
Cc: [email protected], [email protected], [email protected],
[email protected], [email protected], Peter Daszak
<[email protected]>, Evelyn Luciano <[email protected]>,

Dear DEFUSE team,
Can you please provide an indirect cost rate agreement (current Forward Pricing Rate
Agreement or Forward Pricing Rate Proposal if available, or if not available, 2 years
historical data to include pool and expense costs used to generate the rates; or, for
academia: DHHS or ONR negotiated rate package or, if calculated by other than a rate,
provide University documentation identifying G&A and fringe costs by position) for your
respective institutions ASAP (not later 4 pm EST tomorrow)?
Molly Turner
--Molly Turner
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.

Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: [EXTERNAL] DEFUSE proposal: fringe rate for National Wildlife Health Center?
Molly Turner <[email protected]>
Tue 3/27/2018 9:39 AM
Cc: Anna Willoughby <[email protected]>; Jonathon Musser <[email protected]>; Evelyn
Luciano <[email protected]>; Luke Hamel <[email protected]>
Hey Tonie,
I've been asking around here and I'm not sure that we ever received the budget justification you're
referring to. I'm so sorry if you sent already, but would you mind sharing again with all of us copied
here?
Alternatively, if you can share with me a fringe rate agreement that supports this I think we've
already done some work on pulling together a narrative to accompany the budget you shared, we
so can just finish that up if you don't have something already prepared.
Thanks again for your quick responses at the 11th hour!
Best,
Molly
Oh sorry, you are right. I didn't read that correctly. Here is our fringe
rates as I described in the budget justification. Fringe benefits are calculated as per
US Geological Survey federally negotiated rate of 30.84% of base salary per year for Dr. Rocke and 26.35% for
Dr. Abbott. Students receive an hourly wage but no fringe benefits
On Mon, Mar 26, 2018 at 5:44 PM, Molly Turner <[email protected]> wrote:
Thanks so much Tonie, I think that is your IDC rate, what is the fringe rate? I see 26.4 listed but
the actual fringe amounts your team has provided seem to vary.
64.54%
On Mon, Mar 26, 2018 at 5:14 PM, Molly Turner <[email protected]> wrote:
Hi Tonie, Rachel, and Katie,
I'm hoping one of you might be able to give me a quick answer as to the fringe rate your
institution is using for your proposed DEFUSE budget?
Molly Turner
--Molly Turner
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--Molly Turner
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Molly Turner
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (cell)
[EXTERNAL] DEFUSE documents as submitted

Wed 3/28/2018 11:59 AM
Cc: Dr. Peter Daszak <[email protected]>; Alison Andre <[email protected]>; Abbott, Rachel
(Contractor) C <[email protected]>; Richgels, Katherine L <[email protected]>
Hi Tonie,
Peter had asked me to send these files to you. They are the final versions of our DEFUSE proposal,
as submitted yesterday.
NWHC budget packet
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 141 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
(b) (3) (B): 41 U.S.C. § 4702 (b)-(c), (b) (4), (b) (6)
[EXTERNAL] RE: DEFUSE documents as submitted

Wed 3/28/2018 12:07 PM
To: Luke Hamel <[email protected]>; Rocke, Tonie E <[email protected]>
Cc: Alison Andre <[email protected]>; Abbott, Rachel (Contractor) C <[email protected]>;
..also want to add my thanks for your help getting this together Tonie!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

To: Rocke, Tonie
Cc: Peter Daszak; Alison Andre; Rachel Abbott; Richgels, Katherine
Hi Tonie,
Peter had asked me to send these files to you. They are the final versions of our DEFUSE proposal, as
submitted yesterday.

NWHC budget packet
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
[EXTERNAL] Re: DEFUSE documents as submitted

Wed 3/28/2018 2:34 PM
To: [email protected] <[email protected]>; [email protected]
<[email protected]>
Cc: [email protected] <[email protected]>; [email protected] <[email protected]>;
Peter, Luke and the entire EHA team,
Thanks for all your work on this proposal too. We appreciate you bringing us on-board at the last minute. Looking
forward to potentially doing great work with all of you. As we become more familiar with our different
institutional capabilities, I’d also like for us to also explore other ways of working together.
Best,
Jerome

To: Luke Hamel <[email protected]>, "Unidad, Jerome <[email protected]>"
<[email protected]>
Cc: Alison Andre <[email protected]>, "Paul, Kateri <[email protected]>"
<[email protected]>
Subject: RE: DEFUSE documents as submitted
And I’d like to add my thanks for helping us bring together a strong proposal, in rapid time!
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
conservation.

Cc: Peter Daszak; Alison Andre; [email protected]
Hi Jerome,
Peter had asked me to send these files to you. They are the final versions of our DEFUSE proposal, as
submitted yesterday.

PARC budget packet
PARC budget justification
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
 Sent Ite…   received:2018-02-01..2018-03-31    Meet NowRE

Salton Sea
 Re: [EXTERNAL]
 Re:DEFUSE proposal:
[EXTERNAL] fringe
DEFUSE rate for
proposal:
Starred 6 National Wildlife Health
fringe rateCenter?
for National Wildlife
 Health Center?
WDA
 This message was sent with High importance.
 New folder
Rocke, Tonie E Tue 3/27/2018 10:25 AM
RE      
Tue 3/27/2018 10:25 To:
AM Molly Turner <[email protected]>
  In-Place Archiv… Cc: Anna Willoughby
To: Molly Turner <[email protected]>
<[email protected]>; Jonathon
Cc: Anna Willoughby <willoughby@ecohealthallia… +3 others
Musser <[email protected]>; Evelyn
Archive 1 Luciano <[email protected]>; Luke Hamel
Budget Justification_rock…
<[email protected]>
34 KB

 Archives
ere are the documents and
H
Deleted It… 372 the(448
 Show all 3 attachments email I sent yesterday to
KB) Download all
Drafts Luke, etc. Please note the

Save all to OneDrive - DOI
Important 4820
budget total is slightly
different due to the mistakes I
Inbox 41762 H
ere are the documents and the email I
found in the travel document
sent yesterday to Luke, etc. Please note
press contacts that was originally provided to
the budget total is slightly different due
me.
reviews to the mistakes I found in the travel
RGEG document that was originally provided
Hello Luke: Attached is my
to me.
Sent Items 195 budget justification (word and
Starred 35
Hello Luke: updated Attached excel
is my files) and my
budget
New folder justification final (word budget.
and updatedI foundexcel
several
files) and my mistakes in the Ioriginal
final budget. found budget
 Groups
several mistakes (miscalculations
in the original in the travel
budget
(miscalculations budget) which
in the travelI fixed and also
budget)
Rocke Lab 2
RGE Women'… 7
which I fixedwhen and alsotime when
was addedtime wasto my
added to mysalary, salary,the thefringe
fringewas wasnot not
Invasive Sp… 47
adjusted. Thus adjusted.
the budgetThus is theslightly
budget is
Discover groups different butslightly not by different
much. I think but not by
I have
caught everything much. Iand think I have
it all addscaught
up
Manage groups
now, but feel everything
free to check. and it-Tonie
all adds up
b f lf h k
PHASE 1
BASE PERIOD 1
Dr. Tonie Rocke, who will dedicate 0.85 months p.a. to this project for phase1, year 1. An
salary for Dr. Abbott who will dedicate 12 months p.a. on this project for phase 1 year 1.
B. Fringe ($18,445)
benefits
C. Travel ($9707.25)
Domestic MeetingTravel ($4,007,25): We are requesting $1,011.25 in phase 1, year 1 to support
domestic travel from Madison, WI to Arlington, VA for one (1) Co-PI/Co-I to attend the DARPA Kickoff
Meeting. We calculate the expenses per person as follows: 1 economy, round-trip tickets (Madison, WI <>
Arlington Virginia) at $333, 2 nights in hotel at 437.50, plus $120 for parking and taxi and a total per diem
allowance of $120.75.
We are requesting $2,996 in the phase 1, year 1 to support domestic travel from Madison, WI, to New
York, New York for one (1) Co-PI/Co-I and one (1) research scientist to attend the annual meeting. We
calculate the expenses per person as follows: 2 economy, round-trip tickets (Madison, WI <> New York,
New York) at $333/person, 3 nights in hotel at $291/person, and a total per diem allowance of
$588.

We have budgeted for one Co-PI to travel for a cave site visit with local partners in China in phase 1,
year 1. Expenses are calculated as follows: 1 economy round trip ticket (Madison, WI<> Kunming,
Yunnan, China) for $1370, $1029 for lodging at $147 x 7 nights, a total per diem allowance of $805, plus
$180 for parking and taxi fare for each visit.

Animal Handling supplies ($11,288.67 Total): We are requesting $11,288.67 for phase 1, Year
1 for bat handling and supplies for both field and laboratory studies to include: a Harp trap for
collecting bats, bat caging materials, mealworms for feeding bats, bat wing bands, anti-parasite
medications, and PPE for handling bats (Cut resistant gloves, Tyvek suits, Tyvek aprons, N95
respirators, and PAPR replacement covers).
$10,693.85 for phase 1, year 1 to purchase necessary supplies for vaccine production and
consumables

Rabies prophylaxis shots ($4020) We are requesting $4020 for phase 1, year 1 to provide rabies
prophylactic vaccination for 4 animal care staff/year. Rabies vaccination is required of all staff
handling bats due to the high prevalence of rabies in bats.
PHASE 1
BASE PERIOD 2
animals, with particular expertise in developing vaccines for bats. We request $6,479 salary for
Dr. Tonie Rocke, who will dedicate 0.6 months to this project for phase1, year 2. An additional 1
month of Dr. Rocke’s time will be provided in-kind.
salary for Dr. Abbott who will dedicate 12 months on this project for phase 1 year 2.
B. Fringe ($17,968)
benefits.
C. Travel ($10,561)
$588.
International Travel ($8245.50): We request $8,245.50 p.a. for phase 1, year 2 to support international
travel from Madison, WI location to Annual Meeting in Wuhan, China. We calculate the expenses as
follows: 1 economy, round trip ticket (Madison, WI<>Wuhan, China at $6,861, 5 nights hotel at $139.65,
and a total per diem allowance of 546.25, plus $140 for parking and taxi fare.
Animal Handling supplies ($7,282.67 Total): We are requesting $7,282.67 for phase 1, year 2
for bat handling and supplies for both field and laboratory studies to include bat caging materials,
mealworms for feeding bats, bat wing bands, anti-parasite medications, and PPE for handling
bats (Cut resistant gloves, Tyvek suits, Tyvek aprons, N95 respirators, and PAPR replacement
covers).
$19,311.85 for phase 1, year 1-2, and phase 2, year 3 to purchase necessary supplies for
vaccine production and biological sampling including cell culture flasks, Nunc cell factories, fetal
bovine serum, DMEM medium, glycerin jelly, rhodamine B, hair collection bags, 96 well plates,
pipette tips and other consumables

Rabies prophylaxis shots ($4020) We are requesting $4020 for phase 1, year 1 to provide

PHASE 2
OPTION PERIOD 1
Dr. Tonie Rocke, who will dedicate 0.8 months p.a. to this project for phase 2, option year 1. An
salary for Dr. Abbott who will dedicate 12 months p.a. on this project for phase 2, Option year 1
B. Fringe ($18,634)
benefits
C. Travel ($11,430)
We are requesting $2,996 in the phase 2, option year 1 to support domestic travel from Madison, WI, to
New York, New York for one (1) Co-PI/Co-I and one (1) research scientist to attend the annual meeting.
We calculate the expenses per person as follows: 2 economy, round-trip tickets (Madison, WI <> New
York, New York) at $333/person, 3 nights in hotel at $291/person, and a total per diem allowance of
Domestic Field visit ($2316): We are requesting $2,316 in phase 2, option year 1 to support domestic
travel from Madison, Wisconsin to a cave site in Upper Peninsula, Michigan for 3 people (1 co-PI, 2
technicians) to test delivery methods in bats. We calculate the expenses per person as follows: 4 nights in
a hotel at $93/person, a total per diem allowance of $204/person, and gas and use of government vehicle
at a cost $588.

We have budgeted for one Co-PI and one research associate to travel for a cave site visit with local
partners in China in phase 2, option year1. Expenses per person are calculated as follows: 1 economy
round trip ticket (Madison, WI<> Kunming, Yunnan, China) for $1370, $1029 for lodging at $147 x 7
nights, a total per diem allowance of $805. An additional $180 is requested for parking and taxi fare.

Animal Handling supplies ($7,282.67 Total): We are requesting $7,282.67 for phase 2, option
year 1 for bat handling and supplies for both field and laboratory studies to include: bat caging
materials, mealworms for feeding bats, bat wing bands, anti-parasite medications, and PPE for
handling bats (Cut resistant gloves, Tyvek suits, Tyvek aprons, N95 respirators, and PAPR
replacement covers).
$10,693.85 for phase 2, option year 1 to purchase necessary supplies for vaccine production and
consumables

Animal Care ($12,600 Total) We are requesting $12,600 for phase 2, option year 1. This
amount covers animal care and room costs for up to 60 bats for 120 days at $105/day in a BSL3
animal facility, including daily husbandry, gut-loading meal worms, cleaning cages, veterinary
services and daily surcharge for room use.
Rabies prophylaxis shots ($4020) We are requesting $4020 for phase 2, option year 1 to provide

PHASE 2
OPTION PERIOD 2
Dr. Tonie Rocke, who will dedicate 0.4 months to this project for phase 2, option period 2.
salary for Dr. Abbott who will dedicate 6 months. on this project for phase 2, option period 2.
B. Fringe ($9,318)
salary per year for Dr. Rocke and 26.35% for Dr. Abbott.
C. Travel ($3501)
We are requesting $3,501 in the phase 2, optional period 2 to support domestic travel from Madison, WI,
to New York, New York for one (1) Co-PI/Co-I and one (1) research scientist to attend the annual
meeting. We calculate the expenses per person as follows: 2 economy, round-trip tickets (Madison, WI <>
New York, New York) at $333/person, 4 nights in hotel at $291 and a total per diem allowance of $296,
plus $140 for parking and taxi fare for Co-PI and 3 nights in a hotel at $291 for research associate, total
per diem allowance of $222 and $140 for parking and taxi fare.

Biological sampling supplies ($2,163,43 Total) We are requesting $2,163,43 for phase 2,
option period 2 to purchase supplies to finish up biological sampling, including 96 well plates,
pipette tips and other consumables.

TRAVEL
Trip #: 1 Location: Arlington, VA, USA
Purpose: DARPA Kickoff Meeting
Days # of People Airfare Meals & Incidental per diem Lodging per diem
1.75 1 $333.00 $69.00 $250.00
Description Amount
Parking $20.00
Total: $120.00
Trip #: 2 Location: Kunming, Yunnan, China
Purpose: China Cave Site Visit
7 1 $1,370.00 $115.00 $147.00
Description Amount
Parking $80.00
Total: $180.00
Trip #: 3 Location: Upper Peninsula Michagan
Purpose: US Cave Site Visit
4 3 $0.00 $51.00 $93.00
Description Amount
Gas $120.00
Total: $588.00
Trip #: 4 Location: New York, NY, USA
Purpose: Annual Meeting (Rocke + Abbott)
3 2 $333.00 $74.00 $291.00
Description Amount
Parking $40.00
Total: $140.00
Trip #: 5 Location: Upper Peninsula, Michigan, USA
4 3 $0.00 $51.00 $93.00
Description Amount
Gas $120.00
Total: $588.00
Purpose: Annual Meeting (Rocke)
4.75 1 $6,861.00 $115.00 $147.00
Description Amount
Parking $40.00
Total: $140.00
Trip #: 7 Location: Upper Peninsula, Michigan, USA
4 3 $0.00 $51.00 $93.00
Description Amount
Gas $120.00
Total: $588.00
Trip #: 8 Location: Kunming, Yunnan, China
Purpose: Deployment Visit
7 2 $1,370.00 $115.00 $147.00
Description Amount
Parking $80.00
Total: $180.00
3 2 $666.00 $74.00 $291.00
Description Amount
Parking $40.00
Total: $140.00
4 1 $333.00 $74.00 $291.00
3 1 $333.00 $74.00 $291.00
Description Amount
Parking $40.00
Total: $140.00
Contract Period
Base 1
Other Total
$120.00 $1,011.25
Contract Period
Base 1
Other Total
$180.00 $3,384.00
Contract Period
Base 1
Other Total
$588.00 $2,316.00
Contract Period
Base 1
Other Total
$140.00 $2,996.00
Contract Period
Base 2
Other Total
$588.00 $2,316.00
Contract Period
Base 2
Other Total
$140.00 $8,245.50
Contract Period
Option I
Other Total
$588.00 $2,316.00
Contract Period
Option I
Other Total
$180.00 $6,588.00
Contract Period
Option I
Other Total
$140.00 $2,996.00
Contract Period
Option II
Other Total
$140.00 $1,933.00
$140.00 $1,568.00
MATERIALS/EQUIPM
Item Manufacturer Part Number Unit Price Quantity
Harp Trap Bat conservation and management $2,003 2
Mealworms Rainbow mealworms $100/20,000 12
bat caging materials various $500/cage 9
bat wing bands Porzana $596/box 9
Cut resistant gloves Varied $15/pr 30
Tyvek suits DuPOnt EV29135313 $306/case 15
Tyvek aprons Lakeland 6EHH7 $58/case 15
N95 respirators 3M 9511 $20/box 45
PAPRs replacement covers 3M $96/3 units 45
Selamectin Zoetis $250
cell culture flasks Corning 430641U 415/case 5
cell culture flasks Corning 431080 425/case 10
Nunc cell factories Nunc 140250 $370/case 12
fetal bovine serum GE Hyclone SH30071.03 $600/bottle 8
DMEM medium GE Hyclone SH30021.02 $30/l 10
glycerin jelly Carolina Biological Supply $43 bottle 50
rhodamine B Sigma $56/100g 6
hair collection bags U-line $75/box 10
96 well plates Corning 3599 $600/case 8
pipette tips Fisher 13-676-10 $100/case 50
Consumables miscellaneous
Total
Y1 Total
Y2 Total
Y3 Total
Y3.5 Total
ERIALS/EQUIPMENT
Total Price Contract Period Additional Information
$4,006.00 Y1
$1,200.00 Y1-Y3
$4,500.00 Y1-Y3 custom made
$4,768.00 Y1-Y3
$450.00 Y1-Y3
$4,590.00 Y1-Y3
$870.00 Y1-Y3
$900.00 Y1-Y3
$4,320.00 Y1-Y3
$250.00 Y1-Y3
$2,075.00 Y1-Y3
$4,250.00 Y1-Y3
$4,440.00 Y1-Y3
$4,800.00 Y1-Y3
$300.00 Y1-Y3
$2,150.00 Y1-Y3
$336.00 Y1-Y3
$750.00 Y1-Y3
$4,800.00 Y1-Y3.5
$5,000.00 Y1-Y3.5
$5,344.00 Y1-Y3.5 needles, syringes,whirl paks, plastic bags, other disposables, all <5K
$60,099.00
$25,854.00 $21,982.52
$17,976.52
$17,976.52
$2,163.43
$60,098.99
OTHER DIRECT COSTS
Description Total Price Contract Period
animal perdiem costs $12,600 Base 1
Base 2
animal perdiem costs $12,600
Option 1
animal perdiem costs $12,600
rabies prphylactic shots $4,020 Option 1
Total $49,860
THER DIRECT COSTS
veterinary services and daily surcharge for rom use,
above)
above)
all animal care and technical staff must be vaccinated against rabies to
work with bats. 1005/person
[email protected]
Applicants tab.
CFDA Number: 12.910
Competition ID:
Competition Title:

[email protected]

DUNS: 0770900660000
Form Version: 1.4

FORM ACTIONS:
Dr. Tonie Rocke 129,590.00 0.85 9,179.00 2,475.00 11,654.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.60 6,479.00 1,998.00 8,477.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.80 8,639.00 2,664.00 11,303.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.40 4,319.00 1,332.00 5,651.00
Dr. Rachel Abbott 61,006.00 6.00 30,502.00 7,986.00 38,488.00

B. Other Personnel

Graduate Students

Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

8.
9.
10.

H. Indirect Costs

POC Phone Number)


Totals ($)
74,346.00
9
380,847.00
Section D, Travel
35,199.75
1. Domestic
17,452.25
2. Foreign
17,747.50
2. Stipends
3. Travel
4. Subsistence
5. Other
115,958.99
60,098.99
6,000.00
8. Other 1
37,800.00
9. Other 2
12,060.00
10. Other 3

Section J, Fee
874,716.56

Mon 3/26/2018 3:54 PM
Cc: Daszak Peter <[email protected]>; Tonie Rocke <(b) (6) @gmail.com>; Abbott, Rachel (Contractor) C
<[email protected]>; Richgels, Katherine L <[email protected]>; Jonathon Musser
Hi Luke: Attached are my comments on the full draft; I added my
comments to Jerome's draft. I corrected a few errors, deleted at least one
sentence in my section, and also added my deliverables for Task 7. I'm not
certain what you want for project metrics. A timeline or something? Just
repeating the deliverables doesn't seem appropriate. Also, I have
someone checking on the CAGE code. Let me know if you need anything
else. Thanks! -Tonie
Hi Tonie,
Thank you for the facility description. There won't be a need for us to have a call, but please
review the draft and look for ways to reduce the text of your technical section.
-
“LARGE BUSINESS”, “SMALL DISADVANTAGED BUSINESS”, “OTHER SMALL BUSINESS”, “HBCU”, “MI”,
“OTHER EDUCATIONAL”, OR “OTHER NONPROFIT”;
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
know if this is sufficient. Also, will we be having a call or not? I have
not yet had a chance to review the technical proposal but will do so
shortly.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
excel files) and my final budget. I found several mistakes in the
original budget (miscalculations in the travel budget) which I fixed
and also when time was added to my salary, the fringe was not
adjusted. Thus the budget is slightly different but not by much. I
think I have caught everything and it all adds up now, but feel free
to check. I will send facility description along soon. Thanks -Tonie
Hi Tonie,
I hope you had a great trip. If you are able to begin drafting a budget justification, that
would be very helpful. Whatever you cannot complete, we will be sure to get done.
Regarding the budget justification, I have reattached a template with appropriate headings and
language that is already correctly formatted. I would just ask you to insert the appropriate
name/cost amount, substituting CAPITALIZED words and filling in gaps (indicated by
underscores).
Each section in the budget (e.g. Personnel, fringe, travel, etc.) should have a corresponding section
in the budget justification (as shown in the template). Essentially, any line item that is listed in the
budget needs to be justified in the 'budget justification' document.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
word document (everything was in the excel file) this AM? I'll
get on it right away if it hasn't already been done. Please
advise. Best -Tonie
Hi Tonie,
budget justification (essentially a Word doc. that provides justification for each line
item of the budget).
understand may very well be the case, we will be happy to take this on. Please let
us know.
Thank you,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Sent from my iPhone
Hi Luke,
documents we have to write to get approval to use our RCN vaccines
in the field (risk analysis for USDA CVB and environmental
assessment for USGS). Unfortunately, as I said before, I'll be
unavailable until next Thursday, but Tonie should be back in her office
on Monday.
--Rachel
knowing the answer), could you please send us your
budget justification document? We are hoping to have
all collaborator budgets and budget justifications as
soon as possible.
will establish methods to assess the 'long-term safety
and efficacy of our preemptive approaches'

species?
I have attached language from the BAA to provide
you with further guidance on what DARPA
requires us to include.
please write-up a short section (a paragraph or
so), that addresses this issue 'long-term safety
and efficacy'?
I apologize for the extremely short notice,
but we would greatly appreciate it if you
could return this to us by tomorrow
afternoon, Sat. (3/24).
assumptions' that may correspond with use of
government facilities. Due to confusion about what
exactly was being asked for, we reached out to DARPA
staff, asking them to clarify the matter:
identify any pricing assumptions beyond those within their
fully detailed and documented budget?
Long story short...there is NO need for you to identify
any additional pricing assumptions.
email and phone (mobile number listed below) over the weekend, should you need
to contact me.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
research into the critical connections between
human and wildlife health and delicate
ecosystems. With this science, we develop
solutions that prevent pandemics and promote
conservation.
--
Rachel Abbott
6006 Schroeder Road
Madison, WI 53711
(608) 270-2489
Fax: (608) 270-2415
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
1
2
including bats.
• Dr. Jerome Unidad, PARC will develop an innovative aerosol technology that could work
with a wide-range of formulations into a field-deployable device that can be used for large-
scale inoculation of bats.
;klj;lkj;lk
;lj;lkj;lkj
;lkj;lkj
;lkj;lkj
C. GOALS AND IMPACT

Overview
bats that will help protect the warfighter within SACOM and SEACOM, and will be scalable to Commented [PD1]: Check on correct DoD names for
these regions
3
existent. SARSr-CoVs are enzootic in Asian, African1, and European bats2 that roost in caves but Commented [PD2]: There’s a new ref that I tweeted
about recently - http://coronavirus.fr/publications/
Technical Area 1
4
risk SARSr-CoVs, two other control/comparison sites), including: radio- and GPS-telemetry to Commented [3]: Are we saying only one cave site
has SARSr-CoVs, or does one site have a higher
identify home range and additional roost sites for each bat species; inventory of bat population prevalence of these compared to controls? Should
density, distribution and segregation and their daily, weekly and seasonal changes; viral validate this with our prelim data if possible. Are 3 sites
sufficient?
The Wuhan Institute of Virology team will test bat fecal, oral, and blood samples for SARSr- Commented [4]: no need for urogenital samples and
these bats are too small to collect those anyway. Fecal
CoVs. We will collect viral load data using fresh fecal pellets from individually sampled bats and and oral are key. Blood is also important for serolgy
from tarps laid on cave floors deployed where necessary to reduce roost disturbance. SARSr- Commented [5]: Edited this slightly, but we could just
CoV spike proteins will be sequenced, analyzed phylogenetically for recombination events, and go with individually sampled bats, should be easy
enough to say we'll sample ~200 individually trapped
high-risk viruses (spike proteins close to SARS-CoV) characterized and isolated. The UNC team bats on a monthly basis at cave entrances using harp
trap, if we want to do away with tarp sampling.
will reverse-engineer spike proteins to conduct binding assay to human ACE2 (the SARS-CoV Alternatively we could leave both and justify the use of
receptor). They will culture SARS-like bat coronaviruses to distinguish high-risk strains that can tarps and that we'll use high-resolution photos of bats
roosting in caves to estimate population size from
replicate in primary human cells and low risk strains that require exogenous enhancers. Viral populations sampled non-invasively using tarp
collection.
5
Technical Area 2
6
of SARSr-CoV is sensitive to interferon treatments, as shown in our previous work13 ; ii) Commented [AW6]: Is this our work? ref may be
wrong
periods22,23.
7
delivered by remote controlled drone. We have already used simple gels to vaccinate bats Commented [t7]: I thought we agreed we weren’t
going to use drones in caves. I don’t think we talk about
against rabies in the lab25, and hand delivered these containing biomarkers to vampire bats in it anywhere else
Deliverables:
strains.
shedding
8
D. TECHNICAL PLAN
Technical Area I: Commented [PD8]: It originally said ‘Phase 1’ – is this
correct?
assemblage contain all the genetic Commented [PD9]: DARPA were v. interested in the
phrase ‘quasispecies’ and ‘machine learning’, so we’re
components of epidemic SARS-CoV30. trying to insert them appropriately – please correct if
wrong!

