Atherosclerosis 181 (2005) 75–85

Changes in intestinal and liver global gene expression in

response to a phytosterol-enriched diet
Laura Calpe-Berdiel a, 1 , Joan Carles Escolà-Gil a, ∗, 1 , Vicent Ribas a , Aleix Navarro-Sastre b ,
Josep Garcés-Garcés c , Francisco Blanco-Vaca a, ∗
a Servei de Bioquı́mica, Institut de Recerca de l’Hospital de la Santa Creu i Sant Pau, C/ Antoni M. Claret 167, 08025 Barcelona, Spain
b Institut de Bioquı́mica Clı́nica, Corporació Sanitària Clı́nic, Barcelona, Spain
c Lipofoods S.L., Gavà, Barcelona, Spain

Received 22 June 2004; received in revised form 27 October 2004; accepted 5 November 2004
Available online 12 February 2005

Abstract

Background: Dietary phytosterols are a recommended therapeutic option for decreasing plasma cholesterol. The increased activity of ATP-
binding cassette (ABC) transporters ABCA1, ABCG5 and ABCG8, or, alternatively, a decrease in Niemann–Pick C1 Like 1 (NPC1L1)
could mediate the reduction in intestinal cholesterol absorption caused by phytosterols. Other biological properties such as a direct immune
modulatory activity have recently been ascribed to these plant compounds.
Methods: To gain insight into the molecular effects of phytosterols, global genome-wide gene profiling and real-time RT-PCR studies were
conducted in small intestines and livers of phytosterol-treated apolipoprotein E-deficient (apoE−/− ) mice. Re-testing of the main results was
performed in C57BL/6J and LDL receptor-deficient (LDLR−/− ) mice.
Results: Intestinal cholesterol absorption was decreased in all mouse models but plasma cholesterol was only decreased in apoE−/− and
LDLR−/− mice. ABCA1, ABCG5, ABCG8 and NPC1L1 mRNA levels were slightly reduced in the intestine of phytosterol-treated apoE−/−
and LDLR−/− mice, but increased in C57BL/6J-treated mice. Phytosterols changed genes involved in immune regulation in apoE−/− mice.
However, these changes were less extensive in LDLR−/− mice and were not found in C57BL/6J mice.
Conclusions: Inhibition of intestinal cholesterol absorption by phytosterols is not mediated via transcriptional changes in ABCA1, ABCG5,
ABCG8 or NPC1L1. Changes suggestive of immunomodulation are associated with the hypocholesterolemic effect of phytosterols and with
apoE deficiency.
© 2005 Elsevier Ireland Ltd. All rights reserved.

Keywords: Phytosterols; Cholesterol; ATP-binding cassette transporter; Atherosclerosis; Immune system; Cancer

Abbreviations: ABCA1, ATP-binding cassette transporter A1; ABCG5, ATP-binding cassette transporter G5; ABCG8, ATP-binding cassette transporter
G8; ALT, alanine aminotransferase; apoE, apolipoprotein E; apoE−/− , apoE-deficient mice; ETV6, ETS variant gene 6; FDPS, farnesyl diphosphate synthase;
FoxQ1, forkhead box Q1; FPLC, fast protein liquid chromatography; GC–MS, gas–liquid chromatography–mass spectrometry; HDL, high-density lipoprotein;
IDL, intermediate-density lipoprotein; IgK-V, immunoglobulin kappa chain variable; LDL, low-density lipoprotein; LDLR−/− , LDL receptor-deficient mice;
LFC, limit fold change; LXR, liver X receptor; MARCO, macrophage receptor with collagenous structure; NCEP, National Cholesterol Education Program;
NPC1L1, Niemann–Pick C1 Like 1; Reg, regenerating islet-derived; RT-PCR, reverse-transcriptase polymerase chain reaction; SREBP, sterol regulatory element
binding protein; SAA3, serum amyloid A3; VLDL, very-low-density lipoprotein
∗ Corresponding authors. Tel.: +34 93 2919451; fax: +34 93 2919196.

E-mail addresses: [email protected] (J.C. Escolà-Gil), [email protected] (F. Blanco-Vaca).

1 These authors contributed equally to this work.

0021-9150/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved.
doi:10.1016/j.atherosclerosis.2004.11.025
76 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85

