Untitled

Anvikshiki
The Indian Journal of Research

Bi-Monthly International Journal of All Research
Editor in Chief
Dr. Maneesha Shukla,[email protected]
Review Editors
Prof. H. D. Khanna,Head Department of Biophysics,Institute of Medical Sciences Banaras Hindu University,Varanasi U.P. India
Ranjana S. Khanna,Department of Chemistry,Faculty of Science,Banaras Hindu University,Varanasi U.P. India
Editors
Dr. Mahendra Shukla, Dr. Anshumala Mishra
Editorial Board
Dr. Anita Singh, Dr. Bhavna Gupta, Dr. Madhavi Shukla, Dr. S. M. Shukla, Dr.Nilmani Prasad Singh, Dr. Reena Chaterjee,
Dr. Pragya Srivastava, Dr. Anup Datt Sharma, Dr. Padmini Ravindra Nath, Manoj Kumar Singh, Deepak Kumar, Archana Rani,
Avanish Shukla, Vijaylaxmi, Kavita, Jyoti Prakash, Rashmi Saxena., Dr. A. K. Thakur, Narendra Shanker Tripathi,
Anil Kr. Tripathi, Dr. Amit Vaibhav.
International Advisory Board
Dr. Javad Khalatbari (Tonekabon, Iran.), Dr. Shohreh Ghorbanshiroudi (Tonekabon, Iran.), Mohammad Mojtaba Keikhayfarzaneh
(Zahedan, Iran.), Saeedeh Motamed (Tonekabon, Iran.), Majid Karimzadeh (Iran), Phra Boonserm Sritha (Thailand),
Rev.Dodamgoda Sumanasara (Kalutara South),Ven.Kendagalle Sumanaransi Thero (Srilanka), Phra Chutidech Sansombat
(Bangkok,Thailand),Rev. T. Dhammaratana (Srilanka),P. Treerachi Sodama (Thailand), Sita Ram Bahadur Thapa (Nepal)
Manager
Maheshwar Shukla,[email protected]
Abstracts and Indexing
http//nkrc.niscair.res.in/browseByTitle.php?Keword=A, ICMJE ,www.icmje.org, , banaras.academia.edu,
ebookbrowse.com, BitLibrary! http:/ www.bitlib.net/, ,freetechebooks.com, ,artapp.net,Catechu PDF /
printfu.org, ,www.fileaway.info, , ,http://www.docslibrary.com, ,Android Tips, Apps,
Theme and Phone Reviews http://dandroidtips.com, , http://www.edu-doc.com, www.themarketingcorp.com,Dunia Ebook
Gratis duniaebook.net, ,www.cn.doc-cafes.com., ,http://scholar.google.co.in, Website : www.onlineijra.com.Motilal
Banarasi Das Index,Varanasi, Motilal Banarasi Das Index,Delhi. Banaras Hindu University Journal Index,Varanasi. www.bhu.ac.in,
D.K.Publication Index, Delhi. National Institute of Science Communication and Information Resources Index, New Delhi.
Subscriptions
Anvikshiki,The Indian Journal of Research is Published every two months (January,March,May,July,September and November) by
mpasvo Press,Varanasi.u.p.India. A Subscription to The Indian Journal of Research : Anvikshiki Comprises 6 Issues in Hindi and
6 in English and 3 Extra Issues. Prices include Postage by Surface mail,or For Subscription in the India by Speed Post.
Airmail rates are also available on request. Annual Subscriptions Rates (Volume 3,6 Issues in Hindi,6 Issues in English and
6 Issues of science 2012):
Subscribers
Institutional : Inland 4,000 +500 Rs. P.C., Single 1500+51 Rs.P.C.,Overseas 6000+2000Rs. P.C., Single 1000+500 Rs.P. C.
Personal : 2,500+500 Rs. P.C., Single 500+51 Rs. P.C., Overseas 5000+2000Rs.P.C., Single 1000+500Rs. P.C.
Advertising & Appeal
Inquiries about advertising should be sent to editor’s address. Anvikshiki is a self financed Journal and support through any kind or
cash shall be highly appreciated. Membership or subscription fees may be submitted via demand draft in faver of Dr. Maneesha
Shukla and should be sent at the address given below. Sbi core banking cheques will also be accepted.
All correspondence related to the Journal should be addressed to
B.32/16 A., Flat No.2/1,Gopalkunj,Nariya,Lanka, Varanasi, U.P.,India
Mobile : 09935784387,Tel.0542-2310539.,e-mail : [email protected],www.anvikshikijournal.com
Office Time : 3-5 P.M.(Sunday off)
Journal set by
Maheshwar Shukla,[email protected]
9415614090
Printed by
mpasvo Press
Maneesha Publication
(Letter No.V-34564,Reg.533/2007-2008)
B-32/16-A-2/1,Gopalkunj,Nariya,Lanka
Varanasi,U.P.,India
Anvikshiki
T he I ndian Jour nal of Resear
ournal esearcch
Volume 7 Number 3 May 2013
Science
Papers
Concept of Vrana in Veda 1-2

Awadhesh kumar Pandey, M. Sahu and Meenakashi Pathak S.N.
Studies of cytochrome c oxidase subunit I gene in the salmo trutta caspius for evolution of Salmonids types 3-7
Abolhasan Rezaei
A Clinical Study To Evaluate The Role Of Pathya In Management Of Kitibha (Psoriasis) 8-12
Dr. Anil Kumar, Dr. Neeru Nathani and Dr. O. P. Singh
Diagnosis and prognosis in complete denture patient – A Systematic Review 13-20

Dr. Rajul Vivek and Dr. Ankita Singh
Profile Of Patients With Diabetic Ketoacidosis At A Tertiary Referral Unit Of North India 21-24
Gautam K Deepak, Prakash Ved, Rai Madhukar and Singh K Surya
Occupational Health Hazards in Dental Practice- a brief review 25-31

Dr. Ankita Singh and Dr. RajulVivek
Study of urinary infection in community based Indian elderly 32-39

Dr Dhiraj Kishore, Prof. Indarjeet Singh Gambhir, Dr Amita Diwaker, Dr Vishal Khurana, Dr Ravi Kant and Prof Sampa Anupurba
Modification of SnuhiKsharasutra and an attempt to assess its efficacy in the management of fistula in ano. 40-44
Dr Gaurav Singh Rathore
Accuracy in proximity of four arbitrary hinge axis points to kinematic hinge axis point located by customized hinge axis locator 45-49
Pavan Kumar Dubey, J. R. Patel, Rajesh Sethuraman, Dr. T.P. Chaturvedi and Dr. Atul Bhatnagar
A Short Review Of Income, Investment and saving pattern on farm holdings in district Azamgarh, U.P. 50-53
Manoj Singh and Dr. K.P. Singh
Transmission Expansion Planning Based on PSO 54-62

Arash Zarinitabar, Hamdi Abdi and Hamid Fattahi
Modern Technology In Agricultural Production : A Review 63-67

Manoj Singh and Dr. K.P. Singh
PRINT ISSN 0973-9777,WEBSITE ISSN 0973-9777

Letter No.V-34564,Reg.533/2007-2008 INDIAN JOURNAL OF RESEARCH(2013)7,1-2
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 30 Jan. 2012
CONCEPT OF VRANA IN VEDA
AWADHESH KUMAR PANDEY*, M. SAHU** AND MEENAKASHI PATHAK S.N.***
Declaration
The Declaration of the authors for publication of Research Paper in The Indian Journal of Research Anvikshiki ISSN 0973-9777
Bi-monthly International Journal of all Research: We, Awadhesh kumar Pandey, M. Sahu and Meenakashi Pathak S.N. the authors of
the research paper entitled CONCEPT OF VRANA IN VEDA declare that , We take the responsibility of the content and material of our
paper as We ourself have written it and also have read the manuscript of our paper carefully. Also, We hereby give our consent to publish our
paper in Anvikshiki journal , This research paper is our original work and no part of it or it’s similar version is published or has been sent
for publication anywhere else.We authorise the Editorial Board of the Journal to modify and edit the manuscript. We also give our
consent to the Editor of Anvikshiki Journal to own the copyright of our research paper.
The earliest record of treatment of wound is found in “Vedas” the oldest book of the world written
about 3000 years B.C., where the general management of wound by herbs has been mentioned.
In Rigveda there is description about injured leg of Queen Bisphala being treated by amputation1.
1- ln~;ks ta?kkek;lh fo”iyk;s ?kus fgrs loZos çR;/kre~A ¼_-os- 1@16@15½
Vrana ropana in reference to transplantation of head of Yagya (Madhuvidhya and Kakshaya Vidhya)
has also been mentioned in Rigveda. For inflammatory edema (Vrana Shoth) use of drugs like Aswatha,
Puskara, Vansha, Shigru etc. have been mentioned.
In Samaveda Vrana ropana of a prince who was injured during war has been depicted (Jaiminya
Brahmans 3/94 — 95).
In Atharvaveda there are number of references where wound and its management has been described.
In case of traumatic injuries use of Jal Chikitsa (Hydrotherapy) has been advised2.
2- i;ZT;a “kro`’.k;eA ¼v-os- 1@27@6½
Measures to control bleeding have also been mentioned which including remedy available from
nature in form of Water3
3- vnks;nok/kkofr voRdekf/k ioZrkr] rr rs d‘.kksfe Hks’kte~A ¼v-os- 2@30@8½
4- mithdk mn~HkjfUr leqnznf/k Hks’kte~A rnklzkoL; Hks’kta rnq jksxe”kh”ker~AA ¼v-os- 2@3@4½
5- rklka lokZlkege”euk fcyeI;/kke~ ¼v-os- 5@35@2½
6- Js’BeklzkoHks’kta ofl’Ba jksxuk”kue~A ¼v-os 6@4@42½
*PhD Scholar [Deptt. Of Shalya Tantra] IMS, BHU Varanasi (U.P.) India.
**Head of Department [Deptt. Of ShalyaTantra] IMS, BHU Varanasi (U.P.) India.
***Senior Resident [Deptt. Of Prasuti Tantra] IMS, BHU Varanasi (U.P.) India.
1
© The Author 2013,Published by Mpasvo Press (MPASVO).All rights reserved.For permissions e-Mail : [email protected]
& [email protected]. Read this paper on www.anvikshikijournal.com
CONCEPT OF VRANA IN VEDA
7- fonz/kL; cyklL; yksfgrL; phinz‘ouL;rsA ¼v-os- 1@2@4½

8- ,oka jksxa pklzkoa pkUrfLrl‘rqe`TtbrA ¼v-os- 1@3@1½
Cold water that comes down from mountains is best remedy for hemorrhage, Upajeeka4 (Balmika
mritika), Stone3 (Ashman) and To stop bleeding drugs Vishanaka6, Cheepadru7, Munja, Laksha8 etc.
have been advised.
The healed fracture of the fossilized skeleton found in Egypt (3000 B.C.) points to Egyptian civilization
to have brought a system of medicine into practice in which surgery had a respectable place.
9- “kksQ/ua ‘kM~fo/ka pSo----------@----------bfr ‘kVf=”knqf}’Vk oz.kkuka leqiØek%A ¼p-fp- 25@40&43½
Atreya Punarvasu (2000 B.C.) expanded the knowledge of wound and its management and made a
detailed description of wound which included their classification, Signs symptoms, prognosis and 36
upakramas for management9.
At the time of Sushurta (1000 BC) the knowledge of wound was at its peak level. Sushruta being a
surgeon knew its value and has dealt almost all possible clinical aspects of wound healing in detail.
Though he mentioned classification, aetiology, sign and symptoms, prognosis with treatment and its
complications, yet he much emphasized on Dushta-vrana or Chronic non-healing wound.
He also described various techniques for control of bleeding, different methods of suturing the fresh
wounds and varieties of drugs to be used for Shodhana and Ropana.
10-e`rlathouh pSo fo”kY;dj.khefiA loZ.; dj.kh pSo la/kku dj.kh rFkkA ¼ok-jk- ;q)dk.M lxZ 74@32½
In Balmiki Ramayana (500 B. C.) it has been described that Lakshamana after being injured in
battlefield was treated by drugs Mritsanjeewani, Vishalyakarani, Savarankarani, and Sandhankarni10.
In Mahabharata (400 B.C.) Bheeshma is said to had been attended by a number of army surgeons
when he was wounded in the war.
In Budha Kala (300 BC). The foot injury of Buddha was managed by Jeewak. Use of Lancet to
incise boils and then use of astringent herbs, compression and bandage was the management of abscess.
Management of Vrana is described by some methods in Buddhist literature, which are :
i. Salluddharana - Extraction foreign body
ii. Vrana dhavana - Cleansing of wound
iii. Shoshana - Drying of wound
iv. Bhesajjanulimpana - Application of ointment.
2
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 11 Feb. 2013
STUDIES OF CYTOCHROME C OXIDASE SUBUNIT I GENE IN THE

SALMO TRUTTA CASPIUS FOR EVOLUTION OF SALMONIDS
TYPES
ABOLHASAN REZAEI*
Declaration
The Declaration of the author for publication of Research Paper in The Indian Journal of Research Anvikshiki ISSN 0973-9777
Bi-monthly International Journal of all Research: I, Abolhasan Rezaei the author of the research paper entitled STUDIES OF
CYTOCHROME C OXIDASE SUBUNIT I GENE IN THE SALMO TRUTTA CASPIUS FOR EVOLUTION OF SALMONIDS
TYPES declare that , I take the responsibility of the content and material of my paper as I myself have written it and also have read the
manuscript of my paper carefully. Also, I hereby give my consent to publish my paper in Anvikshiki journal , This research paper is my
original work and no part of it or it’s similar version is published or has been sent for publication anywhere else. I authorise the Editorial
Board of the Journal to modify and edit the manuscript. I also give my consent to the Editor of Anvikshiki Journal to own the copyright
of my research paper.
Abstract
Salmo trutta caspius were collected from three regions of Iran, were studied for the rate homology between salmo trutta
caspius with other salmonids by using cytochrome c oxidase subunit I. The full length of this gene has around 1200 bp in
length, that reported in Genebank. In this project were designed one pair of primers from cytochrome c oxidase gene by
DNAMAN program and NCBI Network system. The PCR products indicated for determination of among homology between
Salmo trutta caspius and other salmonids that compared with cytochrome c oxidase gene.
Keywords: Salmo trutta caspius, Cytochrome c oxidase, PCR product.
Introduction
The complete DNA mitochondrial genomic contains thirteen coding gene, twenty two transfer RNAs
(tRNA), two ribosomal RNAs (rRNAs) and one non-coding region that commonly known as the
displacement loop (D-loop) in vertebrates. The complete sequence of mitochondrial genomic in Atlantic
salmon (Salmo Salar), 16674 bp. In the length, had deposited in GenBank: JQ390055.1.
The Salmo trutta caspius species is a special marine teleost that is very important in the industrial
aquaculture in countries around of the Caspian Sea, especially in Iran. This species inhabits Rivers
around the Caspian sea, individually in the west and southwest of the Caspian sea regions too. The
*Department of Genetics-School of Basic Science [Tonekabon Branch] Islamic Azad University Tonekabon, Iran. e-Mail : [email protected]
3
STUDIES OF CYTOCHROME C OXIDASE SUBUNIT I GENE IN THE SALMO TRUTTA CASPIUS FOR EVOLUTION OF SALMONIDS
TYPES
recent study used simicrosatellite markers, no genetic differentiation was found between samples of
salmonids (Todd et al. 2004). Studies of mitochondrial genes have been extensively used in population
polymorphism, patterns of gene flow and phylogenetic relationships (Hale and Singh, 1987; Garcia-
Machado et al. 1999).Cytochrome c oxidase subunit I (COI), 16S rRNA, ATPase subunit 6 (A6) and
Cytochrome b (Cyt b) are part of the mitochondrial genes that have been reported to be highly informative
for population genetic studies in other crustaceans and arthropods (Marshall and Baker 1999; McGlashan
and Hughes, 2000, Hurwood et al. 2003). The present study we amplified on the DNA of cytochrome
oxidase I gene, for finding the rate of homology between Salmo trutta caspius and other salmonids,
there were a high homology between and within of salmonids.
Materials and Methods : DNA extraction: Samples of blood from Salmo trutta caspius specimens were
used to isolate total DNA. The geographical origins of the samples are caught from the rivers of
Tonekabon- Iran.
Primers development: One pair of cytochrome c oxidase universal primers was designed using sequences
of reported in Genebank-NCBI Network system from Salmo Salar, Salmo trutta and Oncorhynchus
mykiss. Conserved regions were selected to place overlapping forward and reverse primers. Primer
design was carried out using Primer3, a web based primer design program (Rozhan and Skaletsky,
2000; Whitehead Institute for Biomedical Research; http/Frodo. WI. mit. edu./cgibin / primer3/
primer3_ www.cgi). The primers will be amplified around 1200 bp in length from cytochrome c
oxidase I in salmo trutta caspius. The primers including:
>COI_For. GGCAATCACACGATGATTTTT
>COI_Rev. TCGTTAACTTGCTTGTACTTGGA
PCR condition: PCR amplification was performed with 50 ng of total genomic in 25 ìl reactions
including, 0.05 U Taq DNA polymerase, 12.5 pmoles of each specific primer, 2.5 ìl of 10X PCR
Buffer, 12.5 ìmole of dNTPs (deoxy - nucleotide-triphosphate) and autoclaved water.
The PCR amplification began with an initial denaturation step of 10 minutes at 94ºC, followed by 30
cycles consisting of a denaturation step at 94ºC for 1 minute, extension at 72ºC for 90 seconds and
ending with a final extension step at a 72ºC for 10 minutes. Following cytochrome oxidase I
amplification, 5ìl of PCR products were electrophoresed on a 1% agarose gel. The size of PCR
products were visualized by Gel Doc (USA).
The results: The ability of designing primer sets to detect of s. salar and s. trutta. The amplified full
length of gene cytochrome c oxidase had around 1200 bp. Hence, genomic DNA was extracted from
blood samples Salmo trutta caspius (Figure 1).
Figure 1 Total genomic DNA in s. t. caspius

4
REZAEI
PCR amplification gel photo: According to reported sequences about cytochrome b genes at NCBI
network, we have expected full length almost 1.2 kb from PCR products but are shown approximately
1.2 kb from full length Salmo trutta caspius between 14 samples of salmons. (Figure 2).
Figure 2 PCR amplification of high quality s. t. caspius using the primers of designed for cytochrome c gene. Samples
were separated by electrophoresis in 1.5% gel electrophoresis. M. Size marker 500 bp.
Discussion
The present study explained PCR product from cytochrome c oxidase I from Salmo trutta caspius.
Cytochrome c oxidase I were used for studies of genetic variation and polymorphism of salmonids
(Avise, 2004)).
We studied variation within cytochrome c oxidase I gene by amplification of the full length of
cytochrome c oxidase I gene. For getting full length of the gene we designed one pair of primers from
first to end of the gene. In related to we selected from all of Salmonids cytochrome c oxidase gene,
especially, Salmo salar and Salmo trutta fario, around eleven full sequences cytochrome oxidase gene
that reported in the Gene Bank. These specific primers followed to synthesize around 1.2 kbp for Salmo
trutta caspius. The result was interesting for us. Because we could amplify PCR product by one pair of
primers from first to end of the gene in Salmo trutta caspius.Hence the result noticed that high homology
with sequences of the salmonids because in other salmonids full length of the gene was around 1.2 kb.
There was observed a high rate of conservation between cytochrome c oxidase in the gene of S. t.
caspius and other salmonids because of high conservation a cause for designing primers and amplified
PCR products. Mitochondrial cytochrome c oxidase gene has been used to explore the phylogenetic
relationships of fishes at different taxonomic levels (Orti and Meyer, 1997; Feng et al. 2005; Li et al.,
2008), mainly due to the fact that it is highly conserved and has a slow evolution (Page and Holmes,
1998).
At the same time, the 12S rRNA gene is considered a promising tool for tracing the history of more
recent evolutionary events (Hills and Dixon 1991) and it has been widely used to study the phylogenetic
relationships between different levels of taxa such as families (Alves-Gomes et al. 1995, Ledje and
Arnason, 1996), genera (Gatesy, et al. 1997, Murphy and Collier, 1997,Wang, et al. 2001, 2003). With
the analyses of this project and other same projects showed that phylogenesis based on the cytochrome
c oxidase I strongly supported a sister relationship between the genus Salmoninae and other bony
5
STUDIES OF CYTOCHROME C OXIDASE SUBUNIT I GENE IN THE SALMO TRUTTA CASPIUS FOR EVOLUTION OF SALMONIDS
TYPES
fishes. However we should be more researches about the markers of genes related to Salmons. In
finally, however the cytochrome c oxidase gene transformed traits by maternal effects (Ovenden,1993;
Breatchez, 1992), but also is better the studies on the other gene’s markers from mitochondrial genomics
those are associated with maternal traits and also some genes that engaged with paternal traits (Gross et
al., 1996).
Acknowledgments
This work was financially supported by the Research Council of Islamic Azad University Tonekabon Branch, Iran.
REFERENCES
CM. TODD, AM. WALKER, MG. RITCHIE, JA. GRAVES, AF. WALKER (2004), Population genetic differentiation of
sea lice (Lepeophtheirus salmonis) parasitic on Atlantic and Pacific salmonids: analyses of microsatellite
DNA variation among wild and farmed hosts. Can J Fish Aquat Sci. (61),1176-1190.
C. LEDJE, U. ARNASON (1996), Phylogenetic relationships within confirm carnivores based on analyses of the
mitochondrial 12S rRNA gene. Journal of Molecular Evolution. (43),641–649.
CH. WANG, CH. KUO, HK. MOK, SC. LEE (2003), Molecular phylogeny of elopomorph fishes inferred from
mitochondrial 12S ribosomal RNA sequences. Zoologica Scripta. (32),231–241.
DA. HURWOOD, JM. HUGHES, SE. BUNN, C. CLEARY (2003), Population structure in the freshwater shrimp
(Paratya australiensis) inferred from allozymes and mitochondrial DNA. Heredity. (90),64-70.
DJ. MC GLUSHAN & JM HUGHS JM (2000), Reconciling patterns of genetic variation with stream structure and
biology in the Australian freshwater fish cratrocephalus stercusmuscarum. Athe Ecol.(9),1737-1751.
DM. HILLIS, MT. DIXON (1991), Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly
Review of Biology. (66), 411–453.
E. GARCIA-MACHADO, M. PEMPERA, N. DENNEBOUY. M. OLIVA-SUAREZ, JC. MOUNOLOU, M. MONNEROT (1999),
Mitochondrial genes collectively suggest the paraphyly of crustacea with respect to insecta. Journal Molecular
Evolution. (49),142-149
G. ORTI, P. PETRY, JA. PORTO, M. JEGU, A. MEYER (1996), Patterns of nucleotide change in mitochondrial ribosomal
RNA genes and the phylogeny of piranhas. Journal of Molecular Evolution. (42),169–182.
HD. MARSHALL, AJ. BAKER (1999), Colonization history of Atlantic island common chaffinches (Fringilla coelebs)
revealed by mitochondrial DNA. Molecular Phylogenetics and Evolution. (11), 201-212.
HY. WANG, MP. TSAI, J. DEAN, SC. LEE (2001), Molecular phylogeny of gobioid fishes (Perciformes: Gobioidei)
based on 12S rRNA sequences. Molecular Phylogenetics and Evolution. 20(3),390–408.
JC. AVISE (2004), Molecular markers, natural history and evolution. 2nd ed. Chapman and Hall, London, 511
pp.
J. LI, X. WANG, X. KONG, K. ZHAO, S. HE, RL. MAYDEN (2008), Variation patterns of the mitochondrial 16S
rRNA gene with secondary structure constraints and their application to phylogeny of cyprinine fishes
(Teleostei: Cypriniformes). Molecular Phylogenetic and Evolution. (47), 472-487.
JR. OVENDEN, R. WATER & WG. WHITE (1993), Mitochondrial DNA nucleotide sequence variation in Atlantic
salmon (Salmo salar), brown trout (S. trutta), rainbow trout (Oncorhynchus mykiss) and brook trout (Salvelinus
fontinalis) from Tasmania, Australia. Aquaculture. (114), 217—227.
J. GATESY, G. AMATO, E. VRBA, G. SCHALLER, RDE. ALLE (1997), A cladistic analysis of mitochondrial ribosomal
DNA from the Bovidae. Molecular Phylogenetics and Evolution. (7), 303-319.
J. ALVES-GOMES, G. ORTI, M. HAYGOOD, W. HEILIGENBERG, A. MEYER (1995), Phylogenetic analysis of South
American electric fishes (order: Gymnotiformes) and the evolution of their electrogenic system: a synthesis
based on morphology, electrophysiology, and mitochondrial sequence data. Molecular Biology and Evolution.
(12), 298–318.
6
REZAEI
L. BREATCHEZ, R. GUYOMARD & F. BONHONME (1992), DNA sequence variation of the mitochondrial conrol
region among geographically and morphologically remote European brown trout Salmo trutta populations.
Molecular Ecology. (1), 161-173.
LR. HALE, RS. SINGH (1987) Mitochondrial DNA variation and genetic structure in populations of Drosophila
melanogaster. Molecular Biology Evolution. (4), 622-637.
R. GROSS, P. SCHLEE, H. STEIN, O. ROTTMANN (1996), Detection of allelic variation within the growth hormone
gene in common bream using heteroduplex analysis, Journal Fish Biology (48),1283–1287.
RDM. PAGE & EC. HOLMES (1998), Molecular evolution: A phylogenetic approach. Blackwell Science, Oxford,
pp. 172–227.
S. ROZEN, HJ. SKALETSKY (2000), Primer3 on the WWW for general users and for biologist programmers. In:
Bioinformatics Methods and Protocols: Methods in Molecular Biology, edited by Krawetz S and Misener S.
Totowa, NJ: Humana.
W.J. MURPHY, GE. COLLIER. (1997), A molecular phylogeny for aplocheiloid fishes (Atherinomorpha,
Cyprinodontiformes): the role of vicariance and the origins of annualism. Molecular Biology and Evolution.
(14), 790–799.
Y. FENG, L. JING, XJ. PEIJUN (2005), Preliminary study on mitochondrial 16S rRNA gene sequences and phylogeny
of flatfishes (Pleuronectiformes). Chinese Journal of Oceanology and Limnology. (23), 335–339.
7
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 15 Mar 2013
A CLINICAL STUDY TO EVALUATE THE ROLE OF PATHYA IN