ACE229.
analysis of SARSr-CoVs (Fig. 3), and Commented [PD10]: This is the phylogeographic map
w/ blue network overlaid on SW China. Please correct
coevoutionary analysis of bats and their CoVs figure to remove fig description.
9
China, and Rhinolophus spp. bats are the likely origin of the SARS-CoV clade, and therefore a
Spatial models of bat origin high-risk viruses across S and SE Asia. We will build models that Commented [PD11]: We’ve not used ‘machine
learning’ in the text now. Noam - please insert
predict regional-scale bat and viral diversity in cave sites across South and SE Asia to enable appropriately, or not….
10
Fig. 4: Predictive global map of total (known and unknown) Commented [PD12]: This map doesn’t help our case –
superficial glance suggests we should be working in L.
viral diversity in bats (Chiroptera species). Based on EHA’s Am. I know this is incorrect, but I think we’d be better
unique database of all known mammal virus-host served putting in a map that highlights SW China as a
hotspot… Could you just recreate this map only for Asia?.
relationships3. Can we also show a hotspot map of host distribution as
well.

11
12
Rhinolophus, Hipposideros, and Myotis spp., although our preliminary data demonstrate that R. Commented [13]: If desired, I can provide a figure
showing prevalence rates across the relevant sites
sinicus and R. ferrumequinum (which co-roost at our sites) are the SARSr-CoV primary reservoir, over time, but not until next week as the data is still
with Hipposideros and Myotis playing an insignificant role in viral dynamics. We will capture being cleaned.
bats using harp traps and mist nets during evening flyout. Rectal, oral, and whole blood samples Commented [PD14]: OK – let’s look at it when it’s
ready – maybe can go joint with the map
lethal viral specimen collection over an 18 month period of the project from all three cave sites. Commented [15]: 3 cave sites will be the same
across the entire project, one cave will later be
Given the average prevalence of SARSr-CoV in these species in our previous investigations in S. experimental cave for intervention with 2 control caves.
China (~6-9%, n=3304 Rhinolophus spp.), this sample size would enable to detect changes of If there aren't enough bats in any given cave, we can
add additional cave sites to get our target sample
10% fluctuation in prevalence between sampling periods. Early in the sampling we will trial the sizes, e.g. 2 adjacent caves sampled instead of one to
get 120 bats per event.
while reducing roost disturbance (REFS). To identify seasonal or reproductive cycle variation in Commented [PD16]: Need references please
13
treatments in TA2 (Fig. XX). We will adjust individual sampling quotas per species to optimize Commented [PD17]: From Kendra’s email
currently maintains IACUC protocols through Tufts University (via inter-institutional agreement) Commented [PD18]: Need to check on this
Commented [PD19]: Correct the abbreviated text for

Sept yr 4
individual bats collected by data loggers will be downloaded every 3 days to examine temporal Commented [20]: Why not just monthly when we're
doing our trapping?
Commented [PD21]: Assume because this will allow
record the total number of bats flying out each night. Recapture data will be collected us to see how often bats travel among caves within that 3
continuously throughout the project. We will attach radio transmitters (1.2g, Advanced month period
14

Flow chart here:
15
(additional box)
down.
16
17
of each vSARSr-CoV, then clinical disease
(weight loss, respiratory function by whole
body plethysmography, mortality, etc.)
followed for 6 days p.i.. Animals will be
sacrificed at day 2 or 6 p.i. for virologic
analysis, histopathology and
immunohistochemistry of the lung and for 22-
parameter complete blood count (CBC) and
determination). Identification of high risk/low abundant variants: We will use RNAseq to
identify low abundant quasispecies (QS) variants encoding mutations in RBD and/or residues
that bind ACE2. These would alter risk assessment calculations as strains identified as low risk,
might actually have low abundant, high risk variants circulating in the QS. To test this the Shi
and Baric lab will structurally model and identify highly variable residue changes in the SARSr-
CoV S RBD and use commercial gene blocks to introduce these changes singly and then in
combination into the S glycoprotein gene of the low risk, highly abundant parental strain. We
will examine the capacity of these low abundance chimeric viruses to use human, bat, civet and
mouse ACE2 receptors, and to replicate in HAE cultures. RBD deletions: Small deletions at
specific sites in the SARSr-CoV RBD leave the key RBD-ACE2 interface residues intact, such that
Clade 1 strains represent higher risk of human infection (Fig. 5). We will analyze the functional Commented [PD22]: This is Ralph’s Fig C
consequences of these RBD deletions on SARSr-CoV hACE2 receptor usage, growth in HAE
cultures and in vivo pathogenesis. First, we will delete these regions, sequentially and then in
combination, in SHC014 and SARS-CoV Urbani, anticipating that the introduction of both
deletions will prevent virus growth in Vero cells and HAE. We hypothesize that the smaller
deletion may be tolerated, given its location in the RBD structure, so in vivo passage in the
presence of receptor will restore growth, while identifying 2nd site reversions that restore
efficient hACE2 usage49. In parallel, we will evaluate whether RBD deletion repair restores the
ability of low risk strains to use human ACE2 and grow in human cells. To test this we will
synthesize full length rs4237, a highly variable SARSr-CoV that encodes a few of the SHC014
RBD contact interface residues but also encodes a mutation at 479 (N479S) and has two
deletions and hence, is not recoverable in vitro. Using the SHC014 backbone sequence, we will
sequentially and then in tandem repair the deletions in the presence and absence of the S479N.
We anticipate that the S479N mutation is critical given its key role in establishing the RBD-ACE2
interface, and that restoration of the RBD deletions will enhance virus recognition of hACE2
18
receptors and growth in Vero cells and HAE cultures S2 Proteolytic Cleave and Glycosylation
Sites: After receptor binding, a variety of cell surface or endosomal proteases63-66 cleave the
SARS-CoV S glycoprotein causing massive changes in S structure 67 and activating fusion-
mediated entry55, which is prevented in the absence of S cleavage68 (Fig. 5). Tissue culture Commented [PD23]: This is Ralph’s Fig. C
adaptations sometimes introduce a furin cleavage site which can direct entry processes, usually
by cleaving S at positions 757 and 900 in S2 of other CoV, but not SARS66. For SARS-CoV, a
variety of key cleavage sites in S have also been identified and we will analyze all SARSr-CoV S
gene sequences for appropriately conserved proteolytic cleavage sites in S2 and for the
presence of potential furin cleavage sites69,70. SARSr-CoV S with mismatches in proteolytic
cleavage sites can be activated by exogenous trypsin or cathepsin L. Where clear mismatches
occur, we will introduce the appropriate human-specific cleavage sites and evaluate growth
potential in Vero cells and HAE cultures. In SARS-CoV, we will ablate several of these sites based
on pseudotyped particle studies and evaluate the impact of select SARSr-CoV S changes on virus
replication and pathogenesis (e.g. R667, R678, R797). We will also review deep sequence data
for low abundant high risk SARSr-CoV that encode functional proteolytic cleavage sites, and if
so, introduce these changes into the appropriate high abundant, low risk parental strain. N-
linked glycosylation: SARS-CoV S has 23 potential N-linked glycosylation sites and 13 of these
have been confirmed biochemically. Several of these regulate SARS-CoV particle binding DC-
SIGN/L-SIGN, alternative entry receptors for SARS-CoV entry into macrophages/monocytes71,72.
Mutations that introduced two new N-linked glycosylation sites may have been involved in the
emergence of human SARS-CoV from civet and raccoon dogs72. While the sites are absent from
civet and raccoon dog strains as well as clade 2 SARSr-CoV, they are present in WIV1, WIV16
and SHC014, supporting a potential role for these sites in host jumping. To evaluate this, we will
sequentially introduce clade 2 residues at positions N227 and N699 of SARS-CoV and SHC014
and evaluate virus growth in Vero cells, nonpermissive cells ectopically expressing DC-SIGN and
in HAE cultures, as well as in human monocytes and macrophages anticipating reduced virus
growth efficiency. Using the clade 2 rs4237 molecular clone, we will introduce the clade I
mutations that result in N-linked glycosylation sites at positions 227 and N699 and in rs4237
RBD deletion repaired strains, evaluating virus growth efficiency in HAE, Vero cells, or
nonpermissive cells ± ectopic DC-SIGN expression72. In vivo, we will evaluate pathogenesis in
transgenic ACE2 mice.
Models to predict viral spillover potential and evolution of high-risk SARSr-CoV strains. Commented [PD24]: We have no preliminary data to
show here. Is it possible to mock something up or run a
Structural equation model of spillover potential: We will use data from the experimental assays simulation so that we have some prelim. figure. Checkout
above to build genotype-phenotype models of bat SARSr-CoV spillover potential. We will use the abstract that Jim Desmond’s involved in – they show a
couple of prelim. simulations of a model and I think it
Bayesian Structural Equation Models (SEM), fit via MCMC methods73, to predict spillover would be good if we could…?
19
20

21
population, under an IRB that can be easily extended to cover DEFUSE work. Commented [PD25]: Please check – I think this
already allows us to use the samples?


84
and the recent success in SADS-CoV zoonotic risk study using LIPS85. To establish SARSr-CoV
22
Thematic Area 2
23
recombinant SARSr-CoV S are expressed by raccoon poxvirus, which has been used extensively Deleted: from
to deliver rabies immunogens in bats and other animals. We will conduct application trials with
live bats to assess suppression of replication and shedding of a broad range of pathogenic SARS-
related CoVs. Both lines of work will begin in Year 1 and run parallel, be assessed competitively
for efficiency, cost, and scalability, and successful candidates used in our live bat trials at our
test sites in Yunnan, China. We believe an immune boosting/priming strategy is a superior
approach for this challenge because solutions are likely to be broadly applicable to many bat
species, and across many viral families.
24
purified protein. Utilization of a universal IFN for bats will Commented [PD26]: Need to say how you will do this.
Just a couple of sentences and references

factor in the bat interferon production pathway92. To fast-track the identification of this target Commented [PD27]: Is this the right reference – I
inserted one here?
25
RNA targets in every gene in the P. alecto genome. The library has already been produced and Commented [PD28]: Need a reference
boost the inducibility of the IFN system in a shorter time-frame. Based on previous work, it is Commented [PD29]: Can we cite a reference here?
26
species93,94. We will also use two coronaviruses (SARSr-CoV WIV1 and MERS-CoV in ABSL3. Commented [PD30]: I put this in – I wasn’t sure
whether you’d use SARS-CoV or SARSr-CoVs?
Details of infection, housing, prior infection trials in the facility… Viral loads will be measured by
Commented [PD31]: Need some more details to show
qPCR, titration of produced virus, NGS transcriptomics and nanostring probes added to the reviewers that we have already done some trials..
bats
immunity against multiple group 2b strains. We will Commented [PD32]: In which model?
27
PFU/ml on Vero cells (Fig. 10). HKU3-Smix is fully neutralized by mAb that specifically target the Commented [PD33]: This is Ralph’s Fig. E
28
and adjuvants in vaccine applications (Fig. 11). Ac-DEX has distinct advantages over other Commented [PD34]: This is Ralph’s Fig. F. We still
need this from Ralph to see if it’s possible to include, or
polymers for vaccine development: 1) synthesis is straightforward and scalable. An FDA- not..
passively target antigen-presenting cells (APCs) based on their size (5-8µm), being Commented [PD35]: Previous draft just said (5-8).
Assume this is microns?
insert]) have limited shelf-life that requires the cold-chain. Ac-DEX MPs can be aerosolized, or Commented [PD36]: Please correct typing or insert
reference
disease control in wildlife populations98,105. Figure F. Particle Delivery Systems. Broadscale immune
5) We have previously encapsulated Poly boosting strategies include (A) Dextran microparticles or
101
Dry nanoparticle powders. (B) Macrophages cultured with
(I:C)(1), resiquimod , and a STING agonist either free poly (I:C) or poly (I:C) encapsulated into Ac-
into our novel MPs106. DEX MPs produce significant TNFα. (C) Comparison of
(left) neutralizing titer and (right) viral load when ferrets are
As seen in Fig. 10, encapsulation of Poly vaccinated with Ac-DEX MPs. Day 0, 28, and 56 (prime,
(I:C) drastically enhances the activity of the boost, and challenge.)
TLR agonist. Additionally, encapsulation of

adjuvants in MPs drastically enhances the
29
displayed better efficacy than state-of-the-art FDA-approved inactivated flu virus (Fluarix) in a
ferret model of influenza. The ferret model is the ideal animal model for influenza because of
their relatively small size and they possess various clinical features associated with human
influenza infection107. This formulation used HA with encapsulated STING agonist cyclic
[G(3',5')pA(3',5')p](16) Commented [PD37]: Is this a reference – if so please
paste into comment box
proof-of-concept in bats. We tested modified vaccinia Ankara (MVA) and raccoon poxvirus
(RCN) vectors for safety and replication in bats using in vivo biophotonic imaging25. RCN Deleted: otr
replicated to higher levels in bats than MVA, even via the oral route, and was found to be highly
safe for bats (Fig. 12). We used raccoon poxvirus-vectored novel rabies glycoprotein (mosaic or
MoG) and demonstrated protective efficacy in bats after oronasal and topical administration25
(Fig. 13). We are currently developing vaccine delivery for vampire bats in several Latin
30
American countries, and vaccines for white-nose syndrome in bats, a devastating disease that
has killed millions of insectivorous bats in North America.

indicative of viral
in the bat Tadarida

a raccoon poxvirus vectored vaccine expressing plague antigens that was incorporated into a
vegetation.
31
fluorescence).
Transcutaneous delivery: In addition to viral vectors, we will also consider methods to achieve
biomarker analysis.
positive for biomarker indicating they had eaten the jelly. We will conduct initial trials with each Commented [t38]: I think you could remove this
sentence
32
Innovative Aerosol Approach to Bat Inoculation: Once we have confirmed uptake in laboratory
studies, we will then assess scalable delivery methods in local caves and hibernacula (using Deleted: mass
Dr. Jerome Unidad of Palo Alto Research Center (PARC), we will develop an innovative aerosol Deleted: their
platform technology unique to PARC into a field-deployable prototype for use in cave settings. Deleted: technology
The technology called Filament Extension Atomization (FEA) can spray fluids with a wide-range Deleted: to
of viscosities ranging from 1mPa-s (the viscosity of saliva and most aqueous vaccine Commented [UJ<39]:
formulations) up to 600Pa-s (the viscosity of creams and gels for topical delivery) using a roll-to- Commented [UJ<40]: J Unidad, E Karatay, R
Neelakantan, A Jose, DM Johnson. Spray Processing of
roll misting process (https://www.parc.com/services/focus-area/amds/) that results in Polymers and Complex Fluids: PARC's Filament
narrowly-dispersed droplets with tunable sizes from 5-500 microns. FEA technology is Extension Atomizer Technology. Proceedings of the 33rd
International Conference of the Polymer Processing
compatible with all the formulations of interest to project DEFUSE, including aqueous Society. Cancun, Mexico. 2017
formulations intended for conventional spraying and the edible gels and creams intended for Deleted: in the form of a field-deployable spray device
triggered by timers and movement detectors at critical cave
topical delivery with no limit on bioactive ingredient loading. FEA can then be a universal entry points. PARC’s Filament Extension Atomization (FEA)
delivery platform for direct spraying onto bats with the formulation geared towards bio- (Fig. 15) …
efficacy. Formatted: Highlight

We will subcontract to PARC to develop a field-deployable FEA prototype, potential form Deleted: 1
factors for which are shown in Fig. 15F, that can be used in cave settings. PARC will develop the Deleted: This will make it compatible with all the fluid
formulations above including the immune-modulating
prototype in close collaboration with USGS-NWHC and will conduct the initial trials with them formulations from TA2, gels and creams for topical delivery
on Wisconsin cave bats. After initial trials, PARC will develop the prototype to a form that will and Poxvirus formulations, making it a universal platform
for inoculating bats. …
be used for the proof-of-concept demonstration at the test sites in the Kunming bat caves,
Deleted: prototype
Yunnan province, China. The field-deployable system will be motion-actuated, and on a timer
Deleted: system
so that bats will be targeted at fly-in and fly-out but diurnal flying non-target species (e.g. cave
Deleted:
swiftlets) can be avoided.
Deleted: for lab testing, optimize spray conditions for
DEFUSE fluids, manipulate fluid formulation for targeted
spreading and bioefficacy, and design a prototype field-
deployable system. We will initially trial this on captive bats
at NWHC, then on Wisconsin cave bats, then at our test
sites in Yunnan Province, China. The field-deployable system
Deleted: , and
Formatted: Font: English (US)
33
Fig. 15: PARC FEA Technology – A. Beads-on-a-string structures in viscoelastic fluids, B. Commented [PD41]: This is from the PARC pdf they
sent to us. Can someone create a neat image please..
Parallelization of filament formation and droplet break-up in an FEA roller system, C.-E. Images
from high speed videos of representative fluids sprayed with FEA (Polyethylene Oxide in Water- Commented [UJ<42]: Olivera, MSN and McKinley, GH.
Iterated Stretching and Multiple Beads-on-a-String
Glycerol, Hyaluronic Acid and Sunscreen), F. Potential form factors of the field-deployable Phenomena in Dilute Solutions of Highly Extensible
prototype for Project DEFUSE (benchtop, handheld) Flexible Polymers. Physics of Fluids 17: 071705. 2005
Dynamic circulation modeling to optimize deployment strategy. To select amongst various Formatted: Highlight
options for immune boosting, priming, and targeting, and multiple delivery options and Deleted: PEO
schedules, we will simulate deployment using a model of viral circulation in cave bat Deleted: ,
34

Province, China. Commented [PD43]: Kevin/Jon/Hongying: We need a
section on this, including how we will work initially on
captive R. sinicus or R. ferrumequinum, then trial out RB
in caves, then deploy. Just a paragraph, including how we
will cordon off side pockets, side entrances to deploy in
MANAGEMENT PLAN controlled volume, then how we would be able to scale
up from that. Need to give details of the number of bats
● Provide a summary of expertise of the team, including any subcontractors, and key we’ll target and how we’ll prove suppression of viral load

35
NWHC for initial trials, and oversee cave experiments in China; #5 to Dr. Jerome Unidad, PARC,
to develop their innovative aerosol platform into a field-deployable device for large-scale Deleted: wide
inoculation of the bats. Dr. Unidad will collaborate closely with Dr. Rocke in developing a field-
deployable prototype for both initial trials and cave experiments in China.
36
of disease (REFS).
Virology.
and animal models and will lead the animal studies. Dr Anderson has established Zika, Influenza Commented [Ai44]: doi: 10.1038/s41598-018-
20185-8, doi: 10.1016/S1473-3099(17)30249-9 &
and Reovirus non-human primate (NHP) models in Singapore, using different inoculation routes Nature DOI if in time…
sensing with expertise focusing on host-pathogen interactions and intrinsic immunity. He Commented [Ai45]: PMID:24746552, PMID:
22633459, PMID: 27934903
37
epidemiology.
Dr. Tonie Rocke is a is a research scientist at the USGS National Wildlife Health Center, the
only federal laboratory with the sole mission to manage disease in wild animals. Dr.
Rocke’s current research is focused on the ecology and management of diseases in wild
mammals (e.g. plague, monkeypox, rabies and white-nose syndrome) with the
overreaching goal of conservation of threatened and endangered species. She and other
colleagues developed an oral recombinant plague vaccine for use in wild rodents. Dr.
Rocke lead a large-scale field trial in 7 western states of the U.S. demonstrating that oral
vaccination through consumption of vaccine-laden baits could prevent plague in wild
prairie dogs, thus reducing the risk of disease for the endangered black-footed ferret, other
animals, and possibly humans. Research is ongoing in Dr. Rocke’s laboratory to develop a
similar oral recombinant vaccine to manage rabies in vampire bats in Latin America and
also white-nose syndrome in North American bats, a fungal disease that has killed millions
of bats in the last few years in the U.S.
Dr. Jerome Unidad is a Member of Research Staff at the Hardware Systems Laboratory at PARC.
His research interests revolve around novel fluid delivery systems (including aerosol delivery)
for high viscosity fluids, polymers and biomacromolecules. At PARC, he is the technical lead in
developing the FEA spray technology for consumer and biomedical applications, as well as
additive manufacturing. He has a PhD in Chemical Engineering, specializing in polymer science
and rheology, from the University of Naples “Federico II” in Naples, Italy and was a postdoctoral
researcher at Forschungszentrum Juelich in Munich, Germany.
Deleted: Dr. Jerome Unidad is a Member of Research
Staff at the Hardware Systems Laboratory at PARC. His
Dr. Peng Zhou is a research interests revolve around novel fluid delivery
Dr. Xinglou Yang systems (including aerosol delivery) for high viscosity fluids,
polymers and biomacromolecules. At PARC, he is the
Dr. Ben Hu technical lead in developing the FEA technology for use
cases in consumer and biomedical applications. He has a
PhD in Chemical Engineering, specializing in polymer science
Dr. Kevin Olival is VP for Research at EcoHealth Alliance. His research over the last 15 years has and rheology, from the University of Naples “Federico II” in
focused on understanding the ecology and evolution of emerging zoonoses, with a focus on Naples, Italy and was a postdoctoral researcher at
Forschungszentrum Juelich in Munich, Germany.¶
38
CAPABILITIES

submitted).
39
STATEMENT OF WORK

task/subtask.



Phase I: Commented [PD46]: Below is formatted like the
THUNDER proposal – need to follow that approach, with
the example below of the sort of length
Karesh).
40
TA1:
Task 1.1
and SE Asia.
Progress Metrics:
Deliverable(s):
Progress Metrics:
Deliverable(s):
41
Preliminary Data:
Deliverables:

Yunnan cave sites.
Deliverable(s):

42
glycoprotein genes
mice.

potential.

transgenic mice.



43
Progress Metrics:
Deliverable(s):
data.


Progress Metrics:
Deliverable(s):
Boosting.
44
expression vectors.
vehicles.