1. Introduction Apolipoprotein E-deficient (apoE−/− ) mice have been

used as an animal model to show the antihypercholes-
Phytosterols, and their saturated forms known as stanols, terolemic and antiatherogenic effects of phytosterols [25,26].
are the most abundant plant sterols. The cholesterol-lowering In the present study, microarray-based technology and quan-
effect of phytosterols has been demonstrated in both humans titative real-time RT-PCR were used to identify phytosterol-
and animals [1,2] and the most recent guidelines for choles- regulated genes in intestine and liver of apoE−/− mice and
terol management of the National Cholesterol Education Pro- the main findings were re-tested in C57BL/6J and in LDL
gram (NCEP) encouraged plant sterol/stanol consumption as receptor-deficient (LDLR−/− ) mice.
a therapeutic dietary option to decrease LDL cholesterol [3].
Further, phytosterols can now be acquired in many coun-
tries without medical prescription. Thus, full understanding 2. Materials and methods
of their effects is highly desirable.
Competition between plant sterols and intestinal choles- 2.1. Mice and diets
terol for incorporation into mixed micelles has been proposed
as the mechanism underlying the hypocholesterolemic effect All animal procedures were in accordance with published
of plant sterols [4]. However, one of the potential explana- recommendations for the use of laboratory animals [27].
tions for this competition, the cocrystallization of cholesterol Use of apoE−/− mice with a C57BL/6J background has
and phytosterols or phystostanols in the intestinal lumen has been described previously [28]. Mice were maintained in a
been recently shown to be unlikely [5]. Further, recent studies temperature-controlled (20 ◦ C) room with a 12-h light:12-
have suggested that plant sterols may exert an unknown h dark cycle and food and water were provided ad li-
molecular action inside enterocytes and hepatocytes, espe- bitum. Eight to ten-week-old female mice were random-
cially considering that plant sterols/stanols do not need to be ized in four groups and fed either a control Western-type
present in the intestinal lumen simultaneously with choles- diet (200 g/kg fat, polyunsaturated/saturated = 0.07, 0.8 g/kg
terol to inhibit its absorption [6]. Recently, several adenosine cholesterol, 170 g/kg protein, 105 g/kg fiber; Mucedola srl,
triphosphate binding cassette (ABC) transporters have been Settimo Milanese, Italy) or a 0.5, 1 or 2% phytosterol-
proposed as carriers exchanging cholesterol and phytosterols enriched Western-type diet (w/w) for 4 weeks. Homozygous
in intestine and liver and sitostanol treatment of Caco-2 cells LDLR−/− in C57BL/6J background and wild-type C57BL/6J
has been shown to increase ABCA1 expression [7]. On the mice were obtained from Jackson Laboratories (Bar Har-
other hand, mutations in ABCG5 and ABCG8 genes cause bour, ME) and were fed either a control Western-type diet
sitosterolemia, a rare autosomal recessive disorder charac- or a 2% phytosterol-enriched Western-type diet (w/w) for
terized by elevated plasma levels and tissue accumulation of 4 weeks. The phytosterol product was composed of 20%
both plant and animal sterols [8]. As ABCA1, ABCG5 and campesterol, 22% stigmasterol and 41% ␤-sitosterol (Lipo-
ABCG8 genes are targets of liver X receptor (LXR) [9,10] foods, S.L., Barcelona, Spain).
and the overexpression of ABCG5 and ABCG8 in mice 2.2. Lipid analyses of plasma, liver, small intestine, bile
promotes biliary cholesterol secretion and reduces dietary and stools
cholesterol absorption [11], phytosterols or their derivatives
could act as LXR ligands [12]. Also recently, Niemann–Pick The methods used for plasma and liver lipid analyses have
C1 Like 1 (NPC1L1) protein has been shown to play a been described in detail elsewhere [28,29]. ␣-Tocopherol, ␣-
critical role in the absorption of intestinal cholesterol [13,14]. carotene, ␤-carotene and retinol plasma content were quan-
Ezetimibe, a drug that inhibits cholesterol absorption acting tified by reverse-phase HPLC [30]. Plasma and tissue phy-
through the NPC1L1 pathway decreases the levels of plant tosterols were analyzed by gas–liquid chromatography–mass
sterols in patients with sitosterolemia [15]. Thus, dietary phy- spectrometry (GC–MS) [31]. Liver and intestine mixtures
tosterols could act also reducing the intestinal expression of were extracted with isopropyl alcohol–hexane (2:3, v/v) and
NPC1L1. quantitative results were obtained by GC–MS and single ion
Although most studies have focused on the cholesterol- monitoring; the m/z+ values used were those described else-
lowering activity of phytosterols, other biological properties where [32].
such as immunomodulation have been ascribed to these com- Bile was removed from the gallbladders of anesthetized
pounds [16,17]. ␤-Sitosterol and its glucoside act as poten- mice using a 30.5-gauge needle. Concentrations of choles-
tially positive immune modulators in humans by increasing terol and phospholipids were determined enzymatically
cytokines derived from TH1 helper cells [16–18]. Interest- using commercial kits adapted to a BM/HITACHI 911
ingly, LXR-dependent gene expression has been shown to autoanalyzer (Roche Diagnostics GmbH, Mannheim, Ger-
play a role in the innate immune response [19]. Moreover, many). Bile acids were measured by the 3␣-hydroxysteroid
experimental studies suggest that phytosterols could protect dehydrogenase method (Sigma Diagnostics, St. Louis, MO,
against common cancers [20–23]. Possible mechanisms of USA). Gallbladder, liver and small intestine bile acids were
protection include effects on membrane structure/function, measured and the bile acid pool size was calculated as the
signal transduction and immune function [21,24]. sum of all bile acids.
 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85 77

Stools from individually housed mice collected over 3 terols and control treatment, the Microarray Suite (MAS)
days were dried, weighed, and ground to a fine powder; 5.0 software uses information from all probe pairs (15–20
bile acids of 0.5 g of feces were extracted in ethanol and per gene). This software allows classifying present mRNA
used to determine total bile acid content as mentioned under comparison as decreased, marginally decreased, not
above. changed, marginally increased or increased. Information
regarding this bioinformatic assessment is available at
2.3. Intestinal cholesterol and lipid absorption http://www.affymetrix.com/. The limit fold change (LFC)
approach was then used to select differentially expressed
Cholesterol absorption was measured by a fecal dual- genes [34]. The LFC model relates the expression level and
isotope ratio method [33]. Lipid content of the diet and stools the fold change (independently of being overexpressed or
was determined using commercial kits as mentioned above repressed) of every gene across the entire range of observed
[28,29]. These data, together with the amount of diet con- expressions. The model is developed by first binning gene
sumed and stools excreted (both expressed as g/(day 100 g expression data into tight classes across the entire range of
body weight)), were used to calculate the fraction of con- expression values. Then, the 95th percentile of fold changes
sumed lipid absorbed. is selected for each bin, which is the higher fold change
(HFC). The relationship between absolute expression,
2.4. Atherosclerosis analysis defined as min ADI (average difference intensity), and HFC,
is plotted in order to set the LFC function. The equation
At the end of the study, heart and proximal aorta were re- LFC = a + (b/min ADI), which is fitted to the 95th percentile
moved and atherosclerotic lesions quantified blindly as pre- of each bin, produces the LFC curve that best models the
viously described [28]. expression data. The LFC curve in our experiments were 95th
LFC model = 1.38 + (3.01/min ADI) in intestinal microarray
2.5. Microarray intestine and liver gene expression and 95th LFC model = 1.44 + (2.54/min ADI) in liver
analyses microarray.

Intestinal tissues were rinsed well of food/fecal materials 2.6. Quantitative real-time RT-PCR analyses
using sterile phosphate buffered saline. Total liver and small
intestine (an equivalent segment of duodenum, jejunum and To confirm the results of the microarray study, a selection
ileum) RNA was isolated from four animals per group using of genes that appeared to be highly regulated were subjected
the trizol RNA isolation method (Gibco/BRL, Grand Island, to real time RT-PCR.
NY, USA). Total RNA samples were repurified (RNeasy mini Total RNA was reverse-transcribed with Oligo(dT)15
kit; QIAGEN, Valencia, CA, USA) and checked for integrity using M-MLV Reverse Transcriptase, RNase H Minus, Point
by agarose gel electrophoresis. Probe synthesis from total Mutant (Promega Corporation, Madison, USA) to generate
RNA pooled samples, hybridization, detection and scanning cDNA. Primer Express Software (Applied Biosystems,
were performed according to standard protocols from CA, USA) was used to design the primers (Table 1). PCR
Affymetrix Inc. (Santa Clara, CA) at Progenika Biopharma assays were performed on an Applied Biosystems Prism
S.L. (Barakaldo, Spain). Seven micrograms of labeled 7000 sequence detection system (Applied Biosystems).
cRNA were hybridized to one mouse U74Av2 genechip The PCR reaction contained (final volume 25 ␮L): 40 ng
(Affymetrix) and scanned after biotin amplification. These of reverse-transcribed RNA, 12.5 ␮L of 2× SYBR Green
arrays allowed screening of 6000 functionally characterized PCR Master Mix (Applied Biosystems) and a 400 nM
sequences in the mouse Unigene database and 6000 EST concentration for each ABCA1 and ABCG8 primer, 900 nM
clusters. To assess gene expression presence or absence and concentration for each ABCG5 primer, and 800 nM for
to compare changes in a given gene between 2% phytos- each Immunoglobulin kappa chain variable 28 (IgK-V28),