MANAGEMENT OF KITIBHA (PSORIASIS)
DR. ANIL KUMAR*, DR. NEERU NATHANI**AND DR. O. P. SINGH***
Declaration
Bi-monthly International Journal of all Research: We, Anil Kumar, Neeru Nathani and O. P. Singh the authors of the research paper
entitled A CLINICAL STUDY TO EVALUATE THE ROLE OF PATHYA IN MANAGEMENT OF KITIBHA (PSORIASIS) declare
that , We take the responsibility of the content and material of our paper as We ourself have written it and also have read the manuscript of
our paper carefully. Also, We hereby give our consent to publish our paper in Anvikshiki journal , This research paper is our original work
and no part of it or it’s similar version is published or has been sent for publication anywhere else.We authorise the Editorial Board of the
Journal to modify and edit the manuscript. We also give our consent to the Editor of Anvikshiki Journal to own the copyright of our
research paper.
Abstract
In Ayurveda, Kitibha is explained under the heading of Kustha, which resembles Psoriasis in sign and symptoms. Psoriasis
is a complex, chronic, non-infectious, inflammatory, multisystem disease. Some studies suggest that incomplete protein
digestion causes bacteria acting on the proteins in the gastrointestinal tract to form toxic compounds that trigger excessive
skin cells proliferation.
According to Ayurvedic references, Kitibha is caused by the vitiation of Vata and Kapha dosha. Although there are
many factors in the vitiation of doshas but Apthya (sour and salty items, guru anna, viruddha ahara, suppression of
natural urges etc.) plays an important role in the accumulation of dooshi visha ( low potency poisons), which is responsible
for basic pathological changes taking place in the system. Pathya (Ahara-Vihara) is the best medicine that alleviates the
sign and symptoms of the disease.
Material And Methods : Total 30 patients with moderate to severe Kitibha (Psoriasis) were assigned for 3 months study in
O.P.D. of Swasthya Rakshana and Kayachikitsa, S.S. Hospital, IMS, BHU. All cases were catagorized into two groups;
group A including 15 patients with Standard drug ( Methotrexate 7.5 mg + Folic acid 5 mg, weekly) and 15 patients in
group B taking Standard drug along with Pathya. The outcome of two groups was estimated by PASI (Psoriasis Area
and Severity Index) score.
Result : After 3 months of study the mean of PASI score decreased to a greater extent in the patients of group B as
compared to group A, and a significant difference was found (P<.001%) between two groups.
Conclusion : At the end of clinical study it was evident that for better management of Kitibha (Psoriasis) a healthy regimen
(Pathya) has to be followed strictly and to avoid faulty lifestyle (Apathya), along with drug therapy.
Keywords : Pathya, Apathya, Viruddha ahara, Dooshi visha, Protein digestion, Natural urges.
*(Corresponding Author) JR-III, Dept. of Swasthavritta and Yoga [Faculty of Ayurveda] IMS, BHU Varanasi (U.P.) India. e-Mail : kumarsunny
[email protected]
**(Supervisor) Assistant Professor, Dept. of Swasthavritta and Yoga [Faculty of Ayurveda] IMS, BHU Varanasi (U.P.) India.
***(Co-Supervisor) Reader, Dept. of Kayachikitsa [Faculty of Ayurveda] IMS, BHU Varanasi (U.P.) India.
8
KUMAR, NATHANI AND SINGH
Introuction
It is an old truth that diet has an impact on human health. In Indian Medicine System Acharya Charaka
described that use of wholesome diet is the only factor that promotes the healthy growth of man and the
factor that makes for disease is the indulgence in unwholesome diet1. Kitibha is a skin ailment described
in Ayurvedic texts under Kustha. Here the specific etiology for Kitibha Kustha has not been described,
so the etiology of Kitibha can be understood on the basis of general etiology of Kustha. According to
Charaka, Kustha is caused by the constant use of mutually incompatible food and drinks, intake of food
during indigestion, suppression of natural urges etc. By these factors all the three humors (doshas) Vata,
Pitta and Kapha become morbid, vitiate the skin, blood, flesh and body fluid. Kitibha is a dry wound
like lesion, which is bluish in color, rough and hard to touch, caused by the vitiation of Vata and Kapha
doshas. Diet is a major cause to imbalance doshas that leads to Psoriasis. Vata, that controls bodily
functions, and Kapha, that controls growth, become unbalanced due to improper food choices, improper
food combinations and dooshi vishas or toxins that accumulate in our digestive tract, resulting in
Psoriasis.2
Psoriasis is considered as a T- cell mediated inflammatory skin disease. It is a chronic, disfiguring,
inflammatory and proliferative condition of the skin, in which both genetic and environmental influences
have a critical role3. It is described that skin diseases occur mainly due to unwholesome diet and faulty
lifestyle. Psoriasis is said to be of unknown etiology and well known for spontaneous remission, relapse
and seasonal variations, that aggravates with stress, obesity, cold and hot weather, sun burns, skin-
injuries, excessive consumption of alcohol, smoking and certain food items. Psoriasis may substantially
affect quality of life. Many treatments are available which may allow short-term improvement of the
disease, but these measures do not lead to complete clearing of Psoriasis4. So, ancient tools of Pathya
Ahara and Vihara may have additive effect in the long term management and prevention of Kitibha
(Psoriasis).
Material and Methods

Objective of study : The main objective of this study was to explore the etiological factors and to assess
the role of Pathya Ahara and Vihara which play a role in management and prevention of Kitibha
(Psoriasis).
Subjects and study design : Out of 30 registered cases of Kitibha (Psoriasis) the clinical evaluation has
been carried out on total 25 patients of Psoriasis who continued the treatment till last follow up. All
30 cases were randomly divided into two groups. Patients of group A (n=15) were adviced to take
Standard drug ( Methotrexate 7.5 mg + Folic acid 5 mg, weekly) and patients of group B (n=15)
taking Standard drug along with Pathya. Each patient was reviewed at every 1 month interval for the
total duration of 3 months. The patients fulfilling the diagnostic criteria were selected for the clinical
study. The method of clinical examination was based on Ayurvedic system of medicine as well as
modern clinical methods as per the Proforma prepared for this purpose. The improvement provided
by the therapy was assessed on the basis of relief in the sign and symptoms of Kitibha (Psoriasis).
Changes in the pathological reports were also taken into consideration. All the signs and symptoms
were assigned by a grade depending upon their severity to assess the effect of management before
and after treatment. The final estimation of the disease was done by Psoriasis Area and Severity
Index (PASI score).
9
A CLINICAL STUDY TO EVALUATE THE ROLE OF PATHYA IN MANAGEMENT OF KITIBHA (PSORIASIS)
Inclusion Criteria :
• Age 16 - 60 yrs.
• Diagnosed cases of Kitibha (Psoriasis) based on the subjective and objective parameters.
• Patient willing to participate in the trial.
Exclusion Criteria :
• Age <16yrs. and >60yrs.
• Severely ill patients with weight loss.
• Pregnant and lactating women.
• Complicated cases of Psoriasis like psoriasis with arthritis etc.
• Psoriasis with DM, TB, CA or other complicated diseases.
Laboratory Assessment :The investigations were performed to rule out any systemic pathology and to
know the changes produced by progress of Kitibha (Psoriasis) and effect of the drug. Samples of
venous blood were collected from the patients before and after treatment for the measurement of
complete blood count, erythrocyte sedimentation rate, haemoglobin level, liver function test and
renal function test.
Statistical Analysis :The appropriate statistical methods were applied by using SPSS software version
16.0 to analyze the data for finding the results. The intra group comparison was done to observe the
overall effect of different treatments by using paired t test for PASI score. The inter group comparison
was done by using unpaired t test.
Pathyapthaya Monitoring
Pathya and Apthya (Ahara and Vihara) were selected on the basis of Ayurvedic literature. Pathya-
Apathya chart for Kitibha has been prepared and was given to the patients. Some are as follows :
PATHYA (Indications)
Laghu Anna : Laghu Anna easily digests and properly get absorbed by the intestine. Guru Ahara causes Ajirna, because of
this digestive system get disturbed and immature food particles get absorbed by the intestine which work as endotoxins
(dooshi visha) to trigger excessive skin cell proliferation.
Tikta dravya and Green vegetables : According to Charaka bitter taste is antidotal to poison, germicidal, curative of
fainting, burning, itching, dermatosis (Kushtha) and thirst (Cha. Su. 26/40). Food with a bitter taste create balance by
increasing Vata while decreasing Kapha, tighten muscles and skin tissue, and reduce burning, itching and inflammation
(Jackie Lohrey. 2011). Green vegetables are a good source of vitamins, minerals, natural fiber etc. Carrots, apricots,
mangoes and green vegetables are high in beta carotene. The body converts beta carotene into vitamin A, which is
essential for healthy skin (Szliszka, et al. 2011).
Cow Ghrita and Flax seed : According to Bhavaprakash 1 year old ghrita is curative in dermatosis (Kushtha). The
effectiveness of cow ghee in the treatment of Psoriasis may be due to the ability of ghee to lower prostaglandins (PG)
level and decrease secretion of leukotrienes, which are inflammatory mediators derived from the arachidonic acid
cascade5. Use of Omega-3 fatty acid rich diet helps in reduction of symptoms. Flaxseed oil consists of approximately
55% alpha linolenic acid (ALA), which makes it six times richer than most fish oils in n-3 fatty acids6.
Grains : Choose a diet with adequate grain product (jwar, barley, gram.... etc.), vegetables and fruit rich in vit. C (amala,
guava, cabbage....etc.) and beta carotene (carrot, sweet potato, green leafy vegetables, mangoes...etc.) which help in
relieving the symptoms of disease.
Rasona (Garlic) : According to Charaka garlic is curative of worms, dermatosis, leprosy, Vata disorders (Cha. Su. 27/173).
In many studies practitioners suggest munching of few garlic cloves before eating breakfast each morning to clear
toxins from blood (Jackie Lohery 2011).
Vihara : Daily exposure to mild sunlight, rubbing of skin with wet towel, proper sleep etc. are beneficial for prevention and
management of Kitibha (Psoriasis).
APTHAYA (Contraindications)
10
KUMAR, NATHANI AND SINGH
Pistanna atisevana, Guru Anna and Meats : According to Ayurveda excess use of navanna, guru anna, pistanna (pastry
items) and mash etc., are the causing factors of Sthulta, Obesity may contribute to the development and severity of
disease7 (Rackett, Zamboni, et al. 1993). A diet high in protein, particularly animal-derived protein, is linked with
increased Psoriasis symptoms according to a report published in the “Indian Journal of Dermatology” in 2010. Meats
are highly rich in proteins, so vegetarian diet may be beneficial for all patients of Psoriasis due to low amino acid intake
resulting in reduced formation of inflammatory eicosanoids (M. Wolters. 2005).
Amla Dravya : According to Charaka Amla rasa provokes the Pitta and vitiate Rakta Dhatu (Cha. Su. 26/44). When pH of
diet is slightly alkaline there is proper absorption of nutrients from the body, increased immunity, and optimal health.
Psoriasis is distinguished by overly acidic body chemistry that is the result of over consumption of acid forming foods
and the re-circulation of toxins from the intestinal tract8. Avoid sour and salty food items in the diet of Psoriatic
patients.
Dadhi : Dadhi is mahaabhisyandhi, causes srotoavarodha and vitiate Doshas.
Egg, Milk, Smoking, Alcohol : The main cause of Psoriasis appears to be the faulty utilization of fat. It has been noted that
patients with this abnormality have excessive amounts of cholesterol in their skin and blood. Recent studies have
shown that Psoriasis involves an abnormality in the mechanism in which skin grows and replaces itself. All animal fats,
including milk, butter and eggs should be avoided. Refined or processed foods and food containing hydrogenated fats
or white sugar, all condiments, tea, coffee, alcohol and tobacco should also be avoided. According to Higgins and Du
Vivier,1994, alcohol consumption is associated not only with a higher incidence and severity of Psoriasis, but also with
a distinctive nature and distribution of the disease. The prevalence of Psoriasis was also associated with a higher
frequency of smoking (Braathen LR, et al. 1989). Psoriasis is positively connected with Body Mass Index (Rocha-
Pereira P, et al. 2001), so animal derived protein (meat…..etc.) are prohibited.
Suppression of Natural Urges : According to Charaka suppression of vomiting causes Kushtha (Cha. Su 7/14). Due to
retention of indigested food by suppression of vomiting, dooshi visha (toxin) produce in the body to cause skin disease.
Do not suppress the natural urges like vomiting, urination, bowel emptying etc.
Divaswapana : According to Ayurveda divaswapna vitiate Vata and Kapha doshas. People with Psoriasis should also avoid
sleeping in day time to help bring the doshas in balance state (Owen Peason, 2010).
Santapati Bhukatvopsavinam (High Sun Light Exposure) : Psoriasis may be provoked by strong sun light. In a study, the
prevalence of photosensitivity in Psoriasis was estimated at 5.5% (Ros A-M, et al.1987).
Result
No more difference was seen in Laboratory Assessment of patients during the whole study. In Group A
Initial mean+S.D. of PASI score was 19.2+12.43 which decreased to 7.14+4.16 after complete follow
ups, it was statistically highly significant result (t = 5.86, p<.001). In Group B mean+S.D. of PASI was
decreased from 18.41+9.22 (BT-before treatment) to 1.63+.805 (F3- last follow up) showing statistically
highly significant result (t = 6.60, p<.001). The difference in mean(BT-F3) was highest in Group B
(16.78) than Group A (12.06). During inter Group comparison (Unpaired t test) it can be concluded that
results were statistically not significant in BT & F1, but in F2 & F3 results were highly significant
(p<.001).
Effect of Different Treatments on PASI score:
Groups BT F1 F2 F3 Within the group comparison (BT-F3)
Group A 19.2+ 18.77+ 9.90+ 7.14+ t= 5.86
12.43 12.53 5.64 4.16 p < .001
Group B 18.41+ 11+ 4.42+ 1.63+ t= 6.60
9.22 6.01 1.88 .805 p< .001
Between the t = .215p t = 2.03 t = 3.20 t = 4.50
groups comparison >.05 p>.05 p < .001 p< .001
Unpaired t test
11
A CLINICAL STUDY TO EVALUATE THE ROLE OF PATHYA IN MANAGEMENT OF KITIBHA (PSORIASIS)
Discussion
Distribution of cases according to Aharaja Nidana reveals that most of the patients were taking sour and
salty food items, meat, milk, pastry etc. in excess. Viharaja Nidana shows that maximum number of
patients having habit of intake of food during indigestion, sleep in day time, suppression of vomiting,
high exposure of sun light after taking very heavy meal. Present study also shows that maximum number
of patients had addiction of tobacco as compared to alcohol and smoking.
Within the Group Comparison (BT-F3) shows decrease in PASI score of Group A and B patients with
highly significant P values (p<.001). But there is more reduction in PASI score of Group B cases
(16.78) than of Group A cases (12.06). It indicates that Pathya if practiced by the same patients along
with Drug then it is more effective in reducing PASI score than the Drug therapy alone.
Conclusion
At the end of this study it is evident that the effect of Standard Drug is highly significant but the synergetic effect of Drug
with Pathya gives more efficacious results in terms of improvement rate of symptoms, than the use of single Drug therapy.
Thus the present study has been conducted entirely on scientific ground to develop a safe and cost effective strategy for the
management of Kitibha (Psoriasis).
REFERENCES
1
Charaka Samhita. “Chapter 25, verse 31”. Reprint Edition-2008.
2
JACKIE LOHERY. Ayurvedic diet for Psoriasis. Jun 14 :2011.
3
C.E.M. GRIFFITH, R.D.R. CAMP, et al. “Skin” Rooks Book of Dermatology.
4
NALDI L, SVENSSON A, DIEPGEN T et al. Randomized clinical trials for psoriasis 1977-2000: the EDEN
survey. J Invest Dermatol 2003; 120:738-41.
5
Center of Integrated Medicine and Department of Pathology, Columbus, OH 43210 USA.
6
BUCHER H C, et al. “an- 3 polyunsaturated fatty acids in coronary heart disease: a meta analysis of
randomised controlled trials”. Am J Med 112 (4): 298-304.
7
RACKETT, S. C. et al. J Am Acad. Dermatol, 29 (1993) 447.
8
PAGANO, JOHN. Healing of Psoriasis: The Natural Alternative. The Pagano organization, Inc. Englewood
Cliffs, NJ, 1991.
12
DIAGNOSIS AND PROGNOSIS IN COMPLETE DENTURE PATIENT –

A SYSTEMATIC REVIEW
DR. RAJUL VIVEK* AND DR. ANKITA SINGH**
Declaration
Bi-monthly International Journal of all Research: We, Rajul Vivek and Ankita Singh the authors of the research paper entitled DIAGNOSIS
AND PROGNOSIS IN COMPLETE DENTURE PATIENT – A SYSTEMATIC REVIEW declare that , We take the responsibility of
the content and material of our paper as We ourself have written it and also have read the manuscript of our paper carefully. Also, We hereby
give our consent to publish our paper in Anvikshiki journal , This research paper is our original work and no part of it or it’s similar version
is published or has been sent for publication anywhere else.We authorise the Editorial Board of the Journal to modify and edit the
manuscript. We also give our consent to the Editor of Anvikshiki Journal to own the copyright of our research paper.
Abstract
Complete edentulism can be defined as “the physical state of the jaw following removal of all erupted teeth and the
condition of the supporting structures available for reconstructive or replacement therapies. The edentulous patient presents
both anatomical and psychosocial factors which affect the treatment and outcome. By identifying these factors, patient
expectations can be modified, thus avoiding disappointment. Rehabilitative and therapeutic treatment and a long-range
plan for maintenance should be identified before initiating care. The During the initial appointment, clinical data,
psychosocial and dental/ medical history, and the patient’s expectations should be recorded. A thorough examination and
consultation ensures that the patient understands his or her problem and responsibility for a successful outcome. This
article review and described the oral and diagnosis aspect of edentulous patient.
Introduction
Diagnosis and treatment planning are the two most important parameters in the successful management
of a patient. Inadequate diagnosis and treatment planning are the major reasons behind the failure of a
complete denture. Patients with some teeth remaining who request complete dentures should be carefully
diagnosed to ensure that treatment alternatives to complete dentures are thoroughly considered. The
decision to retain or remove even one tooth is serious and all alternatives must be explored before the
final decision is made.
*Service Senior Resident, Faculty of Dental Sciences [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
**(Corresponding Author) Service Senior Resident, Faculty of Dental Sciences [Institute of Medical Sciences] Banaras Hindu University, Varanasi
(U.P.) India.
13
© The Author 2013, Published by Mpasvo Press (MPASVO).All rights reserved.For permissions e-Mail : [email protected]
DIAGNOSIS AND PROGNOSIS IN COMPLETE DENTURE PATIENT – A SYSTEMATIC REVIEW
Question Sequence : 1, 2, 3 Sequential recording of case history starts with patient information such as
name, age, sex, occupation that helps in gathering certain information required before formulating a
particular treatment plan for the patient.
Examination : 4 The primary step in gathering of data is by examining the patient through visual
perception. Through visual perception, typical tasks to be identified are detection, discrimination,
recognition, identification and judgment.
Diagnosis : Essential diagnostic data obtained from patient interview, definitive oral examination,
consultation with medical and dental specialists, radiographs, mounted and surveyed diagnostic
casts should be carefully evaluated during treatment planning.
Mental Attitude of Patients : De Van stated, “meet the mind of the patient before meeting the mouth of
the patient”. Hence, we understand that the patient’s attitudes and opinions can influence the outcome
of the treatment.
A doctor should evaluate the patient’s hair colour, height, weight, gait, behavior, socioeconomic status,
etc right from the moment he/she enters the clinic. A brief conversation will reveal his/her mental
attitude. Actually patient evaluation is done along with history taking but since it is usually begun
prior to history taking, we have discussed it in detail here.
Based on their mental attitude, patients can be grouped under two classifications. Dr.M.M. House
proposed the first one in 1950, which is widely followed.
House’s Classification5
Dr.M.M.House in 1950 classified patient’s psychology into four types :
Class I: Philosophical
a. Those who have presented themselves prior to the extraction of their teeth, have had no experience in wearing dentures,
and do not anticipate any special difficulties in that regard.
b. Those wearing dentures unsatisfactory in appearance and usefulness, and who doubt the ability of the dentist to render
a satisfactory treatment, and those who insist on a written guarantee or expect the dentist to make repeated attempts to
please them.
These patients are precise, above average in intelligence, concerned in their dress and appearance, usually dissatisfied by
their previous treatment, do not have confidence in the dentist. It is very difficult to satisfy them. But once satisfied they
become the dentist’s greatest supporter.
Class III: Hysterical
a. Those in bad health with long neglected pathological mouth conditions and who are positive in their minds that they can
never wear dentures. They are emotionally unstable and tend to complain without justification.
b. Those who have attempted to wear dentures but failed. They are thoroughly discouraged. They are of a hysterical,
nervous, very exacting temperament and will demand efficiency and appearance from the dentures equal to that of the
most perfect natural teeth. Unless their mental attitude is changed it is difficult to give a successful treatment.
These patients do not want to have any treatment done. They come out of compulsion from their relatives and friends. They
have a highly negative attitude to the dentist and the treatment. They have unrealistic expectations and want the dentures
to be better than their natural teeth. They are the most difficult patients to manage. They show poor prognosis.
Class IV: Indifferent
Those who are unconcerned about their appearance and feel very little or no necessity for teeth for mastication. They are,
therefore uncooperative and will hardly try to become accustomed to dentures. They will not maintain the dentures
properly and do not appreciate the efforts and skills of the dentist.
Health History : The health history or clinical interview is an integral part of the diagnosis and is best
obtained in the consultation room.
Past Medical History6: The medical history provides important insights regarding the patient’s dental
prognosis. A patient in good general health is generally able to accept and adjust to a complete
14
VIVEK AND SINGH
denture better than one who is in poor health. Systemic factors that may affect complete denture
treatment include; anemia, arthritis, Bell’s palsy, carcinomas, diabetes, nicotinic stomatitis, Paget’s
disease, Parkinson’s disease, and therapies that cause xerostomia and infectious diseases.
Diabetes: The following diagnostic features are in evidence in diabetes: a dry feeling in the mouth; a
coated tongue, with swollen edges and tooth impressions along the borders; fissures on the tongue;
small abscesses throughout the mouth, poor tissue tone; and a burning and metallic taste in the
mouth.
Arthritis: The oral aspects of arthritis are usually seen in the temporomandibular joint. These are limited
movement and opening, generalized pain throughout the side of the face, abnormal chewing
procedures, and changing occlusal relations.
Bell’s palsy: Bell’s palsy is a toxic, infective, thermal, or mechanical over stimulation of the facial
nerve, which results in facial asymmetry, lack of muscular control on the affected side, failure of the
eyelid to close normally on the affected side, excessive tearing on the paralyzed side, droping of the
corner of the mouth, and emission of saliva.
Parkinson’s disease (Paralysis Agitans): Parkinson’s disease is characterized by rhythmical muscular
tremors which include the tongue and muscles of mastication, muscle rigidity, which is usually
evident, very slow movements by the patient, excessive salivation, and a fixed masklike expression.
mastication, muscle rigidity, which is usually evident, very slow movements by the patient, excessive
salivation, and a fixed masklike expression.
Anemia: Various type of anemia present the following generalized symptoms: changes in the mucous
membrane; pallor of the tongue and lips; burning, smooth, glossy tongue; and usually pain in the
tongue and supporting areas.
Pemphigus: Pemhigus is the most often fatal of the dermatologic diseases. Orally it presents vesicles
and bullae on the mucous membrane as well as on the skin. When the vesicles rupture, they leave
eroded areas and ulcerations, and the resulting condition causes discomfort and pain.
Clinical Examination of the Patient 7