RBD.

mice and bats.
45
Task 7: Develop and assess delivery methods to bats for immune boosting and priming
molecules

Progress Metrics: Still not sure what format you want this in? Formatted: Highlight
Deliverable(s):
1. Poxvirus construct expressing optimal SARS/CoV spike protein for immunizing bats Formatted: Font: (Default) +Headings (Calibri),
Italic
a. Genetically insert SARS/CoV spike proteins into raccoon poxvirus and confirm antigen
expression
b. Conduct laboratory studies to confirm serologic conversion, first in mice (UNC) and
then in bats (NWHC)
c. Master seed production of viral stocks for use in later field trials
Formatted: Font: (Default) +Headings (Calibri),
Italic
2. Mediums/vehicles and methods to deliver immunomodulatory agents to bats. Formatted: Left, Widow/Orphan control, Adjust
space between Latin and Asian text, Adjust space
between Asian text and numbers
a/ Determine appropriate medium (e.g. glycerin jelly or other viscous substance) for Formatted: Font: (Default) +Headings (Calibri),
delivering virally vectored vaccines and nanoparticles to bats Italic
b. Assess minimum dosage required for adequate uptake by bats after topical Formatted: Font: (Default) +Headings (Calibri),
application Italic
c. Determine appropriate delivery methods to apply appropriate dosages in conjunction with Formatted: Normal, No bullets or numbering,
PARC, first in laboratory settings, and then in local field sites Tab stops: 0.06", Left
3. Prototype system for automatic, mass delivery of immunomodulatory substances to bats (in Formatted: Font: (Default) +Headings (Calibri),
Italic
collaboration with PARC)
a. Conduct biomarker studies to validate application methods in bats, first in local field sites and Formatted: Normal, No bullets or numbering
then at sites in China
b.. Conduct field trial in China with prototype delivery method using selected
immunomodulatory substances deemed most useful for bats
Italic
4. Data on uptake in insectivorous bats.
a. Provide data on biomarker uptake in insectivorous bats for use in modeling studies Formatted: List Paragraph
5. Annual reports, manuscripts, presentations. Formatted: Font: (Default) +Headings (Calibri),
Italic
Italic
46
PREEMPT TRANSITION PLAN Commented [PD47]: Description from the BAA:
● Indicate the types of partners (e.g. government, private industry, non-profit) PREEMPT Transition Plan
Proposers must include a PREEMPT Technology
Transition Plan. Proposers must indicate the types of
● Submit a timeline with incremental milestones toward successful engagement. partners (e.g. government, private industry, non-profit)
they plan to pursue and submit a timeline with
NOTE: begin transition activities during the early stages of the program (Phase I). incremental milestones toward successful engagement.
Proposers should begin transition activities during the
early stages of the program (Phase I). Awardees must
● Describe any potential DARPA roles. include
DARPA in the development of transition relationships.
If the transition plan includes a start-up company, a
business development strategy must be included as
Project DEFUSE partners come from academic, government, private industry, private non-profit well. The extent by which the proposed intellectual
institutions and will develop a coherent transition plan for research findings, data and any property (IP) rights will impede the Government’s ability
to transition the technology will be considered in the
technology developed in this work. proposal evaluation.
PARC as a private industry partner (large business) is a fully-owned subsidiary of Xerox Formatted: Font:
Formatted: Indent: Left: 0.5", No bullets or
Corporation and is committed to commercializing the FEA technology through IP licensing for numbering
different applications spaces to different commercial partners. In the context of project Formatted: No bullets or numbering
DEFUSE, PARC has been and will continue to engage potential licensees (OEMs) in the
biotechnology and biomedical fields for eventual transitioning of targeted delivery technology
that might result in the project. PARC already has existing networks of business relations in the
biotechnology and biomedical space, both large companies (Fortune 500, Fortune 1000) and
small businesses and start-ups who could be transition partners for FEA as a wide-scale, large-
area drug delivery device. In addition, in collaboration with our extended network of DEFUSE
partners and with DARPA, we will further identify existing government needs for our delivery
technology, particularly in wildlife health management (in collaboration with EHA and USGS-
NWHC) as well as in suppression of emerging threats (in collaboration with government
agencies such as the CDC). PARC will leverage this knowledge in developing a needs-based
commercialization plan with potential partners.
47
PREEMPT RISK MITIGATION PLAN
● Provide the following:



BIBLIOGRAPHY
RELEVANT PAPERS
Propose:

48
doi:10.1128/jvi.00650-10 (2010).
Nature 546, 646-650 (2017).
3048-3053, doi:10.1073/pnas.1517719113 (2016).
doi:10.1038/nm.3985 (2015).
microbe (2018).
(2016).
doi:10.1128/jvi.02453-08 (2009).
31-34 (2009).
318 (2013).
88, 11825-11833 (2014).
E7348-E7357 (2017).
49
immunology 23, 211-219 (2010).
doi:10.1016/j.vaccine.2016.08.088 (2016).
(2016).
doi:10.1371/journal.ppat.1006698 (2017).
679 (2005).
a priority? Oryx 47, 526-531 (2013).
50
201-209 (2016).
39 IUCN. Vol. 2017-1 (2017).
(2018).
191 (2015).
94, 1028-1038 (2013).
doi:10.1093/ve/vex012 (2017).
82, 2274-2285, doi:10.1128/jvi.02041-07 (2008).
Res. 27, 119-129, doi:10.1038/cr.2016.152 (2017).
82, 6984-6991, doi:10.1128/jvi.00442-08 (2008).
doi:10.1126/science.1116480 (2005).
3198-3203, doi:10.1074/jbc.M508381200 (2006).
doi:10.1073/pnas.1405889111 (2014).
51
doi:10.1371/journal.ppat.1006546 (2017).
doi:10.1007/s11427-017-9189-3 (2017).
doi:10.1128/jvi.01804-08 (2008).
doi:10.1073/pnas.1311542110 (2013).
(2003).
Virology 85, 13363-13372, doi:10.1128/JVI.05300-11 (2011).
doi:10.1016/j.antiviral.2013.09.028 (2013).
doi:10.1371/journal.pone.0179177 (2017).
23, 468-478, doi:10.1016/j.tim.2015.06.003 (2015).
doi:10.1073/pnas.1708727114 (2017).
(2016).
(2004).
52
Reports 2, 261, doi:10.1038/srep00261 (2012).
(2006).
(2007).
(2013).
(2002).
JoVE, doi:10.3791/1549 (2009).
679, doi:10.1126/science.1118391 (2005).
6, doi:10.1038/srep21722 (2016).
53
bats. Cytokine 87, 156-156 (2016).
S109-S118 (2015).
PloS one 7, e45479 (2012).
12 (2012).
doi:10.1073/pnas.0701372104 (2007).
doi:10.1371/journal.pone.0025434 (2011).
7458-7466 (1994).
doi:10.1128/JVI.02377-07 (2008).
(2012).
(2009).
interfaces 4, 4149-4155 (2012).
54
512, 147-157 (2016).
334-343, doi:10.1016/j.ijpharm.2014.10.022 (2014).
(2014).
200 (2013).
(2017).
55
doi:10.1038/nature06536 (2008).
4, e00598-00513 (2013).
doi:10.1017/s0950268810000695 (2010).
56
Fwd: letter for Jonathan to sign

Wed 3/21/2018 4:42 PM
Here's the letter you need. -Tonie
From: Schroeder, Rebecca <[email protected]>
Subject: Re: letter for Jonathan to sign
Here you go.
Becky Schroeder
Executive Assistant to the Director's Office
6006 Schroeder Rd.
Madison, WI 53711
Phone: (608) 270-2402
Email: R [email protected]
Hi Rebecca: Can you put this draft letter on our letterhead, add
Jonathan's credentials as he likes to use, and get his signature? If you
send the signed letter back to me, I'll pass it on. Thanks much! -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: DARPA PRE-EMPT

Tue 3/20/2018 4:20 PM
To: Anna Willoughby <[email protected]>
Hi Anna: Should I wait for Peter's updated draft before I make revisions?
Also, attached is a file containing bios for both Rachel Abbott and myself.
Please let me know if you think they are sufficient. Best -Tonie
On Tue, Mar 20, 2018 at 4:15 PM, Anna Willoughby <[email protected]> wrote:
Dear all,
Please find the NWHC section of the proposal. Peter is currently working on an updated draft,
but this should be sufficient for composing your budget and particular task. Please let me know if
you have any questions. If needed, I am also attaching the original BAA for the program, with
PARC's focus being TA2.
Best,
Anna
- Jerome to send more detailed scope of work with paragraphs and revised budget by early
next week
For your question on collaborating with other institutes, it is likely

that all organizations involved may have insight into the aerosol-bat
interaction. I believe this topic would be covered during the Annual
Meeting between all partners, as well as during relevant cross-
partner trips, in addition to monthly conference calls.
Best,
Anna

the technical lead for coordinating this segment of the project be USGS – National Wildlife Center? Or
should we also expect to work/coordinate with other institutes who would give feedback and insights on
how this works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Cc: 'Luke Hamel' <[email protected]>; 'Anna Willoughby' <willoughby@ecohealthalliance.
org>; 'Alison Andre' <[email protected]>; 'Amanda Andre' <amanda.andre@ecohealthallianc
e.org>; 'Rocke, Tonie' <[email protected]>; Paul, Kateri <[email protected]> <[email protected]>
Peter and team,
approximately Monday. Officially, for the submission, our capture manager, Kateri Paul, who takes care of
the other things would need the following things from your equivalent to facilitate our parts of the
submission.
DARPA
Once we have finalized the scope of work and the budget, Kateri will be in touch for these other aspects.
Her contact information can be found below.
Kateri E. Paul
Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


Dear all,
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


<[email protected]>
Tonie and Jerome,
great.
BK
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

between human and wildlife health and delicate ecosystems. With this science we
develop solutions that promote conservation and prevent pandemics.
ahead with a short call we had been planning anyway regarding some
technical details. I told him our concerns about the proposed budget and we
think we have a pretty good plan to reduce the scope of work to the funds we
have available. PARC is very unique in developing this technology and their
another meeting to run off to for the rest of the day. I'm available the rest of
the day if you wish to chat about this in person. Best -Tonie

Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC

Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD




Dear all,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Dear Dr. Unidad,
Thanks for your quick responses to Dr. Rocke. Would you be available
for a short call with Dr. Daszak, Dr. Rocke and me this afternoon or Friday.
We’re on tight timeline so we thought a phone call might be save quite a

bit of time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Dr. Tonie Rocke, Ph.D. is a research scientist at the USGS National Wildlife Health Center, the
only federal laboratory with the sole mission to manage disease in wild animals. Dr. Rocke’s
current research is focused on the ecology and management of diseases in wild mammals (e.g.
plague, monkeypox, rabies and white-nose syndrome) with the overreaching goal of
conservation of threatened and endangered species. She and other colleagues developed an oral
recombinant plague vaccine for use in wild rodents. Dr. Rocke lead a large-scale field trial in 7
western states of the U.S. demonstrating that oral vaccination through consumption of vaccine-
laden baits could prevent plague in wild prairie dogs, thus reducing the risk of disease for the
endangered black-footed ferret, other animals, and possibly humans. Research is ongoing in Dr.
Rocke’s laboratory to develop a similar oral recombinant vaccine to manage rabies in vampire
bats in Latin America and also white-nose syndrome in North American bats, a fungal disease
that has killed millions of bats in the last few years in the U.S.
For more information, see: https://www.researchgate.net/profile/Tonie_Rocke/publications and
http://www.nwhc.usgs.gov/
Dr. Rachel Abbott, DVM, M.S. has been managing field and laboratory projects as a part of Dr.
Rocke’s team at the USGS National Wildlife Health Center for the last 6 years. She has played a
key role in plague vaccine studies and more recent work on white nose syndrome in bats. Dr.
Abbott designs studies, coordinates animal work, oversees technical help, analyzes data, and
prepares manuscripts and written reports. For more information, see:
https://www.researchgate.net/profile/Rachel_Abbott/publications.
revised budget
Tue 3/20/2018 3:57 PM
To: Anna Willoughby <[email protected]>
Ok Anna, I think I have this broken down as far as I can. Please review and
let
--
me know. Best -Tonie
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
TRAVEL
Trip #: 1 Y1 Location: Arlington, VA
Purpose: DARPA Kickoff Meeting
1.75 1 $333.00 $172.50 $500.00
Description Amount
parking 20
Total: $120.00
Trip #: 2 Y1 Location: Kunning, China
Purpose: Site Visit
7 1 $1,370.00 $1,035.00 $1,029.00
Description Amount
parking 80
Trip #: 3 Y1 option Location: Kunning, China

Purpose: Deployment Visit
7 1 $1,370.00 $1,035.00 $1,029.00
Description Amount
parking 80
Total: $100.00
Trip #: 4 Y1 Location: New York, NY
3 2 $666.00 $518.00 $2,328.00
Description Amount
parking 40,00
transportation $100.00
Total: $140.00
Trip #: 5 Y2 Location: Wuhan, China
3 1 $6,861.00 $575.00 $588.00
Description Amount
parking 40
Total: $140.00
Trip #: 6 Y3 Location: New York, NY
3 2 $666.00 $518.00 $2,328.00
Description Amount
parking 40
Total: $140.00
Trip #: 7 Y3.5 Location: New York, NY
4 2 $666.00 $518.00 $2,328.00
Description Amount
parking 40
Total: $140.00
Trip #: 8 Y1 Location: Upper Peninsula Michagan

4 3 $0.00 $459.00 $837.00
Description Amount
gas 120
govt car use $468.00
Total: $588.00

4 3 $0.00 $459.00 $837.00
Description Amount
gas 120
Total: $588.00

4 3 $0.00 $459.00 $837.00
Description Amount
gas 120
Total: $588.00
Contract Period
Base Period
Other Total
$120.00 $1,125.50
Contract Period
Base Period
Other Total
$180.00 $3,614.00
Contract Period
Option I
Other Total
$180.00 $3,614.00
Contract Period
Base Period
Other Total
$140.00 $3,652.00
Contract Period
Base Period
Other Total
$140.00 $8,649.00
Contract Period
Option I
Other Total
$140.00 $3,652.00
Contract Period
Option II
Other Total
$140.00 $3,652.00
Contract Period
Option I
Other Total
$588.00 $1,884.00
Contract Period
Option I
Other Total
$588.00 $1,884.00
Contract Period
Option I
Other Total
$588.00 $1,884.00
MATERIALS/EQUIPM
Item Manufacturer Part Number Unit Price Quantity
Mealworms Rainbow mealworms $100/20,000 12
bat caging materials various $500/cage 9
bat wing bands Porzana $596/box 9
Cut resistant gloves Varied $15/pr 30
Tyvek suits DuPOnt EV29135313 $306/case 15
Tyvek aprons Lakeland 6EHH7 $58/case 15
N95 respirators 3M 9511 $20/box 45
PAPRs replacement covers 3M $96/3 units 45
cell culture flasks Corning 430641U 415/case 5
cell culture flasks Corning 431080 425/case 10
Nunc cell factories Nunc 140250 $370/case 12
96 well plates Corning 3599 $600/case 8
fetal bovine serum GE Hyclone SH30071.03 $600/bottle 8
DMEM medium GE Hyclone SH30021.02 $30/l 10
pipette tips Fisher 13-676-10 $100/case 50
Selamectin Zoetis $250
glycerin jelly Carolina Biological Supply $43 bottle 50
rhodamine B Sigma $56/100g 6
Harp Trap Bat conservation and management $2,003 2
hair collection bags U-line $75/box 10
Consumables miscellaneous
Note:
Consumables may be listed as a lump sum if no individual item is over $5,000. For those items that are over $5,000, list
ERIALS/EQUIPMENT
Total Price Contract Period Additional Information
1,200 Y1-Y3
4,500 Y1-Y3 custom made
4,768 Y1-Y3
450 Y1-Y3
4,590 Y1-Y3
870 Y1-Y3
900 Y1-Y3
4320 Y1-Y3
2075 Y1-Y3
4250 Y1-Y3
4440 Y1-Y1-Y3
4800 Y1-3.5
4800 Y1-Y3
300 Y1-Y3
5000 Y1-Y3.5
250 Y1-Y3
2150 Y1-Y3
336 Y1-Y3
4006 Y1
750 Y1-Y3
5,344 Y1-Y3.5 needles, syringes,whirl paks, plastic bags, other disposables, all <5K
60,099
s that are over $5,000, list separately from the rest of consumable pricing.
bles, all <5K
60099
OTHER DIRECT COSTS
Year Description Total Price Contract Period
1 animal perdiem costs $12,600 Y1
Y2
2 animal perdiem costs $12,600
Y3
3 animal perdiem costs $12,600
rabies prphylactic shots $4,020 Y1
$49,860
THER DIRECT COSTS
veterinary services and daily surcharge for rom use,
above)
above)
Fwd: Support letter (PREEMPT)

Tue 3/20/2018 12:54 PM
To: Sleeman, Jonathan M <[email protected]>; Richgels, Katherine L <[email protected]>
Finally, EHA sent this letter they need signed, but I have no idea how to
address this issue of eligibility. I have asked for more information and
perhaps for a name at DARPA we can call. Perhaps you could at least edit
the letter as you see fit or perhaps you know what to do about this
eligibility question. Thanks -Tonie
Subject: Support letter (PREEMPT)
Cc: Rachel Abbott <[email protected]>, Jonathon Musser <[email protected]>,
Hi Tonie,
Please see the required collaborator support letter (attached) and comments within. Thank
you for your patience and please let me know if you have any questions.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
--
Tonie E. Rocke
6006 Schroeder Rd.

Madison, WI 53711
608-270-2451
[email protected]
DARPA proposal budget to review

Mon 3/19/2018 8:54 PM
To: Meicher, Lisa K <[email protected]>; Richgels, Katherine L <[email protected]>
Hi Lisa: Please review the attached budget to make sure it is correct.
Katie and I have talked about it and agreed to the categories. Katie, I
reduced my salary to 0.6 month/year (5% of my time) b/c I couldn't fit in
the travel budget otherwise. Let me know if you have questions. If any
changes need to be made, I'll adjust supplies to keep the same total
budget. Thanks -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
[email protected]
Applicants tab.
CFDA Number: 12.910
Competition ID:
Competition Title:

[email protected]

DUNS: 0770900660000
Form Version: 1.4

FORM ACTIONS:
Tonie Rocke 129,590.00 0.60 6,479.00 1,747.00 8,226.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00
Project Role: Coordinates animal studies

B. Other Personnel

Graduate Students
3 Undergraduate Students 3.00 24,782.00 24,782.00


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

9.
10.

H. Indirect Costs

POC Phone Number)


Tonie Rocke 129,590.00 0.60 6,479.00 1,747.00 8,226.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

9.
10.

H. Indirect Costs

POC Phone Number)


Tonie Rocke 129,590.00 0.60 6,479.00 1,747.00 8,226.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

9.
10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 0.60 6,479.00 1,747.00 8,226.00
Dr. Rachel Abbott 61,006.00 6.00 30,502.00 7,986.00 38,488.00
Project Role: collate data, assist with reprots writing and publication

B. Other Personnel

Graduate Students

Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

8. Animal care
9.
10.

H. Indirect Costs

POC Phone Number)


Totals ($)
74,346.00
9
376,666.00
Section D, Travel
28,262.00
1. Domestic
12,385.00
2. Foreign
15,877.00
2. Stipends
3. Travel
4. Subsistence
5. Other
121,227.00
79,427.00
4,000.00
8. Other 1
37,800.00
9. Other 2
10. Other 3

Section J, Fee
865,750.00
Re: [Reminder] PREEMPT call, Wed. 3/21

Mon 3/19/2018 1:39 PM
Just to be clear, I will NOT be able to sign the document on behalf of
NWHC. -Tonie
Something I will pass along to the team here at EHA. It's possible that we will have you sign the
document on behalf of NWHC. Thank you for the information!
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Also, to be honest, I don't know how long it will take my people to sign
it. -T
great-thanks! I just didn't want it to fall through the cracks since I am
leaving the country on Thursday. -Tonie
Yes, of course - my apologies for the delay. I am working with Jonathon and Evelyn to
finalize the document that we will send to you. Our plan is to send it to you later this
afternoon.
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)
Please don't forget to send me a template or whatever is you need
my director to sign off on. I need to get that done before
Wednesday. -Tonie
Hi Tonie,
This is just a reminder that our next PREEMPT call will take place on Wed. 3/21 @ 10
AM ET.
Phone: 1-719-785-9461
Password: 9784#
Best,
Luke Hamel
Program Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

(b) (6) (mobile)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: DARPA PRE-EMPT

Fri 3/16/2018 3:51 PM
Hi Jerome: Sure, here's my draft narrative. I was planning to update it
once we figured out if we could contract with you and after Peter reviewed
it. Also, I have no idea what to put as a start date and haven't got a
response to my inquiry about it. So I guessed at 10/1/18 but I'd be
surprised if it comes through that fast. -Tonie
Tonie,
Thanks for your email. Just for organizational purposes so we clearly know who is the technical lead for this
main part. Would you be able to share the concept paper that you submitted to DARPA prior to this full
proposal? Just for our information. If not, I will just wait for Peter to send the full integrated proposal and
identify the blanks we might need to fill in.
We really appreciate your effort in bringing us in. Our team is very excited to be involved in this project.
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Subject: Fwd: DARPA PRE-EMPT
Hi Jerome: I think we'll be your point of contact for most of the project, and we will probably use
both biomarker analysis and viral load in fecal samples as response indicators for the final field
trial where several investigators will be involved. I asked EHA to provide the subcontract to you
instead of us to avoid possible hassles with it needing to go out for bid from our contracting
office. Thanks for being flexible! -Tonie
From: Anna Willoughby <[email protected]>
Date: Fri, Mar 16, 2018 at 2:12 PM
Cc: "William B. Karesh" <[email protected]>, Peter Daszak
<[email protected]>, [email protected], Luke Hamel
<[email protected]>, Alison Andre <[email protected]>, Amanda Fuchs
week
For your question on collaborating with other institutes, it is likely that all organizations involved may
have insight into the aerosol-bat interaction. I believe this topic would be covered during the Annual
Meeting between all partners, as well as during relevant cross-partner trips, in addition to monthly
conference calls.
Best,
Anna

works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Peter and team,
DARPA
Kateri E. Paul

Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


Dear all,
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD



<[email protected]>
Tonie and Jerome,
great.
BK
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
Jerome Unidad, PhD


Dear Dr. Unidad,
of time.
Thanks in advance,
Billy
EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)

--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Anna Willoughby
Research Assistant
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
priming molecules

for bats.
a. b. c. d.
fluorescence).
O.N. Infection O.N.

RCN-MoG ON
RCN-MoG Topical
RCN-G ON
RCN-luc
ON
captured (w/o inc)
All bats 64 34 25 5 58
Recaptured
19 18 0 1 100
marked bats
the biomarker, RB.
Deliverable(s):




1253-x.

