TYPE Original Research

PUBLISHED 08 January 2024

DOI 10.3389/fcimb.2023.1285584

Anti-obesity effects by parasitic

OPEN ACCESS nematode (Trichinella spiralis)
EDITED BY
Ivana Klun,
University of Belgrade, Serbia
total lysates
REVIEWED BY
Oscar Medina-Contreras,
Shin Ae Kang 1 and Hak Sun Yu 1,2*
Mexico Children’s Hospital, Mexico 1
Department of Parasitology and Tropical Medicine, School of Medicine, Pusan National
Chia-Kwung Fan,
University, Yangsan, Republic of Korea, 2 Research Institute for Convergence of Biomedical
Taipei Medical University, Taiwan
Science and Technology, Pusan National University Yangsan Hospital, Yangsan,
*CORRESPONDENCE Republic of Korea
Hak Sun Yu
[email protected]

RECEIVED 30 August 2023 Background: Obesity is an inducible factor for the cause of chronic diseases
ACCEPTED 11 December 2023 and is described by an increase in the size and number of adipocytes that
PUBLISHED 08 January 2024
differentiate from precursor cells (preadipocytes). Parasitic helminths are the
CITATION
strongest natural trigger of type 2 immune system, and several
Kang SA and Yu HS (2024) Anti-obesity
effects by parasitic nematode studies have showed that helminth infections are inversely correlated with
(Trichinella spiralis) total lysates. metabolic syndromes.
Front. Cell. Infect. Microbiol. 13:1285584.
doi: 10.3389/fcimb.2023.1285584
Methodology/Principal findings: To investigate whether helminth-derived
COPYRIGHT
© 2024 Kang and Yu. This is an open-access molecules have therapeutic effects on high-fat diet (HFD)-induced obesity, we
article distributed under the terms of the isolated total lysates from Trichinella spiralis muscle larvae. We then checked
Creative Commons Attribution License (CC BY).
the anti-obesity effect after intraperitoneal administration and intraoral
The use, distribution or reproduction in other
forums is permitted, provided the original administration of total lysate from T. spiralis muscle larvae in a diet-induced
author(s) and the copyright owner(s) are obesity model. T. spiralis total lysates protect against obesity by inhibiting the
credited and that the original publication in
this journal is cited, in accordance with
proinflammatory response and/or enhancing M2 macrophages. In addition, we
accepted academic practice. No use, determined the effects of total lysates from T. spiralis muscle larvae on anti-
distribution or reproduction is permitted obesity activities in 3T3-L1 preadipocytes by investigating the expression levels
which does not comply with these terms.
of key adipogenic regulators, including peroxisome proliferator-activated
receptor gamma (PPARg), CCAAT-enhancer-binding protein alpha (C/EBPa)
and adipocyte protein 2 (aP2). Oil Red O staining showed that the total lysates
from T. spiralis muscle larvae decreased the differentiation of 3T3-L1
preadipocytes by decreasing the number of lipid droplets. In addition, the
production levels of proinflammatory cytokines IL-1b, IL-6, IFN-g and TNF-a
were examined by enzyme-linked immunosorbent assay (ELISA). T. spiralis
total lysates decreased intracellular lipid accumulation and suppressed the
expression levels of PPARg, C/EBPa and aP2.

Conclusion/Significance: These results show that T. spiralis total lysate

significantly suppresses the symptoms of obesity in a diet- induced obesity
model and 3T3-L1 cell differentiation and suggest that it has potential for
novel anti-obesity therapeutics.

KEYWORDS

obesity, Trichinella spiralis, adipocytes, adipogenesis, M1 macrophage

Frontiers in Cellular and Infection Microbiology 01 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

Introduction Materials and methods

Obesity is a prevalent health problem worldwide and can cause Mice
diverse diseases such as cardiovascular disease, type 2 diabetes and
cancer (Valenzuela et al., 2023). The prevail of obesity and the Six-week-old female C57BL/6 mice were purchased from Orient
number of patients with metabolic disorders induced by obesity are Bio, Inc. (Seongnam, Korea). The mice housed at a specific
increasing in most countries (Han and Lean, 2016) But, the pathogen-free facility at the Institute for Laboratory Animals of
development of anti-obesity medications progresses and some Pusan National University, where all animal studies were
have been come into market, most of these drugs have been conducted. In line with “The Act for the Care and Use of
withdrawn because of serious side effects (Scheen et al., 2023). Laboratory Animals” of the Ministry of Food and Drug Safety of
Thus, it is necessary to develop alternative medications to treat Korea, the Pusan National University Animal Care and Use
obesity without causing adverse effects. Committee registered and approved the experiments (approval
Adipogenesis is the process through which cells differentiate no. PNU- 2021-3149). They were bred in-house at the Pusan
into adipocytes. Pre-adipocytes transform maturing adipocytes with National University specific pathogen-free animal facility and
intracellular lipid accumulation (Cao et al., 2023). It is controlled by accommodated according to regulations. The animals were
pivotal adipogenic transcription factors such as CCAAT-enhancer- maintained at a relative humidity of 50–60% and temperature of
binding protein alpha (C/EBPa), and peroxisome proliferator 25°C ± 2°C under natural light and dark condition (12 h light-dark
activated receptor gamma (PPARg). C/EBPa and PPARg also cycle) with standard diet for 1 week prior to experimentation.
boost adipogenesis by inducing the expression of adipokines
including adipocyte fatty acid-binding protein (aP2) (Giby and
Ajith, 2014). Since adipocytes play a pivotal role in controlling Study design
adipokine secretion, which induces adipogenesis, elucidating the
molecular mechanisms that control adipogenesis is important for Mice were fed research diets, which were a normal low-fat diet
discovering anti-obesity therapy (Kiernan and MacIver, 2020). with 10 kcal% fat [LFD], or a high-fat diet with 60kcal% fat [HFD]
Trichinella spiralis is a zoonotic parasite that has broad (New Brunswick, NJ, USA) to induce obesity during 6weeks. We
mammalian host range and is responsible for the disease determined the effects of HFD-induced obesity after T. spiralis total
trichinellosis. T. spiralis plays an important role in immune lysates treatment. After 6 weeks, T. spiralis total lysates (50ug) was
regulation. Parasitic infection drives Th2-biased immune responses injected intraperitoneally [HFD+TS IP] or intraorally [HFD+TS
and upregulates regulatory T (Treg) cells. In a previous study, T. IO] once every 3 days for a period of 5 weeks in HFD group. The
spiralis infection activated type 2 immune responses, including M2 dietary treatments of LFD and HFD group were maintained
macrophages within the adipose tissue, which is important for throughout the experimental period (Figure 1).
ameliorating obesity (Kang et al., 2021). T. spiralis infection
ameliorated glucose and lipid metabolism and reduced lipid
accumulation in the liver and adipose tissues. Understandably, Preparation of Trichinella spiralis
instigating a T. spiralis infection in the process of developing total lysate
obesity-improving drugs would be highly dangerous as well as
unethical. Therefore, we wanted to check whether there was an T. spiralis was propagated as previously described (Kang et al.,
obesity-improving effect by isolating parasite-derived molecules (T. 2012). T. spiralis larvae were collected as described previously (Kang
spiralis total lysates). We also investigated the antiadipogenic effects et al., 2012). T. spiralis larvae were homogenized using a disposable
underlying the action of T. spiralis total lysates in 3T3-L1 adipocytes. Biomasher homogenizer (Nippi, Japan).