Facial form : House and Loop, Frush ad Fisher, and Williams classified facial form based on the
outline of the face as square, tapering, square tapering and ovoid. Examining the facial form helps in
teeth selection.
Facial profile: Examination of the facial profile is very important because it determines the jaw relation
and occlusion. Angle classified facial profile as:
Class I : Normal or straight Profile, Class II: Retrognathic profile, Class III: Prognathic profile
Lip: The contour and appearance of the vermillion border is usually altered by tooth loss. Restoration of lip support and
vermilion border width must be considered during placement of anterior teeth. Classify the lip contour as “adequately
supported” or “unsupported.” Also, comment on the amount of vermillion border visible Lip mobility should be noted
Lip length can be classified as – class I: normal, Class II: long., Class III: short. Classify lip mobility as normal
(class 1), reduced mobility (class 2), or paralysis (class 3).
Neuromuscular Examination : It includes the examination of speech and neuromuscular coordination.
Speech : Speech is classified based on the ability of the patient to articulate and coordinate it.
Type 1: Normal. Patients who are capable of producing an articulated speech with their existing dentures can easily
accommodate to the new dentures.
Type 2 : Affected. Patients who have impaired articulation or coordination of speech with their existing dentures require
special attention during anterior teeth setting.
Patients whose speech was altered due to a poorly-designed denture require more time to adapt to a proper articulated
speech in the new denture. They also fall under affected speech.
15
Neuromuscular Coordination : The patient is to be observed from the time he/she enters the clinic. The patient’s gait,
coordination of movements, the ease with which he moves and his steadiness are important points to be considered.
Facial movements have to be noted as much as bodily movements. Abnormal facial movements like lip smacking,
tongue tremors, uncontrollable chewing movements can influence complete denture performance and may also lead to
prosthetic failure.
Intraoral Examination
Arch Size: Arch size is classified as follows:
The size of the maxilla and mandible ultimately will determine the amount of basal seat available for the denture foundation.
Class 1: Large (Best for retention and stability),Class 2: Medium (good retention and stability but not ideal) ,Class 3: Small
(difficult to achieve good retention and stability)
Arch Form: Classified according to House
Class I. – Square: The square arch is the best form to prevent rotational movement. Class II. – Tapering: The tapering form
offers some resistance to movement but to a lesser degree than a square arch., Class III. – Ovoid: The ovoid form,
because of its rounded shape, gives little or no resistance to rotational movements.
Ridge Form : Ridge contour can vary widely. The ideal is a high ridge with a flat crest and parallel or nearly parallel slopes.
This type of ridge will give maximum support and stability and resistance to horizontal movement.
Bony Undercuts
Class I ;A residual ridge with bone undercuts is most unfavorable to a stable denture, and surgical
reduction may be necessary. ,Class II-There are small undercuts over which the denture can be
placed by changing the path of insertion or by relieving the completed denture after pressure indicating
paste has been applied to reveal pressure areas.,Class III Prominent bilateral undercuts are corrected
by surgery. Sometimes surgery can be limited to undercuts on one side only.
Tori
Classification :
Class 1: Tori are absent or minimal in size. Existing tori do not interfere with denture construction.
Class 2: Clinical examination reveals tori of moderate size. Such tori offer mild difficulties in denture construction and
use. Surgery is not required.
Class 3: Large tori are present. These tori compromise the fabrication and function of dentures. Such tori usually require
surgical recontouring or removal.
Interarch Space
Classification:
Class I: the patient has enough interarch distance to accommodate the denture., Class II: There is excessive space. The
dentures are usually less stable because the distance between the teeth and the supporting bone is so great..Class III:
Inter-ach space is limited. Placement of the artificial teeth can be a defiant procedure.
Ridge relationship
Classified according to Angle
Class I (normal): The maxillary alveolar ridge crest is directly under the mandibular ridge. This is
usually the most favorable ridge relation for complete dentures .Class II (retroganathous, Angle’s
16
VIVEK AND SINGH
class II): The mandibular ridge is narrower and shorter than the maxillary ridge. In some instances it
may be as wide as the maxillae in the posterior. Such patients often have a large protrusive excursion
that makes balanced occlusion difficult, Class III (Prognathous, Angle’s Class III). The mandible is
longer and usually wider than the maxillae. Such patients rarely show excessive jaw excursions.
Lateral throat form

8
classified according to Neil :
It is classified as class I, II, III according to the depth and width of the retro-mylohoid sulcus. Palatal throat form Classified
according to House.
Class I - Large & normal form with a relatively immovable band of resilient tissue 5-12mm distal to a line drawn across the
distal edge of the tuberosities , Class II - Medium size & normal form, with a relatively immovable resilient band of
tissue 3-5mm distal to a line drawn across the distal edge of the tuberosities ,Class III - Usually accompanies a small
maxilla. The curtain of soft tissues turns down abruptly 3-5mm anterior to a line drawn across the palate at the distal
edge of the tuberosities.
Shape of the Hard Palate

Vertical support and retention for the maxillary denture is partially determined by the shape of the hard
palate. The palate may be classified as flat, U, or V- shaped Class I - The broad flat palate offers
excellent resistance to vertical stresses. A large median palatal raphe, if present, may cause an adverse
prognosis, Class II - The U-shaped palate offers good retention and/or resistance to both vertical and
horizontal forces, Class III - The v- shaped palate has a poor prognosis. Vertical forces tend to break the
seal.
Slope of the soft palate

The degree of flexure of the soft palate to the hard palate determines the posterior extent of the maxillary13
denture.
Class I - The soft palate slopes gradually down from the hard palate this type generally allows several
millimeters of soft, relatively immovable tissue for the formation of a gross
seal. The precise location of the posterior extent of the denture is also not as critical.
Class II - The soft palate slopes more sharply than the class I type, thus limiting the seal area and the
posterior denture length.
Class III - The soft palate drops sharply down from the hard palate. The precise location of the posterior
extent is critical and the area for the seal is restricted. Generally this form shows a great deal of soft
palate movement when the patient speaks and swallows.
Mucosa condition : Classified according to House,Class 1: Healthy,Class 2: Irritated,Class 3: Pathologic
Tongue size
Classification according to House
Class 1: Normal in size, development, and function. Sufficient teeth are present to maintain normal
form and function.,Class 2: Teeth have been absent long enough to permit a change in the form and
function of the tongue.,Class 3: Excessively large tongue, all teeth have been absent for an extended
period of time, allowing for abnormal development of the size of the tongue. class 3 tongue.
17
Tongue position: Classification according to Wright Normal: The tongue fills the floor of the mouth
and is confined by the mandibular teeth. The lateral borders restn on the occlusal surfaces of the
posterior teeth and the apex rests on the incisal edges of the anterior teeth. ,Class 1: Retracted: The
tongue is retracted. The floor of the mouth is pulled downward and is exposed back to the molar
area. The lateral borders are raised above the
Saliva
Class I: The saliva is normal in amount and consistency ,Class II There is an excessive amount of thin,
watery saliva or thick, ropy saliva. Excessive saliva may cause gagging and will usually complicate
impression making.,Class III Insufficient saliva reduces the retentive qualities of the denture and
may cause an excessive dryness of the mucosa.
Radiographs
Radiographs are essential for evaluating the conditions existing in every patient needing prosthodontic
service. The dentist must know the condition under the mucous membrane. Abnormalities such as
foreign bodies, retained tooth roots, unerupted teeth, varied pathosis of developmental, inflammatory
or neoplastic origin may exist. Radiographs show the relative thickness of submucosa covering the
bone in the edentulous region, the location of mandibular canal, and mental foramen in relation to the
basal seat of the dentures. Sharp spicules of bone on ridges crest are also apparent on properly exposed
dental radiographs. Preoperative photos, radiographs, face profile 11 cutouts, moulds, and mounted
casts help in the treatment planning. lip.
Existing Dentures as Diagnostic Aids9

The recognition of deficiencies in the existing dentures enables the dentist to correct those deficiencies
in the new ones and also know that this is one of the treatment limitations for that particular patient The
examination and evaluation of the present prostheses are valuable aids in gaining insights into the
patient’s previous experience, prosthetic tolerance, and esthetic values Existing dentures should be
evaluated to determine physical, esthetic, and anatomic characteristics. Shape shade, mold and material
should be recorded for both anterior and posterior teeth. Esthetics, phonetics, retention, stability,
extensions, and contours: Existing esthetics, phonetics, retention, stability, extensions, and contours
should be evaluated. These attributes should be rated as (1) good, (2) fair and (3) poor.
Centric Relation and Vertical Dimension of Occlusion10

Centric relation and vertical dimension of occlusion should be assessed and rated “acceptable” or
“unacceptable.” If unacceptable, it should be noted whether the existing VDO is inadequate” or
excessive.”
Palate: The palate of the existing maxillary denture should be examined. The denture base material and
thickness should be noted. Anatomic features should be assessed. The practitioner should note the
presence or absence of rugae on the cameo surface of the denture base. Denture wearers may have
become accustomed to a particular palatal form, and may resist change. The practitioner should
listen to speech patterns, and determine whether appropriate “valving” is taking place. Placement of
rugae or a change in thickness may affect pronunciation.
18
VIVEK AND SINGH
Post dam :11 The posterior border of the maxillary denture should be examined. Like-wise, soft tissues
in the vicinity of the “vibrating line” should be observed. The seal of the existing maxillary denture
should be evaluated clinically. Often, deficiencies in retention of the maxillary denture may be traced
to improper post damming. The post dam should be rated “acceptable” or “unacceptable.”
Comfort: The patient should be questioned regarding then comfort of maxillary and mandibular dentures.
Comfort for the respective arches should be classified as “acceptable” or unacceptable.” Patients
who experience discomfort should be questioned to determine the nature and source of the discomfort.
Hygiene: The patient’s ability and motivation to clean the dentures should be assessed during the clinical
evaluation. The patient should also be questioned about his or her denture cleansing regimen. These
factors may affect denture-base contouring (e.g., closed interdental contours versus open interdental
contours) and tooth arrangement (e.g., presence or absence of diastema). Hygiene should be classified
as (1) good, (2) fair, or (3) poor.
Prognosis
A forecast as to the probable result of a disease or a course of therapy. Prognosis can be categorized into
good, fair, poor and bad. Anatomic and physiologic factors: The first step is a careful analysis of the
diagnostic findings, paying particular attention to specific components. With knowledge of these needs,
the second step involves developing a list of possible means of addressing them. The treatment should
be stated in a logical sequence and will include adjunctive care. Its detail and clarity will permit estimates
of operatory time and laboratory time, as well as associated fees. Failure to have such a plan makes
informed consent by the patient impossible. Proceeding without informed consent exposes the dentist
to problems ranging from loss of patients confidence to difficulty with fee collection or even to litigation.
Inadequate plans also make it difficult or impossible for staff to deliver smooth patient care.
Following are some of the most common diseases encountered in the practice of prosthodontic
treatment: In diabetes, the success of dentures goes hand in hand with medical control. The operator
should use a non pressure impression for maximum physiologic compatibility of the denture base with
the supporting tissues. Careful occlusal corrections should be accomplished to remove all interferences.
The food table should be small, and the patient should be given detailed instructions on eating habits
and oral hygiene. Periodical adjustment of dentures is necessary. In arthritis, the problems for the
prosthodontist are as follows: the limited opening of the mandible during impressions may necessitate
special trays and procedures. It may be difficult to record proper jaw relation registrations, and the
technique may have to be changed. Probably the tactile method is the most satisfactory. Occlusal
correction must be made often because of arthritic changes in the temporomandibular joint.
Treatment planning
Treatment planning thus means developing a course of action that encompasses the ramifications and
sequelae of treatment to serve the patient’s needs.
REFERENCE
1.
KOPER, A. The initial interview with complete denture patients: Its structure and strategy. J Prosthet Dent
23:590-597, 1970.
2.
HOUSE, M. M. Relationship of oral examination to dental diagnosis. J Prosthet Dent 8:208-219, l958.
19
3.
BASEHEART, J. R. Non-verbal communication in the dentist-patient relationship. J Prosthet Dent 34:4-10,
1975.
4.
BARONE, J. V. Diagnosis and prognosis in complete denture prosthesis. J Prosthet Dent 14:207-213, 1964.
5.
KOPER, A. Why dentures fail. DCNA 8:721-734, 1964.
6.
BOLENDER, C. L., SWOOPE, C. C. & SMITH, D. E. The Cornell Medical Index as a prognostic aid for complete
denture patients. J Prosthet Dent 22:20-29, 1969.
7.
B ERGMAN B. & CARLSON, G. E. Clinical long-term study of complete denture wearers. J Prosthet
Dent 53:56-61, 1985.
8.
LANDA, L.S. Diagnosis and Management of Partially Edentulous Cases with a Minimal number of Remaining
Teeth. DCNA - Vol. 29, No. 1, Jan 1985.
9.
BERNARD LEVIN. Impression for complete dentures. Quintessence Publications. Co.1984.
10.
GEORGE A. ZARB, CHARLES L. BOLENDER. Prosthodontic treatment for edentulous patients. Elsevier
publications. Co, Twelfth edition.
11.
Atwood D A: Reduction of residual alveolar ridges: A major oral disease entity. J Prosthet Dent 1971; 26:
266-279.
20
PROFILE OF PATIENTS WITH DIABETIC KETOACIDOSIS AT A

TERTIARY REFERRAL UNIT OF NORTH INDIA
GAUTAM K DEEPAK*, PRAKASH VED**, RAI MADHUKAR***AND SINGH K SURYA****
Declaration
Bi-monthly International Journal of all Research: We, Gautam K Deepak, Prakash Ved, Rai Madhukar and Singh K Surya the authors
of the research paper entitled PROFILE OF PATIENTS WITH DIABETIC KETOACIDOSIS AT A TERTIARY REFERRAL UNIT OF
NORTH INDIA declare that , We take the responsibility of the content and material of our paper as We ourself have written it and also
have read the manuscript of our paper carefully. Also, We hereby give our consent to publish our paper in Anvikshiki journal , This research
paper is our original work and no part of it or it’s similar version is published or has been sent for publication anywhere else.We authorise
the Editorial Board of the Journal to modify and edit the manuscript. We also give our consent to the Editor of Anvikshiki Journal to own
the copyright of our research paper.
Abstract
Objective: To study the clinical profile of patients with diabetic ketoacidosis in order to identify the most common
precipitating factors, clinical findings and improve its management to lessen the mortality. Material & methods: Predefined
parameters were compiled retrospectively through medical records of patients admitted with diabetic ketoacidosis at a
tertiary referral centre of north India over last four years. The causes that precipitated ketotic state, clinical and biochemical
findings, amount of insulin requirement, mean duration of hospital stay and outcome were compiled for forty three patients.
Results: There were thirty three patients with type-1 diabetes, four with type-2 diabetes and six with atypical diabetes. The
mean age of patients with type-1 diabetes was 21.22 ± 7.65 yrs, with type-2 diabetes was 41.09 3.32 yrs and with atypical
diabetes 18.77 ± 4.02 yrs. The mean of random blood glucose at admission was 512.8 ± 162.5 mg/dl for type-1, 599.1 ±
93.6 mg/dl for type-2 and 242 ± 113.6 mg/dl for atypical. The mean of total insulin requirement per day during hospitalization
before ketones became undetectable was 53.4 ± 18.3 IU for type-1, 50.6 ± 28.3 IU in type-2 and 50.9 ± 32.3 IU in atypical.
The mean pH on arterial blood gas analysis was 7.02 ± 0.06 for type-1, 7.35 ± 0.04 for type-2 and 7.33 ± 0.07 for atypical.
The mean of bicarbonate levels were 8.02 ± 5.31 for type-1, 18.43 ± 0.77 for type-2 and 19.31 ± 0.68 for atypical. Mean
duration of hospital stay was 10.66 ± 5.45 days for type-1, 5.98 ± 4.46 days for type-2 and 7.88 ± 2.01 days for atypical
diabetes. Thirty eight patients were discharged on improvement; four patients expired of which three were with type-1 and
one with type-2. One patient with type-1 diabetes left against medical advice. Dehydration and acidotic breathe were the
most common clinical findings. Hypokalemia was the most common electrolyte abnormality. Mortality in this study is
9.3%. Conclusions: Systemic infections were the most common precipitating factor. Poor hydration followed by acidotic
breathe was the most frequently encountered clinical abnormality. Outcome was good with intensive monitoring but poor
outcome could not be related to any of the clinical or biochemical parameter.
Keywords: ketoacidosis, atypical diabetes, insulin, hypokalemia, precipitating factors
*Department of Medicine [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
**Department of Endocrinology & Metabolism [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
***Department of Medicine [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
****Department of Endocrinology & Metabolism [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
21
PROFILE OF PATIENTS WITH DIABETIC KETOACIDOSIS AT A TERTIARY REFERRAL UNIT OF NORTH INDIA
Introduction
Diabetic ketoacidosis (DKA) is a potentially life threatening complication seen in patients with diabetes
mellitus frequently with type-1 but is not uncommon with other types. It is a medical emergency and
was first described in 1886. Until 1922, before the advent of insulin, it was invariably fatal. The clinical
profile of DKA has been quite variable depending upon its awareness amongst population and existing
health care facilities. Profile of DKA in our population has hardly been studied more than a couple of
times. So we compiled this data of forty three patients retrospectively through past medical record over
last four years to study the common precipitating factors, clinical and biochemical findings and their
typical course during hospital stay with outcome of treatment.
Material & Methods

Forty three patients (32 male, 11 female) presenting with DKA to a tertiary referral centre in last four
years were studied. Their findings were jotted down in predefined format under desired queries as
elaborated in the results. These data were entered in excel sheet to prepare a master chart. Mean of
desired variables were then derived.
Observations & Results

There were thirty three (22 male, 11 female) patients with type-1 diabetes, four with type-2 diabetes (all
male) and six (all male) with atypical or ketosis-prone diabetes (KPD) who did not qualify ADA
classification to either category of type-1 or 2 diabetes. The mean age for patients with type-1 diabetes
was 21.22 ± 7.65 yrs, with type-2 diabetes was 41.09 ± 3.32 yrs and 18.77 ± 4.02 yrs with atypical
diabetes.
Prior awareness of suffering with diabetes was found in thirty seven patients. Regarding the attributing
precipitating factor for ketoacidosis – it was localised infections like abscess or cellulitis in seven
patients, stoppage of insulin injections in nine patients, acute gastroenteritis in four patients and systemic
infections in thirteen patients. The precipitating factor for DKA could not be attributed to any identified
cause in ten patients - all six with KPD and four with type-1 diabetes. There was no history of alcohol
intake in any patient.
Hypokalemia was present in nine patients with type-1, in two patients with type-2 and in two with
KPD. Hyperkalemia was not detected in any. Hypernatremia was present in three patients, all with
type-1. Hyponatremia was not found in any.
The mean of random blood glucose at admission was 512.8 ± 162.5 mg/dl for patients with type-1,
599.1 ± 93.6 mg/dl for type-2 and 242 ± 113.6 mg/dl for atypical. The mean of total insulin requirement
per day during hospitalization before ketones became undetectable was 53.4 ± 18.3 IU for patients with
type-1, 50.6 ± 28.3 IU for type-2 and 50.9 ± 32.3 IU for KPD.
The mean of pH on arterial blood gas analysis was 7.02 ± 0.06 for patients with type-1, 7.35 ± 0.04
for type-2 and 7.33 ± 0.07 for KPD. The mean of bicarbonate levels were 8.02 ± 5.31 for type-1, 18.43
± 0.77 for type-2 and 19.31 ± 0.68 for KPD.
Mean duration of hospital stay was 10.66 ± 5.45 days for patients with type-1, 5.98 ± 4.46 days for
type-2 and 7.88 ± 2.01 days for patients with atypical diabetes. Thirty seven patients were discharged
on improvement, four patients expired - three with type-1 and one with of type-2. One patient with
type-1 diabetes left against medical advice.
22
DEEPAK,VED, MADHUKAR AND SURYA
T A B L E 1 Clinical findings
Clinical findings/complications seen Type-1(n=33) Type-2(n=4) Atypical (n=6)
Hypotension 13 0 0
Acidotic breathe 25 1 6
Dehydration 33 4 6
Neuropathy 16 4 0
Retinopathy 8 2 0
Nephropathy 4 0 0
Diabetic foot 4 0 0
Discussion
Diabetic ketoacidosis and hyperglycemic hyperosmolar states are acute complications of diabetes. DKA
was formerly considered a hallmark of type-1 diabetes, but it also occurs in individuals who lack
immunologic features of type-1 diabetes and who can sometimes subsequently be treated with oral
hypoglycaemic agents. Clinical features of DKA are nausea, vomiting, increased thirst, abdominal pain
and shortness of breath. Most common examination findings are tachycardia, tachypnea, dehydration,
hypotension, altered sensorium or coma. Decreased arterial pH, hyponatremia and normokalemia or
hyperkalemia are the usual findings along with presence of ketone bodies in the urine. But in this study,
hypokalemia was one of the most common electrolyte abnormalities and hypernatremia was seen in
three patients in place of hyponatremia and this is in contrast to what is described in the texts or in
studies done earlier by Edo AE, 2012.1 This could be attributed to inappropriate fluid therapy that our
patients might have received before being referred to our centre. The cause of hypokalemia can be
attributed to use of insulin as has been earlier found by Arora S et al, 20122 where they found hypokalemia
in 5.6% of their study subjects. These findings support the ADA recommendation to obtain serum
potassium before initiating intravenous insulin therapy in a patient with DKA.
Dehydration was the most common clinical finding in our study followed by acidotic breath which
has classically been described in texts to be identifying feature of ketoacidosis. But the degree of
dehydration in our patients was neither found to be correlating to any of the electrolyte abnormalities
nor with the outcome of treatment. Similar results were obtained by Sottosanti M et al, 2012.3
Infections, both systemic e.g. malaria or septicaemia, as well as localized such as abscess or cellulitis
were found to be the most common precipitating factor in our study as well as in earlier studies by
Barski L et al, 2012.4 This is due to the fact that infections are insulin resistant states and result in
increased demand of insulin for metabolic needs, so creating a transient state of relative insulin deficiency
leading to hyperglycemia and hyperosmolality.
Obligatory need of insulin during ketoacidosis in type-2 and ketosis-prone diabetes and then later
shifting to oral agents is due to the fact that high blood glucose levels bring about near total shut down
of endogenous insulin secretion. Once the blood sugar levels are brought down by exogenous insulin
administration, thereafter body’s own secretion takes up its hand.
Requirement of insulin was much higher till ketones were positive in all the three types as it is well
known that ketosis is an insulin resistant state. Mortality of 9.3% in our study is slightly higher than
those in western countries or intensive care units that roughly range from 3-6% as has been studied by
Barski L et al, 20124 and Ganesh R et al, 2009.5 In various studies, low mortality correlated to
administration of insulin at a slower and precise rate and admission in intensive care units. In other
words, the only factors that were found to make a difference in mortality were use of infusion pumps
and better monitoring during hospital stay.
23
PROFILE OF PATIENTS WITH DIABETIC KETOACIDOSIS AT A TERTIARY REFERRAL UNIT OF NORTH INDIA
Conclusions
Most of the patients with type-1 diabetes presented with ketoacidosis at the time of first diagnosis. Irrespective of type of
diabetes, infections remained the most common precipitating factor for DKA. Patients with KPD required insulin only till
the ketones were positive and could be successfully shifted to oral hypoglycemic agents later. Poor hydration was the most
frequently encountered clinical abnormality followed by acidotic breathe. The outcome of monitoring and treatment was
good. Poor outcome as in few expired patients was unrelated to any of the clinical or biochemical parameter.
REFERENCES
1.
EDO AE. Clinical profile and outcomes of adult patients with hyperglycemic emergencies managed at a
tertiary care hospital in Nigeria. Niger Med J. 2012 Jul; 53(3):121-5.
2.
ARORA S, CHENG D, WYLER B, MENCHINE M. Prevalence of hypokalemia in ED patients with diabetic
ketoacidosis. Am J Emerg Med. 2012 Mar; 30(3):481-4.
3.
SOTTOSANTI M, MORRISON GC, SINGH RN, SHARMA AP, FRASER DD, ALAWI K, SEABROOK JA, KORNECKI A.
Dehydration in children with diabetic ketoacidosis: a prospective study. Arch Dis Child. 2012 Feb; 97(2):
96-100.
4.
BARSKI L, NEVZOROV R, RABAEV E, JOTKOWITZ A, HARMAN-BOEHM I, ZEKTSER M, ZELLER L, SHLEYFER E,
ALMOG Y. Diabetic ketoacidosis: clinical characteristics, precipitating factors and outcomes of care. Isr Med
Assoc J. 2012 May; 14(5):299-303.
5.
GANESH R, ARVINDKUMAR R, VASANTHI T. Clinical profile and outcome of diabetic ketoacidosis in children.
Natl Med J India. 2009 Jan-Feb; 22(1):18-9.
24
OCCUPATIONAL HEALTH HAZARDS IN DENTAL PRACTICE- A