Fwd: DARPA PRE-EMPT

Fri 3/16/2018 2:38 PM
Hi Jerome: I think we'll be your point of contact for most of the project,
and we will probably use both biomarker analysis and viral load in fecal
samples as response indicators for the final field trial where several
investigators will be involved. I asked EHA to provide the subcontract to
you instead of us to avoid possible hassles with it needing to go out for bid
from our contracting office. Thanks
for being flexible! -Tonie
From: Anna Willoughby <[email protected]>
Date: Fri, Mar 16, 2018 at 2:12 PM
Cc: "William B. Karesh" <[email protected]>, Peter Daszak
<[email protected]>, [email protected], Luke Hamel <[email protected]>,
Alison Andre <[email protected]>, Amanda Fuchs
week
organizations involved may have insight into the aerosol-bat interaction.
I believe this topic would be covered during the Annual Meeting
between all partners, as well as during relevant cross-partner trips, in
addition to monthly conference calls.
Best,
Anna

For the spray technology, refinement of the details with respect to aerosol-bat interaction (i.e. the preliminary
field testing to see how bats react to the aerosol) and eventual field-deployment in China, will the technical
lead for coordinating this segment of the project be USGS – National Wildlife Center? Or should we also expect
to work/coordinate with other institutes who would give feedback and insights on how this works?
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Peter and team,
I’m currently working on putting together a revised budget and equivalent statement of work (tasks breakdown)
for PARC’s involvement with the project. You can expect this about early next week – approximately Monday.
Officially, for the submission, our capture manager, Kateri Paul, who takes care of the other things would need
the following things from your equivalent to facilitate our parts of the submission.
1. Request for Proposal that we can respond to with what they need for their package to DARPA

Kateri E. Paul
Palo Alto, CA 94304
[email protected]
650-812-4821 (desk)
617-596-2023 (mobile)
---------------------------------------------------------------------
Jerome Unidad, PhD


Willoughby <[email protected]>; Alison Andre <[email protected]>; Amanda Andre
<[email protected]>
Dear all,
10AM-11AM PST (12PM-1PM CT, 1PM-2PM ET) should work for us. I shall setup a WebEx meeting for this, given
the number of participants.
Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


<[email protected]>
Tonie and Jerome,
great.
BK

EcoHealth Alliance
+1.212.380.4463 (direct)
+1.212.380.4465 (fax)
Hi all: Since we didn't hear back from EcoHealth Alliance, Jerome and I went ahead
with a short call we had been planning anyway regarding some technical details. I
told him our concerns about the proposed budget and we think we have a pretty
good plan to reduce the scope of work to the funds we have available. PARC is
very unique in developing this technology and their technology fits very well with
other work I am doing, so we both feel pretty confident we can work something
out. If you still wish to have a discussion among all of us, we can schedule that for
tomorrow, as I believe Jerome had another meeting to run off to for the rest of the
day. I'm available the rest of the day if you wish to chat about this in person. Best
-Tonie
On Thu, Mar 15, 2018 at 3:42 PM, Peter Daszak <[email protected]>

wrote:
Today Thursday.
Is that possible?
Passcode: 9784#
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC

Thanks,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD




Dear all,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD


Cc: Rocke, Tonie <[email protected]>; Peter Daszak <[email protected]>; Luke
Hamel <[email protected]>
Dear Dr. Unidad,
We’re on tight timeline so we thought a phone call might be save quite a bit of
time.
Thanks in advance,
Billy
EcoHealth Alliance
New York, NY 10001
(b) (6) (direct)

1.212.380.4465 (fax)
(b) (6) (cell)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
March 15, 2018, 1pm EST
EHA: Billy Karesh, Peter Daszak, Anna WIlloughby
NWHC: Tonie Rocke
PARC: Jerome Unidad and David Johnson
Project DEFUSE, PI Peter Daszak
Budget
● Current budget is 580k for all tasks in original scope (360k development; 220 field
prototype: 3-4 copies)
● EHA: Budget is currently too expensive. Avenues for reduction:
○ Reduce scope/trim intermediate steps? (not preferable)
● Original estimate is lean for prototype for scale: 2-3 bats at a time, generating aerosol for
significant amount of space
● PARC may be able to make less expensive (for beginning scope of work)
● DARPA may have further, add-on support after program has begun
● Include some travel: PARC will need a cross-partner visit with EHA (or vice versa), will
attend annual meeting, Y2 China visit, visit to TR captive colony in Y1.
Collaboration
● Exclusive partnership between EHA and PARC for DARPA application
Scope of Work (EHA needs more details, paragraph per item)

● Goals for EHA are to have engagement from PARC for duration of project and for
deployment trials
● PARC sent white paper, should insert relevant info into proposal
● PARC want time to optimize correctly, (eg spray quality, fluid consistency)
● For DARPA purposes: proof of concept that you can interfere and disrupt v.
transmission. Large scale intervention not necessary.
● Y1: Creating initial product, modifying existing fixtures; deploy biomarker in captive
species, each captive bat experiment is ~32k (TR)
● Y2: Refining prototype for field use, deploy biomarker in field species stateside (TR)
○ Bats will be sampled for biomarker spread
● EHA add link to video in proposal
Deployment Details
● For Chinese bat caves: we would go to minor entrances/side pocket. (smaller scale,
could then be scaled up after the project)
● PARC: How big are caves? EHA: Volume 2 ft by 2 ft, similar to furniture size, Not going
to cave with 10,000 bats. This is simply a field trial.
● EHA: Deploy for 2-3 days at one site for field trial in China. Have at least 2 prototypes
● EHA: Will not manufacture large-scale spray material as too expensive
● Deploy Biomarker Study: Captive Bats (NWHC) -> Field (US) -> Field (China)
● Deploy Mesocosm Study: Captive Bats (Duke-NUS) -> Field (China)
-
NWHC budget
Fri 3/16/2018 12:53 PM
To: Luke Hamel <[email protected]>; Daszak Peter <[email protected]>; Billy Karesh
Hi all: Here is a quick summary and my "draft" budget templates. I
wanted to get this to you today so you can figure out the workflow over
the weekend as you put together the proposal and so it is very clear what I
can do. Note I have to get this budget approved by NWHC on Monday so
something might change slightly.
You indicated you had budgeted $1,065,750 for 3.5 years for my part of
the project, which primarily involves developing the appropriate delivery
mechanism to bats. Based on our conversations about PARC and the
need to subcontract the engineering of the spray device (which in my
mind is absolutely critical to the project so glad our phone conversation
with PARC went well-thanks!!) I have subtracted $200K ($50K/yr).
Bat experiments are quite costly because they require us trapping them
and hand feeding on a daily basis. Also full PPE, because they potentially
carry rabies (we had an outbreak in our facility last year). See below for a
breakdown. So, after reducing for overhead costs, that leaves me
$526,154. For that amount, this what I can give you in terms of animal
experiments.
Year 1: 1 -2 experiments with up to 60 bats for up to 120 days (includes
30 day quarantine period-rabies watch) $35K (note since these are not
terminal studies, we can potentially use the bats for more than 1
experiment).
Year 2: 1 -2 experiments with up to 60 bats for up to 120 days (includes
30 day quarantine period) $35K
Year 3: 1 experiment with up to 60 bats for 90 days (includes 30 day
quarantine period) $26K
1 RCN construct (Ralph thought that was sufficient and any more than
that would require more $). I will provide the virally vectored immunogen
to Ralph and he will first conduct mouse studies, before we put it in bats.
The rest of my budget is in personnel costs, travel-estimated at this point,
and a minimal supply budget.

After talking with Ralph about response variables to measure with immune
boosting particles, I realized we can easily do an experiment to evaluate
an RCN construct as he can measure serologic response. However, the
other products (agonists, adjuvants) would require quite a bit of additional
work which I can not provide, unless it is simply providing frozen tissue to
another partner (not sure about that and Ralph wasn't either). That needs
to be done elsewhere, and in any case these products should be tested in
the target species. In addition to the RCN study, I will assess
methods/mediums of delivery, dosages, application rates, etc. We need
to figure out how much to apply to a bat topically to deliver the appropriate
dosage for consumption. We would also work with Ralph's group to
assess nanoparticle uptake, dosage, etc., and work with Parc to assess
how their delivery system is working first in the lab and then in the field.
Let me know if you have questions or concerns.
Peter, I will wait to get a new draft from you before updating my section,
but just a reminder, I need to provide finals to you before COB 3/21 as I
won't have easy access to email in Mexico.
Thanks and good luck this weekend pulling it all together. -Tonie
Bat care costs (based on a 60-bat experiment for ~120 days in 2017)
$105/day per diem ($12,600)
720 man hours of hand feeding ($12,240)
food, PPE, drugs, rabies shots, caging materials ($10,000)
trapping ($400)
Total: $35,240K
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
[email protected]
Applicants tab.
CFDA Number: 12.910
Competition ID:
Competition Title:

[email protected]

DUNS: 0770900660000
Form Version: 1.4

FORM ACTIONS:
Tonie Rocke 129,590.00 1.00 10,800.00 3,329.00 14,129.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

9.
10.

H. Indirect Costs

POC Phone Number)


Tonie Rocke 129,590.00 1.00 10,800.00 3,329.00 14,129.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

9.
10.

H. Indirect Costs

POC Phone Number)


Tonie Rocke 129,590.00 1.00 10,800.00 3,329.00 14,129.00
Dr. Rachel Abbott 61,006.00 12.00 61,006.00 15,970.00 76,976.00

B. Other Personnel

Graduate Students


Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

9.
10.

H. Indirect Costs

POC Phone Number)


Dr. Tonie Rocke 129,590.00 1.00 10,800.00 3,329.00 14,129.00
Dr. Rachel Abbott 61,006.00 6.00 30,502.00 7,986.00 38,488.00
Project Role: collate data, assist with reprots writing and publication

B. Other Personnel

Graduate Students

Total Equipment

2. Stipends
3. Travel
4. Subsistence
5. Other

8. Animal care
9.
10.

H. Indirect Costs

POC Phone Number)


Totals ($)
74,346.00
9
400,278.00
Section D, Travel
38,525.00
1. Domestic
25,525.00
2. Foreign
13,000.00
2. Stipends
3. Travel
4. Subsistence
5. Other
87,352.00
52,702.00
8. Other 1
34,650.00
9. Other 2
10. Other 3

Section J, Fee
865,750.00
Re: PARC FEA

Thu 3/15/2018 9:40 AM
Hi Jerome: Thanks for the quick response. We are working through our
budget to see what is possible. Perhaps we could chat later this
afternoon. One thing I want to discuss is how the laboratory studies might
go. The most expensive part of our work is the care and feeding of bats
(they have to hand fed so it is quite labor intensive). So the sooner we can
test in field settings the better. Also, we typically use rhodamine B in our
preparation because it shows up in animals hair (visible under a
fluorescence microscope) within 24 hours of consumption. So we can go
in 1-2 days after spraying, capture animals to collect hair, and assess the
rates of application to the bats. I don't know if you are aware of this dye,
but it is bright fuschia, comes in powder form but is readily dissolved, and
gets everywhere. The more work we can do in a field setting (versus an
indoor laboratory) the better. For this project, if we can even get to a
hand-held sprayer to show proof of concept, we'd be happy with that, as
we believe DARPA would invest more in the project if we get that far. Let
me know what you think. I am trying to loop in the PI as well but not sure
he is available today. Best -Tonie
On Wed, Mar 14, 2018 at 5:46 PM, <[email protected]> wrote:
Hi Tonie,
I agree based on our discussion that I think there’s a lot of interesting space for our technology
for wildlife health management that we can work on together. We are certainly interested in
exploring these other funding opportunities with you, particularly the WNS one which seems to
be in the intermediate term.
Regarding PRE-EMPT, we understand that coming in this late that you guys probably have
already fleshed out the project direction and tasks with equivalent budget and there might not be
a lot of flexibility. In our proposed involvement, we would not want to change anything that you
already just fleshed but rather supplement it with our spray technology. Based on preliminary
estimation on how this involvement might be like, I came up with the following tasks and a lean
estimate of the associated cost:
Phase I
2. Optimization of FEA spray conditions for PRE-EMPT fluids (Year 1) - $ (b) (4)
3. Refinements of FEA delivery system (setup, fluid form ion, general aerosol delivery
scheme) based on preliminary lab testing (Year 2) - $ (b) (4)
4. Preliminary design of a field-deployable FEA system (Year 2) - $ (b) (4)
Phase II
5. Fabrication and testing of field-deployable FE ystems (Year 3) - $(b) (4)
6. Project management and communication - $ (b) (4)
The cost of the entire involvement as drafted is $(b) (4) over the full period of 3.5 years (Phase I
and II). Some of the tasks proposed above (example task 3) are included to ensure that we refine
our technology continually to meet the requirements of the application at hand. We have a good
working relationship with DARPA on various projects that we would want to maintain and, at the
same time, we would like to take this chance to work with institutions such as yours on
something with broad impact.
Please let me know what your thoughts are and whether this might work. I can make myself
available for a phone call tomorrow, as needed. Also, feel free to loop in your project PI/prime in
the discussion in case it might be helpful.
Thanks,
Jerome

Hi Jerome: I had a good conversation with my colleagues and shared your material and
video link with them. They agreed this looks like a great option for us, so we'd like to
further explore how to move forward. Our PREEMPT proposal encompasses a wide variety
of aims related to understanding and managing disease in bats in SE Asia, primarily in
relation to SARS/coronaviruses. So a big part of the project is testing and developing the
appropriate immune boosting agents. At the same time, we'd like to start developing the
methods for delivery to bats via technology like your FEA you've described, first testing in
laboratories and small caves - stateside, with the ultimate goal of conducting a field trial in
a single cave system in China as proof of concept. So given that, what kind of budget do
you think you might need to be involved, or alternatively, could you break things down for
me by task, so we can see how we might structure this in stages? Honestly, we don't have
alot of flexibility in the budget at the moment, but we see a ton of applications of this
technology for your company in the future in managing wildlife health issues, not only with
DARPA, but also DOI (white nose syndrome), USDA (bat rabies), and other government
agencies, both foreign and domestic, so perhaps your company might view this as a good
opportunity to test and illustrate the value of your technology. There is also another
funding opportunity I am looking at for WNS that we might be able to partner on if you are
interested. Let me know what you think. Also, with your permission, we'd like to include the
link to the video in our proposal and perhaps pull an illustration or two for the text of the
proposal with credits of course. Best regards -Tonie

prototype quickly with some optimization as early as possible so that we can transition the
setup to the corresponding partners (e.g. your group) to initiate the lab testing as soon as
possible, and then spend the succeeding work on refining various aspects (fluid formulation
for targeted spreading or bioefficacy, etc.) and maybe later on developing a field-deployable
version, with motion-actuation (or timed-actuation, whatever case maybe), for Phase 2. We
should be able to flesh it out very quickly depending on whatever structure you guys already
have in mind.
Best,
Jerome
---------------------------------------------------------------------
Jerome Unidad, PhD

Thanks Jerome. That is just what i need. The video is awesome. I'll talk things over with the
PI tomorrow. In terms of a subcontract, do you think we could split it over 2-3 years? Best -
Tonie

Tonie,
Thanks for reaching out. Here’s a 1-pager on our spray technology. If you are curious about
how the spray might actually look like, you can check out a video here --
We would really be interested in working with your proposal team on this. If possible, it will
be more value-generating for us to be a subcontractor and to contribute more to tailoring
our spray technology for the intended use case. I’d also like to mention that another aspect
we could bring to the table is in transitioning out the technology into a reality, particularly
towards commercialization, because we have a good history on this – particularly on the
device side but also, and increasingly, in the biomedical space through other commercial
partners.
Thanks,
Jerome

Subject: Re:
Hi Jerome: 1-2 CT is fine for me. I may not be in my office, however, so can I call you? Is
this number good? 650-812-4209. Thanks -Tonie

Sorry, I mixed up the schedule. I actually do have a meeting in the 1-2PM PST slot, how
about 11AM-12PM PST (1-2PM CT)?
Thanks,
Jerome

Hi Jerome: I have been working on developing vaccines for use in managing disease in
wild bats - e.g. rabies in vampire bats and white-nose syndrome in insectiverous bats. I
am also collaborating on a PREEMPT proposal and one of my collaborators passed on
your contact information and description regarding PARC's spray technology for possible
application in this field. Would you have time to chat tomorrow? I'll be available anytime
after noon CT. Thanks much! -Tonie
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
Re: FW: Nanoparticle slide from Ralph

Thu 3/8/2018 7:52 AM
To: Baric, Toni C <[email protected]>
Hi Toni (nice to meet a fellow Toni - I don't often); Yes, 11:30 works for
me. Is that ET? I'm not yet sure if I'll be working from home tomorrow, so
probably best if I call you. I'd like to hear your thoughts on how these
proteins are best delivered to bats and what has been attempted so far.
Thanks -Tonie
On Thu, Mar 8, 2018 at 7:07 AM, Baric, Toni C <[email protected]> wrote:
Dear Tonie,
Can you make a call at 11:30 am on March 9?
Toni
From: Baric, Ralph S

To: Rocke, Tonie <[email protected]>
Cc: Baric, Toni C <[email protected]>
Subject: RE: FW: Nanoparticle slide from Ralph
Hi Tonie, nice to hear from you. Toni will help find a time for us to talk. Ralph

Subject: Re: FW: Nanoparticle slide from Ralph
Hi Ralph: I have a couple of questions about the SARS-CoV spike glycoproteins you are developing with
respect to the DARPA grant we are collaborating on. Do you have time for a call sometime tomorrow? I
have unfortunately contracted the flu so I am working from home for a few days. I'd be happy to call you if
you can provide me a time and number. Many thanks! -Tonie
On Mon, Mar 5, 2018 at 1:55 PM, Peter Daszak <[email protected]> wrote:

Toni – this is the info from Ralph Baric on the nanoparticle work he’s been involved in…
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4474
@PeterDaszak
@EcoHealthNYC
From: Baric, Ralph S [mailto:[email protected]]

To: Peter Daszak
Cc: Sheahan, Timothy Patrick

Subject: FW: Slide
The microparticle delivery system
From: Ainslie, Kristy

Sent: Wednesday, February 14, 2018 10:14 AM
To: Bachelder, Eric Michael <[email protected]>; Baric, Ralph S
<[email protected]>
Subject: Slide
R-
It was nice chatting with you today. I think we have a lot of mutual interests. I have composed
a slide which I think highlights most of our platforms features. Let me know if you have any
questions or concerns.
Thanks
K
----
Kristy M. Ainslie, PhD
Associate Professor - UNC Eshelman School of Pharmacy
Division Pharmacoengineering & Molecular Pharmaceutics
4211 Marsico Hall - 125 Mason Farm Rd - Chapel Hill, NC 27599
Ph: 919-962-4556
http://ainslielab.web.unc.edu
--
Tonie E. Rocke
Re: Invitation to be an advisor on a proposal we're submitting

Fri 2/2/2018 12:41 PM
Cc: William B. Karesh <[email protected]>; Aleksei Chmura <[email protected]>; Alison Andre
Thanks for the call. Papers as promised. -Tonie
On Fri, Feb 2, 2018 at 12:08 PM, Peter Daszak <[email protected]> wrote:
Can I call in about 10 mins – 1.15 my time, 12.15 yours?
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

Sent: Friday, February 2, 2018 1:05 PM
To: Peter Daszak
Cc: William B. Karesh; Aleksei Chmura; Alison Andre; Luke Hamel
Subject: Re: Invitation to be an advisor on a proposal we're submitting
Hi Peter: Sounds interesting. Yes, I'm available if we can talk fairly soon, say before 1:30 my
time. I am heading out of town this afternoon. -Tonie
On Fri, Feb 2, 2018 at 11:57 AM, Peter Daszak <[email protected]> wrote:

Tonie,
We’re submitting a proposal for work on bat viruses, and need some advice on vaccine delivery to wildlife.
You’re the world expert on this right now, and I wondered if you’d be able to talk briefly today (Friday), anytime
this afternoon.
Also, I’d really like to invite you to be part of the proposal as an advisor to help with vaccine delivery. Could we
talk about this also..
Cheers,
Peter
Peter Daszak
President
EcoHealth Alliance
New York, NY 10001
Tel. +1 212-380-4473
conservation.

Sent: Wednesday, July 19, 2017 1:49 PM
To: Brian Baker
Cc: Peter Daszak; Anthony Ramos; Aleksei Chmura
Subject: Re: Prairie Dog Papers NWHC/EHA Press Release
Hi Brian: Yes, when the articles went online we released a media alert. Here's a link. Feel free to
use whatever you would like. Best regards -Tonie
This release can be found in the USGS Newsroom at: https://www.usgs.gov/news/oral-plague-vaccine-helps-

reduce-outbreaks-prairie-dog-colonies.
On Wed, Jul 19, 2017 at 12:43 PM, Brian Baker <[email protected]> wrote:
Hi Tonie,
Peter recently attended a conference in South Korea where he spoke with Jonathan Sleeman
about your group’s prairie dog papers in EcoHealth, and decided to put together press release to
make a big splash! Since they are already published online, we were going to have the press
release coincide with the publishing of the print-version, accompanied by an intro piece in the
Journal from Dan Salkeld.
Has the NWHC had any press out regarding your papers, or do you have anyone that EHA could
collaborate with? I’ve cc’d Anthony Ramos, our Senior Director of Marketing and Development, as
he will be the lead on this for us.
Thanks!
Brian
—
Brian Baker
New York, NY 10001
1.212.380.4498 (direct)
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
--
Tonie E. Rocke
6006 Schroeder Rd.
Madison, WI 53711
608-270-2451
[email protected]
RESEARCH ARTICLE
Protection of bats (Eptesicus fuscus) against

rabies following topical or oronasal exposure
to a recombinant raccoon poxvirus vaccine
Ben Stading1, James A. Ellison2, William C. Carson2, Panayampalli
Subbian Satheshkumar2, Tonie E. Rocke3‡*, Jorge E. Osorio1‡*
1 Department of Pathobiological Sciences, University of Wisconsin - Madison, Madison, Wisconsin, United
States of America, 2 Poxvirus and Rabies Branch, Division of High-Consequence Pathogens and Pathology,
National Center for Emerging Zoonotic Infectious Diseases, Centers for Disease Control and Prevention,
Atlanta, Georgia, United States of America, 3 US Geological Survey, National Wildlife Health Center,
a1111111111 Madison, Wisconsin, United States of America
a1111111111
a1111111111 ‡ These authors are joint senior authors on this work.
a1111111111 * [email protected] (JEO); [email protected] (TER)
a1111111111
Abstract
Rabies is an ancient neglected tropical disease that causes tens of thousands of human
OPEN ACCESS
deaths and millions of cattle deaths annually. In order to develop a new vaccine for potential
Citation: Stading B, Ellison JA, Carson WC, use in bats, a reservoir of rabies infection for humans and animals alike, an in silico antigen
Satheshkumar PS, Rocke TE, Osorio JE (2017)
designer tool was used to create a mosaic glycoprotein (MoG) gene using available
Protection of bats (Eptesicus fuscus) against rabies
following topical or oronasal exposure to a sequences from the rabies Phylogroup I glycoprotein. This sequence, which represents
recombinant raccoon poxvirus vaccine. PLoS Negl strains more likely to occur in bats, was cloned into raccoonpox virus (RCN) and the efficacy
Trop Dis 11(10): e0005958. https://doi.org/ of this novel RCN-MoG vaccine was compared to RCN-G that expresses the glycoprotein
10.1371/journal.pntd.0005958
gene from CVS-11 rabies or luciferase (RCN-luc, negative control) in mice and big brown
Editor: Charles E Rupprecht, Wistar Institute, bats (Eptesicus fuscus). Mice vaccinated and boosted intradermally with 1 x 107 plaque
UNITED STATES
forming units (PFU) of each RCN-rabies vaccine construct developed neutralizing antibod-
Received: May 25, 2017 ies and survived at significantly higher rates than controls. No significant difference in anti-
Accepted: September 12, 2017 body titers or survival was noted between rabies-vaccinated groups. Bats were vaccinated
Published: October 4, 2017 either oronasally (RCN-G, RCN-MoG) with 5x107 PFU or by topical application in glycerin
jelly (RCN-MoG, dose 2x108 PFU), boosted (same dose and route) at 46 days post vaccina-
Copyright: This is an open access article, free of all
copyright, and may be freely reproduced, tion (dpv), and then challenged with wild-type big brown variant RABV at 65 dpv. Prior to
distributed, transmitted, modified, built upon, or challenge, 90% of RCN-G and 75% of RCN-MoG oronasally vaccinated bats had detectable
otherwise used by anyone for any lawful purpose. levels of serum rabies neutralizing antibodies. Bats from the RCN-luc and topically vacci-
The work is made available under the Creative
nated RCN-MoG groups did not have measurable antibody responses. The RCN-rabies
Commons CC0 public domain dedication.
constructs were highly protective and not significantly different from each other. RCN-MoG
Data Availability Statement: All relevant data are
provided 100% protection (n = 9) when delivered oronasally and 83% protection (n = 6)
within the paper and its Supporting Information
Files. when delivered topically; protection provided by the RCN-G construct was 70% (n = 10). All
rabies-vaccinated bats survived at a significantly (P 0.02) higher rate than control bats
Funding: This work was supported by the National
Institutes of Health Ruth L. Kirschstein National (12%; n = 8). We have demonstrated the efficacy of a novel, in silico designed rabies MoG
Research Service Award Institutional Training antigen that conferred protection from rabies challenge in mice and big brown bats in labora-
Grant T32 RR023916 from the National Center for
tory studies. With further development, topical or oronasal administration of the RCN-MoG
Research Resources and the United States
Geological Survey. The funders had no role in
PLOS Neglected Tropical Diseases | https://doi.org/10.1371/journal.pntd.0005958 October 4, 2017 1 / 19