FIGURE 1
Experimental model. Schematic design illustrates the treatment of T. spiralis total lysates in a diet induced obesity model. HFD+TS IP, high-fat diet
and intraperitoneal treatment of total lysates; HFD+TS IO, high-fat diet and intraoral treatment of total lysates.

Frontiers in Cellular and Infection Microbiology 02 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

Measurement of body weight and used to determine the number of F4/80-positive cells, and CD11c or
food uptake CD206 surface expression was then determined from the
gated population.
Food intake and body weight were weighed weekly, and the
food was replaced weekly. The intake was measured by subtracting
the remaining food, including any spilled food, from a weighed RNA extraction and cDNA synthesis
aliquot every week.
Gene expression was analyzed as previously described. Briefly,
total RNA was isolated using TRIzol Reagent® (Invitrogen,
Measurement of lipids, glucose and insulin Burlington, ON, Canada). Quantitative reverse transcription-PCR
in the blood assays were performed by using SYBR™ Select Master Mix
(Thermo Fisher Scientific, Waltham, MA, USA) in a QuantStudio
Plasma total cholesterol, triglyceride, and glucose levels were 3 Real-Time PCR Instrument (Thermo Fisher Scientific). b- actin
measured using a Fuji Dri-Chem system (FUJIFILM Corp., Tokyo, was used as a reference gene. The primer sequences are listed
Japan). Plasma insulin levels were measured using a mouse insulin in Table 1.
enzyme-linked immunosorbent assay (ELISA) kit (SHIBAYAGI
Co., Ltd. Gunma, Japan). Plasma insulin levels were determined
by ELISA (mouse insulin ELISA, ALPCO, NH, USA). Isolation of adipocytes and stromal
vascular fraction from adipose tissue

Oral glucose tolerance test Gonadal white adipose tissues (gWAT) were collected from
infected and uninfected mice, minced, and digested for 1 h at 37°C
In addition, for OGTT, 16-hour fasted mice were administered in HEPES buffer (pH 7.4) containing 0.5 g/L type 1 collagenase from
20% aqueous glucose solution (fasting body mass (g) × 10 = volume Clostridium histolyticum (Sigma-Aldrich, St. Louis, MO, USA) and
(µL) 20% glucose solution) by gavage through a gastric tube (outer 2% (w/v) dialyzed bovine serum albumin (Fraction V; Sigma-
diameter 1.2 mm) that was inserted in the stomach. Blood samples Aldrich). Disaggregated adipose tissue was filtered through a
were collected at 0, 15, 30, 60, and 120 min after the administration 100 mm nylon mesh. The residue of the gonadal adipose tissue
of glucose. Blood glucose levels were measured using a glucometer homogenate was used to isolate the SVF cells for flow cytometry.
(Accu-Chek Active [Model GB] Kit; Roche Diabetes, Mannheim, The sample was centrifuged for 10 min at 350 g, the supernatant
Germany). The area under the curve (AUC) during OGTT
represents glucose levels. To estimate the baseline-corrected AUC,
TABLE 1 Primers used for realtime PCR.
basal glucose levels (time point 0) were taken away all subsequently
obtained blood glucose levels for each mouse individually, followed Primer sequence
by the calculation of the individual AUCs. Statistical analysis was
Ap2-F GATGCCTTTGTGGGAACCT
performed using Student’s two-tailed t-test.
Ap2-R CTGTCGTCTGCGGTGATTT

C/EBPa-F CAAGAACAGCAACGAGTACCG
Measurement of cytokine production
C/EBPa-R GTCACTGGTCAACTCCAGCAC

ELISA was used to measure the culture supernatants of the IL-6-F AGGATACCACTCCCAACAGACC

spleen using according to the manufacturer’s instructions IL-6-R AAGTGCATCATCGTTGTTCATACA

(eBioscience, San Diego, CA, USA). Serum concentrations of T
Leptin-F TGGCTTTGGTCCTATCTGTC
helper cell-derived cytokines IL-1b, IL-6 and TNF-a were
determined using a ELISA assay (eBioscience, San Diego, Leptin-R TCCTGGTGACAATGGTCTTG

CA, USAA). PPAR g-F GGAAGACCACTCGCATTCCTT-

PPAR g -R GTAATCAGCAACCATTGGGTCA

Flow cytometry Sirt1-F CGG CTA CCG AGG TCC ATA TAC

Sirt1-R CAG CTC AGG TGG AGG AAT TGT

To investigate macrophage polarization during infection, live
TNF-a-F TACTGAACTTCGGGGTGATTGGTCC
cells were isolated from the adipose tissue. The cell surfaces were
stained with FITC rat anti-mouse F4/80, PE rat anti-mouse CD11c TNF-a-R CAGCCTTGTCCCTTGAAGAGAACC

and APC rat anti-mouse CD206 antibodies (eBioscience) according b-actin -F CGTGCGTGACATCAAAGAGAA
to the manufacturer’s recommendations. During sample gating,
b-actin -R GCTCGTTGCCAATAGTGATGA
cells were first gated for macrophages. The macrophage gate was

Frontiers in Cellular and Infection Microbiology 03 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

was removed and the pellet was treated with ACK lysis buffer USA) at 4°C. After washing with TBST, the membranes were
(Fujisaka et al., 2009). incubated with horseradish peroxidase-conjugated secondary
antibodies at room temperature for 1 h. Proteins were detected
using an enhanced chemiluminescence reagent (GE Healthcare,
Cell culture Chicago, IL, USA).