BRIEF REVIEW
DR. ANKITA SINGH* AND DR. RAJULVIVEK**
Declaration
Bi-monthly International Journal of all Research: We, Ankita Singh and Rajul Vivek the authors of the research paper entitled
OCCUPATIONAL HEALTH HAZARDS IN DENTAL PRACTICE- A BRIEF REVIEW declare that , We take the responsibility of the
content and material of our paper as We ourself have written it and also have read the manuscript of our paper carefully. Also, We hereby
give our consent to publish our paper in Anvikshiki journal , This research paper is our original work and no part of it or it’s similar version
is published or has been sent for publication anywhere else.We authorise the Editorial Board of the Journal to modify and edit the
Abstract
Dental professionals are susceptible to a number of occupational hazards. Occupational hazard refers to a risk or danger
as a consequence of the nature or working conditions of a particular job. Type of occupational exposure that dentists may
get exposed to may include Infectious hazards, Psycho-social hazards, Allergic reactions, Physical hazards, Mercury
health hazard, Ionizing radiation, Non-ionizing radiation, Anesthetic gases in the dental office. Continuous educating
and appropriate intervention studies are needed to reduce the complication of these hazards
Basically, for any infection control strategies, dentists should be aware of individual protective measures and appropriate
sterilization or other high-level disinfection utilities. Concerning prevention, the global literature focuses strictly on
control of infections and appropriate management of potentially infected materials, owing to the high profile of dentistry
regarding infection transmission. The current review aims at discussing occupational health problems in dental practice
as “the importance of avoiding accidents withinfected material cannot be overemphasized!”
Keywords : Occupational hazard, infection control, occupational health problems
Introduction
Dentists are exposed to a number of occupational hazards during their professional life. These cause
various ailments that are specific to the profession, which develop and intensify with years. In many
cases they result in diseases and disease complexes, some of which are regarded as occupational illnesses.
Prevention of these hazardous conditions in the workplace is of utmost importance in the practiceof
occupational health as a profession. Occupational health and dental waste management should be
*Service Senior Resident, Unit of Prosthodontics, Faculty of Dental Sciences [Institute of Medical Sciences] Banaras Hindu University Varanasi
(U.P.) India. e-Mail : [email protected]
**(Corresponding Author) Service Senior Resident, Unit of Prosthodontics, Faculty of Dental Sciences [Institute of Medical Sciences] Banaras
Hindu University Varanasi (U.P.) India. e-Mail : [email protected]
25
OCCUPATIONAL HEALTH HAZARDS IN DENTAL PRACTICE- A BRIEF REVIEW
considered an integral part of the broader delivery of public health services.Potential dangers to
increasingly hostile oral environment are a risk to the dental team and increased public and professiona
awareness is mandatory for protection.
The hazards can be:
Psychological hazards : stress is the most common psychological condition that occurs in the dental profession.
Physical hazards : musculoskeletal problems that have a direct relation to practising dentistry such as postural practices
that may increase the risk of twisting and contorting the body.
Infectious hazards : needles and other sharp objects, spatter and aerosols can be sources of viral infections. Bacterial
infections are also a potential risk. The major areas of concern are syphilis and tuberculosis.
Allergic reactions : latex gloves and few dental materials are responsible for most of the allergic skin reactions.
Mercury health hazard : it is known that high exposure to mercury vapour can cause biological and neurological damage.
Anaesthetic gases in the dental office : this is a specific hazard for those who use nitrous oxide gas regularly over an
extended period of time.
Ionizing radiation : the use of X-ray machines in the dental office exposes dentists to ionizing radiation.
Non-ionizing radiation : this has recently become a concern since the introductionof composites and other resins, in
addition to the introduction of lasers in dentistry, which has added another potential hazard to eye and other tissues.
This article reviews various occupational health hazards faced by dental professional in their practice that may predispose
the dentist to risk of ailments that tend to intensify with age.
Psycho-social Hazard
The psychological aspects of dentist-patient co-operation are very important. In everyday clinical practice
a dentist has to adapt an individual attitude towards a patient, depending on his/her mental state &
personality. A stress situation is produced if the patient is not satisfied with the treatment rendered by
the dentist. The knowledge of psychology and good communication skills are the most important factors
that help in establishment of a proper relation between dentist and the patient thus deciding the outcome
of the treatment.
Many clinical situations produce stress to a dentist1-5 and these include, among others, procedures
connected with anaesthetization of patients, overcoming of pain and fear, unanticipated emergency
situations in which a patient’s life is in danger, or procedures with hesitant prognosis. According to a
study 5, administration of anesthesia to patient is seldom discussed and it forms a major source of stress
in this profession. Unskillful planning of a treatment may be source of disappointment and pain associated
with failure both to a doctor and a patient. In many dentists an inseparable presence of stress situations
may elicit painful thoughts, emotions or fears. It may also contribute to the development of such
instantaneous reactions as increased tension, high blood pressure, fatigue, sleeplessness, touchiness
and depression.6The following factors, such as the necessity to keep aproper professional standard,
aspiration to achievetechnical perfection, causing pain or fear in patients, thenecessity to cope with
cancelled visits or late arrivals bypatients, having to cope with different levels of cooperation with
patients, were recognized as very important sourcesof stress in everyday dental practice.
Allergic Reaction
Dentist’s protective equipment definitely includes gloves and mask. Dentists have been routinely using
Latexgloves for more than two decades as a part of their good infection control strategies. Potential
health hazard to some dental staff and patients have been reported due to the residual or integral chemical
components pose.Allergy to latex gloves is the most frequently reported cause of dermatitis in dental
personnel in various studies around the world 7,8 , 9-11 A study in America found a 15% prevalence of
adverse reactions to latex gloves in a major dental facility 11
26
SINGH AND VIVEK
The clinical symptoms of latex allergies include: urticaria, conjunctivitis accompanied by lacrimation
and swelling of eyelids, mucous rhinitis, bronchial asthma and anaphylactic shock.12,13Corn-starch or
the so called absorbable dusting powder also plays an important role in latex allergies, manifesting
itself in the reaction on the part of airways.is allergenic and takes part in immediate allergic reactions.
Starch particles combined with latex protein allergens become airborne, and consequently they are
inhaled, or absorbed by our skin. 7, 14, 15The intensity of aerosol effect grows with the increased use of
rubber gloves.12
Dermatitis may also result from exposure to various chemicals and dental materials, such as methyl
methacrylate and cyanoacrylate, both of which have been reviewed elsewhere.16,17 Respiratory
hypersensitivity represents another occupational health issue for dentists. The cause include MMA,
latex, and chloramine-T(sodium-N-chlorine-p-toluene sulphonamide)11. Trace toxic metals such as
beryllium, may also be generated from dental materials which contain alloys of beryllium. 8
Biological Hazards
Dentists constitute a group of professionals who are likely to become exposed to biological health
hazards. These hazards are constituted by infectious agents of human origin and include prions, viruses,
bacteria and fungi. A dentist can become infected either directly or indirectly. In the first case,
microorganisms can pass into organism, through a cut on the skin of his/her hand while performing a
medical examination, as a result of an accidental bite by the patient during a dental procedure, or
through a needle wound during an anaesthetic procedure. An indirect infection occurs when an infectious
agent is transmitted into organism through the so-called carrier. The following are the main sources of
indirect infection: aerosols of saliva, gingival fluid, natural organic dust particles (dental caries tissue)
mixed with air and water, and breaking free from dental instruments and devices.The following are the
main entry points of infection for adentist: epidermis of hands, oral epithelium, nasal epithelium,
epithelium of upper airways, epithelium of bronchial tubes, epithelium of alveoli, and conjunctival
epithelium.
In dental procedures such as processing of tooth tissues (carietic defects, denture abutments), filling
procedures,removal of dental concrement, dentists use tools with a slow-speed, turbine, or ultrasound
burs which spray around the bacterial flora included in the oral cavity.18,19Dental procedures causes
major changes in the microbiological environment of a dentist’s surgery. Legnaniet al.20 made an
assessment of the aerosol contamination resulting from dental procedures. Air contamination was
measured by means of the Surface Air System method and the “plate” method (Air Microbial Index). It
was proved that during working hours the average air bacterial load increased over three times, and the
air load levels were 1.5 times (aerobic bacteria) and 2 times (anaerobes) greater as compared to the
initial load.
A patient attending the surgery for treatment can be source of harmful micro-organisms for dental
personnel and various studies have shown that the risk of hepatitis B infection is very high among the
dental profession 21 and some dentists have been infection with HIV virus. 22 The pathogenic micro-
organisms present in saliva, blood, gingival exudate and tooth debris from the mouth of a patient can be
disseminated by:
• Direct contact with the dentist’s fingers and instruments.
• Aerosols
• Droplet splatter
• Impressions
27
Aerosols can arise from coughs and sneezes, brushes and ultrasonic equipments as demonstrated by
Miller et al 23.Appropriate clinical procedures to prevent cross-infection is of utmost requirement as
many types of micro-organisms can be transmitted to the dental personnel and their attendant diseases
from the patient’s mouth.
The spread of infection in prosthetics may occur via contaminated impressions and prostheses. Large
number of micro-organisms have been isolated from impression materials contaminated impressions
and prostheses. Large number of microorganisms has been isolated from impression materials
contaminated with saliva from healthy patients.24
Mercury health hazard

There are many potentially toxic materials that are used in dentistry that may pose a health hazard in the
absence of appropriate precautionary measures. Most of the dental materials undergo an extensive
range of tests both before and after use. Even so, some dental materials are aerosolized during high
speed cutting and finishing and may thereby be inhaled by dental staff. Other dental materials are
volatile and may give rise to dermatological and respiratory effects .The dangers of chronic exposure to
mercury are well documented. On the contrary, it is now recognized that the health hazards of amalgam
restorations is negligible, with the exception of rare allergic reactions. The greatest exposure to mercury
from dentists comes from handling amalgam and amalgam capsules for restorations and storage and
disposal of amalgam also represent important sources of exposure 25. While concerns regarding its
systemic toxicity have reduced with decreasing urinary mercury levels detected in dentists over the
recent years, continuing attention to mercury hygiene, particularly proper amalgam storage, handling
and disposal, is essential 26. New filling materials have been developed to help reduce the dependence
on mercury based substances, such as composite resins, although these may be less durable and clinically
effective than mercury amalgam.
Anaesthetic gases in the dental office

Among the best known of these is the risk of waste anesthetic gases, such as nitrous oxide, have been
measured in the dental clinic during dental procedures. 27Concerns have also been raised that high
levels of ambient gases may impair performance and the well- being of those exposed.28
The national institute for occupational safety and health (NIOSH) in 1994 issued a warning that
even with preventive measures such as scavenging systems in place where workers may be at risk for
serious health effects due to their exposure. 29Several human studies have shown that occupational
exposure to N2O, may cause reduced fertility, spontaneous abortions, and neurologic, renal, and liver
disease as well as documented decrease in mental performance, audiovisual ability, and mental dexterity
in susceptible individuals.29, 30
Physical hazards
Dental personnel are exposed to both ionizing and nonionizing type of radiations. Ionizing radiation is
a well-established risk factor for cancer. However, despite the fact that most dental offices and clinics
have x-ray machines that are in frequent use, the exposure of dental workers to ionizing radiation and
the associated potential cancer risk have been assessed in only a few studies. Dental staff should stand
behind protective barriers and also use radiation monitoring badges to protect themselves.31Non-ionizing
28
SINGH AND VIVEK
radiation has become an important concern with the use of blue light and ultra-violet light to cure
various dental materials. Exposure to the radiations emitted by these can cause damage to the various
structures of the eye including the retina and the cornea. 26 Use of safety glasses and appropriate shields
can minimize or eliminate the radiations in this regard.32
Noise Generated by Dental Equipments

Dental personnel are exposed to noise of different sound levels while working in dental clinics or
laboratories. Dental laboratory machine, dental handpiece, ultrasonic scalers, amalgamators, high speed
evacuation devices and other items produce sound at different levels which is appreciable. As reported
in an earlier study conducted among dentists and dental auxiliaries, 16.6% of subjects reported of
tinnitus, 30% had difficult in speech discrimination and 30.8% had speech discrimination in a background
noise. 33 The noise levels of modern dental equipment is below 85 db and up to this point the risk of
hearing loss is negligible.34,35 But the risk is amplified while using older or faulty equipment. To avoid
any danger ear protection should ne worn during these procedures and hearing tests at least once a year
are recommended. 36,37
Ergonomics
Musculo-Skeletal Disorders
Dental professionals often develop musculoskeletal problems, which are related to suboptimal work-
environment ergonomics that might be responsible for improper sitting postures and movements causing
unnecessary musculoskeletal loading, discomfort, and fatigue. Insufficient or inappropriate equipment,
inappropriate work-area design, direct injuries, repetitive movements from working with dental
instruments, or sitting for extended times with a flexed and twisted back are contributing factors to
neck and low-back ailments.38,39-41 Various structures can be affected— muscles, ligaments, tendons,
nerves, joints, and supporting structures (intervertebral discs). A number of disorders are included
under this category: upper and lower back pain, herniated disc, neck pain with or without cervical root
problems, carpal tunnel syndrome, tendinopathies, shoulder pain, rotator cuff tendinopathies, and
repetitive strain injuries. A Finnish study reports musculoskeletal symptoms from the back and neck of
30% of the dentists. In an American study, 57% of 960 dentists in a Dental Society reported occasional
back pain. 42The overstress produces a negative effect on the musculoskeletal system and the peripheral
nervous system; above all, it affects the peripheral nerves of the upper limbs and the neck nerve
roots.43, 44
The dental chair position and the dentist’s stool position and orientation relative to that of the patient,
combined with the doctor’s effort to maintain visibility of the oral environment, result in awkward
positions over long periods of time; these in turn result in back problems. The symptoms include low
back pain, stiffness, and sciatica with neurological features such as tingling, paresthesia, and muscle
weakness
Neck problems are associated with a similar etiology, especially awkward body and head posture,
which are often required for direct vision into the mouth. The introduction of magnifying loupes is
probably the only development over the years that helps dentists keep a more neutral or balanced
posture.45
Carpal tunnel syndrome (CTS) is the most common nerve entrapment syndrome. It involves
entrapment of the median nerve at the level of the wrist. In the work environment, CTS results from
29
rapid, repetitive, and daily use of the hand and fingers for many hours at a time. The problem is
compounded when working with a bent wrist, exerting force, working with vibratory tools, and in cold
environments. Rapid movement of tendons in the synovial tube causes inflammation and fluid buildup.
This can result in atrophy of the thenar muscles; tingling in the thumb, index, middle, and half of the
ring finger; night pain; and pain when handling tools.46
Conclusion
Occupational health hazards are a potential riskin dentistry.
Reckless practice can have devastating health effects on both dentists and patients. Adequate awareness about most of
these hazards exists yet needs to be promoted among dentists. The well-being of dentists should be protected by reducing
the effect of occupational hazards through the implementation of various health measures.
REFERENCES
1.
CHARPIN D, VERVOLET D: Epidemiology of immediate-type allergic reactions to latex. Clin Rev Allergy
1993, 11, 385-390.
2.
CORAH NL, O’SHEA RM, BISSELL GD. The dentist - patient relationship: mutual perceptions and behaviours.
J Am Dent Assoc 1986; 113: 253-5.
3.
GALE EN, CARLSSON SG, ERIKSSON A, JONTELL M. Effects of dentist’s behavior on patient’s attitudes. J Am
Dent Assoc 1984; 109: 444-6.
4.
O’SHEA R, CORAH N, Ayer W: Sources of dentists’ stress. J Am Dent Assoc 1984; 109: 48-51.
5.
SIMON JF, PELTIER B, CHAMBERS D, DOWER J. Dentists troubled by the administration of anesthetic injections:
long-term stresses and effects. Quintessence Int 1994; 25: 641-6.
6.
GORTZAK RA, STEGEMAN A, TEN BRINKE R, PETERS G, ABRAHAM INPIJN L. Ambulant 24-hour blood pressure
and rate of dentists. Am J Dent 1995; 8: 242-4.
7.
CHOWANADISAI S, lEGGAT PA, KUKIATTRAKOON B, YAPONG B, KEDJARUNE U (2000) Occupational health
problems of dentists in southernThialand. Int Dent J 50, 36-40
8.
MESSITE J 1984, ch. 1. Occupational safety and health in the dental workplace. In: Occupational Hazards in
Dentistry, Goldman HS, Hartman KS and Messite J (Eds.), 1-19, Year Book Medical Publishers, Chicago.
9.
KATELARIS CH, WIDMER RP, LAZARUS RM 1996 Prevalence of latex allergy in a dental school. Med J Aust
164, 711-4.
10.
WALSH LJ, LANGE P, SAVAGE NW 1995 Factors influencing the wearing of protective gloves in general
dental practice. Quintessence int 26, 203-9
11.
RANKIN KV, JONES DL, REES TD 1993 Latex glove reactions found in a dental school. J Am Dent Assoc
124, 67-71
12.
TARLO SM, SUSSMAN G, CONTALA A, SWANSON MC: Control of airborne latex by use of powder-free gloves.
J Allergy Clin Immunol1994, 93, 985-989.
13.
TURJANAMAA K, ALENIUS H, MÄKINEN-KILJUNEN S, REUNALA T, PALOSUO T: Natural rubber latex allergy.
Allergy 1996, 51, 593-602.
14.
CORAH NL, O’SHEA RM, BISSELL GD. The dentist - patient relationship: perceptions by patients of dentist
behavior in relation to satisfaction and anxiety. J Am Dent Assoc 1985; 111 : 443-6.
15.
SEGGEV JS, MAWHINNEY TP, YUNGINGER JW, RAUM SR: Anaphylaxis due to cornstarch surgical glove
powder. Ann Allergy 1990, 65, 152-155
16.
CHOWANADISAI S, LEGGAT PA, KUKIATTRAKOON B, YAPONG B, KEDJARUNE U (2001) Occupational health
problems of dentists in southernThialand. Int Dent J 51, 11-6
17.
PIIRILA P, HODGON U, ESTLANDER T, KESKINEN H, SAALO A, VOUTILAINEN R, KANERVA L 2002, Occupational
respiratory hypersensitivity in dental personnel. Int Arch Occup Environ Health 75, 209-16
18.
BENTLEY CD, BURKHART NW, CRAWFORD JJ: Evaluating spatter and aerosol contamination during dental
procedures. J Am Dent Assoc1994,125, 579-584.
30
SINGH AND VIVEK
19.
NIMMO A, WERLEY MS, MARTIN JS, TANSY MF: Particulate inhalation during the removal of amalgam
restorations. J Prosthet Dent 1990, 63, 228-233.
20.
LEGNANI P, CHECCHI L, PELLICCIONI GA, D’ACHILLE C: Atmospheric contamination during dental procedures.
Quintessence Int1994, 25, 435-439.
21.
LEMASNEY JF. HEPATITIS B, The dentist and the role of Vaccination. J Irish dent Ass. 1998;34:60
22.
RAY A “maternal mortality in a subdivisional hospital of eastern Himalyan region”. J Indian Med Assoc.
1992;90:124.
23.
SMITH AM. Emergency obstetric hysterectomy.J ObstetGynaecol. 1981;2:245.
24.
GHANI F, HOBKIRK JA & WILSON M. Evaluation of a new antiseptic containing alginate impression material.
Br Dent J. 1990; 169:83
25.
MARTIN MD, NALEWAY C, CHOU HN, 1995 Factors contributing to mercury exposure in dentists. J Am
Dent Assoc 126, 1502-11
26.
YENGOPAL V, NAIDOO S, CHIKTE UM, 2001, Infection control among dentists in private practice in Durban.
S Afr Dent J 56, 580-4
27.
BORGANELLI GN, PRIMOSCH RE, HENRY RJ 1993, Operatory Ventilation and scavenger evacuation rate
influence on ambient nitrous oxide levels. J Dent Res 72, 1275-8
28.
MESSITE J 1984 Ch. 1. Occupational safety and health in the dental workplace. In: Occupational hazards in
dentistry, Goldman HS, Hartman KS and Messite J (Eds.), 1-19. Year Book Medical Publishers, Chicago.
29.
Nitrous Oxide Continues to Threaten Health Care Workers [monograh on the internet]; 2008 [cited 2008
March 11]. Available from: www. cdc.gov/niosh/updates/94-118.html
30.
SAMARANAYAKE LP, ANIL S, SCULLY C. Occupational Hazards in Dentistry: Part 1. FDI 2001; 8-12
31.
SMITH NJ 1987, Risk Assessment: the philosophy underlying radiation protection. Int Dent J 37, 43-51
32.
BERRY EA, PITTS DG, FRANCISCO PR, VONDERLEHR WN 1986, An evaluation of lenses designed to block
light emitted by lightcuring units. J Am Dent Assoc 112, 70-2
33.
CABALLERO AJ, PALENCIA IP, CARDENAS SD. Ergonomic factors that cause the presence of pain muscle in
students of dentistry. MedOralPatol Oral Cir Bucal 2010; 15 : e906-11.
34.
BAHANNAN S, EL-HAMID AA, BAHNASSY A. Noise level of dental handpieces and laboratory engines. J
Prosthet Dent 1993; 70: 356-60.
35.
SETCOS JC, MAHYUDDIN J. Noise levels encountered in dental clinical and laboratory practice. Int J
Prosthodont 1998; 11: 150-7.
36.
Council on dental materials and Devices. Noise control in the dental operatory. J Am Dent Ass.
1974;89:1384
37.
COLES RRA & HOLARE NW. Noise induced hearing loss and the dentist. Br Dent J. 1985;159:209
38.
HAMANN C, WERNER RA, FRANZBLAU A, RODGERS PA, SIEW C, GRUNINGER S. Prevalence of carpal tunnel
syndrome and medianmononeuropathy among dentists. J Am Dent Assoc 2001;132: 163-70.
39.
MILLER DJ, SHUGARS DA, The health of the dental professional. J Am Dent Assoc 1987;114:515-8.
40.
LEHTO TU, HELENIUS HY, ALARANTA HT. Musculoskeletal symptoms of dentists assessed by a multidis-
ciplinary approach. Community Dent Oral Epidemiol 1991;19:38-44.
41.
RUCKER LM, SUNELL S. Ergonomic risk factors associated with clinical dentistry. J Calif Dent Assoc
2002;30:139-48
42.
MOEN BE, BJORVATN K. Musculoskeletal symptoms among dentists in a dental school. Occup Med 1996;
46: 65-6.
43.
RUNDCRANTZ BL, JOHNSSON B, MORITZ U. Cervical pain and discomfort among in dentist. Epidemiological,
clinical and therapeutic aspects.Part 1.A survey of pain and discomfort.Swed Dent J 1990; 14: 71-80.
44.
RUNDCRANTZ BL, JOHNSSON B, MORITZ U. Pain and discomfort in the musculoskeletal system among dentists:
a prospective study. Swed Dent J 1991; 15: 219-28.
45.
OLESKE DM, NEELAKANTAN J, ANDERSSON GB, HINRICHS BG, LAVENDER SA, MORRISSEY MJ, et al. Factors
affecting recovery from work-related, low back disorders in autoworkers. Arch Phys Med Rehabil 2004;85:
1362-4.
46.
FISH DR, MORRIS-ALLEN DM. Muscoloskeletal disorders in dentists. N Y State Dent J 1998;64:44-8.
31
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 10 Jan 2013
STUDY OF URINARY INFECTION IN COMMUNITY BASED INDIAN

ELDERLY
DR DHIRAJ KISHORE*, PROF. INDARJEET SINGH GAMBHIR**,DR AMITA DIWAKER***,

DR VISHAL KHURANA****, DR RAVI KANT***** AND PROF SAMPA ANUPURBA******
Declaration
Bi-monthly International Journal of all Research: We, Dhiraj Kishore, Indarjeet Singh Gambhir, Amita Diwaker, Vishal Khurana,
Ravi Kant and Sampa Anupurba the authors of the research paper entitled STUDY OF URINARY INFECTION IN COMMUNITY
BASED INDIAN ELDERLY declare that , We take the responsibility of the content and material of our paper as We ourself have written
it and also have read the manuscript of our paper carefully. Also, We hereby give our consent to publish our paper in Anvikshiki journal , This
research paper is our original work and no part of it or it’s similar version is published or has been sent for publication anywhere else.We
authorise the Editorial Board of the Journal to modify and edit the manuscript. We also give our consent to the Editor of Anvikshiki
Journal to own the copyright of our research paper.
Abstract
Background : Prevalence of urinary tract infection in Indian elderly aged 60 years or more living in community or
institutions is important for effective management policies.
Aims: Present prospective observational cohort study done to know epidemiological profile for urinary tract infection
among rural, urban and institutionalized elderly persons.
Material and Method : The present prospective cohart study has been done on institutionalized, urban and rural
communities to identify the urinary tract symptoms, bactiuria and pyuria among elderly more than 60 years. A total of
450 subjects, 150 from respective categories constituted the sample. Exclusion was done for moderate to severe dementia,
severely ill, aphasic, and comatose unable to communicate and catheterised patients.
Statistical analysis : Data analysis was done comparative percentage, chi square test and ‘Z’ test.
Result : Mean age of the subjects was 67±6.55 and 67±6.05 amongst males and females respectively. Overall male to
female ratio was 1.16:1. There was no statistical difference between age and sex ratio in overall study population as
well as in each group. The prevalence of bacteriuria was 20.66% among institutionalized elderly, 12% among urban
and 7.3% among rural elderly people. pyuria was associated with high negative predictive value (95%) for the absence
of bacteriuria.
Conclusions : Urinary tract infection is quite common and under diagnosed problem in elderly in India. There was
significant relation between bacteriuria and place of residence, increasing age but not with sex. Pyuria had highly
significant negative predictive value for bacteriuria
*Assistant Professor [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
**Professor and head-department of general medicine [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
***Senior Resident, Department of Obs & Gyn [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
****Senior resident, Department of general medicine [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
*****Asstt Prof Medicine [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
******Professor, Dept of Microbiology [Institute of Medical Sciences] Banaras Hindu University, Varanasi (U.P.) India.
32
KISHORE, GAMBHIR, DIWAKER, KHURANA, KANT AND ANUPURBA
Introduction
In elderly, Urinary tract infection is a major problem causing a significant amount of mortality worldwide.
Over 7 million elderly population visits hospitals for this problem in United States annually, with more
than 1 million hospital admissions each year1. The prevalence of bacteriuria in women at 70 years of
age is 5-10% and increases to approximately 20% at 80 years of age2. In contrast, approximately 1-3%
of men between the ages of 60 and 65 years have bacteriuria. But the incidence increases to more than
10% for men greater than 80 years of age.3 Overall, the incidence of bacteriuria exceeds 20% in the
institutionalized, non-ambulatory population for both genders4,5. The mortality rate is approximately
10-30% for UTI associated with bacteremia.6 Urosepsis accounts for 56% of sepsis in elderly with a
mortality rate up to 25%7 . If other risk factors are controlled, advanced age does not increase mortality
rate. Elderly population in India is already more than 7% of total population and by 2025, it is predicted
to be more than 11% of the same. Unfortunately customarily in our society, urinary tract infection is not
considered as a disease per se, but a part of the aging process and hence remains under-reported. Many
such study are published from west but none from India which is having marked ethnic and socio
cultural difference from west.
Material and Method