Recombinant raccoon poxvirus vaccines protect bats against rabies
study design, data collection and analysis, decision vaccine could potentially mitigate rabies in wild bat populations, reducing spillover of this
to publish, or preparation of the manuscript. deadly disease into humans, domestic mammals, and other wildlife.
Competing interests: The authors have declared
that no competing interests exist.
Author summary
Rabies remains a significant and costly zoonotic disease worldwide. While control of
canine rabies can significantly diminish the threat to human health, spillover of rabies and
related lyssaviruses from bats into terrestrial animals and humans continues to be an
important issue. Here we describe the development of a novel rabies vaccine, using rac-
coonpox virus (RCN) as a viral vector, and a computer designed rabies virus mosaic anti-
gen. We demonstrate that this new vaccine leads to protection against experimental
challenge in wild caught big brown bats when administered oronasally or topically. This
technology could be adapted to target other bat species and also be directly applicable
toward control of vampire-bat associated rabies in Mexico and Central and South
America.
Introduction
Rabies is a fatal viral zoonotic disease known to humans for nearly four millennia that contin-
ues to cause significant public health concern with over 50,000 human deaths every year [1].
Fortunately, over 15 million people receive post-exposure prophylaxis for rabies exposure,
which effectively prevents rabies if administered promptly [2]. In Mexico and Central and
South America, rabies transmitted by vampire bats is a tremendous public health and eco-
nomic issue, as it threatens not only the people in these areas, but also an at-risk population of
more than 70 million head of cattle [3–6]. Vampire bats were thought to have caused cattle
losses in Latin America worth more than $40 million US in 1983, and again in 1984 [7], and
these losses, coupled with the cost of measures to prevent bovine rabies, are a significant eco-
nomic burden.
Rabies virus (RABV, Family: Rhabdoviridae, Genus: Lyssavirus) has adapted to numerous
mammalian reservoirs that maintain transmission, typically by bite, and as a result has evolved
into specific lineages and variants. Bats are considered the primary evolutionary host of RABV
[8] and harbor a diversity of other lyssaviruses, all of which cause rabies disease, with non-
RABV lyssaviruses occurring in the Old World and Australia [9,10]. Lyssaviruses are divided
into distinct phylogroups based on serological analysis and genome sequence [11]. While lys-
saviruses within phylogroup I (PG-I) are considered cross-protective immunologically, epide-
miologically important antigenic variation between vaccine strains and wild-type rabies
viruses have been observed [12] and variable vaccine efficacy has been reported against some
PG-I viruses[13]. In addition, numerous antigenic variants of rabies have been found in bats
in the Americas [14]. In Brazil, nine different variants have been reported; in Mexico, at least
7, and antigenic variants differ between bats species and geographic locations.
Rabies in terrestrial wild mammals can be successfully controlled, and in some areas, elimi-
nated through the use of oral rabies vaccination (ORV) campaigns [15–17], but similar mass
vaccination has not yet been attempted for wild bats. Recombinant viral-vectored vaccines
have been developed to make use of the antigenicity of the RABV surface glycoprotein (G).
The main benefit of these viral-vectored constructs is their ability to induce immunity when
given orally, which makes them effective and efficient for vaccinating wildlife. A vaccinia virus

construct expressing the G protein (or V-RG) has been used extensively for wild carnivores,
but this construct can cause vaccinia infection in humans that are inadvertently exposed to the
vaccine, especially in immuno-compromised individuals [18–20]. More recently a similar vac-
cine has been developed and licensed using a human adenovirus vector (ONRAB) [21], but to
our knowledge, that vector (and vaccine) has not yet been tested in bats.
Our previous study showed that RCN is a suitable vaccine vector for bats; it safely expressed
exogenous antigens and induced significant immune responses following mucosal exposure of
Tadarida brasiliensis bats [22]. The safety profile of the RCN vector has been evaluated previ-
ously [23–25], and a RCN-based sylvatic plague vaccine is under evaluation in field trials in
prairie dog populations [26]. In this study, we used G sequences from 664 RABV to design a
novel PG-I lyssavirus mosaic glycoprotein gene (MoG) that could potentially provide broader
antigenic coverage for the variety of rabies strains circulating in bats, and perhaps a more effec-
tive vaccine. We successfully expressed MoG in the RCN vaccine vector and then evaluated its
efficacy in preventing rabies mortality in mice and big brown bats (Eptesicus fuscus) in labora-
tory challenge studies, comparing it to a previously reported RCN-G construct that expresses
the CVS-11 glycoprotein [27]. Our results suggest that MoG is a successful rabies antigen as
both mucosal and topical application of RCN-MoG protected against high-dose rabies virus
challenge.
Methods
Cells and viruses
Recombinant viruses were generated and amplified on cell monolayers of rat embryonic fibro-
blasts (Rat-2, ATCC #CRL-1764) or African Green monkey (Chlorocebus sabaeus) kidney
epithelial cells (BSC40, ATCC #CRL-2761, or Vero, ATCC #CCL-18). Cell cultures were main-
tained at 37˚C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) or Opti-MEM
(Life technologies, Madison, WI 53719), supplemented with 2–5% fetal bovine serum (FBS).
Recombinant RCN-G [3] and wild-type RCN (RCN-wt) viruses were provided by the Centers
for Disease Control (CDC), Atlanta, GA, while the RCN-luc strain used in this study was pre-
viously described [28].
The RABV CVS-11 (GenBank accession no AB069973) strain used in mouse challenge
studies was provided by the Wisconsin State Laboratory of Hygiene and was amplified on
baby hamster kidney cells (BHK-21, ATCC #CCL-10) in DMEM as described elsewhere [29].
The virus was titered by infecting BHK-21 cells in 96-well plates with serial dilutions in qua-
druplicate. After 72 hours, the cells were fixed with 80% acetone and subsequently probed with
a FITC-conjugated rabies antibody (LIGHT DIAGNOSTICS Rabies DFA Reagent 5100, Milli-
pore, Billerica, Massachusetts, USA) to determine focus forming unit (FFU) titer.
The wild type big brown bat variant RABV used for bat challenge has been previously
described (GenBank #JQ685920.1); it was isolated from the salivary glands of a naturally
infected big brown bat in Pennsylvania during 2006 and subsequently passaged once through
murine neuroblastoma cell culture [30]. The virus was provided under a cooperative research
and development agreement with the CDC (A06-3684).
Design and construction of recombinant RCN-MoG virus

Design and in silico assessment of mosaic rabies glycoprotein. All available sequences
for PG-I lyssaviruses (rabies virus, Duvenhage virus, European bat lyssavirus -1 and -2, Aravan
virus, Australian bat lyssavirus, Khujand virus, Irkut virus, and Bokeloh bat lyssavirus)
were obtained from the National Center for Biotechnology Information (NCBI) and were
screened to exclude incomplete and redundant sequences. As a result, a total number of 664

glycoprotein sequences were submitted to the Mosaic Vaccine Designer tool webpage (http://
www.hiv.lanl.gov/content/sequence/MOSAIC/makeVaccine.html) to generate a mosaic pro-
tein sequence as previously described [31]. Mosaic proteins are assembled in silico from frag-
ments of the natural proteins using a genetic algorithm in a way that prevents formation of
new epitopes. The program chooses the most frequent epitopes and combines them to form a
synthetic antigen, unlike consensus sequences which pick the most frequent amino acid at
each position. The parameter options were set as follows: 1) the cocktail size was set to 1 to
generate a single peptide that represented all input glycoproteins, 2) the rare threshold was set
to 3 for optimal value, and 3) the epitope length parameter was set to an amino acid length of
12-mer in an attempt to match the length of natural T helper cell epitopes. The resulting
mosaic lyssavirus glycoprotein was back-translated, codon optimized for expression in vac-
cinia virus, and then commercially synthesized (GenScript USA Inc., Piscataway, NJ, USA).
Sequences, along with the optimal mosaic vaccine candidate (MoG), were aligned with
default settings in muscle v3.8.31 [32] with subsequent manual correction and curation in
Mesquite [33]. A maximum likelihood tree was inferred using IQ-TREE v1.4.2 [34] employing
the best-fit model of molecular evolution as determined by the automatic model selection pro-
cedure (data available upon request). Statistical support values were determined using the
ultrafast bootstrap algorithm (n = 1000; [35]) and SH-like approximate likelihood ratio tests
(n = 1000; [36]).
Construction of recombinant RCN viruses. To aid in the selection of recombinant RCN
constructs, we first created an RCN virus with the thymidine kinase (tk) gene knocked-out
and replaced with green fluorescent protein (GFP). Removal of the tk gene results in attenua-
tion of poxviruses without loss of immunogenicity [37], and also serves as a good insertion site
for heterologous genes. The RCN-tk—GFP construct was generated by homologous recombi-
nation as described elsewhere[38]. Briefly, Vero cells were co-transfected with RCN-wt, at a
multiplicity of infection (MOI) of 0.05 PFU/cell, and the pTK-GFP plasmid using the FuGENE
HD transfection reagent (Promega Corp., Madison, WI, USA). GFP-positive plaques were
then selected through 5 rounds of viral purification.
For creating RCN-MoG, the MoG sequence was cloned into the multiple-cloning site
(MCS) in the pTK vector under control of the SE/L promoter, and then positive clones were
selected. The RCN-MoG construct was then generated by co-transfecting the pTK-SE/L-MoG
plasmid and RCN-tk—GFP in BSC-40 cells as described above.
An additional construct was made that utilized an internal ribosomal entry site (IRES) for
the expression of the MoG antigen, as it has been found to enhance expression in other con-
structs [39]. The RCN-IRES-MoG was constructed using the same methods as above by creat-
ing a pTK-SE/L-IRES-MoG.
In vitro expression of RCN-MoG construct. Immunofluorescence and western blot anal-
ysis were used to confirm the expression of the artificial MoG antigen by the RCN construct.
For immunofluorescence, 6-well plates of Vero cells were infected with RCN-G, RCN-MoG,
RCN-IRES-MoG, or RCN-GFP (as a negative control) at an MOI of 1.0 PFU/cell. After 24
hours (h), the plates were fixed with 4% formaldehyde for 10 minutes (min), washed with PBS,
then permeabilized with a PBS/0.2%Triton-X-100/0.2% BSA solution for 10 min on ice. The
plates were then rinsed and blocked with a PBS/0.02% Triton-X-100/3% BSA solution for 30
min. After blocking, the plates were stained with a 1:1000 dilution of mouse anti-rabies Ab
(Rab-50, Invitrogen, Thermo Fisher Scientific Inc., Fitchburg, WI, USA) in blocking solution
overnight at 4˚C. Primary Ab was then removed, and the wells were washed four times, 10
min each, with a PBS/0.02% Triton-X-100/1.5% BSA washing solution. A secondary Ab solu-
tion with a 1:2000 dilution of Alexa Fluor 594 tagged goat anti-mouse Ab (Invitrogen, Thermo
Fisher Scientific Inc.) was then added to the wells and left at room temperature for 2 h,

followed by an additional four rounds of 10 min washes with the washing solution. Wells were
then observed under a fluorescence microscope (excitation wavelength: 590 nm, emission
wavelength: 617 nm; AMG EVOSfl, Thermo Fisher Scientific Inc.).
For western blot analysis, Vero cells were plated into six-well plates and infected at an MOI
of 10 PFU/cell with RCN-MoG, RCN-IRES-MoG, RCN-G, or RCN-luc as a negative control.
Cells and supernatant were collected 48 h post inoculation and lysed with Laemmli sample
buffer (Bio-Rad, Hercules, CA, USA) and heated to 95˚C for 5 min. Protein was fractionated
via SDS-PAGE and transferred onto a nitrocellulose membrane. Pooled serum from rabies-
vaccinated mice (IMRAB3, Merial, Athens, GA, USA) was used as the primary antibody for
rabies glycoprotein detection. 3,3’,5,5’-Tetramethylbenzidine (TMB) was used to visualize the
glycoprotein in the membranes.
Animal studies
Ethics statement. This study was carried out in strict accordance with recommendations
set forth in the National Institutes of Health Guide for the Care and Use of Laboratory Animals
[40]. All animals and animal facilities were under the control of the School of Veterinary Medi-
cine with oversight from the University of Wisconsin (UW) Research Animal Resource Cen-
ter. The protocols were approved by the UW Animal Care and Use Committee (approval #’s
V01605, V005278), and studies were conducted first in mice, followed by bats.
All animal studies involving rabies virus were conducted under ABSL-2+ conditions in lim-
ited access facilities; all individuals involved in the study had documented evidence of pre-
existing rabies prophylaxis through recent (<2 years) completion of the full recommended
vaccination schedule or confirmation of sufficient circulating rabies neutralizing antibody
titers (0.5 IU/mL).
Mouse challenge study. A/J mice (4 week old) were purchased from Jackson Laboratory
(JAX, Sacramento, CA, USA) and housed at the UW Charmany Instructional Facility accord-
ing to UW husbandry protocols. After a 1 week acclimation period, the mice were separated
into 4 treatment groups of n = 16 mice each. Each treatment group was vaccinated with
RCN-MoG, RCN-IRES-MoG, RCN-G, or RCN-luc via intradermal injection of 1x 107 PFU’s
given in 30 μl in the hind limb footpad. Mice were then bled via maxillary lance every 15 days
until the rabies challenge, and serum was stored at -80˚C. At 75 dpv, mice were boosted with
the same vaccine and the same route as previously described. At 208 dpv (133 days post boost),
six mice from each group were challenged with 25 x LD50 of CVS-11 RABV in 30μl via the
intracerebral (IC) route. Mice were then weighed daily and euthanized if they had lost more
than 20% of their maximum body weight, or if clinical signs of rabies were evident. All car-
casses were frozen at -80˚C for diagnostic assessment. The study was ended 14 days after
challenge.
Bat challenge study. Adult E. fuscus bats (N = 39) were wild-caught using mist nets in Lee
county, Alabama, by Dr. Matthew Grilliot of Troy University under collection permit #8565
provided by the Alabama Department of Conservation and Natural Resources. After acclima-
tion to captive conditions for 4 weeks, the bats were transferred to UW Charmany Instruc-
tional facility, where all vaccine studies were conducted. Upon transfer, bats were maintained
in screen flight cages (Reptarium, Apogee, Dallas, TX, USA) for a quarantine period of 30
days. During this time blood samples were taken for rabies serology as described below (all
bats were negative on intake), and bats were treated topically for parasites with selamectin
(Zoetis, Florham Park, NJ, USA). Electronic microchip identification units (Avid Identifica-
tion Systems, Inc., Folsom, Louisiana, USA) were inserted into each animal, between the scap-
ulae, via subcutaneous injection. Bats were maintained on mealworms (Tenebrio molitor),

supplemented with vitamins and an omega fatty acids mixture, and water was available ad libi-
tum. They were individually weighed at least once per week.
Four bats failed to adapt to captivity and died during quarantine. Two additional bats that
continued to lose weight after the quarantine period died 28 days after initial vaccination, and
were subsequently tested and found to be rabies negative. The remaining 33 bats formed 4
treatment groups. Three groups of females received 5x107 PFU of RCN-MoG (n = 9), RCN-G
(n = 10), or RCN-luc (n = 8) via the oronasal (ON) route, with 50μl given orally and 10μl
deposited in each nostril (70 μl total volume). One group of males (n = 6) received 2x108 PFU
of RCN-MoG mixed with laboratory grade glycerin jelly (Carolina Biological Supply, Burling-
ton, NC, USA) to a final volume of 250μl. This aliquot was distributed equally in the fur of the
ventral lateral thorax (near the wing membrane). All bats were anesthetized for inoculation for
~5 minutes and then returned to their cages for recovery. Bats received a booster immuniza-
tion (same dose and route) at 46 days post initial immunization. All bats were bled via the
interfemoral vein on days 0, 21, and 65 dpv. At 65 dpv, bats were challenged with 1x105.5
MICLD50/ml of RABV in 100μl delivered bilaterally into the masseter muscles (50μl each). Fol-
lowing challenge, all bats were monitored daily for evidence of disease and weighed twice a
week. Any bats that lost 20% of their body weight within 7 days or that had evidence of clini-
cal rabies were euthanized under anesthesia by cardiac exsanguination, followed by adminis-
tration of sodium pentobarbital (Beuthenasia-D, Intervet/Merck Animal Health, Madison, NJ,
USA). Carcasses were kept at -80˚C until analysis. The study was ended 42 days post challenge,
after a 14-day period with no deaths.
Rabies diagnosis and serology. Serum rabies neutralizing antibody (RVNA) titers were
determined using a microneutralization test that is based on the rapid fluorescent focus inhibi-
tion test [40], with some modifications [41]. To determine RVNA titer of individual bats and
mice, ten microscopic fields per well on a 4-well slide were scored for presence/absence of at
least one fluorescent focus. Endpoint titers were calculated by the Reed-Muench method and
were converted to international units (IU/mL) by comparison to a standard rabies immune
globulin (SRIG) control containing 2 IU/mL[41]. For the objective of this study, positive
RVNA titers (0.06 IU/mL) were defined by at least 50% neutralization of the RABV challenge
virus dose (50 focus forming doses) at a 1:10 dilution. Final titers less than 0.06 IU/mL were
considered negative for the presence of RVNA for the purposes of this investigation.
All mouse and bat carcasses were analyzed for evidence of rabies disease. Brain impressions
were fixed in acetone at -20˚C, and RABV antigens were detected by the direct fluorescent
antibody test (dFA), using fluorescein isothiocyanate (FITC)-labelled monoclonal antibody
(mAb) conjugate (Fujirebio Diagnostics, Inc., Malvern, PA, USA) as described [42].
Statistical analysis. One-way analysis of variance (ANOVA) was used to analyze neutraliz-
ing antibody titers between groups of animals. Wilcoxon matched pairs T-tests were used to
compare group body weights over time. Kaplan Meier survival analyses were performed to com-
pare survival between vaccinates and controls. Probability values of 0.05 were considered signifi-
cant. GraphPad Prism (v6) software (La Jolla, CA, USA) was used for all statistical analyses.
Results
Characterization of mosaic constructs
The antigenic coverage of the designed MoG sequence (S1) achieves 61% exact matches of
putative T cell epitopes with an epitope length set to 12 amino acids (Fig 1A). This improves to
84% matches if 1 of those 12aa is allowed to be a mismatch (off-by-1) and 92% for off-by-2.
This is similar to the results for previously described, effective mosaic proteins[43,44]. If the
nominal epitope length is set to 9 amino acids, the coverage increases to 67% exact matches;

Fig 1. Antigenic coverage of putative T cell epitopes by the designed mosaic phylogroup I lyssavirus glycoprotein. A) Antigenic coverage with
the epitope length set to 12 amino acids. B) Antigenic coverage with the epitope length set to 9 amino acids. C) Comparison of 12-mer epitope coverage
between the mosaic sequence and all input sequences.
https://doi.org/10.1371/journal.pntd.0005958.g001
87% off by 1; 94% off by 2 (Fig 1B). Comparing epitope coverage of the MoG to the other PG-I
lyssaviruses used for its design, it is better than any single "wild type" virus (Fig 1C). A compar-
ison of amino acid sequences of four major and one minor PG-I antigenic sites reveal that
MoG retains most RABV sequences (Table 1).
Immunofluorescence assays of cultured cells infected with RCN-MoG, RCN-IRES-MoG,
and RCN-G confirmed presence of rabies virus antigen when compared to the RCN-GFP neg-
ative control (Fig 2A). Western blot analysis revealed bands visible at ~60kDa in the pellet of
the RCN-MoG, RCN-IRES-MoG, and RCN-G infected cells, and absent in the negative con-
trol, demonstrating expression of an antigenic glycoprotein (Fig 2B). The RCN-IRES-MoG
seems to be slightly smaller and have a secondary band, which may indicate variation in glyco-
sylation [46] or production of truncated forms of the MoG.

Table 1. Amino acid sequence of major phylogroup I lyssavirus antigenic sites based on Evans et al. 2012[45], including mosaic G. The underlined
residues are those that differ from the RABV sequence, given in the top row.
Virus Site IIb Site IIa Site I Site IV Site III Site ‘a’
(34–42) (198–200) (226–231) (263–264) (330–338) (342–343)
RABV GCTNLSEFS KRA KLCGVL FH KSVRTWNEI KG
ABLV GCTSLSGFS KKA KLCGIS FN KSVRTWDEI KG
ARAV GCTNLSGFT KKA KLCGVM FH KSVREWTEV KG
BBLV GCTTLTVFS KKA KLCGVS FH KSIRQWTEI KG
DUVV GCTTLTPFS KKA RLCGIS FH KSVREWKEI KG
EBLV-1 GCTTLTPFS KKA RLCGVP FH KSVREWKEV KG
EBLV-2 GCTTLTVFS KKA KLCGIS FH KSIREWTDV KG
IRKV GCTTLTAFN KKA KLCGMA DR KSIREWKEI KG
KHUV GCTTLSGFT KKA KLCGVS FH KSIREWSEI KG
MoG GCTNLSGFS KRA KLCGVL FH KSVRTWNEI KG
https://doi.org/10.1371/journal.pntd.0005958.t001
Immunogenicity of RCN-vectored MoG vaccines and survival upon

challenge in mice
Serum samples from mice (n = 16 per group) were tested by the RFFIT assay (at CDC). All
RCN-rabies constructs induced significant antibody titers when measured at 45 dpv (Fig 3).
No significant differences in antibody levels were observed between groups (P = 0.399).
Following rabies virus challenge, one mouse each from the RCN-G and RCN-luc groups
were euthanized due to loss of 20% of their body weight within 3 days post challenge (dpc;
Fig 2. In vitro assessment of rabies glycoprotein expression in novel RCN-vectored rabies vaccines. A) Immunofluorescence of RCN expressing
in silico designed lyssavirus phylogroup I glycoprotein (MoG) with and without an internal ribosomal entry site (IRES). A previously described RCN
construct expressing the glycoprotein from rabies CVS-11 (RCN-G) was used as a positive control, and RCN expressing green fluorescent protein (GFP)
was used as a negative control. B) Western blot of supernatant (Sup.) or pellet collected from Vero cells infected with RCN-MoG, RCN-IRES-MoG,
RCN-G (positive control) or RCN-luc (negative control), The rabies glycoprotein is expected to be around 62 kDa.

Fig 3. Rabies neutralizing antibody levels in mice following vaccination with various RCN-vectored
rabies vaccines. Serum titers of rabies neutralizing antibodies (IU/ml) in mice 45 days post vaccination with
RCN-MoG, RCN-IRES-MoG, or RCN-G. No significant differences were detected between groups
(P = 0.399).
Table 2). Two other mice, one in each of the RCN-G and RCN-IRES-MoG groups were found
to have lost 20% of their body weight by14 dpc, the last day of the trial. All four of these
mice were rabies negative by the dFA test (Table 2) and were censored in the survival analysis.
All other mice that were euthanized with signs of disease during the challenge were positive by
dFA. All RCN-rabies treatment groups had statistically higher survival than the RCN-luc nega-
tive controls (P<0.03). All mice survived to day 14 in the RCN-MoG group compared to 50%
(3/6) in the RCN-IRES-MoG group, 80% (4/5) in the RCN-G group and 0/5 in the RCN-luc
group. Although no significant difference (P >0.05) in survival was detected between groups
that received the three rabies vaccines (Fig 4), RCN-IRES-MoG was not included in further
studies in bats.
Immunogenicity of RCN-vectored vaccines and survival upon challenge

in bats
After inoculation with RCN-vectored vaccines, no signs of clinical disease were evident in any
of the bats. Topically vaccinated bats also showed no evidence of adverse effects due to the
glycerin jelly application or the vaccine virus. No significant change in weight was evident in
the groups after initial vaccination or boost (P>0.05, S1 Fig).
After initial vaccination, 2/9 bats from the RCN-MoG ON group had titers between 0.1–0.4
IU/ml and 4/10 bats from the RCN-G ON group responded with titers >0.5 IU/ml, while no

Table 2. Survival and % change in weight of vaccinated mice prior to and following challenge with rabies virus.
Group Mouse ID Day of death or euthanasia % weight change Challenge outcome dFA rabies diagnosis
RCN-MOG 1 1.04 Survived Negative
2 1.02 Survived Negative
RCN-IRES MOG 1 14 0.79 Died Positive
3 13 0.79 Died Positive
6 14 0.77 Censored Negative
RCN-G 1 8 0.77 Died Positive
RCN-luc 9 9 0.80 Died Positive
detectable antibodies were found in any of the bats from the RCN-luc group or the RCN-MoG
topically vaccinated bats (Table 3, Fig 5). After boost, 2/8 bats tested in the RCN-MoG ON
group had titers > 0.5 IU/ml, and an additional 4 bats had titers of 0.1–0.4. In the RCN-G ON
group, 6/10 bats had RVNA levels 0.5 IU/ml, 3 had levels of 0.1–0.4, and one bat had no
detectable RVNA. Even though more bats that received RCN-G ON had RVNA titers com-
pared to RCN-MoG ON, no significant difference in titer was detected between these groups
(P = 0.22). Bats in the RCN-luc and RCN-MoG topically vaccinated groups had no detectable
neutralizing antibodies prior to challenge.
After challenge with rabies virus, all vaccine treatment groups had significantly greater
(P 0.02) rates of survival than the negative control (RCN-luc) group (Fig 6). The first con-
firmed rabies deaths occurred at 12 dpc and the final at 27 dpc. The majority of mortalities
occurred between 12 and 19 dpc. All bats administered RCN-MoG by the ON route survived
challenge, although interestingly only 2/8 had pre-challenge RVNA levels above 0.5 IU/ml
(Table 2, Fig 5). Likewise, 5/6 (83%) of the bats that received RCN-MoG topically survived
challenge, despite none having seroconverted. Comparatively, 7/10 of the RCN-G ON vacci-
nated group survived challenge, including two bats with antibody titers below 0.5 IU/ml. Inter-
estingly, one bat in this group with a titer of 0.5 IU/ml succumbed to rabies challenge and 1/8
bats immunized with RCN-luc survived challenge.
No clinical signs were observed in any of the surviving bats. Direct FA confirmed rabies
diagnoses consistent with our survival analysis (Table 2). All bats that were found dead or
euthanized were rabies positive, while all remaining bats at the study end were negative.