Cells from SVF (5x106 cells/mL) were cultured in 5% CO2

incubator at 37°C for 24 hours in the presence or absence of
Statistical analysis
Ionomycin (5 mg/mL) and PMA (0.4 mg/mL). After incubation,
Statistical analysis was performed using GraphPad Prism software
the supernatant was collected and stored at -80°C until use.
(version 5.0; GraphPad, Inc., La Jolla, CA, USA), with Student’s t-test
Cytokine production were determined by ELISA.
or analysis of variance (ANOVA). Multivariate data analysis and group
differences were assessed using one-way or two-way ANOVA, followed
by Bonferroni’s post-hoc test. All experiments were conducted in
3T3-L1 cell differentiation
triplicates and showed similar results. The results are expressed as
the mean ± SD (standard deviation) from each experiment.
Mouse 3T3-L1 preadipocytes were purchased from ATCC,
Manassas, VI, USA. 3T3-L1 cells were cultured in Dulbecco’s
modified Eagle’s medium (DMEM) (Thermo Fisher Scientific) Results
containing 10% bovine calf serum (ATCC) and 1% penicillin/
streptomycin (Thermo Fisher Scientific) and maintained at 37°C in a Trichinella spiralis total lysates treatment
humidified atmosphere with 5% CO2. Cells were differentiated 2 days reduces obesity in HFD-fed obese mice
after confluence, and then were stimulated with DMEM (4.5 g/L
glucose) containing 10% fetal bovine serum (FBS) (Corning, To determine the effect of T. spiralis total lysates on HFD-
Corning, NY, USA), 1 g/mL insulin, 0.5 mM isobutylmethylxanthine induced obesity, C57BL/6 female mice were fed a HFD for 6 weeks
(IBMX), 1 mM dexamethasone, and 1, 5, or 10 µg of total lysate, or PBS to induce obesity. T. spiralis total lysate was administered either
(for control cells) for 2 days. On day 2, the differentiation medium was intraorally or intraperitoneally three times a week for five weeks
replaced with DMEM (4.5 g/L glucose) containing 10% FBS, 1 mg/mL (Figure 1). All the groups were assayed for body weight, food
insulin, and changed every two days from days two to ten. efficiency ratio [FER= total body weight gain (g)/total food intake
(g)], final fat mass, and blood biochemical parameters. Figure 2A
shows a protein electrophoresis image of T. spiralis total lysates.
Oil red O staining Several bands over 40 kDa were detected, but no single bands.
Figures 2B, C show photographs of representative mice from each
The Oil Red O staining protocol was modified from that described group (LFD, HFD, HFD+TS IP, and HFD+TS IO) after six weeks. As
by Pacifici et al. (Pacifici et al., 2020). The differentiated cells were expected, HFD feeding lead to a significant increase in body weight
washed with phosphate-buffered saline (PBS, pH 7.4, Sigma-Aldrich) and fat mass in the total lysate treatment group. However, significant
and fixed in 4% formalin (Sigma-Aldrich) for 20-30 min at room differences were observed in body and fat weight of mice treated with
temperature. The cells were then washed with double-distilled water T. spiralis total lysates (HFD+TS IP and HFD+TS IO) and non-
and incubated with 60% isopropanol for 5 min at room temperature treated HFD-fed mice (HFD) (*p < 0.005) (Figures 2D, E). According
(Sigma-Aldrich). After that, the cells were stained with Oil Red to the food efficiency ratio (FER) equation, a change in body weight
O solution (0.5 g/L, Sigma Aldrich) for 30 min at room temperature was the most important factor influencing the FER, as there were no
and washed completely with double-distilled water. Images were significant changes in the food intake of the various groups of mice.
acquired using an optical microscope. Oil Red O dye retained in the Thus, it is possible to apply the FER as an indicator; a small FER value
cells was eluted in pure isopropanol and quantified at 490 nm using a can denote obesity prevention. In our experiments, food intake did
microplate reader. not differ significantly between T. spiralis total lysate-treated and
non-treated HFD-fed mice. FER was significantly higher in the HFD-
fed mice than in the LFD-fed mice (***p < 0.001). T. spiralis total
Western blot analysis lysate-treated HFD-fed mice had significantly lower FER than non-
treated HFD-fed mice (*p < 0.005) (Figure 2F).
3T3-L1 adipocytes were lysed using PRO PREP™ Protein
Extraction Solution (iNtRON Biotechnology, Seangnam, Korea).
Proteins (30 µg) were separated on 10% sodium dodecyl sulfate Trichinella spiralis total lysates treatment
polyacrylamide gels (SDS-PAGEs). Next, proteins were transferred could ameliorate glucose and
to nitrocellulose membranes, blocked in 5% skim milk in TBST (10 lipid metabolism
mM Tris pH 8.0, 150 mM NaCl, and 0.05% Tween 20) for 1 h, and
incubated overnight with primary antibodies against PPARg, Obesity induces abnormal glucose and lipid metabolism. To
C/EBPa and actin (Cell Signaling Technology, Danvers, MA, assess glucose metabolism, we examined whether T. spiralis-

Frontiers in Cellular and Infection Microbiology 04 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

A B C

D E

F G

FIGURE 2
The effect of T. spiralis total lysates on body weight and food efficiency ratio (FER) in high-fat diet (HFD)-fed mice. Total lysates were isolated T.
spiralis muscle larvae. (A) Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) of total lysates from T. spiralis muscle larvae.
Obesity was induced in mice by feeding them a HFD for six weeks. The mice were then intraperitoneally injected with T. spiralis total lysate three
times per week for five weeks. (B) Images of representative mice from each group (LFD, HFD, HFD+TS IP, and HFD+TS IO) after five weeks. (C)
Representative image of gonadal adipose tissue. (D, E) Body weight and gonadal fat. (F) Food efficiency ratio (FER) = increased body weight (g)/food
intake (g). (G) Overnight-fasted mice were administered 20% glucose by gastric gavage. Blood samples were collected at 0, 15, 30, 60, 90, and
120 min. Blood glucose levels measured using a glucometer. (*; p < 0. 05, **; p < 0.01 ***; p < 0.001, n = 5 mice per group, three independent
experiments). LFD, low-fat diet; HFD, high-fat diet; HFD+TS IP, high-fat diet and intraperitoneal treatment of total lysates; HFD+TS IO, high-fat diet
and intraoral treatment of total lysates.

mediated attenuation of obesity improved the harmful effects of significantly decreased total cholesterol (Figure 3A), triglyceride
obesity. In a previous study, infection of T. spiralis ameliorated (Figure 3B) and insulin (Figure 3D) (*p < 0.005) levels in HFD-fed
glucose and lipid metabolism. In all groups of mice, maximum mice, however this difference was not significant for glucose
plasma glucose levels were reached 15 min after the glucose levels (Figure 3C).
challenge. In contrast, few glucose eliminations were monitored
between 15 and 30 min in high-fat diet–fed mice, suggesting severe
glucose intolerance. Glucose tolerance tests showed that when HFD Treatment of Trichinella spiralis affected
mice were challenged with glucose, they had higher blood glucose immune response in the HFD-fed
levels, whereas T. spiralis total lysate-treated mice showed improved obese mice
glucose tolerance at various time points in the tolerance test. The
60- and 120-minute insulin response to the intraorally glucose To evaluate the effects of T. spiralis treatment on cytokine
challenge were significantly weaken after high-fat feeding compared profiles, ELISA was conducted for IL-1b, L-6, TNF-a, IL-4, IL-17A,
with those in T. spiralis total lysate-treated mice (*p < 0.001) and IL-10. Figure 4A shows the levels of the six cytokines in the
(Figure 2G). T. spiralis total lysates-treated mice showed spleen. As expected, the HFD group mice had higher

Frontiers in Cellular and Infection Microbiology 05 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

A B

C D

FIGURE 3
The Effect of T. spiralis total lysates on serum lipid profiles, glucose and insulin levels of mice fed an HFD. (A) Serum total cholesterol. (B) Serum
triglyceride. (C) Serum glucose. (D) Serum insulin. To evaluate the effects of T. spiralis total lysates on serum lipid profiles, glucose and insulin. The
serum biochemical parameters were assessed in mice of each group (LFD, HFD, HFD+IP, HFD+IO). (*; p < 0.05, **; p < 0.01, ***; p < 0.001, n = 5
mice/group, three independent experiments) LFD, low-fat diet; HFD, high-fat diet; HFD+TS IP, high-fat diet and intraperitoneal treatment of total
lysates; HFD+TS IO, high-fat diet and intraoral treatment of total lysates.