Table 1
Primers used in quantitative real-time RT-PCR analyses
Gene Forward primer 5 –3 Reverse primer 5 –3
Ig kappa chain variable 28 ACTCTCCAATCCTGTCACTTCTGG GAAACCAATTCAAGTATGTCTTCCC
Regenerating islet-derived 2 TAATTGAAGACCGTTTGACCTGG AAAGTTGCTCTCAGCCTGGC
Forkhead box Q1 CGAGATCAACGAGTACCTCATGG GCATCCAGTAGTTGTCCTTGCC
Ig heavy chain V region fragment GATTGCTGCAAGTAGAAACAAAGC ACAGTGTCCTCAGCTCTCAGGG
ABCA1 CTTCCCACATTTTTGCCTGG AAGGTTCCGTCCTACCAAGTCC
ABCG5 TGTCCTACAGCGTCAGCAACC GGCCACTCTCGATGTACAAGG
ABCG8 AGAGTTGCATCCCCCTAGCC TCCTTGACACAGGCATGAAGC
Niemann–Pick C1 Like 1 ATCCTCATCCTGGGCTTTGC GCAAGGTGATCAGGAGGTTGA
␤-Actin CAGATCATGTTTGAGACCTTCAAC TCGAAGTCTAGAGCAACATAGCAC
78 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85

Regenerating islet derived 2 (Reg2), Forkhead box Q1

(FoxQ1), Immunoglobulin heavy chain V region fragment
and Niemann–Pick C1 Like 1 (NPC1L1). Optimal primer
amplification efficiency for each primer set was assessed and
a dissociation protocol was carried out to assure a single PCR
product. All analyses were performed in duplicate and rel-
ative RNA levels were determined using ␤-actin as internal
control.

2.7. Statistical analysis

All values are expressed as mean ± S.E.M. Comparison

of data for two groups was performed by Student’s t-test or
Mann–Whitney U-test, depending on whether the distribu-
tion of data was Gaussian or not. Correlations among vari-
ables were determined by Pearson coefficient of correlation
(rP ). Statistical tests were performed using GraphPad Prism
version 4.0 for Windows (GraphPad Software, San Diego,
CA, USA). A value of P < 0.05 was considered statistically
significant.

3. Results

3.1. Plasma biochemical analyses in apoE−/− mice

Mice seemed healthy during the study and tolerated

well the Western diets with or without phytosterols. Final
body weights, weight gain and food consumption per cage
during the study were similar in all groups (data not shown).
Total cholesterol levels were determined at baseline and
at weeks 2 and 4 (Fig. 1A). Plasma total cholesterol was
markedly increased after consumption of Western diet in
control apoE−/− mice. Mice given phytosterols showed no
significant dose-related increase in plasma cholesterol after
baseline relative to control. ApoE−/− mice given 2% phy-
tosterols for 4 weeks exhibited a marked decrease in plasma
total cholesterol (from 18.6 to 9.5 mmol/L), VLDL and IDL
fractions and, to a lesser degree, in LDL when isolated by
FPLC (Fig. 1B). The mean atherosclerotic lesion areas of
apoE−/− mice fed a control Western-type diet were 2.2-fold
larger compared with those treated with 2% phytosterols
(Fig. 1C). Fig. 1. Effects of phytosterols in plasma lipoproteins and atherosclerosis
In order to ascertain the major pathophysiological susceptibility in apoE−/− mice. (A) Line graph shows plasma total choles-
and molecular mechanisms implicated in the hypocholes- terol from mice fed either a 0.5, 1 or 2% phytosterol-enriched Western diet
at 0, 2 and 4 weeks of treatment. Values represent the mean ± S.E.M. of data
terolemic effects of phytosterols, a series of experiments was (n = 13 for each group). (B) FPLC was performed on 0.2 mL of pooled plasma
conducted in mice given 2% phytosterols for 4 weeks. Plasma samples obtained from mice feeding each diet for 4 weeks. The position of
phytosterols were measured in 2% phytosterol-treated and elution of the VLDL, IDL/LDL and HDL are represented by horizontal lines.
control mice (Fig. 2). Only a slight amount of campes- (C) Mean area of atherosclerotic lesion of phytosterol-treated and control
terol was detected in control mice, whereas plasma levels of mice. Results are expressed as mean ± S.E.M. of the average area of lesion
of four proximal aortic sections from each mouse. Significantly different
campesterol and ␤-sitosterol increased markedly and slightly,
(P < 0.05) from control mice.
respectively, in mice fed the phytosterol-enriched diet. Stig-
masterol was not detected in any group (Fig. 2A). In addition,
plasma carotenoids were not found at a detectable level in
treated or control mice, and no differences were observed in
plasma ␣-tocopherol levels (16.0 ␮M versus 15.8 ␮M) and
 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85 79

Table 2
Liver, biliary and intestinal parameters in 4-week-phytosterol-treated and
control apoE−/− mice
Control 2% Phytosterols
Number of mice 13 13
Liver weight (g) 1.1 ± 0.08 1.1 ± 0.06
Liver cholesterol (mg/g tissue) 19.6 ± 2.0 7.5 ± 0.7*
Liver phospholipids (mg/g tissue) 24.3 ± 2.7 19.1 ± 1.1
Liver triglyceride (mg/g tissue) 115.5 ± 19.0 95.3 ± 11.3
Plasma ALT (U/L) 36.1 ± 2.4 36.9 ± 4.4
Biliary cholesterol (␮mol/mL) 4.0 ± 0.5 2.6 ± 0.3*
Biliary bile acids (␮mol/mL) 91.4 ± 25.3 86.7 ± 1.4
Biliary phospholipids (␮mol/mL) 29.0 ± 5.7 20.9 ± 1.0*
Bile acid pool size (␮mol/100 bw) 48.8 ± 14.2 44.5 ± 1.9
Intestinal cholesterol absorption (%)a 71.5 ± 6.9 39.1 ± 4.0*
Intestinal lipid absorption (%)a 96.3 ± 0.8 93.8 ± 1.5
Fecal bile acid excretion 1.9 ± 0.6 2.7 ± 1.1
(␮mol/(day 100 g bw))a
Values represent mean ± S.E.M. of data. Bw, body weight; ALT, alanine
aminotransferase.
a Six animals per group.
∗ Significantly different (P < 0.05) from control mice.

absorption and fecal bile acid excretion were found in these

mice (Table 2).
Liver campesterol in phytosterol-treated mice was higher
than that of control mice (Fig. 2C). Although the phytosterol-
treated liver weight, liver phospholipids and triglyceride lev-
els and alanine aminotransferase (ALT) activities did not dif-
fer significantly from those of control mice, liver cholesterol
content was significantly decreased in 2% phytosterol-treated
mice compared with that of control mice (Table 2).
Significant decreases were observed in cholesterol and
phospholipid concentrations of bile from 2% phytosterol-
treated mice, but no significant differences were found in
biliary bile acid content and bile acid pool size between
phytosterol-treated and control mice (Table 2).

3.3. Gene expression profiles in apoE−/− mice

2864 and 2608 transcripts were defined as present in small

Fig. 2. Phytosterol levels of 4-week-phytosterol-treated and control intestines and livers of control mice, respectively. The small
apoE−/− mice. Lipids from pooled plasma (A), intestine (B) and liver (C) intestines and livers of 2% phytosterol-treated apoE−/− mice
of each group of mice. Nd, not detected. expressed 2953 and 2816 transcripts, respectively. Differen-
tially expressed genes were determined using the Microarray
Suite and the LFC model, considering hybridization inten-
retinol (0.6 ␮M versus 0.7 ␮M) between phytosterol-treated sity >48 in at least one of the samples (which is the 95th
and control mice. percentile of gene transcripts determined as absent), as ex-
plained in Section 2.
3.2. Intestinal, liver and bile biochemical parameters in Tables 3 and 4 show gene expression changes (≥1.5-fold)
apoE−/− mice in small intestines and livers of phytosterol-treated apoE−/−
mice compared with control mice. Significant upregulation
Intestinal phytosterols, especially campesterol and ␤- of 17 sequences and downregulation of 12 sequences were
sitosterol, were markedly increased in phytosterol-treated found in small intestines of phytosterol-treated apoE−/−
mice (Fig. 2B). Intestinal cholesterol absorption was reduced mice. In liver, 26 sequences were significantly upregulated
by 45% in 2% phytosterol-treated mice compared with con- and 17 were downregulated in mice given phytosterols.
trol mice. In contrast, no significant differences in total lipid The rest of comparisons were not classified as increased or
80 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85

Table 3
Differentially expressed genes in small intestines of 4-week-phytosterol-treated apoE−/− mice
Gene symbol Full name Phyt/Ctrl ratio Gene Bank ID Affymetrix ID Process
Igk-V28 Ig kappa chain variable 28 39.4 V00779 96969 at Humoral immune response
Reg2 Regenerating islet-derived 2 19.7 D14011 95786 at Cell proliferation
Foxq1 Forkhead box Q1 6.9 AF010405 92658 at Cell immune response
Ig heavy chain V Ig heavy chain V region fragment 6.4 AF000913 97720 at Unknown
region fragment
Reg3g Regenerating islet-derived 3 gamma 2.0 D63362 96064 at Immune response/Cell
proliferation
Ig K light chain Ig K light chain 1.8 AF044198 97570 at Unknown
9030624C24Rik 1.7 AF045953 93162 f at Unknown
Pap Pancreatitis-associated protein 1.7 AV371861 161890 f at Inflammatory response
Mail-pending Molecule possessing ankyrin 1.6 AA614971 98988 at Inflammatory response
repeats-induced by LPS
Prom Prominin 1.6 AF039663 93390 g at Phototransduction
2010309G21Rik 1.6 J00592 92316 f at Antigen binding
Calb3 Calbindin-D9K 1.6 AF028071 160918 at Calcium ion binding
Slc11a2 Solute carrier family 11 1.6 AI852578 104451 at Iron transport
Akp3 Alkaline phosphatase 3 1.6 M61705 102147 at Hydrolase activity
Asml3a-pending Acid sphingomyelinase-like 1.5 Y08135 94872 at Carbohydrate metabolism
phosphodiesterase 3a
ESTs 1.5 AI594427 93471 at Unknown
ABCB1a ATP-binding cassette, sub-family B 1.5 M24417 102910 at Transport
(MDR/TAP), member 1A
Rfxank Regulatory factor X-associated −1.5 AF094761 103801 at Transcription regulation
ankyrin-containing protein
ESTs −1.5 AA881307 99825 at Unknown
0610039N19Rik −1.5 AW047688 95026 at Unknown
Ace Angiotensin converting enzyme −1.5 AV258262 161224 f at Proteolysis and peptidolysis
Igtp Interferon gamma induced GTPase −1.5 U53219 160933 at GTPase activity
Isg15 Interferon-stimulated protein (15 kDa) −1.6 X56602 98822 at Immune response
Cyp2e1 Cytochrome P450, 2e1, ethanol inducible −1.7 X010226 93996 at Electron transport
H2-Q10 Histocompatibility 2, Q region locus 10 −1.7 X16426 101898 s at Defense response
Spi1-3 Serine protease inhibitor 1–3 −1.7 M75720 101565 f at Serine proteases inhibition
Ifit1 Interferon-induced protein with −1.7 U43084 100981 at Immune response
tetratricopeptide repeats 1
Adn Adipsin −1.8 X04673 99671 at Complement activation
Alb 1 Albumin 1 −2.5 X13060 94777 at Transport
For each group, total RNA from small intestines of four animals were prepared for Affymetrix oligonucleotide hybridization as described in Section 2. Relative
expression profile of each phytosterol (Phyt)/control (Ctrl) gene shows whether a gene is significantly upregulated or downregulated.

decreased by the Microarray Suite software or did not reach

the cut-off level set by the LFC (see Section 2 for details).

3.4. Real-time RT-PCR analyses in apoE−/− mice

Gene expression absolute changes >3-fold in microarray

analyses were also studied by real-time RT-PCR (Fig. 3). In
all cases, these genes were confirmed to be overexpressed.
The level of concordance of the two methods was very good
with the exception of the Ig heavy chain V region fragment
that was found to be overexpressed an average of 21.6-fold in
the real-time RT-PCR assay and 6.4-fold in the microarray.
ABCA1 was expressed at low levels in small intestine and
ABCG5, ABCG8 and NPC1L1 were not represented on the Fig. 3. Gene expression changes confirmed by real-time RT-PCR. Gene
above-mentioned microarray. Thus, real-time RT-PCR was expression changes >3-fold in microarray analyses were confirmed by real-
also used to measure the intestinal and hepatic expression time RT-PCR. ␤-Actin was used as an internal control for these studies,
and values represent the amount relative to the amount in the apoE−/− con-
of these genes (Fig. 4). Ingestion of phytosterols was asso- trol mice, which was arbitrarily standardized to 1. Results are expressed as
ciated with a small reduction in the intestinal expression of mean ± S.E.M. of real-time RT-PCR analyses performed on samples from
the three mRNA ATP-binding cassette transporters analyzed individual animals (n = 4, same animals of microarray analyses plus 3 addi-
and NPC1L1 (Fig. 4). However, no significant correlation was tional samples for each group). P < 0.05 compared with the control.
 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85 81

Table 4
Differentially expressed genes in livers of 4-week-phytosterol-treated apoE−/− mice
Gene symbol Full name Phyt/Ctrl Gene Bank ID Affymetrix ID Process
ratio
Etv6 ETS variant gene 6 (TEL oncogene) 2.5 AI845538 160119 at Transcription regulation
Fdps Farnesyl diphosphate synthetase 2 AI846851 160424 f at Sterol synthesis
Gas5 Growth arrest specific 5 1.9 AI849615 98531 g at Cell cycle arrest
LOC207933 1.9 AA716963 96269 at Sterol biosynthesis
3110041O18Rik 1.9 AW047445 92437 at Unknown
Pbx1 Pre B-cell leukemia transcription factor 1 1.7 AW124932 94325 at Sex differentiation
Sc4mol Sterol-C4-methyl oxidase-like 1.7 AI848668 160388 at Sterol biosynthesis
Vnn1 Vanin 1 1.7 AJ132098 104165 at Nitrogen metabolism
Tieg TGFB inducible early growth response 1.6 AF064088 99603 g at Transcription regulation
5730469M10Rik 1.6 AI850090 96634 at Unknown
Rgs16 Regulator of G-protein signaling 16 1.6 U94828 94378 at G-protein regulation
Ech1 Enoyl coenzyme A hydratase 1, peroxisomal 1.6 AF030343 93754 at Fatty acid metabolism
Cct6a Chaperonin subunit 6a (zeta) 1.6 AV370410 162279 f at Protein folding
4933432H23Rik 1.6 AA597220 160959 at Unknown
Bhlhb2 Basic helix–loop–helix domain containing, class B2 1.6 Y07836 104701 at Transcription regulation
Nsdhl NAD(P) dependent steroid dehydrogenase-like 1.5 AW106745 98631 g at Cholesterol metabolism
Cappa2 Capping protein alpha 2 1.5 U16741 98127 at Actin cytoskeleton
organization
Fdft1 Farnesyl diphosphate farnesyl transferase 1 1.5 D29016 97518 at Isoprenoid biosynthesis
3110001A13Rik 1.5 AI644158 96640 at Unknown
2610207I16Rik 1.5 AI648018 96095 i at Sterol carrier activity
Slc16a7 Solute carrier family 16, member 7 1.5 AF058054 95060 at Transport
1190008F14Rik 1.5 AI848671 93806 at Unknown
Clk CDC-like kinase 1.5 M38381 93274 at Protein amino acid
phosphorylation
Decr1 2,4-Dienoyl CoA reductase 1, mitochondrial 1.5 AI844846 160711 at Reductase activity
Rad51I1 RAD51-like 1 (S. cerevisiae) 1.5 U92068 103944 at DNA repair
Npm1 Nucleophosmin 1 1.5 M33212 101634 at Nucleic acid, RNA and
protein binding
Bcl2l11 BCL2-like 11 (apoptosis facilitator) −1.5 AF032459 99418 at Apoptosis
Gtpbp1 GTP binding protein 1 −1.5 AV239949 161683 r at Protein synthesis elongation
Abcg1 ATP-binding cassette, sub-family G −1.5 Z48745 160612 at Transport
(WHITE), member 1
1110032A03Rik −1.5 AI851206 104314 r at Unknown
Egfr Epidermal growth factor receptor −1.5 AW049716 101841 at Protein amino acid
phosphorylation
Mt2 Metallothionein 2 −1.5 K02236 101561 at Metallothionein
Srebf1 Sterol regulatory element binding factor 1 −1.6 AI843895 93264 at Lipid metabolism
Emr1 EGF-like module containing, mucin-like, −1.6 X93328 103507 at G-protein regulation
hormone receptor-like 1
Pfc Properdin factor, complement −1.6 X12905 101468 at Complement activation
AI326478 Ig heavy chain 6 −1.7 V00817 93583 s at Humoral immune response
Hamp Hepcidin antimicrobial peptide −1.7 AI255961 104588 at Antibacterial peptide activity
Lgals3 Lectin, galactose binding, soluble 3 −1.8 X16834 95706 at Sugar binding
Rpo1–2 RNA polymerase 1–2 (128 kDa subunit) −1.8 U58280 92225 f at Transcription
Basp1 Brain abundant, membrane attached signal protein 1 −2.0 AW124113 95673 s at Unknown
Saa3 Serum amyloid A 3 −2.0 X03505 102712 at Oxidative stress response
Marco Macrophage receptor with collagenous structure −2.3 U18424 102974 at Immune response
Ldh2 Lactate dehydrogenase 2, B chain −2.6 X51905 101990 at Anaerobic glycolysis pathway
For each group, total RNA from livers of four animals were prepared for Affymetrix oligonucleotide hybridization as described in Section 2. See legend to
Table 3.

found between these intestinal lipid transporters expression 3.5. Re-testing main results obtained in apoE−/− in
and non-HDL cholesterol levels (data not shown). A signif- C57BL/6J and LDLR−/− mice
icant increase in ABCG8 and NPC1L1 mRNA expression
was observed in livers of mice fed with phytosterols. Again, To ascertain whether the changes found in apoE−/− mice
no significant correlation was found between liver ABCA1, were due to the hypocholesterolemic effect of phytosterols
ABCG5, ABCG8 and NPC1L1 mRNA expression and non- or to the lack of apoE, two other strains (C57BL/6J and
HDL cholesterol levels (data not shown). LDLR−/− ) of mice were also analyzed after being fed with
82 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85

Fig. 4. Relative mRNA levels for ABCA1, ABCG5, ABCG8 and NPC1L1 of apoE−/− Western-fed mice treated with or without phytosterols for 4 weeks.
mRNA levels for ABCA1 (A), ABCG5 (B) and ABCG8 (C) and NPC1L1 (D) were quantified by real-time RT-PCR and ␤-actin used as an internal control.
Tissue with the most abundant signal was set to a normalized value of 100 arbitrary units. Results are expressed as mean ± S.E.M. of individual animals (n = 4,
same animals of microarray analyses plus 3 additional samples for each group). P < 0.05 compared with the control.

the same Western-type diet enriched or not with phytosterols. the non-HDL fraction. Phytosterol-treated LDLR−/− mice
These strains were selected because their plasma cholesterol showed a small but statistically significant decrease in intesti-
levels were very different before and after phytosterol treat- nal ABCA1, ABCG5, ABCG8, NPC1L1 and Ig heavy chain
ment. The results of these analyses are presented in Table 5. V region mRNA expression, whereas the relative level of IgK-
Phytosterols inhibited intestinal cholesterol in both types V28 and Reg2 increased by almost fourfold (Table 5). In con-
of mice but only prevented increase in plasma cholesterol trast, phytosterol-treated C57BL/6J mice presented a small
in LDLR−/− mice. Plasma total cholesterol in phytosterol- increase in the expression of intestinal ABCA1, ABCG8 and
treated LDLR−/− mice was 9.8 mmol/L versus 15.8 mmol/L NPC1L1 and decreased relative level of Reg2 mRNA com-
in non-treated animals, a reduction that corresponded to pared with non-treated C57BL/6J mice (Table 5).

Table 5
Effects of phytosterols on plasma lipoproteins, intestinal cholesterol absorption and relative intestinal mRNA levels of selected genes in C57BL/6J and LDLR−/−
mice
C57BL/6J LDLR−/−

Control 2% Phytosterols Control 2% Phytosterols

Plasma total cholesterol (mM) 2.9 ± 0.1 2.6 ± 0.2 15.8 ± 1.6 9.8 ± 1.2*
Plasma non-HDL cholesterol (mM) 0.6 ± 0.08 0.5 ± 0.2 14.1 ± 1.6 8.4 ± 1.1*
Intestinal cholesterol absorption (%) 57.9 ± 3.7 23.8 ± 7.9* 78.7 ± 2.2 36.0 ± 2.0*
Relative level of ABCA1 mRNA 100 ± 9.7 149 ± 12* 100 ± 9.4 44.7 ± 2.8*
Relative level of ABCG5 mRNA 100 ± 10.3 105.9 ± 9.0 100 ± 6.4 49.9 ± 5.3*
Relative level of ABCG8 mRNA 100 ± 8.3 153.6 ± 16.8* 100 ± 7.7 53.9 ± 3.2*
Relative level of NPC1L1 mRNA 100 ± 8.1 132.7 ± 13.1* 100 ± 7.0 76.7 ± 5.3*
Relative level of IgK-V28 mRNA 100 ± 8.4 167.9 ± 56.0 100 ± 14.9 370.4 ± 94.4*
Relative level of Reg2 mRNA 100 ± 14.3 56.4 ± 8.6* 100 ± 17.9 391.5 ± 99.2*
Relative level of FoxQ1 mRNA 100 ± 13.3 85.8 ± 14.2 100 ± 21.1 85.7 ± 8.7
Relative level of Ig heavy chain V region mRNA 100 ± 15.7 166.0 ± 45.5 100 ± 23.6 25.1 ± 5.0*
Results are expressed as mean ± S.E.M. of individual animals (n = 5 for each group). Tissue of control animals was set to a normalized value of 100 arbitrary
units.
∗ P < 0.05 compared with the control.
 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85 83

4. Discussion suggests that most changes found in intestinal gene expres-

sion are more related to the level of plasma cholesterol (or
As expected [25,26], phytosterols decreased serum its consequences) than to a direct phytosterol effect. Previ-
cholesterol levels and atherosclerosis in apoE−/− mice. They ous evidence of a relationship between cholesterol levels and
also did so in LDLR−/− mice, but not in C57BL/6J mice, immunity status does exist [19]. Further, there is an apoE-
even though a reduction in intestinal cholesterol absorption dependence effect in some of these changes in intestinal
was observed in all models. This may be due to the low level gene expression whose origin is unknown. In this context,
of plasma cholesterol in C57BL/6J mice that could lead cells it should be pointed out that apoE-deficiency also modulates
to compensate lower absorption of cholesterol with increased dietary cholesterol absorption and cholesterol bile excretion
synthesis. In line with previous observations, no effects of [44].
phytosterols were found on bile acid pool size, biliary bile
acid levels and fecal excretion of bile acids [35]. In con- 4.2. Liver
trast, a phytosterol-mediated decrease in bile cholesterol and
phospholipid content was found in apoE−/− , the only animal It is noteworthy that gene expression and detailed bio-
model in which these parameters were analyzed. These data chemical studies of the liver were only conducted in apoE−/− .
suggest that the reduced liver cholesterol levels were rate-
limiting for the excretion of cholesterol into the bile, which 4.2.1. Lipid metabolism
is usually coupled to phospholipid excretion [36]. It is noticeable the fact that ABCG8 and NPC1L1 mRNA
expression increased in liver of phytosterol-treated apoE−/−
4.1. Small intestine mice. However, liver ABCG8 overexpression has no effect on
the plasma lipid profile [45]. The increase in liver NPC1L1
4.1.1. Lipid metabolism expression is unlikely to be of relevance in the hepatic clear-
The results of this study demonstrate that the inhibition ance of phytosterols since the liver expression of this gene in
of cholesterol absorption by phytosterols does not require mouse is very small relative to intestine. This contrasts with
increases in the mRNA expression of intestinal ABCA1, a high liver expression of NPC1L1 in humans [13].
ABCG5 and ABCG8 transporters. Moreover, it reveals that The relatively lower levels of liver cholesterol were not
the downregulation found in intestinal NPC1L1 does not cor- compensated and this is consistent with the absence of tran-
relate with the hypocholesterolemic effect of phytosterols. In scriptional changes in 3-hydroxy-3-methylglutaryl (HMG)-
fact, these transporters are slightly decreased in the cases of CoA reductase and LDL receptor genes. This fact has previ-
phytosterol-treated apoE−/− and LDLR−/− mice. This ob- ously been observed in mice [35] but not in humans treated
servation contrasts with phytosterol-treated C57BL/6J mice, with stanols [46]. Taken together, most of the observed
which presented slightly increased gene expression of all changes in liver gene expression may be the primary or the
these sterol transporters. Similar findings have recently been compensatory response to an increased campesterol liver con-
reported in hamsters in which the intestinal expression of centration together with reduced liver cholesterol content that
these genes after a phytosterol-treatment changed in the could lead, at least in part, to a decrease in LXR-mediated
same direction as plasma cholesterol after different interven- activation. This could be the case of the moderate down-
tions, such as cholesterol feeding, stanol ester feeding and regulations of the sterol regulatory element binding factor 1
cholestyramine/lovastatin treatment [37]. We speculate that (SREBP-1) or the ABCG1 transporter [47,48].
although phystosterols may increase per se the intestinal gene
expression of ABCA1, ABCG5, ABCG8 and NPC1L1, their 4.2.2. Immune regulation
hypocholesterolemic effect could decrease the intestinal ex- Changes in genes that operate in cell growth/differentia-
pression of these transporters, perhaps through an associated tion and stress/inflammatory pathways were also identi-
decrease in oxysterol signaling to LXR [38]. Obviously, the fied in apoE−/− mice. The E-Twenty-Six (ETS) family
possibility exists that activities of these intestinal proteins member TEL (ETV6) [49] upregulation observed would
may be altered by phytosterols through postranscriptional be consistent with a potential role of phytosterols in can-
mechanisms. cer protection [20,21,24]. Further, mRNA expression of two
stress-responsive genes, serum amyloid A3 (SAA3) and
4.1.2. Immune regulation macrophage receptor with collagenous structure (MARCO)
Results of the small intestine microarray analyses in were downregulated. SAA3 is an acute-phase reactant pro-
apoE−/− mice were indicative of activation of genes involved tein specially induced by interleukin-1 through a mechanism
in immune response. This is the case of IgK-V28 [39], Ig that involves a nuclear factor kappa beta-mediated increase
heavy chain V region fragment, Reg2 [40–42], and FoxQ1 in transcription [50,51]. MARCO, an LXR-controlled gene,
[43]. However, only IgK-V28 and Reg2 were found to be up- plays a role in host defense as well as in innate immunity
regulated, at a lower level, in phytosterol-treated LDLR−/− against infectious agents and its capacity to scavenge acety-
mice and none of these changes in intestinal gene expres- lated LDL has also been described [19,52,53]. In line with
sion were present in phytosterol-treated C57BL/6J mice. This the other results, we may hypothesize that a number of these
84 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85

changes are related to the decreased liver cholesterol content [5] Mel’nikov SM, Seijen ten Hoorn JWM, Bertrand B. Can choles-
and the lack of apoE. terol absorption be reduced by phytosterols and phytostanols via a
cocrystallization mechanism? Chem Phys Lipids 2004;127:15–33.
[6] Plat J, van Onselen EN, van Heugten MM, Mensink RP. Effects on
4.2.3. Study limitations serum lipids, lipoproteins and fat soluble antioxidant concentrations
It is noteworthy that some changes in gene expression of consumption frequency of margarines and shortenings enriched
with plant stanol esters. Eur J Clin Nutr 2000;54:671–7.
could be even more pronounced given the dilution of im- [7] Plat J, Mensink RP. Increased intestinal ABCA1 expression con-
mune cells in an enterocyte- or hepatocyte-enriched medium. tributes to the decrease in cholesterol absorption after plant stanol
Thus, gene expression profiles in specific cell cultures incu- consumption. FASEB J 2002;16:1248–53.
bated with phytosterols may provide additional significant [8] Berge KE, Tian H, Graf GA, et al. Accumulation of dietary choles-
information. This approach has been followed in other recent terol in sitosterolemia caused by mutations in adjacent ABC trans-
porters. Science 2000;290:1771–5.
studies [7,54]. Our experimental approach does not allow us [9] Repa JJ, Turley SD, Lobaccaro JMA, et al. Regulation of absorp-
to determine whether changes in gene expression are due to tion and ABC1-mediated efflux of cholesterol by RXR heterodimers.
decreased cholesterol levels, increased plant sterols, or both. Science 2000;289:1524–9.
However, this question has also been addressed recently by [10] Repa JJ, Berge KE, Pomajzl C, et al. Regulation of ATP-binding
another group [55]. cassette sterol transporters ABCG5 and ABCG8 by the liver X re-
ceptors alpha and beta. J Biol Chem 2002;277:18793–800.
[11] Yu L, Li-Hawkins J, Hammer RE, et al. Overexpression of
ABCG5 and ABCG8 promotes biliary cholesterol secretion and
5. Conclusions reduces fractional absorption of dietary cholesterol. J Clin Invest
2002;110:671–80.
[12] Kaneko E, Matsuda M, Yamada Y, et al. Induction of intestinal ABC
The data presented here provide, to our knowledge, the transporters by a phytosterol-derived liver X receptor agonist. J Biol
first global assessment of gene expression patterns in re- Chem 2003;278:36091–8.
sponse to phytosterol treatment. Our data show that transcrip- [13] Altmann SW, Davis HR, Zhu LJ, et al. Niemann–Pick C1 Like
tional changes in ABCA1, ABCG5, ABCG8 and NPC1L1 do 1 protein is critical for intestinal cholesterol absorption. Science
not play an essential role in the phytosterol-sensitive reduc- 2004;303:1201–4.
[14] Davis HR, Zhu L, Hoos LM, et al. Niemann–Pick C1 Like 1
tion in cholesterol absorption in mice. Rather, the intestinal (NPC1L1) is the intestinal phytosterol and cholesterol transporter
expression of these transporters seems to be modified in rela- and a key modulator of whole body cholesterol homeostasis. J Biol
tion to plasma cholesterol concentrations. Microarray anal- Chem 2004;279:33586–92.
yses permitted identification of changes in the expression of [15] Salen G, von Bergmann K, Lütjohann D, et al., Multicenter Sitos-
four novel phytosterol-inducible genes involved in immune terolemia Study Group. Ezetimibe effectively reduces plasma plant
sterol in patients with sitosterolemia. Circulation 2004;109:966–71.
response of the gut, although these changes are dependent, [16] Bouic PJD. The role of phytosterols and phytosterolins in immune
first, on the hypocholesterolemic action of phytosterols and, modulation: a review of the past 10 years. Curr Opin Clin Nutr
second, at least in part to the lack of apoE. Metab Care 2001;4:471–5.
[17] Breytenbach U, Clark A, Lamprecht J, Bouic P. Flow cytometric
analysis of the TH1–TH2 balance in healthy individuals and patients
infected with the human immunodeficiency virus (HIV) receiving a
Acknowledgments plant sterol/sterolin mixture. Cell Biol Int 2001;25:43–9.
[18] Bouic PJD, Etsebeth S, Liebenberg RW, et al. Beta-sitosterol and
We are grateful to Christine O’Hara for editorial assis- beta-sitosterol glucoside stimulate human peripheral lymphocyte pro-
tance. This study was supported by Lipofoods, S.L. and grants liferation: implications for their use as an immunomodulatory vita-
min combination. Int J Immunopharmacol 1996;18:693–700.
from FIS C03-08 and G03-181. During part of this work, [19] Joseph SB, Bradley MN, Castrillo A, et al. LXR-dependent gene ex-
J.C.E.-G was funded by the Programa Ramón y Cajal del pression is important for macrophage survival and the innate immune
Ministerio de Ciencia y Tecnologı́a. response. Cell 2004;119:299–309.
[20] Takaku T, Kimura Y, Okuda H. Isolation of an antitumor compound
from Agaricus blazei Murill and its mechanisms of action. J Nutr
2001;131:1409–13.
References [21] Awad AB, Fink CS. Phytosterols as anticancer dietary components:
evidence and mechanism of action. J Nutr 2000;130:2127–30.
[1] Moghadasian MH, Frohlich JJ. Effects of dietary phytosterols on [22] Awad AB, Chen YC, Fink CS, Hennessey T. Beta-Sitosterol inhibits
cholesterol metabolism and atherosclerosis: clinical and experimental HT-29 human colon cancer cell growth and alters membrane lipids.
evidence. Am J Med 1999;107:588–94. Anticancer Res 1996;16:2797–804.
[2] Plat J, Kerckhoffs DA, Mensink RP. Therapeutic potential of plant [23] Awad AB, Downie A, Fink CS, Kim U. Dietary phytosterol inhibits
sterols and stanols. Curr Opin Lipidol 2000;11:571–6. the growth and metastasis of MDA-MB-231 human breast cancer
[3] The Expert Panel. Executive summary of the third report of the Na- cells grown in SCID mice. Anticancer Res 2000;20:821–4.
tional Cholesterol Education Program (NCEP) expert panel on de- [24] Park KY, Cho EJ, Rhee SH, et al. Kimchi and an active component,
tection, evaluation, and treatment of high blood cholesterol in adults ␤-sitosterol, reduce oncogenic H-Rasv12-induced DNA synthesis. J
(Adult Treatment Panel III). J Am Med Assoc 2001;285:2486–97. Med Food 2003;6:151–6.
[4] Ikeda I, Tanabe Y, Sugano M. Effects of sitosterol and sitostanol [25] Moghadasian MH, McManus BM, Pritchard PH, Frohlich JJ. “Tall
on micellar solubility of cholesterol. J Nutr Sci Vitaminol oil”-derived phytosterols reduce atherosclerosis in ApoE-deficient
1989;35:361–9. mice. Arterioscler Thromb Vasc Biol 1997;17:119–26.
 L. Calpe-Berdiel et al. / Atherosclerosis 181 (2005) 75–85 85

[26] Moghadasian MH, McManus BM, Godin DV, Rodrigues B, Frohlich [40] Unno M, Yonekura H, Nakagawara K, et al. Structure, chromosomal
JJ. Proatherogenic and antiatherogenic effects of probucol and phy- localization, and expression of mouse reg genes, reg I and reg II. A
tosterols in apolipoprotein E-deficient mice: possible mechanisms of novel type of reg gene, reg II, exists in the mouse genome. J Biol
action. Circulation 1999;99:1733–9. Chem 1993;268:15974–82.
[27] National Research Council. Guide for the care and use of labora- [41] Okamoto H, Takasawa S. Recent advances in the Okamoto model:
tory animals. Publication no. 85-23 (rev.). Washington, DC: National the CD38–cyclic ADP–ribose signal system and the regenerating
Institutes of Health; 1985. gene protein (Reg)–Reg receptor system in beta-cells. Diabetes
[28] Escolà-Gil JC, Julve-Gil J, Marzal-Casacuberta À, et al. Expression 2002;51:462–73.
of human apolipoprotein A-II in apolipoprotein E-deficient mice in- [42] Kazumori H, Ishihara S, Hoshino E, et al. Neutrophil chemoattractant
duces features of familial combined hyperlipidemia. J Lipid Res 2 beta regulates expression of the Reg gene in injured gastric mucosa
2000;41:1328–33. in rats. Gastroenterology 2000;119:1610–22.
[29] Marzal-Casacuberta À, Blanco-Vaca F, Ishida BY, et al. Func- [43] Hong HK, Noveroske JK, Headon DJ, et al. The winged he-
tional lecithin:cholesterol acyltransferase deficiency and high den- lix/forkhead transcription factor Foxq1 regulates differentiation of
sity lipoprotein deficiency in transgenic mice overexpressing human hair in satin mice. Genesis 2001;29:163–71.
apolipoprotein A-II. J Biol Chem 1996;271:6720–8. [44] Sehayek E, Shefer S, Nguyen LB, et al. Apolipoprotein E regu-
[30] Sánchez-Quesada JL, Ortega H, Payés-Romero A, et al. LDL from lates dietary cholesterol absorption and biliary cholesterol excre-
aerobically trained subjects shows higher resistance to oxidative tion: studies in C57BL/6 apolipoprotein E knockout mice. PNAS
modification than LDL from sedentary subjects. Atherosclerosis 2000;97:3433–7.
1997;132:207–13. [45] Wu JE, Basso F, Shamburek RD, et al. Hepatic ABCG5 and
[31] Honda A, Tint GS, Salen G, et al. Sterol concentrations in cul- ABCG8 overexpression increases hepatobiliary sterol transport but
tured Smith–Lemli–Opitz syndrome skin fibroblasts: diagnosis of does not alter aortic atherosclerosis in transgenic mice. J Biol Chem
a biochemically atypical case of the syndrome. Am J Med Genet 2004;279:22913–25.
1997;68:282–7. [46] Plat J, Mensink RP. Effects of plant stanol esters on LDL receptor
[32] Plat J, Brzezinka H, Lütjohann D, Mensink RP, von Bergmann K. protein expression and on LDL receptor and HMG-CoA reductase
Oxidized plant sterols in human serum and lipid infusions as mea- mRNA expression in mononuclear blood cells of healthy men and
sured by combined gas–liquid chromatography–mass spectrometry. women. FASEB J 2002;16:258–60.
J Lipid Res 2001;42:2030–8. [47] Yang C, Yu L, Li W, et al. Disruption of cholesterol homeostasis by
[33] Turley SD, Daggy BP, Dietschy JM. Psyllium augments the plant sterols. J Clin Invest 2004;114:813–22.
cholesterol-lowering action of cholestyramine in hamsters by en- [48] Edwards PA, Kast HR, Anisfeld AM. BAREing it all: the adoption
hancing sterol loss from the liver. Gastroenterology 1994;107:444– of LXR and FXR and their roles in lipid homeostasis. J Lipid Res
52. 2002;43:2–12.
[34] Mutch DM, Berger A, Mansourian R, Rytz A, Roberts MA. The [49] Wood LD, Irvin BJ, Nucifora G, Luce KS, Hiebert SW. Small
limit fold change model: a practical approach for selecting differ- ubiquitin-like modifier conjugation regulates nuclear export of
entially expressed genes from microarray data. BMC Informatics TEL, a putative tumor suppressor. Proc Natl Acad Sci USA
2002;3:17–27. 2003;100:3257–62.
[35] Volger OL, van der Boom H, de Wit EC, et al. Dietary plant [50] Bing Z, Huang JH, Liao WS. NFkappa B interacts with serum amy-
stanol esters reduce VLDL cholesterol secretion and bile saturation loid A3 enhancer factor to synergistically activate mouse serum amy-
in apolipoprotein E*3-Leiden transgenic mice. Arterioscler Thromb loid A3 gene transcription. J Biol Chem 2000;275:31616–23.
Vasc Biol 2001;21:1046–52. [51] Liao F, Lusis AJ, Berliner JA, et al. Serum amyloid A protein fam-
[36] Smit JJ, Schinkel AH, Oude Elferink RP, et al. Homozygous dis- ily. Differential induction by oxidized lipids in mouse strains. Arte-
ruption of the murine mdr2 P-glycoprotein gene leads to a com- rioscler Thromb 1994;14:1475–9.
plete absence of phospholipid from bile and to liver disease. Cell [52] Gough PJ, Gordon S. The role of scavenger receptors in the innate
1993;75:451–62. immune system. Microbes Infect 2000;2:305–11.
[37] Field FJ, Born E, Mathur SN. Stand esters decrease plasma [53] Kraal G, van der Laan LJW, Elomaa O, Tryggvason K. The
cholesterol independently of intestinal ABC sterol transporters and macrophage receptor MARCO. Microbes Infect 2000;2:313–6.
Niemann-Pick CL-like L protein gene expression. J Lipid Res [54] Field FJ, Born E, Mathur SN. LXR/RXR ligand activation enhances
2004;45:2252–9. the basolateral efflux of ␤-sitosterol in Caco-2 cells. J Lipid Res
[38] Bjorkhem I, Diczfalusy U. Oxysterols: friends, foes, or just fel- 2004;45:905–13.
low passengers? Arterioscler Thromb Vasc Biol 2002;22:734– [55] Duan LP, Wang HH, Wang DQ-H. Cholesterol absorption is
42. mainly regulated by the jejunal and ileal ATP-binding cassette
[39] Lefranc MP. Nomenclature of the human immunoglobulin kappa sterol efflux transporters Abcg5 and Abcg8 in mice. J Lipid Res
(IGK). Genes Exp Clin Immunogenet 2001;18:161–74. 2004;45:1312–23.