Fig 4. Survival after rabies challenge in mice. Efficacies of raccoon poxvirus (RCN) vectored rabies
vaccines in mice after intracerebral challenge with the CVS-11 strain of rabies virus. Every mouse (6/6) in the
RCN-MoG group survived challenge to day 14 compared to 3 of 6 in the RCN-IRES-MoG group, and 4 of 5 in
the RCN-G group. All (5/5) negative controls (RCN-luc) succumbed by day 9 post challenge. A chart of p-
values associated with the survival curve is also provided. Survival of all vaccinated mice was significantly
higher (P < 0.05) than negative controls, but there was no significant difference (P > 0.05) between vaccine
treated groups.
Discussion
Rabies spillover from wildlife, particularly by vampire bats (Desmodus rotundus), continues to
be an important public health and economic issue in Mexico and Central and Latin America
[17,47], despite using culling of bats as a control measure[48–50]. In this study, we demon-
strated that an in silico designed mosaic lyssavirus PG-I glycoprotein (MoG) is an effective
immunogen against rabies in mice and bats. Furthermore, a recombinant RCN-vectored vac-
cine expressing MoG, delivered by mucosal or topical routes, protected bats against rabies
challenge. While survival did not differ significantly among any of the vaccine treated groups
(P = 0.08), RCN-MoG provided 100% protection in ON immunized bats challenged with a
wild-type big brown bat RABV variant. As in our previous study [22], both RCN vaccine con-
structs were safe; no evidence of morbidity was observed in treated bats. Though these results
are very promising, additional challenge studies with other bat RABV variants, are needed to
assess whether our bioinformatically designed RCN-MoG vaccine is an improvement over
RCN-G.
Currently available rabies vaccines, which are almost entirely developed from lab-adapted
strains (e.g. CVS-11), are considered protective against all PG-I lyssaviruses when given at the
recommended dose and schedule. However, antigenic variation in PG-I strains has been iden-
tified and may lead to inconsistent protection [12,13]. The CVS-11 strain has been passaged
over a thousand times in rabbit and mouse brains and cell culture [51]. One study showed that
5.1 units of antigenic difference exists between CVS-11 and “wild type” RABV strains isolated
from different hosts, equivalent to a more than 10-fold dilution in antibody titer[12]; thus
higher titers are needed for protection. For wildlife consuming variable doses of vaccines via

Table 3. Serological and survival results of vaccinated E. fuscus prior to and following challenge with rabies virus.
Group Bat ID Rabies virus titer VNA (IU/ml) Challenge outcome dFA rabies diagnosis
days post primary inoculation
22 65
RCN-MoG (Oronasal) 1504 0.0 0.1 Survived Negative
1511 0.0 0.1 Survived Negative
1531 0.0 no sample Survived Negative
RCN-MoG (Topical) 1512 0.0 0.0 Survived Negative
1529 0.0 0.0 Died Positive
RCN-G (Oronasal) 1506 13.0 12.2 Survived Negative
RCN-luc (Oronasal) 1501 0.0 0.0 Died Positive
the oral route of delivery, it is important to use the most efficient vaccine, protective at the low-
est titer possible with the fewest doses, as boosts are generally unfeasible. Although bats were
boosted in our initial study to optimize their response, testing of a single dose application will
be critical in future studies.
In an attempt to maximize vaccine efficiency, we designed MoG to be more broadly repre-
sentative of all PG-I lyssavirus glycoproteins. MoG has 93% similarity to the wild-type big
brown bat variant RABV used in the challenge study. The glycoprotein of the CVS-11 strain
has 94.7% consensus amino acid similarity to MoG, but only 90% similarity to the big brown
bat variant RABV. The higher level of similarity between MoG and the challenge strain, as
compared to the CVS-11 G protein, may have resulted in the slightly higher survival of

Fig 5. Rabies virus neutralizing antibodies in bats following oronasal vaccination with RCN-based
rabies vaccine constructs. Serum rabies neutralizing antibody titers at various time-points as determined by
rapid fluorescence focus inhibition test (RFFIT). Day 22 represents levels after initial vaccination, and day 65
represents levels after boost and immediately prior to challenge.
Fig 6. Survival after rabies challenge in E. fuscus bats. Percent survival of E. fuscus bats is shown over
time after experimental infection. Bats were vaccinated oronasally with RCN-MoG, RCN-G, or RCN-luc
(negative control). A fourth group was given RCN-MoG topically in a glycerin jelly vehicle. Vaccinated bats
had significantly greater survival than negative controls (P = 0.002).

RCN-MoG vaccinated bats (survival 9/9) compared to RCN-G vaccinated bats (survival 7/10),
although the difference observed between these small groups was not statistically significant.
Mosaic proteins are synthetically designed to represent all potential epitopes from related
input sequences and have been shown to induce greater cross-reactivity than consensus
sequences [52]. Thus, we expected the immune response elicited by vaccination with MoG to
be more efficient at neutralizing naturally circulating RABV than current antigens, however
this was not detected by RFFIT (Table 2). Interestingly, RVNA did not correlate directly with
survival. Specifically, topically vaccinated bats, as well as some bats vaccinated ON with
RCN-MoG, did not seroconvert prior to challenge, yet survived. While it is generally believed
that RVNA are needed for protection, results similar to ours have been reported elsewhere
[53–56]. In our case, it is possible that the RCN-MoG vaccine may be better at priming TH
cells or activating other adaptive cellular immune responses necessary for clearance of RABV
[57–61]. The use of viral vaccine vectors usually leads to a Th1, CTL response directed at the
target antigen. The earlier production of antigen due to the S E/L promoter also leads to
an increased CTL response[62]. It is possible that CD8 cells, elicited by vaccination with
RCN-MoG, lysed infected cells shortly after challenge, resulting in protection in the absence of
detectable neutralizing antibody responses. The enhanced inflammatory response induced by
activated CD8 T cells may also have contributed to antibody-mediated clearance, as has been
previously suggested[60]. In follow-up studies, it would be useful to assess the cellular immune
response to vaccination.
Alternatively, it is possible that RVNA induced by RCN-MoG were not properly recognized
due to the use of CVS-11 strain in the RFFIT analysis. Thus, it might be necessary to develop a
RIFFT assay with MoG as the substrate antigen and to compare the neutralizing capacity of
antibodies induced by both RCN-MoG and RCN-G constructs to various divergent
lyssaviruses.
The studies presented here are especially relevant for vampire bats. So far, most efforts to
reduce their threat have centered on culling through the application of anticoagulants to indi-
vidual bats that are released to poison additional bats through contact and commensal groom-
ing. Vampire bats in particular are known to practice self and social grooming at a very high
rate [63], so this method of application is very effective. Unfortunately, culling of bats has
largely failed to reduce the incidence of bovine rabies and may be counterproductive for dis-
ease control [49,50,64]. Also, this method frequently leads to indiscriminate killing of other
bat species [3], which are key members of their ecosystems. Instead, by immunizing certain
vampire bat populations against rabies with sufficient coverage to create herd immunity, it
may be possible to reduce rabies transmission, thereby lowering the risk of exposure to
humans and livestock.
Previous laboratory studies have demonstrated successful topical vaccination of Desmodus
using a vaccinia virus expressing the glycoprotein from the ERA strain of rabies (VR-G)
[53,65,66]. However, the vaccinia vector can infect humans, especially immunocompromised
individuals [18,67], and oral delivery of this vaccine to vampire bats induced lower levels of
rabies neutralizing antibodies than oral delivery of RCN-G to E. fuscus in this study and T. bra-
siliensis in our previous study [22]. With further testing in vampire bats, RCN-MoG may offer
a safer, more effective alternative that could be delivered topically via glycerin jelly or another
medium. For a topical vaccine to be practical and effective, it must induce significant immu-
nity after limited oral exposure and must be applied in an appropriate medium that maintains
vaccine titer for extended periods in ambient conditions and attaches firmly to the fur of the
target species. Although glycerin jelly was effective in our initial studies, more work is required
to determine its utility as a delivery medium for free-ranging bats. An alternative to topical

application of vaccine may be aerosolized application to roost sites in caves, but that remains
to be tested.
Finally, this approach could be adapted for other species or groups of bats and for other
important diseases, such as white nose syndrome, a fungal disease killing millions of bats in
North America [68]. While much effort has gone into identifying and characterizing the path-
ogens carried by bats, little has been done to prevent disease in bat hosts. Successful vaccina-
tion of bats against rabies could potentially lead to the development of other bat-targeted
vaccines.
Supporting information
S1 Fig. Bat weights over time. Bat weights (in g with SD) are shown over time (each date as a
time-point), with vertical bars denoting the date of initial vaccination (1/25), boost dose
(3/10), and rabies challenge (3/29). No significant weight loss is appreciable after vaccination
with RCN constructs.
(TIFF)
Acknowledgments
We sincerely thank all those who helped in making this project possible, including Matt Gril-
liot of Troy University for providing the bats used in this study and Tavis Anderson for provid-
ing expertise in the use of the mosaic antigen generator. We would also like to thank Claudia
Hirsch, Ray Sommers, Andy Pressnell, and other members of the Charmany Instructional
facility for their assistance and patience in housing captive bats. Also Jennifer Brunner, Katrien
Werner, and the other employees at the US Geological Survey, National Wildlife Health Cen-
ter that helped with bat care and logistics. Special thanks given to Elizabeth Falendysz and
Rebekah Franklin for assistance with veterinary care and Kevin Karem for reviewing early
drafts of the manuscript. The findings and conclusions in this report are those of the authors
and do not necessarily represent the official position of the Centers for Disease Control and
Prevention. The use of trade, product, or firm names does not imply endorsement by the U.S.
Government.
Author Contributions
Conceptualization: Ben Stading, Tonie E. Rocke, Jorge E. Osorio.
Data curation: Ben Stading, Tonie E. Rocke.
Formal analysis: Ben Stading, Tonie E. Rocke.
Funding acquisition: Tonie E. Rocke, Jorge E. Osorio.
Investigation: Ben Stading, James A. Ellison, William C. Carson.
Methodology: Ben Stading, James A. Ellison, William C. Carson, Panayampalli Subbian
Satheshkumar, Tonie E. Rocke, Jorge E. Osorio.
Project administration: Tonie E. Rocke, Jorge E. Osorio.
Resources: Tonie E. Rocke, Jorge E. Osorio.
Supervision: Jorge E. Osorio.
Visualization: Ben Stading, Tonie E. Rocke.
Writing – original draft: Ben Stading, Tonie E. Rocke, Jorge E. Osorio.

Writing – review & editing: Ben Stading, James A. Ellison, Panayampalli Subbian Satheshku-
mar, Tonie E. Rocke, Jorge E. Osorio.
References
1. Wunner WWH, Conzelmann K-K. Rabies Virus. In: Jackson AC, editor. Rabies: Scientific Basis of the
Disease and its Management. Third. Oxford: Elsevier; 2013. pp. 17–49.
2. WHO. Rabies: fact sheet [Internet]. http://www.who.int/mediacentre/factsheets/fs099/en/: WHO; 2016.
http://www.who.int/mediacentre/factsheets/fs099/en/
3. Johnson N, Aréchiga-Ceballos N, Aguilar-Setien A. Vampire Bat Rabies: Ecology, Epidemiology and
Control. Viruses. 2014. pp. 1911–1928. https://doi.org/10.3390/v6051911 PMID: 24784570
4. Ellison JA, Gilbert AT, Recuenco S, Moran D, Alvarez DA, Kuzmina N, et al. Bat Rabies in Guatemala.
PLoS Negl Trop Dis. 2014; 8. https://doi.org/10.1371/journal.pntd.0003070 PMID: 25080103
5. Lee DN, Papeş M, Van den Bussche RA. Present and potential future distribution of common vampire
bats in the Americas and the associated risk to cattle. PLoS One. 2012; 7: e42466. https://doi.org/10.
1371/journal.pone.0042466 PMID: 22900023
6. Anderson A, Shwiff S, Gebhardt K, Ramı́rez AJ, Kohler D, Lecuona L. Economic evaluation of vampire
bat (Desmodus rotundus) rabies prevention in Mexico. Transbound Emerg Dis. 2014; 61: 140–146.
https://doi.org/10.1111/tbed.12007 PMID: 22984914
7. Acha P, Alba A. Economic losses due to Desmodus rotundus. In: Greenhall A, Schmidt U, editors. Natu-
ral history of vampire bats. Florida: CRC Press; 1988. pp. 207–214.
8. Badrane H, Tordo N. Host switching in Lyssavirus history from the Chiroptera to the Carnivora orders. J
Virol. 2001; 75: 8096–8104. Available: http://www.ncbi.nlm.nih.gov/pubmed/11483755 https://doi.org/
10.1128/JVI.75.17.8096-8104.2001 PMID: 11483755
9. Banyard AC, Evans JS, Luo TR, Fooks AR. Lyssaviruses and bats: emergence and zoonotic threat.
Viruses. 2014/08/06. 2014; 6: 2974–2990. https://doi.org/10.3390/v6082974 PMID: 25093425
10. Calisher CH, Ellison JA. The other rabies viruses: The emergence and importance of lyssaviruses from
bats and other vertebrates. Travel Med Infect Dis. 2012; 10: 69–79. https://doi.org/10.1016/j.tmaid.
2012.01.003 PMID: 22386761
11. Badrane H, Bahloul C, Perrin P, Tordo N. Evidence of two Lyssavirus phylogroups with distinct pathoge-
nicity and immunogenicity. J Virol. 2001; 75: 3268–3276. https://doi.org/10.1128/JVI.75.7.3268-3276.
2001 PMID: 11238853
12. Horton DL, McElhinney LM, Marston DA, Wood JLN, Russell CA, Lewis N, et al. Quantifying Antigenic
Relationships among the Lyssaviruses. J Virol. 2010; 84: 11841–11848. https://doi.org/10.1128/JVI.
01153-10 PMID: 20826698
13. Hanlon CA, Kuzmin I V, Blanton JD, Weldon WC, Manangan JS, Rupprecht CE. Efficacy of rabies bio-
logics against new lyssaviruses from Eurasia. Virus Res. 2005; 111: 44–54. https://doi.org/10.1016/j.
virusres.2005.03.009 PMID: 15896401
14. Escobar LE, Peterson AT, Favi M, Yung V, Medina-Vogel G. Bat-borne rabies in Latin America. Rev
Inst Med Trop Sao Paulo. Instituto De Medicina Tropical De Sao Paulo; 2015; 57: 63–72. https://doi.
org/10.1590/S0036-46652015000100009 PMID: 25651328
15. Freuling CM, Hampson K, Selhorst T, Schroder R, Meslin FX, Mettenleiter TC, et al. The elimination of
fox rabies from Europe: determinants of success and lessons for the future. Philos Trans R Soc L B Biol
Sci. 2013/06/27. 2013; 368: 20120142. https://doi.org/10.1098/rstb.2012.0142 PMID: 23798690
16. Sterner RT. Tactics and Economics of Wildlife Oral Rabies Vaccination, Canada and the United States.
Emerg Infect Dis. 2009; 15: 1176–1184. https://doi.org/10.3201/eid1508.081061 PMID: 19757549
17. Fooks AR, Banyard AC, Horton DL, Johnson N, McElhinney LM, Jackson AC. Current status of rabies
and prospects for elimination. Lancet. 2014/05/16. 2014; 384: 1389–1399. https://doi.org/10.1016/
S0140-6736(13)62707-5 PMID: 24828901
18. Baxby D. Safety of Recombinant Vaccinia Vaccines. Lancet. 1991; 337: 913. Available: http://www.
sciencedirect.com/science/article/pii/014067369190241G
19. Use of Vaccinia Virus Smallpox Vaccine in Laboratory and Health Care Personnel at Risk for Occupa-
tional Exposure to Orthopoxviruses—Recommendations of the Advisory Committee on Immunization
Practices (ACIP), 2015. 2016; 1–6.
20. Centers for Disease Control and Prevention (CDC). Human contacts with oral rabies vaccine baits dis-
tributed for wildlife rabies management—Ohio, 2012. MMWR Morb Mortal Wkly Rep. 2013; 62: 267–9.
Available: http://www.ncbi.nlm.nih.gov/pubmed/23575240 PMID: 23575240

21. Yarosh OK, Wandeler a I, Graham FL, Campbell JB, Prevec L. Human adenovirus type 5 vectors
expressing rabies glycoprotein. Vaccine. 1996; 14: 1257–64. http://dx.doi.org/10.1016/S0264-410X(96)
00012-6 PMID: 8961515
22. Stading BR, Osorio JE, Velasco-Villa A, Smotherman M, Kingstad-Bakke B, Rocke TE. Infectivity of
attenuated poxvirus vaccine vectors and immunogenicity of a raccoonpox vectored rabies vaccine in
the Brazilian Free-tailed bat (Tadarida brasiliensis). Vaccine. 2016; 34: 5352–5358. https://doi.org/10.
1016/j.vaccine.2016.08.088 PMID: 27650872
23. Tripp DW, Rocke TE, Streich SP, Abbott RC, Osorio JE, Miller MW. Apparent field safety of a raccoon
poxvirus-vectored plague vaccine in free-ranging prairie dogs (Cynomys spp.), Colorado, USA. J Wildl
Dis. 2015/01/15. 2015; 51: 401–410. https://doi.org/10.7589/2014-02-051 PMID: 25588006
24. Fleischauer C, Upton C, Victoria J, Jones GJ, Roper RL. Genome sequence and comparative virulence
of raccoonpox virus: the first North American poxvirus sequence. J Gen Virol. 2015/05/30. 2015; 96:
2806–2821. https://doi.org/10.1099/vir.0.000202 PMID: 26023150
25. Jones GJB, Boles C, Roper RL. Raccoonpoxvirus safety in immunocompromised and pregnant mouse
models. Vaccine. 2014; 32: 3977–3981. https://doi.org/10.1016/j.vaccine.2014.05.018 PMID:
24837508
26. Rocke TE, Tripp DW, Russell RE, Abbott RC, Richgels KLD, Matchett MR, et al. Sylvatic Plague Vac-
cine Partially Protects Prairie Dogs (Cynomys spp.) in Field Trials. Ecohealth. 2017; https://doi.org/10.
1007/s10393-017-1253-x PMID: 28643091
27. Esposito JJ, Knight JC, Shaddock JH, Novembre FJ, Baer GM. Successful oral rabies vaccination of
raccoons with raccoon poxvirus recombinants expressing rabies virus glycoprotein. Virology. Division
of Viral Diseases, Centers for Disease Control, Atlanta, Georgia 30333.; 1988; 165: 313–316. Available:
http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Retrieve&list_uids=3291388&dopt=
abstractplus
28. Hwa S, Iams KP, Hall JS, Kingstad BA, Osorio J. Characterization of Recombinant Raccoon Pox Vac-
cine Vectors in Chickens. Avian Dis. 2010; 54: 1157–1165. https://doi.org/10.1637/9315-032410-Reg.1
PMID: 21313834
29. Crick J, King A. Culture of rabies virus in vitro. In: Campbell J, Charlton K, editors. Rabies. Boston:
Kluwer Academic Publishers; 1988. pp. 47–66.
30. Turmelle AS, Jackson FR, Green D, McCracken GF, Rupprecht CE. Host immunity to repeated rabies
virus infection in big brown bats. J Gen Virol. 2010; 91: 2360–2366. https://doi.org/10.1099/vir.0.
020073-0 PMID: 20519458
31. Fischer W, Perkins S, Theiler J, Bhattacharya T, Yusim K, Funkhouser R, et al. Polyvalent vaccines for
optimal coverage of potential T-cell epitopes in global HIV-1 variants. Nat Med. 2006; 13: 100–106.
https://doi.org/10.1038/nm1461 PMID: 17187074
32. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic
Acids Res. 2004; 32: 1792–7. https://doi.org/10.1093/nar/gkh340 PMID: 15034147
33. Maddison WP, Maddison DR. Mesquite: a modular system for evolutionary analysis. In: Version 2.75.
2011.
34. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm
for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2015; 32: 268–74. https://doi.org/10.
1093/molbev/msu300 PMID: 25371430
35. Minh BQ, Nguyen MAT, von Haeseler A. Ultrafast approximation for phylogenetic bootstrap. Mol Biol
Evol. 2013; 30: 1188–95. https://doi.org/10.1093/molbev/mst024 PMID: 23418397
36. Guindon S, Dufayard J-F, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods
to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol.
2010; 59: 307–21. https://doi.org/10.1093/sysbio/syq010 PMID: 20525638
37. Lee MS, Roos JM, McGuigan LC, Smith KA, Cormier N, Cohen LK, et al. Molecular attenuation of vac-
cinia virus: mutant generation and animal characterization. J Virol. 1992/05/01. 1992; 66: 2617–2630.
Available: https://www.ncbi.nlm.nih.gov/pubmed/1560521/ PMID: 1560521
38. Earl PL, Moss B, Wyatt LS, Carroll MW. Generation of recombinant vaccinia viruses. In: Ausubel FM
et al., editor. Current protocols in molecular biology. 2001.
39. Osorio JE, Powell TD, Frank RS, Moss K, Haanes EJ, Smith SR, et al. Recombinant raccoon pox vac-
cine protects mice against lethal plague. Vaccine. 2003/02/01. 2003; 21: 1232–1238. Available: http://
www.ncbi.nlm.nih.gov/pubmed/12559803 PMID: 12559803
40. Institute of Laboratory Animal Resources Committee. Guide for the Care and Use of Laboratory Ani-
mals. Guide for the Care and Use of Laboratory Animals. 2011.
41. Reed LJ, Muench H. A simple method of estimating fifty percent endpoints. Am J Epidemiol. 1938; 27:
493.