proinflammatory cytokines such as TNF-a, IL-1b and IL-6. Treatment of Trichinella spiralis induces
Moreover, T. spiralis total lysates-treated mice (HFD+TS IP, HFD the ‘anti-inflammatory’ M2 levels by a
+TS IO) had significantly decreased proinflammatory cytokines, balance transit in M1/M2 macrophage ratio
such as IL-1b and TNF-a, compared to the HFD group (*p < 0.001).
In contrast, the production of the Th2 cytokine (IL-4), Treg-related Obesity is related to macrophage accumulation in the adipose
cytokines (IL-10) and Th17 cytokines (IL-17A) was not significantly tissue. The number and population of macrophages in adipose tissue
increased compared to that in the HFD group. We check the m- differs according to the metabolic state. We assessed whether helminth-
RNA expression level of adipokines including IL-6, TNF-a and derived molecules induced an imbalance in the ratio of M1/M2
leptin in gonadal white adipose tissue (Figure 4B). The results macrophages in gonadal fat tissue. The results from our FACS
showed that adipokines including IL-6, TNF-a and leptin are analysis showed that HFD feeding of untreated obese mice led to an
significantly increased due to diet- induced obesity, but the increase in M1 cells (F4/80+ CD11C+) and this increase was prevented
increased adipokines are significantly decreased due to T. spiralis by treatment with T. spiralis total lysate (***p < 0.01) (Figures 5A, B). In
total lysates treatment. contrast, HFD feeding of non-treated obese mice lead to decreased M2
We used an ELISA assay to measure the levels of T helper cell- cells (F4/80+ CD206+) and T. spiralis total lysate treatment group (HFD
derived cytokines IL-1b, IL-6 and TNF-a in serum (Figure 4C). +TS IP, HFD+TS IO) induced increase of M2 macrophages (F4/80+
HFD mice exhibit increased levels of systemic (IL-1b, IL-6 and CD206+) in the gonadal fat tissue (**p < 0.05). These results suggest
TNF-a) inflammatory cytokines. We detected a significant decrease that treatment with T. spiralis total lysate may protect against diet-
in immune and AT-mediated cytokines in the group of mice fed induced obesity by promoting macrophage polarization to anti-
HFD compared to those treated T. spiralis total lysates. These data inflammatory M2 macrophages in the gonadal fat of obese mice.
suggest that T. spiralis total lysates downregulate the chronic Adipose tissues also produce cytokines known as adipokines that are
inflammation, at least in part decreasing circulating levels of involved in the development of metabolic diseases (Hotamisligil, 2017).
systemic cytokines. These results suggest an evident impact of Because of the importance of these cytokines in metabolism, we
parasite-derived molecule treatment on cytokine production analyzed their production in gWAT. SVF cells were isolated from
profiles and effector T cell differentiation in HFD-fed mice by the adipocytes, cultured for 24 h, and cytokine levels were measured in
suppressing Th1 cell responses. the supernatants. We found no difference in the production of Th2

Frontiers in Cellular and Infection Microbiology 06 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

FIGURE 4
The production of cytokines in the spleen and the m-RNA expression levels in white adipose tissue. (A) Cytokine production was measured in
lymphocytes isolated from the mouse spleen. Lymphocytes were activated using anti-CD3 antibody. The wells were incubated with 0.5 mg/mL of
anti-CD3 for 16 h at 4 °C, and then the lymphocytes isolated from the spleen were added to the well and incubated for 3 days. After activation, the
cytokine concentrations in the supernatant were measured using ELISA kits in accordance with the manufacturer’s instructions. (B) RNA isolated
form gonadal white adipose tissue. Relative mRNA expression confirmed the expression of adipokine genes. The results show that T. spiralis total
lysates treatment clearly decreased the expression of IL-6, leptin and TNF-a, as well as the mRNA of their target genes, including aP2. (C) Serum
concentrations of T helper cell-derived cytokines IL-1b, IL-6 and TNF-a were determined using using ELISA kits in accordance with the
manufacturer’s instructions. HFD induction increases the secretion of systemic cytokines into the serum. T. spiralis total lysates treatment
significantly decreased the expression of IL-1b, IL-6 and TNF-a. Bars represent the means ± SD from three independent experiments. (*; p < 0. 05,
** p < 0.01 *** p < 0.001, n = 5 mice/group, three independent experiments) LFD, low-fat diet; HFD, high-fat diet; HFD+TS IP, high-fat diet and
intraperitoneal treatment of total lysates; HFD+TS IO, high-fat diet and intraoral treatment of total lysates.

cytokines (IL-4), Th17 cytokine (IL-17A) and anti-inflammatory lipid droplets. Especially, these histopathological changes were
cytokine (TGF-b) by SVF cells when comparing HFD and T. spiralis attenuated by T. spiralis total lysate (Figure 7B). Hepatic H&E
total lysates treatment group (data not shown). On the other hand, the staining showed that the high fat diet increased hepatocellular
production of proinflammatory adipocytokines like IL-6 and TNF-a, vacuolation due to cellular lipid accumulation, enlarged hepatocytes,
by SVF cells, was increased in the HFD group when compared to T. shifted nuclei toward the plasma membrane, and narrowed sinusoidal
spiralis total lysates treatment group (HFD+TS IP, HFD+TS IO) channels. In summary, we suggest that treatment with T. spiralis total
(Figure 6). These data suggest that the effect of T. spiralis total lysates lysate could regulate diet-induced lipid accumulation in white adipose
treatment on metabolic parameters might be associated with a tissue and the liver, which could reduce the risk of fatty liver disease and
reduction in pro-inflammatory cytokines rather than the production excessive adipocyte lipid accumulation, which could induce severe
of anti-inflammatory or homeostatic adipocytokines. hepatic steatosis.

Liver histopathology Trichinella spiralis total lysates regulates

3T3-L1 differentiation
Histopathological analysis of the liver was assessed by hematoxylin
and eosin (H&E) staining (Figure 7A). Hepatic H&E staining revealed To investigate whether T. spiralis total lysates regulate
that HFD increased hepatocellular vacuolation and the frequency of adipocyte maturation, the differentiation of 3T3-L1 cells was

Frontiers in Cellular and Infection Microbiology 07 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

FIGURE 5
Expression of M1 adipose tissue macrophages (F40/80+CD11c+) and M2 adipose tissue macrophages (F40/80+CD206c+). To evaluate the
population of macrophages after the administration of T. spiralis total lysate (IO and intraperitoneal injections), we evaluated the adipose tissue
macrophage marker (CD11c+, CD206+) levels in the adipose tissue macrophages of mice. Gonadal adipose tissue from mice was digested with
collagenase, and adipose tissue macrophages were isolated. Cells were stained with FITC rat anti-mouse F4/80, PE rat anti-mouse CD11c, and APC
rat anti-mouse CD206 antibodies. (A) After staining, the plots indicate the expression levels of the proinflammatory M1 adipose tissue macrophage
marker (CD11c+) and M2 adipose tissue macrophage marker (CD206+) in gated F4/80 positive cells. (B). (** p < 0.01, *** p < 0.05, n = 5 mice/
group, three independent experiments). LFD, low-fat diet; HFD, high-fat diet; HFD+TS IP, high-fat diet and intraperitoneal treatment of total lysates;
HFD+TS IO, high-fat diet and intraoral treatment of total lysates.

induced, and the lipids intracellular storage was monitored by regulating adipocyte differentiation, which may highly
performing Oil Red O staining on day 10. Treatment with T. contribute to reduced adipose cell mass accumulation.
spiralis total lysates significantly reduced lipid accumulation at 1,
5, 10 mg, compared with control cells (Figure 8A). It was
confirmed by measuring the absorbance of Oil Red O at 490 Trichinella spiralis total lysates exerts anti-
nm. Lipid accumulation in 3T3-L1 cells was significantly inflammatory effects
decreased by 35% following T. spiralis total lysates, compared
to the control (p < 0.01) (Figures 8B, C). Taken together, these Adipogenesis is involved in enhancing the proinflammatory
results highlight the related ability of T. spiralis total lysate in state (Okuno et al., 2018). We evaluated whether T. spiralis total

FIGURE 6
Cytokine production of in the SVFs. Cytokine production was measured in lymphocytes isolated from the stromal vascular fraction of the gonadal
white adipose tissue (gWAT). Cells from SVF (5x106 cells/mL) were cultured in 5% CO2 incubator at 37°C for 24 hours in the presence or absence of
Ionomycin (5 mg/mL) and PMA (0.4 mg/mL). After incubation, the supernatant was collected and stored at -80°C until use. Cytokine production
were determined by ELISA. (*; p < 0. 05, ** p < 0.01 *** p < 0.001, n = 5 mice/group, three independent experiments). LFD, low-fat diet; HFD, high-
fat diet; HFD+TS IP, high-fat diet and intraperitoneal treatment of total lysates; HFD+TS IO, high-fat diet and intraoral treatment of total lysates.

Frontiers in Cellular and Infection Microbiology 08 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

FIGURE 7
Histopathological alterations in the liver of mice from each group. Histopathological alterations in the livers of mice in each group. Hematoxylin and
eosin (H&E) staining of the liver (200× magnification). Arrows indicate lipid droplets. Scale bar = 50 µm. (A) Representative images of one section per
mouse are shown (B). Area of lipid droplets was quantified by microscopy (***p < 0.001, n = five mice/group, in three independent experiments).
LFD, low-fat diet; HFD, high-fat diet; HFD+TS IP, high-fat diet and intraperitoneal treatment of total lysates; HFD+TS IO, high-fat diet and intraoral
treatment of total lysates.

lysate reduced the proinflammatory state typically of adipocyte Trichinella spiralis total lysates weaken
differentiation. In particular, we detected the levels of adipogenesis by controlling the C/EBPa
proinflammatory cytokine such as IL-1b, IL-6, IFN-g, and TNF- and Sirt1/PPARg pathway
a in supernatants of fully differentiated adipocytes treated with T.
spiralis total lysates. Although they did not decrease in a To investigate the molecular mechanisms underlying the
concentration-dependent manner, all cytokine (IL-1b, IL-6, antiadipogenic effect of T. spiralis total lysates, we evaluated
IFN-g, TNF-a) levels were significantly reduced by T. spiralis mRNA expression levels of C/EBPa, and PPARg as key
total lysates (p < 0.01) compared to those in control cells. We regulatory factors of adipogenesis (Jackson et al., 2017). As
found no difference in the production of other cytokines (IL-4, expected, after 10 days, T. spiralis total lysates treatment during
IL-10, IL-17A) when comparing differentiation and T. spiralis cellular differentiation significantly decreased expression of PPARg
total lysates treatment group (data not shown) (Figure 9). T. and C/EBPa, compared to control cells (Figure 10). In particular,
spiralis total lysates may contribute to enhancing the changes in we examined PPARg and C/EBPa protein levels in completely
obesity-induced systemic conditions through their anti- differentiated adipocytes treated with T. spiralis total lysates. PPARg
inflammatory effect. and C/EBPa levels were significantly reduced by T. spiralis total

Frontiers in Cellular and Infection Microbiology 09 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

B C

FIGURE 8
The effects of T. spiralis total lysates on adipocyte differentiation of 3T3-L1 cells. Preadipocyte 3T3-L1 cells were induced to differentiate by the
addition of MDI (IBMX, DEX, and insulin). 3T3-L1 cells were treated with 1, 5, or 10 mg T. spiralis total lysates during differentiation. (A) The effect of
T. spiralis total lysates on lipid accumulation in 3T3-L1 adipocytes. Oil Red O staining images of 3T3-L1 adipocytes at the terminal stage of
differentiation. (B) Oil Red O was extracted from cells with 100% isopropanol and absorbance was determined spectrophotometrically at 490 nm.
(C) 3T3-L1 adipocytes positive for Oil Red O staining were quantified. Scale bars represent 100 mm. (*; p < 0. 05, **; p < 0.01, n = 4 samples per
group, three independent experiments). NC, negative control, undifferentiation; PC, positive control, differentiation; TS 1, treatment of T. spiralis total
lysates 1 µg; TS 5, treatment of T. spiralis total lysates 5 µg; TS 10, treatment of T. spiralis total lysates 10 µg.

FIGURE 9
Effects of T. spiralis total lysates on the levels of IL-1b, IL-6, IFN-g, and TNF-a in 3T3-L1 Adipocytes. Cytokines were detected in culture supernatants
by ELISA. The cytokine concentrations in the supernatants of 3T3L1 cells were measured using ELISA kits in accordance with the manufacturer’s
instructions. Values are expressed as mean ± SD. As expected, the differentiation group had higher proinflammatory cytokine such as IL-1b, IL-6,
INF-g and TNF-compared to non-differentiation group. Treatment of T. spiralis total lysates were significantly reduced proinflammatory cytokine
such as IL-1b, IL-6, INF-g and TNF-(*; p < 0. 05, ** p < 0.01, *** p < 0.001, n = 4 samples per group, three independent experiments). NC, negative
control, undifferentiation; PC, positive control, differentiation; TS 1, treatment of T. spiralis total lysates 1 µg; TS 5, treatment of T. spiralis total lysates
5 µg; TS 10, treatment of T. spiralis total lysates 10 µg.

Frontiers in Cellular and Infection Microbiology 10 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

lysates compared to control cells in a concentration dependent et al., 2014; Kang et al., 2019; Kang and Yu, 2021; Kang et al., 2021;
manner (Figure 11) (p < 0.05). In addition, inhibition in adipocyte Park et al., 2022). Moreover, parasite-derived excretory-secretory
differentiation was also evaluated by measuring aP2 levels, which products can suppress pro-inflammatory responses in vivo and in
are specific markers of adipose tissue differentiation (Ertunc et al., vitro (34, 36). Recently, we found that parasitic infections ameliorated
2015; Palhinha et al., 2019). T. spiralis total lysates significantly diet-induced obesity in mice (Kang et al., 2021).
reduced the levels of aP2, confirming the effect of T. spiralis total The relationship between the metabolism and immune response
lysates as an antiadipogenic compound (Figure 10). Particularly, has become an important issue. Adipose tissue is a major immune
Sirt1 inactivation or deletion induces metabolic dysfunction and an organ in metabolism. It has been shown that changes in the metabolic
increase in adipose tissue (Chalkiadaki and Guarente, 2012). state of an individual later result in changes in the immune balance.
Accordingly, a significant improvement in Sirt1 expression was Obesity mainly weaken Th2 responses, while strengthening type 1
present following T. spiralis total lysates (p < 0.05), compared to inflammatory responses. Whereas, hunger and malnutrition result in
untreated cells, suggesting that the antiadipogenic effect of T. a type 2 biased immune response (Schmidt et al., 2022).
spiralis total lysates may be mediated by the Sirt1/PPARg Th2 cells are beneficial to the homeostatic environment of
pathway. Taken together, these results highlight the role of T. adipose tissue in lean individuals. A question may be raised as to
spiralis total lysates in reducing adipocyte differentiation, which whether the induction of Th2 cells during obesity has an effect in
may markedly reduce the accumulation of adipose cell mass. improving obesity. Several studies reveals that helminth infections to
induce a Th2 and regulatory condition that may impact the
seriousness of irrelevant inflammation and illness (Ryan et al., 2020).
Discussion Previous studies, including ours, have shown that parasitic
infection changes the differentiation of adipose tissues and
Parasites have evolved to regulate the host immune system and metabolism in mice (Lu et al., 2020). Based on our previous data
tissue repair responses to induce survival by modulating from murine models, T. spiralis infection significantly induces Th2
inflammation that would otherwise induce worm expulsion immune response and M2 macrophage polarization, which
(Gomes et al., 2016). Parasitic infections generally drive a type 2 ameliorates diet-induced obesity. Several studies have revealed
immune response, thereby maintaining an anti-inflammatory that infection of diet-induced obese mice with Heligmosomoides
immune microenvironment and improving host metabolic diseases polygyrus Schistosoma mansoni and Nippostrongylus brasiliensis
including obesity (van der Zande et al., 2019). Our research group has alleviates whole-body glucose tolerance and insulin sensitivity
focused on the infective immunity of T. spiralis for a long time. We (Weng et al., 2007; Yang et al., 2013; Su et al., 2018). These
previously reported the accumulation of immunomodulatory cells in results show an inverse relation between helminth infection and
the host following infection with this parasite (Kang et al., 2012; Kang the incidence of metabolic syndrome (Wiria et al., 2012).

FIGURE 10
The effect of T. spiralis total lysates on adipogenic genes mRNA and protein expression. 3T3-L1 adipocytes were treated with 1, 5, or 10 mg T. spiralis
total lysates during differentiation. RNA and proteins were isolated from the cells at the end-stage of differentiation. Relative mRNA expression
confirmed the expression of adipogenic genes. The results show that T. spiralis total lysates treatment clearly decreased the expression of PPARg,
C/EBPa, and aP2 mRNA. Bars represent the means ± SD from three independent experiments. (*; p < 0. 05, ** p < 0.01 ***; p < 0.001*** n = 4;
samples per group, two independent experiments). NC, negative control, undifferentiation; PC, positive control, differentiation; TS 1, treatment of T.
spiralis total lysates 1 µg; TS 5, treatment of T. spiralis total lysates 5 µg; TS 10, treatment of T. spiralis total lysates 10 µg.

Frontiers in Cellular and Infection Microbiology 11 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

A B

FIGURE 11
Effect of T. spiralis total lysates on adipogenic factors. The cells were seeded at a density of 8 × 104 cells/well in a 6-well plate. Differentiation was
induced with or without T. spiralis total lysate for up to 10 days. (A) Steady-state levels of PPARg, C/EBPa and actin were evaluated by western blot
analysis. Results are expressed as the mean ± SEM. ∗p < 0.05. (B) Graphs show the results of three separate experiments. NC, negative control,
undifferentiation; PC, positive control, differentiation; PBS, treatment of PBS; TS 1, treatment of T. spiralis total lysates 1 µg; TS 5, treatment of T.
spiralis total lysates 5 µg; TS 10, treatment of T. spiralis total lysates 10 µg.

This study aimed to determine the effect of T. spiralis total lysate content was measured using spectrophotometry and lipid
treatment on diet-induced obesity (in vivo) and adipocyte accumulation was evaluated using Oil Red O staining. The results
differentiation (in vitro). First, we investigated the effects of T. demonstrate that T. spiralis total lysates suppress the differentiation
spiralis total lysates treatment in diet-induced obese mice. Secondly, of 3T3-L1 adipocytes. Specifically, 3T3-L1 adipocytes treated with
we investigated whether the in vitro anti-obesity effects were retained. T. spiralis total lysate showed decreased lipid accumulation.
The present study investigated the antiadipogenic effects underlying Adipocyte differentiation is related to mainly by a cascade
the action of T. spiralis total lysate on 3T3-L1 adipocytes. reaction entailing transcription factors such as C/EBPa and
Our results showed that T. spiralis total lysates treatment PPARg (Farmer, 2006). The differentiation of preadipocytes into
significantly promotes M2 macrophage polarization and inhibits mature adipocytes is divided into early and late stages.
the proinflammatory cytokine as IL-1b and TNF-a. In the early stages, the transcription factors C/EBPb and C/EBPd
Our results are consistent with prior reports that helminth are caused by specific hormones. Subsequently, PPARg and C/EBPa
infection alleviate obesity (Weng et al., 2007; Yang et al., 2013; Su are caused by these factors (Cao et al., 1991). PPARg and C/EBPa
et al., 2018; Yao et al., 2022) T cell derived cytokines play a pivotal then induce adipogenesis by modulating in a positive manner (Cao
role for generation of proinflammatory M1 macrophages during et al., 1991; Kim et al., 2018). Consistent with the data from the Oil
obesity. Therefore, the decreased production of IL-4 and IL-10 Red O staining, the results of the present study revealed that T.
within the adipose tissue results in a relative decrease of anti- spiralis total lysates significantly decreased the expression of PPARg
inflammatory M2 macrophages. Whereas, the increase of Th1 cells and C/EBPa mRNA and proteins, which are pivotal adipogenic
promotes M1 macrophages (Winer et al., 2009). Our results showed transcription factors related to the final stage of adipocyte
that there was no significant increase of IL-4 and IL-10, but T. differentiation. Additionally, the expression levels of adipogenic
spiralis total lysate treatment significantly inhibited the production marker genes including aP2 were decreased by T. spiralis total
of Th1 cells. Leptin is an adipokine produced primarily by lysate treatment. These findings suggest that T. spiralis lysates
adipocytes, although it is produced by various cells, such as reduce adipogenesis by regulating C/EBPa and PPARg pathways.
immune cells. Therefore, increasing adiposity result in increased Further, Sirt1 is a major modulator of adipogenesis and lipid
systemic concentrations of leptin. Studies provided evidence that metabolism; it belongs to the 7 sirtuins, which are class III histone
leptin has been identified as a critical immune modulator in an deacetylases that regulate senescent process and metabolic
obesity-associated inflammation by promoting pro-inflammatory homeostasis (Li and Kazgan, 2011). Further, Sirt1 weakens
immune response (Kiernan and MacIver, 2020; Perakakis et al., adipogenesis by impairing PPARg expression (Picard et al., 2004).
2021). Our results showed that T. spiralis total lysate treatment We used two methods for T. spiralis total lysate treatment: IO
reduced the amount of fat mass and the expression level of leptin in and IP administration. However, no significant differences were
a white adipose tissues. Preadipocytes differentiate into mature observed between the two administration methods. There was a
adipocytes. Hyperplasia and hypertrophy of these cells can result difference in the absorption time between the two methods, but
in an increase in adipose tissue mass (Kim et al., 2013; Chen et al., there was no significant difference in the anti-obesity effect.
2014). During adipocyte differentiation, intracellular lipid droplets In conclusion, the present study demonstrated that changes in
build up in mature adipocytes (Kim et al., 2013). Intracellular lipid immune cell composition caused by T. spiralis total lysate treatment

Frontiers in Cellular and Infection Microbiology 12 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

improved glucose tolerance in mice fed a high-fat diet. T. spiralis editing. SK: Data curation, Formal analysis, Investigation,
total lysates inhibit the expression of adipogenic marker genes and Methodology, Validation, Visualization, Writing – original draft.
lipid accumulation through down-regulation of C/EBPa and
PPARg. Further studies are required to identify specific molecules
involved in the prevention and treatment of obesity through such Funding
pathways. Taken together, results from our study raise the
interesting possibility of using parasite lysates as effective and The author(s) declare financial support was received for the
novel therapeutics in the treatment of obesity. research, authorship, and/or publication of this article. Basic
Science Research Program through the National Research
Foundation of Korea (NRF) funded by the Ministry of Education
Data availability statement (NRF-2017R1D1A3B05035680) supported this research.

The original contributions presented in the study are included

in the article/supplementary materials, further inquiries can be Conflict of interest
directed to the corresponding author/s.
The authors declare that the research was conducted in the
absence of any commercial or financial relationships that could be
Ethics statement construed as a potential conflict of interest.

The animal study was approved by Pusan National University

Animal Care and Use Committee. The study was conducted in Publisher’s note
accordance with the local legislation and institutional requirements.
All claims expressed in this article are solely those of the authors
and do not necessarily represent those of their affiliated
Author contributions organizations, or those of the publisher, the editors and the
reviewers. Any product that may be evaluated in this article, or
HY: Conceptualization, Funding acquisition, Project claim that may be made by its manufacturer, is not guaranteed or
administration, Resources, Supervision, Writing – review & endorsed by the publisher.

References
Cao, Y., Chen, Y., Miao, K., Zhang, S., Deng, F., Zhu, M., et al. (2023). PPARgamma Hotamisligil, G. S. (2017). Inflammation, metaflammation and immunometabolic
as a potential target for adipogenesis induced by fine particulate matter in 3T3-L1 disorders. Nature. 542 (7640), 177–185. doi: 10.1038/nature21363
preadipocytes. Environ. Sci. Technol. 57 (20), 7684–7697. doi: 10.1021/acs.est.2c09361
Jackson, R. M., Griesel, B. A., Gurley, J. M., Szweda, L. I., and Olson, A. L. (2017).
Cao, Z., Umek, R. M., and McKnight, S. L. (1991). Regulated expression of three C/ Glucose availability controls adipogenesis in mouse 3T3-L1 adipocytes via up-
EBP isoforms during adipose conversion of 3T3-L1 cells. Genes Dev. 5 (9), 1538–1552. regulation of nicotinamide metabolism. J. Biol. Chem. 292 (45), 18556–18564.
doi: 10.1101/gad.5.9.1538 doi: 10.1074/jbc.M117.791970
Chalkiadaki, A., and Guarente, L. (2012). High-fat diet triggers inflammation- Kang, S. A., Cho, M. K., Park, M. K., Kim, D. H., Hong, Y. C., Lee, Y. S., et al. (2012).
induced cleavage of SIRT1 in adipose tissue to promote metabolic dysfunction. Cell Alteration of helper T-cell related cytokine production in splenocytes during
Metab. 16 (2), 180–188. doi: 10.1016/j.cmet.2012.07.003 Trichinella spiralis infection. Vet. Parasitol. 186 (3-4), 319–327. doi: 10.1016/
Chen, H., Mo, D., Li, M., Zhang, Y., Chen, L., Zhang, X., et al. (2014). miR-709 j.vetpar.2011.12.002
inhibits 3T3-L1 cell differentiation by targeting GSK3beta of Wnt/beta-catenin Kang, S. A., Choi, J. H., Baek, K. W., Lee, D. I., Jeong, M. J., and Yu, H. S. (2021).
signaling. Cell Signal. 26 (11), 2583–2589. doi: 10.1016/j.cellsig.2014.07.017 Trichinella spiralis infection ameliorated diet-induced obesity model in mice. Int. J.
Ertunc, M. E., Sikkeland, J., Fenaroli, F., Griffiths, G., Daniels, M. P., Cao, H., et al. Parasitol. 51 (1), 63–71. doi: 10.1016/j.ijpara.2020.07.012
(2015). Secretion of fatty acid binding protein aP2 from adipocytes through a Kang, S. A., Park, M. K., Cho, M. K., Park, S. K., Jang, M. S., Yang, B. G., et al. (2014).
nonclassical pathway in response to adipocyte lipase activity. J. Lipid Res. 56 (2), Parasitic nematode-induced CD4+Foxp3+T cells can ameliorate allergic airway
423–434. doi: 10.1194/jlr.M055798 inflammation. PloS Negl. Trop. Dis. 8 (12), e3410. doi: 10.1371/journal.pntd.0003410
Farmer, S. R. (2006). Transcriptional control of adipocyte formation. Cell Metab. 4 Kang, S. A., Park, M. K., Park, S. K., Choi, J. H., Lee, D. I., Song, S. M., et al. (2019).
(4), 263–273. doi: 10.1016/j.cmet.2006.07.001 Adoptive transfer of Trichinella spiralis-activated macrophages can ameliorate both
Fujisaka, S., Usui, I., Bukhari, A., Ikutani, M., Oya, T., Kanatani, Y., et al. (2009). Th1- and Th2-activated inflammation in murine models. Sci. Rep. 9 (1), 6547.
Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced doi: 10.1038/s41598-019-43057-1
obese mice. Diabetes. 58 (11), 2574–2582. doi: 10.2337/db08-1475 Kang, S. A., and Yu, H. S. (2021). Acceleration of Trichinella spiralis worm expulsion
Giby, V. G., and Ajith, T. A. (2014). Role of adipokines and peroxisome proliferator- by leukotriene B4 receptor binding inhibition. Parasite Immunol. 43 (9), e12843.
activated receptors in nonalcoholic fatty liver disease. World J. Hepatol. 6 (8), 570–579. doi: 10.1111/pim.12843
doi: 10.4254/wjh.v6.i8.570 Kiernan, K., and MacIver, N. J. (2020). The role of the adipokine leptin in immune
Gomes, P. S., Bhardwaj, J., Rivera-Correa, J., Freire-De-Lima, C. G., and Morrot, A. cell function in health and disease. Front. Immunol. 11. doi: 10.3389/
(2016). Immune escape strategies of malaria parasites. Front. Microbiol. 7. doi: 10.3389/ fimmu.2020.622468
fmicb.2016.01617 Kim, H. L., Jeon, Y. D., Park, J., Rim, H. K., Jeong, M. Y., Lim, H., et al. (2013). Corni
Han, T. S., and Lean, M. E. (2016). A clinical perspective of obesity, metabolic fructus containing formulation attenuates weight gain in mice with diet-induced
syndrome and cardiovascular disease. JRSM Cardiovasc. Dis. 5, 2048004016633371. obesity and regulates adipogenesis through AMPK. Evid Based Complement Alternat
doi: 10.1177/2048004016633371 Med. 2013, 423741. doi: 10.1155/2013/423741

Frontiers in Cellular and Infection Microbiology 13 frontiersin.org

Kang and Yu 10.3389/fcimb.2023.1285584

Kim, J. S., Lee, S. G., Min, K., Kwon, T. K., Kim, H. J., and Nam, J. O. (2018). Eupatilin Scheen, A., De Flines, J., and Paquot, N. (2023). [Anti-obesity drugs : from previous
inhibits adipogenesis through suppression of PPAR gamma activity in 3T3-L1 cells. disappointments to new hopes]. Rev. Med. Liege. 78 (3), 147–152.
Biomedicine Pharmacotherapy. 103, 135–139. doi: 10.1016/j.biopha.2018.03.073 Schmidt, V., Hogan, A. E., Fallon, P. G., and Schwartz, C. (2022). Obesity-mediated
Li, X., and Kazgan, N. (2011). Mammalian sirtuins and energy metabolism. Int. J. immune modulation: one step forward, (Th)2 steps back. Front. Immunol. 13.
Biol. Sci. 7 (5), 575–587. doi: 10.7150/ijbs.7.575 doi: 10.3389/fimmu.2022.932893
Lu, Y., Liu, H., Yang, X. Y., Liu, J. X., Dai, M. Y., Wu, J. C., et al. (2020). Microarray Su, C. W., Chen, C. Y., Li, Y., Long, S. R., Massey, W., Kumar, D. V., et al. (2018).
Analysis of lncRNA and mRNA Reveals Enhanced Lipolysis Along With Metabolic Helminth infection protects against high fat diet-induced obesity via induction of
Remodeling in Mice Infected With Larval Echinococcus granulosus. Front. Physiol. 11. alternatively activated macrophages. Sci. Rep. 8 (1), 4607. doi: 10.1038/s41598-018-
doi: 10.3389/fphys.2020.01078 22920-7
Okuno, Y., Fukuhara, A., Hashimoto, E., Kobayashi, H., Kobayashi, S., Otsuki, M., et al. Valenzuela, P. L., Carrera-Bastos, P., Castillo-Garcia, A., Lieberman, D. E., Santos-
(2018). Oxidative stress inhibits healthy adipose expansion through suppression of SREBF1- Lozano, A., and Lucia, A. (2023). Obesity and the risk of cardiometabolic diseases. Nat.
mediated lipogenic pathway. Diabetes. 67 (6), 1113–1127. doi: 10.2337/db17-1032 Rev. Cardiol. 20 (7), 475–494. doi: 10.1038/s41569-023-00847-5
Pacifici, F., Farias, C. L. A., Rea, S., Capuani, B., Feraco, A., Coppola, A., et al. (2020). van der Zande, H. J. P., Zawistowska-Deniziak, A., and Guigas, B. (2019). Immune
Tyrosol may prevent obesity by inhibiting adipogenesis in 3T3-L1 preadipocytes. Oxid. regulation of metabolic homeostasis by helminths and their molecules. Trends
Med. Cell Longev. 2020, 4794780. doi: 10.1155/2020/4794780 Parasitol. 35 (10), 795–808. doi: 10.1016/j.pt.2019.07.014
Palhinha, L., Liechocki, S., Hottz, E. D., Pereira, J., de Almeida, C. J., Moraes-Vieira, Weng, M., Huntley, D., Huang, I. F., Foye-Jackson, O., Wang, L., Sarkissian, A., et al.
P. M. M., et al. (2019). Leptin induces proadipogenic and proinflammatory signaling in (2007). Alternatively activated macrophages in intestinal helminth infection: effects on
adipocytes. Front. Endocrinol. (Lausanne). 10. doi: 10.3389/fendo.2019.00841 concurrent bacterial colitis. J. Immunol. 179 (7), 4721–4731. doi: 10.4049/
Park, M. K., Kang, S. A., Cho, M. K., and Yu, H. S. (2022). Trichinella spiralis nurse jimmunol.179.7.4721
cell formation is regulated via CCR7(+) dendritic cells. Parasite Immunol. 44 (9), Winer, S., Chan, Y., Paltser, G., Truong, D., Tsui, H., Bahrami, J., et al. (2009).
e12938. doi: 10.1111/pim.12938 Normalization of obesity-associated insulin resistance through immunotherapy. Nat.
Perakakis, N., Farr, O. M., and Mantzoros, C. S. (2021). Leptin in leanness and Med. 15 (8), 921–929. doi: 10.1038/nm.2001
obesity: JACC state-of-the-art review. J. Am. Coll. Cardiol. 77 (6), 745–760. Wiria, A. E., Djuardi, Y., Supali, T., Sartono, E., and Yazdanbakhsh, M. (2012).
doi: 10.1016/j.jacc.2020.11.069 Helminth infection in populations undergoing epidemiological transition: a friend or
Picard, F., Kurtev, M., Chung, N., Topark-Ngarm, A., Senawong, T., MaChado De foe? Semin. Immunopathol. 34 (6), 889–901. doi: 10.1007/s00281-012-0358-0
Oliveira, R., et al. (2004). Sirt1 promotes fat mobilization in white adipocytes by Yang, Z., Grinchuk, V., Smith, A., Qin, B., Bohl, J. A., Sun, R., et al. (2013). Parasitic
repressing PPAR-gamma. Nature. 429 (6993), 771–776. doi: 10.1038/nature02583 nematode-induced modulation of body weight and associated metabolic dysfunction in
Ryan, S. M., Eichenberger, R. M., Ruscher, R., Giacomin, P. R., and Loukas, A. (2020). mouse models of obesity. Infect. Immun. 81 (6), 1905–1914. doi: 10.1128/IAI.00053-13
Harnessing helminth-driven immunoregulation in the search for novel therapeutic Yao, J., Wu, D., and Qiu, Y. (2022). Adipose tissue macrophage in obesity-associated
modalities. PloS Pathog. 16 (5), e1008508. doi: 10.1371/journal.ppat.1008508 metabolic diseases. Front. Immunol. 13. doi: 10.3389/fimmu.2022.977485

Frontiers in Cellular and Infection Microbiology 14 frontiersin.org