The present prospective cohort study has been done on institutionalized, urban and rural communities
to identify the urinary tract symptoms, bacteriuria and pyuria among elderly more than 60 years. A total
of 450 subjects, 150 from respective categories constituted the sample.
Subjects were recruited from institutionalized, urban and rural communities in Varanasi district of
India. Participants were aged 60 years or older and had no history of dementia. Those who were severely
ill, catheterized, having condom connection, aphasic, comatose, moderate or severe dementia, or unable
to communicate were excluded.
Every possible care was taken to prevent contamination by commensal flora. Mid stream urine
sample was used for analysis. The samples were transported to lab for microscopy, culture and sensitivity
within half to one hour or kept on ice pack before transportation.
The number of leucocytes/ml was measured in uncentrifuged, unstained urine using haemocytometer.
The leucocytes were counted in the squares present at the four corners of the counting chamber, total
count was calculated.
Culture and sensitivity was done by “semi quantitative calibrated loop method”. The urine was
mixed thoroughly before plating on cysteine lactose electrolyte deficient media (CLED). After incubating
overnight at 35-37° C in air; colonies were counted on each plate. The number of colony forming units
(CFU) was multiplied by hundred, as 0.01ml loop was used, to determine the micro organism /ml in
original specimen of urine.
Criteria of culture positivity were:8,9 102 CFU coliforms/ml or 105 CFU non coliforms/ml in
symptomatic women or 103 CFU /ml in symptomatic male or 105 CFU /ml in asymptomatic individuals
on two consecutive cultures or Any pure culture of staphylococcus aureus
Data analysis : Elderly persons were interviewed, examined and data collected were analyzed with
help of Statistical Package for Social Science (SPSS) software version 10 for windows. Quantitative
variables are presented as the means ± standard deviation, and the qualitative variables are presented
as proportions. Chi-square test was used for comparison of proportions. The difference was considered
significant when p value was less than 0.05.
33
STUDY OF URINARY INFECTION IN COMMUNITY BASED INDIAN ELDERLY
Results
Elderly People of more than 60 years were studied in community to identify the urinary tract infection.
450 people irrespective of symptoms were evaluated for UTI on a preformed Clinical Performa. Age
and sex distribution of study population and it’s group is given in table-1. Male to female ratio was
1.16:1, when all the three groups were taken together males constituted 53.77% (242/450) while females
were 46.22% (208/450). Maximum number of cases belonged to age group of 65-75years 50.66%
(228/450) followed by 36.66% (165/450) in the age group between 60-65 years while elderly population
of more than 75 years were least in number , 12.66% (57/450). Although there was a trend towards
male preponderance in all the three groups, it was statistically insignificant (P >0.05).
Culture positivity was 13.3% (60/450) in whole study group. Institutionalised elderly had maximum
culture positivity 20.6%.When comparison was made between bacteriuria in three groups, there was a
significant difference noted between Institutionalized Vs Urban elderly (χ 2 =8.28, p <0.05),
Institutionalized Vs rural. (χ2=12.26 p <0.05) and Urban Vs rural (χ2=8.32, p<0.05) and hence bacteriuria
had significant co-relation with the place of residence (Table-2)
Significant Pyuria (table-3), i.e. pus cells more than 10/cu.mm were present in 19.1% (86/450)
subjects in the overall population. In the community wise distribution of significant pyuria,
institutionalized elderly had the maximum 28.6% (43/150) followed by urban 16.5% (25/150) and
rural population 12% (18/150). There was a significant difference between pyuria amongst
institutionalized and urban people (χ2=6.16, p <0.05), institutionalized and rural (χ2=16.13, p < 0.05),
but there was no statistical difference noted between urban and rural population (χ2=1.32, p>0.05)
(Table-3).
In the institutionalized elderly who had significant pyuria the probability of having culture positivity
was found to be 77% with the specificity of 84% , positive predictive value of 44.1% and negative
predictive value of 93.45%. Amongst the urban population the sensitivity was 72% specificity was
90.9%, positive predictive value only 48% while negative predictive value was 96%. In the rural
population these figures were sensitivity 40.9%, specificity 93% , positive predictive value 50% and
negative predictive value of 94.4%. When the whole study population with significant pyuria was
considered together the probability of culture positivity was found to have of sensitivity 78% ,with
specificity 89.8% ,positive predictive value 53.5% (C.I. 95%, 0.52,3.28) and negative predictive value
of 96% (C.I.95% 1.17,2.84)-table 4.
In all the study group there was significant correlation between bacteriuria and increasing age (p<0.05).
In Institutionalized and rural groups there was clearly an increasing pattern in the bacteriuria with the
increasing age, however there was slight difference in the urban population. Institutionalized elderly of
both sexes and rural elderly females had statistically significant co-relation between advancing age and
bacteriuria (p <0.05). Culture positivity was almost 45% (4/9) and 50% (5/10) in males and females in
institutionalized elderly of more than 75 years while in rural community females more than 75 years
had 42.9% (3/7) culture positivity. Though there was an increasing trend in rest of the groups it was not
statistically significant. When rural and urban community were taken together the prevalence of
bacteriuria was found to be 10.4% (10/72) in females in 60-65 years, in more than 75 years this community
had 37% (6/16) bacteriuria. When the whole population with bacteriuria was considered it was noted
that there was females preponderance of bacteriuria, in females the prevalence of bacteriuria was 56.6%
(34/60) while in males it was 43.3% (26/60). Statistically there was no difference in bacteriuria among
males and females in institutionalized (χ2 = 0.00 Df= 1 p>0.05), urban (χ2 = 0.24 Df= 2 p>0.05) or rural
34
elderly (χ2 = 0.99 Df= 1 p>0.05), or when all the three groups were combined together (χ2 = 1.1 Df= 1
p>0.05).so there was no significant sex predilection for bacteriuria in our study (Table-5).
Pyuria was present in 39(43.34%) male and 47(54.65%) female, ratio was 1:1.2. When the whole
study population was considered for the co-relation between advancing age and significant pyuria it
was found to be significant (χ2 = 14.08, Df= 2, p<0.05) , however the relationship remained insignificant
regarding the sex (χ2 = 2.63, Df= 2, p >0.05 ) There was a tendency to get significant pyuria in higher
proportion as the age advanced , it was found to statistically significant in case of Institutionalized
males (χ2 = 8.5 Df= 2 p<0.05) but not in females (p value >0.05) but in overall Institutionalized
population it was significant (χ2 =9.778 Df=2 p value< 0.05). There was no statistically significant
difference between males and females (χ2 = 0.27, Df=1, p>0.05) regarding significant pyuria. In the
urban population advancing age was not associated with significant pyuria either in males (χ2 = 0.27,
Df= 1, p>0.05) or in females (χ2 = 1.34, Df= 2, p>0.05) or in overall population (χ2=2.64, Df=2, p value
>0.05).Amongst the rural population there was good co-relation between advancing age and significant
pyuria, especially in case of females (χ2 = 9.5, Df= 2, p<0.01), the relationship was also significant
amongst males (χ2 = 7.15, Df= 2, p<0.05) as well as in the overall population (χ2 = 15.85, Df= 2,
p<0.05). There was no difference noted amongst males and females.
In the urban population 13.9% males had significant pyuria. Whereas 25% of more than 75 years
males had significant pyuria. Only 8.8% people had positive culture, and, it was highest in more than
75 years males. Females in urban population had significant pyuria in 19.7% subjects and 15.5% were
culture positive. The relationship between pyuria and culture positivity did not reach statistical
significance in both males and females (p >0.05) in urban elderly. In the rural population significant
pyuria was present in 8.4% and 16.4% in males and females respectively. Culture positivity was seen
in4.8% and 10.4% in the corresponding groups. Maximum culture positivity was seen in females more
than 75 years (42.9%). There was no statistical significant co-relation in the culture positivity with
pyuria in relation to advancing age (p >0.05) in any of the groups.
Both significant pyuria and culture positivity was maximum in elderly males more than 75 years.
(table5).Significant pyuria in different age group was present in 20%, 21.9%, 66.6% in institutionalized
males and overall it was 26.3% while the corresponding culture positivity was 6.6%, 21.95% and 25%,
in institutionalised female population the prevalence of significant pyuria was 21.9%, 35.7% and 50%
in the age group of 60-65, 65-75 and >75 years respectively overall significant pyuria was present in
31.45%. Positive culture was found in 12.5%, 25% and 40% in corresponding age group of females.
There was a tendency to have culture positivity in higher proportion as the age advanced it was almost
40% in >75yrs. of age and only 11% in elderly people <65yrs. The difference was statistically significant
(P<0.05). In the institutionalised age group 80 male subjects 21(26.3%) were having significant pyuria,
15 (18.7%) were having positive culture. In the urban population 13.9% males had significant pyuria.
Whereas among males of 75 years age group, more than 25% had significant pyuria. Only 8.8% people
had positive culture, and, it was highest in more than 75 years males. Females in urban population had
significant pyuria in 19.7% subjects and 15.5% were culture positive. The relationship between pyuria
and culture positivity did not reach statistical significance in both males and females (p >0.05) in urban
elderly. In the rural population significant pyuria was present in 8.4% and 16.4% in males and females
respectively. Culture could be obtained from 4.8% and 10.4% in the corresponding groups. Maximum
culture positivity was seen in females more than 75 years (42.9%). There was no statistical significant
co-relation in the culture positivity with pyuria in relation to advancing age (p >0.05) in any of the
groups (table5).
35
Discussion
Elderly population is increasing fast worldwide. In our country there were about 70 million elderly
people (≥60 years) 2001 census. The sex wise distribution of more than 60 years Indian population
reveals that males between the age group of 60-64, 65-69 years and more than 70 years are 2.9%, 2%
and 3.3%, the female population in these groups is 3%, 2% and 2.8%. The mean age of males in our
study group was 67±6.55 and the mean age of females was 67±6.05 years. Male (M) to female (F) ratio
was 1.16:1 (Table 1). This is at variance with the western world where females out number males.9
This may be due to lower life expectancy of Indian women due to various socio-economic factors and
poor health attention in the community.
In a community based study showed that at least 20% of women and 10% of men above 65 years of
age have bacteriuria,9 in our study the prevalence of bacteriuria in community in more than 65 years
females was 14% while in males it was 6.8%. In the institutionalized males more than 65 years the
prevalence of bacteriuria was 26% and amongst females it was 31.6%. A study4 showed that the overall
prevalence of bacteriuria in institutionalized, non ambulatory elderly exceeds 20%, in our study the
prevalence was found to be 20.66% in 60 years and above which very well co-relates with the above
study. Nicolle et al4,5 showed that in males there was 6-13% prevalence of bacteriuria amongst those
living in their homes, it was 17-26% amongst residential homes and 30-33% in hospitalized elderly.
The prevalence was still higher in those residing in long stay hospital wards 6 it was almost 34%.
Whereas in females prevalence was 17-33% living in their homes, 30-34% in hospitalized females and
34-50% amongst those living in long stay hospital wards6. In our study in the institutionalised elderly
patients also the prevalence of bacteriuria was 35%.
As compared to the rural elderly there was significantly higher degree of bacteriuria in the urban and
institutionalized elderly population. The institutionalized ambulatory elderly showed a significantly
higher bacteriuria as compared to urban elderly even. Our study confirms that in Indian elderly also, the
place of residence plays a significant role in the degree of prevalence of bacteriuria.
In our study there was significant correlation of bacteriuria and pyuria with increasing age.
Brocklehurst10 and Sourander LB11 showed that the prevalence of bacteriuria among the elderly rises
substantially with increasing age .Similar result observed in the community based study that bacteriuria
increases with age, in females the prevalence of bacteriuria at age 70 years is 5-10%, it increases to
approximately 20% at age 80 years.12 In the present study the prevalence of bacteriuria in females was
10.4% at age 60-65 years and was 37% in more than 75 years old female in community. Similarly the
prevalence of bacteriuria amongst males varies between 1-3% at age 60-65 years and reaches 10% in
more than 80 years,13 the corresponding values in our study were 6.7% in 60-65 years and 9% in more
than 75 years in community. The prevalence of bacteriuria in more than 75 years females in our study
exceeds the prevalence of bacteriuria from the literature. The reason may be poor health consciousness
in our setup and underestimation of symptoms of urinary tract infection, many of which are taken as a
normal phenomenon of ageing. The age related increase in the prevalence of bacteriuria was found to
be significant in case of the institutionalized elderly of both sex and rural females. Culture positivity
almost reached 45% and 50% respectively in males and females of more than 75 years amongst
institutionalized population while it was 6.6 and 12.5% in males and females in 60-65 years. This trend
was maintained in case of rural females wherein the culture positivity reached 42.9%. Though the
relationship was not significant in other groups, there was a rise in culture positivity as the age advanced
in rest of the groups as well. Elderly females had higher bacteriuria as compared to males. In the total
culture positive subjects 56.6% were accounted by females and 43.3% by males. The greater
36
preponderance of bacteriuria in elderly females as compared to males in our study is in line with the
world literature. Though with age the sex difference in the bacteriuria (adult F:M 30:1) diminishes but
it still persists. In the urban population the cohort of 60-65 years is almost similar to the corresponding
cohort of institutionalized population. This group has higher co-morbidities as compared to rural elderly
and that may have predisposed this group for greater degree of bacteriuria.
Culture positivity was found to be 72% in institutionalized and urban elderly having significant
pyuria. It was 61% in rural population with significant pyuria. Only 3.8% elderly had culture positive in
the absence of significant pyuria. There was a significant co-relation between advancing age and pyuria
in case of institutionalized males and rural elderly of both sex. Though it was statistically insignificant
there was a rising trend in other groups as well. Significant pyuria was observed in 86 people (19.1%).
Advancing age had significant impact on pyuria (p <0.05) in the overall population. There is a wide
variation in the world literature about culture positivity with significant pyuria ranging from 36-79% of
elderly patients with bacteriuria.4,13,14
Baldassarre et al12 1991 showed that the presence of pyuria to be a poor predictor for the presence of
bacteriuria but absence of pyuria to be a very good predictor for the absence of bacteriuria. Sourandor
et al11 and Baldassarre et al12 found that out of 133 women with pyuria, 60.9% did not have bacteriuria
and out of 184 women without pyuria only 4.3% had bacteriuria. Nicolle et al2,4,13 observed that absence
of significant pyuria among institutionalized elderly females had an 80% negative predictive value for
the absence of bacteriuria. Our observations fall within the range in literature. The poor positive predictive
value and strong negative predictive value in relation to culture positive cases is in conformity with the
literature. Pyuria can be found in various other infective (viruses, fungi, fastidious, Mycobacterium
tuberculosis) and non infective causes like systemic inflammatory disease, malignant hypertension,
polycystic kidney disease, NSAIDS and non specific urethritis. The positive predictive value was low
because of multifactorial aetiology of pyuria.
Conclusion
Urinary tract infection is an extremely common problem with increased morbidity and mortality. Though there are many
landmark studies from abroad, they are lacking from India. The present study has been undertaken to know the prevalence
and profile of urinary tract infection in community. Total 450 subjects, 150 from institutions, urban and rural communities
were included in the study. The mean age of the subjects was 67±6.55 and 67±6.05 amongst males and females respectively.
Overall male to female ratio was 1.16:1. There was no statistical difference between age and sex ratio in overall population
as well as in each group. Maximum number of elderly in study groups were in the age range of 65-75 years (228, 50.6%).In
this study13.3% of elderly were bacteriuric. The prevalence of bacteriuria was 12% among urban, 7.3% among rural
elderly people and 20.66% among institutionalized elderly. The significant pyuria was present in 19.1% of total elderly of
which instutionalized elderly were maximum 50% followed by urban 29% and rural 21% respectively. There was significant
co relation between bacteriuria, pyuria and place of residence and advancing age in our study. Bacteriuria was significantly
more common in institutionalized elderly as compared to urban and rural community based elderly with increasing age but
not with sex.
REFERENCES
1.
PATTON JP, NASH DB, ABRUTYN E. Urinary Tract Infection: Economic considerations. Med Clin North Am
1991;75:495-513.
2.
NICKEL JC, PIDUTTI R. A rational approach to urinary tract infections in older patients. Geriatrics 1992;47:
49-55.
3.
NORDENSTAM G, SUNDH V, LINCOLN K, et al. Bacteriuria in representative samples of persons aged 72-79
years. Am J Epidemiol 1989;130:1176-86.
37
4.
NICOLLE LE. Urinary tract infection in the elderly. J Antimicrob Chemother 1994;33:99-109.
5.
NICOLLE L E. Symptomatic Urinary Tract Infection in Nursing Home Residents. J Am Geriatr Soc
2009;57:1113-4.
6.
MUDER RR, BRENNEN CR, WAGENER MM, et al. Bacteriuria in a long-term care facility: A five-year
prospective study of 173 consecutive episodes. Clin Infect Dis 1992;14:647-54.
7.
Kunin C. Urinary Tract Infections: Detection, Prevention, and Management, 5th edition, Baltimore, MD:
Williams & Wilkins, 1997, pp. 150-4.
8.
STAMM WE, COUNTS GW, RUNNING KR, FIHN S, TURCK M, HOLMES KK. Diagnosis of coliform infection in
acutely dysuric women. N Engl J Med 1982;307:463-8.
9.
SOBEL JD. Pathogenesis of urinary tract infection: role of host defenses. Infect Dis Clin North Am
1997;11:531-49.
10.
BROCKLEHURST JC, DILLANE JB, GRIFFITH L, FRY J. The prevalence and symptomatology of urinary infection
in and aged population. Gerontol Clin 1968;10:242-53.
11.
SOURANDER LB. Urinary tract infection in the aged – an epidemiological study. Ann Med Intern Fenn
Suppl 1966;45:7-55.
12.
BALDASSARRE JS, KAYE D. Special problems of urinary tract infection in the elderly. Med Clin North Am
1991;75:375-90.
13.
NICOLLE LE, HENDERSON E, BJORNSON J, MCINTYRE M, HARDING GK, MACDONELL JA. The association of
bacteriuria with resident characteristics and survival in elderly institutionalized men. Ann Intern Med
1987;106:682-6.
14.
MANISHA JUTHANI-MEHTA, VINCENT QUAGLIARELLO, ELEANOR PERRELLI VIRGINIA TOWLE, PETER H. VAN
NESS, MARY TINETTI . Clinical Features to Identify Urinary Tract Infection in Nursing Home Residents: A
Cohort Study. J Am Geriatr Soc 2009;57:963-70.
T A B L E 1 Age and Sex distribution of the study population
Age INS URB Rural Total G.T.
M (%) F (%) M (%) F (%) M (%) F (%) M (%) F (%)
60-65 30 32 28 25 30 20 88 77 165
(18.18) (19.39) (16.96) (15.1) (18.18) (12.12) (53.33) (46.66)
>65-75 41 28 39 37 43 40 123 105 228
(17.98) (12.28) (17.10) (16.2) (18.85) (17.54) (53.94) (46.05)
> 75 9 10 12 9 10 7 31 26 57
(15.78) (17.54) (21.05) (15.8) (17.54) (12.28) (54.38) (45.61)
Total 80 70 79 71 83 67 242 208 450
(17.77) (15.55) (17.55) (15.7) (18.44) (14.88) (53.77) (46.22)
Mean 67.38 66.86 67.97 67.75 67.59 68.04 67.64 67.54 67.60
±SD ± 6.51 ±7.13 ± 6.86 ±6.59 ± 6.55 ±6.09 ±6.62 ±6.60 ±6.60
p value p>0.05 p>0.05 p>0.05 p>0.05
Note: Figures in the brackets represents percentage
T A B L E 2 Prevalence of bacteriuria in the study groups
Community Culture + Culture – Total
N (%) N (%) N
Institutionalized 31 (20.6) 119 (79.3) 150
Urban 18 (12) 132 (88) 150
Rural 11 (7.3) 139 (92.6) 150
Total 60 (13.3) 390 (86.6) 450
T A B L E 3 Prevalence of significant and insignificant pyuria
Community Pyuria Total
significant insignificant N
N (%) N (%)
38
Institutionalized 43 (28.6) 107(71.3) 150

Urban 25(16.6) 125(8.3) 150
Rural 18(12) 132(88) 150
Total 86(19.1) 364(80.88) 450
T A B L E 4 Co-relation between significant pyuria and bacteriuria
Community Distribution of the subjects Total
P+ C+ P- C+ P+ C- C+ P+
Inst. 24 7 19 31 43
Urban 13 5 12 18 25
Rural 9 2 9 11 18
Total 46 14 40 60 86
P+ = Significant pyuria (pus cells >10/cumm.) P- Insignificant pyuria
C+= positive culture C- Negative culture
T A B L E 5 Co-relation between degree of significant pyuria and bacteriuria with advancing age and sex in various
group.
Age (N) Pyuria Culture Z p
M F M F M F M/F M/F-P
Insitutionalized
60-65 30 32 6 7 2 4 1.1/1.01 >0.05

(20%) (21%) (6.6%) (12.5)
65-75 41 28 9 10 9 7 .27/.88 >0.05
(21.9%) (35.7%) (21.9%) (28%)
>75 9 10 6 5 4 5 2.13/.45 >0.05
(66.7%) (50%) (44.4%) (40%)
Total 80 70 21 22 15 16 .96/1.35 >0.05
(26.3%) (31.4%) (18.7%) (21.4%)
Urban
60-65 28 25 2 5 3 3 -/.78 -
(7.1%) (20%) (10.7%) (12%)
65-75 39 37 6 6 3 5 .91/.33 >0.05
(15.4%) (16.2%) (7.7%) (13.5%)
>75 12 9 3(25%) 3(33%) 1(8.3%) 3(33.3%) .50/.53 >0.05
Total 79 71 11 14 7 11 .99/.89 >0.05
(13.9%) (19.7%) (8.8%) (15.5%)
Rural elderly
60-65 30 20 1(3.3%) 2(10%) 1(3.3%) 1(5%) 0/.61 >0.05
65-75 43 40 3(7%) 5(12.5) 2(4.7%) 3(7.5%) .45/.75 >0.05
>75 10 7 3(30%) 4 1(10%) 3(42.9%) 1.16/.54 >0.05
(57.1%)
Total 83 67 7(8.4%) 11 4(4.8%) 7(10.4%) .95/1.02 >0.05
(16.4%)
39
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 2 Apr 2013
MODIFICATION OF SNUHIKSHARASUTRA AND AN ATTEMPT TO

ASSESS ITS EFFICACY IN THE MANAGEMENT OF FISTULA IN
ANO.
DR GAURAV SINGH RATHORE*
Declaration
The Declaration of the author for publication of Research Paper in The Indian Journal of Research Anvikshiki ISSN 0973-9777
Bi-monthly International Journal of all Research: I, Gaurav Singh Rathore the author of the research paper entitled MODIFICATION
OF SNUHIKSHARASUTRA AND AN ATTEMPT TO ASSESS ITS EFFICACY IN THE MANAGEMENT OF FISTULA IN ANO.
declare that , I take the responsibility of the content and material of my paper as I myself have written it and also have read the manuscript
of my paper carefully. Also, I hereby give my consent to publish my paper in Anvikshiki journal , This research paper is my original work
and no part of it or it’s similar version is published or has been sent for publication anywhere else. I authorise the Editorial Board of the
Journal to modify and edit the manuscript. I also give my consent to the Editor of Anvikshiki Journal to own the copyright of my research
paper.
Abstract
Anal fistulas are real night-mares for surgeons to deal with as they are very difficult to treat with high reoccurrence rates
as well as complications like anal incontinence. So, the exact solution is the Ksharasutra therapy, which is described in
ancient Ayurvedic texts and also under the phase of intense development and modernization in last 50 years. In this
process, there are many type of threads were prepared and used, getting clues from ancient writings and also on the basis
of close observations obtained from studies on the effect of herbs on the process of wound healing. Out of there, the
SnuhiKsharasutra is one of the best types in terms of best fistulous tract cutting rates but it causes a lot of pain and
discomfort to the patient. Considering this fact, some modifications have been done and then put this thread on clinical
trials. The results obtained are very encouraging.
Introduction
SnuhiKasharasutra is perhaps one of the types which was initially built and put on clinical trials. It
shows satisfactory outcomes especially in terms of unit Cutting Time. But it causes a lot of pain and
discomfort to the patients. In fact, a close review of previously done research works clearly suggests
that this type of thread is best one in terms of cutting time. Considering these fact, some sort of
modifications have been done in the classically prepared SnuhiKsharasutra and put on clinical trials.
*Lecturer, S.G.M.P.G. Ayurvedic Medical College & Hospital [Sehari] Gazipur (U.P.) India.
40
RATHORE
The classically prepared SnuhiKasharasutrahas been prepared by total 21 coatings on a 21 number

surgical linen thread. Out of these 21 coatings, first 11 ones are of Snuhi latex followed by 7 coatings of
ApamargaKahara and then 3 coatings of Haridra powder. But the thread used in this study has following
21 coatings:
⇒ The Guggulu resin extracted in ethyl alcohol- 3 times
⇒ Followed by The latex of Snuhi – 8 times
⇒ Followed by again The Guggulu resin extracted in ethyl alcohol- 3 times
⇒ Followed by ApamargaKshara- 4 times
⇒ Followed by Haridra powder- 3 times
In this attempt of modification, the Guggulu resin was selected considering its advantages like good
binding property as well as having anti-inflammatory and analgesic chemical composition. These
properties are well observed and established in other studies on other type of Ksharasutra containing it
and also in studies on wound healing. Further, the obtained results were recorded carefully and analysed
on the basis of various parameters. The obtained results have shown satisfactory results and clearly
suggests that the this attempt of modification have its own merits and demerits over the classically
prepared SnuhiKsharasutra.
Methodology
This present study was carried out on 20 patients having simple low anal type of fistulas. These patients
were divided into two groups having equal number of patients, i.e. 10 in each group. This division was
irrespective of age, sex, habitat and nature of work etc. However, the patients suffering from diseases
like hypertension, diabetes mellitus, tuberculosis, hepatitis and HIV were excluded from this study.
So the two groups were:
1. Group A- treated with tradition SnuhiKsharasutra.
2. Group B- treated with Modified SnuhiKsharasutra.
Criteria for assessment: In this study, three procedures were adopted for the assessment of
trialKsharasutras. These procedures were:
1. Clinical Features: Symptoms and signs and their characters were noted at subsequent intervals i.e. 1, 14, 28, 42, 56 and
70th day i.e. after every 14th day or on every alternate visit for changing of thread.
Criteria for assessing clinical features
Pain Scoring Discharge Scoring Oedema Scoring
No pain 0 No discharge 0 No swelling 0
Mild pain & 1 Serious discharge 1 Mild swelling < 2 cm 1
No analgesic < 2 ml
required
Moderate pain 2 Seropurulent 2 Moderate swelling with 2
discharge < 5 ml tenderness
Severe pain 3 Purulent discharge 3 Swelling with tenderness 3
Analgesic > 5 ml > 5 cm
required
2. Histopathological Study: Histopathology of fistulous wound at subsequent interval of 21 days was carried out to evaluate
the difference in the pattern of wound healing between both the two groups. To evaluate the effects of Ksharasutra on
the healing of the tract Punch biopsy was done in both groups after an interval of every 21 days till the end of the
treatment.
3. Unit Cutting Time: The length of the thread was measured at an interval of 7 days. After few weeks, when the placed
Ksharasutra comes out with its knot intact then this is cut-through stage and this is indicative of complete excision of
41
MODIFICATION OF SNUHIKSHARASUTRA AND AN ATTEMPT TO ASSESS ITS EFFICACY IN THE MANAGEMENT OF FISTULA IN
ANO.
fistulous tract. The total number of days required for cut through from initial threading was noted. It was calculated on
the basis of the length of the thread or Ksharasutra placed in fistulous tract.
The Unit Cutting Time is measured as the time taken by Ksharasutra to cut one cm of fistulous track in days by the
following formula:
Total number of days taken for cut through
Unit Cutting Time =
Initial length of track in cm
Observations
Effectiveness in terms of Pain : The efficacy of both types of Ksharasutra was assessed in terms of
reduction of pain felt by the patients during the treatment. The results obtained are as following:
Analysis of pain in the two groups.
Group Initial Follow up
I F1 F2 F3 F4
A 2.76±0.28 2.82±0.36 2.70±0.42 2.45±0.24 2.12±0.16
B 2.80±0.32 2.42±0.45 2.06±0.30 1.88±0.26 1.14±0.16
Pain – No-0, Mild No Analgesic-1, Moderate, Mild analgesic-2, Severe full dose of analgesic-3.
The results reveal a gradual decrease in pain in both the two groups on successive follow-ups. But the
degree of pain felt by the patients were more in Group A, which was the group of traditionally
prepared SnuhiKsharasutra. On the other hand, in Group B, which was treated by the modified
SnuhiKsharasutra the intensity of pain was very low in compare to the Group A patients.
Effectiveness in terms of Edema: The second clinical parameter was the edema observed in the patients
who underwent different treatment.
Analysis of edema in the two groups.
I F1 F2 F3 F4
A 2.94±0.26 2.88±0.38 2.68±0.42 2.04±0.48 1.08±0.32
B 2.98±0.26 2.70±o.46 1.98±0.54 1.56±o.36 0.64±0.44
No swelling-0, Mild swelling <2 cm-1, Moderate swelling + tend 2-5 cm - 2, Severe swelling + tend. > 5 cm
In this analysis, it was clearly observed that the Group B patients have shown better results in comparison
to the Group A. As in group B patients the level of edema comes down to a great extent. This is
perhaps due to the presence of Guggulu in the modified SnuhiKsharasutra.
Effectiveness in terms of Discharge: The effect of both types of Ksharsutra was assessed on the basis of
amount of discharge from the fistulous tract and this study revealed that:
Analysis of discharge the two two groups.
I F1 F2 F3 F4
A 2.88±0.28 3.12±0.40 2.68±0.58 1.54±0.32 0.52±0.26
B 2.82±0.36 2.74±o.52 2.38±0.48 1.86±0.36 0.98±0.28
Discharge – No-0, Serous 2-5 ml-1, Seropurulent>5 ml - 2, Purulent, offensive odour > 5 ml – 3
The data in this table presentsthe level of discharge of the patients initially at the beginning of the
treatment and at subsequently on four follow-ups, for both the groups.
The results reveal a gradual decrease in discharge both the two groups on successive follow-ups. But
the in Group A the level of discharge was increased in the mid phase of treatment which clearly
indicates that the traditionally prepared SnuhiKsharasutra have shown better debriding properties in
42
RATHORE
the mid-phase of treatment. This is perhaps due to the presence of good amount of Kshara in this
thread.
Histopathological Study
Histopathology of fistulous wound at subsequent interval of 21 days was carried out to evaluate the
effect of trial Ksharasutras on the pattern of wound healing in both the two groups. As the healing of
wound is also of very importance. So the histopathological assessment of the fistulous wound was
carried out to assess the nature and pattern of wound healing in both the two groups. To evaluate the
effects of Ksharasutra on the healing of the fistulous wound or fistulous tract, a Punch biopsy was taken
from all after an interval of every 21 days till the treatment ended.
Observation
In this assessment it was found that both of Ksharasutras had shown good wound healing and deriding
properties. But the group treated with Guggulu based SnuhiKsharasutra had shown relatively early
debridement of slough, unhealthy and necrosed tissue. In the mid-phase of treatment, this group again
showed better results in comparison to the other group as marked reduction of inflammatory cells,
neutrophils, polymorphs and micro abscesses was observed. The Group B also has shown the early
appearance of fibro collagenous tissues, early collagen laying and early marked vascular proliferation.
In this group the earlier presence of healthy granulation tissues also again indicates the better wound
healing properties. These healthy granulation tissues help in the early healing of the excised fistulous
wound.
In this way, this analysis clearly indicates towards the better wound healing properties of the Modified
SnuhiKsharasutra. Perhaps, this better result is due to the presence of Guggulu resin in the thread,
again.
The Average Unit Cutting Time (UCT)

The Unit Cutting Time (UCT) provides an accurate idea about the total time taken for the cutting of 1
cm of the fistulous tract by the applied Ksharasutra. The UCT was noted very carefully in all the 20
patients distributed in the two groups.
At the end, on the basis of collected UCT of every individual case, the Average Unit Cutting Time of
the whole single Group was calculated and the obtained findings are as following:
Average unit cutting in Days/cm in all the three groups.
Groups Average unit cutting in Days/cm
Group A 6.08
Group B 7.42
Conclussion
Anal fistula is one of the surviving challenges for the surgeons in general. Therefore, getting clues from ancient Ayurvedic
texts the Ksharasutra were prepared as a solution for this problematic disease. The SnuhiKsharasutra is perhaps the very
initial Ksharasutra, which was prepared and put on clinical trials to study the role of Ksharasutra in the management of
fistula in ano. In this present study, an attempt has been made to modify the SnuhiKsharasytra on the basis of previous
43
MODIFICATION OF SNUHIKSHARASUTRA AND AN ATTEMPT TO ASSESS ITS EFFICACY IN THE MANAGEMENT OF FISTULA IN
ANO.
experiences. The Guggulu resin was added as an ingredient for modification. As Guggulu have shown better binding
properties as well as anti-inflammatory and anti-analgesic properties in the previously carried out research works.
The obtained results clearly suggests that the Modified thread have many advantages as it reduces the intensity of pain
to a great extend along with also reduces edema in comparison to the first one to a great extent. This is perhaps due to the
presence of Guggulu in good amount as ingredient and also due to the presence of less amount of raw Kshara. But on the
other hand, the traditionally prepared SnuhiKsharasutra have its own benefits as, due to the presence of good amount of
Kshara it shows better debriding properties as the level of discharge increases a lot in the midphase of treatment which was
clear indicative of good debriding properties. Apart from this, this Ksharasutra has also shown better UCT in comparison
to the other one which means a faster cutting of the tract which results in less duration of treatment.
In this way, this study reveals that due to the presence of Guggulu resin the SnuhiKsharasutra causes less pain to a great
extend with other satisfactory outcomes.
REFERENCES
BHAVAMISHRA; BHAGANDARAADHIKARA (2000), bhavaprakasha II part, 7th Edition, Chowkhamba Sankrit Sansthan,
Varanasi, 50, Pg 500-506.
CHAKRAPANI DATTA; BHAGANDARAADHIKARA (1959), Chakradatta, 2nd Edition, SrilaxmiVenkateshwara steam
press, Bombay, Pg 206-208
GUPTA A K, PATHAK S N (1984), Studies on kshara sutra prapareed by Snuhiswarasa, Thesis for M.S (Shalyatantra),
Department of Shalysshalkya, Institute of Medical Sciences, BHU.
KUMAR P, SAHU M (1998), Study of Guggulu based kshara sutra in the management of Bhagandra, Thesis for
M.S (Shalyatantra), Department of Shalysshalkya, Institute of Medical Sciences, BHU.
RAVISHANKAR P G, PATHAK S N (1988), Effect of modified kshara sutra in the management of fistula in ano,
Thesis for M.S (Shalyatantra), Department of Shalysshalkya, Institute of Medical Sciences, BHU.
SHARMA K R, DESHPANDE P J (1968), Role of kshara sutra in the treatment of Bhagandara (fistula in ano), Thesis
for M.D (Shalyatantra), Department of ShalyaShalakya, Institute of Medical Sciences, BHU.
SHAH R K, PRASD G C (1994), Effect of Snuhiksheera extract (triterpenes) kshara sutra in fistula in ano, Thesis
for M.S (Shalyatantra), Department of Shalysshalkya, Institute of Medical Sciences, BHU.
SANJAY KUMAR SINGH, SAHU M (2002), Role of Guggulu based kshara sutra in the management of Recurrent
high anal fistula in ano, Thesis for M.S (Shalyatantra), Department of Shalysshalkya, Institute of Medical
Sciences, BHU.
Sushrut : Sushruta Samhita with Nlibandha Sangraha commentary of Dalhana, Chaukhambha Surbharati
Prakashan, Varanasi (1994).
Vagbhata- Astanga Sangraha with Indu, Commentary, Edited by Athasvale A.D., Pune (1980).
44
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 10 Apr 2013
ACCURACY IN PROXIMITY OF FOUR ARBITRARY HINGE AXIS

POINTS TO KINEMATIC HINGE AXIS POINT LOCATED BY
CUSTOMIZED HINGE AXIS LOCATOR
PAVAN KUMAR DUBEY*, J. R. PATEL**, RAJESH SETHURAMAN***, DR. T.P. CHATURVEDI**** AND
DR. ATUL BHATNAGAR*****
Declaration
Bi-monthly International Journal of all Research: We, Pavan Kumar Dubey, J. R. Patel, Rajesh Sethuraman, T.P. Chaturvedi and Atul
Bhatnagar the authors of the research paper entitled ACCURACY IN PROXIMITY OF FOUR ARBITRARY HINGE AXIS POINTS
TO KINEMATIC HINGE AXIS POINT LOCATED BY CUSTOMIZED HINGE AXIS LOCATOR declare that, We take the responsibility
of the content and material of our paper as We ourself have written it and also have read the manuscript of our paper carefully. Also, We
hereby give our consent to publish our paper in Anvikshiki journal , This research paper is our original work and no part of it or it’s similar
version is published or has been sent for publication anywhere else.We authorise the Editorial Board of the Journal to modify and edit
the manuscript. We also give our consent to the Editor of Anvikshiki Journal to own the copyright of our research paper.
Abstract
The need for accurate hinge axis location, record and subsequent transfer to a suitable articulator, assists in developing
static and dynamic relationship of teeth. The present study was designed with an aim to determine the proximity of four
arbitrary hinge reference points viz. Beyron’s , Bergstrom’s, Gysi’s And Hobo Point to kinematic hinge axis point located
through customized kinematic hinge axis locator. Forty dentulous subjects aged between 20-30 years were selected.
Employing customized hinge axis locator and conventional methodology, kinematic and arbitrary hinge axis points were
recorded. Linear distances of each of four arbitrary hinge points to kinematic hinge axis points were recorded, tabulated
and subjected to statistical analysis. The result showed, co-linearity in Beyron’s point and it being closest to true hinge
axis as compared to other three arbitrary reference points.
Key words: Hobo’s point, Beyron’s point, Bergstrom’s point, Gysi’s point, Acrylic grid, Co-linearity.
Introduction
A kinematic location of hinge axis reference point is believed to be mandatory to ensure that the
restorations meet the demand of close tolerances in cusp-pathways; and no single arbitrary hinge reference
point is suitable for general population. However, it has been mathematically demonstrated that location
*(Corresponding author) Service Senior Resident , Department Of Dentistry [Faculty Of Dental Sciences] Institute Of Medical Sciences, Banaras
Hindu University, Varanasi (U.P.) India.
**Professor and Head , Department of Prosthodontics, K.M. Shah Dental College and Hospital [Waghodia road, Piparia] Vadodara (Gujarat) India.
***Reader, Department of Prosthodontics, K.M. Shah Dental College and Hospital [Waghodia road, Piparia] Vadodara (Gujarat) India.
****Professor & Head, Department Of Dentistry [Faculty Of Dental Sciences] Institute Of Medical Sciences, Banaras Hindu University, Varanasi
(U.P.) India.
*****Reader, Department Of Dentistry [Faculty Of Dental Sciences] Institute Of Medical Sciences, Banaras Hindu University, Varanasi (U.P.) India.
45
ACCURACY IN PROXIMITY OF FOUR ARBITRARY HINGE AXIS POINTS TO KINEMATIC HINGE AXIS POINT LOCATED BY
of an arbitrary hinge axis point ± 5mm antero-posterior to the kinematic hinge axis point will result in
, negligible error 4,11. Many workers have significantly contributed to solve this enigma and have suggested
various arbitrary reference points for locating the hinge axis e.g. Beyron’s point, Bergstrom’s point and
Gysi’s point 1. The present study was designed to determine the proximity of aforementioned points
along with Hobo’s point 5, to kinematic hinge axis point located through customized kinematic hinge
locator (Table-1).
Review of literature
Much discussion, argument and controversy has been associated with hinge axis, its existence, co-
linearity and methods employed to locate it 1-9. The need for accurate hinge axis location, record and
subsequent transfer to a suitable articulator, assists in developing static and dynamic occlusal relationship
of teeth 10. The hinge axis may be located by using selected arbitrary reference points or by determining
the true centre of condyles i.e. kinematic hinge axis.
Method
Forty dentulous subjects (age 20 to 30 years), ethically cleared by institutional human ethical committee,
from randomly screened staff and students of K.M. Shah Dental College, Vadodara, India, participated
in the study after giving informed consent. The present study had following inclusion and exclusion
criteria: intact full complement natural dentition, with bilateral smooth synchronous well coordinated
mandibular movements, no masticatory muscle or temporomandibular joint tenderness or pain on
palpation, no pain on movement of mandible and no limitation in range of motion. Through markings
for kinematic points (black) on both sides of the face, the kinematic axis was recorded for each patient,
seated upright, using customized hinge axis locator (Fig 1, 2, 3) and employing a method described by
Lauritzen and Kesalvad et al 12. Prior to the location of the kinematic points, four arbitrary points on
each side of the face (Table I) were marked in different colors (Fig. 4) on the patients skin, employing
four different methods respectively (Table I). All kinematic and arbitrary points were confirmed by two
other faculty members from Department of Prosthodontics, K.M. Shah Dental College, Vadodara, India.
The kinematic and arbitrary hinge axis points were transferred on to the transparency sheet attached to
customized hinge axis locator through acrylic grid. (Fig. 5) After dis-assembling hinge axis locator,
transparency with acrylic grid was removed from the grid slot. With the help of a magnifying glass,
linear distances of each of the four arbitrary hinge axis points to kinematic hinge axis point on each side
of the face were measured, on the 0.5 mm grid. Data thus obtained, was tabulated and subjected to
statistical analysis.
Results
The mean values(Table –II) for the four arbitrary reference points on both sides suggest that Beyron’s
point lies closest to the kinematic point followed by Bergstrom’s point and Hobo’s point, farthest being
the Gysi’s point. Highest frequency distribution (Table III) also shows that Beyron’s point lies nearest
to the kinematic point followed by Bergstrom’s and Hobo’s arbitrary points.Gysi’s point, being farthest
in proximity, to the kinematic point.The values of t-test for each point on both sides suggest that Beyron’s
point has least significant values followed by Gysi’s point, Bergstrom’s point and Hobo’s point. This
suggests that the distance of Beyron’s point on both sides is quite coincident or collinear. Similar
46
DUBEY, PATEL, SETHURAMAN, CHATURVEDI AND BHATNAGAR
inference can be drawn for the Bergstrom’s point. However, Hobo’s point and Gysi’s point are non-
collinear.
Discussion
Hinge axis location for complete denture construction is important to shorten time required for the
patient’s chair-side and laboratory procedures, to facilitate correct teeth positioning, condylar registration
and to simulate condylar movements 3. It is desirable to place an arbitrary hinge axis as close as possible
to the kinematic hinge axis; however, the results obtained in the present study, indicate that none of the
arbitrary hinge axis location methods used, was accurate enough to locate the hinge axis. There was
also a wide range in approximate position of the axis in different individuals, which suggests the
unreliability of arbitrary guides for universal application. Out of 320 observations, 88.3% observations
were within the range of 5 mm to kinematically determined true hinge axis. Pertaining to each arbitrary
point, 100% of the Beyron’s point, 97.5% of Bergstrom’s point, 92.5% Hobo point and 67.5% of Gysi’s
point were within the range of 5 mm. Apart from being within the 5 mm range, Beyron’s point also
showed the closest relation to the true hinge axis followed by Gysi’s point, Bergstrom’s point and
Hobo’s point. Hence it may be suggested that Beyron’s point may be the best bet at being reliable
arbitrary posterior reference point to determine the arbitrary hinge axis.
It is difficult to state the specific cause for the variations in different published studies. These variations
when compared to the present study may be attributed to the various locations of the Tragus-Canthus
reference lines. Other causes for the discrepancies 4, might be sample size, techniques used for
measurements, hinge axis location, jaw manipulation and significant morphological variations 5.
Conclusion
Kinematic location of the true hinge axis is always appreciable .A minimal error of 5 mm can be expected with all the
arbitrary points evaluated in the study. If minimal error of 5 mm is allowed all points tested happen to be acceptable. In
terms of location of arbitrary posterior reference points the Beyron’s point is closest to the true hinge axis as compared to
the Bergstrom’s, Gysi’s and Hobo’s point and on the same time there is collinearity in Beyron’s point. Placement of points
on the Tragus-Canthus line at the superior border of the Tragus of the ear as is the case with Gysi’s point, as well as with FH
line in case of Hobo’s point, will contribute to greater inaccuracy in most of the patients
REFERENCES
1.
WINSTANLEY RB. The hinge axis: a review of the literature. J Oral Rehabil, 1985; 12:135-59.
2.
BROTMAN DN. Hinge axis –part I. The transverse hinge axis. J Prosthet Dent, 1960; 10:436-40.
3.
RAZEK MKA. Clinical evaluation of methods used in locating the mandibular hinge –axis. J Prosthet Dent,
1981; 46:369-73.
4.
WALKER PM. Discrepancies between arbitrary and true hinge axes. J Prosthet Dent, 1980; 43:279-85.
5.
SEIFERT D, JEROLIMOV V, CAREK V. Terminal hinge axis - Hobo point - Frankfurt horizontal relations. Coll
Antropol. 2000;24:479-84
6.
CAMPION GG. Some graphic records of movements of the mandible in the living subject and their bearing
on the mechanism of joint and construction of the articulator. Dental cosmos, 1905; 47:39.
7.
SCHALLHORN RG. A study of the arbitrary center and the kinematic centre of rotation for face –bow mountings.
J Prosthet Dent.1957; 7:162-69.
8.
WEINBERG LA. The transverse hinge axis: real or imaginary. J Prosthet Dent, 1959; 9:755-87.
9.
LA PERA F. Determination of the ‘hinge axis’. J Prosthet Dent, 1964; 14:651.
47
ACCURACY IN PROXIMITY OF FOUR ARBITRARY HINGE AXIS POINTS TO KINEMATIC HINGE AXIS POINT LOCATED BY
10.
GRANGER ER. Functional relations of the stomatognathic system. J Am Dent Assoc, 1954; 48:638.
11.
BERNHARDT O, KUPPERS N, ROSIN M, MEYER G. Comparative tests of arbitrary and kinematic transverse
horizontal axis recordings of mandibular movements. J Prosthet Dent, 2003; 89:175-9.
12.
KESHAVAD A, WINSTANLEY RB, Hooshmand T. Intercondylar width as a guide to setting up complete denture
teeth. J Oral Rehabil, 2001; 27:217-26.
T A B L E I Description of various arbitrary posterior reference points
Point Location Marking ink color
Bergstrom’s point 10 mm anterior to center of auditory meatus and 7 mm below Frankfort plane. Red
Beyron’s point 13 mm anterior to the posterior border of the tragus of the ear, on a line Green
between the mid-posterior margin of the tragus and the outer canthus of the eye.
Gysi’s point On a line from upper border of external auditory meatus to outer canthus of the Blue
eye, 13 mm ant of margin of meatus.
Hobo point 12mm anterior of mid-point of the posterior rim of the tragus of the ear, 5mm Orange
lower and perpendicular to the cantho- tragal line.
T A B L E II shows the mean and standard deviation for arbitrary hinge axis points in relation to the kinematic point on
each side of the face.
Bergstrom’s point (mean ± SD) Left 3.7±0.88
Right 3.26±1.06
Beyron’s point (mean ± SD) Left 2.41±1.01
Right 2.24±1.00
Gysi’s point (mean ± SD) Left 5.06±0.63
Right 4.71±0.95
Hobo point (mean ± SD) Left 4.31±0.67
Right 3.7±1.01
T A B L E III shows highest frequency distribution of each of the arbitrary points on either side of the face from
kinematic point, suggesting
Range (0.50-6.50) Frequency
Bergstrom’s point Beyron’s point Gysi’s point Hobo’s point
Left Right Left Right Left Right Left Right
0.5 - - 1 2 - - - -
1.0 - - 3 3 - - - -
1.5 - 1 11 9 - - - -
2.0 2 6 2 10 - 1 - 2
2.5 3 8 6 5 - 1 - 4
3.0 8 7 8 3 - - 3 9
3.5 7 6 7 4 - 2 3 7
4.0 12 6 1 3 6 10 14 7
4.5 2 1 - 1 5 3 10 7
5.0 5 2 1 - 13 12 6 1
5.5 1 3 - - 10 6 4 1
6.0 - - - - 6 4 - 1
6.5 - - - - - 1 - 1
T A B L E IV shows t-test for the difference in means between kinematic point and four arbitrary points for right and left
sides (for P<0.05).
Distance of Bergstrom’s point from THA Sides N Mean SD t Df Sig
Right 40 3.26 1.06 - 78 0.49
Left 40 3..27 0.88 2.003
Distance of Beyron’s point from THA Sides N Mean SD t Df Sig
Right 40 2.41 1.00 -.780 78 0.437
48
DUBEY, PATEL, SETHURAMAN, CHATURVEDI AND BHATNAGAR
Left 40 2.24 1.01

Distance of Gysi’s point from THA Sides N Mean SD t Df Sig
Right 40 4.71 0.95 - 78 0.055
Left 40 5.06 0.63 1.945
Distance of Hobo point from THA Sides N Mean SD t Df Sig
Right 40 3.7 2.01 - 78 0.002
Left 40 4.31 0.67 3.212
Fig 1 shows the markings made for four arbitrary Fig 2 shows the placement of hinge axis locator
posterior reference points device on the patient
Fig 3 shows the location of true hinge axis Fig 4 shows the transparent caliberated acrylic grids
recorded by the device for measuring the linear distances between 4
arbitrary posterior reference points
49
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 20 Apr. 2013
A SHORT REVIEW OF INCOME, INVESTMENT AND SAVING

PATTERN ON FARM HOLDINGS IN DISTRICT AZAMGARH, U.P.
MANOJ SINGH* AND DR. K.P. SINGH**
Declaration
Bi-monthly International Journal of all Research: We, Manoj Singh and K.P. Singh the authors of the research paper entitled A
SHORT REVIEW OF INCOME, INVESTMENT AND SAVING PATTERN ON FARM HOLDINGS IN DISTRICT AZAMGARH,
U.P. declare that , We take the responsibility of the content and material of our paper as We ourself have written it and also have read the
manuscript of our paper carefully. Also, We hereby give our consent to publish our paper in Anvikshiki journal , This research paper is our
original work and no part of it or it’s similar version is published or has been sent for publication anywhere else.We authorise the Editorial
Board of the Journal to modify and edit the manuscript. We also give our consent to the Editor of Anvikshiki Journal to own the
copyright of our research paper.
Abstract
When India achieved independence, it was very clear by the Government that a reduction in the concentration of income
was to be one of the main objectives of its economic policy. The common argument that runs through all the plans is that
for special as well as economic regions in national income alone is not enough; there must be a simultaneous process of
income more equitably. The income, saving and investment in agriculture has assumed great significance in view of the
Government’s new policy wherein it is clearly stated that investment in agriculture would receive the highest priority in
the economic development of the country side by side the farmers would be motivated to increase the efficiency of production
and make such adjustment in their investment pattern as to meet fully the consumer’s demand.
Introduction
The main variables of economic development have been regarded as income, saving and investment.
The increase in capital stock along with its efficiency directly influences the productive capacity of the
economy for increasing the total output or income. However, this growth in capital is in turn directly
dependent on the part of additional output which is not immediately consumed but is saved and is
available for investment or increase in capital. This important role of saving as a determinant of growth
in income and economic development found its recognition even with most of the classical economists
including Adam Smith, Recardo and John Stuart Mill. Even the Keynsian consumption function which
*Research Scholar, Department of Agricultural Economics and Statistics, Tilak Dhari Post Graduate College Jaunpur (U.P.) India
**Ex.- Reader & Head, Department of Agricultural Economics and Statistics, Tilak Dhari Post Graduate College Jaunpur (U.P.) India
50
& [email protected]. Read this paper on www.anvikshikijournal.com.
SINGH AND SINGH
brought a revolution in the theory of employment is intimately linked to what he called, ‘propensity to
save’.
In ‘An Enquiry into the Nature and causes of Wealth of Nation’ (1976), the famous classical economist
Adam Smith argued that national economic progress consists not in the accumulation of gold and silver
but in the increasing productivity of a country’s people brought about largely by the accumulation of
capital in the form of machinery and other productive equipments. Another important political economist
David Recardo says, “There are two ways in which capital may be accumulated, it may be saved either
in consequence of increased revenue or of diminished consumption”.
For the neo-classical economists, “saving is an excess of income over necessary expenditure”.
According to J.S.Mill, “saving enriches and spending impoverishes the community alongwith the
individual”. According to neo-classical economists, given to the level of technology, an increase in
population by lowering money wage rates, leads to an increase in employment and thereby more intensive
utilization of existing capital equipment raises marginal productivity of capital. The interest rate rise to
the extent of saving is responsive to the higher rate of interest. Thus the rate of interest and also the
level of income determine the level of saving. According to Alfred Marshall, “The power to save depends
on an excess of income over necessary expenditure and that a rise in the rate of interest offered for
capital, i.e. the demand of price saving tends to increase the volume of saving”.
Keyns considered investment as a key variable around which other variables move in tune with it. In
the Keynsian system saving by definition emerges to be equal to investment, but it is investment which
determines the volume of savings and not the other way about changes in investment bring about
corresponding changes in saving through movement in the level of income. Another economist Mrs.
John Robinson observed, that the level of income is determined by the rate of investment and the desire
to save. Given the desire to save, the level of income that will rule is governed by the rate of investment
and given the rate of investment, the level of income is determined by the desire to save. Thus income,
saving and investment constituted the three strategic determinants of economic development in the
classical, neo-classical and Keynesian system.
The most necessary condition of economic development is the increase in savings. This assumes all
the greater importance in the context of developing economies where basically low level of capital
stock not only lies at the root of their underdevelopment but also provides a basic solution to their
problem of development and growth. As Nurkse observes, that capital formation lies at the very central
problem of development in economically backward countries. In all the developing economies which
have chosen the path of planned economic development, the increase in income and saving, naturally
forms one of the most crucial element of the strategy of growth. Hence capital is the most vital input
required for achieving the much desired goal of growth both in micro and macro units of economy and
the agriculture sector is no exception.
Clearly, this new agriculture-oriented policy would perform structural change in farm economy
calling for a detailed analysis of the farm and non-farm sources of income, cost of production, net
income, consumption expenditure, net saving and the proportion of net saving for reinvestment in
agriculture. The area of balancing mechanism of income, consumption and saving constitutes the base
for stabilizing agriculture production and assuring stable prices and reasonable income to the farmers
for ultimate investment in farming.
In Indian economy, agriculture and industry are the main sections. Agriculture generates about 25
percent of the national income. The technological break-through in agriculture production took place in
the country during 1967-68. It brought a substantial change in income pattern of the farming community.
Intensive research efforts are being made to explore new methods and techniques that would further
51
A SHORT REVIEW OF INCOME, INVESTMENT AND SAVING PATTERN ON FARM HOLDINGS IN DISTRICT AZAMGARH, U.P.
raise agricultural production, increase in income and thus in saving. As a result the farmers are motivated
to save and invest in order to expand their volume of farm business and further raise their income. The
progressiveness of agriculture will, however, depend upon what the farmers do with the additional
income generated from year to year. The growth rate in the farm economy largely depends on the stock
of capital built and plans of saving for further improvement. If the increase in farm income were mostly
utilized for increasing capital investment in farm organization, the growth rate in agriculture sector
would be higher. If the increasing capital investment are spent on house hold expenditure without
building up the necessary infrastructure, the economic development of agriculture might be hampered.
Thus the utilization of additional income earned by the families as a matter of concern, is in the
context of rapid economic development of the developing countries.
Agricultural development of a country like India is of prime importance, because the majority of the
population depends on agriculture as the main source of livelihood. For the development of agriculture
sector, the country needs a huge amount of creating the infrastructure in the rural area and for supplying
the basic inputs to the farming community. Since it is difficult for any government to meet the
requirements of the rural masses for their own resource it becomes necessary to increase the income of
the farmers by increasing the productivity of agriculture. An increase in the income of the farmers will
increase their saving potentialities, which will ultimately add the capital formation in agriculture. In
this connection, the example of Japan and USSR may be cited, where a number of economists have
recently begun to emphasise that agriculture should generate surpluses and finance not only its own
investments and capital formation but should also help in non-farm sector.
District Azamgarh of Eastern U.P. has an important place in terms of fertility and agricultural
advancement in India. The land of this part is Loamy which is most fertile. The total geographical area
of the district is 423400.00 ha. Out of which 273413.96 ha., 125.68 ha, 35108.93 ha, 15585.35 ha,
8979.22 ha and 37832.18 ha were net sown area, area under forest, barren and uncultivated land, cultivable
waste, trees and groves, current fallows and old fallows respectively. Out of total cultivated area 74.20
percent is under irrigation and intensity of cropping is 157.94 percent.
Thus, keeping in view the importance of income, saving and investment pattern in agricultural
economy of the country, state and the study area, the present study has been undertaken in district
Azamgarh U.P. with the following objectives. The findings of the study would be of great significance
to the policymakers, administrators, economists and extension workers for making development plans
for the improvement of agricultural sector in the study area.
Objectives of the Investigation

1. To examine the level of income from different sources on the sample farms.
2. To examine the extent and pattern of family consumption expenditure on the sample farms.
3. To study the farm structure and level of investment on the sample farms.
4. To workout the magnitude of saving and investment on the sample farms.
5. To identify the factors influencing the level and pattern of income, investment and saving.
WORKS CITED
APPA RAO (1981) ; Income, saving and Investment of small farmers, Financing Agriculture, 13 (1) : 33-34.
CHAUHAN, K.K.S. ; MUNDIE, S. & JADHAV, D. (1972). Income, saving and investment behavior of small farmers,
Indian J. Agril. Econ., 27 : 43-50.
CHINAPPA, B. (1999). Income and employment potential of irrigation cropping systems in Karnataka.
Agricultural Economics Research Association (India), 7th Annual Conference, Oct. 6-7, 54-55.
52
SINGH AND SINGH
DESAI, B.M. & DESAI, D.K. (1971). Potentialities for mobilizing investible funds in developing agriculture.
Report : 72-100.
GOYAL, S.K. ; GUPTA, D.D. & SINGH, J.P. (1999). Temporal changes in consumption pattern of food items in
rural and urban Haryana. Indian J. Agril. Econ., 54 (3) : 459.
KUMAR, N.R., PANDEY, N.K. & RANA, R.K. (2003). Price behavior of potatoes in Meerut wholesale market.
Journal of Indian Potato Association, 30 (1-2); 203-304.
KUMAR, RAM ; SHARMA, M.I. & SISODIA, G.S. (1975), Mobilization of rural surplus (A study of Saving Rural
Hissar). Indian J. Agril. Econ., 30(3) : 16.
KUSHWAHA, R.K.S. ; MAURYA, O.P. & SINGH, G.N. (1996). Income, saving and investment pattern in farming
district Etawah (U.P.). Indian J. Agril. Econ., 15 (4) : 628.
LAL, S.K.; BHALERAO, M.M. & GUPTA, S.B.L. (1983), Pattern of consumption, Investment, Saving & expenditure
among tribals”, Rural India, 46 (2-3) : 47.
MITRA, SANDIP & SARKAR ABHIRUP (2003). Relative profitability from production and trade : a study selected
potato markets in West Bengal. Economic and Political-Weekly, 38 (44) : 4694-4699.
PANDEY, H.K., VISHWANATH & SINGH, RP. (1972), Pattern of income saving and investment in agriculture in
eastern U.P., Indian J. Agril. Econ., 27 (4) : 30-36.
PATEL, M.I. (1965), Farm Investment pattern of a Tribal village in M.P., Indian J. Agril. Econ., 29 (1) : 192-200.
PRAKASH, BRAHM & SHARMA, D.K. Ibid (1999), Changes in consumption pattern in rural and urban India
during pre-and post- reforms period, Indian J. Agril. Econ., 54(3) : 435.
RAO, N.J.M.; SINGH, RV. & PATEL, RK. (1982), Consumption Pattern in Vijaywada, Arth Yozana 24 (1) : 29-39.
53
TRANSMISSION EXPANSION PLANNING BASED ON PSO
ARASH ZARINITABAR*, HAMDI ABDI** AND HAMID FATTAHI***
Declaration
Bi-monthly International Journal of all Research: We, Arash Zarinitabar, Hamdi Abdi and Hamid Fattahi the authors of the research
paper entitled TRANSMISSION EXPANSION PLANNING BASED ON PSO declare that , We take the responsibility of the content
and material of our paper as We ourself have written it and also have read the manuscript of our paper carefully. Also, We hereby give our
consent to publish our paper in Anvikshiki journal , This research paper is our original work and no part of it or it’s similar version is
published or has been sent for publication anywhere else.We authorise the Editorial Board of the Journal to modify and edit the
Abstract
Transmission Expansion Planning (TEP) is one of the important issues for planning power systems. Particle Swarm
Optimization (PSO) is used as one the modern intelligent methods in the fields of Electrical Engineering and it can
generate acceptable solutions in comparison with other methods. In this paper, supplying load demand by minimizing
costs in restructured environment is considered as one of the major requirements of power electric industry; Also load
demand and minimum cost are combined by doing multiple hierarchical optimizations. A comparison between proposed
algorithm and PSO is done. The results show that PSO produces more and various optimum solutions and it has an
understandable structure in comparison with other algorithms. Also it is shown that PSO gives choices to transmission
planners so that they can choose the suitable routes which have maximum Compatibility in order to maintain the existing
lines as well as supply the future load.
Keywords: Restructured power system; Transmission Expansion Planning; Particle Swarm Optimization
(PSO)
1. Introduction
TEP includes planning for all the changes required in transmission part, in other words TEP makes
balance between predicted load demand and supplied power by minimizing investment and operating
costs. Also it should consider technical, economical and environmental constraints in a long term
planning. Then TEP is a complicated, nonlinear and synthetic optimization problem. Solutions should
include the type and quality of transmission equipment, their location in power system and yearly
*Science and Research Branch, Islamic Azad University, Kermanshah, Iran. e-Mail : [email protected]
**Department of Electrical Engineering, Razi University Kermanshah, Iran. e-Mail : [email protected]
***Science and Research Branch, Islamic Azad University, Kermanshah, Iran. e-mail : [email protected]
54
ZARINITABAR, ABDI AND FATTAHI
overall timing for desired planning. Appearance of various uncertainties in investment decisions and
increasing load demand, also future location and number of plants make this issue intensely risky and
synthetic 1. To solve TEP problem, various static and dynamic models are represented in order to reduce
complication and computation time 2. Old optimization techniques are based on searching solutions for
the problem and they need to long time for computing 1,2. Heuristic methods as a part of new methods
which are initiated from classics optimization iterative methods have been used interesting procedure
for finding the best solution 3-5. However these methods cannot guarantee reaching to overall optimum
solution, too. Meta-heuristic methods as effective tools for solving complicated optimization problems
can produce high quality solutions and their computational time is appropriate. Nowadays, meta-heuristic
techniques such as PSO can successfully solve optimization problem related to power systems 6,7.
In this paper, PSO is applied to a test power system ( 6-bus Garver system) and optimum solution of
object function for Static Transmission Expansion Planning (STEP) is investigated. This method is
simpler than a multilevel model and is a robust method for solving integer programming problems in
which there are many local optimum solutions. Effectiveness of PSO in proposed system is investigated
by comparing the resulting solutions to other methods. Then a proposed algorithm is introduced and the
results of using this algorithm are investigated.
The rest of this paper is organized as follow: The structure of PSO is described in section 2. Section
3 includes proposed algorithm and its implementation. In section 4, the results of PSO implementation
is analyzed and its advantages than other algorithm are examined. Conclusion is presented in section 5.
2. Concepts of PSO Optimization Algorithm

In this section, we introduce PSO method based on optimizing mathematical tools 8-12. After that, the
mathematical model applied to STEP problem is explained.
2.1. PSO Principles: Swarm intelligence is a branch of artificial intelligence studying complicated
social behaviors in decentralized systems which are automatically organized and have a social
structure. Swarms are the basis of gathering behaviors and features of all intelligence groups; they
are based on the following five principles:
1. Vicinity (proximity): the ability to show the extent and time of calculations
2. Quality: the population responsibility to the environmental quality factors
3. Distinct Reaction: the productivity of an infinitive set of different reactions
4. Stability: the ability to maintain the constant behavior under smoothly environmental changes
Fig.1. Vector representation for describing equations of particles behavior

55
5. Fitness: the ability to change behavior during change imposition by external factors.
The basis of PSO algorithm is that the best experience or position obtained by each factor will be
recorded and then will be extended to each component or/ and total population. Fig.1 and Fig.2 show
the above described procedure.
Fig.2. The procedure of moving the position of the best swarm to the new position
In a mathematical framework, if ( ) is the search space and ( ) is objective
function then available population in this space will be named swarm and the individual of this population
will be called particle.
Each swarm can be defined as a set of N particles:
S=(xi,xi2,...xim) (1)
Where
xi=(xi1,xi2,...,xim)∈A i=1,2,...N
N is a function which is determined by user and it is related to the parameters of the problem. Each
particle can include m vector component which are defined the other dimension of the problem.
, the objective function is given for all the points of existing space A, therefore each particle is
a unique function of fi=f(xi)∈Y values. It is supposed that particles move repeatedly in space A, adjust
their positions and pick up speed, where:
Vi=Vi1,Vi2,...,VimT (2)
For i= 1,2,….,N. Particles velocity is adjusted by the resulting data from previous iteration step of
algorithm. This requirement is performed in each period of memory. On the other hand, each particle
can save the best position which is faced to during the searching. Then we have:
P={p1,p2,...,pm} (3)
P is a set of memories includes the best positions in which each particle is always located; where:
pi = ( pi1,pi2,…,pim)T∈A
56
And i=1, 2,…,N.. By minimizing the problem and considering g as the index of best position with
smallest value in P function for a given t iteration, the first definition of PSO is as bellow:
Where
i = 1,2,….,N and j = 1, 2, …, M.
t shows the number of iterations, R1 and R2 are random values which are uniformly distributed
between [0, 1]. c1 and c2 are importance factors which are respectively named cognitive and social
parameters. After updating and evaluating particles, in each iteration the best position (memory) also
updates. After that, in each iteration the index of new g is determined in order to update the best
complicated positions.
2.2. Mathematical Modeling- DC Model

The existing mathematical model is very similar to DC model which is described as follow:
θl,fkl are infinitive. Also in which ,ykl, , , fkl and are respectively
related to the cost of adding one circuit to the forward direction k-l‘ circuit sensitivity k-l‘ the number
of existing circuit in the studied circuit, total load flow and maximum load flow corresponding to it for
each existing circuit in forward direction k-l.
Variable v is the investment outlay, S is the transposed of nodes and branches’ intersection matrix of
studied power system, f is a vector of element, g is a vector of gr elements (produced in r bus)
which its maximum is g , d is demand vector, is the maximum number of circuits which can add to
forward direction k-l, is the phase angle of l bus, and Ω is a set of all forward directions.
The objective function is considered as (6). The constraints shown in (7) are represented power
protection in each node. These restrictions are modeled in DC equivalent circuit of network by KCL.
57
The restriction mentioned in (8) is related to apply ohm law to DC equivalent circuit of network. Then
KVL is considered in calculations and these constraints are nonlinear.
3. Method of Algorithm Implementation

In this section, PSO implementation in TEP problem is explained and the effectiveness of algorithm is
examined.
3.1. Implementation Steps of PSO Algorithm
1) Entering the electrical network data
2) Adjusting PSO parameters (i.e. swarm size, number of neighbors, maximum number of iterations,
first iteration and etc.)
3) Initializing particles positions and random velocities.
4) Evaluating objective function by using of DC model which is described in section (2.2).
5) Updating the best individual characteristics and local positions of particles.
6) If considered stop criteria are not enough, these steps must be added:
6-1) increasing the number of iterations
6-2) updating the velocity of each particle by the equations (4, 5, 14)
6-3) examining the velocity constraints
6-4) updating the swarm
6-5) examining the swarm constraints
6-6) evaluating the objective function by using of DC model shown in section (2.2)
6-7) updating the best generalities, characteristics and local positions of particles
7) Finish.
3.1.1. Network Data : In normal case, the data used for STEP implementation is depended on electrical
networks conditions. The problem dimensions are considered by using the number of forward direction
in which the possibility of adding circuits to the system based on load flow and load patterns is exist.
3.1.2. Setting the Parameters : Some parameters are very important to ensure PSO convergence. The
number of particles (N) is a dependent parameter to the problem which can choose based on the
importance of problem. The values of parameters are identified by trial and error 11.
3.1.3. Initializing the swarm and velocities : Here, similar random initialization technique is used which
is an evolutionary computational method. This method just includes random vectors with the same
distribution probabilities defined between [0, 1]. Then produced values in corresponding search
space are divided and particles and velocities corresponding to them are adjusted based on their
limitations.
3.1.4. Swarms and velocity constraints : For limiting the search space, maximum and minimum
constraints are defined for each particle. In this problem, the number of forward circuits in the main
electrical network is xmin and the maximum number of forward circuits for each direction is xmax .
These two quantities are defined as the particles limits. As well, components velocities are examined
to maintain it respectively between the constraints -vmax and vmax, in which vmax is supposed as
2xmax.
3.1.5. Evaluating of Objective Function : To meet the existing constraints, the objective function (6) is
slightly modified and written as follow:
F0 = f(x)+p(x) (12)
fx =(k,l)∈Ωcklnkl (13)
58
x is a vector including the number of nkl circuits for each particle with importance degree of m –
here the number of forward directions candidate for adding to circuits- which is added to each k-l
forward direction .
P(x) is penalty function that defines as below:
1. Zero, if x is a feasible point in search space.
2. P1, if x is a broken constraint in equations.
3. (P2*nl), if x is a broken constraint of equation.
Where nl is the number of lines in which load flow is exceeded of the limits. When limitations are
exist, it is possible to have an algorithm which does not consider isolated nodes of power network and
becomes convergence to a feasible solution. As well, adding some constraints to the problem will be
very simple.
3.1.6. Updating velocities and swarm: STEP is formulated by integer variables. Therefore, the equation
(4) is moderated to some extent and shown as follow:
xijt+1=round[xijt+vijt+1] (14)
Therefore, is instantly updating by varying the position of equation; then its answer will be rounded to
nearest integer.
3.1.7. Stop Criterion: Here, two criteria are used to stop the algorithm. First, the maximum number of
allowed iterations which are restricted to the number of evaluation functions. Since the studied
system with known solutions is used, the second stop criterion is related to future convergence in
known values of function. Stepped searching also can be used as another stop criterion. Furthermore,
the number of evaluation functions can be considered as a stop criterion.
4. Results
Here, a test system (6-bus Garver system) is used: this 6 bus system has 15 candidate branch with total
load of 760MW. The maximum lines which are acceptable in each forward direction equal to 4. PSO is
successful in reaching to optimum values for system. This system is frequently used in various
publications and studies of transmission system planning as a very famous test system. Complete list of
required data are available in 13,14.
Now, for better understanding about the effect of
PSO, we overview the results of a typical proposed
algorithm using previously in TEP problem 15 and then
compare it to the explained PSO algorithm. Required
data and the process of performing algorithm are
available in 15. After performing the related algorithm,
the lines marked by dotte lines are added to Garver
system.
PSO algorithm implements and runs in MATLAB.
The function of evaluating process can be generated by
DC model introduced in section (2.2). The tests can be
done without considering generation timing. The results
Fig.3. Schematic Garver system after of solving this system are shown in figure4. Here, the
applying propose d algorithm in [15] PSO effectiveness applying to transmission expansion
planning is represented and its related data are analyzed later. This test is done with 300 iterations. One
of the advantages of PSO is that most of its parameters are adjusted automatically. However, the most
59
sensitive parameter in this problem is swarm size that is common for all PSO techniques and it is
determined through a combination of experiences resulting from trial and error. Generation Unit Size
Cost (US$=200,000) is considered without further planning of generation. Two bellow tables are
represented in order to compare the effect of Swarm Size (SS) in algorithm convergence. It is seen that
by increasing the swarm size, the success rate of algorithm is increased. In the bellow tables, u is a
parameter using for converging the algorithm.
T A B L E 1 Examination of PSO effectiveness by using SS=60
PSO
u=0 u =0.5 u=1
Test Time 100 100 100
Success Rate 100 88 50
Average of Iterations 29 11 10
Standard Deviation of Iterations 8 2 5
Average Evaluation Function 1753 656 1215
T A B L E 2 Examination of PSO effectiveness by using SS=80
PSO
u=0 u =0.5 u=1
Test Time 100 100 100
Success Rate 100 89 60
Average of Iterations 28 11 12
Standard Deviation of Iterations 7 4 4
Average Evaluation Function 2244 883 1922
Convergence procedure of PSO algorithm is shown in figure 5.
By performing PSO, bellow circuits are adding to 6-bus Garver system:

n3-5=1 , n4-6 = 2 and n2-6 =4.
60
Fig.4. Optimum schematic of transmission system expansion in a 6-bus Garver system by using PSO
5.Conclusion
By comparing the results of two above algorithms, it is obvious that PSO produces various and more optimum solutions.
Also in comparison with other algorithms, PSO has a routine and intelligible structure which is one the advantages of this
algorithm. From the above test, it was found that using PSO can make a choice for transmission planners to choose the best
optimum directions having maximum compatibility in order to maintain existing lines and also supply the future load. If
economic issues are not propounded, PSO can easily determine new required lines to supply the future load demand.
Considering economic issues in TEP problem by using PSO is a new idea which is necessary to be addressed to it.
REFERENCES
1
M. OLOOMI BUYGI. H. M. SHANECHI. G. BALZER & M. SHAHIDEHPOUR. “Transmission Planning Approaches
in Restructured Power Systems.”IEEE 2003 Bologna Power Tech Conference, June 23-26, Bologna, Italy.
2
GERARDO LATORRE , RUBÉN DARÍO CRUZ. JORGE MAURICIO AREIZA & ANDRÉS VILLEGAS. “Classification of
Publications and Models on Transmission Expansion Planning” IEEE TRANSACTIONS ON POWER
SYSTEMS, VOL. 18, NO. 2, MAY 2003.
3
MUHAMMAD RASHID, “Combining PSO Algorithm and Honey Bee Food Foraging Behavior for Solving
Multimodal and Dynamic Optimization Problems”, Department of Computer Science. National University of
Computer & Emerging Sciences, Islamabad, Pakistan. (February 2010)
4
M. MAHDAVI, H. MONSEF, A. BAGHERI.” Transmission Lines Loading Enhancement Using ADPSO Approach”
International Journal of Electrical and Electronics Engineering 4:6 2010.
5
MANUEL COSTEIRA DA ROCHA & JOÃO TOMÉ SARAIVA.”Discrete Evolutionary Particle Swarm Optimization
for Multiyear Transmission Expansion Planning” 17th Power Systems Computation Conference. Stockholm
Sweden - August 22-26, 2011.
6
DEL VALLE, et.al, “Particle Swarm Optimization: Basic Concepts, Variants and Applications in Power
Systems” IEEE Transactions on Evolutionary Computation, Vol. 12, No. 2, April 2008
7
H. SHAYEGUI, M. MAHDAVI, A. BAGHERI, “Discrete PSO algorithm based optimization of transmission lines
loading in TNEP problem”, Energy Conversion and Management, pp. 112-121, Elsevier, October 2009
8
MIRANDA, “Evolutionary Algorithms with Particle Swarm Movements”, Proceedings of the 13th International
Conference on Intelligent Systems Application to Power Systems, pp 6-21, 6-10 Nov. 2005.
9
V. MIRANDA, HRVOJE KEKO, ALVARO JARAMILLO, “EPSO: Evolutionary Particle Swarms,” en Advances in
Evolutionary Computing for System Design, Serie: Studies in Computational Intelligence, vol 66, L. Jain, V.
Palade, D. Srinivasan, Eds. Springer, 2007, pp 139-168.
61
10
K. P ARSOPOULUS, M. V RAHATIS , “Particle Swarm Optimization and Intelligence: Advances and
Applications”, ISBN 978-1-61520-666-7, Information Science Reference, USA, 2010.
11
CLERC, “Particle Swarm Optimization”, ISBN 978-1-905209-04-0, ISTE, Great Britain, 2006.
12
J. KENNEDY, R. EBERHART, “Swarm Intelligence”, ISBN 1-55860-595-9, Academic Press, USA, 2001.
13
R. ROMERO, A. MONTICELLI, A. GARCÍA, S. HAFFNER, “Test systems and mathematical models for transmission
network expansion planning”, IEE Proc.-Gener. Transm. Distrib. Vol. 149, No. 1, pp. 27-36, January 2002.
14
R. ROMERO, C. ROCHA, J.R.S. MANTOVANI, I.G. SANCHEZ, “Constructive heuristic algorithm for the DC
model in network transmission expansion planning”, IEEE Proc.-Gener. Transm. Distrib., Vol.152, No. 2, pp.
277- 282, March 2005.
15
G R KAMYAB, H RAJABI MASHADI , M FOTOHI. “Network Transmission Expansion Planning for Increasing
competition and Decreasing Energy Not Supplied”. international power system conference. Tehran iran. 98-F-
PSS-651
62
ANVIKSHIKI ISSN 0973-9777 Advance Access publication 20 Apr. 2013
MODERN TECHNOLOGY IN AGRICULTURAL PRODUCTION : A

REVIEW
MANOJ SINGH* AND DR. K.P. SINGH**
Declaration
Bi-monthly International Journal of all Research: We, Manoj Singh and K.P. Singh the authors of the research paper entitled MODERN
TECHNOLOGY IN AGRICULTURAL PRODUCTION : A REVIEW declare that , We take the responsibility of the content and
material of our paper as We ourself have written it and also have read the manuscript of our paper carefully. Also, We hereby give our
consent to publish our paper in Anvikshiki journal , This research paper is our original work and no part of it or it’s similar version is
published or has been sent for publication anywhere else.We authorise the Editorial Board of the Journal to modify and edit the
Abstract
The adoption of modern technology in agricultural production including seed-fertilizer-irrigation revolution has accelerated
the transformation of farm economy from subsistence level to a profitable farm business. It has raised the agricultural
production, marketable surplus and farm incomes. As a result, the farmers are motivated to save and invest more in order
to expand their volume of farm business and raise their incomes. However, the variation in farm income, savings and
investment result from variation in crop yields which in turn are influenced by (i) natural factors like weather conditions
including rainfall and topography and (ii) resource inputs and level of technology etc.
Discussion
The present study provide an insight into the variation of income, savings and investment on different
farms as a result of their resource utilization and managerial capacity. It therefore, calls for an examination
of the problems and issues relating to variation in income, saving and investment on farms under study.
In this context, the present study implies the following issues for discussion :
(i) What are the major sources of income of the farmers? How much income is received from various sources?
(ii) What is the level of savings and pattern of investment on different size group of farms?
(iii)How is the investment in agriculture financed?
(iv) What factors influence the income, savings and investment in agriculture?
(v) What changes from the present position are needed for increasing income, savings and investment of the farmers of
different size group of farms.
*Research Scholar, Department of Agricultural Economics and Statistics, Tilak Dhari Post Graduate College Jaunpur (U.P.) India
**Ex.- Reader & Head, Department of Agricultural Economics and Statistics, Tilak Dhari Post Graduate College Jaunpur (U.P.) India
63
& [email protected]. Read this paper on www.anvikshikijournal.com.
MODERN TECHNOLOGY IN AGRICULTURAL PRODUCTION : A REVIEW
To answer the above questions and deal with the above issues, the inter-relationship established by
the study shows that the study area is dominated by marginal and small farms holdings, which constituted
about 87 percent of the total farm holdings. The average size of operational holding being small (1.17
hect.). Hence the income of the farmers obtained from farming alone is not sufficient to meet out even
the family consumption expenditure. So the farmers of the study area have to depend on number of
other sources of income for their livelihood. These may include dairying, agricultural wages, non-
agricultural wages, service, business/shop keeping etc. It was found that the marginal and small farmers
of the study area derived a major portion of their income through wage earnings. Total household
annual income of Rs. 31750.42 of marginal farms (average size of operational holding being 0.52
hect.), contribution of income through wage earnings accounted for nearly 24 percent while remaining
76 percent came from crop + milk production enterprises. In case of small farms the total income came
to Rs. 63685.30 per household (average size of operational holding being 1.35 hect.), of which about 8
percent was from wages & remaining from crop and milk production enterprises. However, Big farmers
(average size of operational holdings being 4.14 hect.) were able to obtain sufficient income from
farming alone. It was due to larger size of farm business on one hand and better financial position and
adoption of modern agricultural technology on the other, which resulted in higher crop yields & thereby
higher income on their farms. It was the reason that the proportion of agricultural income in total
income was considerably higher on large farms as compared to small farms. As regards ratio of agricultural
and non-agricultural income in total income it came to 75.98; 20.09 and 80.42 : 17.52 in case of marginal
and small farms respectively as compared to large farms, where it came to 90.21 : 8.25.
However, inspite of various sources of income, marginal farmers were having no savings with them.
Their income was not sufficient to meet out even family consumption expenditure. It was due to poor
income received from farming because of limited resources on one hand and poor opportunities of
income from other sources including wage employment on the other. Thus, marginal farmers were not
in position to re-invest any funds in durable assets, or make improvement in farming. It resulted in
lower crop yields, lower incomes, poor savings or no savings and lower investment. As regards small
farmers (average operational holding 1.35 hectares) and Big farmers (average operational land holding
4.14 hect.), they were found to be in better position than marginal farmers. The per household savings
on small farms came to Rs. 21219.79 per annum, whereas on large farms it came to Rs. 117047.89 per
household per annum. The higher incomes resulted into more savings and greater investment on their
farms.
As regards level and pattern of investment on farms, it worked out to Rs. 48368.65 per household
per annum, which included investment in farm capital, non-farm capital and financial investment. It
was highest in farm capital followed by financial investment and non-farm capital. However, in farm
capital, investment in working capital was highest followed by fixed capital. In fixed capital investment,
the farmers gave first priority to irrigation works, then milch animals, farm building and improvement
of land etc. As regards different size group of farms, the farmers of small farm holdings, preferred to
invest more in purchase of milch animals, then irrigation works, while Big farmers preferred first to
invest in irrigational works, then implements & machinery and farm buildings. Thus, irrigation and
farm machinery which are supposed to be directly related with crop production enterprise received
higher priority to Big farmers. It was also due to large size of farm business and better financial position
of the Big farmers. As mentioned above small & marginal farmers preferred to make investment in
purchase of milch animals so as to earn additional income through sale of milk to meet out their
consumption needs. The farmers having savings also invested some money in non-farm capital like
purchase of household furniture, vehicle, radio, television etc., while sufficient savings were also invested
in financial institutions in the form of saving certificates, kisan vikas patra, LIC etc.
64
SINGH AND SINGH
However, the level of income, savings and investment was lowest in the small size groups. The main
point is that the marginal farmers were not making intelligent decision for use of resources. It is therefore
necessary that resource planning must be considered as of a high priority in determining and protecting
the interest of the marginal farmers. Benefits to marginal farmers in terms of increase in value of their
capital goods and services was negligible because of poor investment capacity. Further, a great difference
in the income of the different size group of farms arise due to different types and quantity of inputs
used. So, these should be made available adequately to the marginal farmers as well.
As already mentioned, the farm income, savings and thereby investment depend upon the natural
factors and the use of resource inputs along with the adoption of level of technology in agriculture.
Savings are of great importance because they have a direct bearing on the investment capacity of the
farmers. With the dissemination of modern technology of agriculture, the farmers income is increasing.
With increase in income, savings also increases. These savings are then transformed into investment to
generate long term growth. Thus, it is the investment pattern in addition to technology know-how, in
the present day agriculture which may forecast the fate of crop incomes and finally the standard of
living of the farmers. The benefits of the modern technology depend upon the irrigation facilities, size
of farm holdings, financial position, education/training, tenurial and social status of the farmers. Various
studies have revealed that these factors vary considerably among regions and among different types and
size of farms and as such, the modern technology may lead to the disparity in income, savings and
investment pattern.
So far as increasing the level of income, savings and investment of the farmers is concerned, there is
need to take full advantage of the flow of modern technology. The direct capital and credit requirements
for fertilizers, quality seeds, pumped irrigation water, use of implements and machinery and pesticides
may be determined for different size group of farms, through development of farm plans and budgets.
The success in stepping up farm incomes and there by savings much depends upon the adoption of new
farm technology on a wider scale and removing impediments standing in the way of farm progress. To
generate long term growth, capital formation in agriculture is necessary. So, the savings of the farmers
should be invested in capital assets such as irrigation structure, farm equipment & machinery, tractors
etc. to generate sustained growth.
The marginal farmers are faced with the lack of resources which need to be matched with the
requirements of the technology. To develop income potentiality of these farmers, the farming need to be
diversified and farmers helped to take up subsidiary occupations like dairying, poultry keeping etc. The
formulation of farm policies for low income group of farmers in provision of timely and strategic
inputs is the first step in creating suitable conditions for increasing farm production, income, savings
and investments.
Although there is a higher degree of socio-political awareness among the farmers and the Government
in recent years have taken up steps through its special developmental programmes to raise the income
levels of the small farmers. But much more remains to be done for the rapid pace of adoption of modern
technology through the development of irrigation potential and establishment of cottage industries
subsidiary to agriculture as a part of long term development programme in a manner that the demand
for inputs is equated with supply resources.
Testing of Hypothesis
On the basis of the findings and discussion on different issues of the study, the hypothesis laid out in
Chapter IInd is hereby proved :
65
MODERN TECHNOLOGY IN AGRICULTURAL PRODUCTION : A REVIEW
The first hypothesis that level of farm income is influenced by the size of farm holding, is proved
according to findings given in Chapter V-2. The level of farm income gave a rising trend with the
increase in farm size due to higher use of input resources. This hypothesis is also supported by the
findings of Singh, Gupta & Singh (1978), and the regression analysis given in Chapter V-6.
The second hypothesis that consumption pattern is influenced by the level of income of households
is proved according to findings given in Chapter V-3. The findings revealed that with the increase in
income, the level of consumption expenditure gave an increasing trend. Besides, the expenditure on
education, housing, clothing and social ceremonies was found higher on large farms because of higher
income as compared to small farms/marginal farms.
The third hypothesis that there is dis-savings on marginal farm households is also confirmed according
to findings given in Chapter V-4. It was because the family consumption expenditure exceeded the
farm business income of the households. This hypothesis is also supported by the findings of Pandey et
al (1972), and Kumar et al (1975).
The fourth hypothesis that investment pattern on farms is associated with the level of savings, which
in turn is correlated with the level of income, is also proved according to findings given in Chapter V5,
V-4 respectively. This hypothesis is supported by the findings of Kushwaha et al (1996).
All the hypotheses mentioned in the chapter 2nd is supported by the findings of Singh and Singh
(1996) in which it is shown that crop production is the principal occupation of small, medium and big
farmers whereas marginal farmers earned a major share from non-farm activities.
REFERENCES
GUPTA, T.R., SINGH, G. & SINGH, B. (1978). ‘Pattern of voluntary rural savings in India’. Saving and Development.
Indian J. Agril. Econ. 2(3) : 224-234.
N.K., SINGH; RAJVIR, SINGH, & SINGH, R.P. (1998). Impact of crop diversification on income, employment and
credit needs of marginal farms. The Bihar J. Agril. Mktg. 6(2) : 160-170.
R.P., SINHA, & KUMAR, R. (1996). Extent and pattern of income, saving and investment on farm households on
Nalanda district (Bihar). Indian J. Agril. Econ., 51 (4) : 609.
SINGH, VIRENDRA; CHAURASIA, S.P.R. & SHARMA, J.S. (2002). An economic analysis of farm income distribution
on potato specialized farms in Agra district of Uttar Pradesh. Indian Journal of Agricultural Economics, 57
(4): 741-749.
SINGH, SURENDRA (1980). ‘Capital formation, Farm size and new technology : A case study in Ganganagar
dristrict of Rajasthan. Economic Journal. 4 (2) : 25-43.
SINGH, V.K. & SINGH, JAI (1996). Distribution of income, expenditure and ivestment of farm households in
Hissar district (Haryana). Indian J. Agril. Econ., 51 (4) : 609-610.
BOOKS
GOLD SMITH, R. (New York 1955); The study of saving in the united states.
GANGULY, E (1978); Studies in Indian Economic Problem.
DUESENBERRY, JS (1949); Income, Saving and Consumer Behavior.
DATTA, A (1982); Essays on economic development.
DUTT, R & SUNDARAM, KP (1998); Bhartiya Arthvyastha.
DUTT, R & SUNDARAM, KP : Indian Economy.
BANDHYAPADHYAY, D (1986); Land reform and farm size in India.
BHAGWATI, J.N. (1974); Contributions to Indian Economic Analysis.
BLYR, G (1954); Saving and consumption behavior of Punjab cultivators.
JALAN, B (1992); The Indian Economy problems and prospects.
66
SINGH AND SINGH
JHINGAN, M.L. (1988); Macro Economics.

JHINGAN, M.L.(1996); Anterrastriya Aarthshastra.
JALAN, BIMAL (1993); Bharat Ka Aarthik Sankath Aur Samadhan.
KHUSRO, A.M. (1964); Economics of land reform and farm size in India.
MISHRA, S.K. & PURI, V.K. (2000); Bhartiya Arthvywastha.
MALAVIYA, H.D. (1967); Land reform in India.
NAGAR, K.N. (1984); Element of statistics.
JOURNALS AND MAGAZINES

Aarthik Jagat (Kolkatta).
Asia week (Hong Kong).
Business India (Mumbai)
Business Today (New Delhi).
Capital (Kolkatta)
Co-operation bulletin
Economic & Political Weekly.
Fortune India (Mumbai).
Facts for you (New Delhi).
The India Economy (Mumbai).
Yojana (New Delhi).
NEWS PAPERS
Financial Express (Mumbai)
The Times of India (New Delhi).
The Indian Express (New Delhi & Mumbai).
The Economic Times.
The Economic Times (New Delhi).
67
Note for Contributors
SUBMISSION OF PAPERS
Contributions should be sent by email to Dr. Maneesha Shukla Editor-in-Chief, Anvikshiki, The Indian Journal of Research
( [email protected]). ). www.onlineijra.com
Papers are reviewed on the understanding that they are submitted solely to this Journal. If accepted, they may not be
published elsewhere in full or in part without the Editor-in-Chief’s permission. Please save your manuscript into the
following separate files-Title; Abstract; Manuscript; Appendix. To ensure anonymity in the review process, do not include
the names of authors or institution in the abstract or body of the manuscript.
Title: This title should include the manuscript, full names of the authors, the name and address of the institution from which
the work originates the telephone number, fax number and e-mail address of the corresponding author. It must also include
an exact word count of the paper.
Abstract: This file should contain a short abstract of no more than 120 words.
MANUSCRIPT: This file should contain the main body of the manuscript. Paper should be between 5 to 10 pages in
lenth,and should include only such reviews of the literature as are relevant to the argument. An exact word count must be
given on the title page. Papers longer than 10 pages (including abstracts, appendices and references) will not be considered
for publication. Undue length will lead to delay in publication. Authors are reminded that Journal readership is abroad and
international and papers should be drafted with this in mind.
References should be listed alphabetically at the end of the paper, giving the name of journals in full. Authors must check
that references that appear in the text also appear in the References and vice versa. Title of book and journals should be
italicised.
Examples:
BLUMSTEIN,A.and COHEN,J.(1973),’A Theory of Punishment’ Journal of Criminal Law and Criminology,64:198-207
GUPTA,RAJKUMAR(2009),A Study of The Ethnic Minority in Trinidad in The Perspective of Trinidad Indian’s Attempt to
Preserve Indian Culture, India: Maneesha Publication,
RICHARDSON,G(1985),Judicial Intervention in Prison Life’, in M. Maguire ,J. Vagg and R. Morgan, eds., Accountability
and Prisons,113-54.London:Tavistocs.
SINGH,ANITA.(2007),My Ten Short Stories,113-154.India:Maneesha Publication.
In the text,the name of the author and date of publication should be cited as in the Harvard system(e.g.Garland 1981:
41-2;Robertson and Taylor 1973;ii.357-9)If there are more than two authors, the first name followed by et al. is manadatory
in the text,but the name should be spelt out in full in the References. Where authors cite them as XXXX+date of publication.
Diagrams and tables are expensive of space and should be used sparingly. All diagrams, figures and tables should be in
black and white, numbered and should be referred to in the text.They should be placed at the end of the manuscript with
there preferred location indication in the manuscript(e.g.Figure 1 here).
Appendix: Authors that employ mathematical modelling or complex statistics should place the mathematics in a technical
appendix.
NOTE : Please submit your paper either by post or e-mail along with your photo, bio-data, e-mail Id and a self-addressed
envelop with a revenue stamp worth Rs.51 affixed on it. One hard copy along with the CD should also be sent.A self-
addressed envelop with revenue stamp affixed on it should also be sent for getting the acceptance letter. Contributors
submitting their papers through e-mail, will be sent the acceptance letter through the same. Editorial Board’s decision will
be communicated within a week of the receipt of the paper. For more information, please contact on my mobile before
submitting the paper. All decisions regarding members on Editorial board or Advisory board Membership will rest with
the Editor. Every member must make 20 members for Anvikshiki in one year. For getting the copies of ‘Reprints’, kindly
inform before the publication of the Journal. In this regard, the fees will be charged from the author.
“ After submission, the manuscript is reviewed by two independent referees. If there is disagreement between the referees
, the manuscript is sent to third referee for review. The final decision is taken by the Editor in chief”.
COPYRIGHT of the papers published in the Journal shall rest with the Editor.

Untitled

Uploaded by

Copyright:

Available Formats

Untitled

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Untitled

Uploaded by

Copyright:

Available Formats

Anvikshiki

The Indian Journal of Research

Concept of Vrana in Veda 1-2

Diagnosis and prognosis in complete denture patient – A Systematic Review 13-20

Occupational Health Hazards in Dental Practice- a brief review 25-31

Study of urinary infection in community based Indian elderly 32-39

Transmission Expansion Planning Based on PSO 54-62

Modern Technology In Agricultural Production : A Review 63-67

PRINT ISSN 0973-9777,WEBSITE ISSN 0973-9777

CONCEPT OF VRANA IN VEDA

AWADHESH KUMAR PANDEY*, M. SAHU** AND MEENAKASHI PATHAK S.N.***

7- fonz/kL; cyklL; yksfgrL; phinz‘ouL;rsA ¼v-os- 1@2@4½

STUDIES OF CYTOCHROME C OXIDASE SUBUNIT I GENE IN THE

Figure 1 Total genomic DNA in s. t. caspius

A CLINICAL STUDY TO EVALUATE THE ROLE OF PATHYA IN

DR. ANIL KUMAR*, DR. NEERU NATHANI**AND DR. O. P. SINGH***

Material and Methods

DIAGNOSIS AND PROGNOSIS IN COMPLETE DENTURE PATIENT –

DR. RAJUL VIVEK* AND DR. ANKITA SINGH**

Clinical Examination of the Patient 7

Lateral throat form

Shape of the Hard Palate

Slope of the soft palate

Existing Dentures as Diagnostic Aids9

Centric Relation and Vertical Dimension of Occlusion10

PROFILE OF PATIENTS WITH DIABETIC KETOACIDOSIS AT A

GAUTAM K DEEPAK*, PRAKASH VED**, RAI MADHUKAR***AND SINGH K SURYA****

Material & Methods

Observations & Results

OCCUPATIONAL HEALTH HAZARDS IN DENTAL PRACTICE- A

DR. ANKITA SINGH* AND DR. RAJULVIVEK**

Mercury health hazard

Anaesthetic gases in the dental office

Noise Generated by Dental Equipments

STUDY OF URINARY INFECTION IN COMMUNITY BASED INDIAN

DR DHIRAJ KISHORE*, PROF. INDARJEET SINGH GAMBHIR**,DR AMITA DIWAKER***,

Material and Method

Institutionalized 43 (28.6) 107(71.3) 150

60-65 30 32 6 7 2 4 1.1/1.01 >0.05

MODIFICATION OF SNUHIKSHARASUTRA AND AN ATTEMPT TO

DR GAURAV SINGH RATHORE*

The classically prepared SnuhiKasharasutrahas been prepared by total 21 coatings on a 21 number

The Average Unit Cutting Time (UCT)

ACCURACY IN PROXIMITY OF FOUR ARBITRARY HINGE AXIS

Left 40 2.24 1.01

A SHORT REVIEW OF INCOME, INVESTMENT AND SAVING

MANOJ SINGH* AND DR. K.P. SINGH**

Objectives of the Investigation

TRANSMISSION EXPANSION PLANNING BASED ON PSO

ARASH ZARINITABAR*, HAMDI ABDI** AND HAMID FATTAHI***

2. Concepts of PSO Optimization Algorithm

Fig.1. Vector representation for describing equations of particles behavior

2.2. Mathematical Modeling- DC Model

3. Method of Algorithm Implementation

By performing PSO, bellow circuits are adding to 6-bus Garver system:

MODERN TECHNOLOGY IN AGRICULTURAL PRODUCTION : A

MANOJ SINGH* AND DR. K.P. SINGH**

JHINGAN, M.L. (1988); Macro Economics.

JOURNALS AND MAGAZINES

You might also like

AWADHESH KUMAR PANDEY, M. SAHU AND MEENAKASHI PATHAK S.N.

DR. ANIL KUMAR, DR. NEERU NATHANIAND DR. O. P. SINGH

GAUTAM K DEEPAK, PRAKASH VED, RAI MADHUKARAND SINGH K SURYA****

DR DHIRAJ KISHORE, PROF. INDARJEET SINGH GAMBHIR,DR AMITA DIWAKER,

ARASH ZARINITABAR, HAMDI ABDI AND HAMID FATTAHI