42. Dean DJ, Abelseth MK, Atanasiu P. The flourescent antibody test. In: Meslin M.M. Koprowski H. FX K,
editor. Laboratory Techniques in Rabies. Geneva, Switzerland: World Health Organization; 1996.
pp. 83–93.
43. Kamlangdee A, Kingstad-Bakke B, Anderson TK, Goldberg TL, Osorio JE. Broad protection against
avian influenza virus by using a modified vaccinia Ankara virus expressing a mosaic hemagglutinin
gene. J Virol. 2014/09/12. 2014; 88: 13300–13309. https://doi.org/10.1128/JVI.01532-14 PMID:
25210173
44. Thurmond J, Yoon H, Kuiken C, Yusim K, Perkins S, Theiler J, et al. Web-based design and evaluation
of T-cell vaccine candidates. Bioinformatics. 2008; 24: 1639–1640. https://doi.org/10.1093/
bioinformatics/btn251 PMID: 18515277
45. Evans JS, Horton DL, Easton AJ, Fooks AR, Banyard AC. Rabies virus vaccines: Is there a need for a
pan-lyssavirus vaccine? Vaccine. 2012; 30: 7447–7454. https://doi.org/10.1016/j.vaccine.2012.10.015
PMID: 23084854
46. Wunner WH, Dietzschold B, Smith CL, Lafon M, Golub E. Antigenic variants of CVS rabies virus with
altered glycosylation sites. Virology. 1985; 140: 1–12. Available: http://www.ncbi.nlm.nih.gov/pubmed/
3966297 PMID: 3966297
47. Mollentze N, Biek R, Streicker DG. The role of viral evolution in rabies host shifts and emergence. Curr
Opin Virol. 2014/07/30. 2014; 8: 68–72. https://doi.org/10.1016/j.coviro.2014.07.004 PMID: 25064563
48. Mayen F. Haematophagous bats in Brazil, their role in rabies transmission, impact on public health, live-
stock industry and alternatives to an indiscriminate reduction of bat population. J Vet Med B Infect Dis
Vet Public Heal. 2003; 50: 469–472. Available: http://www.ncbi.nlm.nih.gov/pubmed/14720182
49. Streicker DG, Recuenco S, Valderrama W, Gomez Benavides J, Vargas I, Pacheco V, et al. Ecological
and anthropogenic drivers of rabies exposure in vampire bats: implications for transmission and control.
Proc R Soc B Biol Sci. 2012; 279: 3384–3392. https://doi.org/10.1098/rspb.2012.0538 PMID:
22696521
50. Blackwood JC, Streicker DG, Altizer S, Rohani P. Resolving the roles of immunity, pathogenesis, and
immigration for rabies persistence in vampire bats. Proc Natl Acad Sci U S A. 2013/12/04. 2013; 110:
20837–20842. https://doi.org/10.1073/pnas.1308817110 PMID: 24297874
51. Tordo N. Characteristics and molecular biology of the rabies virus. In: Meslin F, Kaplan M, Koprowski H,
editors. Laboratory techniques in rabies. Fourth. Geneva: World Health Organization; 1996. pp. 8–51.
52. Santra S, Liao HX, Zhang R, Muldoon M, Watson S, Fischer W, et al. Mosaic vaccines elicit CD8+ T
lymphocyte responses that confer enhanced immune coverage of diverse HIV strains in monkeys. Nat
Med. 2010; 16: 324–328. https://doi.org/10.1038/nm.2108 PMID: 20173754
53. Aguilar-Setién A, Leon YC, Tesoro EC, Kretschmer R, Brochier B, Pastoret P-P. Vaccination of vampire
bats using recombinant vaccinia-rabies virus. J Wildl Dis. Wildlife Dis Assoc; 2002; 38: 539–544. Avail-
able: http://www.ncbi.nlm.nih.gov/pubmed/12243138
54. Blanton JDJD, Self JJ, Niezgoda MM, Faber M-LML, Dietzschold BB, Rupprecht CC. Oral vaccination
of raccoons (Procyon lotor) with genetically modified rabies virus vaccines. Vaccine. 2007; 25: 5.
https://doi.org/10.1016/j.vaccine.2007.08.004 PMID: 17826874
55. Rupprecht CE, Dietzschold B, Cox JH, Schneider LG. Oral vaccination of raccoons (Procyon lotor) with
an attenuated (SAD-B19) rabies virus vaccine. J Wildl Dis. 1989; 25: 548–54. https://doi.org/10.7589/
0090-3558-25.4.548 PMID: 2810555
56. Setien AA, Brochier B, Tordo N, De Paz O, Desmettre P, Peharpre D, et al. Experimental rabies infec-
tion and oral vaccination in vampire bats (Desmodus rotundus). Vaccine. 1998/07/31. 1998; 16: 1122–
1126. Available: https://doi.org/10.1016/S0264-410X(98)80108-4 PMID: 9682368
57. Turner GS. Thymus dependence of rabies vaccine. J Gen Virol. 1976; 33: 535–8. https://doi.org/10.
1099/0022-1317-33-3-535 PMID: 1087335
58. Celis E, Wiktor TJ, Dietzschold B, Koprowski H. Amplification of rabies virus-induced stimulation of
human T-cell lines and clones by antigen-specific antibodies. J Virol. 1985; 56: 426–33. Available:
http://www.ncbi.nlm.nih.gov/pubmed/3877176 PMID: 3877176
59. Kawano H, Mifune K, Ohuchi M, Mannen K, Cho S, Hiramatsu K, et al. Protection against rabies in mice
by a cytotoxic T cell clone recognizing the glycoprotein of rabies virus. J Gen Virol. 1990; 71 (Pt 2): 281–
7. https://doi.org/10.1099/0022-1317-71-2-281 PMID: 2307962
60. Hooper DC, Morimoto K, Bette M, Weihe E, Koprowski H, Dietzschold B. Collaboration of antibody and
inflammation in clearance of rabies virus from the central nervous system. J Virol. 1998; 72: 3711–9.
Available: http://www.ncbi.nlm.nih.gov/pubmed/9557653 PMID: 9557653
61. Li J, Ertel A, Portocarrero C, Barkhouse DA, Dietzschold B, Hooper DC, et al. Postexposure treatment
with the live-attenuated rabies virus (RV) vaccine TriGAS triggers the clearance of wild-type RV from
the Central Nervous System (CNS) through the rapid induction of genes relevant to adaptive immunity

in CNS tissues. J Virol. American Society for Microbiology; 2012; 86: 3200–10. https://doi.org/10.1128/
JVI.06699-11 PMID: 22238315
62. Baur K, Brinkmann K, Schweneker M, Pätzold J, Meisinger-Henschel C, Hermann J, et al. Immediate-
early expression of a recombinant antigen by modified vaccinia virus ankara breaks the immunodomi-
nance of strong vector-specific B8R antigen in acute and memory CD8 T-cell responses. J Virol. Ameri-
can Society for Microbiology (ASM); 2010; 84: 8743–52. https://doi.org/10.1128/JVI.00604-10 PMID:
20538860
63. Carter G, Leffer L. Social Grooming in Bats: Are Vampire Bats Exceptional? PLoS One. 2015; 10:
e0138430. https://doi.org/10.1371/journal.pone.0138430 PMID: 26445502
64. Stoner-Duncan B, Streicker DG, Tedeschi CM. Vampire bats and rabies: toward an ecological solution
to a public health problem. PLoS Negl Trop Dis. 2014; 8: e2867. https://doi.org/10.1371/journal.pntd.
0002867 PMID: 24945360
65. Almeida MF, Martorelli LF, Aires CC, Barros RF, Massad E. Vaccinating the vampire bat Desmodus
rotundus against rabies. Virus Res. 2008; 137: 275–277. https://doi.org/10.1016/j.virusres.2008.07.024
PMID: 18761044
66. Almeida MF, Martorelli LF, Aires CC, Sallum PC, Massad E. Indirect oral immunization of captive vam-
pires, Desmodus rotundus. Virus Res. 2005; 111: 77–82. https://doi.org/10.1016/j.virusres.2005.03.
013 PMID: 15896405
67. Centers for Disease Control and Prevention. Human vaccinia infection after contact with a raccoon
rabies vaccine bait—Pennsylvania, 2009. MMWR Morb Mortal Wkly Rep. 2009; 58: 1204–1207. Avail-
able: http://www.ncbi.nlm.nih.gov/pubmed/19893480 PMID: 19893480
68. Blehert DS, Lorch JM, Ballmann AE, Cryan PM, Meteyer CU. Bat White-Nose Syndrome in North Amer-
ica. Microbe. 2011; 6: 267–273.

HHS Public Access
Author manuscript
Vaccine. Author manuscript; available in PMC 2017 October 17.
Author Manuscript
Published in final edited form as:

Vaccine. 2016 October 17; 34(44): 5352–5358. doi:10.1016/j.vaccine.2016.08.088.
Infectivity of attenuated poxvirus vaccine vectors and

immunogenicity of a raccoonpox vectored rabies vaccine in the
Brazilian Free-tailed bat (Tadarida brasiliensis)
Ben R. Stadinga,b, Jorge E. Osorioa, Andres Velasco-Villac, Michael Smothermand, Brock
Kingstad-Bakkea, and Tonie E. Rockeb
aUniversity
of Wisconsin – Madison, School of Veterinary Medicine, 1656 Linden Dr., Madison, WI
Author Manuscript
53706, USA
bU.S.Geological Survey, National Wildlife Health Center, 6006 Schroeder Rd., Madison, WI
53711, USA
cCenters for Disease Control and Prevention, 1600 Clifton Rd., Atlanta, GA 30333, USA
dTexas A&M University, 3258 TAMU, College Station, TX 77843, USA
Abstract
Bats (Order Chiroptera) are an abundant group of mammals with tremendous ecological value as
insectivores and plant dispersers, but their role as reservoirs of zoonotic diseases has received
more attention in the last decade. With the goal of managing disease in free-ranging bats, we
Author Manuscript
tested modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN) as potential vaccine vectors
in the Brazilian Free-tailed bat (Tadarida brasiliensis), using biophotonic in vivo imaging and
immunogenicity studies. Animals were administered recombinant poxviral vectors expressing the
luciferase gene (MVA-luc, RCN-luc) through oronasal (ON) or intramuscular (IM) routes and
subsequently monitored for bioluminescent signal indicative of viral infection. No clinical illness
was noted after exposure to any of the vectors, and limited luciferase expression was observed.
Higher and longer levels of expression were observed with the RCN-luc construct. When given
IM, luciferase expression was limited to the site of injection, while ON exposure led to initial
expression in the oral cavity, often followed by secondary replication at another location, likely the
gastric mucosa or gastric associated lymphatic tissue. Viral DNA was detected in oral swabs up to
7 and 9 days post infection (dpi) for MVA and RCN, respectively. While no live virus was detected
in oral swabs from MVA-infected bats, titers up to 3.88 × 104 PFU/ml were recovered from oral
Author Manuscript
swabs of RCN-infected bats. Viral DNA was also detected in fecal samples from two bats
inoculated IM with RCN, but no live virus was recovered. Finally, we examined the
immunogenicity of a RCN based rabies vaccine (RCN-G) following ON administration.
Significant rabies neutralizing antibody titers were detected in the serum of immunized bats using
the rapid fluorescence focus inhibition test (RFFIT). These studies highlight the safety and
immunogenicity of attenuated poxviruses and their potential use as vaccine vectors in bats.
Correspondence to: Tonie E. Rocke.

Appendix A. Supplementary material: Supplementary data associated with this article can be found, in the online version, at http://
dx.doi.org/10.1016/j.vaccine.2016.08.088.
Stading et al. Page 2
1. Introduction
Author Manuscript
Over the last few decades, the importance of bats (order Chiroptera) in the maintenance and
transmission of zoonotic diseases has become increasingly evident; bats are thought to
harbor the most zoonotic agents per species [1]. The list of pathogens that infect bats
includes the major mammalian paramyxoviruses [2], coronaviruses [3,4], filoviruses [5–7],
distinct influenza lineages [8,9], hepadnaviruses [10], and hantaviruses [11], as well as
lyssa-viruses such as rabies virus [12,13]. In the United States, bats are often the most
common source of rabies infections in humans [14], and in Central and South America,
rabies transmitted by vampire bats is a serious zoonotic and economic issue [15]. This
association between bats and pathogens that significantly impacts human populations has
increased public fear and misunderstanding of these animals and lead to culling campaigns
[15–18]. Unfortunately, culling campaigns often lead to the death of valuable non-target bat
species [16] and appear ineffective in reducing disease incidence [17]. Alternatively,
Author Manuscript
vaccination of other wildlife species has been successful in mitigating the public health
impact of rabies with the development of efficient and practical distribution methods for
mass immunization.
Poxviral vectors have been used extensively for oral vaccines to control infectious diseases
in a variety of animal species over the last 25 years [19,20]. Several advantages of
poxviruses as vaccine vectors include: (1) their allowance of large insertions of foreign
DNA; (2) ease of manufacturing; (3) thermal and genetic stability; (4) safety and infectivity
for multiple target species; and (5) ability to infect via mucosal and dermal routes. For
example, an oral rabies vaccine, constructed by inserting the rabies G glycoprotein into
vaccinia virus and distributed via baits, has been used for many years to curtail rabies
outbreaks in foxes, raccoons and other animals in North America and Europe [21]. Previous
Author Manuscript
studies assessing a vaccinia-based rabies vaccine (VR-G) in Desmodus bats demonstrated

the protective efficacy of that construct [22–24]. However, this vector has undesirable side-
effects, especially in immunocompromised individuals [25], necessitating the development
of attenuated virus strains. More recently, an oral sylvatic plague vaccine using another
poxvirus (raccoon pox, RCN) was shown to protect prairie dogs and is currently being tested
in large-scale field trials [26,27]. RCN was first isolated from the upper respiratory tract of
apparently healthy raccoons in North America [28]. It has since been shown to be safe and
effective in a variety of species, including domestic cats, piglets, dogs, raccoons, skunks,
foxes, bobcats, rabbits, sheep, prairie dogs, non-human primates, and chickens, with none of
the immunized animals showing clinical side effects [29–32]. Additionally, RCN has been
shown to be immunogenic via non-parenteral routes in both domestic species [29] and free
ranging wildlife [33,34]. Another orthopoxvirus vector, modified vaccinia Ankara (MVA), is
Author Manuscript
a highly attenuated form of vaccinia [35,36] and has also been demonstrated to safely and
effectively induce immunity [37,38].
Based on the success of mucosal vaccination with poxvirus vectors in many other species,
we hypothesized that poxviruses could be immunogenic and safe when given mucosally in
chiropteran species. To test this, we assessed the infectivity and pathogenicity of MVA and
RCN in T. brasiliensis via in vivo imaging studies. The immunogenicity of RCN given

oronasally was also assessed using standard serologic techniques after vaccination with an
Author Manuscript
RCN-based rabies vaccine (RCN-G).
2. Materials and methods

2.1. Ethics statement
The use of bats in this experiment was approved by (Protocol #EP111018) and conducted in
accordance with the U.S. Geological Survey (USGS), National Wildlife Health Center
(NWHC), Animal Care and Use Committee (ACUC).
2.2. Animals
Adult male bats (T. brasiliensis; n = 22) were caught in Brazos County, Texas under Texas
Parks and Wildlife Department permit number SPR-1104-610 and Texas A&M University
Author Manuscript
ACUC approval number 2012-130 (courtesy of Mike Smotherman, Texas A&M University,
USA). After acclimating to captivity, the bats were transferred to NWHC (Madison,
Wisconsin, USA), where all bat studies were conducted under ABSL-3 conditions. Upon
transfer to the NWHC, bats were maintained in flight cages for a quarantine period of 30
days. During this time blood samples were taken and bats were treated topically for
parasites. Electronic microchip identification units (Avid Identification Systems, Inc.,
Folsom, Louisiana, USA) were inserted into each animal, between the scapulae, via
subcutaneous injection. Bats were maintained on mealworms (Tenebrio molitor)
supplemented with vitamins and an omega fatty acids mixture, and water was available ad
libitum. Light cycles were set to 12 h of light per day inverted from the natural cycle to
allow monitoring of bat activities during facility working hours.
2.3. Viruses and cells

Author Manuscript
The RCN-luc strain used in this study was previously described [32]. The MVA-GFP strain
used to create the MVA-luc constructs was generously provided by Inviragen (Madison,
WI), while RCN-G [34] was kindly provided by the Centers for Disease Control (Atlanta,
GA). Recombinant viruses were generated and amplified on cell monolayers of rat
embryonic fibroblasts (Rat-2, ATCC #CRL-1764), baby hamster kidney cells (BHK-21,
ATCC #CRL-12072), African Green monkey kidney epithelial cells (Vero, ATCC
#CCL-18), or primary chicken embryo fibroblasts (CEF, Charles River Laboratories, INC,
Wilmington, WA, USA)). Cell cultures were maintained at 37 °C and 5% CO2 in Dulbecco's
Modified Eagle Medium (DMEM) or Opti-MEM® (Life technologies, Madison, WI 53719),
supplemented with 2–5% fetal bovine serum (FBS). Viruses were titrated prior to use with
plaque dilution assays in 6-well plates.
Author Manuscript
2.4. Construction of recombinant MVA-luc

Recombinant MVA-luc viruses were constructed as described elsewhere [39]. Briefly, CEF
cells were infected with MVA-GFP at a multiplicity of 0.05 PFU per cell; one hour later the
cells were transfected using the FuGENE® reagent protocol (Promega, Fitchburg, WI) with
a pI2 transfer plasmid containing (1) DNA flanking segments adjacent to deletion III within
the HindIII A fragment of MVA, (2) the Red Fluorescent Protein (RFP) under the control of
a p11 promoter, and (3) the firefly luciferase gene (luc) under the control of a strong

synthetic early/late (SE/L) vaccinia virus promoter upstream Supplementary Fig. S1). At
Author Manuscript
48-72 h post transfection, the cell cultures were put through three freeze-thaw cycles,
harvested, sonicated, and centrifuged at 500g for 5 min at 4 °C. The sonicated cell extracts
were plated onto fresh BHK-21 cells and overlaid with 0.8% agarose. After 48–-72 h,
through the use of specific microscope filters, the recombinant viruses were detected by the
presence of the RFP gene, which replaced the GFP gene during homologous recombination.
Selected cell/virus samples were sonicated and plated again as described above. After four
consecutive rounds of plaque isolation, recombinant MVA-luc virus was confirmed by PCR
analysis using OneTaq® Quick-Load® 2X Master Mix with Standard Buffer (New England
BioLabs Inc., Ipswich, MA 01938, USA) amplifying the insertion at the Del III flanks using
ATGCGGCACCTCTCT-TAA as a forward primer and
CCAAAGCTTGCACATACATAAGTA as the reverse primer. The virus subsequently
amplified in freshly prepared CEF cells.
Author Manuscript
2.5. Bioluminescent imaging

Biophotonic luminescent imaging (BLI) has been successfully used to assess the infectivity,
infection course, and tissue tropism of viruses and candidate vaccine vectors [40]. Unlike
traditional pathogenicity studies that require euthanasia of animals at different time points,
BLI allows study of the course of infection over time in a single host, increasing the
information gained while reducing the number of animals required.
Groups of 8 wild-caught T. brasiliensis were separated into two screened flight cages (33″W
× 66″D × 84″H) approximately 5 m apart. Four bats from each group were given 109
plaque forming units (PFU) in 100 μl of either RCN-luc or MVA-luc by intramuscular (IM)
injection, split into two 50 μl volumes injected into each thigh muscle. The remaining four
bats in each group were given the same amount of virus in 70 μl sterile saline; using a
Author Manuscript
micropipette with sterile tips, the volume split among the nostrils (10 μl given each nare) and
mouth (50 μl) for oronasal (ON) exposure. Bats were monitored for 3 h post inoculation for
signs of adverse effects. Animals were scanned using an IVIS 200 Biophotonic imager
(PerkinElmer, Hopkinton, MA, USA) at one-day post infection (dpi) and every-other day
thereafter until 2 consecutive images with less than 100 radiance units (comparable to
background) were observed. Bats were scanned prior to infection and confirmed to have no
auto-luminescence beyond background levels. Imaging was conducted at roughly the same
time period each day, midway through the bats' active period. On imaging days the bats were
separated individually into paper lunch bags, weighed, and injected intraperitoneally (i.p)
with d-luciferin (Potassium-Luciferin, Gold Biotechnology, St. Louis, MO 63132, dose:
150mg/kg) at 14min prior to imaging the ON group and 26 min prior to imaging the IM
group, which were empirically determined to be the time of peak luminescence post
Author Manuscript
substrate exposure on the first day of imaging. All bats were examined for signs of disease
or discomfort at the time of substrate injection. For imaging, animals were anesthetized by
chamber-delivered isoflurane and positioned in the imager in dorsal recumbency with wings
extended laterally, where they were maintained on mask-delivered isoflurane. After imaging
the anesthesia was ceased, bats were monitored and given thermal support during recovery.
After 11 dpi the bats with remaining detectable luminescence were imaged every 3 days
until luminescence was below detectable levels. Images were collected and analyzed using

Living Image software (Caliper Life Sciences, Alameda, California, USA). A region of
Author Manuscript
interest (ROI) was created which covered the entire body of the bat when analyzing the
luminescence data.
At 87 dpi, a random group of six bats, all initially exposed to RCN-luc by either the ON (n =
4) or IM (n = 2) route, was given a booster exposure to the RCN-luc vaccine via the ON
route at the same dose. Bats from this group were imaged at 1, 3, and 5 dpi using the same
protocol as described above.
2.6. Assessment of viral shedding

During anesthesia for each imaging time-point, oral swabs were collected (CLASSIQSwabs,
Copan Flock Technologies, 25125 Brescia, Italy) and placed in a 1.5 ml tube containing 200
μl DMEM media. Fecal samples were also retrieved when available from the bags in which
the individuals were contained during imaging, placed in a 1.5 ml tube without media. All
Author Manuscript
samples were quickly stored at -80 °C until testing. Prior to testing, 100 μl DMEM media
was added to fecal samples, vortexed thoroughly and sonicated four times in a bath sonicator
for 15 s. DNA was extracted from 40 μl of the samples using the Zymo Quick-gDNA™
MiniPrep kit (Zymo Research, Irvine, CA 92614, U.S.A.), and a PCR assay was run to
assess for presence of the inoculated virus. PCR was performed with OneTaq® Quick-Load®
2× Master Mix with Standard Buffer (New England BioLabs Inc., Ipswich, MA 01938,
USA) and primers targeting the luc insert flanks [Supplemental info)]. The limit of detection
for this PCR protocol was determined to be 0.125 picograms of DNA, or 6.8×104 copies, as
determined by serial dilution of a known quantity of viral DNA. Any samples positive by
PCR were then assessed for levels of live virus by determining the median tissue culture
infective dose (TCID50). For RCN-luc samples, positive wells were assessed by plaque
observation, and the TCID50 was calculated and used to approximate plaque forming units
Author Manuscript
(PFU)/ml by the Spearman & Kärber algorithm [41]. For MVA-luc samples, positive wells
were assessed for viral titer by the luciferase marker using steadylite plus™ (PerkinElmer
Inc, Waltham, MA 02451). Serial dilutions from 10−2 to 10−7 were made, and 100 μl from
each was used to infect a 96 well plate with BHK-21 cells at ∼80% confluency. Due to
minimal sample volume left, no smaller dilutions were possible. After 3 days of infection,
100 μl of the steadylite reagent was added to each well, mixed by pipetting, and after 15 min
the plates were scanned in a luminometer (Veritas™ Microplate Luminometer, Turner
BioSystems, Inc, Sunnyvale, CA 94085).
2.7. RCN-G immunization

An additional group of five T. brasiliensis were housed separately in the same type of caging
and given RCN-G via the ON route to assess the immunogenicity of RCN-delivered rabies
Author Manuscript
CVS strain glycoprotein. For this exposure the bats were anesthetized with isoflurane prior
to exposure. A dose of 108 PFU of viral vaccine was given in 70 μl sterile saline, split
between 50 μl orally and 10 μl in each nare. Bats were monitored through their anesthesia
recovery for 3 h for potential adverse events. Serum samples were obtained prior to
vaccination and at 30 and 60 dpi and tested for the presence of anti-rabies neutralizing
antibodies by the rapid fluorescence focus inhibition test (RFFIT). Serum samples from bats
given RCN-luc (used in the luminescence study) were also collected at 0 and 60 dpi and

used for controls. Serum was collected by making a small lance in the interfemoral vein and
collecting up to 200 μl of blood in a capillary tube (Microvette® CB 300 Blood Collection
Author Manuscript
System, Sarstedt AG & Co., Nümbrecht, Germany), which was subsequently centrifuged at
10,000g for 10 min. A micropip-ette was used to collect the serum from the top of the blood
container and transfer it to a separate tube for storage at −80°.
Testing was conducted at the CDC Poxvirus and Rabies Branch using standard RFFIT
protocols [42], augmented for smaller volumes of serum as previously described [43]. The
assay was run in triplicate for each sample, and the results reported represent average titers.
Prior to the 60 dpi sample collection, two bats from the RCN-G group were lost from the
study due to non-vaccine related mortalities.
2.8. Statistical analysis

Analysis of the data was performed using the R-commander software package [44]. Weight
Author Manuscript
change was analyzed with repeated measures ANOVA, where ‘weight’ is a function of
group, route, and time, plus all interactions, using individual bats as the repeated measures.
Differences in luminescence were analyzed using a linear mixed-effects model fit by the
restricted maximum likelihood approach (REML).
3. Results
3.1. In vivo imaging studies
To assess the infectivity, tissue tropism, and course of infection of RCN and MVA in T.
brasiliensis, bats were infected with recombinant virus expressing the firefly luciferase gene
(luc). Two routes were assessed; the IM route and the ON route, which is most biologically
relevant for wildlife vaccination. Throughout the study, no clinical signs of disease, lesions,
Author Manuscript
or significant weight loss were observed after administration of viral vectors (Supplementary
Fig. S2,Supplementary Table S3). All bats infected with luc-expressing poxvirus vectors had
detectable expression of luminescence by 1 dpi, and peak levels were observed at 1 and 3
dpi for the IM and ON routes, respectively (Figs. 1 and 2). Viral infection via IM exposure
was cleared within 7 days for MVA and 9 days for RCN, while infection after ON exposure
was cleared within 9 days for MVA and 21 days for RCN (final images for RCN given ON
not shown). Statistical analysis revealed that luminescence was significantly higher (P =
0.028) in bats that received RCN compared to MVA and significantly higher (P = 0.032) for
those administered virus by the IM route compared to the ON route. In the IM injected
groups, significant viral spread to other areas was not evident. In contrast, an initial site of
viral replication was evident in the oral cavity after ON exposure, often followed by a
secondary site of expression further down the gastrointestinal tract. All luminescence
Author Manuscript
measurements are listed in Supplementary Table S4).
In the group of bats re-exposed to RCN-luc to assess whether prior exposure would affect
the infectivity of the viral vectors, no significant difference (P = 0.33) was detected in
luminescence when compared to initial exposure through 5 dpi (Fig. 3).

