ORIGINAL RESEARCH

published: 29 April 2020

doi: 10.3389/fmars.2020.00197

The Potential Role of Marine Protein

Hydrolyzates in Elevating Nutritive
Values of Diets for Largemouth Bass,
Micropterus salmoides
Min Dai 1 , Songlin Li 1,2,3* , Cefeng Fu 1 , Hongjie Qiu 1 and Naisong Chen 1,3*
1
Research Centre of the Agriculture Ministry on Environmental Ecology and Fish Nutrition, Shanghai Ocean University,
Shanghai, China, 2 Guangxi Key Laboratory of Marine Natural Products and Combinatorial Biosynthesis Chemistry, Guangxi
Beibu Gulf Marine Research Center, Guangxi Academy of Sciences, Nanning, China, 3 National Demonstration Center
for Experimental Fisheries Science Education, Shanghai Ocean University, Lingang New City, China

The study was conducted to explore the improvement function of marine protein
hydrolyzates on nutritive values of diets for largemouth bass. The diet with no inclusion
of marine protein hydrolyzate was considered as the control (NC), and four other
diets were formulated with fish soluble (FS), squid paste (SqP), shrimp paste (ShP),
or a mixture of FS, SqP, and ShP (Mix). Triplicate tanks of fish were fed to apparent
Edited by: satiation twice daily for 81 days. Results showed that the growth performance was
Kang-le Lu,
Jimei University, China
elevated due to the inclusion of marine protein hydrolyzates along with significantly
Reviewed by:
elevated feed intake and protein digestibility. Thereinto, the inclusion of FS and ShP
Xuan Wang, significantly improved the growth performance compared to NC. The supplementation
Ocean University of China, China
of marine protein hydrolyzates elevated the protein content and lysozyme activity
Xiaofang Liang,
Chinese Academy of Agricultural of serum, but significantly decreased the activity of liver alanine transaminase and
Sciences, China aspartate transaminase. The gene expression analysis revealed that marine protein
*Correspondence: hydrolyzate inclusion up-regulated the expression of insulin-like growth factor I (IGF-I)
Songlin Li
[email protected]
with increased expression of TOR pathway-related genes including protein kinase B
Naisong Chen (AKT) 1 and ribosomal protein S6. However, the expression of activating transcription
[email protected]
factor 4 (ATF4) and regulated in development and DNA damage responses 1 (REDD1)
Specialty section:
involved in the amino acids response (AAR) pathway was depressed with the addition
This article was submitted to of marine protein hydrolyzates. The activation of the TOR pathway and depression of
Marine Fisheries, Aquaculture,
the AAR pathway may be beneficial for the improved performance of fish. In the above,
and Living Resources,
a section of the journal the marine protein hydrolyzate, especially FS and ShP, can elevate nutritive values of
Frontiers in Marine Science diets for largemouth bass.
Received: 11 February 2020
Accepted: 13 March 2020 Keywords: marine protein hydrolyzates, growth performance, gene expression, nutrient-sensing pathway,
largemouth bass
Published: 29 April 2020
Citation:
Dai M, Li S, Fu C, Qiu H and
Chen N (2020) The Potential Role
INTRODUCTION
of Marine Protein Hydrolyzates
in Elevating Nutritive Values of Diets
Fish meal has been recognized as an indispensable protein source in the feed for carnivorous fish
for Largemouth Bass, Micropterus with high protein requirement because of its abundant protein content, excellent amino acid profile,
salmoides. Front. Mar. Sci. 7:197. and high palatability (Tacon and Metian, 2008). However, the reduced resource and rising price of
doi: 10.3389/fmars.2020.00197 fish meal seriously limit its use (FAO, 2016), and therefore, alternative protein sources have been

Frontiers in Marine Science | www.frontiersin.org 1 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

widely explored to reduce the use of fish meal in aquafeed (Gatlin in our lab has demonstrated that soybean meal could reduce
et al., 2007; Lim and Webster, 2008). the use of fish meal in the diet for largemouth bass to 35%
In general, high inclusion of plant protein in aquafeed without negative effect on growth performance (Chen et al.,
commonly produces negative effects on digestive physiology and 2013). The present study was conducted to evaluate the effect
further reduces the growth performance of farmed fish, mainly of marine protein hydrolyzate inclusion, fish soluble (FS), squid
due to their shortcomings in enriched anti-nutritional factors, paste (SqP), and shrimp paste (ShP), on the growth performance
unbalanced amino acid composition, and poor palatability (Burel and feed utilization of largemouth bass fed the diet with relative
et al., 2000; Barros et al., 2002; Colburn et al., 2012; Song low fishmeal. In addition, the response of IGF-1 expression, TOR
et al., 2014). The marine by-products, such as the by-products pathway, and AAR pathway was investigated at the transcription
of shrimp, squid, scallop, and fish, could be effectively converted level in the present study.
to biologically functional products via enzymatic hydrolysis
(Shahidi, 1994; Gildberg and Stenberg, 2001). The study in red sea
bream (Pagrus major) has demonstrated the improving nutritive MATERIALS AND METHODS
values of low fish meal diet with the inclusion of small amounts
(10%) of some crude ingredients including fish soluble, krill meal, Experimental Diets and Experimental
and squid meal (Kader et al., 2010). In addition, the mixture of Procedure
seafood by-products and soybean proteins realizes the complete Five isonitrogenous (crude protein 48%) and isolipidic (12%)
substitution of fish meal in the diet for red sea bream (Kader et al., diets were formulated, where diet was with no inclusion of
2012). Accordingly, marine protein hydrolyzates, containing marine protein hydrolzsate (NC) or with 10% FS, SqP, ShP, or
balanced amino acids and high trace elements including taurine a mixture of the above three protein hydrolyzate each at the
and free amino acids similar to fish meal, have been confirmed 3.33% (Mix) (Table 1). The contents of amino acids and free
to improve the growth performance of farmed fish fed with high amino acids in experimental diets were presented in Tables 2, 3,
plant protein diets (Cahu et al., 2004; Kader et al., 2010, 2012; respectively. The marine protein hydrolyzate, FS, SqP, and ShP,
Kader and Koshio, 2012). used in the present study was supplied by Zhejiang Yifeng
The nutritional status effectively affects the growth hormone Marine Biological Products Co., Ltd (Zhejiang, China). The
(GH)/insulin-like growth factor (IGF) system to regulate the addition of marine protein hydrolyzate was conducted at the
development and growth of vertebrates (Thissen et al., 1994; expense of fermented soybean meal and corn gluten meal to
Duan, 1998; Reinecke et al., 2005). In general, high replacement maintain consistent crude protein content. Fish oil content was
of fish meal commonly produces negative effects on growth changed to adjust the lipid content caused by the addition
performance of fish species with depressed expression of IGF- of marine by-product, and soybean oil was used to maintain
I (Gómez-Requeni et al., 2004; Luo et al., 2012; Men et al., the consistent of crude lipid content. Cr2 O3 was added as
2014; Wang et al., 2017). The mechanistic target of rapamycin an indicator to evaluate the apparent digestibility coefficients
(TOR) pathway and amino acids response (AAR) pathway (ADCs) of nutrients. The formulated process of experimental
act as the main cellular nutrient-sensing pathway to regulate diets was conducted following the description of Li et al.
protein synthesis and downstream metabolism (Kimball and (2019). Briefly, the low-lipid ingredients, after being grounded
Jefferson, 2002). The activation of the TOR pathway promotes through 75-µm mesh, were blended thoroughly, followed by
protein synthesis and inhibits autophagy to regulate organismal the mixture with lipid ingredients. Then, water was added to
growth (Laplante and Sabatini, 2012), while the AAR pathway make a stiff dough, which was then extruded by a pelleting
could be activated by amino acid deficiency to repress global machine. The extruded pellets were stored at −20◦ C after
protein synthesis (Kilberg et al., 2005). In the study of teleost, being cooked for starch gelatinization and dried in a ventilated
the replacement of fish meal with soybean meal or meat oven until used.
and bone meal resulted in the down-regulation of the TOR The animal study was reviewed and approved by the
pathway and activation of the AAR pathway, and this accounted Animal Care and Use Committee of Shanghai Ocean University.
for the reduced growth performance of turbot, Scophthalmus The experimental largemouth bass were obtained from a
maximus (Song et al., 2016; Xu et al., 2016). Available literatures commercial hatchery (Suzhou, China) and then reared in an
have reported that the marine protein hydrolyzates act as indoor temperature-controlled recirculating freshwater system
attractants in high plant protein-based diets for maintaining (Shanghai, China) for 4 weeks’ domestication with commercial
normal feeding behavior and growth performance (Hidaka et al., feed. After acclimatization, the fish with uniform size (initial
2000; Toften et al., 2003; Kofuji et al., 2006; Kousoulaki et al., body weight, 10.68 ± 0.01 g), after being fasted for 24 h, were
2009; Kader et al., 2010, 2012), while it is unclear whether the selected and allocated into 15 glass reinforced plastic tanks with a
improved growth performance is mediated by the TOR pathway density of 40 fish per tank. Triplicate tanks were fed to apparent
and AAR pathways. satiation twice daily (8:00 and 16:00 h) for 81 days. During the
Largemouth bass (Micropterus salmoides) has been widely feeding trial, the water in the system was recirculated after being
cultured in China and its production is approximately 432,000 deposited, filtered by sponges and coral sand, and sterilized by
tons in 2018 in China (Yearbook, 2019). This carnivorous fish ultraviolet light. In addition, water quality was monitored: water
possesses high dietary protein requirement (48%) with fish meal temperature was 27 ± 1◦ C, pH was 7.2 ± 0.2, dissolved oxygen
as major protein source (Huang et al., 2017). A previous study was ≥6 mg/L, and ammonia nitrogen content was ≤0.2 mg/L.

Frontiers in Marine Science | www.frontiersin.org 2 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

TABLE 1 | Ingredient composition and proximate analysis of the experimental diet TABLE 2 | Amino acid content of the diets (g 100 g−1 dry matter)*.
(% dry matter).
Amino acids Marine protein hydrolyzates
Ingredients Marine protein hydrolyzates
NC FS SqP ShP Mix
NC FS SqP ShP Mix
Essential amino acid (EAA)
Fish meala 35 35 35 35 35 Threonine 2.11 2.21 2.13 2.19 2.16
Fermented soybean meala 12.5 7 8.5 6.5 7 Valine 2.56 2.63 2.56 2.66 2.59
Corn gluten meala 17.5 11 13.5 11.5 12.5 Methionine 1.16 1.25 1.17 1.17 1.16
Blood meala 5 5 5 5 5 Isoleucine 1.81 1.88 1.99 1.90 1.77
Wheat gluten meala 2 2 2 2 2 Leucine 4.60 4.46 4.70 4.40 4.45
Beer yeasta 2 2 2 2 2 Phenylalanine 2.18 2.23 2.26 2.19 2.14
α-Starch 5 5 5 5 5 Histidine 1.73 1.73 1.73 1.71 1.74
Soybean oil 1.8 2.4 2.2 2.4 0.8 Lysine 3.09 3.46 3.12 3.30 3.26
Fish oil 3.6 2.6 0 3 3.4 Arginine 2.50 2.40 2.76 2.45 2.49
Lecithin oil 2.5 2.5 2.5 2.5 2.5 Total EAA 21.72 22.26 22.42 21.97 21.75
Vitamin mixtureb 1 1 1 1 1 Non-essential amino acid (NEAA)
Mineral mixturec 1 1 1 1 1 Proline 3.09 3.04 3.3 3.17 3.04
Aspartic acid 4.53 4.72 4.66 4.55 4.69
Ca(H2 PO4 )2 1 1 1 1 1
Glutamic acid 8.35 8.33 8.39 8.08 8.53
Cr2 O3 0.5 0.5 0.5 0.5 0.5
Serine 2.52 2.45 2.60 2.43 2.54
Carboxymethyl cellulose 1.5 1.5 1.5 1.5 1.5
Glycine 2.32 2.60 2.28 2.58 2.59
Zeolite powder 7.8 10.2 9 9.8 9.6
Alanine 3.14 3.22 3.02 3.12 3.20
Fish solubled 0 10 0 0 3.3
Cystine 0.51 0.49 0.49 0.45 0.49
Squid pasted 0 0 10 0 3.3
Tyrosine 1.48 1.46 1.56 1.42 1.45
Shrimp pasted 0 0 0 10 3.3
Total NEAA 25.94 26.31 26.29 25.79 26.54
Phytase 0.3 0.3 0.3 0.3 0.3
Total AA 47.66 48.57 48.71 47.76 48.29
Proximate composition (% dry matter basis)
*Tryptophan was not determined in the present study.
Crude protein 49.74 49.71 49.66 49.71 49.74
Crude lipid 12.21 12.11 12.19 12.48 12.29
Ash 19.36 20.77 19.53 20.96 20.51 TABLE 3 | Free amino acid content of the diets (g 100 g−1 dry matter)*.
Gross energy (kJ g−1 ) 18.82 18.44 18.58 18.79 18.62
Amino acids Marine protein hydrolyzates
a Supplied by Zhejiang Xinxin Tianen Aquatic Feed Corporation (Jiaxing, China):
white fish meal, crude protein, 67.44%, crude lipid, 8.83%; wheat gluten meal, NC FS SqP ShP Mix
crude protein, 76.56%; fermented soybean meal, crude protein, 51.62%, crude
lipid, 0.54%; corn gluten meal, crude protein, 63.01%, crude lipid, 7.57%; blood Essential amino acid (EAA)
meal, crude protein, 78.12%, crude lipid, 1.53%; brewer’s yeast meal, crude Threonine 0.03 0.12 0.06 0.12 0.10
protein, 45.99%, crude lipid, 0.40%. b Vitamin Premix (mg kg−1 diet): vitamin A,
Valine 0.04 0.17 0.08 0.15 0.13
16000 IU; vitamin D3 , 8000 IU; vitamin K3 , 14.72; vitamin B1 , 17.80; vitamin
B2 , 48; vitamin B6 , 29.52; vitamin B12 , 0.24; vitamin E, 160; vitamin C, 800; Methionine 0.01 0.09 0.02 0.07 0.06
niacinamide, 79.20; calcium-pantothenate, 73.60; folic acid, 6.40; biotin, 0.64; Isoleucine 0.03 0.16 0.06 0.14 0.12
inositol, 320; choline chloride, 1500; L-carnitine, 100. c Mineral Premix (mg kg−1 Leucine 0.07 0.31 0.13 0.24 0.23
diet): Cu (CuSO4 ), 2.00; Zn (ZnSO4 ), 34.4; Mn (MnSO4 ), 6.20; Fe (FeSO4 ), 21.10; I
Phenylalanine 0.05 0.21 0.08 0.16 0.14
[Ca(IO3 )2 ], 1.63; Se (Na2 SeO3 ), 0.18; Co (COCl2 ), 0.24; Mg (MgSO4 ·H2 O), 52.70.
d Supplied by Zhejiang Yifeng Marine Biological Products Co., Ltd (Zhejiang, Histidine 0.16 0.15 0.16 0.15 0.15
China): fish soluble, crude protein, 31.43%, crude lipid, 4.51%; squid paste, Lysine 0.06 0.18 0.1 0.14 0.15
crude protein, 31.22%, crude lipid, 23.14%; shrimp paste, crude protein, 29.54%, Arginine 0.05 0.05 0.08 0.05 0.06
crude lipid, 2.43%.
Total EAA 0.50 1.44 0.76 1.22 1.13
Non-essential amino acid (NEAA)
Sample Collection Taurine 0.24 0.42 0.33 0.45 0.43
Fifteen juveniles were randomly collected prior to the feeding Proline 0.06 0.15 0.13 0.24 0.18
trial for the analysis of initial body composition. Feces samples Aspartic acid 0.04 0.19 0.07 0.15 0.13
were collected with the collection column fixed to the bottom of Glutamic acid 0.07 0.31 0.11 0.18 0.19
experimental tanks following the description of Lee (2002) after Serine 0.03 0.03 0.06 0.07 0.05
4 weeks’ feeding. When the feeding trial was finished, fish number Glycine 0.03 0.17 0.05 0.19 0.14
per tank was counted and final body weight was recorded after Alanine 0.12 0.22 0.15 0.21 0.22
fish being fasted for 24 h. Then, five fish per tank were randomly Cystine 0.01 0.02 0.01 0.01 0.01

picked for whole body composition analysis, and another 12 Tyrosine 0.04 0.16 0.05 0.13 0.11

fish of each tank were randomly selected for the measurement Total NEAA 0.65 1.66 0.97 1.63 1.45

of body length and weight to calculate condition factor (CF) Total AA 1.15 3.10 1.73 2.85 2.58

followed by the collection of blood samples with syringes. The *Tryptophan was not determined in the present study.

Frontiers in Marine Science | www.frontiersin.org 3 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

blood samples were then centrifuged at 4000 × g for 10 min TABLE 4 | Specific primer used in the present study.
(4◦ C) to separate the serum to evaluate the non-specific immune
Gene Forward sequence (50 -30 ) Reverse sequence (50 -30 )
response. After that, liver samples of six fish were sampled for
gene expression analysis and enzymatic activity analysis. Another IGF-I CTTCAAGAGTGCGATGTGC GCCATAGCCTGTTGGTTTACTG
six fish were sampled to dissect and weight the viscera and TOR TCAGGACCTCTTCTCATTGGC CCTCTCCCACCATGTTTCTCT
liver to calculate viscerosomatic index (VSI) and hepatosomatic AKT1 CACCGTAGAACCGAGCCCGCT CGCCATGAAGATCCTAAAGAA
index (HSI), respectively, and the liver and muscle samples were S6 GCCAATCTCAGCGTTCTCAAC CTGCCTAACATCATCCTCCTT
obtained for proximate composition analysis. eIF2α TAAGTCCAGCCCATCCAAAA CACCCGAGGAGGCCATCAAG
ATF4 GGAGACCAGGAAGATGCGTAG TGTCCAGCAGCAGTGATGACA

Chemical Analysis REDD1 TGACCTGTGTCCCTCTAATGA ATGTGCTCCAGAAGTTTCTCA

The moisture, ash, and crude protein content were detected β-Actin ATCGCCGCACTGGTTGTTGAC CCTGTTGGCTTTGGGGTTC

following the method described by AOAC (2003). Briefly, IGF-I, insulin-like growth factor I; TOR, target of rapamycin; AKT, protein kinase
moisture was measured by the weight loss method through B; S6, ribosomal protein S6; eIF2α, elongation initiation factor 2α; ATF4,
activating transcription factor 4; REDD1, regulated in development and DNA
drying samples to constant weight at 105◦ C, and ash was damage responses 1.
measured by the burning method with muffle furnace (AOAC,
2003). Crude protein was determined by the Kjeldahl method
(N × 6.25) (Kjeltec 2200, FOSS, Denmark) (AOAC, 2003). Crude after the reaction, to confirm the single PCR product in the
lipid was measured with the chloroform–methanol extraction reactions. The relative gene expressions were calculated with the
method (Folch et al., 1957). Oxygen bomb calorimeter (6200, 2−11Ct method (Livak and Schmittgen, 2001).
Parr, United States) was used to determine the gross energy of
diets. The Cr2 O3 content of diet and feces was analyzed with the Calculations and Statistical Methods
wet-acid digestion method based on the description of Divakaran The following variables were calculated:
et al. (2002). Amino acid content was determined by an automatic Survival rate (SR,%) = final fish number/initial fish
amino acid analyzer (S-433D, Sykam, Germany) following the number × 100.
method of Llames and Fontaine (1994), and free amino acid Specific growth rate (SGR,%/day) = (Ln final body weight –
content was analyzed using the o-phthaldialdehyde precolumn Ln initial body weight) × 100/days.
derivatization method (Antoine et al., 1999). Condition factor (CF) = final body weight (g)/length
(cm)3 × 100.
Non-specific Immune Response and Hepatosomatic index (HSI,%) = liver weight/final body
Transaminase Activities weight × 100.
The activity of serum lysozyme was evaluated following Viscerosomatic index (VSI,%) = viscera weight/final body
the method of Ellis (1990), and serum protein content weight × 100.
was determined with the Coomassie Brilliant Blue method Feed efficiency ratio (FER) = Increased body weight/dry
(Bradford, 1976). The obtained liver simples were homogenized feed consumed;
in ice-cold phosphate buffer (1:9, w/v) and then centrifuged Protein efficiency ratio (PER) = Increased body
(3000 rpm, 10 min, 4◦ C) to separate the supernatant. Then, weight/protein intake.
the isolated supernatant was maintained at −20◦ C until Feed intake (g/day) = (Feed offered – feed discarded or
it is used for the measurement of transaminase activities. uneaten feed)/days.
The activity of alanine transaminase (ALT) and aspartate Nutrient retention rate (NRR,%) = Nutrient
transaminase (AST) was measured with the Reitman–Frankel retention/nutrient intake × 100.
method (Reitman and Frankel, 1957). Apparent digestibility coefficient (ADC) of nutrient
(%) = 100 – 100 × (tracer in diet/tracer in
RNA Extraction and Real-Time feces) × (nutrient in feces/nutrient in diet).
Quantitative PCR The results were expressed as the mean ± standard error of
The total RNA of liver samples was extracted using Trizol the mean (SEM). All data were compared with one-way analysis
Reagent (Takara, Japan) followed by quality measurement with of variance (ANOVA) using SPSS. Turkey’s multiple range test
denaturing agarose gel. Then, first-strand cDNA was synthesized was chosen as multiple comparison test, and P < 0.05 was
through reverse transcription reaction with Prime ScriptTM RT considered significantly.
kit (Takara, Japan). Specific primers used in the present study
were designed based on the obtained nucleotide sequences
(Table 4). The β-action was used as housekeeping gene following RESULTS
the verification of its stability, and the amplification was
conducted in a quantitative thermal cycler (Mastercycler EP Growth Performance and Feed
Realplex, Eppendorf, Germany) with the following procedure: Utilization
95◦ C for 2 min, followed by 40 cycles of 95◦ C for 10 s, 57◦ C for No significant difference was observed in survival rate (SR) with
10 s, and 72◦ C for 20 s. Melting curve analysis was conducted, the inclusion of marine protein hydrolyzates (P > 0.05) (Table 5).

Frontiers in Marine Science | www.frontiersin.org 4 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

TABLE 5 | Growth performance and feed utilization of largemouth bass fed the experimental diets for 81 days*.

Parameters Marine protein hydrolyzates

NC FS SqP ShP Mix

IBW (g) 10.68 ± 0.01 10.68 ± 0.01 10.68 ± 0.01 10.68 ± 0.01 10.68 ± 0.01
FBW (g) 100.52 ± 2.41b 107.84 ± 0.29a 106.24 ± 0.87ab 110.06 ± 0.31a 104.3 ± 0.62ab
SR (%) 96.67 ± 2.20 100.00 ± 0.00 100.00 ± 0.00 100.00 ± 0.00 100.00 ± 0.00
SGR (%/day) 2.80 ± 0.02b 2.89 ± 0.00a 2.87 ± 0.01ab 2.92 ± 0.00a 2.85 ± 0.01ab
CF 2.11 ± 0.02 2.13 ± 0.02 2.16 ± 0.03 2.08 ± 0.02 2.07 ± 0.01
HSI (%) 2.49 ± 0.20 2.63 ± 0.28 2.37 ± 0.05 2.72 ± 0.14 2.79 ± 0.01
VSI (%) 8.96 ± 0.52 8.10 ± 0.18 8.43 ± 0.12 8.78 ± 0.40 8.88 ± 0.41
FI (g/fish/day) 0.98 ± 0.01c 1.14 ± 0.01a 1.07 ± 0.00b 1.14 ± 0.01a 1.05 ± 0.01b
FER 1.14 ± 0.01a 1.07 ± 0.01c 1.11 ± 0.01ab 1.08 ± 0.01bc 1.11 ± 0.01ab
PER 2.15 ± 0.06 2.04 ± 0.01 2.14 ± 0.02 2.07 ± 0.02 2.12 ± 0.02
PRR (%) 38.73 ± 1.08 36.73 ± 0.20 39.14 ± 0.44 38.45 ± 0.45 39.63 ± 0.21
LRR (%) 67.75 ± 2.26 70.24 ± 2.08 66.95 ± 1.92 67.52 ± 0.87 70.70 ± 0.34
ADC of protein (%) 91.40 ± 0.18c 93.62 ± 0.20a 91.34 ± 0.24c 92.57 ± 0.19b 92.67 ± 0.25ab
ADC of lipid (%) 92.57 ± 0.16b 94.32 ± 0.18a 93.54 ± 0.18a 93.79 ± 0.16a 91.78 ± 0.28b

*Values (means ± SEM, N = 3) within a row with a common superscript letter are not significantly different from the other dietary groups (P > 0.05). IBW, initial body
weight; FBW, final body weight; SR, survival rate; SGR, specific growth rate; CF, condition factor; HSI, hepatosmatic index; VSI, viscerosomatic index; FI, feed intake;
FER, feed efficiency ratio; PER, protein efficiency ratio; PRR, protein retention rate; LRR, lipid retention rate; ADC, apparent digestibility coefficient.

Meanwhile, the addition of marine protein hydrolyzates elevated lipid content of muscle in fish fed the diet with marine protein
growth of largemouth bass, and the final body weight (FBW) and hydrolyzates showed no significant difference than that of NC
specific growth rate (SGR) in fish fed the diets with FS and ShP (P > 0.05) (Table 6). However, the ash content in muscle of fish
were significantly higher than that of NC (P < 0.05) (Table 5). fed the diet with Mix was significantly higher than that of ShP
However, marine protein hydrolyzates produced no significant (P < 0.05) (Table 6).
influence on morphological index including CF, HSI, and VSI
(P > 0.05) (Table 5). Non-specific Immune Response and
The inclusion of marine protein hydrolyzates significantly Transaminase Activities
elevated the feed intake (FI) (P < 0.05), and meanwhile, the value The activity of serum lysozyme was elevated with the inclusion
in fish fed the diet with FS and ShP were remarkably higher of marine protein hydrolyzates, and fish fed the diet with FS and
than that of SqP and Mix (P < 0.05) (Table 5). However, the Mix significantly improved its activity compared to that of NS
feed efficiency ratio (FER) was significantly reduced due to the (P < 0.05) (Table 7). Meanwhile, the marine protein hydrolyzates
inclusion of FS and ShP compared to NS (P < 0.05) (Table 5). increased the serum protein content, and the inclusion of Mix
The marine protein hydrolyzates did not cause any significant resulted in a significant serum protein content compared to
difference on protein efficiency ratio (PER) and protein retention that of NC (P < 0.05) (Table 7). The activity of hepatic
rate (PRR), which was consistent with the variation of lipid ALT was significantly decreased with the inclusion of marine
retention rate (LRR) (P > 0.05) (Table 5). However, the ADC protein hydrolyzates (P < 0.05) (Table 7), and the variation
of protein in fish fed the diet with FS, ShP, and Mix was of AST activity followed a similar pattern with that of ALT
significantly higher than that of NC with the highest value in (P < 0.05) (Table 7).
FS group (P < 0.05), while the inclusion of SqP did not lead
to any significant difference on ADC of protein (P > 0.05) Gene Expression Analysis
(Table 5). The fish fed the diet with FS, SqP, and ShP obtained The inclusion of marine protein hydrolyzates elevated the
significantly higher ADC of lipid than the other two groups expression of IGF-I, and its expression in fish fed the diet with
(P < 0.05) (Table 5). FS was significantly higher than that of NS (P < 0.05) (Figure 1).
No significant difference was observed in the expression of TOR
Body Composition Analysis with the inclusion of marine protein hydrolyzates (P < 0.05)
The inclusion of protein hydrolyzates caused no significant (Figure 2). However, the supplementation of marine protein
difference on the proximate composition except the ash content hydrolyzates significantly up-regulated the expression of protein
(P > 0.05) (Table 6). The ash content in fish fed the diet with FS, kinase B (AKT) 1 (P < 0.05), and meanwhile, the expression of
ShP, and Mix was significantly higher than that of NC (P < 0.05) AKT1 in the FS group was significantly higher than that of SqP
(Table 6). However, the inclusion of marine protein hydrolyzates and Mix (P < 0.05) (Figure 2). The marine protein hydrolyzates
significantly decreased the hepatic lipid content without any including FS, SqP, and ShP elevated the expression of ribosomal
significant difference on the content of moisture, protein, and protein S6 (S6), and the inclusion of FS significantly elevated its
ash in liver (P < 0.05) (Table 6). The moisture, protein, and expression compared to that of NC (P < 0.05) (Figure 2). The

Frontiers in Marine Science | www.frontiersin.org 5 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

TABLE 6 | Whole-body, liver proximate composition, and muscle proximate composition of largemouth bass fed the experimental diets for 81 days*.

Marine protein hydrolyzates

NC FS SqP ShP Mix

Whole body
Moisture (%) 69.30 ± 0.32 69.39 ± 0.33 69.59 ± 0.61 68.97 ± 0.42 68.39 ± 0.31
Crude protein (%) 18.01 ± 0.16 18.02 ± 0.20 18.30 ± 0.38 18.55 ± 0.37 18.72 ± 0.25
Crude lipid (%) 7.73 ± 0.01 8.16 ± 0.18 7.67 ± 0.15 8.17 ± 0.13 8.25 ± 0.12
Ash (%) 3.87 ± 0.05c 4.58 ± 0.17ab 4.21 ± 0.06bc 4.79 ± 0.05a 4.56 ± 0.04ab
Liver
Moisture (%) 68.35 ± 0.32 68.85 ± 0.36 68.19 ± 0.27 68.23 ± 0.43 67.51 ± 0.41
Crude protein (%) 9.58 ± 0.16 9.26 ± 0.11 9.28 ± 0.06 9.59 ± 0.07 9.76 ± 0.27
Crude lipid (%) 3.32 ± 0.09a 2.57 ± 0.13bc 2.77 ± 0.07b 2.1 ± 0.14cd 1.97 ± 0.1d
Ash (%) 0.94 ± 0.08 1.04 ± 0.03 1.04 ± 0.01 1.00 ± 0.03 1.00 ± 0.04
Muscle
Moisture (%) 76.50 ± 0.27 76.47 ± 0.19 76.82 ± 0.23 77.04 ± 0.13 77.21 ± 0.03
Crude protein (%) 21.22 ± 0.11 21.19 ± 0.18 20.71 ± 0.21 20.51 ± 0.08 20.76 ± 0.04
Lipid (%) 1.53 ± 0.07 1.49 ± 0.03 1.47 ± 0.04 1.43 ± 0.03 1.55 ± 0.06
Ash (%) 1.63 ± 0.05ab 1.51 ± 0.03ab 1.72 ± 0.07ab 1.51 ± 0.07b 1.73 ± 0.02a

*Values (means ± SEM, N = 3) within a row with a common superscript letter are not significantly different from the other dietary groups (P > 0.05).

TABLE 7 | Non-specific immune response and hepatic transaminase activities of largemouth bass fed the experimental diets for 81 days*.

Marine protein hydrolyzates

NC FS SqP ShP Mix

Lysozyme activity (U/µl) 4.69 ± 0.37b 7.57 ± 0.70a 7.00 ± 0.35ab 7.07 ± 0.76ab 7.40 ± 0.46a
Serum protein content (mg/ml) 40.71 ± 0.46b 41.67 ± 0.63ab 41.35 ± 0.66ab 41.73 ± 0.23ab 43.83 ± 0.73a
ALT (U/gprot) 15.92 ± 0.32a 10.27 ± 0.56b 10.16 ± 0.35b 11.32 ± 0.08b 11.7 ± 0.45b
AST (U/gprot) 27.06 ± 0.91a 18.47 ± 0.44c 21.94 ± 0.41b 22.57 ± 0.56b 22.71 ± 0.23b

*Values (means ± SEM, N = 3) within a row with a common superscript letter are not significantly different from the other dietary groups (P > 0.05). ALT, alanine
transaminase; AST, aspartate transaminase.

of the activating transcription factor 4 (ATF4) was decreased

with the supplementation of marine protein hydrolyzates, and
ATF4 expression of fish fed the diet with ShP was significantly
lower than that of NC (P < 0.05) (Figure 3). Additionally,
the expression of regulated in development and DNA damage
responses 1 (REDD1) was significantly down-regulated with the
inclusion of marine protein hydrolyzates (P < 0.05), and SqP
and Mix supplementation significantly reduced the expression of
REDD1 compared to the FS and ShP (P < 0.05) (Figure 3).

DISCUSSION
The replacement of fish meal with alternative protein sources
is essential for sustainable aquaculture due to the limited fish
FIGURE 1 | Relative expression of hepatic insulin-like growth factor I (IGF-I)
gene of largemouth bass fed the experimental diets for 81 days. Values meal resources. The fish meal content could be reduced to 35%
(means ± standard error of the mean, SEM) in bars that have the same letter with plant protein source in the diet for largemouth bass without
are not significantly different (P > 0.05; Tukey’s test) among treatments (N = 3). negative effects on growth performance (Chen et al., 2013).
Previous studies have demonstrated that the supplementation of
some marine protein hydrolyzates could benefit for improving
inclusion of marine protein hydrolyzates did not result in any nutritive values of low fish meal diet (Toften et al., 2003;
significant difference on the expression of elongation initiation Kousoulaki et al., 2009; Kader et al., 2010, 2012; Kader and
factor 2α (eIF2α) (P > 0.05) (Figure 3). However, the expression Koshio, 2012; Bui et al., 2014; Wu et al., 2018). In the present

Frontiers in Marine Science | www.frontiersin.org 6 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

FIGURE 2 | The expression of TOR pathway-related genes, target of rapamycin (TOR), protein kinase B (AKT) 1, and ribosomal protein S6 (S6) of largemouth bass
fed the experimental diets for 81 days. Values (means ± standard error of the mean, SEM) in bars that have the same letter are not significantly different (P > 0.05;
Tukey’s test) among treatments (N = 3).

FIGURE 3 | The expression of AAR pathway-related genes, elongation initiation factor 2α (eIF2α), activating transcription factor 4 (ATF4), and regulated in
development and DNA damage responses 1 (REDD1) of largemouth bass fed the experimental diets for 81 days. Values (means ± standard error of the mean, SEM)
in bars that have the same letter are not significantly different (P > 0.05; Tukey’s test) among treatments (N = 3).

study, the effect of three marine protein hydrolyzates (FS, SqP, Bui et al., 2014), rainbow trout Oncorhynchus mykiss (Toften
and ShP) inclusion on the overall performance of largemouth et al., 2003), Atlantic salmon Salmo salar (Kousoulaki et al.,
bass was investigated at the fish meal level of 35%, which could 2009), and yellow catfish Pelteobagrus fulvidraco (Wu et al., 2018).
determine the optimal marine protein hydrolyzate and provide Meanwhile, the inclusion of marine by-products in the present
basis for further reducing the use of fish meal in the diets for significantly elevated the FI in accordance as described previously
largemouth bass. (Toften et al., 2003; Kofuji et al., 2006; Kousoulaki et al., 2009;
The growth performance was elevated with the inclusion of Kader et al., 2010, 2012), and this mainly related to the increased
marine protein hydrolyzates in the present study. The promotion SGR. Some free amino acids, such as alanine and glycine, have
effect of marine protein hydrolyzates on growth performance has been considered as feeding stimulant to enhance the appetite
also been observed in red sea bream (Kader et al., 2010, 2012; of fish (Shamushaki et al., 2007). Additionally, taurine exhibits

Frontiers in Marine Science | www.frontiersin.org 7 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

the function of promoting feeding in fish (Kim et al., 2005; the elevated IGF-I expression could partly account for the better
Chatzifotis et al., 2008). Therefore, the elevated free amino acids growth performance in those groups.
and taurine may partly account for the elevated FI and SGR with The IGF system has been considered as the main nutrient-
the inclusion of marine protein hydrolyzates. Meanwhile, fish fed sensing pathway, which develops its function in regulating
the diet with FS and ShP showed relative higher growth and feed protein synthesis through the integration of phosphatidylinositol
intake than that of SqP and Mix, which also followed a similar 3-kinase (PI3K)/AKT/TOR pathways (Fuentes et al., 2013). In
pattern with the content of taurine and free amino acids in diets. the present study, the expression of AKT1 was elevated with
The improvement in the non-specific immune response has the inclusion of marine protein hydrolyzates, which may be
been reported with the inclusion of marine protein hydrolyzates associated with the increased expression of IGF-1. Meanwhile,
in some previous studies (Bui et al., 2014; Khosravi et al., 2015; the activation of TOR directly induces the expression of
Siddik et al., 2019). Lysozyme is an essential component of innate translation regulators eukaryotic initiation factor 4E (elF4E)
immune system, and its activity effectively reflects the innate binding protein 1 (4EBP1) and S6 to promote protein synthesis
immune response to pathogen infection (Saurabh and Sahoo, (Ma and Blenis, 2009). The up-regulation of S6 in the present
2008). The activity of lysozyme was significantly elevated with the study revealed the activation of the TOR pathway to some
inclusion of marine protein hydrolyzates in red sea bream (Bui extent. Meanwhile, the TOR pathway is necessary to perceive
et al., 2014; Khosravi et al., 2015) and barramundi Lates calcarifer the amino acid abundance at the cellular level (Gallinetti et al.,
(Siddik et al., 2019). Similarly, in the present study, the inclusion 2013). The significantly enhanced ADC of protein in the marine
of marine protein hydrolyzates significantly elevated the serum protein hydrolyzate groups may produce the variation in amino
lysozyme activity. The major components of serum protein acid abundance, which partly accounted for the activation of
are albumin and immunoglobulin, and the supplementation of the TOR pathway. Additionally, in mammals, the inclusion of
marine protein increased the immunoglobulin content in red taurine could also activate the TOR pathway (Li et al., 2012;
seabream (Bui et al., 2014; Khosravi et al., 2015). Meanwhile, Solon et al., 2012), and therefore, the increased taurine content
the serum protein content was significantly increased with caused by the inclusion of marine protein hydrolyzates may
the marine protein hydrolyzate inclusion in the present study, also be responsible for the activation of the TOR pathway. The
indicating the immunostimulatory effect of marine protein AAR pathway commonly functions in opposition to the TOR
hydrolyzates. Aminotransferases, such as AST and ALT, are pathway, and the scarce or imbalanced amino acids commonly
capable of catabolizing amino acids and transferring amino to leads to the phosphorylation of eIF2α to reduce protein synthesis
α-keto acids, commonly used for the detection of liver damage and the promotion of translation of ATF4 (Kilberg et al., 2009;
or organ dysfunction in fish species (Lin and Luo, 2011; Luo Castilho et al., 2014). Previous studies in turbot suggest that the
et al., 2012; Li et al., 2014; Lu et al., 2017). In general, high activation of the AAR pathway partly accounts for the protein
fish meal replacement with plant protein significantly decreased synthesis with high replacement of fish meal (Song et al., 2016;
the activity of AST and ALT with negative effects on growth Xu et al., 2016). In the present study, the inclusion of marine
performance (Lin and Luo, 2011; Luo et al., 2012; Li et al., protein hydrolyzates significantly decreased the expression of
2014). However, in the present study, the inclusion of marine ATF4, which indicated the inhibition of the AAR pathway to
protein hydrolyzates significantly decreased the activity of AST some extent. However, no significant difference was observed
and ALT, which seemed to be in conflict with the improved in the expression of eIF2α, which may be regulated at the
performance with the marine protein hydrolyzate inclusion. The phosphorylation level as in mammals. The phosphorylation of
marine protein hydrolyzates are also rich in soluble protein, eIF2α induces the expression of REDD1 in an ATF4-dependent
peptides, and low-molecular-weight components (Harnedy and manner (Jin et al., 2009; Whitney et al., 2009). In the present
FitzGerald, 2012), and the more digestible protein hydrolyzates study, the expression of REDD1 was significantly decreased
may account for the decreased transaminase activities and the with the inclusion of marine protein hydrolyzates, and this
elevated ADC of protein in fish fed the diet with marine confirmed the down-regulation of the AAR pathway in those
protein hydrolyzates. groups. In addition, REDD1 acts as a negative regulator of
It is well known that IGF-I is essential in regulating the the TOR pathway in mammals (Ma and Blenis, 2009), and
development and growth of vertebrates (Moriyama et al., 2000). the down-regulation of REDD1 and activation of the TOR
In general, the expression of IGF-I could partly illustrate the pathway indicated the existence of similar regulation mechanism
variation in growth performance induced by feed intake (Duan, in fish species.
1998), and meanwhile, a positive relationship between IGF-I In the above, the inclusion of marine protein hydrolyzates
and growth has been observed in Japanese flounder Paralichthys improved the growth performance of largemouth bass with
olivaceus (Zheng et al., 2012), gilthead seabream Sparus aurata enhanced non-specific immunity, and fish fed the diet with
(Gómez-Requeni et al., 2004), Japanese seabass Lateolabrax FS and ShP obtained significantly higher growth than that of
japonicus (Men et al., 2014), and hybrid grouper Epinephelus NC. The promotion of growth was partly associated with the
lanceolatus × E. fuscoguttatus (Luo et al., 2016). The inclusion elevated feed intake and protein digestibility. In addition, with the
of fish protein hydrolyzates has been confirmed to promote liver supplementation of marine protein hydrolyzates, the expression
IGF-I mRNA expression and serum IGF-I content (Zheng et al., of IGF-I was up-regulated along with the activation of the
2012). Similarly, in the present study, the expression of IGF-I was TOR pathway and depression of the AAR pathway. Further
improved with the inclusion of marine protein hydrolyzates, and studies would be conducted to replace the use of fish meal with

Frontiers in Marine Science | www.frontiersin.org 8 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

suitable marine protein hydrolyzates, FS and ShP, in the diet of AUTHOR CONTRIBUTIONS
largemouth bass.
MD conducted most of the experiment, analyzed the data, and
wrote the manuscript under the guidance of SL and NC. CF and
DATA AVAILABILITY STATEMENT HQ offered their help in the feeding trial. All authors read and
approved the final manuscript.
All datasets generated for this study are included in the
article/supplementary material.

FUNDING
ETHICS STATEMENT
This study was supported by the China Agriculture Research
The animal study was reviewed and approved by the Animal Care System (CARS-46 to NC) and the Shanghai Talent Development
and Use Committee of the Shanghai Ocean University. Fund (No. 2019116 to SL).

REFERENCES Ellis, A. E. (1990). “Lysozyme assays,” in Techniques in fish immunology, eds J. S.

Stolen, T. C. Fletcher, D. P. Anderson, S. L. Kaattari, and A. F. Rowley (Fair
Antoine, F. R., Wei, C. I., Littell, R. C., and Marshall, M. R. (1999). HPLC method Haven, NJ: SOS Publications), 101–103.
for analysis of free amino acids in fish using o-phthaldialdehyde precolumn FAO (2016). The State of World Fisheries and Aquaculture 2016: Contributing to
derivatization. J. Agr. Food Chem. 47, 5100–5107. doi: 10.1021/jf990032+ Food Security and Nutrition for All. Rome: FAO, 200.
AOAC (2003). Official Methods of Analysis, 17th Edn. Washington, DC: AOAC. Folch, J., Lees, M., and Sloane-Stanley, G. H. (1957). A simple method for the
Barros, M. M., Lim, C., and Klesius, P. H. (2002). Effect of soybean meal isolation and purification of total lipids from animal tissues. J. Biol. Chem. 226,
replacement by cottonseed meal and iron supplementation on growth, immune 497–509.
response and resistance of Channel Catfish (Ictalurus puctatus) to Edwardsiella Fuentes, E. N., Valdés, J. A., Molina, A., and Björnsson, B. T. (2013). Regulation
ictaluri challenge. Aquaculture 207, 263–279. doi: 10.1016/S0044-8486(01) of skeletal muscle growth in fish by the growth hormone-insulin-like growth
00740-2 factor system. Gen. Comp. Endocr. 192, 136–148. doi: 10.1016/j.ygcen.2013.
Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of 06.009
microgram quantities of protein utilizing the principle of protein-dye binding. Gallinetti, J., Harputlugil, E., and Mitchell, J. R. (2013). Amino acid sensing
Anal. Biochem. 72, 248–254. doi: 10.1016/0003-2697(76)90527-3 in dietary-restriction-mediated longevity: roles of signal-transducing kinases
Bui, H. T. D., Khosravi, S., Fournier, V., Herault, M., and Lee, K. J. (2014). Growth GCN2 and TOR. Biochem. Eng. J. 449, 1–10. doi: 10.1042/BJ20121098
performance, feed utilization, innate immunity, digestibility and disease Gatlin, D. M. III, Barrows, F. T., Brown, P., Dabrowski, K., Gaylord, T. G., Hardy,
resistance of juvenile red seabream (Pagrus major) fed diets supplemented with R. W., et al. (2007). Expanding the utilization of sustainable plant products in
protein hydrolysates. Aquaculture 418, 11–16. doi: 10.1016/j.aquaculture.2013. aquafeeds: a review. Aquac. Res. 38, 551–579. doi: 10.1111/j.1365-2109.2007.
09.046 01704.x
Burel, C., Boujard, T., Kaushik, S. J., Boeuf, G., Van Der Geyten, S., Mol, K. A., Gildberg, A., and Stenberg, E. (2001). A new process for advanced utilisation
et al. (2000). Potential of plant-protein sources as fish meal substitutes in diets of shrimp waste. Process Biochem. 36, 809–812. doi: 10.1016/S0032-9592(00)
for turbot (Psetta maxima): growth, nutrient utilisation and thyroid status. 00278-8
Aquaculture 188, 363–382. doi: 10.1016/S0044-8486(00)00342-2 Gómez-Requeni, P., Mingarro, M., Calduch-Giner, J. A., Médale, F., Martin,
Cahu, C., Rønnestad, I., Grangier, V., and Infante, J. Z. (2004). Expression and S. A. M., Houlihan, D. F., et al. (2004). Protein growth performance, amino acid
activities of pancreatic enzymes in developing sea bass larvae (Dicentrarchus utilisation and somatotropic axis responsiveness to fish meal replacement by
labrax) in relation to intact and hydrolyzed dietary protein; involvement of plant protein sources in gilthead sea bream (Sparus aurata). Aquaculture 232,
cholecystokinin. Aquaculture 238, 295–308. doi: 10.1016/j.aquaculture.2004. 493–510. doi: 10.1016/S0044-8486(03)00532-5
04.013 Harnedy, P. A., and FitzGerald, R. J. (2012). Bioactive peptides from marine
Castilho, B. A., Shanmugam, R., Silva, R. C., Ramesh, R., Himme, B. M., and processing waste and shellfish: a review. J. Funct. Foods 4, 6–24. doi: 10.1016/j.
Sattlegger, E. (2014). Keeping the eIF2 alpha kinase Gcn2 in check. BBA-Mol. jff.2011.09.001
Basis. Dis. 1843, 1948–1968. doi: 10.1016/j.bbamcr.2014.04.006 Hidaka, I., Kohbara, J., Araki, T., Morishita, T., Miyajima, T., Shimizu, S., et al.
Chatzifotis, S., Polemitou, I., Divanach, P., and Antonopoulou, E. (2008). Effect of (2000). Identification of feeding stimulants from a jack mackerel muscle extract
dietary taurine supplementation on growth performance and bile salt activated for young yellowtail Seriola quinqueradiata. Aquaculture 181, 115–126. doi:
lipase activity of common dentex, Dentex dentex, fed a fish meal/soy protein 10.1016/S0044-8486(99)00221-5
concentrate-based diet. Aquaculture 275, 201–208. doi: 10.1016/j.aquaculture. Huang, D., Wu, Y., Lin, Y., Chen, J., Karrow, N., Ren, X., et al. (2017). Dietary
2007.12.013 protein and lipid requirements for juvenile largemouth bass, Micropterus
Chen, N., Ma, X., Zhao, M., Ji, Z., and Tong, C. (2013). Suitable inclusion levels of salmoides. J. World Aquacult. Soc. 48, 782–790. doi: 10.1111/jwas.12417
white fish meal and two kinds of soybean meal in diets for juvenile largemouth Jin, H. O., Seo, S. K., Woo, S. H., Kim, E. S., Lee, H. C., Yoo, D. H., et al. (2009).
bass (Micropterus salmoides). J. Fish. China. 37, 1389–1400. doi: 10.3724/SP.J. Activating transcription factor 4 and CCAAT/enhancer-binding protein-β
1231.2013.38638 negatively regulate the mammalian target of rapamycin via Redd1 expression in
Colburn, H. R., Walker, A. B., Breton, T. S., Stilwell, J. M., Sidor, I. F., Gannam, response to oxidative and endoplasmic reticulum stress. Free Radical Bio. Med.
A. L., et al. (2012). Partial replacement of fishmeal with soybean meal and soy 46, 1158–1167. doi: 10.1016/j.freeradbiomed.2009.01.015
protein concentrate in diets of Atlantic cod. N. Am. J. Aquacult. 74, 330–337. Kader, M. A., Bulbul, M., Koshio, S., Ishikawa, M., Yokoyama, S., Nguyen, B. T.,
doi: 10.1080/15222055.2012.676008 et al. (2012). Effect of complete replacement of fishmeal by dehulled soybean
Divakaran, S., Obaldo, L. G., and Forster, I. P. (2002). Note on the methods meal with crude attractants supplementation in diets for red sea bream, Pagrus
for determination of chromic oxide in shrimp feeds. J. Agr. Food Chem. 50, major. Aquaculture 350, 109–116. doi: 10.1016/j.aquaculture.2012.04.009
464–467. doi: 10.1021/jf011112s Kader, M. A., and Koshio, S. (2012). Effect of composite mixture of seafood by-
Duan, C. M. (1998). Nutritional and developmental regulation of insulin- products and soybean proteins in replacement of fishmeal on the performance
like growth factors in fish. J. Nutr. 128, 306S–314S. doi: 10.1093/jn/128. of red sea bream. Pagrus Major. Aquaculture 368, 95–102. doi: 10.1016/j.
2.306S aquaculture.2012.09.014

Frontiers in Marine Science | www.frontiersin.org 9 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

Kader, M. A., Koshio, S., Ishikawa, M., Yokoyama, S., and Bulbul, M. (2010). in relation to gene expression of juvenile cobia (Rachycentron canadum).
Supplemental effects of some crude ingredients in improving nutritive values of Aquaculture 368, 109–116. doi: 10.1016/j.aquaculture.2012.09.013
low fishmeal diets for red sea bream, Pagrus major. Aquaculture 308, 136–144. Luo, Y., Wu, X., Li, W., Jiang, S., Lu, S., and Wu, M. (2016). Effects of different
doi: 10.1016/j.aquaculture.2010.07.037 corn starch levels on growth, protein input, and feed utilization of juvenile
Khosravi, S., Rahimnejad, S., Herault, M., Fournier, V., Lee, C. R., Bui, H. T. D., hybrid grouper (male Epinephelus lanceolatus× female E. fuscoguttatus). N Am.
et al. (2015). Effects of protein hydrolysates supplementation in low fish meal J. Aquacult. 78, 168–173. doi: 10.1080/15222055.2015.1129004
diets on growth performance, innate immunity and disease resistance of red sea Ma, X. M., and Blenis, J. (2009). Molecular mechanisms of mTOR-mediated
bream Pagrus major. Fish Shellfish Immu. 45, 858–868. doi: 10.1016/j.fsi.2015. translational control. Nat. Rev. Mol. Cell Biol. 10, 307–318. doi: 10.1038/
05.039 nrm2672
Kilberg, M. S., Pan, Y. X., Chen, H., and Leung-Pineda, V. (2005). Nutritional Men, K., Ai, Q., Mai, K., Xu, W., Zhang, Y., and Zhou, H. (2014). Effects of dietary
control of gene expression: how mammalian cells respond to amino acid corn gluten meal on growth, digestion and protein metabolism in relation to
limitation. Annu. Rev. Nutr. 25, 59–85. doi: 10.1146/annurev.nutr.24.012003. IGF-I gene expression of Japanese seabass. Lateolabrax japonicus. Aquaculture
132145 428, 303–309. doi: 10.1016/j.aquaculture.2014.03.028
Kilberg, M. S., Shan, J., and Su, N. (2009). ATF4-dependent transcription mediates Moriyama, S., Ayson, F. G., and Kawauchi, H. (2000). Growth regulation by
signaling of amino acid limitation. Trends Endocrin. Met. 20, 436–443. doi: insulin-like growth factor-I in fish. Biosci. Biotech. Bioch. 64, 1553–1562. doi:
10.1016/j.tem.2009.05.008 10.1271/bbb.64.1553
Kim, S. K., Takeuchi, T., Yokoyama, M., Murata, Y., Kaneniwa, M., and Sakakura, Reinecke, M., Björnsson, B. T., Dickhoff, W. W., McCormick, S. D., Navarro, I.,
Y. (2005). Effect of dietary taurine levels on growth and feeding behavior of Power, D. M., et al. (2005). Growth hormone and insulin-like growth factors
juvenile Japanese flounder Paralichthys olivaceus. Aquaculture 250, 765–774. in fish: where we are and where to go. Gen. Comp. Endocr. 142, 20–24. doi:
doi: 10.1016/j.aquaculture.2005.04.073 10.1016/j.ygcen.2005.01.016
Kimball, S. R., and Jefferson, L. S. (2002). Control of protein synthesis by amino Reitman, S., and Frankel, S. (1957). A colorimetric method for the determination
acid availability. Curr. Opin. Clin. Nutr. 5, 63–67. doi: 10.1097/00075197- of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin.
200201000-00012 Pathol. 28, 56–63. doi: 10.1093/ajcp/28.1.56
Kofuji, P. Y. M., Hosokawa, H., and Masumoto, T. (2006). Effects of Saurabh, S., and Sahoo, P. K. (2008). Lysozyme: an important defence molecule of
dietary supplementation with feeding stimulants on yellowtail Seriola fish innate immune system. Aquac. Res. 39, 223–239. doi: 10.1111/j.1365-2109.
quinqueradiata (Temminck & Schlegel; Carangidae) protein digestion at low 2007.01883.x
water temperatures. Aquac. Res. 37, 366–373. doi: 10.1111/j.1365-2109.2005. Shahidi, F. (1994). Seafood Processing By-Products. In Seafoods: Chemistry,
01435.x Processing Technology and Quality. Boston, MA: Springer, 320–334. doi: 10.
Kousoulaki, K., Albrektsen, S., Langmyhr, E., Olsen, H. J., Campbell, P., and 1007/978-1-4615-2181-5_16
Aksnes, A. (2009). The water soluble fraction in fish meal (stickwater) Shamushaki, V. A. J., Kasumyan, A. O., Abedian, A., and Abtahi, B. (2007).
stimulates growth in Atlantic salmon (Salmo salar L.) given high plant protein Behavioural responses of the Persian sturgeon (Acipenser persicus) juveniles
diets. Aquaculture 289, 74–83. doi: 10.1016/j.aquaculture.2008.12.034 to free amino acid solutions. Mar. Freshw. Behav. Phys. 40, 219–224. doi:
Laplante, M., and Sabatini, D. M. (2012). mTOR signaling in growth control and 10.1080/10236240701602184
disease. Cell 149, 274–293. doi: 10.1016/j.cell.2012.03.017 Siddik, M. A., Howieson, J., and Fotedar, R. (2019). Beneficial effects of
Lee, S. M. (2002). Apparent digestibility coefficients of various feed ingredients tuna hydrolysate in poultry by-product meal diets on growth, immune
for juvenile and grower rockfish (Sebastes schlegeli). Aquaculture 207, 79–95. response, intestinal health and disease resistance to Vibrio harveyi in juvenile
doi: 10.1016/S0044-8486(01)00751-7 barramundi. Lates calcarifer. Fish Shellfish Immu. 89, 61–70. doi: 10.1016/j.fsi.
Li, S., Sang, C., Wang, A., Zhang, J., and Chen, N. (2019). Effects of dietary 2019.03.042
carbohydrate sources on growth performance, glycogen accumulation, insulin Solon, C. S., Franci, D., Ignacio-Souza, L. M., Romanatto, T., Roman, E. A., Arruda,
signaling pathway and hepatic glucose metabolism in largemouth bass, A. P., et al. (2012). Taurine enhances the anorexigenic effects of insulin in the
Micropterus salmoides. Aquaculture 513:734391. doi: 10.1016/j.aquaculture. hypothalamus of rats. Amino Acids 42, 2403–2410. doi: 10.1007/s00726-011-
2019.734391 1045-5
Li, Y., Ai, Q., Mai, K., Xu, W., Deng, J., and Cheng, Z. (2014). Comparison Song, F., Xu, D., Mai, K., Zhou, H., Xu, W., and He, G. (2016). Comparative study
of high-protein soybean meal and commercial soybean meal partly replacing on the cellular and systemic nutrient sensing and intermediary metabolism after
fish meal on the activities of digestive enzymes and aminotransferases in partial replacement of fishmeal by meat and bone meal in the diet of turbot
juvenile Japanese seabass. Lateolabrax japonicus (Cuvier, 1828). Aquac. Res. 45, (Scophthalmus maximus L.). PLoS One 11:e0165708. doi: 10.1371/journal.pone.
1051–1060. doi: 10.1111/are.12042 0165708
Li, Y., Hu, Z., Chen, B., Bu, Q., Lu, W., Deng, Y., et al. (2012). Taurine attenuates Song, Z., Li, H., Wang, J., Li, P., Sun, Y., and Zhang, L. (2014). Effects of fishmeal
methamphetamine-induced autophagy and apoptosis in PC12 cells through replacement with soy protein hydrolysates on growth performance, blood
mTOR signaling pathway. Toxicol. Lrtt. 215, 1–7. doi: 10.1016/j.toxlet.2012. biochemistry, gastrointestinal digestion and muscle composition of juvenile
09.019 starry flounder (Platichthys stellatus). Aquaculture 426, 96–104. doi: 10.1016/
Lim, C., and Webster, C. D. (2008). Alternative Protein Sources in Aquaculture j.aquaculture.2014.01.002
Diets, ed. C. S. Lee (New York, NY: Haworth Press). Tacon, A. G., and Metian, M. (2008). Global overview on the use of fish meal
Lin, S., and Luo, L. (2011). Effects of different levels of soybean meal inclusion and fish oil in industrially compounded aquafeeds: trends and future prospects.
in replacement for fish meal on growth, digestive enzymes and transaminase Aquaculture 285, 146–158. doi: 10.1016/j.aquaculture.2008.08.015
activities in practical diets for juvenile tilapia. Oreochromis niloticus× O. aureus. Thissen, J. P., Ketelslegers, J. M., and Underwood, L. E. (1994). Nutritional
Anim. Feed Sci. Tech. 168, 80–87. doi: 10.1016/j.anifeedsci.2011.03.012 regulation of the insulin-like growth factors. Endocr. Rev. 15, 80–101. doi:
Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression 10.1210/edrv-15-1-80
data using real-time quantitative PCR and the 2-11CT method. Methods 25, Toften, H., Arnesen, A. M., and Jobling, M. (2003). Feed intake, growth and
402–408. doi: 10.1006/meth.2001.1262 ionoregulation in Atlantic salmon (Salmo salar L.) smolts in relation to dietary
Llames, C. R., and Fontaine, J. (1994). Determination of amino acids in feeds: addition of a feeding stimulant and time of seawater transfer. Aquaculture 217,
collaborative study. J. AOAC Int. 77, 1362–1402. doi: 10.1093/jaoac/77.6.1362 647–662. doi: 10.1016/S0044-8486(02)00404-0
Lu, K. L., Wang, L. N., Zhang, D. D., Liu, W. B., and Xu, W. N. (2017). Wang, P., Zhu, J., Feng, J., He, J., Lou, Y., and Zhou, Q. (2017). Effects of dietary
Berberine attenuates oxidative stress and hepatocytes apoptosis via protecting soy protein concentrate meal on growth, immunity, enzyme activity and protein
mitochondria in blunt snout bream Megalobrama amblycephala fed high-fat metabolism in relation to gene expression in large yellow croaker Larimichthys
diets. Fish Physiol. Biochem. 43, 65–76. doi: 10.1007/s10695-016-0268-5 crocea. Aquaculture 477, 15–22. doi: 10.1016/j.aquaculture.2017.04.030
Luo, Y., Ai, Q., Mai, K., Zhang, W., Xu, W., and Zhang, Y. (2012). Effects of dietary Whitney, M. L., Jefferson, L. S., and Kimball, S. R. (2009). ATF4 is
rapeseed meal on growth performance, digestion and protein metabolism necessary and sufficient for ER stress-induced upregulation of REDD1

Frontiers in Marine Science | www.frontiersin.org 10 April 2020 | Volume 7 | Article 197

Dai et al. Marine Protein Hydrolyzates in Diets

expression. Biochem. Bioph. Res. 379, 451–455. doi: 10.1016/j.bbrc.2008. flounder (Paralichthys olivaceus). Aquacult. Nutr. 18, 297–303. doi: 10.1111/j.
12.079 1365-2095.2011.00896.x
Wu, D., Zhou, L., Gao, M., Wang, M., Wang, B., He, J., et al. (2018). Effects of
stickwater hydrolysates on growth performance for yellow catfish (Pelteobagrus Conflict of Interest: The authors declare that the research was conducted in the
fulvidraco). Aquaculture 488, 161–173. doi: 10.1016/j.aquaculture.2018.01.031 absence of any commercial or financial relationships that could be construed as a
Xu, D., He, G., Mai, K., Zhou, H., Xu, W., and Song, F. (2016). Postprandial potential conflict of interest.
nutrient-sensing and metabolic responses after partial dietary fishmeal
replacement by soyabean meal in turbot (Scophthalmus maximus L.). Brit. J. Copyright © 2020 Dai, Li, Fu, Qiu and Chen. This is an open-access article distributed
Nutr. 115, 379–388. doi: 10.1017/S0007114515004535 under the terms of the Creative Commons Attribution License (CC BY). The use,
Yearbook, C. F. S. (2019). China Fishery Statistics Yearbook. Bureau of Fisheries, distribution or reproduction in other forums is permitted, provided the original
Ministry of Agriculture. Beijing: China Agriculture Press. author(s) and the copyright owner(s) are credited and that the original publication
Zheng, K., Liang, M., Yao, H., Wang, J., and Chang, Q. (2012). Effect of dietary in this journal is cited, in accordance with accepted academic practice. No use,
fish protein hydrolysate on growth, feed utilization and IGF-I levels of Japanese distribution or reproduction is permitted which does not comply with these terms.

Frontiers in Marine Science | www.frontiersin.org 11 April 2020 | Volume 7 | Article 197