3.2. Assessment of viral shedding

Author Manuscript
PCR analysis of oral swabs revealed the presence of MVA-luc DNA in 5 out of 8 bats up to
7 dpi (3 infected IM, 2 infected ON), however no live virus was recovered. RCN-luc DNA
was present in 4 out of 8 bats up to 9 dpi (2 infected IM, 2 infected ON), with low levels of
live virus detected (6.33 × 103 PFU/ml average, with a median of 9.20 PFU/ml in those with
detectable virus). Two bats from the RCN-luc group that had live virus detected by oral
swabs also had PCR positive fecal samples at 7 and 9 dpi, however no live virus was
recoverable from these samples in titration. Viral shedding appears to occur at very low
levels independent of route of exposure, and with no evidence of shedding viable MVA.
3.3. Antibody responses to RCN-G

To assess the immunogenicity of RCN, an additional group of bats (n = 5) was infected via
the ON route with RCN expressing rabies virus surface glycoprotein (RCN-G). Again, there
Author Manuscript
was no evidence of clinical disease in any of the vaccinated bats in this experiment. The
rabies virus G is very well characterized and known to induce protective humoral immunity
to rabies virus [30,45,46]. All bats assessed by RFFIT had negligible Ab titers prior to
vaccination (Supplementary Table S5). As a control, bats vaccinated with luc-expressing
virus for the imaging study (N = 7) were bled at 0 and 60 dpi and assessed by RFFIT as
well. By 30 dpi all rabies vaccinated bats (5/5) developed Ab titers greater than 0.2 IU/ml
(0.20–11.46, with a mean of 5.14), while 7/7 bats that received RCN-luc had titers 60.09
IU/ml (Supplementary Table S5). While there is no “protective” level of rabies virus
neutralizing antibodies (RVNA), there is a positive correlation between RVNA titers and the
level of protection after virus challenge [22,47–50]. Titers between 0.1 and 3.0 IU have been
protective for other mammalian species [22,47–50].
Author Manuscript
4. Discussion
Despite the association between bats and zoonotic diseases, there is currently no significant
effort to decrease the incidence of important infectious diseases in these animals. Instead,
efforts are more focused on culling of populations (e.g. vampire bats in Latin America) or
controlling disease after spill-over into other animal hosts. The continued spillover of rabies
virus strains to humans and domestic animals from terrestrial carnivores has led to the
development of successful oral rabies vaccination (ORV) programs in Europe and North
America. These campaigns often utilize recombinant viral vectors that stimulate immunity
to the surface glycoprotein of rabies when ingested orally. When distributed in baits targeted
toward certain rabies-carrying species, these vaccines lead to protection from the virus and
reduction in local incidence of disease, and even local eradication of some strains of rabies
[20,51]. ORV programs are continually evolving and making use of the best available
Author Manuscript
vaccine technology and disease modeling studies. In this study we assessed whether two
attenuated pox-viruses might be viable vaccine vectors in a bat species.
Through in vivo imaging studies we have demonstrated that attenuated MVA and RCN are
able to infect T. brasiliensis via the ON route for a limited time, without causing disease.
Our studies demonstrate the tissue tropism and course of infection after exposure of a new
animal model, T. brasiliensis, to attenuated orthopox-viruses. We show evidence of limited

autologous spread of the viruses after ON exposure, although there is no evidence that the
Author Manuscript
virus spreads outside of GI-associated tissues. MVA was cleared faster and resulted in less
detectable luminescence compared to RCN, which may be expected due to the highly
attenuated nature of MVA. The lack of significant difference in the levels of viral encoded
protein (luciferase) production upon re-infection with RCN, as shown in the booster study
(Fig. 3), may be important if bats had been previously exposed to RCN, or if boost
inoculations of RCN-vectored vaccine are necessary. While neither vector caused clinical
illness, the fact that RCN produced more viral encoded protein (luciferase) over a longer
period suggests it is a more immunogenic vector when expressing heterologous antigens.
Due to limitations of this study, we were not able to compare the immunogenicity of the
vectors directly.
The development of significant levels of rabies neutralizing antibodies after ON exposure to

RCN-G demonstrates that the vaccine is highly immunogenic in T. brasiliensis. While
Author Manuscript
previous studies have demonstrated the effectiveness of injectable vaccines in this species
[52], our study is the first to demonstrate effective mucosal vaccination. An average anti-
rabies G titer of 5.14 IU at 60 dpi was detected in bats orally administered RCN-G, which is
higher than the levels obtained after vaccination with the VR-G construct in any previous
studies, including oral, IM, and scarification routes of exposure (28–30). While these
differences may be due to the animal models used, this is additional evidence of the
superiority of the RCN vector over vaccinia in bat species. Additionally, the previous studies
failed to address the infectivity of vaccinia in the bat host, relying on the lack of clinical
disease and development of protective immunity to assess the virus-host interaction. We
were unable to assess the duration of immunity past 60 days, but this would be useful
information to collect in future studies.
Author Manuscript
Limited oral shedding of the RCN virus was detected in bats by both PCR and culture of live
virus up to 9 dpi, but at very low levels. While there was no evidence of shedding of live
MVA virus, there was PCR evidence of vector DNA in oral swabs through 7 dpi; detection
of live virus may have been limited due to the method used and the necessary lack of lower
dilutions resulting from low sample volumes. One of the advantages of in vivo imaging
studies is that it is not necessary to sacrifice animals to obtain data, and the bats used in this
study went on to be used in a different investigation. Because of this, we were unable to
assess organ tissue for evidence of pathology during the infection trials. However, the lack of
any apparent morbidity in RCN-treated bats, along with RCN's natural history, record of
success in various domestic and non-domestic species, and ability to induce immunity via
the oral route, make it a very attractive candidate for use in free-ranging bats.
Author Manuscript
The results of our experiments provide proof-of-principle that oral vaccination is possible in
free-ranging bats. In future work, topical vehicles will be developed that could be used to
deliver oral vaccines to the fur coat of bats as they roost or are otherwise congregated. Bats
are fastidious animals and spend a large proportion of their time self-grooming [53], which
could lead to significant oral exposure to topically applied vaccines. A vaccine that would
broadly protect free-ranging bats from rabies virus infection may reduce local incidence of
rabies in certain bat populations, limiting the amount of spill-over into humans and other
species. T. brasiliensis represents a species that roosts in dense colonies and is exposed to

significant levels of circulating rabies virus in their population that may result in human
Author Manuscript
exposures [54]. Therefore, a topically delivered rabies vaccine may be directly applicable to
this species, but only if a method for mass application (such as a spray) could be developed.
Further research is required to assess the viral vector in other species, such as vampire bats
(Desmodus spp.), for which topically distributed poison protocols are well developed for
culling of colonies [15,55]. While culling has been successful in reducing overall numbers
of Desmodus at a local level, it has not reduced the incidence of rabies in bat populations
and may indeed be counterproductive [17]. Development of topical poxvirus vectored
vaccines could potentially lead to effective, applicable, and practical means for reducing
disease burden in some free ranging bat populations.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Author Manuscript
Acknowledgments
We would like to acknowledge the technical assistance of Jennifer Brunner, Elizabeth Falendysz, Nicole Ward, and
the other employees at the NWHC that helped with bat care. Additionally, we are grateful to Robin Russell and
Katie Richgels for assistance in statistical analysis, Erik Hofmeister for reviewing the manuscript, and David
Blehert and Dave Redell for providing their knowledge and expertise. This work was supported by the USGS and
the National Institutes of Health, Ruth L. Kirschstein National Research Service Award Institutional Training Grant
T32 RR023916, from the National Center for Research Resources. The findings and conclusions in this report are
those of the authors and do not represent the views of the Centers for Disease Control. The use of trade, firm, or
product names is for descriptive purposes only and does not imply endorsement by the U.S. Government.
References
1. Luis AD, Hayman DTS, O'shea TJ, Cryan PM, Gilbert AT, et al. A comparison of bats and rodents
as reservoirs of zoonotic viruses: are bats special? Proc Royal Soc B Biol Sci. 2013; 280(1756):
Author Manuscript
20122753.
2. Drexler JF, Corman VM, Muller MA, Maganga GD, Vallo P, Binger T, et al. Bats host major
mammalian paramyxoviruses. Nat Commun. 2012; 3:796. [PubMed: 22531181]
3. Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, et al. Bats are natural reservoirs of SARS-like
coronaviruses. Science. 2005 Oct; 310(5):676–9. [PubMed: 16195424]
4. Memish ZA, Mishra N, Olival KJ, Fagbo SF, Kapoor V, Epstein JH, et al. Middle East respiratory
syndrome coronavirus in bats, Saudi Arabia. Emerg Infect Dis. 2013 Nov; 19(11):1819–23.
[PubMed: 24206838]
5. Leroy EM, Kumulungui B, Pourrut X, Rouquet P, Hassanin A, Yaba P, et al. Fruit bats as reservoirs
of Ebola virus. Nature. 2005 Dec 1; 438(7068):575–6. [PubMed: 16319873]
6. Pourrut X, Souris M, Towner JS, Rollin PE, Nichol ST, Gonzalez JP, et al. Large serological survey
showing cocirculation of Ebola and Marburg viruses in Gabonese bat populations, and a high
seroprevalence of both viruses in Rousettus aegyptiacus. BMC Infect Dis. 2009; 9:159. [PubMed:
19785757]
Author Manuscript
7. Amman BR, Carroll SA, Reed ZD, Sealy TK, Balinandi S, Swanepoel R, et al. Seasonal pulses of
Marburg virus circulation in juvenile Rousettus aegyptiacus bats coincide with periods of increased
risk of human infection. PLoS Pathog. 2012; 8(10):e1002877. [PubMed: 23055920]
8. Tong S, Li Y, Rivailler P, Conrardy C, Castillo DA, Chen LM, et al. A distinct lineage of influenza A
virus from bats. Proc Natl Acad Sci U S A. 2012; 109(11):4269–74. [PubMed: 22371588]
9. Wu Y, Tefsen B, Shi Y, Gao GF. Bat-derived influenza-like viruses H17N10 and H18N11. Trends
Microbiol. 2014 Apr; 22(4):183–91. [PubMed: 24582528]

10. Drexler JF, Geipel A, König A, Corman VM, van Riel D, Leijten LM, et al. Bats carry pathogenic
hepadnaviruses antigenically related to hepatitis B virus and capable of infecting human
Author Manuscript
hepatocytes. Proc Natl Acad Sci U S A. 2013; 110(40):16151–6. [PubMed: 24043818]

11. Guo WP, Lin XD, Wang W, Tian JH, Cong ML, Zhang HL, et al. Phylogeny and origins of
hantaviruses harbored by bats, insectivores, and rodents. PLoS Pathog. 2013; 9(2):e1003159.
[PubMed: 23408889]
12. Badrane H, Tordo N. Host switching in Lyssavirus history from the Chiroptera to the Carnivora
orders. J Virol. 2001 Sep; 75(17):8096–104. [PubMed: 11483755]
13. Banyard AC, Evans JS, Luo TR, Fooks AR. Lyssaviruses and bats: emergence and zoonotic threat.
Viruses. 2014 Aug; 6(8):2974–90. [PubMed: 25093425]
14. Dyer JL, Yager P, Orciari L, Greenberg L, Wallace R, Hanlon CA, et al. Rabies surveillance in the
United States during 2013. J Am Vet Med Assoc. 2014 Nov 15; 245(10):1111–23. [PubMed:
25356711]
15. Johnson N, Aréchiga-Ceballos N, Aguilar-Setien A. Vampire bat rabies: ecology, epidemiology
and control. Viruses. 2014:1911–28. [PubMed: 24784570]
16. Mayen F. Haematophagous bats in Brazil, their role in rabies transmission, impact on public health,
Author Manuscript
livestock industry and alternatives to an indiscriminate reduction of bat population. J Vet Med B
Infect Dis Vet Public Health. 2003; 50(10):469–72. [PubMed: 14720182]
17. Streicker DG, Recuenco S, Valderrama W, Gomez Benavides J, Vargas I, Pacheco V, et al.
Ecological and anthropogenic drivers of rabies exposure in vampire bats: implications for
transmission and control. Proc Royal Soc B Biol Sci. 2012 Jul 26; 279(1742):3384–92.
18. Stoner-Duncan B, Streicker DG, Tedeschi CM. Vampire bats and rabies: toward an ecological
solution to a public health problem. PLoS Negl Trop Dis. 2014; 8(6):e2867. [PubMed: 24945360]
19. Muller T, Freuling CM, Wysocki P, Roumiantzeff M, Freney J, Mettenleiter TC, et al. Terrestrial
rabies control in the European Union: historical achievements and challenges ahead. Vet J. 2015;
203(1):10–7. [PubMed: 25466578]
20. Slate D, Algeo TP, Nelson KM, Chipman RB, Donovan D, Blanton JD, et al. Oral rabies
vaccination in North America: opportunities, complexities, and challenges. PLoS Negl Trop
Diseases. 2009; 3(12):e549–e.
21. Weyer J, Rupprecht CE, Nel LH. Poxvirus-vectored vaccines for rabies–a review. Vaccine. 2009
Author Manuscript
Nov; 27(51):7198–201. [PubMed: 19925953]

22. Almeida MF, Martorelli LF, Aires CC, Barros RF, Massad E. Vaccinating the vampire bat
Desmodus rotundus against rabies. Virus Res. 2008; 137(2):275–7. [PubMed: 18761044]
23. Aguilar-Setién A, Leon YC, Tesoro EC, Kretschmer R, Brochier B, Pastoret PP. Vaccination of
vampire bats using recombinant vaccinia-rabies virus. J Wildl Dis. 2002; 38(3):539–44. [PubMed:
12243138]
24. Setien AA, Brochier B, Tordo N, De Paz O, Desmettre P, Peharpre D, et al. Experimental rabies
infection and oral vaccination in vampire bats (Desmodus rotundus). Vaccine. 1998; 16(11-12):
1122–6. [PubMed: 9682368]
25. Baxby D. Safety of recombinant vaccinia vaccines. Lancet. 1991; 337(8746):913.
26. Rocke, TE., Kingstad-Bakke, B., Berlier, W., Osorio, JE. Vaccines (Basel). 2014. A recombinant
raccoon poxvirus vaccine expressing both yersinia pestis F1 and truncated V antigens protects
animals against lethal plague; p. 772-84.
27. Tripp DW, Rocke TE, Streich SP, Abbott RC, Osorio JE, Miller MW. Apparent field safety of a
raccoon poxvirus-vectored plague vaccine in free-ranging prairie dogs (Cynomys spp.), Colorado,
Author Manuscript
USA. J Wildl Dis. 2015; 51(2):401–10. [PubMed: 25588006]

28. Herman, Y. Isolation and characterization of a naturally occuring poxvirus of raccoons. In: Kallio,
RE., editor. Bacteriological Proceedings of the 64th Annual Meeting of the American Society for
Microbiology; 1964 May 3–7; Washington, D.C.. American Society for Microbiology; 1964. p.
117
29. Osorio JE, Frank RS, Moss K, Taraska T, Powell T, Stinchcomb DT. Raccoon poxvirus as a
mucosal vaccine vector for domestic cats. J Drug Target. 2003; 11(8-10):463–70. [PubMed:
15203914]

30. Esposito, JJ., Chandler, FW., Baer, GM. Vaccines. Cold Spring Harbor: Spring Harbor Laboratory
Press; 1989. Oral immunization of animals with raccoon poxvirus expressing rabies virus
Author Manuscript
glycoprotein; p. 403-8.
31. DeMartini JC, Bickle HM, Brodie SJ, He BX, Esposito JJ. Raccoon poxvirus rabies virus
glycoprotein recombinant vaccine in sheep. Arch Virol. 1993; 133(1-2):211–22. [PubMed:
8240013]
32. Hwa SH, Iams KP, Hall JS, Kingstad BA, Osorio JE. Characterization of recombinant raccoonpox
vaccine vectors in chickens. Avian Dis. 2010; 54(4):1157–65. [PubMed: 21313834]
33. Rocke TE, Smith SR, Stinchcomb DT, Osorio JE. Immunization of black-tailed prairie dog against
plague through consumption of vaccine-laden baits. J Wildl Dis. 2008; 44(4):930. [PubMed:
18957649]
34. Esposito JJ, Knight JC, Shaddock JH, Novembre FJ, Baer GM. Successful oral rabies vaccination
of raccoons with raccoon poxvirus recombinants expressing rabies virus glycoprotein. Virology.
1988 Jul 1; 165(1):313–6. [PubMed: 3291388]
35. Mayr A, Stickl H, Müller HK, Danner K, Singer H. The smallpox vaccination strain MVA: marker,
genetic structure, experience gained with the parenteral vaccination and behavior in organisms
Author Manuscript
with a debilitated defence mechanism (author's transl). Zentralbl Bakteriol B. 1978 Dec; 167(5-6):
375–90. [PubMed: 219640]
36. Antoine G, Scheiflinger F, Dorner F, Falkner FG. The complete genomic sequence of the modified
vaccinia Ankara strain: comparison with other orthopoxviruses. Virology. 1998; 244(2):365–96.
[PubMed: 9601507]
37. Gilbert SC. Clinical development of Modified Vaccinia virus Ankara vaccines. Vaccine. 2013;
31(39):4241–6. [PubMed: 23523410]
38. Gherardi MM. Recombinant poxviruses as mucosal vaccine vectors. J Gen Virol. 2005 Nov 1;
86(11):2925–36. [PubMed: 16227213]
39. Earl, PL., Moss, B., Wyatt, LS., Carroll, MW. Generation of recombinant vaccinia viruses. In:
Ausubel, FM., et al., editors. Current protocols in molecular biology.
40. Contag CH, Spilman SD, Contag PR, Oshiro M, Eames B, Dennery P, et al. Visualizing gene
expression in living mammals using a bioluminescent reporter. Photochem Photobiol. 1997; 66(4):
523–31. [PubMed: 9337626]
Author Manuscript
41. Killington H. Virol Meth Manual. 1996

42. Smith JS, Yager PA, Baer GM. A rapid reproducible test for determining rabies neutralizing
antibody. Bull. World Health Organ. 1973; 48(5):535–41.
43. Kuzmin IV, Niezgoda M, Franka R, Agwanda B, Markotter W, Beagley JC, et al. Lagos bat virus
in Kenya. J Clin Microbiol. 2008; 46(4):1451–61. [PubMed: 18305130]
44. Fox J. The R Commander: a basic statistics graphical user interface to R. J Stat Softw. 2005:1–42.
45. Wiktor TJ, Macfarlan RI, Reagan KJ, Dietzschold B, Curtis PJ, Wunner WH, et al. Protection from
rabies by a vaccinia virus recombinant containing the rabies virus glycoprotein gene. Proc Natl
Acad Sci U S A. 1984; 81(22):7194–8. [PubMed: 6095272]
46. Henderson H, Jackson F, Bean K, Panasuk B, Niezgoda M, Slate D, et al. Oral immunization of
raccoons and skunks with a canine adenovirus recombinant rabies vaccine. Vaccine. 2009; 27(51):
7194–7. [PubMed: 19925952]
47. Rupprecht CE, Wiktor TJ, Johnston DH, Hamir AN, Dietzschold B, Wunner WH, et al. Oral
immunization and protection of raccoons (Procyon lotor) with a vaccinia-rabies glycoprotein
recombinant virus vaccine. Proc Natl Acad Sci U S A. 1986; 83(20):7947–50. [PubMed: 3464010]
Author Manuscript
48. Rupprecht CE, Dietzschold B, Cox JH, Schneider LG. Oral vaccination of raccoons (Procyon
lotor) with an attenuated (SAD-B19) rabies virus vaccine. J Wildl Dis. 1989 Oct; 25(4):548–54.
[PubMed: 2810555]
49. Follmann E, Ritter D, Swor R, Dunbar M, Hueffer K. Preliminary evaluation of Raboral V-RG(R)
oral rabies vaccine in Arctic foxes (Vulpes lagopus). J Wildl Dis. 2011; 47(4):1032–5. [PubMed:
22102679]
50. Brown LJ, Rosatte RC, Fehlner-Gardiner C, Bachmann P, Ellison JA, Jackson FR, et al. Oral
vaccination and protection of red foxes (Vulpes vulpes) against rabies using ONRAB, an
adenovirus-rabies recombinant vaccine. Vaccine. 2014; 32(8):984–9. [PubMed: 24374501]

51. Vitasek J. A review of rabies elimination in Europe. Vet Med Czech. 2004; 5:171–85.
52. Turmelle AS, Allen LC, Schmidt-French BA, Jackson FR, KunzTH, McCracken GF, et al.
Author Manuscript
Response to vaccination with a commercial inactivated rabies vaccine in a captive colony of

Brazilian free-tailed bats (Tadarida brasiliensis). J Zoo Wildl Med. 2010; 41(1):140–3. [PubMed:
20722268]
53. Carter G, Leffer L. Social grooming in bats: are vampire bats exceptional? PLoS ONE. 2015;
10:e0138430. http://dx.doi.org/10.1371/journal.pone.0138430. [PubMed: 26445502]
54. Mayes BC, Wilson PJ, Oertli EH, Hunt PR, Rohde RE. Epidemiology of rabies in bats in Texas
(2001—2010). J Am Vet Med Assoc. 2013; 243(8):1129–37. [PubMed: 24094260]
55. Linhart SB, Flores Crespo R, Mitchell GC. Control of vampire bats by means of an anticoagulant.
Bol Oficina Sanit Panam. 1972; 73(2):100–9. [PubMed: 4262434]
Author Manuscript
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Author Manuscript
Fig. 1.
Luminescent images for bats given attenuated poxviral vectors, raccoon poxvirus (RCN) or
modified vaccinia Ankara (MVA) via intramuscular (IM) (A) or oronasal (ON) routes (B).
Images were taken with the IVIS 200 Biophotonic imager and analyzed using the Living
Image software. For each vector group, the scale of luminescence is given in photons/
second/cm2/steridian (p/s/cm2/sr) which has been standardized to compare individuals over
time in days post infection (DPI).
Author Manuscript

Author Manuscript
Author Manuscript
Fig. 2.
Average luciferase expression per vector by route over time for the four groups of bats given
luciferase-expressing constructs. Luminescence is given in photons/second/cm2/steridian
(p/s/cm2/sr). Luminescence was significantly higher (P = 0.028) for those receiving raccoon
poxvirus (RCN) than modified vaccinia Ankara (MVA) and also higher (P = 0.032) for those
administered virus by the intramuscular (IM) route compared to the oronasal (ON) route.
Author Manuscript
Author Manuscript

Author Manuscript
Author Manuscript
Fig. 3.
Average luciferase expression after oronasal (ON) exposure to raccoon poxvirus (RCN)
initially and after re-exposure. Luminescence is given in photons/ second/cm2/steridian
(p/s/cm2/sr). No significant difference (P = 0.33) was detected in luminescence when
compared to initial exposure through 5 days post infection.
Author Manuscript
Author Manuscript

USGS DEFUSE 2021 006245 Combined Records Redacted

Uploaded by

Copyright:

Available Formats

USGS DEFUSE 2021 006245 Combined Records Redacted

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

USGS DEFUSE 2021 006245 Combined Records Redacted

Uploaded by

Copyright:

Available Formats

United States Department of the Interior

In Reply Refer To: December 5, 2023

Ms. Emily Anne Kopp

Dear Ms. Kopp:

Records maintained by U.S. Geological Survey by Tonie Rocke ([email protected]), a

Exemption 3 allows the withholding of information protected by a nondisclosure provision in a

Exemption 5 allows an agency to withhold “inter-agency or intra-agency memorandums or

Deliberative Process Privilege

DOI FOIA/Privacy Act Appeals Office Contact Information

Department of the Interior

Office of Government Information Services

College Park, Maryland 20740-6001

Re: Form 9-3090 - EcoHealth Alliance

Please find the signed form attached.

Please let me know if you need anything else.

USGS Ethics Office

12210 Sunrise Valley Drive, MS 603

Form 9-3090 - EcoHealth Alliance

Re: [EXTERNAL] RE: DEFUSE documents as submitted

Sent from my Verizon, Samsung Galaxy smartphone

460 West 34th Street – 17th Floor

New York, NY 10001

From: Luke Hamel [mailto:[email protected]]

Attached files include:

(b) (6) (direct)

Fwd: [EXTERNAL] DEFUSE documents as submitted

FYI Tonie has submitted the PREEMPT grant.

Sent from my Verizon, Samsung Galaxy smartphone

-------- Original message --------

---------- Forwarded message ----------

Attached files include:

Technical and Management Proposal (Vol. I)

(b) (6) (direct)

Teaming Overview and Objectives

Dr. Jerome Unidad; email: [email protected]; telephone: 650-812-4209

First (rough) draft of the DARPA abstract - Project DEFUSE

Some important points:

Abstract Submission Requirements:

A. Cover Sheet (does not count towards page limit):

B. Executive Summary Slide:

1. What is the proposed work attempting to accomplish or do?

2. How is it done today? And what are the limitations?

3. What is innovative in your approach and how does it compare to current

6. How much will it cost and how long will it take?

Overview Commented [PD2]: I know this is too long. I’ll edit

Subcontract #1: University of North Carolina Medical School

Subcontract #2: USGS National Wildlife Health Center

Subcontract #3: Duke NUS, Singapore

Subcontract #4: Wuhan Institute of Virology, China

1) 5.1.1. Overall Scientific and Technical Merit

2) 5.1.2. Potential Contribution and Relevance to the DARPA Mission

3) 5.1.3. Cost Realism

RE: First (rough) draft of the DARPA abstract - Project DEFUSE

Linfa (Lin-Fa) WANG, PhD FTSE

From: Peter Daszak [mailto:[email protected]]

Some important points:

Abstract Submission Requirements:

A. Cover Sheet (does not count towards page limit):

B. Executive Summary Slide: