Hakeem Et Al., 2013

Crop Improvement
Khalid Rehman Hakeem • Parvaiz Ahmad

Munir Ozturk
Editors
Crop Improvement
New Approaches and Modern Techniques
2123
Editors
Khalid Rehman Hakeem Munir Ozturk
Universiti Putra Malaysia Universiti Putra Malaysia
Serdang, Selangor Serdang, Selangor
Malaysia Malaysia
Dr. Parvaiz Ahmad

Government Anantnag
College, Srinagar, India
ISBN 978-1-4614-7027-4 ISBN 978-1-4614-7028-1 (eBook)

DOI 10.1007/978-1-4614-7028-1
Springer New York Dordrecht Heidelberg London
Library of Congress Control Number: 2013939183
© Springer Science+Business Media, LLC 2013

All rights reserved. This work may not be translated or copied in whole or in part without the written
permission of the publisher (Springer Science+Business Media, LLC, 233 Spring Street, New York, NY
10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connec-
tion with any form of information storage and retrieval, electronic adaptation, computer software, or by
similar or dissimilar methodology now known or hereafter developed is forbidden.
The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are
not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject
to proprietary rights.
Printed on acid-free paper
Springer is part of Springer Science+Business Media (www.springer.com)

Foreword
Crop improvement is now one of the most significant subject matters in agriculture,
which includes the genetic alteration of plants to satisfy ever increasing human need.
A large number of genetic techniques were developed and refined in the twentieth-
century. It has been suggested that many of the limitations of conventional breeding
can be overcome with advances in molecular biology. The aim in crop develop-
ment is to support innovative and excellent research to underpin the development
of improved crop varieties that deliver increased productivity and consistent, high
quality end products. The limitations of the new breeding methods include technical
problems, such as the difficulty of transformation, problems of gene expression, or
the lack of knowledge concerning suitable genes to transfer.
Biotechnology is generally accepted as the use of living systems and organisms
to develop or make useful products. Increases in crop yield is one of the most obvi-
ous applications of modern biotechnology in agriculture, it is also recognized the
most difficult one. Many of the genetic characteristics associated with yield (e.g.,
enhanced growth) are controlled by a large number of genes, each of which has a
minimal effect on the overall yield. Most of the current commercial applications of
modern biotechnology in agriculture are related to reduce the dependence of farm-
ers on agrochemicals. There is a need much scientific work to be done in this area.
The book contains state-of-the-art new research results in crop improvement
and related disciplines in crop development. It provides up-to-date information for
researchers, educators, graduate students and industry. It consists of 17 Chapters.
The first Chapter provides the reader with extensive information on A. rhizogene,
s which is responsible for the development of hairy root disease in a wide range of
dicotyledonous plants and its T-DNA system components. Second Chapter talks
about recent advances in bioinformatic tools, together with advance molecular
technology under clear biological categories. Chapter 3 deals with tissue culture,
which is employed for large-scale propagation of disease free clones and gene pool
conservation. It covers in vitro propagation and role of biotechnology in crop im-
provement. Chapter 4 describes about mutagenesis, which is a crucial step in crop
improvement program.
Chapter 5 explains the importance of biofertilizers in sustainable ecosystem.
Biofertilizers are now gaining ground as they are used to maintain the soil health,
v
vi Foreword
curtail the environmental pollution and cut down on the use of chemicals in agricul-
ture. Chapter 6 indicates the importance of Arbuscular mycorrhizal fungi (AMF)
for soil quality and tolerance of plants to biotic and abiotic stresses. Biotic stress is
the subject matter of Chap. 7 is the subject matter of how wheat genetic variability
is obtained. New and useful genetic variations exist in the wild wheat progenitor
species that can be utilized for the enhancement of the existing wheat breeding
pools and improve yield stability. This was followed by Chapter 8 dealing specifi-
cally with Variability in Fusarium Species causing wilt disease in crops. Abiotic
stresses including salinity are a major threat to agricultural productivity and hence
global food security are described in Chapter 9. Crop plants have adopted special-
ized strategies to reduce the impact of stress.
Chapter 10 is devoted to wheat grain quality advances in the genomics of grain
quality are considered crucial for defining genes and their networks underpinning
functional flour qualities. Chapter 11 talks about N use efficiency (NUE) in agri-
culture and future development. The use of N in agriculture and its significance in
the sustaining human society is addressed, especially in the developing countries.
Chapters 12 and 13 covers the issue of heavy metals toxicity in soils, uptake by
plants. They throw light on the arsenic toxicity in plants and their tolerance mecha-
nism in plants.
Chapter 14 describes the in vitro production of secondary metabolites using
elicitor in Catharanthus roseus. Elicitation has been carried out in a large number
of medicinal plants, this article deals with the Catharanthus roseus, as it is an im-
portant source of anticancer compounds Vinblastine (VLB) and Vincristine (VCR).
Handling soybeans under stress is the topic of Chapter 15. Soybean is among the
most important leguminous plants with the ability to establish symbiotic association
with the N-fixing bacteria, Bradyrhizobium japonicum. One of the most important
processes, affecting the performance of soybean under stress is the inhibited ex-
change of the signal molecules, specifically genistein, between the host legume and
B. japonicum during the initiation of symbiosis. Chapter 16 is a review on the genus
Atriplex. This review is a contribution to the knowledge on the ecological and socio-
economical potential of some plant genus Atriplex. The last Chapter 17 deals with’
the role of polyamines in stress responses’. Genetic manipulation of crop plants for
altered regulation of PA biosynthesis/catabolism may lead to improved stress toler-
ance potential.
This book will be a new contribution on crop improvement and be useful for
scientists and graduate students in the area.
Prof. Dr. Ahmet Ruhi Mermut

President, Federation of the European Soil Scientists, Turkey & Prof. of Soil
Sciences, University of Saskatchewan, Canada.
Preface
The improvement of crop species has been a basic pursuit since cultivation began
thousands of years ago. To feed an ever increasing world population will require a
great increase in food production. Wheat, corn, rice, potato and few others are ex-
pected to lead as the most important crops in the world. Enormous efforts are made
all over the world to document as well as use these resources. Everybody knows
that the introgression of genes in wheat provided the foundation for the “Green
Revolution”. Later also demonstrated the great impact that genetic resources have
on production. Several factors are contributing to high plant performance under
different environmental conditions, therefore an effective and complementary use
of all available technological tools and resources is needed to meet the challenge.
The developments in biotechnology, genomic research, and molecular marker
applications has brought to the forefront an interdisciplinary science that is revo-
lutionizing 21st century crop improvement. Many new genomics technologies like
next generation sequencing, omics technologies have emerged as powerful tools for
understanding genome variation in crop species at different molecular levels.
The era of genomics seems to be upon us and new techniques will probably
enable us to access the genetic basis of metabolomics associated traits much more
rapidly. The information and developments related to the metabolomics, tran-
scriptomics analysis and extensive phenotyping of genetically diverse populations
together with bioinformatics is going to prove of great help in the field of crop
biotechnology. These technologies will unveil the metabolic pathways for under-
resourced crop species.
In this book attempt has been made to bring together chapters from different
authors and highlight the current status of crop productivity in the light of develop-
ments in crop biotechnology, and at the same time provide information on some
recent genomic tools and novel genetic and breeding approaches with a final aim of
crop improvement. Emphasis has been laid on the topics related to advances in crop
biotechnology, the key principles influencing the current practice in crop improve-
ment programs and elucidate the nature of new approaches as well as modern tech-
niques in crop improvement and how molecular plant breeding opens new avenues
for research and is contributing to discoveries in this field.
vii
viii Preface
We hope that a new generation of researchers will benefit much from this book
and share the respect for the crop plants we all live by and concern for the mainte-
nance of diversity.
The final objective of this book is to refresh and emphasize the fact that we are
compelled to save our biodiversity, otherwise plant breeding possibilities will de-
crease to the extent that it will cost us much.
Dr. Khalid Rehman Hakeem

Dr. Parvaiz Ahmad
Prof. Munir Ozturk
Contents
1 A
grobacterium rhizogenes-Mediated Transformation and Its
Biotechnological Applications in Crops . . . . . . . . . . . . . . . . . . . . . . . . . 1
Ibrahim Ilker Ozyigit, Ilhan Dogan and Ebru Artam Tarhan
2 Bioinformatic Tools in Crop Improvement . . . . . . . . . . . . . . . . . . . . . . 49

L. F. De Filippis
3 Crop Improvement Through Plant Tissue Culture. . . . . . . . . . . . . . . . 123

Sumiya Jamsheed, Saiema Rasool, Shivani Koul,
Mohamed Mahgoub Azooz and Parvaiz Ahmad
4 Mutagenesis—A Potential Approach for Crop Improvement . . . . . . . 149

Rajib Roychowdhury and Jagatpati Tah
5 Role of Bio-fertilizers in Crop Improvement. . . . . . . . . . . . . . . . . . . . . 189

Majeed–ul-Hassan Chesti, Tabasum N. Qadri, Asiya Hamid,
Javed Qadri, Mohamed Mahgoub Azooz and Parvaiz Ahmad
6 P
lant-Microorganism Interactions: Effects on the
Tolerance of Plants to Biotic and Abiotic Stresses. . . . . . . . . . . . . . . . . 209
Muriel da Silva Folli-Pereira, Lydice Sant’Anna Meira-Haddad,
Cristina Maria Nobre Sobral de Vilhena da Cruz Houghton and
Maria Catarina Megumi Kasuya
7 B
iotic Stress and Crop Improvement:
A Wheat Focus Around Novel Strategies. . . . . . . . . . . . . . . . . . . . . . . . 239
Alvina Gul Kazi, Awais Rasheed and Abdul Mujeeb-Kazi
ariability in Fusarium species Causing

8 V
Wilt Disease in Crops: A Transcriptomic Approach to
Characterize Dialogue Between Host and Pathogen. . . . . . . . . . . . . . . 269
Reiaz ul Rehman, Khalid Rehman Hakeem, Inayatullah Tahir,
Bilal Ahmad Padder, Mehraj ul Din Shah and Mushtaq Ahmad Teli
ix
x Contents
9 C
oping Abiotic Stress with Plant Volatile Organic Chemicals
(PVOCs): A Promising Approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 295
Penna Suprasanna and Prasad Shekhar Variyar
10 An Overview of Omics for Wheat Grain Quality Improvement . . . . . 307

Awais Rasheed, Tariq Mahmood, Alvina Gul-Kazi
and Abdul Mujeeb-Kazi
11 From Agronomy to Molecular Genetics and Proteomics in an

Effort to Improve Nitrogen Use Efficiency in Crops. . . . . . . . . . . . . . . 345
Ruby Chandna and Khalid Rehman Hakeem
12 Arsenic Toxicity and Tolerance Mechanisms in Plants:

An Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 363
Saiema Rasool, Muneeb U. Rehman, Mohamed Mahgoub Azooz,
Muhammad Iqbal, Tariq Omar Siddiqi and Parvaiz Ahmad
13 Arsenic Stress in Plants: An Inside Story. . . . . . . . . . . . . . . . . . . . . . . . 379

Iti Sharma
14 In vitro Production of Secondary Metabolites Using

Elicitor in Catharanthus roseus: A Case Study. . . . . . . . . . . . . . . . . . . . 401
Zahid Hameed Siddiqui, Abdul Mujib, Mahmooduzzafar,
Junaid Aslam, Khalid Rehman Hakeem and Talat Parween
15 Handling Soybean ( Glycine max L.) Under Stress. . . . . . . . . . . . . . . . . 421

Mohammad Miransari
16 Environmental and Economical Opportunities for the

Valorisation of the Genus Atriplex: New Insights . . . . . . . . . . . . . . . . . 441
Maali Benzarti, Kilani Ben Rejeb, Ahmed Debez and Chedly Abdelly
17 Dealing with Environmental Stresses: Role

of Polyamines in Stress Responses. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 459
Rinukshi Wimalasekara and Günther F. E. Scherer
Index. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 485
About the Editors
Dr. Khalid Rehman Hakeem, PhD is Post Doctorate Research Fellow at

Universiti Putra Malaysia (UPM), Serdang, Selangor, Malaysia. He has completed
his Post Graduation (Env. Botany) as well as Ph.D. (Botany) from Jamia Hamdard,
New Delhi, India in 2006 and 2011 respectively. Dr. Hakeem has more than 6 years
of teaching/research experience in Plant Eco-Physiology, Biotechnology, as well
as Environmental sciences. Recipient of several fellowships at both national and
international levels, Dr. Hakeem has so far edited/authored more than seven books
with International publishers. He has also to his credit more than 20 research
publications in peer reviewed journals and 10 book chapters. Dr. Hakeem is
currently engaged in studying the plant processes at ecophysiological as well as
proteomic levels.
Dr. Parvaiz Ahmad, PhD is Assistant professor in Botany at A.S. College, Srinagar,
Jammu and Kashmir, India. He has completed his post-graduation in Botany in
2000 from Jamia Hamdard New Delhi India. After receiving Doctorate degree from
Indian Institute of Technology (IIT) Delhi, India he joined International Centre for
Genetic Engineering and Biotechnology, New Delhi in 2007. His main research
area is stress physiology and molecular biology. He has published more than 30
research papers in peer reviewed journals and 16 book chapters. He is also editor
of 6 volumes (5 with Springer and 1 with Studium Press-New Delhi, India). He is
recipient of Junior Research Fellowship and Senior Research Fellowship by CSIR,
India, and has been awarded Young Scientist Award under Fast Track scheme in
2007, by the Department of Science and Technology, Govt. of India. Dr. Parvaiz is
actively engaged in studying the molecular and physio-biochemical responses of
different agricultural and horticultural plants under environmental stress.
Prof. Munir Ozturk, PhD is a Consultant Fellow at Faculty of Forestry, Universiti
Putra Malaysia. He has completed his Post-Graduation in Botany in 1964 Jammu
& Kashmir University, India, Ph.D. and D.Sc. in 1970, 1975 in the field of Eco-
Physiology from Ege University, Izmir, Turkey. Dr. Ozturk was appointed as full
Professor in 1980 at the Ege University and served as Chairman of Botany from
1983–1986, and served as Director of Centre for Environmental Studies between
xi
xii About the Editors
1990–1998. His main research areas are Eco-Physiology, Phytoremediation, Sabkha

Ecosystems and Medicinal-Aromatic Plant Diversity. He has published more than
400 papers in national and international journals, more than 50 book chapters and
has edited more than 10 books with Springer and Cambridge Scholars. He is fellow
of the Islamic World Academy of Sciences.
Contributors
Bilal Ahmad Padder Division of Plant Pathology, SKAUST-K, Srinagar 191121,

India
e-mail: [email protected]
Chedly Abdelly Laboratoire des Plantes Extrêmophiles, Centre de Biotechnologie
de Borj-Cedria (CBBC), BP 901, 2050 Hammam-Lif, Tunisia
Junaid Aslam Department of Biotechnology, Hamdard University, New Delhi
110062, India
Mohamed Mahgoub Azooz Department of Biological Sciences, Faculty of
Science, King Faisal University, Hofuf, Saudi Arabia
Department of Botany, Faculty of Science, South Valley University, 83523 Qena,
Egypt
Maali Benzarti Laboratoire des Plantes Extrêmophiles, Centre de Biotechnologie
Mehraj ul Din Shah Division of Plant Pathology, SKAUST-K, Srinagar 191121,
India
Ruby Chandna Department of Botany, Jamia Hamdard New Delhi, New Delhi
110062, India
Majeed–ul-Hassan Chesti Regional Agricultural Research Station, SKUAST-J,
Tandwal, Rajouri 185131, Jammu and Kashmir, India
xiii
xiv Contributors
Lou F. De Filippis Centre for Environmental Sustainability (CENS), Department

of Environmental Sciences, University of Technology, Sydney NSW 2007, P O Box
123, Sydney, Australia
Ahmed Debez Laboratoire des Plantes Extrêmophiles, Centre de Biotechnologie
Ilhan Dogan Department of Molecular Biology and Genetics, Faculty of Science,
Izmir Institute of Technology, 35430 Urla, Izmir, Turkey
Muriel da Silva Folli-Pereira Departamento de Microbiologia, Universidade
Federal de Viçosa, 36570-000 Viçosa, Minas Gerais, Brasil
Asiya Hamid Department of Botany, GDC Budgam, Srinagar, Jammu and Kashmir,
India
Cristina Maria Nobre Sobral de Vilhena da Cruz Houghton Faculdade de
Ciências, Universidade de Lisboa, 1749-016, Lisboa, Portugal
Muhammad Iqbal Department of Botany, Faculty of Science, Jamia Hamdard,
New Delhi 110062, India
Sumiya Jamsheed Department of Botany, Faculty of Science, Jamia Hamdard,
Maria Catarina Megumi Kasuya Departamento de Microbiologia, Universidade
Federal de Viçosa, 36570-000 Viçosa, Minas Gerais, Brasil
Alvina Gul Kazi Atta-ur-Rahman School of Applied Biosciences, National
University of Sciences and Technology (NUST), Islamabad, Pakistan
Shivani Koul Department of Botany, Faculty of Science, Jamia Hamdard, New
Delhi 110062, India
Tariq Mahmood Department of Plant Sciences, Quaid-i-Azam University,
Islamabad, Pakistan
Mahmooduzzafar Department of Botany, Hamdard University, New Delhi
110062, India
Contributors xv
Mohammad Miransari AbtinBerkeh Limited Co., Imam Blvd., Shariati Blvd.,

#107, 3973173831, Tehran, Iran
Mehrabad Rudehen, Imam Ali Blvd., Mahtab Alley, 55, 3978147395, Tehran, Iran
Lydice Sant’Anna Meira-Haddad Centro de Ciências Agrárias, Ambientais e
Biológicas, Universidade Federal do Recôncavo da Bahia, Cruz das Almas, BA,
Brasil
Abdul Mujib Department of Botany, Hamdard University, New Delhi 110062,
India
Abdul Mujeeb-Kazi National Institute of Biotechnology and Genetic Engineering
(NIBGE), Faisalabad, Pakistan
Ibrahim Ilker Ozyigit Department of Biology, Faculty of Science & Arts,
Marmara University, Goztepe, 34722 Istanbul, Turkey
Talat Parween Department of Bioscience, Jamia Millia Islamia, New Delhi
110025, India
Javed Qadri Regional Agricultural Research Station, SKUAST-J, Tandwal,
Rajouri 185131, Jammu and Kashmir, India
Tabasum N. Qadri Department of Botany, GDC Budgam, Srinagar, Jammu and
Kashmir, India
Awais Rasheed Department of Plant Sciences, Quaid-i-Azam University,
Islamabad, Pakistan
Saiema Rasool Department of Botany, Faculty of Science, Jamia Hamdard, New
Delhi 110062, India
Muneeb U. Rehman Department of Medical Elementology and Toxicology,
Faculty of Science, Jamia Hamdard, New Delhi 110062, India
Reiaz ul Rehman P.G Programme in Bioresources, Department of Botany,
University of Kashmir, Srinagar 190006, India
xvi Contributors
Khalid Rehman Hakeem P.G Programme in Bioresources, Department of Botany,

University of Kashmir, Srinagar 190006, India
Faculty of Forestry, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
Kilani Ben Rejeb Laboratoire des Plantes Extrêmophiles, Centre de Biotechnologie
Physiologie Cellulaire et Moléculaire des Plantes, UR5, EAC 7180 CNRS,
Université Pierre et Marie Curie (UPMC), Case 156, 4 place Jussieu, 75252 Paris
cedex 05, France
Rajib Roychowdhury Department of Biotechnology, Visva-Bharati, Santiniketan
731235, West Bengal, India
Günther F. E. Scherer Institute of Floriculture and Wood Science, Section
of Molecular Developmental Physiology, Leibniz University of Hannover,
Herrenhäuser Str. 2, 30419, Hannover, Germany
Iti Sharma Department of Bioscience and Biotechnology, Banasthali University,
Banasthali 304022, India
Tariq Omar Siddiqi Department of Botany, Faculty of Science, Jamia Hamdard,
Zahid Hameed Siddiqui Department of Botany, Zakir Husain Delhi College,
University of Delhi, Jawahar Lal Nehru Marg, New Delhi 110002, India
Penna Suprasanna Nuclear Agriculture and Biotechnology Division, Bhabha
Atomic Research Centre, Trombay, Mumbai 400085, India
Jagatpati Tah Botany Department (UGC-CAS), The University of Burdwan,
Burdwan 713104, West Bengal, India
Inayatullah Tahir Department of Botany, University of Kashmir, Srinagar 190006,
India
Ebru Artam Tarhan Department of Biology, Faculty of Science & Arts, Marmara
University, Goztepe, 34722 Istanbul, Turkey
Contributors xvii
Mushtaq Ahmad Teli Division of Plant Pathology, SKAUST-K, Srinagar 191121,

India
Prasad Shekhar Variyar Food Technology Division, Bhabha Atomic Research
Centre, Trombay, Mumbai 400085, India
Parvaiz Ahmad Department of Botany, GDC Anantnag, Jammu and Kashmir
192101, India
Rinukshi Wimalasekara Institute of Floriculture and Wood Science, Section
of Molecular Developmental Physiology, Leibniz University of Hannover,
Herrenhäuser Str. 2, 30419, Hannover, Germany
Chapter 1
Agrobacterium rhizogenes-Mediated
Transformation and Its Biotechnological
Applications in Crops
Ibrahim Ilker Ozyigit, Ilhan Dogan and Ebru Artam Tarhan
Abstract The history of Agrobacterium-related plant biotechnology goes back for

more than three decades with the discovery of molecular mechanisms of crown gall
disease in plants. After 1980s, gene technologies began developing rapidly and today,
related with the improved gene transfer methods, plant biotechnology has become one
of the most important branches in science. Till now, the most important genes related
with agricultural affairs have been utilized for cloning of plants with the deploy-
ment of different techniques used in genetic engineering. Especially, Agrobacterium
tumefaciens was used extensively for transferring desired genetic materials to plants
rapidly and effectively by the researchers to create transgenic plants. Recognition
of the biology of Agrobacterium species and newly developed applications of their
T-DNA systems has been a great step in plant biotechnology. This chapter provides
the reader with extensive information on A. rhizogenes which is responsible for the
development of hairy root disease in a wide range of dicotyledonous plants and its
T-DNA system. This knowledge will be useful in improving utilization of crops and
the formulation of new and up-graded transgenic based food products.
Introduction
The increase in demand for food is dramatic with an expanding population

growth in the world. According to latest projections, continued increase at the
current rate of the population is expected to reach between 7.5 and 10.5 billion by
I. I. Ozyigit () · E. Artam Tarhan

Department of Biology, Faculty of Science & Arts, Marmara University,
Goztepe, 34722 Istanbul, Turkey
I. Dogan
Department of Molecular Biology and Genetics, Faculty of Science,
Izmir Institute of Technology, 35430 Urla, Izmir, Turkey
E. Artam Tarhan
K. R. Hakeem et al. (eds.), Crop Improvement, DOI 10.1007/978-1-4614-7028-1_1, 1

2 I. I. Ozyigit et al.
2050 (Census 2012). Climate changes in terms of shifting weather patterns will
result in decreased water availability and in conjunction with this, providing food
for this inevitable future population size will be a very hard task without adding
new arable lands (Milly et al. 2005). To deal with this challenge one of the ma-
jor solutions is plant breeding, which has been used since ancient times in order
to create desired genotypes and phenotypes for specific objectives. The main
goals of conventional plant breeding are improvement of crop yield and quality,
agricultural convenience and resistance to the parasites. While the conventional
plant breeding efforts used in the past were sufficient, nowadays with the increas-
ing demand additional and supplementary technology necessities emerged (Ge-
pts 2002). As a result of industrial revolution and its reflection to the biological
and agricultural sciences, plant biotechnology reached spectacular success with
understanding of how genes operate and function in plant. The first genetically
modified crops were obtained in the early 1980s by using Agrobacterium tume-
faciens following the plant regeneration systems, production of novel chimeric
genes and transformation vectors. Multidisciplinary studies of academic institu-
tions and agricultural seed companies took the leadership on genetic engineering
and biotechnological progresses of crop plants (Özcan et al. 2004). Although,
many political, regulatory, ethical and religious obstacles are still present, the
adoption rate of crop biotechnology in the area of agriculture is high at global
level. Crop biotechnology involves a different set of technologies such as indus-
trial use of recombinant DNA, cell fusion and tissue engineering. Agrobacteri-
um-mediated transformation has always been the most commonly used method
for novel transgenic technologies. Till now, a number of commercially valuable
crops like tomato, potato, rice, wheat, maize, cotton, soybean, alfalfa, barley, car-
rot, sugarcane, pepper and broccoli were obtained using Agrobacterium-mediated
transformation (Ozyigit 2012).
Characteristics of Agrobacterium rhizogenes
Certain bacterial species are capable of transferring some of their genes to higher
plants ending up with insertion and permanent integration in the nuclear genome
(Broothaerts et al. 2005; Kumar et al. 2006). Members of genus Agrobacterium are
widely known for their ability of forming a wide variety of different neoplastic dis-
eases, including crown gall ( A. tumefaciens and A. vitis), hairy root ( A. rhizogenes)
and cane gall ( A. rubi) (Gelvin 2009; Ozyigit 2012). Among them, the first identi-
fied one was A. rhizogenes (formerly Phytomonas rhizogenes) in 1930s belonging
to the family Rhizobiaceae in the alpha-2 subclass of Proteobacteria (Riker et al.
1930; Hildebrand 1934; Conn 1942; White 1972; Kersters and De Ley 1984; Woese
et al. 1984; Willems and Collins 1993).
A. rhizogenes is a rod-shaped Gram-negative, non-spore forming (0.6–1 μm by
1.5–3.0 μm in size) soil bacterium that occurs singly or in pairs and is motile by
means of one to six peritrichous flagella (Conn 1942; Meyer et al. 2000; Tzfira and
1 Agrobacterium rhizogenes-Mediated Transformation … 3
Fig. 1.1 Scanning electron

micrograph of attachment of
Agrobacterium rhizogenes
strain R1000 to sunflower
( Helianthus annuus L.) coty-
ledonary node cell
Citovsky 2000; Giri and Giri 2007; Murugesan et al. 2010) (Fig. 1.1). It is a close
relative of the better known A. tumefaciens, which is the best-characterized species
among the genus Agrobacterium (Rao 2009; Ozyigit 2012) (Fig. 1.1).
All A. rhizogenes strains are characterized by the presence of a large root induc-
ing (Ri) plasmid containing a highly conserved “core” DNA region required for
hairy root formation (Filetici et al. 1987; Gelvin 2003; Veena and Taylor 2007).
Like the crown gall disease, which is caused by A. tumefaciens (Ream 2002; Mc-
Cullen and Binns 2006; Ozyigit 2012) A. rhizogenes causes hairy root (root-mat)
disease in infected plants through genetic transformation (Weller and Stead 2002;
Weller et al. 2005).
Hairy Root Disease
The “hairy root” is the term first used in 1900 by Stewart et al. (as quoted by Hil-
debrandt 1934). The distinctive symptom of hairy root disease is the formation of
a mass of roots. Following the A. rhizogenes infection, hairy root formation occurs
as a result of protruding large numbers of small roots as fine hairs directly from
the infection site (Chandra 2012) (Fig. 1.2). Besides the plagiotropic root growth,
hairy-root disease is characterized as short internodes, a high degree of lateral
branching, wrinkled leaves, reduced apical dominance, reduced fertility, profusion
of root hairs, abnormal flower production, advanced flowering, increased number
of flowers, enhanced growth rates and changed secondary metabolite accumulation
(Ackermann 1977; Tepfer 1983; Balandrin et al. 1985; Charlwood and Charlwood
1991; Pellegrineschi et al. 1994; Flores et al. 1999; Lee et al. 2001; Keil 2002; Ca-
sanova et al. 2004; Veena and Taylor 2007) (Fig. 1.2).
Fig. 1.2 Hairy root formation induced by A. rhizogenes strain 8196 in potato ( Solanum tuberosum
L.) callus cultures (a), regenerated tobacco ( Nicotiana tabacum L.) plantlets (b). (From Arican)
In nature, when plants are suffering from wounds, phenolic compounds are re-
leased from wounded sides and that cause attraction for A. rhizogenes. The bacte-
rium moves toward the wounded sites by chemotaxis and infect plant cells. Sub-
sequent infection at wound site followed by transfer of a particular DNA segment
(T-DNA) from the root-inducing (Ri) plasmid (pRi) of the bacteria (Kumar et al.
2006). A. rhizogenes-induced roots have the unique property of being able to grow
in vitro without exogenous plant growth regulators (Lee et al. 2001; Rao and Rav-
ishankar 2002). With this unique ability, by the utilization of A. rhizogenes strains
in in vitro plant organ cultures, broad range difficulties were eliminated and as a
result, fast growing organs with the capable of producing extensive branching and
main metabolites even higher than the mother plant or new metabolites undetected
in the mother plant or in other kinds of in vitro cultures were generated (Doran
2002; Nader et al. 2006; Bensaddek et al. 2008).
Over the three decades, hairy roots have been applied in a wide range of funda-
mental studies of plant biochemistry, molecular biology, and physiology, as well as
for agricultural, horticultural, and large-scale tissue culture purposes (Doran 2002).
In general, hairy root cultures have been used extensively in root nodule research
(Diaz et al. 1989; Quandt et al. 1993; Diouf et al. 1995; Hu and Du 2006; Hirotaka
and Hiroshi 2003; Aarrouf et al. 2012), production of artificial seeds (Uozumi and
Kobayashi 1997), plant secondary metabolites and proteins (Aarrouf et al. 2012),
plant breeding and plant improvement, experimental systems to study responses to
chemicals (Downs et al. 1994; Mugnier 1997), plant morphology and development
(Bandyopadhyay et al. 2007; Turgut-Kara and Ari 2008; Hasancebi et al. 2011;
Aarrouf et al. 2012), detoxifing environmental pollutants (Rugh 2001), validate
and analyze the functions of genes conferring resistance to root specific pathogens
(Remeeus et al. 1998; Hwang et al. 2000; Alpizar et al. 2006; Aarrouf et al. 2012)
and study interactions with other organisms such as nematodes (Kifle et al. 1999),
mycorrhizal fungi and root pathogens (Mugnier 1997; Christey 2001). Besides
these sights, enhanced rooting in plants helps establishment or surviving transplant
shocks or abiotic stress like drought, salinity and heavy metal stress (Bulgakov,
2008; Li et al. 2011).
Fig. 1.3 Scanning Electron

Micrograph of A. rhizo-
genes strain 8196 colonizing
sunflower ( H. annuus L.)
cotyledonary node cell wall
The Mechanism of Hairy Root Formation
The overall process of hairy roots disease by A. rhizogenes wild strains is defined
by the following four steps. Chimiotactism is the first step leading to induced move-
ment of Agrobacterium towards to the plant cells. The following step is binding of
Agrobacterium to the surface components of the cell wall (Fig. 1.3). After binding,
transfer and integration of the transfer-DNA (T-DNA) into the plant genome is com-
pleted. The last step is subsequent induction of root formation and growth (Zupan
et al. 1996). The information gained in the first three steps is better understood be-
cause of the similarities in biological processes and existing models of pathogenesis
provided by extensive studies of A. tumefaciens stain C58 (Tomilov et al. 2007;
Abarca-Grau et al. 2011). The compositions as well as structures are broadly simi-
lar for Ri and the Ti plasmids from A. rhizogenes and A. tumefaciens, respectively
(Gelvin 2003; Ozyigit 2012) (Fig. 1.3).
Comparative studies showed a high degree of homology between Ri and Ti
plasmids indicating that there are conserved regions between the two types of plas-
mids. This shows general mechanisms such as activation, processing, and move-
ment of the T-DNA from the bacteria to the plant cell are highly sustained. A seg-
ment in both Ri and Ti plasmids called T-DNA consists of highly homologous
24-bp direct repeats known as border sequences (Yadav et al. 1982; Filichkin and
Gelvin 1993; Ziemienowicz 2001; Veena and Taylor 2007; Chandra 2012). Dur-
ing infection with Agrobacterium, T-DNA is transferred from the bacterium to the
plant cell (Rao et al. 2009). The wild-type T-DNA encodes oncogenes and opine
catabolism genes, which cause neoplastic growth of tissues and the production of
opines (Guyon et al. 1980, 1993; Costantino et al. 1994; Gaudin et al. 1994; Weis-
ing and Kahl 1996; Hong et al. 1997; Lee et al. 2001; Rao and Ravishankar 2002;
Veena and Taylor 2007). Also, another segment known as the virulence (vir) region
in the Ti-plasmid is involved in transferring of DNA into the plant genome (Bulga-
kov et al. 2004). Hairy roots are capable of growing in the absence of exogenous
plant hormones on the plant cells due to the presence of T-DNA. Agrobacterium
species are highly adapted for sophisticated parasitic relationship with host plants
and thus found to establish a unique ecological niche by genetically engineering
(Vilkar et al. 1987).
Gall Proteins
One of the similarities of Ri and Ti plasmid is that bearing nearly identical or-
ganization of the vir operons (Zhu et al. 2000). Only noticeable difference can
be seen is neither genomes nor Ri plasmids of A. rhizogenes contains virE1 and
virE2 genes (Moriguchi et al. 2001; Hodges et al. 2004). As known from studies
about A. tumafaciens VirE2 is a single-stranded DNA binding protein and VirE1
acts as a chaperone of VirE2. The VirE2 covers single-stranded T-DNA (T-strands)
from nuclease attack (Rossi et al. 1996; Ozyigit 2012) and involves nuclear im-
port of T-DNA to the plant cells (Yusibov et al. 1994; Rossi et al. 1996; Zupan
et al. 1996; Gelvin 1998). virE genes play critical roles in pathogenesis of A. tu-
mefaciens (Christie et al. 1988; Citovsky et al. 1992; Ward and Zambryski 2001;
Duckely and Hohn 2003; Ozyigit 2012). However, the absence of virE genes or no
other homolog genes in the A. rhizogenes genome clearly shows that virE genes
are not necessary in the mechanism of hairy root induction (Moriguchi et al. 2001).
Recent studies imply that despite sharing no homology, the GALLS gene located
on the Ri plasmid can substitute VirE2 function in A. tumefaciens (Hodges et al.
2004). GALLS protein differs from VirE2 with ATP-binding and helicase motifs
resembling to those in TraA protein involved in conjugation. Both GALLS and
VirE2 contain nuclear localization sequences and a C-terminal type IV secretion
signal. Mutations in these domains lead to loss of GALLS ability to substitute for
VirE2 (Sinkar et al. 1988; Hodges et al. 2006). However, mechanism of GALLS
protein in A. rhizogenes is still not fully known. All these facts reveal that in spite
of differences in their virulence systems, the Ti and Ri plasmids are share a com-
mon ancestor. However, the way of T-DNA transfer and those other variations in
T-DNA processing also show signs of independent evolution from each other. Cur-
rent understanding of the molecular bases of the differences between hairy root and
gall formation will be accelerated by further studies on genome sequencing and
comparison of various Agrobacterium strains (Hodges et al. 2006).
Ri Plasmid
Ri plasmid in all A. rhizogenes strains has a region known as T-DNA which carries
genes ( rol-genes) involved in root initiation and development and genes essential
for opine biosynthesis (Slightom et al. 1986; Hansen et al. 1994a). Agrobacterium
Fig. 1.4 Schematic representation of Mannopine type Ri plasmid of A. rhizogenes
T-DNA makes up a small region (approximately 200 kb) of Ti/Ri plasmids which

are involved in functions not only for Ti/Ri plasmid conjugation, opine synthesis
and catabolism, but also initiation, transfer and integration of the T-DNA (Ozyigit
2012). Although T-DNA contains genes with bacterial origin, these genes have eu-
karyotic regulatory sequences enabling their expression in infected plant cells (Giri
and Narasu 2000). After integration of T-DNA into genomic DNA of the plant cell,
T-DNA expresses enzymes that direct the synthesis of unusual amino acid sugar de-
rivatives known as opines, which used by the Agrobacterium as nutrient source (Pe-
tit et al. 1983; Dessaux et al. 1992; Gartland 1995; Moyano et al. 1999; Navarrete
et al. 2006; Bensaddek et al. 2008; Ozyigit 2012).
There are at least two classes of opines produced by A. rhizogenes strains. One
such class is represented by opines of agropine group, and the other class being
the agrocinopine group. Most of the A. rhizogenes strains are capable of producing
agrocinopine type opines and all or a few strains of producing agropine type opines.
The agropine-type opines including agropine, mannopine, agropinic acid and man-
nopinic acid are produced by the strains known as the agropine-type whereas all
agropine-type opines excluding agropine are produced by the strains known as the
mannopine-type (Figs. 1.4, 1.5) (White et al. 1982; Petit et al. 1983; Tempe et al.
1984; Savka et al. 1990; Gartland, 1995; Navarrete et al. 2006).
Fig. 1.5 Schematic representation of Agropine type Ri plasmid of A. rhizogenes
The most common A. rhizogenes strains which represented by Ri plasmids are

agropine-type: pRiA4, pRi1855, pRiHRI, pRi15834, and pRiLBA9402, manno-
pine-type: pRi8196, cucumopine type: pRi2659 and mikimopine-type pRi1724. Al-
though mikimopine and cucumopine are stereo-isomers, there is no homology be-
tween opine biosynthetic genes on the nucleotide level (Filetici et al. 1987; Davioud
et al. 1988; Gartland 1995; Ouartsi et al. 2004; Veena and Taylor 2007) (Fig. 1.4).
Among the different known strains of A. rhizogenes, K47, K599 and HRI are
hyper-virulent types known to be capable of infecting a broad range of plant hosts.
More research on the virulence factors of these strains needs to be done for under-
standing of whether they are located on the chromosome(s), plasmid(s) or both
(Petit et al. 1983; Isogai et al. 1988; Porter 1991; Suzuki et al. 2001). Also, there
are differences between A. rhizogenes strains in terms of polarity of infection of
the plant tissue. For example, root growth can be induced by some strains of A.
rhizogenes only on the apical surfaces of carrot root discs and yield no detectable
outgrowth on the basal surfaces, whereas root proliferation can be induced by oth-
ers both inoculation of apical and basal surfaces (Cardarelli et al. 1985; Ryder et al.
1985; Capone et al. 1989; Limami et al. 1998). Based on these findings, various A.
rhizogenes strains were further classified as polar and non-polar types. Agropine
type strains are non-polar whereas all other strains are polar. Agropine type strains
give rise to the formation of the hairy roots regardless of the orientation of the disc
and the strains other than agropine type form hairy roots when the disc is placed
inverted orientation. The presence of second T-DNA encoding genes responsible
for auxin production possibly causes observed variation in the polarity of infection
in the plant cells transformed by the agropine-type Ri plasmid (Meyer et al. 2000;
Veena and Taylor 2007) (Fig. 1.5).
Ri T-DNA Genes
Independent transformations of both left T-DNA (TL-DNA) (about 15–20 kb) and

right T-DNA (TR-DNA) (about 8–20 kb) to the plant genome termed as “split”
T-DNA are carried out by Agropine strains pRi, whereas mannopine strains only
transfer a single T-DNA (TL-DNA). TL-DNA of pRi contains the four rol genes,
designated as rolA, rolB, rolC and rolD (Schmulling et al. 1988; Petersen et al.
1989; Gelvin 2003; Bensaddek et al. 2008). In Ri plasmid, TL-DNA and TR-DNA
are separated from each other by at least 15 kb of non-integrated DNA, which is
represented by T-Central DNA (TC-DNA) as seen in Fig. 1.5.
The phenotype of hairy root is related with the genes whose products act as the
determinants located on TL-DNA (Tepfer 1984; Taylor et al. 1985; Jouanin et al.
1987b; Nakamura et al. 1988; Schmulling et al. 1988; Sinkar et al. 1988) whereas
the genes on the TR-DNA would only play a role in root induction (Cardarelli et al.
1985; Ryder et al. 1985; Cardarelli et al. 1987a; Smulders et al. 1991). Two frag-
ments, defined as TL-DNA and TR-DNA, can be transferred and integrated indepen-
dently into the plant genome during the infection process. However, the integration
capacity of TL-DNA was much higher than TR-DNA (Chilton et al. 1982; Costan-
tion et al. 1984; David et al. 1984; Grant et al. 1991; Phelep et al. 1991; Nilsson
and Olsson 1997; Holefors et al. 1998; Sevon and Oksman-Caldentey 2002; Kumar
et al. 2006; Navarrete et al. 2006; Bensaddek et al. 2008). Furthermore, the present
findings imply that a higher number of Ri-T-DNA copies integrated into the plant
genome increase the phenotypic effect in the Ri-line (Christensen et al 2008).
TR-DNA
It was found that the right T-DNA (TR-DNA) contains genes homologous to T-DNA
of A. tumefaciens Ti plasmid (Huffman et al. 1984; Jouanin 1984; Vilaine and Casse-
Delbart 1987; Hansen et al. 1991; Chandra 2012). Among them, the most impor-
tant genes are those homologous to the tms1 and tms2 of the Ti-plasmid. tms1 and
tms2 genes play important roles in auxin biosynthesis in A. tumefaciens (Inze et al.
1984; Schröder et al. 1984; Thomashow et al. 1984, 1986; Vilaine and Casse-Delbart
1987). Homology, mutagenesis and complementation experiments show that the two
Fig. 1.6 Schematic represen-

tation of gene locations on
TR-DNA
morphogenic loci located on the TR-DNA are counterpart of the tms loci located
on the Ti plasmids and involve in hairy root tumorigenesis (White et al. 1985). In
A. rhizogenes infected Nicotiana glauca tissue, the transcripts of the tms loci of Ri
plasmids are found to be similar in size to those transcripts found in the tms region
of Ti-plasmids (Willmitzer et al. 1983; Taylor et al. 1985; Vilaine and Casse-Delbart
1987). Similar transcripts were also found in carrot plants regenerated from tissues
infected with A. rhizogenes (De Paolis et al. 1985; Vilaine and Casse-Delbart 1987).
The root induction is probably due to auxin biosynthesis carried out by the aux loci
located on TR-DNA. The aux loci are found to be homologous to the tms loci of A.
tumefaciens T-DNA (Vilaine and Casse-Delbart 1987).
aux1, aux2, rolBTR, mas1, mas2, and ags genes located on the TR-DNA are
responsible for the biosynthesis of agropine and auxin, which cause differences
in hairy root growth and morphology when compared to non-transformed roots
(Fig. 1.6). It was also reported that the presence of these genes on transformed plant
cells caused increase auxin sensitivity (Grant et al. 1991; Lambert and Tepfer 1992;
van der Salm et al. 1997; Hansen et al. 1997; Meyer et al. 2000; Alpizar et al. 2006;
Nemoto et al. 2009).
Sequence analysis revealed two open reading frames corresponding to proteins
of 749 amino acids as aux1 gene protein and 466 amino acids aux2 gene protein
(De Paolis et al. 1985; Camilleri and Jouanin 1991; Gaudin and Jouanin 1995;
Christensen et al. 2008; Chandra 2012). Auxin biosynthetic pathway comprises two
steps. The t2m (tryptophan 2- monooxygenase) gene product encoded by the aux1
catalyzes the conversion of tryptophan to indole-3-acetamide (IAM) (Comai and
Kosuge 1982; Van Onckelen et al. 1986; Camilleri and Jouanin 1991). Then, IAM
is converted to indole-3-acetic acid (IAA) by IAM hydrolase, the product of the
aux2 (Jouanin 1984; Schröder et al. 1984; Thomashow et al. 1984). The T-DNA of
mannopine, cucumopine and mikimopine type strains in Ri plasmids do not carry
aux genes. Since these strains are still capable to induce a “hairy-root” phenotype, it
can be said that the presence of the aux genes on TR-DNA is not necessary to gener-
ate hairy root phenotype. It has been demonstrated that the aux genes are required
to support the “hairy root” phenotype and to extend the host range of the bacterium
(White et al. 1985; Cardarelli et al. 1987b; Hansen et al. 1991; Sevon and Oksman-
Caldentey 2002).
Hybridization experiments also revealed that the genes encoding agropine bio-
synthesis ( ags) are also located on the TR-DNA region (Willmitzer et al. 1982;
Huffman et al. 1984; Lahners et al. 1984; Vilaine and Casse-Delbart 1987; Giri and
Fig. 1.7 Schematic representation of gene locations on TL-DNA
Narasu 2000; Christey 2001). Deletion of the right border of nopaline-type or oc-
topine-type T-DNA in Ri plasmids appears to affect virulence. Also, mutations cre-
ated within this region have the same effect as removing the tms loci of Ti plasmid
resulted with being avirulent on plants. The deletion of TL-DNA in Ri plasmids
is being less susceptible to oncogenic transformation than the TR-DNA deletion
(Vilaine and Casse-Delbart 1987). Expression of the TR-DNA alone can induce root
formation in some plants, but the resulting phenotype is not as strong as when both
TL- and TR-DNA are introduced together (Vilaine and Casse-Delbart 1987).
TL-DNA
The size of TL-DNA of agropine type Ri-plasmid is about 19–20 kb in length but,
unlike the TR-DNA, it does not appear to be closely related to any other characterized
loci of Ti-plasmids (Huffman et al. 1984; Vilaine and Casse-Delbart 1987; Aoki and
Syono 1999; Chandra 2012). In many species, TL-DNA size seems almost constant,
except in Nicotiana tabacum consisting shorter TL-DNA (Jouanin et al. 1987b). The
mannopine/cucumopine type T-DNAs and the agropine type TL-DNA contain two
strongly conserved regions which flank an only partially homologous central region
(Filetici et al. 1987; Brevet and Tempe 1988; Aoki and Syono 1999; Chandra 2012).
A substance carrying out stimulation of hairy root differentiation under the influence
of endogenous auxin is synthesized by genes of TL-DNA (Ooms et al. 1986; Shen
et al. 1988; Giri and Narasu 2000; Mishra and Ranjan 2008).
As a result of mutagenesis in TL-DNA of Ri plasmid, the loss or attenuation of
virulence is shown (White et al. 1985). The TL-DNA of Ri plasmids carrying several
loci is identified to be essential for hairy root induction (so-called rol genes for root
oncogenic loci) (Fig. 1.7). Transposon mutagenesis in the TL-DNA has identified
at least four genes ( rolA, rolB, rolC and rolD) involved in tumorigenesis as affect-
ing some plants (White et al. 1985; Estramareix et al. 1986; Slightom et al. 1986;
Vilaine and Casse-Delbart 1987; Meyer et al. 2000; Christensen et al. 2008). All rol
genes have been shown to carry out formation of hairy root phenotype (White et al.
1985; Cardarelli 1987a; Jouanin 1987a; Vilaine et al. 1987a; Schmulling et al. 1988;
Petersen et al. 1989; Lee et al. 2001; Bensaddek et al. 2008). It has been reported
that the TL-DNA of the agropine-type Ri plasmid consists of at least 18 open read-
ing frames (ORF). ORF 10, 11, 12 and 15 coincided with rolA, rolB, rolC and rolD,
respectively (Slightom et al. 1986; Scorza et al. 1994).
Rol Genes
The T-DNAs have many other genes other than those opine and hormone synthesis
genes. Although their functions are not well characterized, they are known to have
very strong effects on growth. At least four genetic loci (rolA, B, C and D) were
identified in the T-DNA regions of pRiA4 by a series of deletions and transposon
insertions studies and shown to play important roles of root-inducing properties
of A. rhizogenes on the TL-DNA (Table 1.1) (White et al. 1985). The rol genes lo-
cated on the TL-DNA of Ri plasmid modify auxin and cytokinin biosynthesis and/
or endogenous hormone levels and their expressions stimulate the formation of
roots in transformed tissues (Nilsson et al. 1993a; Maurel et al. 1994; Moritz and
Schmülling 1998; Shen et al. 1990; Bonhomme et al. 2000; Ishizaki et al. 2002;
Hong et al. 2006; Bensaddek et al. 2008). Studies have focused on characterizing
the three rol genes named as rolA, rolB, and rolC because they are considered es-
sential for the hairy root initiation based on transposon “loss-of-function” analysis
(White et al. 1985). Induced adventitious root formation by rolA, rolB and rolC
genes is shown on tobacco, kalanchoe and tomato leaves (Cardarelli et al. 1987a;
Spena et al. 1987; Vilaine et al. 1987; Spano et al. 1988; van Altvorst et al. 1992; Ki-
yokawa et al. 1994) and plants carrying these genes are morphologically equivalent
to those carrying the whole TL-DNA (Spano et al. 1988). Inactivation or overexpres-
sion of various rol genes in stable transgenic lines or hairy-root cultures exhibits dif-
ferent variations in plant phenotypes and root morphology (Schmulling et al. 1988;
Martin-Tanguy et al. 1996; Casanova et al. 2004).
rolA
The rolA gene is found on all Ri plasmids and encodes a small protein with a
molecular mass of approximately 11 kDa (Nilsson and Olsson 1997). The rolA
gene sequence length differs in various A. rhizogenes strains ranges from 279 to
423 bp (Meyer et al. 2000). Analysis of amino acid sequences showed that rolA
encodes a protein with basic isoelectric point (PI 11.2). It also contains a frequent
sequence motif common in DNA-binding proteins (Suzuki 1989) and proposed
to function as a regulatory transcription factor (Levesque et al. 1988; Veena and
Taylor 2007).
A dramatic reduction in several classes of hormones, including auxin, cytokinin,
gibberellic acid (GA) and abscisic acid triggered by the expression of rolA gene is
Table 1.1 Oncogenes of A. rhizogenes, their encoded proteins, functions and phenotypic changes
in host plants
Gene Protein Function Phenotype
rolA Sequence motif Inhibits cell elongation via Stunted growth, dark green
common in DNA- diffusible factor wrinkled leaves with
binding proteins Decreases hormone an altered length to
Regulatory transcrip- concentrations width ratio, condensed
tion factor Increase sensitivity to auxin inflorescences, retarded
Modulating hormone physiol- onset of flowering,
ogy of GA compact reduced number
Interfere polyamine of flowers
metabolism
Correlate with plasma mem-
brane H+ ATPase activity
rolB Localizes to plasma Alterations in the reception/ Fast growth, root meri-
membrane transduction of the auxin stem neoformation,
signal high branching and
Stimulates new meristem plagiotropism
formation
Induce secondary metabolism
rolC Phloem-specific Reduces cell size Increased branching,
expression in the Reduces abscisic acid (ABA), dwarfed plants with short
root, low expres- polyamine, and ethylene internodes, reduced epi-
sion in the leaf, levels dermal cell size in inter-
and no expression Formation of shoot meristems nodes, lanceolate leaves,
in the shoot tip Regulate sugar metabolism early flowering, reduced
and transport flower size and reduced
Stimulate the production of pollen production
high levels of secondary
metabolites
rolD Only expresses in Incapable of inducing root Increased flowering, reduced
Agropine type formation on its own rooting, elongating and
strains Provide defense response as expanding tissues of each
Cytosolic protein a result of environmental organ but not on apical
Exhibits poor tissue- stress meristem, callus growth
or organ-specific giving rise to initia-
expression tion of tumor resemble
formation
rolBTR CX5R motif is absent rolB homolog on TR-DNA Wrinkled leaves bent
N-terminal part in the agropine type Ri strongly downward,
contain 14 amino plasmid formed shoots at the base
acids of the stem and retarded
growth
ORF3n Modification of phe- Negative regulator to the Retarded flowering, less
nolic enzymes and dedifferentiation of tissues dense inflorescences,
involve secondary altered internode elonga-
metabolism and/ tion and leaf morphology
or the transport of and necrotic tips of upper
hormones leaves, sepals and bracts
no sign of necrosis on the
basal leaves
Table 1.1 (continued)

Gene Protein Function Phenotype
ORF8 Fusion protein Modifies sucrose transport Growth retardation, chlo-
consisting of N-terminal domain causes rotic and necrotic leaves
N-terminal sugar/starch accumulation and accumulation of high
domain (NORF8) C-terminal domain reduces levels of sugars (glucose,
and C-terminal sugar/starch accumulation fructose and sucrose) and
part (CORF8) starch
Tryptophan monoox-
ygenase activity
ORF13 Contains a con- Hormone homeostasis and Induce cell proliferation
servative regulation of the cell cycle such as dense green and
retinoblastoma Increases number of mitoses rapidly proliferating cal-
(RB)-binding in shoot apical meristem lus, including irregular
motif LxCxE Induces dedifferentiation (pre- formation of leaves,
requisite to competence) severe leaf nervure,
Graft transmissible shortened and variable
internode length, abnor-
mal and asymmetric
flowers, agravitropic root
growth and a reduced
cell number and cell size
in the root
ORF13a Tissue specific Necessary for root induction Not yield a visible
manner in plants, Regulatory function of itself phenotype
primarily in leaf
vascular tissues
May interact directly
with DNA
SPXX repeat motif
ORF14 Auxin like effect Act together with ORF13 to No morphological change
induce root induction
observed in N. tabacum. The reduction ratio depends on tissue type and growth stage
of the plant (Dehio et al. 1993). It was demonstrated that despite low level of auxin
concentration, auxin sensitivity is enhanced in transgenic plants (Maurel et al. 1991;
Vansuyt et al. 1992). Additionally, the effects of rolA can be attenuated, probably
through methylation (Martin-Tanguy et al. 1996; Lee et al. 2001). Inactivation of
rolA leads to the formation of long, straight roots giving a less compact appearance
on Kalanchoe daigremontiana leaves (Vilaine and Casse-Delbart 1987). Transgenic
N. tabacum plants are also show stunted growth, dark green wrinkled leaves with an
altered length to width ratio, condensed inflorescences, retarded onset of flowering,
a reduced number of flowers and compact styles (Dehio et al. 1993).
A. rhizogenes infected plant tissues are 100 times more sensitive to auxin than
normal phenotype exhibiting plant tissues. This suggests that the increased sensitiv-
ity of transformed plants should not be due to a particular insertion position of the
rolA gene in the transgenic plant genome, but rather reflects the effect(s) of the rolA
gene product (Vansuyt et al. 1992). It was found that N. tabacum leaves of rolA
transgenic clones show 40–60 % reduction of GA content compared to wild-type

leaves. The reduction of GA content is indirectly cause stem elongation and planar
leaf blade growth (Dehio et al. 1993). When the wild-types of N. tabacum treated
by gibberellin biosynthesis inhibitors, rolA expressing plants and wild types show
similar phenotypes. On the other hand, when rolA transgenic plants treated with GA,
the phenotype of transgenic plant not completely restored (Dehio and Schell 1993;
Dehio et al. 1993). All these shows that the rolA gene has been considered in playing
an important role in modulating hormone physiology of GA and polyamine metabo-
lism (Sun et al. 1991; Dehio and Schell 1993; Dehio et al. 1993; Prinsen et al. 1994;
Martin-Tanguy et al. 1996; Veena and Taylor 2007). It was thought that the sensitiv-
ity of auxin response might correlate with plasma membrane H+ ATPase activity ob-
served in rolA expressing transgenic plants (Maurel et al. 1991; Vansuyt et al. 1992).
There is data suggesting that there is an antagonism between rolA and rolB genes
in general. An observation of additional transcripts ranging from 2.1 to 2.8 kb in
size explains this antagonism (Durand-Tardif et al. 1985). Size of transcription of
rolA would be more than 2 kb. This would span the whole rolB sequence, leading to
the generation of an antisense message for rolB. Its occurrence could be the major
cause of antagonism between rolA and rolB in the transformed plant cells. Probably,
existence of a mechanism prevents co-expression of rolA and rolB (Capone et al.
1989; van Altvorst et al. 1992; Veena and Taylor 2007).
rolB
The rolB gene size ranging 765 (strain 8196) to 840 bp (strain 2659) length depend-
ing on the strain and encodes 254–279 amino acid protein which has molecular
weight of 30 kDa localized in the plasma membrane (Filippini et al. 1996; Meyer
et al. 2000; Veena and Taylor 2007). rolB gene is present in all Ri plasmids with
approximately 60 % identity between strains (Meyer et al. 2000). RolB proteins
encoded by pRi1724 and pRi2659 have a 17 amino acid longer N-terminal stretch
than the RolB proteins encoded by pRi1855 (pRiA4) (Meyer et al. 2000). The phys-
ical presence of the rolB gene in TL-DNA segment of Ri plasmid of the infecting
Agrobacterium in leaf tissues of plants regenerated from selected rhizoclones was
demonstrated by a positive PCR amplification (Pal et al. 2012).
The reports have shown that the RolB may have a critical role in early steps of
hairy-root induction (Bellincampi et al. 1996). The root induction is totally allevi-
ated when rolB gene is inactivated in the pRiA4 on kalanchoe leaves (White et al.
1985). rolB also has capacity nearly as much as the wild type A. rhizogenes T-
DNA for enhancing rooting and hairy root formation on wounded N. tabacum stems
(Cardarelli et al. 1987b; Bellincampi et al. 1996; Altamura and Tomassi 1998; Binns
and Costantino 1998) and leaves (Spena et al. 1987).
Phenotypical abnormalities such as root meristem neoformation on leaf discs and
fast growth of rolB-transgenic plants and growth pattern of rolB-induced roots are
characterized by fast growth, high branching, and plagiotropism. As a result of these
observations firstly suggested that there is a similarity between the auxin-mediated

effects and morphogenic effects of rolB. However, further studies demonstrated
that an auxin-induced hyperpolarization at the plasma membrane is exhibited by
rolB-transformed plants. The morphogenic effects of rolB involve changes in either
the responsiveness to auxin or in auxin content (Cardarelli et al. 1987b; Shen et al.
1988; Capone et al. 1989; Maurel et al. 1991). Activation of auxin-induced hyper-
polarization through H+ ATPase protein pump at the plasma membrane appears to
be related to the proton excretion (Ephritikhine et al. 1987; Keller and Van Volken-
burgh 1998). rolB gene causes transformed plant cells to bind more auxin than wild
type and the additional auxin-binding activity is completely abolished by using anti-
RolB antibodies (Filippini et al. 1994; Shoja 2010).
Estruch et al. (1991) reported that RolB protein exhibits a β-glucosidase activ-
ity able to hydrolyze biologically active indole-3-glucosidese. It can be explained
by the increased auxin perception and sensitivity with releasing the hormone from
β-glucoside conjugates. As a result of increase concentration of auxin cause the
phenotypic alterations observed in rolB transgenic tissues (Shen et al. 1988, 1990;
Maurel et al. 1991, 1994; Meyer et al. 2000). However, later studies showed that
neither the intracellular concentration nor the metabolism of auxin was changed
by rolB expression in plant cells. Rather, the increased auxin sensitivity of rolB-
transformed cells results from alterations in the reception/transduction of the auxin
signal (Nilsson et al. 1993b; Schmülling et al. 1993; Delbarre et al. 1994; Bellin-
campi et al. 1996; Veena and Taylor 2007).
Overexpressing rolB gene under a constitutive promoter in transgenic plants
suppresses adventitious root induction (Spena et al. 1987) and necrosis in callus
tissues and leaves of young plants (Schmulling et al. 1988). Both callus and root
formations at wound sites are cancelled if mutations occur in rolB gene (Vilaine and
Casse-Delbart 1987). Normal growth of these organs depends upon the expression
level of rolB gene necessary for active growth of hairy roots. A high or low level
of expression correlates with impaired growth of these organs (Tanaka et al. 2001;
Veena and Taylor 2007).
A. rhizogenes rol genes enhance the biosynthesis of certain groups of secondary
metabolites in transformed plant cells. It was shown that rolB is apparently the most
powerful inducer of secondary metabolism and at the same time, the most important
inhibitor of callus growth (Palazon et al. 1998; Bonhomme et al. 2000; Bulgakov
et al. 2002a; Shkryl et al. 2008; Shoja 2010). rolB gene mediated stimulatory effect
on resveratrol and anthraquinone production suppresses with the tyrosine phospha-
tase inhibitors proven that RolB also has tyrosine phosphatase activity (Filippini
et al. 1996; Kiselev et al. 2007).
rolC
The rolC gene sequences vary in different strains but their sizes are similar and
ranging between 537 bp (strain 8196) to 543 bp (strain 2659, 1724 and A4). rolC
gene encodes 178–180 amino acid protein (approximately 20 kDa) that share more
than 65 % identity with each other (Meyer et al. 2000).
rolC transformed plants exhibited reduced apical dominance leading to increased
branching, dwarfed plants with short internodes, lanceolate leaves, early flowering,
reduced flower size and reduced pollen production (Schmulling et al. 1988). Dwarf-
ing was caused by reduced epidermal cell size in internodes (Oono et al. 1990).
Regulation of expression of rolC is complex, and varies depending upon the exis-
tence of the complete T-DNA sequences. In addition, root production was increased
compared to untransformed plants, but decreased compared to plants transformed
with the complete set of rol genes (Palazòn et al. 1998). Expressing rolC shows
phloem-specific expression in the root, low expression in the leaf, and no expres-
sion in the shoot tip (Schmulling et al. 1988; Estruch et al. 1991). However, rolC is
highly expressed in leaves when the whole T-DNA is present (Durand-Tardif et al.
1985; Leach and Aoyagi 1991). More recently, rolC gene has been shown to play
a role in formation of shoot meristems, hence suggesting its important role in the
formation of pluripotent stem cells (Gorpenchenko et al. 2006).
The rolC promoter is utilized extensively for phloem-specific gene expression
making it a useful tool in some biotechnological programs on pathogen resistance.
Replication of many plant viruses, including luteoviruses, reoviruses and most
geminiviruses transmitted by hemipteran vectors occur exclusively in phloem-
associated tissues. Therefore, by introducing an insecticidal gene that is toxic to
hemipteran vectors under the control of phloem-specific rolC is a promising way
for the control of such viruses through its expression in transgenic plants (Graham
et al. 1997). Similarly, a plant lectin with insecticidal activity is encoded by ASAL
( Allium sativum leaf agglutinin) gene and under control of the rolC promoter, it
confers resistance against various hemipteran pests in transgenic rice, tobacco and
chickpea plants (Saha et al. 2007).
rolC is known to stimulate rooting by an auxin-like effect of the gene (Schmull-
ing et al. 1988; Zuker et al. 2001; Casanova et al. 2003). An increase in auxin
sensitivity may lead to occurrence of the auxin-like effect. In fact, in comparison
between rolC transgenic N. tabacum protoplasts and their wild-type counterparts
showed that more sensitivity was recorded in transgenic N. tabacum in the measure-
ment of transmembrane hyperpolarization in response to auxin (Maurel et al. 1991;
Shoja 2010).
Also, abscisic acid (ABA), polyamine, and ethylene levels are extensively re-
duced due to rolC expression. The promoter of rolC activated by sucrose was found
to be very high (Yokoyama et al. 1994; Faiss et al. 1996), implying that rolC may be
influencing the source-sink relationship of a plant by regulating sugar metabolism
and transport (Nilsson et al. 1996a, b; Martin-Tanguy 2001).
Alike rolB, the rolC gene is able to stimulate the production of high levels of sec-
ondary metabolites such as tropane alkaloids (Bonhomme et al. 2000), pyridine al-
kaloids, indole alkaloids (Palazon et al. 1998), ginsenosides (Bulgakov et al. 1998)
and anthraquinone phytoalexins (Bulgakov et al. 2002b; Shkryl et al. 2008; Shoja
2010) in transgenic plants.
rolD
The rolD gene is found only in TL-DNA of agropine type Ri plasmids. It is also
the only rol gene that is incapable of inducing root formation on its own (Mauro
et al. 1996). The rolD gene size 1,032 bp and encodes a protein of 344 amino acids
(Meyer et al. 2000; Christey 2001). This is a cytosolic protein with a sequence
similar to ornithine cyclodeaminase (OCD) that catalyzes the conversion of orni-
thine to proline. Proline is an osmoprotectant and its accumulation is considered
to be a defense response as a result of environmental stress in many plant species
(Mauro et al. 1996; Trovato et al. 2001; Bettini et al. 2003). High levels of proline
accumulation are in flowers suggesting a role in flowering (Trovato et al. 2001).
The pleiotropic effects induced by expression of rolD gene in transgenic plants are
increased flowering and reduced rooting (Mauro et al. 1996; Trovato et al. 2001).
Although flower yield is accelerated, the flowers show heteromorphic incompa-
bility, which prevents self-fertilization. Production of viable seeds is achieved
through manually-selfed plants (Mauro et al. 1996). However, it should be noted
that these experiments were conducted using the rolD sequence from pRi1855. It
has been reported that the induction of flowering is not performed by rolD from
pRiHRI (Lemcke and Schmulling 1998). rolD exhibits poor tissue- or organ-spe-
cific expression in comparison with other rol genes but is shown to have a pre-
dominantly developmental expression pattern (Vilaine and Casse-Delbart 1987).
Activity is seen in the elongating and expanding tissues of each organ in adult
plants, but never in apical meristems. As the plants age, expression decreases and
ceases at senescence. The mutations in rolD appear to accentuate callus growth
giving rise to initiation of tumor formation resembling the Ti-plasmid infection
(Trovato et al. 1997).
rolBTR (rolB Homologue in TR-DNA)
A rolB homolog on TR-DNA in the agropine type Ri plasmid was discovered and
named as rolBTR. Excluding the 5′ or 3′ flanking sequences, there is a 53 % nucleo-
tide similarity between rolBTR and rolB in their sequences (Bouchez and Camilleri
1990). The expression of rolBTR in N. tabacum is shown to cause phenotypical
alterations such as wrinkled leaves bent strongly downward, formed shoots at the
base of the stem and retarded growth is observed which are different than rolB
phenotype. Two big differences were noted by the alignment of protein sequences
of rolB and rolBTR. First, a CX5R motif is absent in rolBTR and second, N-terminal
part of RolBTR contains 14 amino acids and mutations in the corresponding se-
quence in rolBTR gene cause abolishment of the altered phenotype (Lemcke and
Schmulling 1998).
ORF Genes
Besides rol (root locus) genes, there are several ORFs (Open Reading Frames) locat-
ed on the TL-DNA (Slightom et al. 1986). Many of 18 open reading frames (ORFs)
nucleotide sequences identified on TL-DNA region contain 5′ and 3′ regulatory ele-
ments similar to those found in eukaryotic genes. They have at least 255 nucleotides
and start with the initiation codon ATG (Slightom et al. 1986; Holefors et al. 1998).
In many cases, CCAAT and TATA elements were situated upstream of putative tran-
scriptional initiation codons and poly(A) addition (AATAAA) elements were present
in presumed 3′-noncoding regions (Slightom et al. 1986). The sequence length of
coding regions of ORFs differ in ranging from 255 bp (ORF 9) up to 2280 bp (ORF8)
and encode protein products ranging in size from 9,600 to 85,000 daltons, respective-
ly. The results from analysis of insertion mutants within the T-DNA region (White
et al. 1985) and transformation experiments with individual or combinations of the
ORFs have showed that the open reading frames ORF10, 11 and 12, corresponding
to the genes rolA, rolB and rolC, were able to promote the formation of hairy root
syndrome (Table 1.1) (Jouanin et al. 1987b; Vilaine et al. 1987; Spena et al. 1987;
Spano et al. 1988; Schmulling et al. 1988). Besides this, it has been showed that
ORF3n, ORF8 and ORF13 DNA sequences are highly conserved among all known
Ri plasmids, indicating that they alter plant morphogenesis or response of transgenic
tissues to plant hormones (Lemcke and Schmulling 1998; Veena and Taylor 2007).
The sensitivity to auxin and cytokinin in combination or auxin alone can be lowered
by expressions of both ORF3n and ORF8 (Lemcke and Schmulling 1998).
ORF3n
Expression of ORF3n in transgenic N. tabacum caused retarded flowering, less

dense inflorescences, altered internode elongation and leaf morphology and necrot-
ic tips of upper leaves, sepals and bracts (Lemcke and Schmulling 1998). Appear-
ance of localized necrosis was noticed on the tips of apical narrow leaves whereas
there was no sign of necrosis on the basal leaves. Additionally, senescence was not
altered in these leaves, and bracts became necrotic as a whole. On sepals, the ne-
crosis emerged on the tips just when the corolla was visible through the calyx (Kol-
tunow et al. 2001; Lemcke and Schmulling 1998). The ORF3n protein (48.7 kDa)
resembles phenolic-modifying enzymes and may be involved in secondary metab-
olism and/or the transport of hormones (Binns et al. 1987; Jacobs and Rubery 1988;
Lemcke and Schmulling 1998). A cessation was observed in the shoot formation
from ORF3n callus in response to auxin and cytokinin. Also, plantlets transferred
to the medium containing auxin and cytokinin showed decreased sensitivity lead-
ing to small and fewer calli than controls. Thus, it has been proposed that ORF3n
may act to negative regulator to the dedifferentiation of tissues as a reaction to
auxin and cytokinin, which may favor the formation of rol gene-induced roots from
such cells during pathogenesis (Britton et al. 2008; Dodueva 2007).
ORF8
The ORF8 gene has the longest sequence of TL-DNA and coding for a protein con-
taining 780 amino acids (Slightom et al. 1986). The ORF8 protein has one of the
most conserved amino acid sequences (81 % similarity) between different strains
like pRiA4 and pRi2659 (Ouartsi et al. 2004).
The protein encoded by the ORF8 gene is a natural fusion protein consisting of
N-terminal domain (NORF8) of 213 amino acids homologous to RolB protein of
the A. rhizogenes strain A4 T-DNA and the C-terminal part (CORF8) of approxi-
mately 506–524 amino acids shows homology to the IaaM proteins of various other
bacteria (Yamada et al. 1985; Slightom et al. 1986; Levesque et al. 1988; Dodueva
2007; Shoja 2010). iaaM genes that homologues to the coding sequence of CORF8
codes for a tryptophan monooxygenase which catalyzes the formation of indole-3-
acetamide (IAM) from tryptophan (Lemcke et al. 2000).
Furthermore, ORF8 possesses a 200 amino acid stretch at its N-terminus that
shows homology with the rolB gene product (33.5 % amino acid identity) (Levesque
et al. 1988). The N-terminal part (NORF8) of this protein functions in carbohydrate
metabolism such that when only NORF8 was expressed, transformed plant showed
growth retardation, chlorotic and necrotic leaves and accumulation of high levels of
sugars (glucose, fructose and sucrose) and starch (Otten and Helfer 2001).
However, some studies show that the auxin content can be elevated by the
genes found in the TL-DNA region on the T-DNA in some hosts, independent of
the presence of the TR-DNA (Lemcke et al. 2000). Presumably this occurs because
of conversion of IAM to IAA in cells expressing only t2m protein (Klee et al. 1987;
Prinsen et al. 1990). Besides this, as a characteristic functional motif of the t2m pro-
teins that catalyzes decarboxylation of tryptophan to indole-3-acetamide exhibits
23-aminoacid- long a flavin adenine dinucleotide (FAD) binding site was identified
by Levesque et al. (1988). The experimental data obtained from plants and bacteria
suggest that the gene product of ORF8 of A. rhizogenes TL-DNA has t2m activ-
ity responsible for the increased IAM content in transgenic tissues (Lemcke et al.
2000). Moreover, there is a physical connection between N- and C-regions of ORF8
protein required for the emergence of a specific phenotype in transgenic plants con-
sisting ORF8 gene. This suggests a distinct specific function for the whole protein
(Umber et al. 2005; Dodueva 2007).
ORF13 and ORF14
The ORF13 and ORF14 genes are found to be highly conserved among A. rhizo-
genes strains (Stieger et al. 2004). It has been demonstrated that alone A4-rolABC
genes carried by an Agrobacterium strain are showed to be incapable of inducing
rooting on carrot disc and aux genes located on the TR-DNA or ORF13 and ORF14
located on TL-DNA are also required for rooting (Cardarelli et al. 1987b; Capone
et al. 1989). In N. tabacum leaf discs harboring rolB and ORF13 genes had capac-
ity to induce rooting almost as well as the full length of TL-DNA (Aoki and Syono
1999). The results obtained via co-inoculation of leaf discs achieved using the rolA,
rolB and rolC with either ORF13 or ORF14 showed a limited root induction on car-
rot disks (Capone et al. 1989). A comparison from the studies showed that there is
no homology between ORF13/ORF14 and auxin biosynthetic genes. Furthermore,
unlike the genes controlling biosynthesis of auxin (Camilleri and Jouanin 1991),
ORF13 and ORF14 have no activity for the induction of roots on N. tabacum leaf
discs (Cardarelli et al. 1987b). A highly divergent gene family known as plast gene
family is constituted by rolB, rolC, ORF13 and ORF14. They have similar func-
tions and are thought to be evolutionary related (Levesque et al. 1988).
The ORF13 gene is approximately 600 bp in size, encoding a 197–200 amino
acid protein, whose expression leads to higher levels in leaves and roots (Durand-
Tardif et al. 1985; Veena and Taylor 2007). ORF13 gene leads to the formation of
induce cell proliferation such as dense green and rapidly proliferating callus on
transformed carrot root and tobacco leaf discs (Capone et al. 1989; Frundt et al.
1998; Dodueva 2007). Wound-inducible and organ-specific expression of ORF13 in
transgenic plants lead to a variety of characteristic modifications including irregular
formation of leaves, severe leaf nervure, shortened and variable internode length,
abnormal and asymmetric flowers, agravitropic root growth and a reduced cell
number and cell size in the root (Hansen et al. 1993, 1997; Lemcke and Schmulling
1998; Veena and Taylor 2007). Accelerated expression level in ORF13 gene trig-
gered a more severe reduction of growth in stem and roots through TC-dependent
overproduction of the ORF13 gene product, affecting both cell number and cell size
in the root. Interestingly, growth and gravitropism was normal in the ORF13 high
expressers (Lemcke and Schmulling 1998).
Expression of ORF13 provokes specific phenotype similar to cytokinin-treated
plants however free or bound cytokinin content of the transformed tissues shows
no difference from wild-type (Medford et al. 1989; Hansen et al. 1993; Lemcke
and Schmulling 1998). Furthermore, the shoot part of the ORF13 transformed plant
does not resemble cytokinin-overproducing plants, indeed the growth reduction re-
sults from the inhibition of cell division in the apical meristems and development
of leaves (Lemcke and Schmülling 1998). Some of the phenotypic alterations in
transgenic plants are thought to arise from interaction of ORF13 with hormone
signaling pathways. ORF13 may play roles in hormone homeostasis and regulation
of the cell cycle in infected cells (Veena and Taylor 2007). The observations and
grafting of transgenic shoots onto wild type plants revealed that ORF13 may cause
the production of a diffusible factor with cytokinin-like activity (Hansen et al. 1993;
Dodueva 2007).
Since the only T-DNA gene that induces cell proliferation is ORF13, when in-
oculated with both carrot discs and tobacco leaf discs produce green callus (Hansen
et al. 1993; Frundt et al. 1998). Application of exogenous cytokinin increases the
number of roots produced from ORF13 tobacco leaf discs, but does not change root
induction on untransformed, even though there was no difference in endogenous cy-
tokinin levels (Specq et al. 1994; Lemcke and Schmulling 1998, Britton et al. 2008).
Furthermore, endoreduplication was reduced in ORF13 plants (Meyer et al. 2000),

indicating an interaction of ORF13 with cell cycle control. Stieger et al. (2004)
claimed that a proliferative effect of ORF13 expression in the shoot apical meristem
(SAM) caused increased number of mitoses and showed no influence on meristem
structure. In consequence, the reductions of cell and meristem sizes and the retar-
dation in the formation of leaf primordia were observed. Smaller leaf sizes can be
explained by an earlier cessation of leaf growth, but not explained with a reduced
size of leaf cells, since the number of epidermal leaf cells per square millimeter was
remain unaltered. Enhanced number of cell divisions in the shoot apical meristems
and accelerated production of leaf primordia were seen in plant expressing ORF13.
ORF13 is involved in the inference of the cell cycle regulation leading to an earlier
stop in organ growth in the developing leaves. Furthermore, earlier flowering of
plants expressing ORF13 may arrest leaf initiation and leaf expansion, explaining
the fewer leaves formed in ORF13 plants (Stieger et al. 2004).
It has been also revealed that ORF13 protein contains a conservative retinoblas-
toma (RB)-binding motif LxCxE (Meyer et al. 2000). This motif was found in all
members of the ORF13 family, including agropine-, mannopine-, cucumopine-, and
mikimopine-type Ri plasmids (Stieger et al. 2004). When mutations are introduced
into the Rb motif, normal leaf size is restored, but plants still show stunting and
reduced apical dominance. It was also observed that ORF13 expression leads to
the formation of spur between minor veins on leaves and petals N. tabacum (Meyer
et al. 2000). Similar structures are formed on leaves, when KNOX (KNOTTED1-
like homeobox) genes are overexpressed (Sinha et al. 1993; Chuck et al. 1996;
Sentoku et al. 2000; Stieger et al. 2004). It was explained that cytokinin-like phe-
notype such as the formation of spikes, stunted growth, loss of apical dominance,
fusion of organs, and stem fasciations observed as consequences of ectopic expres-
sion of KNOX genes which are induced by ORF1 and cell cycle regulations (Stieger
et al. 2004).
Among the additional ORFs in the TL-DNA, there are two genes, which may
also contribute to the hairy root phenotype, ORF13a and ORF14. ORF13a is located
between ORF13 and ORF14 on the opposite strand. Expression of this gene is taken
place in a tissue specific manner in plants, primarily in leaf vascular tissues (Hansen
et al. 1994b). ORF13a is necessary for root induction (Capone et al. 1989). ORF13a
containing motifs common to phorphorylated gene regulatory proteins codes for a
protein that may interact directly with DNA (Hansen et al. 1994b). Despite a higher
expression rate of ORF13a was found in roots compared to leaves, its expression
did not yield a visible phenotype (Lemcke and Schmulling 1998; Veena and Taylor
2007). The putative protein encoded by ORF13a has a SPXX repeat motif and is
considered to have a regulatory function for this gene (Hansen et al. 1994b). ORF14
is in the same gene family as rolB, rolC, ORF8 and ORF13 (Levesque et al. 1988).
Although overexpression of ORF14 in transgenic carrot and tobacco produced no
morphological changes (Lemcke and Schmulling 1998), it has been shown that the
rol genes and ORF13 act together to induce root induction (Capone et al. 1989;
Aoki and Syono 1999) (Table 1.1).
A. rhizogenes and Crop Biotechnology
Genes can be transferred between species and in conjunction with this fact; plant
improvements for many decades have been relied heavily upon gene transfer. Either
by natural selection or through the efforts of plant breeders, development of plants
has always depended upon creating, evaluating and selecting of right combination
of alleles. Transgenic plants possessing useful features such as resistance to dis-
eases, insects and pests have been developed by transferring such traits to crop
varieties from different species.
Since 1970, rapid progress being made in developing tools for recombinant DNA
technology has led to the creation of genetically modified plants. Genetically modi-
fied crops have been developed for improving various agricultural, nutritional and
food processing traits and used commercially all over the world (Miflin 2000; Kui-
per et al. 2001; James 2006; Olempska-Beer et al. 2006). Establishment of plant
tissue culture techniques are the most important and preliminary steps for many
direct (electroporation, biolistic, microinjection, etc.) and indirect (virus- or bacte-
ria-mediated) gene transfer methods in biotechnology and these methods are used
successfully by a lot of laboratories around the world (Ozyigit 2012). The particle
bombardment and electroporation transformation methods were favored DNA de-
livery systems because they do not show any plant host range problems and very
effective with high DNA delivery rate (Hauptmann et al. 1987; Birch 1997; Taylor
and Fauquet 2002; Turgut-Kara and Ari 2010). However with these methods, gene
silencing/co-suppression can be occurred as a result of high copy number of DNA
inserted in host cells (Block 1993; Yasuda et al. 2005). On the other hand, Agro-
bacterium-based plant transformation is very effective method of creating plants at
low cost, simple to use and with low copy number inserted. Limited number of host
range is the only disadvantage (Lessard et al. 2002; Chandra 2012). For achieving
transformation of plants, Agrobacterium based technology has been used since the
mid-1990s increasingly (Hiei et al. 1994). Agrobacterium-mediated transformation
in generating transgenic plants has been employed as a major DNA delivery system
for novel transgenic technologies starting with the transformations of dicotyledon-
ous (Zambryski et al. 1983) and monocotyledonous (Hiei et al. 1994) species in the
1980–1990s. Increasing understanding of Agrobacterium-plant relationship (Gelvin
2003) and the mechanisms of transgene integration and genetic recombination in
plants (Vain 2007) will lead to achieve further advances in these areas. Conducting
efficient and controlled research on targeted gene replacement/alteration, overex-
pression and mis-expression could provide valuable resource to define gene regula-
tion/function and traits in further in crops. Achievements on Agrobacterium-based
transformation technologies enable large-scale transgenic studies in a range of im-
portant plant and crop species (such as indica rice, wheat, barley, etc.) (Vain 2007)
and also bring opportunity to define and select plant cultivars, which could not be
obtained by conventional breeding methods (Christou 1997).
For many crops, aim of breeding program is altering plant forms. Establishment
of plants with reduced size is favorable in many crops ranging from fruit trees to
annual bedding plants (Mayo 1987). Breeding strategies empowered by genetic en-
gineering will lead to the development of more useful and productive crops for
plant breeders. While transferring genes to plants for being resistant against dis-
eases and insects, they might have been affected in other ways having altered prop-
erties (Oono et al. 1987; Spena et al. 1987; Schmulling et al. 1988; Fladung 1990;
Smigocki and Hammerschlag 1991; Scorza et al. 1994). Legumes are not only pro-
viding a main source of protein and oil for human and animal nutrition but also
contributing to the biological fixation of nitrogen. Moreover, a better understanding
of plant-microbe interactions such as symbiotic nitrogen fixation, mycorrhizal as-
sociations, and legume-pathogen interactions can be possible with legume studies
(Chilton et al. 1982; Christey 2001). Studies on aspects of hairy roots in legumes
showed that proliferous root growth and abundant lateral branching are important
for improving nitrogen fixation (Cheng et al. 1992).
Most plant structures, such as the hypocotyl, leaf, stem, stalk, petiole, shoot tip,
cotyledon, protoplast, storage root, and tuber, have shown capacity to be infected
and genetically transformed by A. rhizogenes resulting in stimulation of hairy root
formation (Mugnier 1988; Han et al. 1993; Bajrovic et al. 1995; Arican et al. 1998;
Drewes and Staden 1995; Giri et al. 2001; Krolicka et al. 2001; Azlan et al. 2002;
Veena and Taylor 2007). Applications of plant biotechnology favor hairy-root cul-
tures because of their special properties such as fast growth, short doubling time,
ease of maintenance, and ability to synthesize a range of chemical compounds and
proteins. Hairy root cultures are usually able to produce the same compounds found
in wild-type roots of the parent plant, without the loss of concentration (Kim et al.
2002; Veena and Taylor 2007). Above all, hairy roots have an ability to regenerate
stable transgenic plants either by a process of somatic embryogenesis or adventi-
tious bud formation, so that genetically modified generations can be achieved (Spa-
no and Costantino 1982; Tepfer 1984; Han et al. 1993; Cho and Wildholm 2002).
It is also known that modification of the cell hormonal balances occurring in
response to infection causes root formation at the infected site (Gaudin et al. 1994;
Aarrouf et al. 2012). However, the response varies depending upon the strain and its
interaction with the plant. One of the most important advantages is that hairy root
formation can be used as a verification of transformation. The use of antibiotic re-
sistance markers in the development of transgenic plants is given rise to substantial
public attention because of their unknown effects (Christey 2001).
Hairy roots have been used for infection of bacteria, fungi and nematodes and
shown to successfully complete their life cycles (Cho et al. 1998; Collier et al.
2005). The resistance genes of nematode have been studied through using hairy
roots (Cai et al. 1995; Remeeus et al. 1998; Kifle et al. 1999; Hwang et al. 2000).
Development of plants using hairy roots have become of interest because of great
potential for building up tolerance to biotic stresses and abiotic stresses (Porter
1991). Hairy root cultures provide an advantage related with making possible the
analysis of the changes in enzyme activities and their isoenzyme patterns (Messner
and Boll 1993; Kärkönen et al. 2002; Talano et al. 2006).
A variety of dicotyledonous plants are susceptible to A. rhizogenes. As a result
of stable transformation, root cultures have been established from a range of spe-
cies of plants (Tepfer 1990). In 1997, Christey reported plant species that had been
genetically modified produced from hairy roots of 60 different taxa, representing
51 species from 41 genera and 23 families including Pinaceae Fabaceae, Brassica-
ceae and Solanaceae Araliaceae, Caricaceae and Rutaceae. In 2001, it was reported
that, transgenic plants have been derived via transgenesis using in 89 different taxa,
representing 79 species from 55 genera and 27 families (Christey 2001). Because
lack of susceptibility, monocotyledonous plants are not a host for A. rhizogenes for
and still there is no example for transgenic monocotyledonous plant except onion
(Dommisse et al. 1990) and asparagus (Hernalsteens et al. 1993; Christey 2001).
According to Web of Science, currently there are more than 500 studies conducted
on A. rhizogenes. Table 1.2 summarizes the studies conducted, the plants and the
genes transferred via A. rhizogenes in chronological order.
Conclusion and Future Perespective
This chapter deals with current research on A. rhizogenes-mediated transformation

and its applications in crops. A. rhizogenes is responsible for the development of
hairy root disease in a wide range of dicotyledonous plants and characterized by a
proliferation of excessively branching roots. Containing case studies demonstrating
the result of A. rhizogenes-mediated transformation includes biosynthesis pathways
in plants created a valuable platform in the last years. Furthermore, the plants trans-
formed with A. rhizogenes are become increasingly popular for offering approaches
to create cost-effective options in mass-producing desired plant metabolites and
expressing foreign proteins. The data from numerous proof-of-concept studies in-
cluding improved the nutritional quality, agronomical characteristics, production of
plant-derived products encourages for the realization of scaling up Agrobacterium
based practices. Recently, transgenic plants produced by Agrobacterium-mediated
transformation have also been shown to have immense potential for applications
in phytoremediation. This chapter highlights recent progresses in the field of A.
rhizogenes-mediated transformation and outlines future perspectives for the exploi-
tation of it.
Acknowledgement Authors are grateful to Professor Nermin Gözükırmızı, Professor Şule Ari,
Associate Professor Ercan Arican and Dr. Neslihan Turgut-Kara at Istanbul University, Depart-
ment of Molecular Biology and Genetics for providing hairy root pictures of their previous stud-
ies and Agrobacterium rhizogenes strains (8196 and R1000) which had been given by Associate
Professor Kemal Melik Taşkın (Çanakkale 18 Mart University, Biology Department) to Istanbul
University Data Collection. Then there were those people at Marmara University, School of Medi-
cine, Department of Histology and Embryology who helped with techniques for obtaining SEM
micrographs. We are grateful to all of them, in particular to: Professor Feriha Ercan, Research
Assistant Özlem T. Çilingir and Yücel Öztürk. We like to acknowledge Designer Recep Cenk
Tarhan and Biologist-Designer İlke Ertem who spent hours of their time helping with the figures
and diagrams, Research Assistants Sezen İğdelioğlu and Onur Zorluer for assistance with compil-
ing the references.
Table 1.2 Summary of the studies conducted, the plants and the genes transferred via
A.rhizogenes in chronological order
Daucus carota Carrot rol David et al. 1984
Kalanchoe daigremontiana Devil’s backbone rol White et al. 1985
Arabidopsis thaliana Mouse ear cress rol Pavingerova and Ondrej 1986
Cucumis sativus Cucumber NPTII Trulson et al. 1986
Lycopersicon esculentum Tomato NPTII Shahin et al. 1986
Petunia hybrida Petunia rol Ondrej and Biskova 1986
Armoracia lapathifolia Horseradish rol Noda et al. 1987
Lycopersicon peruvianum – NPTII Morgan et al. 1987
Nicotiana debneyi Debney’s tobacco NPTII Davey et al. 1987
Nicotiana plumbaginifolia – NPTII Davey et al. 1987
Solanum nigrum Black nightshade NPTII Davey et al. 1987
Anagallis arvensis Pimpernel rol Mugnier 1988
Convolvulus arvensis Morning glory rol Mugnier 1988
Foeniculum vulgare Fennel rol Mugnier 1988
Linum usitatissimum Flax rol Zhan et al. 1988
Nicotiana glauca Tree tobacco rol Sinkar et al. 1988
Nicotiana hesperis – rol Walton and Belshaw 1988
Brassica oleracea var. Ornamental kale rol Hosoki et al. 1989
acephala
Catharanthus roseus Periwinkle rol Brillanceau et al. 1989
Glycine argyrea Wild soybean NPTII Rech et al. 1989
Glycine canescens Wild soybean NPTII Rech et al. 1989
Lotus corniculatus Bird’s-Foot trefoil GUS Forde et al. 1989
Solanum tuberosum Potato NPT II, GUS Visser et al. 1989
Stylosanthes humilis Townsville stylo NPT II Manners and way 1989
Trifolium repens White clover rol Diaz et al. 1989
Brassica napus Rapeseed NPTII Boulter et al. 1990
Nicotiana rustica Mapacho ODS Hamill et al. 1990
Nicotiana tabacum Tobacco NPTII Hatamoto et al. 1990
Vicia faba Fava bean NPTII Ramsay and Kumar 1990
Actinidia deliciosa Kiwifruit rol Rugini et al. 1991
Allocasuarina verticillata Drooping she-oak rol Phelep et al. 1991
Cichorium intybus Chicory rol Sun et al. 1991
Hyoscyamus muticus Egyptian henbane rol Oksman-Caldentey et al.
1991
Medicago arborea Tree medick HPT Damiani and Aricioni 1991
Medicago sativa Alfalfa/lucerne rol Golds et al. 1991
Olea europaea Olive rol Rugini et al. 1996
Onobrychis viciifolia Sainfoin rol Golds et al. 1991
Pistacia vera Pistachio rol Rugini and Mariotti 1991
Malus domestica Apple rolB Rugini and Mariotti 1991
Solanum dulcamara Nightshade NPTII, rol McInnes et al. 1991
Anthyllis vulneraria Kidney vetch NPTII, ipt Stiller et al. 1992
Atropa belladonna Deadly nightshade bar Saito et al. 1992
Brassica campestris Turnip NPT II Christey and Sinclair 1992

Brassica campestris var. Turnip GUS, NPTII, Christey and Sinclair 1992
rapifera ALS
Brassica oleracea var. Forage kale GUS, NPTII, Christey and Sinclair 1992
acephala ALS
Malus pumila Apple rol Lambert and Tepfer 1992
Medicago truncatula Barrel clover NPTII Thomas et al. 1992
Papaver somniferum Opium poppy rol Yoshimatsu and Shimomura
1992
Coffea arabica Coffea rol Spiral et al. 1993
Eucalyptus sp. Eucalyptus rol MacRae and van Staden 1993
Glycine max Soybean GUS Olhoft et al. 2007
Ipomoea batatas Sweet potato NPTII, GUS Otani et al. 1993
Populus trichocarpa × Cottonwood NPTII Han et al. 1993
P. deltoides
Robinia pseudoacacia Black locust NPTII Han et al. 1993
Vicia hirsuta Hairy vetch rol Quandt et al. 1993
Vigna aconitifolia Moth bean SbPRP1 Suzuki et al. 1993; Lee et al.
1993
Diospyros kaki Japanese rol Tao et al. 1994
persimmon
Larix decidua European larch NPTII, aroA, Shin et al. 1994
BT
Pelargonium graveolens Lemon geranium rol Pellegrineschi et al. 1994
Rosa hybrida Hybrid tea rose NPTII, GUS Firoozabady et al. 1994
Rubia peregrina Wild madder ICS Downs et al. 1994
Vinca minor Lesser periwinkle NPTII, GUS Tanaka et al. 1994
Vitis vinifera Grapevine NPTII, GUS Nakano et al. 1994
Casuarina glauca Swamp she-oak GUS Diouf et al. 1995
Gentiana scabra Japanese gentian rol Suginuma and Akihama 1995
Solanum tuberosum L. Potato rol Bajrovic et al. 1995
Rudbeckia hirta Black-Eyed susan rol Daimon and Mii 1995
Verticordia grandis Scarlet NPTII, GUS Stummer et al. 1995
featherflower
Citrus sinensis Sweet orange rol Li et al. 1996
Ajuga reptans Blue bugle GUS Uozumi et al. 1996
Begonia tuberhybrida Begonia rol Kiyokawa et al. 1996
Brassica campestris Turnip GUS Christey et al. 1997
Brassica oleracea Wild cabbage GUS Christey et al. 1997
Carica papaya Papaya NPTII, GUS Cabrera-Ponce et al. 1996
Eustoma grandiflorum Lisianthus NPTII, GUS Handa 1992
Ipomoea trichocarpa Blue morning NPTII, GUS Otani et al. 1993
glory
Juglans regia Walnut rolB Caboni et al. 1996
Lotus angustissimus Slender bird’s-foot NPTII, GUS Nenz et al. 1996
trefoil
Pelargonium fragrans Nutmeg geranium rol Pellegrineschi and Davolio-
Mariani 1996

Pelargonium Apple geranium rol Pellegrineschi and Davolio-
odoratissimum Mariani 1996
Pelargonium quercifolium Oak-Leaved rol Pellegrineschi and Davolio-
geranium Mariani 1996
Pinus contorta Lodgepole pine rol Yibrah et al. 1996
Pinus halepensis Aleppo pine rol Tzfira et al. 1996
Pinus nigra Austrian pine rol Mihaljevic et al. 1996
Populus tremula Aspen NPTII, GUS Tzfira et al. 1996
Rosa sp. Rose rol Van der Salm et al. 1997
Scoparia dulcis Licorice weed rol Yamazaki et al. 1996
Aconitum heterophyllum Indian atees rol Giri et al. 1997
Artemisia annua Sweet wormwood rol Banerjee et al. 1997
Brassica napus Oilseed rape GUS, NPTII, Christey et al. 1997
ALS
Brassica oleracea Wild cabbage GUS, NPTII Christey et al. 1997
Datura arborea Angel’s trumpets rol Giovannini et al. 1997
Datura sanguinea Red Angel’s rol Giovannini et al. 1997
trumpets
Digitalis lanata Grecian foxglove rol Pradel et al. 1997
Gentiana cruciata Gentian GUS Momčilović et al. 1997
Gentiana purpurea Purple gentian rol Momčilović et al. 1997
Gentiana triflora × G. – rol Hosokawa et al. 1997
scabra
Lotus japonicus Lotus japonicus rol Stiller et al. 1997
Nierembergia scoparia Tall cupflower rol Godo et al. 1997
Peganum harmala Harmal TDS Berlin et al. 1993
Antirrhinum majus Snapdragon bar, NPTII Hoshino and Mii 1998
Arachis hypogaea L. Groundnut rol Akasaka et al. 1998
Astragalus sinicus Chinese milk vetch GUS Cho et al. 1998
Citrus aurantifolia Mexican lime NPTII, GUS Pérez-Molphe-Balch and
Ochoa-Alejo 1998
Nicotiana spp. – rol Palazon et al. 1998
Panax ginseng Ginseng rol Yang and Choi 2000
Prunus avium Sweet cherry rol Gutierrez-Pesce et al. 1998
Brassica campestris var. Chinese cabbage NPTII, EAS Christey et al. 1999
pekinensis
Brassica oleracea L. var. Broccoli rol Henzi et al. 1999
italica
Brassica oleracea var. Cauliflower NPTII, GUS Christey et al. 1999
botrytis
Brassica oleracea var. Cabbage NPTII, GUS Christey et al. 1999
capitata
Brassica oleracea var. Brussels sprouts NPTII Christey et al. 1999
gemmifera
Brassica oleracea var. Broccoli NPTII, EAS Christey et al. 1999
italica
Gentiana punctata Spotted gentian GUS Vinterhalter et al. 1999
Pimpinella anisum Anise rol Andarwulan and Shetty 1999
Pyrus communis Pear rolC Bell et al. 1999

Rubia tinctorum Common madder rol Ercan et al. 1999
Ulmus spp. Elm rol Rinallo et al. 1999
Ziziphus jujuba Jujube rol Hatta et al. 1996
Crotalaria juncea Sunn hemp rol Ohara et al. 2000
Trifolium pratense Red clover rol Díaz et al. 2000
Brassica napus var. Swede (Rutabaga) bar Christey and Braun 2001
rapifera
Oryza sativa var. japonica Japanese Rice rolA, NPTII Lee et al. 2001
Spinacia oleracea Spinach rol Ishizaki et al. 2002
Citrus aurantium Bergamot orange rol Chavez-Vela et al. 2003
Ginkgo biloba Ginkgo rol Ayadi and Tremouillaux-
Guiller 2003
Rauvolfia micrantha – rol Sudha et al. 2003
Sesbania rostrata Pea rol Van de Velde et al. 2003
Aesculus hippocastanum Horse-chestnut GUS Zdravkovic-Korac et al. 2004
Alstroemeria sp. Peruvian lily NPTII, GUS, Akutsu et al. 2004
rol
Camptotheca acuminata Happy tree rol Lorence et al. 2004
Genista tinctoria Greenweed rol Luczkiewicz and
Kokotkiewicz 2005
Typha latifolia Common bulrush rol Nandakumar et al. 2005
Brassica oleracea var. Savoy cabbage GUS Sretenovıc-Rajicic et al. 2006
sabauda
Brassica oleracea var. Savoy cabbage rol Sretenovic-Rajicic et al. 2006
sabauda
Eustoma grandiflorum Lisianthus rol Popa et al. 2006
Echinacea purpurea Purple coneflower rolB Wang et al. 2006
Phaseolus vulgaris Common bean GFP, GUS Estrada-Navarrete et al. 2006
Tylophora indica Indian ipecac rol Chaudhuri et al. 2006
Asimina triloba Pawpaw rolB, C Ayala-Silva et al. 2007
Pueraria candollei – rolB Medina-Bolivar et al. 2007
Beta vulgaris Red beet NPTII Thimmaraju et al. 2008
Glycyrrhiza glabra Licorice rol Mehrotra et al. 2008
Musa sp. Banana rol Matsumoto et al. 2009
Plumbago rosea Plumbago rol Satheeshkumar et al. 2009
Podophyllum hexandrum Himalayan rol Lin et al. 2003
mayapple
Psoralea corylifolia Babchi rol Shinde et al. 2009
Drosera burmannii Tropical sundew rol Putalun et al. 2010
Echium rauwolfii Echium rauwolfii rol Abd El-Mawla 2010
Fagopyrum esculentum Buckwheat GUS Kim et al. 2010
Mangifera indica Mango rol Chavarri et al. 2010
Przewalskia tangutica – rol Lan and Quan 2010
Corchorus capsularist Jute GUS Chattopadhyay et al. 2011
Nasturtium officinale Watercresses rol Park et al. 2011
Prunus sp. – Egfp, NPTII Bosselut et al. 2011
Amaranthus spinosus Spiny amaranth rolB Pal et al. 2012
Capsicum annuum Pepper GFP Aarrouf et al. 2012
Clitoria ternatea Butterfly pea rol Swain et al. 2012
References
Aarrouf J, Castro-Quezada P, Mallard S, Caromel B, Lizzi Y, Lefebvre V (2012) Agrobacte-

rium rhizogenes-dependent production of transformed roots from foliar explants of pepper
( Capsicum annuum): a new and efficient tool for functional analysis of genes. Plant Cell Rep
31:391–401
Abarca-Grau AM, Penyalver R, Lopez MM, Marco-Noales E (2011) Pathogenic and non-patho-
genic Agrobacterium tumefaciens, A. rhizogenes and A. vitis strains form biofilms on abiotic as
well as on root surfaces. Plant Pathol 60:416–425
Abd El-Mawla AMA (2010) Effect of certain elicitors on production of pyrrolizidine alkaloids in
hairy root cultures of Echium rauwolfii. Pharmazie 65:224–226
Ackermann C (1977) Pflanzen aus Agrobacterium rhizogenes tumoren and Nicotiana tabacum.
Plant Sci Lett 8:23–30
Akasaka Y, Mii M, Daimon H (1998) Morphological alterations and root nodule formation in
Agrobacterium rihzogenes-mediated transgenic hairy roots of peanut ( Arachis hypogaea L.).
Ann Bot 81:355–362
Akutsu M, Ishizaki T, Sato H (2004) Transformation of the monocot Alstroemeria by Agrobacte-
rium rhizogenes. Mol Breeding 13:69–78
Alpizar E, Dechamp E, Espeout S, Royer M, Lecouls AC, Nicole M, Bertrand B, Lashermes P,
Etienne H (2006) Efficient production of Agrobacterium rhizogenes-transformed roots and
composite plants for studying gene expression in coffee roots. Plant Cell Rep 25:959–967
Altamura MM, Tomassi M (1998) Auxin, photoperiod and putrescine affect flower eoformation
in normal and rolB-transformed tobacco thin cell layers. Plant Physiol Biochem 36:441–448
Andarwulan N, Shetty K (1999) Phenolic synthesis in differentiated tissue cultures of untrans-
formed and Agrobacterium-transformed roots of anise (Pimpinella anisum L.). J Agric Food
Chem 47:1776–1780
Aoki S, Syono K (1999) Short communication synergistic function of rolB, rolC, ORF13 and
ORF14 of TL-DNA of Agrobacterium rhizogenes in hairy root induction in Nicotiana tabacum.
Plant Cell Physiol 40(2):252–256
Arican E, Bajrovic K, Gozukirmizi N (1998) Effects of naphthalene acetic acid on transforma-
tion frequency of potato and tobacco via Agrobacterium rhizogenes. Biotechnol Biotec Eq
12(1):29–33
Ayadi R, Tremouillaux-Guiller J (2003) Root formation from transgenic calli of Ginkgo biloba.
Tree Physiol 23:713–718
Ayala-Silva T, Bey CA, Dortch G (2007) Agrobacterium rhizogenes mediated transformation of
Asimina triloba L. cuttings. Pak J Biol Sci 10:132–136
Azlan GJ, Marziah M, Radzali M, Johari (2002) Establishment of Physalis minima hairy roots
culture for the production of physalins. Plant Cell Tiss Org 69:271–278
Bajrovic K, Arı Ş, Arıcan E, Kazan K, Gözükırmızı N (1995) Biotechnol Biotec Eq 1:29–32
Balandrin MF, Klocke JA, Wurtele ES, Bollinger WH (1985) Natural plant chemicals: sources of
industrial and medicinal materials. Science 228:1154–1160
Bandyopadhyay M, Jha S, Tepfer D (2007) Changes in morphological phenotypes and withanolide
composition of Ri-transformed roots of Withania somnifera. Plant Cell Rep 26:599–609
Banerjee S, Zehra M, Gupta MM, Kumar S (1997) Agrobacterium rhizogenes mediated transfor-
mation of Artemisia annua -production of transgenic plants. Planta Med 63:467–469
Bellincampi D, Cardarelli M, Zaghi D, Serino G, Salvi G, Gatz C, Cervone F, Altamura MM,
Constantino P, De-Lorenzo G (1996) Oligogalacturonides prevent rhizogenesis in rolB trans-
formed tobacco explants by inhibiting auxin-induced expression of the rolB gene. Plant Cell
8:477–487
Bell RL, Scorza R, Srinivasan C, Webb K (1999) Transformation of ‛Beurre Bosc’ pear with the
rolC gene. J Arner Soc Hort Sci 124:570–574
Bensaddek L, Villarreal ML, Fliniaux MA (2008) Induction and growth of hairy roots for the pro-
duction of medicinal compounds. Electron J Integr Biosci 3(1):2–9
Berlin J, Ruegenhagen C, Dietze P, Fecker LF, Goddijn OJM, Hoge JHC (1993) Increased pro-
duction of seratonin by suspension and root cultures of Peganum harmala transformed with a
tryptophan decarboxylase cDNA clone from Cathranthus roseus. Transgenic Res 2:336–344
Bettini P, Michelotti S, Bindi D, Giannini R, Capuana M, Buiatti M (2003) Pleiotropic effect of
the insertion of the Agrobacterium rhizogenes rolD gene in tomato ( Lycopersicon esculentum
Mill.). Theor Appl Genet 107:831–836
Binns AN, Costantino P (1998) The Agrobacterium oncogenes. In: Spaink HP, Kondorosi A,
Hooykaas PJ (eds) The Rhizobiaceae: molecular biology of model plant-associated bacteria.
Kluwer Academic Publishers, Dordrecht, pp. 251–266
Binns AN, Chen RH, Wood HN, Lynn DG (1987) Cell division promoting activity of naturally
occurring dehydrodiconiferyl glucosides: do cell wall components control cell division? Proc
Natl Acad Sci USA 84:980–984
Birch RG (1997) Plant transformation: problems and strategies for practical application. Annu Rev
Plant Physiol Plant Mol Biol 48:297–326
Block M (1993) The cell biology of plant transformation: current state, problems, prospects and
the implications for the plant breeding. Euphytica 71(1–2):1–14
Bonhomme V, Laurain-Mattar D, Lacoux J, Fliniaux MA, Jacquin-Dubreuil A (2000) Tropane
alkaloid production by hairy roots of Atropa belladonna obtained after transformation with
Agrobacterium rhizogenes 15834 and Agrobacterium tumefaciens containing rolA, B, C genes
only. J Biotech 81(2–3):151–158
Bosselut N, Van Ghelder C, Claverie M, Voisin R, Onesto JP, Rosso MN, Esmenjaud D (2011)
Agrobacterium rhizogenes-mediated transformation of Prunus as an alternative for gene func-
tional analysis in hairy-roots and composite plants. Plant Cell Rep 30(7):1313–1326
Bouchez D, Camilleri C (1990) Identification of a putative rolB gene on the TR-DNA of the Agro-
bacterium rhizogenes A4 Ri plasmid. Plant Mol Biol 14:617–619
Boulter ME, Croy E, Simpson P, Shields R, Croy RRD, Shirsat AH (1990) Transformation of
Brassica napus L. (oilseed rape) using Agrobacterium tumefaciens and Agrobacterium rhizo-
genes- a comparison. Plant Sci 70:91–99
Brevet J, Tempe J (1988) Homology mapping of T-DNA regions on three Agrobacterium rhizo-
genes Ri plasmids by electron microscope heteroduplexstudies. Plasmid 19:75–83
Brillanceau MH, David C, TempeÂ J (1989) Genetic transformation of Catharanthus roseus G.
Don by Agrobacterium rhizogenes. Plant Cell Rep 8:63–66
Britton MT, Escobar MA, Dandekar M (2008) The oncogenes of Agrobacterium tumefaciens and
Agrobacterium rhizogenes. In: Tzfira T, Citovsky V (eds) Agrobacterium: from biology to
biotechnology. Springer, Heidelberg, pp. 525–563
Broothaerts W, Mitchell HJ, Weir B, Kaines S, Smith LMA, Yang WM, Jorge E, Roa-rodriguez CJ,
Richard A (2005) Gene transfer to plants by diverse species of bacteria. Nature 433:629–633
Bulgakov VP (2008) Functions of rol genes in plant secondary metabolism. Biotechnol Adv
26:318–324
Bulgakov VP, Khodakovskaya MV, Labetskaya NV, Tchernoded GK, Zhuravlev YN (1998) The
impact of plant rolC oncogene on ginsenoside production by ginseng hairy root cultures. Phy-
tochemistry 49:1929–1934
Bulgakov VP, Tchernoded GK, Mischenko NP, Khodakovskaya MV, Glazunov VP, Zvereva EV,
Fedoreyev SA, Zhuravlev YN (2002a) Effect of salicylic acid, methyl jasmonate, ethephon and
cantharidin on anthraquinone production by Rubia cordifolia callus cultures transformed with
the rolB and rolC genes. J Biotechnol 97:213–221
Bulgakov VP, Kusaykin M, Tchernoded GK, Zvyagintseva TN, Zhuravlev YN (2002b) Carbohy-
drase activities of the rolC-gene transformed and non-transformed ginseng cultures. Fitoterapia
73:638–643
Bulgakov VP, Tchernoded GK, Mischenko NP, Shkryl YN, Fedoreyev SA, Zhuravlev YN (2004)
The rolB and rolC genes activate synthesis of anthraquinones in Rubia cordifolia cells by
mechanism independent of octadecanoid signaling pathway. Plant Sci 166:1069–1075
Caboni E, Lauri P, Tonelli M, Falasca G, Damiano C (1996) Root induction by Agrobacterium
rhizogenes in walnut. Plant Sci 118:203–208
Cabrera-Ponce JL, Vegas-Garcia A, Herrera-Estrella L (1996) Regeneration of transgenic papaya

plants via somatic embryogenesis induced by Agrobacterium rhizogenes. In Vitro Cell Dev
Biol Plant 32:86–90
Cai G, Li G, Ye H (1995) Hairy root culture of Artemisia annua L. by Ri plasmid transformation
and biosynthesis of artemisinin. Chinese J Biotechnol 11(4):227–235
Camilleri C, Jouanin L (1991) The TR-DNA region carrying the auxin synthesis genes of the
Agrobacterium rhizogenes agropine type plasmid pRiA4: nucleotide sequence analysis and
introduction into tobacco plants. Mol Plant Microbe Interact 4:155–162
Capone IL, Spano L, Cardarelli M, Bellincampi D, Petit A, Constantino P (1989) Induction and
growth properties of carrot roots with different complements of Agrobacterium rhizogenes T-
DNA genes. Plant Mol Biol 13:43–52
Cardarelli M, Spanò L, De Paolis A, Mauro ML, Vitali G, Costantino P (1985) Identification of
the genetic locus responsible for non-polar root induction by Agrobacterium rhizogenes 1855.
Plant Mol Biol 5:385–391
Cardarelli M, Mariotti D, Pomponi M, Spano L, Capone I, Costantino P (1987a) Agrobacte-
rium rhizogenes T-DNA genes capable of inducing hairy root phenotype. Mol Gen Genet
209(3):475–480
Cardarelli M, Spano L, Mariotti D, Mauro ML, Van Sluys MA, Costantino P (1987b) The role of
auxin in hairy root induction. Mol Gen Genet 208:457–463
Casanova E, Zuker A, Trillas MI, Moysset L, Vainstein A (2003) The rolC gene in carnation exhib-
its cytokinin- and auxin-like activities. Sci Hortic 97:321–331
Casanova E, Valdes AE, Zuker A, Fernandez B, Vainstein A, Trillas MI, Moysset L (2004) rolC-
transgenic carnation plants: adventitious organogenesis and levels of endogenous auxin and
cytokinins. Plant Sci 167(3):551–560
Census (2012) The official website of U.S. Department of Commerce, U.S. Census Bureau-World
POPClock Projection. http://www.census.gov. Accessed: 25. May 2011
Chandra S (2012) Natural plant genetic engineer Agrobacterium rhizogenes: role of T-DNA in
plant secondary metabolism. Biotechnol Lett 34(3):407–415
Charlwood BV, Charlwood KA (1991) Terpenoid production in plant cell culture. In: Harborne JB,
Tomas-Barberan FE (eds) Ecological chemistry and biochemistry of plant terpenoids. Claren-
don Press, Oxford, pp 95–132
Chattopadhyay T, Roy S, Mitra A, Maiti MK (2011) Development of a transgenic hairy root sys-
tem in jute ( Corchorus capsularis L.) with GUSA reporter gene through Agrobacterium rhizo-
genes mediated co-transformation. Plant Cell Rep 30(4):485–493
Chaudhuri KN, Ghosh B, Tepfer D, Jha S (2006) Spontaneous plant regeneration in transformed
roots and calli from Tylophora indica: changes in morphological phenotype and tylophorine
accumulation associated with transformation by Agrobacterium rhizogenes. Plant Cell Rep
25(10):1059–1066
Chavarri M, García AV, Zambrano AY, Gutiérrez Z, Demey JR (2010) Insertion of Agrobacterium
rhizogenes rolB gene in Mango. Interciencia 35(7):521–525
Chavez-Vela NA, Chavez-Ortiz LI, Perez-Molphe Balch E (2003) Genetic transformation of sour
orange using Agrobacterium rhizogenes. Agrociencia 37:629–639
Cheng M, His DCH, Philips GC (1992) In vitro regeneration of Valencia type peanut ( Arachis
hypogaea L.) from cultured petioles, epicotyl, sections and other seedling explants. Peanut Sci
19:82–87
Chilton MD, Tepfer D, Petit A, David C, Delbart C-F, Tempt J (1982) Agrobacterium rhizogenes
inserts T-DNA into the genomes of the host plant root cells. Nature 295:432–434
Cho HJ, Wildholm JM (2002) Improved shoot regeneration protocol for hairy roots of the legume
Astragalus sinicus. Plant Cell Tiss Org 69:259–269
Cho H-J, Widholm JM, Tanaka N, Nakanishi Y, Murooka Y (1998) Agrobacterium rhizogenes-
mediated transformation and regeneration of the legume Astragalus sinicus (Chinese milk
vetch). Plant Sci 138:53–65
Christensen B, Sriskandarajah S, Serek M, Müller R (2008) Transformation of Kalanchoe bloss-

feldiana with rol-genes is useful in molecular breeding towards compact growth. Plant Cell
Rep 27:1485–1495
Christey MC (2001) Use of Ri-mediated transformation for production of transgenic plants. In
Vitro Cell Dev Biol Plant 37:687–700
Christey MC, Braun RH (2001) Transgenic vegetable and forage Brassica species: rape, kale,
turnip and rutabaga (Swede). In: Bajaj YPS (ed) Biotechnology in agriculture and forestry,
Transgenic crops II 47:87–101
Christey MC, Braun RH, Reader JK (1999) Field performance of transgenic vegetable brassicas
( Brassica oleracea and B. rapa) transformed with Agrobacterium rhizogenes. Sabrao J Breed
Genet 31:93–108
Christey MC, Sinclair BK (1992) Regeneration of trasgenic kale ( Brassica oleracea var. acephal),
rap ( B. napus) and turnip ( B. campestris var rapifera) plants via Agrobacterium rhizogenes
mediated transformation. Plant Sci 87:161–169
Christey MC, Sinclair BK, Braun RH, Wyke L (1997) Regeneration of transgenic vegetable bras-
sicas ( Brassica oleracea and B. campestris) via Ri-mediated transformation. Plant Cell Rep
16:587–593
Christie PJ, Ward JE, Winans SC, Nester EW (1988) The Agrobacterium tumefaciens virE2 gene
product is a single-stranded- DNA-binding protein that associates with T-DNA. J Bacteriol
170:2659–2667
Christou P (1997) Biotechnology applied to grain legumes. Field Crop Res 53:83–97
Chuck G, Lincoln C, Hake S (1996) KNAT1 induces lobed leaves with ectopic meritems when
overexpressed in Arabidopsis. Plant Cell 8:1277–1289
Citovsky V, Zupan J, Warnick D, Zambryski P (1992) Nuclear localization of Agrobacterium
VirE2 protein in plant cells. Science 256:1802–1805
Collier R, Fuchs B, Walter N, Kevin LW, Taylor CG (2005) Ex vitro composite plants: an inexpen-
sive, rapid method for root biology. Plant J 43:449–457
Comai L, Kosuge T (1982) Cloning and characterization of iaaM, a virulence determinant of
Pseudomonas savastanoi. J Bacteriol 149:40–46
Conn HJ (1942) Validity of the genus Alcaligenes. J Bacteriol 44:353–360
Costantion P, Spano L, Pomponi M, Benevuto E, Ancora G (1984) The T-DNA of Agrobacterium
rhizogenes is transmitted through meiosis to the progeny of hairy root plants. J Mol Appl Genet
2(5):465–470
Costantino P, Capone I, Cardarelli M, De-Paolis A, Mauro ML, Trovato M (1994) Bacterial plant
oncogenes: the rol genes’ saga. Genetica 94:203–211
Daimon H, Mii M (1995) Plant regeneration and thiophene production in hairy root cultures of
Rudbeckia hirta L. used as an antagonistic plant to nematodes. Jpn J Crop Sci 64:650–655
Damiani F, Aricioni S (1991) Transformation of Medicago arborea L. with Agrobacterium rhi-
zogenes binary vector carrying the hygromycin resistance genes. Plant Cell Rep 10:300–303
Davey MR, Mulligan BJ, Gartland KMA, Peel E, Sargent AW, Morgan AJ (1987) Transformation
of Solanum and Nicotiana species using an Ri plasmid vector. J Exp Bot 38:1507–1516
David C, Chilton MD, Tempe J (1984) Conservation of T-DNA in plants regenerated from hairy
root cultures. Biotech 2:73–76
Davioud E, Petit A, Tate ME, Ryder MH, Tempe J (1988) Cucumopine-a new T-DNA-encoded
opine in hairy root and crown gall. Phytochemistry 27(8):2429–2433
De Paolis A, Mauro ML, Pompon M, Cardarelli M, Spano L, Costantino P (1985) Localization of
agropine synthesizing functions in the TR region of the root inducing plasmid of Agrobacte-
rium rhizogenes 1855. Plasmid 13:1–7
Dehio C, Grossmann K, Schell J, Schmülling T (1993) Phenotype and hormonal status of trans-
genic tobacco plants overexpressing the rolA gene of Agrobacterium rhizogenes T-DNA. Plant
Mol Biol 23(6):1199–1210
Dehio C, Schell J (1993) Stable expression of a single-copy rolA gene in transgenic Arabidopsis
thaliana plants allows an exhaustive mutagenic analysis of the transgene-associated pheno-
type. Mol Gen Genet 241:359–366
Delbarre A, Muller P, Imhoff V, Barbier-Brygoo H, Maurel C, Leblanc N, Perrot-Rechenmann

C, Guern J (1994) The rolB Gene of Agrobacterium rhizogenes does not increase the auxin
sensitivity of tobacco protoplasts by modifying the intracellular auxin concentration. Plant
Physiol 105:563–569
Dessaux Y, Petit A, Tempe J (1992) Opines in Agrobacterium biology. In: Verma DPS (ed) Mo-
lecular signals in plant-microbe communications. CRC Press, Boca Raton, pp 109–136
Diaz CL, Melchers LS, Hooykaas PJJ, Lugtenberg BJJ, Kijne JW (1989) Root lectin as a determi-
nant of host-plant specificity in the Rhizobium-legume symbiosis. Nature 338:579–581
Díaz Cl, Spaink HP, Kijne JW (2000) Heterologous rhizobial lipchitin oligosaccharides and chitin
oligomers induce cortical cell divisions in red clover roots, transformed with the pea lectin
gene. Mol Plant Microbe Interact 13:268–276
Diouf D, Gherbi H, Prin Y, Franche C, Duhoux E, Bogusz D (1995) Hairy root nodulation of
Casuarina glauca: a system for the study of symbiotic gene expression in an actinorhizal tree.
Mol Plant Microbe Interact 8:532–537
Dodueva IE (2007) A Study of expression of the genes involved in systemic control of cell division
and differentiation in higher plants on the model of spontaneous tumorigenesis in inbred rad-
ish lines ( Raphanus sativus var. radicula Pers.). Cand Sci (Biol) Dissertation, St. Petersburg:
Gos. Univ
Dommisse EM, Leung DWM, Shaw ML, Conner AJ (1990) Onion is a monocotyledonous host for
Agrobacterium. Plant Sci 69:249–257
Doran PM (2002) Properties and applications of hairy root cultures. In: Marja K, Caldentey
KM, Barz W (eds) Plant biotechnology and transgenic plants. Marcel Dekker Inc, New York,
pp 1–20
Downs CG, Christey MC, Davies KM, King GA, Seelye JF, Sinclair BK, Stevenson DG (1994)
Hairy roots of Brassica napus: II glutamine synthase over expression alters ammonia assimila-
tion and the response to phosphinothricin. Plant Cell Rep 14:41–46
Drewes FE, Staden JV (1995) Initiation of and solasodine production in hairy root cultures of
Solanum mauritianum. Scop Plant Growth Regul 17:27–31
Duckely M, Hohn B (2003) The VirE2 protein of Agrobacterium tumefaciens: the Yin and Yang of
T-DNA transfer. FEMS Microbiol Lett 223:1–6
Durand-Tardif M, Broglie R, Slightom J, Tepfer D (1985) Structure and expression of Ri T-DNA
from Agrobacterium rhizogenes in Nicotiana tabacum. J Mol Biol 186:557–564
Ephritikhine G, Barbier-Brygoo H, Muller JF, Guern J (1987) Auxin effect on the transmembrane
potential difference of wild-type and mutant tobacco protoplasts exhibiting a differential sensi-
tivity to auxin. Plant Physiol 83:801–804
Ercan AG, Taski KM, Turgut K, Yuce S (1999) Agrobacterium rhizogenes-mediated hairy root
formation in some Rubia tinctorum L populations grown in Turkey. Turk J Bot 23:373–378
Estrada-Navarrete G, Alvarado-Affantranger X, Olivares JE, Diaz-Camino C, Santana O, Mu-
rillo E, Guillen G, Sanchez-Guevara N, Acosta J, Quinto C, Li DX, Gresshoff PM, Sanchez
F (2006) Agrobacterium rhizogenes transformation of the Phaseolus spp: a tool for functional
genomics. Mol Plant Microb Interact 19:1385–1393
Estramareix C, Ratet P, Boulanger F, Richaud F (1986) Multiple mutations in the transferred re-
gions of the Agrobacterium rhizogenes root-inducing plasmids. Plasmid 15:245–247
Estruch JJ, Chriqui D, Grossmann K, Schell J, Spena A (1991) The plant oncogene rolC is respon-
sible for the release of cytokinins from glucoside conjugates. EMBO J 10:2889–2895
Faiss M, Strnad M, Redig P, Dolzak K, Hanus J, Van Onckelen H, Schmuelling T (1996) Chemi-
cally induced expression of the rol cencoded β-glucuronidase in transgenic tobacco plants and
analysis of cytokinin metabolism: RolC does not hydrolyze endogenous cytokinin glucosides
in planta. Plant J 10:33–46
Filetici P, Spano L, Costantino P (1987) Conserved regions in the T-DNA of different Agrobacte-
rium rhizogenes root inducing plasmid. Plant Mol Biol 9:19–26
Filichkin SA, Gelvin SB (1993) Formation of a putative relaxation intermediate during T-DNA
processing directed by Agrobacterium tumefaciens VirD1/D2 endonuclease. Mol Microbiol
8:915–926
Filippini F, Lo Schiavo F, Terzi M, Costantino P, Trovato M (1994) The plant oncogene rolB alters
binding of auxin to plant cell membranes. Plant Cell Physiol 35:767–771
Filippini F, Rossi V, Marin O, Trovato M, Costantino P, Downey PM, Lo Schiavo F, Terzi M
(1996) A plant oncogene as a phosphatase. Nature 379:499–500
Firoozabady E, Moy Y, Courtney-Gutterson N, Robinson K (1994) Regeneration of transgenic
rose (Rosa hybrida) plants from embryogenic tissue. Bio/Technology 12:609–613
Fladung M (1990) Transformation of diploid and tetraploid potato clones with the rolC gene
of Agrobacterium rhizogenes and the characterization of transgenic plants. Plant Breeding
104:295–304
Flores HE, Vivanco JM, Loyola-Vargas VM (1999) Radicle biochemistry: the biology of root-
specific metabolism. Trends Plant Sci 4:220–226
Forde BG, Day HM, Turton JF, Shen WJ, Cullimore V, Oliver JE (1989) Two glutamine synthase
genes from Phaseolus vulgaris L. display contrasting developmental and spatial patterns of
expression in transgenic Lotus corniculatus plants. Plant Cell 1:391–401
Frundt C, Meyer AD, Ichikawa T, Meins FJ (1998) Evidence for the ancient transfer of Ri plasmid
T-DNA genes between bacteria and plants. In: Syvanen M, Kado CI (eds) Horizontal gene
transfer. Chapman and Hall, London, pp 94–106
Gartland JS (1995) Agrobacterium virulence. In: Gartland KMA, Davey MR (eds) Methods in
molecular biology 44 Agrobacterium protocols. Humana Press, New Jersey
Gaudin V, Jouanin L (1995) Expression of Agrobacterium rhizogenes auxin biosynthesis genes in
transgenic tobacco plants. Plant Mol Biol 28:123–36
Gaudin V, Vrain T, Jouanin L (1994) Bacterial genes modifying hormonal balances in plants. Plant
Physiol Biochem 32:11–29
Gelvin SB (1998) Agrobacterium VirE2 proteins can form a complex with T strands in the plant
cytoplasm. J Bacteriol 180:4300–4302
Gelvin SB (2003) Improving plant genetic engineering by manipulating the host. Trends Biotech-
nol 21:95–98
Gelvin SB (2009) Agrobacterium in the genomics age. Plant Physiol 150:1665–1676
Gepts P (2002) A Comparison between crop domestication, classical plant breeding, and genetic
engineering. Crop Sci 42:1780–1790
Giovannini A, Pecchioni N, Rabaglio M, Allavena A (1997) Characterization of ornamental datura
plants transformed by Agrobacterium rhizogenes. In Vitro Cell Dev Biol Plant 33:101–106
Giri A, Banerjee S, Ahuja PS, Giri CC (1997) Production of hairy roots in Aconitum heterophyllum
wall using Agerobacterium rhizogenes. In Vitro Cell Dev Biol Plant 33:280–284
Giri A, Giri CC, Dhingra V, Narasu ML (2001) Enhanced podophyllotoxin production from
Agrobacterium rhizogenes transformed cultures of Podophyllum hexandrum. Nat Prod Lett
15:229–235
Giri A, Narasu ML (2000) Research review paper transgenic hairy roots: recent trends and applica-
tions. Biotechnol Adv 18:1–22
Giri CC, Giri A (2007) Plant biotechnology. Practical Manual I International Publishing House
Pvt. Ltd., New Delhi, pp 69–76
Golds TJ, Lee JY, Husnain T, Ghose TK, Davey MR (1991) Agrobacterium rhizogenes mediated
transformation of the forage legumes Medicago sativa and Onobrychis viciifolia. J Exp Bot
42:1147–1157
Gorpenchenko TY, Kiselev KV, Bulgakov VP, Tchernoded GK, Bragina EA, Khodakovskaya MV,
Koren OG, Batygina TB, Zhuravlev YN (2006) The Agrobacterium rhizogenes rolC-gene in-
duced somatic embryogenesis and shoot organogenesis in Panax ginseng transformed calluses.
Planta 22:3457–3467
Graham LA, Liou YC, Walker VK, Davies PL (Aug 1997) Hyperactive antifreeze protein from
beetles. Nature 388(6644):727–728
Grant JE, Dommisse EM, Conner AJ (1991) Gene transfer to plants using Agrobacterium. In:
Murray DR (ed) Advanced methods in plant breeding and biotechnology. CAB International,
Wallingford, pp 50–73
Gutierrez-Pesce P, Taylor K, Muleo R, Rugini E (1998) Somatic embryogenesis and shoot regen-
eration from transgenic roots of the cherry root stock colt ( Prunus avium, P. pseudocerasus)
mediated by pRi 1855 T-DNA of Agrobacterium rhizogenes. Plant Cell Rep 17:574–580
Guyon P, Chilton M-D, Petit A, Tempe J (1980) Agropine in “null-type” crown gall tumors: evi-
dence for generality of the opine concept. Proc Natl Acad Sci 77:2693–2697
Guyon P, Petit A, Tempe J, Dessau Y (1993) Transformed plants producing opines specifically
promote growth of opine-degrading agrobacteria. Mol Plant Microb Interact 6:92–98
Hamill JD, Robins RJ, Parr AJ, Evans PM, Furze JD, Rhodes MJC (1990) Over expressing a yeast
ornithine decarboxylase gene in transgenic roots of Nicotiana rustica can lead to enhanced
nicotine accumulation. Plant Mol Biol 15:27–38
Han KH, Keathley DE, Davis JM, Gordon MP (1993) Regeneration of a transgenic woody legume
Robinia pseudoacacia L, (Black locust) and morphological alterations induced by Agrobacte-
rium rhizogenes mediated transformation. Plant Sci 88:149–57
Handa T (1992) Regneration and charaterization of prairie gentian ( Eustoma grandiflorum) plants
transformed by Agrobacterium rhizogenes. Plant Tiss Cult Lett 9:10–14.
Hansen G, Larribe M, Vaubert D, Tempe J, Biermann BJ, Montoya AL, Chilton MD, Brevet J
(1991) Agrobacterium rhizogenes pRi8196 T-DNA: mapping and DNA sequence of functions
involved in mannopine synthesis and hairy root differentiation (Ri plasmid). Proc Natl Acad
Sci 88:7763–7767
Hansen G, Vaubert D, Heron JN, Clerot D, Tempe J, Brevet J (1993) Phenotypic effects of overex-
pression of Agrobacterium rhizogenes T-DNA ORF13 in transgenic tobacco plants are medi-
ated by diffusible factor(s). Plant J 4:581–585
Hansen G, Das A, Chilton MD (1994a) Constitutive expression of the virulence genes improves
the efficiency of plant transformation by Agrobacterium. Proc Nat Acad Sci 91:7603–7607
Hansen G, Vaubert D, Clerot D, Tempe J, Brevet J (1994b) A new open reading frame, encoding a
putative regulatory protein, in Agrobacterium rhizogenes T-DNA. C R Acad Sci III 317:49–53
Hansen G, Vaubert D, Clerot D, Brevet J (1997) Wound-inducible and organ-specific expression
of ORF13 from Agrobacterium rhizogenes 8196 T-DNA in transgenic tobacco plants. Mol Gen
Genet 254(3):337–343.
Hasancebi S, Turgut Kara N, Cakir O, Ari S (2011) Micropropagation and root culture of Turkish
endemic Astragalus chrysochlorus (Leguminosae). Turk J Bot 35:203–210
Hatamoto H, Boulter ME, Shirsat AH, Croy EJ, Ellis JR (1990) Recovery of morphologically nor-
mal transgenic tobacco from hairy roots co-transformed with Agrobacterium rhizogenes and a
binary vector plasmid. Plant Cell Rep 9:88–92
Hatta M, Beyl CA, Garton S, Diner AM (1996) Induction of roots on jujube softwood cuttings
using Agrobacterium rhizogenes. J Hortic Sci 71(6):881–886
Hauptmann RM, Ozias-Akins P, Vasil V, Tabaeizadeh Z, Rogers SG, Horsch RB, Vasil IK, Fraley
RT (1987) Transient expression of electroporated DNA in monocotyledonous and dicotyledon-
ous species. Plant Cell Rep 6(4):265–270
Henzi MX, Christey MC, McNeil DL, Davies KM (1999) Agrobacterium rhizogenes-mediated
transformation of broccoli ( Brasica oleracea L. var italica) with an antisense 1-aminocyclo-
propane-1-carboxylic acid oxidase gene. Plant Sci 143:55–62
Hernalsteens JP, Bytebier B, Van Montagu M (1993) Transgenic asparagus. In: Kung SD, Wu R
(eds) Transgenic plants, present status and social and economic impacts, vol 2. San Diego,
Academic Press pp 35–46
Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice ( Oryza sativa L)
mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J
6:271–282
Hildebrand E (1934) Life history of the hairy-root organism in relation to its pathogenesis on
nursery apple trees. J Agric Res 48:857–885
Hirotaka K, Hiroshi K (2003) Gene silencing by expression of hairpin RNA in Lotus japonicus
roots and root nodules. Mol Plant Microbe Interact 16:663–668
Hodges LD, Cuperus J, Ream W (2004) Agrobacterium rhizogenes GALLS protein substitutes
for Agrobacterium tumefaciens single- stranded DNA-binding protein VirE2. J Bacteriol
186:3065–3007
Hodges LD, Vergunst AC, Neal-McKinney J, den Dulk-Ras A, Moyer DM, Hooykaas PJ, Ream W
(2006) Agrobacterium rhizogenes GALLS protein contains domains for ATP binding, nuclear
localization, and type IV secretion. J Bacteriol 188:8222–8230
Holefors A, Xue ZT, Welander M (1998) Transformation of the apple rootstock M26 with the rolA
gene and its influence on growth. Plant Sci 136:69–78
Hong S-B, Hwang I, Dessaux Y, Guyon P, Kim K-S, Farrand SK (1997) A T-DNA gene required
for agropine biosynthesis by transformed plants is functionally and evolutionarily related to
a Ti plasmid gene required for catabolism of agropine by Agrobacterium strains. J Bacteriol
179:4831–4840
Hong SB, Peebles CA, Shanks JV, San KY, Gibson SI (2006) Terpenoid indole alkaloid production
by Catharanthus roseus hairy roots induced by Agrobacterium tumefaciens harboring rolABC
genes. Biotechnol Bioeng 93:386–390
Hoshino Y, Mii M (1998) Bialaphos stimulates shoot regeneration from hairy roots of snapdragon
(Antirrhinum majus L.) transformed by Agrobacterium rhizogenes. Plant Cell Rep 17:256–261
Hosokawa K, Matsuki R, Oikawa Y, Yamamura S (1997) Genetic transformation of gentian using
wild-type Agrobacterium rhizogenes. Plant Cell Tiss Org Cult 51:137–140
Hosoki T, Shiraishi K, Kigo T, Ando M (1989) Transformation and regeneration of ornamental
kale (Brassica oleracea var. Acephala DC) mediated by Agrobacterium rhizogenes. Sci Hort
40:259–266
Hu ZB, Du M (2006) Hairy root and its application in plant genetic engineering. J Int Plant Biol
48:121–127
Huffman GA, White FF, Gordon MP, Nester EW (1984) Hairy-root-inducing plasmid: physical
map and homology to tumor-inducing plasmids. J Bacteriol 157:269–276
Hwang CF, Bhakta AV, Truesdell GM, Pudlo WM, Williamson VM (2000) Evidence for a role of
the N terminus and leucine-rich repeat region of the Mi gene product in regulation of localized
cell death. Plant Cell 12:1319–1329
Inze D, Follin A, Van Lijsebettens M, Simoens C, Genetello C, Van Montagu M, Schell J
(1984) Genetic analysis of the individual T-DNA genes of Agrobacterium tumefaciens; fur-
ther evidence that two genes are involved in indole-3-acetic acid synthesis. Mol Gen Genet
194:265–274
Ishizaki T, Hoshino Y, Masuda K, Oosawa K (2002) Explants of Ri-transformed hairy roots of
spinach can develop embryogenic calli in the absence of gibberellic acid, an essential growth
regulator for induction of embryogenesis from nontransformed roots. Plant Sci 163:223–231
Isogai A, Fukuchi N, Hayashi M, Kamada H, Harada H, Suzuki A (1988) Structure of a new
opine, mikimopine, in hairy root induced by Agrobacterium rhizogenes. Agric Bio and Chem
52:3235–3237
Jacobs M, Rubery PH (1988) Naturally occurring auxin transport regulators. Science 241:346–349
James C (2006) Global Status of Commercialized Biotech/GM Crops: 2006. ISAAA Briefs No.
35. ISAAA (International Service for the Acquisition of Agri-Biotech Applications). Ithaca,
New York
Jouanin L (1984) Restriction map of an agropine-type Ri plasmid and its homologies to Ti plas-
mids. Plasmid 12:91–102
Jouanin L, Guerche P, Pamboukdjian N, Tourneur C, Casse Delbart F, Tourneur J (1987a) Structure
of T-DNA in plants regenerated from roots transformed by Agrobacterium rhizogenes strain
A4. Mol Gen Genet 206(3):387–392
Jouanin L, Vilaine F, Tourneur J, Tourneur C, Pautot V, Muller JF, Caboche M (1987b) Transfer
of a 4.3-kb fragment of the TL-DNA of Agrobacterium rhizogenes strain A4 confers the pRi-
transformed phenotype to regenerated tobacco plants. Plant Sci 53:53–63
Kärkönen A, Koutaniemi S, Mustonen M, Syrjänen K, Brunow G, Kilpeläinen I, Teeri TH, Simola
LK (2002) Lignification related enzymes in Picea abies suspension cultures. Physiol Plant
114:343–353
Keil M (2002) Fine chemicals from plants. In: Marja K, Caldentey KM, Barz W (eds) Plant bio-
technology and transgenic plants. Marcel Dekker Inc, New York, pp 1–20
Keller CP, Van Volkenburgh E (1998) Evidence that auxin-induced growth of tobacco leaf tissues
does not involve cell wall acidification. Plant Physiol 118:557–564
Kersters K, De Ley J (1984) Genus III Agrobacterium Conn 1942 In Bergey’s Manual of Systemat-
ic Bacteriology, vol 1. In: Krieg NR, Holt JG (eds) Baltimore: Williams & Wilkins, pp 244–254
Kifle S, Shao M, Jung C, Cai D (1999) An improved transformation protocol for studying gene
expression in hairy roots of sugar beet ( Beta vulgaris L). Plant Cell Rep 18:514–519
Kim YJ, Weathers PJ, Wyslouzil BE (2002) The growth of Artemisia annua hairy roots in liquid
and gas phase reactors. Biotechnol Bioeng 80:454–464
Kim YK, Hui X, Park WT, Park NI, Young LS, Park SU (2010) Genetic transformation of buck-
wheat (Fagopyrum esculentum M.) with Agrobacterium rhizogenes and production of rutin in
transformed root cultures. Aust J Crop Sci 4(7):485–490s
Kiselev KV, Dubrovina AS, Veselova MV, Bulgakov VP, Fedoreyev SA, Zhuravlev YN (2007)
The rolB gene-induced overproduction of resveratrol in Vitis amurensis transformed cells. J
Biotechnol 128:681–692
Kiyokawa S, Kobayashi K, Kikuchi Y, Kamada H, Harada H (1994) Root-inducing of mikimopine
type Ri plasmid pRi1724. Plant Physiol 104:801–802
Kiyokawa S, Kikuchi Y, Kamada H, Harada H (1996) Genetic transformation of Begonia tuber-
hybrida by Ri rol genes. Plant Cell Rep 15:606–609
Klee HJ, Horsch RB, Hinchee MA, Hein MB, Hoffmann NL (1987) The effect of over produc-
tion of two Agrobacterium tumefaciens T-DNA auxin biosynthetic gene products in transgenic
Petunia plants. Genes Dev 1:86–89
Koltunow AM, Johnson SD, Lynch M, Yoshihara T, Costantino P (2001) Expression of rolB in
apomictic Hieracium piloselloides Vill. causes ectopic meristems in planta and changes in
ovule formation, where apomixis initiates at higher frequency. Planta 214:196–205
Krolicka A, Staniszewska II, Bielawski K, Malinski E, Szafranek J, Lojkowska E (2001) Estab-
lishment of hairy root cultures of Ammi majus. Plant Sci 160:259–264
Kuiper HA, Kleter GA, Noteborn HPJM, Kok EJ (2001) Assessment of the food safety issues
related to genetically modified foods. The Plant J 27(6):503–528
Kumar V, Sharma A, Prasad BCN, Gururaj HB, Ravishankar GA (2006) Agrobacterium rhizo-
genes mediated genetic transformation resulting in hairy root formation is enhanced by ultra-
sonication and acetosyringone treatment. Electron J Biotech 9(4):349–357
Lahners K, Byrne MC, Chilton MD (1984) T-DNA fragments of hairy root plasmid pRi8196 are
distantly related to octopine and nopaline Ti plasmid T-DNA. Plasmid 11:130–140
Lambert C, Tepfer D (1992) Use of Agrobacterium rhizogenes to create transgenic apple trees hav-
ing an altered organogenic response to hormones. Theor Appl Genet 85:105–109
Lan XZ, Quan H (2010) Hairy root culture of Przewalskia tangutica for enhanced production of
pharmaceutical tropane alkaloids. J Med Plants Res 4:1477–1481
Leach F, Aoyagi K (1991) Promoter analysis of the highly expressed rolC and rolD root-inducing
genes of Agrobacterium rhizogenes: enhancer and tissue-specific DNA determinants are dis-
sociated. Plant Sci 79:69–76
Lee NG, Stein B, Suzuki H, Verma DPS (1993) Expression of antisense nodulin-35 RNA in Vi-
gna aconitifolia transgenic root nodules retards peroxisome development and affects nitrogen
availability to the plant. Plant J 3:599–606
Lee S, Blackhall NW, Power JB, Cocking EC, Tepfer D, Davey MR (2001) Genetic and mor-
phological transformation of rice with the rolA gene from the Ri TL-DNA of Agrobacterium
rhizogenes. Plant Sci 161:917–925
Lemcke K, Schmulling T (1998) Gain of function assays identify non-rol genes from Agrobac-
terium rhizogenes TL-DNA that alter plant morphogenesis or hormone sensitivity. Plant J
15(3):423–433
Lemcke K, Prinsen E, Van Onckelen H, Schmülling T (2000) The ORF8 gene product of Agro-
bacterium rhizogenes TL-DNA has tryptophan 2-monooxygenase activity. Mol Plant Microbe
Interact 13:787–790
Lessard PA, Kulaveerasingam H, York GM, Strong A, Sinskey AJ (2002) Manipulating gene ex-
pression for the metabolic engineering of plants. Metab Eng 4:67–79
Levesque H, Delepelaire P, Rouze P, Slightom J, Tepfer D (1988) Common evolutionary origin
of the central portions of the Ri TL-DNA of Agrobacterium rhizogenes and the Ti T-DNAs of
Agrobacterium tumefaciens. Plant Mol Biol 11:731–744
Li N, Huxtable S, Yang SF, Kung SD (1996) Effects of N-terminal deletions on 1-minocyclopro-
pane-1-carboxylate synthase activity. FEBS Lett 378:286–290
Li D, Zhang Y, Hu X, Shen X, Ma L, Su Z, Wang T, Dong J (2011) Transcriptional profiling of
Medicago truncatula under salt stress identified a novel CBF transcription factor MtCBF4 that
plays an important role in abiotic stress responses. BMC Plant Biology 11:109–138
Limami A, Sun LY, Douat C, Helgeson J, Tepfer D (1998) Natural genetic transformation by Agro-
bacterium rhizogenes. Plant Physiol 118:543–550
Lin HW, Kwok KH, Doran PM (2003) Production of podophyllotoxin using cross-species cocul-
ture of Linum flavum hairy roots and Podophyllum hexandrum cell suspensions. Biotechnol
Bioeng 19:1417–1426
Lorence A, Medina-Bolivar F, Nessler CL (2004) Camptothecin and 10-hydroxycamptothecin
from Camptotheca acuminata hairy roots. Plant Cell Rep 22:437–441
Luczkiewicz M, Kokotkiewicz A (2005) Genista tinctoria hairy root cultures for selective produc-
tion of isoliquiritigenin. Z Naturforsch 60c:867–875
MacRae S, Van Staden J (1993) Agrobacterium rhizogenes-mediated transformation to improve
rooting ability of eucalypts. Tree Physiol 12:411–418
Manners JM, Way H (1989) Efficient transformation with regeneration of the tropical pasture
legume Stylosanthes humilis using Agrobacterium rhizogenes and a Ti plasmid-binary vector
system. Plant Cell Rep 8:341–345
Martin-Tanguy J (2001) Metabolism and function of polyamines in plants: recent development
(new approaches). Plant Growth Regul 34:135–148
Martin-Tanguy J, Sun LY, Burtin D, Vernoy R, Rossin N, Tepfer D (1996) Attenuation of the
phenotype caused by the root-inducing, left-hand, transferred DNA and its rolA gene. Plant
Physiol 111:259–267
Matsumoto K, Cabral GB, Teixeira JB, Monte DC (2009) Agrobacterium-mediated transient ex-
pression system in banana immature fruits. Afr J Biotechnol 8(17):4039–4042
Maurel C, Barbier-Brygoo H, Spena A, Tempe J, Guern J (1991) Single rol genes from the Agro-
bacterium rhizogenes TL-DNA alter some of the cellular responses to auxin in Nicotiana taba-
cum. Plant Physiol 97(1):212–216
Maurel C, Leblanc N, Barbier-Brygoo H, Perrot-Rechenmann C, Bouvier-Durand M, Guern J
(1994) Alterations of auxin perception in rolB-transformed tobacco protoplasts (time course
of rolB mRNA expression and increase in auxin sensitivity reveal multiple control by auxin).
Plant Physiol 105:1209–1215
Mauro ML, Trovato M, Paolis AD, Gallelli A, Costantino P, Altamura MM (1996) The plant onco-
gene rolD stimulates flowering in transgenic tobacco plants. Dev Biol 180:693–700
Mayo O (1987) The theory of plant breeding, 2nd edn. Clarendon Press, Oxford
McCullen CA, Binns AN (2006) Agrobacterium tumefaciens and plant cell interactions and activi-
ties required for interkingdom macromolecular transfer. Annu Rev Cell Dev Biol 22:101–127
McInnes E, Morgan AJ, Mulligan BJ, Davey MR (1991) Phenotypic effects of isolated pRiA4 TL-
DNA rol genes in the presence of intact TR-DNA in transgenic plants of Solanum dulcamara
L. J Exp Bot 42(10):1279–1286
Medford J, Horgan R, El-Sawi Z, Klee HJ (1989) Alterations of endogenous cytokinins in trans-
genic plants using a chimeric isopentenyl transferase gene. Plant Cell 1:403–413
Medina-Bolivar F, Condori J, Rimando AM, Hubstenberger J, Shelton K, O'Keefe SF, Bennett
S, Dolan MC (2007) Production and secretion of resveratrol in hairy root cultures of peanut.
Phytochemistry 68:1992–2003
Mehrotra S, Kukreja AK, Kumar A, Khanuja SPS, Mishra BN (2008) Genetic transformation stud-
ies and scale up of hairy root culture of Glycyrrhiza glabra in bioreactor. Electron J Biotech
11(2):15
Messner B, Boll M (1993) Elicitor-mediated induction of enzymes of ligninbiosynthesis and for-

mation of lignin-like material in a cell suspension culture of spruce ( Picea abies). Plant Cell
Tiss Org 34:261–269
Meyer A, Tempe J, Costantino P (2000) Hairy root: a molecular overview functional analysis of
Agrobacterium rhizogenes T-DNA genes. In: Stacey G, Keen N (eds) Plant-microbe interac-
tions, vol 5. APS Press, Minnesota, pp 93–139
Miflin B (2000) Crop improvement in the 21st century. J Exp Biol 51(342):1–8
Mihaljevic S, Stipkovic S, Jelaska S (1996) Increase of root induction in Pinus nigra explants us-
ing Agrobacteria. Plant Cell Rep 15:610–614
Milly PCD, Dunne KA, Vecchia AV (2005) Global patterns of trends in streamflow and water
availability in a changing climate. Nature 438:347–350
Mishra BN, Ranjan R (2008) Growth of hairy-root cultures in various bioreactors for the produc-
tion of secondary metabolites. Biotechnol Appl Biochem 49:1–10
Morgan AJ, Cox PN, Turner DA, Peel E, Davey MR, Gartland KMA, Mulligan BJ (1987) Trans-
formation of tomato using an Ri plasmid vector. Plant Sci 49:37–49
Moriguchi K, Maeda Y, Satou M, Hardayani NS, Kataoka M, Tanaka N, Yoshida K (2001) The
complete nucleotide sequence of a plant root-inducing (Ri) plasmid indicates its chimeric
structure and evolutionary relationship between tumor-inducing (Ti) and symbiotic (Sym)
plasmids in Rhizobiaceae. J Mol Biol 307:771–784
Moritz T, Schmülling T (1998) The gibberellin content of rolA transgenic tobacco plants is specifi-
cally altered. J Plant Physiol 153:774–776
Moyano E, Fornalé S, Palazón J, Cusidó RM, Bonfill M, Morales C, Piñol MT (1999) Effect of
Agrobacterium rhizogenes T-DNA on alkaloid production in Solanaceae plants. Phytochemis-
try 52(7):1287–1292
Momčilović I, Grubišić D, Kojić M, Nešković M (1997) Agrobacterium rhizogenes -mediated
transformation and plant regeneration of four Gentiana species. Plant Cell Tiss Org Organ Cult
50(1):1–6
Mugnier AJ (1988) Establishment of new axenic hairy root lines by inoculation with Agrobacte-
rium rhizogenes. Plant Cell Rep 7:9–12
Mugnier J (1997) Mycorrhizal interactions and the effects of fungicides, nematicides and herbi-
cides on hairy root cultures. In: Doran PM (ed) Hairy roots: culture and applications. Harwood
Academic Publishers, Amsterdam, pp 123–132
Murugesan S, Manoharan C, Vijayakumar R, Panneerselvam A (2010) Isolation and characteriza-
tion of Agrobacterium rhizogenes from the root nodules of some leguminous. Intl J Microbiol
Res 1(3):92–96
Nader BL, Taketa AT, Pereda-Miranda R, Villarreal ML (2006) Production of triterpenoids in liq-
uid-cultivated hairy roots of Galphimia glauca. Planta Med 72:842–844
Nakamura T, Handa T, Oono Y, Kanaya K, Michikawa M, Uchimiya H (1988) Organ-specific
mRNA in transgenic tobacco plants possessing T-DNA of Ri plasmids. Plant Sci 56:213–218
Nakano M, Hoshino Y, Mii M (1994) Regeneration of transgenic plants of grape vine ( Vitis vi-
nifera L.) via Agrobacterium rhizogenes mediated transformation of embryogenic calli. J Exp
Bot 45(274):649–656
Nandakumar R, Suzanne LC, Rogers MD (2005) Agrobacterium-mediated transformation of the
wetland monocot Typha latifolia L (Broadleaf cattail). Plant Cell Rep 23:744–750
Navarrete GE, Affantranger XAl, Olivares JE, Camino CD, Santana O, Murillo E, Guillen G,
Guevara NS, Acosta J, Quinto C, Li D, Gresshoff PM, Sanchez F (2006) Agrobacterium rhizo-
genes transformation of the phaseolus spp.: a tool for functional genomics. Mol Plant Microbe
Interact 19(12):1385–1393
Nemoto K, Hara M, Suzuki M, Seki H, Oka A, Muranaka T, Mano Y (2009) Function of the aux and
rol genes of the Ri plasmid in plant cell division in vitro. Plant Signal Behav 4(12):1145–1147
Nenz E, Pupilli F, Paolocci F, Damiani F, Cenci CA, Arcioni S (1996) Plant regeneration and ge-
netic transformation of Lotus angustissimus. Plant Cell Tiss Organ Cult 45:145–152
Nilsson O, Crozier A, Schmülling T, Sandberg G, Olsson O (1993a) Indole-3-acetic acid homeo-

stasis in transgenic tobacco plants expressing the Agrobacterium rhizogenes rolB gene. Plant
J 3:681–689
Nilsson O, Moritz T, Imbault N, Sandberg G, Olsson O (1993b) Hormonal characterization of
transgenic tobacco plants expressing the rolC gene of Agrobacterium rhizogenes TL-DNA.
Nilsson O, Little CH, Sandberg G, Olsson O (1996a) Expression of two heterologous promoters,
Agrobacterium rhizogenes rolC and cauliflower mosaic virus 35S, in the stem of transgenic hy-
brid aspen plants during the annual cycle of growth and dormancy. Plant Mol Biol 31:887–895
Nilsson O, Moritz T, Sundberg B, Sandberg G, Olsson O (1996b) Expression of the Agrobacterium
rhizogenes rolC gene in a deciduous forest tree alters growth and development and leads to
stem fasciation. Plant Physiol 112:493–502
Nilsson O, Olsson O (1997) Getting to the root: the role of the Agrobacterium rhizogenes rol genes
in the formation of hairy roots. Physiol Plant 100:463–473
Noda T, Tanaka N, Mano Y, Nabeshima S, Ohkawa H, Matsui C (1987) Regeneration of horserad-
ish hairy roots incited by Agrobacterium rhizogenes infection. Plant Cell Rep 6:283–286
Ohara A, Akasaka Y, Daimon H, Mii M (2000) Plant regeneration from hairy roots induced by
infection with Agrobacterium rhizogenes in Crotalaria juncea L. Plant Cell Rep 19:563–568
Oksman-Caldentey KM, KivelaÈ O, Hiltunen R (1991) Spontaneous shoot organogenesis and
plant regeneration from hairy root cultures of Hyoscyamus muticus. Plant Sci 78:129–136
Olempska-Beer ZWS, Merker RI, Ditto MD, DiNovi MJ (2006) Food-processing enzymes from
recombinant microorganisms-a review. Regul Toxicol Pharmacol 45:144–158
Olhoft PM, Bernal LM, Grist LB, Hill DS, Mankin SL, Shen Y, Kalogerakis M, Wiley H, Toren
E, Song H-S, Hillebrand H, Jones T (2007) A novel Agrobacterium rhizogenes-mediated trans-
formation method of soybean [Glycine max (L.) Merrill] using primary-node explants from
seedlings. In Vitro Cell Dev Biol Plant 43:536–549
Ondrej M, Biskova R (1986) Differentiation of Petunia hybrida tissues transformed by Agrobacte-
rium rhizogenes and Agrobacterium tumefaciens. Biol Plant 28:152–155
Ooms G, Twell D, Bossen ME, Hoge JHC, Burrell MM (1986) Developmental regulation of RI TL-
DNA gene expression in roots, shoots and tubers of transformed potato ( Solanum tuberosum
cv. Desiree). Plant Mol Biol 6:321–330
Oono Y, Kanaya K, Uchimiya H (1990) Early flowering in transgenic tobacco plants possessing
the rolC gene of Agrobacterium rhizogenes Ri plasmid. Jpn J Genet 68:7–16
Oono Y, Handa T, Kanaya K, Uchimiya H (1987) The TL-DNA gene of Ri plasmids responsible
for dwarfness of tobacco plants. Jpn J Genet 62:501–505
Otani M, Mu M, Handa T, Kamada H, Shimada T (1993) Transformation of sweet potato ( Ipomoea
batatus (L.) Lam.) plants by Agrobacterium rhizogenes. Plant Sci 94:151–159
Otten L, Helfer A (2001) Biological activity of the rolB-like 5′ end of the A4-ORF8 gene from the
Agrobacterium rhizogenes TL -DNA. Mol Plant Microbe Interact 14:405–411
Ouartsi A, Clerot D, Meyer A, Dessaux Y, Brevet J, Bonfill M (2004) The T-DNA ORF8 of the
cucumopine-type Agrobacterium rhizogenes Ri plasmid is involved in auxin response in trans-
genic tobacco. Plant Sci 166:557–567
Ozyigit II (2012) Agrobacterium tumefaciens and its use in plant biotechnology. In: Ashraf M, Oz-
turk M, Ahmad MSA, Aksoy A (eds) Crop production for agricultural improvement. Springer,
The Netherlands, pp 317–361
Özcan S, Uranbey S, Sancak C, Parmaksiz İ, Gürel E, Babaoğlu M (2004) Agrobacterium
aracılığıyla gen aktarımı. In: Özcan S, Gürel E, Babaoğlu M (eds) Bitki Biyoteknolojisi II
(Plant biotechnology, II), Genetik Mühendisliği ve Uygulamaları (Genetic engineering and its
applications), Cilt II, 2nd edn. SÜ Vakfi Yayınlari, Turkey, pp 112–159
Pal A., Swain SS, Mukherjee AK, Chand PK (2012) Agrobacterium pRi TL-DNA rolB and TR-
DNA opine genes transferred to the spiny Amaranth ( Amaranthus spinosus L.)—A nutraceuti-
cal crop. Food Technol Biotech (In press)
Palazon J, Cusido RM, Roig C, Pinol MT (1998) Expression of the rol gene and nicotine produc-
tion in transgenic hairy roots and their regenerated plants. Plant Cell Rep 17:384–90
Park Nl, JK Kim, WT Park, JW Cho, YP Lim, SU Park (2011) An efficient protocol for genetic
transformation of watercress ( Nasturtium officinale) using Agrobacterium rhizogenes. Mol
Biol Rep 38:4947–4953
Pavingerova D, Ondrej M (1986) Comparison of hairy root and crown gall tumors of Arabidopsis
thaliana. Biol Plant 28:149–151
Pellegrineschi A, Davolio-Mariani O (1996) Agrobacterium rhizogenes-mediated transformation
of scented geranium. Plant Cell Tiss Organ Cult 47:79–86
Pellegrineschi A, Damon JP, Valtorta N, Paillard N, Tepfer D (1994) Improvement of ornamental
characters and fragrance production in lemon-scented geranium through genetic transforma-
tion by Agrobacterium rhizogenes. Nat Biotechnol 12:64–68
Pérez-Molphe-Balch E, Ochoa-Alejo N (1998) Regeneration of transgenic plants of Mexican lime
from Agrobacterium rhizogenes-transformed tissues. Plant Cell Rep 17:591–596
Petersen SG, Stummann BM, Olesen P, Henningsen KW (1989) Structure and function of root-
inducing (Ri) plasmids and their relation to tumor-inducing (Ti) plasmids. Physiol Plantarum
77:427–435
Petit A, David C, Dahl G, Ellis JG, Guyon P, Casse-Delbart FC, Tempe J (1983) Further extension
of the opine concept: plasmids in Agrobacterium rhizogenes cooperate for opine degradation.
Mol Gen Genet 19:204–214
Phelep M, Petit A, Martin L, Duhoux E, Tempe J (1991) Transformation and regeneration of a
nitrogen-fixing tree, Allocasuarina verticillata Lam. Biotechnol 9:461–466
Popa G, Cornea C P, Brezeanu A (2006) Influence of different Agrobacterium rhizogenes strains
on hairy roots induction in Eustoma grandiflorum. Roum Biotechnol Lett 11(1):2587–2592
Porter J (1991) Host range and implications of plant infection by Agrobacterium rhizogenes. Crc
Cr Rev Plant Sci 10:387–421
Pradel H, Dumke-Lehmann U, Dietrich B, Luckner M (1997) Hairy root cultures of Digitalis la-
nata. Secondary metabolism and plant regeneration. J Plant Physiol 151:209–215
Prinsen E, Bytebier B, Hernalsteens JP, De Greef J, Van Onckelen H (1990) Functional expression
of Agrobacterium tumefaciens T-DNA onc-genes in Asparagus crown gall tissues. Plant Cell
Physiol 31:69–75
Prinsen E, Chriqui D, Vilaine F, Tepfer M, Van Onckelen H (1994) Endogenous phytohormones in
tobacco plants transformed with Agrobacterium rhizogenes pRi TL-DNA genes. Plant Physiol
144:80–85
Putalun W, Udomsin O, Yusakul G, Juengwatanatrakul T, Sakamoto S, Tanaka H (2010) Enhanced
plumbagin production from in vitro cultures of Drosera burmanii using elicitation. Biotechnol
Lett 32:721–724
Quandt HJ, Pühler A, Broer I (1993) Transgenic root nodules of Vicia hirsuta a fast and efficient
system for the study of gene expression in indeterminate-type nodules. Mol Plant Microbe
Ramsay G, Kumar A (1990) Transformation of Vicia faba cotyledon and stem tissues Agrobacte-
rium rhizogenes: infectivity and cytological studies. J Exp Bot 41:841–847
Rao AQ, Bakhsh A, Kiani S, Shahzad K, Shahid AA, Husnain T, Riazuddin S (2009) The myth of
plant transformation. Biotechnol Adv 27:753–763
Rao SR, Ravishankar G (2002) Plant cell cultures: chemical factories of secondary metabolites.
Biotechnol Adv 20:101–153
Ream W (2002) Agrobacterium genetics. In: Streips UN, Yasbin RE (eds) Modern Microbial Ge-
netics, 2nd edn. Wille-Liss Inc., New York, pp 323–348
Rech EL, Golds TJ, Husnain T, Vainstein MH, Jones B, Hammat N, Mulligan BJ, Davey MR
(1989) Expression of a chimaeric kanamycin resistance gene introduced into the wild soybean
Glycine canescens using a cointegrate Ri plasmid vector. Plant Cell Rep 8:33–36
Remeeus PM, van Bezooijen J, Wijbrandi J, van Bezooijen J (1998) In vitro testing is a reliable
way to screen the temperature sensitivity of resistant tomatoes against Meloidogyne incognita.
In: Proceedings of 5th international symposium on crop protection, Universiteit Gent Belgium,
vol 63, pp 635–640
Riker AJ, Banfield WM, Wright WH, Keitt GW (1930) Studies on infectious hairy root of nursery
apple trees. J Agric Res 41:507–540
Rinallo C, Mittempergher L, Frugis G, Mariotti D (1999) Clonal propagation in the genus Ulmus:
improvement of rooting ability by Agrobacterium rhizogenes T-DNA genes. J Hortic Sci Bio-
technol 74:502–506
Rossi L, Hohn B, Tinland B (1996) Integration of complete transferred DNA units is dependent
on the activity of virulence E2 protein of Agrobacterium tumefaciens. Proc Natl Acad Sci USA
93:126–130
Rugh CL (2001) Mercury detoxification with transgenic plants and other biotechnological break-
throughs for phytoremediation. In Vitro Cell Dev Biol Plant 37:321–325
Rugini E, Mariotti D (1991) Agrobacterium rhizogenes T-DNA genes and rooting in woody spe-
cies. Acta Hort 300:301–307
Rugini E, Pellegrineschi A, Mencuccini M, Mariotti D (1991) Increase of rooting ability in the
woody species kiwi ( Actinidia deliciosa A. Chev.) by transformation with Agrobacterium rhi-
zogenes rol genes. Plant Cell Rep 10:291–295
Rugini E, Muganu M, Gutiérrez-Pesce P E, Lolletti D (1996) Comportamento vegeto-produttivo
di alcune specie fruttifere transgeniche per il T-DNA e geni rol di Agrobacterium rhizogenes.
Convegno SIGA, Workshop Organismi geneticamente modificati e resistenze genetiche, Bo-
logna, pp 55–57
Ryder MH, Tate ME, Kerr A (1985) Virulence properties of strains of Agrobacterium on the apical
and basal surfaces of carrot root discs. Plant Physiol 77:215–221
Saha P, Chakraborti D, Sarkar A, Dutta I, Basu D, Das S (2007) Characterization of vascularspe-
cific RSs1 and rolC promoters for their utilization in engineering plants to develop resistance
against hemipteran insect pests. Planta 226:429–442
Saito K, Yamazaki M, Anzai H, Yoneyama K, Murakoshi I (1992) Transgenic herbicide-resistant
Atropa belladonna using an Ri plasmid vector and inheritance of the transgenic trait. Plant Cell
Rep 11:219–224
Satheeshkumar K, Jose B, Sonia EV, Seeni S (2009) Isolation of morphovariants through plant
regeneration in A. rhizogenes induced hairy root cultures of Plumbago rosea L. Indian J Bio-
technol 8:435–441
Savka MA, Ravillion B, Noel GR, Farrand SK (1990) Induction of hairy roots on cultivated
soybean genotypes and their use to propagate the soybean cyst nematode. Phytopathology
80(5):503–508.
Schmulling T, Schell J, Spena A (1988) Single genes from Agrobacterium rhizogenes influence
plant development. EMBO J 7:2621–2629
Schmülling T, Fladung M, Grossmann K, Schell J (1993) Hormonal content and sensitivity of
transgenic tobacco and potato plants expressing single rol genes of Agrobacterium rhizogenes
T-DNA. Plant J 3:371–382
Schröder G, Waffenschmidt S, Weiler E, Schröder J (1984) The region of Ti plasmid codes for an
enzyme synthesizing indole-3-acetic acid. Eur J Biochem 138:387–391
Scorza R, Zimmerman TW, Cordts JM, Footen KJ (1994) Horticultural characteristics of transgenic
tobacco expressing the rolC gene from Agrobacterium. J Amer Soc Hort Sci 119(5):1091–1098
Sentoku N, Sato Y, Matsuoka M (2000) Overexpression of rice OSH genes induces ectopic shoots
on leaf sheaths of transgenic rice plants. Dev Biol 220:358–364
Sevon N, Oksman-Caldentey KM (2002) Agrobacterium rhizogenes mediated transformation:
root cultures as a source of alkaloids. Planta Med 68:859–868
Shahin EA, Sukhapinda K, Simpson RB, Spivey R (1986) Transformation of cultivated tomato
by a binary vector in Agrobacterium rhizogenesis: transgenic plants with normal phenotypes
harbor binary vector T-DNA but no Ri-plasmid T-DNA. Theor Appl Genet 72:770–777
Shen WH, Petit A, Guern J, Tempe J (1988) Hairy roots are more sensitive to auxin than normal
roots. Proc Natl Acad Sci 85:3417–3421
Shen WH, Davioud E, David C, Barbier-Brygoo H, Tempe J, Guern J (1990) High sensitivity to
auxin is a common feature of hairy root. Plant Physiol 94:554–560
Shin DI, Podila GK, Huang Y, Karnosky DF (1994) Transgenic larch expressing genes for herbi-
cide and insect resistance. Can J For Res 4:2059–2067
Shinde AN, Malpathak N, Fulzele PD (2009) Enhanced production of phytoestrogenic isoflavones
from hairy root cultures of Psoralea corylifolia L. using elicitation and precursor feding. Bio-
technol Bioprocess E 14:288–294
Shkryl YN, Veremeichik GN, Bulgakov VP, Tchernoded GK, Mischenko NP, Fedoreyev
SA, Zhuravlev YN (2008) Individual and combined effects of the rolA, B and C genes
on anthraquinone production in Rubia cordifolia transformed calli. Biotechnol Bioeng
100(1):118–125
Shoja HM (2010) Contribution to the study of the Agrobacterium rhizogenes plast genes, rolB and
rolC, and their homologs in Nicotiana tabacum. Universite de Strasbourg, France
Sinha N, Williams R, Hake S (1993) Overexpression of the maize homeobox gene, KNOTTED-1,
causes a switch from determinate to indeterminate cell fates. Genes Dev 7:787–795
Sinkar V, Pythoud F, White F, Nester E, Gordon M (1988) rolA locus of the Ri plasmid directs
developmental abnormalities in transgenic plants. Genes Dev 2:688–697
Slightom JL, Durand-Tardif M, Jouanin L, Tepfer D (1986) Nucleotide sequence analysis of TL-
DNA of Agrobacterium rhizogenes agropine type plasmid. J Biol Chem 261:108–121
Smigocki AC, Hammerschlag FA (1991) Regeneration of plants from peach embryo cells infected
with a shooty mutant strain of Agrobacterium. J Amer Soc Hort Sci 116:1092–1097
Smulders M JM, Croes AF, Kemp A, Hese KM, Harren F, Wullems GJ (1991) Inhibition by ethyl-
ene of auxin promotion of flower bud formation in tobacco explants is absent in plants trans-
formed by Agrobacterium rhizogenes. Plant Physiol 96:1131–1135
Spano L, Costantino P (1982) Regeneration of plants from callus cultures of roots induced by
Agrobacterium rhizogenes on tobacco. Z Pflanzenphysiol 106:87–92
Spano L, Mariotti D, Cardarelli M, Branca C, Costantino P (1988) Morphogenesis and auxin
sensitivity of transgenic tobacco with different complements of Ri T-DNA. Plant Physiol
87(2):479–483
Specq A, Hansen G, Vaubert D, Clerot D, Heron JN, Tempe J, Brevet J (1994) Studies on hairy root
T-DNA: regulation and properties of ORF13 from Agrobacterium rhizogenes 8196. In Plant
Pathogenic Bacteria, Versailles, pp 465–468
Spena A, Schmulling T, Konct C, Schell JS (1987) Independent and synergistic activity of rolA, B
and C loci in stimulating abnormal growth in plants. EMBO J 206(13):3891–3899
Spiral J, Thierry C, Paillard M, Petiard V. (1993) Obtention de plantules de Coffea canephora
Pierre (Robusta) transformées par Agrobacterium rhizogenes. C R Acad Sci Hebd Seances
Acad Sci 316:1–6
Sretenovic-Rajicic T, Ninkovi S, Miljus-Dukic J, Vinterhalter B, Vinterhalter D (2006) Agrobac-
terium rhizogenes-mediated transformation of Brassica oleracea var. sabauda and B. oleracea
var. capitata. Biol Plant 50:525–530
Stieger PA, Meyer AD, Kathmann P, Fründt C, Niederhauser I, Barone M, Kuhlemeier C (2004)
The orf13 T-DNA Gene of Agrobacterium rhizogenes confers meristematic competence to dif-
ferentiated cells. Plant Physiol 135(3):1798–1808
Stiller J, Nasinec V, Svoboda S, Nemcova B, Machackova T (1992) Effects of agrobacterial onco-
genes in kidney vetch ( Anthyllis vulneraria L.). Plant Cell Rep 11:363–367
Stiller J, Martirani L, Tuppale S, Chian RJ, Chiurazzi M, Gresshoff PM (1997) High frequency
transformation and regeneration of transgenic plants in the model legume Lotus japonicus. J
Exp Bot 48:1357–1365
Stummer BE, Smith SE, Langridge P (1995) Genetic transformation of Verticordia grandis
(Myrtaceae) using wild-type Agrobacterium rhizogenes and binary Agrobacterium vectors.
Plant Sci 111:51–62
Sudha CG, Obul Reddy B, Ravishankar GA, Seeni S (2003) Production of ajmalicine and ajma-
line in hairy root cultures of Rauvolfia micrantha Hookf, a rare and endemic medicinal plant.
Biotechnol Lett 25:631–636
Suginuma C, Akihama T (1995) Transformation of gentian with Agrobacterium rhizogenes. Acta
Hort 392:153–160
Sun, L-Y, Monneuse M-O, Martin-Tanguy J, Tepfer D (1991) Changes in flowering and accumula-
tion of polyamines and hydroxycinnamic acid-polyamine conjugates in tobacco plants trans-
formed by theA locus from the Ri TL-DNA of Agrobacterium rhizogenes. Plant Sci 80:145–146
Suzuki M (1989) SPXX, a frequent sequence motif in gene regulatory proteins. J Mol Biol
207:61–84
Suzuki H, Fowler T, Tierney M (1993) Deletion analysis and localization of SbPRP1, a soybean
cell wall protein gene, in roots of transgenic tobacco and cowpea. Plant Mol Biol 21:109–119
Suzuki K, Tanaka N, Kamada H, Yamashita I (2001) Mikimopine synthase (mis) gene on pRi1724.
Gene 263:49–58
Swain SS, Rout KK, Chand PK (2012) Production of Triterpenoid Anti-cancer Compound Taraxe-
rol in Agrobacterium-Transformed Root Cultures of Butterfly Pea (Clitoria ternatea L.). Appl
Biochem Biotechnol 168(3):487–503
Talano MA, Agostini E, Medina MI, Reinoso H, Tordable Mdel C, Tigier HA, de Forchetti SM
(2006) Changes in lignosuberization of cell walls of tomato hairy roots produced by salt treat-
ment with the release of a basic peroxidase. J Plant Physiol 163:740–749
Tanaka N, Takao M, Matsumoto T (1994) Agrobacterium rhizogenes mediated transformation and
regeneration of Vinca minor L. Plant Tiss Cult Lett 11:191–198
Tanaka N, Fujikawa Y, Aly MAM, Saneoka H, Fujita K, Yamashita I (2001) Proliferation and rol
gene expression in hairy root lines of Egyptian clover ( Trifolium alexandrinum L.). Plant Cell
Tiss Org 66:175–182
Tao R, Handa T, Tamura M, Sugiura A (1994) Genetic transformation of Japanese persimmon
(Diospyros kaki L.) by Agrobacterium rhizogenes wild type strain A4. J Jap Soc Hort Sci
63:283–289
Taylor BH, Amasino RM, White EW, Gordon MP (1985) T-DNA analysis of plants regenerated
from hairy root tumors. Mol Gen Genet 201: 554–557
Taylor NJ, Fauquet CM (2002) Microparticle bombardment as a tool in plant science and agricul-
tural biotechnology. DNA and Cell Biol 21(12):963–977
Tempe J, Petit A, Farrand SK (1984) Induction of cell proliferation by Agrobacterium tumafaciens
and A. rhizogenes: a parasite’s point of view D.P.S Verma and T. Hohn. Genes involved in
microbe-plant interactions. Springer-Verlag, New York, pp 271–286
Tepfer D (1983) The potential uses of Agrobacterium rhizogenes in the genetic engineering of
higher plants: nature got there first. In: Lurquin P, Kleinhofs A (eds) Genetic engineering in
eukaryotes. Plenum, New York, pp 153–164
Tepfer D (1984) Transformation of several species of higher plants by Agrobacterium rhizogenes:
sexual transmission of the transformed genotype and phenotype. Cell 37:959–967
Tepfer D (1990) Genetic transformation using Agrobacterium rhizogenes. Physiol Plant 79:140–146
Thimmaraju R, Venkatachalam L, Bhagyalakshmi N (2008) Morphometric and biochemical char-
acterization of red beet ( Beta vulgaris L.) hairy roots obtained after single and double transfor-
mations. Plant Cell Rep 27:1039–1052
Thomas MR, Rose RJ, Nolan KE (1992) Genetic transformation of Medicago truncatula using
Agrobacterium with genetically modified Ri and disarmed Ti plasmids. Plant Cell Rep 11:113–
117
Thomashow LS, Reeves S, Thomashow MF (1984) Crown gall oncogenesis: evidence that a T-
DNA gene from the Agrobacterium Ti plasmid pTiA6 encodes an enzyme that catalyzes syn-
thesis of indoleacetic acid. Proc Natl Acad Sci 81:5071–5075
Tomilov A, Tomilova N, Yoder JI (2007) Agrobacterium tumefaciens and Agrobacterium rhizo-
genes transformed roots of the parasitic plant Triphysaria versicolor retain parasitic compe-
tence. Planta 225(5):1059–1071
Trovato M, Mauro ML, Costantino P, Altamura MM (1997) The rolD gene from Agrobacterium
rhizogenes is developmentally regulated in transgenic tobacco. Protoplasma 197:111–120
Trovato M, Maras B, Linhares F, Constantino P (2001) The plant oncogene rolD encodes a func-
tional ornithine cyclodeaminase. Proc Natl Acad Sci 98:13449–13453
Trulson AJ, Simpson RB, Shahin EA (1986) Transformation of cucumber ( Cucumis sativus L.)
plants with Agrobacterium rhizogenes. Theor Appl Gene 73:11–15
Turgut Kara N, Ari S (2008) In vitro plant regeneration from embryogenic cell suspension culture
of Astragalus chrysochlorus ( Leguminoseae). Afr J Biotechnol 7(9):1250–1255
Turgut Kara N, Ari S (2010) The optimization of voltage parameter for tissue electroporation in so-
matic embryos of Astragalus chrysochlorus (Leguminosae). Afr J Biotechnol 9(29):4584–4588
Tzfira T, Citovsky V (2000) From host recognition to T-DNA integration: the function of bacterial
and plant genes in the Agrobacterium-plant cell interaction. Mol Plant Pathol 11(4):201–212
Tzfira T, Yarnitzky O, Vainstein A, Altman A (1996). Agrobacterium rhizogenes-mediated DNA
transfer in Pinus halepensis Mill. Plant Cell Rep 16:26–31
Umber M, Clement B, Otten L (2005) The T-DNA oncogene A4- orf8 from Agrobacterium rhizo-
genes strain A4 induces abnormal growth in tobacco. Mol Plant Microbe Interact 18:205–211
Uozumi N, Kobayashi T (1997) Artificial seed production through hairy root regeneration. In:
Doran PM (ed) Hairy roots: culture and applications. Harwood Academic Publishers, Amster-
dam, pp 113–122
Uozumi N, Ohtake Y, Nakashimada Y, Morikawa Y, Tanaka N, Kobayashi T (1996) Efficient re-
generation from GUS-transformed Ajuga hairy root. J Ferm Bioeng 81:374–378
Vain P (2007) Thirty years of plant transformation technology development. Plant Biotechnol J
5:221–229
van Altvorst AC, Bino RJ, van Dijk AJ, Lamers AMJ, Lindhout WH, Van Der Mark F, Dons JJM
(1992) Effects of the introduction of Agrobacterium rhizogenes rol genes on tomato plant and
flower development. Plant Sci 83:77–85
van de Velde W, Mergeay J, Holsters M, Goormachtig S (2003) Agrobacterium rhizogenes-medi-
ated transformation of Sesbania rostrata. Plant Sci 165:1281–1288
van der Salm TPM, Van Der Toorn CJG, Bouwer R, Haenisch ten Cate CH, Dons HJM (1997)
Production of rol gene transformed plants of Rosa hybrida L. and characterization of their root-
ing ability. Mol Breed 3:39–47
van Onckelen H, Prinsen E, Inze D, Rudelsheim P, van Lijsebettens M, Follin A, Schell J, van
Montagu M, De Greef J (1986) Agrobacterium T-DNA gene codes for tryptophan 2-monooxy-
genase activity in tobacco crown gall cells. FEBS Lett 198:357–360
Vansuyt G, Vilaine F, Tepfer M, Rossingnol M (1992) rolA modulates the sensitivity to auxin of
the protontranslocationcatalyzed by the plasmamembrane H+ -ATPase in transformed tobacco.
FEBS Lett 298:89–92
Veena V, Taylor CG (2007) Agrobacterium rhizogenes: recent developments and promising ap-
plications. In Vitro Cell Dev Biol Plant 43:383–403
Vilaine F, Casse-Delbart F (1987) A new vector derived from Agrobacterium rhizogenes plasmids:
a micro-Ri plasmid and its use to construct a mini-Ri plasmid. Gene 55(1):105–14
Vilaine F, Charbonnier C, Casse-Delbart F (1987) Further insight concerning the TL-region of the
Ri plasmid of Agrobacterium rhizogenes strain A4: transfer of a 1.9 kb fragment is sufficient to
induce transformed roots on tobacco leaf fragments. Mol Gen Genet 210:111–115
Vinterhalter B, Orbović V, Vinterhalter D (1999) Transgenic root cultures of Gentiana punctata L.
Acta Soc Bot Pol 4:275–280
Visser RGF, Hesseling-Meinders A, Jacobsen E, Nijdam H, Witholt B, Feenstra WJ (1989) Ex-
pression and inheritance of inserted markers in binary vectors carrying Agrobacterium rhizo-
genes transformed potato ( Solanum tuberosum L.). Theor Appl Genet 78:705–14
Walton NJ, Belshaw NJ (1988) The effect of cadaverine on the formation of anabasine from lysine
in hairy root cultures of Nicotiana hesperis. Plant Cell Rep 7:115–118
Wang CY, Chiao MT, Yen PJ, Huang WC, Hou CC, Chien SC, Yeh KC, Yang WC, Shyur LF, Yang
NS (2006) Modulatory effects of Echinacea purpurea extracts on human dendritic cells: a cell-
and gene-based study. Genomics 88:801–808
Ward DV, Zambryski P (2001) The six functions of Agrobacterium VirE2. Proc Natl Acad Sci
USA 98:385–386
Weising K, Kahl G (1996) Natural genetic engineering of plant cells: the molecular biology of
crown gall and hairy root disease. World J Microbiol Biotechnol 2:327–351
Weller SA, Stead DE (2002) Detection of root mat associated Agrobacterium strains from
plant material and other sample types by post-enrichment TaqMan PCR. J Appl Microbiol
92:118–126
Weller SA, Stead DE, Young JPW (2005) Induction of root-mat symptoms on cucumber plants by
Rhizobium, but not by Ochrobactrum or Sinorhizobium, harbouring a cucumopine Ri plasmid.
Plant Pathol 54:799–805
White LO (1972) The taxonomy of the crown gall organism Agrobacterium tumefaciens and its
relationship to Rhizobia and to other Agrobacterium. J Gen Microbiol 72:565–574
White FF, Ghidossi G, Gordon MP, Nester EW (1982) Tumor induction by Agrobacterium rhi-
zogenes involves the transfer of plasmid DNA to the plant genome. Proc Natl Acad Sci USA
79:3193–3197
White FF, Taylo BH, Huffman GA, Gordon MP, Nesterr EW (1985) Molecular and genetic analy-
sis of the transferred DNA regions of the root-inducing plasmid of Agrobacterium rhizogenes.
J Bacteriol 164(1):33–44
Willems A, Collins MD (1993) Phylogenetic analysis of Rhizobia and Agrobacteria based on 16S
rRNA gene sequences. Intl J Syst Bacteriol 43:305–313
Willmitzer L, Sanchez-Serrano J, Buschfeld E, Schell J (1982) DNA from Agrobacterium rhi-
zogenes is transferred to and expressed in axenic hairy root plant tissues. Mol Gen Genet
186:16–22
Willmitzer L, Dhaese P, Schreier PH, Schmalenbach W, Van Montagu M, Schell J (1983) Size,
location and polarity of T-DNA-encoded transcripts in nopaline crown gall tumors, common
transcripts in octopine and nopaline tumors. Cell 32(4):1045–1056
Woese CR, Gupta R, Hahn CM, Zillig W, Tu J (1984) The phylogenetic relationships of three
sulfur-dependent archaebacteria. Syst Appl Microbiol 5:97–105
Yadav NS, Van Der Leyden J, Bennett DR, Barnes WM, Chilton M-D (1982) Short direct repeats
flank the T-DNA on a nopaline Ti plasmid. Proc Natl Acad Sci 79:6322–6326
Yamada T, Palm CJ, Brooks B, Kosuge T (1985) Nucleotide sequences of the Pseudomonas savas-
tanoi indole acetic acid gene show homology with Agrobacterium tumefaciens T-DNA. Proc
Natl Acad Sci 82:6522–6526
Yamazaki M, Son L, Hayashi T, Morita N, Asamizu T, Mourakoshi I, Saito K (1996) Transgenic
fertile Scoparia dulcis L., a folk medicinal plant, conferred with a herbicide-resistant trait using
an Ri binary vector. Plant Cell Rep 15:317–321
Yang DC, Choi YE (2000) Production of transgenic plants via Agrobacterium rhizogenes-mediat-
ed transformation of Panax ginseng. Plant Cell Rep 19(5):491–496
Yasuda H, Tada Y, Hayashi Y, Jomori T, Takaiwa F (2005) Expression of the small peptide GLP-1
in transgenic plants. Transgenic Res 14(5):677–684
Yibrah HS, Grönroos R, Lindroth A, Franzén H, Clapham D, von Arnold S (1996) Agrobacterium
rhizogenes-mediated induction of adventitious rooting from Pinus contorta hypocotyls and the
effect of 5-azacytidine on transgene activity. Transgenic Res 5:75–85
Yokoyama R, Hirose T, Fujii N, Aspuria ET, Kato A, Uchimiya H (1994) The rolC promoter of
Agrobacterium rhizogenes Ri plasmid is activated by sucrose in transgenic tobacco plants. Mol
Gen Genet 244:15–22
Yoshimatsu K, Shimomura K (1992) Transformation of opium poppy (Papaver somniferum L.)
with Agrobacterium rhizogenes MAFF 03-01724. Plant Cell Rep 11:132–136
Yusibov VM, Steck TR, Gupta V, Gelvin SB (1994) Association of single-stranded trans-
ferred DNA from Agrobacterium tumefaciens with tobacco cells. Proc Natl Acad Sci USA
91:2994–2998
Zambryski P, Joos H, Genetello C, Leemans J, Van Montagu M, Schell J (1983) Ti-plasmid vec-
tor for the introduction of DNA into plant cells without alteration of their normal regeneration
capacity. EMBO J 2:2143–2150
Zdravkovic-Korac S, Muhovski Y, Druart PH, Calic D, Radojevic LJ (2004) Agrobacterium rhi-
zogenes-mediated DNA transfer to Aesculus hippocastanum L. and the regeneration of trans-
formed plants. Plant Cell Rep 22:698–704
Zhan XC, Jones DA, Kerr A (1988) Regeneration of flax plants transformed by Agrobacterium
rhizogenes. Plant Mol Biol 11:551–559
Zhu JP, Oger M, Schrammeijer B, Hooykaas PJJ, Farrand SK, Winans SC (2000) The bases of
crown gall tumorigenesis. J Bacteriol 182:3885–3895
Ziemienowicz A, Merkle T, Schoumacher F, Hohn B, Rossi L (2001) Import of Agrobacterium
T-DNA into plant nuclei: two distinct functions of VirD2 and VirE2 proteins. Plant Cell
13:369–383
Zuker A, Tzfira T, Scovel G, Ovadis M, Shklarman E, Itzhaki H (2001) rolC-transgenic carnation
with improved agronomic traits: quantitative and qualitative analyses of greenhouse-grown
plants. J Am Soc Hortic Sci 126:13–18
Zupan JR, Zambryski P, Citovsky V (1996) Agrobacterium VirE2 protein mediates nuclear uptake
of single-stranded DNA in plant cells. Proc Natl Acad Sci 93:2392–2397
Chapter 2
Bioinformatic Tools in Crop Improvement
L. F. De Filippis
Abstract Bioinformatic resources and web databases are essential for the most
effective use of genetic, proteomic, metabolomic and phenome information impor-
tant in increasing agricultural crop productivity. Innovations in web based platforms
for omics based research, and application of such information has provided the
necessary platform to promote molecular based research in model plants, as well
as important crop plants. Combinations of multiple omics web based sites and inte-
gration of outcomes is now an important strategy to identify molecular systems
promoting comparative genomics, the biological properties in many species, and
to accelerate gene discovery and functional analyses. The review details recent
advances in plant omics data acquisition sites, together with relevant databases
and advance molecular technology under clear biological categories. The informa-
tion is set out under the molecular biology divisions of; DNA based resources and
sequencing, RNA and variation analysis, proteomics, structural proteins, and post-
translation modifications, metabolomics, phenome and plant comparative analyses.
Tables of relevant web sites are presented under similar headings for convenience,
and the application of bioinformation data is reviewed in light of the possible use
of these resources for crop improvement. Finally, a long list of future perspectives
and research still to be attempted is detailed, which in the fullness of time should
enable the full potential of bioinformatics and use in crop improvement programs
to be achieved.
Introduction
Sustainable agricultural production and food security are two important issues of
concern in response to population increase, environmental degradation and climate
change (Brown and Funk 2008; Turner et al. 2009). According to the United Na-
tions, the world population increases by 70–75 million people annually, an aver-
L. F. De Filippis ()
Centre for Environmental Sustainability (CENS), Department of Environmental Sciences,
University of Technology, Broadway/Sydney NSW 2007,
P O Box 123, Sydney, Australia
K.R. Hakeem et al. (eds.), Crop Improvement, DOI 10.1007/978-1-4614-7028-1_2, 49

50 L. F. De Filippis
age of more than two persons every second; and over 95 % of these will live in
developing countries (De Filippis 2012). It will be difficult satisfying the needs of
this growing population and avoid serious food shortages or even famine from the
limited arable land and natural resources available. These factors combined have
already resulted in food deficiency and malnutrition, which have become serious
health problems. Additionally, recent increased demand for biofuel crops has cre-
ated a new market for agricultural commodities, causing even more stress on food
security (Ozturk et al. 2006; Ozturk 2010; Hakeem et al. 2012). In order to try to re-
solve these problems and increase crop yields, breeding plants based on a better mo-
lecular understanding of gene function, and on the regulatory mechanisms involved
in crop production (Pinstrup-Andersen and Cohen 2000; Takeda and Matsuoka
2008) appears to be necessary. Plant molecular biology continues to progress, and
important gene sequences and their function have been described; many of which
are related to crop yields (production), crop quality (protein and carbohydrate), and
tolerance to biotic and abiotic stresses (De Filippis 2012). There are legal, social
and political barriers to the full potential use of crop biotechnology and transgenic
plants, nevertheless advances in these fields have lead to improvements in agricul-
ture and human life. One vital tool of biotechnology is ‘bioinformatics’, which is
commonly used to genetically type and identify genotypic and phenotypic changes
in plants, and this information is important for improvement in performance of crop
plants (Ahmad et al. 2011).
The complete genome sequence of the mustard plant Arabidopsis thaliana has
been available to scientists since 2000 (International Arabidopsis Genome Initia-
tive 2000; Somerville and Dangl 2000). Similarly, the rice ( Oryza sativun cv. ja-
ponica) complete genome sequence has been documented since 2005 (International
Rice Genome Sequencing Project 2005; Itoh et al. 2007; Hakeem et al. 2012). The
rice genome sequencing project in particular with its molecular methods and DNA
markers on chromosomes, introduced important developments in mapping popula-
tions and chromosome marker resources, which accelerated the isolation of agro-
nomically important quantitative trait loci (QTLs) in crop breeding programs (Ashi-
kari et al. 2005; Konishi et al. 2006; Ma et al. 2006; Kurakawa et al. 2007; Ma et al.
2007; Zhang et al. 2007).
Each biological element that can been measured, can also be represented in a
typical plant cell, tissue and organ at various molecular and/or morphological lev-
els, or in other words a conceptual model with layers ranging from the ‘genome’
to the ‘phenome’; a model called ‘omic space’ (Fig. 2.1) (Toyoda and Wada 2004).
Advances in each ‘omics’ research area have become essential for investigations of
gene function and structure, and the type of phenotypic changes present in plants.
A schematic presentation of relevant ‘omics’ resource is shown in Fig. 2.1, together
with the current status of available areas of research from Arabidopsis, rice, soy-
bean, corn and Brassica; just to cite a few examples. Some of these advances have
included improved methods for gene expression, gene modifications, molecular
breeding, plant genome and proteome interactions, and metabolite profiling. Large
volumes of information in biological resources, mass identification of mutant lines
and full-length cDNAs, and the publication of this information in web-based data
2 Bioinformatic Tools in Crop Improvement 51
Fig. 2.1 A conceptual

model called ‘omic space’
with layers ranging from the
‘genome’ to the ‘phenome’.
(After Toyoda and Wada
2004)
banks have been available for some time (Brady and Provart 2009; Kuromori et al.
2009; Seki and Shinozaki 2009).
Bioinformatic information and web sites have become important for crop scien-
tists in gene data mining, and linking this knowledge to its biological significance
(Mochida and Shinozaki 2010). However there needs to be a note of caution. As
genomic and proteomic knowledge expands, new forms of electronic data becomes
available to help interpret results. Biological data is notoriously variable (even unre-
liable at times) and ‘noisy’ in electronic form, due to living systems being complex
and measurement and analysis technologies are often imperfect. In my experience
two approaches for reducing ‘noise’ and help reliability of this type of data are
required; aggregation and visualisation. Firstly, when combined, multiple forms of
evidence become more and more accurate than for example a single source of data,
simply because each replicate form of the data reduces overall uncertainty. Sec-
ondly, the human mind is an outstanding data analysis tool. It can absorb textual
data rather poorly, but it can assimilate visual information in great detail, and the
mind can process visual data efficiently to help identify common trends and themes
(Cline and Kent 2009).
In this chapter, we provide an overview of the many web-based resources avail-
able for use in ‘omics’ plant research, with particular emphasis on recent progress
related to crop species and crop improvement. Therefore we describe DNA and
RNA sequence-related resources, molecular markers, whole genome sequencing,
protein coding and non-coding transcripts, and provide molecular technology up-
dates. We then review resources important for genetic map-based approaches such
as QTL analyses and population genetic (diversity) studies. We also describe the
current status of resources and some technologies for transcriptomics, proteomics
and metabolomics; however some of these research areas are more comprehensive-
ly described in other chapters of this book. We then review molecular developments
in each ‘omics’ field, as well as instances of their combined uses in investigations
of particular crop systems. Mutant genotypes for use in ‘phenome’ research will be
discussed, and the integration of ‘omics’ data between plant species in comparative
genomics is dealt with. Throughout this review we provide examples of applica-
tions through available databases in crop plants, and where improvement in crop
production has been described.
Bioinformatics and web addresses for plant genomics and proteomics have been
reviewed by a number of authors (Rose et al. 2004; Sterck et al. 2007; Takeda and
Matsuoka 2008; Zhang 2008; Baginsky 2009; Varshney et al. 2009; Mochida and
Shinozaki 2010; Jackson et al. 2011; Memon 2012), and this review will basically
cover some new areas in population (breeding) genetics, and topics which require
more detail explanation and are updated in crop plants. The excellent review by
Mochida and Shinozaki (2010) has provided the framework for this review, and we
intend to concentrate on more recent developments, and focus on bioinformation
and implications in crop improvement; although the technology, instrumentation
and molecular biology achieved in other plants must also be covered.
DNA Based Sequence Resources
Genome Sequencing Projects
Initially, the publication and accumulation of nucleotide sequences for model plants
only provided fundamental information, however now these base sequences form
the fundamentals of research in functional plant genetics in applied species such as
crops and domestic animals. Furthermore, DNA sequence data continues to be cen-
tral in providing the genomic basis for accelerating molecular level understanding
of basic biological mechanisms, and the application of such information to crops.
In this section, we describe recently developed plant sequencing advancements.
Species-specific nucleotide sequences are now providing information related to
phenotypic characters, even when based on genome comparative analyses from the
few model plants available (Cogburn et al. 2007; Flicek et al. 2008; Paterson 2008;
Tanaka et al. 2008).
The genome sequence of Arabidopsis thaliana is now used as a model species
in plant molecular biology mainly because of its small size, short generation time
and high efficiency of transformation. The genome sequence of rice ( Oryza sativa),
including japonica and indica (an important staple food and a model monocotyle-
don) has also been used for comparative studies. These two plants still provide the
only model plant systems to date, however several genome sequencing projects
involving other plants have been completed, and many others are in progress; these
are detailed in Table 2.1. Listed below are six of the most important web-based sites
for DNA based genome sequencing and annotation projects, their purpose and their
URL are detailed in Table 2.2.
NCBI—BioProject
The NCBI site provides genome sequences and information for many plant spe-
cies (Viridiplantae) designed to facilitate comparative genomic studies amongst the
Table 2.1 List of plant species in which partial or whole genomes have been sequenced. (Data
extracted from the following internet sites: http://www.ncbi.nlm.nih.gov/genomes/PLANTS/
PlantList.html; http://www.arabidopsis.org/portals/genAnnotation/other_genomes/index.jsp;
http://www.ildis.org/)
Division Class Species
Non Vascular Algae Chlamydomonas reinhardtii Chlorella variabilis Cocco-
myxa sp. Cyanidioschyzon merolae Ectocarpus siliculo-
sus Micromonas pusilla Micromonas sp. Ostreococcus
lucimarinus Ostreococcus tauri Volvox carteri Zostera
marina
Bryophytes Physcomitrella patens Selaginella moellendorffii
Vascular Dicotyledons Amborella trichopoda Aquilegia sp. Arabidopsis lyrata
Arabidopsis thaliana Arachis hypogaea Asclepias syri-
aca Beta vulgaris Boechera holboellii Brassica napus
Brassica napa Brassica rapa Caffea caneophora Cajanus
cajan Cannabis sativa Capsella rubella Carica papaya
Castanea mollissima Citrullus lanatus Citrus clementine
Corchorus olitorius Cucumis sativus Eucalyptus grandis
Fragaria vesca Glycine max Gossypium hirsutum Gos-
sypium raimonddi Hordeum vulgare Jatropha curcas
Lactuca sativa Linum usitatissinun Lotus japonicas
Malus domestica Manihot esculenta Medicago trun-
catula Mimulus guttatus Phaseolus vulgaris Pinus taeda
Populus tremula Ricinus communis Theobroma cacao
Populus nigra Populus trichocarpa Prunus avium Prunus
persica Pyrus bretschneideri Rubus idaeus Salix purpure
Solanum lycopersicum Solanum pimpinellifolium
Solanum tuberosum Spirodella polyrhiza Thellungiella
parvula Vitis vinifera
Monocotyledons Brachypodium distachyon Elaeis guineensis Miscanthus
giganteus Musa acuminate malaccensis Oryza sativa
Oryza glaberrima Panicum hallii Panicum virgatum
Phoenix dactylifera Seratia italic Sorghum bicolor Triti-
cum aestivum Zea mays
many other records of plants there. The current version consists of documentation
in at least 115 different plants with partial sequences, and about 40,000 Expressed
Sequence Tags (ESTs). It also contains separate sites and resources for other web
based tools, data banks and other web servers, including agronomically important
crops for food or fruit, medicinal plants, a number of green algae, pathogenic bac-
teria and fungi, viruses and animals. It will be important to become familiar and
navigate through this very important site.
Phytozome
The site includes genome sequences and data sets for various crop species designed
to facilitate comparative genomic studies amongst other green plants. The current
version consists of 31 plant species wholly or partially sequenced, and is set-up into
10 evolutionary significant nodes.
Table 2.2 Integrative databases for DNA, Gene Sequences and Population Genetics analysis in
plants
Database Name Plant Species/Purpose URL
Home—BioPro- Multi-Purpose site; Over 1000 http://www.ncbi.nlm.nih.gov/sites/
ject—NCBI genomes; plants, animals, bacte- entrez?db=bioproject
ria, fungi, virus
Phytozome v8.0: Over 31 species of plants; some http://www.phytozome.net/Phyto-
Details software zome_info.php
Gramene Over 29 species of mainly monocots http://www.gramene.org/
BLAST: Basic Multi-Purpose site for genome com- http://blast.ncbi.nlm.nih.gov/Blast.
Local Align- parison; plants, animals, bacteria, cgi
ment Search fungi, virus
Tool
GrainGenes Class Triticeae and Avena site; nearly 200 http://wheat.pw.usda.gov/
Browser: species cgi-bin/graingenes/browse.
Marker cgi?class=marker
PlantGDB— Multi Plant site; 15 dicot, 7 monocot, http://www.plantgdb.org/
Resource Plant 3 other plant species
Comparative
Genomics
TreeView Phylogenetic tree software http://taxonomy.zoology.gla.ac.uk/
rod/treeview.html
Rod Page Population genetics, gene diversity http://taxonomy.zoology.gla.ac.uk/
software rod/rod.html
Software Softwere site; BLAST, sequence http://evolve.zoo.ox.ac.uk/Evolve/
alignment Software.html
LALIGN Server Sequence alignment software http://www.ch.embnet.org/software/
LALIGN_form.html
PopGene Population genetics software http://www2.unil.ch/popgen/soft-
wares/fstat.htm
Arlequin 3.11 Population genetics program http://cmpg.unibe.ch/software/
arlequin3/
ANU Bot Zool Population genetics statistics, http://www.anu.edu.au/BoZo/
software GenAlEx/genalex_down-
load_6_1.php
SOPH U AB Population genetics programs http://www.soph.uab.edu/ssg/
linkage/population
Francis Yeh PopGen software http://www.ualberta.ca/~fyeh/
IBD Gene and Distance relations statistics http://www.bio.sdsu.edu/pub/andy/
IBD.html
PRIMER-E Population software and gene diver- http://www.primer-e.com/
sity statistics and indices
Gramene
An information resource established as a portal for grass species and grass genom-
ics; including genome sequence information. The current version provides data on
24 plants; including 12 wild and domesticated rice genomes. An organelle data bank
is also available from this site (Sect. 4.5).
NCBI—Entrez
Tracks over 800 whole genome projects from biological organisms, and the 115
species of Viridiplantae; including agronomically important crops for food and
fruit, medicine and a number of green algae. The Entrez database can be accessed
through the home page of NCBI.
NCBI—BLAST
One of the most important sites and tools available, in determining base similari-
ties between nucleotide sequences in databanks. It also contains protein searches
and queries. It includes searches for translated nucleotide sequences, conserved do-
mains, multiple alignment tools, evolutionary relationships, and can be applied to
all organisms, or limited to specific plants.
GrainGenes and PlantGDB
GrainGenes is a specific database for Triticeae and Avena genes, markers, maps
and germplasm. PlantGDB contains sequences and a search engine linked to NCIB
BLAST for 15 Dicotyledon, 7 Monocotyledon and 3 other plant species. It contains
more limited information than the NCBI site over most plants, but is especially use-
ful for agricultural grain species.
DNA Sequencing and UltraHigh-Throughput
Genome sequence information aids researchers in identify genes and gene families,
including the identification of coding or non-coding regions, regulatory genes, and
repetitive sequences within the genome (e.g. simple sequence repeats—SSRs); all
of these are important in molecular biology. This type of information has become
primary material for the design of genome advancements, such as microarrays, till-
ing arrays or molecular and chromosome markers, and these methods are important
in whole plant genomic sequencing (Sect. 2.3 below). Pyrosequencing, massive
parallel DNA sequencing and single molecule sequencing are adaptations of exist-
ing methods, which have become available in recent years (Margulies et al. 2005;
Ansorge 2009). These new technologies have provided researchers with new meth-
ods to addressed web information in an entirely different way, and ongoing innova-
tions in next-generation sequencing technology (Sect. 2.3), and the release of new
genome sequenced plants (listed in Table 2.1) is expected to accelerate the use of

the DNA based web-information considerably in crop plants.
Whole Genome Sequencing
Information obtained from whole-genome sequencing in plants allows attempts

at chromosome-scale genetic comparisons, thereby identifying conserved genetic
areas, which can facilitate identification and documentation of similar genomic
sequences in related plant species (Haas et al. 2004; De Bodt et al. 2005). Whole-
genome comparisons identifying chromosomal duplication of alleles among related
species for example can provide comparative evolutionary histories and diversifi-
cation of species in ecology, taxonomy and plant breeding (Paterson et al. 2009;
Schnable et al. 2009). Next-generation sequencing will allow identification of even
more fundamental diversity and variation in genes amongst and between individu-
als, strains and/or populations. Single nucleotide polymorphisms (SNPs) have been
central to these advancements, and SSR fragments have been shown to map con-
sistently in many non-sequenced plant species; a capability that is of immensely
important in genetic research. A genome re-sequencing project to identify whole-
genome sequence variations in 1001 strains (accessions) of Arabidopsis is in prog-
ress. On completion this data will become an important resource for future genetics
and population studies to identify alleles associated with phenotypes and diversity
across entire plant species (http://1001genomes.org/) (Weigel and Mott 2009). In
the same way a high-throughput method for genotyping recombinations in popu-
lations of rice, using whole-genome resequencing data generated by the Illumina
Genome Analyzer has already been initiated (Huang et al. 2009).
Molecular (DNA) Markers
Identification and location of available molecular DNA markers have contributed

significantly to marker-assisted studies and selection (MAS) in plant breeding, and
in a wider range of research, including species identification and evolution. Genetic
markers constructed to cover the complete genome may allow identification of in-
dividual genes associated with complex traits by QTL analysis, and the identifica-
tion of genetic diversity and induced variations (Feltus et al. 2004; Varshney et al.
2005; Caicedo et al. 2007). Genome sequencing and large-scale EST databanks
(Sect. 3) have become important for the construction of molecular markers, and
a number of genome-wide rice DNA polymorphic markers have been constructed
based on co-alignment between japonica and indica rice ESTs (Han and Xue 2003;
Shen et al. 2004). Computer assisted EST-base single-nucleotide polymorphisms
(SNPs) and/or EST-SNP markers for the purpose of identifying sequence-tagged
sites (STS) has progressed for numerous species; including the crop plants of bar-
ley, wheat, maize, melon, Brassica, common bean, sunflower, potato, citrus and
grapevine (Mullins et al. 2006; Torada et al. 2006; Jaillon et al. 2007; Heesacker
et al. 2008; Kota et al. 2008; Talon and Gmitter 2008; Blair et al. 2009; Deleu et al.
2009; Kaur et al. 2009; Li et al. 2009).
Some molecular markers identified this way allow the indirect selection of in-
teresting genotypes (i.e. breeding lines in crops), and these cultivars constitute an
essential tool for the development of marker-assisted selection (MAS) in plant
breeding. The use of DNA markers (and indirectly EST markers from RNA) for
direct selection offers greater potential gains in breeding for QTL and traits with
low heritability, and these can be the most difficult to work with in crop breeding.
However these low heritability traits are also amongst the most interesting and the
most difficult to develop.
When a locus has many variants, or alleles, it is referred to as being polymor-
phic. Mutation(s) at a number of loci generate multiple alleles, most of which are
eliminated from the population by genetic drift or breeding selection. Only a small
number of alleles are incorporated into the population by chance or selection. Most
polymorphisms can be genetically straightforward, with two alleles directly de-
termining two versions of the same protein (gene), however, some can be highly
complex, with multiple, related genes in a complex system of metabolic differ-
ences. Crop breeders have known the complexity of multiple alleles for decades.
However with the advent of molecular markers, genetic diversity and other forms
of genetic structure in breeding populations is possible. Listed in Table 2.2 are the
most important web-based sites for DNA markers and some of the population sta-
tistics programs and web resources commonly in use. Molecular markers fall into a
number of types listed below, each having positive and negative features, and care-
ful consideration is required before they are adopted in any type of research (Hoang
et al. 2009; De Filippis 2012).
Restriction Fragment Length Polymorphism (RFLP)
RFLP requires hydrolysis of probe DNA from samples. RFLP can provide high
quality data but has severe restrictions on throughput because large amounts of
DNA are required, and because it is not based on amplification of the target DNA
via the polymerase chain reaction (PCR).
Random Amplified Polymorphic DNA (RAPD)
RAPD is a method based on PCR but uses arbitrary short primers (10 bases long)
to identity plant DNA regions. No knowledge of the genome is needed, but by the
same token markers can target many places on the genome. Results can be inconsis-
tent and only dominant genes can be identified.
Simple Sequence Repeats (SSR)
SSR are high quality and consistent DNA markers, but they are the most expensive
to develop. SSR markers require extensive band sequencing data for each marker
developed, and often the markers are species and even cultivar specific. However
they are molecular markers of choice in crop plants.
Amplified Fragment Length Polymorphism (AFLP)
AFLP requires enzymatic degradation of DNA and careful fragment separation,

where only a sub-fraction of the population genetic data is sampled by PCR. It can
provide too much information at any time. It is more technically demanding and
information can be difficult to interpret. It produces very good high quality data,
which is suitable for high output sources and automation.
Single Nucleotide Polymorphism (SNP)
SNP relies on the fact that the vast majority of differences in eukaryotic organisms
are surprising point mutations in their DNA. So there are a vast number of poly-
morphisms that are SNPs. The biggest advantage is automation and techniques that
do not require electrophoresis to separate fragments. However it does require DNA
sequencing which can be costly. SNPs are becoming more and more important as
molecular markers for genome information and advancement in crop plants.
Expressed Sequence Tags (EST)
ESTs require cDNA synthesis from RNA, and therefore are the only markers list-
ed which are based on RNA. Preferences for this method should be for crop spe-
cies where there is already extensive sequencing, and part or full EST data present
(Sect. 3).
NCBI—Plant Markers
A genetic marker web database that contains molecular markers such as SNP, SSR
and conserved ortholog set cosmid (COS) markers and primers from various plant
resources (Heesacker et al. 2008).
GrainGenes
Theweb site for Triticeae genomics, and provides considerable detail of DNA mark-
ers and chromosome linkage map data on wheat, barley, rye and oat (Carollo et al.
2005).
Gramene
A database for plant comparative genomics providing gene information and some
genetic linkage maps for 29 monocotyledon (grass) species, using some of the more
important and more commonly used genetic markers detailed above (Liang et al.
2008; Ware 2007).
Genetic Diversity and Population Genetics Analysis
Comprehensive discussion of the genetic and statistical analyses employed in popu-

lation genetics is beyond the scope of this review, but I refer you to the following
books and reviews (Clark and Gorley 2001; Conte et al. 2008; Wall et al. 2008;
Barnholtz-Sloan and Tiwari 2009; Pu et al. 2009). Population gene family data are
usually produced by computational procedures including a first step that conducts
an all-against-all sequence similarity analysis or matrix, and then a second step in
building clusters of inter- and intra- population analysis parameters, by methods
such as Markov Clustering (MCL), multi dimensional scaling (MDS), and principle
component analysis (PPO); using programs like PRIMER and Arlequin (Table 2.1).
Advanced software statistics (GenAlEx—Table 2.2) can yield indices and informa-
tion that are useful for further statistical analysis and phylogenetic studies using
Analysis of Co-Variance (ANCOVA), Analysis of Similarity and Analysis of Vari-
ance (ANOVA). Listed in Table 2.2 are a number of important web-based sites for
population genetics analysis and computation; and for ease their purpose and URL
are also presented there.
RNA Variation Resources
EST and cDNA
Expressed Sequence Tag (ESTs) are determined by partial sequencing of randomly

picked gene transcripts that have originated from isolated RNA and converted to
cDNA (Adams et al. 1993). Since cDNA and EST collections can be easily gener-
ated regardless of chromosome and gene complexity, this method has been applied
not only to model plants, but also to a number of crop species with large genomes;
due mainly to polyploidy and/or to the number of repetitive sequences. Because
EST data collected from cDNA libraries of an organism consists of redundant se-
quences from the same gene locus or RNA target, it is often necessary to perform
EST grouping by metabolic and/or functional units. Then these groups are further
consolidated into alignment sequences for each transcript before further analysis
(Ewing et al. 1998; Huang and Madan 1999; Masoudi-Nejad et al. 2006). The
comprehensive and rapid accumulation of cDNA clones, together with mass data
sets of their sequence tags have become important resources for functional genom-
ics (Boguski et al. 1993). ESTs derived from tissues in a range of developmental
stages or under various kinds of stress could significantly facilitate discovery of
new genes and their function. For example, large-scale expression analysis, genome
comparative DNA sequences and the design of expressed gene-specific molecular
markers and probes for microarrays have only been possible with extensive EST
data (Zhang et al. 2004; Kawaura et al. 2006; Mochida et al. 2006). Listed below
are a number of important web-based sites for RNA analysis and ESTs; and for ease
their purpose and URL are detailed in Table 2.3.
TriMEDB
The Triticeae Mapped EST database (TriMEDB) provides information regarding

mapped cDNA motifs, which are related to barley and wheat sequences (Mochida
et al. 2008); a similar database, TriFLDB has much the same information (Mochida
et al. 2009b).
NCBI—dbEST (Expressed Sequence Tag)
There are over 63 million ESTs in the NCBI dbEST databank, a most important
public domain EST database that includes a number of crop plant species (Boguski
et al. 1993). The data sets obtained from representative transcripts can be used as
unified transcript and sequence data, in line with other web sites below (Lee et al.
2005; Close et al. 2007; Duvick et al. 2008).
NCBI—UniGene
Identifies transcripts from the same locus as expressed in different types of tissue,
age or health status. Most importantly it reports not only on ESTs, but also on re-
lated proteins and clone resources.
TIGR
Plant transcript assemblies and gene indices web site. The databank relies on EST/
cDNA sequences linked to GenBank from NCBI. New releases and new plant data-
bases are documented regularly.
Table 2.3 Integrative databases for RNA and Expressed Sequence Tag (EST) analysis in plants
Database Name Plant Species/Purpose Uniform Resource Locator
(URL)
TriMEDB:Triticeae Triticeae EST database; over http://trimedb.psc.riken.jp/
Mapped EST DataBase 6000 sequences index.pl
ver.2.0
NCBI dbEST EST of the extensive databank http://www.ncbi.nlm.nih.gov/
from NCBI; multi species dbEST/
Home—UniGene—NCBI Unigene (EST) comparison site http://www.ncbi.nlm.nih.gov/
from NCBI; multi species unigene
TIGR Plant Transcript TA and EST of many plants, http://plantta.jcvi.org/
Assemblies including conifers, algae,
monocots and dicots
DFCI—Plant Gene Indices Plant gene indices (similar to http://compbio.dfci.harvard.
TA) of 60 important agricul- edu/tgi/plant.html
tural plants
HarvEST Home Page EST database of 10 of the most http://harvest.ucr.edu/
important agricultural/horti-
cultural plants
HARVEST-BLAST.ORG HarvEST Blast search software http://www.harvest-blast.org/
from NCBI
Plant MicroRNA Database Plant micro RNA website and http://bioinformatics.cau.edu.
database of some commer- cn/PMRD/
cial plants
Diversity Arrays Technol- Analysis of molecular diversity; http://www.diversityarrays.com/
ogy Pty Ltd (DArT SNP, SSR, AFLP, RFLP, index.html
P/L) | Diversity Arrays methylation
Technology
Home | Affymetrix GeneChip mi RNA arrays http://www.affymetrix.com/
information—Affymetrix estore/
miRNA Array | Noncoding GeneChip mi RNA information http://www.affymetrix.com/
RNA | Affymetrix and species estore/browse/products.
jsp?productId=131473#1_1
GeneChip Medicago Medicago GeneChip array and http://www.affymetrix.
Genome Array | its symbiont com/browse/products.
Affymetrix jsp?productId=131472#1_1
GoldenGate Genotyping Site for Golden Gate genotype http://www.illumina.com/tech-
Assay—A flexible, pre- assay nology/goldengate_genotyp-
optimized assay ing_assay.ilmn
Illumina—Assay Golden Gate genotype technol- http://www.illumina.com/com-
Technology ogy information pany/assay_technology.ilmn
Illumina Genotyping High-throughput SNP http://dnatech.genomecenter.
genotyping—Illumina ucdavis.edu/illumina.html
CLC Biology Multi-purpose gene work http://www.clcbio.com/index.
bench; with downloads php?id=354
Plant Gene Index
The web site documents a number of animal, plant, protist and fungi species. The
site contains a number of web tools, and contains cDNA and genechip data from a
number of crop plants.
HarvEST
HarvEST software is available for 10 important agricultural crops. It originated

as an EST database with software linked to gene function, microarray design and
SNP identification. It is also available as a HarvEST BLAST search engine from an
alternative site present on the homepage.
cDNA (Full Length)
Partial cDNAs are useful for rapidly documenting and cataloguing targeted genes,
but they are not used or suitable for further study of gene function. This is because
the most popular method for preparing a cDNA library does not provide the full-
length cDNA that includes the capped site sequences. The biotinylated cap trap
method using a thermostabilised reverse transcriptase is one method for construct-
ing full-length cDNA-enriched libraries suitable for studies of gene function; and
these have become invaluable for life science projects (Maeda et al. 2006; Tanaka
et al. 2008; Yamasaki et al. 2008a). The sequences derived from full-length cDNAs
can also help in identifying transcribed regions in completed or draft genomes in
other plants. In Arabidopsis and rice, full-length cDNA sequences have been used
to identify genomic structural features, such as transcription start sites (TSSs) and
transcriptional genes and variant alleles in metabolic activity (Iida et al. 2004; Itoh
et al. 2007; Yamamoto et al. 2009). In species for which we have draft genomes,
such as Physcomitrella, soybean and poplar, full-length cDNA clones have been
used to help consolidate genomic (gene) and chromosome structure and function;
and this should also greatly contribute to discovery of new genetic information
(Nanjo et al. 2007; Ralph et al. 2008a; Umezawa et al. 2008).
Full-length cDNA libraries have contributed to functional analysis using over-
expressors in reverse genetics. The full-length cDNA overexpressor (FOX) gene
hunting system, which uses full-length cDNA from transgenic plants as overex-
pressors, has introduced another approach to high-throughput analysis of functional
genes associated with phenotypic traits (Ichikawa et al. 2006; Fujita et al. 2007;
Kondou et al. 2009). Full-length enriched cDNA libraries have been constructed
for non-sequenced crop or forestry species, such as wheat ( Triticum aestivum), bar-
ley ( Hordeum vulgare), cassava ( Manihot esculenta), Japanese cedar ( Cryptomeria
japonica), Sitka spruce ( Picea sitchensis) and Lotus (Sato et al. 2008; Kawaura
et al. 2009; Sato et al. 2009); as well as for plant species showing specific charac-
teristics such as salt tolerance in salt cress ( Thellungiella halophila) and selenium
accumulation in a number of species (De Filippis 2010). Full-length cDNA libraries
serve as primary sequence resources for designing microarray probes, and as cloned
resources for genetic engineering to improve crop efficiency (Sakurai et al. 2007;
Futamura et al. 2008; Ralph et al. 2008b; Taji et al. 2008). Because of the important
function of full-length cDNA resources in ‘omics’ data and information, it is es-
sential to establish relevant information resources that provide gateways to these
sites, and to integrate this to related data sets derived from other ‘omics’ field. A
comprehensive computational tool to achieve this total integration is the CLC Biol-
ogy workbench system (Table 2.3).
small RNA (sRNA) Information
In plants, sRNAs, which can include microRNAs (miRNAs), short interfering

RNAs (siRNAs) and trans-acting siRNAs (ta-siRNAs) play important roles in
epigenetic processes, and may control gene activities involved in plant develop-
ment and homeostasis (Ruiz-Ferrer and Voinnet 2009). These RNA molecules are
important regulatory resources that should be detailed, and their expression anal-
ysed using the most recent next-generational genomic methods (Nobuta et al. 2007;
Chellappan and Jin 2009). In maize, sRNAs in the wild type and in the isogenic
mop1-1 loss-of-function mutant were analysed by deep sequencing using Illumina’s
sequencing-by-synthesis (SBS) technology to characterise possible regulatory roles
for maize sRNA (Nobuta et al. 2008). In poplar, expressed sRNAs from leaves and
vegetative buds were also studied using high throughput Roche 454 pyrosequenc-
ing, and genes in similar families of miRNA identified, including novel new genes
(Barakat et al. 2007). Nucleotide sequencing of Brachypodium sRNAs have also
been performed, resulting in the identification of miRNAs involved in low tem-
perature stress tolerance (Zhang et al. 2009a). The plant miRNA database (PMRD)
is a useful information resource on plant miRNA, and is available on the web site
of PMRD (Zhang et al. 2009b). The Affymetrix GeneChip miRNA Arrays web site
is also important for such studied. Listed in Table 2.3 are important web-based sites
and URL for databanks often used in regulatory plant micro RNA research.
Variation Analysis Platforms
High-throughput polymorphic analyses are important for studying genome-wide ge-

notyping using a hybridization-based SNP molecular marker methods, which have
been used to analyse Arabidopsis ecotypes and rice strains, and the data identified
variation patterns for each species. The Arabidopsis 1,001 project and genome-wide
variation study is one of the few available information web sites so far contain-
ing this information. Therefore, the demand is rapidly increasing for high through-
put and cost-effective platforms for comprehensive variation analysis studies (also
called ‘variome’ analysis). Complete genome resequencing information are already
being realized as a direct solution to ‘variome’ analysis in species whose reference
genome sequence data are already available; the URL list for the web sites used for
variation analysis are detailed below and URL listed in Table 2.3.
DArT P/L
Diversity Array Technology (DArT) is a high throughput genotyping system that

was developed based on microarrays (Jaccoud et al. 2001; Wenzl et al. 2007). In
various crop species such as wheat, barley and sorghum, DArT markers have been
used with other conventional molecular markers to construct dense genetic maps
and/or to perform genetic association studies (Crossa et al. 2007; Peleg et al. 2008;
Mace et al. 2009). This genotype technology web site describes DNA variations us-
ing SNP, as well as other molecular markers; and also described is information on
DNA methylation.
Gene Chip Array
In barley and wheat, Affymetrix GeneChip Arrays have been used to show nucle-
otide polymorphisms based on the differential hybridization of GeneChip probes
(Rostoks et al. 2005; Bernardo et al. 2009). The Affimetrix site includes a spe-
cific Medicago chip and a miRNA site. The Illumina GoldenGate Assay allows
the simultaneous analysis of up to 1,536 SNPs in 96 samples, and has been used to
analyse genotypes of segregating populations in order to construct genetic maps of
SNPs in crops such as barley, wheat and soybean (Hyten et al. 2008; Akhunov et al.
2009; Close et al. 2009).
SNP Genotyping
The University of California, Davis site contains a number of options for high
throughput genotyping. It operates a commercial division where SNP genotyping
can be performed using Illumina technology and GoldenGate Assay.
Analysis of Variation
Comprehensive gene family data sets are usually produced by computer programs,
including a sequence similarity search, and then a step for building clusters of EST
families by methods such as Markov Clustering (MCL), multi dimensional scaling

(MDS) and principle component analysis (PPO) (Table 2.1). Advanced statistics
can yield data sets that are useful for further variation analysis using gene mark-
ers, as well as phylogenetic studies, using Analysis of Co-Variance and Phylogeny
programs (see also Sect. 2.5). Listed in Table 2.1 are a number of web-based sites
for genetic variation analysis and computation; and for ease their purpose and URL
are also detailed there.
Transcriptome Resources
Comprehensive, high-throughput analysis of gene expression, also called ‘transcrip-

tome’ analysis, is a good approach to screen targeted genes, predict gene function
and discover cis-regulatory motifs. Hybridization-based methods, such as that used
in microarrays and GeneChips have been well established now for acquiring large-
scale gene expression profiles from various species. The recent rapid accumulation
of data containing large-scale gene expression profiles, and comparison of this data
to large repositories in genetic databanks have provided large amounts of informa-
tion now available in the public domain. This public data is an efficient and valuable
resource for many secondary uses, such as co-expression of genes and comparative
genomic studies. Furthermore, as next-generation DNA sequencing applications
and deep sequencing of short fragments of expressed RNAs and sRNAs become
common, they become important tools to use in both genome-sequenced and non-
sequenced species (Harbers and Carninci 2005; de Hoon and Hayashizaki 2008).
Listed below are the most important web-based sites for microchip and microarray
analysis; their purposes and their URL are detailed in Table 2.4.
Sequence Tag Based Transcriptomics
Documentation of large-scale sequence ESTs from cDNA libraries was an early

approach in developing transcriptome data. The alternative is to use ESTs that are
randomly sequenced in an unbiased cDNA library, which are classified into clusters
of transcriptional units using sequence-clustering and/or other assembly methods.
The abundance of each transcript unit expressed in each tissue is then estimated by
counting the number of ESTs with identifiers for each cDNA library and/or each
sequence cluster. The same methodological principles have been applied in hu-
man and mouse, and a form of ‘organism map’ to determine the transcriptome in
various tissues and organs has been realised (Hishiki et al. 2000; Kawamoto et al.
2000; Ogasawara et al. 2006). There are no impediments in similar methods and
approaches being use in plant and crop transcriptomics.
Table 2.4 Integrative databases for Microarray and Microchip technology and analysis in plants
(URL)
Serial Analysis of Gene Serial analysis of gene expres- http://www.sagenet.org/
Expression sion (SAGE) information
page
Serial Analysis of Gene SAGE differential expression http://www.invitrogen.com/
Expression-SAGE™ | of genes site/us/en/home/Products-
Life Technologies and-Services/Applications/
Sequencing/Capillary-
Electrophoresis-Sequencing/
SAGE-Sequencing.html
Microarray, SAGE and Microarray, SAGE and gene http://www.hsls.pitt.edu/obrc/
other gene expression expression data bases; index.php?page=gene_
databases | HSLS multi-species expression_databases
Serial Analysis of Gene Applications for SAGE; multi http://www.sagenet.org/find-
Expression purpose ings/index.html
GermSAGE | Home Germ cell line SAGE; mainly http://germsage.nichd.nih.gov/
animal species germsage/home.html
Bioinformatics resources Ultimate web site for SAGE; http://www.bioinformatics.fr/
applications, information, resources.php?tag=sage
books etc
MAGE—Workgroups— Microarray Analysis of Gene http://www.mged.org/Work-
FGED Expression; MAGE site groups/MAGE/mage.html
CEA Direction des sciences SADE; SAGE adaptation http://www-dsv.cea.fr/dsv/
du vivant—iBiTec-S: for downsized extracts instituts/institut-de-biol-
Adaptation du SAGE (microquantities) ogie-et-de-technologies-
pour micro-quantités de-saclay-ibitec-s/unites/
service-de-biologie-
integrative-et-genetique-
moleculaire-sbigem/
laboratoire-de-physio-
genomique-lpg/adaptation-
du-sage-pour-micro-quan-
tites
Next-Gen Sequence Next-generation sequences http://mpss.udel.edu/
Databases databases; some commercial
crops
PlantPromoterDB Genome sequences and regula- http://ppdb.agr.gifu-u.ac.jp/
tory elements for Rice and ppdb/cgi-bin/index.cgi
Arabidopsis
UniGene
The digital differential display (DDD) tool, a component of the NCBI’s UniGene
database has been applied in large-scale cDNA projects for various species, includ-
ing crop plants (Mochida et al. 2003; Fei et al. 2004; Sterky et al. 2004; Zhang et al.
2004). Although this approach, coupled with cDNA clone resources has facilitated
gene discovery and expression profiling, various disadvantages including high cost
and limited resolution due to the need for large-scale sequencing are still present.
SAGE
Serial analysis of gene expression (SAGE) is a method based on sequencing of

short-read cDNA tags. SAGE allows the identification of a large number of tran-
scripts present in tissues, and enables quantitative comparison of transcriptomes
(Velculescu et al. 1995). Sequencing of selected clones from the SAGE library al-
lows the efficient collection of transcript sequencetags (TSS). Complete genome
sequencing or large-scale ESTs data are required, and because few plants fall into
this category, very few crop plants have approached the genetics of crop improve-
ment in this manner.
SAGE Derivatives
Some derivatives of the original SAGE protocol (MAGE, SADE, microSAGE,

miniSAGE, longSAGE, superSAGE, deepSAGE, GermSAGE, 5′ SAGE) have
been developed to improve the utility of SAGE (Hashimoto et al. 2004; Anisimov
2008). For example, superSAGE is an improved version of SAGE, and this method
has been applied to quantitative gene expression of both rice infected host cells and
their pathogen (Matsumura et al. 2003). The development of superSAGE tags has
also been used to design probes directly for oligonucleotide based microarrays in
plants (Matsumura et al. 2008).
Parallel Signature Sequencing (MPSS)
Massive parallel signature sequencing (MPSS) is uses as an alternate method to

quantify gene expression levels, and generate short sequence tags using a micro-
bead array (Brenner et al. 2000). The database of MPSS includes information from
Arabidopsis, rice, grape, soybean, Medicago, maize, Brachypodium and Magna-
porthe grisea (the rice blast fungus) (Nakano et al. 2006).
MPSS 2 and Plus (Arabidopsis profiling)
A new MPSS method has been used to perform genome-scale expression profiling
of sRNAs in Arabidopsis and rice (Lu et al. 2006; Nobuta et al. 2007). The MPSS2
method has recently been used for quantitative analysis of the 5′ end of transcripts,
which are then coupled to the cap-trap method for full-length cDNA cloning; it is
reported to be applicable to a number of different plants.
High Density Mapping of TSS
The method has been applied to perform high-density mapping of TSS in Arabidop-
sis, and identify genome-scale presence of plant promoters (Yamamoto et al. 2009).
The data set of Arabidopsis CT-MPSS tags is accessible from the PPDB site, a plant
promoter database that provides promoter information and motifs for Arabidopsis
and rice (Yamamoto and Obokata 2008).
Hybridisation-Based Platforms
DNA microarrays had their beginning with Brown’s research at Stanford University
in 1995 (Schena et al. 1995), and since then, microarray and DNA chip-related tech-
nologies have advanced rapidly; and their application has expanded to a wide vari-
ety of life science disciplines. DNA microarray or GeneChip analysis are designed
to acquire comprehensive data of the molecular abundance of each molecule in a
given sample, based on its simultaneous hybridization with a large population of
synthetic (DNA or cDNA) oligonucleotide species; usually immobilized on a glass
slide or on a silicon chip. With the recent and rapid increase in the number of se-
quenced plant species, the availability of DNA microarrays have also increased for
transcriptome analysis. For example, Seki and co-workers designed a custom DNA
microarray that uses 7,000 full-length cDNA clones of Arabidopsis as probes, and
then successfully screened genes in response to abiotic stresses using a two-colour
method (Seki et al. 2002a). With the recent increase in commercially available DNA
microarrays, laboratories are able to use a particular DNA microarray design to
obtain transcriptome data from many experiments, and in so doing accumulate com-
prehensive information on organism-specific transcriptional data. Gene expression
analysis and gene chip technology, URL web sites and the use of such technology
are detailed in Table 2.5.
DNA Microarray Types
DNA microarrays can be classified into two types: (i) the ‘spotting’ type, which
was developed at Stanford University; and (ii) the ‘on-chip synthesis’ type based on
manufactured probes by a number of molecular biology companies. The spotting
type was commonly used during the early years of transcriptome research. This
method entailed preparing DNA microarrays by spotting a cDNA solution onto a
glass slide, but spot microarrays are being replaced quickly by on-chip synthesis
type.
Table 2.5 Integrative databases for Gene Expression analysis and technology in plants
(URL)
Roche NimbleGen | Array Roche platform; information on http://www.nimblegen.
Synthesis MAS digital technology com/company/technol-
ogy/index.html
Roche NimbleGen Information website for biochip http://www.biochipnet.
technology com/node/146
Gene Expression Omnibus GEO navigation and browser http://www.ncbi.nlm.nih.
(GEO) Main page software—NCBI gov/geo/
AtGenExpress—Weigel Microarray data and web informa- http://www.weigel-
World tion for plant species world.org/resources/
microarray/
AtGenExpress/
TAIR—Gene Expression Micrarray data and gene expression, http://arabidopsis.org/
and stress factors in Arabidopsis portals/expression/
microarray/ATGenEx-
press.jsp
AtGenExpress JPN (Arabi- Arabidopsis gene expression profile https://database.riken.
dopsis Gene Expression data base from RIKEN jp/sw/en/AtGenEx-
profile data base) | Data- press_JPN_(Arabidop-
base Registry | RIKEN sis_Gene_Expression_
profile_data_base)/
crib151s2rib151s85i/
ATTED-II: Home Site for the co-regulation gene func- http://atted.jp/
tions; mainly in Arabidopsis and
rice
GENEVESTIGATOR—The Site for the search engine—Gene- https://www.genevestiga-
gene expression search investigator; biomedical, plant tor.com/gv/
engine biology
The BAR and other Data Bio Array resource for plant biology; http://bar.utoronto.ca/
Analysis Tools for Plant number of crop plants welcome.htm
Biology
http://www.bar.utoronto. 3D data display initiative for large http://3ddi.org/
ca/3DDI/ scale dataset display
http://www.arexdb.org/ Arabidopsis gene expression data http://www.arexdb.org/
base web site
Yale Rice Project Whole genome transcription profile http://bioinformatics.med.
for rice cells, tissues yale.edu/riceatlas/
Tiling Array, Tiling primers Design whole genome primers for http://www.premierbiosoft.
& probes, design prim- use in array design, including com/dnamicroarray/til-
ers for tiling, amplify DNA methylation ing_array.html
whole genome tiling
arrays
Tiling Arrays, Library File GeneChip tilling array, software and http://www.affymetrix.
Updates | Affymetrix analysis com/support/technical/
libraryfileupdatesmain.
affx
Arabidopsis thaliana—Til- Arabidopsis tilling array express; http://www.weigel-
ing Array Express— genome browser and used for world.org/resources/
Weigel World visual cross platform comparison microarray/at-tax

(URL)
Publication Detail Arabidopsis whole genome tilling http://www.arabidopsis.
array and expression and tran- org/servlets/TairObj
script identification ect?type=publication
&id=501727375
ChIP-Seq On line analysis tool; cross-referenc- http://ccg.vital-it.ch/
ing numerous datasets and gene chipseq/
expression profiles
MACS—Model-based Model based analysis for ChIP Seq http://liulab.dfci.harvard.
Analysis for ChIP-Seq datasets and software edu/MACS/
SOLiD® ChIP-Seq | Life Chromatin immunoprecipitation http://www.invitrogen.
Technologies (ChIP) sequencing kits protocols com/site/us/en/
home/Products-and-
Services/Applications/
epigenetics-noncoding-
rna-research/Chro-
matin-Remodeling/
Chromatin-Immuno-
precipitation-ChIP/
SOLiD-ChIP-Seq-.html
Chromatin Immunopre- ChIP sequencing technology; chro- http://www.illumina.com/
cipitation sequencing matin immunoprecipitation technology/chip_seq_
(ChIP-Seq)—Data assay.ilmn
On-Chip Transcriptome Research
The on-chip in situ oligo synthesis-based method is a light-directed chemical pro-

cess that combines solid-phase synthesis with photolithographic techniques. This
method was initially employed with the Affymetrix-manufactured GeneChip Array
system. In the Affymetrix GeneChip system, a known gene or potentially expressed
sequence is represented on the chip by up to 20 unique oligonucleotide probes.
The ‘On-Chip’ technology is fast becoming more readily available and more cost
effective.
High Density DNA Array
Roche NimbleGen and Agilent Technology offer platforms to manufacture high-

density DNA arrays based on Roche’s patented Maskless Array Synthesizer (MAS)
technology, and on a non-contact industrial inkjet printing process, both of which
are also used for in situ oligonucleotide synthesis.
NCBI Gene Expression Omnibus (GEO)
NCBI’s Gene Expression Omnibus (GEO) and the European Bioinformatics Insti-
tute (EBI)’s ArrayExpress are important web sites serving as primary archives of
transcriptome data in the public domain (Parkinson et al. 2007; Barrett et al. 2009).
There are cross-linkages on this web site to several focused databases that provide
calculated transcriptome data with user-friendly interfaces.
AtGenExpress
AtGenExpress is a multinational project designed to uncover the transcriptome of

A. thaliana. The data sets collected in AtGenExpress have been one of the most
comprehensive resources for the Arabidopsis transcriptome described to date
(Kilian et al. 2007; Goda et al. 2008).
ATTED II
ATTED II is a database that provides co-expression analysis calculated from pub-

licly available Arabidopsis ATH1 GeneChip data (Obayashi et al. 2007, 2009). Co-
expression analysis generated from collected transcriptomes has aided gene expres-
sion studies in plants.
GeneInvestigator
Genevestigator, which is a reference expression database and meta-analysis system,

also provides summary information from hundreds of microarray experiments on
various organisms, including Arabidopsis, barley and soybean, with an easyinter-
face forresults (Zimmermann et al. 2004).
Electronic Fluorescence Pictograph (eFP)
The electronic fluorescent pictograph (eFP) browser provides gene expression

patterns collected from Arabidopsis, poplar, Medicago, rice and barley via a user-
friendly program (Winter et al. 2007). The Bio-Array resources on this site, how-
ever, directs most of the information to Arabidopsis, and the 3DDI site provides
three dimensional display data designed to generate extendible models for plants.
AREX
The Arabidopsis Gene Expression Database AREX is a web site that provides data
of high-resolution gene expression patterns of root tissues in Arabidopsis (Birn-
baum et al. 2003; Brady et al. 2007).
RICEATLAS
The RICEATLAS is a database housing rice transcriptome data covering various

types of tissues using laser capture microdissection (Jiao et al. 2009). It is housed
within the search engine of the Yale Virtual Centre for Cellular Expression Profiling
of Rice web address, and in the TIGR site.
Tilling Arrays
Tilling arrays are high-density oligonucleotide probes covering the genome in a

particular organism, and therefore are a platform for analysing expressed regions
throughout the genome. The method is effective in discovering novel genes and elu-
cidating their structure. For example, Seki and co-workers performed transcriptome
analysis in Arabidopsis under abiotic stress using whole-genome tilling array and
described a number of antisense transcripts induced by stress (Matsui et al. 2008).
At-TAX
Arabidopsis thaliana Tilling Array Express (At-TAX) is a whole-genome tilling

array resource for developmental expression analysis and transcript identification
(Laubinger et al. 2008; Zeller et al. 2009). The utility of tilling arrays has been ex-
tended recently by coupling this platform with an immunoprecipitation method (see
Sects. 3.6.13 and 3.6.14 below).
MADS
The MADS domain uses a chromatin immunoprecipitation (ChIP) method that has
been used to identify transcriptional regulator sites for somatic embryogenesis,
when coupled with the Affymetrix tilling array for Arabidopsis. This rather complex
method to use and master, nevertheless found approximately 2,000 sites of regula-
tion (Zheng et al. 2009).
ChIP–Seq
A methylcytosine immunoprecipitation (mCIP) method, in combination with Ara-

bidopsis tilling array, can map comprehensive DNA methylation sites; and is often
referred to as ‘methylome’ data (Zhang et al. 2006). Sequencing of co-precipitated
DNA and a protein using next generation sequencing, ‘ChIP-seq’, has also become
an important experimental approach (Park 2009). MACS and SOLiD ChIP-Seq
web sites contain information and commercial kits and alternative analysis using
the ChIP-Seq platform. A chromatin ChIP-Seq assay is also available from Illumina
using the chromatin immunoprecipitation approach (Farrer et al. 2009).
Protein (Proteomics)
Genome sequencing projects for several organisms have been completed, but pro-
teome analysis, which is the detailed investigation of the function, modification
network and 3D structure of proteins, has gained increase attention (De Filippis and
Magel 2012; Memon 2012). Large-scale proteome information can be an important
resource for a better understanding of protein function in cellular systems, which
are controlled primarily by polypeptides and proteins. Protein dynamic properties
reflect cell and organ differences in terms of growth, development and response to
biotic and abiotic stress. The primary objective of plant proteomics has tradition-
ally been to simply identify all (or most of) the proteins in cells, organs and tissues.
Recent rapid technical advances in proteomics (e.g. protein separation and purifica-
tion, advances in mass spectrometry and methodological development in protein
quantification and identification) have lead scientists into the second stage of pro-
teomics, including quantitative proteomics, subcellular proteomics, modifications
of proteins and protein-metabolite interactions (Rose et al. 2004; Rossignol et al.
2006; Baginsky 2009; Yates et al. 2009).
Resources in Proteomics
The different Web-accessible plant proteome-related databases are summarized

on the proteomics subcommittee home web page of the Multinational Arabidopsis
Steering Committee (MASCP); under the heading of ‘Proteomic Databases and Re-
sources’. A summary of the information in various basic and advance proteomics
sites and databases is given in Table 2.6, including their relevant URL.
Proteome Profiling
A typical experimental research pathway for protein profiling can be summa-

rized as; (i) sample preparation of impure plant protein mixtures, (ii) separation
and purification of the proteins, (iii) detection of proteins and/or polypeptides, and
(iv) identification of fractionated or ionised proteins and polypeptides. Various
technical advances for each step of the process above have greatly increased the
overall performance, efficiency and cost effectiveness of plant proteomics research
(Rose et al. 2004; Jorrin-Novo et al. 2009; Uauy et al. 2009).
Table 2.6 Integrative databases for Proteomics and Protein (Polypeptide) analysis in plants
(URL)
Matrix Home page for peptide mass fin- http://www.matrixscience.com/
Science—Mascot gerprint database, searches and search_form_select.html
peptide identification
Entrez Databases Entrez database and tools; a multi- http://www.ncbi.nlm.nih.gov/
purpose proteomics site About/tools/restable_mol.
html
Main Page—Mascp Arabidopsis proteomic multinational http://www.masc-proteomics.
sub-committee org/mascp/index.php/
Main_Page
World-2DPAGE ExPASy Swiss protein 2D PAGE; http://world-2dpage.expasy.org/
Constellation: important web site for documen- swiss-2dpage/
SWISS-2DPAGE tation and software
The World-2DPAGE ExPASy Swiss protein 2D PAGE http://world-2dpage.expasy.org/
Constellation site; important repository and
search engine software
Kazusa Genome Genome and proteomic resources http://genome.kazusa.or.jp/
Resources from Miyakogusa.jp
Cyanobase CyanoBase; resources for http://genome.kazusa.or.jp/
cyanobacteria cyanobase
Rhizobase RhizoBase; resources for http://genome.kazusa.or.jp/
rhyzobacteria rhizobase/
MudPIT Multidimensional protein identifica- http://www.proteome.soton.
tion technology ac.uk/mudpit.htm
FTICR/MS Fourier transform mass spectrom- http://www.wangnmr.com/
Technology etry (FTMS) derived from ion FTICR_MS_technology.htm
cyclotron resonance (ICR)
spectrometry
DIGE Protein abundance changes using http://www.med.uc.edu/pro-
dige multi-fluorescent dye teomics/dige.htm
DECODON—Dif- Generic proteomics site for informa- http://www.decodon.com/Solu-
ferential in gel tion on methodologies tions/Delta2D/digeAnalysis.
electrophoresis html
(DIGE)—image
analysis—Delta2D
Proteomics services: Generic proteomics site for informa- http://www.appliedbiomics.
2D DIGE, iTRAQ, tion on methodologies com/
MS, and Phosphor-
ylation sites
3Dye™ 2D DIGE Kits Kits and uses for 3Dye 2D DIGE http://www.lumiprobe.
com/p/2d-dige-kits
Isotope-Coded Affin- The ICAT methodology and its http://www.bio.davidson.edu/
ity Tags (ICAT) uses—an interactive site courses/genomics/ICAT/
Methodology ICAT.html
ICAT, Quantitation, ICAT uses in relative quantitative http://www.creative-proteomics.
Quantification, Iso- proteomics, especially regulation com/ICAT.htm
tope Coded Affinity
Tag Technology

(URL)
SILAC—Stable Stable isotope labeling by amino http://www.silac.org/
isotope labeling by acid in cell culturing for MS
amino acids in cell quantitative proteomics
culture
Super-SILAC Technol- Peptide fingerprint analysis method http://medgadget.com/2011/02/
ogy for Quantita- used in conjunction with MS supersilac_technology_for_
tive Proteomics in ionization quantitative_proteomics_in_
Neoplasms neoplasms.html
Duke Proteomics Core Facilities and methodology for pro- http://www.genome.duke.edu/
Facility—Protein tein quantification using methods cores/proteomics/services/
Quantitation—IGSP described in Table 8 protein-quantitation/
Sample Preparation
Sample preparation is perhaps one of the most important steps in proteomics re-
search. Methods that use trichloroacetic acid (TCA) and acetone are still the most
commonly used procedures for protein precipitation and separation from other me-
tabolites in plant mixtures (Song et al. 2006; Wang et al. 2006). An alternate method
using phenol and ammonium acetate/methanol is also popular for plant separation.
Sample purification effectively improves protein detection and increases proteome
separation in subsequent steps by reducing interference in samples. The use of dif-
ferent reagents to separate proteins by their different solubilities and membrane as-
sociations can be effective in reducing the complexity of proteins in fractions, and
to enrich rare proteins in samples. Modifications of these basic procedures can be
used to separate membrane associated proteins in large amounts from the remainder
of the soluble protein fraction (Agrawal et al. 2005; Barjaktarovic et al. 2007).
Chromatography (SDS-PAGE)
Sequential treatment of the isolated proteins on various inert substrates is a common

method for separating protein samples based on a combination of solubility, molec-
ular mass and isoelectric point. At one time only one-dimensional SDS–PAGE had
wide use in separating complex proteins, based only on their molecular mass, but
now this approach has limited application. In contrast, high-resolution separation
of proteins by two-dimensional gel electrophoresis (2-DE), which uses isoelectric
focusing (IEF) in the first dimension and SDS–PAGE in the second dimension, is
a more effective and exact technique. The recent development of the immobilized
pH gradient (IPG)-IEF strips for use in the first dimension has improved reproduc-
ibility and resolution. The 2-DE method has been widely accepted in proteomics
for a range of important crop and bacterial species containing massive cell walls
(Chen and Harmon 2006; Herbert et al. 2006; Berkelman and Stenstedt 2002). Da-
tabases housing 2-DE information have been developed and released to the public.
For example, the Swiss Institute of Bioinformatics SWISS-2DPAGE database, Ex-

pasy and the Kazusa DNA Research Institute Cyano2Dbase are important. Differ-
ent chromatography separation methods, such as gel filtration chromatography, ion
exchange chromatography and affinity chromatography can also be used, but are
used less often in plants (Wu et al. 2005; Frolich and Arnold 2006).
Identification Methods
To identify each protein or polypeptide found in a sample, peptide mass fingerprint-

ing has been widely employed. Currently the most efficient method available con-
sists of two steps; (i) enzymatic digestion of well separated proteins excised from
gels into smaller peptides, and (ii) accurate mass measurements (fingerprints) of the
peptide fractions using mass spectrometry (MS). Various ‘in-gel’ digestion methods,
and modifications of these have been used to separate protein samples using 2-DE,
and further developments of these methods will continue to play an important role
in proteomics. The MS equipment generally consists of a source to ionise samples
and a mass spectrometer(s) to detect the ionized samples. The matrix-assisted laser
desorption ionization (MALDI) method is used in combination with time of flight
(TOF) MS (as MALDI-TOF-MS), or the electrospray ionization (ESI) method is
used in combination with quadrupole (Q) or ion trap (IT) MS. More recent develop-
ments in MS procedures, such as Q-TOF MS, IT-TOF MS or MALDI Q-TOF MS,
have become popular. Furthermore, ion fragmentation by collision-induced dissoci-
ation (CID) using tandem MS such as Q-TOF MS or post-source decay (PSD) using
MALDI-TOF MS have been used to determine more correctly peptide amino acid
sequences. Eventually though, to identify the target proteins obtained, peptide mass
fingerprint data are searched against a database of theoretically predicted masses of
known amino acid sequences (Hirano et al. 2004; Newton et al. 2004). To aid in the
correct identification of proteins and polypeptides, pI and molecular mass informa-
tion from gels are used to check the accuracy of MS identification fingerprint data
(De Filippis and Magel 2012).
Shotgun Proteomics
Conventional gel electrophoresis-based separation is by far the most common meth-

od used, however a gel-free separation method has been used from time to time;
sometimes being referred to as a ‘shotgun proteomics’ approach. In this gel-free
method, the protein mixture is directly digested into peptides and separated by one
of the separation and identification methods just described.
MudPIT
The multidimensional protein identification technology (MudPIT) consists of a

combination of different separation methods described before, in atypical ‘shotgun
approach’. MudPIT is especially suitable for the analysis of proteins that are diffi-
cult to separate by 2-DE, as well as for high-volume analysis by automated analyti-
cal instruments now in common use (Yates et al. 2009).
FT-ICR MS
Fourier transformation ion cyclotron resonance mass spectrometry (FT-ICR MS)

possesses high resolution, high sensitivity, high dynamic range and high mass
measurement accuracy. The high resolution and precision of FT-ICR MS allows
researchers to carry out ‘top-down proteomics’, similar to a ‘shotgun approach’
in which an intact protein mixture is analysed directly, without separation and/or
purification of the proteins (Bogdanov and Smith 2005).
Quantitative Proteomics
Quantification of the abundance of proteins identified is important for a better un-

derstanding of protein dynamics and kinetics, in response to cellular activities and
environmental changes. A quantitative proteome approach also plays a crucial role
in the discovery of key proteomic changes, including expression, repression, inter-
action and modification of proteins that are associated with genetic variations and/
or phenotypic changes in organisms (Gstaiger and Aebersold 2009).
DIGE
Difference gel electrophoresis (DIGE) is now a popular method for differential dis-
play of proteins for quantitative protein comparisons. In DIGE, protein samples
are labelled with different fluorescent dyes before 2-D electrophoresis, enabling
accurate determination of differences in protein abundance between samples (Ros-
signol et al. 2006). This method is effective in minimising and even negatinggel to
gel variation while significantly increasing accuracy and reproducibility of samples.
There are a number of commercial suppliers of 2D DIGE based gels available and
ready for proteomic studies.
iCAT (iTRAQ)
Isotope-coded affinity tags (ICATs) and isobaric tags for relative and absolute quan-
tification and comparison in basic regulation of proteins (iTRAQ), are other impor-
tant methods in proteomics.
SILAC
Stable isotope labelling with amino acids in cell cultures (SILAC) is a method used
for protein differential display using stable isotope labelling (Jorrin-Novo et al.
2009). Super SILAC technology is available from suppliers, and well suited for
plant cell and tissue culture comparisons.
MS-MS Analysis (Differential Isotopes)
Using a single MS/MS analysis, corresponding peptides from each sample are dif-
ferentially detected based on mass shifts caused by the different isotopes used; and
this type of analysis allows comparison of relative protein and polypeptide abun-
dance between samples.
LC-MS/MS
Recently, label-free quantitative techniques have been developed to facilitate high-

throughput comparisons specific for proteomic expression. For example, label-free
quantification in the proteomes from each of two samples are separately analysed
using liquid chromatography (LC)-MS/MS. Then, each MS spectrum is aligned to
calculate relative protein abundance and changes based on ion intensity differences,
such as peptide peak areas or peak heights in the chromatograms. Finally, MS/MS
analysis is used to identify the peptides of interest (Gstaiger and Aebersold 2009).
Subcellular Proteomics (Organelles)
Accurate and quick proteome analysis of cell organelles has become very important
for understanding the various enzymatic activities within cell organelles, the com-
partmentalisation of metabolites and metabolic pathways, cellular logistics such as
protein targets, their movement and regulation; and it has become very important to
understand proteomic dynamics at the subcellular level (Andersen and Mann 2006;
Chen and Harmon 2006; Baginsky 2009). A number of different approaches listed
below have been applied to analyse the proteome of organelles and subcellular com-
partments of plant cells. Studies so far have included cell organelles and compart-
ments like the chloroplasts, etioplasts, amyloplasts, chromoplasts, mitochondria,
vacuoles, plasma membrane, nucleus, peroxisomes, cytosolic ribosomes and cell
walls (Baginsky 2009).
Chloroplasts, Mitochondia and Organelles
Proteomic analyses of chloroplasts, mitochondria and othercell fractions have been

carried out to determine detailed localisation of proteins in sub-cellular compart-
ments. Methods for organelle isolation and purification are already available, and
are essential in the initial steps before protein is isolated and identified from them
(Sakai et al. 2004; Holy and Perkins 2009).Techniques for quantitative proteomics,
such as ICAT and iTRAQ described above, are then applied to resolve quantita-
tive data on the proteome in each organelle or cell compartment. In Arabidopsis,
rice and algae, differential proteome profiles of the plant plasma membranes were
obtained, and used to identify different proteins expressed in response to environ-
mental stresses such as cold, salt stress and bacterial elicitors (Benschop et al. 2007;
Katz et al. 2007; Cheng et al. 2009; Minami et al. 2009). Listed below are the most
important web-based sites for sub-cellular proteomics, their purpose and the URL
are detailed in Table 2.7. Several databases below provide subcellular proteome
information.
Rice Proteome Database
The rice proteome database is a 2-DE image information base for rice that con-
tains data from various tissues, as well as subcellular compartments and organelles
(Komatsu 2005).
Plant Organelle Database and GOBASE
These two web sites detail numerous external links to plant organelles (O’Brien
et al. 2009).
NASC Proteomics Database
The Nottingham Arabidopsis Stock Centre (NASC) Proteomics database is also

useful for both cellular and organelle data mining of proteins.
SUBA
The Sub-cellular location database for Arabidopsis proteins (SUBA) provides sub-
cellular proteome analytical and energy data on proteins in subcellular compart-
ments (Dunkley et al. 2006).
Table 2.7 Integrative databases for Sub-cellular Proteomics and Protein Modification analysis
in plants
Database Name Plant Species/Purpose Uniform Resource Locator (URL)
Enzyme A comprehensive protein and http://www.brenda-enzymes.org/
Database— enzyme information search and
BRENDA retrevel data system; an impor-
tant proteomics site
Rice Proteome Rice proteome database; protocols http://gene64.dna.affrc.go.jp/RPD/
Database and tools including sub-cellular
proteins and modifications of
proteins
Proteomics Arabidopsis NASC) proteome http://proteomics.arabidopsis.info/
Database for database; protocols and tools
Arabidopsis including sub-cellular and modi-
data fications of proteins
SUBA II Search engine for Arabidopsis pro- http://suba.plantenergy.uwa.edu.au/
teins, including phosphoproteins
and protein modifications
My 2D-PAGE— Soybean proteome database; 2D http://proteome.dc.affrc.go.jp/cgi-
map viewer protocols and tools including bin/2d/2d_view_map.cgi
sub-cellular and modifications of
proteins
PhosPhAt 3.0 Protein phosphorylation database http://phosphat.mpimp-golm.mpg.
mainly using MS, and predictor de/
software
P3DB—Plant Plant protein phosphorylation data- http://www.p3db.org/
Protein Phos- base for 6 plants, but contains
phorylation over 11,000 phosphoproteins and
DataBase 32,000 phosphosites
GOBASE—The Gene databank for cell http://gobase.bcm.umontreal.ca/
Organelle orgamelles and sub-cellular
Genome compartmentation
Database
Soybean Proteome Database
The soybean proteome database also provides 2-DEdata for various tissues, as well
as for subcellular compartments and organelles (Sakata et al. 2009).
Gramene
A database for plant comparative genomics and proteomics providing information

on monocotyledon (grass) plant species, and is cross linked to the GenBank protein
and organelle databases (Ware 2007).
Post-Translation Protein Modification
Modificon
Modificon research is when a comprehensive approach is used to investigate vari-

ous kinds of post-translational protein modifications, which can play an important
role in our current understanding of proteomics. Modificon data reports and iden-
tifies modified proteins, and elucidates and coordinates the role of each protein
modification with its associated biological action (Kwon et al. 2006). In this regards
protein phosphorylation is one of the most critical key regulatory process we have
discovered that can control the expression of many regulatory proteins. The list
of web sites and URL for protein modification structure and analysis are given in
Table 2.7, including their URL.
Protein Phosphorylation
Protein phosphorylation is an important regulatory step in most signalling path-

ways, and is a widespread protein modification step affecting most basic cellu-
lar processes in eukaryotic organisms (Schmelzle and White 2006). Advances in
MS-based technologies, accompanied by phosphopeptide enrichment techniques
have allowed researchers to perform high-volume, large-scale in vivo phosphory-
lation site mapping. So far, several different plant phosphoproteome studies have
been reported (Nuhse et al. 2004; de la Fuente van Bentem et al. 2006; Benschop
et al. 2007; Nuhse et al. 2007; Sugiyama et al. 2008). For example, the proteome-
wide mapping of in vivo phosphorylation sites in Arabidopsis have recently been
achieved, and some other preliminary studies have been completed on other plants
(Chitteti and Peng 2007; Barjaktarovic et al. 2009).
LC MS/MS
A primary method for proteome-wide mapping of in vivo phosphorylation sites in

Arabidopsis, and this has recently been achieved by using complementary phospho-
peptide enrichment methods, coupled to high-accuracy LC-MS/MS with a Finnigan
LTQ-Orbitrap (Sugiyama et al. 2008).
PhosPhAT
The Arabidopsis Protein Phosphorylation Site Database (PhosPhAt) provides infor-

mation on Arabidopsis phosphorylation sites, which have been identified in MS by
different research groups.
P3DB
The Plant Protein Phosphorylation Database (P3DB) is an information resource for

plant phosphoproteome research, andprovides a resource for protein phosphoryla-
tion data and detail information from multiple plant species (Gao et al. 2009).
Ubiquitination
Ubiquitination of protein is another one of the post-translational modifications oc-

curring in most eukaryotic cells, including plants. Protein ubiquitination is another
regulatory mechanism that controls protein localization and activity. Several large-
scale analyses of protein ubiquitination sites in plants have been reported (Maor
et al. 2007; Manzano et al. 2008; Igawa et al. 2009).
Anti-Ubiquitin Antibody
In Arabidopsis, affinity purification using an anti-ubiquitin antibody, and the subse-

quent use of MS/MS analyses has been performed to identify ubiquitinated proteins
(Igawa et al. 2009).
Structural Proteomics
Large data sets of protein 3D structures are also important as information resources
for elucidating relationships between protein function and structure, or for analys-
ing the active sites and their molecular identity in various protein complexes. To
deal with the technical aspects, methodology and interpretation of protein structure
in more detail is beyond the scope of this review, and I refer you to some recent
reviews on this topic (Yan and Chen 2005; Wlodawer et al. 2008). However listed
below in summary form are some of the most important features for structural pro-
teomics and web-based sites for protein structural projects, their purpose and URL
are detailed in Table 2.8.
ISGO
The International Structural Genomics Organization (ISGO) site (Stevens et al.
2001) is designed to facilitate co-operation to determine protein structures using
existing instrumentation in a number of international laboratories for structural pro-
teomics, and have identified many DNA-binding domains (DBDs) of plant-specific
transcription factors (TF) (Yamasaki et al. 2004; Yamasaki et al. 2008b).
Table 2.8 Integrative databases for Structural Proteomics analysis in plants

(URL)
International Structural ISGO main web site: Reports, http://www.isgo.org/
Genomics Organization Activities and Publications
Welcome to RSGI RIKEN Structural Genomic http://www.rsgi.riken.jp/
(RIKEN) Proteomic Initiative—Home
page
RSGI (RIKEN Structural Integrated database for pro- https://database.riken.jp/sw/
Genomics/Proteomics tein structure, including links/en/cria266s4i/6p
Initiative) structure | Arabidopsis
Integrated Database of
Protein | SciNetS
Download | (RIKEN Download web page for most http://biolod.org/class/
Structural Genomics/ of the RIKEN proteomic cria266s4i/RSGI_RIKEN_
Proteomics Initiative) software Structural_Genomics_Pro-
Somantic Ontology teomics_Initiative_structure
Class Database | RDF/
OWL
Home : PSI-Nature Web site to keep informed on http://www.sbkb.org/
Structural Biology structural genomics and
Knowledgebase biology
The Protein Structure Web site for research articles http://f1000.com/reports/b/4/7
Initiative: achievements and methods on structural
and visions for the genomics and structural
future—F1000 Biology biology
PSI Pilot Phase Fact NIH web site for proteomics http://www.nigms.nih.gov/
Sheet—National Insti- fact sheets and protein infor- Research/FeaturedPrograms/
tute of General Medical mation in mainly the health PSI/Background/PilotFacts.
Sciences sciences htm
RCSB Protein Data Portal and search engine http://www.pdb.org/pdb/home/
Bank—RCSB PDB –Biological Macromolecular home.do
Structures and Resouces
CLC bio: Integrated 3D Integrated workbench for http://www.clcbio.com/index.
molecule viewer analyzing 2D gel data and php?id=500
MS peptide fingerprinting
profiles
I-TASSER server for Complete function and structure http://zhanglab.ccmb.med.
protein structure and prediction for over 1,00,000 umich.edu/I-TASSER/
function prediction proteins from international
sources linked to the NCBI
protein databanks
DisEMBL 1.5—Predic- Intrinsic protein disorder http://dis.embl.de/
tors of intrinsic protein prediction web site linked to
disorder SWISS protein identification
GTOP database Genomes TO Protein structure http://spock.genes.nig.
and function site; unfor- ac.jp/~genome/gtop.html
tunately contains no plant
data, but has interesting
bacteria and virus

(URL)
CATH: Protein Structure Proteins classified into struc- http://www.cathdb.info/
Classification Data- tural domains and superfam-
base—Prof. Orengo’s ilies; useful web site once
Bioinfomatics Group at protein identity is known
UCL, London, UK even with plants
SCOP: Structural Classifi- Contains proteins in fold http://scop.mrclmb.cam.ac.uk/
cation of Proteins domains and superfamilies; scop/index.html
useful in assessing protein
structural similarities across
species
PANTHER—Classifica- Browser and search engine http://www.pantherdb.org/
tions of Genes and for proteins, and divides
Proteins them into ontogeny and
superfamilies
RIKEN (RSGI)
The RIKEN Structural Genomics/Proteomics Initiative (RSGI) in Japan is an im-

portant and key centre for structural genomic and proteomic analysis. BioLOD.org
is another of the RSGI sub-web sites for structural proteomics. The RIKEN SGPI
has solved over 2,700 protein structures, including 33 from Arabidopsis that appear
on another important web site, the PDB site listed below.
SBKB from PSI Nature
Keeps you informed about advances in structural biology and structural proteomics.
It is an easy to navigate web site and includes information on other proteomic re-
search done at other web addresses.
PSI and F1000
The Protein Structure Initiative (PSI) in the USA, and the structural genomics cen-
tres of Europe (Yokoyama et al. 2000) are important sites. The PSI has promoted
large-scale attempts to determine the 3D structure of proteins and deposition into a
database. In 2005, the PSI shifted to its second phase, known as PSI-2 ‘information
phase’ which was to solve more challenging structures such as protein complexes
and folding, and to identify membrane associated proteins (Fox et al. 2008).
PDB
The number of solved protein structures appearing in the protein data bank (PDB)
is fast growing, and has been one of the most popular resources for biomolecular
structural data; the PDB site has had a dramatically increased in available data de-
posited during the past decade (Kouranov et al. 2006).
CLC BIO
CLC has an integrated 3D molecular viewer for determining structures of proteins.

It has a fully navigational and integrated 3D viewer tool for use. It has file systems
and graphics that are compatible with publication of the 3D structures directly.
Cell-Free System (Wheat Germ Embryo)
Although methodological problems still exist in structural and analytical pro-

teomics, some new methods and computational advances have played important
roles in cellular protein determination and identification. One major bottleneck has
been the production of proteins as they may be present in living organism, in 3D
structure. Most researchers in structural proteomics have used Escherichia coli cells
for protein production in automated methods, as an approximation of the cell-based
3D protein structure. However Escherichia coli is a bacterium and prokaryote, and
doubts have been expressed as to the protein folds and structures assembled in a
prokaryote being relevant to eukaryotic organisms. Cell-free expression systems
have also been used mainly as a method to address several limitations of cell-based
methods, such as protein quality and quantity, and high throughput issues. The wheat
germ embryo cell-free system has been developed as a eukaryotic cell-free system
to overcome such problems, and has the advantage of producing multi-domain pro-
teins (Endo and Sawasaki 2003, 2006). For example, a comparative study of protein
production from 96 Arabidopsis open reading frames (ORFs) demonstrated marked
differences in protein profiles between the wheat germ cell system and the cell free
system (Tyler et al. 2005).
NMR Methods Plus CP/MAS/DD
The technology and platform of NMR spectroscopy has played an important role in
structural proteomics. High-resolution multidimensional solid-state NMR methods
used in combination with cross polarization (CP), magic angle spinning (MAS)
and dipolar decoupling (DD) are now becoming the methods of choice for struc-
tural analysis in NMR equipment (Castellani et al. 2002; McDermott 2009). Recent
improvements in NMR include a cryoprobe for improved sensitivity, a micro-coil
probe for sample mitigation, and a flow-probe designed to shorten preparation time.
X-Ray Crystallography
X-ray crystallography has also been used to determine the protein structures of
almost 90 % of protein entries in the PDB database. The third generation X-ray syn-
chrotrons have become essential for macromolecular crystallography (MX) of large
proteins and protein complexes (Samatey et al. 2001). For example, the synchrotron
SPring-8 of RIKEN in Japan has been used to determine the structures of important
membrane proteins and large complex proteins; such as Ca2+-ATPase, rhodopsin
and flagellin (Palczewski et al. 2000; Samatey et al. 2001; Toyoshima et al. 2003).
Informationand Web Resources in Structural Proteomics
Bioinformatics and related databases are therefore important tools for advancing
the study of structural proteomics. The methods used in computational prediction
of protein 3D structures are readily available and described by Zhang (2008) and
Zhang (2009b). Free modeling, which is sometimes called ‘de novo’ modelling is
used to predict the 3D structure of proteins, and the web-based sites for information
on structural proteomics, their purpose and URL are detailed in Table 2.8.
I-TASSER
A number of web servers and computational tools for free and/or template-based
protein modelling have recently been made available; for example, the I-TASSER
internet server.
CASP
I-TASSER is often used in Critical Assessment of Techniques for Protein Struc-

ture Prediction (CASP) (Zhang 2009a). This template-based modelling method is a
comparatively new method for matching proteins using evolutionarily related pro-
teins of known structure as a template.
Swiss Model Server (DisEMBL)
There are many web services and tools (e.g. Swiss Institute of Bioinformatics
SWISS-MODEL server) to support template-based modelling (Schwede et al.
2003). The Intrinsic Protein Disorder prediction program, which is linked to the
Swiss Model server, is one such piece of software.
GTOP
Databases housing previously predicted structures from amino acid sequences by

template-based modelling for a wide range of species exist on this site; the Genome
TO Protein structure and function (GTOP) database. Data in this site is obtained
by the application of various computational tools for structural prediction from se-
quences of amino acids and genomes (Fukuchi et al. 2009).
CATH/SCOP
The databases for structure-related protein classification, as typified by CATH and

the Structural Classification of Proteins (SCOP) data sites, have provided important
clues to the relationship between proteins, protein function and protein evolution
(Greene et al. 2007; Andreeva et al. 2008).
PANTHER
A database for protein families based on conserved protein domains, the Protein
Analysis Through Evolutionary Relationships (PANTHER) is an important site for
classifying proteins into families. The database contains the evolution and function
of proteins, and the resources are used in genome-wide identification of genes (Mi
et al. 2005; Wilson et al. 2007; Finn et al. 2008; Wilson et al. 2008).
Plant-Metabolism (Metabolomics)
Metabolomics is referred to as an understanding of metabolism primarily based on

comprehensive and multidimensional approaches, by taking advantage of various
analytical instruments and bioinformation available to identify metabolites. Metab-
olomic data can include individual and multiple assessments of metabolites, and to
quantify particular metabolites in order to provide advantages over chemical pheno-
type analysis. The plant metabolome is complex enough for an individual plant, but
it is even more challenging for comparison between plants (Bino et al. 2004; von
Roepenack-Lahaye et al. 2004). Therefore, plant metabolomics is a great analyti-
cal challenge, but nevertheless it is important to an understanding of plant growth
and development. Metabolomics has the ability to improve knowledge of plant cell
systems, to engineer molecular breeding and to improve the productivity and func-
tion of plants in areas like stress tolerance, pharmaceutical production, food quality,
biomaterials and energy (Trethewey 2004; Oksman-Caldentey and Saito 2005; Fer-
nie and Schauer 2009). In this section, we include metabolomic analytical sites for
plants, metabolic profiling, instrumentation and their applications with respect to
other ‘omics’ research. We also describe plant metabolomics related computational
tools and databases commonly in use.
Instruments in Metabolomics
Many technological advances have recently been made in instrumentation related

to metabolomics. Metabolomics data starts with the acquisition of metabolic finger-
prints using these analytical instruments (Fiehn et al. 2000; Roessner et al. 2001;
Fernie et al. 2004). Methods for sample separation, such as gas chromatography
(GC), high-performance or ultra performance liquid chromatography (LC) and cap-
illary electrophoresis (CE) are used, in conjunction with various types of MS. CE-
MS is especially effective, because it is a highly-sensitive method for separating
and analysing biological molecules (Ramautar et al. 2009). Detailed below, are the
URL web pages for explanation, methodology and instruments used in metabolo-
mics, and outlined in Table 2.9.
QMS and TOF MS
QMS is especially usefull in metabolomics. TOF MS are also well regarded for use
in metabolomics. Triple Q (QqQ) MS (a tandem-type MS) and Q-TOF (a hybrid
type MS) are also in common use.
FT-ICR MS
Methods that do not involve pre-separation of samples can be used, e.g. FT-ICR
MS, are often employed, allowing for MS analysis even on quite crude plant prepa-
rations (Werner et al. 2008).
NMR Based Methods
NMR-based methods are used in metabolomic analysis (Dixon et al. 2006; Schripse-
ma 2009). These methods can be broadly classified into solution NMR and insolu-
ble or solid-state NMR, according to sample solubility. High-resolution (hr)-MAS
techniques can generate suitable metabolic fingerprints from insoluble samples
and solid-state preparations (Bertocchi and Paci 2008). One-dimensional NMRis
where protons (1 H) are observed (1 H-NMR), however more detailed analyses
and metabolite identification and/or flux analysis can be obtained with other nuclei,
particularly 13 C and 15 N (Kikuchi et al. 2004; Sekiyama and Kikuchi 2007).
Processed sets of data are subsequently used to identify metabolites corresponding
to each spectrum signal by searching against standard compound databases. In non-
target analyses, spectrum data sets that include spectra of unknown compounds are
subjected to statistical analyses, such as multivariate analysis (Sect. 5.1.8 below), to
mine data for biological significance (Tikunov et al. 2005). In target analyses, spec-
Table 2.9 Integrative databases for Metabolomics and Instrumentation analysis in plants
GC/MS Web Site Web site for explanation of http://www.scientific.org/tutorials/
gas chromatography and articles/gcms.html
mass spectrometry
Comprehensive Pesticide Agricultural, food, flavor and http://www.restek.com/Technical-
Residue Analysis by fragrance identity of com- Resources/Technical-Library/
LC/MS/MS Using pounds via LC/MS/MS—a Foods-Flavors-Fragrances/
an Ultra Aqueous commercial company site fff_A020
C18 Column/Foods,
Flavor—Restek
Chromatography
Lipid Analysis with Metabolite (lipid) identity of http://fiehnlab.ucdavis.edu/
GC-MS, LC-MS, compounds via LC/MS/ staff/kind/Metabolomics/
FT-MS—Metabolo- MS—another commercial LipidAnalysis/
mics Fiehn Lab site
FTIR Analysis Industrial application and http://www.semlab.com/ftir.html
compound identity—FTIR
FTIR Analysis—Fourier Web site explaining FTIR http://www.ides.com/articles/test-
Transform Infrared analysis and identity ing/2008/FTIR_Analysis.asp
Spectroscopy
NMR Analysis, Processing Explanation of NMR analysis http://nmr-analysis.blogspot.com.
and Prediction au/
NMR Analysis NMR analysis, methodol- http://www.intertek.com/analysis/
ogy and equipment nmr/
requirements
Metabolome Analysis Various applications for http://www.infinitebio.com/prod-
Service by CE-MS CE-MS in drugs, toxicol- ucts/HMT_Metaborolomics_
ogy, disease, blood, cell Analysis/index.html
and tissue; including pos-
sible use in plants
QMS 403 C Aëo- New dimensions and equip- http://www.netzsch-thermal-anal-
los®—Quadrupole ment for gas analysis; the ysis.com/en/products/detail/
Mass Spectrometer- QMS 403; the quadruple pid,33.html
NETZSCH MS instrument
Evolved Gas Analysis- Quadruple MS and standard http://www.netzsch-thermal-
EGA (QMS, TG- MS analysis, especially analysis.com/en/products/
GC-MS, FTIR, coupled to FTIR; pulse evolved-gas-analysis/
SKIMMER) thermal analysis
GEN | Application Notes: MALDI-TOF MS; used to http://www.genengnews.
MALDI-TOF MS select Biomarkers which com/application-notes/
Analysis of Nanotrap are often masked by high maldi-tof-ms-analysis-of-
Enriched Low Molecu- abundant proteins, and/ nanotrap-enriched-low-molec-
lar Weight Protein— or may be susceptible to ular-weight-proteins-from-
Human Serum example proteolysis human-serum/22/
NMR Spectroscopy Web site to explain Proton http://www2.chemistry.msu.edu/
NMR spectroscopy and faculty/reusch/VirtTxtJml/
multi uses Spectrpy/nmr/nmr1.htm

SOMA | Self Organizing A web tool used in DNA http://soma.arb-silva.de/
Map Application Site and protein fragment
classification
Recent advances from the Research article on the web http://f1000.com/reports/b/2/7/
F1000 Biology Reports describing recent advances
in metabolomics and
greener pastures (ie in
plant biology)
trum data sets that are associated with particular compounds are used as metabolic
profiles for each compound.
Statistics (PCA-HC-SOM)
Data analysis is most important in determination of biological significance in

metabolomics. Statistical analyses using multivariate analysis, such as principal
component analysis (PCA), hierarchical clustering analysis (HCA) and self-orga-
nization mapping (SOM), are typically used to classify samples and/or metabolites
(Hirai et al. 2004; Jonsson et al. 2004; Matsuda et al. 2009). The visualization of
metabolic profiles on metabolic maps is also used in combination with other ‘omics’
methods, which can include gene expression profiles of particular genes encoding
the enzymes involved in those particular pathways (Thimm et al. 2004; Tokimatsu
et al. 2005).
Metabolite Profiling Plants
The systematic collection of metabolite profiles is the initial step in metabolomics.

This step can be performed with various instruments (described above) capable of
high turnover and simultaneously many measurements. Comprehensive metabolic
profile data can contribute to the understanding of the cellular system in response to
changes in intracellular and extracellular metabolites. Furthermore, the changes in
metabolic pathways associated with genetic variations can be evaluated as chemical
fingerprints to identify genes involved in metabolism. A number of studies of meta-
bolic profiling in plant species have been performed that have resulted in the release
of results; unfortunately these results are mostly present on web databases. Listed
below are the most important web-based sites for metabolite and product analysis,
their purpose and URL are detailed in Table 2.10.
Table 2.10 Integrative databases for Metabolite and Products analysis in plants
(URL)
Metabolomic Tool Arabidopsis web site predicting http://www.garnetcommu-
Kit—GARNet metabolites and enzymes; nity.org.uk/resources/
software ‘omics viewer is metabolomic-tool-kit
particularly usefull
Metabolomics Search engine for metabolomics http://appliedbioinformatics.
Bioinformatics and protein wur.nl/moto/
Database—KOMICS A series of databases for plant http://www.kazusa.or.jp/komics/
transcriptome and metabo- en/en-database.html
lome analysis
ARMec Repository Database for mass spectrometry http://www.armec.org/
identity MetaboliteLibrary/
CSB.DB: GMD Golm metabolome database http://csbdb.mpimp-golm.mpg.
for some model organisms, de/csbdb/gmd/gmd.html
including Arabidopsis
MS2T Phytochemical spectral data for http://prime.psc.riken.jp/lcms/
proteomic research; Arabi- ms2tview/ms2tview.html
dopsis, rice, wheat, soybean,
brassica, allium
PRIMe LC-MS Branch Mass spectrometry of plant http://prime.psc.riken.jp/lcms/
fractionation databank of
secondary metabolites
AtMetExpress LCMS Mass spectrometry data of http://prime.psc.riken.jp/lcms/
different growth stage and AtMetExpress/
metabolites in Arabidopsis
PRIMe: Simple BL-SOM Self-organising map and sta- http://prime.psc.riken.
tistics tool to detail genes/ jp/?action=blsom_index
metabolites into a series of
rows for analysis
TAIR—Home Page Arabidopsis information on http://www.arabidopsis.org/
genetic maps, markers,
sequencing and expression
KEGG PATHWAY Collection of manually drawn http://www.genome.jp/kegg/
Database pathway maps for molecular pathway.html
interactions
Plant metabolic pathway Broad network of plant meta- http://www.plantcyc.org/
database (PMN/Plant bolic pathways; including
Cyc) home page literature, analysis, proteins,
enzymes
Pathway Tools Information Comprehensive systems biology http://bioinformatics.ai.sri.com/
Site software and bioinformatics ptools/
databank
Home—MapMan Software for analysis of RNA http://mapman.gabipd.org/web/
and sequences guest
Home—KaPPA—Portal Web based databank for visual http://kpv.kazusa.or.jp/en/
uploaded ‘omics’ metabolic
pathway data

(URL)
PRIMe: Platform for Web based service for transcrip- http://prime.psc.riken.jp/
RIKEN Metabolomics tomics and metabolomics in
life science
International Potato Center Potato centre web site which http://cipotato.org/
includes the potato databank
Plant Metabolomics
In the case of Arabidopsis, an NSF-funded multi-institutional project aimed at fully

developing the metabolomics database, ‘Plantmetabolomics’, has recently been
documented through GARNet. The site contains a tool kit of resources for meta-
bolic data analysis and comparison.
Solanaceae (Tomato/Potato)
Several databases for Solanaceae and other plants are available (also web sites be-
low) at the Plant Research International at Wageningen, Netherlands homepage.
The Metabolome Tomato Database (Moco et al. 2006) and potato database CIPO-
TATO were developed here (Mullins et al. 2006).
KOMICS
The KOMICS (Kazusa-omics) database collects annotation data of metabolite peaks

detected by LC-FT-ICR-MS, and the web site contains a representative metabolome
data set for the model tomato cultivar, ‘Micro-tom’ (Iijima et al. 2008).
ARMeC Repository Project
The Armec Repository Project provides metabolome data on the potato, and serves
as a data repository for metabolite peaks detected by ESI-MS.
Golm Metabolome Database
The Golm Metabolome Database (GMD) provides public access to custom mass
spectral libraries and metabolite profile data, and contains additional tools and base
information (Kopka et al. 2005).
MS2T/PRIMe
The MS/MS spectral tag (MS2T) libraries at the Riken Metabolomics (PRIMe)
website provides access to libraries of phytochemical LC-MS2 spectra obtained
from various plant species.
LC-ESI-Q TOF/MS
By using the automatic MS2 retreval function of LC-ESI-QTOF/MS (Matsuda et al.

2009), MS2T/PRIMe and LC-ESI-Q TOF/MS databases can play crucial roles as
information resources and repositories of large amount of new data. They also serve
as tools for further integration of metabolic profiles containing comprehensive data
acquired from other ‘omics’ research (Akiyama et al. 2008).
Combined Approaches in Metabolomics
Metabolome research can help in the understanding of metabolic activity at the

cell, tissue and organ levels, and achieving profiles complementary to other ‘omics’
research; which can aid genetic variation studies. At present these combination of
methods have been demonstrated mostly in the model plant Arabidopsis by utilising
the many other ‘omics’ web sites and resources that currently exist for this model
plant; including whole-genome sequencing, large-scale transcriptome data and re-
lated expression data, bioresources from mutants, and full-length cDNA clones.
The experimental scheme for systematic information retrieval of gene-to-metab-
olite data through a combination of transcriptome and metabolome resources has
been demonstrated by Saito’s group at the RIKEN Plant Science Centre (Saito et al.
2008). The URL list and resources below are also listed in Table 2.10.
map (BL-SOM)
Data containing transcriptome and metabolome changes in Arabidopsis under stress

conditions induced by deficiency of sulfur and nitrogen were analysed using batch-
learning, self-organizing map (BL-SOM) analysis, which enabled the identification
of genes involved in glucosinolate biosynthesis (Hirai et al. 2004). An integrated
approach with an activation-tagged mutant line with overexpressed genes wasd
used to identify genes involved in anthocyanin biosynthesis (Tohge et al. 2005).
ATTED II Database
Co-expression data of the Arabidopsis transcriptome has been provided by the AT-
TED-II database. Investigation of key genes involved in specific metabolic path-
ways, and metabolome analysis was used with mutant lines (Obayashi et al. 2009).
The ATTED-II database has identified genes involved in lipid metabolism, and
UDP-glucose pyrophosphorylase 3 (UGP3) as an essential requirement in the first
step of sulfolipid biosynthesis (Okazaki et al. 2009). Co-expression analysis was
used to identify genes related to flavonoid biosynthesis, and the role of two key and
important flavonoid pathway genes UGT78D3 and RHM1 (Yonekura-Sakakibara
et al. 2008).
Results in Metabolite Profiling
The metabolic pathways that act in response to cold and dehydration conditions
in Arabidopsis were investigated by metabolome analysis using MS and microar-
ray analysis of overexpressors in genes encoding transcriptional factors (Maruyama
et al. 2009). Metabolomic profiling was also used to investigate chemical pheno-
typic changes between wild-type Arabidopsis and a knockout mutant of the NCED3
gene under dehydration. The metabolic data was integrated with transcriptome data
to reveal ABA-dependent regulatory pathways (Urano et al. 2009). Metabolome
profiling has also been used to evaluate chemical phenotypes of natural variations
and/or segregating populations in plant ecology and plant breeding. Analysis be-
tween metabolic expression and genomic diversity will enable the discovery of
more key genes involved in differences between metabolic and phenotype expres-
sion of plants (Schauer et al. 2008; Fu et al. 2009).
Metabolite QTL (mQTL)
Metabolite QTL (mQTL) analysis using segregated populations has been applied to
various plant species such as Arabidopsis, poplar and tomato in a popular ‘forward
genetics’ approach (Morreel et al. 2006; Schauer et al. 2006; Lisec et al. 2008;
Rowe et al. 2008; Schauer et al. 2008).
Metabolic and Genomic Diversities
The recent availability of data for genome-wide variation acquired by high-through-

put genotyping methods, including high volume resequencing, has provided some
details of genes association with nucleotide variation and phenotypic changes; es-
pecially ibn relation to the identification of key genes that play significant roles
in evolutionary histories and phylogeny (Sect. 2.5). Attempts to mine correlative
patterns between metabolic and genomic diversities have recently been applied to
sesame and rice using seeds of natural variant phenotypes (Laurentin et al. 2008;
Mochida et al. 2009a).
Information Resources for Metabolomics
Various information resources related to metabolomics have played a central role

not only in metabolome research but also in synergistic integration of data with
other ‘omics’ information through a variety of sites; such as the web sites listed
below and their URL are detailed in Table 2.10.
TAIR
The web site of metabolome resources at TAIR provides a summarized list of web
hyperlinks to resources that facilitate metabolome research around the world, and
other web pages and sites.
KEGG
A set of biological pathway maps is available via the Kyoto Encyclopaedia of Genes
and Genomes (KEGG), using a popular database for general information on life sci-
ences called the KEGG PATHWAY Database (Kanehisa and Goto 2000; Kanehisa
et al. 2008).
PMN
The Plant Metabolic Network (PMN) is a collaborative project that aims to build
plant metabolic pathway databases for plants. It contains a number of other impor-
tant web tools described below.
Plant Cyc
PlantCyc, is a comprehensive plant biochemical pathway database that contains in-

formation from available literature, and computational analyses and tools for genes,
enzymes, compounds, reactions and pathways involved in primary and secondary
plant metabolism.
AraCyc/PoplarCyc
AraCyc and PoplarCyc are also available at the PMN web site, which provides a
review of information about metabolic pathways in Arabidopsis and poplar respec-
tively (Mueller et al. 2003). There are also metabolic pathway databases for several
other plant species generated by PMN researchers. MapMan is a tool to project
‘omics’ data onto metabolic pathways (Thimm et al. 2004).
KaPPA-View
KaPPA-View is a web-based analysis tool that can be used to superimpose tran-

scriptome and metabolome data onto plant metabolic pathway maps (Tokimatsu
et al. 2005).
PRIMe
PRIMe is a web-based service that provides data of metabolites measured by multi-

dimensional NMR spectroscopy, GC-MS, LC-MS and CE-MS, in an integrated ap-
proach to analysis of comprehensive data within the metabolome and transcriptome
search engines present there (Akiyama et al. 2008).
Plant Phenotype (Phenome) Analysis
Analysis of mutants is an effective approach for investigation of gene structure and

function (Springer 2000; Stanford et al. 2001). Collections of mutant lines are also
essential bioresources for accelerating forward and reverse genetics in plants. The
available mutant resources for phenome analysis in plant species have been well
described in a recent review by Kuromori et al. (2009). The demand for compre-
hensive collection of mutants and related information has increased dramatically
encouraged by the high-throughput and genome-wide phenome analysis in plants
(Alonso and Ecker 2006). Listed below are six of the most important web-based
sites for phenome analysis and insertion mutants, their purpose and their URL are
detailed in Table 2.11.
Insertion Mutants
Insertion mutant resources with index data that document the inserted gene muta-
tion position have become extremely beneficial resources to investigate functional
analysis of genes that can be up-regulated by promoters, or disrupted, down-regu-
lated and silenced by reverse genetics.
Table 2.11 Integrative databases for Phenotype and Genotype Tagging analysis in plants
(URL)
SNPs between Nip- Generic browser for SNP in http://koshigenome.dna.affrc.
ponbare IRGSP plants, animals and micoor- go.jp/cgi-bin/gbrowse/
build4—Koshihikari ganisms, and chromosome koshig/?help=general
locations
Rice Genome Annotation Sequence annotation of the 12 http://rice.plantbiology.msu.
Project rice chromosomes edu/
OryzaSNP @ MSU Rice SNP identification and http://oryzasnp.plantbiology.
sequence; over 150,000 high msu.edu/
quality SNP
OryGenesDB: database for Rice database and information http://orygenesdb.cirad.fr/
rice reverse genetics on Flanking Sequence Tags
(FST)
FOX Hunting | RIKEN Full-length cDNA library for http://nazunafox.psc.data-
SciNetS plant expression studies by base.riken.jp/sw/en/
repeated transformation FOX_Hunting_/ria61i/
Rice FOX Database Rice full-length cDNA over- http://ricefox.psc.riken.jp/
expressed Arabidopsis
mutant database website
Tilling Targeting induced local lesions http://tilling.ucdavis.edu/index.
in genomes website; wide php/Main_Page
application in plant gene
function and breeding
TILLING Genes To Soybean targeting induced local http://www.ars.usda.gov/is/ar/
Improve Soybeans lesions in genomes site archive/jul05/genes0705.
htm
About RevGen UK Platform and data for gel based http://revgenuk.jic.ac.uk/about.
reverse genetics in Lotus, htm
Medicago, Brassica
TILLING DATABASE Platform and databank for http://urgv.evry.inra.fr/UTILLdb
phenotype recording in Pea,
Tomato and Brachypodium
CATMA Website Complete Arabidopsis tran- http://www.catma.org/
scriptome microarray page
for gene specific tag (GST)
http://www.agrikola.org/ Systematic RNAi knockouts in http://www.agrikola.org/index.
Arabidopsis GST from the php?o=/agrikola/%20html/
CATMA consortium index
GO:0009616 virus induced Virus induced gene silencing http://www.ebi.ac.uk/QuickGO/
gene silencing wbsite; including cross-links GTerm?id=GO:0009616
fioreDB: Database for Gene silencing technology and http://www.cres-t.org/fiore/pub-
Flower Bio-engineering database for genes encoding lic_db/index.shtml
by CRES-T system crop, flower factors
T-DNA-tagged (SNP)
Transferred DNA-tagged (T-DNA-tagged) lines and transposon-tagged lines have

recently become popular for investigation of insertion mutants in plants, and short
nucleotide polymorphisms (SNPs) (Krysan et al. 1999). The two component maize
transposon, Activator ( Ac)/Dissociation ( Ds), is a popular system for the produc-
tion of transposon-based insertion mutations, and generation of mutants with a high
proportion of single-copy insertions (SNP) (Long et al. 1993). In rice, the endog-
enous retrotransposon Tos17, which can be activated under controlled conditions,
is also available for the study of the insertion mutant lines of japonica rice cultivars
(see under SNP markers for rice).
Nipponbare
Nipponbare (Miyao et al. 2003, 2007), is the web resource that provides informa-
tion on the rice Tos17 mutant rice lines with flanking sequences of insertion.
Maize Enhancer/Suppressor Mutator
The maize Enhancer/Suppressor Mutator ( En/Spm) element has also been used as
an effectivetool for the study of functional genomics in maize cultivars (Kumar
et al. 2005).
Enhanced Trap (ET)/Gene Trap (GT)
The enhancer trap (ET) and the gene trap (GT) genetic constructs have been cou-
pled with T-DNA and Ac/Ds transposons, and can facilitate discovery of genes ad-
jacent to promoter or enhancer activities sites in plants (Sundaresan et al. 1995; An
et al. 2005).
OryGenes DB
OryGenesDB is a database that integrates information of available insertion mutant

resources in rice (Droc et al. 2009). There are a number of resources for insertion
mutant populations with insertion site index and tagged data available for various
other plant species (Kuromori et al. 2009)
Activation Tagging
Activation tagging (AT) is another popular method for generating gain-of-function

mutant lines. The method uses T-DNA or a transposable element containing the
cauliflower mosaic virus 35S enhancer (Weigel et al. 2000). Transcriptional activa-
tion of genes near the insertion aids in novel phenotype identification and identifies
genes that are redundant and/or essential for survival. AT resources have now been
used to isolate genes from Arabidopsis, rice, petunia and tomato (Kakimoto 1996;
Zubko et al. 2002; Mathews et al. 2003; Mori et al. 2007). Recently, AT systems
using transposons of maize En/Spm or Ac/Ds have been developed in Arabidopsis,
rice and soybean (Weigel et al. 2000; An et al. 2005: Schneider et al. 2005; Qu
et al. 2008; Kuromori et al. 2009). Web-based sites for genotype tagging and mutant
lines, and their purpose and URL are detailed in Table 2.11.
Fox Hunting
The FOX gene hunting system has been developed as an efficient gain-of-function
system that combines a transformation algorithm with large-scale information from
full-length cDNA clones (Ichikawa et al. 2006). The system can be applied across
plant species, like the development of a set of full-length rice cDNA clones aimed
at ‘in planta’ high-throughput screening of rice functional genes; but with Arabi-
dopsis set as the host reference species (Nakamura et al. 2007; Kondou et al. 2009).
Similar results (overexpressors using cDNA) have been achieved in tobacco (Lein
et al. 2008).
Chemical and Physical Mutagenesis
Spontaneous and induced mutations are the major source of most of the existing
genetic variation in plants, and are commonly used in plant breeding. The occur-
rence of spontaneous mutations in nature is relatively rare and difficult to identify
because they can be recessive, or are deleterious and quickly eliminated. Increasing
the rate of mutation (ie induced mutations) can provide additional sources of variant
genotypes important in plant breeding. Mutagenic agents include alkylating agents,
ethyl methanesulfonate (EMS), sodium azide and methylnitrosourea (MNU), or
X-ray and UV-light, fast-neutrons, ion-beam irradiationand nuclear (alpha, beta,
gamma rays) radiation. Alkylating agents that react with DNA to change nucleotide
sequences produce relatively few useful point mutations. However, the absorption
of ionising radiation produces more complex DNA and structural chromosomal
changes, and are considered the mutagenic agents of choice in plant breeding appli-
cations, however most of these mutagenic agents have been used to generate mutant
populations for many years now; these mutant lines have been particularly useful
in forward genetics studies in various plant species (Hoang et al. 2009; Uauy et al.
2009; Jackson et al. 2011).
Mutations can occur in tissue cultured plantlets and the process can be rapid; this
process is sometimes called ‘somaclonal variation’ and these plants have also found
value in plant breeding. In recent years the use of tissue culture in combination with
radiation induced mutations have resulted in a number of desired genotypes in rice,
and a number of these have been used directly or indirectly in breeding programs
(Hoang et al. 2009; Rahman et al. 2012). Some web sites and URL for developing
mutant lines, analysis and use in crop breeding are detailed in Table 2.11.
TILLING
Targeting induced local lesions in genomes (TILLING) was developed as a reverse-

genetics tool that provides an allelic series of induced point mutations in genes of
importance (Till et al. 2004, 2006). Because high-throughput TILLING permits the
rapid and low-cost recovery of induced point mutations in populations of chemical-
ly mutagenised individuals, the methods employed have had a level of acceptance
and have yielded informationon various animal and crop plant species.
EcoTILLING
The TILLING methodology can also be used to explore allelic variations that ap-
pear in natural populations; this technology is called EcoTILLING (Comai et al.
2004; Wang et al. 2006). Several laboratory sites have established TILLING and/
or EcoTILLING centers for researches in the public domain (Barkley and Wang
2008). TILLING mutagenic lines and projects in rice, tomato, soybean and Arabi-
dopsis have been performed at the University of California, Davis Genome Centre.
RevGenUK
RevGenUK at the John Innes Centre provides TILLING service for population
studies and information in Medicago trunculata, Lotus japonica and Brassica rapa.
UTILLdb/ INRA
UTILLdb of INRA is another database for TILLING populations of pea and tomato
that provide an interface to search for TILLed crop lines based on phenotype de-
scriptions.
Gene Silencing Techniques
Although insertion mutagenesis is an effective method for generating loss-of-func-

tion mutants, it has severe limitations in use with redundant genes and lethal muta-
tions. To overcome these limitations, methods to interrupt gene expression have
been developed and applied to the functional analysis of plant genes. Some web
sites and URL for gene silencing are detailed in Table 2.11.
RNAi
RNA interference (RNAi) is a method for RNA-mediated gene silencing by se-

quence-specific degradation of homologous mRNA, triggered by double-stranded
RNA (dsRNA); also known as post-transcriptional gene silencing (PTGS) (Water-
house et al. 1998; Chuang and Meyerowitz 2000).
ihp RNA
Constitutive expression of an intron-containing self-complementary hairpin RNA

(ihpRNA) has been another method for silencing target genes in plants. With de-
mands for conditional silencing of target genes (the most useful silencing in genet-
ics is that which results in prevention of plant regeneration or embryonic lethality),
RNAi systems using chemical-inducible Cre/LoxP recombination or a promoter of
heat shock inducible genes have been developed (Guo et al. 2003; Masclaux et al.
2004).
CATMA
In Arabidopsis, the Complete Arabidopsis Transcriptome MicroArray (CATMA)

project has been initiated to design and produce high-quality gene-specific and gene
silencing sequence tags (GSTs) covering most of the Arabidopsis genome.
AGRIKOLA
Using the GST data set of the CATMA project, the Arabidopsis Genomic RNAi
Knock-out Line Analysis (in AGRIKOLA) project has also been started, with the
goal of systematically analysing Arabidopsis genes by RNAi interference (Hilson
et al. 2003). The Medicago trunculata RNAi database is also available on this web
site as an information resource for RNAi-based gene silencing.
VIGS
Virus-induced gene silencing (VIGS) is a derivative method of the ones above that
takes advantage of the plant RNAi-mediated antiviral defence mechanism, via RNA
interference. The VIGS system was used to assess the function of almost 5000 ran-
dom Nicotiana benthamiana cDNAs in disease resistance (Lu et al. 2003a, b).
CRES-T
The chimeric repressor silencing technology (CRES-T) system was developed as

a novel method for gene silencing, and a plant specific repression domain that act
as a repressor in transgenic plants; and these can inhibit the expression of target
genes (Hiratsu et al. 2003). The CRES-T system has been applied to Arabidopsis in
order to analyse their biological function, and to obtain transgenic plants with agro-
nomically preferable traits. An associated database, FioreDB (Mitsuda and Ohme-
Takagi 2009) also provides gene silencing information through chimeric repression
in flowers.
Plant Comparison Genomics and Databases
The accumulation of nucleotide sequences for many of the agricultural crop species
and domestic animals, will allow us to perform genome-wide comparative analy-
ses with the aim of discovering new and important genes involved in phenotypic
expression (Sato and Tabata 2006; Itoh et al. 2007; Neale and Ingvarsson 2008).
The accumulation of genomic resources derived from various species, such as the
extensive collection of cDNAs, ESTs and data from whole-genome sequencing,
should facilitate sharing of information about gene function between model plants
and other less described crop plants. In time this will also accelerate molecular and
cellular systems related to agronomically important traits. A number of information
resources for plant genomics comparisons and data exchange on the web have ap-
peared, along with appropriate analytical tools. Here we highlight integrative data-
bases promoting complete plant comparative genomics that we have not described
previously. The URLs of each integrative database in plant genomics are shown in
Table 2.12.
Plant Portal Information
TAIR
TAIR is one of the most popular and integrated information resources in plants,
and although mentioned before it plays important roles as a portal in Arabidopsis
research (Swarbreck et al. 2008).
SIGnAL
The Salk Institute Genomic Analysis Laboratory (SIGnAL) is also an information

resource that integrates various data sets of whole plant‘omics’ results, again mainly
related to Arabidopsis.
Table 2.12 Integrative databases for Comparison Genomics Database analysis in plants
(URL)
SIGnAL: Salk Institute Salk insertion sequence data- http://signal.salk.edu/
Genomic Analysis base; Rice, Arabidopsis
Laboratory Home Page included, also Human data
RARGE- RIKEN Ara- Site for downloading a number https://database.riken.jp/sw/en/
bidopsis Genome of important web brows- RIKEN_RARGE_Promoter/
Encyclopedia ers and search engines for ria12i/
Arabidopsis
WebGBrowse Generic genome browser used http://webgbrowse.cgb.indiana.
for display along reference edu/cgi-bin/webgbrowse/
sequences uploadData
GBrowse.org Home Page Portal for entry to software, http://www.gbrowse.org/index.
repository, and browsers html
Generic Model Organ- A free and easy to use database http://sourceforge.net/projects/
ism Database Proj- and browser in a number of gmod/files/Generic%20
ect—Generic Genome different languages Genome%20Browser/
Browser at SourceForge.
net
Sol Genomics Network Solonaceae website for QTL http://nar.oxfordjournals.org/
and molecular breeding; content/early/2010/10/08/
mainly tomato nar.gkq866.full
SoyBase.org SoyBase and soybean breed- http://soybase.org/
ers toolbox; molecular and
physiological data present
MaizeGDB Maize informatics; molecular http://www.maizegdb.org/
and physiological data
present
Plant Genome Duplication Database to catalogue whole http://chibba.agtec.uga.edu/
Database plant genomes; focus on 30 duplication/
agronomic flowering plants
GRASSIUS: Plant Genome Systems approach to identify http://grassius.org/plantgenome.
Project regulatory netwirks in html
grasses
GRASSIUS: About Home Page for extensive web http://grassius.org/about.html
resource for gene expres-
sion, and regulation in
grasses
GRASSIUS: GrassTFDB: Transcriptional factors database http://grassius.org/grasstfdb.
Transcription Factor for grasses; maize, sugar- html
Database cane, sorghum and rice
LegumeTFDB Digital library and database http://dl.acm.org/citation.
for legume transcriptional cfm?id=1707758
factors
SoybeanTFDB Digital library and database http://soybeantfdb.psc.riken.jp/
for legume transcriptional
factors
RARGE
The RIKEN Arabidopsis Genome Encyclopaedia (RARGE) is a portal site provid-

ing a gateway for access to comprehensive ‘omics’ data and/or bioresources (Saku-
rai et al. 2005). The site also house cross-referenced data between each described
gene and its description, such as full-length cDNA clones, gene mutants, gene ex-
pression patterns, homologous genes and phenotypic expression.
Gbrowse
Web browsers are commonly used to visualize genes along with genome sequences
and associated information, genome browsers such as Gbrowse have been very of-
ten used (Donlin 2007).
Gramene
Gramene is a popular site for integrated rice information and plant comparative
genomics in grasses. Gramene offers integrated genome associated data including
sequences and molecular markers, but is also an important QTL database for breed-
ing in Gramineae species (Ware 2007; Liang et al. 2008).
Sol Genomics
The integration of a number of resources have recently been completed for various
individual plant species. The Sol genomics network is a portal site for Solanaceae
species that includes information on the tomato and potato genome sequencing
projects (Mueller et al. 2005; Mullins et al. 2006).
Soybase
SoyBase is a resource portal and repository site for genomic soybean research and it
includes released whole-genome sequence data for this important crop plant.
Maize GDB
The MaizeGDB is the community database for biological information about Zea
mays, and includes genetic and genomic data sets and other related information on
maize (Lawrence et al. 2004).
Genome-wide Comparison in Plants
The completion of a number of genome sequencing projects in plants has increased

information on genome-scale comparative analyses and data that facilitate identi-
fication of conserved and/or characteristic properties between plant species. Using
model and inferred proteome data deduced from sequenced genomes of plants has
enabled several efforts to completed and construct comprehensive gene families
in other species for comparison. The aim of establishing platforms to verify and
compare gene content and elucidating the process of gene duplication and func-
tional diversification among species is on the way (Sterck et al. 2007). Web-based
sites for genome-wide comparison in plants, their purpose and URL are detailed in
Table 2.11.
Markov Clustering and Multi Dimensional Scaling
Comprehensive gene family data sets are usually produced by computational pro-
cedures including a step that conducts an all-against-all sequence similarity search
matrices, and then a step for building clusters of protein families by methods such
as Markov Clustering (MCL), multi dimensional scaling (MDS) (see Sects. 2.5, 3.4
and 5.1; programs and statistical URL sites are listed in Table 2.1).
PGDD
Correlated gene arrangements among taxa, along with chromosomal location, also
known as synteny and collinearity, have become valuable sites for inference of
shared ancestry amongst genes, and for transfer of knowledge from one species to
another related species (Tang et al. 2008a). The plant genome duplication database
(PGDD) provides a data set of intra-genome or cross-genome syntenic relation-
ships identified throughout genome-sequenced plant species at present (Tang et al.
2008b).
Databases for Plant Genomics
Databases housing sets of genomic information and annotations of cross-reference

species are now essential for a better understanding of the biology of plants, in
particular gene families and/or particular cellular processes. In plants, the genome-
wide identification of genes encoding transfer factors (TFs) in Arabidopsis have
been reported, and comparisons with other organisms revealed important informa-
tion (Riechmann et al. 2000; Guo et al. 2008). Further integration of such data must
be performed, establishing an integrative, knowledge-based resource across related
plant species in terms of comparative genomics of regulation processes. A number
of general and specific web-based crop plant databases, their purpose and URL are
detailed in Table 2.11.
GRASSIUS
GRASSIUS provides the first step toward building a comprehensive platform for
integration of data, tools and resources in comparative regulatory genomics across
the grass species (Yilmaz et al. 2009).
Grass TFDB
The Grass Transcription Factor Database (GrassTFDB) of GRASSIUS houses in-

tegrated information on a number of important crop species, and the species listed
below in Sect. 7.3.3 are all available.
Crop Plant Specific Databases
GRASSIUS contains MaizeTFDB, RiceTFDB, SorghumTFDB, SugarcaneTFDB

and Brachypodium TFDB.
Legume TFDB
The LegumeTFDB provides predicted TF encoding genes in the genome sequences

of three major legume species: soybean, L. japonicus and M. trunculata; and is an
extended version of the Soybean TFDB site below.
Soybean TFDB
SoybeanTFD is aimed at a more integrated knowledge base for legume TFs, provid-
ing a public resource for comparative genomics of the TFs of legumes, non-legume
plants and even other organisms (Mochida et al. 2009c, 2010).
Conclusions and Future Perspective
High-throughput DNA technological advances have provided new opportunities to

develop collections of related genomic and proteomic information for crop plants,
never before available to plant and agricultural scientists. Such comprehensive ap-
proaches can provide an excellent starting point for integrating knowledge and al-
lowing the comparison among, and within crop species. This approach promises to
be an efficient way to discover new information on genes and their function that are
important in crop improvement. However there is much research still to be done!
Pyrosequencing procedures, massive parallel DNA sequencing and single mol-

ecule sequencing are now becoming normal and readily available to scientists. Ad-
ditionally, these new technologies have provided researchers with new avenues to
addressed web information at the entire genome level in the fields of inter-species
and intra-species comparative genomics and evolutionary genetics. In evolution-
ary and population genetics, knowledge of genetic diversity, natural and induced
variations and population structure are not only important in ecology, but are also
important to the breeding and biodiversity of crop plants in agriculture.
New and efficient procedures for whole-genome de novo sequencing in crop
plants is perhaps one of the most anticipated innovations for next-generation se-
quencing and related applications. Although, to date, this approach has been real-
ized only in bacteria, a number of tentative attempts are being made to realise this
advancement in higher plants, and this must be developed further in crop species.
Breeding crop plants for QTL and traits with low heritability can be the most
interesting and the most difficult to work with in breeding programs, but marker as-
sisted selection (MAS) is improving all the time and stable, specific more informa-
tive molecular markers must be developed for crop plants. In crop plants especially
these traits with low heritability can be important in improving yield, quality and
production, and despite being difficult to master must be addressed.
Expressed Sequence Tags (ESTs) derived from different and specific tissues,
including tissues from organisms in a range of developmental stages or under biotic
and abiotic stress could significantly facilitate gene discovery, and this information
is vital in the design of molecular markers and probes for microarrays and gene-chip
studies. Full-length cDNA libraries have contributed to function alanalysis by creat-
ing overexpressors used in reverse genetics, and this approach is only beginning to
be applied in crop plants. However for results to be easily interpreted, reverse genet-
ics must be used in conjunction with comparative analyses of ‘modificon’ events
among plants.
RNA interference, includingsRNAs, microRNAs (miRNAs), short interfering
RNAs (siRNAs) and trans-acting siRNAs (ta-siRNAs) are playing important roles
as crucial components of epigenetic processes, and gene networks involved in plant
development and homeostasis. More information on identification and expression
of interfering RNA molecules is necessary, especially by using next-generational
genomic technologies in crop plants.
Measurement in abundance of transcripts expressed in cells, tissues and organs
can now be estimated from sequence clusters. These methodological principle have
been applied in human and mouse, in the form of a type of ‘tissue or organ map’ to
derive the transcriptome in organs; and such ‘plant tissue and organ’ mapping could
be instrumental as reference material for increased crop production.
Differential display methods are now cost effective and produce large amounts
of data. Serial analysis of gene expression (SAGE) and derivatives of this method
can genetically define host cells and their pathogens simultaneously in crop plants,
and additionally superSAGE tags have been used to design probes directly for oligo
microarrays in plants and pathogen alike. Microarray and DNA chip-related tech-
nologies have advanced rapidly and their application has expanded to a wide variety
of crop science disciplines. Today commercially available DNA microarrays are
becoming easier and cheaper to obtain, which promises increased availability of

‘transciptome’ information in all plants
Functional proteomics, including quantitative proteomics, subcellular pro-
teomics and various modifications of proteins and polypeptides, and protein-protein
and protein-DNA interactions are new and essential technologies to develop in crop
plants. The MALDI or ESI MS methods are still popular and important, but more
recent MS procedures must be considered and used in crop plants to obtain high res-
olution, high sensitivity, high dynamic range and high mass measurement accuracy.
Difference gel electrophoresis (DIGE), isotope-coded affinity tags (ICATs) and
isobaric tags for relative and absolute quantitation (iTRAQ) of proteins will enable
a better insight into basic regulation of proteins and polypeptides. Stable isotope
labelling with amino acids in cell culture (SILAC) combined with MS-MS Analysis
(using differential isotope analysis) are further improvements in protein determina-
tion important to crop plant proteomics.
Cell organelle analysis of their proteome and metabolite contents are essential
for understanding the various enzymatic activities within cell organelles, the com-
partmentalisation of metabolic pathways, protein targeting, trafficking and regula-
tion, and polypeptide dynamics for many of the crop plants still to be investigated.
Modificon research can be aimed to identify modified proteins, through protein
phosphorylation and ubiquitination, and although these important studies are just
beginning they are becoming more and more important to our understanding of
plant metabolism.
Systematic collection of metabolite profiles and advances in instrumentation like
NMR analysis will create new information in metabolomics. Chemical phenotype
identification are important to develop in crop plants, which can be used to identify
genes involved in particular metabolic pathways and cellular processes. This type of
information is important to integrate with other ‘omics’ research, such as profiles of
the transcriptome and proteome, now mainly available in Arabidopsis.
It is essential in crop breeding to associate and determine molecular, metabolic,
genomic and proteomic diversity of species, cultivars and breeding lines in those
plants. This will increase our knowledge and identify many of the genes involved in
phenotypic changes, and would also aid in the identification of genetic associations,
providing a strong basis for better utilisation of marker assisted selection (MAS),
and the use of more stable and informative molecular markers in plant breeding.
T-DNA-tagged lines have emerged as a popular mutant resource, due to the
rapid generation of large-scale mutant populations, but are not readily available in
many crop plants. Activation tagging (AT) is a popular method for generating gain-
of-function mutants important in breeding, and a better knowledge across related
breeding stocks and species in terms of comparative genomics. Computer assembly
into gene families can verify gene content and elucidates gene duplication (poly-
ploidy).
Chemical mutagenic agents and physical mutagens should be utilised more often
to obtain a comprehensive set of crop mutant lines, and then employ these to target
induced local lesions in genomes (ie TILLING) as a tool for general reverse-genet-
ics, and RNA interference (RNAi) to screen for gene silencing and gene inactiva-
tion. Gene silencing and virus-induced gene silencing (VIGS) can be used in crop
plants to discover key genes involved in phenotypic differences.
References
Adams MD, Soares MB, Kerlavage AR, Fields C, Venter JC (1993) Rapid cDNA sequencing
(expressed sequence tags) from a directionally cloned human infant brain cDNA library. Nat
Genet 4:373–380
Ahmad P, Ashraf M, Younis M, Hu X, Kumar A, Akram NA, Al-Qurainy F (2011) Role of trans-
genic plants in agriculture and biopharming. Biotech Advances 30:525–540
Agrawal GK, Yonekura M, Iwahashi Y, Iwahashi H, Rakwal R (2005) System, trends and perspec-
tives of proteomics in dicot plants. Part I: technologies in proteome establishment. J Chro-
matogr B 815:109–123
Akhunov E, Nicolet C, Dvorak J (2009) Single nucleotide polymorphism genotyping in polyploid
wheat with the Illumina GoldenGate assay. Theor App Genet 119:507–517
Akiyama K, Chikayama E, Yuasa H, Shimada Y, Tohge T, Shinozaki K et al (2008) PRIMe: a Web
site that assembles tools for metabolomics and transcriptomics. In Silico Biol 8:339–345
Alonso JM, Ecker JR (2006) Moving forward in reverse: genetic technologies to enable genome-
wide phenomic screens in Arabidopsis. Nat Rev Genet 7:524–536
An G, Jeong DH, Jung KH, Lee S (2005) Reverse genetic approaches for functional genomics of
rice. Plant Mol Biol 59:111–123
Andersen JS, Mann M (2006) Organellar proteomics: turning inventories into insights. EMBO
Rep 7:874–879
Andreeva A, Howorth D, Chandonia JM, Brenner SE, Hubbard TJ, Chothia C et al (2008) Data
growth and its impact on the SCOP database: new developments. Nucleic Acids Res 36:D419–
D425
Anisimov SV (2008) Serial analysis of gene expression (SAGE): 13 years of application in re-
search. Curr Pharm Biotechnol 9:338–350
Ansorge WJ (2009) Next-generation DNA sequencing techniques. Nat Biotechnol 25:195–203
Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A et al (2005) Cytokinin
oxidase regulates rice grain production. Science 309:741–745
Baginsky S (2009) Plant proteomics: concepts, applications, and novel strategies for data interpre-
tation. Mass Spectrom Rev 28:93–120
Barakat A, Wall PK, Diloreto S, Depamphilis CW, Carlson JE (2007) Conservation and divergence
of microRNAs in Populus. BMC Genomics 8:481
Barjaktarovic Z, Nordheim A, Lamkemeyer T, Fladerer C, Madlung J, Hampp R (2007) Time
course of changes in amounts of specific proteins upon exposure to hyper-g, 2-D clinorotation,
and 3-D random positioning of Arabidopsis cultures. J Exper Botany 58:4357–4363
Barjaktarovic Z, Schultz W, Madlung J, Fladerer C, Nordheim A, Hampp R (2009) Changes in
the effective gravitational field strength affect the state of phosphorylation of stress related
proteins in callus of Arabidopsis thaliana. J Exper Botany 60:779–789
Barkley NA, Wang ML (2008) Application of TILLING and EcoTILLING as reverse genetic ap-
proaches to elucidate the function of genes in plants and animals. Curr Genomics 9:212–226
Barnholtz-Sloan JS, Tiwari HK (2009) Population Genetics. In: Krawetz S (ed) Bioinformatics for
Systems Biology. Humana Press (Springer Science Business Media)
Barrett T, Troup DB, Wilhite SE, Ledoux P, Rudnev D, Evangelista C et al (2009) NCBI GEO:
archive for high-throughput functional genomic data. Nucleic Acids Res 37:D885–D890
Benschop JJ, Mohammed S, O’Flaherty M, Heck AJ, Slijper M, Menke FL (2007) Quantitative
phosphoproteomics of early elicitor signaling in Arabidopsis. Mol Cell Proteomics 6:1198–
1214
Berkelman T, Stenstedt T (2002) 2-D Electrophoresis: Principles and methods. Amersham Biosci-
ence AB, Uppsala
Bernardo AN, Bradbury PJ, Ma H, Hu S, Bowden RL, Buckler ES et al (2009) Discovery and
mapping of single feature polymorphisms in wheat using Affymetrix arrays. BMC Genomics
10:251
Bertocchi F, Paci M (2008) Applications of high-resolution solidstate NMR spectroscopy in food
science. J Agric Food Chem 5:9317–9327
Bino RJ, Hall RD, Fiehn O, Kopka J, Saito K, Draper J et al (2004) Potential of metabolomics as
a functional genomics tool. Trends Plant Sci 9:418–425
Birnbaum K, Shasha DE, Wang JY, Jung JW, Lambert GM, Galbraith DW et al (2003) A gene
expression map of the Arabidopsis root. Science 302:1956–1960
Blair MW, Torres MM, Giraldo MC, Pedraza F (2009) Development and diversity of Andean-
derived, gene-based microsatellites for common bean ( Phaseolus vulgaris L). BMC Plant Biol
9:100
Bogdanov B, Smith RD (2005) Proteomics by FTICR mass spectrometry: top down and bottom
up. Mass Spectrom Rev 24:168–200
Boguski MS, Lowe TM, Tolstoshev CM (1993) dbEST—database for ‘expressed sequence tags’.
Nat Genet 4:332–333
Brady SM, Provart NJ (2009) Web-queryable large-scale data sets for hypothesis generation in
plant biology. Plant Cell 21:1034–1051
Brenner S, Johnson M, Bridgham J, Golda G, Lloyd DH, Johnson D et al (2000) Gene expres-
sion analysis by massively parallel signature sequencing (MPSS) on microbead arrays. Nat
Brown M, Funk CC (2008) Climate. Food security under climate change. Science 319:580–581
Caicedo AL, Williamson SH, Hernandez RD, Boyko A, Fledel-Alon A, York TL et al (2007) Ge-
nome-wide patterns of nucleotide polymorphism in domesticated rice. PLoS Genet 3:1745–
1756
Carollo V, Matthews DE, Lazo GR, Blake TK, Hummel DD, Lui N et al (2005) GrainGenes 2.0. an
improved resource for the smallgrains community. Plant Physiol 139:643–651
Castellani F, van Rossum B, Diehl A, Schubert M, Rehbein K, Oschkinat H (2002) Structure of
a protein determined by solid-state magic-angle-spinning NMR spectroscopy. Nature 420:98–
102
Chellappan P, Jin H (2009) Discovery of plant microRNAs and short-interfering RNAs by deep
parallel sequencing. Methods Mol Biol 495:121–132
Chen S, Harmon AC (2006) Advances in plant proteomics. Proteomics 6:5504–5516
Cheng Y, Qi Y, Zhu Q, Chen X, Wang N, Zhao X et al (2009) New changes in the plasma-mem-
brane-associated proteome of rice roots under salt stress. Proteomics 9:3100–3114
Chitteti BR, Peng Z (2007) Proteome and phosphoproteome differential expression under salinity
stress in rice ( Oryza sativa) root. J Proteome Res 2007:1718–1727
Chuang CF, Meyerowitz EM (2000) Specific and heritable genetic interference by double-strand-
ed RNA in Arabidopsis thaliana. Proc Natl Acad Sci USA 97:4985–4990
Clark KR, Gorley RN (2001) Primer version 5.2.7 user manual/tutorial. Plymouth Marine Labora-
tory. PRIMER-E Ltd, Plymouth, UK
Cline MS, Kent WJ (2009) Understanding genome browsing. Nature Biotechnol 27:153–155
Close TJ, Wanamaker S, Roose ML, Lyon M (2007) HarvEST: an EST database and viewing
software. Methods Mol Biol 406:161–178
Close TJ, Bhat PR, Lonardi S, Wu Y, Rostoks N, Ramsay L et al (2009) Development and imple-
mentation of high-throughput SNP genotyping in barley. BMC Genomics 10:582
Cogburn LA, Porter TE, Duclos MJ, Simon J, Burgess SC, Zhu JJ et al (2007) Functional genom-
ics of the chicken-a model organism. Poult Sci 86:2059–2094
Comai L, Young K, Till BJ, Reynolds SH, Greene EA, Codomo CA et al (2004) Efficient discov-
ery of DNA polymorphisms in natural populations by Ecotilling. Plant J 37:778–786
Conte MG, Gaillard S, Lanau N, Rouard M, Perin C (2008) GreenPhylDB: a database for plant
comparative genomics. Nucleic Acids Res 36:D991–D998
Crossa J, Burgueno J, Dreisigacker S, Vargas M, Herrera-Foessel SA, Lillemo M et al (2007) As-
sociation analysis of historical bread wheat germplasm using additive genetic covariance of
relatives and population structure. Genetics 177:1889–1913
De Bodt S, Maere S, Van de Peer Y (2005) Genome duplication and the origin of angiosperms.
Trends Ecol Evol 20:591–597
De Filippis LF (2010) Biochemical and molecular aspects in phytoremediation of selenium. In:
Ashraf M, Ozturk M, Ahmad MSA (eds) Plant Adaptation and Phytoremediation. Springer
Science – Business Media
De Filippis LF (2012) Breeding for biotic stress tolerance in plants. In: Asharaf M, Ozturk M,
Ahmad MSA, Aksoy A (eds) Crop Production for Agricultural Improvement. Springer Science
– Business Media
De Filippis LF, Magel E (2012) Identification of biochemical differences between the sapwoos and
transition zone in Robinia pseudoacacia L. by differential display of proteins. Z Holzforschung
66:543–549
de Hoon M, Hayashizaki Y (2008) Deep cap analysis gene expression (CAGE): genome-wide
identification of promoters, quantification of their expression, and network inference. Biotech-
niques 44:627–628
de la Fuente van Bentem S, Anrather D, Roitinger E, Djamei A, Hufnagl T, Barta A et al (2006)
Phosphoproteomics reveals extensive in vivo phosphorylation of Arabidopsis proteins in-
volved in RNA metabolism. Nucleic Acids Res 34:3267–3278
Deleu W, Esteras C, Roig C, Gonzalez-To M, Fernandez-Silva I, Gonzalez-Ibeas DD et al (2009) A
set of EST-SNPs for map saturation and cultivar identification in melon. BMC Plant Biol 9:90
Dixon RA, Gang DR, Charlton AJ, Fiehn O, Kuiper HA, Reynolds TL et al (2006) Applications of
metabolomics in agriculture. J Agric Food Chem 54:8984–8994
Donlin MJ (2007) Using the Generic Genome Browser (GBrowse). Curr Protoc Bioinformatics
Chapter 9:Unit 9
Dunkley TP, Hester S, Shadforth IP, Runions J, Weimar T, Hanton SL et al (2006) Mapping the
Arabidopsis organelle proteome. Proc Natl Acad Sci USA 103:6518–6523
Duvick J, Fu A, Muppirala U, Sabharwal M, Wilkerson MD, Lawrence CJ et al (2008) PlantGDB:
a resource for comparative plant genomics. Nucleic Acids Res 36:D959–D965
Endo Y, Sawasaki T (2003) High-throughput, genome-scale protein production method based on
the wheat germ cell-free expression system. Biotechnol Adv 21:695–713
Endo Y, Sawasaki T (2006) Cell-free expression systems for eukaryotic protein production. Curr
Opin Biotechnol 17:373–380
Ewing B, Hillier L, Wendl MC, Green P (1998) Base-calling of automated sequencer traces using
phred. I. Accuracy assessment. Genome Res 8:175–185
Farrer RA, Kemen E, Jones JD, Studholme DJ (2009) De novo assembly of the Pseudomonas
syringae pv. syringae B728a genome using Illumina/Solexa short sequence reads. FEMS Mi-
crobiol Lett 291:103–111
Fei Z, Tang X, Alba RM, White JA, Ronning CM, Martin GB et al (2004) Comprehensive EST
analysis of tomato and comparative genomics of fruit ripening. Plant J 40:47–59
Feltus FA, Wan J, Schulze SR, Estill JC, Jiang N, Paterson AH (2004) An SNP resource for rice
genetics and breeding based on subspecies indica and japonica genome alignments. Genome
Res 14:1812–1819
Fernie AR, Schauer N (2009) Metabolomics-assisted breeding: a viable option for crop improve-
ment? Trends Genet 25:39–48
Fernie AR, Trethewey RN, Krotzky AJ, Willmitzer L (2004) Metabolite profiling: from diagnos-
tics to systems biology. Nat Rev Mol Cell Biol 5:763–769
Fiehn O, Kopka J, Dormann P, Altmann T, Trethewey RN, Willmitzer L (2000) Metabolite profil-
ing for plant functional genomics. Nat Biotechnol 18:1157–1161
Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz HR et al (2008) The Pfam protein families
database. Nucleic Acids Res 36:D281–D288
Flicek P, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y et al (2008) Ensembl 2008. Nucleic
Acids Res 36:D707–D714
Fox BG, Goulding C, Malkowski MG, Stewart L, Deacon A (2008) Structural genomics: from
genes to structures with valuable materials and many questions in between. Nat Methods
5:129–132
Frölich T, Arnold GJ (2006) Proteome research based on modern liquid chromatography-tan-
dem mass spectrometry: Separation, identification and quantification. J Neural Transmission
133:973–994
Fu J, Keurentjes JJ, Bouwmeester H, America T, Verstappen FW, Ward JL et al (2009) System-
wide molecular evidence for phenotypic buffering in Arabidopsis. Nat Genet 41:166–167
Fujita M, Mizukado S, Fujita Y, Ichikawa T, Nakazawa M, Seki M et al (2007) Identification
of stress-tolerance-related transcriptionfactor genes via mini-scale Full-length cDNA Over-
eXpressor (FOX) gene hunting system. Biochem Biophys Res Commun 364:250–257
Fukuchi S, Homma K, Sakamoto S, Sugawara H, Tateno Y, Gojobori T et al (2009) The GTOP da-
tabase in 2009: updated content and novel features to expand and deepen insights into protein
structures and functions. Nucleic Acids Res 37:D333–D337
Futamura N, Totoki Y, Toyoda A, Igasaki T, Nanjo T, Seki M et al (2008) Characterization of ex-
pressed sequence tags from a full-length enriched cDNA library of Cryptomeria japonica male
strobili. BMC Genomics 9:383
Gao J, Agrawal GK, Thelen JJ, Xu D (2009) P3DB: a plant protein phosphorylation database.
Nucleic Acids Res 37:D960–D962
Goda H, Sasaki E, Akiyama K, Maruyama-Nakashita A, Nakabayashi K, Li W et al (2008) The
AtGenExpress hormone and chemical treatment data set: experimental design, data evaluation,
model data analysis and data access. Plant J 55:526–542
Greene LH, Lewis TE, Addou S, Cuff A, Dallman T, Dibley M et al (2007) The CATH domain
structure database: new protocols and classification levels give a more comprehensive resource
for exploring evolution. Nucleic Acids Res 35:D291–D297
Gstaiger M, Aebersold R (2009) Applying mass spectrometrybased proteomics to genetics, ge-
nomics and network biology. Nat Rev Genet 10:617–627
Guo HS, Fei JF, Xie Q, Chua NH (2003) A chemical-regulated inducible RNAi system in plants.
Plant J 34:383–392
Guo A, He K, Liu D, Bai S, Gu X, Wei L et al (2005) DATF: a database of Arabidopsis transcrip-
tion factors. Bioinformatics 21:2568–2569
Guo AY, Chen X, Gao G, Zhang H, Zhu QH, Liu XC et al (2008) PlantTFDB: a comprehensive
plant transcription factor database. Nucleic Acids Res 36:D966–D969
Hakeem KR, Ahmad A, Iqbal M, Gucel S, Ozturk M (2011) Nitrogen efficient rice genotype can
reduce nitrate pollution. Environ Sci Pollut Res 18:1184–1193
Hakeem K, Ozturk M, Memon AR (2012) Biotechnology as an aid for crop improvement to
overcome food shortage. In: Ashraf et al (eds) Crop production for agricultural improvement.
Springer
Haas BJ, Delcher AL, Wortman JR, Salzberg SL (2004) DAGchainer: a tool for mining segmental
genome duplications and synteny. Bioinformatics 20:3643–3646
Han B, Xue Y (2003) Genome-wide intraspecific DNA-sequence variations in rice. Curr Opin
Plant Biol 6:134–138
Harbers M, Carninci P (2005) Tag-based approaches for transcriptome research and genome an-
notation. Nat Methods 2:495–502
Hashimoto S, Suzuki Y, Kasai Y, Morohoshi K, Yamada T, Sese J et al (2004) 5′-end SAGE for the
analysis of transcriptional start sites. Nat Biotechnol 22:1146–1149
Hayashizaki Y (2003) RIKEN mouse genome encyclopedia. Mech Ageing Dev 124:93–102
Heesacker A, Kishore VK, Gao W, Tang S, Kolkman JM, Gingle A et al (2008) SSRs and INDELs
mined from the sunflower EST database: abundance, polymorphisms, and cross-taxa utility.
Theor Appl Gene 117:1021–1029
Herbert BR, Grinyer J, McCarthy JT, Isaacs M, Harry E et al (2006) Improved 2-DE of microor-
ganisms after acid digestion. Electrophoresis 27:1630–1640
Hilson P, Small I, Kuiper MT (2003) European consortia building integrated resources for Arabi-
dopsis functional genomics. Curr Opin Plant Biol 6:426–429
Hirai MY, Yano M, Goodenowe DB, Kanaya S, Kimura T, Awazuhara M et al (2004) Integration of
transcriptomics and metabolomics for understanding of global responses to nutritional stresses
in Arabidopsis thaliana. Proc Natl Acad Sci USA 101:10205–10210
Hirano H, Islam N, Kawasaki H (2004) Technical aspects of functional proteomics in plants. Phy-
tochemistry 65:1487–1498
Hiratsu K, Matsui K, Koyama T, Ohme-Takagi M (2003) Dominant repression of target genes by
chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis. Plant J
34:733–739
Hishiki T, Kawamoto S, Morishita S, Okubo K (2000) BodyMap: a human and mouse gene ex-
pression database. Nucleic Acids Res 28:136–138
Holy J, Perkins E (2009) Structure and function of the nucleus and cell organelles. In: Krawetz S
(ed) Bioinformatics for Systems Biology. Humana Press (Springer Science – Business Media)
Hoang TML, De Filippis LF, Le XT (2009) Salt tolerance and screening for genetic changes in
rice mutants after gamma irradiation using RAPD and microsatellite (RAMP) markers. Open
J Plant Sci 2:12–18
Huang X, Madan A (1999) CAP3: A DNA sequence assembly program. Genome Res 9:868–877
Huang X, Feng Q, Qian Q, Zhao Q, Wang L, Wang A et al (2009) High-throughput genotyping by
whole-genome resequencing. Genome Res 19:1068–1076
Hyten DL, Song Q, Choi IY, Yoon MS, Specht JE, Matukumalli LK et al (2008) High-throughput
genotyping with the GoldenGate assay in the complex genome of soybean. Theor Appl Genet
116:945–952
Ichikawa T, Nakazawa M, Kawashima M, Iizumi H, Kuroda H, Kondou Y et al (2006) The FOX
hunting system: an alternative gain-of-function gene hunting technique. Plant J 48:974–985
Igawa T, Fujiwara M, Takahashi H, Sawasaki T, Endo Y, Seki M et al (2009) Isolation and iden-
tification of ubiquitin-related proteins from Arabidopsis seedlings. J Exp Bot 60:3067–3073
Iida K, Seki M, Sakurai T, Satou M, Akiyama K, Toyoda T et al (2004) Genome-wide analysis of
alternative pre-mRNA splicing in Arabidopsis thaliana based on full-length cDNA sequences.
Nucleic Acids Res 32:5096–5103
Iijima Y, Nakamura Y, Ogata Y, Tanaka K, Sakurai N, Suda K et al (2008) Metabolite annotations
based on the integration of mass spectral information. Plant J 54:949–962
Imanishi T, Itoh T, Suzuki Y, O’Donovan C, Fukuchi S, Koyanagi KO et al (2004) Integrative
annotation of 21,037 human genes validated by full-length cDNA clones. PLoS Biol 2:e162
International Rice Genome Sequencing Project (2005) The map-based sequence of the rice ge-
nome. Nature 436:793–800
International Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flow-
ering plant Arabidopsis thaliana. Nature 408:796–815
Itoh T, Tanaka T, Barrero RA, Yamasaki C, Fujii Y, Hilton PB et al (2007) Curated genome an-
notation of Oryza sativa ssp. Japonica and comparative genome analysis with Arabidopsis
thaliana. Genome Res 17:175–183
Jaccoud D, Peng K, Feinstein D, Kilian A (2001) Diversity arrays: a solid state technology for
sequence information independent genotyping. Nucleic Acids Res 29:E25
Jackson SA, Iwata A, Lee S-H, Schmutz J, Shoemaker R (2011) Sequencing crop genomes: ap-
proaches and applications. New Pytol 191:915–926
Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A et al (2007) The grapevine genome
sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 449:463–467
Jiao Y, Tausta SL, Gandotra N, Sun N, Liu T, Caly NK et al (2009) A transcriptome atlas of rice
cell types uncovers cellular, functional and developmental hierarchies. Nat Genet 41:258–263
Jonsson P, Gullberg J, Nordstrom A, Kusano M, Kowalczyk M, Sjostrom M et al (2004) A strategy
for identifying differences in large series of metabolomic samples analyzed by GC/MS. Anal
Chem 76:1738–1745
Jorrin-Novo JV, Maldonado AM, Echevarria-Zomeno S, Valledor L, Castillejo MA, Curto M et al
(2009) Plant proteomics update (2007–2008): second-generation proteomic techniques, an ap-
propriate experimental design, and data analysis to fulfill MIAPE standards, increase plant
proteome coverage and expand biological knowledge. J Proteomics 72:285–314
Kakimoto T (1996) CKI1, a histidine kinase homolog implicated in cytokinin signal transduction.
Science 274:982–985
Kanehisa M, Goto S (2000) KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids
Res 28:27–30
Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M et al (2008) KEGG for linking
genomes to life and the environment. Nucleic Acids Res 36:D480–D484
Katz A, Waridel P, Shevchenko A, Pick U (2007) Salt-induced changes in the plasma membrane
proteome of the halotolerant alga Dunaliella salina as revealed by blue native gel electropho-
resis and nano-LC-MS/MS analysis. Mol Cell Proteomics 6:1459–1472
Kaur S, Cogan NO, Ye G, Baillie RC, Hand ML, Ling AE et al (2009) Genetic map construction
and QTL mapping of resistance to blackleg ( Leptosphaeria maculans) disease in Australian
canola ( Brassica napus L.) cultivars. Theor Appl Genet 120:71–83
Kawamoto S, Yoshii J, Mizuno K, Ito K, Miyamoto Y, Ohnishi T et al (2000) BodyMap: a collec-
tion of 3′ESTs for analysis of human gene expression information. Genome Res 10:1817–1827
Kawaura K, Mochida K, Yamazaki Y, Ogihara Y (2006) Transcriptome analysis of salinity stress
responses in common wheat using a 22k oligo-DNA microarray. Funct Integr Genomics
6:132–142
Kawaura K, Mochida K, Enju A, Totoki Y, Toyoda A, Sakaki Y et al (2009) Assessment of adaptive
evolution between wheat and rice as deduced from full-length common wheat cDNA sequence
data and expression patterns. BMC Genomics 10:271
Kigawa T, Yabuki T, Yoshida Y, Tsutsui M, Ito Y, Shibata T et al (1999) Cell-free production and
stable-isotope labeling of milligram quantities of proteins. FEBS Lett 442:15–19
Kikuchi J, Shinozaki K, Hirayama T (2004) Stable isotope labelling of Arabidopsis thaliana for an
NMR-based metabolomics approach. Plant Cell Physiol 45:1099–1104
Kilian J, Whitehead D, Horak J, Wanke D, Weinl S, Batistic O et al (2007) The AtGenExpress
global stress expression dataset: protocols, evaluation and model data analysis of UV-B light,
drought and cold stress responses. Plant J 50:347–363
Komatsu S (2005) Rice proteome database: a step toward functional analysis of the rice genome.
Kondou Y, Higuchi M, Takahashi S, Sakurai T, Ichikawa T, Kuroda H et al (2009) Systematic
approaches to using the FOX hunting system to identify useful rice genes. Plant J 57:883–894
Konishi S, Izawa T, Lin SY, Ebana K, Fukuta Y, Sasaki T, Yano M (2006) An SNP caused loss of
seed shattering during rice domestication. Science 312:1392–1396
Kopka J, Schauer N, Krueger S, Birkemeyer C, Usadel B, Burgmüller E et al (2005) GMD@CSB.
DB: the Golm Metabolome Database. Bioinformatics 21:1635–1638
Kota R, Varshney RK, Prasad M, Zhang H, Stein N, Graner A (2008) EST-derived single nucleo-
tide polymorphism markers for assembling genetic and physical maps of the barley genome.
FunctIntegr Genomics 8:223–233
Kouranov A, Xie L, de la Cruz J, Chen L, Westbrook J, Bourne PE et al (2006) The RCSB PDB
information portal for structural genomics. Nucleic Acids Res 34:D302–D305
Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant
Cell 11:2283–2290
Kumar CS, Wing RA, Sundaresan V (2005) Efficient insertional mutagenesis in rice using the
maize En/Spm elements. Plant J 44:879–892
Kurakawa T, Ueda N, Maekawa M, Kobayashi K, Kojima M, Nagato Y et al (2007) Direct control
of shoot meristem activity by a cytokinin-activating enzyme. Nature 445:652–655
Kuromori T, Takahashi S, Kondou Y, Shinozaki K, Matsui M (2009) Phenome analysis in plant
species using loss-of-function and gain-of-function mutants. Plant Cell Physiol 50:1215–1231
Kwon SJ, Choi EY, Choi YJ, Ahn JH, Park OK (2006) Proteomics studies of post-translational
modifications in plants. J Exp Bot 57:1547–1551
Laubinger S, Zeller G, Henz SR, Sachsenberg T, Widmer CK, Naouar N et al (2008) At-TAX: a
whole genome tiling array resource for developmental expression analysis and transcript iden-
tification in Arabidopsis thaliana. Genome Biol 9:R112
Laurentin H, Ratzinger A, Karlovsky P (2008) Relationship between metabolic and genomic di-
versity in sesame ( Sesamum indicum L.). BMC Genomics 9:250
Lawrence CJ, Dong Q, Polacco ML, Seigfried TE, Brendel V (2004) MaizeGDB, the community
database for maize genetics and genomics. Nucleic Acids Res 32:D393–D397
Lee Y, Tsai J, Sunkara S, Karamycheva S, Pertea G, Sultana R et al (2005) The TIGR Gene Indices:
clustering and assembling EST and known genes and integration with eukaryotic genomes.
Lein W, Usadel B, Stitt M, Reindl A, Ehrhardt T, Sonnewald U et al (2008) Large-scale phenotyp-
ing of transgenic tobacco plants ( Nicotiana tabacum) to identify essential leaf functions. Plant
Biotechnol J 6:246–263
Li F, Kitashiba H, Inaba K, Nishio T (2009) A Brassica rapa linkage map of EST-based SNP mark-
ers for identification of candidate genes controlling flowering time and leaf morphological
traits. DNA Res 16:311–323
Liang C, Jaiswal P, Hebbard C, Avraham S, Buckler ES, Casstevens T et al (2008) Gramene: a
growing plant comparative genomics resource. Nucleic Acids Res 36:D947–D953
Lisec J, Meyer RC, Steinfath M, Redestig H, Becher M, Witucka-Wall H et al (2008) Identifica-
tion of metabolic and biomass QTL in Arabidopsis thaliana in a parallel analysis of RIL and IL
populations. Plant J 53:960–972
Liu X, Lu T, Yu S, Li Y, Huang Y, Huang T et al (2007) A collection of 10,096 indica rice full-
length cDNAs reveals highly expressed sequence divergence between Oryza sativa indica and
japonica subspecies. Plant Mol Biol 65:403–415
Long D, Martin M, Sundberg E, Swinburne J, Puangsomlee P, Coupland G (1993) The maize
transposable element system Ac/Ds as a mutagen in Arabidopsis: identification of an albino
mutation induced by Ds insertion. Proc Natl Acad Sci USA 90:10370–10374
Lu R, Malcuit I, Moffett P, Ruiz MT, Peart J, Wu AJ et al (2003a) High throughput virus-induced
gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J 22:5690–
5699
Lu R, Martin-Hernandez AM, Peart JR, Malcuit I, Baulcombe DC (2003b) Virus-induced gene
silencing in plants. Methods 30:296–303
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS et al (2006) MicroRNAs and
other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant.
Genome Res 16:1276–1288
Ma JF, Tamai K, Yamaji N, Mitani N, Konishi S, Katsuhara M et al (2006) A silicon transporter in
rice. Nature 440:688–691
Ma JF, Yamaji N, Mitani N, Tamai K, Konishi S, Fujiwara T et al (2007) An efflux transporter of
silicon in rice. Nature 448:209–212
Mace ES, Rami JF, Bouchet S, Klein PE, Klein RR, Kilian A et al (2009) A consensus genetic
map of sorghum that integrates multiple component maps and high-throughput Diversity Array
Technology (DArT) markers. BMC Plant Biol 9:13
Maeda N, Kasukawa T, Oyama R, Gough J, Frith M, Engström PG et al (2006) Transcript annota-
tion in FANTOM3: mouse gene catalog based on physical cDNAs. PLoS Genet 2:e62
Manzano C, Abraham Z, Lopez-Torrejon G, Del Pozo JC (2008) Identification of ubiquitinated
proteins in Arabidopsis. Plant Mol Biol 68:145–158
Maor R, Jones A, Nuhse TS, Studholme DJ, Peck SC, Shirasu K (2007) Multidimensional protein
identification technology (MudPIT) analysis of ubiquitinated proteins in plants. Mol Cell Pro-
teomics 6:601–610
Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA et al (2005) Genome se-
quencing in microfabricated high-density picolitre reactors. Nature 437:376–380
Marques MC, Alonso-Cantabrana H, Forment J, Arribas R, Alamar S, Conejero V et al (2009) A
new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery
and functional characterization in citrus. BMC Genomics 10:428
Maruyama K, Takeda M, Kidokoro S, Yamada K, Sakuma Y, Urano K et al (2009) Metabolic

pathways involved in cold acclimation identified by integrated analysis of metabolites and
transcripts regulated by DREB1A and DREB2A. Plant Physiol 150:1972–1980
Masclaux F, Charpenteau M, Takahashi T, Pont-Lezica R, Galaud JP (2004) Gene silencing using
a heat-inducible RNAi system in Arabidopsis. Biochem Biophys Res Commun 321:364–369
Masoudi-Nejad A, Tonomura K, Kawashima S, Moriya Y, Suzuki M, Itoh M et al (2006) EGassem-
bler: online bioinformatics service for large-scale processing, clustering and assembling ESTs
and genomic DNA fragments. Nucleic Acids Res 34:W459–W462
Mathews H, Clendennen SK, Caldwell CG, Liu XL, Connors K, Matheis N et al (2003) Activation
tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modifica-
tion, and transport. Plant Cell 15:1689–1703
Matsuda F, Yonekura-Sakakibara K, Niida R, Kuromori T, Shinozaki K, Saito K (2009) MS/MS
spectral tag-based annotation of non-targeted profile of plant secondary metabolites. Plant J
57:555–577
Matsui A, Ishida J, Morosawa T, Mochizuki Y, Kaminuma E, Endo TA et al (2008) Arabidopsis
transcriptome analysis under drought, cold, high-salinity and ABA treatment conditions using
a tiling array. Plant Cell Physiol 49:1135–1149
Matsumura H, Reich S, Ito A, Saitoh H, Kamoun S, Winter P et al (2003) Gene expression analy-
sis of plant host–pathogen interactions by SuperSAGE. Proc Natl Acad Sci USA 100:15718–
15723
Matsumura H, Kruger DH, Kahl G, Terauchi R (2008) SuperSAGE: a modern platform for ge-
nome-wide quantitative transcript profiling. Curr Pharm Biotechno 9:368–374
McDermott A (2009) Structure and dynamics of membrane proteins by magic angle spinning sol-
id-state NMR. Annu Rev Biophys 38:385–403
Memon AR (2012) Transcriptomics and proteomics analysis of root nodules of modern legume
plants. In: Asharaf M, Ahmad MSA, Ozturk M, Aksoy A (eds) Crop Production for Agricul-
tural Improvement. Springer Science – Business Media
Mi H, Lazareva-Ulitsky B, Loo R, Kejariwal A, Vandergriff J, Rabkin S et al (2005) The PAN-
THER database of protein families, subfamilies, functions and pathways. Nucleic Acids Res
33:D284–D288
Minami A, Fujiwara M, Furuto A, Fukao Y, Yamashita T, Kamo M et al (2009) Alterations in
detergent-resistant plasma membrane microdomains in Arabidopsis thaliana during cold ac-
climation. Plant Cell Physiol 50:341–359
Ming R, Hou S, Feng Y, Yu Q, Dionne-Laporte A, Saw JH et al (2008) The draft genome of the
transgenic tropical fruit tree papaya ( Carica papaya Linnaeus). Nature 452:991–996
Mitsuda N, Ohme-Takagi M (2009) Functional analysis of transcription factors in Arabidopsis.
Plant Cell Physiol 50:1232–1248
Miyao A, Tanaka K, Murata K, Sawaki H, Takeda S, Abe K et al (2003) Target site specificity of
the Tos17 retrotransposon shows a preference for insertion within genes and against insertion
in retrotransposon-rich regions of the genome. Plant Cell 15:1771–1780
Miyao A, Iwasaki Y, Kitano H, Itoh J, Maekawa M, Murata K et al (2007) A large-scale collection
of phenotypic data describing an insertional mutant population to facilitate functional analysis
of rice genes. Plant Mol Bio 63:625–635
Mochida K, Shinozaki K (2010) Genomics and bioinformatics resources for crop improvement.
Mochida K, Yamazaki Y, Ogihara Y (2003) Discrimination of homoeologous gene expression in
hexaploid wheat by SNP analysis. Mol Genet Genomics 270:371–377
Mochida K, Kawaura K, Shimosaka E, Kawakami N, Shin-I T, Kohara Y et al (2006) Tissue
expression map of a large number of expressed sequence tags and its application to in silico
screening of stress response genes in common wheat. Mol Gen Genomics 276:304–312
Mochida K, Saisho D, Yoshida T, Sakurai T, Shinozaki K (2008) TriMEDB: a database to integrate
transcribed markers and facilitate genetic studies of the tribe Triticeae. BMC Plant Biol 8:72
Mochida K, Furuta T, Ebana K, Shinozaki K, Kikuchi J (2009a) Correlation exploration of meta-
bolic and genomic diversities in rice. BMC Genomics 10:568
Mochida K, Yoshida T, Sakurai T, Ogihara Y, Shinozaki K (2009b) TriFLDB: a database of clus-

tered full-length coding sequences from Triticeae with applications to comparative grass ge-
nomics. Plant Physiol 150:1135–1146
Mochida K, Yoshida T, Sakurai T, Yamaguchi-Shinozaki K, Shinozaki K, Tran LS (2009c) In silico
analysis of transcription factor repertoire and prediction of stress responsive transcription fac-
tors in soybean. DNA Res 16:353–369
Mochida K, Yoshida T, Sakurai T, Yamaguchi-Shinozaki K, Shinozaki K, Tran LS (2010) Legu-
meTFDB: an integrative database of Glycine max, Lotus japonicus and Medicago truncatula
transcription factors. Bioinformatics 26:290–291
Moco S, Bino RJ, Vorst O, Verhoeven HA, de Groot J, van Beek TA et al (2006) A liquid chroma-
tography–mass spectrometry-based metabolome database for tomato. Plant Physiol 141:1205–
1218
Mori M, Tomita C, Sugimoto K, Hasegawa M, Hayashi N, Dubouzet JG et al (2007) Isolation and
molecular characterization of a Spotted leaf 18 mutant by modified activation-tagging in rice.
Morreel K, Goeminne G, Storme V, Sterck L, Ralph J, Coppieters W et al (2006) Genetical me-
tabolomics of flavonoid biosynthesis in Populus: a case study. Plant J 47:224–237
Mueller LA, Zhang P, Rhee SY (2003) AraCyc: a biochemical pathway database for Arabidopsis.
Mueller LA, Solow TH, Taylor N, Skwarecki B, Buels R, Binns J et al (2005) The SOL Ge-
nomics Network: a comparative resource for Solanaceae biology and beyond. Plant Physiol
138:1310–1317
Mullins E, Milbourne D, Petti C, Doyle-Prestwich BM, Meade C (2006) Potato in the age of bio-
technology. Trends Plant Sci 11:254–260
Nakamura H, Hakata M, Amano K, Miyao A, Toki N, Kajikawa M et al (2007) A genome-wide
gain-of function analysis of rice genes using the FOX-hunting system. Plant Mol Biol 65:357–
371
Nakano M, Nobuta K, Vemaraju K, Tej SS, Skogen JW, Meyers BC (2006) Plant MPSS databases:
signature-based transcriptional resources for analyses of mRNA and small RNA. Nucleic Ac-
ids Res 34:D731–D735
Nanjo T, Sakurai T, Totoki Y, Toyoda A, Nishiguchi M, Kado D et al (2007) Functional annotation
of 19,841 Populus nigra full length enriched cDNA clones. BMC Genomics 8:448
Neale DB, Ingvarsson PK (2008) Population, quantitative and comparative genomics of adapta-
tion in forest trees. Curr Opin Plant Biol 11:149–155
Newton RP, Brenton AG, Smith CJ, Dudley E (2004) Plant proteome analysis by mass spectrom-
etry: principles, problems, pitfalls and recent developments. Phytochemistry 65:1449–1485
Nobuta K, Venu RC, Lu C, Belo A, Vemaraju K, Kulkarni K et al (2007) An expression atlas of
rice mRNAs and small RNAs. Nat Biotechnol 25:473–477
Nobuta K, Lu C, Shrivastava R, Pillay M, De Paoli E, Accerbi M et al (2008) Distinct size distribu-
tion of endogeneous siRNAs in maize: evidence from deep sequencing in the mop1–1 mutant.
Proc Natl Acad Sci USA 105:14958–14963
Nuhse TS, Stensballe A, Jensen ON, Peck SC (2004) Phosphoproteomics of the Arabidopsis plas-
ma membrane and a new phosphorylation site database. Plant Cell 16:2394–2405
Nuhse TS, Bottrill AR, Jones AM, Peck SC (2007) Quantitative phosphoproteomic analysis of
plasma membrane proteins reveals regulatory mechanisms of plant innate immune responses.
Plant J 51:931–940
Obayashi T, Kinoshita K, Nakai K, Shibaoka M, Hayashi S, Saeki M et al (2007) ATTED-II: a
database of co-expressed genes and cis elements for identifying co-regulated gene groups in
Arabidopsis. Nucleic Acids Res 35:D863–D869
Obayashi T, Hayashi S, Saeki M, Ohta H, Kinoshita K (2009) ATTED-II provides coexpressed
gene networks for Arabidopsis. Nucleic Acids Res 37:D987–D991
O’Brien EA, Zhang Y, Wang E, Marie V, Badejoko W, Lang BF, Burger G (2009) GOBASE: an
organelle genome database. Nucleic Acids Res 37:D946–D950
Ogasawara O, Otsuji M, Watanabe K, Iizuka T, Tamura T, Hishiki T et al (2006) BodyMap-Xs:

anatomical breakdown of 17 million animal ESTs for cross-species comparison of gene expres-
sion. Nucleic Acids Res 34:D628–D631
Okazaki Y, Shimojima M, Sawada Y, Toyooka K, Narisawa T, Mochida K et al (2009) A chloro-
plastic UDP-glucose pyrophosphorylase from Arabidopsis is the committed enzyme for the
first step of sulfolipid biosynthesis. Plant Cell 21:892–909
Oksman-Caldentey KM, Saito K (2005) Integrating genomics and metabolomics for engineering
plant metabolic pathways. Curr Opin Biotechnol 16:174–179
Ozturk M (2010) Agricultural residues and their role in bioenergy production. Version steele 24
May 09. Proceedings-second consultation AgroResidues-Second expert consultation ‘The uti-
lization of agricultural residues with special emphasis on utilization of agricultural residues as
biofuel’, Cairo Egypt, November 2007, pp 31–43
Ozturk M, Ergin M, Akçiçek E (2006) Ecology, sustainability, and stewardship. Proc.of the 13th
IAS science conference on “Energy for Sustainable Development” and “Science for the Fu-
ture of the Islamic World and Humanity”, Kuching/Sarawak, Malaysia (2003). In: Ergin M,
Zou’bi MR (eds) Islamic World Academy of Sciences (IAS). National Printing Press, Amman,
pp 261–278
Palczewski K, Kumasaka T, Hori T, Behnke CA, Motoshima H, Fox BA et al (2000) Crystal struc-
ture of rhodopsin: a G proteincoupled receptor. Science 289:739–745
Park PJ (2009) ChIP-seq: advantages and challenges of a maturing technology. Nat Rev Genet
10:669–680
Parkinson H, Kapushesky M, Shojatalab M, Abeygunawardena N, Coulson R, Farne A et al (2007)
ArrayExpress-a public database of microarray experiments and gene expression profiles. Nu-
cleicAcids Res 35:D747–D750
Paterson AH (2008) Genomics of sorghum. Int J Plant Genomics 2008:362–451
Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H et al (2009) The
Sorghum bicolor genome and the diversification of grasses. Nature 457:551–556
Peleg Z, Saranga Y, Suprunova T, Ronin Y, Roder MS, Kilian A et al (2008) High-density genetic
map of durum wheat × wild emmer wheat based on SSR and DArT markers. Theor Appl Genet
117:103–115
Pinstrup-Andersen P, Cohen M (2000) Modern biotechnology for food and agriculture: Risks and
opportunities for the poor. In: Persley GJ, Lantin MM (eds) Agricultural biotechnology and the
poor. Consultative Group on International Agricultural Research, Washington, DC
Qu S, Desai A, Wing R, Sundaresan V (2008) A versatile transposonbased activation tag vector
system for functional genomics in cereals and other monocot plants. Plant Physiol 146:189–199
Rahman U, Shaheen T, Ashraf M, Zafar Y (2012) Bridging genomic and classic breeding ap-
proaches for improving crop productivity. In: Asharaf M, Ozturk M, Ahmad MSA, Aksoy A
(eds) Crop Production for Agricultural Improvement. Springer Science – Business Media
Ralph SG, Chun HJ, Cooper D, Kirkpatrick R, Kolosova N, Gunter L et al (2008a) Analysis of
4,664 high-quality sequence-finished poplar full-length cDNA clones and their utility for the
discovery of genes responding to insect feeding. BMC Genomics 9:57
Ralph SG, Chun HJ, Kolosova N, Cooper D, Oddy C, Ritland CE et al (2008b) A conifer genomics
resource of 200,000 spruce ( Picea spp.) ESTs and 6,464 high-quality, sequence-finished full-
length cDNAs for Sitka spruce ( Picea sitchensis). BMC Genomics 9:484
Ramautar R, Somsen GW, de Jong GJ (2009) CE-MS in metabolomics. Electrophoresis 30:276–
291
Riechmann JL, Heard J, Martin G, Reuber L, Jiang C, Keddie J et al (2000) Arabidopsis transcrip-
tion factors: genome-wide comparative analysis among eukaryotes. Science 290:2105–2110
Roessner U, Luedemann A, Brust D, Fiehn O, Linke T, Willmitzer L et al (2001) Metabolic pro-
filing allows comprehensive phenotyping of genetically or environmentally modified plant
systems. Plant Cell 13:11–29
Rose JCK, Bashir S, Giovannoni JJ, Jahn MM, Saravanan RS (2004) Tackling the plant proteome:
Practicalapproaches, hurdles and experimental tools. Plant J 39:715–733
Rossignol M, Peltier JB, Mock HP, Matros A, Maldonado AM, Jorrin JV (2006) Plant proteome
analysis: a 2004–2006 update. Proteomics 6:5529–5548
Rostoks N, Borevitz JO, Hedley PE, Russell J, Mudie S, Morris J et al (2005) Single-feature poly-
morphism discovery in the barley transcriptome. Genome Biol 6:R54
Rowe HC, Hansen BG, Halkier BA, Kliebenstein DJ (2008) Biochemical networks and epistasis
shape the Arabidopsis thaliana metabolome. Plant Cell 20:1199–1216
Ruiz-Ferrer V, Voinnet O (2009) Roles of plant small RNAs in biotic stress responses. Annu Rev
Saito K, Hirai MY, Yonekura-Sakakibara K (2008) Decoding genes with co-expression networks
and metabolomics-‘majority report by precogs’. Trends Plant Sci 13:36–43
Sakai A, Takano H, Kuroiwa T (2004) Organelle nuclei in higher plants: structure, composition,
function and evolution. Int Rev Cytol 238:59–118
Sakata K, Ohyanagi H, Nobori H, Nakamura T, Hashiguchi A, Nanjo Y et al (2009) Soybean
proteome database: a data resource for plant differential ‘omics’. J Proteome Res 8:3539–3548
Sakurai T, Plata G, Rodriguez-Zapata F, Seki M, Salcedo A, Toyoda A et al (2007) Sequencing
analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions
in gene families related to stress response. BMC Plant Bio 7:66
Samatey FA, Imada K, Nagashima S, Vonderviszt F, Kumasaka T, Yamamoto M et al (2001) Struc-
ture of the bacterial flagellar protofilament and implications for a switch for supercoiling. Na-
ture 410:331–337
Sato S, Tabata S (2006) Lotus japonicus as a platform for legume research. Curr Opin Plant Bio
9:128–132
Sato S, Nakamura Y, Kaneko T, Asamizu E, Kato T, Nakao M et al (2008) Genome structure of the
legume, Lotus japonicus. DNA Res 15:227–239
Sato K, Shin IT, Seki M, Shinozaki K, Yoshida H, Takeda K et al (2009) Development of 5006 full-
length cDNAs in barley: a tool for accessing cereal genomics resources. DNA Res 16:81–89
Schauer N, Semel Y, Roessner U, Gur A, Balbo I, Carrari F et al (2006) Comprehensive metabolic
profiling and phenotyping of interspecific introgression lines for tomato improvement. Nat
Schauer N, Semel Y, Balbo I, Steinfath M, Repsilber D, Selbig J et al (2008) Mode of inheritance
of primary metabolic traits in tomato. Plant Cell 20:509–523
Schena M, Shalon D, Davis RW, Brown PO (1995) Quantitative monitoring of gene expression
patterns with a complementary DNA microarray. Science 270:467–470
Schmelzle K, White FM (2006) Phosphoproteomic approaches to elucidate cellular signaling net-
works. Curr Opin Biotechnol 17:406–414
Schnable PS, Ware Doulton RS, Stein JC, Wei F, Pasternak S et al (2009) The B73 maize genome:
complexity, diversity, and dynamics. Science 326:1112–1115
Schneider A, Kirch T, Gigolashvili T, Mock HP, Sonnewald U, Simon R et al (2005) A transposon-
based activation-tagging population in Arabidopsis thaliana (TAMARA) and its applicationin
the identification of dominant developmental and metabolic mutations. FEBS Let 579:4622–
4628
Schripsema J (2009) Application of NMR in plant metabolomics: techniques. problems and pros-
pects. Phytochem Anal 21:14–21
Schwede T, Kopp J, Guex N, Peitsch MC (2003) SWISS-MODEL: an automated protein homolo-
gy-modeling server. Nucleic Acids Res 31:3381–3385
Seki M, Shinozaki K (2009) Functional genomics using RIKEN Arabidopsis thaliana full-length
cDNAs. J Plant Res 122:355–366
Seki M, Narusaka M, Ishida J, Nanjo T, Fujita M, Oono Y et al (2002a) Monitoring the expression
profiles of 7000 Arabidopsis genes under drought, cold and high-salinity stresses using a full-
length cDNA microarray. Plant J 31:279–292
Seki M, Narusaka M, Kamiya A, Ishida J, Satou M, Sakurai T et al (2002b) Functional annotation
of a full-length Arabidopsis cDNA collection. Science 296:141–145
Sekiyama Y, Kikuchi J (2007) Towards dynamic metabolic network measurements by multi-di-
mensional NMR-based fluxomics. Phytochemistry 68:2320–2329
Shen YJ, Jiang H, Jin JP, Zhang ZB, Xi B, He YY et al (2004) Development of genome-wide DNA
polymorphism database for map-based cloning of rice genes. Plant Physiol 135:1198–1205
Somerville C, Dangl J (2000) Genomics. Plant biology in 2010. Science 290:2077–2078
Song J, Braun G, Bevis E, Doncaster K (2006) A simple protocol for protein extraction of recalci-
trant fruit tissues suitable for 2-D electrophoresis and MS analysis. Electrophoresis 27:3144–
3151
Springer PS (2000) Gene traps: tools for plant development and genomics. Plant Cell 12:1007–
1020
Stanford WL, Cohn JB, Cordes SP (2001) Gene-trap mutagenesis: past, present and beyond. Nat
Rev Gene 2:756–768
Sterck L, Rombauts S, Vandepoele K, Rouze P, Van de Peer Y (2007) How many genes are there
in plants (… and why are they there)? Curr Opin Plant Biol 10:199–203
Sterky F, Bhalerao RR, Unneberg P, Segerman B, Nilsson P, Brunner AM et al (2004) A Populus
EST resource for plant functional genomics. Proc Natl Acad Sci USA 101:13951–13956
Stevens RC, Yokoyama S, Wilson IA (2001) Global efforts in structural genomics. Science
294:89–92
Sugiyama N, Nakagami H, Mochida K, Daudi A, Tomita M, Shirasu K et al (2008) Large-scale
phosphorylation mapping reveals the extent of tyrosine phosphorylation in Arabidopsis. Mol
Syst Biol 4:193
Swarbreck D, Wilks C, Lamesch P, Berardini TZ, Garcia-Hernandez M, Foerster H et al (2008)
The Arabidopsis Information Resource (TAIR): gene structure and function annotation. Nucle-
ic Acids Res 36:D1009–D1014
Taji T, Sakurai T, Mochida K, Ishiwata A, Kurotani A, Totoki Y et al (2008) Large-scale col-
lection and annotation of full-length enriched cDNAs from a model halophyte, Thellungiella
halophila. BMC Plant Biol 8:115
Takeda S, Matsuoka M (2008) Genetic approaches to crop improvement: responding to environ-
mental and population changes. Nat Rev Genet 9:444–457
Talon M, Gmitter FG Jr (2008) Citrus genomics. Inter J Plant Genomics 2008:1–17
Tanaka T, Antonio BA, Kikuchi S, Matsumoto T, Nagamura Y, Numa Y et al (2008) The Rice
Annotation Project Database (RAP-DB): 2008 update. Nucleic Acids Res 36:D1028–D1033
Tang H, Bowers JE, Wang X, Ming R, Alam M, Paterson AH (2008a) Synteny and collinearity in
plant genomes. Science 320:486–488
Tang H, Wang X, Bowers JE, Ming R, Alam M, Paterson AH (2008b) Unraveling ancient hexa-
ploidy through multiply-aligned angiosperm gene maps. Genome Res 18:1944–1954
Thimm O, Blasing O, Gibon Y, Nagel A, Meyer S, Kruger P et al (2004) MAPMAN: a user-driven
tool to display genomics data sets onto diagrams of metabolic pathways and other biological
processes. Plant J 37:914–939
Tikunov Y, Lommen A, de Vos CH, Verhoeven HA, Bino RJ, Hall RD et al (2005) A novel ap-
proach for nontargeted data analysis for metabolomics. Large-scale profiling of tomato fruit
volatiles. Plant Physiol 139:1125–1137
Till BJ, Reynolds SH, Weil C, Springer N, Burtner C, Young K et al (2004) Discovery of induced
point mutations in maize genes by TILLING. BMC Plant Biol 4:12
Till BJ, Colbert T, Codomo C, Enns L, Johnson J, Reynolds SH et al (2006) High-throughput
TILLING for Arabidopsis. Methods Mol Biol 323:127–35
Tohge T, Nishiyama Y, Hirai MY, Yano M, Nakajima J, Awazuhara M et al (2005) Functional
genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-
expressing an MYB transcription factor. Plant J 42:218–235
Tokimatsu T, Sakurai N, Suzuki H, Ohta H, Nishitani K, Koyama T et al (2005) KaPPA-view: a
web-based analysis tool for integration of transcript and metabolite data on plant metabolic
pathway maps. Plant Physiol 138:1289–1300
Torada A, Koike M, Mochida K, Ogihara Y (2006) SSR-based linkage map with new markers us-
ing an intraspecific population of common wheat. Theor Appl Gene 112:1042–1051
Toyoda T, Wada A (2004) Omic space: coordinate-based integration and analysis of genomic phe-
nomic interactions. Bioinformatics 20:1759–1765
Toyoshima C, Nomura H, Sugita Y (2003) Crystal structures of Ca2+-ATPase in various physi-

ological states. Ann NY Acad Sci 986:1–8
Trethewey RN (2004) Metabolite profiling as an aid to metabolic engineering in plants. Curr Opin
Turner WR, Oppenheimer M, Wilcove DS (2009) A force to fight global warming. Nature
462:278–279
Tyler RC, Aceti DJ, Bingman CA, Cornilescu CC, Fox BG, Frederick RO et al (2005) Comparison
of cell-based and cell-free protocols for producing target proteins from the Arabidopsis thali-
ana genome for structural studies. Proteins 59:633–643
Uauy C, Paraiso F, Colasuonno P, Tran RK, Tsai H, Berardi S, Comai L, Dubcovsky J (2009) A
modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat.
BMC Plant Biol 9:115–129
Umezawa T, Sakurai T, Totoki Y, Toyoda A, Seki M, Ishiwata A et al (2008) Sequencing and analy-
sis of approximately 40,000 soybean cDNA clones from a full-length-enriched cDNA library.
DNA Res 15:333–346
Urano K, Maruyama K, Ogata Y, Morishita Y, Takeda M, Sakurai N et al (2009) Characterization
of the ABA-regulated global responses to dehydration in Arabidopsis by metabolomics. Plant
J 57:1065–1078
Varshney RK, Graner A, Sorrells ME (2005) Genomics-assisted breeding for crop improvement.
Trends Plant Sci 10:621–630
Varshney RK, Nayak SN, May GD, Jackson SA (2009) Next-generation sequencing technologies
and their implications for crop genetics and breeding. Trends Biotechnol 27:522–530
Velculescu VE, Zhang L, Vogelstein B, Kinzler KW (1995) Serial analysis of gene expression.
Science 270:484–487
Wall PK, Leebens-Mack J, Muller KF, Field D, Altman NS, de Pamphilis CW (2008) Plant-
Tribes: a gene and gene family resource for comparative genomics in plants. Nucleic Acids
Res 36:D970–D976
Wang DK, Sun ZX, Tao YZ (2006) Application of TILLING in plant improvement. Yi Chuan Xue
Bao 33:957–964
Ware D (2007) Gramene: a resource for comparative grass genomics. Methods Mol Biol 406:315–
330
Waterhouse PM, Graham MW, Wang MB (1998) Virus resistance and gene silencing in plants can
be induced by simultaneous expression of sense and antisense RNA. Proc Natl Acad Sci USA
95:13959–13964
Weigel D, Mott R (2009) The 1001 genomes project for Arabidopsis thaliana. Genome Biol 10:107
Weigel D, Ahn JH, Blazquez MA, Borevitz JO, Christensen SK, Fankhauser C et al (2000) Activa-
tion tagging in Arabidopsis. Plant Physiol 122:1003–1013
Wenzl P, Raman H, Wang J, Zhou M, Huttner E, Kilian A (2007) A DArT platform for quantitative
bulked segregant analysis. BMC Genomics 8:196
Werner E, Heilier JF, Ducruix C, Ezan E, Junot C, Tabet JC (2008) Mass spectrometry for the iden-
tification of the discriminating signals from metabolomics: current status and future trends. J
Chromatogr B 871:143–163
Wilson D, Madera M, Vogel C, Chothia C, Gough J (2007) The SUPERFAMILY database in 2007:
families and functions. Nucleic Acids Res 35:D308–D313
Wilson D, Charoensawan V, Kummerfeld SK, Teichmann SA (2008) DBD-taxonomically broad
transcription factor predictions: new content and functionality. Nucleic Acids Res 36:D88–D92
Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007) An ‘electronic fluores-
cent pictograph’ browser for exploring and analyzing large-scale biological data sets. PLoS
ONE 2:e718
Wlodawer A, Minor W, Dauer Z, Jaskolski M (2008) Protein crystallography for non-crystallogra-
phers, or how to get the best (but not more) from published macromolecular structures. FEBS
J 275:1–21
Wu WW, Wang G, Baek SJ, Shen R-F (2005) Comparative study of three proteomic quantitative
methods, DIGE, cICAT, and iTRAQ, using 2D gel- or LC- MAL:DI TOF/TOF. J Proteome
Res 5:651–658
Yamamoto YY, Obokata J (2008) ppdb: a plant promoter database. Nucleic Acids Res 36:D977–
D981
Yamamoto YY, Yoshitsugu T, Sakurai T, Seki M, Shinozaki K, Obokata J (2009) Heterogeneity of
Arabidopsis core promoters revealed by high-density TSS analysis. Plant J 60:350–362
Yamasaki K, Kigawa T, Inoue M, Tateno M, Yamasaki T, Yabuki T et al (2004) Solution structure
of the B3 DNA binding domain of the Arabidopsis cold-responsive transcription factor RAV1.
Plant Cell 16:3448–3459
Yamasaki C, Murakami K, Fujii Y, Sato Y, Harada E, Takeda J et al (2008a) The H-Invitational
Database (H-InvDB), a comprehensive annotation resource for human genes and transcripts.
Yamasaki K, Kigawa T, Inoue M, Watanabe S, Tateno M, Seki M et al (2008b) Structures and
evolutionary origins of plant-specific transcription factor DNA-binding domains. Plant Physiol
Bioche 46:394–401
Yan W, Chen S (2005) Mass spectrometry-based quantitative proteomic profiling. Brief Funct
Genome Proteome 4:1–12
Yates JR, Ruse CI, Nakorchevsky A (2009) Proteomics by mass spectrometry: approaches, ad-
vances, and applications. Annu Rev Biomed Eng 11:49–79
Yilmaz A, Nishiyama MY Jr, Fuentes BG, Souza GM, Janies D, Gray J et al (2009) GRASSIUS:
a platform for comparative regulatory genomics across the grasses. Plant Physiol 149:171–180
Yonekura-Sakakibara K, Tohge T, Matsuda F, Nakabayashi R, Takayama H, Niida R et al (2008)
Comprehensive flavonol profiling and transcriptome coexpression analysis leading to decod-
ing gene-metabolite correlations in Arabidopsis. Plant Cell 20:2160–2176
Zeller G, Henz SR, Widmer CK, Sachsenberg T, Ratsch G, Weigel D et al (2009) Stress-induced
changes in the Arabidopsis thaliana transcriptome analyzed using whole-genome tiling arrays.
Plant J 58:1068–1082
Zhang Y (2008) Progress and challenges in protein structure prediction. Curr Opin Struct Biol
18:342–348
Zhang Y (2009a) I-TASSER: fully automated protein structure prediction in CASP8. Proteins
77(Suppl 9):100–113
Zhang Y (2009b) Protein structure prediction: when is it useful? Curr Opin Struct Biol 19:145–155
Zhang H, Sreenivasulu N, Weschke W, Stein N, Rudd S, Radchuk V et al (2004) Large-scale
analysis of the barley transcriptome based on expressed sequence tags. Plant J 40:276–290
Zhang X, Yazaki J, Sundaresan A, Cokus S, Chan SW, Chen H et al (2006) Genome-wide high res-
olution mapping and functional analysis of DNA methylation in Arabidopsis. Cell 126:1189–
1201
Zhang J, Xu Y, Huan Q, Chong K (2009a) Deep sequencing of Brachypodium small RNAs at the
global genome level identifies microRNAs involved in cold stress response. BMC Genomics
10:449
Zhang Z, Yu J, Li D, Liu F, Zhou X, Wang T, Ling Y, Su Z (2009b) PMRD: plant microRNA data-
base. Nucleic Acids Res 38:D806–D814
Zheng Y, Ren N, Wang H, Stromberg AJ, Perry SE (2009) Global identification of targets of the
Arabidopsis MADS domain protein AGAMOUS-Like 15. Plant Cell 21:2563–2577
Zhu QH, Guo AY, Gao G, Zhong YF, Xu M, Huang M et al (2007) DPTF: a database of poplar
transcription factors. Bioinformatics 23:1307–1308
Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W (2004) GENEVESTIGATOR. Ara-
bidopsis microarray database and analysis toolbox. Plant Physiol 136:2621–2632
Zubko E, Adams CJ, Machaekova I, Malbeck J, Scollan C, Meyer P (2002) Activation tagging
identifies a gene from Petunia hybrida responsible for the production of active cytokinins in
plants. Plant J 29:797–808
Chapter 3
Crop Improvement Through Plant Tissue
Culture
Sumiya Jamsheed, Saiema Rasool, Shivani Koul, Mohamed Mahgoub Azooz

and Parvaiz Ahmad
Abstract Plant tissue culture has emerged as a powerful and cost-effective tool for
the crop improvement. Tissue culture is alternatively called cell, tissue and organ
culture through in vitro condition. It can be employed for large scale propagation
of disease free clones and gene pool conservation. Agricultural industry has applied
immensely in vitro propagation approach for large scale plant multiplication of elite
superior varieties. As a result, hundreds of plant tissue culture laboratories have
come up worldwide, especially in the developing countries due to cheap labour
costs. Tissue culture has been exploited to create genetic variability from which
crop plants can be improved and to increase the number of desirable germplasms
available to the plant breeder. The selection of somaclonal variations appearing in
the regenerated plants may be genetically stable and useful in crop improvement.
Available methods for the transfer of genes could significantly simplify the breed-
ing procedures and overcome some of the agronomic and environmental problems,
which otherwise would not be achievable through conventional propagation meth-
ods. Transgenic crops resistant to pests, insects, diseases and other abiotic stresses is
a great achievement in the field of plant biotechnology. This article is cover in vitro
propagation and role of biotechnology in crop improvement.
P. Ahmad ()
Department of Botany, GDC Anantnag, Jammu and Kashmir 192101, India
S. Jamsheed · S. Rasool · S. Koul
Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi 110062, India
S. Rasool
S. Koul
M. M. Azooz
Department of Biological Sciences, Faculty of Science, King Faisal University,
Hofuf, Saudi Arabia
Department of Botany, Faculty of Science, South Valley University, 83523 Qena, Egypt

124 S. Jamsheed et al.
Introduction
Plant biotechnology involves a number of technologies and the techniques, methods

and strategies involved in in-vitro culture are only a part of it. Plant tissue culture has
now become a major component of this applied branch. Advances made in molecu-
lar biology can be manifested in plants through plant tissue culture. This technique
is new and has changed the scenario of plant science (Hussain and Hasnain 2012).
Apart from the conventional methods of pollination and cross fertilization, there are
a number of methods for producing genetically modified plants. Last 20 years have
witnessed a number of developments in this field. However, the modern molecular
biological techniques are still under way to make a broad based development on
crop improvement to raise a selected plant to the stage of cultivar release (Hussain
et al. 2011). A number of recalcitrant crops are now able to regenerate using the
techniques of in-vitro culture utilizing cells or calli or protoplasts in this process
and each such explants can be used in genetic transformation (Davey et al. 2005).
Now a days the application of tissue culture to various branches of plant science
like plant breeding, horticulture, forestry, industrial production of compounds and
conservation of ever depleting natural genetic resources has been the focal point of
research (Roy et al. 2011).
Advancement in the techniques of protoplast, cell, tissue and organ culture and
regeneration of whole plants has resulted in the development of tissue culture as a
technology (Thorpe 2012). The technique has advanced rapidly over the years due
to extensive investigations into problems related to basic and applied aspects of
plants. The phenomenon of growth, metabolism, differentiation and morphogen-
esis can be well understood by the knowledge of tissue culture (Karkonen et al.
2011). Plant tissue culture is of great interest to molecular biologists, plant breeders
and industrialists. The methods of tissue culture have been used as an important
aid to conventional methods of plant improvement. They have been used for the
production of genetically modified superior clones, ex-situ conservation of germ-
plasm, pathogen free plants as well as in the synthesis of many important secondary
compounds (including pharmaceuticals). The advantages offered by tissue culture
in agriculture and general plant biotechnology have well been witnessed by many
research labs and industries (Mustafa et al. 2011).
The conventional breeding programmes can be complemented by biotechnol-
ogy and expedite the crop improvement programmes. A large number of centres
are involved in studies involving in vitro culture and selection, micropropagation,
embryo rescue, genetic transformation, marker assisted characterization and DNA
fingerprinting worldwide. Micropropagation protocols and somatic embryogenesis
has been achieved in a number of important genera. Germplasm screening has be-
come successful due to the techniques of in vitro selections for antibiotic tolerance
and fungal toxin resistance. Agrobacterium tumefaciens mediated transformation
has been established in a number of cereal, fruit and vegetable crops (Azria and
Bhalla 2011; Pons et al. 2012). A number of fruit ripening genes have been cloned
and transferred into plants and DNA fingerprinting for genetic diversity analysis
3 Crop Improvement Through Plant Tissue Culture 125
has been conducted on many crop species (Shi and Zhang 2012, Chandel et al.
2010). The technique of tissue culture helps in crop improvement through different
approaches like breeding, wide hybridization, haploidy, somaclonal variation and
micropropagation.
Approaches for Crop Improvement
Distant Hybridisation
Crop improvement can be achieved by the methods of genetic transfer, whether via
single gene, through genetic engineering, or multiple genes, through conventional
breeding or tissue culture techniques. In angiosperms fertilization depends upon a
number of factors which include, transfer of pollen grains from anthers to stigma,
germination of pollen grains to produce a pollen tube, penetration of pollen tube to
the stigma and the style to reach the ovule. The pollen tube discharge triggers and
the two sperm nuclei then fuse with their respective partners i.e., the egg cell and
the secondary nucleus which results in the formation of the embryo and endosperm
respectively. However, this phenomenon can be stopped at any stage, resulting in
a barrier to hybridization and thus, the inhibition of gene transfer between the two
plants. However, in case of distant crosses involving individuals of different spe-
cies or genus, a number of barriers have to be overcome for hybridization to take
place. These barriers include pre-fertilization barriers like failure of pollen tube to
germinate or poor pollen tube growth which can be overcome by in vitro fertiliza-
tion (Dresselhaus et al. 2011) and post-fertilization barriers such as no endosperm
development which may be overcome by embryo, ovule or pod culture. Protoplast
fusion has been successful in producing the desired hybrids in plants where fertil-
ization can’t be induced by in vitro treatments (Ingram 2010).
In Vitro Fertilization
In vitro fertilization has been used to obtain both interspecific and intergeneric hy-
brids by overcoming physiological based self-incompatibility. A large number of
plant species have been obtained via pollination of pistils and ovules (Palanivelu
and Preuss 2006). This range includes agricultural crops, such as tobacco, rice,
corn, clover, poppy and cotton. Wide hybridization, pollination with abortive pol-
len, delayed pollination, and physicochemical treatment of the ovary can be used to
produce haploids (Islam and Tuteja 2012). In vitro fertilization studies have helped
to understand many important phenomena regarding pollination and fertilization. A
glycoprotein, TTS was purified from tobacco stylar tissue, which supports pollen
tube growth (Hancock et al. 2005)
Embryo Culture
Poor endosperm development in wide hybridization results in embryo abortion dur-

ing post-zygotic events. The in-vitro embryo culture technique has been successful
in overcoming the major barrier and solving the problems of low seed set, seed dor-
mancy, slow seed germination, including embryo growth in the absence of a symbi-
otic partner and the production of monoploids (Lin et al. 2011). The breeding cycle
of a number of ornamentals like roses, orchids and banana and Colocasia has been
reduced (Henning et al. 2004). A number of interspecific and intergeneric hybrids
of a number of agriculturally important crops have been produced, including cotton,
barley, tomato, rice, jute, Hordeum x Secale, Tripsacumx Zea and some Brassicas
(Sanei et al. 2010; Tommonaro et al. 2012). At least seven Canadian barley cultivar
were obtained from the material selected from doubled haploids originating through
the bulbosum method of cross-fertilization and embryo rescue (Munoz-Amatrian
et al. 2009). Monoploid wheat varieties have also been produced by this technique
(Zhang et al. 2008). An in vitro spikelet culture system was developed to check the
fruit set and early fruit development in rice crop. The cultured ovary of pollinated
spikelets developed into fruits with an embryo and endosperm. While unpollinated
spikelets when cultured on a medium containing 2,4-D, developed parthenocarpic
fruits (Uchiumi and Okamoto 2010). An in-vitro protocol was developed for the
culture of immature embryos of Medicago truncatula that permits their develop-
ment in a way comparable to that observed in plants (Ochatt 2011).
Protoplast Fusion
When hybrid plants cannot be produced by conventional breeding, the role of proto-
plast fusion comes into play which acts as a means of creating unique hybrid plants.
Protoplasts can be obtained from a number of crop species (Wang et al. 2011).
However, while protoplasts of any two plants can be fused by chemical or physical
means, production of unique somatic hybrid production is limited by the ability to
generate the fused product and sterility in the interspecific hybrids rather than the
production of protoplasts. Nicotiana is the best example of the use of protoplast
fusion to improve crop production. The somatic hybrid products of a chemical fu-
sion of protoplasts have been produced with modified alkaloid content and disease
resistance of commercial tobacco cultivars (Patel et al. 2011).
The genetic components needed for taxol synthesis in Taxus chinensis var. mairei
were transferred to a more tractable plant Bupleurum scorzonerifolium. RAPD data
of the hybrid genome confirmed the presence of 82.4–96.8 % genome of B. scor-
zonerifolium and 4.6–13.9 % from the donor i.e., T. chinensis (Zhang et al. 2011).
Haploids
The significance of haploids in genetics and plant breeding has been realized for a
long time. However, their exploitation remained restricted because of the extremely
low frequency with which they occur in nature (usually 0.001–0.01 %). Spontane-
ous production of haploids usually occurs through the process of parthenogenesis
(embryo development from an unfertilized egg). However, they reproduce the char-
acters of the male parent alone suggesting their origin through ovule androgenesis
(embryo development inside the ovule by the activity of the male nucleus alone).
Haploid plants have the gametophytic number of chromosomes (Atanassov et al.
1995; Zapata Arias et al. 1995). The production of haploids in tomato has been tried
and is still at a poor stage of development. The process of early embryogenesis from
isolated microspores and the disruption of normal meiotic development and change
of developmental fate towards callus proliferation, morphogenesis and plant regen-
eration have been shown in tomato by using light and electron microscopy (Segui-
Simaro and Nuez 2007). For cell culture studies and breeding in flax, haploid and
double haploid material and homozygous lines need to be produced. Anther culture
has proved to be the most successful method producing doubled haploid lines in
flax (Obert et al. 2009).
A fast and cheap method to obtain pure or homozygous lines is a priority for
hybrid seed production in important crop plants. Pure lines can be produced tra-
ditionally by inbreeding and selection techniques, which are time consuming and
costly. Alternatively, it has become possible through a biotechnological approach to
accelerate the production of homozygous lines i.e., the induction of androgenesis to
generate double haploid plants. Androgenesis reduces this process to a single gen-
eration, which implies time and cost saving. Due to these advantages, androgenic
doubled haploids are the choice in a number of important crop plants where the
methodology is well set up. In solanaceae family, crops like eggplant and pepper
anther cultures are used for doubled haploid production and recent advances in the
knowledge of embryo development are opening new ways to achieve the final goal
of an efficient protocol in recalcitrant species (Segui-Simaro et al. 2011).
Gynogenesis is the phenomenon of production of whole plants from the unfer-
tilized ovules. In Gentian ( Gentiana triflora, G. scabra and their hybrids) an or-
namental flower, unfertilized ovules were cultured in a medium containing a high
concentration of sucrose (Doi et al. 2011) results in production of young plantlets.
Although the embryos showed genotypic variation, all the genotypes gave response.
The ovules collected from flower buds just before anthesis showed higher response.
The dark culture condition also gave more number of haploid embryos as in 16-hour
light condition.
Somaclonal Variation
The phenotypic variation of plants regenerated from cell culture is referred to as so-
maclonal variation. Apart from the mutant cell lines and plants obtained as a result
of mutations many variants have been obtained through the tissue culture process
cycle itself. The somaclonal variants may be genetic or epigenetic and are usually
observed in the regenerated plantlets (Velker et al. 2012). These are dependent on
the natural variations in a population of cells. Somaclonal variation may be due to
pre-existing genetic differences in the cells or variations induced by tissue culture.

The variation may be created through several types of mutations like inversion,
deletion, duplication, gene amplification or de-amplification, by the activation of
transposable element, point mutations, or re-activation of silent genes in multigene
families (Karp 1994). Many aspects of the mechanism of somaclonal variation re-
main undefined, however in rice transposition of retrotransposons is one of the main
causes of somaclonal variation (Pistelli et al. 2012). Somaclonal variation may also
be induced in cultures via tissue culture process as reported in Saintpaulia sp. (Sato
et al. 2011). A number of somaclonal variations observed in in vitro raised regener-
ants have been found to be of agricultural and horticultural significance. Some of
such important alterations include chloroplast and chromoplast physiology, growth
and development of the plant, seed yield, morphology of the flower and leaf, pro-
duction of essential oils, fruit solids and disease resistance. Many of the important
crops including wheat, rice, oats, maize, sugarcane, alfalfa, tobacco, tomato, potato,
oil seed rape and celery have been observed with such variations (Karp 1994). This
variation can also be obtained from gametic tissue.
One of the most important advantages of somaclonal variation is the induction
of more genetic variability in economically important crops (Schellenbaum et al.
2008). In vitro selection of such somaclonal variants or rapid plant screening meth-
ods will be valuable. Enhancement in some somaclonal variants has been reported
under in vitro conditions that include resistance to diseases, pathotoxins and herbi-
cides or tolerance to different stress conditions (Zebrowska 2010).
Micropropagation
Propagation of Plants
Almost all types of plants can now be regenerated into plantlets from explants or
callus. Thus, majority of the plant species have now well established micropropaga-
tion protocols and at present among the different techniques of plant tissue culture
technology micropropagation is of widest use (Loyola-Vargas and Ochoa Alejo
2012). At present there are a number of tissue culture firms involved in in vitro mul-
tiplication, elimination of pathogens, storage of germplasm, genetic manipulation
and plant-breeding programs (Ding et al. 2008). Micropropagation plays a major
role in crop improvement. However, there are several limitations to the use of this
technique. Up to 70 % of the production costs of micropropagation are required to
fulfill the cost of labour needed to transfer tissue repeatedly between vessels and for
asepsis. Tissue culture laboratory is greatly affected by the problems of vitrification,
acclimatization and contamination (Doran 2009). A large number of desirable eco-
nomic traits are lost in the tissue-cultured products due to genetic variation in cul-
tured lines, such as polyploidy, aneuploidy and mutations. Enhancing axillary-bud
breaking, production of adventitious buds and somatic embryogenesis are the three
methods of micropropagation. In the latter two methods, differentiated structures

arise directly or indirectly from callus. Axillary bud breaking produces very less
number of plantlets as the number of shoots cultured is affected by the number of
axillary buds cultured. However, it is the most widely used method in commercial
micropropagation as it produces the most true to type plantlets. Adventitious bud-
ding is advantageous as bud primordial may be formed on any part of the inoculums
(Brown and Thorpe 1996). Unfortunately, largest number of plantlets can be pro-
duced by somatic embryogenesis but only limited numbers of species respond to it.
The use of bioreactors helps in large scale production of somatic embryos and their
delivery in the form of synthetic seeds.
Synthetic Seeds
Synthetic or artificial seed is analogous to a zygotic seed and may be defined as a

somatic embryo encapsulated inside a coating (Redenbaugh 1993). Synthetic seeds
may be of different types: somatic embryos in a coating of water gel, dried and
coated somatic embryos, suspended in a fluid, and buds encapsulated in a water gel.
The use of synthetic seeds is advantageous over the traditional micropropagation
protocols as it may have a cost of saving, as the labour intensive step of transfer-
ring plants from in vitro to field conditions. Other applications of synthetic seeds
include the male sterile and parental line maintenance, for hybrid crop production
and the preservation and multiplication of woody plants that have long juvenile
developmental phase (Marimuthu et al. 2011). However, before the widespread of
this technology, somaclonal variation has to be minimized. The production of high
quality embryos at large scale must be perfected in the desired species and the mi-
cropropagation protocols will have to be cost-effective compared with existing seed
or technologies.
Pathogen Eradication
The crop plants multiplying through vegetative propagation are generally infected
with pathogens. Although in many cases the presence of the pathogen may not be
obvious, but the yield or quality may be substantially reduced due to infection. In
vitro culture has helped in increasing the yield of many crop plants. In China, virus
free potatoes, produced by in vitro culture gave higher yields than the normal field
plants with increase up to 150 % (Meiyalaghan et al. 2011). Seeds are responsible
for only 10 % of viral infection, therefore, careful propagation from seeds can elimi-
nate most of the viruses. The viruses are not distributed uniformly in the plant and
the apical meristems are usually free from viruses (Wang and Valkonen 2008). The
culture of the apical meristem coupled with chemo or thermo-therapy, have been
used to produce virus-free material for micropropagation (Cantrill et al. 2005).
Germplasm Preservation
Conservation of germplasm, under in vitro storage can be done by slow growth

conditions i.e., at low temperature or by fortifying the medium with growth retard-
ing compounds. This is usually done by cryopreservation or by desiccated synthetic
seeds (Silva et al. 2012). All such technologies depend on reducing or stopping
growth and metabolic activity. However, the limiting factors are lack of a com-
mon method suitable for all species and genotypes, the expenditure and somaclonal
variations and non-intentional cell-type selection in the preserved material e.g., cell
divisions resulting in aneuploidy at low temperature or non-optimal conditions giv-
ing a particular cell type a selective growth advantage (Hajari et al. 2011).
Plant Tissue Culture, a Back Bone to Genetically Modified

(GM) Crops
The expression of heterosis via hybrid vigour could be realized by performing pol-
lination under controlled conditions as this leads to the development of new genera-
tions that performed better in the field than either of the parents and the progeny of
the subsequent generation. Manipulation of the genetic makeup is one of the major
activities in plant breeding, thus, a availability of genetic diversity is the prerequi-
site in plant breeding (Shefferson and Roach 2012). And the role of biotechnology
and tissue culture comes into play in this area for creating genetic diversity and ma-
nipulating genetic variability. Although there is still lot of integration required most
of the plant biotechnology and plant breeding programmes, but field trials of trans-
genics have now become much more common. Therefore, the modern technologies
have revolutionized the advancements in the crop improvement programmes and it
has been predicted for more than a decade (Ranganath 2011).
Various plant species are being modified genetically, either by vector dependent
e.g., Agrobacterium or vector independent, which includes biolistic, micro-injection
and liposome methods (Tagaki et al. 2011; She et al. 2012). In majority of the cases,
tissue culture technology has been used to recover the modified cells or tissues. In
fact, plant tissue culture techniques have played a major and important role in the
development of genetic engineering. Plant tissue culture has helped in achieving
many great successes in the field of transgenics. Davis and Reznikov (1992) have
set milestones in the field of plant biotechnology by using a range of protoplast,
microscope, tissue and organ culture protocols in many crop plants. Development
of efficient transformation methods can enable the possibility of obtaining trans-
genic events that are devoid of marker gene/s upfront. Eggplant, an economically
important vegetable crop does form only a non-significant percentage of agricul-
tural production as it is susceptible to a number of pathogens with bacterial and
fungal wilts being most devastating. A crop improvement approach has been de-
veloped which involves an Agrobacterium mediated transformation from two types
of egg plants, a Solanum melongena L. breeding line, and S. melongena L. Black

egg plant (Todaro et al. 2011). The use of leaf derive callus for the generation of
stably transformed maize plants has been reported (Ahmadabadi et al. 2007; Chen
et al. 2010). This method combines both conventional breeding and biotechnologi-
cal techniques. Genetic transformation using Agrobacterium tumefaciens mediated
transformation has been reported in mango, an important fruit crop (Krishna and
Singh 2007; Singh et al. 2011). A technique for developing transgenics without the
use of any selectable marker gene has been developed in peanut by taking advan-
tage of high and consistent transformation potential of this crop (Bhatnagar et al.
2010). The technique of genetic engineering especially gene transfer depends upon
plant tissue culture for the foreseeable future (Budzianowska 2009).
Besides this backcloth, a number of transgenic crops have been developed and a
few are being grown in many parts of the world and these crops are either herbicide-
tolerant or insect resistant.
Insect Resistance
For 21st century, the demands of sustainable agriculture were fulfilled by the ge-
netically engineered crop resistance to insect pests that offers the prospective us-
er-friendly environment and consumer friendly method of crop production. These
biotech crops are genetically modified with Bacillus thuringiensis (Bt) endotoxins
for insect resistance and the development of Bt crops stands as one of the most out-
standing successes of transgenic plant biotechnology (Table 3.1). The Bt is a strong
biological insecticide, which comprises of crystal protein endotoxin that is pro-
duced by some stains of soil bacterium Bacillus thuringiensis (Goudar et al. 2012).
The Bt crystal (cry) genes are toxic to lepidopterans (Cohen et al. 2000), dipterans
(Andrews et al. 1987) and coleopterans (Herrnstadt et al. 1986). Bt cry protein is
toxic to insects (BANR 2000) and non-toxic to humans and animals. The Bt toxin
gene was first discovered by Ishiwaki in 1901, in diseased silkworms and the first
Bt toxin gene was cloned in 1981 (Jain et al. 2007). In 1986, the field test of trans-
genic tobacco expressing Bt toxin was performed. Moreover, in 1988 the first GM
plant of japonica rice was produced and after that indica rice in 1990 (Ahmad et al.
2012). Now the biotech crops are grown globally including soybean, maize, cot-
ton, canola, squash, papaya, sugar beet and tomato and the global biotech crop area
derives soybean, corn, cotton and canola (Brookes and Barfoot 2011). The avail-
able data this time showed that biotech crops like soybean accounted the largest
share (52 %) followed by corn (30 %) and canola (5 %). 16.7 million farmers across
29 countries (10 industrialized and 19 developing countries) planted 160 million
hectares of biotech crops in 2011 and 90 % were small and resource poor farmers in
developing countries (James 2010; Ahmad et al. 2012). However the combination
of transgenic expression and improved protein stability has resulted even death of
the Bt-resistant insects (Chougule and Bonning 2012; Kota et al. 1999). But now
a days other insecticidal proteins like lectins, antibodies, protease inhibitors, wasp
Table 3.1 Transgenic plants expressing genes for insect and disease resistance
Plant Gene Resistance to Reference
Potato Cry1Ab Potato tuber moth Kumar et al. (2010)
Rice Cry1Ab Lepidopteron Qi et al. 2009
Tobacco Magi6 peptide Spodoptera frugiperda Hernández-Campuz-
ano et al. 2009
Rice (Indica, Basmati) Cry1Ac, Cry2A YSBa Bashir et al. (2005)
Rice (Indica, Ming- Cry2A YSB Chen et al. (2005)
huli 63)
Rice (Indica, Ming- Cry1Ac, Cry2A, Cry9c YSB and Asiatic rice Chen et al. 2008
huli 63) borer
Rice (Elite Fused gene, Cry1Ab- YSB Ho et al. (2006)
Vietnamese) 1B and hybrid
Bt gene, Cry1A/
Cry1Ac
Indica pusa basmati 1, Potato proteinase YSB Bhutani et al. (2006)
Japonica, Tainung inhibitor 2 (Pin 2)
67
Indica basmati 370 Cry1Ac, Cry2A YSB Riaz et al. (2006)
Rice (Korean variet- Cry1Ab YSB Kim et al. (2008)
ies) P-I, P-II, P-III
Rice (Zhuxian B) Sbti + GNA Leaf folder + BPH Li et al. (2005)
Indica rice Cry1Ab, Cry1Ac, gna YSB Ramesh et al. (2004)
Indica rice Cry1Ab, Cry1Ac YSB Alcantara et al. (2004)
Indica rice Cry1Ac, Cry2A, gna Lepidopteron insects Rahman et al. (2007)
Indica rice Chitinase + β-1,3- Rhizoctonia solani Sridevi et al. (2008)
glucanase genes
Rape hrf2 gene encoding Sclerotinia Ma et al. (2008)
harpinxooc protein sclerotinorium
Tobacco p35 gene from baculo- TMV a Wang et al. (2008)
virus Autographa
californica
Japonica Pi-d2 Rice leaf blast and Chen et al. (2010)
neck blast
Tobacco GbTLP1 Verticillium dahliae Munis et al. (2010)
Potato StPUB17 (UND/PUB/ Phytophthora Ni et al. (2010)
ARM) repeat type infestans
gene
Potato RB resistance gene Potato late blight Liu and Halterman
(2009)
Wheat Ta-Tlp (thaumatin- Powdery mildew and Xing et al. (2008)
like protein gene) Fusarium head
blight
a
YSB yellow stem borer, TMV tobacco mosaic virus
and microbial insecticides, spider toxins and insect peptide hormone have been dis-
covered (Whetstone and Hammock 2007; Van Damme 2008). For instance, bacte-
rium Photorhabdus luminescens produces photorhabdus toxin, which is an alterna-
tive to Bt for transgenic production. And the combination of photorhabdus toxins
and Bt toxins in transgenic crops can be used to fight insect resistance. US based
company Monsanto with India’s Maharastra Hybrid Seeds Company (Mahyco) has
recently developed a Bt eggplant ( Solanum melongena) by incorporating a crystal
gene (Cry1Ac) from B. thuringiensis (Krattiger 2010; Cotter 2011).
Disease Resistance
Diseases caused by bacteria, fungi, viruses and nematodes are responsible for dam-
aging the crop plants, i.e phytopathogens have been threatening human life through
the loss of crop production. For example the production of potato has been threat-
ened by several fungal diseases and microbial pathogens resulting in 20 % yield
loss (Walter et al. 2011). Even though in potato the Botrytis cinerea is not the main
disease, it may cause other serious diseases like Fusarium solani and Phytophthora
infestans. But the transgenic approaches have used the genes encoding pathogenesis
related (PR) proteins that confer the resistance to fungal pathogens (Hoshikawa
et al. 2012; Gao et al. 2000) (Table 3.1). These PR proteins have antimicrobial
properties against many fungal and bacterial pathogens. Transgenic approaches pro-
vide a powerful tool for the development of disease resistant crops (Melchers and
Stuiver 2000; Rommens and Kishor 2000; Ellis et al. 2000). One approach involves
the viral gene expression that interferes with the completion of life cycle of viruses.
Powell-Abel et al. 1986 discovered that the coat proteins for TMV (tobacco mosaic
virus) expressed in host plant interfered with the replication and plants expressing
the TMV coat protein gene were resistant to TMV infection. This approach is now
widely used to protect the crops from a large number of viruses (Mundembe et al.
2009). In 1992, china was the first country to commercialize these virus resistant
transgenic crops (Brookes and Barfoot 2012; James 1997). After this virus-resis-
tant tomato, squash and watermelon plants were also produced (Meeusen 1996).
In oilseed rape, overexpression of tomato chitinase gene with a strong promoter
gene has resulted increased resistance fungal attack in plants (i.e pathogens such as
Cylindrosporium concentricum and Phoma lingam) (Grison et al. 1996). Anand
et al. (2003) reported that wheat plants co-expressing a chitinase and β-1, 3-glu-
canase genes obtained to Fusarium graminearum. And under the green house and
field conditions, transgenic potato plants expressing alfalfa antifungal peptide (al-
fAEP) showed strong defense activity against fungal pathogen, Verticillium dahliae
(Gao et al. 2000). Thionins (PR proteins) are toxic to phytopathogens by attacking
the cell membrane to increase their permeability and cause the death of the fungal
cell due to leakage of proteins, nucleotides and other components (Chan et al. 2005;
Hoshikawa et al. 2012). For example, overexpressed gamma-thionin gene from
wasabi ( Eutrema wasabi) in transgenic rice enhanced resistance to rice blast disease
caused by Magnaporthe grisea (Kanzaki et al. 2002). Even in transgenic potato
plants, potato thionin (snaking-1) gene expressed enhanced resistance to Rhizocto-
nia solani and Erwinia cartovora (Almasia et al. 2008). The wasabi thionin gene in
transgenic potato plants had antifungal activity against gray mold ( Botrytis cinerea)
(Khan et al. 2006; Hoshikawa et al. 2012). Another disease that adversely affect the
barely and wheat production is Fusarium head blight (FHB). Fusarium produced
trichothecene mycotoxin deoxynivalenol (DON) contamination with food is a great
risk for humans and animals because trichothecenes are cytotoxins for eukaryotic
cell. Recently, Di et al. (2010) has verified that expression of an N-terminal frag-
ment of yeast L3 (L3∆) in wheat showed reduction in disease ruthlessness and im-
proved level of DON in transgenic wheat kernel when compared to non-transgenic
wheat plants. Trichothecenes play multiple roles in the cell. They inhibit the protein
synthesis (McLaughlin et al. 2009; Di et al. 2010). Critical role of trichothecene
mycotoxin (tcmI) in the protein synthesis (Grant et al. 1976), which encodes the
ribosomal protein L3 in yeast was observed by McLaughlin et al. (2009). Over-
expression of RPL3 gene in transgenic plants induces resistance to trichothecene
mycotoxin deoxynivalenol (DON) (McLaughlin et al. 2009).
Herbicide Resistance
Effective weed control has become one of the most important procedures in crop-
ping operations to ensure good quality harvest. But the required mechanical weed
control practices are now viewed as unsatisfactory and have been replaced by
chemical weed control using herbicides. Herbicides are vicious for most of the
plants because they function by disrupting the essential processes like photosyn-
thesis, pigment biosynthesis, mitosis or essential amino acid biosynthesis (Mulwa
and Wanza 2006). Now a day these herbicides have been replaced by new chemi-
cals like glyphosate that is environmental friendly as it is degraded rapidly by soil
micro-organisms (Day 1996). Glyphosate a highly translocated foliar herbicide was
discovered in 1970 (Franz et al. 1996). Glyphosate is a non specific herbicide like
many other herbicides and kills the green plants, therefore it can be used prior to
seed emergence. Plants expressing herbicide tolerance accounted for 71 % of all the
transgenic crops were grown worldwide in 1998 and 1999 (James 1999). Herbicide
tolerant soybean, corn, cotton and canola represents the major transgenic products
(James 1999; Liu 1999). Scientists in 1983, at Monsanto and Washington University
isolated the common soil bacteria, Agrobacterium tumefaciens strain CP4, which is
highly tolerant to glyphosate because its EPSPS (5-enolpyruvylshikimate-3-phos-
phate synthase) is less sensitive to inhibition by glyphosate than EPSPS found in
plants (Watrud et al. 2004). In 1986, they successfully inserted the CP4 EPSPS gene
into the plant genome and obtained the glyphosate resistant (GR) plants. GR soy-
bean was commercialized within 10 years. Initial GR crops were the most quickly
adopted technology in the history of agriculture (James 2007).
Recently, herbicide resistant Amaranthus palmeri by expressing glyphosate-in-
sensitive herbicide target site gene, 5-enolpyruvylshikimate-3-phosphate synthase
(EPSP) that is involved in the shikimate cycle where it catalyzes the reversible addi-
tion of the enolpyruvyl moiety of phosphor-enolpyruvate to shikimate 3-phosphate
was developed (Gaines et al. 2010). In the western and central Africa considerable
loss of maize was observed by a parasitic weed Striga hermonthica. Menkir et al.
(2010) incorporated an imidazolinone resistance (IR) XA17 gene into some maize
lines that confers resistance to imazaquin and nicosulfuron herbicides. These IR-
maize lines showed resistance to the Striga hermonthica weed and the yield loss
was minimized to a considerable level. The expression of bar gene responsible for
resistance to herbicides in sweet potato was demonstrated by Zang et al. (2009).
Approaches that have been used to generate herbicide-tolerant crops are: (1)
Decrease the sensitivity of the plants to the herbicide by modifying the sensitivity of
the target enzyme and (2) engineer a herbicide detoxifying pathway in to the plant
(Simoens and Van Montagu 1995). For instance glyphosate and acifluoren tolerance
is included in first approach. Transgenic plants tolerant to the herbicide acifluorfen,
which inhibits chlorophyll biosynthesis, have been produced through overexpres-
sion of the target enzyme involved in chlorophyll biosynthesis (Lermontova and
Grimm 2000; Ahmad et al. 2012). Second approach includes the resistance to glu-
fosinate and bromoxynil. To enhance the metabolism of these herbicides various
genes were introduced and the active compound is converted to products are non-
toxic to the crop (Haumann 1997; Ahmad et al. 2012). Now the critics of herbicide
resistant crops fear the over use of herbicides and the development of herbicide
resistant weeds. But the herbicide resistant weeds can be controlled by rotating the
crops with different transgenic modes of action. Various environmentally friendly
herbicides and their corresponding resistant genes are available that makes crop
rotation practices possible.
Abiotic Stress
Abiotic stress (Salinity, drought, temperature, UV Radiations etc.) has been found
to have negative impact on the crop production. The crop loss due to these abiotic
stresses is responsible for the enormous economic loss worldwide (Ahmad et al.
2008, 2010, 2012).
Conventional breeding techniques have been used to improve the crop produc-
tion but much success has not been achieved in generating stress tolerant plants.
Plant biologists have developed transgenic technology to generate stress tolerant
plants and to improve the crop production. Modification of the biochemical path-
ways through the transgenic approach and overexpression of the stress tolerant
genes have great success in achieving the target of generating stress tolerant plants.
For further information see Table 3.2.
Conclusions and Future Perspectives
Plant tissue culture has emerged as an inescapable tool with possibilities for comple-
menting the conventional methods in plant breeding and crop improvement. These
techniques have proved successful and are now being used globally for the ex-situ
conservation of the plants including crop plants. Plant cell/tissue culture is a rapidly
Table 3.2 Some promising genes that can be expressed in plants for abiotic stress tolerance
Gene and gene product Plant Resistance to Reference
betA (Choline Tobacco Salinity and low Holmstrom et al.
dehydrogenase) temperature (2000)
BADH1 (Betaine aldehyde Tomato Salinity Jia et al. (2002)
dehydrogenase)
EctA, ectB, ectC Tobacco Salinity Nakayama et al.
(2000)
OstA, OstB (Trehalose-6-P Tobacco rice Salt, drought Garg et al. (2002)
synthase, Trehalose-6-P
phosphatase)
TPS and TPP (Trehalose Arabidopsis Drought, salt, Miranda et al. (2007)
synthesis) temperature
TPP1 (Trehalose synthesis) Rice Salt and cold Ge et al. (2008)
TPS1 (Trehalose synthesis) Alfalfa Drought, salt, Suarez et al. (2009)
temperature
WCOR15 (cold induced Tobacco Freezing Shimamura et al.
gene) (2006)
AtOAT (Ornithine amino Rice Drought and salt Jang et al. (2003)
transferase)
pdc1 (Pyruvate decarboxylase Rice Submergence Minhas and Grover
overexpression) tolerance (1999)
pdc1 and pdc2 (Pyru- Arabidopsis Hypoxic stress Ismond et al. (2003)
vate decarboxylase survival
overexpression)
ppo (Polyphenol oxidases Tomato Drought Thipyapong et al.
suppression) (2004)
SAMDC (polyamine Tobacco Drought, salinity, Waie and Rajam
synthesis) Verticillium, (2003)
Fusarium wilts
SPDS (Spermidine synthase) Arabidopsis Salinity Bagni et al. (2006)
P5CS (∆1-pyrroline-5-carbox- Bean Drought, salt and cold Chen et al. (2009)
ylate synthase)
P5CS (∆1-pyrroline-5-carbox- Potato Salt Hmida-Sayari et al.
ylate synthase) (2005)
P5CS (∆1-pyrroline-5-carbox- Wheat Drought Vendruscolo et al.
ylate synthase) (2007)
adc (polyamine synthesis) Rice Drought Capell et al. (2004)
Osm1 to Osm4 (Osmotin Strawberry Salt and drought Husaini and Abdin
protein accumulation) (2008)
ME-leaN4 (Lea protein) Lettuce Salt Park et al. (2005)
Os LEA3-1 (Lea protein) Rice Drought Xiao et al. (2007)
HVA1 (group 3 LEA protein Mulberry Salt and drought Lal et al. (2008)
gene)
BhLEA1, LEA2 (LEA Tobacco Drought Liu et al. (2009)
protein)
HAL3 (FMN-binding Arabidopsis Salt and osmotic Espinosa-Ruiz et al.
protein) tolerance (1999)
HAL1 Arabidopsis Salt Ellul et al. (2003)
Table 3.2 (continued )

HAL1 Watermelon Salt Yang et al. (2001)
OsDREB1A Arabidopsis Drought, salt and cold Dubouzet et al. (2003)
tolerance
DREB1A (Transcription Paspalum Drought James et al. (2008)
factor) grass
DREB1A (Transcription Tobacco Salt Cong et al. (2008)
factor)
DREB1A, DREB2A (Tran- Arabidopsis Drought and cold Maruyama et al.
scription factor) (2009)
OsNAC10 (Transcription Rice Drought Jeong et al. (2010)
factor)
OsSMCP1 (Transcription Arabidopsis Salt Yokotani et al. (2009)
factor)
Osmyb4 (Cold induced tran- Apple Drought and cold Pasquali et al. (2008)
scription factor) tolerance
A1fin1 (Transcription factor) Alfalfa Salt Winicov (2000)
OrbHLH2 (Transcription Arabidopsis Salt and osmotic Zhou et al. (2009)
factor) stress
OsWRKY45 (Transcription Arabidopsis Drought Qiu and Yu (2009)
factor)
Tsi1 (EREBP/AP2 DNA Tobacco Salt and pathogen Park et al. (2001)
binding motif)
CBF1 (DREB1B) Tomato Drought Hsieh et al. (2002)
CBF4 Arabidopsis Drought Haake et al. (2002)
ABF3/ABF4 Arabidopsis Drought Kang et al. (2002)
AtMYC2/AtMYB2 Arabidopsis Drought Abe et al. (2003)
ZPT2-3 (Cys2/His2-type Petunia Drought Sugano et al. (2003)
Zinc-finger protein)
CpMYB10 Arabidopsis Drought and salt Villalobos et al.
(2004)
FeSOD (Superoxide Tobacco Salt and oxidative Van Camp et al.
dismutase) stress (1996)
MnSOD Arabidopsis Oxidative stress Wang et al. (2004)
MnSOD Rice Oxidative stress Tanaka et al. (1999)
Glutathione-S-transferase/ Tobacco Salt and cold Roxas et al. (1997)
glutathione peroxidase
KatE (Catalase) Tobacco Salt and oxidative Al-Taweel et al.
stress (2007)
DHAR1 (Dehydroascorbate Arabidopsis Salt tolerance Ushimaru et al. (2006)
reductase)
AtALDH3 (Aldehyde Arabidopsis Drought, salt and Sunkar et al. (2003)
dehydrogenase) oxidative stress
MsALR (Aldose/aldehyde Alfalfa Drought and heavy Oberschall et al.
reductase) metal (2000)
Ascorbate peroxidise Tobacco Drought and salt Badawi et al. (2004)
GlyI and GlyII (Glyoxylase) Tobacco Salt Yadav et al. (2005)
OsCDPK (calcium dependent Rice Drought and salt Saijo et al (2000)
protein kinase)
Table 3.2 (continued )

Cnb1 (Calcineurin) Tobacco Salt Pardo et al (1998)
DnaK (Heat shock proteins) Tobacco Salt Sugino et al. (1999)
AtHsp 17.6A (Small heat Arabidopsis Drought and salt Sun et al (2001)
shock protein)
AtGSK1 Arabidopsis Drought and Salt Piao et al (2001)
AtNDPK2 (Nucleotide Arabidopsis Salt, cold, methyl Moon et al. (2002)
diphosphate kinase) viologen
AtNHX1 (Vacuolar Na+/H+ Tomato Salt Zhang and Blumwald
antiporter) (2001)
AtNHX1 (Vacuolar Na+ /H+ Mustard Salt Zhang et al. (2001)
antiporter)
AtNHX1 (Vacuolar Na+ /H+ Rice Salt Ohta et al. (2002)
antiporter)
SOS1 (Plasma membrane Arabidopsis Salt Shi et al. (2003)
Na+/H+ antiporter)
AVP1 (K+ /Na+ transport Arabidopsis Drought and salt Gaxiola et al. (2001)
regulation)
CaXTH3 (Xyloglucan Arabidopsis Drought and salt Cho et al. (2006)
endotransglucosylase)
ZmOPR1 (12-Oxo-Phytodie- Arabidopsis Osmotic and salt Gu et al. (2008)
noic acid reductases) stress
SPCP2 (papain-like cysteine Arabidopsis Salt and drought Chen et al. (2010)
protease)
W6 (Ethylene responsive fac- Tobacco Salt tolerance Lu et al. (2010)
tor gene)
TSRF1 (Ethylene responsive Rice Drought Quan et al. (2010)
factor)
TERF2/LeERF2 (Ethylene Tomato Freezing Zhang and Huang
responsive factor) tobacco (2010)
StPUB17 (UND/PUB/ARM) Potato Salt tolerance Ni et al. (2010)
repeat type gene
developing technology which holds promise of restructuring agricultural, horticul-

tural and forestry practices. Cultured explants undergo frequent genetic changes
which are expressed at biochemical or molecular level. The genetic variability ex-
pressed in regenerated plants can be transmitted to the progeny through sexual or
vegetative propagation. Rapid advances in plant genetic engineering have made it
possible to improve endogenous metabolic pathways and/or bestow foreign func-
tions. Utilization of plants, however, is disturbed by environmental stresses such as
drought, high salinity, low temperature, and pathogens, which either directly cause
cell death or inhibit growth by disarranging the intracellular water balance. The
application of tissue culture technology as a central tool or as an adjunct to other
methods, including recombinant DNA techniques, is at the vanguard in plant modi-
fication and improvement for agriculture, horticulture and forestry.
References
Abe H, Urao T, Ito T, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Arabidopsis AtMYC2

(b-HLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signalling.
Plant Cell 15:63–78
Ahmad P, Sarwat M, Sharma S (2008) Reactive oxygen species, antioxidants and signaling in
plants. J Plant Biol 51(3):167−173
Ahmad P, Jaleel CA, Salem MA, Nabi G, Sharma S (2010) Roles of Enzymatic and non-enzymatic
antioxidants in plants during abiotic stress. Crit Rev Biotechnol 30(3):161–175
Ahmad P, Ashraf M, Younis M, Hu X, Kumar A, Akram NA, Al-Qurainy F (2012) Role of trans-
genic plants in agriculture and biopharming. Biotechnol Adv 30:524–540
Ahmadabadi M, Ruf S, Bock R (2007) A leaf-based regeneration and transformation system for
maize ( Zea mays L.). Transgenic Res 16:437–448
Alcantara EP, Aguda RM, Curtiss A, Dean DH, Cohen MB (2004) Bacillus thuringiensis
δ-endotoxin binding to brush border membrane vesicles of rice stem borers. Arch Insect Bio-
chem Physiol 55:169–177
Almasia NI, Bazzini AA, Hopp HE, Vazquez-Rovere C (2008) Overexpression of snakin-1 gene
enhances resistance to Rhizoctonia solani and Erwinia carotovora in transgenic potato plants.
Mol Plant Pathol 9:329–338
Al-Taweel K, Iwaki T, Yabuta Y, Shigeoka S, Murata N, Wadan AA (2007) Bacterial transgene for
catalase protects translation of D1 protein during exposure of salt-stressed tobacco leaves to
strong light. Plant Physiol 145:258–265
Anand A, Zhou T, Trick HN, Gill BS, Bockus WW, Muthukrishnan S (2003) Green-house and
field testing of transgenic wheat plants stably expressing genes for thaumatin-like protein,
chitinase and glucanase against Fusarium graminearum. J Exp Bot 54:1101–1111
Andrews RW, Fausr R, Wabiko MH, Roymond KC, Bulla LA (1987) Biotechnology of Bt: a criti-
cal review. Biotechnol 6:163–232
Atanassov A, Zagorska N, Boyadjiev P, Djilianov D (1995) In vitro production of haploid plants.
World J Microbiol Biotechnol 11:400–408
Azria D, Bhalla PL (2011) Agrobacterium-mediated transformation of Australian rice varieties and
promoter analysis of major pollen allergen gene, Ory s 1. Plant Cell Rep 30:1673–1681
Badawi GH, Kawano N, Yamauchi Y, Shimada E, Sasaki R, Kubo A, Tanaka K (2004) Overex-
pression of ascorbate peroxidase in tobacco chloroplasts enhances the tolerance to salt stress
and water deficit. Physiol Plant 121:231–237
Bagni N, Ruiz-Carrasco K, Franceschetti M, Fornalè S, Fornasiero RB, Tassoni A (2006) Poly-
amine metabolism and biosynthetic gene expression in arabidopsis thaliana under salt stress.
Plant Physiol Biochem 44:776–786
BANR (Board on Agriculture and Natural Resources) (2000) Genetically modified pest protected
plant: science and regulation. Committee on genetically modified pest protected plants. Na-
tional Research Council, National Academy Press, Washington, p 292
Bashir K, Husnain T, Fatima T, Riaz N, Makhdoom R, Riazuddin S (2005) Novel indica basmati
line (B-370) expressing two unrelated genes of Bacillus Thuringiensis is highly resistant to two
lepidopteran insects in the field. Crop Protection 24:870–879
Bhatnagar M, Prasad K, Bhatnagar-Mathur P, Narasu ML, Waliyar F, Sharma KK (2010) An effi-
cient method for the production of marker-free transgenic plants of peanut ( Arachis hypogaea
L.). Plant Cell Rep 29:495–502
Bhutani S, Kumar R, Chauhan R, Singh R, Choudhury VK, Choudhury JB (2006) Development
of transgenic indica rice plants containing potato proteinase inhibitor 2 gene with improved
defense against yellow stem borer. Physiol Mol Biol Plant 12:43–52
Brookes G, Barfoot P (2011) Global impact of biotech crops: environmental effects 1996–2009.
Lands Biosci 2:34–49
Brookes G, Barfoot P (2012) GM crops: global socio-economic and environmental impacts 1996–
2010. Dorchester, UK
Brown DCW, Thorpe TA (1996) Crop improvement through tissue culture. World J Microbiol
Budzianowska A (2009) In-vitro cultures of tobacco and their impact on development of plant
biotechnology. Biotechnol Adv 25:223–243
Cantrill LC, Overall RL, Goodwin PB (2005) Changes in macromolecular movement accompany
organogenesis in thin cell layers of Torenia fournieri. Planta 222:933–946
Capell T, Bassie L, Christou P (2004) Modulation of the polyamine biosynthetic pathway in trans-
genic rice confers tolerance to drought stress. PNAS 101:9909–9914
Chan YL, Prasad V, Sanjaya C, Chen KH, Liu PC, Chan MT, Cheng CP (2005) Transgenic tomato
plants expressing an Arabidopsis thionin (i2.1) driven by fruit-inactive promoter battle against
phytopathogenic attack. Planta 221:386–393
Chandel G, Datta K, Datta SK (2010) Detection of genomic changes in transgenic Bt rice popula-
tions through genetic fingerprinting using amplified fragment length polymorphism (AFLP).
GM Crops 1:327–336
Chen H, Tang W, Xu C, Li X, Lin Y, Zhang Q (2005) Transgenic indica rice plants harboring a syn-
thetic cry2A* gene of Bacillus thuringiensis exhibit enhanced resistance against lepidopteran
rice pests. Theor Appl Genet 111:1330–1337
Chen H, Zhang G, Zhang Q, Lin Y (2008) Effect of transgenic Bacillus thuringiensis rice lines on
mortality and feeding behavior of rice stem borers (Lepidoptera: Crambidae). J Econ Entomol
101:182–189
Chen HJ, Su CT, Lin CH, Huang GJ, Lin YH (2010) Expression of sweet potato cysteine protease
SPCP2 altered developmental characteristics and stress responses in transgenic Arabidopsis
plants. J Plant Physiol 167:838–847
Chen JB, Wang SM, Jing RL, Mao XG (2009) Cloning the PvP5CS gene from common bean
( Phaseolus vulgaris) and its expression patterns under abiotic stresses. J Plant Physiol 166:12–19
Chen ZY, Brown RL, Damann KE, Clevel TE (2010) PR10 expression in maize and its effect on
host resistance against Aspergillus flavus infection and aflatoxin production. Mol Plant Pathol
11:69–81
Cho SK, Kim JE, Park JA, Eom TJ, Kim WT (2006) Constitutive expression of abiotic stress-
inducible hot pepper CaXTH3, which encodes a xyloglucan endotransglucosylase/hydrolase
homolog, improves drought and salt tolerance in transgenic Arabidopsis plants. FEBS Letters
580:3136–3144
Chougule NP, Bonning BC (2012) Toxins for transgenic resistance to hemipteran pests. Toxins
4:405–429
Cohen BM, Gould F, Bentur JC (2000) Bt rice: practical steps to sustainable use. Int Rice Res
25:4–10
Cong L, Zheng HC, Zhang YX, Chai TY (2008) Arabidopsis DREB1A confers high salinity toler-
ance and regulates the expression of GA dioxygenases in tobacco. Plant Sci 174:156–164
Cotter J (2011) Genetically engineered (GE) Bt egg-plant (talong): health risks, environ-
mental impacts and contamination from field trials. Greenpeace Breifing, GRL-TN-02.
http://gaia-health.com/articles451/000460-greenpeacebt.pdf
Davey MR, Anthony P, Power JB, Lowe KC (2005) Plant protoplasts: status and biotechnological
perspectives. Biotechnol Adv 23:131–171
Davis J, Reznikoff WS (1992) Milestones in biotechnology. Classic papers on genetic engineering.
Boston Butterworth Heinemann, Boston
Di R, Blechl A, Dill-Macky R, Tortora A, Tumer NE (2010) Expression of a truncated form of
yeast ribosomal protein L3 in transgenic wheat improves resistance to fusarium head blight.
Plant Sci 178:374–380
Ding F, Jin S, Hong N, Zhong Y, Cao Q, Yi G, Wang G (2008) Vitrification-cryopreservation, an
efficient method for eliminating Candidatus liberobacter asiaticus, the citrus Huanglongbing
pathogen, from in-vitro adult shoot tips. Plant Cell Rep 27:241–250
Doi H, Yokoi S, Hikage T, Nishihara M, Tsutsumi KI, Takahata Y (2011) Gynogenesis in gentians
(Gentiana triflora, G. scabra): production of haploids and doubled haploids. Plant Cell Rep
30:1099–1096
Doran PM (2009) Application of plant tissue cultures in phytoremediation research: incentives and
limitations. Biotechnol Bioeng 103:60–76
Dresselhaus T, Lausser A, Marton ML (2011) Using maize as a model to study pollen tube growth
and guidance, cross-incompatibility and sperm delivery in grasses. Ann Bot 108:727–737
Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet EG, Miura S, Seki M, Shinozaki K, Yamagu-
chi-Shinozaki K (2003) OsDREB genes in rice, ( Oryza sativa L.) encode transcription activa-
tors that function in drought, high salt and cold responsive gene expression. Plant J 33:751–763
Ellis J, Dodds P, Pryor T (2000) Structure, function and evolution of plant disease resistance genes.
Curr Opin Plant Biol 3:278–284
Ellul P, Rios G, Atares A, Roig LA, Serrano R, Moreno V (2003) The expression of the Saccha-
romyces cerevisiae HAL1 gene increases salt tolerance in transgenic watermelon ( Citrullus
lanatus (Thunb.) Matsun. & Nakai.). Theor Appl Genet 107:462–469
Espinosa-Ruiz A, Belles JM, Serrano R, Culianez-Macia FA (1999) Arabidopsis thaliana AtHAL3:
a flavoprotein related to salt and osmotic tolerance and plant growth. Plant J 20:529–539
Franz JE, Mao MK, Sikorski JA (1996) Glyphosate: a unique global pesticide. American Chemical
Society, Washington, p 653
Gaines TA, Zhang W, Wang D, Bukun B, Chisholm ST, Shaner DL, Nissen SJ, et al. (2010) Gene
amplification confers glyphosate resistance in Amaranthus palmeri. Proc Nat Acad Sci USA
107:1029–1034
Gao AG, Hakimi SM, Mittanck CA, Wu Y, Woerner BM, Stark DM, Shah DM, Liang J, Rommens
CMT (2000) Fungal pathogen protection in potato by expression of a plant defensin peptide.
Nat Biotechnol 18:1307–1310
Garg AK, Kim JK, Owens TG, Ranwala AP, Choi YD, Kochian LV, Wu RJ (2002) Trehalose
accumulation in rice plants confers high tolerance levels to different abiotic stresses. PNAS
99:15898–15903
Gaxiola R, Li J, Undurraga S, Dang LM, Allen GJ, Alper SL, Fink GR (2001) Drought and salt
tolerant plants result from overexpression of the AVP1 H + pump. Proc Nat Acad Sci USA
98:11444–11449
Ge LF, Chao DY, Shi M, Zhu MZ, Gao JP, Lin HX (2008) Overexpression of the trehalose-6-phos-
phate phosphatase gene OsTPP1 confers stress tolerance in rice and results in the activation of
stress responsive genes. Planta 228:191–201
Goudar G, Alagawadi GAR, Krishnaraj PU, Basavana Goud K (2012) Characterization of Bacil-
lus thuringiensis isolates of Western Ghats and their insecticidal activity against diamond back
moth ( Plutella xylostella L.). Karnataka J Agric Sci 25(2):199–202
Grant PG, Schindler D, Davies JE (1976) Mapping of trichodermin resistance in Saccharomyces
cerevisiue: a genetic locus for a component of the 60s ribosomal subunit. Genetics 83:667–673
Grison R, Grezes-Besset B, Schneider M, Lucante N, Olsen L, Leguay JJ, Toppan A (1996) Field
tolerance to fungal pathogens of Brassica napus constitutively expressing a chimeric chitinase
gene. Nat Biotechnol 14:643–646
Gu D, Liu X, Wang M, Zheng J, Hou W, Wang G, Wang J (2008) Overexpression of ZmOPR1 in
Arabidopsis enhanced the tolerance to osmotic and salt stress during seed germination. Plant
Sci 174:124–130
Haake V, Riechmann JLCD, Pineda O, Thomashow MF, Zhang JZ (2002) Transcription factor
CBF4 is a regulator of drought adaptation in Arabidopsis. Plant Physiol 130:639–648
Hajari E, Berjak P, Pammenter NW, Watt MP (2011) A novel means for cryopreservation of germ-
plasm of the recalcitrant-seeded species, Ekebergia capensis. Cryo Letters 32:308–316
Hancock CN, Kent L, McClure BA (2005) The stylar 120 kDa glycoprotein is required for
S-specific pollen rejection in Nicotiana. Plant J 43:716–723
Haumann BE (1997) Bioengineered oilseed acreage escalating. Inform 8:804–811
Henning L, Gruissem W, Grossniklaus U, Kohler C (2004) Transcriptional programs of early re-
productive stages in arabidopsis. Plant Physiol 135:1765–1775
Hernández-Campuzano B, Suárez R, Lina L, Hernández V, Villegas E, Corzo G, Iturriaga G (2009)
Expression of a spider venom peptide in transgenic tobacco confers insect resistance. Toxicon
53:122–128
Herrnstadt C, George GS, Edward WR, David L (1986) A new strain of Bacillus thuringiensis with
activity against coleopteran insects. Nat Biotechnol 4:305–308
Hmida-Sayari A, Gargouri-Bouzid R, Bidani A, Jaoua L, Savouré A, Jaoua S (2005) Overexpres-
sion of Δ1-pyrroline-5-carboxylate synthetase increases proline production and confers salt tol-
erance in transgenic potato plants. Plant Sci 169:746–752
Ho NH, Baisakh N, Oliva N, Datta K, Frutos R, Datta SK (2006) Translational fusion hybrid Bt
genes confer resistance against yellow stem borer in transgenic elite vietnamese rice ( Oryza
sativa L.) Cultivars. Crop Sci 46:781–789
Holmstrom KO, Somersalo S, Manda A, Palva TE, Welin B (2000) Improved tolerance to salinity
and low temperature in transgenic tobacco producing glycine betaine. J Exp Bot 51:177–185
Hoshikawa K, Ishihara G, Takahashi H, Nakamura I (2012) Enhanced resistance to gray mold
(Botrytis cinerea) in transgenic potato plants expressing thionin genes isolated from Brassica-
ceae species. Plant Biotechnol 29:87−93
Hsieh TH, Lee JT, Charng YY, Chan MT (2002) Tomato plants ectopically expressing Arabidopsis
CBF1 show enhanced resistance to water deficit stress. Plant Physiol 130:618–626
Husaini AM, Abdin MZ (2008) Overexpression of tobacco osmotin gene leads to salt stress toler-
ance in strawberry ( Fragaria x ananassa Duch.) plants. Indian J Biotechnol 7:465–472
Hussain A, Hasnain S (2012) Comparative assessment of the efficacy of bacterial and cyanobacte-
rial phytohormones in plant tissue culture. World J Microbiol Biotechnol 28:1459–1466
Hussain AM, Rashid Z, Mir RU, Aquil B (2011) In vitro cultures of tobacco and their impact on
development of plant biotechnology. GM Crops 2:150–162
Ingram GC (2010) Family life at close quarters: communication and constraint in angiosperm seed
development. Protoplasma 247:195–214
Islam SM, Tuteja N (2012) Enhancement of and rogenesis by abiotic stress and other pretreatments
in major crop species. Plant Sc 182:134–144
Ismond KP, Dolferus R, Pauw MD, Dennis ES, Good AG (2003) Enhanced low oxygen survival
in arabidopsis through increased metabolic flux in the fermentative pathway. Plant Physiol
132:1292–1302
Jain M, Chengalrayan K, Abouzid A, Gallo M (2007) Prospecting the utility of a/MI/mannose se-
lection system for the recovery of transgenic sugarcane (Saccharum spp. hybrid) plants. Plant
Cell Rep 26:581–590
James C (1997) Global status of transgenic crops in 1997. Int Service Acquisition Agric biotechnol
Appl 5:1–30
James C (1999) Global review of commercialized transgenic crops in 1999. Int Service Acquisi-
tion Agric Biotechnol Appl 12:1–7
James C (2007) Global Status of Commercialized Biotech/GM Crops. http://www.isaaa.org/re-
sources/publications/briefs/
James C (2010) A global overview of biotech (GM) crops, adoption, impact and future prospects.
GM Crops 1:8–12
James VA, Neibaur I, Altpeter F (2008) Stress inducible expression of the DREB1A transcrip-
tion factor from xeric, Hordeum spontaneum L. in turf and forage grass ( Paspalum notatum
Flugge) enhances abiotic stress tolerance. Transgenic Res 17:93–104
Jang IC, Oh SJ, Seo JS, Choi WB, Song SI, Kim CH, Kim YS, Seo HS, Choi YD, Nahm BH, Kim
JK (2003) Expression of a bifunctional fusion of the Escherichia coli genes for trehalose-6-
phosphate synthase and trehalose-6-phosphate phosphates in transgenic rice plants increases
trehalose accumulation and abiotic stress tolerance without stunting growth. Plant Physiol
131:516–524
Jeong JS, Kim YS, Baek KH, Jung H, Ha SW, Choi YD, Kim M, Reuzeau C, Kim JK (2010) Root
specific expression of OsNAC10 improves drought tolerance and grain yield in rice under field
drought conditions. Plant Physiol 153:185–197
Jia GX, Zhu ZQ, Chang FQ, Li YX (2002) Transformation of tomato with the BADH gene from
atriplex improves salt tolerance. Plant Cell Rep 21:141–146
Kang J, Choi H, Im M, Kim SY (2002) Arabidopsis basic leucine zipper proteins that mediate
stress-responsive abscisic acid signaling. Plant Cell 14:343–357
Kanzaki H, Nirasawa S, Saitoh H, Ito M, Nishihara M, Terauchi R, Nakamura I (2002) Overex-

pression of the wasabi defensin gene confers enhanced resistance to blast fungus ( Magna-
porthe grisea) in transgenic rice. Theor Appl Genet 105:809–814
Karkonen A, Santanen A, Iwamoto K, Fukuda H (2011) Plant tissue cultures. Methods Mol Biol
715:1–20
Karp A (1994) Origins, causes and uses of variation in plant tissue cultures. In: Thorpe TA (ed)
Plant cell and tissue culture: methods and applications in agriculture. New York Academic
Press, pp 181–211
Khan RS, Nishihara M, Yamamura S, Nakamura I, Mii M (2006) Transgenic potatoes expressing
wasabi defensin peptide confer partial resistance to gray mold ( Botrytis cinerea). Plant Bio-
technol 23:179–183
Kim S, Kim C, Li W, Kim T, Li Y, Zaidi MA, Altosaar I (2008) Inheritance and field performance
of transgenic Korean Bt rice lines resistant to rice yellow stem borer. Euphytica 164:829–839
Kota M, Daniell H, Varma S, Garczynski SF, Gould F, Moar WJ (1999) Overexpression of the
Bacillus thuringiensis (Bt) Cry2Aa2 protein in chloroplasts confers resistance to plants against
susceptible and Bt-resistant insects. Proc Natl Acad Sci USA 96:1840–1850
Krattiger A (2010) Intellectual property, commercial needs and humanitarian benefits: must there
be a conflict? New Biotechnol 27:573–577
Krishna H, Singh SK (2007) Biotechnological advances in mango ( Mangifera indica L.) and their
future implication in crop improvement: a review. Biotechnol Adv 25:223–243
Kumar M, Chimote V, SinghR, Mishra GP, Naik PS, PandeySk, Chakrabarti SK (2010) Develop-
ment of Bt transgenic potatoes for effective control of potato tuber moth by using cry1Ab gene
regulated by GBSS promoter. Crop Prot 29:121–127
Lal S, Gulyani V, Khurana P (2008) Overexpression of HVA1 gene from barley generates tolerance
to salinity and water stress in transgenic mulberry ( Morus indica). Transgenic Res 17:651–663
Lermontova I, Grimm B (2000) Overexpression of plastidic protoporphyrinogen IX oxidase leads
to resistance to the diphenyl-ether herbicide acifluorfen. Plant Physiol 122:75–84
Li G, Xu X, Xing H, Zhu H, Fan Q (2005) Insects resistance to nilaparvata lugens and cnepha-
locrosis medinalis in transgenic indica rice and the inheritance of gna + sbtitransgenes. Pest
Manag Sci 61:390–396
Lin M, Wu Q, Zheng S, Tian H (2011) Tissue culture and polyploidy induction of morinda offici-
nalis. Zhongguo Zhong Yao Za Zhi 36:2325–2328
Liu K (1999) Biotech crops: products, properties, and prospects. Food Technol 53:42–48
Liu X, Wang Z, Wang L, Wu R, Phillips J, Deng X (2009) LEA 4 group genes from the resurrec-
tion plant Boea hygrometrica confer dehydration tolerance in transgenic tobacco. Plant Sci
176:90–98
Liu Z, Halterman D (2009) Analysis of proteins differentially accumulated during potato late
blight resistance mediated by the RB resistance gene. Physiol Mol Plant Pathol 74:151–160
Loyola-Vargas VM, Ochoa-Alejo N (2012) An introduction to plant cell culture: the future ahead.
Methods Mol Biol 877:1–8
Lu Y, Liu P, Xu ZS, Zhang RY, Liu L, Li LC, Chen M, Ye XG, Chen YF, Ma YZ (2010) Overex-
pression of W6 gene increases salt tolerance in transgenic tobacco plants. Acta Agron Sinica
34:984–990
Ma L, Huo R, Gao Xw, He D, Shao M, Wang Q (2008) Transgenic Rape with hrf2 Gene Encoding
HarpinXooc Resistant to Sclerotinia sclerotinorium. Agricul Sci China 7:455–461
Marimuthu MP, Jolivet S, Ravi M, Pereira L, Davda JN, Cromer L, Wang L, Noque F, Chan SW,
Siddiqi I, Mercier R (2011) Synthetic clonal reproduction through seeds. Science 331:876
Maruyama K, Takeda M, Kidokoro S, Yamada S, Sakuma Y, Urano K, Fujita M, Yoshiwara K,
Matsukura S, Morishita Y, Sasaki R, Suzuki H, Saito K, Shibata D, Shinozaki K, Yamaguchi-
Shinozaki K (2009) Metabolic pathways involved in cold acclimation identified by integrated
analysis of metabolites and transcripts regulated by DREB1A and DREB2A. Plant Physiol
150:1972–1980
McLaughlin JE, Bin-Umer MA, Tortora A, Mendez N, McCormick S, Tumera NE (2009) A ge-
nome-wide screen in saccharomyces cerevisiae reveals a critical role for the mitochondria in
the toxicity of a trichothecene mycotoxin. Proc Natl Acad Sci 106:21883–21888
Meeusen RL (1996) Commercialization of transgenic seed products: two case studies. In: Collins
GB, Shepherd RJ (eds) Engineering plants for commercial products and applications. NY Acad
Sci, New York, pp 172–176
Meiyalaghan S, Barrell PJ, Jacobs JM, Conner AJ (2011) Regeneration of multiple shoots from
transgenic potato events facilitates the recovery of phenotypically normal lines: assessing a
cry9Aa2 gene conferring insect resistance. BMC Biotechnol 11:93
Melchers LS, Stuiver MH (2000) Novel genes for disease-resistance breeding. Curr Opin Plant
Biol 3:147–152
Menkir A, Chikoye D, Lum F (2010) Incorporating an herbicide resistance gene into tropical
maize with inherent polygenic resistance to control Striga hermonthica (Del.) Benth. Plant
Breed 129:385–392
Minhas D, Grover A (1999) Transcript levels of genes encoding various glycolytic and fermenta-
tion enzymes change in response to abiotic stresses. Plant Sci 146:41–51
Miranda JA, Avonce N, Suarez R, Thevelein JM, Dijck PV, Iturriaga G (2007) A bifunctional TPS–
TPP enzyme from yeast confers tolerance to multiple and extreme abiotic-stress conditions in
transgenic Arabidopsis. Planta 226:1411–1421
Moon H, Baek D, Lee B, Prasad DT, Lee SY, Cho MJ, Lim CO, Choi MS, Bahk J, Kim MO, Hong
JC, Yun DJ (2002) Soybean ascorbate peroxidase suppresses Bax-induced apoptosis in yeast
by inhibiting oxygen radical generation. Biochem Biophys Res Commun 290:457–462
Mulwa RMS, Mwanza LM (2006) Biotechnology approaches to developing herbicide tolerance/
selectivity in crops. Afr J Biotechnol 5(5):396–404
Mundembe R, Matibiri A, Sithole-Niang I (2009) Transgenic plants expressing the coat protein
gene of cowpea aphid-borne mosaic potyvirus predominantly convey the delayed symptom
development phenotype. Afr J Biotechnol 8:2682–2690
Munis MFH, Tu L, Deng F, Tan J, Xu L, Xu S, LongL, Zhang X (2010) A thaumatin-like protein
gene involved in cotton fiber secondary cell wall development enhances resistance against
Verticillium dahliae and other stresses in transgenic tobacco. Biochem Biophy Res Commu
393:38–44
Munoz-Amatrian M, Svensson Jt, Castillo AM, Close TJ, Valles MP (2009) Microspore embryo-
genesis: assignment of genes to embryo formation and green vs. albino plant production. Funct
Integr Genomics 9:311–323
Mustafa NR, de Winter W, van Irene F, Verportee R (2011) Initiation, growth and cryopreservation
of plant cell suspension cultures. Nat Protoc 6:715–742
Nakayama H, Yoshida K, Ono H, Murooka Y, Shinmyo A (2000) Ectoine, the compatible solute of
Halomonas elongata, confers hyperosmotic tolerance in cultured tobacco cells. Plant Physiol
122:1239–1247
Ni X, Tian Z, Liu J, Song B, Li J, Shi X, Xie C (2010) StPUB17, a novel potato UND/PUB/
ARM repeat type gene, is associated with late blight resistance and NaCl stress. Plant Sci
178:158–169
Oberschall A, Deak M, Török K, Saa L, Vass I, Kovacs I, Feher A, Dudits D, Horvath GV (2000)
A novel aldose/aldehyde reductase protects transgenic plants against lipid peroxidation under
chemical and drought stresses. Plant J 24:437–446
Obert B, Zackova Z, Samaj J, Pretova A (2009) Doubled haploid production in Flax ( Linum usita-
tissimum L.). Biotechnol Adv 27:371–375
Ochatt SJ (2011) Immature seeds and embryos of Medicago truncatula cultured in vitro. Methods
Mol Biol 710:39–52
Ohta M, Hayashi Y, Nakashima A, Hamada A, Tanaka A, Nakamura T, Hayakawa T (2002) Intro-
duction of a Na+/H+ antiporter gene from Atriplex gmelini confers salt tolerance to rice. FEBS
Lett 532:279–282
Palanivelu R, Preuss D (2006) Distinct short-range ovule signals attract or repel Arabidopsis thali-
ana pollen tubes in vitro. BMC Plant Biol 6:1–7
Pardo JM, Reddy MP, Yang S, Maggio A, Huh GH, Matsumoto T, Coca MA, Paino-D’Urzo M,
Koiwa H, Yun DJ, Watad AA, Bressan RA, Hasegawa PM (1998) Stress signaling through
Ca2+/calmodulin dependent protein phosphatase calcineurin mediates salt adaptation in plants.
Proc Natl Acad Sci 95:9681–9686
Park BJ, Liu Z, Kanno A, Kameya T (2005) Increased tolerance to salt- and water-deficit stress in
transgenic lettuce ( Lactuca sativa L.) by constitutive expression of LEA. Plant Growth Regul
45:165–171
Park JM, Park CJ, Lee SB, Ham BK, Shin R, Paek KH (2001) Overexpression of the tobacco Tsi1
gene encoding an EREBP/AP2-type transcription factor enhances resistance against pathogen
attack and osmotic stress in tobacco. Plant Cell 13:1035–1046
Pasquali G, Biricolti S, Locatelli F, Baldoni E, Mattana M (2008) Osmyb4 expression improves
adaptive responses to drought and cold stress in transgenic apples. Plant Cell Rep 27:1677–
1686
Patel D, Power JB, Anthony P, Badakshi F, Pat Heslop-Harrison JS, Davey MR (2011) Somatic
hybrid plants of Nicotiana x sanderae (+) N. debneyi with fungal resistance to Peronospora
tabacina. Ann Bot 108:809–819
Piao HL, Lim JH, Kim SJ, Cheong GW, Hwang I (2001) Constitutive overexpression of AtGSK1
induces NaCl stress responses in the absence of NaCl stress and results in enhanced NaCl toler-
ance in Arabidopsis. Plant J 27:305–314
Pistelli L, Iacona C, Miano D, Crilli M, Colao MC, Mensuali-Sodi A, Muleo R (2012) Molecular
spectrum of somaclonal variation in regenerated rice revealed by whole genome sequencing.
Pons E, Peris JE, Pena L (2012) Field performance of transgenic citrus trees: assessment of the
long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and
phenotypic characteristics. BMC Biotechnol 12:41
Powell-Abel P, Nelson RS, De B, Hoffman H, Rogers SG, Fraley RT, Beachy RN (1986) Delay
of disease development in transgenic plants that express the tobacco mosaic virus coat protein
gene. Science 232:738–743
Qi YB, YeSH, Lu YT, Jin QS, Zhang XM (2009) Development of marker-free transgenic Cry1Ab
rice with lepidopteran pest resistance by Agrobacterium mixture-mediated co-transformation.
Rice Sci 16:181–186
Qiu Y, Yu D (2009) Overexpression of the stress-induced OsWRKY45 enhances disease resistance
and drought tolerance in Arabidopsis. Environ Exp Bot 65:35–47
Quan R, Hu S, Zhang Z, Zhang H, Zhang Z, Huang R (2010) Overexpression of an ERF transcrip-
tion factor TSRF1 improves rice drought tolerance. Plant Biotech J 8:476–488
Rahman M, Rashid H, Shahid AA, Bashir K, Husnain T, Riazuddin S (2007) Insect resistance and
risk assessment studies of advanced generations of basmati rice expressing two genes of Bacil-
lus thuringiensis. Elect J Biotech 10(2):240–251
Ramesh S, Nagadhara D, Reddy VD, Rao KV (2004) Production of transgenic indica rice resistant
to yellow stem borer and sap-sucking insects, using super-binary vectors of Agrobacterium
tumefaciens. Plant Sci 166:1077–1085
Ranganath RM (2011) Developmental switches that hold the key to a revolution in crop biotech-
nology. Nat Rev Genet 12:224
Redenbaugh K (1993) Synseeds: applications of synthetic seeds to crop improvement. CRC Press,
Boca Ratan FL
Riaz N, Husnain T, Fatima T, Makhdoom R, Bashir K, Masson L, Altosaar I, Riazuddin S (2006)
Development of Indica basmati rice harboring two insecticidal genes for sustainable resistance
against lepidopteran insects. South African J Bot 72:217–223
Rommens CM, Kishore GM (2000) Exploiting the full potential of disease-resistance genes for
agricultural use. Curr Opin Biotechnol 11:120–125
Roxas VP, Smith Jr RK, Allen ER, Allen RD (1997) Overexpression of glutathione-S-transferase/
glutathione peroxidase enhances the growth of transgenic tobacco seedlings during stress. Nat
Roy AK, Malaviya DR, Kaushal P (2011) Generation of interspecific hybrids of trifolium using
embryo rescue techniques. Methods Mol Biol 710:141–151
Saijo Y, Hata S, Kyozuka J, Shimamoto K, Izui K (2000) Overexpression of a single Ca2+ de-
pendent protein kinase confers both cold and salt/drought tolerance on rice plants. Plant J
23:319–327
Sanei M, Pickering R, Fuchs J, Banei Moghaddam AM, Dziurlikowska A, Houben A (2010) In-
terspecific hybrids of hordeum marinum ssp. marinum x H. bulbosum are mitotically stable
and reveal no gross alterations in chromatin properties. Cytogenet Genome Res 129:110–116
Sato M, Hosokawa M, Doi M (2011) Somaclonal variation is induced De Novo via the tissue cul-
ture process: a study quantifying mutated cells in Saintpaulia. Plos One 6:e23541
Schellenbaum P, Mohler V, Wenzel G, Walter B (2008) Variation in DNA methylation patterns of
grapevine somaclones ( Vitis vinifera L.). BMC Plant Biol 8:78
Segui-Simaro JM, Nuez F (2007) Embryogenesis induction, callogenesis and plant regeneration
by in vitro culture of tomato isolated microspores and whole anthers. J Exp Bot 58:1119–1132
Segui-Simaro JM, Corral-Martinez P, Parra-Vega V, Gonzalez-Garcia B (2011) Androgenesis in
recalcitrant solanaceous crops. Plant Cell Rep 30:765–778
She M, Yin G, Li J, Li X, Du L, Ma W, Ye X (2012) Efficient regeneration potential is closely
related to auxin exposure time and catalase metabolism during the somatic embryogenesis of
immature embryos in triticum aestivum L. Mol Biotechnol 4:213–217
Shefferson RP, Roach DA (2012) The triple helix of plantago lanceolata: genetics and the environ-
ment interact to determine population dynamics. Ecology 93:793–802
Shi H, Lee BH, Wu SJ, Zhu JK (2003) Overexpression of a plasma membrane Na+/H+ antiporter
gene improves salt tolerance in Arabidopsis thaliana. Nat Biotechnol 21:81–85
Shi HY, Zhang YX (2012) Pear ACO genes encoding putative 1-aminocyclopropane-1-carboxyl-
ate oxidase homologs are functionally expressed during fruit ripening and involved in response
to salicylic acid. Mol Biol Rep 12:19–26
Shimamura C, Ohno R, Nakamura C, Takumi S (2006) Improvement of freezing tolerance in
tobacco plants expressing a cold-responsive and chloroplast-targeting protein WCOR15 of
wheat. J Plant Physiol 163:213–219
Silva Rde C, Camillo J, Scherwinski-Pereira JE (2012) A method for seedling recovery in jatropha
curcas after cryogenic exposure of the seeds. Rev Biol Trop 60:473–482
Simoens C, Van Montagu M (1995) Genetic engineering in plants. Hum Reprod Update 1:523–542
Singh RK, Ali SA, Nath P, Sane VA (2011) Activation of ethylene-responsive p-hydroxyphenylpy-
ruvate dioxygenase leads to increased tocopherol levels during ripening in mango. J Exp Bot
62:3375–3385
Sridevi G, Parameswari C, Sabapathi N, Raghupathy V, Veluthambi K (2008) Combined expres-
sion of chitinase and β-1,3-glucanase genes in indica rice ( Oryza sativa L.) enhances resistance
against Rhizoctonia solani. Plant Sci 175:283–290
Suarez R, Calderon C, Iturriaga G (2009) Enhanced tolerance to multiple abiotic stresses in trans-
genic alfalfa accumulating trehalose. Crop Sci 49:1791–1799
Sugano S, Kaminaka H, Rybka Z, Catala R, Salinas J, Matsui K, Ohme-Tkagi M, Takatsuji H
(2003) Stress-responsive zinc finger gene ZPT2–3 plays a role in drought tolerance in petunia.
Plant J 36:830–841
Sugino M, Hibino T, Tanaka Y, Nii N, Takabe T, Takabe T (1999) Overexpression of DnaK from a
halotolerant cyanobacterium Aphanotece halophytica acquires resistance to salt stress in trans-
genic tobacco plants. Plant Sci 146:81–88
Sun W, Bernard C, van de Cotte, Van Montagu M, Verbruggen N (2001) At-HSP17. 6A, encoding
a small heat-shock protein in Arabidopsis, can enhance osmo-tolerance upon overexpression.
Plant J 27:407–415
Sunkar R, Bartels D, Kirch HH (2003) Overexpression of a stress inducible aldehyde dehydro-
genase gene from Arabidopsis thaliana in transgenic plants improves stress tolerance. Plant
J 35:452–464
Tagaki K, Nishizawa K, Hirose A, Kita A, Ishimoto M (2011) Manipulation of saponin biosynthe-

sis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.
Plant Cell Rep 30:1835–1846
Tanaka K, Hibino T, Hayashi Y, Tanaka A, Kishitani S, Takabe T, Yokota S, Takabe T (1999) Salt
tolerance of transgenic rice overexpressing yeast mitochondrial Mn-SOD in chloroplasts. Plant
Sci 148:131–138
Thipyapong P, Melkonian J, Wolfe DW, Steffens JC (2004) Suppression of polyphenol oxidase
increases stress tolerance in tomato. Plant Sci 167:693–703
Thorpe T (2012) History of plant tissue culture. Methods Mol Biol 877:9–27
Todaro A, Cavallaro R, Argento S, Branca F, Spagna G (2011) Study and characterization of poly-
phenol oxidase from egg plant ( Solanum melongena L.). J Agric Food Chem 59:11244–11248
Tommonaro G, de prisco R, Abbamondi Gr, Marzocco S, Saturnino C, Poli A, Nicolaus B (2012)
Evaluation of antioxidant properties, total phenolic content, and biological activities of new
tomato hybrids of industrial interest. J Med Food 15:483–489
Uchiumi T, Okamoto T (2010) Rice fruit development is associated with an increased IAA content
in pollinated ovaries. Planta 232:579–592
Ushimaru T, Nakagawa T, Fujioka Y, Daicho K, Naito M, Yamauchi Y, Nonaka H, Amako K, Yam-
awaki K, Murata N (2006) Transgenic arabidopsis plants expressing the rice dehydroascorbate
reductase gene are resistant to salt stress. J Plant Physiol 163:1179–1184
Van Camp W, Capiau K, Van Montagu M, Inze D, Slooten L (1996) Enhancement of oxidative
stress tolerance in transgenic tobacco plants overproducing Fe-superoxide dismutase in chlo-
roplasts. Plant Physiol 112:1703–1714
Van Damme EJM (2008) Plant lectins as part of the plant defense system against insects. In:
Schaller A (ed) Induced plant resistance to herbivory. Springer Dordrecht, Netherlands,
pp 285–307
Velker BA, Denomme MM, Mann MR (2012) Embryo culture and epigenetics. Methods Mol Biol
912:399–421
Vendruscolo EC, Schuster I, Pileggi M, Scapim CA, Molinari HB, Marur CJ, Vieira LG (2007)
Stress induced synthesis of praline confers tolerance to water deficit in transgenic wheat. J
Villalobos MA, Bartels D, Iturriaga G (2004) Stress tolerance and glucose insensitive phenotypes
in arabidopsis overexpressing the CpMYB10 transcription factor gene. Plant Physiol 135:309–
324
Waie B, Rajam MV (2003) Effect of increased polyamine biosynthesis on stress responses in trans-
genic tobacco by introduction of human S- denosylmethionine gene. Plant Sci 164:727–734
Walter RS, Rosemary L, Gary DF, Weingartner DP (2011) Compendium of potato diseases (APS
compendium of plant disease series). APS Press, The American Phytopathological Society, St.
Paul
Wang GX, Tang Y, Yan H, Sheng XG, Hao WW, Zhang L, Lu K, Liu F (2011) Production and
characterization of interspecific somatic hybrids between brassica oleracea var. botrytis and B.
nigra and their progenies for the selection of advanced pre-breeding materials. Plant Cell Rep
30:1811–1821
Wang QC, Valkonen JP (2008) Elimination of two viruses which interact synergistically from
sweet potato by shoot tip culture and cryotherapy. J Virol Methods 154:135–145
Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat shock proteins and molecu-
lar chaperones in the abiotic stress response. Trends Plant Sci 9:244–252
Wang Z, Song J, Zhang Y, Yang B, Wang Y, Chen S (2008) Mechanism analysis of broad-spectrum
disease resistance induced by expression of anti-apoptotic p35 gene in tobacco. Chinese J Bio-
tech 24:1707–1713
Watrud LS, Lee EH, Fairbrother A, Burdick C, Reichman JR, Bollman M, Storm M, King G,
Van de Water PK (2004) Evidence for landscape-level, pollen-mediated gene flow from ge-
netically modified creeping bentgrass with CP4 EPSPS as a marker. Proc Natl Acad Sci USA
101:14533–14538
Whetstone PA, Hammock BD (2007) Delivery methods for peptide and protein toxins in insect
control. Toxicon 49:576–596
Winicov I (2000) Alfin1 transcription factor overexpression enhances plant root growth under
normal and saline conditions and improves salt tolerance in alfalfa. Planta 210:416–422
Xiao B, Huang Y, Tang N, Xiong L (2007) Overexpression of a LEA gene in rice improves drought
resistance under field conditions. Theor Appl Genet 115:35–46
Xing LP, Wang HZ, Jiang ZN, Ni JL, Cao AZ, Yu L, Chen PD (2008) Transformation of wheat
thaumatin-like protein gene and analysis of reactions to powdery mildew and Fusarium head
blight in transgenic plants. Acta Agronomica Sinica 34:349–354
Yadav SK, Singla-Pareek SL, Reddy MK, Sopory SK (2005) Transgenic tobacco plants over-ex-
pressing glyoxylase enzymes resist an increase in methylglyoxal and maintain higher reduced
glutathione levels under salinity stress. FEBS Lett 579:6265–6271
Yang SX, Zhao YX, Zhang Q, He YK, Zhang H, Luo HA (2001) L1 mediate salt adaptation in
Arabidopsis thaliana. Cell Res 11:142–148
Yokotani N, Ichikawa T, Kondou Y, Maeda S, Iwabuchi M, Mori M, Hirochika H, Mastsui M,
Oda K (2009) Overexpression of a rice gene encoding a small C2 domain protein OsSMCP1
increases tolerance to abiotic and biotic stresses in transgenic Arabidopsis. Plant Mol Biol
71:391–402
Zang N, Zhai H, Gao S, Chen W, He S, Liu Q (2009) Efficient production of transgenic plants us-
ing the bar gene for herbicide resistance in sweet potato. Sci Hort 122:649–653
Zapata-Arias FJ, Torrizo LB, Ando A (1995) Current developments in plant biotechnology for
genetic improvement, the case of rice ( Oryza sativa L.). World J Microbiol Biotechnol 11:393–
399
Zebrowska JI (2010) In vitro selection in resistance breeding of strawberry (Fragaria x ananassa
duch.). Commun Agric appl Biol Sci 75:699–704
Zhang L, Chen Q, Yuan Z, Xiang Z, Zheng Y, Liu D (2008) Production of aneuhaploid and euhap-
loid sporocytes by meiotic restitution in fertile hybrids between durum wheat langdon chromo-
some substitution lines and Aegilops tauschii. J Genet Genomics 35:617–623
Zhang F, Wang P, Ji D, Kang G, Xiang F (2011) Asymmetric somatic hybridization between bu-
pleurum scorzonerifolium willd and taxus chinensis var. mairei. Plant Cell Rep 30:1857–1864
Zhang HX, Blumwald E (2001) Transgenic salt tolerant tomato plants accumulate salt in foliage
but not in fruit. Nat Biotechnol 19:765–768
Zhang HX, Hodson JN, Williams JP, Blumwald E (2001) Engineering salt-tolerant Brassica
plants: characterization of yield and seed oil quality in transgenic plants with increased vacu-
olar sodium accumulation. Proc Natl Acad Sci USA 98:12832–12836
Zhang Z, Huang R (2010) Enhanced tolerance to freezing in tobacco and tomato overexpress-
ing transcription factor TERF2/LeERF2 is modulated by ethylene biosynthesis. Plant Mol Bio
73:241–249
Zhou J, Li F, Wang JL, Ma Y, Chong K, Xu YY (2009) Basic helix-loop-helix transcription factor
from wild rice ( OrbHLH2) improves tolerance to salt- and osmotic stress in Arabidopsis. J
Chapter 4
Mutagenesis—A Potential Approach
for Crop Improvement
Rajib Roychowdhury and Jagatpati Tah
Abstract Global environmental dissociative changes are now in steady state. Its
negative impacts were gradually imposed on a wide range of crops and thus crop
improvement was hindered as well. Given this challenge, existing and new, appro-
priate technologies need to be integrated for global crop improvement. Among the
different present approaches, mutagenesis and mutation breeding and the isolation
of improved or novel phenotypes in conjunction with conventional breeding pro-
grammes can result in mutant varieties endowed with new and desirable variation of
agrometrical traits. Induced mutations and its related technologies play very well in
this ground and this overall strategy helps to trace the crop genetic diversity along
with its biodiversity maintenance. Such induced mutagenesis, a crucial step in crop
improvement programme, is now successful in application due to the advancement
and incorporation of large-scale selection techniques, micropropagation and other
in vitro culture methods, molecular biology tools and techniques in modern crop
breeding performance. Time to time, different mutation techniques and their appli-
cation processes are changing significantly; in this perspective, insertional muta-
genesis and retrotransposons are taking more supports for mutational tagging and
new mutation generation. For details investigation on plant structure and function,
mutagenic agents and their precise role are much essential as it can produce mutants
with some phenotypic changes. Functional genomics studies make the ultimatum
platform on this field of study where few crop plants were used for mutational
experimentation on some prime agronomic traits till now. This is a prerequisite step
and is applying on diverse crop for further improvement. High throughput DNA
technologies for mutation screening such as TILLING (Targeting Induced Limited
R. Roychowdhury ()
Department of Biotechnology, Visva-Bharati, Santiniketan 731235, West Bengal, India
J. Tah
Botany Department (UGC-CAS), The University of Burdwan,
Burdwan 713104, West Bengal, India

150 R. Roychowdhury and J. Tah
Lesions IN Genomes), high-resolution melt analysis (HRM), ECOTILLING etc.

are the key techniques and resources in molecular mutation breeding. Molecular
mutation breeding will significantly increase both the efficiency and efficacy of
mutation techniques in crop breeding. Such modern and classical technologies are
using for the development of mutation induction with the objective of using a set
of globally important crops to validate identified relevant novel techniques and
build these into modular pipelines to serve as technology packages for induced
crop mutations. Thus, mutation assisted plant breeding will play a crucial role in the
generation of ‘designer crop varieties’ to address the uncertainties of global climate
variability and change, and the challenges of global plant-product insecurity.
Introduction
Mutation breeding is the purposeful application of mutations in plant breeding area.

It offers good prospects for the domestication of promising underutilized wild spe-
cies, for agricultural or horticultural uses as well as for improving adaptation of
recently introduced crops to unsuitable environments. Mutagenesis has remained
popular for close to a century because of its simplicity, technical and economic via-
bility, applicability to all plant species and usability at small or large scales (Siddiqui
and Khan 1999). More than 2,000 plant varieties that contain induced mutations
have been officially released for cultivation either directly as new varieties or used
as parents to derive new varieties without the regulatory restrictions faced by ge-
netically modified material (Maluszynski et al. 2000; Waugh et al. 2006). The main
strategy in mutation-based breeding has been to upgrade the well-adapted plant
varieties by improving a few desirable major yield and quality traits (Ahloowalia
et al. 2004; Wilde et al. 2012). Besides, the increased yield and enhanced quality of
the novel varieties included several other components such as subsequent use for
breeding, improved harvest index from heterosis in hybrid cultivars, response to
increased agronomic inputs, and consumer preference.
Plant breeding categorized into three sub-types as mutation breeding, recombi-
nation breeding and transgenic breeding has the potential of generating variation
and selection of target lines. In case of mutation breeding, the basic fundamental
and the unique feature is the generation of new mutated alleles. The key steps
includes analysis of difference in the sensitivity of different genotypes and plant
tissues to different mutations often measured using lethal doses (LD), generation
of genetic chimeras after mutagenic treatment and analysis of their effect on trans-
mission of mutated alleles and segregation in the subsequent generation and also
often the recessive nature of induced mutations. This knowledge is important for
establishing proper doses and modes of mutagenic treatment. Apart from this, the
knowledge can also be employed for the planning of methodology of harvesting
and growing second mutant (M2) populations from first mutant (M1) generations
(Table 4.1). Like any other scientific innovative technology, mutation breeding has
its advantages and limitations. The advantages being creation of new genetic al-
4 Mutagenesis—A Potential Approach for Crop Improvement 151
Table 4.1 Three important plant breeding strategies

Breeding Source of genetic Transmission, Nature of gene Breeding
Methods variation expression and action generations
inheritance
Mutation New alleles Induced mutations Mostly recessive About 2–3
breeding artificially subject to diplon- alleles generations
and randomly tic and haplontic
created from selection
endogenous
genes
Recombinant Recombination No selective Dominant, About 10
breeding of gene alleles transmission; recessive generations
from parental co-segregation alleles, and
varieties of closely linked QTLs
alleles
Transgenic Insertion of new Expression of trans- Mostly domi- About 3
breeding genes or genes subject to nant alleles generations
modification position effect or
of endogenous silencing
genes
QTL-Quantitative trait loci
leles that do not persist in germplasm pools and the induction of new gene alleles
for a commercial variety such that new varieties carrying desired mutation alleles
can be directly used as a commercial variety. Also, the limited genetic changes
of any single plant of a mutated population and the often recessive nature enable
breeders to develop a new variety in a short breeding cycle. The limitation being its
limited power in generating the dominant alleles which might be desired; its less
effectiveness than cross breeding for a trait needs for a combination of multiple
alleles, such as tolerance to abiotic stresses. The low mutation frequency requires
growing and screening a large population for selection of desired mutants at a rea-
sonable confidence. This becomes very expensive for traits that have to be evalu-
ated through laborious phenotypic analysis (Roychowdhury 2011; Roychowdhury
and Tah 2011).
The knowledge of the extent to which the desirable characters with economic
values are heritable is a prerequisite for any crop improvement programme (Roy-
chowdhury and Tah 2011b; Roychowdhury et al. 2011a). Breeders have continually
retained their interest in the grouping of the germplasm and the pedigree of selected
cultivars since the information might be particularly helpful in effective breeding
strategy determination (Ali et al. 2011). For this purpose, inducible mutation, using
chemical or physical mutagens, is a suitable source of producing variation through
mutation breeding procedure (Domingo et al. 2007; Roychowdhury and Tah 2011a)
which can produce several improved mutant varieties with high demanding eco-
nomic value (Din et al. 2004). From implicational point of view, it is quite possible
to induce gene-mutation artificially with the help of some potent chemical muta-
gens to create any new variation in crops.
Time to time, the spectrum of available mutation techniques has also signifi-
cantly increased. Important practical results have been achieved through the use of
chronic irradiation from gamma-field or by irradiation with heavy ion beam or by
chemical mutagenesis. In vitro cultured somaclonal variations have been proved to
be useful for creating variation in many characters, especially the ones that can be
selected under in vitro cultural environments. Classical insertional mutagenesis and
more recently retro-transposons have become almost irreplaceable tools in generat-
ing and tagging of new mutations for crop improvement. Potent mutagenic agents
(‘mutagens’ that cause mutation) can be used to produce the ‘morphological mu-
tants’ that are essential for dissecting plant structure, functions and their regulation
(Maluszynski 1999). The traditional mission of mutation breeding technology deals
with the development of new and desired variation(s) through breeding programs
for overall crop improvement that has recently been significantly spread widely. In-
duced mutations can play an important role in the conservation and preservation of
crop biodiversity. Induced mutations and related advance technologies are impor-
tant not only for extending genetic diversity of major crops but also are an important
additional source of biodiversity enhancement of neglected and local crops.
Mutation and Mutagens
A mutation is a sudden heritable change in the DNA of a living cell, not caused
by the common phenomena of genetic segregation or genetic recombination. Mu-
tations may occur in nature without intentional human intervention, and are said
to be spontaneous. Spontaneous mutations may result from the activity of mobile
genetic elements (transposons) that can move around to different positions within
the genome of a single cell and affect the activity of the gene in which they are
inserted (Wessler 2006). Mobile genetic elements affect the gene function through
various mechanisms. Retro-transposons, for example, move in the genome by be-
ing transcribed to RNA and then back to DNA by reverse transcriptase, while DNA
transposons move directly from one position to another within the genome using
a transposase enzyme to ‘cut and paste’ them within the genome, causing sponta-
neous mutations (Kidwell 2005). Most spontaneous mutations occur in very low
frequencies (10−6) of an individual gene. Moreover, not all phenotypically observed
variation refers to genetic changes. At the same time, not all the spontaneous chang-
es in the DNA ultimately result in permanent changes of the DNA. Even if such
changes would be permanent, they may not always result in visible or detectable ef-
fects (Ranel 1989). For example, there may be latent adaptive mutations in African
nightshade that help the plants to survive in the wild, but these are not known so far.
Besides, spontaneous mutations depend on chance and make breeding programmes
considerably slow. Although selection for economically useful spontaneous mu-
tants still takes place with some level of success (Ahloowalia et al. 2004; Wilde
et al. 2012), the purposeful induction of a specifically desired mutation at a specific
time and place, and in a selected genotype for a selected purpose is a much more
attractive option.
Mutation Induction
A physical or chemical agent that changes the genetic information (usually DNA)
of an organism and thus increasing the number of mutations above the natural back-
ground level is called a mutagen (Fig. 4.1). DeVries (1905) suggested the use of
radiation to induce mutations. The discovery that X-ray induced mutations in Dro-
sophila melanogaster (Muller 1927) and in Hordeum vulgare (Stadler 1928) led to
the use of radiation-induced mutations for changing plant traits by plant breeders
and geneticists. Auerbach and Robson (1946) reported the use of chemicals such
as mustard gas to be highly mutagenic. Since then a number of agents have been
discovered that can increase the frequency of artificially induced mutations. The
main mutagens available for induction of mutations include UV radiation, electro-
magnetic waves such as X-rays, γ-rays and cosmic rays; fast moving particles such
as α-particles, β-particles and neutrons; and chemical agents such as, alkylating
agents, acridines, azides, hydroxyl amides, etc. In general, ionizing radiations such
as X-rays and γ-rays are preferred over chemical mutagens because of their ease of
application, good penetration and reproducibility, high mutation frequency and less
disposal problems. The X-rays are obtained from X-ray machines by bombarding
tungsten or molybdenum with electrons in a vacuum, whereas γ-rays are obtained
from radioisotopes like 60Co and 137Caesium in the γ-chamber. The UV-radiations
possess limited tissue penetrating ability [low linear energy transfer or in short
LET] and cause relatively little damage except after prolonged exposure as a result
of which their use is restricted to pollen grains (Kovacs and Keresztes 2002).
The application of this phenomenon has come a long way to become a real
tool, not only in crop breeding but also in basic research on the plant genome, its
structure and function. Breeders were the first to recognize the potential of induced
mutations through analogy with spontaneous mutants, often selected as new plant
types in many crops, from cereals to apples, not to mention ornamental and decora-
tive plants. Many mutants with desired traits were selected in the second or third
generation after mutagenic treatment and subsequently released as new cultivars
after agronomic evaluation in regional and national trials. These or other mutants
developed with mutations in desired traits, even though not released as new cul-
tivars, have been used in cross-breeding programmes as a source of particular al-
leles, often allelic to the spontaneous ones, but in a desired genotype. Among them
were sources for characters such as short stature and lodging resistance; disease
resistance; oil quality; and increased nitrogen fixation. These mutated genes are
especially valuable as the best currently grown cultivar was usually selected for
mutagenic treatment. A desired mutation in a good genetic background is a very
attractive component in breeding programmes. This approach is much simpler and
faster than crossing with an exotic source, and it is one of the main reasons for the
Fig. 4.1 Different kinds of physical and chemical mutagens that are mostly used and selected
plants parts for mutagenic treatment/induction
wide use of mutated alleles in the breeding of numerous species. Mutation induction
raises the natural mutation rates 10–100 fold, expanding the opportunity to isolate a
higher number of mutants in a limited space. Today, induced mutations are ideal for
augmenting natural variation in germplasm and as an alternative to hybridization
and recombination in plant breeding. Mutations provide new starting material for
the production of new cultivars and on the other hand they offer excellent tools for
identifying new genes, for studying the nature of genes and their way of controlling
biochemical pathways (Micke et al. 1990). The genetic variation from mutagenesis
is different from that existing in germplasm collections or obtainable from cross-
ing as it is not yet selected by nature or man and thus contains traits which were
not favored during evolution or previous plant breeding activities. Besides, genes
for a desired trait may not be fit or may be tightly linked with undesirable genes so
that recombination through hybridization is rare or impossible. For example, genes
causing pollen abortion cannot be transmitted gametophytically to future genera-

tions; consequently homozygous plants with all aborted pollen are lost in the cause
of evolution.
Mutation and mutation breeding is a tool and being used to study the nature and
function of genes which are the building blocks and basis of plant growth and de-
velopment, thereby producing raw materials for genetic improvement of economic
crops (Adamu and Aliyu 2007). Mutation induction offers significant increase in
crop production (Kharkwal and Shu 2009) and the possibility of inducing desired
attributes that either cannot be found in nature or have been lost during evolution.
Treatment with mutagens alters genes or breaks chromosomes. Gene mutations oc-
cur naturally as errors in DNA replication. Most of these errors are repaired but some
may pass to the next cell division to become established in the plant offspring as
spontaneous mutations. Gene mutations without phenotypic expressions are usually
not recognized. Consequently, genetic variation appears rather limited and breeders
have to resort to mutation induction (Novak and Brunner 1992; Kozgar et al. 2012).
Mutagenic agents have been used to induce useful phenotypic variations in plants
for more than seventy decades (Vasline et al. 2005; Roychowdhury et al. 2011).
During the past 70 years, more than 2,543 mutant cultivars from 175 plant species
including ornamentals, cereals, oilseeds, pulses, vegetables, fruits and fibers have
been officially released in 50 countries all over the world (Maluszynski et al. 2000;
Chopra 2005). Chemical mutagenesis (the non-GMO approach) is an approach to
create mutation in plants for their improvement of potential agronomic traits. In
any mutation breeding programme, selection of an effective and efficient mutagen
is very essential to produce high frequency of desirable mutation. Many chemical
mutagens have been employed for obtaining useful mutants in various crop spe-
cies (Singh and Singh 2001a; Roychowdhury and Tah 2011c; Roychowdhury et al.
2012a). However the various workers emphasizes that artificial induction of muta-
tion by colchicine (COL), ethyl methane sulphonate (EMS), sodium azide (SA),
maleic hydrazide (MH) provides tool to overcome the limitations of variability in
plants and induces specific improvement without disturbing their better attributes
(Mensah and Obadoni 2007; Islam 2010; Roychowdhury 2011; Roychowdhury and
Tah 2011; Roychowdhury et al. 2011b; Gnanamurthy et al. 2012). It might be con-
sidered that, these chemical induced growth abnormalities were mainly due to cell
death and suppression of mitosis at different exposures. Several factors such as
properties of mutagens, duration of treatment, pH, pre- and post-treatment, tem-
perature and oxygen concentrations, etc. influence the effect of mutagens. The dose
of a mutagen applied is an important consideration in any mutagenesis programme.
Generally, it was observed that higher the concentrations of the mutagen greater
the biological damage. To enhance the mutagenic effectiveness and efficiency and
especially the metabolite, more knowledge about the effect of time, pH value, tem-
perature, seed soaking and various concentrations are required (Khan et al. 2009;
Roychowdhury and Tah 2011a, 2011c; Roychowdhury et al. 2012a). Crop plants of-
fers many opportunities exploitation of mutations, recombination and of increasing
genetic variability in quantitatively inherited agronomic characters. Induced muta-
tions are also useful when it is desired to improve easily identifiable characters.
Initial studies on induced mutations were mainly directed to finding optimum

combination of mutagen and dose to elicit the best response. Both physical and
chemical mutagens were tested in various crop species such as wheat, barley, rice,
tobacco, corn, Brassica, fruit crops and vegetables. These studies helped to initiate
large-scale mutation breeding experiments for various practical applications (Cho-
pra 2005). Since various physical and chemical mutagens are known to act in dif-
ferent ways to cause DNA lesions, combined effects of mutagens were investigated.
In wheat, combined treatment with UV and X-rays showed dose-dependent ef-
fects. UV pretreatment of seeds reduced the frequency of mutations at low doses of
X-rays (11–16 kr) but increased it at high doses of 22–30 kr (Swaminathan and Na-
tarajan 1959; Bansal et al. 1962). In barley, treatment with S-2 aminoethylisothiou-
ronium bromide hydrobromide (AET) was tested as both pre- and post-treatment
with X-rays. Frequency of chromosome aberrations and chlorophyll mutations reg-
istered a significant drop when AET treatment was followed by X-ray irradiation.
On the other hand, post x-ray treatment of AET caused a slight drop in chromosome
aberrations (Chopra et al. 1965). Similarly, combined treatment of two chemical
mutagens, ethyl methane sulfonate (EMS) and hydroxyl amine (HA), was inves-
tigated in wheat. Data of chlorophyll and viable mutations indicated that EMS is
a potent mutagen in Triticum dicoccum but HA is a weak mutagen. But when HA
was administered after EMS treatment, there was a significant drop in mutation
frequency indicating that HA may be involved in mutational repair process (Cho-
pra and Swaminathan 1966). Studies with Drosophila showed that formaldehyde,
which is not mutagenic in female flies, could enhance mutation frequency when
administered following X-ray treatment. This suggested that formaldehyde might
be blocking some DNA repair process (Mahajani and Chopra 1973).
Mutagens and Their Doses
One of most crucial requirements for a successful breeding programme is the selec-
tion of an effective and efficient doze of a mutagen for mutagenizing the starting
material. Historically, the effectiveness of a mutagen has been measured in terms
of biological effect that it produces. It is, however, desirable to establish a relation-
ship between the observed biological effect to a well-defined and easily measurable
physical quantity characterizing the amount of radiation or chemical mutagen re-
sponsible for that effect (Roychowdhury 2011). Therefore, the mutagenic effect in
biological targets is commonly and conveniently described in terms of dose-effect
relationships. In quantitative radiation biology, the ‘simple dose’ (D) is the amount
of energy absorbed per mass of irradiated matter at the point of interest. The special
unit of D is rad (1 tad 100 erg/g = 10−2 joule/kg), expressed in terms of time as rad/h,
rad/min and rad/s. Thus, among others, changes in radiation doses and duration of
exposure of biological material to the irradiation are important parameters of physi-
cal mutations. In case of chemical agents, the dose of treatment is determined based
on several parameters viz., (i) concentration, (ii) duration of treatment and (iii) tem-
Fig. 4.2 The schematic view of E5B beam line. (RRC = RIKEN Ring Cyclotron)
perature during treatment. The concentration of chemical mutagen is determined

by the per cent strength of the chemical in the solvent (distilled water). The volume
of treatment solution is also equally important so as to provide each seed or organ
an opportunity to absorb the same number of moles of mutagen. It is generally ac-
cepted that a treatment giving 30–40 % growth reduction is likely to give an optimal
mutation yield in crops. The treatment duration must provide an opportunity for
hydration and full penetration through the treated tissue of the mutagen. Long treat-
ment is advisable, but it can be shortened by using pre-soaked seeds. However, the
treatment duration also depends on the hydrolytic rate of the mutagen. For a short
period, a high concentration is used after pre-soaking at high temperatures. The
temperature of mutagenic solution greatly influences the mutagenic process. When
there is no published information of mutation dose in a particular crop, we often re-
sort to LD50 (Lethal Dose-50), which is a common parameter to decide the effective
doses of both physical and chemical mutagens (Albokari et al. 2012). Thus, LD50 is
a dose, which results in 50 % mortality of treated seeds (Roychowdhury 2011). With
ionizing radiations, a dose which restricts survival to 50 % (LD50) or growth to 50 %
(GR50) is a good treatment.
Ion Beam Mutagenesis
Application of ion beams for mutation induction was started with low-energy
ions in China in the late 1980s and with heavy ions in Japan in the early 1990s.
While ion beam technology has been used for food crop improvement in China,
it has been more extensively used for floriculture plants in Japan. Ion beams as
a mutagen are different from other physical mutagens such as gamma or X-rays
in that they not only involve energy transfer (as gamma or X-rays), but also mass
deposition and charge exchange (Hase et al. 2012); hence could result in complex
DNA damage and changes that are not found when gamma or X-rays are used
(high percentage of double strand breaks and subsequent chromosome aberrations).
Ion beams are produced by particle accelerators, i.e. cyclotrons. Figure 4.2 is a
schematic view of the E5B beam line available in the RIKEN Accelerator Research
Facility (RARF), Japan.
Table 4.2 Heavy ions for biological research in RIKEN Accelerator Research Facility (RARF).
(Modified from Kazama et al. 2008)
Heavy ions Charges Energy LET (keV/μm) Range in water
MeV/u GeV (mm)
12
C + 6 135 1.62 22.5 43
14
N + 7 135 1.89 26.3 34
20
Ne + 10 135 2.70 61.1 23
40
Ar + 17 95 3.80 280.0 8
56
Fe + 24 90 5.04 624.0 4
Typical heavy ions used for irradiation on biological samples are neon-20, nitro-
gen-14, carbon-12, lithium-7, argon-40, iron-56 (Table 4.2).
They have different energy levels and linear energy transfer (LET), ionization
densities which correlate to the complexity of DNA damage, and different ranges
of penetration (Fig. 4.3).
LET is the energy deposited to target material when an ionizing particle passes
through it. Once an accelerated particle encounters any substance, it gradually los-
es its own energy (i.e., the same amount of energy is transferred to the substance
causing damage.) and eventually stops at the point where the maximum energy
loss is observed (Fig. 4.4). In this figure, an ionizing particle gradually loses its
own energy as it slows down in the target material. LET refers to this energy loss,
which is deposited to the material. In this cartoon, LET is represented by wavy
lines. LET reaches its maximum just before the ionizing particle stops. Immediately
after this peak, LET plunges to zero. LET is usually expressed in kilo electron volts
per micrometer (keV/mm), which represents the average amount of energy lost per
unit distance. Ion beams have a relatively high LET (around 10–1,000 keV/µm or
higher), while X-rays, γ-rays and electrons have low LETs (around 0.2 keV/µm).
Therefore, ion beams are able to cause more severe damage to living cells than
other forms radiation, resulting in the high relative biological effectiveness (Blakely
1992; Lett 1992). It is possible to modulate the treatment of plant material with one
species of ion at different LETs by passing the ions through a combination of ab-
sorbers—since changes in the LET of ion species occur as they pass through matter
(Kazama et al. 2008).
Studies have shown that the biological effect of ion beam radiation is dependent
on absorption doses and LET values but independent of ion species (Kazama et al.
2008), which means that the treatment of carbon-12 would produce similar biologi-
cal effect on rice seeds as neon-20 if the same dose (say 50 Gy) and same LET (say
30 keV/μm) is applied. DNA double strand breaks are believed to be the most im-
portant consequence of ion beam radiation. Very complex repair mechanisms have
been unveiled but are prone to errors due to double-strand breaks and lead to dele-
tions, insertions, inversions and translocations. Studies on the mutant gene alleles
induced by ion beam radiation showed that most mutations are deletions and that
the size of DNA deletion is LET-dependent. Most complex DNA damage caused
by the intricate set of effects of heavy ion beams (HIB) escapes the repair efforts
Fig. 4.3 A beam with suf-

ficient energy penetrates a
plantlet and/or plant tissue
with rather low and uniform
LET and it will then drasti-
cally increase towards the
end of the track that is known
as the Bragg peak (BP).
(Modified from Kazama et al.
2008)
Fig. 4.4 Conceptual diagram

of LET
and thus is described as more biologically effective and mutagenic than X-rays and
gamma rays. A wider mutation spectrum and less collateral physiological damage
(i.e. effect on plant survival and growth) is commonly reported for ion beam radia-
tion as compared to other mutagens, which is considered an important advantage.
In China, 23 new rice and wheat mutant varieties have been bred using ion beam
technology and released for large scale commercial production (more than 1 mil-
lion ha per annum). The wheat variety ‘Wanmai 54’ displayed excellent resistance
to head scab disease and rust disease and recorded the highest yield in the national
new wheat variety yield trial (2003–2007), with yield increases over control variety
of 7–10.6 %. In Japan, ion beam technology has been used for generating mutants
for a vast number of plant species by various researchers; for example, a consortium
of more than 90 user groups was established to utilize the ion beam technology
available in RARF (Japan). Six new flower varieties have been developed using
this technology and marketed in Canada, Japan, USA and the EU since 2002. Oka-
mura et al. (2012) demonstrated that ion-beam radiation mediated breeding can
alter and improve petal color and shading; this leads to the success creating the
most glittering carnation ever by taking advantage of new mutagenesis techniques
combined with exploiting genomic information. Here, Nakayam et al. (2012) sum-
marized their ideas obtained from their successive ion-beam mutant studies that can
be generally applied to the generation of mutants as follows:
1. Because of cooperative and compensative biosynthetic regulation between a tar-
get and its related compounds, mutants in which the target compounds either
increased or decreased could be generated by ion-beam irradiation.
2. When multiple compounds are concerned in the expression of one phenotype,
different types of mutants occur among the same phenotype.
3. Structural changes of the target compound influence the physical, chemical and
physicochemical properties, such as light-absorption, co-pigmentation effect and
solubility, respectively, resulting in the acquisition of a novel phenotype.
Gamma Phytotron
Genetic improvement by chronic irradiation is another important option of mutation

breeding technique, especially when a wide array of mutants and minimal growth
arrest are needed. Therefore, a chronic irradiation of living plant materials has been
favored to induce useful mutants in mutation breeding. Unfortunately, these kinds’
of facilities are scarce and only a few Asian countries including Japan, Malaysia,
and Thailand have operational chronic irradiation facilities such as gamma field,
gamma greenhouse, and gamma phytotron, respectively. There are still many fac-
tors to consider when operating these types of facilities such as security and man-
agement issues. For this purpose, Kang et al. (2010) constructed a new gamma
phytotron which can be occupied with living pot plants or cultured callus during
long periods of chronic irradiation at lower doses. The ionizing source is 60Co with
the radioactivity strength of about 400 curies. The facility consists of an irradiation
room, a non-irradiation room, a glasshouse for acclimation, an operating room, and
an office. The total area of the irradiation room is about 104.16 m2. The target plant
materials for a gamma ray irradiation can be arranged from 2 m (612.9 m Gy/h) to
7 m (60.1 m Gy/h) from the 60Co source at present.
For safety reasons, the building, where the 60Co source is located, is surrounded
by concrete walls with 1.2 m depth and a twofold lead shielded door between the
control room and the irradiation room. Moreover, the irradiation room is equipped
with two CCD camera systems, which enable an inner situation check of the con-
trol room. The irradiation room and non-irradiation control room have automatic
control systems for various ranges of temperature (15–35 °C), humidity (50–80 %)
and light condition (maximum 30,000 lx), which can be finely setup according to
Fig. 4.5 The diagrammatic view of the gamma ray source and associated apparatus in gamma
phytotron. (Modified from Kang et al. 2010)
the growth conditions of targeted plants (Fig. 4.5). The difference of mutagenic ef-
fects of the acute and chronic irradiation can be compared using the same treatment
dose. It is expected that the heavy applications of the chronic gamma phytotron will
be extended to various crop plants, which are eventually provided to domestic and
global communities for mutation breeding and fundamental research.
Chemical Mutagenesis
The use of chemical mutagens is also very simple and can be done in any bio-
logical laboratory with basic equipment. However, it should be kept in mind that
most chemical mutagens are also strong carcinogens. For this reason, all steps of
mutagenic treatment should be carried out wearing gloves and under a Biohazard
flow-hood. These safety conditions are not necessary for treatment with sodium
azide, which is a very powerful mutagen, but only for a limited number of species,
including barley, rice, maize, oat, sorghum, sesame, jute and soybean. Numerous
chemical mutagens have been successfully used for crop improvement.
The mutagenic action of a chemical mutagen induces somatic and genetic effects
in a treated cell, tissue or organ. After treatment of seeds, only unrepaired damage
to the DNA in initial cells of the sporogenic layer (germ line cells) are transferred
as mutations to the next generation. Other mutations in somatic cells of the embryo,
including mitotic chromosomal aberrations, together with toxic action of a muta-
gen on all components of cytosol, affect plant growth and development, and are
called the ‘somatic effect’ of the mutagen. The steps generally followed in muta-
genic treatment of seeds with chemical mutagens are: pre-soaking in distilled water,
pre-treatment rinsing in tap water, treatment with the mutagen, post-treatment rins-
ing in tap water and drying (if necessary) on a filter paper. All steps of mutagenic
treatment should be done using glass beakers to avoid any interaction of chemical
mutagens with even trace quantities of metallic cataions or other active reagents.
Seeds for each dose of mutagenic treatment (M0 generation) and for the untreated
control, usually the parent variety, are put into beakers that are visibly labeled with
the applied concentration of mutagen (Roychowdhury 2011).
As dry seeds are usually used for treatment, pre-soaking in distilled water should
be applied to activate seeds physiologically before treatment with mutagen. The
amount of water used in pre-soaking should be at least 2–3 times the volume of dry
seeds. The beakers with pre-soaked seeds should be gently shaken a few times to
remove air bubbles, which can block access of mutagen to embryos. Duration of
pre-soaking depends on the biology of germination of a particular crop species. For
example, in barley and other major cereals, 8–10 h of pre-soaking in room tempera-
ture (20–24 °C) is usually applied. Pre-soaking significantly reduces the somatic
effect of chemical mutagen (Roychowdhury and Tah 2011a). Short washing, 2–3
times in room-temperature tap water should be applied after soaking to remove
water-soluble substances leaching from the seed. Such prepared seeds are ready
for mutagenic treatment. It is advisable to use three doses of mutagen for a large-
scale field experiment. This is especially desired for regions with very variable
and unpredictable weather conditions during the growing period of mutagenetically
treated material. Drought, cold and heat can significantly modify the somatic ef-
fect of a mutagen and influence the final effect of treatment. The concentration of
mutagen, its duration and temperature of treatment are understood under the term
‘dose’ in chemical mutagenesis. A temperature of mutagenic solution of 22–24°C is
most often applied for the seed treatment of various crop species. The use of other
temperatures is also possible. However, it should be noted that the increased tem-
perature will significantly shorten the half-life of chemical mutagen and generate
products of hydrolysis that can increase undesired somatic effect of a mutagen. This
is especially relevant to treatment with mutagens such as diethyl sulfate (DES) or
ethyl methane sulphonate (EMS). To obtain equal penetration of a mutagen through
the cells of a seed embryo, it is necessary to treat seeds in a water solution of the
mutagen for 3–5 h. Similar to the pre-soaking, the treatment should be done with
a significant surplus of mutagenic solution, some 2–3 times the volume of the dry
seeds. In cereals, about 1–1.5 ml of mutagenic solution is applied per seed. The
concentration of the mutagen should be considered, together with duration of the
treatment. A shorter treatment time with higher concentration of mutagen can in-
crease somatic effects and could be insufficient to penetrate equally all cells in the
plant material. A gentler treatment requires a lower concentration but longer period
of application.
Extensive post-treatment rinsing several times in room-temperature tap water is
necessary to stop action of the mutagen and to remove its residues from the surface
of the seeds. To facilitate sowing, the treated seeds can be dried on filter paper
under a fume hood. However, too intensive drying, especially with increased air
temperature, can enhance somatic effects of the mutagen. Surface-dry seeds are
ready for sowing and are termed the M1 generation. In a well-organized labora-
tory, pre-soaking is done overnight and mutagenic treatment in the early morning.
This allows the M1 seeds to be sown the same day. Should this be impossible, due
to prolonged pre-soaking or mutagenic treatment, the mutagen treated seeds, after
brief drying, can be kept in a refrigerator at a temperature of around 6–8 °C. Some
mutagens are active in a particular acidity of a treatment solution. This is the case
for sodium azide, which is a very efficient mutagen in several species if applied at
low pH. For this reason, sodium azide is dissolved in a phosphate buffer at pH 3 and
this solution is used for treatment.
Mutation Breeding Strategy
A sequential strategy is essential for any mutation breeding steps where mutagen-
ic induction and its mutagenesis are much helpful for autogamous crops than the
cross-pollinating one. This is due to several problems regarding the incorporation,
selection and maintenance of recessive mutations in crop plant, many plant breed-
ing problems in the cross-pollinating species, sometime many handling based prob-
lem for the existing variability. Where the lack of variability exists for specific
and simply inherited traits, the basis of choosing between induced mutations and
hybridization is essentially the same in self- and cross-fertilizing species. However,
the genetic consequences of the failure of recessive imitations to express in cross-
fertilizing systems without forced selling or sib-mating must be taken into consid-
eration in assessing the cost of such ventures. The efficiency of mutation breeding,
more than any other breeding method is dependent on the effectiveness with which
useful variants can be recognized in M2 or M3 generation. The first step in the muta-
tion breeding selection process is to reduce the population of potential variants to a
sufficiently small fraction to permit more detailed analysis and evaluation.
Probability of Obtaining Mutants
Mutations occur more or less at random and for mutagenesis-derived populations,

unlike segregating populations derived from cross-breeding, there is no clue as to
the kind or magnitude of genetic change. A particular gene can be expected to mu-
tate once in about 10,000 mutagen treated cells, provided that an effective treatment
was given. On an average, it appears that tail about five cells of the embryonic
shoot apex may become part of the germ line and thus relate to the next generation.
This would mean that for seed propagated species the M2 generation of 2,000 mu-
tagen treated (M1) plants has to be examined in order to have reasonable chance of
finding mutation in a particular gene. To extend the simplified calculation further, one
might assume that plant genome possesses 10–100 × 103 relevant genes. Based
upon the single locus mutation rate estimate of 1 × 10-4 this would mean that in an
experiment using 2,000 M1 plants, there would 10–100 × 10-3 mutations or 1–10
per treated cell. Of these, some may be easily recognizable, others not; few usable,
most of them not. Admittedly such estimates cannot be very accurate but the old, of
magnitude should be acceptable and, therefore, be taken into account (Roychowd-
hury 2011).
Size of Ml Population
The Ml population is the plants that are generated from mutagenized seeds or other
propagules. Determination of target population size in Ml is the most crucial com-
ponent of mutation breeding. The target should be fixed so as to allow high number
of mutation events, yet the population size should be manageable by the breeder.
It is obvious that the population size will depend on the inheritance pattern of the
gene. If the mutation is monogenic recessive, the probability of recovering a mutant
phenotype will be higher than for a trait controlled by more than one gene. In math-
ematical terms, if ‘n’ is the number of mutation events in the Ml generation after
treatment, and ‘P’ is the probability of occurrence of at least one mutation, then-
log(1 − P )
n= , where µ is the rate of mutation
log(1 − µ )
With a mutation frequency of 1 × 10-4, ‘n’ equals to 46,520 for a monogenic reces-
sive trait. As there are two alleles, the number may be reduced to 23,260, indicating
that about 25,000 plants are to be grown to obtain a useful mutation in Ml genera-
tion. In practice, ten times of the size has to be considered, because the mutation
produced may be useful or undesirable. Mutation breeding is an input intensive
process. It is therefore advisable to select mutagens with high mutation frequency,
so that Ml generation size can be reduced.
While planting Ml population, it is suitable to divide the whole seed lot in dif-
ferent small sections for ease of screening and analysis of chimera. It is to be re-
membered that germ-line mutations take place only in the initial cells of embryo,
so depending on the nature of the species, products of initial divisions should be
screened. For example, cereals like rice, wheat, barley, oat etc. produce multiple
tillers. Those tillers that generates first (primary tillers) have maximum chance to
carry mutation. In case of tuber crops like potato, the mutation may be present in
any of the stems arising from different discs of a tuber, so each of them has equal
chance to give rise to a mutation. Obviously, here the segregation pattern of muta-
tion will depend on both the number of stems as well as the ploidy level of potato,
which is an autotetraploid crop. Mutation breeding in polyploidy crop is more dif-
ficult than a diploid crop due to therecombination and segregation problem.
Genetically, a mutant plant in Ml should be heterozygous, because during treat-
ment, only one allele is affected by one mutation. Probability of occurrence of a
mutation in both the alleles simultaneously is product of individual probabilities

of mutation and therefore, is extremely low. It is not possible to identify a reces-
sive mutation in Ml stage; only dominant mutations can be identified. However,
due to occurrence of this expression is also sectorial, or may not be observable. A
breeder should attempt to screen mutations in M2 generation, where the mutation
will segregate generating homozygotes for recessive or dominant alleles. The Ml
plants should not be allowed to cross pollinate, because recombination will lead to
generation of new variability that will be difficult to separate from effects of muta-
tion (Roychowdhury 2011).
M1 Generation Maintenance
The treated seeds need to be handled with care. The seeds treated, with physical mu-
tagens can be stored before sowing. However, the seeds treated with chemical mu-
tagens should be washed thoroughly and be planted as soon as possible. If the seeds
cannot be plowed soon for various reasons such as weather or long transport, the
seeds should be dried in shade to a moisture content of about 13 % as soon as pos-
sible without causing any damage to the seeds. Soil conditions can have consider-
able influence on survival and growth of the M1. Nitrogen fertility of the soil should
be normal or slightly sub-normal to limit excessive vegetative growth. However,
other nutrients should be at optimum levels. The time of sowing should be slightly
later (2 or 3 weeks) than normal so as to reduce excessive vegetative growth. The
purpose of isolation of the M1 is to avoid the introduction of genetic variability
other than that induced with the mutagenic treatment. Most mutagen treatments will
induce some pollen sterility increasing the amount of out crossing. M1 population
should be planted 75–100 m apart from the parental or other genotypes of the same
crop species. If the crop is frequently insect pollinated, as with some legumes, the
required isolation may he greater and other means of isolation may be required.
Mutagen treated M1 materials normally flower over a longer period than the control
materials. A slightly later sowing of M1 material than the parental genotype will
permit separation of flowering times. When mutation breeding is practiced with a
limited number of M1 types of a crop, it may be possible to grow M1 treatments side
by side since F1 hybrids may not occur or could easily be recognized by means of
marker traits such as flower, plant or spike colour. Mechanically isolation can be
achieved by bagging spikes in cereals using plastic or paper bags to prevent cross-
pollination and bird damage. M1 generation can also be grown in a green house or
in the screen enclosures to achieve control over pollination by insects. Methods of
harvesting the M1 populations will depend on the pattern of ontogenetic develop-
ment in the species, the methods of screening and the generation to be screened
for mutants. In case the seed yield from each branch is reasonably adequate, it is
suggested that each primary branch may be harvested separately. In case of cereals,
individual plant or spike can be harvested (Roychowdhury 2011; Roychowdhury
et al. 2011c, 2012).
Management of M2 Population
Sowing of M2 generation depends upon the method of harvesting of M1 generation.

Two methods of sowing M2 generation can be followed. Firstly, M1 plant to row,
where all seeds produced from a single plant are grown in row. The success of its
use will depend, to a large extent, on how well the branching has been controlled
because it tends to dilute the yield of M2 mutants. Second method is of M1 spike
or branch to row, which offers the greatest precision with regard to the origin of a
mutant when the material treated is genetically homogeneous as regards the non-
mutant allele and when outcrossing is controlled.
Mainly three types of screening/selection techniques can be employed for the
selection of mutants in M2 and subsequent generation viz. visual, mechanical/physi-
cal and other methods (Roychowdhury et al. 2012). Visual screening is the most
effective and efficient method for identifying mutant phenotypes. Visual selection
often is the prime basis for selecting for disease resistance, earliness, plant height,
colour changes, ion-shattering, adaptation to soil, climate, growing period etc.
Mechanical or physical selection can be used very efficiently for seed size, shape,
weight, density, etc., using appropriate sieving machinery. In other category, chemi-
cal, biochemical, physiological, physio-chemical like screening procedures may be
needed for selecting certain types of mutants. Low alkaloid content mutants can he
selected using colorimetric tests. Colorimetric, chromatographic or electrophoresis
techniques may be used to select isolate protein variants.
Propagation and Evaluation of Mutants
When a mutant appears promising, seed multiplication for extensive field testing is
necessary. The mutant, the mother strain and other varieties with which it is intend-
ed to compare, should produce comparable seed properties for the basic trial seed.
Mutants of vegetatively propagated plants can be multiplied by the usual method
for the crop in question such as cuttings, grafting, budding, layering, bulbs, tubers
etc. The methods of testing mutants in comparative trials are essentially the same
as for any other newly developed strain. It is intended to find whether the mu-
tant promises to become a variety surpassing the value of the mother strain and of
the best available variety (a) in at least one property or (b) by a better combina-
tion of different characters; mutants of growth rhythm, growth habit, structure
and yield components should be tested in a wide range of environments such as
locations, soil, water and nutrient conditions, seed rates, planting, distances, sowing
dates etc.
Mutagenesis and Genetic Variability
Diversifying the limited genetic variability for agronomic traits of interest, espe-
cially yield and its associate attributes and developing new crop cultivars are much
demanding in this modern era (Roychowdhury et al. 2012). Due to lack of suf-
ficient natural variability, the mutation breeding performance in crop species can
significantly accelerate many breeding endeavors, which have proven difficult with
classical breeding procedures (Roychowdhury 2011; Roychowdhury et al. 2011).
Various metrical attributes like seed weight, number of branches, leaves, flowers,
leaf area, etc., are very much complex in nature because it is governed by polygenes
and greatly influenced by environmental factors (Roychowdhury et al. 2011, 2011c,
2012). This may raise breeder’s concern, since the genetic organization provides
the base for crop enhancement of environmental adaptation, yield and other associ-
ated attributes. The presence of adequate genetic variability between treatments of
a cultivar is critically important (Fasoula and Fasoula 2002). Moreover, the genetic
progress in a breeding program is actually dependent on the variation in the pres-
ent gene pool (Dreisigacker et al. 2004) associated with the magnitude of several
genetic parameters.
It is a powerful and effective tool in the hands of plant breeders for self-pol-
linating crops having narrow genetic base as well as for cross-pollinating crops
(Micke 1988). The success of any breeding program depends to a large extent on
the amount of genetic variability present in the population. The role of mutation
breeding in increasing the genetic variability for desired traits in various crop plants
have been proved beyond doubt by a number of scientists (Tah 2006; Adamu and
Aliyu 2007; Khan and Goyal 2009; Kozgar et al. 2011; Mostafa 2011; Kozgar et al.
2012). Wide spectrum of genetic variability has been induced using both physical
and chemical mutagens in order to utilize it in crop improvement and inheritance
studies (Patil 1966; Ashri 1970; Gowda et al. 1996). Induced mutations have been
used to generate genetic variability and have been successfully utilized to improve
yield and yield components of various crops like Oryza sativa (Singh et al. 1998),
Dianthus caryophyllus (Roychowdhury and Tah 2011b), Solanum melongena (Roy-
chowdhury et al. 2011c), Cicer arietinum (Kozgar et al. 2012), Vicia faba (Ismail
et al. 1977), Vigna radiata (Wani and Khan 2006; Roychowdhury et al. 2012),
Vigna unguiculata (Mensah and Akomeah 1992), Cajanus cajan (Srivastava and
Singh 1996), Vigna mungo (Singh and Singh 2001b) and Lens culinaris (Khan et al.
2006). These reports show that mutagenesis is a potential tool to be employed for
crop improvement.
Overall variability must be partitioned into heritable and non-heritable compo-
nents with the aid of genetic parameters such as genotypic and phenotypic coef-
ficients of variation, heritability and genetic advance (Ariyo 1987; Roychowdhury
and Tah 2011b; Roychowdhury et al. 2011a, 2011c, 2012). Genetic variability stud-
ies provide basic information regarding the genetic properties of the population
based on which breeding methods are formulated for further improvement of the
crop. These studies are also helpful to know about the nature and extent of vari-
ability that can be attributed to different causes, sensitive nature of the crop to envi-
ronmental influences, heritability of the characters and genetic advance that can be
realized in practical breeding. Progress in any crop improvement venture depends
mainly on the magnitude of genetic variability and heritability present in the source
material. The extent of variability is measured by genotypic coefficient of variance
(GCV) and phenotypic coefficient of variance (PCV) which provides information
about relative amount of variation in different characters. Hence, to have a thorough
comprehensive idea, it is necessary to have and analytical assessment of metrical
components. Since heritability is also influenced by environment, the information
on heritability alone may not help in pin pointing characters enforcing selection.
Nevertheless, the heritability estimates in conjunction with the predicted genetic ad-
vance will be more reliable (Johnson et al. 1955). Heritability gives the information
on the magnitude of inheritance of quantitative traits, while genetic advance will be
helpful in formulating suitable selection procedures. Thus such studies permit an
effective screening of large plant population leading to generate demanding mutant
lines. Therefore, an investigative attempt is essential for estimation the extent of
various genetic parameters like variability, heritability and genetic advance in mu-
tagen treated crop lines for some common agronomically important metrical traits
and establishing a suitable breeding procedure, except expensive available molecu-
lar breeding methods along with developing a high quality and better yielding new
crop germplasm to increase its diversity and sustainable agro-economical market
demand by analyzing the stability capability and effect of mutagens for character
improvement (Roychowdhury et al. 2011c).
Introduce of analysis of variance (ANOVA) revealed either significant or non-
significant differences (at 1 % and/or 5 % level of probability) amongst the crop
genotypes for all the analyzed traits. When highly significant differences were
found, the crop genotypes showed a wide range of variation for all the characters
studied. After analysis of variance (ANOVA) for each character, F-value was cal-
culated. The wide range of F-values provides bright scope to select superior and
suitable genotypes to be incorporated in the breeding programmes for further crop
improvement. It is also important to note the value of coefficient of variation (CV)
and critical difference (CD) values whose significant numerals indicate that the
crop cultivar is suitable for its respective locational field where prevailing environ-
mental effects were favorable. The higher CD value indicates higher stability in that
environment (Roychowdhury 2011).
Substantial differences within phenotypic (PCV) and genotypic (GCV) co-ef-
ficient of variation were needed to mark for all the studied attributes. The least
difference between PCV and GCV indicating phenotypic variability is reliable mea-
sure of genotypic variability. The PCV was higher than the corresponding GCV
for all time the traits which might be due to the interaction of the genotypes with
the environment to some degree or other denoting environmental factors influenc-
ing the expression of these characters. Close correspondence between PCV and
GCV for the characters implied their relative resistance to prevailing environmental
variation. Higher values of PCV and GCV indicate the presence of high degree of
variability and better scope for improvement. However, low values have indicated
narrow range of variation for these characters and provides very least scope for se-
lection. This also described that genetic factors were predominantly responsible for
expression of these attributes and selection could be made effectively on the basis
of phenotypic performance (Roychowdhury et al. 2011c).
The heritability estimates indicate the relative amount of estimates have been
found to be satisfactory tools for selection based on phenotypic performance. The
high estimates of heritability suggested that selection based on phenotypic perfor-
mance would be more effective. However, heritability values alone may not provide
clear predictability of the breeding value. Heritability in conjugation with genetic
advance over mean (GAM) and/or genetic gain is more effective and reliable in
predicting the resultant effect of selection (Roychowdhury and Tah 2011b; Roy-
chowdhury et al. 2011c, 2012). High heritability combined with high genetic gain
indicates less influence of environment in expression of these characters; and preva-
lence of additive gene action in their inheritance (Panse 1957). Hence, these metri-
cal traits require simple selection in breeding programmes. High heritability with
moderate genetic gain indicates that the characters were governed by additive gene
interaction. High heritability coupled with low genetic gain indicating non-additive
gene action; hence heterosis breeding would be recommended for that trait.
Mutational Analysis of Plant Structure and Function
As a prerequisite for functional genomics, mutational analysis of the most important

characters that determine the plant productivity should be considered for the most
important crops. Germplasm collection and maintenance is necessary for the re-
covery of various crop mutants. Rice, maize, barley, mung bean, carnation, tomato
are the only positive examples of crop mutant germplasm conservation. In all these
collections, the number of mutants with described and characterized mutations of
genes responsible for plant productivity or for other agronomically important and
desirable characters for breeding is exceptionally low.
According to Brown and Peters (1996), during investigation on mouse genom-
ics for dissection of basic pathophysiological mechanisms, the first defined term
‘Phenotype gap’ depicts that many mouse mutations are extremely valuable for the
investigation of human diseases and for identification of the critical genes involved
in human pathologies. This ‘phenotype gap’ concept can easily be extended to ge-
netic investigation of plant species as a basic component of the mutational analysis
of any crop plants. The phenotype gap will reflect the gulf between available mutant
resources and the full range of phenotypes of an investigated plant species.
In Arabidopsis thaliana, having a very low amount of DNA per haploid genome,
it seems that the phenotype gap is also very wide. Probably only 1.8 % of visible
markers have been described in which 167 genes are expected per megabase (Mb)
and an average number of identified visible markers of 3 per Mb have been identi-
fied (Vizir et al. 1994). The genome of rice ( Oryza sativa), barley ( Hordeum vul-
gare) and wheat ( Triticum aestivum) contain about 4, 37 and 115 times more DNA
(DNA amounts correspond to genome length) than A. thaliana. This indicates the
amount of work that should be done to fill in the ‘phenotype gap’ in higher plants,
especially the major crop species. Because of the small rice genome size, large scale
mutational work should be initiated with this crop. The synteny of cereal genomes
can help in the use of mutated genes in other cereals.
To narrow the ‘phenotype gap’ in crop plant species, it is necessary to expand
mutant resources in breadth and depth (Brown and Peters 1996) by recovering mu-
tations at new loci and recovering further mutations at known mutated loci. Closing
the ‘phenotype gap’ requires efficient mutagenesis protocols and sensitive screen-
ing methods. As current mutagenesis has a great number of mutagenic agents such
as various types of radiation, chemical mutagenesis, in vitro conditions, insertional
mutagenesis, and activation of retro-transposons, the efficient and sensitive screen-
ing method is still the most limiting factor for isolation of a particular mutation.
There are many misconceptions related to frequency of specific locus mutations.
Most probably, underestimation of the frequency of mutations induced by radia-
tion or chemical mutagens leads to a very critical assessment of their usefulness in
generating desired genetic variability and diversity in plants. It has generally been
accepted, from the last 3 decades, that the average frequency of induced mutations
is approximately on the level of 1 × 10−6. This figure ignores the data related to the
level of spontaneous mutations which have almost similar level for higher eukary-
otes (Drake et al. 1998). Consequently, too high of mutagen doses have often been
used, which induced too many mutations in the nucleus of each treated cell. The
generative progeny that develop from this cell segregate for many characters that
may negatively influence agronomically important characters, such as adaptability
and yield potential. As a result, due to the use of high doses, many mutants were se-
lected in mutated populations but most frequently with significant modifications in
parental genetic background that made their usefulness in breeding programs high-
ly questionable. The effectiveness of mutational strategies was also compromised
by improper handling of successive mutated generations due to misunderstanding
of the genetic consequences of chimeric structure of first mutant generation (M1)
plants and the adoption of ‘diplontic selection’ concept. In reality, the frequency
of mutations at numerous loci is much higher, as is indicated by the frequency of
mutants in the second mutant generation (M2) of some crop species.
Recent developments of gene transfer technology have enormous promise for
improvement of plant productivity; however, there is a lack of available new genes
which can be transferred to current high-yielding varieties and further significantly
increase yield. In other words, there are no genes that have been identified which
can contribute to world crop production. Borlaug (1997) referred to these genes as
‘master genes’ and concluded that Biotechnology may be a new window through
which to search for new ‘master genes’ for high yield potential by eliminating the
confounding effects of other genes. Therefore until new master genes are discov-
ered, alternative solutions for crop improvement must be pursued. Further increases
in crop yield may involve breeding for improved root systems. Breeding programs
for high yield and adaptability have only indirectly selected favorable root systems.
Nevertheless, such an approach cannot replace a gene recombination breeding pro-

gram that focuses on such characters of the root system as the dynamics of soil
penetration; seminal, adventitious, and secondary root numbers; total root length;
weight, number, and distribution of root hairs; and many physiological characters
that directly influence plant productivity. Phosphorus uptake in barley can be almost
doubled by increasing root hair density and length (Gahoonia and Nielsen 1997).
The availability of phosphorous, zinc and other nutrients in poor soils as well as
water and nitrogen nutrition depend also on mycorrhiza associations (Barker et al.
1998). Mycorrhizal fungi transfer assimilated carbon between tobacco plants (Mull-
er and Dulieu 1998). These examples indicate an urgent need for further develop-
ment of selection methods and for studies of the inheritance of characters related
to the root system structure, function, and their linkage with other plant characters.
Mutational analysis of selected root characters in breadth and depth would be the
most desired approach, especially since a high frequency of induced mutations has
been observed in relation to the root characters. More than 3.3 % of progenies of
barley M1 plants have indicated mutation in root system characters after combined
seed treatment with sodium azide (NaN3) and N-methyl-N-nitroso-urea (MNH) ac-
cording to the mutagenic treatment method described by Szarejko and Maluszynski
(1980). Mutant lines selected in M3 generation indicated mutations related to root
hairs, number and length of seminal roots, rootlessness, and abnormal root tip de-
velopment.
Root mutants, described in maize, were obtained after mutagenic treatment with
EMS and mutator MU (Feix et al. 1997). Mutants with unusual gravitropism be-
havior, aberrant lateral root formation, premature root degradation, and with lack of
crown and brace roots were described in mutated generations. The genetic analysis
of mutants indicated that the formation of the various root types and classes is con-
trolled by different genes. Mutational analysis has been demonstrated as a powerful
tool to dissect signaling pathways for plant defense responses (Dangl et al. 1996;
Yang et al. 1997). There are also several examples of the use of mutational analysis
to define the physical size, organization, and the sequence complexity of the major
cluster of pathogenesis-related genes or the fine gene structure, e.g. downy mildew
resistance genes in lettuce (Anderson et al. 1996) and for the Mlo locus for powdery
mildew resistance in barley (Buschges et al. 1997).
Induced mutations in rice, especially for semi-dwarfness and earliness, are
most often used to demonstrate the fastest way to obtain these characters in geno-
types where crosses can modify particular characters such as adaptability, aroma,
taste as well as requirements of local markets. More recently, mutation techniques
have also been used to generate mutants with particular requirements related to
quality characters where a rapid selection method is available. Very useful mu-
tants have been obtained for fatty acid composition in rapeseed (Kott 1995), canola
(Wong and Swanson 1991), flax (Dribnenki et al. 1996), soybean (Schnebly et al.
1995), cuphea (Knapp and Tagliani 1991), camelina (Vollmann et al. 1997), for
grain quality in rice (Kumamaru et al. 1997) and for amylose-free starch in potato
(Leij et al. 1991).
Officially Released Mutant Varieties
Of a total of 1,847 accessions of the FAO/IAEA Mutant Varieties Database (http://

www-mvd.iaea.org), crop species are represented by 1,357 officially released mu-
tant cultivars and ornamental and decorative plant species by 490 mutant varieties.
Crop mutant cultivars were mainly developed in seed propagated plant species
(1,284 entries), whereas vegetatively propagated crops are represented by only 73
varieties. Among the cereals (869 mutant varieties), rice (333) ranks first, followed
by barley (261), bread wheat (147), maize (49), durum wheat (25), and others
(54). Most of the rice mutant varieties (67.6 %) were released as ‘direct mutants’,
i.e. direct seed multiplication of selected mutants and their subsequent distribu-
tion to farmers. In addition, some mutants such as ‘Reimei’ (Japan) and ‘Calrose
76’ (United States) were successfully used in extensive crossbreeding programs.
Semi-dwarfness (129 varieties) and earliness (117 varieties) were the most often
selected characters from the treated populations. The list of improved characters
also contains traits desired for increasing sustainability in rice production, i.e. tol-
erance to cold (13) salinity (6), and photoperiod insensitivity (3). The vast majority
(201) of the directly released rice mutant varieties was induced with physical and
only 25 with chemical mutagens. Radiation was applied in 199 cases and laser
mutagenesis only in the development of two mutant varieties. Among the radiation
sources, gamma rays were used in 199 cases, including 37 varieties developed by
chronic gamma irradiation, followed by 14 with X-rays, 9 with neutrons, and 3
varieties with other sources of radiation. Methyl- and ethyl-nitroso-urea (12) as
well as ethyl methane sulphonate or EMS (9) was most commonly used as chemi-
cal mutagens to induce mutations for breeding new varieties. According to the
database, the mutant rice varieties were officially released in 26 countries. The
seven top countries are: China (117), Japan (46), India (31), United States (23) and
Vietnam (14). The economic impact of rice mutant varieties has been reviewed by
Rutger (1992).
Achievements Through Mutagenesis
Several achievements in crop improvement through mutation breeding: mutation

breeding efforts to date have resulted into two major outcomes—improved varieties
that are directly used as variety for commercial cultivation and new genetic stocks
with improved characters or with better combining ability. Although development
of new cultivars has been the primary objective of mutation breeding, the genetic
stocks developed can have numerous applications in plant breeding, from being
used as a donor parent in conventional breeding programme or as a parent in hybrid
breeding programme. Apart from these, mutation research itself has also a very dif-
ferent objective, i.e., mapping of genes. The technique of identification of a gene
by knockdown of the phenotypic expression through induced mutagenesis is a ma-
jor component of today research on molecular genetics and genomics. Specific se-
quences like transposons can be randomly inserted into a genotype through genetic
crossing, which when inserted within a gene, blocks its transcription, thereby caus-
ing loss of phenotype. The gene then can be identified by using the sequences of
transposon, a technique known as transposon tagging. A variety of other techniques
including RNA interference, gene trap, activation tagging and virus induced gene
silencing are based on the same principle of knocking out the phenotype through
inactivation either at DNA or RNA level to establish gene-phenotype relationship.
Discussion of such techniques is beyond the scope of discussion and will primarily
concentrate on the application of mutation induction for crop improvement purpose
only. International Atomic Energy Association (IAEA) has categorized its mutant
variety database of 3,220 (as on December 2008) varieties according to six breeding
methods namely:
1. Development of commercial cultivars through direct mutagenesis of genotype
(2,738 genotypes),
2. Development of variety using mutant line as one of the parents in crossing pro-
gramme (375 genotypes),
3. Development of variety through crossing of two mutants (28 genotypes),
4. Development of hybrid variety using mutant genotype as one parent (26
genotypes),
5. Development of variety through mutation of segregating generation (53
genotypes).
The first category includes 273R varieties and involves all the released variety
through mutagenesis of seed, vegetative propagules and cultured tissues. Among
the other classes, more success have resulted from using mutant line as parent in
breeding programme as well as mutagenesis of breeding nurseries. Country wise,
China ranks first in development of new varieties through induced mutagenesis
and is well ahead of other countries in numbers. Many of these mutant varieties
have been developed in rice, the principal food crop of India, China and other some
Asian countries, through induced mutagenesis of seed as well as anther culture.
Major commercial mutant varieties of China have been developed in rice, wheat,
maize, Capsicum, cotton, tomato and groundnut. India ranks second after China,
developing about 240 mutant varieties of different crops through direct mutagenesis
of which major varieties have been developed for rice, wheat, barley, pearl millet,
jute, groundnut, soybean, chickpea, mung bean, cowpea, black gram, sugarcane,
chrysanthemum, rose and Dahlia. Additionally, about 50 varieties have been devel-
oped through using mutant lines in breeding programme. Indian mutation breeding
programme became successful in the sixties with development of mutant varieties
in wheat and rice and thereafter flourished in the next decades where new mutants
have been developed in about 60 agricultural and horticultural crops. The major
methods of mutation breeding in India involve irradiation with gamma rays, X-rays
and treatment with EMS. Major Indian Institutes involved in mutation breeding are
Bhabha Atomic Research Centre (BARC) in Mumbai, Indian Agricultural Research
Institute (IARI) in New Delhi and National Botanical Research Institute (NBRI)
in Lucknow. Besides, some State Universities like The University of Burdwan
(BU), Punjab Agricultural University (PAU), Tamil Nadu Agricultural University
(TNAU) and crop specific National Research Centers have contributed a lot in mu-
tation breeding programme in India.
Functional Genomics Approach
In plants, the two most common methods for producing reduction-of-function

mutations are antisense RNA suppression (Finnegan et al. 1996) and insertional
mutagenesis (van Houwelingen et al. 1998; Speulman et al. 1999). However, anti-
sense RNA suppression requires considerable effort for any given target gene be-
fore knowing whether it will work, and insertional mutagenesis occurs at a low
frequency per genome. However, its efficacy is not yet clear; for example, epigen-
etic phenotypes can be variegated and unpredictable (Que and Jorgensen 1998).
Because these techniques rely either on Agrobacterium T-DNA vectors for trans-
mission or on an endogenous tagging system, their usefulness as general reverse
genetics methods is limited to very few plant species. Moreover, these techniques
produce a very limited range of allele types. Therefore, as the amount of sequence
data grows for Arabidopsis and other organisms, it is important to develop genome-
scale reverse genetic strategies that are automated, broadly applicable, and capable
of creating the wide range of mutant alleles that is needed for functional analysis.
Targeting specific loci is especially attractive when only a few genes of interest
exist. Of the targeting methods for plants, posttranscriptional gene silencing (PTGS)
is becoming increasingly popular (Waterhouse et al. 1998), replacing the less re-
liable antisense suppression methods that have been used for years. PTGS takes
advantage of the innate RNAi system that is found in most eukaryotes, in which
double-stranded RNAs are processed into 22–25-bp pieces (Baulcombe 2002) that
can diffuse out of cells through plasmodesmata and the vascular system and into
other cells. These pieces then target homologous transcripts for degradation and
even can target genes for DNA methylation (Matzke et al. 2001). Reports of suc-
cess using this method are encouraging (Chuang and Meyerowitz 2000), although
the efficiency of silencing can vary, so results may be unpredictable. Furthermore,
throughput is limited by the needs to engineer a construct for each gene of interest
and to individually transform plants with each one. PTGS may be the best way to
simultaneously target multiple closely related genes in a family.
Homologous recombination may be the most desirable strategy for targeted mu-
tagenesis and has been routine in some microbial organisms such as E. coli and
yeast for decades (Struhl et al. 1979). However, this technique has thus far been dif-
ficult or infeasible in multicellular eukaryotes, which have less-active homologous
recombination systems. In a few model organisms, including mammals (Capecchi
2000), flies (Rong and Golic 2000), and the moss Physcomytrella (Schaefer 2001),
there has been substantial progress in developing targeting by homologous recom-
bination. However, in higher plants, homologous recombination is not yet efficient

enough for practical use (Wang et al. 2001). Another potentially powerful targeting
method uses chimeric RNA/DNA hybrid oligonucleotides to introduce base chang-
es, insertions, or deletions (Rice et al. 2000), although, to our knowledge, the broad
applicability of this method remains to be demonstrated.
Nucleotide sequence variation is a major determinant of heritable phenotypic
difference in plant genomes. Variation can either be natural, from divergent popu-
lations, or induced through treatment with mutagens (Till et al. 2007a). There are
several methods used in discovery mutations, which are natural or induced through
treatment with mutagens in the genomes. TILLING and ECOTILLING are closely
related methods that are useful in the rapid detection of small mutations and natural
polymorphisms, respectively.
TILLING: A Best Screening Tool for Mutant Plant Population
Genetic variation is a powerful resource that humans have exploited over the mil-
lennia to advance biological knowledge and generate the crops and horticultural
varieties that have become so much a part of everyday life. In recent years, the
availability of genomic sequences from many plant species and the development of
a wide array of molecular-genetic technologies have enhanced our ability to detect
or engineer such variation at specific genetic loci (reverse genetics), greatly expand-
ing our capacity for both probing gene function and genetic engineering. McCallum
et al. (2000a) have introduced a new reverse genetic strategy that combines the high
density of point mutations provided by traditional chemical mutagenesis with rapid
mutational screening to discover induced lesions. TILLING ( Targeting Induced Lo-
cal Lesions IN Genomes) combines chemical mutagenesis (Koornneef et al. 1982)
with a sensitive mutation detection instrument.
The TILLING strategy utilizes traditional mutagenesis followed by high through-
put mutation discovery (Mccallum et al. 2000b; Colbert et al. 2001). The main
steps in TILLING are mutagenesis, the development of a non-chimeric population,
preparation of a germplasm stock, DNA extraction and sample pooling, screening
the population for induced mutations, and the validation and evaluation of mutants
(Fig. 4.6). The methods required for each step can be applied to many species, mak-
ing the TILLING process broadly applicable. Mutants discovered by TILLING can
be used for gene-function studies and can be introduced into breeding programs.
In a pilot experiment, DNA from a collection of EMS-mutagenized Arabidop-
sis plants was pooled, subjected to PCR amplification, and screened for mutations
using denaturing HPLC (DHPLC). DHPLC detects mismatches in heteroduplexes
created by melting and annealing of heteroallelic DNA. Among the lesions detected
were base transitions causing missense and nonsense changes that can be used for
phenotypic analyses.
TILLING is suitable for any organism that can be heavily mutagenized, even
those that lack genetic tools. Starting with a homozygous population is desirable,
Fig. 4.6 A TILLING chart for gene function analysis and developing new crop varieties. A muta-
genized population is prepared using a mutagen that primarily causes small lesions (single nucleo-
tide polymorphisms, or insertions/deletions) randomly throughout the genome. Many mutagenic
treatments produce a chimeric plant in the first generation. Chimeras are dissolved and a structured
population is typically developed. A germplasm stock is prepared for long term storage of mutant
lines, and DNA is extracted from each individual mutant. DNAs are pooled and the library of
samples is screened for induced mutations in selected regions of target genes. Candidate mutants
are removed from the germplasm stock and further characterized genotypically and phenotypi-
cally. Individuals or lines exhibiting the desired characteristics can be incorporated into the breed-
ing program
because DHPLC will detect polymorphisms. Nevertheless, this strategy can be ap-
plied to species and hybrids that cannot be practically homozygosed: we and others
have detected rare polymorphisms in a heteroallelic background using DHPLC. The
general applicability of TILLING makes it appropriate for genetic modification of
crops, and there may be agricultural interest in producing phenotypic variants with-
out introducing foreign DNA of any type into a plant’s genome.
TILLING consists of several major steps: development of a mutagenized popu-
lation, DNA preparation and pooling, and mutation discovery (Fig. 4.7). At first,
random mutations are induced in genomes by using chemical mutagens; seeds are
mutagenized by treatment with ethyl methane sulfonate (EMS). The resulting M1
plants are self-fertilized to get the M2 individuals which are used to prepare DNA
samples for mutational screening. DNA is extracted from test samples. The DNA
samples are pooled and arrayed into microtiter plates. Screening for mutations be-
gins with PCR amplification of a target fragment of up to 1.5 kb using gene-specific
infra-red dye-labeled primers. The forward primer is 5′-end labeled with a fluores-
cent dye that is detected at 700 nm (IRDye 700) and the reverse primer is labeled
with the IRDye 800 nm (Till et al. 2006). These PCR products are denatured and
re-annealed to allow the formation of mismatches, or heteroduplexes, which rep-
resent naturally occurring single nucleotide polymorphisms (SNPs) and induced
SNPs. Samples, are then incubated with a single-strand specific nuclease to digest
mismatched base pairs. For mismatch-specific cleavage, several enzymes, includ-
ing S1 nuclease (Howard et al. 1999) and T4 endonuclease VII (Youil et al. 1996)
Fig. 4.7 Schematic diagram of the overall TILLING and ECOTILLING strategy for plants.
(Modified from Simsek and Kacar 2010)
have been used. After cleavaging, DNA samples are purified from buffer compo-
nents and then each sample is loaded onto a denaturing polyacrylamide gel. Cleaved
heteroduplexes produced two smaller molecular weight products, one labeled with
IRDye 700 and the other with IRDye 800, whose sizes added up to the size of the
full length product (Till et al. 2007b).
TILLING was first applied to Arabidopsis thaliana (McCallum et al. 2000a,
2000b). A mutagenized population was created by treating seeds with EMS. Proof
of concept was shown by the discovery of novel alleles in two cytosine methyl
transferase genes. Researchers have also developed web based software programs
to calculate the putative effect of induced or natural polymorphisms on gene func-
tion. CODDLE (http://www.proweb.org/input) allows requestors to specifically de-
sign their PCR primers to target the functional domain in which they are interested
or to target the most-conserved domain, which is likely to be the most sensitive
to amino-acid substitutions (Gilchrist and Haughn 2005). Also, the conservation-
based SIFT (Sorting Intolerant from Tolerant) software predicts with approximately
75 % accuracy, whether or not an amino acid change is damaging a protein (Ng
and Henikoff 2003). By using a reference DNA sequence, an exon/intron position
model and a list of polymorphisms, software reports the effects of these polymor-
phisms on the expressed gene product in a graphical format (Taylor and Greene
2003). Perry et al. (2003) adapted the TILLING method for the model legume Lotus
japonicas. In a pilot experiment, the frequency of point mutations was analyzed in
the symbiosis defective (symbiosis receptor kinase) gene, which is required for root
symbioses (Stracke et al. 2002). Using this population, 17 mutations were identified
that relate to six independent alleles, thus demonstrating the concept of Perry et al.
(2003) The applicability of TILLING in a polyploid species for wheat was reported
by Slade and Knauf (2005). Over 200 mutations were discovered in the pilot screen
and the estimated mutation densities were exceptionally high: 1 mutation/40 kb in
tetraploid and 1/24 kb in hexaploid wheat. The TILLING method was applied to
model crop rice (Till et al. 2007b). Two different mutagenic treatments provide
a suitably high density of mutations (over 1/500 kb) to consider development of
rice for a high throughput TILLING service. It was shown that high-throughput
TILLING is feasible to maize (an important commercial crop plant with a large ge-
nome but with limited reverse-genetic resources).Screening results from the pools
of DNA samples for mutations in 1 kb segments from 11 different genes, obtaining
17 independent induced mutations from a population of 750 pollens mutagenized in
maize plants. One of the genes targeted was the DMT102chromomethylase gene, in
which an allelic series of three missense mutations were obtained and are predicted
to be strongly deleterious (Till et al. 2004).
High-Resolution Melt Analysis (HRM): An Alternative

Screening Platform
Although Cel1-based TILLING is very efficient for detecting mutations in large

(1–2 kb) exon-rich amplicons from target genes, it is less productive when used to
screen genes with multiple small exons separated by larger introns, as mutations in
introns, except those at splice junctions, rarely affect gene function. High-resolution
melt analysis (HRM) has been established as an alternative screening platform for
such targets. HRM depends on the loss of fluorescence from intercalating dyes bound
Fig. 4.8 Schematic of PCR

and heteroduplex production in
high-resolution melt analysis
(HRM)
to double-stranded DNA during thermal denaturation (Ririe et al. 1997). Accurate

control of temperature and continuous monitoring of fluorescence in instruments al-
lows detection of single base mismatches in amplicons up to 500 bp. The method has
been used both for genotyping and SNP discovery in medical genetics (Zhou et al.
2004, 2005), and SNP genotyping in plants has been demonstrated. Mutation scan-
ning by HRM in hexaploid wheat requires a two-step amplification process, first,
using homeologue-specific primers to amplify a larger amplicon containing several
coding regions, followed by HRM analysis using primers specific for each exon or
part thereof; a simple flowchart is shown in Fig. 4.8. As the melt analysis following
PCR is extremely rapid, the throughput of this technique is equal to or greater than
that of Cel1-based TILLING and is, arguably, easier to establish (Parry et al. 2009).
Ecotilling
The genomes of individuals within a single species contain significant genetic vari-
ation that has arisen from spontaneous mutation. The vast majority of this diversity
is in the form of single nucleotide changes commonly referred to as simple nucleo-
tide polymorphisms (SNPs). Such naturally occurring SNPs are of great interest
to scientists because they are useful as genetic markers in mapping, breeding and
genotyping and can provide information concerning gene structure, linkage dis-
equilibrium, population structure or adaptation. A number of different techniques
for identifying SNPs have been developed. Some of these detect differences in de-
naturation or single stand structure that result from changes in nucleotide sequence
but such techniques fail to identify the number or position of mutations within the
DNA fragment examined (DeFrancesco and Perkel 2001) so detection must be fol-
lowed by sequencing to distinguish between different polymorphisms. The more
direct methods of array hybridization or sequencing are currently expensive when
applied to multiple loci in large numbers of individuals. TILLING provides an alter-
nate approach to identification of naturally occurring SNPs in large populations that
is both robust and relatively inexpensive. This application of TILLING has been
termed ECOTILLING (Comai et al. 2004). Allowing of forceful discovery of mu-
tations, high throughput TILLING technology is ideal for the detection of natural
polymorphisms: CEL I cut with partial efficiency, allowing the display of multiple
mismatches in a DNA duplex. Therefore, interrogating an unknown homologous
DNA by heteroduplexing to a known sequence reveals the number and position of
polymorphic sites. Both nucleotide changes and small insertions and deletions are
identified, including at least some repeat number polymorphisms. This method is
called ECOTILLING.
As with TILLING, ECOTILLING is general, and should be applicable to most
species. The ECOTILLING allows the rapid detection of variation in many indi-
viduals and is cost effective because only one individual for each haplotype need to
be sequenced. The technology is applicable to any organism including those that are
heterozygous and polyploid (Comai et al. 2004). Sixty-three novel SNPs were iden-
tified in 9 target genes, for 41 tree accessions. The ECOTILLING method also was
applied to sugarcane ( Saccharum sp.), a complex polyploidy species, as a model to
develop and test new protocols for high throughput ECOTILLING using capillary
electrophoresis (Eliot et al. 2008). If SNPs in a population occur relatively rarely
(less than one polymorphic individual per pool), the DNA of up to eight such in-
dividuals can be pooled, as is done in TILLING. However, when most individuals
within a population differ at one or more base pairs in any given specific target
sequence, 8-fold pooling will complicate genotyping. For this reason, in highly het-
erozygous species, the genomic DNA from each individual is usually pooled only
with DNA from a reference individual for which the target has been sequenced.
In addition, to detect those loci that were heterozygous prior to pooling, unpooled
genomic DNA from an individual is Ecotilled separately.
ECOTILLING detects the number and relative position of all SNP’s, includ-
ing point mutations, and small insertions and deletions, within a target sequence in
each individual tested. Thus both the spectrum of natural variation within the target
sequence and the distribution of that variation throughout the population can be
established. If knowledge of the specific nucleotide changes is required then DNA
sequencing must be done following ECOTILLING (Fig. 4.7). However, since the
number of different genotypes will normally be much smaller than the number of in-
dividuals examined, the target DNA from only a few representative individuals will
need to be sequenced to establish the exact array of genotypes thus reducing the cost
of SNP detection relative to direct sequencing (Simek and Novoselovi 2012). The
efficacy of ECOTILLING has been demonstrated by two recent studies involving
representative plants from different ecotypes of Arabidopsis thaliana (Comai et al.

2004) and different sub-populations of the poplar Populus trichocarpa (Gilchrist
and Haughn 2005). Both studies were effective in rapidly identifying numerous
target sequence SNP’s within the populations examined. The poplar study provided
information on population heterozygosity and linkage disequilibrium, identified a
conserved potential regulatory domain in an intron and generated ecotype and spe-
cies specific markers for genotyping. The fact that A. thaliana is a small inbreeding
annual while P. trichocarpa is a large out-breeding perennial underscore the univer-
sality of ECOTILLING.
Conclusion and Future Perspectives
The spectrum of available mutation techniques has significantly increased; as a

result, following the recent trend in the release of crop mutant varieties in some
countries, the number of officially released mutant varieties listed in the FAO/IAEA
Mutant Varieties Database will exceed exponentially year after year. The conven-
tional breeding method takes several years to develop a new cultivar/variety from
wild species. Induced mutagenesis and its breeding approaches are potential tools
and being highly used in crops to improve their quality and quantitative yield traits.
Mutagenic induction is much easy to apply on crops and inexpensive to develop de-
sired agronomical traits, high yield, stress tolerance properties and resistant ability
in various crops. Developing genetically novel germplasm becomes more feasible
concurrent with the enhancement of breeding techniques, genomics, molecular ma-
nipulations and genetic engineering. The cost effectiveness of applying new muta-
tion associated technologies (mutation breeding) and trained manpower would be
of paramount importance for crop improvement. In classical mutation breeding,
induced mutations are embedded in mutants that are either directly or indirectly
(through crosses with other varieties) used for developing a new variety, whereby
it is rather difficult to trace the mutated genes in subsequent breeding. The mutant
plant species can be easily selected from some conventional simple screening and
by PCR and non PCR based techniques. Therefore, it should be applied on vari-
ous crops. It is now possible to tag mutated genes, pyramid them into a single elite
breeding line, and follow them up in subsequent breeding programs. In view of
the significance of conventionally induced mutants in functional genomics, there is
great opportunity ahead for us in the era of genomics.
Now, several modern and classical technologies are using for the development
of mutation induction with the objective of using a set of globally important crops
to validate identified relevant novel techniques and build these into modular pipe-
lines to serve as technology packages for induced crop mutations. Thus, mutation
assisted plant breeding will play a crucial role in the generation of ‘designer crop
varieties’ to address the uncertainties of global climate variability and change, and
the challenges of global food insecurity.
References
Adamu AK, Aliyu H (2007) Morphological effects of sodium azide on tomato ( Lycopersicon
esculentum Mill.). Sci World J 2(4):9–12
Ahloowalia BS, Maluszynski M, Nichterlein K (2004) Global impact of mutation derived variet-
ies. Euphytica 135:187–204
Albokari MMA, Alzahrani SM, Alsalman AS (2012) Radiosensitivity of some local cultivars of
wheat ( Triticum aestivum L.) to gamma irradiation. Bangladesh J Bot 41(1):1–5
Ali Z, Xu ZL, Zhang DY, He XL, Bahadur S, Yi JX (2011) Molecular diversity analysis of egg-
plant ( Solanum melongena) genetic resources. Genet Mol Res 10(2):1141–1155
Anderson PA, Okubara PA, Arroyo-Garcia R, Meyers BC, Michelmore RW (1996) Molecular
analysis of irradiation-induced and spontaneous deletion mutants at a disease resistance locus
in Lactuca sativa. Mol General Genet 251:316–325
Ariyo OJ (1987) Variation and heritability of fifteen characters in Okra ( Abelmoschus esculentus
L.). Tropic Agric 45:67–71
Ashri A (1970) A dominant mutation with variable penetrance and expressivity induced by diethyl
sulfate in peanuts ( Arachis hypogaea Linn.). Mutation Res 9:473–480
Auerbach C, Robson JM (1946) Chemical production of mutations. Nature 157:302
Bansal HC, Chopra VL, Swaminathan MS (1962) Effect of ultraviolet pre- and post-treatment on
yield of mutations by X-rays in wheat. Indian J Genet 22:162–166
Barker SJ, Tagu D, Delp G (1998) Regulation of root and fungal morphogenesis in mycorrhizal
symbioses. Plant Physiol 116:1201–1207
Baulcombe D (2002) RNA silencing. Curr Biol 12:R82–R84
Blakely EA (1992) Cell inactivation by heavy charged particles. Radiat Environ Biophys 31:181–196
Borlaug NE (1997) Feeding a world of 10 billion people: the miracle ahead. Plant Tiss Cul Biotech
3(3):119–127
Brown SDM, Peters J (1996) Combining mutagenesis and genomics in the mouse—closing the
phenotype gap. Trends Genet 12(11):433–435
Buschges R, Hollrichter K, Panstruga R, Simons G, Wolter M, Frijters A, van Daelen R, von der
Lee T, Diergaarde P, Groenendijk J, Topsch S, Vos P, Salamini F, Schulze-Lefert P (1997) The
barley Mlo gene: a novel control element of plant pathogen resistance. Cell 88:695–705
Capecchi MR (2000) How close are we to implementing gene targeting in animals other than the
mouse? Proc Natl Acad Sci U S A 97:956–957
Chopra VL (2005) Mutagenesis: investigating the process and processing the outcome for crop
improvement. Curr Sci 89(2):353–359
Chopra VL, Swaminathan MS (1966) Mutagenic efficiency of individual and combined treatments
of ethyl-methane sulfonate and hydroxyl amine in emmer wheat. Indian J Genet 26:59–62
Chopra VL, Kapoor ML, Swaminathan MS (1965) Effects of pre- and post-treatments with S-2-
aminoethyllisothiouronium bromide hydrobromide on the frequency of chromosome aberra-
tions and chlorophyll mutations induced by X-rays in barley. Indian J Exp Biol 3:123–125
Chuang CF, Meyerowitz EM (2000) Specific and heritable genetic interference by double-strand-
ed RNA in Arabidopsis thaliana. Proc Natl Acad Sci U S A 97:4985–4990
Colbert T, Till BJ, Tampa R et al (2001) High-throughput screening for induced point mutations.
Comai L, Young K, Reynolds SH, Codomo C, Enns L, Johnson J, Burtner C, Henikoff JG, Grene
EA, Till BJ, Henikoff S (2004) Efficient discovery of nucleotide polymorphisms in populations
by ECOTILLING. Plant J 37:778–786
Dangl JL, Dietrich RA, Richberg MH (1996) Death don’t have no mercy: cell death programs in
plant-microbe interaction. Plant Cell 8:1793–1807
DeFrancesco L, Perkel JM (2001) In search of genomic variation. Scientist 15:24–26
DeVries H (1905) Species and varieties: their origin by mutation. The Open Court Publishing
Company, Chicago
Din R, Qasim M, Ahmad K (2004) Radio sensitivity of various wheat genotypes in M1 generation.
Int J Agric Biol 6:898–900
Domingo C, Andres F, Talon M (2007) Rice cv. Bahia mutagenized population: a new resource for
rice breeding in the Mediterranean basin. Span J Agric Res 5:341–347
Drake JW, Charlesworth B, Charlesworth D, Crow JF (1998) Rates of spontaneous mutation.
Genetics 148:1667–1686
Dreisigacker S, Zhang P, Warburton ML, Van Ginkel M (2004) SSR and pedigree analyses of
genetic diversity among CIMMYT wheat lines targeted to different mega environments. Crop
Sci 44:381–388
Dribnenki JCP, Green AG, Atlin GN (1996) Linola TM 989 low linolenic flax. Can J Plant Sci
76:329–331
Eliot F, Cordeiro G, Bundock PC, Henry RJ (2008) SNP discovery by ECOTILLING using capil-
lary electrophoresis. Plant Genotyping 2: SNP Technol 5:78–87
Fasoula VA, Fasoula DA (2002) Principles underlying genetic improvement for high and stable
crop yield potential. Field Crops Res 75:191–209
Feix G, Hochholdinger F, Wulff D (1997) Genetic analysis of root formation in maize. In: Devel-
opmental pathways in plants: biotechnological implications. The Hebrew University of Jeru-
salem, Rehovot, p 10
Finnegan EJ, Peacock WJ, Dennis ES (1996) Reduced DNA methylation in Arabidopsis thaliana
results in abnormal plant development. Proc Natl Acad Sci U S A 93:8449–8454
Gahoonia TS, Nielsen NE (1997) Variation in root hairs of barley cultivars doubled soil phospho-
rous uptake. Euphytica 98:177–182
Gilchrist EJ, Haughn GW (2005) TILLING without a plough: a new method with applications for
reverse genetics. Curr Opin Plant Biol 8:211–215
Gnanamurthy S, Dhanavel D, Chidambaram ALA (2012) Frequency in germination studies of
chlorophyll mutants in effectiveness and efficiency using chemical mutagens. Int J Curr Life
Sci 2(3):23–27
Gowda MVC, Nadaf HL, Sheshagiri R (1996) The role of mutation in intraspecific differentiation
of groundnut ( Arachis hypogaea L.). Euphytica 90:105–113
Hase Y, Akita Y, Kitamura S, Narumi I, Tanaka A (2012) Development of an efficient mutagen-
esis technique using ion beams: Toward more controlled mutation breeding. Plant Biotechnol
29:193–200
Howard JT, Ward J, Watson JN, Roux KH (1999) Heteroduplex cleavage analysis using S1 nucle-
ase. Biotech 27:18–19
Islam SMS (2010) The effect of colchicine pretreatment on isolated microspore culture of wheat
( Triticum aestivum L.). Aus J Crop Sci 4(9):660–665
Ismail MA, Heakal MY, Fayed A (1977) Improvement of yield through induced mutagenesis in
broad beans. Indian J Genet Plant Breed 36(3):347–350
Johnson HW, Robinson HF, Comstock RE (1955) Estimation of genetic and environmental vari-
ability in soybean. Agron J 47:314–318
Kang SY, Kim JB, Lee GJ, Kim DS (2010) Gamma phytotron: a new chronic gamma irradiation
facility. Plant Mut Rep 2(2):50–51
Kazama Y, Saito H, Yamamoto YY, Hayashi Y, Ichida H, Ryuto H, Fukunishi N, Abe T (2008)
LET-dependent effects of heavy-ion beam irradiation in Arabidopsis thaliana. Plant Biotech-
nol 25:113–117
Khan S, Goyal S (2009) Improvement of mungbean varieties through induced mutations. Afr J
Khan S, Wani MR, Parveen K (2006) Sodium azide induced high yielding early mutant in lentil.
Agric Sci Digest 26(1):65–66
Khan S, Al-Qurainy F, Anwar F (2009) Sodium azide: a chemical mutagen for enhancement of
agronomic traits of crop plants. Environ Int J Sci Tech 4:1–21
Kharkwal MC, Shu QY (2009) The role of induced mutations in world food security. Shu QY
(eds) In: Induced plant mutations in the genomics era. Food and Agriculture Organization of
the United Nations, Rome, pp 33–38
Kidwell MG (2005) Transposable elements. In: Gregory TR (eds) The evolution of the genome.
Elsevier, San Diego, pp 165–221
Knapp SJ, Tagliani LA (1991) Two medium chain fatty acid mutants of Cuphea viscosissima. Plant
Breed 106:338–341
Koornneef M, Dellaert LW, Van Der Veen JH (1982) EMS- and radiation-induced mutation fre-
quencies at individual loci in Arabidopsis thaliana (L.) Heynh. Mutat Res 93:109–123
Kott L (1995) Production of mutants using the rapeseed doubled haploid system. In: Induced muta-
tions and molecular techniques for crop improvement. IAEA, Vienna
Kovacs E, Keresztes A (2002) Effect of gamma and UV-BIC radiation on plant cells. Micron
33:199–210
Kozgar MI, Goyal S, Khan S (2011) EMS induced mutational variability in Vigna radiata and
Vigna mungo. Res J Bot 6:31–37
Kozgar MI, Khan S, Wani MR (2012) Variability and correlations studies for total iron and manga-
nese contents of chickpea ( Cicer arietinum L.) high yielding mutants. American J Food Tech
7:437–444
Kumamaru T, Sato H, Satoh H (1997) High-lysine mutants of rice, Oryza sativa L. Plant Breed
116:245–249
Leij FR, Visser RGF, Oosterhaven K, Kop DAM, Jacobsen E, Feenstra WJ (1991) Complementa-
tion of the amylose-free starch mutant of potato ( Solanum tuberosum) by the gene encoding
granule-bound starch synthase. Theor Appl Genet 82:289–295
Lett JT (1992) Damage to cellular DNA from particulate radiations, the efficacy of its process-
ing and the radiosensitivity of mammalian cells. Emphasis on DNA double strand breaks and
chromatin breaks. Radiat Environ Biophys 31:257–277
Mahajani S, Chopra VL (1973) Interaction of formaldehyde and X-rays on mutation production in
Drosophila melanogaster. Curr Sci 42:473–474
Maluszynski M (1999) Crop germplasm enhancement through mutation techniques. Proceed-
ings of the International Symposium on Rice Germplasm Evaluation and Enhancement
Arkansas, Stuttgart, pp 74–83
Maluszynski M, Nichterlein K, van Zanten L, Ahloowalia BS (2000) Officially released mutant
varieties—the FAO/IAEA Database. Mut Breed Rev 12:1–12
Matzke M, Matzke AJM, Kooter JM (2001) RNA: guiding gene silencing. Science 293:1080–1083
McCallum CM, Comai L, Greene EA, Henikoff S (2000a) Targeting Induced Local Lesions in
Genomes (TILLING) for plant functional genomics. Plant Physiol 123:439–442
McCallum CM, Comai L, Grene EA, Henikoff S (2000b) Targeted screening for induced muta-
tions. Nat Biotechnol 18:455–457
Mensah JK, Akomeah PA (1992) Mutagenic effects of hydroxylamine and streptomycin on the
growth and seed yield of cowpea ( Vigna unguiculata L. Walp). Legume Res 15(1):39–44
Mensah JK, Obadoni O (2007) Effects of sodium azide on yield parameters of groundnut ( Arachis
hypogea L.). Afr J Biotechnol 6:20–25
Micke A (1988) Genetic improvement of grain legumes using induced mutations: an overview. In:
Improvement of grain legume production using induced mutations. IAEA, Vienna, pp 1–51
Micke A, Donini B, Maluszynski M (1990) Induced mutations for crop improvement. Mut Breed
Rev 7:41
Mostafa GG (2011) Effect of sodium azide on the growth and variability induction in Helianthus
annuus L. Int J Plant Breed Genet 5:76–85
Muller HJ (1927) Artificial transmutation of the gene. Science 66:84–87
Muller J, Dulieu H (1998) Enhanced growth of non-photosynthesizing tobacco mutants in the
presence of a mycorrhizal inoculum. J Exp Bot 49(321):707–711
Nakayama M, Tanikawa N, Morita Y, Ban Y (2012) Comprehensive analyses of anthocyanin
and related compounds to understand flower color change in ion-beam mutants of cyclamen
( Cyclamen spp.) and carnation ( Dianthus caryophyllus). Plant Biotechnol 29:215–221
Ng PC, Henikoff S (2003) SIFT: predicting amino acid changes that affect protein function.
Novak FJ, Brunner H (1992) Plant breeding: induced mutation technology for crop improvement.
IAEA Bull 4:25–32
Okamura M, Umemoto N, Onishi N (2012) Breeding glittering carnations by an efficient mutagen-
esis system. Plant Biotechnol 29:209–214
Panse VG (1957) Genetics of quantitative characters in relation to plant breeding. Indian J Genet
Plant Breed 17:318–328
Parry MAJ, Madgwick PJ, Bayon C, Tearall K, Hernandez-Lopez A, Baudo M, Rakszegi M,
Hamada W, Al-Yassin A, Ouabbou H, Labhilili M, Phillips AL (2009) Mutation discovery for
crop improvement. J Exp Bot 60(10):2817–2825
Patil SH (1966) Mutations induced in groundnut by X-rays. Indian J Genet 26A:334–348
Perry JA, Wang TL, Welham TJ, Gardner S, Pike JM, Yoshida S, Parniske M (2003) A TILLING
reverse genetics tool and a web accessible collection of mutants of the legume Lotus japonicus.
Que Q, Jorgensen RA (1998) Homology-based control of gene expression patterns in transgenic
petunia flowers. Dev Genet 22:100–109
Ranel C (1989) The nature of spontaneous mutations. Mutation Res 212:3342
Rice MC, May GD, Kipp PD, Parekh H, Kmiec EB (2000) Genetic repair of mutations in plant
cell-free extracts directed by specific chimeric oligonucleotides. Plant Physiol 123:427–438
Ririe KM, Rasmussen RP, Wittwer CT (1997) Product differentiation by analysis of DNA melting
curves during the polymerase chain reaction. Anal Biochem 245:154–160
Rong YS, Golic KG (2000) Gene targeting by homologous recombination in Drosophila. Science
288:2013–2018
Roychowdhury R (2011) Effect of chemical mutagens on carnation ( Dianthus caryophyllus L.): a
mutation breeding approach. LAP Lambert Academic Publishing, Germany, pp 1–276
Roychowdhury R, Tah J (2011) Mutation breeding in Dianthus caryophyllus L. for economic
traits. Electronic J Plant Breed 2(2):282–286
Roychowdhury R, Tah J (2011a) Assessment of chemical mutagenic effects in mutation breeding
programme for M1 generation of Carnation ( Dianthus caryophyllus). Res Plant Biol 1(4):23–32
Roychowdhury R, Tah J (2011b) Genetic variability study for yield and associated quantitative
characters in mutant genotypes of Dianthus caryophyllus L. Int J Biosci 1(5):38–44
Roychowdhury R, Tah J (2011c) Chemical mutagenic action on seed germination and related agro-
metrical traits in M1 Dianthus generation. Curr Bot 2(8):19–23
Roychowdhury R, Bandyopadhyay A, Dalal T, Tah J (2011) Biometrical analysis for some
agro-economic characters in M1 generation of Dianthus caryophyllus. Plant Archives
11(2):989–994
Roychowdhury R, Tah J, Dalal T, Bandyopadhyay A (2011a) Selection response and correlation
studies for metrical traits in mutant carnation ( Dianthus caryophyllus L.) genotypes. Cont J
Agric Sci 5(3):6–14
Roychowdhury R, Sultana P, Tah J (2011b) Morphological architecture of foliar stomata in M2
carnation ( Dianthus caryophyllus L.) genotypes using scanning electron microscopy (SEM).
Electronic J Plant Breed 2(4):583–588
Roychowdhury R, Roy S, Tah J (2011c) Estimation of heritable components of variation and char-
acter selection in eggplant ( Solanum melongena L.) for mutation breeding programme. Cont J
Biol Sci 4(2):31–36
Roychowdhury R, Datta S, Gupta P, Tah J (2012) Analysis of genetic parameters on mutant popu-
lations of mungbean ( Vigna radiata L.) after ethyl methane sulphonate treatment. Not Sci Biol
4(1):137–143
Roychowdhury R, Alam MJF, Bishnu S, Dalal T, Tah J (2012a) Comparative study for chemical
mutagenesis on seed germination, survivability and pollen sterility in M1 and M2 generations
of Dianthus. Plant Breed Seed Sci 65(1):29–38
Rutger JN (1992) Impact of mutation breeding in rice—a review. Mut Breed Rev 8:1–24
Schaefer DG (2001) Gene targeting in Physcomitrella patens. Curr Opin Plant Biol 4:143–150
Schnebly SR, Fehr WR, Welke GA, Hammond EG, Duvick DN (1995) Inheritance of reduced and
elevated palmitate in mutant lines of soybean. Crop Sci 34:829–833
Siddiqui BA, Khan S (1999) Breeding in crop plants: mutations and in vitro mutation breeding.
Kalyani, India, p 402
Simek R, Novoselovi D (2012) The use of reverse genetics approach in plant genomics. Poljo-
privreda 18(1):14–18
Simsek O, Kacar YA (2010) Discovery of mutations with TILLING and ECOTILLING in plant
genomes. Sci Res Essays 5(24): 3799–3802
Singh J, Singh S (2001a) Induced mutations in basmati rice ( Oryza sativa L.). Diamond Jub Symp,
New Delhi, p 212
Singh M, Singh VP (2001b) Genetic analysis of certain mutant lines of Urdbean for yield and qual-
ity traits in M4 generation. Indian J Pulses Res 14(1):60–62
Singh S, Richharia AK, Joshi AK (1998) An assessment of gamma ray induced mutations in rice
( Oryza sativa L.). Indian J Genet Plant Breed 58(4):455–463
Slade AJ, Knauf VC (2005) TILLING moves beyond functional genomics into crop improvement.
Transgenic Res 14:109–115
Speulman E, Metz PL, van Arkel G, te Lintel Hekkert B, Stiekema WJ, Pereira A (1999) A two-
component enhancer-inhibitor transposon mutagenesis system for functional analysis of the
Arabidopsis genome. Plant Cell 11:1853–1866
Srivastava A, Singh VP (1996) Induced high yielding Pigeon pea mutants. Mut Breed Newsletter
42:8–9
Stadler LJ (1928) Mutation in barley induced by X-rays and radium. Science 67:186–187
Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S, Sandal N, Stougaard J,
Szczyglowski K, Parniske M (2002) A receptor-like kinase required for both bacterial and
fungal symbiosis. Nature 417:959–962
Struhl K, Stinchcomb DT, Scherer S, Davis RW (1979) High-frequency transformation of yeast:
autonomous replication of hybrid DNA molecules. Proc Natl Acad Sci U S A 76:1035–1039
Swaminathan MS, Natarajan AT (1959) Effect of ultraviolet pretreatment on yield of mutations by
X-rays in wheat. Science 130:1407–1409
Szarejko I, Maluszynski M (1980) Analysis of usefulness of sodium azide in plant breeding. Acta
Biol 9:60–66
Tah PR (2006) Induced macromutation in mungbean [Vigna radiata (L.) Wilczek]. Int J Bot
2:219–228
Taylor NE, Greene EA (2003) PARSESNP: a tool for the analysis of nucleotide polymorphisms.
Till BJ, Burtner C, Comai L, Henikoff S (2004) Mismatch cleavage by single-strand specific nu-
cleases. Nucleic Acids Res 32:2632–2641
Till BJ, Zerr T, Bowers E, Grene EA, Comai L, Henikoff S (2006) High throughput discovery of
rare human nucleotide polymorphisms by ECOTILLING. Nucleic Acids Res 34:99
Till BJ, Comai L, Henikoff S (2007a) TILLING and ECOTILLING for crop improvement. In:
Genomics-assisted crop improvement, vol 1. Genomics approaches and platforms. Springer,
Germany, pp 333–349
Till BJ, Cooper J, Tai TH, Colowit P, Greene EA, Henikoff S, Comai L (2007b) Discovery of
chemically induced mutations in rice by TILLING. BMC Plant Biol 7:19
Van Houwelingen A, Souer E, Spelt K, Kloos D, Mol J, Koes R (1998) Analysis of flower pig-
mentation mutants generated by random transposon mutagenesis in Petunia hybrida. Plant J
13:39–50
Vasline YA, Vennila S, Ganesan J (2005) Mutation—an alternate source of variability. UGC na-
tional seminar on present scenario in plant science research. Department Botany, Annamalai
University, Annamalainagar, pp 42
Vizir IY, Anderson ML, Wilson ZA, Mulligan BJ (1994) Isolation of deficiencies in the Arabidop-
sis genome by gamma irradiation of pollen. Genetics 137:1111–1119
Vollmann J, Damboeck A, Baumgartner S, Ruckenbauer P (1997) Selection of induced mutants
with improved linolenic acid content in camelina. Fett/Lipid 99(10):357–361
Wang HX, Viret JF, Eldridge A, Perera R, Signer ER et al (2001) Positive-negative selection for
homologous recombination in Arabidopsis. Gene 272:249–55
Wani MR, Khan S (2006) Estimates of genetic variability in mutated populations and the scope of
selection for yield attributes in Vigna radiata (L.) Wilczek. Egypt J Biol 8:1–6
Waterhouse PM, Graham MW, Wang MB (1998) Virus resistance and gene silencing in plants can
be induced by simultaneous expression of sense and antisense RNA. Proc Natl Acad Sci U S
A 95:13959–13964
Waugh R, Leader DJ, McCallum N, Caldwell D (2006) Harvesting the potential of induced bio-
logical diversity. Trends Plant Sci 11:71–79
Wessler SR (2006) Transposable elements and the evolution of eukaryotic genomes. Proc Natl
Acad Sci U S A 103:17600–17601
Wilde HD, Chen Y, Jiang P, Bhattacharya A (2012) Targeted mutation breeding of horticultural
plants. Emir J Food Agric 24(1):31–41
Wong RSC, Swanson E (1991) Genetic modification of canola oil: high oleic acid canola. In:
Haberstroh C, Morris CE (eds) Fat and cholesterol reduced food. Gull, Houston, pp 154–164
Yang Y, Shah J, Klessig DF (1997) Signal perception and transduction in plant defense responses.
Genes Dev 11:1621–1639
Youil R, Kemper B, Cotton RG (1996) Detection of 81 of 81 known mouse beta-globin promoter
mutations with T4 endonuclease VII—the EMC method. Genomics 32:431–435
Zhou L, Vandersteen J, Wang L, Fuller T, Taylor M, Palais B, Wittwer CT (2004) High-resolution
DNA melting curve analysis to establish HLA genotypic identity. Tissue Antigens 64:156–164
Zhou LM, Wang L, Palais R, Pryor R, Wittwer CT (2005) High resolution DNA melting analysis
for simultaneous mutation scanning and genotyping in solution. Clinical Chem 51:1770–1777
Chapter 5
Role of Bio-fertilizers in Crop Improvement
Majeed–ul-Hassan Chesti, Tabasum N. Qadri, Asiya Hamid, Javed Qadri,

Mohamed Mahgoub Azooz and Parvaiz Ahmad
Abstract Bio-fertilizers are cost effective, ecofriendly and renewable source of

plant nutrients to supplement chemical fertilizers in sustainable agricultural system.
Bio-fertilizers are preparations containing living cells of efficient nitrogen fixing,
P-solubilizing/mobilizing or cellulose decomposing microorganisms, which when
applied to seed or inoculated into the soil enhance availability of nutrients to plants
either working symbiotically/asymbiotically or through solubiization of soil nutri-
ents such as phosphorus or decomposition of complex materials. Bio-fertilizers are
gaining impetus due to the growing emphasis on maintenance of soil health, curtail
the environmental pollution and cut down on the use of chemicals in agriculture.
Bio-fertilizers are also ideal input for reducing the cost of cultivation and for prac-
ticing organic farming. In the present context of very high cost of chemical fertil-
izers, the bio-fertilizers assume special significance.
M.-ul-H. Chesti () · J. Qadri

Regional Agricultural Research Station, SKUAST-J, Tandwal, Rajouri 185131,
Jammu and Kashmir, India
J. Qadri
T. N. Qadri · A. Hamid
Department of Botany, GDC Budgam, Srinagar, Jammu and Kashmir, India
A. Hamid
M. M. Azooz
Department of Botany, Faculty of Science, South Valley University, 83523 Qena, Egypt
Department of Biological Sciences, Faculty of Science, King Faisal University,
Al Ahsa, Saudi Arabia
P. Ahmad
Department of Botany, GDC Anantnag, Srinagar, Jammu and Kashmir, India

190 M.-ul-H. Chesti et al.
Introduction
Bio-fertilizers are microbial inoculants of bacteria, algae, fungi that augment the
availability of nutrients to the plants. Use of bio-fertilizers, in contrast to chemical
fertilizers, accounts economical and ecological benefits to farmers (Brahmaprakash
and Sahu 2012). Different types of microorganisms show the potential of converting
essential soil nutrients which are in unavailable form to available form with the help
of biological activity biological process such as nitrogen fixation and solubilization
of rock phosphate (Rokhzadi et al. 2008). Bio-fertilizers improve plant growth, pro-
tect plants from amelioration of toxic effect in soils, root pest and disease control,
improved water usage and soil fertility (Halim 2009; El-yazeid et al. 2007; Badawi
et al. 2011; Mader et al. 2011; Mohammadi and Sohrabi 2012).
In addition they get engaged in symbiotic as well as associative microbial activi-
ties with higher plants Tiwari et al. 2003. These being an economical and safer source
of plant nutrition for increasing the agricultural production, improve soil fertility and
are called mini fertilizer factories (Vyas et al. 2008). The microorganisms form root
nodules in leguminous plants by colonizing roots of legumes. Nitrogen fixation, phos-
phorus solublization and phytohormone production abilities have been observed and
result in enhancement of agricultural productivity, e.g. Rhizobium for legumes (grain,
fodder) (Ali et al. 2010) plant growth promoting rhizobacteria (PGPR) for cereals
(wheat, rice, grasses etc.), Azolla for rice ecosystem, and actinomycetes ( Frankia
spp.) (Zhang et al. 2012), for forest trees (Danso et al. 1992). These microorganisms
also have the ability to convert atmospheric nitrogen to plant usable form and can pro-
vide up to 200 kg N/ha/crop. Besides nitrogen, phosphorus is an essential element for
crop production. Another group of bacteria which play important role in stimulating
growth of plants are plant growth-promoting rhizobacteria (PGPR), they in addition
to stimulating growth of plants also control plant pathogens, and pest infestation i.e
they act as bio-fertilizers as well as biopesticides and ought to have meticulous con-
sideration for agricultural purposes (Lugtenberg and Kamilova 2009). PGPR colo-
nizes the rhizosphere, i.e, around the root, and even in the intercellular spaces of root.
Advantages of Bio-fertilizers over Chemical Fertilizers
Uses of microbial products have various advantages over traditional chemicals for
agricultural purposes (Mahdi et al. 2010). These products have been commended
safer than many of the chemicals that are used, they can fix atmospheric nitrogen
in nodules of leguminous plants and soil and make it available to the plants and in-
crease the fertility of soil (Shankar et al. 2012). They solublize the insoluble forms
of phosphorous and again make is available to the plants (Hashemabadi et al. 2012),
they also produce hormones which promote the growth of rhizosphere in addition to
these properties they also help in mineralization of soil by decomposing the organic
matter (Mahdi et al. 2010).
5 Role of Bio-fertilizers in Crop Improvement 191
Above all neither toxic exudates of these microbes, nor microbes themselves
are accumulated in the food chain, self-replication of microbes curtails the need for
repeated application and target organisms rarely build up resistance as is observed
when chemical agents are used to get rid of the pests detrimental to plant develop-
ment (Mahdi et al. 2010).
Agricultural land deprived of essential nutrients gets impoverished after long
term cultivation, to provide or nourish the soil nutrient content under conventional
farming system, farmers use apply elevated doses of chemical fertilizers which in
turn contaminate the ecosystem. Thus to implement the agricultural land a balanced
and accountable use of organic agriculture is required. The principles of organic
farming also outline the similar concepts where the soil health and biodiversity
is built up to sustain the plant growth in longer term (Mahdi et al. 2010). Various
beneficial microbes and their products found in rhizosphere are useful to plants
by means of promoting growth or by acting as bio-control agents or both and are
termed as Plant Growth-Promoting Rhizobacteria (PGPR) (Akhtar et al. 2012;
Faramarzi et al. 2012). Rosenblueth and Martinez (2006) described several endo-
phytic bacteria from different plant species mainly belonging to genera Rhizobium,
Azospirillum, Bacillus, Pseudomonas, Azotobacter, Burkholderia, Herbaspirillum,
etc. play beneficial roles e.g. endophytic N-fixation, increased P-uptake, improve
photosynthesis and plant vigor, tolerance to biotic as well as abiotic stresses and in
addition to these properties they act as insecticides and help in phytoremediation of
polluted soils. Bio-fertilizers application can be used on crops prior to planting i.e.
directly to soil, as a side dressing or as a foliar spray because it does not pollute and
it adds humus to the soil (Raj 2007; Venkatashwarlu 2008). Co-inoculation of some
Pseudomonas and Bacillus strains along with effective Rhizobium spp. is shown
to stimulate chickpea growth, nodulation and nitrogen fixation (Mohammadi et al.
2010). Findings of Mohammadi et al. (2010) showed that the highest sugar, protein,
starch contents, nodule weight and seed nitrogen, potassium, phosphorus of chick-
pea were obtained from combined application of phosphate solubilizing bacteria,
Rhizobium and Trichoderma fungus. The Bio-fertilizers fix nitrogen in the soil that
benefits the plant to overcome the nutritional stress. Appropriate doses of phospho-
rus, potassium, zinc, iron, molybdenum and cobalt along with fertilizers mitigate
the stress and the legume starts responding directly to the nutrient. Usually most
of the nitrogen fixed passes directly into the plant whereas some of it gets leaked
into the soil for non-legume plant. However, after death, decay of these legumes by
micro-organisms nitrogen eventually returns to the soil.
Types of Bio-fertilizers
A variety of recognized microorganisms for nitrogen fixation are also used such as
Azorhizobium caulinodans and is effectively utilized in rice and maize. Likewise
Acetobacter and Sinorhizobium have been used for sugarcane and soybean crop.
Respectively microbes like Thiobacillus and Thiooxidans are known for sulphur
and iron oxidization.
Nitrogen Fixing Bio-fertilizers
The nitrogen fixing bacteria are of two types’ i.e., biological nitrogen fixation (sym-
biotic) and non-symbiotic nitrogen fixation (free living). The former develops as
an association with crop plants through formation of nodules in their roots while
as free living bacteria can fix atmospheric nitrogen without association with plants.
Biological Nitrogen Fixation
Atmosphere contains approximately 70 % of N which is not readily available form

and therefore is not consumed by living organisms. It can be made available with
the help of chemical or biological processes, though chemical nitrogen fertilizers
are relatively expensive (Zilli et al. 2004). Living organisms utilize nitrogen in the
form of ammonia to synthesize proteins, nucleic acids, amino acids, and other nitro-
gen-containing compounds for the maintenance of life. The process of conversion
of inert N2 to biologically important NH3 with the help of bacteria is called biologi-
cal Nitrogen Fixation. The nitrogen fixation is done by the bacteria, and the NH3
produced is absorbed by the plant.
This biological reduction of nitrogen to ammonia is performed only by some
prokaryotes and is a highly oxygen-sensitive process. The Biological nitrogen fixa-
tion includes diverse range of diazotrophic soil microbes belonging to aerobes ( Azo-
tobacter, Beijerinckia, Drexia), facultative anaerobes (Clostridium, Pseudomonas,
Rhizobium), heterotrophs ( Klebsiella, Enterobacter), phototrophs ( Anabaena, Nos-
toc, Azosprillium) The most competent nitrogen fixers establish a symbiosis with
higher plants in which the energy for nitrogen fixation and, in general, the oxygen
protection system in particular are provided by the plant partner. In these symbiotic
relationships prokaryotic partnership is provided by soil bacteria Rhizobium in legu-
minous plants and Frankia bacteria in actinorhizal symbiosis. Biological Nitrogen
Fixation confers tremendous amount of NH3 to natural ecosystems.
Rhizobium
Rhizobium is a gram-negative, free living organism present in soil, once it comes

in contact with specific legume crop, nitrogen fixation starts and this rhizobium-
legume association is of significant environmental and agricultural importance in
view of the fact that it accounts for an estimated 180 million tons biological ni-
trogen fixation per year (Postgate 1982). Rhizobium invades the root hairs of the
legumes by forming nodules. First time, bacterium capable of fixing nitrogen was
isolated from nodules of a legume in 1888 by Beijirinck from Holland. Later on this
bacterium was reported in Bergey’s Manual of Determinative Bacteriology under
the genus Rhizobium. Rhizobium has the ability to fix the atmospheric N in symbi-
otic state only. Rhizobium also exists as an endosymbiotic N fixing microorganism
associated with root of legumes. It enters into plants through the root system then
it forms nodule. The name Rhizobium was established by Frank in 1889. Seven
distinct species of rhizobium has so far being discovered on the basis of “Cross
Inoculation Group Concept” and more than twenty cross-inoculations groups have
been established so far. Out of this, merely seven are most important. One group of
rhizobia are very slow growing and are known as Bradyrhizobium while as other
group is rhizobia is fast growing and is known as Rhizobium. Both slow growing as
well as fast growing rhizobia has ability to fix atmospheric nitrogen. They create a
symbiotic association with legumes and some non-legumes like Parasponia. Rhizo-
bium legume symbiosis is very host-specific process and it fixes N in particular host
plant only, this host specifity is mediated by plant compounds such as flavonoids
(Goethals et al. 1992). Flavonoid activates the nod genes present in Rhizobium. The
communication of rhizobia and legumes begins with signal exchange and recogni-
tion of the symbiotic partners, which is followed by attachment of the rhizobia to
the plant root hairs. After infection, the root hair starts deforming, and the bacteria
invades the plant by a newly produced infection thread growing through it at the
same time, cortical cells which are mitotically activated, give rise to the nodule pri-
mordium. Infection threads grow toward the primordium, and the bacteria are then
released into the cytoplasm of the host cells, surrounded by a plant derived perib-
acteroid membrane (PBM) (Van Workum et al. 1998). In the course of process the
nodule primordium develops into a mature nodule, while the bacteria differentiate
into their endosymbiotic form that is called as the bacteroid. The effective nodules
are filled with pink sap called leghaemoglobin pigment. Leghaemoglobin regulates
the supply of oxygen to the bacteria and helps the activity of nitrogenase enzyme
and other regulatory enzymes (Choudhury and Kennedy 2004). The nitrogenase is
responsible for reduction of nitrogen to ammonia in the process of nitrogen fixation.
Bacteroids, together with the surrounding PBMs, are called symbiosomes. When
symbiosomes are developed, bacteria synthesize nitrogenase, which catalyzes
the reduction of nitrogen (Mylona et al. 1995). The product of nitrogen fixation,
ammonia, is then exported to the plant. The plant provides all immediate nutrients
and energy for the bacteria and just in a week small bead like structures i.e., nodules
are formed. The root nodules act as a micro fermentor for biological N fixation
where they can convert atmospheric N into ammonia. Rhizobium is able to induce
the shoot and root growth in rice plants. (Yanni and El-Fattah 1999). Nodules occur
in many shapes such as in Alfalfa and clover, nodules are fingerlike, round in Lentil,
palm shaped in Cicer, though the entire nodule is generally less than 1/2 in in di-
ameter during favorable conditions. Since the Nitrogen fixed is not free so the plant
must contribute a considerable amount of energy in the form of photosynthates and
other essential nutritional factors which are important for the bacteria. Rhizobium
plays a key role and is the maximum researched bio-fertilizer (Mishra and Dadhich
2010). Currently the legume-rhizobia symbiosis has been extended to economically
essential food crops or cereals and certain rhizobia that are competent of crack entry
into ruptured epidermis during emergence of lateral rootlets in cereal crops (Kalia
and Gupta 2002) the process can be improved by the addition of phytohormones
(Kannaiyan et al. 2001) or use of signal chemicals (Amutha and Kannaiyan 2000).
Classification of Rhizobium Bio-fertilizers
1. Rhizobium leguminosarum
2. Biovarphaseoli Phaseolus (Bean)
3. Biovarviceae Vicea (Vetch)
4. Biovartrifolii Trifolium (Berseem)
5. Rhizobium meliloti Melilotus (Senji) Rhizobium loti
6. Bradyrhizobium japonicum Glycine (Soybean)
7. Bradyrhizobium species Lupinus (Lupin), Vigna, Cicer
Recently two more genera have been included in the family Rhizobiaceae. They are
Sinorhizobium and Azorhizobium which are nodulating the Soybean and Dhaincha
(Sesbania), respectively. Azorhizobium caulinodans were isolated from the stem
nodules of Sesbania rostrata but can also colonise and produce nodules in rice
roots. Azorhizobium caulinodans also capable of fixing nitrogen in the free living
state (Mandon et al. 1998).
Blue Green Algae (BGA)/Cyanobacteria
Blue-green algae or cyanobacteria are photosynthetic prokaryotes capable of fixing

nitrogen with the help of enzyme nitrogenase. They are generally aquatic, small
organisms visible as a single cell or large accumulation of cells (colonies) or strings
of cells i.e. trichomes under microscope, sometimes accumulations are so large that
they can be seen with a naked eye. Another name for blue-green algae is cyano-
phytes, cyanobacteria and most recently cyanoprokaryotes. As far as vegetative
structure is considered they are resemble algae and other free living bodies. Their
requirements for light, nutrients and carbon dioxide are similar. Certain types of
blue-green algae have tiny gas vesicles in their cells that help to regulate buoyancy
or get submerged under water in response to light fluctuations and availability of
nutrient. BGA include Anabaena, Nostoc, Plectonema, Syctonema, Calothrix, Aulo-
sira, Tolypothrix. Among these commercially available representatives are cultures
of Anabaena, Nostoc, Tolyphorix and Aulosira. The blue-green alga ( Anabaena
azollae) shows a symbiotic association with Azolla (aquatic fern) and also fixes
atmospheric nitrogen. BGA has shown to be associated with the Azolla present in
ventral pore along the dorsal lobe of each vegetative leaf. This endophyte fixes at-
mospheric nitrogen and remains inside the tissue of the water fern in addition to its
use in utilization in paddy fields. BGA fixes atmospheric nitrogen in semi aquatic
ecosystem and takes part in photosynthetic activity. Azolla is a fast growing water
fern and has ability to double its weight within a week. Azolla being rich in organic
manure mineralizes the soil nitrogen rapidly and is made available to the plants. It
is a protein rich feed to fish and poultry. BGA besides nitrogen fixation also synthe-
sizes and releases growth stimulating substances viz., auxin and amino compounds
that enhance the growth of rice plants. Algae can be multiplied in the paddy field
by broadcasting the inoculants at the rate of about 10 kg/ha. It has been observed
that incorporation of Azolla-Anabaena to paddy field increases rice yields and ad-
dition of dried Azolla filiculoides at the rate of 93 kg N/ha has increased a rice yield
upto 70 %, the increase obtained with an equivalent amount of ammonium sulphate
(Anitha and Kannaiyan 1999). In a field experiment the cyanobacteria was used
to degrade coir pith with the help of lignolytic enzyme. (Malliga et al. 1996) and
produced cyanopith, it can be used as bio-fertilizer to improve the crop productivity
(Jha and Prasad 2005). Coir pith contains high lignin (31 %), cellulose (27 %), con-
tent (Bhat et al. 2003) and carbon nitrogen ratio (C/N) of 104:1 (Palaniappan 2005).
Manoharan et al. 2011 used cynopith as bio-fertilizers on Amaranthus dubius that
increases the growth of Amaranthus.
Azospirillum
Azospirillum is microaerophilic, free living, non-symbiotic, loosely associative

nitrogen fixing bacteria and it establishes a close association with various plants
mainly with C4 maize, sorghum, sugarcane, ray grass, Amaranthus etc. This micro-
organism fixes atmospheric N and makes it available for plants in asymbiotic man-
ner (Steenhoudt and Vanderleyden 2006). Azospirillum grows in the rhizosphere of
the plants or occasionally penetrates into the root tissues but is not able to produce
any visible nodule or out growth on the root tissue but grows intracellularly (Saikia
et al. 2007). This association is due to the ability of the microbe to use malic acid,
an organic acid formed for capturing CO2 as a carbon source. It also secretes vari-
ous phytohormones which include gibberellins, cytokinins, auxins and affect de-
velopment and morphology of root by increasing root length, number of root hair
cells, lateral roots. Azosprillium also secretes iron-chelating siderphores that help
in the sequestering of iron sufficient for plant growth (Romerheld and Marshner
1986). A free living nitrogen fixing bacteria was for the first time reported by Bei-
jerinck in 1925 under the name of Spirillum lipoferum and later on renamed this
organism as Azospirillum (nitrogen fixing Spirillum) in 1978. Azosprillium is one
of recognized dominant soil microbe and is able to fix about 10–40 kgN/ha. The
Azosprillium inoculation improves vegetative growth of the plants (Naderifar and
Daneshian 2012). Till date only four species of Azospirillum have been identified
which include A. lipoferum, A. brasilense, A. amazonense, A. iraquense. Among
these species only A. brasilense and A. lipoferum are very common in Indian soils.
Inoculation of vegetable crops with Azospirillum has resulted in yield enhancement.
The field experiment of Azosprillium with maize was examined and was confirmed
that this association benefits enzyme activating glutamine synthetase and glutamine
synthetase in the leaves of paranodulated maize plants. Bhaskara Rao and Charyulu
(2005) studied the association of A. lipoferum inoculated to foxtail millet plant in
combination with N fertilizer and demonstrated the increase in plant growth level,
dry weight of shoot and root over when compared with control plants.
Maize plants inoculated with Azospirillum showed high rate of photosynthesis
and stomatal conduction leading to high yield compared to control plants (Kumar
and Bhaskara Rao 2012). Rice plant inoculated with A. brasilense at population
rate of 8 × 10–7/g of dry weight under field conditions showed a yield of 1.6–10.5 g
plant-1 (Mirza et al. 2000; Malik et al. 2002). Azospirillum population enhances the
uptake of P and NH4 compounds in rice plants (Murty and Ladha 1988).
Azotobactor
Azotobactor is a gram-negative, aerobic, heterotrophic, rod shaped nitrogen fix-

ing bacteria present in alkaline and neutral soils (Lakshmi-narayana 1993). They
are free living organism present in soil, water and also in association with some
plants (Gandora et al. 1998; Martyniuk and Martyniuk 2003). Various species of
Azotobacter are A. agilis, A. chrococcum, A. beijerinckii, A. vinelandii, A. ingrinis.
Among these Azotobacter, Azotobactor chrococcum is the most commonly found
in arable soils of India. In addition to its capability to fix atmospheric nitrogen
(20–40 Kg N/ha) for different crops, it can also produce various growth promot-
ing substances viz., auxins, and gibberellins cytokinins, indole acetic acid includ-
ing vitamins and antibiotics, which control plant pathogens and help to maintain
soil fertility. Azotobacter produces slime like substances which help in aggregation
of soil particles. Many strains of Azotobactor exhibit fungicidal properties against
certain species of fungus. Various crop plants like rice, maize, cotton, sugarcane,
pearl millet, vegetable and some plantation crops show response to Azotobacter.
Occurrence of organic matter in uncultivated soil promotes its multiplication and
nitrogen fixing capacity. Field experiments carried out on Azotobacter under differ-
ent agro-climatic conditions pointed out that Azotobacter is suitable when inocu-
lated with seed or seedling of crop plants like onion, brinjal, tomato and cabbage.
Azotobacter being heaviest among breathing organism and requires a large amount
of organic carbon for its growth. Although it is poor competitor for nutrients in soil
but it enhances plant growth through nitrogen fixation, release of growth promot-
ing substances, and fungicidal substances. It improves seed germination and plant
growth. N fixation process which is highly sensitive to O2, Azotobacter have special
mechanism against O2 it reduces the concentration of O2 in the cells (Shank Yu
et al. 2005). Nitrogenase enzyme is also sensitive to O2, but is supposed that the
extreme respiration role of Azotobacter utilizes free O2 within the cells and pro-
tects the nitrogenase (Kumar and Bhaskara Rao 2012). Azotobacter species have
various types of nitrogenases viz., molybdenum–iron nitrogenase, vanadium–iron
nitrogenase (Robson et al. 1986; Narula et al. 2000). Azotobacter requires carbon
source for their energy (Kanungo et al. 1997) and is capable of fixing 10 mg N/g of
carbohydrates in field conditions. Azotobacter is believed to be one of the signifi-
cant bio-fertilizer for rice and other cereals, it can be applied by seed dipping and
seedling root dipping methods (Kannaiyan et al. 1980; Kannaiyan 1999; Ruttimann
et al. 2003; Singh et al. 1999). Azotobacter can also able to enhance the growth in
wheat crop (Kader et al. 2002).
Non-legume-Frankia Symbiosis
Frankia a genus of actinomycetes, is a free, gram’s positive nitrogen fixing bac-

terium that lives in soil and develops symbiotic interaction with various trees and
shrubs forming symbiotic nodules (Verghese and Misra 2002). There are about 264
species belonging to 25 genera which take part in Frankia symbiosis. The Frankia
is of fundamental and ecological interests for diverse reasons that include its wide
distribution, its ability to fix nitrogen, differentiate specialized cell for nitrogen
fixation (Verghese 2002). These specialized cells are called sporangium and ves-
icles and in addition to it can nodulate non-leguminous trees by forming root nod-
ules, such as Casuarina, Alnus, Dansea, Myrica, Elaeagnus (Dawson et al. 2005;
Franche et al. 2009). In wastelands fertility of soil can be improved by growing
such non-leguminous plants in nitrogen deficient soils. In the process of nodula-
tion, Frankia develops as little lateral swelling on roots and subsequently develops
into new lobes at their apices forming cluster coralloid structure (Duhoux et al.
2001). Inoculation of Frankia enhances growth, nodulation, nitrogenase activity of
nodule and nodule dry weight of Casuarina and Alnus plants. They live in the soil
and have a symbiotic relationship with certain woody angiosperms, called actino-
rhizal plants. Frankia sp. produces three types of cells: sporangiospores, hyphae,
and diazo-vesicles (Tjepkema et al. 1980), these diazo-vesicles are spherical, thick
walled, lipid-enveloped cellular structures responsible for providing sufficient ni-
trogen to the host plant during symbiosis. Frankia enter into plants by root hair
infection, nodules formed on lateral roots with cortical cylinder of vascular tissue
(Ganesh et al. 1994). Frankia supplies almost total nitrogen needed by host plant
and thus can establish a nitrogen-fixing symbiosis with host plants where nitrogen
is the limiting factor for plant development. Therefore, actinorhizal plants colonize
and often prosper in soils that are low in combined nitrogen (Benson and Silvester
1993). Symbiotic interaction of this category adds a large quantity of new nitrogen
to numerous ecosystems such as temperate forests, dry chaparral, sand dunes, mine
wastes etc. They also assist in creating and transporting certain root hormones, con-
trolling pathogens and nematodes, water retention, mineral uptake, root exploration
and resource sharing (Benson and Silvester 1993). Frankia specifically fixes nitro-
gen in the air and produces molecules that other plants can use. Frankia is said to be
responsible for 15 % of the biologically fixed nitrogen in the world (Trujillo 2008).
Plant Growth Promoting Rhizobacteria
An assemblage of rhizobacteria (bacteria on rhizosphere) to facilitate beneficial

effect on plant growth is referred to as plant growth promoting rhizobacteria or
PGPR (Schroth and Hacock 1981). PGPR belong to several genera, e.g., Alcalige-
nes, Agrobacterium Arthrobacter, Azotobacter, Actinoplanes, Bacillus, Bradyrhizo-
bium, Amorphosporangium, Pseudomonas sp., Enterobacter, Rhizobium, Erwinia,
Cellulomonas, Streptomyces Flavobacterium, and Xanthomonas (Weller 1988). In
a recent study it was found that PGPR covers a wide range of plant species. In all
successful plant microbe interactions, the capability to colonize plant habitats is

important. Single bacterial cells can affix to surfaces and, after repeated cell di-
visions and proliferation, dense aggregates are formed which are commonly re-
ferred to as macro colonies or biofilms (Mohammadi and Sohrabi 2012). Steps of
colonization include attraction, recognition, adherence, invasion (only endophytes
and pathogens), colonization and growth, and several strategies to establish inter-
actions (Nihorimbere et al. 2011). There is crosstalk between plant roots and soil
microbes. Plants roots initiate crosstalk by producing signals that are recognized by
the microbes, which in turn produce signals that initiate colonization (Berg 2009).
PGPR reach root surfaces by active motility facilitated by flagella and are guided
by chemotactic responses. This implies that PGPR capability highly depends either
on their abilities to take advantage of a specific environment or on their abilities
to adapt to changing conditions or plant species (Nihorimbere et al. 2011). Habibi
et al. (2011) strongly recommended that use of bio-fertilizers (combined strains) in
addition with organic and chemical fertilizers have resulted in the maximum grain
yield and oil yield in medicinal pumpkin. They revealed that 50 % of required ni-
trogen and phosphorus fertilizers might be replaced by bio and organic fertilizers,
since bio and organic fertilizers improve the efficiency of recommended nitrogen
and phosphorus fertilizers and reduced the cost of chemical fertilizers and also pre-
vent the environment pollution from extensive application of chemical fertilizers.
de Freitas et al. (1993) demonstrated that inoculation of beans with Rhizobium.
leguminosarum and Pseudomonas putida increased the number of nodules and
acetylene reduction activity (ARA) significantly. A significant positive effect on
grain yield and ARA in roots of barley was obtained due to combined inoculation of
nitrogen fixer’s A. lipoferum, Arthrobacter mysorens and the phosphate solubilizing
strain Agrobacterium radiobacter by Belimov et al. (1995). Radhakrishnan (1996)
revealed that inoculation of Azospirillum and phosphor-bacteria resulted in higher
root biomass and more bolls in cotton. Findings of Mohammadi (2010) showed
that inoculation of bio-fertilizers (PSB + Trichoderma fungi) + application of FYM
had a great influence on canola growth, height and grain yield when compared to
control treatment. Findings of Mohammadi et al. (2011) showed that application of
bio-fertilizers had a significant effects on nutrient uptake of chickpea combined ap-
plication of Phosphate solubilizing bacteria and Trichoderma harzianum produced
the highest leaf P content and grain P content. Capacity of Bacillus sp. to produce
organic acid such as gluconic, citric and fumaric acids under P-limiting conditions
may increase the solubility of poorly soluble phosphorus (Mohammadi and Sohrabi
2012).
Phosphorus Solubilizing/Mobilizing Microorganisms (PSM)
Phosphorous makes about 0.2 % of the plant on dry weight basis. It has distinct role
in plant metabolism which includes cell division, cell development, photosynthesis,
breakdown of sugars, nuclear transport within plants, and transfer of genetic char-
acteristics from one generation to another generation and regulation of metabolic
pathway (Rodriguez and Fraga 1999). The plant obtains their phosphate require-
ments from the soil pool. It occurs in soil as inorganic phosphate, produced by
weathering of rocks that is unable to be utilized by the plants (Lee et al. 2005) or as
organic phosphate derived from decaying plant, animal or microorganisms (Rodri-
guez and Fraga 1999). About 15–20 % of applied phosphorus is recovered from the
crops and rest gets fixed in the soil and is not readily available to the plants. A group
of morphologically different microorganisms which have the property of solubiliz-
ing the fixed phosphorous by producing organic acids and enzymes and to make
them easily available to the crops are known as Phosphorous Solublising Microor-
ganisms (PSM). They include diverse species of Bacillus, Aspergillus, Pseudomo-
nas, Penicillium, Agrobacterium, Achromobacter, Burkholderia, Aerobacter, Er-
winia, Micrococcus, Flavobacterium and Trichoderma. These organisms solubilize
the fixed soil phosphorus thereby releasing the citrate and water soluble phosphorus
so as to help in mineralizing organic phosphate compounds that are present in the
organic wastes (Rodriguez and Fraga 1999). These microorganisms have the prop-
erty to bring phosphate solublization by secreting organic acids such as propionic
acid, lactic acid, formic acid, acetic acid, succinic acids etc. these acids lower the
pH and help to dissolve the phosphate bound (Rodriguez and Fraga 1999). They
also produce growth promoting substances e.g. IAA, GA etc. experiments conduct-
ed in field conditions in India have shown to replace 20–50 kg P2O5/ha in different
crops due to PSM’s inoculation (Vora and Shelat 1996, 1998, 1999). Improvement
in seed germination by application of PSB has been reported by Sharma et al. (2007)
in Cicer arietinum. Various horticultural plants and vegetables were successfully
inoculated with P-solubilizing bio-fertilizers to obtain higher yields (Khan et al.
2010; Velineni and Brahmaprakash 2011). Field experiments demonstrated that P-
solubilizing bio-fertilizers in addition to improving the growth and quality of crops,
also reduced) the usage of chemical or organic fertilizers significantly (Young 1990;
Chang and Young 1992a, b; Young et al. 1998a, b; Young and Chen 1999; Chang
and Young 1999; Young et al. 2000; Liu and Young 2001; Young et al. 2003). Phos-
phate solubilizing bacteria has the capacity to convert inorganic unavailable phos-
phorus form to soluble forms like HPO42− and H2PO4− with the help of processes
like organic acid production, chelation and ion exchange reactions and make them
available to plants (Chang and Yang 2009; Banerjee et al. 2010). Naturally occur-
ring rhizospheric phosphorus solubilizing microorganism (PSM) has a long history
and dates back to 1903 (Khan et al. 2007). Alam et al. (2002) pointed out that bac-
teria are more effective in phosphorus solubilization than fungi. Among the whole
microbial population in soil, phosphate solubilizing bacteria (PSB) comprise
1–50 %, whereas phosphorus solubilizing fungi (PSF) are only 0.1–0.5 %. (Chen
et al. 2006). Number of phosphorous solubilizing bacteria amongst total PSM in
north Iranian soil was around 88 % (Fallah 2006). Microorganisms concerned in
phosphorus acquirement include mycorrhizal fungi and PSMs (Fankem et al. 2006).
Among the soil bacterial communities, effective phosphate solubilizers ectorhizo-
spheric strains from Pseudomonas and Bacilli, and endosymbiotic rhizobia have
been described as (Igual et al. 2001). Strains from bacterial genera Pseudomonas,
Bacillus, Rhizobium and Enterobacter along with Penicillium and Aspergillus fungi
are the most influential P solubilizers (Whitelaw 2000). B. circulans, Bacillus

megaterium, B. subtilis, B. sircalmous, B. polymyxa, Enterobacter and Pseudomo-
nas striata, can be referred as the most important strains (Subbarao 1988; Kucey
et al. 1989). A fungus Arthrobotrys oligospora is also found to have the ability to
solubilize the phosphate rocks (Duponnois et al. 2006). Increased high percentage
of PSM is concentrated in the rhizosphere, and they are metabolically more active
than from other sources (Vazquez et al. 2000). By and large, 1 g of fertile soil con-
tains about 101–1010 bacteria, and their live weight may exceed 2,000 kg ha−1. Soil
bacteria can be cocci (sphere, 0.5 μm), bacilli (rod, 0.5–0.3 μm) or spiral (1–100 μm)
shapes. Bacilli are common in soil, where as spirilli are very rare in natural environ-
ments (Baudoin et al. 2002). The PSB are cosmopolitan and vary in forms and pop-
ulation in diverse soils. Their population depends upon the physical and chemical
properties organic content and phosphorous content of soil and cultural activities
(Kim et al. 1998). Maximum populations of PSB are found in agricultural and
rangeland soils (Yahya and Azawi 1998). In north of Iran, the PSB count ranged
from 0 to 107 cells g−1 soil, with 3.98 % population of PSB among total bacteria
(Fallah 2006). Mineralization and solubilization potential for organic and inorganic
phosphorus, are also shown by bacterial populations (Hilda and Fraga 1999; Khiari
and Parent 2005). Phosphorus solubilizing activity is determined by the capacity of
microbes to liberate metabolites such as organic acids, which through their hydrox-
yl and carboxyl groups chelate the cation bound to phosphate, than are transformed
to soluble forms (Sagoe et al. 1998). Various microbial processes/mechanisms in-
cluding organic acid production and proton extrusion are used in Phosphate solubi-
lization. (Surange 1995; Dutton and Evans 1996; Nahas 1996). A wide range of
microbial P solubilization mechanisms exist in nature and much of the global cy-
cling of insoluble organic and inorganic soil phosphates is attributed to bacteria and
fungi (Banik and Dey 1982). Whitelaw (2000) suggested that Phosphorus solubili-
zation is also carried out by a large number of saprophytic bacteria and fungi acting
on sparingly soluble soil phosphates, mainly by chelation-mediated mechanisms.
Phosphate solubilizing microorganisms secrete organic acids and enzymes that act
on insoluble phosphates and convert it into soluble form, thus, proving P to plants
(Ponmurugan and Gopi 2006). Inorganic P is solubilized by the action of organic
and inorganic acids secreted by PSB in which hydroxyl and carboxyl groups of ac-
ids chelate cations (Al, Fe, Ca) and decrease the pH in basic soils (Kpomblekou and
Tabatabai 1994; Stevenson 2005). The PSB dissolve the soil P through production
of low molecular weight organic acids mainly gluconic and ketogluconic acids
(Goldstein 1995; Deubel et al. 2000), in addition to lowering the pH of rhizosphere.
The pH of rhizosphere is lowered through biotical production of proton/bicarbonate
release (anion/cation balance) and gaseous (O2/CO2) exchanges. Phosphorus solu-
bilization ability of PSB has direct correlation with pH of the medium. In addition
to phosphorous solublization ability of PSB, they also can improve plant growth by
enhancing the availability of other trace element such as iron (Fe), zinc (Zn), etc.
Gull et al. (2004) suggested that PSB can solubilize the fixed soil P and applied
phosphates resulting in higher crop yields. According to Goenadi et al. (2000) direct
application of phosphate rock is usually ineffective in the short time period of most
annual crops. Gyaneshwar et al. (2002) suggested that acid producing microorgan-
isms are able to increase the solubilization of phosphatic rock. The PSB in conjunc-
tion with single super phosphate and rock phosphate reduce the P dose by 25 and
50 %, respectively (Sundara et al. 2002). Pseudomonas striata and Bacillus poly-
myxa solubilized 156 and 116 mg P L−1, respectively (Rodríguez and Fraga 1999).
Pseudomonas fluorescens solubilized 100 mg P L−1 containing Ca3(PO4)2 or 92 and
51 mg P L−1 containing AlPO4 and FePO4, respectively (Henri et al. 2008).
Mycorrhiza
Mycorrhizae are mutualistic associations between fungi and plant roots. The host
plant gets mineral nutrients from mycorrhizal fungi, while as the fungus partener is
provided with photosynthetic products from the host plant (Jakobsen et al. 2002).
Fungi become integrated into the root structure, or fungi lives in close association
with plant roots. Fungal hyphae may live on the external surface of roots (ectomy-
corrhizal) or may invade root cells (endomycorrhizal). Mycorrhiza belong to fun-
gi kingdom Basidiomycetes, Ascomycetes and Zygomycetes. Mycorrhizal fungi,
and fungi generally, have a strong influence on soil structure (Rillig and Mummey
2006). Their hyphal strands help to hold soil aggregates together, and they also
excrete organic substances that help cement the aggregates (Rillig and Mummey
2006). Hyphae conduct water and immobile nutrients (like P) to roots despite dis-
ruption of capillary water flow in soil. Of the many types of mycorrhizal associa-
tion the most important association which are economically as well as ecologically
importance are: ectomycorrhizal associations, and the endomycorrhizal association
of the vesicular-arbuscular (VA) type (Rillig and Mummey 2006). In case of ecto-
mycorrhizal associations, the fungi attack the cortical region of the host root devoid
of piercing cortical cells. Ectomychorrhizae are recognized to occur in the families
of Salicaceae, Fagaceae, Pinaceae, Betulaceae, Tiliaceae, Juglandaceae and Ceasal-
pinionideae. The ectomycorrhizal roots lack root hairs and are covered by a sheath
of fungal hypae which almost looks like host tissue. This tissue is called Pseudopa-
renchamatous sheath. Hyphae from this sheath enter into the cortex and remain in
the outer cortical region to form a network called Hartig’s net (Alizadeh 2011). The
nutrients absorbed by the hyphae are transported to the plant with the help of this
Hartig’s net. Infection of host plants by ectomycorrhizal fungi frequently leads to
changes in feeder roots that are apparent to the naked eye but in case of endomycor-
rhizal associations of the VA type, the fungi penetrate the cortical cells and form
clusters of delicately divided hyphae known as arbuscules in the cortex (Alizadeh
2011). They also form vesicles, which are membrane-bound organelles of varying
shapes, inside or outside the cortical cells. Arbuscules are supposed to be the sites
where resources are exchanged among the host plant and the fungi (Alizadeh 2011).
Vesicles in general serve as storage space but when they are old they can serve as
reproductive structures. Vesicles and arbuscules, together with large spores, com-
prise the diagnostic features of the VA mycorrhizas. Most ectomycorrhizal fungi
belong to several genera within the class Basidiomycetes, while some belong to the
zygosporic Zygomycetes and Ascomycetes. On the other hand, AM fungi belong to
six genera within the azygosporous zygomycetes
Vesicular Arbuscular Mycorrhiza (VAM)
VAM are common, ancient and most fascinating class of fungi which proves to
be very beneficial to plants (Alizadeh 2011). VAM is an endotrophic mycorrhiza
formed by aseptate phycomycetous fungi. They produce an interconnected network
of hyphae between cortical cells that extend to the soil and hence absorb various
nutrients and water (Sally et al. 2011) VAM forms an association with various crop
plants which include monocot, dicot, annual or perennial crops. The use of VAM en-
hances growth of plants in less fertile soils besides application of FYM and cereal-
legume crop rotations. Whereas, application of chemicals mostly fungicide sup-
presses its existence.
Mycorrhiza enhances the feeding areas of the plant root as the hyphae spreads
around the roots. It also mobilizes the nutrients particularly phosphorous that are
present in organic or inorganic form in soil and translocate it to plants with the help
of extensive mycelium. In addition to translocation of phosphorous to plant it also
stores the nutrients and removes the toxic substances for example, phenolics which
otherwise hinder nutrient availability in addition to this it also provides protection
against other fungi and nematodes. VAM also assists in transfer of nutrients other
than phosphorus, like zinc and sulfur Cu (copper), K (potassium), Al (aluminum),
Mn (manganese), Fe (iron) and Mg (magnesium) from the soil to the plant roots.
They act as intracellular obligate fungal endo-symbiont by penetrating the root
cortex (Alizadeh 2011). In addition they possess vesicles intended for storage of
nutrients and arbuscular for transferring these nutrients into root system as well as
enhances water absorption. However, in ecto-mycorrhiza, the hyphae cover both
outside and within the root in the intercellular spaces of epidermis and cortex. Trees
are usually found to be infected with ectomycorrhiza, they increase the tolerance of
plants against drought and salt stress, increase the photosynthetic activity of plants,
higher chlorophyll content, higher leaf water potential restored capacity (Wang
1989, 1998). VAM helps in soil conservation and soil aggregation, increase the re-
sistance of plants against root-pathogens, increases habitatrestoration (Dodd 2000).
Conclusions and Future Prospects
Bio-fertilizers increase crop productivity by increasing availability or uptake of nu-

trients through solubilization or increased absorption stimulation of plant growth
with the help of hormonal action or antibiosis, or by decomposition of organic resi-
dues. Moreover, bio-fertilizers also help to reduce the use of chemical fertilizers
which in turn reduces the amount and cost of chemical fertilizers and thus prevents
the environment pollution from extensive application of chemical fertilizers.
To get better productivity of agricultural lands and to maintain this productiv-
ity, the integrated approach to determine the most favorable plant-microorganism
interaction is important. The bio-fertilizers are thought to be more expensive and
show unpredictable performance. Besides, the effect on the crops is slow, compared
to chemical fertilizers. In order to get potential benefit from bio-fertilizers in com-
mercial agriculture, consistency in their performance is to be improved. Special
care such as mode of application on crops and to keep them effective for extensive
use is needed. As bio-fertilizers contain living organisms, their concert therefore
depends on environment surrounding them, Short shelf life, lack of suitable carrier
materials, susceptibility to high temperature, problems in transportation and storage
of bio-fertilizers are major bottlenecks that are at a standstill and have to be solved
in order to acquire efficient inoculation. The main criteria to take into consideration
in making of bio-fertilizers are microbes’ growth profile, types and optimum condi-
tion of organism, and formulation of inoculums, methods of application and storage
of the product are all critical to the success for a sustainable agriculture.
References
Abdul Halim NB (2009) Effects of using enhanced biofertilizer containing N-fixer bacteria on
patchouli growth. Thesis. Faculty of chemical and natural resources engineering university
Malaysia, Pahang. p. 145
Akhtar A, Hisamuddin, Robab MI, Abbasi, Sharf R (2012) Plant growth promoting rhizobacteria:
an overview. J Nat Prod Plant Resour 2(1):19–31
Alam S, Khalil S, Ayub N, Rashid M (2002) In vitro solubilization of inorganic phosphate by phos-
phate solubilizing microorganism (PSM) from maize rhizosphere. Intl J Agric Biol 4:454–458
Ali B, Sabri AN, Hasnain S (2010) Rhizobacterial potential to alter auxin content and growth of
Vigna radiata (L.). World J Microbiol Biotechnol 26:1379–1384
Alizadeh O (2011). Mycorrhizal symbiosis. Adv Studies Biol 6(3):273–281
Amutha K, Kannaiyan S (2000) Effect of kinetin and inoculation of Azorhizobium cauulinodans
on induction of lateral rootlets and paranodules in rice. J Microb World 2:1–7
Anitha KG, Kannaiyan S (1999) Carrier based immobilized cyanobacterial cultures as biofertil-
izer for rice. Paper presented in the seminar on modern trends in plant sciences, AVC College,
Mannampandal, Tamil Nadu, India
Badawi FSHF, Biomy, AMM, Desoky AH (2011) Peanut plant growth and yield as influenced by
co-inoculation with Bradyrhizobium and some rhizo-microorganisms under sandy loam soil
conditions. Ann Agric Sci 56:17–25
Banerjee S, Palit R, Sengupta C, Standing D (2010) Stress induced phosphate solubilization by Ar-
throbacter sp. and Bacillus sp. Isolated from tomato rhizosphere. Aust J Crop Sci 4(6):378–383
Banik S, Dey BK (1982) Available phosphate content of an alluvial soil as influenced by inocula-
tion of some isolated phosphate solubilizing microorganisms. Plant Soil 69:353–364
Baudoin E, Benizri E, Guckert A (2002) Impact of growth stages on bacterial community structure
along maize roots by metabolic and genetic finger printing. Appl Soil Ecol 19:135–145
Belimov AA, Kojemiakov AP, Chuvarliyeva CV (1995) Interaction between barley and mixed
cultures of nitrogen fixing and phosphate-solubilizing bacteria. Plant Soil 173:29–37
Benson DR, Silvester WB (1993) Biology of Frankia strains, actinomycete symbionts of actinorhi-
zal plants. Microbiol Rev 57(2):293–319
Berg G (2009) Plant-microbe interactions promoting plant growth and health: perspectives for
controlled use of microorganisms in agriculture. Appl Microbiol Biotech 84:11–18
Bhaskara Rao KV, Charyulu PBBN (2005) Evaluation of effect of inoculation of Azospirillum on
the yield of Setaria italic (L.). Afr J Biotech 4(9):989–995
Bhat A, Bhat A, Narayan P (2003) Chromatographic analysis of phenolic and study of kalson lig-
nin biodegraded, coir pith using Pleurotus Sajorcaju. BSc, Dissertation, University of Kerala,
Alappuzha.
Brahmaprakash GP, Sahu PK (2012) Bio-fertilizers for sustainability. J Ind Inst Sci 92:37–62
Chang CH, Yang SS (2009) Thermo-tolerant phosphate-solubilizing microbes for multi-functional
biofertilizer preparation. Biores Technol 100:1648–1658
Chang FP, Young CC (1992a) Ecology of vesicular-arbuscular mycorrhizal fungi in tea garden
soils. Tai Tea Res Bull 11:63–77
Chang FP, Young CC (1992b) Effects of VA mycorrhizal fungi and phosphorus-solubilizing bacte-
ria inoculated on growth of tea cuttings in plastic bag. Tai Tea Res Bull 11:79–89
Chang FP, Young CC (1999) Studies on soil inoculation with P-solubilizing bacteria and P fertil-
izer on P-uptake and quality of tea. Soil Environ 2:35–44
Chen YP, Rekha PD, Arunshen AB, Lai WA, Young CC (2006) Phosphate solubilizing bacteria from
subtropical soil and their tri-calcium phosphate solubilizing abilities. Appl Soil Ecol 34:33–41
Choudhury ATMA, Kennedy IR (2004) Prospects and potentials for systems of biological nitrogen
fixation in sustainable rice production. Biol Fert Soils 39:219–227
Danso SKA, Bowen GD, Snaginga N (1992) Biological nitrogen fixation in trees in agro-
ecosystems. Plant and Soil 141:177–196
Dawson JO, Gottfried GJ, Urbana IL, Hahn D (2005). Occurrence, structure, and nitrogen-fixation
of root nodules of actinorhizal Arizona alder. USDA forest service proceedings RMRS-P-36.
pp. 75–79
De Freitas JR, Gupta VVS, Germida JJ (1993). Influence of Pseudomonas syringae R 25 and P.
putida R 105 on the growth and N2 fixation (ARA) of pea ( Pisum sativum L.) and field bean
( Phaseolus vulgaris). Biol Fertil Soils 16:215–220
Deubel A, Gransee A, Merbach W (2000) Transformation of organic rhizodeposites by rhizoplane
bacteria and its influence on the availability of tertiary calcium phosphates. J Plant Nutr Soil
Sci 163:387–392
Dodd JC (2000) The role of arbuscular mycorrhizal fungi in agro- and natural ecosystems. Outlook
Agric 29:55–62
Duhoux E, Rinaudo G, Diem HG, Auguy F, Fernandez D, Bogusz D, Franche C, Dommergues Y,
Huguenin B (2001) Angiosperm Gymnostoma trees produce root nodules colonized by arbus-
cular mycorrhizal fungi related to Glomus. New Phytol 149:115–125
Duponnois R, Kisa M, Plenchette C (2006) Phosphate solubilizing potential of the nemato fungus
Arthrobotrys oligospora. J Plant Nutr Soil Sci 169:280–282
Dutton MV, Evans CS (1996) Oxalate production by fungi: Its role in pathogenicity and ecology
in the soil environment. Can J Microbiol 42:881–895
El-Yazeid AA, Abou-Aly HA, Mady MA, Moussa SAM (2007) Enhancing growth, productivity
and quality of squash plants using phosphate dissolving microorganisms (bio phosphor) com-
bined with boron foliar spray. Res J Agric Biol Sci 3(4):274–286
Fallah A (2006) Abundance and distribution of phosphate solubilizing bacteria and fungi in some
soil samples from north of Iran. 18th World Congress of soil science, July 9
Fankem H, Nwaga D, Deubel A, Dieng L, Merbach W, Etoa FS (2006) Occurrence and function-
ing of phosphate solubilizing microorganisms from oil palm tree rhizosphere in Cameroon. Afr
J Biotech 5:2450–2460
Faramarzi A, Pourgorban MA, Ansari MH, Taghizadeh R (2012) The effects of plant growth pro-
moting rhizobacteria (PGPR) inoculation on the yield and yield components of grain corn ( Zea
mays L.) in Astara. Iran J Food Agricul Environ 10(1):299–301
Franche C, Kristina Lindstrom K, Elmerich C (2009) Nitrogen-fixing bacteria associated with

leguminous and non-leguminous plants. Plant Soil 321:35–59
Gandora V, Gupta RD, Bhardwaj KKR (1998) Abundance of Azotobacter in great soil groups of
North-West Himalayas. J Ind Soc Soil Sci 46(3):379–383
Ganesh G, Misra AK, Chapelon C, Normand P (1994) Morphological and molecular charac-
terization of Frankia sp. isolates from nodules of Alnus nepalensis Don. Arch Microbiol
161:152–155
Goenadi DH, Siswanto G, Sugiarto Y (2000) Bioactivation of poorly soluble phosphate rocks with
a phosphorus-solubilizing fungus. Soil Sci Soc Am J 64:927–932
Goethals K, Van Montagu M, Holsters M (1992) Conserved motifs in a divergent nod box of
Azorhizobium caulinodans ORS571 reveals a common structure in promoters regulated by
LysR-type proteins. Proc Natl Acad Sci USA 89:1646–1650
Goldstein AH (1995) Recent progress in understanding the molecular genetics and biochemistry
of calcium phosphate solubilization by Gram-negative bacteria. Biol Agri Hort 12:185–193
Gull M, Hafeez FE, Saleem M, Malik KA (2004) Phosphorus uptake and growth promotion
of chickpea by co-inoculation of mineral phosphate solubilizing bacteria. Aust J Exp Agric
44:623–628
Gyaneshwar P, Kumar GN, Parekh LJ, Poole PS (2002) Role of soil microorganisms in improving
P nutrition of plants. Plant Soil 245:83–93
Habibi A, Heidari G, Sohrabi Y, Badakhshan H, Mohammadi K (2011) Influence of bio, organic
and chemical fertilizers on medicinal pumpkin traits. J Med Plant Res 5(23):5590–5597
Hashemabadi D, Zaredost F, Ziyabari MB, Zarchini M, Kaviani B, Solimandarabi MJ, Torkash-
vand AM, Zarchini S (2012) Influence of phosphate bio-fertilizer on quantity and quality fea-
tures of marigold ( Tagetes erecta L.). Australian J Crop Sci 6(6):1101–1109
Henri F, Laurette NN, Annette A, John Q, Wolfgang M, François-Xavier E, Dieudonne E (2008)
Solubilization of inorganic phosphates and plant growth promotion by strains of Pseudomonas
fluorescens isolated from acidic soils of Cameroon. Afr J Microbiol Res 2:171–178
Hilda R, Fraga R (1999) Phosphate solubilizing bacteria and their role in plant growth promotion.
Biotechnol Adv 17:319–339
Igual JM, Valverde A, Cervantes E, Velazquez E (2001) Phosphate-solubilizing bacteria
asinoculants for agriculture: use of updated molecular techniques in their study. Agronomie
21:561–568
Jakobsen I, Smith SE, Smith FA (2002) Function and diversity of arbuscular Mycorrhizae in car-
bon and mineral nutrition. In: van der Heijden MGA, Sanders I (eds) Mycorrhizal ecology.
Ecological studies, vol 157. Springer, Berlin
Jha MN, Prasad AN (2005) Efficiency of new inexpensive cyanobacteria biofertilizer including its
self life. World J Microb Biotechnol 22(1):73–79
Kader MA, Miar MH, Hoque MS (2002) Effects of Azotobacter inoculants on the yield and Nitrogen
uptake by Wheat. J Biol Sci 2(4):259–261
Kalia A, Gupta RP (2002) Nodule induction in non-legumes by rhizobia. Ind J Microbiol 42:183–193
Kannaiyan S (1999) Biological fertilizers for rice production. In: Kannaiyan S (ed) Bioresources
technology for sustainable agriculture, Associate Publishing Company, New Delhi, pp 1–29
Kannaiyan S, Govindarajan K, Lewin HD (1980) Effect of foliar spray of Azotobacter chroococ-
cum on rice crop. Plant Soil 56:487–490
Kannaiyan S, Kumar K, Gopalswamy G (2001). Stem nodulating Sesbania rostrata as a biore-
source for rice production, induction of nodulation and endophytic N2 fixation in rice. Madras
Agric J 88:547–560
Kanungo PK, Panda D, Adhiya TK, Ramakrishnan B, Rao VR (1997) Nitrogenase activity and
nitrogen fixing bacteria assoiciated with rhizosphere of rice cultivars. J Sci Food Aric 73:485–
488
Khan MS, Zaidi A, Ahemad M, Oves M, Wani PA (2010). Plant growth promotion by phosphate
solubilizing fungi: current perspective. Arch Agron Soil Sci 56:73–98
Khan MS, Zaidi A, Wani PA (2007) Role of phosphate-solubilizing microorganisms in sustainable

agriculture—a review. Agron Sustain Dev 27:29–43
Khiari L, Parent LE (2005) Phosphorus transformations in acid light-textured soils treated with dry
swine manure. Can J Soil Sci 85:75–87
Kim KY, Jordan D, Mc Donald GA (1998) Effect of phosphate-solubilizing bacteria and vesic-
ular-arbuscular mycorrhizae on tomato growth and soil microbial activity. Biol Fertil Soils
26:79–87
Kpomblekou K, Tabatabai MA (1994) Effect of organic acids on release of phosphorus from phos-
phate rocks. Soil Sci 158:442–453
Kucey RMN, Janzen HH, Leggett ME (1989) Microbially mediated increases in plant-available
phosphorus. Ad Agron 42:199–228
Kumar SR, Bhaskara Rao KV (2012) Biological nitrogen fixation: a review. IJALS 1:1–9
Lee KD, Bai Y, Smith D, Han HS, Supanjani S (2005) Isolation of plant growth promoting endo-
phytic bacteria from bean nodule. Res J Agric Biol Sci 1(3):232–236
Lugtenberg B, Kamilova F (2009) Plant-growth-promoting rhizobacteria. Ann Rev Microbiol
63:541–546
Mader P, Kaiser F, Adholeya A, Singh R, Uppal HS, Sharma AK, Srivastava R, Sahai V, Aragno
M, Wiemken A, Johri BN, Fried PM (2011) Inoculation of root microorganisms for sustainable
wheat-rice and wheat-black gram rotations in India. Soil Biol & Biochem. 43:609–619
Mahdi SS, Hassan GI, Samoon SA, Rather HA, Showkat AD, Zehra B (2010) Bio-fertilizers in
organic agriculture. J Phytol 2(10):42–54
Malik KA, Mirza MS, Hassan U, Mehnaz S, Rasul G, Haurat J, Bally R, Normand P (2002) The
role of plant-associated beneficial bacteria in rice-wheat cropping system. In: Kennedy IR,
Choudhury ATMA (eds) Biofertilisers in action. Rural Industries Research and Development
Corporation, Canberra, pp 73–83
Malliga PL, Uma L, Subramanian G (1996) Lignolytic activity of the cyanobacterium Anabae-
na Azolla ML2 and the value of coir waste as a carrier for BGA bio-fertilizers. Microbios
86:175–183
Mandon K, Michel-Reydellet N, Encarnacion S, Kaminski PA, Leija A, Cevallos MA, Elmerich C,
Mora J (1998) Poly-β-hydroxybutyrate turnover in Azorhizobium caulinodans is required for
growth and affects nifA expression. J Bacteriol 180:5070–5076
Manoharan G, Chitra Devi K, Malliga P (2011) Effect of cyanopith and cyanospray biofertilizer on
Amaranthus Dubius. Int J Env Sci 2(1):352–360
Martyniuk S, Martyniuk M (2003) Occurrence of Azotobacter Spp. In Some Polish Soils. J Envi-
ron Stud 12(3):371–374
Mirza MS, Rasul G, Mehnaz S, Ladha JK, Ali S, Malik KA (2000) Beneficial effects of inoculated
nitrogen-fixing bacteria on rice. International Rice Research Institute, Los Baos, Philippines,
pp 191–204
Mishra BK, Dadhich SK (2010) Methodology of nitrogen biofertilizer production. J Adv Dev Res
1(1):3–6
Mohammadi K (2010) Ecophysiological response of canola ( Brassica napus L.) to different fertil-
ity systems in crop rotation. Ph.D thesis. Agronomy Department. Tarbiat Modares University,
Tehran, Iran. p. 354
Mohammadi K, Ghalavand A, Aghaalikhani M, Heidari GR, Sohrabi Y (2011) Introducing the
sustainable soil fertility system for chickpea (Cicer arietinum L.). Afr J Biotech 10(32):6011–
6020
Mohammadi K, Ghalavand A, Aghaalikhani M, Sohrabi Y, Heidari GR (2010) Impressibility of
chickpea seed quality from different systems of increasing soil fertility. Electronic J Crop Prod
3(1):103–119
Mohammadi K, Sohrabi Y (2012) Bacterial bio-fertilizers for sustainable crop production: a re-
view. J Agri Bio Sci 7:307–316
Murty MG, Ladha JK (1988) Influence of Azospirillum inoculation on the mineral uptake and
growth of rice under hydroponic conditions. Plant Soil 108:281–285
Mylona P, Pawlowski K, Bisseling T (1995) Symbiotic nitrogen fixation. Plant Cell 7:869–885
Naderifar M, Daneshian J (2012) Effect of different nitrogen and bio-fertilizers effect on growth
and yield of Brassica napus L. Intl J Agri Crop Sci 4(8):478–482
Nahas E (1996) Factors determining rock phosphate solubilization by microorganism isolated
from soil. World J Microb Biotech 12:18–23
Narula N, Kumar V, Behl RK, Deubel A, Granse A, Merbach W (2000) Effect of P-solubilizing
A. chroococcum on NPK uptake in P responsive wheat genotypes grown under green house
conditions. J Plant Nutr Soil Sci 163:93–398
Nihorimbere V, Ongena M, Smargiassi M, Thonart P (2011) Beneficial effect of the rhizosphere mi-
crobial community for plant growth and health. Biotechnol Agron Soc Environ 15(2):327–337
Palaniappan P (2005) Effect of coir waste based basal cyanobacterial bio-fertilizers and foliar
spray on cowpea (Vigna unigiculata). M.Sc., Dissertation, Bharathidasa University, Tiruchi-
rappalli, Tamil Nadu, India
Ponmurugan P, Gopi C (2006) In vitro production of growth regulators and phosphatase activity
by phosphate solubilizing bacteria. Afr J Biotechnol 5:348–350
Postgate JR (1982) The fundamentals of nitrogen fixation. Cambridge University Press, Cam-
bridge
Radhakrishnan KC (1996) Role of bio-fertilizers in cotton productivity. National seminar biofertil-
izer production problem and constraints, TNAU, Coimbatore, Jan 24–25
Raj SA (2007) Bio-fertilizers for micronutrients. Biofertilizer Newsletter (July), pp 8–10
Rillig MC, Mummey DL (2006) Mycorrhizas and soil structure. New Phytol 171:41–53
Robson RL, Eady RR, Richardson TH, Miller RW, Hawkins M, Postgate JR (1986) London. Na-
ture 322:388–390
Rodrguez H, Fraga R (1999) Phosphate solubilizing bacteria and their role in plant growth promo-
tion. Biotech Adv 17:319–339
Rokhzadi A. Asgharzadeh A, Darvish F, Nourmohammadi G, Majidi E (2008) Influence of plant
growth-promoting rhizobacteria on dry matter accumulation and yield of chickpea ( Cicer ari-
etinum L.) under field condition. Am-Euras J Agric Environ Sci 3(2):253–257
Romerheld V, Marshner H (1986) Evidence for az specific uptake system for iron physiderophores
in roots of grasses. Plant Physiol 80:175–180
Rosenblueth M, Martinez RE (2006) Bacterial endophytes and their interactions with hosts. Mol
Plant Microb In 9(8):827–837.
Ruttimann JC, Rubio LM, Dean DR Ludden PW (2003) VnfY is required for full activity of the
vanadium-containing dinitrogenase in Azotobacter vinelandii. J Bacteriol 185:2383–2386
Sagoe C, Ando T, Kouno K, Nagaoka T (1998) Relative importance of protons and solution calcium
concentration in phosphate rock dissolution by organic acids. Soil Sci Plant Nutr 44:617–625
Saikia SP, Jain V, Khetarpal S, Aravind S (2007) Dinitrogen fixation activity of Azospirillum brasi-
lense in maize (Zea mays). J Curr sci 93(9/10):1296–1300
Schroth MN, Hancock JG (1981) Selected topics in biological control. Ann Rev Microbiol
35:453–476
Shankar PV, Vishwas PS, Pathade GR (2012) Comparative use of chemical and biological fertil-
izers and pesticides and their health effects on farmers in Satara tahsil, Maharashtra. Universal
J Environ Res Technol 2:174–178
Sharma K, Dak G, Agrawal A, Bhatnagar M, Sharma R (2007) Effect of phosphate solubilizing
bacteria on germination of Cicer arietinum seeds and seedling growth. J Her Med Toxicol
1(1):61–63
Singh MS, Devi RKT, Singh NI (1999) Evaluation of methods for Azotobacter application on the
yield of rice. Ind J Hill Farm 12:22–24
Steenhoudt O, Vanderleyden J (2006) Azospirillum, a free-living nitrogen-fixing bacterium closely
associated with grasses: genetic, biochemical and ecological aspects. FEMS Microbiol Review
24:487–506
Stevenson FJ (2005) Cycles of Soil: Carbon, Nitrogen, Phosphorus, Sulfur, Micronutrients. Wiley,
New York
Subbarao NS (1988) Phosphate solubilizing microorganism. In: Biofertilizer in agriculture and
forestry. Regional Biofert. Dev. Centre, Hissar, India. pp. 133–142
Sundara B, Natarajan V, Hari K (2002) Influence of phosphorus solubilizing bacteria on the chang-
es in soil available phosphorus and sugarcane yields. Field Crops Res 77:43–49
Tjepkema JD, Ormerod W, Torrey JG (1980) Vesicle formation and acetylene reduction activity in
Frankia sp. CP11 cultured in defined nutrient media. London. Nature 287:633–635
Van Workum WAT, Van Slageren S, Van Brussel AAN, Kijne JW (1998) Role of exopolysac-
charides of Rhizobium leguminosarum bv. viciae as host plant-specific molecules required
for infection thread formation during nodulation of Vicia sativa. Mol Plant Microbe Interact
11:1233–1241
Vazquez P, Holguin G, Puente M, Cortes AE, Bashan Y (2000) Phosphate solubilizing microorgan-
isms associated with the rhizosphere of mangroves in a semi arid coastal lagoon. Biol Fertil
Soils 30:460–468
Velineni S, Brahmaprakash GP (2011) Survival and phosphate solubilizing ability of Bacillus
megaterium in liquid inoculants under high temperature and desiccation stress. J Agr Sci Tech
13:795–802
Venkatashwarlu B (2008) Role of bio-fertilizers in organic farming: organic farming in rain fed
agriculture. Central institute for dry land agriculture, Hyderabad. pp. 85–95
Verghese S, Misra AK (2002) Frankia–actinorhizal symbiosis with special reference to host-mi-
crosymbiont relationship. Curr Sci 83(4):404–408
Vora MS, Shelat HH (1996) Isolation and screening of micro-organisms for dissolving tricalcium
Phosphate. J Madras Agric 83:353–354
Vyas RV, Shelat HN, Vora MS (2008) Bio-fertilizers techniques for sustainable production of ma-
jor crops for green revolution in Gujarat—an overveiw. Green Farm 1(10–11):68–72
Wang CL (1998) Response of Phaseolus angularis. Weight inoculated with arbuscular mycorrhi-
zal fungi under drought stress. J Agri Assoc China 181:92–101
Weller DM (1988) Biological control of soil borne plant pathogens in the rhizosphere with bacte-
ria. Ann Rev Phytopathol 26:379–407
Whitelaw MA (2000) Growth promotion of plants inoculated with phosphate solubilizing fungi.
Adv Agron 69:99–151
Yahya A, Azawi SKA (1998) Occurrence of phosphate solubilizing bacteria in some Iranian soils.
Plant Soil 117:135–141
Yanni YG, El-Fattah FKA (1999) Towards integrated biofertilization management with free living
and associative dinitrogen fixers for enhancing rice performance in the Nile delta. Symbiosis
27:319–331
Young CC (1990) Effects of phosphorus-solubilizing bacteria and vesicular-arbuscular mycorrhizal
fungi on the growth of tree species in subtropical-tropical soils. Soil Sci Plant Nut 36:225–231
Young CC, Juang TC, Chao CC (1988) Effect of Rhizobium and VA mycorrhiza inoculation on
nodulation, symbiotic nitrogen fixation and soybean yield in subtropical-tropical fields. Biol
Pert Soils 6:165–169
Young CC, Chang CH, Chen LF, Chao CC (1998a) Studies on the properties of nitrogen fixation
and ferric phosphate solubilizing bacteria isolated from a Taiwan soil. J Chinese Agri Chem
Soci 36:201–210
Young CC, Hung LJ, Chen LF (1998b) Studies on the exudate and characteristics of P-solubiliza-
tion with P-solubilizing rhizobia for four green manures. Soil Environ 1:7–17
Young CC, Chen LG, Chen LF (2000) Effects of nitrogen fertilization on loss of nutrient in four-
Taiwan soils. J Agricul Assoc China 1:1–14
Young CC, Lai WA, Shen FT, Hung MH, Huang WS, Arun AB (2003) Exploring the microbial
potentiality to augment soil fertility in Taiwan. In the Proceedings of 6th ESAFS inter-national
conference: soil management technology on low productivity and degraded soils, Taipei, Tai-
wan. pp. 25–27
Zhang J, Wang M, Cao Y, Wu L, Xu S (2012) Iron and zinc accumulation trend in a Japonica rice
grains after anthesis. Afr J Agric Res 7:1312–1316
Zilli JE, Valisheski RR, Filho FR, Nerves MP, Rumianek NG (2004) Assessment of cowpea rhizo-
bium diversity in Cerrado area of northeastern Brazil. Braz J Microbiol 35(4):281–287
Chapter 6
Plant-Microorganism Interactions: Effects
on the Tolerance of Plants to Biotic and
Abiotic Stresses
Muriel da Silva Folli-Pereira, Lydice Sant’Anna Meira-Haddad,

Cristina Maria Nobre Sobral de Vilhena da Cruz Houghton and
Maria Catarina Megumi Kasuya
Abstract Arbuscular mycorrhizal fungi (AMF) establish mutualistic symbiosis

(arbuscular mycorrhiza—AM), with the roots of most species of terrestrial plants,
acting as a bridge between the soil and plants. AMF are critical in the establish-
ment and adaptation of plants in locations severely disturbed. They affect also the
physico-chemical properties of substrate and act for the formation and maintenance
of soil structure, acting in the aggregation of soil particles. The AM occurs in the
roots of most plants, promoting improvements in the growth and development of
plants and increase in tolerance and/or plant resistance to various adverse environ-
mental agents and can also be used as a potential biological control agent of plant
diseases. The different responses of plants to this symbiosis can be assigned to the
functional diversity of AM, depending of the interaction between AMF, plants and
environmental conditions. The establishment and functioning of MAs during stress
conditions involves a complex process of recognition and development, concur-
rently at physiological, biochemical and molecular changes in both symbionts. In
addition, mycorrhizal colonization of roots has a significant impact on the gene
expression of several plants that encode proteins presumably involved in tolerance
to stress. In this context, whereas the AMF are essential in the establishment and
M. C. Megumi Kasuya () · M. da Silva Folli-Pereira

Departamento de Microbiologia, Universidade Federal de Viçosa, 36570-000 Viçosa,
Minas Gerais, Brasil
M. da Silva Folli-Pereira
L. Sant’Anna Meira-Haddad
Centro de Ciências Agrárias, Ambientais e Biológicas,
Universidade Federal do Recôncavo da Bahia, Cruz das Almas, BA, Brasil
C. M. N. S. de Vilhena da Cruz Houghton
Faculdade de Ciências, Universidade de Lisboa, 1749-016, Lisboa, Portugal

210 M. da Silva Folli-Pereira et al.
adaptation of plants on disturbed sites, this chapter will be covered the molecular
and physiological mechanisms of the association MA, responsible for this adapta-
tion and greater tolerance of plants to biotic and abiotic stresses.
Introduction
Plants are constantly exposed to various abiotic and biotic stresses, such as radia-
tion, temperature, water, minerals, plants, animals, and microorganisms, which alter
the biosynthesis and development of plants as a consequence of oxidative burst
(Gill and Tuteja 2010). During aerobic metabolism, molecular oxygen is partially
reduced, generating transient intermediates that are highly reactive and damaging
to the cell. This partial reduction of O2 produces reactive oxygen species (ROS),
including the superoxide anion (O2), the hydroxyl radical (OH-), and hydrogen per-
oxide (H2O2). Further conversions can occur among these molecules, transforming
them into even more reactive species (Hajiboland and Joudmand 2009; Gill and
Tuteja 2010; Abdel Latef and Chaoxing 2011). These ROS cause morphological,
physiological and molecular alterations, resulting in plant damage and eventual
death. However, plants have enzymatic and non-enzymatic defence systems to mi-
nimise the effects of ROS (Arfaoui et al. 2007; Gill and Tuteja 2010).
The microhabitat of the rhizosphere is a specialised ecosystem, where microbial
populations are highly favoured, allowing the growth, development and multiplica-
tion of these microorganisms. Plants can form beneficial associations with these
microorganisms, acquiring tolerance and/or resistance to biotic and abiotic stress
factors (Dimkpa et al. 2009; Singh et al. 2011)
Bacteria and fungi are the most numerous inhabitants of the rhizosphere. Plant
growth-promoting rhizobacteria (PGPR) are beneficial bacteria that colonise the
root system of plants and promote growth through various mechanisms including
producing plant growth regulators, increasing the cycling and availability of soil
nutrients, functioning as pathogen biocontrol agents and conferring tolerance and/
or resistance to biotic and abiotic stresses (del Mar Alguacil et al. 2009). Arbus-
cular mycorrhizal fungi (AMF) are common inhabitants of soil that form mutu-
alistic associations within the root systems of a large number of agricultural plant
species, conferring benefits to host plants distributed throughout various habitats
(Smith et al. 2010). Arbuscular mycorrhizae improve the nutritional status of plants,
facilitate plant adaptation to different ecosystems, and increase plant tolerance to
biotic and abiotic stress factors, and they are also considered to be biocontrol agents
(Singh et al. 2012)
Plants that associate with microorganisms become more tolerant to stress condi-
tions. Several mechanisms have been described to explain this greater tolerance
(Pozo et al. 2010). The physiological changes induced in the plant through relation-
ships with symbionts prevent pathogenic attacks and activate defence mechanisms.
Phytoalexins, pathogenesis-related proteins, and agents for the lignification of the
cell wall have been reported in mycorrhizal plants in areas far from infection sites,
6 Plant-Microorganism Interactions: Effects on the Tolerance of Plants … 211
thus indicating the occurrence of systemic resistance. AMF play an important role
in enhancing the absorption of water and nutrients, conferring an enhanced hydra-
tion and nutritional status to the plant (Pozo et al. 2010; Folli-Pereira et al. 2012).
The benefits of microorganisms might help plants in terms of tolerance to several
biotic and abiotic stress factors. Thus, it is necessary to understand each symbiosis
to ensure the best utilisation of the benefits to plants.
AMF and Growth Promoter Bacteria as Potential Factors

Involved in Plant Tolerance to Stress
Plant growth promoting rhizobacteria (PGPRs) are bacteria that increase plant
growth through interactions with plant roots. PGPRs represent a functionally ac-
tive portion of the soil biota present inside the plant root, in the rhizosphere, or
on the rhizoplane. The literature indicates their potential as a component of the
sustainable management of agricultural systems, conferring characteristics such as
greater resistance to biotic and abiotic stress conditions to the host and promoting
plant growth, leading to their widespread biotechnological use. PGPRs can enhance
growth of plants through a variety of mechanisms: (a) production of plant hor-
mones; (b) controlling pathogens; and (c) increasing tolerance to stress conditions
(Kohler et al. 2006, 2009; Jalili et al. 2009; del Mar Alguacil et al. 2009).
The mechanisms of plant growth promotion include direct actions, such as bio-
logical nitrogen fixation, production of plant growth regulator hormones, and the
solubilisation of inorganic phosphate, and indirect actions, such as biological con-
trols, production of siderophores and allelochemicals and the induction of local and
systemic resistance. The use of PGPRs in biotechnology has intensified with the
production of antibiotics and other bioactive molecules and the application of these
microorganisms in bioremediation processes and transgenic techniques.
These mechanisms are potentially applicable in the field for the quantitative and
qualitative improvement of agricultural production. The use of these microorgan-
isms in agriculture depends on knowledge of their diversity, plant-bacteria interac-
tion mechanisms, and the ability to maintain, manipulate, and modify beneficial
populations under field conditions.
PGPRs, especially those belonging to the fluorescent Pseudomonas group,
have been well studied but have a disadvantage relative to Bacillus. Bacillus have
developed a resistance structure, called the endospore, which is produced under ad-
verse conditions and enables the bacterium to withstand these conditions. Once the
conditions change in favour of the microorganism, its reproduction cycle allows it
to express its beneficial characteristics to the host plant.
Arbuscular mycorrhizal associations in turn have important consequences for
nutrient cycling in soil, providing plants with essential nutrients such as phosphorus
when they are scarce or if they have low mobility in the soil solution. In exchange,
photosynthetic carbon is transported to the soil through the transfer of sugar from
the root to the AMF, which subsequently translocates this carbon as lipids and sug-
ars into the external mycelium distributed throughout the soil (Bago et al. 2003).
The symbiosis between plants and AMF also results in the reduction of physiologi-
cal losses through stress (Munier-Lamy et al. 2007) and consequently faster growth,
leading to economy input and a reduction of environmental contamination (Huang
et al. 2009). Moreover, these fungi can act as potential biological control agents,
reducing the effects and damage from plant pathogens through indirect means or
increased nutrition and plant resistance (Meira-Haddad 2008; Folli-Pereira et al.
2012). AMF also play an important role in the aggregation of soil particles.
PGPRs have been traditionally used as inducers of systemic resistance to dis-
eases in plants. Currently, new PGPRs have been proposed for use in agricultural
crops. Studies concerning the specific interactions of symbiotic microorganisms
and pathogens have demonstrated the complexity of rhizospheric interactions in-
volving both mycorrhizal and non-mycorrhizal fungi, beneficial and pathogenic
bacteria, the plant and the soil. It is no longer possible to study only the isolated
microorganism without considering the complexity of its habitat. The association of
PGPRs with other microorganisms such as AMF is both economical and practical.
PGPRs colonise plant roots and promote the development of AMF through the
enhanced absorption of P and N (Artursson et al. 2006; Richardson et al. 2009).
However, there are limited data concerning the PGPR hyphal inoculation of AMF
(Hartmann et al. 2009).
The strength of the physiological phases of bacterial binding to AMF hyphae
varies, including a weak electrostatic binding in the first stage, followed by a strong
bond in the second stage, which is related to the production of cellulose and other
extracellular bacterial products (Artursson et al. 2006). Indeed, mutant bacteria
are unable to produce these products in the presence of the AMF hyphae (Arturs-
son et al. 2006). Some bacterial strains such as Pseudomonas spp. can colonise
both plant roots and AMF hyphae, suggesting that the mechanisms of the related
processes could be relatively similar.
The association of gram-positive bacteria with AMF is high compared with
gram-negative bacteria, although this relationship has not been verified (Artursson
et al. 2005). The significance of these interactions is due to the synergistic inter-
action of some important PGPRs, including the gram-positive Bacillus spp., with
AMF (Francis et al. 2010). The enzymes of soil bacteria and AMF can also influ-
ence the decomposition of organic matter in the soil (de Boer et al. 2005).
There are a large number of bacteria, including PGPR and Rhizobium, which pro-
mote the activity and development of AMF (Frey-Klett et al. 2007; Richardson et al.
2009). These mycorrhizal helper bacteria are usually fungus-specific (Rillig et al.
2005) and promote the growth of specific AMF during symbiosis with the host plant.
This specificity has been attributed to the size and surface rugosity of the spore (Bha-
radwaj et al. 2008). Thus, Frey-Klett et al. (2007) proposed the term “mycorrhizal
auxiliary bacteria” to describe a broader concept than “mycorrhizal helper bacteria”
(MHB), which includes the beginning of the arbuscular mycorrhizal symbiosis and
the effects of MHB on the biocontrol of other species in terms of specificity. MHB
may influence the germination of spores, affect the spore wall (de Boer et al. 2005),
produce stimulants such as CO2 (Carpenter-Boggs et al. 1995), or affect the absorp-
tion of P by the AMF (Ruiz-Lozano and Bonfante 2000).
Moreover, the AMF might compete for nutrients from the soil, resulting in af-
fecting changes within the bacterial community of the rhizosphere. The associa-
tion of some bacteria with AMF is specific (Artursson et al. 2005), suggesting that
fungal exudates stimulate communication between bacteria and AMF (Artursson
et al. 2006). Indeed, some genera of bacteria, including Arthrobacter and Bacillus,
were most commonly observed in the hyphosphere or within soil around AMF hy-
phae, while Pseudomonas spp. were more distributed in the rhizosphere of Sorghum
bicolour (Artursson et al. 2005).
The adhesion of PGPRs to AMF is determined by the formation of biofilms
(Seneviratne et al. 2009). MHB, which primarily includes Bacillus and Pseudomo-
nas, can affect the functions of the AMF, influencing root permeability, root exu-
dation, AMF colonisation of the host root, and phytohormone production, thereby
mitigating the adverse effects of the environment on hyphal growth and stimulating
the growth of root hairs in plants. Some strains of rhizobia are also able to affect
the pre-symbiotic stage of fungi, influencing spore germination and hyphal growth
(Frey-Klett et al. 2007).
The symbiosis between AMF and plants contributes to the stability of soil aggre-
gates, including soils with high salinity (Caravaca et al. 2005). Stability is initiated
through macroaggregates (> 250 mm), which tangle hyphae and deposit organic
substances that assist in the subsequent stability of soil aggregates. A key factor in
the contribution of these fungi to the stabilisation of saline soils is the production
of glomalin, a glycoprotein that acts as an insoluble glue to stabilise aggregates
(Gadkar and Rillig 2006).
The influence of AMF on plant growth has been attributed to bacteria associated
with the mycorrhizosphere (Larsen et al. 2009). The production of exopolysaccha-
rides (EPSs) in response to adverse environmental conditions such as drought can
contribute to soil aggregation, leading to increased water retention in the rhizo-
sphere (Kaci et al. 2005), which can eventually affect the growth of AMF in these
soils. The effectiveness of the PGPR inoculation of plants leads to soil stabilisation
and promotes soil fertility (Kohler et al. 2006). The study of the antagonistic and
synergistic effects of different microbial inoculants when co-inoculated is a crucial
step in the development of efficient host-microorganism combinations. The inocu-
lation with rhizobacteria, alone or in combination with AMF, improves the physical
properties of the soil, even under saline stress.
Inoculation with AMF is an effective method of increasing the capacity of host
plants to establish and address stress situations, such as nutrient deficiency, drought
and soil disturbance (Caravaca et al. 2003). In fact, several authors have indicated
that AMF inoculation stimulates the absorption of water and nutrients, especially
N and P (Jeffries et al. 2003; Folli-Pereira et al. 2012) in the plant or enhances the
aggregation of eroded soils (Caravaca et al. 2002) to improve seedling performance.
In return, the mycorrhizal plants provide fungus with photosynthetic C, which is
delivered into the soil through fungal hyphae. Thus, the formation of mycorrhizae
can affect the microbial population in the rhizosphere directly or indirectly through
changes in exudation patterns or fungal exudates. Moreover, soil microorganisms
might affect the formation and function of arbuscular mycorrhiza (AM). Growth-
promoting mycorrhizal helper bacteria are known to stimulate the mycelial growth
of AMF or improve the establishment of the mycorrhizal association (Toro et al.
1997).
The combined inoculation of beneficial microorganisms in the soil rhizosphere
reduces the need for agricultural chemicals that are harmful to the environment;
consequently, these microorganisms are gaining more attention for establishing
sustainable agroecosystems. Indeed, microorganisms are active at the soil-plant in-
terface, where microcosm systems such as the rhizosphere are developed (Cordier
et al. 2000). Carbon flows are essential to the functioning of the rhizosphere. Many
microbial interactions are responsible for key environmental processes, such as bio-
geochemical nutrient cycles and the maintenance of plant health and soil quality.
The effectiveness of microorganisms as modifiers of soil fertility and facilitators
of plant development has been verified through the analysis of alterations in nutri-
tional status and plant development. The combined inoculation of selected micro-
organisms in the rhizosphere has been recommended to maximise the growth and
nutrition of plants. The study of the antagonistic and synergistic effects of different
microbial inoculants when co-inoculated is a crucial step for the development of
effective microorganism-host combinations. It has been reported that the double in-
oculation of Glomus intraradices and Bacillus subtilis promotes the establishment
of the AMF and increases the plant biomass and P accumulation (Toro et al. 1997).
Inoculation with both growth-promoting bacteria and AMF produced decreased
Na and increased K absorption in lettuce leaves, increasing the salinity tolerance
of plants (Kohler et al. 2009). The PGPR strain Pseudomonas mendocina produces
exopolysaccharides (Kohler et al. 2006) that bind to cations, including Na, thereby
decreasing the content of Na available for absorption by plants.
AMF might influence bacterial communities in the soil, including PGPRs that
are involved in soil aggregation through the exudation of carbon derived from pho-
tosynthesis in the mycorrhizosphere. However, the mechanisms underlying changes
in the soil matrix and their significance for soil aggregation are poorly understood.
Unlike AMF, which exert a strong influence on the scale of macroaggregates, rhi-
zobacteria directly influence the formation and stabilisation of microaggregates.
Thus, the AMF-mediated alteration of prokaryotic communities could indirectly
influence aggregation processes at smaller scales than macroaggregates. In drought
conditions, the formation of aggregates in the soil and the consequent soil stabilisa-
tion are essential for the increased accumulation of water in the soil, which conse-
quently increases plant productivity during water stress. In addition, PGPRs and
AMF produce phytohormones that contribute to increased development and root
growth, and plant roots contribute to the stability of soil aggregates directly through
the root “material” and indirectly through the stimulation of microbial activity in
the rhizosphere.
Glomalin in Soil: The Importance of the Soil-Plant-

Microorganism System
AMF are critical for the establishment and adaptation of plants in severely disturbed
locations, including those contaminated with heavy metals (Vallino et al. 2006).
They also affect the physicochemical characteristics of the substrate and contribute
to the formation and maintenance of soil structure through the aggregation of soil
particles, hyphal exudates, and residues. Moreover, mycorrhizal fungi produce glo-
malin, a protein extracted from soil as glomalin-related soil protein (GRSP) (Rillig
2004), which plays a key role in the stability of the soil (Bedini et al. 2009).
GRSP is an alkali-soluble protein material related to AMF (Rillig 2004; Nichols
and Wright 2006), whose biochemical nature has not been elucidated. As fungal
hyphae are shed (Driver et al. 2005), GRSP is transferred to the soil as a complex of
repeat monomer structures connected by hydrophobic interactions (Nichols 2003),
which bind to soil particles and stabilise aggregates (Rillig and Mummey 2006). In
addition, GRSP contains bound iron (0.04–8.8 %) (Nichols 2003), but it does not
contain phenolic compounds such as tannins (Rillig et al. 2001).
Glomalin contains approximately 60 % carbohydrates, comprising N linked to
oligosaccharides. It also contains Fe, which is insoluble in water. Glomalin exhibits
high hydrophobicity, which might contribute to the initiation of soil aggregation.
The amount of immunoreactive glomalin extracted from the soil is directly pro-
portional to soil aggregate stability in various regions of the world. Glomalin was
detected in large amounts in many soils (Nichols 2003), which has been attributed
to the fact that AMF colonise the roots of approximately 80 % of vascular plant
species and have a global distribution. Large “pools” of glomalin might result from
their high persistence in soil (Rillig et al. 2001).
Soil aggregates have also become an important protective environment for AMF
hyphae. In degraded soils in recovery, improved aggregation is accompanied by an
increased amount of colonised fine roots and hyphae that influence the geometric
diameter of the aggregates. Because well-aggregated soils are less affected by ero-
sion and more favourable for plant development, the effects of AMF on aggregation
contribute to agricultural productivity and sustainability and to the conservation and
functionality of natural ecosystems.
C losses in the soil result from leaching and erosion (Rillig et al. 2006). Stable
soil structural units (aggregates) provide resistance to erosion. The importance of
AMF in reducing erosion losses is related to their role in soil aggregation (Rillig
2004) and consequently in nutrient cycling through the reduction of carbon leaching
in soils (Rillig et al. 2006).
Cations are bound to GRSP in quantities that vary in different soils (Nichols
2003; Chern et al. 2007). Recently, González-Chávez et al. (2004) clearly showed
an increased binding capacity of GRSP to heavy metals (MTs) (Cu, Pb and Cd).
Based on the results of his investigation, it has been suggested that this sequestra-
tion could be important for biostabilisation in soils contaminated with MTs. Bedini
et al. (2009) showed that the amounts of Cu, Ni, Pb and Co bound to GRSP were,
respectively 2.3, 0.83, 0.24, 0.24 % of the total amount of MTs present in contami-
nated soil, thereby reducing the bioavailability of toxic elements and, consequently,
plant stress. Vodnik et al. (2008) showed that GRSP represented 21.2 % of the or-
ganic matter in soil contaminated with MTs, which was positively correlated with
the concentrations of Pb and Zn in the soil; notably, the amount of lead bound to
GRSP ranged from 0.69 to 23.4 mg g-1 DW GRSP, which represented 0.8–15.5 %
of the total Pb in the soil.
Wright et al. (1996) hypothesised that AMF secrete glomalin into the soil, which
helps in soil aggregation. This model was directly based on the observed correla-
tion between the GRSP concentrations with the stability of soil aggregates in water.
The increase of soil aggregation would benefit both the host and associated AMF,
justifying the energy “cost” of glomalin production. Experimental evidence, though
obtained in an artificial manner, suggested that relations between the production
of glomalin, soil aggregation and the enhancement of extraradicular AMF hyphae
growth might indeed exist (Bedini et al. 2010). However, AMF also appear to pro-
duce GRSP in soils where organic matter is not the primary binding agent in the
soil, and GRSP and soil aggregation are not correlated (Rillig et al. 2003). This find-
ing suggests that the promotion of soil aggregation might not be the primary func-
tion of glomalin. In addition, the AMF communities and many other groups of soil
biota profit from an improved soil structure (Niklaus et al. 2003), which makes it
unlikely that the promotion of soil aggregation is the primary function of glomalin.
Using an in vitro sterile culture system, Driver et al. (2005) showed that most
(80 %) of the glomalin was contained in the fungal mycelium, rather than in the liq-
uid growth medium. It is unclear if this result translates from the artificial aqueous
culture system to the soil environment, or if it applies to fungi across the spectrum
of AMF species. However, if it does, it suggests that a primary function of glomalin
may be in the living fungus. Indeed, the putative function of glomalin is homolo-
gous to that of heat shock proteins. Based on these observations, Purin and Rillig
(2007) proposed a new model for glomalin function. This model has the following
key components: (a) glomalin primarily functions as chaperone in the cell. It is
known that certain chaperones have the ability to act as a signal, resulting in greater
thermotolerance and control of spore viability; (b) in the context of soil aggregation,
the environmental function of glomalin is secondary to its primary physiological
function.
There are few reports of heat shock proteins (Hsp) that act as chaperones in
Glomeromycota, other than glomalin. Using the AMF species G. intraradices,
Porcel et al. (2006) showed the expression of the small Hsp 30 improved plant
tolerance to water stress.
Functional Diversity of AMF as a Determinant in the

Ability of AMF to Increase Plant Tolerance to Stress
Conditions
Arbuscular mycorrhizal fungi form the most common mutualistic relationship in

nature with the roots of approximately 80 % of terrestrial plants, with a presumed
origin of approximately 460 million years ago (INVAM 2012). The intimacy of
mycorrhizal associations provides a seamless morphological and physiological in-
tegration, resulting in increased functional compatibility. Fungal hyphae act as an
extension of the plant root system, conferring increased absorption of water and nu-
trients to plants, while the plant provides the fungus with photo-assimilates, allow-
ing it to complete its life cycle, which only occurs in the presence of the host in the
case of AMF (Smith and Read 2008). Although this symbiosis is often considered
to be mutualistic because the AMF receive carbon from the plant, the net effect on
the plant capacity varies from mutualistic to parasitic (Kiers and van der Heijdenet
2006), depending on the ecological conditions and plant-fungus combinations.
Spores, fragments of colonised roots and the extraradicular mycelium of soils are
the primary potential sources of inoculum, contributing the colonisation of plants.
The relative contribution of each type of propagule to the colonisation of plant roots
is difficult to determine.
Colonising ability (Avio et al. 2006) is used to describe the ability of AMF to
propagate inside the plant roots. As such, it should be considered to be a measure of
the ‘‘steady state’’, differing from the level of colonisation observed in a particular
segment of the root at a given time. The dynamic colonisation process requires a
continuous signal exchange during the growth of hyphae and roots. Different AMF
can colonise a particular host species at the same level, whereas the symbiotic ef-
fectiveness, measured as the growth response, can vary substantially (Smith et al.
2004). Abiotic and biotic factors influence the symbiotic effectiveness between the
two partners at the organismal and cellular level. At the community level, abiotic
factors such as the availability of soil nutrients; the micro and macroclimate, includ-
ing light and moisture (Staddon et al. 2003); and biotic factors such as community
composition (Klironomos et al. 2000) indirectly influence symbiotic effectiveness.
Interactions with pathogens and parasites affect carbon gain at the community level
and the organismal levels.
Because of the lack of evidence for “taxonomic specificity”, the different sym-
biotic responses of the host plant to the various AMF isolates suggest the existence
of a “functional specificity” (Finlay 2004). This specificity is related to the balance
between benefits and costs of the fungus for the host, which is sometimes attrib-
uted to differences in the colonisation degree or the efficiency of nutrient transport
between fungus and plant. There may be a preferential fungus-plant association at
a certain stage of plant development, which is modulated by the physiology and
ecology of the plant through mechanisms of evolutionary convergence between
symbionts (Pawlowska 2004). Therefore, a functional mycorrhiza results from
the seamless morphological and physiological integration of partners, reflecting
complex biochemical, genetic and physiological interactions and relationships that

depend on the nature of the soil and the environment.
Although there is no evidence for host-specific AMF, there is evidence of
functional specificity when considering the effects of these fungi on host plants
(Pouyu-Rojas et al. 2006). As fungal isolates may vary depending on environ-
mental changes, it is important to evaluate occurrence and functional diversity as
critical factors in the structure of the plant community and ecosystem productivity
(O’Connor et al. 2002).
Knowing the AMF community structure of a certain environment or biome and
evaluating the functional diversity of these symbionts are critically important when
trying to exploit the potential of these fungi. The functional diversity of arbuscular
mycorrhizae (AMs) has often been defined in terms of responses in plant growth,
which can range from negative to positive, depending on the particular plant-fungus
combination and environmental conditions (Johnson et al. 1997). This functional
diversity can be measured using the colonisation rate, absorption of nutrients and
plant growth effects. Plants respond differently to different AMF, and these respons-
es are observed both among the AMF of different species and among isolates of the
same species (Munkvold et al. 2004; Smith et al. 2004).
Pouyu-Rojas et al. (2006) suggested the existence of selectivity and differen-
tiated symbiotic compatibility, with preferred combinations in the formation of
AMs and variable responses depending on the mycorrhizal genotype involved in
the fungus-plant relationship. Some studies have shown that a given AMF species
originates from the same soil and colonises different plant species with distinct
sporulation patterns (Eom et al. 2000). In some cases, AMF that promote the host
growth in one plant species could inhibit growth in another (Smith and Read 2008),
and this beneficial or parasitic relationship depends on the fungus-plant combina-
tion and environmental conditions (Johnson et al. 1997; Smith and Read 2008).
Additionally, individual species of AMF can vary greatly in their response to
the growth of different plant species, and variations can occur both among AMF
isolates belonging to different species and isolates of the same species (Munkvold
et al. 2004; Smith et al. 2004). Consequently, the presence or absence of certain
AMF species influences structural changes in the population (Klironomos et al.
2000). For example, increasing the diversity of these fungi in the soil (Rillig
2004) influences the diversity, structure and productivity of the plant community
(Heijden et al. 2004), in experimental studies performed in greenhouses and in natural
ecosystems.
Inoculation with different AMF species differentially alters the growth and co-
existence of different plant species (Heijden et al. 2003), and increasing the species
richness of these fungi increases the diversity and productivity of plants. Santos
(2008) verified the influence of AMF species richness in the soil community on
the initial growth of tree species native to Brazil. The results of this study showed
that the benefits of increased AMF richness are greater when plants are grown in
complex communities with a considerable amount of competition. However, those
studies used a single individual as a representative of each AMF species, and each
culture was initiated from a single spore. Therefore, these results cannot indicate
whether intraspecific variation could account for the differences observed between
isolates of the same species.
Hart and Klironomos (2002) showed that variation in plant growth was greater
among plants inoculated with different AMF species than among those inoculated
with different isolates of the same species. However, this finding does not prove
that the variability within isolates is not ecologically important. More recently,
considerable variability has been observed within AMF species. Munkvold et al.
(2004) demonstrated that large differences in plant growth and P absorption were
observed within AMF species, showing the importance of the ecological potential
of variability within AMF species. Hart and Reader (2002), tested the effect of 21
AMF isolates on plant growth, and showed that AMF families also differ in the ben-
efits conferred to host plants, although there is great variability within and between
AMF species and genera. These studies show that there is considerable functional
diversity in AMF and that variability within an AMF species can be greater than
between different AMF species or genera. This functional diversity is important for
individual plant growth and the composition of plant communities. Thus, it is clear
that there is great functional diversity in AMF and that the increase in the diversity
of these fungi in soil (Rillig 2004) influences the diversity and productivity of the
plant community.
It is unclear whether plants utilise this diversity to select efficient AMF or AMF
combinations that are more beneficial in terms of the stimulation of their growth
(Heijden et al. 2004). Thus, it is important to determine whether increasing the
AMF diversity in soil influences plants and which plant-fungus combinations oc-
cur preferentially and effectively. Moreover, it would be important to determine
whether the inoculation of plants with a mixture of AMF reconstitutes the AMF
community observed in nature. Studies like these can be used to monitor plant per-
formance and reveal whether the diversity of the AMF species in plant roots is
linked to functional diversity.
Almost all data on the variability of the functions or functional diversity of AMF
were obtained from experiments in which plants have been inoculated with an AMF
isolate and the plant growth or total P absorption was measured. Such experiments
are not entirely relevant to field situations when more than one AMF species is gen-
erally present in a single root system (Jansa et al. 2003). Currently, the challenge
is to establish mixed communities using different AMF species to assess whether
plants are able to select efficient AMF or AMF combinations that are complemen-
tary in their functions. However, such studies are complex because of the difficulty
to identify the AMF that are colonising the roots, which becomes a limiting factor
for understanding the control of these relationships. The consequences of the si-
multaneous colonisation of a plant by functionally different AMF have been little
explored.
If a plant is colonised by AMF species that are complementary in their func-
tions, for example the absorption of nutrients from different soil “pools”, they can
be more beneficial to the plant as a mixture than any one species separately (Alkan
et al. 2006; Gustafson and Casper 2006). Johnson et al. (2004) showed that the di-
versity of AMF in the roots of Plantago lanceolata was positively correlated with
the concentrations of P and N in the shoots of the plants. However, other studies
indicate that the maximum benefits to the plants could be achieved with a single
efficient AMF species and that increasing the mycorrhizal diversity would not re-
sult in greater benefits for the plants. According to Santos (2008), increasing AMF
diversity in the community present in the soil can increase the chances for the estab-
lishment of a fungus species that is more efficient for plant growth. Thus, it is im-
portant to characterise the community structure of AMF in a particular environment
or ecosystem and assess the functional diversity of these symbionts to establish
whether there is a relationship between the AMF diversity and benefits to plants.
Physiological Aspects of the Arbuscular Mycorrhizal

Association in the Plant Tolerance to Stress
The establishment of AMs confers the plants with a range of benefits, primarily
through the extraradicular mycelium of the fungus that facilitates the absorption
of nutrients from areas located beyond the depletion zone of the roots, particularly
phosphorus, and it increases the availability and translocation of nutrients to cortex
cells in the plant roots. Other relevant effects of AMF are increased plant resistance
to pathogens of the root system and water absorption capacity. In soil, they favour
aggregate formation and stability, not only through the physical action of the my-
celium but also through the action of glomalin. Through the enhancement of the
hydric and nutritional status of plants, AMF can contribute the increased tolerance
to environmental stress conditions.
Thus, the symbiosis between plants and AMF also results in the reduction of
losses by stresses (Munier-Lamy et al. 2007) and consequently faster growth, with
economic inputs and the reduction of environmental contamination (Huang et al.
2009). Furthermore, these fungi can act as potential biological control agents, re-
ducing the effects or damage caused by plant pathogens through indirect means,
enhanced plant nutrition, or increased resistance in the root system.
The plant response to colonisation by AMF depends on the severity and frequen-
cy of drought, and other soil conditions. AMF can affect the growth and productiv-
ity of the host plant under conditions of high and low humidity (Borowicz 2010).
Thus, symbiosis could increase plant responses to moderate water deficit through
various mechanisms, including increased water absorption from the soil through
the hyphae (Augé et al. 2003), alteration of hormonal levels causing changes in sto-
matal conductance (Augé et al. 2008), increased leaf turgor and osmotic potential
reduction (Wu et al. 2006), and improved nutrition of the host plant (Chen et al.
2005).
Mycorrhizal plants develop a root system uses carbon more efficiently. Conse-
quently, these plants convert larger quantities of photosynthates in the root develop-
ment to increase their absorption capacity (Neocleous and Vasilakakis 2007).
The chlorophyll concentration in the leaves is an important physiological in-
dex for determining the degree of photosynthesis in plants. AMF can increase the
chlorophyll concentration in the leaves. Indeed, mycorrhizal plants growing under

stress conditions possess greener leaves, suggesting that salt interferes with the syn-
thesis of chlorophyll (Colla et al. 2008). Mycorrhizal inoculation also increases the
absorption of phosphorus and magnesium and reduces the sodium content in the
plant, which in turn increases the chlorophyll content and consequently improves
the overall performance of mycorrhizal plants under stress conditions (Sheng et al.
2008).
Plants associated with AMF often have greater resistance to saline stress, per-
haps with greater consistency than the stress due to drought. Salinity negatively
affects the formation and functioning of the mycorrhizal symbiosis (Sheng et al.
2008). Studies indicate that AMF can increase plant growth and nutrient absorption,
reduce losses in productivity under salinity conditions and improve the tolerance to
salinity (Hajiboland et al. 2010). The colonisation of plant roots by some AMF is
reduced in the presence of NaCl (Giri et al. 2007), potentially due to the direct effect
of NaCl on the fungi (Juniper and Abbott 2006), indicating that salinity can inhibit
the formation of mycorrhiza (Sheng et al. 2008).
Many researchers have reported that AMF increases the ability of plants to ad-
dress saline stress (Jahromi et al. 2008) because of the enhanced absorption of
nutrients by the plants (Asghari et al. 2005) and the ionic equilibrium (Giri et al.
2007), which protects enzymatic activity (Rabie and Almadini 2005), and facilita-
tion of water absorption. However, there are few studies concerning the influence of
mycorrhizal inoculation on photosynthesis and water relations during saline stress.
Some reports indicate that mycorrhizal colonisation can improve the relative water
content in squash leaves (Colla et al. 2008), hydric potential and photosynthesis
of maize plants (Sheng et al. 2008), and chlorophyll concentration in the leaves of
various plant species (Sannazzaro et al. 2006; Colla et al. 2008).
Recent findings suggest that glomalin might indirectly influence the storage of
carbon in the soil through the stabilisation of soil aggregates (Zhu and Miller 2003)
and soil stability. The stability of soil aggregates is one of the most important prop-
erties to control plant growth in arid and semi-arid environments through the con-
trol of the soil-plant hydric status.
The establishment of mycorrhizal associations results in increased tolerance of
plants to environmental stresses (Tang et al. 2009). However, little is known about
the physiological and molecular mechanisms responsible for this greater tolerance.
Increased activity and induction of new isoenzymes that participate in the anti-
oxidant system in inoculated plants allow the plant to tolerate excess superoxide
radicals generated during the prevalence of stress conditions.
Salinity induces oxidative stress in plants (Hajiboland and Joudmand 2009).
Plant cells contain an array of protection mechanisms and repair systems that can
minimise the occurrence of oxidative damage caused by reactive oxygen species
(ROS) (Abdel Latef and Chaoxing 2011). The induction of enzymes that eliminate
ROS such as superoxide dismutase (SOD), catalase (CAT), peroxidase (POD) and
ascorbate peroxidase (APX) is the most common mechanism for detoxifying the
ROS synthesised during a stress response.
Information about the response of the antioxidant defence system under condi-
tions of stress in mycorrhizal plants is contradictory: an increase, lack of change,
and even a decrease in SOD, CAT, APX and POD activity were reported in mycor-
rhizal soy (Porcel et al. 2003) subjected to hydric stress and tomatoes subjected to
salinity (He et al. 2007; Hajiboland et al. 2010).
Under conditions of hydric deficit, plants attempt to maintain their water content
by accumulating compatible, non-toxic solutes such as proline and glycine beta-
ine, which do not interfere with the normal physiological processes of the plant
(Ma et al. 2006; Zhang et al. 2008). The accumulation of these solutes is a sensi-
tive physiological index of plants in response to salt and other stresses (Peng et al.
2008). For plants to survive under conditions of salinity and water, adjusting the
leaf osmotic potential is important and requires intracellular osmotic balance. Thus,
under hydric and salinity stresses, plants accumulate some organic solutes (pro-
line, soluble sugars, glycine betaine, among others) and inorganic ions to maintain
greater osmotic adjustment (Yang et al. 2009). The presence of AMF in the roots
could modify the osmotic potential of the leaves and influence the carbohydrate
composition and proline level.
Proline is the most common compatible osmolyte in plants and plays an impor-
tant role in increasing the adaptation of plants to drought and salinity (Hasegawa
et al. 2000). In addition to osmotic adjustment, this molecule has other proposed
functions in osmotically stressed plant tissues: it maintains and protects the integ-
rity of the plasma membrane (Hincha and Hagemann 2004), acts as a source of
carbon and nitrogen, and eliminates hydroxyl radicals. Proline accumulation in my-
corrhizal plants subjected to drought has been reported, and the variable effects of
mycorrhizal colonisation on the levels of proline in plants under saline stress have
been observed. However, to date, there is little information concerning the influence
of colonisation by arbuscular mycorrhizal fungi on this accumulation (Sannazzaro
et al. 2007).
Despite the accumulation of proline induced in plants under stress (Andrade et al.
2009), evidence of the effects of mycorrhizal symbiosis on the levels of proline or
soluble amino acids are scarce or null under stress conditions. Andrade et al. (2010)
observed that soluble amino acids and the proline content of the leaves of mycor-
rhizal and non-mycorrhizal bean plants increased in response to the addition of Cu
to soil, suggesting a stress response similar to the excess of this metal in the soil.
However, proline accumulation in the leaves of mycorrhizal plants showed a more
pronounced increase in response to Cu in the soil when compared to homologous
non-mycorrhizal plants, indicating a possible role of this amino acid in the response
to Cu toxicity in mycorrhizal plants, which exhibited greater biomass accumulation
than non-mycorrhizal plants.
Moreover, AMF increase the vigorousness of the root system and stimulate the
production of hormones by plants (Yao et al. 2005). Thus, the increase in plant tol-
erance to hydric and/or saline stress might be related to the increased expression of
genes in response to stress.
Glycine betaine acts as a protective non-toxic osmolyte during periods of drought
in many organisms, including algae, bacteria, large plants and animals (Treberg and
Driedzic 2007). It is synthesised at high levels in many plant species in response to

several types of environmental stresses, acting not only as an osmoprotectant but
also as a stabiliser of proteins and membranes (Oishi and Ebina 2005). This com-
pound appears to be a critical determinant of stress tolerance. Its accumulation is
induced under stress conditions, and this accumulation is correlated with the toler-
ance level (Wu et al. 2008).
The role of arbuscular mycorrhizae in attenuating the stress caused by heavy
metals in plants growing in contaminated soils has been recognised (Göhre and
Paszkowski 2006). Improvement of the nutritional status and reduced or altered
metal absorption are among the greatest benefits related to mycorrhizae on host
plants under heavy metal stress (Andrade et al. 2008). AMF can alter the concentra-
tion of metals in plants through the immobilisation of metal in the cell wall of in-
tra or extraradicular hyphae, metal chelation through compounds secreted by AMF
such as glomalin (Vodnik et al. 2008), or metallic compartmentalisation in fungal
cells. Thus, these fungi act as a filter for metal, reducing local concentrations in the
soil and creating a suitable environment for plant growth in soils contaminated with
metals (Göhre and Paszkowski 2006).
The mycorrhizal association can alter the metal absorption in plants (Andrade
et al. 2008), with reports of both the increase and reduction of metal concentrations
in plant tissues. As a consequence of physiological alterations, mycorrhizal plants
perform better under metal stress conditions (Paradi et al. 2003). At the molecular
level, the expression of some genes related to plant tolerance to heavy metals is al-
tered through arbuscular mycorrhizal symbiosis. However, the global mechanisms
by which the fungi reduce the phytotoxicity of the metal in plants have not been
fully elucidated, and the results f some studies show conflicting results, depending
on specific plant/fungal species/metal interactions.
The literature has reported several detoxification mechanisms in plants, but the
mechanisms associated with AMF vary among plant species. Variation is also ob-
served for the metal used, applied concentration, plant organ, and duration of the
exposure (Gratão et al. 2008).
Abiotic Stress and its Influence on the AMF Community

in the Soil
Mycorrhizae are complex symbioses formed by several components that determine

the colonisation rate, incidence of propagules and the effects and functions of the
symbiosis for plants and ecosystems. The primary components of this system are
the fungus, the plant, and the environment (soil), which have strong interrelation-
ships and interdependences.
Arbuscular mycorrhizae (AMs) are of widespread occurrence in superior plants,
and AMF are prevalent among fungi normally found in the rhizosphere or among
root colonisers. It is estimated that most plant species (approximately 250,000
species) are capable of forming AMs. Therefore, this association has widespread
occurrence, except in plants that are members of the following families: Brassica-
ceae, Amarantaceae, Comelinaceae, Juncaceae, Proteaceae, Poligonaceae, Cypera-
ceae and Chenopodiaceae. Approximately 87 % of the Cruciferae (Brassicaceae),
67 % of the Chenopodiaceae, 37 % of the Poligonaceae and 4 % of the legumes do
not form AMs. Surveys conducted in various regions of the world confirm that AMs
are much more abundant than ectomycorrhizae and occur in most Phanerogams
(97 %), including almost all species of agronomic and pastoral interest and forest
species native to the tropics.
The richness of AMF varies greatly, and two to 33 species per ecosystem have
been identified. Although several studies have been conducted, the wealth, diversity
and symbiotic potential of AMF populations in Brazilian ecosystems have not yet
been sufficiently studied. The occurrence of AMF in the country includes surveys
conducted in various crops and non-cultivated ecosystems. Many of them reveal
the richness of the species, with many of them that have not yet been identified
(approximately 20 % of the species observed).
The cultivation of soil and the imposition of environmental stress cause major
changes in the structure of fungal communities through changes in the distribution
and dominance of the species. These effects are due to biotic and abiotic changes
in the edaphic environment, such as changes in the vegetation (roots) and chemical
properties of the soil, especially in the components of acidity, availability of nutri-
ents, water, salinity and heavy metal contamination. Propagules of these fungi are
present in almost all soils, and the type of vegetation and environment determine
the occurrence and degree of root colonisation. AMF have reduced occurrence or
are absent in soils that are fumigated, severely disturbed by erosion, subject to min-
ing, in areas of civil construction, under long fallow period or flooding, and those
cultivated for long periods with non-host species and high concentrations of envi-
ronmental pollutants.
The presence of heavy metals at toxic concentrations in the soil greatly influ-
ences the AMF. The excess metals reduce spore germination, mycelia growth, de-
gree of colonisation and sporulation of these fungi, causing a significant impact
on their ecology and diversity (Klauberg-Filho et al. 2005). Despite these effects,
more than 30 species of AMF have been identified in contaminated soils world-
wide and some at high frequencies, such as Paraglomus occultum, G. clarum,
G. intraradices and Scutellospora pellucida, in addition to abundant colonisation
and sporulation. Even at high concentrations of toxic metals, increased colonisation
rates and spore densities have been reported (Gaur and Adhoeya 2004); however,
in soils contaminated with Cd, Zn, Cu and Pb, the species richness decreases with
the increasing concentration of these metals in the soil (Klauberg-Filho et al. 2002).
The presence of heavy metals inhibits spore germination and mycelial growth, re-
ducing the mycorrhizal colonisation of plants. Several studies provide evidence of
the different AMF behaviours in relation to excess metals in the soil, and several
isolates are known to be tolerant to multiple metal contaminants in the soil. Con-
sidering the importance of these fungi in the ecology of plants, isolates tolerant
to heavy metals are of great interest in the revegetation of areas degraded by the
accumulation of these elements.
The “arable” layer of the soil is where the absorbing roots of plants are
concentrated, becoming the primary habitat and reservoir of AMF propagules in
ecosystems. Any factor impacting this layer will exert a great influence on the AMF
community. Weissenhorn et al. (1993) and Weissenhorn et al. (1994) evaluated the
tolerance of isolates of Glomus mosseae obtained from adjacent areas that were
polluted or not polluted with heavy metals (Cd and Zn), and also in relation to a
reference isolate maintained in the laboratory. Germination tests showed that the
isolates obtained from contaminated areas showed greater tolerance to heavy met-
als than the isolates from adjacent uncontaminated areas. This result demonstrates
that different isolates of the same “species” are functionally distinct and suggest that
AMF have the ability to adapt to anthropogenic changes.
The AMF responses to heavy metals are diverse at the fungus species level (Hil-
debrandt et al. 2007). For example, Glomus etunicatum was more sensitive to Cd,
Pb and Zn than G. intraradices (Pawlowska and Charvat 2004), and the G. mosseae
isolated from soils polluted with heavy metals was more tolerant to Cd than the
same species isolated from a non-polluted substrate (Weissenhorn et al. 1994). An
adequate understanding of the AMF community under stress by heavy metals could
contribute to the recognition of the interactions between fungi and heavy metals
and future revegetation or phytoremediation of regions polluted by heavy metals
(Hildebrandt et al. 2007). Studies indicate that many species of plants growing well
in areas polluted by a single heavy metal, such as Fragaria vesca, Viola calaminar-
ia, Veronica rechingeri, Solidago giante, Thymus polytrichus and Thlaspi praecox,
were colonised by various AMF and AMF isolates that can positively act to regulate
plant resistance to heavy metal stress (Zarei et al. 2008; Sonjak et al. 2009).
Studies conducted with AMF in preserved and disturbed areas show the impor-
tance of these fungi in the studied areas (Silva et al. 2005). Silva et al. (2005) identi-
fied 15 species of AMF in an area of preserved caatinga and an area degraded by
copper mining and observed a strong reduction in plant diversity and AMF species
community; the community was quantitatively and qualitatively affected by mining
activity. In areas of high salinity, Yano-Melo et al. (2003) identified 21 taxa of AMF,
especially G. mosseae and G. intraradices, which favoured sporulation in the first
cycle of multiplication in a trap culture and decreased from the second cycle.
Salinity stress negatively affects the formation and function of mycorrhizal sym-
biosis by inhibition of spore germination, plant colonisation and formation of new
spores (Juniper and Abbott 2006; Giri et al. 2007; Abdel Latef and Chaoxing 2011).
Other environmental factors such as soil water content, concentrations of available
phosphorus, organic matter content in the soil, soil pH and vegetation coverage
affect levels of colonisation in plants through AMF. AMF in wetland habitats are
periodically exposed to anaerobic conditions and high salinity in soils (Bohrer et al.
2004; Carvalho et al. 2004). Depending on the AMF species, soil salinity levels
can affect spore production and germination (Carvalho et al. 2004). The presence
of heavy metals in toxic concentrations in the soil also exert great influence on the
AMF, and the excess metal reduces spore germination, mycelial growth, degree of
colonisation, and sporulation of these fungi, which might have a significant impact
on their ecology and diversity (Klauberg-Filho et al. 2005).
Because mycorrhizae are compartmentalised biological systems, they are in-

fluenced by the effects of the environment and countless edaphic factors of each
component that directly or indirectly regulate the formation, operation, and occur-
rence of AMs. The components and controlling factors have constant and intense
interactions, such that a change in any of these factors influences the occurrence of
mycorrhizae and AMF propagules.
Establishment of AMF in Extreme Temperature Conditions
Arbuscular mycorrhizal fungi (AMF) may respond to high temperature conditions

by changing their morphology, modifying their external environment, or adapting
their internal metabolism, although the degree of phenotypic plasticity might vary.
Because AMF obtain carbon from autotrophic host plants, fungi can also be ex-
posed to stress through changes in carbon allocation from the host plant. Results
obtained from the refinement and application of molecular identification methods
in recent years has revealed that the degree of host specificity by some mycorrhi-
zal fungi might be greater than expected. This result implies that the availability
of compatible roots influences the survival of the fungus and changes in species
composition in plant communities. Restricting the supply of assimilates from the
compatible host root could limit the growth of certain fungi in rehabilitation areas.
Therefore, in many situations, mycorrhizal colonisation appears to be more depen-
dent on the host plant than on the temperature (Hawkes et al. 2008), and normally
high temperatures such as 35 and 40 °C show no significant effects on mycorrhizal
development (Zhu et al. 2010).
There are few studies that examine in detail the factors that affect the survival
of specific AMF in their natural habitats. Instead, the effects of physical-chemical
factors, especially temperature, on plants are widely reported.
Few plant species survive under continuous temperatures above 45 °C. Both
photosynthesis and respiration are inhibited at supra-optimal temperatures. How-
ever, as the temperature increases, the photosynthetic rate decreases more rapidly
than the respiration.
The structure and stability of cell membranes are important during high tempera-
ture stress. The excessive fluidity of lipid membranes at elevated temperatures is
correlated with the loss of physiological function. In some species, the acclimatisa-
tion to high temperatures is associated with the increased saturation of fatty acids
in the lipids, which makes membranes less fluid. The strength of hydrogen bonds
and electrostatic interactions between the polar groups of the aqueous phase of the
membrane decreases, which results in a stronger association between integral pro-
teins of the membrane and its lipid phase. Thus, high temperatures modify the com-
position and structure of membranes, resulting in the loss of ions and the inhibition
of metabolic processes such as photosynthesis and respiration.
One aspect common to fungi and plants when subjected to high temperature
stress is the generation of reactive oxygen species. The uncontrolled accumulation
of ROS generates oxidative stress and can cause membrane lipid peroxidation, inac-
tivation of enzymes containing SH groups, and RNA and DNA damage. ROS, par-
ticularly the superoxide radical (O2-) and hydrogen peroxide (H2O2), are generated
in the cytoplasm, chloroplasts, mitochondria, peroxisomes, and apoplast.
In microorganisms, particularly AMF, the components of antioxidant systems
are not well known. It is known, however, that enzymes such as catalase, peroxi-
dise, and superoxide dismutase participate in the decomposition of ROS. Histori-
cally, research has shown that the establishment of mycorrhizal associations result
in increased plant tolerance to adverse environmental factors, although many of the
effects are attributed to enhanced plant nutrition associated with the AMF. The in-
creased activity and induction of new isoenzymes that participate in the antioxidant
system in mycorrhizal plants confers tolerance to excess superoxide radicals gen-
erated during the prevalence of stress conditions (Costa 2003). In arbuscular my-
corrhizal associations ( Trifolium pratense–G. mosseae), there is an increase in the
activity and synthesis of new SOD isoenzymes induced through symbiosis (Palma
et al. 1993).
Through the involvement of oxidative stress enzymes against oxidative dam-
age caused by the increased production of ROS during stress conditions, AMF can
increase the capacity to resist oxidative and environmental stresses in the plant,
conferring increased tolerance to ROS, although the role of these enzymes in my-
corrhizae is little elucidated.
Arbuscular Mycorrhizal Fungi in Plants Tolerance

to Nematode Attacks
The protection of plants against abiotic stress caused by pathogens in soil can also
be attributed to AMF (Moraes et al. 2004; Meira 2004; Hol and Cook 2005; Elsen
et al. 2008; Meira-Haddad 2008; Vos et al. 2012).
AMF can be considered to be biocontrol agents (Azcón-Aguilar and Barea 1996;
Pozo et al. 2002) and have received much attention for promoting resistance and/
or tolerance, decreasing the incidence and severity of plant diseases, and reducing
the number of soil pathogens (Cordier et al. 1998; Hol and Cook 2005; Borges et al.
2007; Meira-Haddad 2008; Vos et al. 2012).
According to Azcón-Aguilar and Barea (1996), AMF promotes the following
mechanisms for biological control of plant diseases: improving the nutritional status
of the host plant, compensation for damage caused by the pathogen, competition for
the site of infection and colonisation site, anatomical and morphological changes in
the root system of the host, changes in the microbial population of the rhizosphere,
and activation of systemic and localised defence mechanisms (Pozo et al. 2002).
Several studies have demonstrated that AMF affect the reproduction of nema-
todes by reducing oviposition, the number of individuals in the roots of infected
plants, and the number of galls and by increasing plant tolerance to pathogen attack
through reductions in their development (Elsen et al. 2003; de La Peña et al. 2006;
Jaiti et al. 2008; Meira-Haddad 2008).
Populations of Pratylenchus coffeae, Radophulus similis, Meloidogyne javanica,
among others, were reduced by G. mosseae and G. intraradices when associated
with banana roots (Pinochet et al. 1996; Elsen et al. 2003). The mycorrhizal fun-
gi might affect nematode reproduction by reducing galls and eggs and inhibiting
penetration (Siddiqui and Mahmood 1995; Meira-Haddad 2008; Vos et al. 2012).
These diverse effects indicate that this interaction is specific, and the plant geno-
type, nematode species, fungal isolates, and changes in the environment could ex-
plain these different responses (Siddiqui and Mahmood 1995; Hol and Cook 2005;
Borges et al. 2007; Jaiti et al. 2008).
Using the root compartmentalisation system of two banana cultivars, it was pos-
sible to demonstrate the direct effect of AMF on M. incognita (Meira-Haddad 2008).
When AMF and nematodes were inoculated in the same compartment, a reduction
in the number of eggs in the cv. Prata-anã and both the number of eggs and galls
in the cv. FHIA 01 was observed (Meira-Haddad 2008). Studies have shown that
plants colonised by AMF have few galls containing few females, and the nematodes
are smaller in size. Because of this characteristic, they need more time to develop to
adulthood (Diedhiou et al. 2003; Freire et al. 2007; de La Peña et al. 2006).
Cells of the root system with arbuscules were not infected with the pathogens,
and its proliferation was reduced in the mycorrhizal roots and also in parts of the
root system, demonstrating that bioprotection is directly linked to AMF root colo-
nisation. Cytomolecular studies have shown that the systemic and localised pro-
tective effect induced of AMF colonisation involves the accumulation of defence
molecules in combination with the elicitation reaction of the host cell wall. Modi-
fications of the cell wall associated with localised resistance and the formation of
papillae characterises systemic resistance to P. parasitica in mycorrhizal tomato
plants (Cordier et al. 1998).
The changes in the root system caused by the AMF promote the vigorous growth
of the plant, thus reducing the negative effect of the pathogen (Siddiqui and Mah-
mood 1995). The reduction of plant growth due to the establishment of nematodes
in roots is lower when colonised by mycorrhizal fungi (Cofcewicz et al. 2001).
The success of the plant defence system against pathogens depends primarily on
the recognition of invasion by the pathogen in the initial stages for the activation
of defence response cascades. Plants in mycorrhizal symbiosis undergo biochemi-
cal, physiological and molecular alterations related to the plant defence system for
the establishment of symbiosis (Garcia-Garrido and Ocampo 2002). However, the
plant defence responses are limited, transient, and restricted to specific cells; how-
ever, the reactions share similarities with the physiological reactions observed dur-
ing colonisation by pathogens (Garcia-Garrido and Ocampo 2002; Lambais et al.
2003). The mycorrhizal colonisation acts as the primary system of plant defence to
pathogen attack (Elsen et al. 2008).
The physiological changes in the plant caused by the symbionts prevent pathogen
attack and activate defence mechanisms because proteins related to pathogenesis,
phytoalexin production, and cell wall lignification have been reported in mycor-
rhizal plants at regions far from the infection sites, indicating the occurrence of sys-
temic resistance (Cordier et al. 1998; Pozo et al. 2002; Selosse et al. 2004).
The successful establishment of mycorrhiza is essential for the control of nema-
todes and has a negative effect on the reproduction of these organisms (Cordier
et al. 1998; Elsen et al. 2003; Vos et al. 2012).
The bioprotector effect of the AMF to plant pathogens might be related to the
induction of localised or systemic resistance (Cordier et al. 1998; Pozo et al. 2002;
Elsen et al. 2008). When colonised by AMF, plants exhibit biochemical, physiologi-
cal and molecular alterations related to the plant defence system as symbiosis is
established (Garcia-Garrido and Ocampo 2002; De Gara et al. 2003; Selosse et al.
2004). However, the plant defence responses are limited, transient, and restricted
to specific cells, but the plant reactions have physiological similarities with the
reactions observed during colonisation by pathogens (Garcia-Garrido and Ocampo
2002; Lambais et al. 2003). Mycorrhizal colonisation acts as the primary system of
plant defence against pathogens (Elsen et al. 2008). Plants with higher antioxidant
activities are more tolerant to different stresses, and mycorrhizae increase the activ-
ity of antioxidant enzymes, such as peroxidise, catalase and superoxide dismutase
(Costa 2003; Lambais et al. 2003; Meira 2004; Arfaoui et al. 2007).
Peroxidase is an enzyme that is transiently induced and subsequently suppressed
during mycorrhizal colonisation. The peroxidases catalyse the oxidative polymeri-
sation of phenylpropanoids for the production of lignin and are involved in cross-
linking the proteins of the cell wall, thus contributing to increased rigidity (Siddiqui
and Mahmood 1995; Hol and Cook 2005; del Río et al. 2006). Consequently, hydro-
gen peroxide plays an important role in strengthening the cell wall and the systemic
induction of defence genes (del Río et al. 2006).
Phenylalanine ammonia lyase is a key enzyme in the phenylpropanoid pathway,
which is responsible for the deamination of L-phenylalanine to form trans-cinnamic
acid and ammonia. Trans-cinnamic acid is incorporated in different phenolic com-
pounds to produce phytoalexins, which are antimicrobial compounds that are closely
related to the resistance of plants to pathogens (Wuyts et al. 2006; Arfaoui et al. 2007).
The study of the mechanisms involved in the AMF bioprotection to nematodes
has been limited due to obligatory biotrophism and parasitism of both. AMF can be
considered to be biological control agents; however, the diversity of responses to
the combination AMF-nematode and plants is unique. Generalisations are hindered
because these interactions are dependent on the host, nematode species, AMF spe-
cies and combinations of nematode and AMF initial inoculum density, soil fertility
and nematode inoculum.
The various interactions that occur between plant roots and microorganisms in the
soil are of importance to ecosystems. The understanding of these interactions can
greatly benefit agriculture through the manipulation of populations of common mi-
croorganisms that inhabit the soil associated with roots, which is a promising area
of research that can be an effective option for increasing plant tolerance to biotic
and abiotic stresses. Beneficial microorganisms that promote plant growth and con-
fer a protective effect against soil pathogens are considered to be of great value to
production systems.
Despite of more than 120 years, since the first descriptions and hypotheses about
the functionality of the mycorrhizal associations, it is suspected that the deeper im-
pact of this symbiosis is yet to be revealed.
The effort by the potentiation of AMF in the field, as well as by the generation of
related techniques, demand studies incorporating multiplication protocols of AMF.
Implies consider this component in long-term studies that seek to detect not only
its impact on the growth and development of a plant, but about the magnitude of its
contribution to global events and structure of plant communities.
With the perspective opened by molecular techniques, there are the opportu-
nity to understand mechanisms of evolution of plant species and the symbiosis. It
remains to researchers in AM extend your range of research in a multidisciplinary
effort, even because, without this approach, it will not possible to understand the
full dimension of this formidable symbiosis.
The AMF and the symbiotic association process require an interaction between
root and fungi, so far not clarified with regard to the mechanism for the recognition
of symbiotic partners and interaction, or the moment from which it is recognized as
an association.
The symbiosis between plants and AMF results in the reduction of losses by
stresses and consequently faster growth, with economic inputs and the reduction
of environmental contamination. Furthermore, AMF can act as potential biological
control agents, reducing the effects or damage caused by plant pathogens through
indirect means, enhanced plant nutrition, or increased resistance in the root system.
Little is known about the physiological and molecular mechanisms responsible
for greater tolerance of mycorrhizal plants. The knowledge that one of the physi-
ological responses to biotic and abiotic stress in plants mediated by AM consists
in the increase of the activity of an oxidative stress set of enzymes (SOD, APX,
POD), in the production of compounds with antimicrobial activity (phenols, qui-
nones, phytoalexins) and the activation of enzymes that catalyze the reactions for
the production of compounds that act as chemical or physical barriers. Furthermore,
increased activity and induction of new isoenzymes that participate in the antioxi-
dant system in inoculated plants can allow the plant to tolerate excess superoxide
radicals generated during the prevalence of stress conditions.
Know the community structure of the AMF of a particular environment or bi-
ome, and evaluate the functional diversity of these symbionts are of fundamental
importance when you want to explore the potential of these fungi to increase the
plants tolerance to biotic and abiotic stress. There are few works that examine in
detail the factors that affect the survival of AMF in their natural habitats. On the
contrary, the effects of physical and chemical factors on plants are widely reported.
Studies on the factors that may regulate the establishment and functioning of
AM and changes biochemical, physiological and molecular in both symbionts dur-
ing biotic and abiotic stress conditions have been made in recent years. However,
the elucidation of these mechanisms is still far from being completed. The limited
information about the genetics of the AMF and the difficulties encountered in car-
rying out these studies, which is hampered by the obligatory symbiotic relation-
ship that is required and by the complexity of fungal genomics, has contributed to
limiting the knowledge of that symbiosis.
References
Abdel Latef AAH, Chaoxing H (2011) Effect of arbuscular mycorrhizal fungi on growth, mineral
nutrition, antioxidant enzymes activity and fruit yield of tomato grown under salinity stress.
Sci Horticul 127:228–233
Alkan N, Gadkar V, Yarden O, Kapulnik Y (2006) Analysis of quantitative interactions between
two species of arbuscular mycorrhizal fungi, Glomus mosseae and G. intraradices, by real-
time PCR. Appl Environ Microbiol 72(6):4192–4199
Andrade SAL, Gratão PL, Silveira APD, Schiavinato MA, Azevedo RA, Mazzafera P (2009) Zn
uptake, physiological response and stress attenuation in mycorrhizal jack bean growing in soil
with increasing Zn concentrations. Chemosphere 75:1363–1370
Andrade SAL, Gratão PL, Azevedo RA, Silveira APD, Schiavinato MA Mazzafera P (2010) Bio-
chemical and physiological changes in jack bean under mycorrhizal symbiosis growing in soil
with increasing Cu concentrations. Environ Exp Bot 68:198–207
Andrade SAL, Silveira APD, Jorge RA, de Abreu MF (2008) Cadmium accumulation in sunflower
plants influenced by arbuscular mycorrhiza. Int J Phytorem 10:1–13
Arfaoui A, El hadrami A, Mabrouk Y, Sifi B, Boudabous A, El hadrami I, Daayf F, Chérif M
(2007) Treatment of chickpea with Rhizobium isolates enhances the expression of phenylpro-
panoid defense-related genes in response to infection by Fusarium oxysporum f. sp. ciceris. Int
J Phytorem 45:470–479
Artursson V, Finlay RD, Jansson JK (2005) Combined bromodeoxyuridine immunocapture and
terminal restriction fragment length polymorphism analysis highlights differences in the ac-
tive soil bacterial metagenome due to Glomus mosseae inoculation or plant species. Environ
Microbiol 7:1952–1966
Artursson V, Finlay RD, Jansson JK (2006) Interactions between arbuscular mycorrhizal fungi and
bacteria and their potential for stimulating plant growth. Environ Microbiol 8:1–10
Asghari H, Marschner P, Smith S, Smith F (2005) Growth response of Atriplex nummularia to in-
oculation with arbuscular mycorrhizal fungi at different salinity levels. Plant Soil 273:245–256
Augé RM, Moore JL, Cho K, Stutz JC, Sylvia DM, Al-Agely A, Saxton AM (2003) Relating de-
hydration resistance of mycorrhizal Phaseolus vulgaris to soil and root colonization by hyphae.
J Plant Physiol 160:1147–1156
Augé RM, Toler HD, Sams CE, Nasim G (2008) Hydraulic conductance and water potential gradi-
ents in squash leaves showing mycorrhiza-induced increases in stomatal conductance. Mycor-
rhiza 18:115–121
Avio L, Pellegrino E, Bonari E, Giovannetti M (2006) Functional diversity of arbuscular mycor-
rhizal fungal isolates in relation to extraradical mycelial networks. New Phytol 172:347–357
Azcón-Aguilar C, Barea JM (1996) Arbuscular micorrizas and biological control of soil-borne
plant pathogens—an overview of the mechanisms involved. Mycorrhiza 6:457–464
Bago B, Pfeffer PE, Abubaker J, Jun J, Allen JW, Brouillette J, Douds DD, Lammers PJ, Shachar-
Hill Y (2003) Carbon export from arbuscular mycorrhizal roots involves the translocation of
carbohydrate as well as lipid. Plant Physiol 131:1496–1507
Bedini S, Pellegrino E, Avio L, Pellegrini S, Bazzoffi P, Argese E, Giovannetti M (2009) Chang-
es in soil aggregation and glomalin-related soil protein content as affected by the arbuscu-
lar mycorrhizal fungal species Glomus mosseae and Glomus intraradices. Soil Biol Biochem
41:1491–1496
Bedini S, Turrini A, Rigo C, Argese E, Giovannetti M (2010) Molecular characterization and

glomalin production of arbuscular mycorrhizal fungi colonizing a heavy metal polluted ash
disposal island, downtown Venice. Soil Biol Biochem 42:758–765
Bharadwaj DP, Lundquist PO, Persson P, Alstrom S (2008) Evidence for specificity of cultivable
bacteria associated with arbuscular mycorrhizal fungal spores (multitrophic interactions in the
rhizosphere). FEMS Microbiol Ecol 65:310–322
Bohrer EK, Friese CF, Amon JP (2004) Seasonal dynamic of arbuscular mycorrhizal fungi in dif-
fering wetland habitats. Mycorrhiza 14:329–337
Borges AJS, Trindade AV, Matos AP, Peixoto MFS (2007) Redução do mal-do-panamá em bana-
neira-maçã por inoculação de fungo micorrízico arbuscular. Pesqui Agropecu Bras 42:35–41
(in Portuguese)
Borowicz VA (2010) The impact of arbuscular mycorrhizal fungi on strawberry tolerance to root
damage and drought stress. Pedobiologia 53:265–270
Caravaca F, Hernández MT, García C, Roldán A (2002) Improvement of rhizosphere aggregates
stability of afforested semi-arid plant species subjected to mycorrhizal inoculation and com-
post addition. Geoderma 108:133–144
Caravaca F, Barea JM, Palenzuela J, Figueroa D, Alguacil MM, Roldán A (2003) Establishment of
shrub species in a degraded semiarid site after inoculation with native or allochthonous arbus-
cular mycorrhizal fungi. Appl Soil Ecol 22:103–111
Caravaca F, Alguacil MM, Azcón R, Parlade J, Torres P, Roldán A (2005) Establishment of two
ectomycorrhizal shrub species in a semiarid site after ‘‘in situ’’ amendment with sugar beet,
rock phosphate and Aspergillus niger. Microbiol Ecol 49:73–82
Carpenter-Boggs L, Loynachan TE, Stahl PD (1995) Spore germination of Gigaspora margarita
stimulated by volatiles of soil-isolated actinomycetes. Soil Biol Biochem 27:1445–1451
Carvalho LM, Correia PM, Martins-Loucao A (2004) Arbuscular mycorrhizal fungal propagules in
a salt marsh. Mycorrhiza 14:165–170
Chen X, Tang JJ, Zhi GY, Hu SJ (2005) Arbuscular mycorrhizal colonization and phosphorus ac-
quisition of plants: effects of coexisting plant species. Appl Soil Ecol 28:259–269
Chern EC, Tsai DW, Ogunseitan OA (2007) Deposition of glomalin-related soil protein and se-
questered toxic metals into watersheds. Environ Sci Technol 41:3566–3572
Cofcewicz ET, Medeiros CAB, Carneiro RMDG, Pierobom CR (2001) Interação dos fungos mi-
corrízicos arbusculares Glomus etunicatum e Gigaspora margarita e o nematóide das galhas
Meloidogyne javanica em tomateiro. Fitopatol Bras 26:65–70 (in Portuguese)
Colla G, Rouphael Y, Cardarelli M, Tullio M, Rivera CM, Rea E (2008) Alleviation of salt stress
by arbuscular mycorrhizal in zucchini plants grown at low and high phosphorus concentration.
Biol Fert Soils 44:501–509
Cordier C, Pozo MJ, Barea JM, Gianinazzi S, Gianinazzi-Pearson V (1998) Cell defense responses
associated with localized and systemic resistance to Phytophthora parasitica induced in to-
mato by an arbuscular mycorrhizal fungus. Mol Plant Microbe Interact 11:1017–1028
Cordier C, Lemoine MC, Lemanceau P, Gianinazzi-Pearson V, Gianinazzi S (2000) The benefical
rhizosphere: a necessary strategy for microplant production. Acta Hortic 530:259–268
Costa FA (2003) Micorrizas arbusculares e enzimas do estresse oxidativo em raízes de cenou-
ra transformada e em morangueiro. Doctoral thesis, Universidade Federal de Viçosa, Minas
Gerais, Brazil 92p (in Portuguese)
de Boer W, Folman LB, Summerbell RC, Boddy L (2005) Living in a fungal world: impact of
fungi on soil bacterial niche development. FEMS Microbiol Rev 29:795–811
De Gara L, Pinto MC, Tommasi F (2003) The antioxidant systems vis-a-vis reactive oxygen spe-
cies during plant-pathogen interaction. Plant Physiol Bioch 41:863–870
De La Peña E, Echeverría SR, Van Der Putten WH, Freitas H, Moens M (2006) Mechanism of
control of root-feeding nematodes by mycorrhizal fungi in the dune grass Ammophila arenaria.
New Phytol 169:829–840
del Mar Alguacil M, Kohler J, Caravaca F, Roldán A (2009) Differential effects of Pseudomonas
mendocina and Glomus intraradices on lettuce plants physiological response and aquaporin
PIP2 gene expression under elevated atmospheric CO2 and drought. Microbiol Ecol 58:942–951
Del Río LA, Sandalio LM, Corpas FJ, Palma JM, Barroso JB (2006) Reactive oxygen species and
reactive nitrogen species in peroxisomes. production, scavenging, and role in cell signaling.
Diedhiou PM, Hallmann J, Oerke EC, Dehne HW (2003) Effects of arbuscular mycorrhizal fungi
and a non-pathogenic Fusarium oxysporum on Meloidogyne incognita infestation of tomato.
Mycorrhiza 13:199–204
Dimkpa C, Weinand T, Asch F (2009) Plant-rhizobacteria interactions alleviate abiotic stress con-
ditions. Plant Cell Environm 32:1682–1694
Driver JD, Holben WE, Rillig MC (2005) Characterization of glomalin as a hyphal wall compo-
nent of arbuscular mycorrhizal fungi. Soil Biol Biochem 37:101–106
Elsen A, Beeterens R, Swennen R, De Waele D (2003) Effects of an arbuscular mycorrhizal fungus
and two plant-parasitic nematodes on Musa genotypes differing in root morphology. Biol Fert
Soils 38:367–376
Elsen A, Gervasio D, Swennen R, De Waele D (2008) AMF-induced biocontrol against plant para-
sitic nematodes in Musa sp.: a systemic effect. Mycorrhiza 18:251–256
Eom AH, Hartnett DC, Wilson GWT (2000) Host plant species effects on arbuscular mycorrhizal
fungal communities in tallgrass prairie. Oecologia 122(3):435–444
Finlay RD (2004) Mycorrhizal fungi and their multifunctional roles. Mycologist 18:91–96
Folli-Pereira MS, Meira-Haddad LS, Rassol N, Otoni WC, Kasuya MCM (2012) Development of
mycorrhized vitroplants of Jatropha curcas L. at different rooting stages. Plant Biotech Rep.
DOI: 10.1007/s11816–012-0232–5
Francis I, Holsters M, Vereecke D (2010) The Gram-positive side of plant--microbe interactions.
Environ Microbiol 12:1–12
Freire ES, Campos VP, Dutra MR, Rocha FS, Silva JRC, Pozza EA (2007) Infectividade de juvenis
do segundo estádio de Meloidogyne incognita em tomateiro após privação alimentar em solo e
água em diferentes condições. Summa Phytopathol 33:270–274 (in Portuguese)
Frey-Klett P, Garbaye J, Tarkka M (2007) The mycorrhiza helper bacteria revisited. New Phytol
176:22–36
Gadkar V, Rillig M (2006) The arbuscular mycorrhizal fungal protein glomalin is a putative homo-
log of heat shock protein. FEMS Microbiol Ecol 263:93–101
Garcia-Garrido JM, Ocampo JA (2002) Regulation of the plant defence response in arbuscular
mycorrhizal symbiosis. J Exp Bot 53:1377–1386
Gaur A, Adholeya A (2004) Prospects of arbuscular mycorrhizal fungi in phytoremediation of
heavy metal contaminated soils. Curr Sci 86(4):528–534
Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant machinery in abiotic stress toler-
ance in crop plant. Plant Physiol Biochem 48:909–930
Giri B, Kapoor R, Mukerji KG (2007) Improved tolerance of Acacia nilotica to salt stress by
arbuscular mycorrhiza, Glomus fasciculatum may be partly related to elevated K/Na ratios in
root and shoot tissues. Microbial Ecol 54:753–760
Göhre V, Paszkowski U (2006) Contribution of the arbuscular mycorrhizal symbiosis to heavy
metal phytoremediation. Planta 223:1115–1123
González-Chávez C, Carrillo-González R, Wright SF, Nichols KA (2004) The role of glomalin, a
protein produced by arbuscular mycorrhizal fungi in sequestering potentially toxic elements.
Environ Poll 130:317–323
Gratão PL, Monteiro CC, Antunes AM, Peres LEP, Azevedo RA (2008) Acquired tolerance of
tomato ( Lycopersicon esculentum cv. Micro-Tom) plants to cadmium-induced stress. Ann Appl
Biol 153:321–333
Gustafson DJ, Casper BB (2006) Differential host plant performance as a function of soil arbuscu-
lar mycorrhizal fungal communities: experimentally manipulating co-occurring Glomus spe-
cies. Plant Ecol 183(2):257–263
Hajiboland R, Aliasgharzadeh A, Laiegh SF, Poschenrieder C (2010) Colonization with arbuscular
mycorrhizal fungi Improves salinity tolerance of tomato ( Solanum lycopersicum L.) plants.
Hajiboland R, Joudmand A (2009) The K/Na replacement and function of antioxidant defense
system in sugar beet ( Beta vulgaris L.) cultivars. Acta Agr Sc B-S P 59:246–259
Hart MM, Klironomos JN (2002) Diversity of arbuscular mycorrhizal fungi and ecosystem func-
tioning. In: van der Heijden MGA, Sanders IR (eds) Mycorrhizal Ecology. Ecological Studies,
vol 157. Springer-Verlag, Heidelberg, pp 225–242
Hart MM, Reader RJ (2002) Host plant benefit from association with arbuscular mycorrhizal fun-
gi: variation due to differences in size of mycelium. Biol Fert Soils 36:357–366
Hartmann A, Schmid M, Van Tuinen D, Berg G (2009) Plant-driven selection of microbes. Plant
Soil 321:235–257
Hasegawa PM, Bressan RA, Zhu JK, Bohnert HJ (2000) Plant cellular and molecular responses to
high salinity. Annu Rev Plant Physiol 51:463–499
Hawkes CV, Hartley IP, Ineson P, Fitter AH (2008) Soil temperature affects carbon allocation with
arbuscular mycorrhizal networks and carbon transport from plant to fungus. Glob Change Biol
14:1181–1190
He Z, He C, Zhang Z, Zou Z, Wang H (2007) Changes of antioxidative enzymes and cell mem-
brane osmosis in tomato colonized by arbuscular mycorrhizae under NaCl stress. Colloids
Surfaces B Biointerfaces 59:128–133
Heijden MGA, van der Scheublin TR, Brader A (2004) Taxonomic and functional diversity in
arbuscular mycorrhizal fungi—is there any relationship? New Phytol 164(2):201–204
Heijden MGA, van der Wiemken A, Sanders IR (2003) Different arbuscular mycorrhizal fun-
gi alter coexistence and resource distribution between co-occurring plants. New Phytol
157(3):569–578
Hildebrandt U, Regvar M, Bothe H (2007) Arbuscular mycorrhiza and heavy metal tolerance.
Hincha DK, Hagemann M (2004) Stabilization of model membranes during drying by compatible
solutes involved in the stress tolerance of plants and microorganisms. Biochem J 383(2):277–
283
Hol WHG, Cook R (2005) An overview of arbuscular mycorrhizal fungi--nematode interactions.
Basic Appl Ecol 6:489–503
Huang H, Zhang S, Wu N, Luo L, Christie P (2009) Influence of Glomus etunicatum/ Zea mays
mycorrhiza on atrazine degradation, soil phosphatase and dehydrogenase activities, and soil
microbial community structure. Soil Biol Biochem 41:726–734
INVAM (2012) Intrepretation of Morphology. In: International Culture Collection of VA Mycor-
rhizal Fungi. http://invam.caf.wvu.edu/fungi/taxonomy/concepts/concepts.htm
Jahromi F, Aroca R, Porcel R, Ruiz-Lozano JM (2008) Influence of salinity on the in vitro devel-
opment of Glomus intraradices and on the in vivo physiological and molecular responses of
mycorrhizal lettuce plants. Microbial Ecol 55:45–53
Jaiti F, Meddich A, El Hadrami I (2008) Effectiveness of arbuscular mycorrhizal fungi in the
protection of date palm ( Phoenix dactylifera L.) against bayoud disease. Physiol Mol Plant P
71:166–173
Jalili F, Khavazi K, Pazira E, Nejati A, Asadi RH, Rasuli SH, Miransari M (2009) Isolation and
characterization of ACC deaminase producing fluorescent pseudomonas, to alleviate salinity
stress on canola ( Brassica napus L.) growth. J Plant Physiol 166:667–674
Jansa J, Mozafar A, Kuhn G, Anken T, Ruh R, Sanders IR, Frossard E (2003) Soil tillage affects the
community structure of mycorrhizal fungi in maize roots. Ecol Appl 13(4):1164–1176
Jeffries P, Gianinazzi S, Perotto S, Turnau K, Barea JM (2003) The contribution of arbuscular
mycorrhizal fungi in sustainable maintenance of plant health and soil fertility. Biol Fert Soils
37:1–16
Johnson D, Vandenkoornhuyse PJ, Leake JR, Gilbert L, Booth RE, Grime JP, Young JPW, Read
DJ (2004) Plant communities affect arbuscular mycorrhizal fungal diversity and community
composition in grassland microcosms. New Phytol 161(2):503–515
Johnson NC, Graham JH, Smith FA (1997) Functioning of mycorrhizal associations along the
mutualism--parasitism continuum. New Phytol 135:575–585
Juniper S, Abbott LK (2006) Soil salinity delays germination and limits growth of hyphae from
propagules of arbuscular mycorrhizal fungi. Mycorrhiza 16:371–379
Kaci Y, Heyraud A, Barakat M, Heulin T (2005) Isolation and identification of an EPS-producing
Rhizobium strain from arid soil (Algeria): characterization of its EPS and the effect of inocula-
tion on wheat rhizosphere soil structure. Res Microbiol 156:522–531
Kiers ET, Van Der Heijden GA (2006) Mutualistic stability in the arbuscular mycorrhizal symbio-
sis: exploring hypotheses of evolutionary cooperation. Ecology 87:1627–1636
Klauberg-Filho O, Siqueira JO, Moreira FMS (2002) Fungos micorrízicos arbusculares em solos
de área poluída com metais pesados. Rev Bras Cienc Solo 6:125–134 (in Portuguese)
Klauberg-Filho O, Siqueira JO, Moreira FMS, Soares CRFS, Silva S (2005) Ecologia, função
e potencial de aplicação de FMAs em condições de excesso de metais pesados. Tópicos em
ciência do solo. Soc Bras Cienc Solo 4:85–144 (in Portuguese)
Klironomos JN, McCune J, Hart M, Neville J (2000) The influence of arbuscular mycorrhizae on
the relationship between plant diversity and productivity. Ecol Lett 3:137–141
Kohler J, Caravaca F, Carrasco L, Roldan A (2006) Contribution of Pseudomonas mendocina and
Glomus intraradices to aggregate stabilization and promotion of biological fertility in rhizo-
sphere soil of lettuce plants under field conditions. Soil Use Manage 22:298–304
Kohler J, Caravaca F, Roldan A (2009) Effect of drought on the stability of rhizosphere soil ag-
gregates of Lactuca sativa grown in a degraded soil inoculated with PGPR and AM fungi. Appl
Soil Ecol 42:160–165
Lambais MR, Ríos-Ruiz WF, Andrade RM (2003) Antioxidant responses in bean ( Phaseolus vul-
garis) roots colonized by arbuscular mycorrhizal fungi. New Phytol 160:421–428
Larsen J, Cornejo P, Barea JM (2009) Interactions between the arbuscular mycorrhizal fungus
Glomus intraradices and the plant growth promoting rhizobacteria Paenibacillus polymyxa
and P. macerans in the mycorrhizosphere of Cucumis sativus. Soil Biol Biochem 41:286–292
Ma QQ, Wang W, Li YH, Li DQ, Zou Q (2006) Alleviation of photoinhibition in drought-stressed
wheat ( Triticum aestivum) by foliar-applied glycinebetaine. J Plant Physiol 163(2):165–175
Meira LS (2004) Atividade de enzimas do estresse oxidativo em morangueiro micropropagado
e inoculado com fungos micorrízicos arbusculares durante a aclimatização. Master’s thesis,
Universidade Federal de Viçosa, Minas Gerais, Brazil 37p (in Portuguese)
Meira-Haddad LS (2008) Efeito de fungos micorrízicos arbusculares sobre o parasitismo do
nematóide das galhas em plantas de bananeira micropropagadas. Doctoral thesis, Universidade
Federal de Viçosa, Minas Gerais, Brazil 134p (in Portuguese)
Moraes RM, Andrade Z, Bedir E, Dayan FE, Lata H, Khan I, Pereira AMS (2004) Arbuscular my-
corrhizal improves acclimatization and increases lignan content of micropropagated mayapple
( Podophyllum peltatum L.). Plant Sci 166:23–29
Munier-Lamy C, Deneux-Mustin S, Mustin C, Merlet D, Berthelin J, Leyval C (2007) Selenium
bioavailability and uptake as affected by four different plants in a loamy clay soil with particu-
lar attention to mycorrhizae inoculated ryegrass. J Environ Radioactiv 97:148–158
Munkvold L, Kjoller R, Vestberg M, Rosendahl S, Jakobsen I (2004) High functional diversity
within species of arbuscular mycorrhizal fungi. New Phytol 164:357–364
Neocleous D, Vasilakakis M (2007) Effects of NaCl stress on red raspberry ( Rubus idaeus L. ‘Au-
tumn Bliss’). Sci Hortic-Amsterdam 112(3):282–289
Nichols K (2003) Characterization of glomalin-a glycoprotein produced by arbuscular mycorrhi-
zal fungi. Ph D Dissertation. University of Maryland, College Park, Maryland, pp 285
Nichols KA, Wright SF (2006) Carbon and nitrogen in operationally defined soil organic matter
pools. Biol Fert Soils 43:215–220
Niklaus PA, Alphei J, Ebersberger D, Kampichler C, Kandeler E, Tscherko D (2003) Six years of
in situ CO2 enrichment evoke changes in soil structure and soil biota of nutrient-poor grass-
land. Glob Change Biol 9:585–600
O’Connor, PJ, Smith SE, Smith FA (2002) Arbuscular mycorrhizas influence plant diversity and
community structure in a semiarid herbland. New Phytol 154:209–218
Oishi H, Ebina M (2005) Isolation of cDNA and enzymatic properties of betaine aldehyde dehy-
drogenase from Zoysia tenuifolia. J Plant Physiol 162:1077–1086
Palma JM, Longa MA, del Río LA, Arines J (1993) Superoxide dismutase in vesicular arbuscular
mycorrhizal red clover plants. Physiol Plantarum 87:77–83
Paradi I, Bratek Z, Lang F (2003) Influence of arbuscular mycorrhiza and phosphorus supply
on polyamine content, growth and photosynthesis of Plantago lanceolata. Plant Biology
46:563–569
Pawlowska TE (2004) Genetic processes in arbuscular mycorrhizal fungi. FEMS Microbiol Lett
251:185–192
Pawlowska TE, Charvat I (2004) Heavy-metal stress and developmental patterns of arbuscular
mycorrhizal fungi. Appl Environ Microbiol 70:6643–6649
Peng YL, Gao ZW, Gao Y, Liu GF, Sheng LX, Wang DL (2008) Eco-physiological characteris-
tics of alfalfa seedlings in response to various mixed salt-alkaline stresses. J Integr Plant Biol
50:29–39
Pinochet J, Calvet C, Camprubi A, Fernandez A (1996) Interactions between migratory endo-
parasitic nematodes and arbuscular mycorrhizal fungi in perennial crops: a review. Plant Soil
185:183–190
Porcel R, Aroca R, Cano C, Bago A, Ruiz-Lozano JM (2006) Identification of a gene from the
arbuscular mycorrhizal fungus Glomus intraradices encoding for a 14-3-3 protein that is up-
regulated by drought stress during the AM symbiosis. Microbial Ecol 53:575–582
Porcel R, Barea JM, Ruiz-Lozano JM (2003) Antioxidant activies in mycorrhizal soybean plants
under drought stress and their possible relationship to the process of nodule senescence. New
Phytol 157:135–143
Pouyu-Rojas E, Siqueira JO, Santos JGD (2006) Compatibilidade simbiótica de fungos micorrízi-
cos arbusculares com mudas de espécies arbóreas tropicais. Rev Bras Cienc Solo 30(3):413–
424 (in Portuguese)
Pozo MJ, Cordier C, Dumas-Gaudot E, Gianinazzi S, Barea JM, Azcón-Aguilar C (2002) Local-
ized versus systemic effect of arbuscular mycorrhizal fungi on defense responses Phytophthora
infection in tomato plants. Jou Exp Bot 53:525–534
Pozo MJ, Jung SC, Lopez-Rãez JA, Azcón-Aguilar C (2010) Impact of arbuscular mycorrhizal
symbiosis on plant response to biotic stress: the role of plant defence mechanisms. Arbuscular
mycorrhizas: Physiol Funct 3:193–207
Purin S, Rillig MC (2007) The arbuscular mycorrhizal fungal protein glomalin: limitations, prog-
ress, and new hypothesis for its function. Pedobiologia 51:123–130
Rabie GH, Almadini AM (2005) Role of bioinoculants in development of salt-tolerance of Vicia
faba plants. Afr J Biotechnol 4:210–222
Richardson A, Barea J-M, McNeill A (2009) PRIGENT-COMBARET C. Acquisition of phospho-
rus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil
321:305–339
Rillig MC (2004) Arbuscular mycorrhizae, glomalin and soil quality. Can J Soil Sci 84:355–363
Rillig MC, Lutgen ER, Ramsey PW, Klironomos JN, Gannon JE (2005) Microbiota accompany-
ing different arbuscular mycorrhizal fungal isolates influence soil aggregation. Pedobiology
49:251–259
Rillig MC, Hoye AT, Carran A (2006) Minimal direct contribution of arbuscular mycorrhizal fungi
to DOC leaching in grassland through losses of glomalin-related soil protein. Soil Biol Bio-
chem 38:2967–2970
Rillig MC, Mummey DL (2006) Mycorrhizas and soil structure. New Phytol 171:41–53
Rillig MC, Ramsey PW, Morris S, Paul EA (2003) Glomalin, an arbuscular-mycorrhizal fungal
soil protein, responds to land-use change. Plant Soil 253:293–9
Rillig MC, Wright SF, Nichols KA, Schmidt WF, Torn MS (2001) Large contribution of arbuscular
mycorrhizal fungi to soil carbon pools in tropical forest soils. Plant Soil 233:167–177
Ruiz-Lozano JM, Bonfante P (2000) Intracellular Burkholderia of the arbuscular mycorrhizal fun-
gus Gigaspora margarita possesses the vacB gene, which is involved in host cell colonization
by bacteria. Microbiology Ecol 39:137–144
Sannazzaro AI, Echeverría M, Albertó EO, Ruiz OA, Menéndez AB (2007) Modulation of poly-
amine balance in Lotus glaber by salinity and arbuscular mycorrhiza. Plant Physiol Bioch
45:39–46
Sannazzaro AI, Ruiz OA, Alberto EO, Menendez AB (2006) Alleviation of salt stress in Lotus
glaber by Glomus intraradices. Plant Soil 285:279–287
Santos JGD (2008) Riqueza de fungos micorrízicos arbusculares no solo e no crescimento inicial
de espécies arbóreas nativas. Doctoral thesis, Universidade Federal de Lavras, Minas Gerais,
Brazil 120p (in Portuguese)
Selosse MA, Baudoin E, Vandenkoornhuyse P (2004) Symbiotic microorganisms, a key for eco-
logical success and protection of plants. C R Biol 327:639–648
Seneviratne G, Thilakaratne RMMS, Jayasekara APDA, Seneviratne KACN, Padmathilake KRE,
De Silva MSDL (2009) Developing beneficial microbial biofilms on roots of non-legumes: a
novel biofertilizing technique. In: Khan MS et al (eds) Microbial strategy for crop improve-
ment. Springer-Verlag, Berlin, pp 51–61
Sheng M, Tang M, Chen H, Yang B, Zhang F, Huang Y (2008) Influence of arbuscular mycorrhizae
on photosynthesis and water status of maize plants under salt stress. Mycorrhiza 18:287–296
Siddiqui Z A, Mahmood I (1995) Role of plant symbionts in nematode management: a review.
Bioresour Technol 54:217–226
Silva GA, Trufem SFB, Saggin Júnior OJ, Mais LC (2005) Arbuscular mycorrhizal fungi in a
semiarid copper mining area in Brazil. Mycorrhiza 15(1):47–53
Singh LP, Gill SS, Tuteja N (2011) Unraveling the role of fungal symbionts in plant abiotic stress
tolerance. Plant Signal Behav 6:175–191
Singh AK, Hamel C, DePauw RM, Knox RE (2012) Genetic variability in arbuscular mycorrhizal
fungi compatibility supports the selection of durum wheat genotypes for enhancing soil eco-
logical services and cropping systems in Canada. Can J Microbiol 58:293–302
Smith SE, Read DJ (2008) Mycorrhizal Symbiosis, 3rd edn. Academic Press, London
Smith SE, Facelli E, Pope S, Smith FA (2010) Plant performance in stressful environments: In-
terpreting new and established knowledge of the roles of Arbuscular Mycorrhizas. Plant Soil
326:3–20
Smith SE, Smith FA, Jakobsen I (2004) Functional diversity in arbuscular mycorrhizal (AM) sym-
bioses: the contribution of the mycorrhizal P uptake pathway is not correlated with mycorrhizal
responses in growth and total P uptake. New Phytol 162:511–524
Sonjak S, Beguiristain T, Leyval C, Regvar M (2009) Temporal temperature gradient gel electro-
phoresis (TTGE) analysis of arbuscular mycorrhizal fungi associated with selected plants from
saline and metal polluted environments. Plant Soil 314:25–34
Staddon PL, Thompson K, Jakobsen I, Grime JP, Askew AP, Alastair Fitter AH (2003) Mycor-
rhizal fungal abundance is affected by long-term climatic manipulations in the field. Global
Change Biol 9:186–194
Tang M, Chen H, Huang JC, Tian ZQ (2009) AM fungi effects on the growth and physiology of
Zea mays seedlings under diesel stress. Soil Biol Biochem 41(5):936–940
Toro M, Azcón R, Barea JM (1997) Improvement of arbuscular mycorrhizal development by in-
oculation of soil with phosphate solubilizing rhizobacteria to improve rock phosphate bioavail-
ability (32P) and nutrient cycling. Appl Environ Microbiol 63:4408–4412
Treberg JR, Driedzic WR (2007) The accumulation and synthesis of betaine in winter skate ( Leu-
coraja ocellata). Comp Biochem Physiol A: Mol Integr Physiol 147(2):475–83
Vallino M, Massa N, Lumini E, Bianciotto V, Berta G, Bonfante P (2006) Assessment of arbus-
cular mycorrhizal fungal diversity in roots of Solidago gigantea growing in a polluted soil in
Northern Italy. Environ Microbiol 8:971–983
Vodnik D, Grčmana H, Mačeka I, Van Elterenb JT, Kovačevičc M (2008) The contribution of
glomalin-related soil protein to Pb and Zn sequestration in polluted soil. Sci Total Environ
392:130–136
Vos C, Claerhout S, Mkandawire R, Panis B, De Waele D, Elsen A (2012) Mycorrhiza-induced re-
sistance in banana acts on nematode host location and penetration. Soil Biol Biochem 47:60–66
Weissenhorn I, Glashoff A, Leyval C, Berthelin J (1994) Differential tolerance to Cd and Zn of

arbuscular mycorrhizal (Am) fungal spores isolated from heavy metal-polluted and unpolluted
soils. Plant Soil 167:189–196
Weissenhorn I, Leyval C, Berthelin J (1993) Cd-tolerant arbuscular mycorrhizal (Am) fungi from
heavy-metal polluted soils. Plant Soil 157:247–256
Wright SF, Upadhyaya A (1996) Extraction of an abundant and unusual protein from soil and com-
parison with hyphal protein of arbuscular mycorrhizal fungi. Soil Sci 161:575–586
Wu QS, Zou YN, Xia RX (2006) Effects of water stress and arbuscular mycorrhizal fungi on reac-
tive oxygen metabolism and antioxidant production by citrus ( Citrus tangerine) roots. Eur J
Soil Biol 42:166–172
Wu WQ, Su XY, Xia Y, Wang YS, Luan LJ (2008) An, The Suaeda liaotungensis kitag betaine
aldehyde dehydrogenase gene improves salt tolerance of transgenic maize mediated with mini-
mum linear length of DNA fragment. Euphytica 159:17–25
Wuyts N, Waele D, Swennen R (2006) Activity of phenylalanine ammonia-lyase, peroxidase and
polyphenol oxidase in roots of banana ( Musa acuminata AAA, cvs Grande Naine and Yan-
gambi Km5) before and after infection with Radopholus similis. Nematology 8:201–209
Yang CW, Xu HH, Wang LL, Liu J, Shi DC, Wang GD (2009) Comparative effects of salt-stress
and alkali-stress on the growth, photosynthesis, solute accumulation, and ion balance of barley
plants. Photosynthetica 47(1):79–86
Yano-Melo AM, Trufem SFB, Maia LC (2003) Arbuscular mycorrhizal fungi in salinized and sur-
rounded areas at the São Francisco submedium valley, Brazil. Hoehnea 30(2):79–87
Yao Q, Zhu HH, Chen JZ (2005) Growth responses and endogenous IAA and iPAs changes of
litchi ( Litchi chinensis Sonn.) seedlings induced by arbuscular mycorrhizal fungal inoculation.
Sci Hortic 105:145–151
Zarei M, König S, Hempel S, Nekouei MK, Savaghebi G, Buscot F (2008) Community structure
of arbuscular mycorrhizal fungi associated to Veronica rechingeri at the Anguran zinc and lead
mining region. Environ Pollut 156:1277–1283
Zhang F-L, Niu B, Wang Y-C, Chen F, Wang S-H, Xu Y, Jiang L-D, Gao J, Wu J, Tang L, Jia Y-J
(2008) A novel betaine aldehyde dehydrogenase gene from Jatropha curcas, encoding an en-
zyme implicated in adaptation to environmental stress. Plant Sci 174:510–518
Zhu XC, Song FB, Xu HW (2010) Influence of arbuscular mycorrhiza on lipid peroxidation and
antioxidant enzyme activity of maize plants under temperature stress. Mycorrhiza 20:325–332
Zhu YG, Miller RM (2003) Carbon cycling by arbuscular mycorrhizal fungi in soil-plant systems.
Chapter 7
Biotic Stress and Crop Improvement: A Wheat
Focus Around Novel Strategies
Alvina Gul Kazi, Awais Rasheed and Abdul Mujeeb-Kazi
Abstract Currently much of the wheat genetic variability is obtained through con-
ventional crop improvement methods involving land races and normal varieties.
Hence, the germplasm base available in the form of cultivars is becoming increas-
ingly narrow and the need for widening the gene pool is essential in view of the
emerging biotic and abiotic stresses due to global warming and climate change.
Major abiotic constraints that have surfaced are due to increased salinity, water log-
ging, drought and heat. Biotic stresses of emphasis here additionally contribute to
the crops productivity situation. To counter these maladies a broad genetic base
is essential to have on hand and its implementation a dire need forming the focus
of this communication. New and useful genetic variations exist in the wild uncul-
tivated wheat progenitor species that can be utilized for the enhancement of the
existing wheat breeding pools and improve yield stability. These genetic variations
can be harnessed through a combination of conventional breeding methods coupled
with interspecific, intraspecific and intergeneric hybridization approaches popularly
known as “wide crossing” that independently and cumulatively augment the avail-
able genetic variability for wheat improvement.
Diploid wheat progenitors (2n = 2x = 14) A, B, and D are the constituents of
bread wheat ( Triticum aestivum L) offering extensive diversity that contributes to
crop improvement by providing novel allelic enrichment. A and D genome dip-
A. G. Kazi ()
Atta-ur-Rahman School of Applied Biosciences,
National University of Sciences and Technology (NUST),
Islamabad, Pakistan
A. Rasheed
Department of Plant Sciences, Quaid-i-Azam University,
Islamabad, Pakistan
A. Mujeeb-Kazi
National Institute of Biotechnology and Genetic Engineering (NIBGE),
Faisalabad, Pakistan

240 A. G. Kazi et al.
loids belong to the “primary” gene pool and the B(S) genome to the “secondary”
pool. Exploiting these diploids requires skills of developing user friendly genetic
stocks commonly known as “synthetic hexaploids (SH)”. The stocks are produced
by combining durum wheat cultivars (2n = 4x = 28) with each diploid thus generat-
ing hexaploids that are genomically AABBDD, AABBAA and AABBBB(SS). All
stocks cytologically are expected to be 2n = 6x = 42 and major resources and provide
unique allelic diversity for wheat improvement.
Biotic stresses of significance vary according to location and our major ones are
the three rusts, karnal bunt with upcoming concern prevailing for powdery mildew,
barley yellow dwarf and the new emergence of spot blotch. Progress to combat
these stresses has be driven in tandem with locational priorities and these dictates
have shifted global and national focus among the rusts to stem rust with the threat
of race UG99’s spread linked with a local races presence. Thus diversity for ex-
ploitation has extended beyond the diploid relatives to include tertiary gene pool
resources where most notable mention is of the diploid Thinopyrum bessarabicum
that has the potential to address multiple stress factors and will be elucidated in an
agglomerated manner to embrace various accessional sources as they relate to the
major biotic stresses resistance management.
Introduction
Currently much of the wheat genetic variability is obtained through conventional

crop improvement methods involving land races and normal varieties. Hence, the
germplasm base available in the form of cultivars is becoming increasingly nar-
row and the need for widening the gene pool is essential in view of the emerging
biotic and abiotic stresses due to global warming and climate change. Major abiotic
constraints that have surfaced are due to increased salinity, water logging, drought
and heat (Mujeeb-Kazi et al. 2008a). Biotic stresses of emphasis here additionally
contribute to the crops productivity situation. To counter these maladies a broad
genetic base is essential to have on hand and its implementation a dire need forming
the focus of this communication. New and useful genetic variations exist in the wild
uncultivated wheat progenitor species that can be utilized for the enhancement of
the existing wheat breeding pools and improve yield stability. These genetic varia-
tions can be harnessed through a combination of conventional breeding methods
coupled with interspecific, intraspecific and intergeneric hybridization approaches
popularly known as “wide crossing” that independently and cumulatively augment
the available genetic variability for wheat improvement.
Diploid wheat progenitors (2n = 2x = 14) A, B, and D are the constituents of bread
wheat ( Triticum aestivum L) offering extensive diversity that contributes to crop
improvement by providing novel allelic enrichment. A and D genome diploids be-
long to the “primary” gene pool and the B(S) genome to the “secondary” pool.
Exploiting these diploids requires skills of developing user friendly genetic stocks
commonly known as “synthetic hexaploids (SH)” (Mujeeb-Kazi et al. 1996a). The
7 Biotic Stress and Crop Improvement: A Wheat Focus Around Novel Strategies 241
stocks are produced by combining durum wheat cultivars (2n = 4x = 28) with each
diploid thus generating hexaploids that are genomically AABBDD, AABBAA and
AABBBB(SS). All stocks cytologically are expected to be 2n = 6x = 42 and major
genetic resources that provide unique allelic diversity for wheat improvement.
Biotic stresses of significance vary according to location and our major ones
are the three rusts, karnal bunt with upcoming concern prevailing for powdery mil-
dew, barley yellow dwarf and the new emergence of spot blotch (Mujeeb-Kazi et al.
2008b). Progress to combat these stresses has be driven in tandem with locational
priorities and these dictates have shifted global and national focus among the rusts
to stem rust with the threat of race UG99’s spread linked with a local races pres-
ence (Mirza et al. 2010). Thus diversity for exploitation has extended beyond the
diploid relatives to include tertiary gene pool resources where most notable men-
tion is of the diploid Thinopyrum bessarabicum that has the potential to address
multiple stress factors and will be elucidated in an agglomerated manner to embrace
various accessional sources as they relate to the major biotic stresses resistance
management. This communication covers our major biotic stresses, address a few
of international importance using strategies that embrace diverse means of intro-
gressing genes integrating technologies that add to the efficiency of pre-breeding
and breeding to deliver outputs that are expected to form a conduit to food security.
The overall theme is captioned “wide crossing”.
Major credit for motivating research on the course of wide crosses goes to Kruse
1967, 1969, 1973, 1974 following the events of 1891 (Rimpau) and 1904 (Farrar).
Initial impetus was derived from the wheat/barley findings of Kruse 1974 that paved
the way for significant cytogenetical outputs by Islam et al. (1981) and followed by
some additional digressions with other Triticeae members Sharma and Gill (1983),
Mujeeb-Kazi and Kimber (1985), Mujeeb-Kazi et al. (1987, 1989), Wang (1989),
Jiang et al. (1994), Sharma (1995). All these reports have centered on “intergeneric
hybridization” and considered complex for realizing alien genetic transfers. Paral-
lel to these efforts since mid-1980s emerged the era of exploiting of close relatives
particularly the diploid wheat progenitor Aegilops tauschii (2n = 2x = 14, DD) via
direct crossing (Alonso and Kimber 1984; Gill and Raupp 1987) or via bridge cross-
ing (Mujeeb-Kazi and Hettel 1995; Mujeeb-Kazi et al. 1996a). Both these strategies
will be highlighted but for handling practical outputs for key biotic stresses only
those at a priority in our perception shall be considered that others could modify
according to their desires.
Wheat Production
The productivity levels across varied environments are separated into the irrigated
and rainfed regimes of cultivation. Stress constraints vary as well and these are
locational holding their specific priority profiles. Often diversity to address a trait
is present in conventional sources but when limitations prevail then unique sources
are tapped. Over the past few decades this emphasis on suing novel genetic resourc-
es has increased and the benefits have also resulted (Mujeeb-Kazi et al. 2008b).
Maximum benefits on a practical scale has come from the closely related wild pro-
genitors like the D genome diploid grass Ae. tauschii that has resulted in variet-
ies in China, Spain, Afghanistan, Ecuador and an abundance of advanced varietal
candidate lines globally possessing biotic stress resistances and high yield levels
(David Bonnett, Personal Communication). Specifying the contribution of special
resources towards biotic stresses a brief consideration covers spot blotch, Septoria
tritici, Karnal bunt, Fusarium graminearum, powdery mildew, yellow rust and stem
rust, substantiated by inputs from other resources that are more divergent are out-
puts for spot blotch and stem rust.
Germplasm for Combating Biotic Stresses
The wheat family members are distributed within three gene pools; primary, sec-
ondary and tertiary (Jiang et al. 1994) and their utilization ranges from a relative
ease to complex based upon genetic distance and genetic affinity traversing from
perfect homology to genomic homeology. Details to elucidate the species distribu-
tion and range are provided in Dewey (1984), Kimber and Feldman (1987).
a. The conventional resource. The globally available accessions in ex situ gene
banks number approximately 800,000 of which 3 % are of wild wheats (Valk-
oun 2001). Those categorized as conventional wheats, land races and grouped
into winter, spring and facultative fall in this section from which special men-
tion will be made of some land races and naturally originated wheats that have
been in extensive use since mid-1970s that carry the spontaneous translocation
T1BL.1RS. National land races approach 1,000 in Pakistan of which 112 are
widely studied and have been evaluated for various parameters. They are further
unique diversity candidates to exploit for wheat improvement.
b. The unique wild/exotic gene pool resources including the diploid progenitors of
the primary and secondary gene pool plus various tetraploids with their contribu-
tion of derived usable stocks which address biotic stresses. In extensive use have
been the D genome followed by the A and in very limited use so far the B(S)
genomes. Capturing interest also are the tetraploids Triticum dicoccum, T. dicoc-
coides, T. carthlicum and the hexaploid T. spelta.
c. The tertiary gene pool species with their diversity made user friendly and specifi-
cally targeted for a biotic stress of current global significance and a potent threat
to wheat production will be addressed. The contributions from this pool have
been tabulated and reported by Mujeeb-Kazi et al. (1987, 1989, 2008a), Sharma
and Gill (1983), Sharma (1995), Friebe et al. (1996), Mujeeb-Kazi (2003, 2005,
2006a), Trethowan and Mujeeb-Kazi (2008), Ogbonnaya et al. (2013) elucidat-
ing that almost all major stresses encountered in wheat cultivation plots can ben-
efit from alleles of value present in these resources.
Germplasm Choice for Wheat Improvement
The range of available genetic resources for improving wheat is enormous but if
the time span for the delivery of final products that translate into varieties is the
measure then the priority would follow intraspecific, interspecific and intergeneric.
At the intraspecific level T. dicoccum/T. dicoccoides followed by T. carthlicum
take lead for both durum and bread wheat improvement with T. spelta being a good
candidate for bread wheat.
At the interspecific level based upon homology the D genome heads the list
along the strategy of bridge crossing and direct crossing. For additive variation A
genome accessions come next and lastly usage of the B(S) from the Sitposis section
that is rarely exploited for applied goals of wheat production.
At the intergeneric level most of the tertiary gene pool species are genomically
far removed from the wheat A, B and D genomes. Hence parental choice of the alien
resource is paramount. If trait is present across various ploidy levels then the prefer-
ence of the species to be exploited would be the lower ploidy. Using such a strategy
the salt tolerance gene transfers from the diploids Thinopyrum bessarabicum or Th.
elongatum are preferred over the tetraploid source T. junceum or the decaploid Th.
ponticum. It is fortuitous that the diploid Th. bessarabicum is also resistant to the
UG99 pathotypes and thus for this paper it shall be discussed in detail.
Hybrid Production
Hybridization varies from the conventional to the radical combinations and thus
can be rather easy to highly complex. In general where polyploidy levels differ,
the higher polyploidy parent serves as the female and after crossing seed is set that
may mature and be shriveled or would have to have its embryo excised from after
10 to 15 days and give plantlets that are self-sterile requiring induced doubling or
backcrossing for further use in pre-breeding or breeding.
Pre-Breeding
Of late this term has been used to justify program organization in some internation-
al output projections. Unfortunately assigning the pre-breeding category to those
crosses where F1 embryo rescue is not needed needs to be separated and fitted
into the conventional hybridization category well within the work arsenal of any
wheat breeder. Intraspecifc crosses have across many decades being handled by
breeders where the classic examples are of the bread wheat/ durum wheat combina-
tions forming the pentaploid and their further exploitation. This remains a 100 %
field operation and calling it pre-breeding in our perception is inappropriate. Thus
all crosses using the AABB tetraploids onto wheat or AABBDD hexaploids with
AABB tetraploids that do not require embryo culture and laboratory assistance to
handle self-fertility or chromosome doubling should fall under the breeder’s do-
main of conventional breeding and not categorized as “pre-breeding”.
Wide hybridization returning to Triticale production, the classic wheat/barley
hybrids then additional Triticeae species that require embryo rescue and media
preparation skills, special plantlet regeneration strategies, handling care of the hy-
brid that is self-sterile with its advance via amphiploidy or backcrossing to affect
alien transfers is the true categorization of the term “pre-breeding” and has been in
operation since the start of such efforts highlighted in reports of Rimpau (1891),
Farrar (1904), Kruse (1967, 1969), Islam et al. (1978), Sharma and Gill (1983),
Mujeeb-Kazi and Kimber (1985), Mujeeb-Kazi et al. (1987, 1989, 1996a, 2013),
Sharma (1995) and Mujeeb-Kazi and Hettel (1995). Outputs from such diverse
crossings require infrastructure and skills that are hard to find within the conven-
tional breeding professionals and requires expertise and controlled environment
facilities that permits adopting special tools for F1 crossing to be done, compat-
ibility to be harnessed, tissue culture to rescue the embryos, cytology to validate the
hybrid, growing conditions that promote vigorous growth, amphiploid induction
and/ or backcrossing before the BC or the amphiploid could be manipulated to
deliver advanced lines that have the potential to become varietal materials. These
facets are true “pre-breeding” steps that has been not been mentioned and the term
loosely used to chart program structures in developing world programs fostered by
international funding.
Breeding
An efficient protocol being followed in CIMMYT has been limited backcrossing

coupled with selected modified bulk for breeding program efficiency. Where novel
diversity becomes a donor of alleles the same protocol has been utilized effectively.
With the focus on bread wheat improvement these steps are as follows:
a. Bread wheat parent as the female crossed by the novel tetraploids to produce
pentaploid F1 hybrids that upon limited backcrossing are advanced mediated by
selected bulk and ultimate cytology to generate hexaploid euploids (2n = 6x = 42,
AABBDD)
b. Similar crossing as in (a) of bread wheat by synthetic hexaploids to result in
F1’s that are ABD AAB, ABD ABB(S) or ABD ABD to yield BC1’s and upon
advance deliver euploids with the 42 complement.
Often with the D genome hexaploids the F1 hybrids exhibit necrosis this knowledge
of the necrotic genes is important to overcome this limitation. Also the tough rachis
requires a sizeable F2 population to allow for selecting free threshing derivatives.
Even though major efforts are on limited backcrossing use of F1 top-crossing in
wide crossing has been exploited significantly (Mujeeb-Kazi and Asiedu 1990).
Mediated in this breeding scheme is achieving homozygosity as early as possible

and often on the segregating F3 population where each selected individual is made
homozygous via the detached tiller strategy (Riera-Lizarazu and Mujeeb-Kazi
1990) that uses haploids from crossing the selections by maize.
The Interspecific Contribution to Biotic Stresses: Some

Crucial Steps in Outputs Generation to Combat Biotic
Stresses
Bridge Crosses
The genetic stocks used for identifying resistance are known as synthetic hexa-
ploids and these are of the three wheat genomes. According to their usage level
they genomically rank as the D, A and B with their hexaploids being AABBDD,
AABBAA and AABBSS with all being 2n = 6x = 42. These have been elaborately
discussed in literature (Mujeeb-Kazi 2003, 2006a; Mujeeb-Kazi et al. 2004, 2008b,
Ogbonnaya et al. 2013).
The Synthetic Production Across A, B (S) and D Genome Diploids,

Maintenance and Their Utilization Mode
Standard conventional procedures of crossing using T. turgidum cultivars as the

female parent, embryo rescue, seedling differentiation, hybrid seedling develop-
ment and induction of the doubled fertile product (amphiploid/ synthetic hexaploid)
permit harnessing of the various stocks that are 2n = 6x = 42 (AABBAA, AABBSS
and AABBDD). Lesser has been the use of T. dicoccum and T. dicoccoides as the
female parental source. No special modifications are needed but subtle variations do
enhance the frequency of the outputs.
The variations are in:
a. use of early pollination or bud pollination,
b. giving cold treatment of 6C to the plated embryos for 2–3 weeks and
c. delaying the colchicine treatment until the 6 leaf stage around a vigorously grow-
ing hybrid plantlet or slightly later.
The synthetics that result are in limited amount as to seed resource and these C-0
stocks require increase that is done on each seed after its cytological validation
having the 42 complement. This is essential since aneuploidy does prevail (Mujeeb-
Kazi and Hettel 1995). Such seed increases for each synthetic allows for building
up each entries seed quantity allowing for materials to be screened for biotic and
abiotic stresses, conduct molecular diagnostics and distribute globally. Extensively
in use has been the D genome synthetics and their elite sub-sets 1 plus 2. Lesser
targeted usage also happens and special requests are met from the euploid reserve
holdings. One significant provision was of a synthetic hexaploid wheat stock to Cor-
nell University wheat program where after being crossed with the cultivar “Opata”
the famous ITMI population of 150 RIL’s was developed . This population was the
conduit for developing the wheat microsatellite map (Roder et al. 1998). D genome
synthetic production has been of worldwide interest but large numbers have been
associated with the CIMMYT wide cross program where close to 1,200 spring and
winter habits synthetics have been produced (Mujeeb-Kazi et al. 2008b) and these
numbers are increasing (Bonnett, Personal Communication with A Mujeeb-Kazi).
In depth details of the global inputs of various laboratories towards the D genome
stocks have been recently reviewed by Ogbonnaya et al. (2013) where the current
status of their practical utilization has also been elucidated.
The close relative genetic diversity beyond the D genome has exploited acces-
sions of the A diploid resources T. boeoticum, T. monococcum and T. urartu and to
a very limited extent the B(S) genome diploid Ae. speltoides of the Sitopsis section.
The A and the B(S) genome stocks have yet to be widely utilized.
The use of the SH route is categorized as bridge crossing as upon crossing se-
lected SH s with bread wheat for its improvement all three genomes are contributors
and allelic richness is harnessed from all three of the SH genomes, i.e., A, B and D
allowing for intraspecific and interspecific coverage to occur where the intraspe-
cific portion simulates the bread wheat/ durum wheat pentaploid breeding protocol.
Direct Crosses
The most efficient technique for exploiting Ae. tauschii variability for bread wheat
improvement is to achieve direct transfers from resistant/tolerant Ae. tauschii ac-
cessions to bread wheat. The methodology rapidly produces improved BC1 deriv-
atives with the six genomes (AABBDD), five of which (AABBD) resemble the
elite bread wheat cultivar used in the cross (Fig. 7.1). Aneuploidy in the BC does
surface and thus recovery of euploids (2n = 6x = 42) requires cytology. Advantages
of direct crossing have been elucidated by Cox et al. (1990) and has tremendous
potential to go beyond the D genome into the A genome diploids. For a targeted ap-
proach screening of the genomic resource is important for practical wheat produc-
tivity goals. Alonso and Kimber (1984), Cox et al. (1990, 1991) and Gill and Raupp
(1987) unequivocally placed priority on direct Ae. tauschii crossing with bread
wheat cultivars. Based on the transfer of stem rust resistance from Ae. tauschii to
the cultivar Chinese Spring Alonso and Kimber (1984) determined that one back-
cross onto the F1 hybrids reinstated 92 % of the genotype of the recurrent parent.
Where there are constraints to screening of the Ae. tauschii accessions, screen-
ing the synthetic hexaploids derived from T. turgidum/Ae. tauschii is an alternative
particularly where the durum parent is susceptible and thus the SH resistance is
Fig. 7.1 Protocol for resis-

tant trait transfer from desired
Ae. tauschii accession into
an elite but susceptible T.
aestivum cultivar by “direct
crossing”
attributed to the Ae. tauschii accession. Therefore, the accession can be selected
from such synthetics for a trait and used in direct crosses.
Innovative Use of Resistance Pyramiding within “D”

Genome Synthetics
Underutilized but with a high potential is the modus operandi is combining resis-
tances identified in two divergent D genome synthetics for a biotic stress that adds
efficiency to pre-breeding/breeding. Divergent synthetics with resistance contribu-
tion from two accessions are first crossed and their F1’s superior resistance perfor-
mance than either parent detected. The F1 upon selfing generates a segregating F2
population from which superior plants with resistance resembling the F1 and bet-
ter than either parent in the cross are selected. Representative tillers detached and
doubled haploids produced, which upon further seed increase and screening will
have value additive of the two synthetic parents in the DH derivatives (Fig. 7.2). In-
tegrated in this scheme could be the DNA profile of both SHs of the cross to ensure
that DNA polymorphism is prevalent extended further to genes in either parent that
Fig. 7.2 Protocol for pyramiding resistance value of polymorphic synthetic hexaploid wheats for
adding to breeding efficiency
could be combined via marker technology. Hence in the offing exists a genetic re-
source area that could combine desired SHs for enhancing recombination breeding
efficiency and for which the entire over a 1,000 D genome SH’s of the D genome
and a couple hundred of the A genome await exploitation.
Additional Diversification from the A and B (S) Genomes
With production and maintenance protocols similar to those of the D genome diploid
accession SH derivatives, uniqueness of the A and B (S) genome synthetics resides
essentially in widening the variability resource that allows for novel allelic richness
to become user friendly and provide the wheat crop additional genes that would
be additive for resistance durability. The generated resource can not only enrich
durum breeding programs but can also complement the efforts with bread wheat im-
provement akin to what pentaploid breeding (2n = 5x = 35, AABBD) efforts provide
due to bread/durum crossings. This diversification comes from numerous acces-
sions of the diploid progenitors and is extended to cover the tetraploids not being
extensively used in the current breeding programs. The allelic richness that becomes
available to exploit does have a down side and needs voicing. In case where genetic
diversity is distributed in the two ploidy level crops by combining and shuffling
their genes, a fear exists that the spectrum of divergence may be reduced or elimi-
nated thus narrowing the base making germplasm derivatives of breeding programs
prone to greater susceptibility occurrences.
The Practical Output Contribution of Novel Genomic

Diversity
Apart from the conventional mode of wheat improvement is the newer trend where
close relatives of the primary gene pool are exploited for improvement programs
and categorized as interspecific breeding. The focus here is on the D genome that
could easily be extended to the A genome diploids and novel AB tetraploids. Though
direct crossing has greater precision this group’s emphasis has been on adding di-
versity to wheat across its three genomes for global handling of complex stresses.
Hence bridge crossing has been favored and has contributed on the applied scale
as evidenced from global varietal releases, registration of stocks and generation of
pre-bred materials. Information has been captured from research conducted up to
2004 in CIMMYT Mexico and reported in Annual Wheat Newsletter of 2004 with
additional outputs from similar resource materials but environmentally removed to
Islamabad, Pakistan from 2005 until the present having the group leader as the com-
mon lead person throughout.
The most significant practical usage of the D genome synthetics for biotic stress-
es to date have been for Fusarium head blight, Septoria leaf blotch, Cochliobolus
spot blotch, karnal bunt, yellow, leaf and stem rust and powdery mildew. The strat-
egy has been to identify resistance first in the primary synthetic hexaploids and then
exploit those in crosses onto elite wheat cultivars that need such improvement. Each
of these biotic stresses are briefly discussed:
Fusarium Head Scab
The internationally recognized Sumai 3 has over the past few decades stood as the
resistant standard for scab resistance and if the emphasis is on Type2 resistance
then acceptance of up to 15 % infection is considered as resistant since the central
inoculated florets get damaged, thus immunity is never present. The extensive test-
ing done in Mexico by the CIMMYT Wheat Wide Crossing program researchers
allowed interspecific and intergeneric cross combination products to define several

entries that were similar to or better than Sumai 3; better in the sense that the in-
oculated florets in the middle of the spike did not damage the seed formation com-
pletely as happens with Sumai 3. Two groups with potent resistance were selected
and one set is of the D genome synthetics (Zaharieva et al. 2003) and another that
has pyramided resistance from a intergeneric combination combined with a primary
synthetic. The former SH group formed a sub-set with 35 primaries and the latter
a few sister lines with extended details to cover all 4 categories of evaluation from
type 1 to 4 and then evaluated for multiple stresses (Mujeeb-Kazi et al. 2004)
Septoria Leaf Blotch
Septoria leaf blotch ( Bipolaris sorokiniana) limits wheat production in high rain-
fall areas across 10.4 × 106 hectares globally. Disease scoring is of a double-digit
scale from 1-1 (resistant) to 9-9 (susceptible) and recorded over the three grain
development stages (watery, milky, doughy). The D genome synthetics proved to
be superior for their resistance levels with numerous giving scores between 1-1 and
3-1 compared to the bread wheat cultivars that exhibited a susceptible trend with
scores between 4-1 and 9-9. The identification of resistance in unique SH sources
led breeders to exploit the germplasm in their wheat improvement efforts. The de-
rivatives allowed for selection of good agronomic plant progenies with high levels
of resistance and also led to germplasm registrations (Mujeeb-Kazi et al. 2000,
2001a). Similar resistance was also observed in the A genome synthetics (AAB-
BAA) where the score range of 1-1–2-1 in abundance were superior to the levels
seen for their durum parents that had the best at 4-1 to poor forms reaching 8-9.
Recently, Aggarwal et al. (2011) developed a SCAR marker for detection of spot
blotch in leaf and field soil which is suggested to play a key role in effective man-
agement of this disease.
Cochliobolus Spot Blotch
Spot blotch affects wheat crops across several environments from Latin America,
Asia and southeast Asia with Bangladesh being represented as a major disease loca-
tion. Its presence in the wheat crop cycle of 2009–2010 in lower Punjab of Pakistan
was alarming causing a leading cultivar “Bhakkar” to be banned from further plant-
ing in that area. The screening site for this disease is the most severe in Mexico at
the location “Poza Rica” where field screening under natural conditions allowed nu-
merous entries to be selected with resistance that included genetic stocks of various
genomes and their advanced pre-bred derivatives. The best resistant lines selected
were later called “Mayoor” and “Sabuf” leading to crop registration (Mujeeb-Kazi
et al. 1996b). Subsequently when focus shifted to exploitation of close wheat pro-
genitors, the D genome diversity at the basic primary level and for the advanced
derivatives became significant for wheat breeding efforts. From the Mayoor and
Sabuf test scores of 9-2–9-4 (9-9 susceptible) screening and a grain finish between
1 and 3 (5 poor blemished grain) the derivatives and D genome stocks utilizing
Ae. tauschii produced selected products that scored 9-2 with a grain finish of 1–2.
These were far superior than Mayoor and Sabuf and utilized via gene pyramid-
ing options. Mayoor was hybridized with a synthetic combination TKSN1081/Ae.
tauschii (222) to yield superior spot blotch resistant derivatives which also possess
multiple disease resistance that covers scab (type 1–4), Septoria and karnal bunt.
Both Mayoor and Sabuf have been further utilized in the development of molecular
mapping populations with susceptible wheat Flycatcher and Ciano (Mujeeb-Kazi
et al. 2004) as follows:
1. Mayoor//TKSN 1081/Ae tauschii (222)/3/Flycatcher with 171 doubled haploids
2. Sabuf/3/Bacanora//Ceta/Ae. tauschii(895)/4/Flycatcher with 125 doubled haploids
3. Sabuf/3/Bacanora//Ceta/Ae. tauschii(895)/4/Ciano with 102 doubled haploids.
The above populations are a conduit for molecular studies involving QTL mapping
aspects and testing internationally.
Karnal Bunt
This soil borne disease ( Neovossia indica) is a tremendous quarantine concern as

once the soil is infected its occurrence is un-ending. The national level of accep-
tance of grain for consumption is set for 3 % infection. Grains shipped across na-
tions spread the disease if they carry it and thus caution is exercised to wash seed,
treat it and stringently apply quarantine testing to provide seed disbursement that is
virtually 0 % infectious. Disease free sites are used for seed increase as in Mexico
by CIMMYT. However some countries are lax as to the seed been tested across
wheat cultivation zones and danger prevails as to its spread. Diversity for resis-
tance exists and breeding efforts are preferred. Durum cultivars are generally field
resistant with bread wheats open to high susceptibility levels. Search for resistant
resources has been a priority for the past 2–3 decades. Since swift outputs have been
sought the choice of the D genome has had a high priority and fortuitously the SH
wheats derived from durum/Ae. tauschii combinations gave outputs where immu-
nity was abundant in the materials tested. Stringent testing under controlled testing
made the field resistant durums susceptible with their SH products remaining im-
mune (Villareal et al. 1996); an unequivocal proof that D genome accessions carried
the resistance. This led to the identification of user friendly developed stocks and
their registration (Mujeeb-Kazi et al. 2001b). Further the SH wheats upon crossing
to susceptible elite bread wheats gave derivatives that had resistance transferred
into the selections (Mujeeb-Kazi et al. 2006a). The identification of QTLs under-
lying the resistance to karnal bunt has been carried out using disease screening in
multiple-environment data and it was established that two major QTLs reside on
chromosomes 3BL and 2DS which ultimately reduced the disease spread (Sukh-
winder-Singh et al. 2012).
Rusts (Leaf, Stem and Yellow)
Of the total 215 million hectares area planted to bread and durum wheat globally
about 44 % (95 million hectares) are in Asia. Sixty-nine million hectares are in Chi-
na, India and Pakistan. Most of the farmers are classed as “poor” or “small” farm-
ers and hence food security plus production stability are of significant importance.
Stem rust has been under control since the green revolution times of the mid-sixties.
Leaf rust (caused by Puccinia triticina) and yellow rust (caused by Puccinia strifor-
mis) however have the potential to affect production levels up to 60 and 43 million
hectares respectively in Asia if susceptible cultivars were grown (Singh et al. 2004).
Though fungicidal applications offer control their use is an added cost to farmers
besides being unsafe environmentally. Hence growing resistant cultivars is the most
effective and efficient control strategy (Rizwan et al. 2008). These major stresses
have to be simultaneously addressed.
Rusts have remained very dynamic pathogens that have consistently existed as
a major wheat-breeding objective globally. Currently major attention is given to
stem rust and yellow rust is a close second that should not be a reason to look at
leaf rust with complacency. The conventional picture details numerous genes for all
three rusts in the Wheat Rust compilation (McIntosh et al. 2003). Genes have been
identified from within conventional wheat cultivars and also from alien species.
The resource of the D genome Ae. tauschii is of interest for this presentation and its
contributions to yellow rust and stem rust shall be elucidated. An in depth coverage
of leaf rust has been made by Dubin and Brennan (2009) in the IFPRI 2020 Vision
Initiative Report hence it is not covered here.
Stripe or Yellow Rust
Stripe rust (yellow rust), caused by Puccinia striiformis f. sp. tritici, is an important
foliar disease of wheat. It occurs in wheat growing areas of temperate, moist and
cool regions in all continents except Antarctica (Chen 2005). Its wider prevalence is
a global threat to wheat production inflicting about 30–100 % grain losses besides
affecting the quality of grain and forage (Chen 2005). In China, India and Paki-
stan; the top wheat producers in Asia where 59.3 million hectares are under wheat
cultivation, stripe rust prevails in 24.8 million hectares i.e., ∼ 40 % of wheat
grown area (Singh et al. 2004). The deployment of stripe rust resistant genes is the
most effective method to protect wheat productivity and several stripe rust resistant
genes have been deployed successfully in the past. So far 84 Yr genes have been
designated in wheat out of which 36 genes have temporary designations (McIn-
tosh et al. in MacGenes 2010). Additionally, 52 QTLs have also been identified
conferring resistance to stripe rust in bread and durum wheats (McIntosh et al. in
MacGenes 2010).
Utilization of genetic resistance and its incorporation in wheat demands genetic
resources with enormous potential. These genetic resources have been categorized
as wild relatives, elite cultivars and landraces (Bux et al. 2012a; Kazi et al. 2012;
Arif et al. 2012). Wild progenitors of wheat possess abundant unutilized genetic
diversity. There are several stripe rust resistance genes derived from wild relatives
like Yr5 from T. spelta (Kema 1992), Yr8 from Ae. comosa (Riley et al. 1968),
Yr9 from Secale cereale (Zeller 1973), Yr28 from Ae. tauschii (Singh et al. 1998),
Yr37 from Ae. kotschyi (Marais et al. 2005), Yr38 from Ae. sharonensis (Marais
et al. 2006), Yr40 from Ae. geniculata (Kuraparthy et al. 2007) and Yr42 from Ae.
neglecta (Marias et al. 2009). Recently, Ren et al. (2012) tagged a Yr gene in syn-
thetic hexaploid line C110 and designated the gene as YrC110. Unfortunately, no
resistance gene to stripe rust has been identified and transferred to wheat from the
A-genome diploid progenitors T. monococcum and T. urartu.
Stem Rust
Stem rust ( Puccinia graminis tritici) resistance got high attention after the new race
TTKSK (UG99) emerged in Uganda in 1999 (Pretorius et al. 2000). Stem rust per
se has the potential to devastate wheat in all continents (Dubin and Brennan 2009;
Hodson 2011) The subsequent spread of TTKSK in that region soon found it to
attack wheat in Kenya, Ethiopia, Yemen reaching up to Iran throwing the SE Asia
region in jeopardy as the migration trends could take the pathogen into Pakistan
and beyond. CIMMYT wheat breeding program had been utilizing the D genome
synthetics for various other attributes and advanced derivatives screened in Kenya
gave encouraging resistant results. Selections were high yielding and also UG99
resistant (Singh et al. 2011a, b) show promise and the danger from its spread some-
what reduced. Global alliances and funding have alleviated the hazard from this
new race and also from its mutant forms. The threat of the race and its lineage has
been substantiated (Singh et al. 2008).
In Pakistan exists a local race of stem rust that has shown virulence and is an
added concern for that region. We have advocated that screening against this race
should be a priority and from the resistant selections further evaluations be made in
Kenya to ensure that final selections have resistance against both forms (i.e. UG99,
mutants, and the local Pakistan race).
Resistance gene Sr2 provided stability to wheat varieties with the release of Ya-
qui 50 in Mexico and other Sr2 carrying wheats released since then stabilized the
stem rust situation in Mexico and other countries where semi-dwarf wheats got
adopted. When present alone Sr2 gene confers slow rusting that is inadequate under
heavy disease pressure but does provide satisfactory resistance when it is in combi-
nation with other minor genes. Identifying/developing adapted resistant cultivars in
a relatively short time and replacing the susceptible cultivars before rust migrates
into our terrain is the strategy to mitigate potential losses. Although several genes
will provide resistance to the race UG99 the long-term strategy should focus on
rebuilding the “Sr2 complex” to achieve long-term durability. The complex to be
built will involve an assemblage of slow rusting gene Sr2 with other unknown ad-
ditive genes of similar nature (Singh et al. 2006). Addressing the target swiftly has
been considered very crucial as migratory paths present a gloomy picture for wheat
production should adequate resistance not be incorporated in regional wheat variet-
ies (Hodson et al. 2005, Reynolds and Borlaug 2006). To add to the swiftness would
be efficient tools (Mujeeb-Kazi et al. 2006b; Randhawa et al. 2009) as an integral
means to drive the gene transfers (Mago et al. 2005) and give allelic output stability
(Mujeeb-Kazi 2003, 2005, 2006). The allelic diversity from unique genetic resourc-
es will also be a significant aid (Coghlan 2006; Rizwan et al. 2007; Simonite 2006).
Hence, the availability of broad-based genetic variability is a pre-requisite for
having a sound and successful wheat improvement program. Genomic diversity is
one unique option available and the maximum ease that permits exploitation of this
resource comes from the D and A genome diploids of the primary Triticeae gene
pool that have generated via pre-breeding the synthetic hexaploid germplasm (Mu-
jeeb-Kazi 2003, 2006). Synthetic hexaploids created by crossing Triticum turgidum
with Aegilops tauschii tap the desirable genes present in the wild D genome dip-
loid species (Trethowan and Mujeeb-Kazi 2008; Trethowan and Van-Ginkel 2009).
These synthetic hexaploid wheats have been used as an intermediary for transfer-
ring resistance genes from the wild D genome ancestor to cultivated wheat. As both
synthetic hexaploid and bread wheat varieties have the same genomic constitution
with perfect homology they can be readily inter-crossed.
Several varieties with UG99 and its lineage lines have been released in various
countries based upon data gathered from Kenya and Ethiopia (Joshi et al. 2011)
and as early as 2006 in CIMMYT a targeted program to increase yield and pos-
sess stem and yellow rust resistance got actively moving with its superior products
obtained as reported by Singh et al. (2011b). It was encouraging to see that in the
various promising high yielding and resistant lines identified a significant number
had unique genetic resources in their pedigrees that included several of Ae. squar-
rosa (Syn. Ae. tauschii) and Thinopyrum acutum. Almost all possessed APR genes
and others that contributed. The contribution to yield from alien resources has been
well demonstrated by the varietal release in Sichuan, China of Chaunmai 42 that
reported a yield enhancement of 22.7 % over the earlier cultivar Chaunmai 107
(Yang et al. 2009).
In initial stages has been the contribution with basic research aspects where sig-
nificant contributions related to UG99 pathotypes resistance has been reported. This
has come through screening of various accessions of the AA diploid progenitor
wheats (Rouse and Jin 2011), the D genome Ae. tauschii accessions (Rouse et al.
2011) and the tertiary gene pool diploid Th. bessarabicum promise (Xu et al. 2009).
All the above have opened up avenues for global researchers to embark on vola-
tile “pre-breeding” programs where from the closely related forms of the AA and
DD resource pay offs will be swifter while those from the EbEb genome transfers
more time consuming due to the genetic distance of that diploid resource but still
needed as translocations from this source may be additive to what has recently been
reported by Qi et al. (2011) with Dasypyrum villosum ( Sr52). A new dimension to

the wild progenitor usage also exists in land race genetic diversity resources that
are worthy of exploiting as done recently by Pretorius et al. (2012) for the South
African land races where Sr2, Sr24 and Sr34 were detected via marker diagnostics.
A Major Anticipated Contribution of the Tertiary Gene Pool using Th. bessara-
bicum
Th. bessarabicum is a diploid salt tolerant grass species with the Eb genome
and a preferred alien diversity resource extensively used by wide cross research-
ers since early 1980’s in England, USA and Mexico. It has been combined with T.
aestivum cv Chinese Spring to yield an amphiploid that is an octoploid (2n = 8x = 56,
AABBDDEbEb). All seven addition lines have since been produced from the initial
five were studied by Zhang et al. 2002. The initial addition line set was shared
with R.R-C Wang by A. Mujeeb-Kazi from CIMMYT, Mexico. Very recently the
complete set of seven was developed by Kazi 2011. The germplasm provided to Xu
by R.R-C Wang in USA has been screened by Xu et al. 2009 for evaluating each
addition line (2n = 6x = 42 + 2 = 44; 1J {Eb} to 7 {Eb}) and the amphiploid for UG99
resistance. Results have shown considerable promise for resistance to race TTKSK
(known as UG99 or TTKS). Disease scores of 0, 1 and 2 were considered as low
infection types and the data obtained by Xu et al. 2009 suggests that the amphiploid,
and addition lines 1J, 2J, 6J and 7J (J = Eb) fell in the low infection category. Under-
way has been a program to introgress the value of resistance from the alien diploid
species into wheat using the Ph gene manipulation strategy exploiting the recessive
ph genetic stock developed by late ER Sears. This effort was initiated to promote
wheat alien translocations from the amphiploid source (Mujeeb-Kazi 2006a) and
also initiated in a targeted manner from each disomic addition line of Th. bessarabi-
cum (Kazi 2011). Several Robertsonian and subtle homologous translocations have
been identified by C-banding and euploid progeny (2n = 6x = 42) recovered (Kazi
2011). Additional resources studies by Xu et al. 2009 included Th. intermedium, Th.
elongatum, Th. ponticum, Elynus recticetus, Ae. caudate and Ae. speltoides which
suggest the value of this removed tertiary gene pool for harnessing diversity of
value.
Powdery Mildew
Wheat powdery mildew, caused by Blumeria graminis (DC.) E.O. Speer f. sp. Triti-
ci Em. Marchal ( Bgt) = Erysiphe graminis DC. Ex Merat f. sp. Tritici Em. Marchal,
is one of the most devastating diseases of common wheat occurs in many areas,
including China, Germany, Japan, Russia, United Kingdom, South and West Asia,
North and East Africa, and the Southeastern United States. Yield losses range from
13–34 % due to this disease (Griffey et al. 1993). To date, 41 loci with more than
60 genes/alleles for resistance to powdery mildew have been identified and located
on 18 different chromosomes in bread wheat. 29 resistance genes/alleles have been
tagged with different types of molecular markers. The desirable type of resistance
to powdery mildew is called adult plant resistance (APR), which retards infection,
growth and reproduction of the pathogen in adult plants but not in seedlings. It is
also called “slow mildewing” and “partial resistance”. APR in wheat cultivar Knox
and its derivatives remained effective against powdery mildew infection during the
20 years in which these cultivars were grown commercially (Shaner 1973). Another
cultivar, Massey, which is a derivative of Knox62, was developed and released in
1981 (Starling et al. 1984) and still has effective powdery mildew resistance in adult
plants. Common sources of Pm genes are different species within the primary, sec-
ondary and tertiary gene pools. Many of the resistance genes were introduced from
ancestral and other wild species related to common wheat such as Triticum mono-
coccum, close relative of the A genome progenitor Triticum uratu, the B genome
progenitor Aegilops speltoides, and the D genome progenitor Ae. Tauschii (Hsam
and Zeller 2002). They reported a total of 22 resistance alleles at ten loci in com-
mon wheat indicating that Pm genes may still be found in cultivated wheat. Earlier
studies by Mains (1933) identified that the wild wheat relatives T. monococcum
(AA genomes), T. dicoccum (AABB), and T. timopheevi (AAGG) are the sources
of resistance genes to powdery mildew as early as 1933. Screening of old wheat
cultivars, landraces and related species for resistance to powdery mildew started
in the 1930’s (Hsam and Zeller 2002). Pm genes were identified in many different,
widely distributed wheat cultivars and landraces. Pm5a and Pm5b, followed by
Pm2, Pm6, and Pm8 are the most common in Europe, Asia and Mediterranean cul-
tivars. Pm3a is commonly found in wheat cultivars grown in diverse geographical
locations including the Balkans, Japan, China and the US. Pm3c was identified in
Germany, while Pm3d was found in several European countries and China. Pm4a
has been used in commercial wheat cultivars in Germany and China. A number
of commercially grown cultivars have been found to have Pm gene combinations
(Heun and Fischbeck 1987). The best known cultivars are Normandie with Pm1,
Pm2, and Pm9, Maris Huntsman with Pm2 and Pm6, Kronjuvel with Pm4b and
Pm8, and 623/65 with Pm4b and Pm8 (Liu et al. 1999). Gene transfer from species
within the primary gene pool of Triticum with homologous chromosomes to wheat
can be done directly by hybridization, recombination and backcrossing.
Ae. tauschii has proved to be an important source of resistance against pow-
dery mildew. Earlier Gill et al. (1986) screened 60 Ae. tauschii accessions to four
different Bgt isolates and identified 11 highly resistant and 20 moderately resis-
tant accessions. Hsam and Zeller (2002) transferred two resistance genes, Pm2
and Pm19, from Ae. tauschii to common wheat. Two germplasm lines, NC96B-
GTD3 and NC97BGTD7, were developed which carries resistance genes Pm34
and Pm35 against PM (Murphy et al. 1998; Mirinda et al. 2006, 2007). Similarly,
Pm25 has been transferred from diploid T. monococcum to common wheat germ-
plasm NC96BGTA5 (Shi et al. 1998; Murphy et al. 1998). In tetraploid wild emmer
wheat ( T. dicoccoides), seven PM resistance genes viz. Pm16, Pm26, Pm3, Pm31,
Pm36, Pm41 and pm42 have been identified and transferred to wheat (Rong et al.
2000; Liu et al. 2002; Hsam and Zeller 2002; Hua et al. 2009). Recently, Rafiq et al.
(2012) identified several A- ( T. monococcum; T. urartu) and S-genome ( Ae. speltoi-
des) derived amphiploids resistant to PM. Both diploid and tetraploid parental lines
were proposed to carry resistance genes against PM.
The other resistance sources against powdery mildew include Pm12 (6B) and
Pm32 (1B) from Ae. speltoides (Jia 1996; Hsam et al. 2003), Pm29 (7D) from Ae.
geniculata (Zeller et al. 2002), Pm34 and Pm35 (5DL) from Ae. tauschii (Miranda
et al. 2006, 2007; Qiu et al. 2006), Pm39 from Ae. umbellulata (Zhu et al. 2006),
and some undesignated genes from Ae. longissima, Ae. searsii, Ae. umbellulata
(Buloichik et al. 2008), Ae. comosa (Bennett 1984) and Ae sharonesis (Olivera
et al. 2007). From T. monococcum, Pm25 and three temporarily designated genes,
Pm2026, Mlm3033 and Mlm80, have been introduced in wheat (McIntosh et al.
2010).
Molecular Diagnosis for Host Resistance
So far, six genes providing resistance against diseases in wheat have been suc-
cessfully cloned (Liu et al. 2012). Diagnostic markers having ability to capture
allelic variation have been developed for a major powdery mildew resistance lo-
cus, Pm3, and Lr34/Yr18/Pm38 locus providing broad spectrum resistance against
leaf rust, stripe rust and powdery mildew (Tommasini et al. 2006; Lagudah et al.
2009; Miedner et al. 2012). The cloning followed by sequencing of the adjacent un-
translated regions of Pm3 resistance alleles helped in development of seven allele-
specific molecular markers which successfully discriminated allelic variants at the
Pm3 locus (Tommasini et al. 2006). In multiple studies, these markers identified
desirable alleles in the US and European wheat cultivars (Peusha et al. 2008; Chen
et al. 2009; Lillemo et al. 2010; Mohler et al. 2011). However, their use for identi-
fication of alleles in Chinese wheats is restricted due to the susceptibility of the all
seven alleles in China. The major locus Lr34/Yr18/Pm38 provides durable resis-
tance against many diseases and its usage is encouraged worldwide. The functional
markers developed by Lagudah et al. (2009) are very simple to apply due to their
easy resolution on agarose gels. This marker provided positive association between
stripe rust and marker data on a wide array of wheat lines developed at CIMMYT
(Wu et al. 2010). In another study on Chinese landraces, this marker showed the
presence of Lr34/Yr18/ Pm38 allele in 82.1 % genotypes. However, 25 % of these
genotypes were found susceptible to stripe rust in field (Wu et al. 2010). The sus-
ceptibility of landraces with positive Lr34/Yr18/ Pm38 allele is proposed due to
the presence of inhibitor genes or absence of a functional gene that is essential in
the biosynthetic pathway for the expression of Lr34/Yr18/Pm38. For more than a
decade, the T1BL.1RS translocation has been widely used in global wheat breed-
ing programs. Several agronomic features and resistance to diseases are associated
with this translocation, although its resistances to diseases have been overcome in
many locations. Therefore, it is important to identify the T1BL.1RS translocation
in wheat breeding. Functional markers based on the rye secalin gene on 1RS were
successfully applied in breeding (Liu et al. 2008). Another important stripe rust
resistance gene, Yr17 located on chromosome 2NS of T. ventricosum Tausch. has

been translocated to the short arm of bread wheat chromosome 2AS (Helguera et al.
2003), and this chromosomal segment also conferred resistance to leaf rust ( Lr37)
and stem rust (Sr38). The Lr19 gene, originated from decaploid Th. ponticum, was
transferred into durum wheat, and widely conferring resistance to leaf rust in wheat
(Gennaro et al. 2009). Ae. tauschii Cosson was the donor of the Lr21 that is a du-
rable and highly effective leaf rust resistance gene, and it has been incorporated into
wheat cultivar and is available for breeding (Talbert et al. 1994). The leaf rust resis-
tance gene Lr47 confers resistance to a wide spectrum of leaf rust strains. This gene
was recently transferred from chromosome 7S of T. speltoides Tausch to chromo-
some 7A of common wheat (Helguera et al. 2000). Leaf rust resistance gene Lr51,
located within a segment of T. speltoides Tausch chromosome 1S, was translocated
to the long arm of chromosome 1B of bread wheat, which is resistant to the cur-
rent predominant races in USA (Helguera et al. 2005). The gene-specific markers
Xucw108 and Xuhw89 for Gpc-B1 and Yr36 originated from chromosome 6BS of
T. turgidum ssp. dicoccoides. They were identified and validated in a collection of
117 cultivated tetraploid and hexaploid wheat germplasm (Uauy et al. 2006).
Molecular Basis of Disease Resistance
It is important to understand the molecular mechanism of disease resistance to

devise sustainable control (Bux et al. 2012b). The earlier findings of Flor (1956)
proposing gene-for-gene hypothesis provided basis for predicting the molecular ba-
sis of disease resistance. The molecular interpretation of Flor’s findings, avirulent
( Avr) genes encode signal transduction that is perceived by the products of plant R
genes, are regarded as foundation concept in disease resistance. The R-gene/aviru-
lence factor complex is thought to instigate a series of signaling cascades leading
to disease resistance. Rapid oxidative bursts, cell wall strengthening, induction of
defense gene expression and rapid cell death at the site of infection are the down-
stream cellular events that confer resistance state (Morel and Dangl 1997). In more
elaborated form, the direct or indirect recognition of pathogen by host ‘R’ genes
lead to a resistance response known as effector-triggered immunity (ETI), which
includes localized programmed cell death (PCD), known as the hypersensitive re-
sponse (HR) which ultimately restrict pathogen growth (Dangl et al. 1996). R gene
proteins serve to recognize pathogen effectors either through direct interaction or as
guards for target molecules and are known to confer resistance to bacteria, viruses,
nematodes, oomycetes, insects, and biotrophic fungi (Martin et al. 2003). Genes for
resistance, their protein products, and underlying mechanism are being investigated
(Hammond-Kosack and Jones 1996). Sufficient progress has been made in these
aspects that will facilitate developing effective control strategies.
Most of the R genes cloned so far, revealed a nucleotide-binding site (NBS)
and a leucine-rich-repeat (LRR) region. These are the most abundant types in
plant species (Meyers et al. 1998). These plant R genes encode proteins that have
a putative amino-terminal signaling domain, a nucleotide binding site and a series

of carboxy-terminal leucine repeats (Meyers et al. 2005). Two different types of
NBS-LRR proteins have been reported. One major class has an amino-terminal
TIR (Toll/interleukin receptor) domain also called TIR-NBS-LRR or TNL proteins.
Other class includes the genes which encode an amino-terminal coiled-coiled motif
(CC-NBS-LRR or CNL proteins). The mechanism of resistance induced by Pm3a
and its other allelic forms in wheat (Feng et al. 2010) and by Pb1 against rice blast
clearly exemplifies that the single amino acid residue at the final position of the ki-
nase-2 motif is the characteristic of coiled-coil (CC) motif while the trytophan (W)
and aspartic acid (D) are the characteristics of TIR-type proteins. The details of the
molecular functions of these protein domains and their interacting partners are still
being established. However, the consistent identification of this class of proteins
across diverse plant species demonstrates that the NBS-LRR genes are a pillar of
plant defense against pathogen. The majority of the R genes in Arabidopsis are TNL
genes; however they have not yet been reported in cereals. In rice, about 1,500 NBS
coding sequences were analyzed and not a single sequence was known to have TIR
binding domain (Zhou et al. 2004).Three leaf rust resistance genes, Lr1, Lr10, Lr21
and one powdery mildew resistance gene, Pmb3b, are known to have CNL type
domain (Feuillet et al. 2003; Huang et al. 2003; Yahiaoui et al. 2004).
Conclusions and Future Prospects
Three areas of prevailing concern that have received enormous attention are global
warming, climate change and food security. Associated with these has been popula-
tion growth with futuristic projections made first at 2025 (8.2 billion) and now for
2050 at 9.2 billion expected to touch 10 billion swiftly by 2055. The three catchy
buzz words above have generated many discussion fora, created a lot of debate and
delivered numerous “smart” ideas as the outcome of various interactive sessions.
However, at the end of the day if we look at national “wheat” based food security
it is doubtful if we are better off now in 2012 than we were a few years before. Our
productivity is not that earth shaking, average national yields in several countries
fluctuate yearly and the yield gap remains as significant as before. The stress con-
straints are more complex and the resolve to adopt a way forward for achieving
promising returns rather feeble. Have we addressed these constraints and can the
outputs be quantified? The trend is negative or on the conservative side “STATIC”
as to progress. The umbrella cover that integrates research/production activities is
non-existent and resources are far from being neatly agglomerated. Taking wheat
in Pakistan as an example we still hover around 25 million tons per acre and mean
yields are not beyond 25–30 maunds. The per hectare figure is estimated at 2.6 t.
Stress constraints still dominate the scene and one wonders if solutions have been
found to allow us to see durability with high value. Problems galore relate to the
three rusts with stem rust the one abused most for personal projection and profes-
sional clout but done with questionable structural quality science. Then come other
attributes like Karnal bunt. Minor diseases like mildew, spot blotch, BYDV, aphids,
loose smut are additive and the environmental limitations imposed by heat, water
and salinity more complex.
Increasing yield per se must receive special attention as we project forward and
for that a holistic strategy is vital that embraces both biotic/abiotic stresses com-
plimented by exploiting targeted yield traits. Details to directly increase yield are
essential to have and it is prudent to be aware how we can get more per unit area
through focused research strategies. Crucial will be “food” security that emanates
from gene and varietal deployment. The tools are there in enormous untapped close
and distant genomic diversity mines, large spikes, 1,000 grain weight, photosyn-
thetic efficiency, root profile, various phenology parameters and efficient technolo-
gies that should be exploited for practical benefit. Advocates of food security must
set targets stringently and implement. The vision 2050 is excellent if we prepare
ourselves accordingly to combat those challenges by on ground outputs that capture
the wide expanses of allele rich diversity resources. Paramount would be holistic
strategies that maintain good multidisciplinary balance, embrace integration, ex-
ploit the conventional resources, selectively tap the high technology inputs, deliver
products that can redefine the output limits that currently exist and have built in du-
rability that can sustain the produce within the national boundaries and also protect
us from the vagrancies of pathogenic migrations via environmental means.
Turbulent environmental scenarios will necessitate researchers to harness genes
from close and distant species resources distributed within the three Triticeae gene
pools and utilize efficient technologies that can add efficiency to delivering varietal
output products in a swift manner. Efforts will rely more on the primary gene pool
species and accessions but not refrain to exploit those forms that are removed and
placed in the tertiary pool. Multiple stresses will be the order of research focus ad-
dressed through multidisciplinary research protocols mediated by novel techniques
that add efficiency to breeding like limited backcrossing, selected modified bulk,
doubled haploidy for rapid homozygosity at earlier segregating generations (prefer-
ably F3), molecular diagnostics (marker assisted selection, gene pyramiding, choice
of linked genes and markers) that are allele specific correlated with agronomic prac-
tices that maximize production targets that fall under crop management.
True that research is the major factor of providing food security but we can safe-
ly say that management can provide faster returns if its cohesive structure is handled
astutely to maximize production via “IMPLEMENTATION” of major contributing
strategies. Objectivity has to guide progress with “creativity” being the pivotal word
in which “diversity” takes the lead for biotic stresses across all wheat genomic
levels. Integration of all available technologies shall be essential to cope with the
projected population increases that will be dictated by availability of practical out-
puts (varieties) that have built in stability for agricultural sustainability on farmers
fields by agglomeration of genes that offer disease resistance durability that can
tackle the volatile dynamic nature of the pathogenic interplay as well as possessing
abiotic tolerance for traits that have a static system and thus generally have a longer
performance tolerance life. For biotic stresses and use of genomic resources for im-
provement the diversity combination permutations are excessive and offer abundant
options for stabilizing wheat varietal profiles for continued wheat global productiv-
ity. The reliance on conventionally available variation within wheat cultivars across
its spring, winter and facultative habits will persist, but the course ahead for adding
unique variations will increase. The forms of closer D genome affinity or homology
receiving greater attention currently (Ogbonnaya et al. 2013) shall be complimented
by a significant shift that shall exploit the other two genomes and the tertiary gene
pool species (Mujeeb-Kazi et al. 2008b). With all pre-breeding and breeding efforts
working in tandem across multiple disciplines aided by molecular diagnostics and
efficient crop production technologies that fit the “holistic” production strategies
we end this presentation optimistically by projecting that the approximately 2 % an-
nual increase required to feed the growing populace is within our grasp.
References
Aggarwal R, Gupta S, Banerjee S, Singh VB (2011) Development of a SCAR marker for detection
of Bipolaris sorokiniana causing spot blotch of wheat. Can J Microbiol 57:934–942
Alonso LC, Kimber G (1984) Use of restitution nuclei to introduce alien genetic variation into
hexaploid wheat. Z Pflanzenzücht 92:185–189
Arif MA, Bux H, Gul-Kazi A, Rasheed A, Napar AA, Riaz A, Mujeeb-Kazi A (2012) Stripe rust
analysis of D-genome synthetic wheats (2n = 6x = 42; AABBDD) and their molecular diversity.
Arch Phytopathol PFL. doi:10.1080/03235408.2012.677492
Bennett FGA (1984) Resistance to powdery mildew in wheat: a review of its use in agriculture and
breeding programmes. Plant Pathol 33:279–300
Buloichik AA, Borzyak VS, Voluevich EA (2008) Influence of alien chromosomes on the resis-
tance of soft wheat to biotrophic fungal pathogens. Cytol Genet 42:9–15
Bux H, Ashraf M, Chen XM (2012a) Expression of high temperature adult plant (HTAP) resis-
tance against stripe rust ( Puccinia striiformis f.sp.tritici) in Pakistan wheat landraces. Can J
Plant Pathol 34:68–74
Bux H, Ashraf M, Rasheed A, Dipak SP, Kazi AG, Afzaal M (2012b). Molecular basis of disease
resistance in cereal crops: an overview. In: Ashraf M, Öztürk M, Ahmad MSA, Aksoy A (eds)
Crop production for agriculture improvement. Springer, pp 477–489. doi:10.1007/978–94-
007–4116-4_18
Chen XM (2005) Epidemiology and control of stripe rust on wheat ( Puccinia striiformis f. sp.
tritici) on wheat. Can J Plant Pathol 27:314–337
Chen YH, Hunger RM, Carver BF, Zhang HL, Yan LL (2009) Genetic characterization of powdery
mildew resistance in U.S. hard winter wheat. Mol Breeding 24:141–152
Coghlan A (2006) Synthetic wheat offers hope to the world. New Scientist. On line report on 11
Feb 2006
Cox TS, Hatchett JH, Gill BS, Raupp WJ, Sears RS (1990) Agronomic performance of hexaploid
wheat lines derived from direct crosses between wheat and Aegilops squarrosa. Plant Breeding
105:271–277
Cox TS, Harrell LC, Chen P, Gill BS (1991) Reproductive behavior of hexaploid/diploid wheat
hybrids. Plant Breeding 107:105–118
Dangl JL, Dietrich RA, Richberg MH (1996) Death don’t have no mercy: cell death programs in
plant-microbe interactions. Plant Cell 8:1793–1807
Dewey DR (1984) The genomic system of classification as a guide to intergeneric hybridization
with the perennial Triticeae. In: Gustafsson JP (ed) Gene manipulation in plant improvement,
16th Stadler Genetics Symposium, Plenum Press, New York, pp 209–279
Dubin HJ, Brennan JP (2009) Combating stem and leaf rust of wheat. IFPRI Discussion Paper
00910, November 2009, pp 1–53
Farrar W (1904) Some notes on the wheat “Bobs”; its peculiarities, economic value, and origin.
Agric Gaz NSW 15:849–854
Feng DS, Ma X, Lin AL, Wang HG, Tian JC (2010) Isolation of resistance gene analogues to
powdery mildew resistance sequences in hexaploid wheat. Biologia Plantarum 54(3):551–555
Feuillet C, Travella S, Stein N, Albar L, Nublat A, Keller B (2003) Map-based isolation of the leaf
rust disease resistance gene Lr10 from the hexaploid wheat ( Triticum aestivum L.) genome.
Proceedings National Academy Sciences 100:15253–15258
Flor H (1956) The complementary genic systems in fl ax and fl ax rust. Adv Genet 8:29–54
Friebe B, Jiang J, Raupp WJ, McIntosh RA, Gill BS (1996) Characterization of wheat-alien trans-
locations conferring resistance to diseases and pests: current status. Euphytica 91:59–87
Gennaro A, Koebner RMB, Ceoloni C (2009) A candidate for Lr19, an exotic gene conditioning
leaf rust resistance in wheat. Functional Integr Genomics 9:325–334
Gill BS, Raupp WJ (1987) Direct gene transfers from Aegilops squarrosa L. to hexaploid wheat.
Crop Sci 27:445–450
Gill BS, Raupp WJ, Sharma HC (1986) Resistance in Aegilops squarrosa to wheat leaf of rust,
wheat powdery mildew, greenbug, and Hessian fly. Plant Dis 70:553–556
Griffey CA, Das MK, Stromberg EL (1993) Effectiveness of adult-plant resistance in reducing
grain yield loss to powdery mildew in winter wheat. Plant Dis 77:618–622
Gul-Kazi A, Rasheed A, Mahmood T, Mujeeb-Kazi A (2012) Molecular and morphological diver-
sity with biotic stress resistances of high 1000-grain weight synthetic hexaploid wheats. Pak J
Bot 44:1021–1028
Hammond-Kosack KE, Jones JDG (1996) Inducible plant defense mechanisms and resistance
gene function. Plant Cell 8:1773–1791
Helguera M, Khan IA, Dubcovsky J (2000) Development of PCR markers for wheat leaf rust
resistance gene Lr47. Theor Appl Genet 101;625–631
Helguera M, Khan IA, Kolmer J, Lijavetzky D, Zhong-qi L, Dubcovsky J (2003) PCR assays for
the Lr37-Yr17-Sr38 cluster of rust resistance genes and their use to develop isogenic hard red
spring wheat lines. Crop Sci 43:1839–1847
Helguera M, Vanzetti L, Soria M, Khan IA, Kolmer J, Dubcovsky J (2005) PCR markers for Triti-
cum speltoides leaf rust resistance gene Lr51 and their use to develop isogenic hard red spring
wheat lines. Crop Sci 45:728–734
Heun M, Fischbeck G (1987) Identification of wheat powdery mildew resistant genes by analyzing
host-pathogen interactions. Plant Breeding 98:124–129
Hodson DP (2011) Shifting boundaries: challenges for rust monitoring. Euphytica 179:93–104
Hodson DP, Singh RP, Dixon JM (2005) An initial assessment of the potential impact of stem rust
(race UG99) on wheat producing regions of Africa and Asia using GIS. Abstracts of the 7th
International Wheat Conference, Mar Del Plata, p 142
Hsam SLK, Zeller FJ (2002). Breeding for powdery mildew resistance in common wheat (T. aes-
tivum L. em Thell.). In: Belanger RR, Bushnell WR, Dik AJ, Carver TLW (eds) The powdery
mildews: a comprehensive treatise, APS Press, St. Paul, pp 219–238
Hsam SLK, Lapochkina IF, Zeller FJ (2003) Chromosomal location of genes for powdery mildew
resistance in common wheat ( Triticum aestivum L. em Thell.). 8. Gene Pm32 in a wheat-
Aegilops speltoides translocation line. Euphytica 133:367–370
Hua W, Liu Z, Zhu J, Xie C, Yang T, Zhou Y, Duan X, Sun Q, Liu Z (2009) Identification and ge-
netic mapping of Pm42, a new recessive wheat powdery mildew resistance gene derived from
wild emmer ( Triticum turgidum var. dicoccoides). Theor Appl Genet 119: 223–230
Huang L, Brooks SA, Li WL, Fellers JP, Trick HN, Gill BS (2003) Map-based cloning of leaf
rust resistance gene Lr21 from the large and polyploidy genome of bread wheat. Genetics
164:655–664
Islam AKMR, Shepherd KW, Sparrow DHB (1978) Production and characterization of wheat-bar-
ley addition lines. Proceedings of 5th International Wheat Genetics Symposium, New Delhi,
pp 365–371
Islam AKMR, Shepherd KW, Sparrow DHB (1981) Isolation and characterization of euplasmic
wheat-barley chromosome addition lines. Heredity 46:161–174
Jia JZ (1996) RFLP-based maps of the homoeologous group-6 chromosomes of wheat and their
application in the tagging of Pm12, powdery mildew resistance gene transferred from Aegilops
speltoides to wheat. Theor Appl Genet 92:559–565
Jiang J, Friebe B, Gill BS (1994) Recent advances in alien gene transfer in wheat. Euphytica
73:199–212
Joshi AK, Azab M, Mossad M, Moselhy M, Osmanzai M, Gelalcha S, Bedada G, Bhatta MR,
Hakiom A, Malakar PK, Haque ME, Tiwari TP, Majid A, Kamal MRJ, Bishaw Z, Singh RP,
Payne T, Braun HJ (2011) Delivering rust resistant wheat to farmers: a step towards increased
food security. Euphytica 179:187–196
Kazi AG (2011) Utilization of Triticeae gene pool diversity for wheat improvement. PhD disserta-
tion, Quaid-i-Azam University, Islamabad, pp 1–240
Kema GHJ (1992) Resistance in spelt wheat to yellow rust I. Formal analysis and variation for
gliadin patterns. Euphytica 63:207–217
Kimber G, Feldman M (1987) Wild wheat. An introduction. Special Report 353, College of Agri-
culture, University of Missouri, Columbia, USA
Kruse A (1967) Intergeneric hybrids between Hordeum vulgare L. ssp. Distichum (v. Pallas,
2 = 14) and Secale cereale L. (v. Petkus, 2n = 14). Royal Veterinary Agricultural College Year-
book 1967. Copenhagen, pp 82–92
Kruse A (1969) Intergeneric hybrids between Triticum aestivum L. (v. Koga II. 2 = 42) and Avena
sativa L. (v. Stal., 2n = 42) with pseudogamous seed formation. Royal Veterinary Agricultural
College Yearbook 1969. Copenhagen, pp 188–200
Kruse A (1973) Hordeum x Triticum hybrids. Hereditas 73:157–161
Kruse A (1974) Hordeum vulgare ssp. distichum (var Bomi) x Triticum aestivum (var. Koga). An
F1 hybrid with generative seed formation. Hereditas 78:319
Kuraparthy V, Chunneja P, Dhaliwal HS, Kaur S, Bowden RL, Gill BS (2007) Characterization
and mapping of cryptic alien introgression from Aegilops geniculata with new leaf rust and
stripe rust resistance genes Lr57 and Yr40 in wheat. Theor Appl Genet 114:1379–1389
Lagudah ES, Krattinger SG, Herrera-Foessel S, Singh RP, Huerta-Espino J, Spielmeyer W, Brown-
Guedira G, Selter LL, Keller B (2009) Gene-specific markers for the wheat gene Lr34/Yr18/
Pm38 which confers resistance to multiple fungal pathogens. Theor Appl Genet 119:889–898
Lillemo M, Skinnes H, Brown JKM (2010) Race specific resistance to powdery mildew in Scan-
dinavian wheat cultivars, breeding lines and introduced genotypes with partial resistance. Plant
Breeding 129:297–303
Liu Z, Sun Q, Yang T (1999) Development of SCAR markers linked to the Pm21 gene conferring
resistance to powdery mildew in common wheat. Plant Breeding 118:215–219
Liu Z, Sun Q, Ni Z, Nevo E, Yang T (2002) Molecular characterization of a novel powdery mildew
resistance gene Pm30 in wheat originating from wild emmer. Euphytica 123:21–29
Liu C, Yang ZJ, Li GR, Zeng ZX, Zhang Y, Zhou JP, Liu ZH, Ren ZL (2008) Isolation of a new re-
petitive DNA sequence from Secale africanum enables targeting of Secale chromatin in wheat
background. Euphytica 159:249–258
Liu Y, He Z, Appels R, Xia X (2012) Functional markers in wheat: current status and future pros-
pects. Theor Appl Genet 125:1–10
Mago R, Bariana HS, Dundas IS, Speilmeyer W, Lawrence GJ, Pryor AJ (2005) Development of
PCR markers for the selection of wheat stem rust resistance genes Sr24 and Sr26 in diverse
wheat germplasm. Theor Appl Genet 111:496–504
Mains EB (1933). Host specialization of Erysiphe graminis tritici. Proc Natl Acad Sci 19:49–53
Marais GF, McCallum B, Snyman JE, Pretorius ZA, Marais AS (2005) Leaf rust and stripe rust
resistance genes Lr54 and Yr37 transferred to wheat from Aegilops kotschyi. Plant Breeding
124:538–541
Marais F, McCallum B, Marais A (2006) Leaf rust and stripe rust resistance genes derived from
Triticum sharonense. Euphytica 149:373–380
Marais F, Marais A, McCallum B, Pretorius Z (2009) Transfer of leaf rust and stripe rust resistance
genes Lr62 and Yr42 from Aegilops neglecta Req. ex Bertol. to common wheat. Crop Sci
49:871–879
Martin GB, Bogdanove AJ, Sessa G (2003) Understanding the functions of plant disease resistance
proteins. Annu Rev Plant Biol 54:23–61
McIntosh RA, Yamazaki Y, Devos KM, Dubcovsky J, Rogers WJ, Appels R (2003) Catalogue of
gene symbols for wheat. In: Pogna NE, Romano M, Pogna EA, Galterio G (eds) Proceedings
of the 10th International Wheat Genetics Symposium, Vol. 4, associated CD-Rom, pp 1–34,
McIntosh RA, Yamazaki Y, Dubcovsky J, Rogers J, Morris F, Somers DJ, Appels R, Devos KM
(2010) Catalog of gene symbols for wheat. MacGene. http://www.shigen.nig.ac.jp/wheat/ko-
mugi/genes/download.jsp. Accessed 25 Mar 2013
Meyers BC, Chin DB, Shen KA, Sivaramakrishnan S, Lavelle DO, Zhang Z, Mitchelmore RW
(1998) The major resistance gene cluster in lettuce is highly duplicated and spans several
megabases. Plant Cell 10:1817–1832
Meyers BC, Kaushik S, Nandety RS (2005) Evolving disease resistance genes. Curr Opin Plant
Biol 8:129–134
Miedner T, Korzun V (2012) Marker-assisted selection for disease resistance in wheat and barley
breeding. Phytopathology 102:560–566
Miranda LM, Murphy JP, Marshall D, Leath S (2006) Pm34: a new powdery mildew resistance
gene transferred from Aegilops tauschii Coss. to common wheat ( Triticum aestivum L.). Theor
Appl Genet 113:1497–1504
Miranda LM, Murphy JP, Marshall D, Cowger C, Leath S (2007) Chromosomal location of Pm35,
a novel Aegilops tauschii derived powdery mildew resistance gene introgressed into common
wheat ( Triticum aestivum L.). Theor Appl Genet 114:1451–1456
Mirza JI, Ahmed I, Khanzada KA, Ahmed N, Rattu A, Fayyaz M, Ahmad Y, Harkro AA, Mujeeb-
Kazi A (2010) Local stem rust virulence in Pakistan and future breeding strategy. Pak J Bot
43(3):1999–2009
Mohler V, Bauer A, Bauer C, Flath K, Schweizer G, Hartl L (2011) Genetic analysis of powdery
mildew resistance in German winter wheat cultivar Cortez. Plant Breeding 130:35–40
Morel J, Dangl JL (1997) The hypersensitive response and the induction of cell death in plants.
Cell Death Differ 4:671–683
Mujeeb-Kazi A (2003) Wheat improvement facilitated by novel genetic diversity and in vitro tech-
nology. Plant Cell, Tissue and Organ Culture. 13:179−210
Mujeeb-Kazi A (2005) Wide crosses for durum wheat improvement. In: Roya C, Nachit MN,
Difonzo N, Araus JL, Pfeiffer WH, Slafer GA (eds) Durum wheat breeding: Current approach-
es and future strategies. The Haworth Press Inc., pp. 703−743
Mujeeb-Kazi A (2006) Utilization of genetic resources for bread wheat improvement. In: Singh
RJ, Jauhar PP (eds) CRC Series, pp 61–97
Mujeeb-Kazi A, Asiedu R (1990) Wide hybridization—potential of alien genetic transfers for
Triticum aestivum improvement. In: Bajaj YPS (ed) Biotech in agriculture and forestry, Vol
13, Wheat, pp 111–127
Mujeeb-Kazi A, Hettel GP (1995) Utilizing wild grass biodiversity in wheat improvement:15 years
of wide cross research at CIMMYT. CIMMYT Report 2, pp 1–140
Mujeeb-Kazi A, Kimber G (1985) The production, cytology and practicality of wide hybrids in the
Triticeae. Cereal Res Commun 13:111–124
Mujeeb-Kazi A, Roldan S, Suh DY, Sitch LA, Farooq S (1987) Production and cytogenetic analy-
sis of hybrids between Triticum aestivum and some caespitose Agropyron species. Genome
29:537–553
Mujeeb-Kazi A, Roldan S, Suh DY, Ter-Kuile N, Farooq S (1989) Production and cytogenetics
of Triticum aestivum L. hybrids with some rhizomatous Agropyron species. Theor Appl Genet
77:162–168
Mujeeb-Kazi A, Rosas V, Roldán S (1996a) Conservation of the genetic variation of Triticum
tauschii (Coss.) Schmalh. ( Aegilops squarrosa auct. non L.) in synthetic hexaploid wheats
( T. turgidum L. s. lat. X T. tauschii; 2n = 6x = 42, AABBDD) and its potential utilization for
wheat improvement. Genet Resour Crop Evol 43:129–134
Mujeeb-Kazi A, Villareal RL, Gilchrist LI, Rajaram S (1996b) Registration of five wheat germ-
plasm lines resistant to Helminthosporium leaf blight. Crop Sci 36:216–217
Mujeeb-Kazi A, Gilchrist LI, Villareal RL, Delgado R (2000) Registration of ten wheat germplasm
lines resistant to Septoria tritici leaf blotch. Crop Sci 40:590–591
Mujeeb-Kazi A, Cano S, Rosas V, Cortes A, Delgado R (2001a) Registration of five synthetic
hexaploid wheat and seven bread wheat germplasm lines resistant to wheat spot blotch. Crop
Sci 41:1653–1654
Mujeeb-Kazi A, Fuentes-Davila G, Villareal RL, Cortes A, Rosas V, Delgado R (2001b) Registra-
tion of 10 synthetic hexaploid wheat and six bread wheat germplasms resistant to karnal bunt.
Crop Sci 41:1652–1653
Mujeeb-Kazi A, Delgado R, Cortes A, Cano S, Rosas V, Sanchez J (2004) Progress in exploiting
Aegilops tauschii for wheat improvement. Annual Wheat Newsletter 50:79–88
Mujeeb-Kazi A., Fuentes-Davilla G, Gul A, Mirza JI (2006a) Karnal bunt resistance in synthetic
hexaploid wheats (SH) derived from durum wheat x Aegilops tauschii combinations and in
some SH x bread wheat derivatives. Cereal Res Commun 34:1199–1205
Mujeeb-Kazi A, Gul A, Ahmad I, Mirza JI (2006b) A simplified and effective protocol for produc-
tion of bread wheat haploids (n = 3x = 21, ABD) with some application areas in wheat improve-
ment. Pak J Bot 38:393–406
Mujeeb-Kazi A, Gul A, Ahmad I, Farooq M, Rauf Y, Rahman A, Riaz H (2008a) Genetic resources
for some wheat abiotic stress tolerances. In: Ashraf M, Ozturk M, Athar HR (eds) Salinity and
water stress: improving crop efficiency, Springer, pp 149–163
Mujeeb-Kazi A, Gul A, Farooq M, Rizwan S, Ahmad I (2008b) Rebirth of synthetic hexaploids
with global implications for wheat improvement. Aust J Agric Res 59:391–398
Mujeeb-Kazi A, Kazi AG, Dundas I, Rasheed A, Chen P, Kishi M, Bonnett D, Wang RRC, Bux H,
Farrakh S (2013) Genetic diversity for wheat improvement as a conduit for food security. In:
Donald Sparks (eds) Advances in Agronomy (in press)
Murphy JP, Leath S, Huynh D, Navarro RA, Shi A (1998) Registration of NC96BGTD1, NC96B-
GTD2, and NC96BGTD3 wheat germplasm resistant to powdery mildew. Crop Sci 38:570
Ogbonnaya FC, Abdalla O, Mujeeb-Kazi A, Kazi AG, Xu SS, Gosman N, Lagudah ES, Bonnett D,
Sorrells ME (2013) Synthetic hexaploid in wheat improvement. In: Janick J (ed) Plant Breed-
ing Reviews (in press)
Olivera PD, Kolmer JA, Anikster Y, Steffenson BJ (2007) Resistance of Sharon goatgrass ( Aegil-
ops sharonensis) to fungal diseases of wheat. Plant Dis 91:942–950
Peusha H, Enno T, Jakobson I, Tso˜mbalova J, Ingver A, Järve K (2008) Powdery mildew resis-
tance of Nordic spring wheat cultivars grown in Estonia. Acta Agric Scand Sect B-Soil Plant
Sci 58:289–296
Pretorius ZA, Singh RP, Wagoire WW, Payne TS (2000) Detection of virulence to wheat stem rust
resistanceJ gene Sr31 in Puccinia graminis f. sp. tritici in Uganda. Phytopathology 84–203
Pretorius ZA, Jin Y, Bender CM, Herselman L, Prins R (2012) Seedling resistance to stem rust race
UG99 and marker analysis for Sr2, Sr24 and Sr31 in South African wheat cultivars and lines.
Euphytica 186:15–23
Qi LL, Pumphery MO, Friebe B, Zhang P, Qian C, Bowden RL, Rouse MN, Jin Y, Gill BS (2011)
A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene ( Sr52)
effective against race UG99 from Dasypyrum villosum into bread wheat. Theor Appl Genet
123:159–167
Qiu YC, Sun XL, Zhou RH, Kong XY, Zhang SS, Jia JZ (2006) Identification of microsatel-
lite markers linked to powdery mildew resistance gene Pm2 in wheat. Cereal Res Commun
34:1267–1273
Rafiq K, Rasheed A, Gul-Kazi A, Bux H, Naz F, Mahmood T, Mujeeb-Kazi A (2012) Powdery mil-
dew resistance in some new wheat amphiploids (2n = 6x = 42) derived from A- and S-genome
diploid progenitors. Plant Genet Resour. doi:10.1017/S1479262112000202
Randhawa HS, Mutti JS, Kidwell K, Morris CF, Chen XM (2009) Rapid and targeted introgression
of genes into popular wheat cultivars using marker assisted background selection. PLoS ONE
4(6):1–11 (e5752)
Ren Q, Liu H, Zhang Z, Feng J, Xu S, Zong-jun PU, Zhi-yong XIN (2012) Characterization and
molecular mapping of a stripe rust resistance gene in synthetic wheat CI110. J Integr Agric
11:521–527
Reynolds MP, Borlaug NE (2006) Applying innovations and new technologies from international
collaborative wheat improvement. J Agr Sci 144:95–110
Riera-Lizarazu O, Mujeeb-Kazi A (1990) Maize ( Zea mays L.) mediated wheat ( Triticum aestivum
L.) polyhaploid production using various crossing methods. Cereal Res Commun 18:339–345
Riley R, Chapman V, Johnson R (1968) Introduction of yellow rust resistance of Aegilops comosa
into wheat by genetically induced homoeologous recombination. Nature 217:383–384
Rimpau W (1891) Kreuzungsprodukte landwirtschaftlicher Kulturpflanzen. Landwirtschaftl Jahrb
20:335–371
Rizwan S, Ahmad I, Ashraf M, Sahi GM, Mirza JI, Rattu AR, Mujeeb-Kazi A (2007) New sources
of wheat yellow rust ( Puccinia striformis f. tritici) seedling resistance. Pak J Bot 39:1207–1216
Rizwan S, Ahmad I, Ashraf M, Mirza JI, Sahi GM, Rattu AR, Mujeeb-Kazi A (2008) Evaluation
of synthetic hexaploid wheats and their durum parents for stripe rust resistance. Rev Mex
Fitopatol 25:152–160
Roder MS, Korzun V, Wendehake K, Plaschke J, Tixier M-H, Leroy P, Ganal M (1998) A micro-
satellite map of wheat. Genetics 149:2007–2023
Rong JK, Millet E, Manisterski J, Feldman M (2000) A new powdery mildew resistance gene:
introgression from wild emmer into common wheat and RFLP-based mapping. Euphytica
115:121–126
Rouse MN, Jin Y (2011) Stem rust resistance in A-genome diploid relatives of wheat. Plant Dis
10:1094 (PDIS,-04–10–0260)
Rouse MN, Olson EL, Gill BS, Pumphery MO, Jin Y (2011) Stem rust resistance in Aegilops taus-
chii germplasm. Crop Sci 51:2074–2078
Shaner G (1973). Evaluation of slow-mildewing resistance of Knox wheat in the field. Phytopa-
thology 63:867–872
Sharma HC (1995) How wide can a wide cross be?. Euphytica 82:43–64
Sharma HC, Gill BS (1983) Current status of wide hybridization in wheat. Euphytica 32:17–31
Shi AN, Leath S, Murphy JP (1998) A major gene for powdery mildew resistance transferred to
common wheat from wild eikorn wheat. Phytopathology 88:144–147
Simonite T (2006) Ancient genetic tricks shape up wheat; turning back the evolutionary clock of-
fers better crops for dry regions. Nature. On line reporting on Jan. 03, 2006
Singh RP, Nelson JC, Sorrells ME (1998) Mapping Yr28 and other genes for resistance to stripe
rust in wheat. Crop Sci 40:1148–1155
Singh RP, William HM, Huerta-Espino J, Rosewarne G (2004) Wheat rust in Asia: meeting the
challenges with old and new technologies. New dimensions for a diverse planet, Proceedings
of the 4th International Crop Science Congress, 26 Sep–1 Oct 2004, Brisbane
Singh RP, Hodson DP, Jin Y, Huerta-Espino J, Kinyua MG, Wanyera R, Njau P, Ward RW (2006)
Current status, likely migration and strategies to mitigate the threat to wheat production from
race Ug99 (TTKS) of stem rust pathogen. CAB reviews: perspectives in Agriculture, Veteri-
nary Science, Nutrition and Natural Resources No. 054. pp 1–13
Singh RP, Hodson DP, Huerta-Espino J, Jin Y, Njau P, Wanyera R, Herrara-Foessel S, Ward R
(2008) Will stem rust destroy the world’s wheat crop? Adv Agron 98:271–309
Singh RP, Hodson DP, Huerta-Espino J, Jin Y, Bhavani S, Njau P, Herrara-Foessel S, Singh PK,
Singh S, Govindan V (2011a) The emergence of UG99 races of the stem rust fungus is a threat
to world wheat production. Annu Rev Phytopathol 49:465–481
Singh RP, Huerta-Espino J, Bhavani S, Herrara-Foessel S, Jin Y, Njau P, Singh PK, Velu G, Singh
S, Pena RJ, Crossa J (2011b) High yielding CIMMYT spring wheats with resistance to UG99
and other rusts developed through targeted breeding. BGRI Technical Workshop, 13–16 June,
St. Paul, pp 98–104
Starling TM, Roane CW, Camper HM (1984). Registration of Massey wheat. Crop Sci 24:1000
(Tenth International Wheat Genetics Symposium, Paestum. pp 772–774)
Sukhwinder-Singh, Hernandez MV, Crossa J, Singh PK, Bains NS (2012) Multi-trait and multi-
environment QTL analyses for resistance to wheat diseases. PLoS ONE 7(6):e38008
Talbert LE, Blake NK, Chee PW, Blake TK, Magyar GM (1994) Evaluation of ‘sequence-tagged-
site’ PCR products as molecular markers in wheat. Theor Appl Genet 87:789–794
Tommasini L, Yahiaoui N, Srichumpa P, Keller B (2006) Development of functional markers spe-
cific for seven Pm3 resistance alleles and their validation in the bread wheat gene pool. Theor
Appl Genet 114:165–175
Trethowan RM, Mujeeb-Kazi A (2008) Novel germplasm resources for improving environmental
stress tolerance of hexaploid wheat. Crop Science 48:1255–1265
Trethowan RM, Van-Ginkel M (2009) Synthetic wheat—an emerging genetic resource. In: Carver
B (ed) Wheat science and trade. Chapter 16. Wiley-Blackwell, Iowa, pp 369–386
Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006) A NAC gene regulating senescence
improves grain protein, zinc, and iron content in wheat. Science 314:1298–1301
Valkoun J (2001) Wheat pre-breeding using wild progenitors. Euphytica 119:17–23
Villareal RL, Mujeeb-Kazi A, Fuentes-Davila G, Rajaram S (1996) Registration of four synthetic
hexaploid wheat germplasm lines derived from Triticum turgidum x T. tauschii crosses and
resistant to karnal bunt. Crop Sci 36:218–220
Wang RR-C (1989) Intergeneric hybrids involving perennial Triticeae. Genet (Life Sci. Advances)
8:57–64
Wu L, Xia XC, Zhu HZ, Li SZ, Zheng YL, He ZH (2010) Molecular characterization of Lr34/
Yr18/Pm38 in 273 CIMMYT wheat cultivars and lines using functional markers. Sci Agric Sin
43:4553–4561
Xu SS, Jin Y, Klindworth DL, Wang RR-C, Cai X (2009) Evaluation and characterization of seed-
ling resistances to stem rust UG99 races in wheat-alien species derivatives. Crop Sci 49:2167–
2175
Yahiaoui N, Srichumpa P, Dudler R, Keller B (2004) Genome analysis at different ploidy levels
allows cloning of the powdery mildew resistance gene Pm3b from hexaploid wheat. Plant J
37:528–538
Yang W, Liu D, Li J, Zhang L, Wei H, Hu X, Zheng Y, He Z, Zou Y (2009) Synthetic hexaploid
wheat and its utilization for wheat genetic improvement in China. J Genet Genomics 36:539–
546
Zaharieva M, Suenaga K, William HM, Mujeeb-Kazi A (2003) Genetic diversity of synthetic hexa-
ploids with enhanced levels of resistance to Fusarium head scab. Annual Wheat Newsletter
49:73–75
Zeller FJ (1973) 1B/1R wheat-rye chromosome substitutions and translocations. In: Sears ER,
Sears LMS (eds) Proceedings of the 4th International Wheat Genetics Symposium, Columbia,
pp 209–221
Zeller FJ, Kong L, Hartl L, Mohler V, Hsam SLK (2002) Chromosomal location of genes for resis-
tance to powdery mildew in common wheat ( Triticum aestivum L. em. Thell.). 7. Gene Pm29
in line Pova. Euphytica 123:187–194
Zhang JY, Li XM, Wang RR-C, Cortes A, Rosas V, Mujeeb-Kazi A (2002) GISH, AFLP, and
RAPD characterization of Eb-genome chromosomes in five Thinopyrum bessarabicum diso-
mic addition lines of bread wheat. Int J Plant Sci 163:167–174
Zhou T, Wang Y, Chen J, Araki H, Jing Z, Jiang K, Shen J, Tian D (2004) Genome-wide identi-
fication of NBS genes in japonica rice reveals significant expansion of divergent non- TIR
NBS—LRR genes. Mol Gen Genet 271:402–415
Zhu Z, Zhou R, Kong X, Dong Y, Jia J (2006) Microsatellite marker identification of a Triticum
aestivum-Aegilops umbellulata substitution line with powdery mildew resistance. Euphytica
150:149–153
Chapter 8
Variability in Fusarium species Causing Wilt
Disease in Crops: A Transcriptomic Approach
to Characterize Dialogue Between Host and
Pathogen
Reiaz ul Rehman, Khalid Rehman Hakeem, Inayatullah Tahir,

Bilal Ahmad Padder, Mehraj ul Din Shah and Mushtaq Ahmad Teli
Abstract Crops are indispensible for the existence of humans and animals and the
commercial importance comes under threat when they are attacked and infected
by the pathogens. The crops are constantly under threat and are exposed to various
pathogens. Some pathogens are host specific and thus can infect the healthy plant
and some of them are opportunists, which gain entry from the wounding site. The
most important and devastating among the pathogens are the fungal pathogens and
important amongst these is Fusarium sp. This genus contains many species attack-
ing diversity of agricultural crops. These are pathogenic to plants and also produce
toxins, which affect the animals and humans consuming the plants. This review
focuses on the pathogenesis of Fusarium sp. causing crop diseases and understand-
ing the host-pathogen interactions including plant defense responses. This article
perceives the potential of transcriptomics in association between two-species. The
R. ul Rehman () · K. R. Hakeem

P.G Programme in Bioresources, Department of Botany, University of Kashmir,
Srinagar 190006, India
K. R. Hakeem
I. Tahir
Department of Botany, University of Kashmir, Srinagar 190006, India
B. A. Padder · M. ul Din Shah · M. A. Teli
Division of Plant Pathology, SKAUST-K, Srinagar 191121, India
M. ul Din Shah
M. A. Teli

270 R. ul Rehman et al.
identified association between species (crops and microbes ( Fusarium sp.) can
reveal processes which can be exploited beneficially for applications in biotechnol-
ogy. Specifically, we address the question how the new knowledge gained from
transcriptomic approaches and analyses of interactions between plants and disease
causing microbes ( Fusarium) can be exploited in ways that will ultimately lead to
crop improvement by development of crop cultivars that are productive under mul-
tiple environmental pressures.
Introduction
The genus Fusarium consists of species that attack almost all food crops. Out of
101 most economically important plants, at least 81 are hosts of Fusarium sp.
(Table 8.1) (Nayaka et al. 2011). The Fusarium spp are responsible for various
diseases among live-stocks and humans and these diseases are ascribed to myco-
toxins produced by these fungi belong to secondary metabolites (Table 8.2). The
diseases caused by Fusarium spp have had several major economic impacts around
the world in time and resulted in loss of billions of dollars. So, due to their economic
importance Fusarium spp are being used as models for various biological and mor-
phological studies. Plant pathogenic fungi show variability as they are known to
contain a considerable number of sub-species/formae specialis or strains, which are
almost morphologically identical but they may have quite different infection capac-
ity on their hosts (Nayaka et al. 2011). This variability in pathogenic populations
results in variation in host resistance (Leilani et al. 2006). Thus, degree of varia-
tions among plant pathogens are must for understanding the pathogen as well as
the disease they cause. The amount of pathogen variation may have a direct impact
on its biological activity and its role in the environment (Zabalgogeazcoa 2008).
The variations may occur at any stage of growth leading to changes in morphology
that determine its host range, inoculum potential, infectivity, and virulence (Parker
and Gregory 2004). Therefore, it is relevant to monitor pathogen populations for
shift in virulence with changes in environmental factors and host cultivar(s). Hence,
the variability studies within and between pathogenic populations from different
geographical regions is essential for selection of resistant genotypes in breeding
programs that aim at developing resistant varieties.
Crop Productivity for Food Security
The Environment has a role in limiting the plant productivity due to biotic and abi-
otic stresses, e.g. most or all the existing crops can be significantly affected by dis-
eases and have reduced productivity in terms of yield and quality. The prevention of
diseases by conventional breeding to yield resistant crops is most effective (Akhond
and Machray 2009; Gust et al. 2010) and is said to be the environmentally friendly
8 Variability in Fusarium species Causing Wilt Disease in Crops … 271
Table 8.1 Important Fusarium diseases in major food crops

Pathogen Host plant Disease
Fusarium spp. Barley Scab/head blight
Fusarium graminearum
Fusarium avenaceum
Fusarium culmorum
Fusarium nivale
Fusarium verticillioides Corn Kernel, root and stalk rot, seed rot, seedling blight
Fusarium avenaceum
Fusarium subglutinans
Fusarium culmorum
Fusarium oxysporum
Fusarium poae
Fusarium solani
Fusarium pallidoroseum
Fusarium verticillioides Millets Head mold/top rot
Fusarium spp.
Fusarium verticillioides Paddy Root rots/seedling blight/bakanae disease
Fusarium fujikuroi
Fusarium proliferatum
Fusarium spp.
Fusarium verticillioides Sorghum Fusarium head blight, root and stalk rot
Fusarium spp.
Fusarium subglutinans
Fusarium spp. Wheat Crown rot/foot rot, seedling blight, root rot
Fusarium
pseudograminearum
Fusarium avenaceum
Fusarium culmorum
Fungal names according to http://www.indexfungorum.org/
and responsible approach to disease prevention as opposed to the indiscriminate

use of pesticides. The other environmentally sensible approach is to understand
and utilize the biotic and abiotic environment of the plant and develop sustainable
disease management strategies. However, the development of management strate-
gies requires in-depth knowledge and understanding of the plant-microbe intimate
interactions with one another in extremely complex environment leading to differ-
ent physiological changes within the plant. Further, more information generation
and knowledge is required to understand the resource utilization within the plant
upon the exposure to the pathogens. The resource management upon exposure to
disease in terms of prioritizing themselves for utilizing in defense mechanisms in-
stead of growth and development to develop the sustainable strategies to improve
upon health of plants and thus agriculture (Schenk et al. 2012).
Table 8.2 Biochemistry of Fusarium mycotoxins
272
Fusarium mycotoxins Toxicity mechanism Toxicity Examples Main enzyme

Trichothecenes (biosynthe- Inhibition of protein Alimentary Toxic Aleukia Diacetoxyscirpenol, Trichodiene synthase (Des-
sis: sesquiterpenes) synthesis Akakabi-byo (red mold disease) T-2 toxin, nivale- jardins and Proctor 2007;
swine feed refusal. In humans nol, deoxynivalenol Murphy and Armstrong
promote neoplasms, cause (vomitoxin) 1995; Berek et al. 2001;
autoimmune disease Lindsay 1997)
Eumonisins (biosynthesis: Inhibition of sphingolipid Carcinogenic: Leukoencephalo- Fumonisin B1, a Fumonisin polyketide
polyketides) metabolism malacia (equines) neural tube propane-1,2,3- synthase (Proctor et al.
defects (rodents); pulmonary tricarboxylic diester 2006)
edema (pigs); neural tube of 2-amino-12,16-di-
defects esophageal cancer methyl-3,5,10,14,15-
(human) pentahydroxyicosane
Zearalenones (biosynthesis: Not acutely toxic Non-steroidal estrogenic: Resorcyclic acid lactone Polyketide synthases (Kim
nonaketide precursors) estrogenic syndromes in swine et al. 2005; Gaffoor and
Trail 2006)
Beauvercin and ennia- Non-toxic Non-ribosomal, cyclic D-2-hydroxyisovaleric acid. Enniatin synthetase (Member
tins (biosynthesis: hexadepsipeptides, enniatins: L-amino acids: valine, of non-ribosomal peptide
N-methylated cyclic Enniatin A beauvericin leucine, or isoleucine, synthetase) (Desjardins
hexadepsipeptides) phenylalanine and Proctor 2007)
Butenolide (4-acetamido-4- Moderately toxic Fescue foot (cattle: edema, Cytochrome P450 mono
hydroxy-2-butenoic acid lameness and gangrenous loss oxygenase (Harris et al.
lactone) of extremities) 2007)
Equisetin N-methyl- Activity against human Activity against human Polyketide synthase-non-
2,4-pyrollidone immunodeficiency immunodeficiency virus ribosomal peptide
(1-methyl-3-acyl-5-hy- virus, gram-positive synthetase (EQIS) (Sims
droxymethyl-2,4-dione) bacteria et al. 2005)
Fusarins 2-pyrrolidones Mutagenic Non-ribosomal peptide Fusarins A, C, D Hybrid polyketide synthase
(polyketide and TCA) synthetase epidemiologically (Gaffoor et al. 2005)
with human diseases
R. ul Rehman et al.
Plant-Fungi Interaction
The wilting caused by Fusarium is result of various factors guided by host-pathogen

interaction such as recognition of pathogen by plant root, attachment of pathogen
by differentiated structure, penetration of the pathogen to have access to vascular
tissue, adaptation of pathogen within the plant system, the proliferation of fungal
components (hyphae and microconidia) in xylem vessels and lastly the secretion
by the pathogen (proteins and toxins) (Inoue et al. 2002; Di Pietro et al. 2003). The
primary defense response by the host includes the production of gums, tyloses and
gels (Beckman 1987). Thus, there is the need for understanding host-pathogen asso-
ciation in terms of infection process (at molecular level), which would provide the
information about the mechanisms of this interaction. The study of this interaction
will unravel the genes involved in different signaling cascades, which would help
us in identifying genes involved in resistance as well as susceptibility. This kind of
association ( Fusarium-Tomato) study has been recently reported as a model system
for infection process (resistance and susceptibililty) at molecular level (Takken and
Rep 2010). Further, some processes related to mechanisms of infection resistance
have been determined by molecular techniques such as gene silencing or insertion
mutagenesis (Inoue et al. 2002; Di Pietro et al. 2003; Michielse 2009). The knowl-
edge about the infection resistance or susceptibility in agricultural crops would help
us in better understanding about the development of strategies in controlling the
disease factors such as infection responses and progression. For example, mRNA
changes in association (host-pathogen) during the infection process could give in-
formation about the resistance and susceptibility processes (Wise et al. 2007).
Use of DNA Based Markers
The advances and development in molecular biology techniques and its applications
to genetic analysis has led to better understanding in terms of knowledge which has
led to elucidation of behavior and structure of fungal genome. For example, these
advances have helped the fungal taxonomists in identification of isolates more rap-
idly and for determining virulence/toxicity of fungal strains. The advances in mo-
lecular biology led to distinction between species (closely related) having little or no
similarity at the morphological level (Wulff et al. 2010) or strain identification with-
in species (Chandra et al. 2010). And thus by looking for the variation within DNA
sequences, the molecular biology provides the base for precise identification within
and between the species. The Polymerase chain reaction (PCR) based assays are be-
ing employed widely used for identification, diagnosis and characterization of patho-
gens ( Fusarium species) (Doohan et al. 1998). Various PCR based markers are in use
(Nayaka et al. 2011), which has led to the understanding of genetic diversity and
establishing phylogeny among different Fusarium species. The PCR based methods
which have been used to generate sequence information include RFLP, AFLP,
RAPD, SCARs, RT-PCR, SNPs, microarrays, pyrosequencing, DNA barcoding and

many more and this has led to gene function determination in fungi (Nayaka et al.
2011). The DNA microarrays and next-generation sequencing techniques have
helped greatly in genome-wide expression, but in these cases known collection of
transcript sequences must be readily available (Roh et al. 2010). However, in com-
parison with above tools, the method of choice for gene discovery (identifying tran-
scripts) in plant-microbe interaction remains to be cDNA-AFLP (Vuylsteke et al.
2007; Gupta et al. 2009). The cDNA-AFLP technique has been used to study the
interaction between the Fusarium pathogens and the plant hosts, e.g. Fusarium in-
teraction with host Cucumis melo through the analysis of differentially expressed
genes in the vascular colonization by using the approach of cDNA-AFLP (Szafran-
ska et al. 2008; Sestili et al. 2011). In the species other than model species the utili-
zation of cDNA-AFLP techniques for expression studies is appropriate as it helps in
identification of genes in two species during infection and is also important for
identifying factors of pathogenesis and virulence and thus would help in developing
strategies in controlled manner (Durrant et al. 2000; Guo et al. 2006; Polesani et al.
2008; Wang et al. 2009; Gupta et al. 2010; Zvirin et al. 2010). Under the evolution-
ary pressure the species of Fusarium have modified for better adaptability and thus
have colonized in differing ecological systems (Desjardins et al. 1993). These spe-
cies produce a variety of compounds (bioactive secondary metabolites), which are
show toxicity towards plants (Munkvold et al. 1997). These toxins also find their
way to animals and humans through the plant products consumed as fodder or food.
The Fusaria have different strains belonging to many groups which are identical
morphologically and thus are difficult to study such as endophytes (Bacon and Hin-
ton 1996), saprophytes (Fracchia et al. 2000), and plant pathogens (Chandra et al.
2008) and thus is the reason for difficulty in establishing taxonomy systems for
Fusarium species. So, it is required to utilize molecular based methods in differen-
tiating taxa. In this context, in recent times the application of phylogenetic species
concept to Fusarium systematic has helped in resolving the difficulties in taxono-
my. This concept requires several characters such as morphology of species cross-
ing between species and molecular markers in species for it to be statistically pow-
erful (Yli-Mattila et al. 2002). However, the molecular markers (DNA sequence
data) are preferred because they provide relevant characters. The molecular data in
combination with other morphological characters within Fusarium have helped to
differentiate species, which were otherwise placed differently (Zeller et al. 2003). It
has been noted, based on the DNA sequences that often the strains of Fusarium
placed in a forma specialis differ significantly and these need not be monophyletic
in origin (Baayen et al. 2000). Inferring from this the traits of plant pathogenicity,
which have high economic importance, need not to have characters that are evolu-
tionary conserved and thus is part in Fusarium species description. Since the arrival
of DNA sequencing at the scene it has become an important criterion in diagnostics
and distinguishing species. The most commonly used sequences to distinguish Fu-
sarium sp. are calmodulin (O’Donnell et al. 2000), TEF (translocation elongation
factor 1-α) (Wulff et al. 2010), ITS1 and ITS2 (internally transcribed spacer regions
in the ribosomal repeat region) (O’Donnell and Cigelnik 1997), tub2 (β-tubulin)
(O’Donnell et al. 1998), and IGS (intergenic spacer region) (Yli-Mattila and Gag-
kaeva 2010). However, it has been seen that all these sequences do not equally work
well with all species (Nayaka et al. 2011). Further, the proteins such as histone H3,
calmodulin, and Tri101 are also used for distinction of species besides (Mule et al.
2005). In short, it is difficult to distinguish and identify Fusarium sp. accurately
based on old traditional methods because of their morphological similarity and ge-
netic variation. Hence, for the accurate identification and characterization of species
DNA-based tools are required. In this direction, SSRs (single sequence repeats) of
the EST databases shall provide a way forward in identification and characteriza-
tion of Fusarium sp. These sequences are ubiquitously transcribed which are co-
dominant and locus-specific, and also are highly polymorphic, often multi-allelic
and finally SSRs are transferrable among species within genera (Power et al. 1996;
Morgante et al. 2002; Varshney et al. 2005a, b). Various EST-SSR markers devel-
oped from EST databases are used for genotyping in several species of flowering
plants (Varshney et al. 2005a) and these have been developed in many plant species
like rice (Temnykh et al. 2001) wheat (Eujayl et al. 2002) rye (Hackauf and Wehling
2002) Cotton (Han et al. 2006) Grape (Cordeiro et al. 2001). These EST-SSR mark-
ers are gene-tagged associated with the expressed gene and are also linked with al-
leles of quantitative and qualitative trait locus (QTLs) (Torben et al. 2007). So far,
many genomes have been sequenced and thus to the comparative genomics has
become an important discipline which helps to extend the information from one
species (model) to another unrelated species or between related species having a
much complex genome (Gale and Davos 1998). The EST-SSR markers in related
species show high level of transferability in comparison to anonymous DNA mark-
ers because they are more conserved and thus these markers are useful for com-
parative genomics, comparative mapping and evolutionary studies across species
(Cordeiro et al. 2001; Thiel et al. 2003; Eujayl et al. 2004; Scott et al. 2000; Saha
et al. 2004). However, the degree of polymorphism may be limited due to conserved
nature of EST-SSRs (Torben et al. 2007) as the transferability across species of the
SSR loci within genus is reported above 50 % (Thiel et al. 2003; Eujayl et al. 2004;
Peakall et al. 1998; Gaitán-Solís et al. 2002; Dirlewanger et al. 2002) and the trans-
ferability across genera of SSRs loci is reported to be poor (Thiel et al. 2003; Peak-
all et al. 1998; White and Powell 1997; Roa et al. 2000). Amongst the molecular
markers the SSRs are widely used for molecular mapping, selection, assessment of
genetic diversity, protection of varieties and thus helping to link genotypic and phe-
notypic variation (Powell et al. 1996; Gupta and Varshney 2000; Varshney et al.
2005a). The SSRs are comprised of tandemly repeated sequences having mono-,
di-, tri-, tetra-, penta-, or hexa- nucleotide units (Ellegren 2004) found in coding and
non-coding regions in prokaryotic and eukaryotic DNA.
The presence of various characteristics within SSRs such as relative abundance,
multi-allelic nature, simple detection, high reproducibility, co-dominant inheritance,
multi-allelic nature, and extensive genome coverage make them the ideal molecular
markers (Powell et al. 1996). However, the SSRs are known to experience high rate
of mutations (reversible length-altering) by replication slippage (transient disso-
ciation of replicating DNA) and unequal crossing over (misaligned reassociation),
which leads to variability in number of SSR motifs at a locus (Levinson and

Gutman 1987; Richards and Sutherland 1992). SSRs show highest variability among
DNA sequences within the genome (Weber 1990), and the rate of mutation and type
mainly depends upon the number of repeat motifs (Wierdl et al. 1997). However,
the rates of mutations differ among loci, among alleles, and between species
(Ellegren 2000). Among the earlier studies the anonymous DNA fragments (isolated
from genomic libraries) were utilized for the development of SSR markers. How-
ever, recently SSRs are being developed computationally from the sequencing data
generated from large-scale EST sequencing projects. The EST-SSR markers are
superior and informative than anonymous DNA markers because they are gene-
tagged and are associated with the expressed gene and hence linked to quantitative
and qualitative trait loci (QTLs) (Andersen and Lübberstedt 2003). The Fusarium
genomes have been conserved and are well documented, and to compare genetic
information from model to related species comparative genomics has become nec-
essary. In short, EST-SSRs derived from expressed genes are conserved with higher
transferability to related species in comparison to anonymous DNA markers, thus,
are very useful as strong markers for evolutionary studies comparative genomics
and comparative mapping across species (Torben 2007).
Fusarium Databases
The comparative analysis among the fungal species is facilitated by the Fusarium
database which gives accesses to various sequenced genomes of Fusarium simul
taneously. The three most important Fusarium spp, which have been studied exten-
sively due to their devastating impact on crops, are F. oxysporum, F. verticillioides
and F. graminearum. Over the last decade there has been enormous advancement
in genomic technology and sequencing of various species has been completed and
thus there arose the need for comparative projects. Thus, the Fusarium Compara-
tive project (http://www.broad.mit.edu/annotation/genome/fusarium_group/Multi-
Home.html) is one such effort which compared the above three species. This project
improved gene annotations and identifying non-coding elements. As these species
are biologically distinct evolutionary studies were done among these above spe-
cies and it was found that F. oxysporum and F. verticillioides genomes have di-
verged from F. graminearum, and thus the comparative of these offers a platform
for interaction studies in plant-fungi (pathogenicity, virulence factors and evolu-
tion). The comparative genomics among these have highlighted the presence of
lineage-specific chromosomes comprising the transposable elements (TEs) and en-
coding pathogenicity related (PR) genes. These projects have also helped in explor-
ing the genetic composition of these chromosomes among the strains of the above
Fusarium species. The F. oxysporum spp. are ubiquitous plant and soil inhabiting
microbes causing the wilt and root rot diseases in over 120 plant species (Michielse
and Rep 2009). It has been reported that many of the strains don’t show apparent
symptoms on the plant and can even protect them from subsequent infections (Al-
abouvette et al. 2009). Further, some strains have also been identified as pathogenic
to humans causing localized or disseminated infections (O’Donnell et al. 2004).

The aims and objectives of comparative genomes project has been to make genome
sequence data for strains available along with the host specificities. The first among
strains of F. oxysporum spp was made available in 2007 which caused tomato wilt
and on comparison with F. graminearum and F. verticillioides genomes, and it
was discovered that the mobile supernumerary chromosomes contained genes for
host specific infection and disease (Ma et al. 2010). Subsequently, 11 more strains
of F. oxysporum have been sequenced out of which two infected tomato (Gale et al.
2003; Rosewich et al. 1999). The other two of the sequenced strains showed speci-
ficity towards crucifers (cabbage yellow disease, radish wilt), Arabidopsis (Diener
and Ausubel 2005) and the other sequenced strain caused wilt of banana, melon,
cotton and pea (Fourie et al. 2011). Some Fusarium oxysporum strains causing
humans diseases such as strains from human blood (O’Donnell et al. 2004) have
been shown to cause necrotic diseases in immune-competent individuals such as
outbreak of keratitis in contact lens users (Chang et al. 2006) and may also be
disseminating infections in neutropenic patients (Boutati and Anaissie 1997). Fur-
thermore, a strain of Fusarium oxysporum has been sequenced which is known to
colonize host roots and shown to be biotic component for wilt disease suppression
(Fravel et al. 2003). Another important species among Fusarium which is distrib-
uted worldwide is Fusarium graminearum which causes head blight of wheat and
barley (O’Donnell et al. 2000, 2004) and it had an economic losses worth of ap-
proximately 3 billion dollars in 1990s to U.S. agriculture (McMullen et al. 1997;
Windels 2000), further it is becoming a threat due to outbreaks in Canada, Europe,
Asia and South America in recent past (Dubin et al. 1997). Fusarium graminearum
species also causes disease on rice and corn (White 1999; Webster and Gunnell
1992) and results in reduced yield and seed quality and also the infestation makes
the food and feed unsuitable due to production of mycotoxins (McMullen et al.
1997). The strains of Fusarium graminearum sequenced by International Gibber-
ella zeae Genomics Consortium (IGGR) was PH-1 (NRRL 31084) (Trail and Com-
mon 2000) was shown to produce mycotoxins; trichothecenes and zearalenone such
as deoxynivalenol and nivalenol toxin (Garvey et al. 2008). Another important spe-
cies present worldwide is Fusarium verticillioides causes kernel and ear rot disease
of maize. The abiotic stress conditions such as high temperature, drought along with
other biotic factors such as the damage by insect can further amplify and enhance
the disease and thus cause reduce crop quality and yield. The negative economic
impact of this species causing several animal (Howard et al. 2001; Seefelder et al.
2003; Wilson et al. 1992; Kriek et al. 1981) and human diseases (Seefelder et al.
2003) is due to fumonisin mycotoxins.
Plant-Defense Responses
The evolution of fungi is dependent directly on the development and the spread of
green plants and most of fungi are saprophytic and few among them are parasitic.
These fungi require nutrients to complete their life cycle, which is provided to them
by the living cells. The plants have effective defense mechanisms to limit the spread
of parasitic fungi and they have to encounter the primary line of defense provided
by cell wall of host plants, which inhibit their penetration to the tissues. The second-
ary line of defense includes the production of wide range of secondary metabolites
or compounds which act as fungicides. These compounds are induced, that is they
are produced only after the infection has occurred (e.g. Phytoalexins). The fungal
parasites are host specific and some of them even require the alteration of hosts,
which may or may not be phylogenetically related for stage wise development on
either host. The fungal pathogens have been seen to cause more damage to agri-
culture (monocultures) than in plant communities rich in species due to high host
specificity. To get hold of the plant nutrients the fungal parasites are having at least
three strategies. (1) Production of enzymes for cell wall and cuticle breakdown. (2)
Production of toxins to either reduce or inhibit the cellular activity. (3) Production
of host-specific substances (e.g. phytohormones) and thus disturbing the hormonal
equilibrium and thus causing disruption of growth and differentiation of the cells
and tissues (e.g. Gibberella fujikuroi) produces gibberellins which affect the growth
of rice. The literature about pathogenicity of fungi is very extensive and majority of
these emphasize on economic considerations, classification, life cycle, symptoms
and diagnostic, host range and factors of host resistance. The processes of plants
molecular mechanisms after infection have been elucidated in recent past and these
can be partially generalized due to variation in possible interaction reactions. The
host resistance is not only based on general and unspecific defense mechanisms
but also on specific mechanisms during which genetically determined substances
are produced which are directed against specific fungal pathogen. Genetic analyses
have shown that the host resistance is caused by genes inherited independently of
each other, such as the existence of dominant alleles of the respective genes, and
resistance genes. It has been shown by microarray analysis that resistance to virus in
melon is associated with defense responsive gene expression/induction (Gonzalez-
Ibeas et al. 2012a) which led to development of a cost-effective kit for microar-
rays (Gonzalez-Ibeas et al. 2012b). Further, the silenced lines of melon developed
by RNA Interference showed resistance against the viruses (Rodriguez-Hernandez
et al. 2012). Plants protect themselves against the diversity of herbivores and mi-
crobial pathogens by expressing an array of constitutive and induced defenses ren-
dering the plant an inaccessible or unsuitable food source. The perception of attack
and deployment of the induced defenses is primarily mediated by three well-studied
defense-signaling pathways that are regulated by jasmonic acid (JA), salicylic acid
(SA) and ethylene (ET) (Glazebrook 2005; Howe and Jander 2008; Walling 2009).
Herbivores and pathogens introduce a distinct set of elicitors and effectors that are
perceived by host plants and these signals allow the plant to tailor its defense re-
sponse to individual challengers (Glazebrook 2005; Howe and Jander 2008; Wall-
ing 2009; McSteen 2008; Zhao et al. 2008a; Stout et al. 2006; Bari and Jones 2009).
The SA-regulated defense pathway is activated by biotrophic pathogens (pathogens
that invade living plant tissue) and many phloem-feeding insects (Glazebrook 2005;
Walling 2009; Kempema et al. 2007; Puthoff et al. 2010; Kusnierczyk et al. 2008;
Zarate 2007). Often SA-induced signaling antagonizes JA- and ET-regulated signal-
ing pathways, although exceptions do exist (Mur et al. 2006; Leon-Reyes et al. 2010;
Verhage et al. 2010). The suppression of JA/ET-regulated defenses confers suscep-
tibility to many tissue-damaging and phloem-feeding herbivores (Howe and Jander
2008; Zarate 2007; Gao et al. 2007; Pieterse and Dicke 2007) and can influence at-
traction of natural enemies (Zhang et al. 2009). However, in some plant—herbivore
interactions, SA-regulated defenses and/or novel defense-signaling pathways con-
tribute to the plant immune response (Thaler et al. 2010; Bhattarai et al. 2007, 2010).
Therefore, the nature of defenses elicited by endosymbiont-like pathogens in their
host plants have the potential to profoundly impact the plant’s interaction with the
insect and/or ability to resist attacks by other pathogens or pests. If an herbivore can
circumvent induced plant defenses or plant recognition by vectoring its endosym-
biont associate into its host plant during feeding, it may have a selective advantage
relative to insects feeding on uninfected plants. Alternatively, effectors from the
endosymbiont may circumvent the plant recognition system, compromising plant
immune responses and related insect and bacterial resistance in both the JA/ET- and
SA-regulated defense pathways. Thus, the endosymbiont’s modification of plant
defenses could result in a more susceptible host plant for both symbiotic partners.
Understanding Pathogenesis: Role of Systems Biology
The Fusarium spp. causes disease to crops (Table 8.1) and the disease effect is huge
in terms of economy due to problems in health to animals as well as humans by con
suming the contaminated grain (McMullen et al. 1997) with mycotoxins (Garvey
et al. 2008). Thus, it becomes necessary to understand pathogenesis (pathogenic
genes) and thereby prevent the invasion by these destructive pathogens. The plant
pathology discipline describe the pathogenesis genes as those which causes losses
or in other words are those which when disrupted causes the reduction of disease
symptoms (Idnurm and Howlett 2001). The identification of these genes can be
done with either the gene silencing or gene knockout studies (Liu et al. 2010). In
F. graminearum 49 pathogenic genes have been verified by utilizing the biologi-
cal methods and then stored in PHI-base database (http://www.phi-base.org/query.
php). However, when we consider the genome size of F. graminearum, it is real-
ized that compilation of the pathogenesis related genes is a huge uphill task as well
as time consuming. To solve this problem, the computational biological methods
could provide an alternative for solving this problem, especially after the release
of genome sequences in Broad Institute (http://www.broadinstitute.org) (Liu et al.
2010). Hence, for the prediction of pathogenesis genes comparative genomics will
be handy and will help in comparison between fungi, which are either pathogenic or
non-pathogenic (Zhao et al. 2008b, c). But, recently it has been found that it is dif-
ficult to identify pathogenesis genes in F. graminearum because there are no unique
features in specific genes among pathogenic and non-pathogenic fungi (Liu et al.
2010). On the basis of literature on pathogenicity in model pathogens (Gohre and
Robatzek 2008), it can be believed that F. graminearum pathogenesis is also involv-
ing the networks of proteins and molecules while interacting from itself as well as
the ones secreted by the host cells (Liu et al. 2010). Thus based on systems biology
approach, the network of molecular interaction in Fusarium spp. can provide ad-
ditional insights into the processes of pathogenesis. Moreover, the protein-protein
interaction maps can also provide clues to potential pathogenesis genes and thus
pathogenesis procedure (Zhao et al. 2009). The pathogenesis genes are generally
expressed differentially before and after invasion so that the pathogen can sustain or
pass through the host immune system and thus adapt in the host. Similarly the dif-
ferentially expressed genes of F. graminearum may be pathogenic genes (Liu et al.
2010). However, false positives may be produced by differentially expressed genes
while identifying genes involved in disease procedures, as some of these genes
are not involved in pathogenesis, despite expression changes during experimenta-
tion. However, by integrating the protein interaction and gene expression studies
on perturbations (drug, extracellular stimuli) (Zhao et al. 2010) shall be useful in
identifying the pathogenesis processes. The approaches in systems biology helps
in integrating the protein interaction mapping data and gene expression data and
works on assumptions proteins interacting in a network share similar functions and
it is termed as “Association rule” (Zhao et al. 2010) and thus are most probably in-
volved in the similar pathways (Zhao et al. 2010). In F. graminearum the prediction
results have shown that most of the pathogenesis genes belong to G-protein coupled
receptors and MAPK signaling pathways (Liu et al. 2010) (Table 8.2).
Transcriptomics: Understanding of Plant—Microbe

Interactions
Transcript profiling is a functional genomics tool, which is used most widely and
can be conducted along with various genomic tools such as SAGE (serial analysis
of gene expression), MPSS (massive parallel signature sequencing) and microar-
rays (Dilip et al. 2010). The transcriptomics of related species (pathogenic and non-
pathogenic) have led to identification of divergence among them in the genome
(Wurtzel et al. 2012). The role of regulatory processes in pathogenesis (i.e. the
protein abundance) can be compared with reference proteomics as well as tran-
scriptomics (Voge and Marcotte 2012). The transcriptomic approach is necessary
for understanding the pathogenesis processes in particular the receptors present
in the plants which help in recognizing or perceiving the conserved signatures of
pathogens (Schwessinger and Ronald 2012). The responses of plants to the biotic
stresses (pathogens) leads to the several changes such as cellular, physiological,
biochemical and most importantly the transcriptomic levels. The interactions are
very complex and are mediated and regulated by the hormonal signaling pathways
(Atkinson and Urwin 2012; Tian et al. 2012). The modulation of defense systems
by the plants upon the infection, invasion or any other biotic stress can be stud-
ies at the transcriptomic level of interacting host and pathogen (Lee et al. 2012;
Tian et al. 2012). The metabolomic and transcriptomic studies could be helpful in
Fig. 8.1 Depicting approaches towards utilizing the interaction of plant-microbe for applications
in biotechnology. (Adapted from Schenk et al. 2012)
revealing the mechanisms of antagonism between species infecting the same plant
as reported recently among Ustilago maydis and Fusarium verticillioides infecting
maize (Jonkers et al. 2012). Based on the extensive collection of ESTs, several mi-
croarrays have been developed for crops (Torben et al. 2007). The plant expression
database of plants and pathogens (PLEXdb, http://www.plexdb.org/index.php) can
provide the microarray data of Fusarium graminearum (obtained with Affymetrix
GeneChip) (Liu et al. 2010). The transcriptomics approach to study the interaction
between two- species may lead to the discovery of important genes in plants and
Fusarium thus leading to characterization, which shall provide disease resistance
strategies (Fig. 8.1). The multidisciplinary approaches are required for obtaining
a comprehensive systems biology look of the involved processes. The studies of
genomics, transcriptomics, proteomics and metabolomics will provide data sets,
which shall be integrated using bioinformatics and statistical tools and thus will
help to identify important biological processes and thus make prediction models.
These approaches are being used to access the information about the associations
(beneficial/detrimental) among two or multiple species. For example, the ectomy-
corrhizal interaction between Laccaria bicolor and aspen ( Populus tremuloides)
roots led to the identification of genes expressed significantly, which were later
mapped to specific metabolic pathways and hence gave rise to the model of ectomy-
corrhizal metabolome. Identification of which genes are expressed is done by uti-
lizing the next-generation short-read transcriptomic sequencing data (Larsen et al.
2011). Predictions were made on the basis of the above model that various metabo-
lites such as allantoin, glutamate, glycine, which are synthesized by L. bicolor may
be used by aspen and in return; the latter provides sugars such as glucose or fructose
to the fungus and thus implying that these analyses could be applied in case of tran-
scriptomics data from other complex systems (Larsen et al. 2011). In addition, the
functional studies and analysis would be useful for the identification of functions of
genes, RNA (Fig. 8.1) and more importantly the functions of proteins and metabo-
lites during plant–microbe interactions. These studies will pin point the important
processes that control these interactions. The above vision can also be achieved by
developing genomic models, which will suit the analysis of metabolic flux. In these
models the microbes may be viewed at one level as one closely interacting super or-
ganisms, whereas the interacting plant may be viewed by genomic models at several
levels based on compartmentalization and thus distinguishing metabolic processes
in vacuoles, mitochondria, chloroplasts, cytoplasm and peroxisomes (Schenk et al.
2012). The genome-scale models have been recently constructed for Arabidopsis,
C4 plants and more than 25 bacterial species based on primary metabolites (Ober-
hardt et al. 2009; de Oliveira Dal’Molin et al. 2010a, b). In addition the quantitative
data obtained from gene expression studies and metabolomics can also be included
in both types of model. Although the transcriptomics approaches are useful for un-
derstanding the plant-microbe interactions, there is a scope for improvements as in
case of transcriptional profiling studies the data generated has not been replicated
and thus defy statistical analyses. It is due to the reason that it has high cost and
is very complex. The less complex environmental samples from sea water (micro-
bial complexity compared to soil) revealed among the unique reference genes only
17 % overlap by repeated pyrosequencing (Stewart et al. 2010) which suggests that
current sequencing platforms need to evolve further for gasping the complexities
within communities. The sequencing platforms of with better coverage are cur-
rently being developed and then are coupled with replicate profiling and statistical
analyses and thus these hold a great promise for representation of the expression
profiles of interactions accurately. Currently, HiSeq 2000 (maximum 600 Gb, cor-
responding to 3 billion reads using TreSeq v3 reagent kits; Illumina, Inc.) platform
delivers the largest amount of sequence data. New insights will be provided by
understanding the detrimental or beneficial plant—Fusarium interactions for bio-
technological purposes. For the association studies between grasses and endophytes
the use of transcriptomics is a tractable system. Similarly, transcriptomics of detri-
mental association identified candidate genes which play pivotal role in infection
processes and in which the interaction switches from being mutalistic to pathogenic
between interacting partners (Eaton et al. 2011; Beatty and Good 2011). Thus the
knowledge obtained from interactions (beneficial/detrimental) between plants and
microbes will provide tremendous opportunities to increase crop productivity. Fur-
thermore, transcriptomics of the environment (soil/water) should be included in
systems biology as an essential component and thus integrated along with other
omics technologies. The future prospect would be if we as scientists could harness
the potential of microbes by engineering such crop plants, which are particularly
suited for beneficial interactions with microbes. An example in this direction could
be the development of cereals, which can fix nitrogen significantly through their
associated N-fixing microbe partners. The cereal crops (such as rice, corn, wheat,
barley, sorghum and sugarcane) are consumed worldwide by humans and animals
and thus if the nitrogen fixing ability of microbes is controlled among these crops,
it will reap enormous financial as well as environmental benefits and the ways to
achieve these milestones are being discussed presently the world over (Charpentier
and Oldroyd 2010). Despite the recent progresses, we are at the beginning stages
and by looking at the current pace of progress the future research upholds great
promise and potential and these new insights will be of great value for the develop-
ment of sustainable production by utilizing new technologies.
Metatranscriptomics Approach
In Metatranscriptomics the environmental samples such as soil or water are used for
RNA extraction to analyze the gene expression in microbial communities without
their cultivation (Morales and Holben 2011; Simon and Daniel 2011). The study
of this multi-species association or interaction with the plant presents with oppor-
tunities, which will help in discovering relationships among plant-microbes with
potential impact. These metatranscriptomic studies of the whole microbial com-
munities at same time will lead to identification of new plant-microbe interactions
either beneficial or detrimental. For example, it is reported that among 150 Pseu-
domonas sp. from rhizosphere of wheat, 40 % of isolates increased the root growth
upon individual inoculation on wheat (Campbell and Greaves 1990). Further, the
outcome of the plant-microbe interaction can be determined by the influence of
environmental conditions such as abiotic along with biotic stresses on the physi-
ological pathways of plants. Thus, understanding of signaling processes and the
cross talk between individual pathways may allow harnessing these pathways to our
advantage for solving problems related to pathogenesis. The expression profiling of
the genes of signaling pathways have revealed that these mechanisms have protein
switches regulated by hormones (e.g. transcription factors, kinases or G-proteins)
(Memelink 2009; Yao et al. 2011; Depuyd and Hardtke 2011; Zhao et al. 2010). The
signaling responses to abiotic and biotic stresses are complicated such as the abiotic
stress-experiencing plants may channel their physiological resources for adaptation
towards such factors but in doing so these plants may become susceptible towards
attack by pathogen or herbivore (Thaler and Bostock 2004; Trewavas 2009; Hey
et al. 2010). The pathways which are activated through the mediation by abscisic
acid (ABA) seem to be dominant in providing protection towards abiotic stresses
and seem antagonistic to defense pathways controlled by SA (salicylic acid), JA
(jasmonic acid) and/or ET (ethylene) (Zabala et al. 2009; Raghavendra et al. 2010;
Peleg and Blumwald 2011). In plants under abiotic stresses such as UV radiation,
increase in ROS (reactive oxygen species) is triggered and these show resistance
against biotrophic pathogens and this response is also achieved when SA is applied
to plants (Bechtold et al. 2005; Kunz et al. 2008; Ahmad et al. 2010). In contrast
the necrotrophic pathogens are benefitted from any kind of physical damage to cells
and JA provides defense against these and further JA is also associated with induced
systemic resistance (ISR), which is a priming reaction against subsequent infections
(Pieterse et al. 2009; Matilla et al. 2010). Henceforth these recent advanced techni-
cal studies of microbial communities on metagenomics and metatranscriptomics
(Morales and Holben 2011; Kakirde et al. 2010) could be applied to pathogens
and then conjoining with plant transcriptomics, shall provide deeper insights into
multiple interactions. In the plant rhizospere 33,000 archeal and bacterial species
were found when grown on disease-suppressive soil, by combining a high-density
16S ribosomal DNA oligonucleotide microarray (PhyloChip metagenomics) of the
rhizosphere microbiome with culture dependent functional analyses (Mendes et al.
2011). The disease caused by Rhizoctonia solani (fungal root-infecting pathogen)
was found to be suppressed by the Proteobacteria, Firmicutes and Actinobacteria
species, which led to the proposal or conclusion that plants interaction with multiple
microbe species can contribute to suppression of the disease (Schenk et al. 2012).
Future Prospects
The prime concerns are related to with the understanding of host-pathogen interac-
tions including plant defense responses. To monitor fungal colonization the system-
atic re-isolation procedures are required in host-pathogen combinations (compatible
and incompatible). This is a challenging issue, which will lead to developing new
strategies to control disease. In order to identify the genes required for the hyper-
sensitive response, studies shall focus on performing expression profiling of crop
plants. The cDNA-AFLP analysis shall provide expression profiling of both normal
and Fusarium infected plants, (identification of plant/pathogen genes associated
with the infection process). The focus on variability of Fusarium sp. infecting Crops
is the need of hour and will help to understand the host-pathogen relationship for
disease management. The crop colonization by Fusarium sp. shall be studied and
the samples collected from definite time points irrespective of speed and extent
of colonization among the strains. The molecular biology advancements have led
to the use of DNA based markers in place of morphological markers. Initially, the
RNA samples of (healthy/infected plants) shall be put to cDNA-AFLP analysis for
identifying transcripts differentially expressed, which are associated with resistance
response and infection process.
Further, the RNA samples from in vitro grown fungal strains shall help in iden-
tifying in planta expressed fungal transcripts and also in identifying in vitro differ-
entially expressed fungal genes among the strains. The infected plants samples col-
lected for analysis by cDNA-AFLP at different time intervals will determine early
to late stages of infection and will also allow detection of the pathogen transcripts.
The expression patterns of the transcripts shall be monitored with several different
primer combinations for amplification in a selective manner and for every primer
combination; the TDFs (transcript derived fragments) can be viewed as bands on
gels. These bands can be visually scored and compared for the differences in inten-
sity for detecting transcripts expressed differentially in plants and for comparison
these will be eluted and reamplified with appropriate cDNA-AFLP primers. This is
followed by sequencing and then the products are screened using public databases
for finding homologous sequences with significant alignment. Using the BLAST
analysis, sequences identical to crop transcripts, transcripts homologous to known
plant sequences in UNIPORT KB Swiss-Prot or TrEMBL http://www.expasy.ch/
sprot/databases or NCBI databases (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and
transcripts homologous to known Fusarium sp. sequences considered as express-
ing in planta shall be identified. The transcripts, which have no matches in any
of the databases, shall also be seen; these may represent transcripts that currently
lack functional annotations. Further the expression pattern and clustering of crop
transcripts shall be done to overview differences between infected and control. The
functional annotation of each transcript can be done with help of Gene Ontology
Database http://www.geneontology.org and through carefully analyzing the scien-
tific literature. Further for the identification of Fusarium genes expressed in crop
plant during infection we can include sequences from all Fusarium sp available in
public databases. Finally, the fungal transcripts differentially expressed among the
strains shall be identified when grown in vitro searching the Fusarium database (Fu-
sarium Comparative Database 2). These studies will provide with information re-
garding transcriptional changes in crops upon Fusarium pathogenesis and also if the
wilting symptoms are derived from active plant response besides the infection. The
studies shall generate information regarding In planta expressed pathogen-derived
transcripts during the infection processes which are related potentially to virulence
functions as well as the in vitro expressed transcripts (expressed differentially be-
tween strains). These will further provide the sequences, which will be helpful for
distinguishing between races. For the dissipation of information the sequence data
generated from these studies shall be deposited in Gene Bank (Gene Expression
Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo). The second impor-
tant concern is related to Identification of the target regions in the fungal genome
for probe generation for their use in phylogeny of Fusarium sp. Further, the use of
a comprehensive EST collection in Fusarium for SSR identification shall help to
develop EST-SSR markers for genetic mapping which will be extremely useful for
diagnostics and research concerned with fungal biology, ecology, and genetics. The
analysis will yield the frequency, type and distribution of SSR motifs in ESTs de-
rived from Fusarium sp. The Perl script MIcroSAtelitte (MISA) (Thiel et al. 2003)
can be used to identify SSRs in the Fusarium spp. EST sequences. These data can
be used to perform comparative analysis of SSR motif polymorphisms between
allelic sequences, and orthologous sequences to conduct and finally to identify
functionally associated EST-SSR markers for application in comparative genomics.
There is a need to study and focus on the development of EST-SSRs. Due to the lack
of sufficient markers for Fusarium sp, it becomes necessary to develop enough mo-
lecular markers for potential use in Fusarium sp. pathogenicity. With the develop-
ment of Fusarium database/projects a vast amount of available EST sequence data
has been generated. The screening for repeat motifs (perfect and imperfect) can be
done in unigenes within the transcript assembly. The SSRs with a minimum repeat
count ( n) threshold of n ≥ 5 can be selected for further analysis and EST-SSR marker
development. Flanking forward and reverse primers will be designed for SSRs in
unigenes using Primer 3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.
cgi) and products can be genotyped by sequencing and the allele lengths can be as-
certained by gene mapper. The SSR markers can be screened for amplification and
length polymorphisms among Fusarium strains on agarose. The estimation of EST-
SSR individual markers heterozygosities ( H) and Genetic distances ( G) can be done
using the proportion of shared alleles estimator in Microsat, where G = (1 − p) and p
is the proportion of shared alleles http://hpgl.stanford.edu/projects/microsat/. These
data offer an opportunity to identify single sequence repeats (SSRs) in expression
sequence tags (ESTs) by data mining. Such kind of studies shall give an insight into
the frequency, distribution and type of Fusarium EST-SSRs and demonstrate suc-
cessful development of EST-SSR markers in crop pathogenesis. These EST-SSR
markers would be enriching the current resources of molecular markers for the sci-
entific community and would be useful for Fusarium identification at species level
and breeding programs to develop resistant varieties. Further, the novel EST-SSRs
would be useful for comparative genetic mapping which shall give us information
about the genetic diversity and polymorphism among the Fusarium sp. All these
shall provide the novel insights and knowledge about Fusarium pathogenesis.
References
Ahmad S, Gordon-Weeks R, Pickett J, Ton J (2010) Natural variation in priming of basal resis-
tance: from evolutionary origin to agricultural exploitation. Mol Plant Pathol 11:817–827
Akhond M, Machray GC (2009) Biotech crops: technologies, achievements and prospects. Eu-
phytica 166:47–59
Alabouvette C, Olivain C, Migheli Q, Steinberg C (2009) Microbiological control of soil-borne
phytopathogenic fungi with special emphasis on wilt-inducing Fusarium oxysporum. New
Phytol 184:529–544
Andersen JR, Lübberstedt T (2003) Functional markers in plants. Trends Plant Sci 8:554–560
Atkinson NJ, Urwin PE (2012) The interaction of plant biotic and abiotic stresses: from genes to
the field. J Exp Bot 63(10):3523–3543
Baayen RP, O’Donnell K, Bonants PJM, Cigelnik E, Kroon LPNM, Roebroeck EJA, Waalwijk
C (2000) Gene genealogies and AFLP analysis in the Fusarium oxysporum complex identify
monophyletic and non-monophyletic formae speciales causing wilt and rot diseases. Phytopa-
thology 90:891–900
Bacon CW, Hinton DM (1996) Symptomless endophytic colonization of maize by Fusarium mo-
niliforme. Can J Bot 74:1195–1202
Bari R, Jones JD (2009) Role of plant hormones in plant defence responses. Plant Mol Biol
69(4):473–488
Beatty PH, Good AG (2011) Future prospects for cereals that fix nitrogen. Science 333:416–417
Bechtold U et al (2005) The influence of the light environment and photosynthesis on oxidative
signaling responses in plant–biotrophic pathogen interactions. Plant Cell Environ 28:1046–
1055
Beckman CH (1987) The nature of wilt diseases of plants. APS Press, American Phytopathological
Society, St. Paul
Berek L, Petri IB, Mesterhazy AA, Teren J, Molnar J (2001) Effects of mycotoxins on human im-
mune functions in vitro. Toxicol In Vitro 15:25–30
Bhattarai KK, Xie QG, Pourshalimi D, Younglove T, Kaloshian I (2007) Coi1-dependent signaling
pathway is not required for Mi-1-mediated potato aphid resistance. Mol Plant Microbe Interact
20:276–282
Bhattarai KK, Hagop SA, Kaloshian I, Eulgem T (2010) WRKY72-type transcription factors con-
tribute to basal immunity in tomato and Arabidopsis as well as gene-for-gene resistance medi-
ated by the tomato R gene Mi-1. Plant J 63:229–240
Boutati EI, Anaissie EJ (1997) Fusarium, a significant emerging pathogen in patients with hema-
tologic malignancy: ten years’ experience at a cancer center and implications for management.
Blood 90:999–1008
Campbell R, Greaves MP (1990) Anatomy and community structure of the rhizosphere. In: Lynch
JM (ed) The rhizosphere. Wiley, Chichester, pp 11–34
Chandra NS, Udaya Shankar AC, Niranjana SR, Reddy MS, Prakash HS, Mortensen CN (2008)
Control of Fusarium verticilliodes causing ear rot of maize by Pseudomonas fluorescens. Pest
Manag Sci 65:769–775
Chandra SN, Shankar ACU, Niranjana SR, Wulff EG, Mortensen CN, Prakash HS (2010) Detec-
tion and quantification of fumonisins from Fusarium verticillioides in maize grown in southern
India. World J Microbiol Biotechnol 26:71–78
Chang DC, Grant GB, O’Donnell K, Wannemuehler KA, Noble-Wang J, Rao CY et al (2006)
Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. JAMA
296:953–963
Charpentier M, Oldroyd G (2010) How close are we to nitrogen fixing cereals? Curr Opin Plant
Biol 13:556–564
Cordeiro GM, Casu R, McIntyre CL, Manners JM, Henry RJ (2001) Microsatellite markers from
sugarcane (Saccharum spp.) ESTs cross transferable to erianthus and sorghum. Plant Sci
160:1115–1123
de Oliveira Dal’Molin CG et al (2010a) C4GEM, a genome-scale metabolic model to study C4
plant metabolism. Plant Physiol 154:1871–1885
de Oliveira Dal’Molin CG et al (2010b) AraGEM, a genome-scale reconstruction of the primary
metabolic network in Arabidopsis. Plant Physiol 152:579–589
Depuyd S, Hardtke CS (2011) Hormone signaling crosstalk in plant growth regulation. Curr Biol
21:365–373
Desjardins AE, Hohn TM, McCormick SP (1993) Trichothecene biosynthesis in Fusarium species:
chemistry, genetics, and significance. Microbiol Mol Biol Rev 57:595–604
Desjardines AE, Proctor RH (2007) Molecular biology of Fusarium mycotoxins. Int J Food Mi-
crobiol 119:47–50
Di Pietro A, Madrid MP, Caracuel Z, Delgado-Jarana J, Roncero MIG (2003) Fusarium oxys-
porum: exploring the molecular arsenal of a vascular wilt fungus. Mol Plant Path 4:315–325
Diener AC, Ausubel FM (2005) Resistance to Fusarium oxysporum 1, a dominant Arabidopsis
disease-resistance gene, is not race specific. Genetics 171:305–321
Dilip R, Panthee DR, Chen F (2010) Genomics of fungal disease resistance in tomato. Curr Ge-
nomics 11:30–39
Dirlewanger E, Cosson P, Tavaud M, Aranzana MJ, Poizat C, Zanetto A, Arús P, Laigret F (2002)
Development of microsatellite markers in peach ( Prunus persica (L.) Batsch) and their use
in genetic diversity analysis in peach and sweet cherry ( Prunus avium L.). Theor Appl Genet
105:127–138
Doohan FM, Parry DW, Jenkinson P, Nicholson P (1998) The use of species-specific PCR-based
assays to analyse Fusarium ear blight of wheat. Plant Pathol 47:197–205
Dubin HJ, Gilchrist L, Reeves L, McNab A (1997) Fusarium head blight: global status and pros-
pects. CIMMYT, Mexico City
Durrant WE, Rowland O, Piedras P, Hammond-Kosack KE, Jones JDG (2000) cDNA AFLP re-
veals a striking overlap in race-specific resistance and wound response gene expression pro-
files. Plant Cell 12:963–977
Eaton CJ et al (2011) What triggers grass endophytes to switch from mutualism to pathogenism?
Plant Sci 180:190–195
Ellegren H (2000) Microsatellite mutations in the germline: implications for evolutionary infer-
ence. Trends Genet 16:551–558
Ellegren H (2004) Microsatellites: simple sequences with complex evolution. Nat Rev Genet
5:435–445
Eujayl I, Sorrells ME, Wolters P, Baum M, Powell W (2002) Isolation of EST-derived microsatel-
lite markers for genotyping the A and B genomes of wheat. Theor Appl Genet 104:399–407
Eujayl I, Sledge MK, Wang L, May GD, Chekhovskiy K, Zwonitzer JC, Mian MA (2004) Medi-
cago truncatula EST-SSRs reveal cross-species genetic markers for Medicago spp. Theor Appl
Genet 108:414–422
Fourie G, Steenkamp ET, Ploetz RC, Gordon TR, Viljoen A (2011) Current status of the taxonomic
position of Fusarium oxysporum formae specialis cubense within the Fusarium oxysporum
complex. Infec Genet Evol 11:533–542
Fracchia S, Garcia-Romera I, Godeas A, Ocampo JA (2000) Effect of the saprophytic fungus Fu-
sarium oxysporum on arbuscular mycorrhizal colonization and growth of plants in greenhouse
and field trials. Plant Soil 223:175–184
Fravel D, Olivain C, Alabouvette C (2003) Fusarium oxysporum and its biocontrol. New Phytol
157:493–502
Fusarium Comparative Database. http://www.broad.mit.edu/annotation/genome/fusarium_group/
MultiHome.html
Gaffoor I, Trail F (2006) Characterization of two polyketide synthase genes involved in zearale-
none biosynthesis in Gibberella zeae. App Environ Microbiol 72(3):1793–1799
Gaffoor I, Brown DW, Plattner RD, Proctor RH, Qi W, Trail F (2005) Functional analysis of
the polyketide synthase genes in the filamentous fungus Gibberella zeae (anamorph Fusarium
graminearum). Eukaryotic Cell 4(11):1926–1933
Gaitán-Solís E, Duque MC, Edwards KJ, Tohme J (2002) Microsatellite repeats in common bean
( Phaseolus vulgaris): isolation, characterization, and cross-species amplification in Phaseolus
ssp. Crop Sci 42:2128–2136
Gale MD, Devos KM (1998) Comparative genetics in the grasses. Proc Natl Acad Sci U S A
95:1971–1974
Gale LR, Katan T, Kistler HC (2003) The probable center of origin of Fusarium oxysporum f. sp.
lycopersici VCG 0033. Plant Dis 87:1433–1438
Gao LL, Anderson JP, Klingler JP, Nair RM, Edwards OR et al (2007) Involvement of the octa-
decanoid pathway in bluegreen aphid resistance in Medicago truncatula. Mol Plant Microbe
Interact 20:82–93
Garvey GS, McCormick SP, Rayment I (2008) Structural and functional characterization of the
TRI101 trichothecene 3-O-acetyltransferase from Fusarium sporotrichioides and Fusarium
graminearum. J Biol Chem 283:1660–1669
Genomics and Gene Discovery bEST Resource. http://wheat.pw.usda.gov/bEST/
Glazebrook J (2005) Contrasting mechanisms of defense against biotrophic and necrotrophic
pathogens. Annu Rev Phytopathol 43:205–227
Gohre V, Robatzek S (2008) Breaking the barriers: microbial effector molecules subvert plant im-
munity. Annu Rev Phytopathol 46:189–215
Gonzalez-Ibeas D, Cañizares J, Aranda MA (2012a) Microarray analysis shows that recessive
resistance to Watermelon mosaic virus in melon is associated with the induction of defense
response genes. Mol Plant Microbe Interact 25(1):107–118
Gonzalez-Ibeas D, Blanca J, Cañizares J, Truniger V, Aranda MA (2012b) A cost-effective double-
stranded cDNA synthesis for plant microarrays. Plant Mol Biol Rep 30(5):1276–1282
Guo J, Jiang RHY, Kamphuis LG, Govers F (2006) A cDNA-AFLP based strategy to identify tran-
scripts associated with avirulence in Phytophthora infestans. Fungal Genet Biol 43(2):111–123
Gupta PK, Varshney RK (2000) The development and use of microsatellite markers for genetic
analysis and plant breeding with emphasis on bread wheat. Euphytica 113:163–185
Gupta S, Chakraborti D, Rangi RK, Basu D, Das S (2009) A molecular insight into the early
events of Chickpea ( Cicer arietinum) and Fusarium oxysporum f. sp. ciceri (Race 1) interac-
tion through cDNA-AFLP analysis. Phytopathology 99:1245–1257
Gupta S, Chakraborti D, Sengupta A, Basu D, Das S (2010) Primary metabolism of chickpea is the
initial target of wound inducing early sensed Fusarium oxysporum f. sp. ciceri Race 1. PLoS
ONE 5(2):e9030
Gust AA et al (2010) Biotechnological concepts for improving plant innate immunity. Curr Opin
Hackauf B, Wehling P (2002) Identification of microsatellite polymorphisms in an expressed por-
tion of the rye genome. Plant Breed 121:17–25
Han Z, Wang C, Song X, Guo W, Gou J, Li C, Chen X, Zhang T (2006) Characteristics, develop-
ment and mapping of Gossypium hirsutum derived EST-SSRs in allotetraploid cotton. Theor
Harris LJ, Alexander NJ, Saparno A, Blackwell B, McCormick SP, Desjardins AE, Robert LS,
Tinker N, Hattori J, Piche C, Schernthaner J, Watson R, Ouellet T (2007) A novel gene cluster
in Fusarium graminearum contains a gene that contributes to butenolide biosynthesis. Fungal
Genet Biol 44:293–306
Hey SJ et al (2010) The interface between metabolic and stress signaling. Ann Bot Rev 105:197–
203
Howard PC, Eppley RM, Stack ME, Warbritton A, Voss KA, Lorentzen RJ, Kovach RM, Bucci TJ
(2001) Fumonisin B1 carcinogenicity in a two-year feeding study using F344 rats and B6C3F1
mice. Environ Health Perspect 109(S2):277–282
Howe GA, Jander G (2008) Plant Immunity to Insect Herbivores. Ann Rev Plant Biol 59:41–66
Idnurm A, Howlett BJ (2001) Pathogenicity genes of phytopathogenic fungi. Mol Plant Pathol
2:241–255
Inoue I, Namiki F, Tsuge T (2002) Plant colonization by vascular wilt fungus Fusarium oxysporum
requires FOW1, a gene encoding a mitochondrial protein. Plant Cell 14:1869–1883
Jonkers W, Estrada AER, Lee K, Breakspear A, May G, Kistler HC (2012) Metabolome and tran-
scriptome of the interaction between Ustilago maydis and Fusarium verticillioides in vitro.
Appl Environ Microbiol 78(10):3656–3667
Kakirde KS et al (2010) Size does matter: application-driven approaches for soil metagenomics.
Soil Biol Biochem 42:1911–1923
Kempema LA, Cui X, Holzer FM, Walling LL (2007) Arabidopsis transcriptome changes in re-
sponse to phloem-feeding silverleaf whitefly nymphs. Similarities and distinctions in respons-
es to aphids. Plant Physiol 143:849–865
Kim YT, Lee YR, Jin J, Han KH, Kim H, Kim JC, Lee T, Yun SH, Lee YW (2005) Two different
polyketide synthase genes are required for synthesis of zearalenone in Gibberella zeae. Mol
Knowledge-based Oryza Molecular Biological Encyclopedia. http://cdna01.dna.affrc.go.jp/
cDNA/
Kriek NPJ, Kellerman TS, Marasas WFO (1981) A comparative study of the toxicity of Fusarium
verticillioides (= F. moniliforme) to horses, primates, pigs, sheep and rats. Ondersterpoort J Vet
Res 48:129–131
Kunz BA et al (2008) UV-induced DNA damage promotes resistance to the biotrophic pathogen
Hyaloperonospora parasitica in Arabidopsis. Plant Physiol 148:1021–1031
Kusnierczyk A, Winge P, Jorstad TS, Troczynska J, Rossiter JT et al (2008) Towards global under-
standing of plant defence against aphids—timing and dynamics of early Arabidopsis defence
responses to cabbage aphid (Brevicoryne brassicae) attack. Plant Cell Environ 31:1097–1115
Larsen PE et al (2011) Using next generation transcriptome sequencing to predict an ectomycor-
rhizal metabolome. BMC Syst Biol 5:70
Lee B, Lee S, Ryu C-M (2012) Foliar aphid feeding recruits rhizosphere bacteria and primes plant
immunity against pathogenic and non-pathogenic bacteria in pepper. Ann Bot 110(2):281–290
Leilani AR, James BH, Gary AP (2006) Marker assisted breeding for host resistance to mycotoxin
contamination. In: Abbas HK (ed) Aflatoxin and food safety. CRC, Boca Raton, pp 423–426
Leon-Reyes A, Van der Does D, De Lange ES, Delker C, Wasternack C et al (2010) Salicylate-me-
diated suppression of jasmonate-responsive gene expression in Arabidopsis is targeted down-
stream of the jasmonate biosynthesis pathway. Planta (Berlin) 232:1423–1432
Levinson G, Gutman GA (1987) Slipped-strand mispairing: a major mechanism for DNA sequence
evolution. Mol Biol Evol 4:203–221
Lindsay JA (1997) Chronic sequelae of foodborne disease. Emerg Infect Dis 3:443–452
Liu X, Tang W-H, Zhao X-M, Chen L (2010) A network approach to predict pathogenic genes for
Fusarium graminearum. PLoS ONE 5(10):e13021 doi:10.1371/journal.pone.0013021
Ma LJ, van der Does HC, Borkovich KA, Coleman JJ, Daboussi MJ, Di Pietro A et al (2010)
Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature
464:367–373
Matilla MA et al (2010) Pseudomonas putida KT2440 causes induced systemic resistance and
changes in Arabidopsis root exudation. Environ Microbiol Rep 2:381–388
McMullen M, Jones R, Gallenberg D (1997) Scab of wheat and barley: a re-emerging disease of
devastating impact. Plant Dis 81:1340–1348
McSteen P, Zhao Y (2008) Plant hormones and signaling: Common themes and new develop-
ments. Developmental Cell 14:467–473
Memelink J (2009) Regulation of gene expression by jasmonate hormones. Phytochemistry
70:1560–1570
Mendes R et al (2011) Deciphering the rhizosphere microbiome for disease-suppressive bacteria.
Science 332:1097–1100
Michielse CB, Rep M (2009) Pathogen profile update: Fusarium oxysporum. Mol Plant Pathol
10:311–324
Michielse CB, van Wijk R, Reijnen L, Cornelissen BJC, Rep M (2009) Insight into the molecular
requirements for pathogenicity of Fusarium oxysporum f. sp. lycopersici through large-scale
insertional mutagenesis. Genome Biol 10(1):R4. (ISSN 14656906)
Morales SE, Holben WE (2011) Linking bacterial identities and ecosystem processes: can ‘omic’
analyses be more than the sum of their parts? FEMS Microbiol Ecol 75:2–16
Morgante M, Hanafey M, Powell W (2002) Microsatellites are preferentially associated with non-
repetitive DNA in plant genomes. Nat Genet 30(2):194–200
Mule G, Gonzalez-Jaen MT, Hornok L, Nicholson P, Waalwijk C (2005) Advances in molecular
diagnosis of toxigenic Fusarium species: a review. Food Addit Contam 22:316–323
Munkvold GP, McGee DC, Carlton WM (1997) Importance of different pathways for maize kernel
infection by Fusarium moniliforme. Phytopathology 87:209–217
Murphy M, Armstrong D (1995) Fusariosis in patients with neoplastic disease. Infect Med 12:66–67
Mur LAJ, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-
specific interactions between salicylate and jasmonate signaling include synergy, antagonism,
and oxidative stress leading to cell death. Plant Physiol 140:249–262
Nayaka SC, Wulff EG, Udayashankar AC, Nandini BP, Niranjana SR, Mortensen CN, Prakash HS
(2011) Prospects of molecular markers in Fusarium species diversity. Appl Microbiol Biotech-
nol 90:1625–1639
NCBI Basic Local Alignment and Search Tool. http://www.ncbi.nlm.nih.gov/BLAST/
NCBI Expressed Sequence Tags Database. http://www.ncbi.nlm.nih.gov/dbEST/
Oberhardt MA et al (2009) Applications of genome-scale metabolic reconstructions. Mol Syst
Biol 5:320
O’Donnell K, Cigelnik E (1997) Two divergent intragenomic rDNA ITS2 types within a mono-
phyletic lineage of the fungus Fusarium are nonorthologous. Mol Phylogenet Evol 7:103–116
O’Donnell K, Cigelnik E, Nirenberg HI (1998) Molecular systematics and phylogeography of the
Gibberella fujikuroi species complex. Mycologia 90:465–493
O’Donnell K, Kistler HC, Tacke BK, Casper HH (2000) Gene genealogies reveal global phylo-
geographic structure and reproductive isolation among lineages of Fusarium graminearum, the
fungus causing wheat scab. Proc Natl Acad Sci U S A 97:7905–7910
O’Donnell K, Sutton DA, Rinaldi MG, Magnon KC, Cox PA, Revankar SG et al (2004) Genetic
diversity of human pathogenic members of the Fusarium oxysporum complex inferred from
multilocus DNA sequence data and amplified fragment length polymorphism analyses: evi-
dence for the recent dispersion of a geographically widespread clonal lineage and nosocomial
origin. J Clin Microbiol 42:5109–5120
Parker IM, Gregory SG (2004) The evolutionary ecology of novel plant—pathogen interactions.
Annu Rev Ecol Syst 35:675–700
Peakall R, Gilmore S, Keys W, Morgante M, Rafalski A (1998) Cross species amplification of soy-
bean (Glycine max) simple sequence repeat (SSRs) within the genus and other legume genera:
implication for transferability of SSRs in plants. Mol Biol Evol 15:1275–1287
Peleg Z, Blumwald E (2011) Hormone balance and abiotic stress tolerance in crop plants. Curr
Opin Plant Biol 14:290–295
Pieterse CMJ, Dicke M (2007) Plant interactions with microbes and insects: from molecular mech-
anisms to ecology. Trends Plant Sci 12:564–569
Pieterse CMJ et al (2009) Networking by small-molecule hormones in plant immunity. Nat Chem
Biol 5:308–316
Polesani M, Desario F, Ferrarini A, Zamboni A, Pezzotti M, Kortekamp A, Polverari A (2008)
c-DNA-AFLP analysis of plant and pathogen genes expressed in grapevine infected with Plas-
mopara viticola. BMC Genomics 9:142–153
Powell W, Machray GC, Provan J (1996) Polymorphism revealed by simple sequence repeats.
Power W, Machray GC, Povran J (1996) Polymorphism revealed by simple sequence repeats.
Proctor RH, Desjardins AE, Brown DW, McCormick SP, Butchko RAE, Alexander N, Busman M
(2006) Biosynthesis of Fusarium mycotoxins and genomics of Fusarium verticillioides. My-
cotoxin Res 22(2):75–78
Puthoff DP, Holzer FM, Perring TM, Walling LL (2010) Tomato pathogenesis-related protein
genes are expressed in response to Trialeurodes vaporiorium and Bemisia tabaci type B feed-
ing. J Chem Ecol 36:1271–1285
Raghavendra AS et al (2010) ABA perception and signaling. Trends Plant Sci 15:395–401
Richards RI, Sutherland GR (1992) Heritable unstable DNA sequences. Nat Genet 1:7–9
Roa AC, Chavarriaga-Aguirre P, Duque MC, Maya MM, Bonierbale MW, Iglesias C, Tohme J
(2000) Cross-species amplification of cassava ( Manihot esculenta) ( Euphorbiaceae) microsat-
ellites: allelic polymorphism and degree of relationship. Am J Bot 87:1647–1655
Rodriguez-Hernandez AM, Gosalvez B, Sempere RN, Burgos L, Arnada MA, Truniger V (2012)
Melon RNA interference (RNAi) lines silenced for Cm-eIF4E show broad virus resistance.
Mol Plant Pathol 13(7):755–763
Roh SW, Abell GC, Kim KH, Nam YD, Bae JW (2010) Comparing microarrays and next-
generation sequencing technologies for microbial ecology research. Trends Biotechnol
28:291–299
Rosewich UL, Pettway RE, Katan T, Kistler HC (1999) Population genetic analysis corroborates
dispersal of Fusarium oxysporum f. sp radicis-lycopersici from Florida to Europe. Phytopa-
thology 89:623–630
Saha MC, Mian MA, Eujayl I, Zwonitzer JC, Wang L, May GD (2004) Tall fescue EST-SSR mark-
ers with transferability across several grass species. Theor Appl Genet 109:783–791
Sestili S, Polverari A, Luongo L, Ferrarini A, Scotton M, Hussain J, Delledonne M, Ficcadenti
N, Belisario A (2011) Distinct colonization patterns and cDNA-AFLP transcriptome profiles
in compatible and incompatible interactions between melon and different races of Fusarium
oxysporum f. sp. melonis. BMC Genomics 12:122. doi:10.1186/1471-2164-12-122
Schenk PM, Carvalhais LC, Kazan K (2012) Unravelling plant—microbe interactions: can multi-
species transcriptomics help? Trends Biotechnol 30(3):177–184
Schwessinger B, Ronald PC (2012) Plant innate immunity: perception of conserved microbial
signatures. Ann Rev Plant Biol 63:451–482
Scott KD, Eggler P, Seaton G, Rossetto M, Ablett EM, Lee LS, Henry RJ (2000) Analysis of SSRs
derived from grape ESTs. Theor Appl Genet 100:723–726
Seefelder W, Humpf H-U, Schwerdt G, Freudinger R, Gekle M (2003) Induction of apoptosis in
cultured human proximal tubule cells by fumonisins and fumonisin metabolites. Toxicol Appl
Pharmacol 192:146–153
Simon C, Daniel R (2011) Metagenomic analyses: past and future trends. Appl Environ Microbiol
77:1153–1161
Sims JW, Fillmore JP, Warner DD, Schmidt EW (2005) Equisetin biosynthesis in Fusarium het-
erosporum. Chem Commun 186–188
Stewart F et al (2010) Development and quantitative analyses of a universal rRNA-subtraction
protocol for microbial metatranscriptomics. ISME J 4:896–907
Stout MJ, Thaler JS, Thomma B (2006) Plant-mediated interactions between pathogenic microor-
ganisms and herbivorous arthropods. Ann Rev Entomol 51:663–689
Szafranska K, Fusari F, Luongo L, Ferrarini A, Polverari A, Delledonne M, Ficcadenti N, Sestili S,
Belisario A (2008) Fusarium wilt infection in melon: a transcriptomic approach to characterize
the genetic dialogue between host and pathogen. In: Pitrat M (ed) Cucurbitaceae 2008, Pro-
ceedings of the IXth EUCARPIA meeting on genetics and breeding of Cucurbitaceae, Avignon,
France, pp 615–619
Takken F, Rep M (2010) The arms between tomato and Fusarium oxysporum. Mol Plant Pathol
11:309–314
Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, McCouch S (2001) Compu-
tational and experimental analysis of microsatellites in rice (O. sativa L.): frequency, length
variation, transposon associations, and genetic marker potential. Genome Res 11:1441–1452
Thaler JS, Bostock RM (2004) Interactions between abscisicacid-mediated responses and plant
resistance to pathogens and insects. Ecology 85:48–58
Thaler JS, Agrawal AA, Halitschke R (2010) Salicylate-mediated interactions between pathogens
and herbivores. Ecology 91:1075–1082
Thiel T, Michalek W, Varshney RK, Graner A (2003) Exploiting EST databases for the develop-
ment and characterization of gene derived SSR-markers in barley (Hordeum vulgare L.). Theor
Tian CF, Garnerone A-M, Mathieu-Demazière C, Masson-Boivin C, Batut J (2012) Plant-activated
bacterial receptor adenylate cyclases modulate epidermal infection in the Sinorhizobium meli-
loti—Medicago symbiosis. PNAS 109(17):6751–6756
Torben A, Ursula KF, Thomas D, Klaus KN, Thomas L (2007) Frequency, type, and distribution of
EST-SSRs from three genotypes of Lolium perenne, and their conservation across orthologous
sequences of Festuca arundinacea, Brachypodium distachyon, and Oryza sativa. BMC Plant
Biol 7:36
Trail F, Common R (2000) Perithecial development by Gibberella zeae: a light microscopy study.
Mycologia 92:130–138
Trewavas A (2009) What is plant behavior? Plant Cell Environ 32:606–616
UniProtKB Swiss-Prot and TrEMBL. http://www.expasy.ch/sprot/databases
Varshney RK, Graner A, Sorrells ME (2005a) Genic microsatellite markers in plants: features and
applications. Trends Biotechnol 23(1):48–55
Varshney RK, Sigmund R, Boerner A, Korzun V, Stein N, Sorrells ME, Langridge P, Graner A
(2005b) Interspecific transferability and comparative mapping of barley EST-SSR markers in
wheat, rye, and rice. Plant Sci 168:195–202
Verhage A, van Wees SCM, Pieterse CMJ (2010) Plant immunity: It's the hormones talking, but
what do they say? Plant Physiol 154:536–540
Voge C, Marcotte EM (2012) Insights into the regulation of protein abundance from proteomic and
transcriptomic analyses. Nat Rev Genet 13:227–232
Vuylsteke M, Peleman JD, van Eijk MJT (2007) AFLP-based transcript profiling (cDNA-AFLP)
for genome-wide expression analysis. Nat Protoc 2:1399–1413
Walling LL (2009) Adaptive defense responses to pathogens and pests. Adv Bot Res 51:551–612
Wang X, Tang C, Zhang G, Li Y, Wang C, Liu B, Qu Z, Zhao J, Han Q, Huang L, Chen X, Kang Z
(2009) cDNA-AFLP analysis reveals differential gene expression in compatible interaction of
wheat challenged with Puccinia striiformis f. sp. tritici. BMC Genomics 10:289
Weber JL (1990) Informativeness of human (dC-dA)n, (dG-dT)n polymorphisms. Genomics
7:524–530
Webster RK, Gunnell PS (1992) Compendium of rice diseases. APS Press, The American Phyto-
pathological Society, St. Paul
White DG (1999) Compendium of corn diseases. APS Press, The American Phytopathological
Society, St. Paul
White G, Powell W (1997) Isolation and characterization of microsatellite loci in Swietenia humi-
lis ( Meliaceae): an endangered tropical hardwood species. Mol Ecol 6:851–860
Wierdl M, Dominska M, Petes TD (1997) Microsatellite instability in yeast: dependence on the
length of the microsatellite. Genetics 146:769–779
Wilson TM, Ross PF, Owens DL, Rice LG, Green SA, Jenkins SJ, Nelson HA (1992) Experimen-
tal reproduction of ELEM—a study to determine the minimum toxic dose in ponies. Myco-
pathologia 117:115–120
Windels, CE (2000) Economic and social impacts of Fusarium head blight: changing farms and
rural communities in the northern great plains. Phytopathology 90:17–21
Wise RP, Moscou MJ, Bogdanove AJ, Whitham SA (2007) Transcript profiling in host-pathogen
interactions. Annu Rev Phytopathol 45:329–369
Wulff EG, Sørensen JS, Lübeck M, Nielsen KF, Thrane U, Torp J (2010) Fusarium spp. associ-
ated with rice Bakanae: ecology, genetic diversity, pathogenicity and toxigenicity. Environ
Wurtzel O, Sesto N, Mellin JR, Karunker I, Edelheit S, Bécavin C, Archambaud C, Cossart P,
Sorek R (2012) Comparative transcriptomics of pathogenic and non-pathogenic Listeria spe-
cies. Mol Syst Biol 8:583
Yao DX et al (2011) Transcriptome analysis reveals salt-stress regulated biological processes and
key pathways in roots of cotton ( Gossypium hirsutum L.). Genomics 98:47–55
Yli-Mattila T, Gagkaeva T (2010) Molecular chemotyping of Fusarium gramineaum, F. culmorum
and F. cerealis isolates from Finland and Russia. In: Gherbawy Y, Voigt K (eds) Molecular
identification of fungi. Springer, Berlin, pp 159–178
Yli-Mattila T, Paavanen-Huhtala S, Bulat SA, Alekhina IA, Nirenberg HI (2002) Molecular,
morphological and phylogenetic analysis of the Fusarium avenaceum/F. arthrosporioides/F.
tricinctum species complex a polyphasic approach. Mycol Res 106:655–669
Zabala MD et al (2009) Antagonism between salicylic and abscisic acid reflects early host-patho-
gen conflict and moulds plant defense responses. Plant J 59:375–386
Zabalgogeazcoa I (2008) Fungal endophytes and their interaction with plant pathogens. Span J
Agric Res 6:138–146
Zarate SI, Kempema LA, Walling LL (2007) Silverleaf whitefly induces salicylic acid defenses
and suppresses effectual jasmonic acid defenses. Plant Physiol 143:866–875
Zeller KA, Summerall BA, Ballock S, Leslie JF (2003) Gibberella konza ( Fusarium konzum) sp.
nov. from prairie grasses, a new species in the Gibberella fujikuroi species complex. Mycologia
95:943–954
Zhang PJ, Zheng SJ, van Loon JJA, Boland W, David A et al (2009) Whiteflies interfere with indi-
rect plant defense against spider mites in Lima bean. P Natl Acad Sci USA 106:21202–21207
Zhao XM, Tang W, Chen L (2008a) Motif based identification of pathogenic patterns for fila-
mentous fungi. The second international symposium on optimization and systems biology,
pp 115–122
Zhao XM, Wang RS, Chen L, Aihara K (2008b) Uncovering signal transduction networks from
high-throughput data by integer linear programming. Nucleic Acids Res 36:e48–e48
Zhao XM, Wang Y, Chen L, Aihara K (2008c) Gene function prediction using labeled and unla-
beled data. BMC Bioinformatics 9:57
Zhao XM, Zhang XW, Tang WH, Chen L (2009) FPPI: Fusarium graminearum protein—protein
interaction database. J Proteome Res 8:4714–4721
Zhao ZX et al (2010) ABA-regulated G protein signaling in Arabidopsis guard cells: a proteomic
perspective. J Proteome Res 9:1637–1647
Zvirin T, Herman R, Brotman Y, Denisov Y, Belausov E, Freeman S, Perl- Treves R (2010) Dif-
ferential colonization and defense responses of resistant and susceptible melon lines infected
by Fusarium oxysporum race 1–2. Plant Pathol 59:576–585
Chapter 9
Coping Abiotic Stress with Plant Volatile
Organic Chemicals (PVOCs): A Promising
Approach
Penna Suprasanna and Prasad Shekhar Variyar
Abstract Abiotic stresses including salinity are a major threat to agricultural pro-
ductivity and hence global food security. Crop plants have adopted specialized
strategies to reduce the impact of stress. The biogenic volatile organic compounds
(VOCs) emitted from a wide range of plants help enable the buildup defense
against biotic and abiotic stresses. Plant VOCs are comprised of different isoprene
and monoterpene class of compounds in addition to alkanes, alkenes, carbonyls,
alcohols, esters, ethers, and acids which have a demonstrated role against abiotic
stress factors. Although it has been shown that several metabolic pathways may be
involved in building up the defense, antioxidant route of alleviation is believed to
be a common mechanism. The identification of the genes, transcriptomic profiling
and proteins of the biosynthetic pathway has enabled ways to manipulate the syn-
thesis of isoprenoid compounds. In recent years, there has been a growing interest
in adopting VOC strategy to alleviate abiotic stresses in crop plants.
Introduction
Environmental stress is a major threat to agricultural productivity and plants have

adopted specialized strategies to reduce the impact of stress. The abiotic stresses
include drought, salinity, cold and high temperature that affect the plant growth, de-
velopment and yields of crop plants. Plants being sessile, experience multiple stress-
es in their life cycle and hence the tolerance trait has become complex to be under-
stood and managed. Among the different abiotic stresses, salinity stress is the most
severe limiting crop productivity. Salinity interferes with the plant’s accessibility to
P. Suprasanna ()
Nuclear Agriculture and Biotechnology Division, Bhabha Atomic Research Centre,
Trombay, Mumbai 400085, India
P. S. Variyar
Food Technology Division, Bhabha Atomic Research Centre,
Trombay, Mumbai 400085, India

296 P. Suprasanna and P. S. Variyar
nutrients and water. Moreover, it induces osmotic stress; the physiological drought,
which typically reduces the growth and photosynthesis in plants (Munns and Tester
2008). Salinity affects plant growth and development in two ways: through osmotic
stress by reducing the soil water potential leading to limiting the water uptake and
by causing uptake of Na+ and Cl− which have an effect on plant metabolism. The
mechanism by which plants perceive stress signals and relay their transmission to
cellular machinery to trigger adaptive responses is crucial for the improvement of
different strategies to impart stress tolerance in crops (Mantri et al. 2012).
The different abiotic stress factors result in the production of reactive oxygen
species (ROS) that are extremely reactive and cause damage to biological macro-
molecules like proteins, lipids, carbohydrates and DNA ultimately leading to oxi-
dative stress. The ROS include, superoxide radicals, hydroxyl radical, perhydroxy
radical, alkoxy radicals, hydrogen peroxide and singlet oxygen (Gill and Tuteja
2010). Under normal growth conditions, the ROS molecules are managed by effi-
cient scavenging machinery consisting of various antioxidative defense mechanisms
(Foyer and Noctor 2005). The production of ROS and their scavenging needs to be
balanced under normal conditions of growth but, however the equilibrium is dis-
turbed by abiotic stress factors including salinity (Tuteja 2007; Mantri et al. 2012).
Volatile Organic Compounds (VOC’s) and Their Action
Plants are sessile and have to encounter challenges imposed by other organisms and
with the environment mainly by depending on their chemical repertoire. The signif-
icance of natural products and their metabolic diversity contribute very much to the
survival of the plant kingdom. The biogenic volatile organic compounds (VOCs)
released from a wide range of plants help enable the buildup defense against insects,
fungi, herbivores and environmental changes (Loreto and Schnitzler 2010; Holo-
painen and Blande 2012). Plant VOCs are comprised of isoprenoids mainly isoprene
and monoterpenes (Variyar et al. 2010). The function of isoprenoid compounds dur-
ing environmental stress includes protection of the photosynthetic apparatus, de-
toxification from free radicals and reactive oxygen species (ROS) (Munné-Bosch
and Alegre 2000a; Spinelli et al. 2011). Although it has been shown that several
metabolic pathways may be involved in building up the defense, antioxidant route is
believed to be the common mechanism (Vickers et al. 2009a). The identification of
genes in the biosynthetic pathway and transcriptomic profiling has enabled ways to
manipulate the synthesis of isoprenoid compounds. Since chloroplasts are the sites
of isoprene synthesis a possible relation may occur between isoprene production
and environmental stresses affecting the photosynthetic apparatus (Velikova 2008;
Loyola et al. 2012). It should thus be of interest to investigate isoprene synthesis in
plants in relation to environmental chemistry. The emission of VOCs contributes to
an appreciable quantity of photosynthetic carbon fixation under stress conditions,
and hence VOCs could also play a significant role in the carbon exchange between
the biosphere and the atmosphere (Guenther et al. 2011). Significant research prog-
9 Coping Abiotic Stress with Plant Volatile Organic Chemicals (PVOCs) … 297
ress has been made in the study of physiological mechanism(s) underlying iso-
prenoid synthesis under abiotic stress conditions, especially high temperatures and
oxidative stress conditions (Fineschi and Loreto 2012).
Isoprenoids protect plants against different abiotic stresses through improving
the ability of plants to deal with cellular oxidative modifications, possibly through
reaction of isoprenoids with the oxidizing species, or alteration of ROS signaling, or
via membrane stabilization. It is postulated that dissolution of VOCs in membranes
coupled to interactions with membrane proteins can lead to changes in transmem-
brane potential and modulation of ion fluxes thereby inducing gene activity and a
subsequent cellular response to stress (Vickers et al. 2009a). Plants have developed
an efficient antioxidant mechanisms for ROS detoxification (Ahmad et al. 2008;
Gill and Tuteja 2010; Ahmad and Umar 2011). Isoprenes can boost plant’s defense
system not only by keeping the membrane integrity intact and making it less sensi-
tive to denaturation, but also due to the fact that they have the capacity to quench
ROS produced under oxidative stress. Vickers et al. (2009a) discussed the possible
functions of isoprenes as natural antioxidant machinery in plants.
Plants are endowed with protective mechanisms to cope with a variety of abiotic
stresses. When the stress impact goes beyond a certain threshold, plants normally
experience stress, resulting in reduced growth and development. Most common and
ensuing response, thus, is the production of reactive oxygen spices (ROS). The
antioxidant effect of the isoprenoid compounds is mediated by their capacity to
swiftly combine with different ROS such as singlet oxygen, superoxide, hydro-
gen peroxide, hydroxyl radical that are released under stress regime (Holopainen
2004; Fineschi and Loreto 2012). Isoprenes are also known to alleviate visible dam-
age (necrosis) of leaves exposed to ozone through a mechanism involving release
of nitric oxide that interacts with increasing levels of ROS especially hydrogen
peroxide. The occurrence of conjugated double bonds (delocalized π-electrons) in
the isoprene molecule may mediate electron and energy transfers, conferring ROS-
scavenging ability (Vickers et al. 2009a). Considering chloroplast as the site of iso-
prene biosynthesis (Logan et al. 2000), the ROS scavenging ability of isoprene
molecule makes it important in plant defense against oxidative stress. Isoprenoids
including terpenoids have also been shown to confer a protective effect on photo-
synthetic process under heat and oxidative stress (Sharkey and Yeh 2001). Isoprenes
have also been implicated to protect the photosynthetic system from thermal stress.
The mechanism underlying such protective nature is attributed to the stabilization
of membrane lipid bilayer by enhancing the hydrophobic (lipid–lipid, lipid–pro-
tein and/or protein–protein) interactions (Sharkey et al. 2008). Based on modeling
studies with membranes, Siwko et al. (2007) demonstrated that isoprenes are able
to partition into the phospholipid membrane enhancing membrane order without
major alteration in the dynamic properties of the membrane.
Much less evidence has been accumulated so far on the role of volatile monoter-
penes in alleviating oxidative stress. In plants that don’t emit monoterpenes, it has
been proved that photosynthesis becomes less sensitive to ozone that are externally
supplied with volatile monoterpenes (Loreto and Fares 2007). In contrast, when
monoterpene synthesis is blocked, ROS rapidly accumulate. The highly volatile
Table 9.1 List of cloned genes involved in the biosynthesis of monoterpenes

Gene Organism References
Linalool synthase Clarkia breweri; Arte- Dudareva et al. (1996); Cseke
misia annua L. et al. (1998); Jia et al.
(1999)
(−)-Limonene synthase Abies grandis; Mentha Colby et al. (1993); Bohlmann
spicata et al. (1997)
( + )-Limonene synthase Agastache rugoa Maruyama et al. (2002)
(−)-Pinene synthase Abies grandis Bohlmann et al. (1997)
Myrcene synthase Abies grandis, Quercus Bohlmann et al. (1997);
ilex L.; Arabidopsis Bohlmann et al. (2000);
thaliana Fischbach et al. (2001)
β-Ocimene synthase Arabidopsis thaliana Bohlmann et al. (2000)
( +)-Bornyl diphosphate synthase, Salvia offcinalis Wise et al. (1998)
1,8 cineole synthase and
( + )-Sabinene synthase
(−)-β-Phellandrene synthase, Abies grandis Bohlmann et al. (1999)
(−)-camphene synthase, Terpi-
nolene synthase and (−)- limo-
nene/(−)-α-pinene synthase
(E)-Beta farnesene synthase Citrus junos Maruyama et al. (2001)
monoterpenes exhibit more effectiveness in scavenging antioxidants. On the other

hand, the less volatile isoprenes pool up in membrane and intercellular spaces and
thus become more effective antioxidants in the aqueous phase. Volatile sesqui-
terpenes are produced in high levels in ozone-resistant tobacco upon exposure to
ozone. It is thus possible that volatile isoprenoids constitute one of the non-enzy-
matic oxidative defense systems thereby, reducing the oxidative damage caused by
abiotic stresses.
Monoterpenes have different effects on plant growth and development, depend-
ing on their structure and the quantity. Thus α-pinene exerts protective effect on
the photosynthetic apparatus, while α-terpinol shows toxicity. Monoterpenes exog-
enously applied at levels of 0.5 g/l exhibited toxicity in plant cell cultures (Brown
et al. 1987). Monoterpenes such as cineole, thymol, geraniol, menthol and camphor
induced oxidative stress and lipid oxidation in maize roots (Zunino and Zygadlo
2004) while, β-myrcene, limonene, β-ocimene and γ-terpinene generated ROS and
oxidative damage (Singh et al. 2009). Menthol has shown an increase in cytosolic
free calcium ions which can generate signal transduction pathways in cucumber
roots (Maffei et al. 2001). The aliphatic monoterpenes (ocimene and myrcene) in-
duced considerable changes in the transcription of several hundred genes in Ara-
bidopsis, many of them are designated as transcription factors, stress and defence
genes (Godard et al. 2008). Several genes involved in the biosynthesis of terpenes
have now been cloned in different plants (Phillips et al. 2006; Christianson 2006;
Degenhardt et al. 2009). Table 9.1 lists some of the genes involved in the synthesis
of monoterpenes.
Salt stress is known to mimic water stress limiting CO2 inflow by lowering con-
ductance of stomata and mesophyll and by impairing carbon metabolism (Delfine
et al. 1998, 1999). Loreto and Delfine (2000) tested whether revival from mod-
est salt treatment could result in bursts of isoprene emission and concluded that
the progression leading to isoprene release is resistant than photosynthesis to salt
stress, and that a secondary source of isoprene, independent of photosynthesis, is
induced by salt-stress. In case of short-term drought stress, significant reductions in
photosynthesis were observed, whereas isoprene emission was either not repressed
or became reduced in Quercus virginiana (Tingey et al. 1981) and Pueraria lo-
bata (Sharkey and Loreto 1993). On the other hand, there was a good relationship
between terpene emission and plant water status. The emission of several mono-
terpenes and sesquiterpenes was studied in Mediterranean species ( Rosmarinus of-
ficinalis, Pinus halepensis, Cistus albidus and Quercus coccifera) upon subjecting
them to long term water dehydration stress (Ormeno et al. 2007). There was a slow
decrease of emissions in plants exposed to long term water deficit periods in P.
halepensis and C. albidus as compared to decrease in sesquiterpene release of R.
officinali. Šimpraga et al. (2011) opined that drought stress can affect the VOC
emissions in plants. In their experiments with young Common beech, the authors
observed sudden burst of non-monoterpene class of VOCs during acute drought
stress indicating opportunities for plant sensing using VOCs.
Manipulating the Synthesis of VOCs
Isoprenoids have been demonstrated to confer defense against abiotic stress fac-
tors, mainly thermal stress and oxidative stress conditions. A full understanding
of the function of terpenes in plant defense process will require experiments at the
molecular level, as terpenes may induce the expression of a number of stress-related
genes. Studies in this direction by using inhibitors like fossidomycin that can inhibit
the MEP pathway, fumigating non-isoprene synthesizing plants with exogenous iso-
prenoid compounds and transgenic plants either expressing terpene synthesis genes
or gene silencing, have yielded results supporting their protection against stresses
(Dudareva and Pichersky 2008; Vickers et al. 2009a).
The enzymes leading to the production of monoterpene all appear to be active
in the plastids, as all the genes in this pathway possess plastid-targeting signals
(Haudenschild and Croteau 1998) and seems to be localized in chloroplasts (Bou-
vier et al. 2000) and leucoplasts (Turner et al. 1999). The principal functional role
of isoprene emission in plants is associated with the protection of leaf physiological
processes against oxidative stress induced by heat (Sharkey and Yeh 2001). Behnke
et al. (2007) analyzed this ‘physiological role’ by testing transgenic Grey poplar
plants in which expression of isoprene synthase ( ISPS) was either silenced via RNA
interference (RNAi) mechanism or upregulated by over-expression of the ISPS
gene. Despite increased ISPS mRNA levels, there was no steady increase in isoprene
release in the over-expressing lines, suggesting that ISPS could be regulated at the
post-transcriptional level while in the RNAi lines, there was no isoprene emission.
The researchers also exposed transgenic lines to high temperature with three tem-
porary heat stages (38–40 °C), followed by recovery at 30 °C. During heat stress,
the non-isoprene-emitting transgenic poplars exhibited low rates of net assimilation
and photosynthetic electron transport, compared to situation where there was no
stress. The poplars plants in which isoprene was repressed had an increased zeaxan-
thin in the absence of stress, suggesting increased non-photochemical quenching
or may indicate an increased necessity for antioxidants (Behnke et al. 2007). This
study demonstrated that down-regulation of isoprene can influence thermotolerance
and induce increased energy dissipation by non-photochemical quenching path-
ways. Isoprene synthase transcription has been shown to increase as leaves undergo
maturity (Wiberley et al. 2005) and is temperature- and light responsive (Sasaki
et al. 2005; Cinege et al. 2008). Variation in the accumulation of isoprene synthase
protein is also observed under different environmental conditions (Schnitzler et al.
2005; Wiberley et al. 2009; Calfapietra et al. 2007).
Transgenic tobacco ( Nicotiana tabacum L.) plants transformed with an isoprene
synthase gene (from poplar) showed isoprene emission at comparable amounts to
a natural situation. These transgenic plants when subjected to heat and combined
heat/light exhibited considerable tolerance to stress-induced oxidative stress (Vick-
ers et al. 2009b). Further, Vickers et al. (2011) used transgenic tobacco lines harbor-
ing a poplar isoprene synthase gene and then examined control of isoprene emis-
sion. In mature transgenic tobacco leaves, it was observed that primary controls on
isoprene emission was thought to be via the substrate supply and changes in enzyme
kinetics rather than changes in isoprene synthase levels or post-translational regula-
tion of activity. The transgenic tobacco plants also had emission patterns remark-
ably similar to naturally emitting plants under a wide variety of conditions and the
emissions correlated with photosynthetic rates in developing and mature leaves, and
with the amount of isoprene synthase protein in mature leaves. Isoprene synthase
protein levels did not change under short-term increase in heat/light, despite an
increase in emissions under these conditions. In a study with a halophytes ( Kande-
lia candel) and Bruguiera gymnorrhiza, mRNA expression of four oxidosqualene
cyclase ( OSC) genes namely, KcMS multifunctional terpenoid synthase and Kc-
CAS cyloartenol synthase ( K. candel), BgbAS ß-amyrin synthase and BgLUS lupeol
synthase ( B. gymnorrhiza) in relation to salt concentration was analyzed (Basyunia
et al. 2009). The mRNA levels of KcMS in both roots and leaves of K. candel and
BgLUS and BgbAS in the roots of B. gymnorrhiza increased with salt concentration.
This result suggested that the function of terpenoids in root is associated with the
salt stress.
Attempts have been made to over-accumulate isoprenoids in transgenic plants
to study their role in stress alleviation. Over-expression of Hevea brasiliensis 3-hy-
droxy-3-methylglutaryl coenzyme A reductase (HMGR) in transgenic tobacco led
to an increase in sterol production (Schaller et al. 1995). Neelakandan et al. (2011)
over-expressed Arabidopsis HMGR1 in soybean, resulting in greater seed sterol
content. The Populus alba isoprene synthase gene was introduced into Arabidopsis
and has shown to confer elevated heat tolerance in the transgenic lines over wild
type (Sasaki et al. 2007). Similarly, the content in some plastidial isoprenoids has
also been successfully enhanced in plants through genetic engineering. Transgenic
mint over-expressing 1-deoxy-D-xylulose-5-phosphate synthase, one of the entry
enzymes into the MEP pathway (DXS), showed increased essential oil content
(Mahmoud and Croteau 2001). Arabidopsis plants over-expressing Brassica juncea
3-hydroxy-3-methylglutaryl-CoA synthase gene ( BjHMGS), coding for the second
enzyme in the cytosolic isoprenoid biosynthesis pathway, have been shown to pro-
vide enhanced fungal and hydrogen peroxide-tolerance (Wang et al. 2011). The
Brassica gene was found to be down-regulated by abscisic acid, mannitol, and water
stress, but up-regulated by growth regulators like salicylic acid, methyl jasmonate,
and wounding, suggesting that it could have a role in plant stress resistance.
The genetic engineering of volatile compounds have also brought to light some
genetic changes on plant growth and development, and challenges to accomplish
efficient production of the suitable volatile terpenoid compounds in a spatial and
temporal mode (Dudareva and Pichersky 2008). For example in Arabidopsis, over-
expression of FaNES1 resulted in the diversion of carbon to linalool production,
without affecting the levels of chlorophylls, lutein and bcarotene, and resulting in a
growth-retardation phenotype that was stable through several generations (Aharoni
et al. 2003). Transgenic potato engineered for linalool production resulted in growth
retardation and leaf bleaching of plants when grown in the greenhouse (Aharoni
et al. 2006). Transgenic tobacco containing high levels of patchoulol as a result of
the expression of PTS coupled with FPP synthase, both targeted to the plastids, led
to plants with growth disturbances like leaf chlorosis, vein clearing, and reduced
stature (Wu et al. 2006). Such growth abnormalities are attributed to the conse-
quences of the reduction of isoprenoid precursors for other metabolites which are
otherwise are essential for plant growth and development, or that the newly intro-
duced terpenoids could become toxic to plant cells.
A number of plant species synthesize myriad of isoprenoid for plant growth,
development and for adaptation to environment (Leivara et al. 2011). The enzyme
3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) in the mevalonate pathway
is modulated by many endogenous and external stimuli. Two B′′ regulatory sub-
units (B′′α and B′′β) of protein phosphatase 2A (PP2A) interact with HMGR1S
and HMGR1L, the two major isoforms of Arabidopsis thaliana HMGR (Leivara
et al. 2011). Since B′′α and B′′β are Ca2+ binding proteins of the EF-hand type, it
was found that PP2A modulates HMGR transcript. Under salt stress conditions, the
B′′α and PP2A mediated the decrease and subsequent increase of HMGR activity
in Arabidopsis seedlings, resulting from a steady rise of HMGR1-encoding tran-
script level and an early sharper reduction of HMGR protein level. In the non-stress
conditions, the PP2A operates as a posttranslational negative regulator of HMGR
activity with the involvement of B′′β. The authors suggested that PP2A can exert
multilevel regulation on HMGR through the five-member B′′ protein family in re-
sponse to stress conditions (Leivara et al. 2011).
The mevalonate pathway that mediates the production of isoprenoids has
been operative in higher eukaryotes. Brodersen et al. (2012) studied the necessi-
ty of isoprenoid biosynthesis for plant miRNA activity in Arabidopsis. In plants
ARGONAUTE (AGO) protein complexes are guided by microRNAs (miRNAs) to

regulate expression of complementary RNAs. Brodersen et al. (2012) used mad3
and mad4, the miRNA action deficient ( mad) mutants, for the isolation of genes in-
volved in isoprenoid biosynthesis. The 3-hydroxy-3-methylglutaryl CoA reductase
(HMG1), acting in the initial C5 building block biogenesis that precedes isoprenoid
metabolism and acts as a key regulatory enzyme controlling the amounts of iso-
prenoid end products is encoded by MAD3 while, the sterol C-8 isomerase that acts
downstream in dedicated sterol biosynthesis is encoded by MAD4. Complementa-
tion studies using yeast system and treatment in planta with an inhibitor of HMG1
(lovastatin), indicated that lack of catalytic activity in HMG1 is adequate to inhibit
miRNA activity. Further knockdown of HMG1/MAD3 reduced AGO1-membrane
interaction and specific hypomorphic mutant alleles of AGO1 displayed compro-
mised membrane association. The study has shown an interesting possibility that for
the activity of plant miRNAs, isoprenoid synthesis could be required and this could
unravel underlying mechanisms of microRNA function and regulation.
Abiotic stresses including salinity, drought and high temperature limit crop pro-
ductivity. In this regard, PVOCs either emitted or induced from different plant spe-
cies can be applied to confer better defense. Understanding of the biosynthesis of
volatile compounds and the genetic machinery involved has greatly contributed to
use this chemical repertoire for integrating biochemical, molecular and functional
data into stress alleviation. A complete picture of metabolic network of PVOC syn-
thesis and information on their regulation will necessitate further investigation. In
addition, screening and use of suitable compounds involved in the biosynthesis of
volatile-induced plant defenses will greatly facilitate fine tuning of plant responses
to stress factors. In the past decade, considerable progress has been made in the
metabolic engineering of the isoprenoid biosynthetic pathway in plants (Mahmoud
and Croteau 2001; Lucker et al. 2001; Nagegowda 2010). An increasing number of
successful attempts have raised hopes that their manipulation could offer a promis-
ing tool for increasing isoprenoid content for varied applications in stress tolerance
and protection from environmental damage.
Another direction in PVOCs is by using priming approach by which planting a
few transgenic plants that release defense volatiles in the field may contribute to
plant protection and provide an advantage to non-transgenic plants (Dudareva and
Pichersky 2008). In order to derive such benefits, it is imperative that we need to
investigate the molecular mechanisms underlying priming induced capacitance, the
detection of volatile signal components that activate the capacitance, species spe-
cific responses and molecular markers for the primed state in crop plants. It has also
been suggested that histone modifications that are operative during a primary event
might create memory associated reaction to a second stress exposure (Jaskiewicz
et al. 2011).
Plants produce a plethora of volatile compounds for both general and special-
ized functions (Ueda et al. 2012). The plant volatilome is defined as the complex
consortium of volatile organic compounds through different biosynthetic pathways
and produced by plants, constitutively and/or after induction, as a defense strategy
against biotic and abiotic stress (Maffei et al. 2007). An integrated approach will
greatly help our understanding about the metabolism, genomics and interactome of
the VOCs in plant’s adaptation to environmental stresses.
References
Aharoni A, Giri AP, Deuerlein S, Griepink F, de Kogel WJ, Verstappen FWA, Verhoeven HA,
Jongsma MA, Schwab W, Bouwmeester HJ (2003) Terpenoid metabolism in wild-type and
transgenic Arabidopsis plants. Plant Cell 15:2866–2884
Aharoni A, Jongsma MA, Kim TY, Ri MB, Giri AP, Verstappen FWA, Schwab W, Bouwmeester
HJ (2006) Metabolic engineering of terpenoid biosynthesis in plants. Phytochem Rev 5:49–58
Ahmad P, Sarwat M, Sharma S (2008) Reactive oxygen species, antioxidants and signaling in
plants. J Plant Biol 51(3):167–173
Ahmad P, Umar S (2011) Oxidative stress: role of antioxidants in plants. Studium Press Pvt Ltd,
New Delhi
Basyunia M, Babab S, Inafukua M, Iwasakia H, Kinjoc K, Okua H (2009) Expression of terpenoid
synthase mRNA and terpenoid content in salt stressed mangrove. J Plant Physiol 166:1786–1800
Behnke K, Ehlting B, Teuber M, Bauerfeind M, Louis S, Hänsch R, Polle A, Bohlmann J, Schnit-
zler JP (2007) Transgenic, non-isoprene emitting poplars don’t like it hot. Plant J 51:485–499
Bohlmann J, Martin D, Oldham NJ, Gershenzon J (2000) Terpenoid secondary metabolism in
Arabidopsis thaliana: cDNA cloning, characterization, and functional expression of a myrcene/
(E)-beta-ocimene synthase. Arch Biochem Biophys 375:261–269
Bohlmann J, Phillips M, Ramachandiran V, Katoh S, Croteau R (1999) cDNA cloning, charac-
terization, and functional expression of four new monoterpene synthase members of the Tpsd
gene family from grand fir ( Abies grandis). Arch Biochem Biophys 368:232–243
Bohlmann J, Steele CL, Croteau R (1997) Monoterpene synthases from grand fir ( Abies grandis).
cDNA isolation, characterization, and functional expression of myrcene synthase, (−)-(4S)-
limonene synthase, and (−)-(1S,5S)-pinene synthase. J Biol Chem 272:21784–21792
Bouvier F, Suire C, d’ Harlingue A, Backhaus RA, Camara B (2000) Molecular cloning of geranyl
diphosphate synthase and compartmentation of monoterpene synthesis in plant cells. Plant J
24:241–252
Brodersen P, Sakvarelidze-Achard L, Schaller H, Khafif M, Schott G, Bendahmane A, Voinnet O
(2012) Isoprenoid biosynthesis is required for miRNA function and affects membrane associa-
tion of ARGONAUTE 1 in Arabidopsis. Proc Natl Acad Sci USA 109:1778–1783
Brown JT, Hegarty PK, Charlwood BV (1987) The toxicity of monoterpenes to plant cell cultures.
Calfapietra C, Wiberley AE, Falbel TG, Linskey AR, Mugnozza GS, Karnosky DF, Loreto F, Shar-
key TD (2007) Isoprene synthase expression and protein levels are reduced under elevated O3
but not under elevated CO2 (FACE) in field-grown aspen trees. Plant Cell Environ 30:654–661
Christianson DW (2006) Structural biology and chemistry of the terpenoid cyclases. Chem Rev
106:3412–3442
Cinege G, Louis S, Hänsch R, Schnitzler JP (2008) Regulation of isoprene synthase promoter by
environmental and internal factors. Plant Mol Biol 69:593–604
Colby SM, Alonso WR, Katahira EJ, McGarvey DJ, Croteau R (1993) 4S-limonene synthase from
the oil glands of spearmint ( Mentha spicata): cDNA isolation, characterization, and bacterial
expression of the catalytically active monoterpene cyclase. J Biol Chem 268:23016–23024
Cseke L, Dudareva N, Pichersky E (1998) Structure and evolution of linalool synthase. Mol Biol
Evol 15:1491–1498
Degenhardt J, Köllner TG, Gershenzon J (2009) Monoterpene and sesquiterpene synthases and the
origin of terpene skeletal diversity in plants. Phytochemistry 70:1621–1637
Delfine S, Alvino A, Zacchini M, Loreto F (1998) Consequences of salt stress on diffusive conduc-
tances, Rubisco characteristics and anatomy of spinach leaves. Aust J Plant Physiol 25:395–402
Delfine S, Alvino A, Villani MC, Loreto F (1999) Restrictions to CO2 conductance and photosyn-
thesis in spinach leaves recovering from salt stress. Plant Physiol 119:1101–1106
Dudareva N, Cseke L, Blanc VM, Pichersky E (1996) Evolution of foral scent in Clarkia:
novel patterns of S-linalool synthase gene expression in the C. breweri flower. Plant Cell
8:1137–1148
Dudareva N, Pichersky E (2008) Metabolic engineering of plant volatiles. Curr Opin Biotechnol
19:1–9
Fineschi S, Loreto F (2012) Leaf volatile isoprenoids: an important defensive armament in forest
tree species. iForest 5:13–17
Fischbach RJ, Zimmer W, Schnitzler JP (2001) Isolation and functional analysis of a cDNA en-
coding a myrcene synthase from holm oak ( Quercus ilex L.). Eur J Biochem 268:5633–5638
Foyer CH, Noctor G (2005) Redox homeostis and antioxidant signaling: a metabolic interface
between stress perception and physiological responses. Plant Cell 17 1866–1875
Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant machinery in abiotic stress toler-
ance in crop plants. Plant Physiol Biochem 48:909–930
Godard KA, White R, Bohlmann J (2008) Monoterpene induced molecular responses in Arabidop-
sis thaliana. Phytochemistry 69:1838–1849
Guenther A, Kulmala M, Turnipseed A, Rinne J, Suni T, Reissell A (2011) Land ecosystem—
atmosphere observational networks. iLeaps Newsletter 11:5–13
Haudenschild CD, Croteau RB (1998) Molecular engineering of monoterpene production. Genet
Eng 20:267–280
Holopainen JK (2004) Multiple functions of inducible plant volatiles. Trends Plant Sci 9(11):
529–533
Holopainen JK, Blande JD (2012) Molecular plant volatile communication. Adv Exp Med Biol
739:17–31
Jaskiewicz M, Conrath U, Peterhänsel C (2011) Chromatin modification acts as a memory for
systemic acquired resistance in the plant stress response. EMBO Rep 12:50–55
Jia JW, Crock J, Lu S, Croteau R, Chen XY (1999) (3R)-linalool synthase from Artemisia annua L.
cDNA isolation, characterization, and wound induction. Arch Biochem Biophys 372:143–149
Leivara P, Antolín-Llovera M, Ferrero S, Closa M, Arró M, Ferrer A, Boronat A, Campos N (2011)
Multilevel control of Arabidopsis 3-hydroxy-3-methylglutaryl coenzyme A reductase by pro-
tein phosphatase 2A. Plant Cell 23:1494–511
Logan BA, Monson RK, Potosnak MJ (2000) Biochemistry and physiology of foliar isoprene
production. Trends Plant Sci 5:477–481
Loreto F, Delfine S (2000) Emission of Isoprene from Salt-Stressed Eucalyptus globulus leaves.
Loreto F, Fares S (2007) Is ozone flux Inside leaves only a damage indicator? Clues from volatile
isoprenoid studies. Plant Physiol 143:1096–1100
Loreto F, Schnitzler JP (2010) Abiotic stress and induced BVOCs. Trends Plant Sci 15:154–166
Loyola J, Verdugo E, Gonzalez I, Casaretto JA, Ruiz-Lara S (2012) Plastidic isoprenoid biosyn-
thesis in tomato: physiological and molecular analysis in genotypes resistant and sensitive to
drought stress. Plant Biol 14:149–156
Lucker J, Bouwmeester HJ, Schwab W, Jan B, Linus H, van der Plas W, Verhoeven HA (2001)
Expression of Clarkia S-linalool synthase in transgenic petunia plants results in the accumula-
tion of S-linalyl-b-Dglucopyranoside. Plant J 27:315–324
Maffei M, Camusso W, Sacco S (2001) Effect of Mentha x piperita essential oil and monoterpenes
on cucumber root membrane potential. Phytochemistry 8:703–707
Maffei ME, Mithofer A, Boland W (2007) Insects feeding on plants: rapid signals and responses
preceding the induction of phytochemical release. Phytochemistry 68:2946–2959
Mahmoud SS, Croteau R (2001) Metabolic engineering of essential oil yield and composition in
mint by altering expression of deoxyxylulose phosphate reductoisomerase and menthofuran
synthase. Proc Natl Acad Sci USA 98:8915–8920
Mantri N, Patade V, Suprasanna P, Rebecca Ford, Edwin Pang (2012) Abiotic stress responses in
plants—present and future. In: Parvaiz A, Prasad MNV (eds) Environmental adaptations to
changing climate: metabolism, productivity and sustainability. Springer, pp 1–20
Maruyama T, Ito M, Honda G (2001) Molecular cloning, functional expression and characteriza-
tion of (E)-beta farnesene synthase from Citrus junos. Biol Pharm Bull 24:1171–1175
Maruyama T, Saeki D, Ito M, Honda G (2002) Molecular cloning, functional expression and char-
acterization of d-limonene synthase from Agastache rugoa. Biol Pharm Bull 25:661–665
Munné-Bosch S, Alegre L (2000a) Changes in carotenoids, tocopherols and diterpenes during
drought and recovery, and the biological significance of chlorophyll loss in Rosmarinus of-
ficinalis plants. Planta 210:139–146
Munns R, Tester M (2008). Mechanisms of salinity tolerance. Annu Rev Plant Biol 59:651–681
Nagegowda DA (2010) Plant volatile terpenoid metabolism: biosynthetic genes, transcriptional
regulation and subcellular compartmentation. FEBS Lett 584:2965–2973
Neelakandan AK, Chamala S, Valliyodan B, Nes WD, Nguyen HT (2011) Metabolic engineering
of soybean affords improved phytosterol seed traits. Plant Biotechnol J 10:12–19
Ormeno E, Mévy JP, Vila B, Bousquet-Mélou A, Greff S, Bonin G, Fernandez C (2007) Water
deficit stress induces different monoterpene and sesquiterpene emission changes in Mediterra-
nean species. Relationship between terpene emissions and plant water potential. Chemosphere
67:276–284
Phillips DR, Rasbery JM, Bartel B, Matsuda SPT (2006) Biosynthetic diversity in plant triterpene
cyclization. Curr Opin Plant Biol. 9:305–314
Sasaki K, Ohara K, Yazaki K (2005) Gene expression and characterization of isoprene synthase
from Populus alba. FEBS Lett 579:2514–2518
Sasaki K, Saito T, Lämsä M, Oksman-Caldentey KM, Suzuki M, Ohyama K, Muranaka T, Ohara
K, Yazaki K (2007) Plants utilize isoprene emission as a thermotolerance mechanism. Plant
Cell Physiol 48:1254–1262
Schaller H, Grausem B, Benveniste P, Chye ML, Tan CT, Song YH, Chua NH (1995) Expression
of the Hevea brasiliensis (H.B.K.) Müll. Arg. 3-hydroxy-3-methylglutaryl-coenzyme A reduc-
tase 1 in tobacco results in sterol overproduction. Plant Physiol 109:761–770
Schnitzler JP, Zimmer I, Bachl A, Arend M, Fromm J, Fischbach RJ (2005) Biochemical properties
of isoprene synthase in poplar ( Populus × canescens). Planta 222:777–786
Sharkey TD, Loreto F (1993) Water stress, temperature, and light effects on the capacity for iso-
prene emission and photosynthesis of kudzu leaves. Oecologia 95:328–333
Sharkey TD, Yeh S (2001) Isoprene emission from plants. Annu Rev Plant Physiol Plant Mol Biol
52:407–436
Sharkey TD, Wiberley AE, Donohue AR (2008) Isoprene emission from plants: why and how.
Ann Bot 101:5–18
Šimpraga M, Verbeeck H, Demarcke M, Joó É, Okorska O, Amelynck C, Schoon N, Dewulf J,
Van Langenhove H, Heinesch B, Aubinet M, Laffineur Q, Müller J-F, Steppe K (2011) Clear
link between drought stress, photosynthesis and biogenic volatile organic compounds in Fagus
sylvatica L. Atmos Environ 45(30):5254–5259
Singh HP, Kaur S, Mittal S, Batish DR, Kohli RK (2009) Essential oil of Artemisia scoparia
inhibits plant growth by generating reactive oxygen species and causing oxidative damage. J
Chem Ecol 35:154–62
Siwko ME, Marrink SJ, de Vries AH, Kozubek A, Schoot Uiterkamp A JM, Mark AE (2007) Does
isoprene protect plant membranes from thermal shock? A molecular dynamics study. Biochim
Biophys Acta 1768:198–206
Spinelli F, Cellini A, Marchetti L, Mudigere NK, Piovene C (2011) Emission and function of
volatile organic compounds in response to abiotic stress. In: Shanker A, Venkateswarlu B (eds)
Abiotic stress in plants-mechanisms and adaptations. InTech Publ. ISBN: 978-953-307-394-1
Tingey DT, Evans R, Gumpertz M (1981) Effects of environmental conditions on isoprene emis-
sion from live oak. Planta 152:565–570
Turner G, Gershenzon J, Nielson EE, Froehlich JE, Croteau R (1999) Limonene synthase, the
enzyme responsible for monoterpene biosynthesis in peppermint, is localized to leucoplasts of
oil gland secretory cells. Plant Physiol 120:879–886
Tuteja N (2007) Mechanisms of high salinity tolerance in plants. Meth Enzymol 428:419–438
Ueda H, Kikuta Y, Matsuda K (2012) Plant communication—mediated by individual or blended
VOCs? Plant Signal Behav 7(2):222–226
Variyar PS, Chatterjee S, Sharma A (2010) Chemistry and biochemistry of odors. In: Logan EW,
Jason MA (eds) The biology of odors: sources, olfaction and response. Nova Science Publisher,
USA, pp 263–294
Velikova VB (2008) Isoprene as a tool for plant protection against abiotic stresses. J Plant Interact
3:1–15
Vickers CE, Gershenzon J, Lerdau MT, Loreto F (2009a) A unified mechanism of action for vola-
tile isoprenoids in plant abiotic stress. Nat Chem Biol 5:283–291
Vickers CE, Possell M, Cojocariu CI, Velikova VB, Laothawornkitkul J, Ryan A, Mullineaux PM,
Nicholas Hewitt C (2009b) Isoprene synthesis protects transgenic tobacco plants from oxida-
tive stress. Plant Cell Environ 32:520–531
Vickers CE, Possell M, Laothawornkitkul J, Ryan AC, Hewitt CN, Mullineaux PM (2011) Isoprene
synthesis in plants: lessons from a transgenic tobacco model. Plant Cell Environ 34:1043–1053
Wang H, Nagegowda DA, Rawat R, Bouvier-Navé P, Guo DJ, Bach TJ, Chye ML (2011) Over-
expression of Brassica juncea wild-type and mutant HMG-CoA synthase 1 in Arabidopsis
up-regulates genes in sterol biosynthesis and enhances sterol production and stress tolerance.
Plant Biotechnol J 10:31–42
Wiberley AE, Linskey AR, Falbel TG, Sharkey TD (2005) Development of the capacity for iso-
prene emission in kudzu. Plant Cell Environ 28:898–905
Wiberley AE, Donohue AR, Westpha, MM, Sharkey TD (2009) Regulation of isoprene emission
from poplar leaves throughout a day. Plant Cell Environ 32:939–947
Wise ML, Savage TJ, Katahira E, Croteau R (1998) Monoterpene synthases from common sage
( Salvia offcinalis): cDNA isolation, characterization, and functional expression of ( + )-sabi-
nene synthase, 1,8-cineole synthase, and ( + )-bornyl diphosphate synthase. J Biol Chem
273:14891–14899
Wu SQ, Schalk M, Clark A, Miles RB, Coates R, Chappell J (2006) Redirection of cytosolic or plas-
tidic isoprenoid precursors elevates terpene production in plants. Nat Biotechnol 24:1441–1447
Zunino MP, Zygadlo JA (2004) Effects of monoterpenes on lipid oxidation in maize. Planta
219:303–309
Chapter 10
An Overview of Omics for Wheat Grain
Quality Improvement
Awais Rasheed, Tariq Mahmood, Alvina Gul-Kazi

and Abdul Mujeeb-Kazi
Abstract Cereal grain quality aspects are integral aspects of a complex food chain,
which assimilate outputs achievable by breeding, production and processing. In
order to get better economic gains and be internationally competitive in diverse
market scenarios, it is paramount to breed wheat cultivars with better grain quality.
Higher grain quality demands are exponentially increasing due to novel processing
technologies, environmental changes and change in consumer preferences due to
striking demographic shifts. Advances in the genomic arena of grain quality are
considered crucial for defining genes and their networks underpinning functional
flour qualities. The complexities associated with the genes underlying these traits
can be resolved by elucidating functional and comparative genomics information
of relevant genes and the efficient transfer of such information across cultivars.
Wheat, due to wider consumption as a staple food, has been a subject of inten-
sive cytogenetic investigations which are now extended further in the genomics
era using powerful tools of molecular biology and new genetic stocks. The recent
progress in wheat genomics research particularly the use of molecular markers for a
variety of purposes and advances in map based positional cloning of several genes
has been remarkable. As a result we have been able to better understand the wheat
genome and the mechanisms involved in the function of different quality encod-
ing genes. Additionally, we have also utilized information generated from genom-
ics research in producing better quality grains. The advances in the genomics of
A. Rasheed () · T. Mahmood

Department of Plant Sciences, Quaid-i-Azam University, Islamabad, Pakistan
T. Mahmood
A. Gul-Kazi
Atta-ur-Rahman School of Applied Biosciences (ASAB), National University of Sciences
and Technology (NUST), Islamabad, Pakistan
A. Mujeeb-Kazi
National Institute for Biotechnology and Genetic Engineering (NIBGE),
Faisalabad, Pakistan

308 A. Rasheed et al.
quality presented in this chapter provide ample information to the underlying gene
networks controlling quality traits thereby addressing the challenges of the brisk
changes prevalent within the wheat based food systems. Aiding the exploitation
of novel genome diversity for quality value addition, research has benefitted from
the unique germplasm resource generated by synthesizing wheat from genomic/
allelic variability residing in the wheat progenitor accessional resource. These
under-utilized diploid wheat progenitor accessions are a promising conduit to wheat
productivity enhancement and the novel genomic resource contributing to wheat
quality as elucidated here.
Introduction
Bread wheat ( Triticum aestivum) is one of the most important crop species, with
global annual production currently over 600 million tonnes providing approximately
one fifth of the world’s total calorific input (FAO 2009). Continually raising the
yield potential of wheat to match human population growth and stabilizing yield
against the damaging effects of climate change is a top priority for agricultural sci-
ence (Reynolds et al. 2009). The multitude demands of variable wheat products are
challenging to fulfill in a scenario of maintaining competitiveness in international
marketplace. Especially, in the most rapidly growing markets of South-Asia and
China where the grain quality improvement has a critical role to play in establish-
ing the linkages with customers. The traditional quality aspects of wheat need to be
evolved due to the advent of new processing technologies and changes in the market
place resulting from the striking demographic changes in the region. The integration
of several disciplines like functional genomics, biotechnology and exploitation of
the genetic resources is stimulating the identification of genetic, biochemical and
physiological basis of quality encoding traits in wheat. The ongoing activities for
wheat quality improvement aim to address the major challenge of capturing the
information from both wheat and model organisms, such as rice and Arabidopsis,
in order to define genes that underpin the unique quality attributes of wheat. The re-
sources being developed using biotechnology, comparative and functional genom-
ics include comprehensive mapping initiatives, genome-wide expression studies
and exploring the molecular basis of quality characteristics. The linkage of large
information generated from these tools need to be incorporated in wheat-breeding
programs in conjunction with high-throughput screening in order to provide the
solution to efficiently develop new, improved quality wheat varieties.
Grain yield and quality, both are determined by the size and composition of
wheat endosperm. Biochemical and genetic studies in the past three decades have
considerably increased the understanding of genetics, structure and composition of
different proteins stored in endosperm which highly influence end-use quality traits
(Ma et al. 2007). Wheat storage proteins include glutenins, gliadins, secalins and
puroindolines within endosperm which largely determine the rheological properties
of wheat flour, the most important quality attribute. Additionally the mineral and
10 An Overview of Omics for Wheat Grain Quality Improvement 309
phytate competition is the major determinant of bioavailability of essential minerals

which is an important component of wheat grain quality. The recent discovery of
NAC gene transcription factor, TtNAM-B1, role in enhancing grain mineral concen-
tration (Uauy et al. 2006b) has opened new ways to efficiently utilize the genomic
approaches to harness quality related genes from wild relatives in order to get desir-
able products.
Some of the quality-encoding traits are polygenic, while the others are simply
inherited. The development and utilization of the functional markers for monogen-
ic quality traits like high molecular weight glutenins (HMW-GS), Low molecular
weight glutenins (LMW-GS), grain hardiness genes ( PINA and PINB) and waxy
alleles have dramatically changed the selection of appropriate breeding material
having desirable genes. Similarly, efforts are underway to identify gene networks
underlying the quality traits through bi-parental quantitative trait and analysis
(QTL) and genome wide association studies (GWAS).
Genomics of Wheat Storage Proteins
The composition and amount of seed storage proteins play an important role in
determining wheat quality (Payne 1987). Beccari in 1745, first isolated the gluten
proteins and until now, the gluten proteins have been active area of investigation
at genomic and proteomic level over a period of 250 years, in order to determine
their structure and properties and to provide basis for manipulating and improving
end use quality (Shewry et al. 2002). At the beginning of the 20th century, Osborne
(1907) developed a systematic way to classify wheat storage proteins based on their
graded extraction and differences in solubility. According to Osborne (1907) four
different protein groups can be recognized in wheat flour. These groups include al-
bumins (water soluble), globulins (water insoluble and soluble in saline solutions),
prolamins (soluble in 70–90 % ethanol) and glutens (soluble in dilute acid or alkali).
The most important protein, gluten, gives rise to two distinct groups based on their
solubility in 70 % ethanol, known as glutenins and gliadins (Wrigley et al. 1996).
Glutenins
High Molecular Weight Glutenin Subunits (HMW-GS)
HMW-GS reportedly account for 12 % of the total seed storage protein which corre-
spond to about 1–1.7 % of the flour dry weight (Halford et al. 1992). However much
of the work has been focused on functional and structural aspects of HMW-GS due
to their largest contribution in wheat end-use quality. HMW-GS are encoded at
Glu-1 loci present on the long arm of homeologous group 1 chromosomes (1AL,
1BL and 1DL), each locus contributing two gene subunits that differ in their prop-
erties and are called x-type and y-type subunits (Payne et al. 1980). These loci are
named Glu-A1, Glu-B1 and Glu-D1, respectively. The x- and y-type subunits have
a comparatively high and low molecular weight, respectively. In earlier studies on
the allelic variation of Glu-1 loci, the number of alleles at all three loci differed
greatly (Payne and Lawrence 1983). Glu-A1 had three allelic forms, eleven alleles
for Glu-1B, and six alleles for Glu-1D were found. However, in the subsequent
studies several alleles were found and the latest information has been documented
by McIntosh et al. (2010).
Gene Expression
All bread wheat cultivars express 1Bx, 1Dx, and 1Dy subunits while some culti-
vars also express 1By and 1Ax subunit as well. The gene encoding the 1Ay subunit
usually remains silent. Nevertheless, many accessions of A-genome related spe-
cies T. monococcum and T. urartu express 1Ay subunits (Waines and Payne 1987;
Rasheed et al. Unpublished; Alvarez et al. 2009; Caballero et al. 2008; Gutierrez
et al. 2011). Some bread wheat with six HMW-GS have also been reported (Mar-
giotta et al. 1996). The extensive studies on the electrophoretic mobility of glute-
nin subunits revealed that durm and bread wheat genotypes lack certain subunits
(Lafiandra et al. 1988). Beitz et al. (1975) reported some mutants lack 1D encoded
HMW-GS in landraces from Nepal. Contrastingly, some tetraploid and hexaploid
genotypes with four and six subunits, respectively, were developed by replacing the
silenced subunit of Glu-A1 by the expressed ones. These genotypes showed an in-
crement in polymeric glutenin quantity, hence better flour characteristics (Lafiandra
et al. 1998). Allelic variation at Glu-D1 has most profound effect on bread-making
quality, although limited numbers of alleles have been reported at this locus. In
addition to hexaploid wheat, Aegilops tauschii Cosson, the diploid ancestor of the
D-genome, conserves many unique Glu-D1 alleles. So far, 14 x-types and 10 y-type
subunits in Ae. tauschii have been identified resulting into combination of 85 differ-
ent Glu-D1 alleles (Rehman et al. 2008).
Amino Acid Composition and Structure
HMW-GS is a highly complex mixture of proteins and high level of polymorphism

is the main limiting factor to study the structure of gluten proteins. However in the
last 30 years, much of the work has focused on HMW-GSs of wheat (Shewry et al.
2002). There is a high resemblance in primary structure of x- and y-type subunits.
Both subunits consist of a signal peptide, N- and C-terminal domains and a repeti-
tive central domain (Shewry and Halford 2002). The significant difference is in the
number of conserved cysteine residues which are four in majority of x-type sub-
units and usually seven in the y-type subunits. These cysteine residues had a major
role in the formation of disulphide bonds within and between subunits. Therefore
these are primarily important in structure and function of the elastic properties of
gluten protein result in risen loaf of wheat dough (Shewry and Tatham 1997). The
repetitive domains are consisted of short and repeated peptide motifs in both x- and
y-type subunits. These peptide motifs may be tripeptide, hexapeptide and nanopep-
tide, while the presence of the tripeptide motif is unique to the repetitive domain
of x-type subunits (Shewry and Tatham 1997). Because the HMW-GS have very
high glutamic acid contents, therefore proline and glycine contents are also very
high, while lysine contents are very low. It is also evident from amino acid com-
position of HMW-GS that the central repetitive domain has hydrophilic nature and
N- and C-terminal domains have hydrophobic characteristics (Shewry et al. 1989).
The polypeptide motifs determine the proportion of the different amino acids in
HMW-GS. Shewry and Tatham (1997) revealed that > 90 % of the repetitive do-
mains are formed from the variations in the consensus repeat sequences (PGQGQQ
and GYYPTSPQQ). Moreover, x-type subunits are characterized by the presence
of unique tri-peptide motif (GQQ). While in y-type subunits, the second proline is
replaced by a leucine in the GYYPTSPQQ repeat motif.
Alleleic identification
The invaluable platform for HMW-GS diagnosis is, no doubt, sodium dodecyl sul-
phate poly-acrylamide gel electrophoresis (SDS-PAGE). However some limitations,
like co-migration of some subunits, difficulty in detecting differences in expression
levels, results in inaccurate identification of alleles differing in functional proper-
ties. Moreover, this technique is only possible from the flour of mature grains. The
advancements in molecular biology has enabled us to overcome these limitations
by using allele specific PCR markers. These markers are developed based on DNA
polymorphism present among the glutenin subunit genes are considered perfect to
study allelic variations for HMW-GS. The major advantage is the high-throughput
analysis of different alleles in breeding materials which is also possible during the
vegetative growth stages (Liu et al. 2008a). We have discussed in detail the mo-
lecular diagnosis approaches for HMW-GS identification in “Functional markers”
section of this chapter.
Among the other proteomics based technologies used to detect HMW-GS in-
clude reversed-phase high-performance liquid chromatography (RP-HPLC) and
the most recent matrix assisted laser desorption time-of-flight mass spectrometry
(MALDI-TOF). Gao et al. (2010) analyzed HMW-GS separation and characteriza-
tion of bread wheat and wild accessions on MALDI-TOF, SDS-PAGE and RP-
HPLC. Comparative analysis demonstrated merits and demerits of each method-
ology. Incorrect identification due to low resolution and overestimation has been
the main drawback of SDS-PAGE. Irrespective of its disadvantages, SDS-PAGE
is the simplest and cheaper technique, therefore, suitable for large-scale and high-
throughput HMW-GS screening for wheat genotypes especially when the glutenin
composition is clear in the breeding material. The most recent mass spectroscopy
MALDI-TOF had several technical advantages including high throughput, high
resolution, and accuracy. However, high equipment cost is the main hindrance to
access this technology for many breeding programs.
Low Molecular Weight Glutenin Subunits
Low molecular weight glutenin subunits (LMW-GS) are also major fraction of glu-
tenins and are also known as prolamine due to high amino acid, glutamines and
pralines. LMW-GS represent about one third of the storage proteins and about 60 %
of total glutenins (Beitz and Wall 1973). The genes controlling LMW-GS are pres-
ent at short arm of group 1 chromosomes, Glu-3 loci ( Glu-A3, Glu-B3 and Glu-
D3), which are tightly linked to the Gli-1 loci. Additionally, three new loci Glu-2,
Glu-4 (Jackson et al. 1985; Liu and Shepherd 1995) and Glu-5 (Sreeramulu and
Singh 1997) located on chromosomes 1B, 1D and 7D respectively, with molecular
weights ranging from 30-31,000 Da, have also been reported to encode LMW-GS.
The LMW-GS are more difficult to characterize and study as compared to HMW-
GS, due to their heterogeneity. However, different analytical tools become avail-
able with the advancement of technology which made easier their characterization.
Biochemical classification revealed three classes of LMW-GS i.e. B, C and D types
(Jackson et al. 1983). Additionally, B type LMW-GS are further classified into three
classes, LMW-m, LMW-s and LMW-i, based on the first amino acid residue which
may be Methionine, Serine and Ile, respectively. Genes present at Glu-A3 locus
manly encode LMWi type subunits, which is the most recently identified class of
LMW-GS (Zhang et al. 2004). Additionally, LMW-i had significant structural dif-
ferences from LMW-m and LMW-s groups due to the lack of an N-terminal region
and localization of cysteine residues in C-terminal region. However, eight number
of cysteine residues are common in all groups. This structural difference is proposed
to encode quality differences by glutenin polymer formation and gluten interac-
tion. The C and D type subunits are composed mainly of proteins related to α/β-,
γ- and ώ-gliadins which have variable numbers of cysteine residues. D’Ovidio and
Masci (2004) proposed these subunits are incorporated into the polymeric network
by virtue of unpaired cysteines. The dough quality is known to be influenced greatly
by allelic variations at the Glu-3 loci and ranking of different alleles due to their
functional properties have been reported (Juhász and Gianibelli 2006).
Gene Expression and Polymorphism
In MacGene (2010) 17, 26 and 11 alleles differentiated by different diagnostic tech-

niques are documented at all Glu-3 loci wheat. However, this does not include the
allelic variants encoded and confirmed in different wild relatives of Triticeae. In
earlier studies, 20 different LMW-GSs were identified in 222 common wheat vari-
eties from 32 countries (Gupta and Shepherd 1990). It was revealed that six alleles
were encoded at Glu-A3, nine at Glu-B3 and five at Glu-D3 locus. Allelic richness
of chromosome 1A encoded subunits was relatively low and even some cultivars
did not express any LMW-GS. While the B-genome encoded LMW-GS, Glu-B3,
showed highest polymorphism. Gupta and Shepherd (1993) provided evidence for
the presence of LMW-GS genes on group 6 chromosomes. There is a close link-
age between gliadins encoded by Gli-1 loci and LMW-GS encoded by Glu-3 loci
(Gianibelli et al. 2001). This linkage between alleles of two loci helped in diagnosis
of several Glu-B3 and Glu-D3 alleles in wheat genotypes. Several glaidins were
found as reliable markers LMW-GS allele diagnosis, due to their easy detection
(Jackson et al. 1996).
The N-termninal sequence is most important for identification of LMW-GS, there-

fore seven main types of LMW-GS have been identified on the basis of first ami-
no acid in the N-terminal sequences of the proteins. These include, seven LMW-s
with starting with sequence SHIPGL-, three LMW-m with N-terminal sequences
of METSHIPGL-, METSRIPGL and METSCIPGL respectively. In three LMW-
GS, the N-terminal sequences resembles to the α-, β- and γ-type gliadins (Cloutier
et al. 2001). The further classification of LMW-GS is based on deduced amino
acid sequences and cysteine residue position facilitating inter-molecule disulfide
linkage (Ikeda et al. 2002). Twelve such LMW-GS groups have been identified in
wheat. Collectively, more than 100 genes of LMW-GS have been characterized and
sequenced from common wheat including several partial and pseudogenes (Cloutier
et al. 2001; Zhang et al. 2004). There was an effort by Long et al. (2005) to develop
LMW-GS group specific primers, which they developed from the analysis of 69
known gene sequences from GenBank and classified them into nine groups by the
deduced amino acid sequence of the highly conserved N-terminal domain. Later on,
Ikeda et al. (2006) also developed 10 primers, based on the available sequences in
the GenBank, which were group specific. In wheat varieties from Australia, Zhao
et al. (2006, 2007) identified 6 different gene sequences and 12 gene haplotypes at
the Glu-D3 locus.
There is high similarity between the secondary structures of LMW-GS and struc-
ture of the S rich gliadins and the only exception of D type LMW-GS (D’Ovidio
et al. 1995). There are about 250–300 residues are reported in polypeptides. Sev-
eral workers have reported the further modification in the two domian structure
of LMW-GS (Kasarda et al. 1984; Wieser 1995). In both domains, the N-terminal
repetitive domains is rich in β-turns while short nonrepetitive domain is rich in
α-helix and is more compact (Thomson et al. 1992).
Allelic identification
SDS-PAGE is considered one of the simplest techniques to identify LMW-GS with

some restrictions. At Glu-A3 locus, SDS-PAGE could identify five out of seven al-
leles, while 2-D gel electrophoresis and PCR based markers identified all the allelic
variation at this locus in bread wheat (Liu et al. 2010). The Glu-B3 alleles are easier
to be identified by SDS-PAGE, MALDI-TOF and PCR based markers but some ad-
ditional validation is more reliable by 2-DE method. Liu et al. (2010) compared four
techniques (SDS-PAGE, 2-DE, MALDI-TOF, PCR based markers) as a conduit to
test their suitability to be integrated in breeding programs. They established that

the PCR based markers are the simplest, most accurate, lowest cost technique and
therefore recommended this method for the identification of Glu-A3 and Glu-B3 al-
leles in breeding programs. However, the combination of different techniques was
required to identify certain alleles, and would be especially useful when character-
izing new alleles from new genetic resources. They also recommended a standard
set of 30 cultivars for use in future studies to represent all LMW-GS allelic variants
in the collection.
Gliadins
In wheat storage proteins, gliadin is an important fraction that accounts for about
40–50 % of the total proteins. It has great impact on processing and nutritional
quality of flour, followed by HMW-GS and LMW-GS. Gliadins are soluble in 70 %
ethanol and are heterogeneous mixtures of single-chained polypeptides. Gliadins
can be seperated in A-PAGE (acid-PAGE) based on the differences in their mobil-
ity. The four different groups identified include α-, β-, γ-, and ω-gliadins, of which
α- gliadins has fastest while ω-gliadins has slowest mobility. Gliadins are controlled
by Gli-1 loci, which are complex and comprise the ω-gliadin and γ-gliadin (Me-
cham et al. 1978) multi-gene families (Harberd et al. 1985), which in some circum-
stances may be divided into Gli-1-1 and Gli-1-2, respectively. The LMW glutenin
multigene families, which are closely linked to the Gli-1 loci (Jackson et al. 1983),
are listed separately as the Glu-3 set (Singh and Shepherd 1985); information on
map distance and gene order in relation to Glu-3 and the centromere is given in the
preamble for the Glu-3 loci.
Gene Expression and Polymorphism
It was identified that short arms of group 1 and group 6 chromosomes encode glia-
din genes. The genes present on Gli-1 loci are controlled by Gli-A1, Gli-B1, and
Gli-D1 loci on 1AS,1BS and 1DS, respectively. Similarly, Gli-2 genes are con-
trolled by Gli-A2, Gli-B2, and Gli-D2 loci on chromosomes 6AS, 6BS and 6DS,
respectively. The genetic analysis revealed that all ω- and many γ-gliadins are en-
coded by Gli-1 loci and all α-, many of β-, and some of γ-gliadins are encoded by
Gli-2 loci. The gene clusters of gliadins encode polypeptides as Mendalian factor
and multiple allelism phenomenons have been observed at both loci (Metakovsky
1991). In MacGene (2010), 23 alleles are listed for Gli-A1, 24 for Gli-B1 and 15
alleles for Gli-D1 in bread and durum wheat. Similarly, among Gli-2 loci, Gli-A2
encodes 36 alleles, Gli-B2 encodes 47 and Gli-D1 encodes 31 alleles. Apart from
these two loci, several workers reported many other loci. These include Gli-3 (4 al-
leles at Gli-A3 and 3 alleles at Gli-B3) coding for ω-gliadins on short arms of group
1 chromosomes (Galili et al. 1984; Sobko 1984), Gli-5 (2 alleles at both Gli-A5 and
Gli-B5 loci) coding for ω-gliadins on short arm of chromosomes 1A and 1B distal
to Gli-1 (Pogna et al. 1993), Gli-6 and Gli-7 on short arm of chromosome 1A and
1D (Metacovsky et al. 1996; Hassani et al. 2006).
Among the four gliadin groups, ω-gliagins have high level of glutamione and pro-
line while low level of sulfurous amino acids (Gianibelli et al. 2002). Compara-
tively, they had few amino acids and high phenylalanine levels as compared to other
gliadin groups (Kasarda et al. 1983; Tatham and Shewry 1995). Difference does
exist among gliadin groups for surface hydrophobicity and ω-gliagins are lower
hydrophobic than that of the α- and γ-type gliadins. Popineau and Pineau (1987)
identified the gliadins as first peptides elute from the reverse phase-HPLC column.
Among all the gluten protein fractions, gliadins are highest hydrophilic with refer-
ence to amino acid composition with only a few residues with charged side chains
(Dupont et al. 2000). Three different types of ω-gliagins have been observed on
the basis of the N-terminal sequences. The nomenclature of ω-gliadins is followed
from the first three amino acids in their N-terminal sequences (Kasarda et al. 1983).
Therefore, these three groups are called ARQ-, KEL-, and SRL-types based on the
aforesaid nomenclature system (Tatham and Shewry 1995).
Similar to the ω-gliadins, α-, β- and γ-gliadins are also rich in glutamine and
proline. In these groups, about 90 % of the glutamic and aspartic acid residues are
amidated (Bietz et al. 1977; Kasarda et al. 1983). They are also characterized by
low levels of basic amino acids and high leucine. In α/β- and γ-gliadins cysteine
residues are 6 and 8, respectively and both all types are rich in sulfur. Müller and
Wieser (1995, 1997) confirmed that 3–4 disulfide bonds between molecules are
formed. The α/β-gliadins are represented by a very small sequence of five amino
acid residues (VRVPV) on the basis of N-terminal sequences (Bietz et al. 1977). In
α/β-gliadin, the pentapeptide motifs (PQQQP and PQQPY) are always present in a
repetitive region that follows the N-terminal region of the proteins (Shewry et al.
1986). Contrastingly, in γ-gliadins the N-terminal region is consisted twelve amino
acid residues (NMQVDPSGQVQW) followed by several repeats of consensus mo-
tif PQQPFPQ (Kasarda et al. 1983; Shewry and Tatham 1990).
Recently, Qi et al. (2009) analyzed 170 γ-gliadin genes isolated from common
wheat and its closely related species, among which 138 sequences are putatively
functional. The ORF lengths of these sequences range from 678 to 1089 bp, and the
repetitive region is mainly responsible for the size heterogeneity of γ-gliadins. The
repeat motif
P(Q/L/S/T/I/V/R/A)F(S/Y/V/Q/I/C/L)P(R/L/S/T/H/C/Y)Q1–2(P(S/L/T/A/F/
H)QQ)1–2
is repeated from 7 to 22 times. They found a wide range of amino acid composition
in γ-gliadins, and those γ-gliadins from subgroup SG-10 and SG-12 and γ-gliadins
with a short repetitive domain are more nutritional.
Kernel Texture (Ha Locus)
In wheat, the grain texture is encoded by the friabilin group of proteins having
Mr~13 k Da. These proteins have strong association with starch. In soft grains,
these are frequently associated with water-washed starch. While in hard grains and
durum they show limited and no association with starch, respectively. It was gener-
ally suggested that friabilins are non-sticky proteins minimizing sticking of starch
granules and protein matrix, thus allowing their easier separation. Friabilin give
rise to two major polypeptides upon electrophoresis separation and amino acid se-
quencing. There are three polypeptides viz. puroindoline a, puroindoline b and grain
softness protein-1 which are designated as PINA, PINB and GSP-1, respectively.
Morris (2002) reviewed the properties, purification methods and discovery of fria-
bilin. Hard and soft kernel textures are not due to difference in amount of friabilin
because both classes have similar amount of friabilin. Rather difference is due to
association of strach granules with friabilin during aqueous isolation. The major
locus, Ha, is responsible for textural properties (Symes 1965), and has been identi-
fied on 5DS chromosome (Mattern et al. 1973; Sourdill et al. 1996). Puroindoline
proteins encoded by two strongly linked genes at this locus were identified that is
associated with variation for grain hardiness (Gautier et al. 1994). A mutation in
Pinb gene results in change in amino acid giving rise to altered protein structure to
bind with membrane polar lipids (Giroux and Morris 1998). This results in altera-
tion of binding strength between protein matrix and starch granules. Apart from this
mutation, Giroux and Morris (1998) also identified a null allele, Pina-Da, on other
puroindoline gene. It was concluded that a variety will have the hard texture hav-
ing mutant alleles ( Pina-D1b or Pinb-D1b) at both puroindoline genes. Although,
higher allelic variation observed at these loci (Morris 2002) but genotypes having
alleles Pina-D1a/Pinb-D1a (soft), Pina-D1a/Pinb-D1b (hard) and Pina-D1b/Pinb-
D1a (extra hard) are predominant (Cane et al. 2004). A positive correlation of these
genotypic classes with water absorption was observed. Genotypes with extra hard
texture absorbed 3.5 % more water than varieties with the hard texture and 8.3 %
more than those with the soft texture. Contrastingly, they, did not find any differ-
ence for water absorption in the ‘‘extra hard’’ and ‘‘hard’’ classes. However a drop
in milling yield in extra hard genotypes was observed by both. Apart from Ha locus,
several QTLs underlying grain hardness characteristics have been discovered.
Genes and Polymorphism
Bhave and Morris (2008) reviewed the molecular genetics, gene regulation and
structure of puroindolines. MacGene (McIntosh et al. 2010) listed 17 alleles at Pina-
D1, 29 alleles at Pinb-D1 and 9 alleles at Gsp-D1 locus. Recently, Chen et al. (2009)
identified 9 haplotypes in 56 sequences from einkorn wheat. Guzman et al. (2012)
also observed genetic polymorphism and nucleotide diversity of puroindoline genes

in einkorn wheat and T. urartu accessions. A new translocation lines (5AmS.5AS)
from CS background carries puroindolines and GSP-1 alleles that confer softer ker-
nel texture. Massa et al. (2004) analyzed 50 accessions of Ae. tauschii which held
enormous diversity at Ha locus. Simeone et al. (2006) identified putative puroin-
doline proteins with 22 and 28 amino acid replacements while working on diploid
species. In some accessions of Ae. speltoides and Ae. searsii, a stop codon at final
Tryptophane of PINA was observed while in other accessions one-residue was de-
leted inin PINB (Lillemo et al. 2002).
Structure of Genes at Ha Locus
The intronless coding regions of the Pina-D1 and Pinb-D1 genes of bread wheat are
447 bp long. The genes are 70.2 % identical in the coding regions but only ~53 %
identical in the 30 un-translated region (Gautier et al. 1994). The physical order
of these genes within BAC clones was identified as Pinb-Pina-Gsp-1 in T. mono-
coccum (Tranquilli et al. 1999) and Ae. tauschii (Turnbull et al. 2003). There are
several reports where additional partial copy of Pina-D1 has been found on 5DL.
Bahve and Morris (2008) discussed in detail the gene expression their regulation
and promoter sequences of puroindolines. The characterization of nucleotide se-
quence in A and B genome of tetraploid wheat, the 50 boundary of the Ha locus was
defined by Gsp gene. A gene cluster known as Gene7 and Gene8 was also validated
by the presence of the 30 boundary. Therefore, a ca 55 kb gDNA segment is defined
as the Ha locus having the Pina, Pinb, two Pinb degenerated copies, Gene3 (only in
D-genome) and Gene5. Chantret et al. (2005) identified a deletion of 38 kb in com-
mon wheat instead of Gene3 and Gene5. Instead these genes were annotated in dip-
loid progenitors of hexaploid wheat. In barley, analysis of Ha locus identified some
genes clusters were found conserved between wheat and barley (Caldwell et al.
2004). Some rearrangements were observed in barley hordoindolines (equivalents
of puroindilines) like upstream position of gene from GC2 instead of downstream
(as in wheat) and they are also in the opposite orientation. However, in barley grain
hardiness is focused to their resistance to pest and disease invasion rather than mill-
ing attributes.
The other important part of Ha locus is Gsp-1 gene which is tightly linked to
Pina and Pinb on chromosome 5DS. Unlike Pin genes, GSP-1 genes are present on
all three group 5 chromosomes in wheat (Chantret et al. 2005). The nucleotide cod-
ing region of these genes consists of 495 nucleotides without introns and resembles
90–100 % with one another and ~42 % with Pin genes (Bhave and Morris 2008).
Some studies suggest multiple Gsp-1 copies per genome in at least some genomes/
accessions (Gollan et al. 2007) whereas mapping studies show only one gene at the
Ha locus (Chantret et al. 2005).
Grain Protein Content (GPC) and Nutritional Aspects
Improving the grain protein content has been area of main focus for wheat breed-
ers due to its major contribution in bread and pasta-making quality and has a major
contribution in improving nutritional status of masses. Despite of its importance,
constrains prevail to increase protein contents due to its quantitative inheritence
and high influence of the environment (Simmonds, 1995). Several reports are avail-
able on QTLs controlling GPC and linked markers are available for MAS. An au-
thentic source of high protein content has been identified in accession of Triticum
turgidum L. ssp. dicoccoides (referred to as DIC) during a survey (Avivi (1978).
Cantrell and Joppa (1991) substituted each chromosome of DIC with the durum
cultivar ‘Langdon (LDN)’ and later it was found that 6B substitution line of DIC
into LDN (DIC-6B) had highest protein contents (Joppa et al. 1997). The DIC-6B
substitution line and LDN were used a parents and a RILs mapping population was
developed to map QTL conferring high GPC, which was found on the chromo-
some 6BS. Another secondary mapping population (RILs) was developed to further
shorten this QTL and it was mapped between RFLP probes Xcdo365 and Xucw65
as a single Mendelian locus ( Gpc-B1) within a 2.7 cm region (Olmos et al. 2003).
Some new markers were developed in this region for high density mapping through
Rice-Wheat micro-colinearity studies. Some additional recombination was initiated
by developing more RILs and Gpc-B1 locus was reduced with a 0.3 cm segment us-
ing newly developed markers (Distelfeld et al. 2004). The Gpc-B1 gene within the
0.3 cm segment was physically mapped which spanned about 250 kb region (Dis-
telfeld et al. 2006). The Gpc-B1 allele in DIC accelerates leaf senescence and Uauy
et al. (2006a) suggested the differences in GPC are actually pelotropic effects of the
in senescence. Kade et al. (2005) discovered the effect of DIC Gpc-B1 allele during
senescence explained the higher levels of soluble proteins and amino acids in flag
leaves after anthesis relative to those with the LDN allele. Higher mineral contents
in DIC were found to be associated with chromosome 6B (Cakmak et al. 2004), but
its association with 250 kb region including Gpc-B1 was validated later (Distelfeld
et al. 2007). The major discovery was reported when map based cloning identified
the Gpc-B1 as a NAC transcription factor ( TtNAM-B1) and it was established that
wild emmer wheat has a functional allele whereas modern wheat varieties carry
a nonfunctional allele originated by a frame shift mutation (Uauy et al. 2006b).
The functional NAM-B1 orthologous has been found on chromosome 6A and 6D
( TtNAM-A1 and TaNAM-A1) and 6D ( TaNAM-D1), and closely related paralogues
on chromosomes 2B ( TtNAM-B2 and TaNAM-B2) and 2D ( TaNAM-D2). In RNAi
studies, RNA levels of these NAM homologs was reduced which in turn delayed
senescence for more than 3 months and reduced grain protein and mineral contents
by more than 30 % as compared to control lines (Uauy et al. 2006b). Most Recently,
Cantu et al. (2011) employed mRNA-seq approach to detect small differences in
transcript levels and identified the monocarpic senescence as an active process lead-
ing to large-scale changes in gene expression which begins considerably before the
appearance of visual symptoms of senescence. As a result several GPC-regulated
genes including transporters, hormone regulated genes, and transcription factors
are activated. These GPC-regulated genes, particularly those up-regulated during

senescence, provide valuable entry points to dissect the early stages of monocarpic
senescence and nutrient remobilization in wheat.
Another main miner bioavailability limiting factor is the presence of phytic acid
(PA). PA is stored in the aleurone layer and hampers the intestinal absorption of
mineral cations by making insouluble complexes (Cheryan, 1980). Phytase activity
of the flour strongly reduces the PA breakdown. Therefore, the mineral bio-avail-
ability depends on, both, mineral and phytase concentrations and these should be
taken into account in wheat improvement for biofortification. Recently, Ram et al.
(2011) indicated the presence of higher genetic variability of phytase in synthetic
hexaploids as compared to Indian cultivars. There is a greater scope for manipu-
lating phytase levels as compared to phytate in wheat breeding, due to the larger
genetic effects and greater genetic variability of the phytase in wheat. Thus, D-ge-
nome synthetics hold significance to be used as source for increasing phytase levels.
The release of cultivars with high mineral concentrations complemented with high
intrinsic phytasic activity could greatly improve the nutritional value of bread, pro-
vided that less refined flour is utilized to preserve the source of the minerals. CIM-
MYT nearly a decade ago screened some wheat progenitor resources and identified
accessions of T. dicoccon with elevated levels of iron and zinc. On these tetraploids,
synthetic hexaploids were developed by the wide crossing unit and produced stocks
( T. dicoccon/Ae. tauschii) for wheat breeding program. A nursery set has been de-
ployed in India and Pakistan from which promise has been observed but impacting
findings are still awaited.
QTLS for Grain Quality Traits
Understanding the genetic architecture underlying quality traits is essential to iso-

late and characterize the desirable genes. Extensive QTL mapping studies have
been performed to study the genetic control of quality traits. The recent trend shifted
to association mapping is the further extension to bi-parental mapping to study the
QTLs with accuracy and precision (Mascri et al. 2012). Earlier, Campbell et al.
(1999, 2001) identified QTL for kernel, milling, and baking traits. QTL for kernel
traits are located on chromosomes 1A, 2B, 2D, 3B, 7A, and 7B. Earlier to this,
Parker et al. (1998) identified two major loci for flour color on chromosomes 3A
and 7A, using RFLP marker in 150 RILs. In quantitative terms, the most important
trait is flour yield and several QTLs have been identified for this trait on chromo-
somes 4A, 4D, 5D (Nelson et al. 2006), 5D (Campbell et al. 2001) and 7D (McCart-
ney et al. 2006). Recently, Carter et al. (2012) identified two QTLs on chromosome
7B explaining the 17 and 19 % variability in 188 RILs population. Similarly, flour
and grain protein identified as a key quality trait largely influencing the quality at-
tributes of dough had several QTLs identified in RILs (Nelson et al. 2006; Carter
et al. 2012) and double haploid (McCartney et al. 2006; Huang et al. 2006) mapping
populations. Two QTLs on chromosomes 2D and 4D explained about 30 % of the
phenotypic variability and were also validated by other researchers.
The genetic control of milling and baking qualities is of paramount interest for
industry. QTL mapping population from a soft x hard wheat was used by Breseghe-
llo et al. (2005) and about 15 QTL conferred control of milling traits, protein con-
tent and baking assay, were detected on group 1 and group 2 chromosomes with
some QTLs on 3A/B, 4B, 5B, and 6B. In another mapping population from RL4452
x ‘AC Domain’ hard wheat cross, about 99 QTLs were found on 18 chromosomes
for 41 quality traits (McCartney et al. 2006). A major QTL on 4D controlling plant
height (Rht-D1b) flanked about 20 QTLs while a crop maturity controlling locus
adhered about 10 QTLs controlling grain quality characteristics like starch contents,
mixograph, farinograph and baking performance.
Apart from the bi-parental QTL studies, recently few association-mapping stud-
ies have been attempted to detect QTL for quality traits in sets of soft wheat germ-
plasm. Several QTLs conferring control of kernel morphology were detected on
chromosomes 2D, 5A, and 5B. Similarly, several quality-encoding QTLs were de-
tected on 15 different chromosomes in an association mapping population by Reif
et al. (2011). The majority of QTLs for flour characteristics, retention capacity of
solvent and softness equivalent were found to be located on chromosome 1B and
2B in soft wheat bi-parental mapping population. We have presented an overview of
QTL detection efforts for grain quality traits in wheat in Table 10.1.
Functional Markers for Wheat Grain Quality Traits
During the past two decades, there are extensive studies on the molecular mapping
of the genes underlying the grain quality traits and a brief overview has been pre-
sented in earlier heading. These QTL analyses identified linked molecular markers
such as SSRs, RAPDs, AFLPs, RFLPs and DArTs with the key quality traits. The
low detection power, distance from the genes and allele specificity to the population
and parents are the key characteristics of the neutral markers which effect on their
predictive value in the diverse populations. Therefore, the diagnostics by the linked
markers (MAS) is questioned in breeding programs and their use is restricted with
some exceptional cases. Due to recent developments in molecular biology, there is
overwhelming response for the use of functional markers as a selection tool due to
their apparent advantage over the linked molecular markers. These are developed
from the nucleotide sequence of the functional gene and it has powerful tendency to
distinguish allelic variation on a single locus, thus are considered perfect markers
for MAB (Varshney et al. 2005). Nevertheless, with the progress in gene cloning
during the last years, the development of corresponding functional markers is get-
ting fast track. In quantitative terms, 97 markers have been developed as a result of
cloning of 30 genes. These markers had ability to identify 93 disease resistance al-
leles, agronomic and grain quality traits. In wheat, the grain processing and baking
quality is controlled by high- and low-molecular weight glutenins, grain hardiness,
and starch contents, polyphenol oxidase (PPO) activity, lipoxynase (LOX) activ-
ity and yellow pigment content (YPC). In total, 56 functional markers have been
Table 10.1 An overview of studies on QTLs for grain quality traits in wheat
Trait MP* No of lines QTL/Marker Interval Position R2** Reference

Flour yield RILs 114 DR Oxo1-Xcdo949 4D 0.16 Nelson et al. ((2006)
RILs 114 XksuD9-Xcdo475 4A 0.17 Nelson et al. (2006)
RILs 114 Xgwm190-Xmta9 5D 0.46 Nelson et al. (2006)
RILs 78 Pinb 5D 0.53 Campbell et al. (1999)
DH 182 QFyd.crc-7D 7D 0.18 McCartney et al. (2006)
RILs 150 Xbcd115-3A-Xpsr754-3A 3A 0.22 Chalmers et al. (1999)
RILs 150 – 7D 0.19 Chalmers et al. (1999)
RILs 188 QFyeld.wak-3B 3B 0.19 Carter et al. (2012)
RILs 188 QBkyeld.wak-3B 3B 0.17 Carter et al. (2012)
Grain protein RILs 114 Xbcd152-Xfbb329 2A 0.15 Nelson et al. (2006)
RILs 114 Xbcd102-Xbcd18 2D 0.32 Nelson et al. (2006)
RILs 114 Xcdo1312-Xabg391 5A 0.19 Nelson et al. (2006)
DH 182 QGpc.crc-4D 4D 0.29 McCartney et al. (2006)
DH 185 QGpc.crc-4D 4D 0.32 Huang et al. (2006)
DH 185 QGpc.crc-7B 7B 0.12 Huang et al. (2006)
DH – QGpc2B 2B 0.14 Zhao et al. (2010)
RILs 188 QPro.wak-3B 3B 0.07 Carter et al. (2012)
Flour protein DH 182 QFpc.crc-4D 4D 0.28 McCartney et al. (2006)
10 An Overview of Omics for Wheat Grain Quality Improvement
DH 182 QFpc.crc-2B 2B 0.16 McCartney et al. (2006)

RILs 114 Xabc158-Xgwm60 7A 0.16 Nelson et al. (2006)
DH 185 QFpc.crc-7B 7B 0.16 Huang et al. (2006)
DH 185 QFpc.crc-4D 4D 0.28 Huang et al. (2006)
SDS sedimentation RILs 114 Xwg177-DRCht1 3A 0.11 Nelson et al. (2006)
RILs 114 Xfbb9-Xfba62 2D 0.21 Nelson et al. (2006)
DH 182 QSsd.crc-1B 1B 0.18 McCartney et al. (2006)
DH 185 QSv.crc-1B 1B 0.15 Huang et al. (2006)
321
322

DH 185 QSv.crc-2D 2D 0.14 Huang et al. (2006)
SWW 207 wmc419 1B 0.23 Reif et al. (2011)
RILs 188 QSev.wak-3B 3B 0.1 Carter et al. (2012)
Zeleny score RILs 114 Xbcd102-Xbcd18 5D 0.18 Nelson et al. (2006)
RILs 114 Xcdo426-XksuD14.1 1A 0.14 Nelson et al. (2006)
Loaf volume RILs 114 Xabc174-Xgwm108 3B 0.18 Nelson et al. (2006)
RILs 78 Pkaba1c 2B 0.12 Campbell et al. (2001)
DH 182 Xgwm666 3A 0.11 Kuchel et al. (2006)
RILs 105 QGpc2B 2B 0.29 Elangovan et al. (2008)
RILs 105 QLv.ncl-6D.3 6D 0.45 Elangovan et al. (2008)
DH 182 QBlvl.crc-4D 4D 0.2 McCartney et al. (2006)
Alveogram (L) RILs 114 Xcdo426-XksuD14.1 1A 0.3 Nelson et al. (2006)
RILs 114 Xmwg706-Xmwg733 1A 0.19 Nelson et al. (2006)
P/L RILs 114 Xcdo426-XksuD14.1 1A 0.31 Nelson et al. (2006)
RILs 114 Xgwm550-XksuD14.1 1B 0.38 Nelson et al. (2006)
RILs 78 QPlr.ipk-1A 1A Campbell et al. (2001)
Alveogram (W) RILs 114 DR Fmt.1-Xgwm550 1B 0.28 Nelson et al. (2006)
RILs 114 Xwg686-Xcdo686 7B 0.14 Nelson et al. (2006)
Alveogram (P) RILs 114 XksuH7-XgbxR080 3B 0.26 Nelson et al. (2006)
RILs 114 Xgwm550-XksuD14 1B 0.24 Nelson et al. (2006)
Pelshenke score RILs 114 DR Fmt.1-Xgwm550 1B 0.32 Nelson et al. (2006)
Yellow pigment RILs 240 QYpc-1B 1B 0.32 Zhang et al. (2009)
RILs 240 QYpc-7A 7A 0.34 Zhang et al. (2009)
Flour color RILs 150 Xbcd828-3A 3A 0.13 Parker et al. (1998)
RILs 150 Xcdo347-Xwg232 7A 0.6 Parker et al. (1998)
A. Rasheed et al.

DH 155 Xgwm193 6B 0.21 Pozniak et al. (2007)
DH 155 Psy1-1 7B 0.23 Pozniak et al. (2007)
Amylose content SCRILS 98 QAmc.ocs-4A.1 4A 0.17 Araki et al. (1999)
Particle size index DH 182 QPsi.crc-7D 7D 0.28 McCartney et al. (2006)
Test weight DH 185 QTw.crc-4D 4D 0.13 Huang et al. (2006)
Soft winter 207 gwm219 6B 0.34 Reif et al. (2011)
wheat
*MP Mapping population, RILs Recombinant inbred lines, DH Double haploids
**In case of several QTLs identified in a study for a single trait, only QTLs with highest R2 values were selected
323
developed for quality traits by cloning of 62 alleles at 16 loci. Functional markers

that have application for wheat quality improvement are presented in Table 10.2.
Isolation and characterization of functional motifs within genes controlling phe-
notypic variability is critical to develop allele specific markers. These motifs are
usually characterized by single nucleotide polymorphisms (SNPs) or insertions/de-
letions (InDels) within the nucleotide sequences of different alleles. Using the map-
based cloning approach, several genes have been isolated in plants; however, the
very large genome is the main problem in common wheat which makes map-based
cloning difficult as compared to rice and maize. Rice-wheat micro-colinerarity and
different comparative genomics tools provides an alternate and efficient way to
dissect target genes in wheat. This is due to the fact that rthologs descended from a
common ancestor often have conserved functions and are expected to produce simi-
lar phenotypes across species (Devos 2005). The whole genome sequence is avail-
able for several grasses including rice, maize and Brachypodium which provided
powerful tools for gene discovery in wheat (Vogel et al. 2010). The in silico technol-
ogy is now widely used for discovery of genes of interest in wheat (Ma et al. 2012).
A major breakthrough is the availability of expressed sequence tags (EST) database,
from where the sequences of putative wheat genes can be obtained by aligning and
joining of orthologous genes with the same function in the grass.
Description of Quality Traits and Their Functional Markers
Significance of HMW-GS and LMW-GS ingrain quality has been described ear-
lier. There are several reports on the nucleotide sequences of the cloned genes for
HMW-GS and LMW-GS. The nucleotide sequence of these cloned genes provided
the basis for marker development for their further use in breeding. Zhang et al.
(2004) developed markers for Glu-A3 alleles based on DNA polymorphisms identi-
fied between the LMW glutenin genes. However markers developed by Wang et al.
(2009b, 2010) for Glu-A3 and Glu-B3 are more efficient and easier to use. However,
due to limited variation among Glu-D3 haplotypes, no allele specific marker was
developed (Liu et al. 2010), and comparatively their impact is also very small com-
pared to Glu-A3 and Glu-B3 loci (Gupta et al. 1989). Zhao et al. (2007b) attempted
to develop markers for Glu-D3 haplotypes and later Appelbee et al. (2009) tried to
use those haplotype specific marker combinations for diagnosis of some specific al-
leles like Glu-D3a, b, c and f. A total of seven allele specific markers for Glu-A3 and
ten markers for Glu-B3 loci have been reported. Additionally, Wang et al. (2009b,
2010) also established multiplex PCR strategies to reduce the cost of technique in
practical breeding programs. The practical usage of functional markers for HMW-
GS and LMW-GS to test wheat cultivars and lines has been established and reported
(Liang et al. 2010; Jin et al. 2011; Ram et al. 2011; Khalid et al. 2013).
The GBSS I (granule-bound starch synthase) is defined as Waxy ( Wx) protein,
and it is a primary enzyme involved in synthesis of amylose in wheat endosperm.
The amylose contents play an important role in determining noodle quality. The
Table 10.2 An overview of functional (allele specific) markers for grain quality traits in wheat
Trait Locus Primer Allele Size (bp) PCR conditions Reference
HMW-GS Glu-A1 F: CGAGACAATATGAGCAGCAAG Ax2* 344 94 °C/60 s–60 °C/60 s–72 °C/2 m Liu et al. 2008
R: CTGCCATGGAGAAGTTGGA Ax1, AxNull 362
F: ATGACTAAGCGGTTGGTTCTT Ax2* 1319 94 °C/30 s–58 °C/30 s–72 °C/2 m Ma et al. 2003
R: ACCTTGCTCCCCTTGTCTTT
Glu-B1 F: CCTCAGCATGCAAACATGCAGC Bx7OE 563 95 °C/30 s–58 °C/30 s–72 °C/1 m Butow et al. 2004
R: CTGAAACCTTTGGCCAGTCATGTC
F:CACTGAGATGGCTAAGCGCC Bx6 321 95 °C/30 s–50 °C/30 s–72 °C/1m Schwarz et al. 2004
R: GCCTTGGACGGCACCACAGG
F: ACGTGTCCAAGCTTTGGTTC Bx7OE 447 94 °C/35 s–63 °C/30 s–72 °C/60 s Ragupathy et al.
2008
R: GATTGGTGGGTGGATACAGG
F: CCACTTCCAAGGTGGGACTA Bx7OE 844 94 °C/35 s–63 °C/30 s–72 °C/60 s
R: TGCCAACACAAAAGAAGCTG
F: CGCAACAGCCAGGACAATT Bx17 669 94 °C/30 s–58 °C/30 s–72 °C/2m Ma et al. 2003
R: AGAGTTCTATCACTGCCTGGT
F: TTAGCGCTAAGTGCCGTCT By8 527 94 °C/30 s–64 °C/30 s–72 °C/90 s Lei et al. 2006
R: TTGTCCTATTTGCTGCCCTT
F: TTCTCTGCATCAGTCAGGA By9 662 94 °C/30 s–59 °C/30 s–72 °C/90 s
R: AGAGAAGCTGTGTAATGCC nonBy9 707

F: GCAGTACCCAGCTTCTCAA By16, ByNull 94 °C/30 s–62 °C/30 s–72 °C/90 s
R: CCTTGTCTTGTTTGTTGCC Bx20
Glu-D1 UMN25F: Dx2 299 94 °C/30 s–60 °C/30 s–72 °C/2 m Liu et al. 2008b
GGGACAATACGAGCAGCAAA
UMN25R: CTTGTTCCGGTTGTTGCCA Dx5 281
Forward: CGTCCCTATAAAAGCCTAGC Dx5 478 94 °C/30 s–58 °C/30 s–72 °C/2 m Ma et al. 2003
Reverse:
AGTATGAAACCTGCTGCGGAC
325
326

UMN26F: Dy10 397 94 °C/30 s–60 °C/30 s–72 °C/2 m Liu et al. 2008b
CGCAAGACAATATGAGCAAACT
UMN26R: TTGCCTTTGTCCTGTGTGC Dy12 415
LMW-GS Glu-A3 F: AAACAGAATTATTAAAGCCGG Glu-A3a 529 94 °C/35 s–60 °C/45 s–72 °C/90 s Wang et al. 2010
R: GGTTGTTGTTGTTGCAGCA
F: TTCAGATGCAGCCAAACAA Glu-A3b 894 94 °C/35 s–60 °C/45 s–72 °C/90 s
R: GCTGTGCTTGGATGATACTCTA
F: AAACAGAATTATTAAAGCCGG Glu-A3ac 573 94 °C/35 s–60 °C/45 s–72 °C/90 s
R: GTGGCTGTTGTGAAAACGA
F: TTCAGATGCAGCCAAACAA Glu-A3d 967 94 °C/35 s–60 °C/45 s–72 °C/90 s
R: TGGGGTTGGGAGACACATA
F: AAACAGAATTATTAAAGCCGG Glu-A3e 158 94 °C/35 s–60 °C/45 s–72 °C/90 s
R: GGCACAGACGAGGAAGGTT
F: AAACAGAATTATTAAAGCCGG Glu-A3f 552 94 °C/35 s–60 °C/45 s–72 °C/90 s
R: GCTGCTGCTGCTGTGTAAA
F: AAACAGAATTATTAAAGCCGG Glu-A3g 1345 94 °C/35 s–60 °C/45 s–72 °C/90 s
R: AAACAACGGTGATCCAACTAA
Glu-B3 F: CACAAGCATCAAAACCAAGA Glu-B3a* 1095 94 °C/35 s–56 °C/35 s–72 °C/90 s Wang et al. 2009b
R: TGGCACACTAGTGGTGGTC
F: ATCAGGTGTAAAAGTGATAG Glu-B3b 1570 94 °C/35 s–56 °C/35 s–72 °C/90 s
R: TGCTACATCGACATATCCA
F: CAAATGTTGCAGCAGAGA Glu-B3c 472 94 °C/35 s–56 °C/35 s–72 °C/90 s
R: CATATCCATCGACTAAACAAA
F: CACCATGAAGACCTTCCTCA Glu-B3d 662 94 °C/35 s–58 °C/35 s–72 °C/90 s
R: GTTGTTGCAGTAGAACTGGA
F: GACCTTCCTCATCTTCGCA Glu-B3e 669 94 °C/35 s–58 °C/35 s–72 °C/90 s
R: GCAAGACTTTGTGGCATT
A. Rasheed et al.
F: TATAGCTAGTGCAACCTACCAT Glu-B3fg* 812 94 °C/35 s–63 °C/35 s–72 °C/90 s

R: CAACTACTCTGCCACAACG
F: CCAAGAAATACTAGTTAACAC- Glu-B3g* 853 94 °C/35 s–61 °C/35 s–72 °C/90 s
TAGTC
R: GTTGGGGTTGGGAAACA
F: CCACCACAACAAACATTAA Glu- = B3h 1022 94 °C/35 s–60 °C/35 s–72 °C/90 s
R: GTGGTGGTTCTATACAACGA
F: TATAGCTAGTGCAACCTACCAT Glu-B3i 621 94 °C/35 s–58 °C/35 s–72 °C/90 s
R: TGGTTGTTGCGGTATAATTT
F: GCATCAACAACAAATAGTAC- Glu-B3bef 750 94 °C/35 s–60 °C/35 s–72 °C/90 s
TAGAA
R: GGCGGGTCACACATGACA
Grain Pin-a F: TCAACATTCGTGCATCATCA Pina-D1r 436 94 °C/50 s–53 °C/1 m–72 °C/1 m Chen et al. 2012
Texture R: CTTCATTCGTCAGAGTTCCAT
Pin-b F: ATGAAGACCTTATTCCTCCTA Pinb-D1a 250 94 °C/45 s–55 °C/45 s–72 °C/1 m Giroux and Morris
1997
R: CTCATGCTCACAGCCGCC
F: ATGAAGACCTTATTCCTCCTA Pinb-D1b 250 94 °C/45 s–55 °C/45s–72 °C/1 m
R: CTCATGCTCACAGCCGCT
Starch Wx-B1 F: CTGGCCTGCTACCTCAAGAG- Wx-B1a 425 94 °C/30 s–65 °C/30 s–72 °C/2 m Nakamura et al. 2002

property CAACT
R: CTGACGTCCATGCCGTTGACGA
F: CTGGCCTGCTACCTCAAGAG- Wx-B1 778 94 °C/30 s–65 °C/30 s–72 °C/2 m Saito et al. 2009
CAACT
R: GGTTGCGGTTGGGGTCGATGAC
F: CGTAGTAAGGTGCAAAAAAGT- Wx-B1 668
GCCACG (Null)
R: ACAGCCTTATTGTAC- 94 °C/30 s–65 °C/30 s–72 °C/2 m
CAAGACCCATGTGTG
327
328

GPC GPC-B1 F: AGCCAGGGATAGAGGAGGAA Gpc-B1 217 94 °C/30 s–58 °C/45 s–72 °C/40 s Uauy et al. 2006
R: AGCTGTGAGCTGGTGTCCTT
F: TCTCCAAGAGGGGAGAGACA Gpc-B1 126 94 °C/30 s–58 °C/45 s–72 °C/40 s Distelfeld et al. 2006
R: TTCCTCTACCCATGAATCTAGCA
PPO Ppo-A1 F: AACTGCTGGCTCTTCTTCCCA Ppo-A1a 685 94 °C/60 s–65 °C/60 s–72 °C/60 s Sun et al. 2005
activity
R: AAGAAGTTGCCCATGTCCGC Ppo-A1b 876
F: CCAGATACACAACTGCTGGC Ppo-A1a 290 95 °C/30 s–66– He et al. 2007
54 °C/30 s–72 °C/60 s*
R: TGATCTTGAGGTTCTCGTCG Ppo-A1b 481
Ppo-D1 F: TGCTGACCGACCTTGACTCC Ppo-D1a 713
R: CTCGTCACCGTCACCCGTAT
F: TGAAGCTGCCGGTCATCTAC Ppo-D1b 490
R: AAGTTGCCCATGTCCTCGCC
Lipoxy- TaLox-B1 F: CCATGACCTGATCCTTCCCTT TaLox-B1a 489 Geng et al. 2012
genase R: GCGCGGATAGGGGTGGT
activity
F: ACGATGTGAGTTGTGACTTGTGA TaLox-B1b 791
R: GCGCGGATAGGGGTGC
Yellow Psy-A1 F: GGACCTTGCTGATGACCGAG PsyA1a 194 95 °C/30 s–65 °C/30 s–72 °C/30 s He et al. 2008
pigment R: TGACGGTCTGAAGTGAGAATGA PsyA1b 231
content
F: GCCAGCCCTTCAAGGACATG PsyA1a 1686 95 °C/60 s–60 °C/2 m–72 °C/30 s He et al. 2009a
R: CAGATGTCGCCACACTGCCA PsyA1c 1001
Psy-B1 F: GCCACAACTTGAATGTGAAAC Psy-B1a 151 95 °C/60 s–60 °C/2 m–72 °C/30 s He et al. 2009a
R: ACTTCTTCCATTTGAACCCC Psy-B1b 156
F: GCCACCCACTGATTACCACTA Psy-B1c 428
R: CCAAGGTGAGGGTCTTCAAC
A. Rasheed et al.
F: GAGTAAGCCACCCACTGATT Psy-B1d 884
R: TCGCTGAGGAATGTACTGAC
F: AGGTACCAGCCAGCCCATA Psy-B1e 716
R: CTCGTCAAAGTTCGTGTACC
Psy1-D1 F: TCCGACACCATCACCAAGTTCC Psy1-D1a 1074 95 °C/30 s–58 °C/30 s–72 °C/60 s Wang et al. 2009a
R: CGTTGTAGGTTTGTGGGAGT Psy1-D1g 1093
F: ACTCCCACAAACCTACAACG Psy1-D1a 967 95 °C/30 s–58 °C/30 s–72 °C/60 s
R: ACGCTCATCAACCCCACG Psy1-D1g 1046
TaZds-A1 F: CCCTAAGGAAGCCGAGCAAAT TaZds-A1a 183 Dong et al. 2012
R: GTGAGAGTACTAATGTTATGACCG TaZds-A1b 179
TaZds-D1 F: GTGGGATCCTGTTGCTTATGC TaZds-D1a Null Zhang et al. 2011
R: GTAGATTATCCAAGCCAACTGCC TaZds-D1b 981
329
Wx-B1 null allele in a wheat cultivar is characterized by low amylose level that is
associated with high noodle making quality. Several allele specific markers have
been developed to facilitate marker assisted introgression of desired waxy allele
(Saito et al. 2009; Nakamura et al. 2002).
The description of puroindoline genes determining the kernel hardness has been
described earlier. Two genes designated as Pina-D1 and Pinb-D1 encoding puroin-
doline a and puroindoline b proteins, respectively, has a profound effect on wheat
milling quality. Molecular markers for identifying alleles at both loci have been
developed by many workers (Giroux and Morris 1997; Gazza et al. 2005; Chen et al.
2012). The allele specific marker for Pinb-D1b is diagnostic for superior milling and
processing qualities and is in extensive use in wheat breeding (Chen et al. 2012).
Polyphenol oxidase (PPO) activity is responsible for brown discoloration of the
wheat products especially Asian noodles, which is an undesirable character. It is
important to screen cultivars for low PPO activity and several markers have been
developed to serve the purpose. The PPO genes are present on chrosomosomes 2A
and 2D (Sun et al. 2005; He et al. 2007). Low PPO activity encoded by the Ppo-A1
gene is characterized by the presence of 87 and 481 PCR fragments amplified by
PPO18 and PPO33 markers, respectively. Similarly, two other allele specific mark-
ers PPO16 and PPO29 can distinguish alleles Ppo-D1a and Ppo-D1b which are
associated with lower and higher PPO activity, respectively. Practical usage of these
markers in wheat breeding for identification of genotypes with lower PPO activity
is scientifically valid (Liang et al. 2010). Nevertheless, PPO gene located on 2B
chromosome had limited polymorphism in Chinese wheat to develop a functional
marker. Lipoxygenase activity is also major determinant of color and processing
quality of wheat products (Geng et al. 2012). A lipoxygenase (LOX) gene has been
localized on chromosome 4BS ( TaLox-B1) and two allele specific markers LOX16
and LOX18 amplify 48 and 791 bp PCR fragments in cultivars with higher and
lower LOX activities, respectively (Geng et al. 2012). The gene, TaLox-B1 was
sequenced and a SNP was identified in the third exon which was helped in develop-
ment of two markers for identifying alleles TaLox-B1a and TaLox-B1b.The color
of wheat derived products is due to the yellow pigment content. Regional prefer-
ence for color does exist, like bright white color is preferred for Chinese white
salted noodles, whereas yellow alkaline noodles with bright yellow color are widely
preferred in southeastern Asia and Japan (Parker et al. 1998). Carotenoids are re-
sponsible for yellow pigment (He et al. 2008) while phytoene synthase (PSY) and
zeta-carotene desaturase (ZDS) are important enzymes in the biosynthetic pathway
for carotenoid synthesis in wheat (Zhang et al. 2011; Dong et al. 2012). PSY genes
are present chromosomes 7AL, 7BL and 7DL and several allele specific markers for
PSY genes have been developed (He et al. 2008, 2009a; Wang et al. 2009a). Simi-
larly, markers for ZDS genes on chromosomes 2A and 2D can discriminate alleleic
difference in wheat (Zhang et al. 2011; Dong et al. 2012).
Genetic Resources for Quality Improvement
The tribe Triticeae had almost 350 species, of which wheat and barley are the mem-
bers. This natural diversity in the Triticeae gene pool can be incorporated in con-
trolled and well directed manner for which the priority is given to annual and peren-
nial Triticeae species. The species resources are distributed within gene pools and
wheat improvement for environmental stresses can be realized by genetic transfer
from these gene pools over short- and long term time frames. The allelic diversity
within Triticeae is crucial to harness for meeting the projected global demand of
wheat. The key resources of variability at priority are the primary gene pool diploid
D genome donor accessions of wheat; Aegilops tauschii, and some sources from
the tertiary gene pool possessing high potential values. Utilization of these genetic
resources to develop genetically compatible germplasm readily available for wheat
improvement needs integrated breeding approach with association of emerging
technologies and multidisciplinary specialties facilitating exploitation of molecular
tools of MAS, SMART (Selectison with marker and advanced reproductive tech-
nologies) breeding and QTLs hopefully to add to breeding efficiency.
The genes coding for high molecular weight glutenins has been dissected from
several species of Triticeae including Hordeum, Secale, Taeniatherum, Thinopy-
rum, Aegilops, Crithopsis, Dasypyrum and their different ploidy members (Wan
et al. 2002; Yan et al. 2002; De Bustos and Jouve 2003; Liu et al. 2003; Sun et al.
2004; Wang et al. 2006; Cao et al. 2007; Liu et al. 2007). Due to wheat domestica-
tion syndrome, Glu-Ay always remains silent in durum and bread wheat however
several A-genone wild species and wild tetraplopid species ( T. dicoccoides and
T. dicoccon) express this gene (Waines and Payne 1987). The presence of active
Ay genes had significant positive effect on the bread-making quality (Ciaffi et al.
1995). The narrow allelic diversity for Glu-A1 locus in bread and durum wheat
which encodes limited number of x-type subunits and does not express an active
y-type subunit require attention to expand it by using novel allelic variants reported
by several workers in T. urartu and T. monococcum (Waines and Payne 1987; Ciaffi
et al. 1998; Alvarez et al. 2009; Caballero et al. 2008; Gutierrez et al. 2011). There
are extensive studies on identification and characterization of allelic variation for
Glu-Dt1 loci from Ae. tauschii and D-genome synthetic hexaploids (An et al. 2009;
Yan et al. 2003; Gianibelli et al. 2001; Rehman et al. 2008; Xu et al. 2010; Bibi
et al. 2012; Rasheed et al. 2012). A higher variability of HMW-GS due to their elec-
trophoretic mobility has been observed in A-genome species ( T. monococcum and
T. urartu) Lee et al. 1999b; Caballero et al. 2008; Gutierrez et al. 2011), AB genome
species ( T. dicoccoides) (Ciaffi et al. 1993), and D-genome species ( T. tauschii)
(Rehman et al. 2008). More recently, Niu et al. (2011) analyzed HMW-GS in Th.
bessarabicum, Th. intermedium, Lophopyrum elongatum, Ae. markgrafii and their
addition lines. The information provided is useful for the development of molecular
markers that will facilitate the introgression of desirable genes from the alien chro-
mosomes into wheat genomes. The identified novel HMWGS alleles may serve as
new genetic resources for wheat quality improvement.
Likewise HMW-GSs, many genes encoding LMW-GS have been isolated and
analyzed in cultivated and wild species of the family Triticeae. The genes coding
LMW-GS have been studied in the genera Elytrigia (Gupta and Shephard, 1990)
Elymus (Obukhova et al. 1997), Dasypyrum (Blanco et al. 1991) and Hordeum
(Atienza et al. 2002). Ae. tauschii (DD) has been an important source for genetic
studies of LMW-GS (Gianibelli et al. 2000, 2002a; Hsam et al. 2001; Pfluger et al.
2001; Vensel et al. 1997; Zhao et al. 2008) and exhibited greater variation in the
coding sequence of LMW-GS (Masci et al. 1991; Lafiandra et al. 2000). Similarly,
the other speices that have been analyzed for LMW-GS include T. monococcum,
T. urartu (Tranquilli et al. 2002; Lee et al. 1999), T. turgidum var. dicoccoides
(AABB) (Ciaffi et al. 1993), T. dicoccum (AABB) (Galterio et al. 2001), T. poloni-
cum (AABB) (Liu and Shepherd, 1996), T. macha (Xiong et al. 2010), Ae. bellulata,
Ae. comosa, Ae. markgrafii and Ae. speltoides (Li et al. 2010), hexaploid obsolete
cultivars and landraces (Ovesna et al. 2001). The variability found for LMW-GS
in wheat wild relatives indicates the valuable potential is available to improve the
properties demanded to make variable products. The advancements have been re-
ported on the molecular characterization of Glu-3 genes from different Triticeae
species. For example nucleotide sequences are available from several species of
Aegilops spp. (Jiang et al. 2008; Li et al. 2008), Agropyron elongatum (Luo et al.
2005), Secale sylvestre (Shang et al. 2005), Crithopsis delileana (Guo et al. 2008),
Hordeum chilense, and H. brevisubulatum (Piston et al. 2005). The nucleotide di-
versity of LMW-GS in these wild species indicated the allelic rich of Glu-3 loci in
Triticeae. The comparative analysis of nucleotide sequences of LMW-GS revealed
some important differences among species. For example, Hordeum chilense and
A. elongatum lacks the N-terminal regions in the predicted mature proteins (Piston
et al. 2005). However, further efforts need to be continued to study the evolution-
ary pattern and structure of LMW-GS gene in Triticeae which will further facilitate
their utilization for wheat quality improvement.
A wide survey to isolate hundreds of Pina, Pinb and GSP genes from wild ac-
cessions of T. aestivum, T. turgidum, T. urartu, T. monococcum, T. timopheevii, T.
zhukovskyi, Ae. tauschii, Ae. speltoides, Secale and Hordeum have been conducted
(Morris 2002). The wild ancestors are known to have very soft texture as compared
to domesticated derivatives (Morris 2002) however the exact variability for tex-
ture is not well established in diploid species. Diploid and hexaploid accessions
of wild species had starch-associated friabilin which are generally absent in tetra-
ploid species. However puroindoline genes are present in accessions of diploid T.
urartu, T. monococcum, Ae. tauschii and Ae. speltoides (Lillemo et al. 2002). SKCS
based characterization of 67 accessions of T. monococcum revealed the soft texture
(Pogna et al. 2002). Similarly, scanning electron microscopy based characteriza-
tion of texture revealed that Aegilops accessions of different genomes and ploidy
were usually soft (Chen et al. 2005) with exception of a single Ae. Sharonensis
accession. The species which lack Pina sequences include S-genome species Ae.
bicornis and Ae. longissima which was contradictory to the findings of Simeone
et al. (2006). They analyzed many combinations of 13 and 24 variable amino acids
in the seven new haplotypes of Pina and Pinb, respectively. A null allele at PINA
locus was found, which carries a premature stop codon, in two Ae. kotschyi (UUSS)
accessions. In Ae. sharonensis (SshSsh) novel haplotypes of Pina and Pinb were
observed with their possible pseudogenes. The credibility of cDNA of intron-less
genes is questioned due to the lack of cDNA equivalents for some genomic cop-
ies. Recently, Chen et al. (2009) studied several accessions of einkorn wheat and
identified 56 sequences encoding the pina protein. All the gene sequences from T.
urartu grouped together, whereas some sharing by three and two clusters was ob-
served for T. monococcum ssp. aegilopoides and T. monococcum ssp. monococcum,
respectively. Guzman et al. (2012) also identified various alleles for Pina and Pinb
genes including three novel alleles for the Pinb locus, Pinb-Am1i, Pinb-Am1j and
Pinb-Am1k, from T. monococcum.
The breeding of food crops for biofortification with high iron and zinc contents
is primarily important component within the food security nexus, especially in de-
veloping countries. There is need to develop special conventional and molecular
breeding approaches for cost effective nutritional improvement in cereal crops
(Bouis and Welch 2010). Currently, the cultivated durum and bread wheat varieties
are low in grain iron and zinc contents than the related wild Triticum and Aegilops
species (Chhuneja et al. 2006). Therefore the wild relatives should be emphasized
for screening for the targeted biofortification traits. Due to ease of genetic transfer,
preference should be given to the T. monococcum L., Triticum turgidum L. ssp.
dicoccoides (Korn. ex Asch. et Graebn.) Thell, Triticum turgidum L. ssp. dicoccon
(Schrank) Thell., and Ae. tauschii accessions. Several QTLs have been identified
for higher grain iron and zinc contents in a Triticum monococcum x T. boeoticum
mapping population consisting of RILs Tiwari et al. (2009). Two chromosomes 2A
and 7A were found important for the presence of QTLs controlling iron zinc con-
centrations. Several Aegilops species have been identified as potential donors of
useful variability for high iron and zinc concentration Rawat et al. (2009). These
species include Ae. kotschyi Boiss., Ae. peregrina (Hack.) Maire et Weill., Ae. ge-
niculata Roth, Ae. ventricosa Tausch, and Ae. cylindrica Host. Recently, Rawat
et al. (2011) characterized addition and substitution lines chromosome 1, 2 and 7
from Ae. kotschyi which possess genes for high grain micronutrients. Similarly,
Neelam et al. (2011) also identified the introgression of group 4 and 7 chromosomes
from Ae. peregrine enhances 100–200 % grain iron and zinc density. A series of
wheat–Ae. longissima amphiploids were also reported to have high grain iron and
zinc concentrations (Tiwari et al. 2008) and could be used as immortal sources of
variability for biofortification of wheat for high grain micronutrient concentrations.
The implementation of marker-trait combination is pre-requisite for genomics

based wheat improvement. There is rapid advancement in high-throughput protein
and gene analyses techniques offering large scale comparative analysis of genes
from wild and domestication sources. Advances in developing functional markers
for quality traits is aiding in diagnostics and introgression of favorable alleles from
different genetic resources of higher and lower ploidy including land races and wild
species. Harnessing the new allelic variability from wild sources using molecular
markers will catalyze the genetic improvement by broadening the gene pool for
maximizing the genetic gain of desirable alleles. The information discussed in this
chapter ensures that the advances in the molecular diagnostics and cytological intro-
gression approaches would resolve the complexities of the gene networks underpin-
ning quality attributes that would help to meet the challenges presented by the swift
changes occurring within the food chain.
Large scale genome sequencing and integration of bioinformatics will accelerate
the analysis structure and function of quality genes. Analysis of huge databases gen-
erated from genome sequencing and high-throughput marker analyses (SNPs and
microarray) of the expressed genes in developing grain and their integration with
web-based comparative genomic tools are formulating the strategies leading to-
wards stringent objectivity. Another avenue is the use of TILLING and small RNAs
where the specific functions are assigned to quality encoding genes by identifying
mutants and deleting the mRNA, respectively. The recent advent of Multi-parent
Advanced Generation Inter-Cross (MAGIC) approach will identify more precisely
the quality encoding genes and resolve the complexities of gene networks underpin-
ning the quality attributes to meet the upcoming challenges in grain quality.
References
Alvarez JB, Cabalero L, Nadal S, Ramirez MC, Martin A (2009) Development and gluten strength
evaluation of introgression lines of Triticum urartu in durum wheat. Cereal Res Commun
37:243–248
An XL, Li XH, Xiong XJ, Yan YM, Zhang YZ, Gao LY, Wang AL, Wang K, Zeller FJ, Hsam, SLK
(2009) Identification and isolation of a new x-type HMW glutenin subunit 1Dx1.6t gene from
Aegilops tauschii. Plant Breed 128:41–45
Appelbee MJ, Mekuria GT, Nagasandra V, Bonneau JP, Eagles HA, Eastwood RF, Mather
DE (2009) Novel allelic variants encoded at the Glu-D3 locus in bread wheat. J Cereal Sci
49:254–261
Araki E, Miura, H, Sawada S (1999) Identification of genetic loci affecting amylose content and
agronomic traits on chromosome 4A of wheat. Theor Appl Genet 98:977–984
Atienza SG, Alvarez JB, Villegas AM, Giménez MJ, Ramírez MC, Martín A, Martín LM (2002)
Variation for the low-molecular-weight glutenin subunits in a collection of Hordeum chilense.
Euphytica 128:269–277
Avivi L (1978) High protein content in wild tetraploid Triticum dicoccoides Korn. In: Ramanujam
S (ed) Proceedings of the 5th international wheat genetics symposium. Indian Society of Ge-
netics and Plant Breeding (ISGPB), New Delhi pp 372–380
Bhave M, Morris CF (2008) Molecular genetics of puroindolines and related genes: allelic diver-
sity in wheat and other grasses. Plant Mol Biol 66:205–219
Bibi A, Rasheed A, Kazi AG, Mahmoood T, Ajmal S, Mujeeb-Kazi A (2012) High-molecular-
weight (HMW) glutenin subunit composition of the Elite-II synthetic hexaploid wheat subset
( Triticum turgidum x Aegilops tauschii; 2n = 6x = 42; AABBDD). Plant Genet Resour 10:1–4
Bietz JA, Huebner FR, Sanderson JE, Wall JS (1977) Wheat gliadin homology revealed through
N-terminal amino acid sequence analysis. Cereal Chem 54:1070–1083
Bietz JA, Shepherd KW, Wall JS (1975) Single-kernel analysis of glutenin: use in wheat genetics
and breeding. Cereal Chem 52:513–532
Bietz JA, Wall JS (1973) Isolation and characterization of gliadin-like subunits from glutenins.
Cereal Chem. 50:537–547
Blanco A, Resta P, Simeone R, Parmar S, Shewry PR, Sabelli P, Lafiandra D (1991) Chromosomal
location of seed storage protein genes in the genome of Dasypyrum villosum. Theor Appl
Genet 82:358–362
Bouis HE, Welch RM (2010) Biofortification—a sustainable agricultural strategy for reducing
micronutrient malnutrition in the global south. Crop Sci 50:20–32
Breseghello F, Finney PL, Gaines C, Andrews L, Tanaka J, Penner G, Sorrells ME (2005) Genetic
loci related to kernel quality differences between a soft and a hard wheat cultivar. Crop Sci
45:1685–1695
Butow BJ, Gale KR, Ikea J, Juhasz A, Bedo Z, Tamas L, Gianibelli MC (2004) Dissemination of
the highly expressed Bx7 glutenin subunit (Glu-B1al allele) in wheat as revealed by novel PCR
markers and RP-HPLC. Theor Appl Genet 109:1525–1535
Caballero L, Martin MA, Alvarez JB (2008) Allelic variation for the high- and low-molecular-
weight glutenin subunits in wild diploid wheat ( Triticum urartu) and its comparison with du-
rum wheat. Aus J Agric Res 59:906–910
Cakmak I, Torun A, Millet E, Feldman M, Fahima T, Korol AB, Nevo E, Braun HJ, Ozkan H
(2004) Triticum dicoccoides: an important genetic resource for increasing zinc and iron con-
centration in modern cultivated wheat. Soil Sci Plant Nutr 50:1047–1054
Caldwell DG, McCallum N, Shaw P, Muehlbauer GJ, Marshall DF, Waugh R (2004) A structured
mutant population for forward and reverse genetics in barley (Hordeum vulgare L.). Plant J
4:143–150
Campbell KG, Bergman CJ, Gualberto DG, Anderson JA, Giroux MJ, Hareland G, Flucher GR,
Sorrells ME, Finney PL (1999) Quantitative trait loci associated with kernel traits in a soft×
hard wheat cross. Crop Sci 39:1184–1195
Campbell KG, Finney PL, Bergman CJ, Gualberto DG, Anderson JA, Giroux MJ, Siritunga D,
Zhu J, Gendre F, Roue´ C, Ve´rel A, Sorrells ME(2001) Quantitative trait loci associated with
milling and baking quality in a soft by hard wheat cross. Crop Sci 41:1275–1285
Cane K, Spackman M, Eagles HA (2004) Puroindoline genes and their effects on grains quality
traits in southern Australian wheat cultivars. Aus J Agric Res 55:89–95
Cantrell RG, Joppa LR (1991) Genetic analysis of quantitative traits in wild emmer ( Triticumtur-
gidum L. var. dicoccoides). Crop Sci 31:645–649
Cantu D, Pearce SP, Distelfeld A, Christiansen MW, Uauy C, Akhunov E, Fahima T, Dubcovsky
J (2011) Effect of the down-regulation of the high grain protein content (GPC) genes on the
wheat transcriptome during monocarpic senescence. BMC Genomics 12:1–12
Cao S, Xu H, Li Z, Wang X, Wang D, Zhang A (2007) Identification and characterization of a
novel Ag. intermedium HMW-GS gene from T. aestivum-Ag. intermedium addition lines TAI-I
series. J Cereal Sci 45:293–301
Carter AH, Garland-Campbell K, Morris FC, Kidwell KK (2012) Chromosomes 3B and 4D are
associated with several milling and baking quality traits in a soft white spring wheat ( Triticum
aestivum L.) population. Theor Appl Genet 124:1079–1096
Chalmers KJ, Rathjen AJ, Langridge P (1999) Mapping loci associated with milling yield in wheat
( Triticum aestivum L.). Mol Breed 5:561–568.
Chantret N, Salse J, Sabot F, Rahman S, Bellec A, Laubin B, Dubois I, Dossat C, Sourdille P,
Joudrier P, Gautier MF, Cattolico L, Beckert M, Aubourg S, Weissenbach J, Caboche M, Ber-
nard M, Leroy P, Chalhoub B (2005) Molecular basis of evolutionary events that shaped the
hardness locus in diploid and polyploid wheat species ( Triticum and aegilops). Plant Cell
17:1033–1045
Chen F, Zhang FY, Xia XC, Dong ZD, Cui DQ (2012) Distribution of puroindoline alleles in bread
wheat cultivars of the Yellow and Huai valley of China and discovery of a novel puroindoline
a allele without PINA protein. Mol Breed. doi:10.1007/s11032-011-9553-2
Chen M, Wilkinson M, Tosi P (2005) Novel puroindoline and grain softness protein alleles in Ae-
gilops species with the C, D, S, M and U genomes. Theor Appl Genet 111:1159–1166
Chen Q, Qi P, Wei Y, Wang J, Zheng Y (2009) Molecular Characterization of the pina Gene in
Einkorn Wheat. Biochem Genet 47:384–396
Cheryan M (1980) Phytic acid interactions in food systems. CRC Crit Rev Food Sci Nutr 13:297–
335
Chhuneja P, Dhaliwal HS, Bains NS, Singh K (2006) Aegilops kotschyi and Aegilops tauschii as
sources for higher levels of grain iron and zinc. Plant Breed 125:529–531
Ciaffi M, Dominici L, Lafiandra D (1998) High molecular weight glutenin subunit variation in
wild and cultivated einkorn wheat. Plant Syst Evol. 209:123–137
Ciaffi M, Lafiandra D, Porceddu E, Benedettelli S (1993) Storageprotein variation in wild emmer
wheat ( Triticum turgidum ssp. dicoccoides) from Jordan and Turkey. I. Electrophoretic charac-
terization of genotypes. Theor Appl Genet 86:474–480
Ciaffi M, Lafiandra D, Turchetta T, Ravaglia S, Bariana H, Gupta R, MacRitchie F (1995) Bread
making potential of durum wheat lines expressing both x- and y-type subunits at the Glu-A1
locus. Cereal Chem 72:465–469
Cloutier S, Rampitsch C, Penner GA (2001) Cloning and expression of a LMW-i glutenin gene. J
Cereal Sci 33:143–154
D’Ovidio R, Masci S (2004) The low-molecular-weight glutenin subunits of wheat gluten. J Cereal
Sci 39:321–339
D’Ovidio R, Masci S, Porceddu E (1995) Development of a set of oligonucleotide primers specificc
for genes at the Glu-1 complex loci of wheat. Theor Appl Genet 91:189–194
De Bustos A, Jouve N (2003) Characterisation and analysis of new HMW-glutenin alleles encoded
by the Glu-R1 locus of Secale cereale. Theor Appl Genet 107:74–83
Devos KM (2005) Updating the ‘crop circle’. Current Opin Plant Biol 8:155–162
Distelfeld A, Cakmak I, Peleg Z, Ozturk L, Yazici AM, Budak H, Saranga Y, Fahima T (2007)
Multiple QTL-effects of wheat Gpc-B1 locus on grain protein and micronutrient concentra-
tions. Physiol Plantarum 127:635–644
Distelfeld A, Uauy C, Fahima T, Dubcovsky J (2006) Physical map of the wheat high-grain protein
content gene Gpc-B1 and development of a high-throughput molecular marker. New Phytolo-
gist 169:753–763
Distelfeld A, Uauy C, Olmos S, Schlatter AR, Dubcovsky J, Fahima T (2004) Microcolinearity
between a 2 cm region encompassing the grain protein content locus Gpc-6B1 on wheat chro-
mosome 6 and a 350-kb region on rice chromosome 2. Func Integrat Genom 4:59–66
Dong CH, Ma ZY, Xia XC, Zhang LP, He ZH (2012) Allelic variation at the TaZds-A1 locus on
wheat chromosome 2A and development of a functional marker in common wheat. Agric Sci
China (in press)
DuPont FM, Vensel WH, Chan R, Kasarda DD (2000) Characterization of the 1Btype ω-gliadins
from Triticum aestivum cultivar Butte. Cereal Chem 77:607–614
Elangovan M, Rai R, Dholakia BB, Lagu MD, Tiwari R, Gupta RK, Rao VS, Roder MS, Gupta
VS (2008) Molecular genetic mapping of quantitative trait loci associated with loaf volume in
hexaploid wheat (Triticum aestivum). J Cereal Sci 47:587–598
FAO (2009) World wheat statistics. Food and Agriculture Organization, Rome
Galili G, Feldman M (1984) Mapping of glutenin and gliadin genes located on chromosome 1B of
common wheat. Mol Gen Genet 193:293–298
Galterio G, Cardarilli D, Codianni P, Acquistucci R (2001) Evaluation of chemical and techno-
logical characteristics of new lines of Triticum turgidum ssp dicoccum. Nahrung 45:263–266
Gao L, Ma W, Chen L, Wang K, Ki J, Wang S, Békés F, Appels R, Yan Y (2010) Characterisation
and comparative analysis of wheat high molecular weight glutenin subunits by SDS-PAGE,
RP-HPLC, HPCE, and MALDI-TOF-MS. J Agric Food Chem 58:2777–2786
Gautier MF, Aleman ME, Guirao A, Marion D, Joudrier P (1994) Triticum aestivum puroindolines,
two basic cystine-rich seed proteins: CDNA sequence analysis and developmental gene expres-
sion. Plant Mol Biol 25:43–57
Geng HW, He ZH, Zhang LP, Qu YY, Xia XC (2012) Cloning the lipoxygenase gene on chromo-
some 4BS and development of functional markers in common wheat. Crop Sci 52. doi:10.2135/
cropsci2011.07.0365
Gianibelli MC, Gupta RB, Lafiandra D, Margiotta B, MacRitchie F (2001) Polymorphism of high
Mr glutenin subunits in Triticum tauschii: characterization by chromatography and electropho-
resis methods. J Cereal Sci 33:39–52
Gianibelli MC, Gupta RB, MacRitchie F (2000) HMW and LMW subunits of glutenin of Triticum
tauschii, the D genome donor to hexaploid wheat. In: Schofield JD (ed.), Wheat Structure,
Biochemistry and Functionality. The Royal Society of Chemistry, UK pp 139–145
Gianibelli MC, Larroque OR, MacRichie F, Wrigley CW (2001) Biochemical, genetic and molecu-
lar characterization of wheat glutenin and its component subunits. Cereal Chem 78:635–646
Gianibelli MC, Masci S, Larroque OR, Lafiandra D, MacRitchie F (2002) Biochemical character-
ization of a novel polymeric protein subunit from bread wheat ( Triticum aestivum L.). J Cereal
Sci 35:265–276
Giroux MJ, Morris CF (1997) A glycine to serine change in puroindoline b is associated with
wheat grain hardness and low levels of starch-surface friabilin. Theor Appl Genet 95:857–864
Giroux MJ, Morris CF (1998) Wheat grain hardness results from highly conserved mutations in the
friabilin components Puroinodoline a and b. Proceedings Nat Acad Sci U S A 95:6262–6266
Gollan P, Smith K, Bhave M (2007) Gsp-1 genes comprise a multigene family in wheat that ex-
hibits a unique combination of sequence diversity yet conservation. J Cereal Sci 45:184–198
Guo ZF, Dong P, Long XY, Wei YM, Zhang LJ, Zheng YL (2008) Molecular characterization
of LMW prolamines from Crithopsis delileana and the comparative analysis with those from
Triticeae. Hereditas 145:204–211
Gupta RB, Shephard KW (1990) Two-step one-dimensional SDSPAGE analysis of LMW subunits
of glutelin. 2. Genetic control of the subunits in species related to wheat. Theor Appl Genet
80:183–187
Gupta RB, Shepherd KW (1993) Production of multiple wheat rye 1RS translocation stocks and
genetic analysis of LMW subunits of glutenin and gliadins in wheat using these stocks. Theor
Gupta RB, Singh NK, Shepherd KW (1989) The cumulative effects of allelic variation in LMW
and HMW glutenin subunits on physical dough properties in the progeny of two bread wheat.
Theor Appl Genet 77:57–62
Gutierrez MV, Guzman C, Martin LM, Alvarez JB (2011) Molecular characterization of the
Glu-Ay gene from Triticum urartu for its potential use in quality wheat breeding. Plant Genet
Resour 9:334–337
Guzman C, Caballero L, Martın MA, Alvarez JB (2012) Molecular characterization and diver-
sity of the Pina and Pinb genes in cultivated and wild diploid wheat. Mol Breed doi:10.1007/
s11032-011-9599-1
Halford NG, Field JM, Blair H, Urwin P, Moore K, Robert L, Thompson R, Flavell RB, Tatham
AS, Shewry PR (1992) Analysis of HMW glutenin subunits encoded by chromosome 1A of
bread wheat ( Triticum aestivum L.) indicates quantitative effects on grain quality. Theor Appl
Genet 83:373–378
Harberd NP, Bartels D, Thompsom RD (1985) Analysis of the gliadin multigene loci in bread
wheat using nullisomic-tetrasomic lines. Mol Gen Genet 198:234–242
Hassani ME, Shariflou MR, Gianibelli MC, Sharp PJ (2006) Gli -Dtt1 and a novel γ-gliadin gene
in Aegilops tauschii. Plant Breed 125:27–31
He XY, He ZH, Ma W, Appels R, Xia XC (2009a) Allelic variants of phytoene synthase 1 (Psy1)
genes in Chinese and CIMMYT wheat cultivars and development of functional markers for
flour colour. Mol Breed 23:553–563
He XY, He ZH, Zhang LP, Sun DJ, Morris CF, Fuerst EP, Xia XC (2007) Allelic variation of
polyphenol oxidase (PPO) genes located on chromosomes 2A and 2D and development of
functional markers for the PPO genes in common wheat. Theor Appl Genet 115:47–58
He XY, Wang JW, Ammar K, Pena RJ, Xia XC, He ZH (2009b) Allelic variants at the Psy-A1
and Psy-B1 loci in durum wheat and their associations with grain yellowness. Crop Sci
49:2058–2064
He XY, Zhang YL, He ZH, Wu YP, Xiao YG, Ma CX, Xia XC (2008) Characterization of phytoene
synthase 1 gene (Psy1) located on common wheat chromosome 7A and development of a func-
tional marker. Theor Appl Genet 116:213–221
Hsam SLK, Kieffer R, Zeller FJ (2001) Significance of Aegilops tauschii glutenin genes on bread-
making properties of wheat. Cereal Chem 78:521–525
Huang XQ, Cloutier S, Lycar L, Radovanovic N, Humphreys DG, Noll JS, Somers DJ, Brown
PD (2006) Molecular detection of QTL for agronomic and quality traits in a doubled hap-
loid population derived from two Canadian wheats ( Triticum aestivum L.). Theor Appl Genet
113:753–766
Ikeda TM, Araki E, Fujita Y, Yano H (2006) Characterization of low-molecular-weight glutenin
subunit genes and their protein products in common wheat. Theor Appl Genet 112:327–334
Ikeda TM, Nagamine T, Fukuoka H, Yano H (2002) Identification of new low-molecular weight
glutenin subunit genes in wheat. Theor Appl Genet 104:680–687
Jackson EA, Holt LM, Payne PI (1983) Characterisation of high-molecular-weight gliadin and
low-molecular-weight glutenin subunits of wheat endosperm by two dimensional electropho-
resis and the chromosomal localisation of their controlling genes. Theor Appl Genet 66:29–37
Jackson EA, Holt LM, Payne PI (1985) Glu-B2, a storage protein locus controlling the D group of
LMW glutenin subunits in bread wheat ( Triticum aestivum). Genet Res 47:11–17
Jackson EA, Morel MH, Sontag-Strohm T, Branlard G, Metakovsky EV, Redaelli R (1996) Pro-
posal for combining the classification systems of alleles of Gli-1 and Glu-3 loci in bread wheat
( Triticum aestivum L.) J Genet Breed 50:321–336
Jiang CX, Pei YH, Zhang YZ, Li XH, Yao DN, Yan YM, Hsam SLK, Zeller FJ (2008) Molecu-
lar cloning and characterization of four novel LMW glutenin subunit genes from Aegilops
longissima, Triticum dicoccoides and T. zhukovskyi. Hereditas 145:92–98
Jin H, Yan J, Peña RJ, Xia XC, Morgounov A, Han LM, Zhang Y, He ZH (2011) Molecular de-
tection of high- and low-molecular weight glutenin subunit genes in common wheat cultivars
from 20 countries using allele-specific markers. Crop Pasture Sci 62:746–754
Joppa LR, Hart GE, Hareland GA (1997) Mapping a QTL for grain protein in tetraploid wheat
( Triticum turgidum L.) using a population of recombinant inbred chromosome lines. Crop Sci
37:1586–1589
Juhász A, Gianibelli MC (2006) Low-molecular-weight glutenin subunits: insight into this abun-
dant subunit group present in glutenin polymers. In: Wrigley CW, Békés F, Bushuk W (eds)
Gliadin and glutenin: the unique balance of wheat quality. AACC International Press, St Paul,
pp 171–212
Kade M, Barneix AJ, Olmos S, Dubcovsky J (2005) Nitrogen uptake and remobilization in tetra-
ploid ‘Langdon’ durum wheat and a recombinant substitution line with the high grain protein
gene Gpc-B1. Plant Breed 124:343–349
Kasarda DD, Autran JC, Lew EJL, Nimmo CC, Shewry PR (1983) N-terminal amino acid se-
quences of ω-gliadins and ω-secalins; Implications for the evolution of prolamin genes. Bio-
chim Biophy Acta 747:138–150
Kasarda DD, Okita TW, Bernardin JE, Baecker PA, Nimmo CC, Lew EJL, Dietler MS, Green FC
(1984) Nucleic (cDNA) and amino acid sequences of α-type gliadins from wheat ( Triticum
aestivum). Proceedings Nat Acad Sci U S A 81:4712–4716
Khalid M, Mahmood T, Rasheed A, Kazi AG, Ali A, Mujeeb-Kazi A (2013) GluDt1 allelic varia-
tion in synthetic hexaploid wheats derived from durum cultivar ‘Decoy’ x Aegilops tauschii
accessional crosses. Pak J Bot 45:409–414
Kuchel H, Langridge P, Mosionek L, Williams K, Jefferies SP (2006) The genetic control of mill-
ing yield, dough rheology and baking quality of wheat. Theor Appl Genet 112:1487–1495
Lafiandra D, Benedettelli S, Porceddu E (1988) Null forms for storage proteins in bread wheat
and durum. pp 963–967 In: Miller TE, Koebner RMD (eds). proceeding the 7th International
Wheat Genetics Symposium. Inst. Plant Sci Res, Cambridge
Lafiandra D, Margiotta B, Colaprico G, Masci S, Roth MR, MacRitchie F (2000) Introduction of
the D-genome related high- and low-Mr glutenin subunits into durum wheat and their effect on
technological properties. In: Shewry PR., Thatam AS (eds.), Wheat Gluten, Royal Society of
Chemistry, UK, pp 51–54
Lafiandra D, Masci S, Margiotta B, Ambrogio ED (1998) Development of durum and bread wheat
with increased number of high molecular weight glutenin subunits. pp 261–264, 146 In: Pro-
ceeding 9th International Wheat Genetics Symposium, Vol. 4. Grain Quality. Slinkard AE (ed).
University of Saskatchewan, Canada
Lee YK, Bekes F, Gras P, Ciaffi M, Morell MK, Appels R (1999) The low-molecular-weight glu-
tenin subunit proteins of primitive wheat. IV. Functional properties of products from individual
genes. Theor Appl Genet 98:149–155
Lei ZS, Gale KR, He ZH, Gianibelli C, Larroque O, Xia SX, Butow BJ, Ma W (2006) Y-type gene
specific markers for enhanced discrimination of high-molecular weight glutenin alleles at the
Glu-B1 locus in hexaploid wheat. J Cereal Sci 43:94–101
Li XH, Ma WJ, Gao LY, Zhang YZ, Wang AL, Ji KM, Wang K, Appels R, Yan YM (2008) A novel
chimeric low molecular-weight glutenin subunit gene from the wild relatives of wheat Aegilops
kotschyi and Ae. juvenalis: evolution at the Glu-3 loci. Genetics 180:93–101
Li XH, Wang K, Wang SL, Gao LY, Xie XX, Hsam SLK, Zeller FJ, Yan YM (2010) Molecular
characterization and comparative transcriptional analysis of LMW-m-type genes from wheat
( Triticum aestivum L.) and Aegilops species. Theor Appl Genet 121:845–856
Liang D, Tang JW, Pen˜a RJ, Singh R, He XY, Shen XY, Yao DN, Xia XC, He ZH (2010) Char-
acterization of CIMMYT bread wheat for high- and low-molecular weight glutenin subunits
and other quality-related genes with SDS-PAGE, RP-HPLC and molecular markers. Euphytica
172:235–250
Lillemo M, Simeone MC, Morris CF (2002) Analysis of puroindoline a and b sequences from
Triticum aestivum cv. ‘Penawawa’ and related taxa. Euphytica 126:321–331
Liu CY, Shepherd KW (1996) Variation of B subunits of glutenin in durum, wild and less-widely
cultivated tetraploid wheat. Plant Breed 115:172–178
Liu L, Ikeda TM, Branlard G, Peña RJ, Rogers WJ, Lerner SE, Kolman MA, Xia XC, Wang LH,
Ma WJ, Appels R, Yoshida H, Wang AL, Yan YM, He ZH (2010) Comparison of low molecular
weight glutenin subunits identified by SDS-PAGE, 2-DE, MALDI-TOF-MS and PCR in com-
mon wheat. BMC Plant Biol 10:124
Liu SW, Gao X, Xia GM (2008b) Characterizing HMW-GS alleles of decaploid Agropyron elon-
gatum in relation to evolution and wheat breeding. Theor Appl Genet 116:325–334
Liu SW, Zhao SG, Chen FG, Xia GM (2007) Generation of novel high quality HMW-GS genes
in two introgression lines of Triticum aestivum/Agropyron elongatum. BMC Evol Biol 7:76
Liu SX, Chao SM, Anderson JA (2008a) New DNA markers for high molecular weight glutenin
subunits in wheat. Theor Appl Genet 118:177–183
Liu Z, Yan Z, Wan Y, Liu K, Zheng Y, Wang D (2003) Analysis of HMW glutenin subunits and
their coding sequences in two diploid Aegilops species. Theor Appl Genet 106:1368–1378
Long H, Wei YM, Yan ZH, Baum B, Nevo E, Zheng YL (2005) Classification of wheat low-molec-
ular-weight glutenin subunit genes and its chromosome assignment by developing LMW-GS
group-specific primers. Theor Appl Genet 111:1251–1259
Luo Z, Chen FG, Feng DS, Xia GM (2005) LMW glutenin genes in Agropyron elongatum and
their potential value in wheat breeding. Theor Appl Genet 111:272–280
Ma DY, Yan J, He ZH, Wu L, Xia XC (2012) Characterization of a cell wall invertase gene TaCwi-
A1 on common wheat chromosome 2A and development of functional markers. Mol Breed
29:43–52
Ma W, Anderson O, Kuchel H, Bonnardeaux Y, Collins H, Morell MK, Langridge P, Appels R

(2009) Genomics of quality traits. In: Feuillet C, Muehlbauer GJ (eds.) Genetics and Genomics
of the Triticeae. Springer, New York, pp 611–652
Ma W, Zhang W, Gale KR (2003) Multiplex-PCR typing of high molecular weight glutenin alleles
in wheat. Euphytica 134:51–60
Margiotta B, Urbano M, Colaprico G, Johansson E, Buonocore F, D’Ovidio R, Lafiandra D (1996)
Detection of y-type subunit at the Glu-A1 locus in some Swedish bread wheat lines. J Cereal
Sci 23:203–211
Masci SM, Porceddu E, Colaprico G, Lafiandra D (1991) Comparison of the B and D subunits of
glutenin encoded at the Glu-D3 locus in two biotypes of the common wheat cultivar Newton
with different technological characteristics. J Cereal Sci 14:35–46
Massa AN, Morris CF, Gill BS (2004) Sequence diversity of puroindoline-a, puroindoline-b, and
the grain softness protein genes in Aegilops tauschii coss. Crop Sci 44:1808–1816
Mattern PJ, Morris R, Schmidt JW, Johnson VA (1973) Location of genes for kernel properties in
the wheat cultivar ‘Cheyenne’ using chromosome substitution lines. In: Sears ER, Sears LMS
(eds.) Proceeding 4th Int. Wheat Genet. Symp. University of Missouri, Columbia pp 703–707
McCartney CA, Somers DJ, Lukow O, Ames N, Noll J, Cloutier S, Humphreys DG, McCallum
BD (2006) QTL analysis of quality traits in the spring wheat cross RL4452 by ‘AC Domain’.
Plant Breed 125:565–575
McIntosh R, Dubcovsky J, Rogers J, Morris C, Appels R, Xia X (2010) Catalogue of gene symbols
for wheat 2010 supplement. Annual Wheat Newsletter 56:273–282
Mecham DK, Kasarda DD, Qualset CO (1978) Genetic aspects of wheat gliadin proteins. Biochem
Genet 16:831–853
Metakovsky EV (1991) Gliadin allele identification in common wheat II. Catalogue of gliadin al-
leles in common wheat. J Genet Breed 45:325–344
Metakovsky EV, Chernakov VM, Upelniek VP, Redaelli R, Dardevet M, Branlard G, Pogna NG
(1996) Recombination mapping of minor omega-gliadin-coding loci on chromosome 1A of
common wheat: a revision. J Genet Breed 50:277–286
Metakovsky EV, Novoselskaya AY, Sozinov AA (1984) Genetic analysis of gliadin components
in winter wheat using two-dimensional polyacrylamide gel electrophoresis. Theor Appl Genet
69:31–37
Morris CF (2002) Puroindolines: the molecular genetic basis of wheat grain hardness. Plant Mol
Biol 48:633–647
Morris CF, Bhave M (2008) Reconciliation of D-genome puroindoline allele designations with
current DNA sequence data. J Cereal Sci 47:277–287
Müller S, Wieser H (1995) Disulphide bonds of α-type gliadins. J Cere Sci 22: 21–27
Müller S, Wieser H (1997) The location of disulphide bonds in monomeric γ-type gliadins.
J Cereal Sci 26:169–176
Nakamura T, Vrinten P, Saito M, Konda M (2002) Rapid classification of partial waxy wheat using
PCR-based markers. Genome 45:1150–1156
Neelam K, Rawat N, Tiwari VK, Kumar S, Chhuneja P, Singh K, Randhawa GS, Dhaliwal HS
(2011) Introgression of group 4 and 7 chromosomes of Ae. peregrina in wheat enhances grain
iron and zinc density. Mol Breed 28:623–634
Nelson JC, Andreescu C, Breseghello F, Finney PL, Daisy G, Gualberto DG, Bergman CJ, Pena
RJ, Perretant MR, Leroy P, Qualset CO, Sorrells ME (2006) Quantitative trait locus analysis of
wheat quality traits. Euphytica 149:145–159
Niu ZX, Klindworth R, Wang R R-C, Jauhar PP, Larkin PJ, Xu SS (2011) Characterization of
HMW glutenin subunits in Thinopyrum intermedium, Th. bessarabicum, Lophopyrum elonga-
tum, Aegilops markgrafii, and their addition lines in wheat. Crop Sci 51:667–677
Obukhova LV, Generalova GV, Agafonov AV, Kumarev VP, Popova NA, Gulevich VV (1997) A
comparative molecular genetic study of glutelins in wheat and Elymus. Genetika 33:1001–1004
Obukhova LV, Maystrenko OI, Generalova GV, Ermakova MF, Popova RK (1997) Composition
of high molecular weight glutenin subunits in common wheat substitution lines created from
cultivars with contrasting bread-making qualities. Russian J Genetics 33:5–100
Olmos S, Distelfeld A, Chicaiza O, Schlatter AR, Fahima T, Echenique V, Dubcovsky J (2003)

Precise mapping of a locus affecting grain protein content in durum wheat. Theor Appl Genet
107:1243–1251
Osborne TB (1907) The protein of the wheat kernel. Publication No. 84. Carnegie Institute:
Washington, DC
Ovesna J, Novakova I, Kucera L, Dotlacil L (2001) Characterisation of variability at Glu-3 loci
in some European wheat obsolete cultivars and landraces using PCR. Cereal Res Commun
29:205–213
Parker GD, Chalmers KJ, Rathgen AJ, Langridge P (1998) Mapping loci associated with flour
colour in wheat ( Triticum aestivum L.). Theor Appl Genet 97:238–245
Payne PI (1987) Genetic of wheat storage proteins and the effect of allelic variation on bread mak-
ing quality. Ann Rev Plant Physiol 38:141–153
Payne PI, Law CN, Mudd EE (1980) Control by homoeologous group 1 chromosomes of the
high-molecular-weight subunits of glutenin, a major protein of wheat endosperm. Theor Appl
Genet 58:113–120
Payne PI, Lawrence GJ (1983) Catalogue or alleles for the complex gene loci, Glu-A1, Glu-B1
and Glu-D1 which code for the high-molecular weight subunit of glutenin whose in hexaploid
wheat. Cereal Res Commun 11:29–35
Payne PI, Nightingale MA, Krattinger AF, Holt LM (1987) The relationship between HMW glu-
tenin subunit composition and bread making quality of British grown wheat varieties. J Sci
Food Agric 40:51–65
Pfluger LA, D’Ovidio R, Margiotta B, Pena R, Mujeeb-Kazi A, Lafiandra D (2001) Characterisa-
tion of high-and low-molecular weight glutenin subunits associated to the D genome of Aegil-
ops tauschii in a collection of synthetic hexaploid wheat. Theor Appl Genet 103:1293–1301
Piston F, Martin A, Dorado G, Barro F (2005) Cloning and molecular characterization of B-horde-
ins from Hordeum chilense (Roem. et Schult.). Theor Appl Genet 111:551–560
Pogna NE, Gazza L, Boggini G (2002) Puroindoline and kernel hardness in Triticum aestivum and
Triticum monococcum. Annual Wheat Newsletter. Experimental Institute for Cereal Research,
Italy p 60
Pogna NE, Metakovsky EV, Redaelli R, Raineri F, Dachkevitch T (1993) Recombination mapping
of Gli-5, a new gliadin-coding locus on chromosomes 1A and 1B in common wheat. Theor
Popineau Y, Pineau F (1987) Investigation of surface hydrophobicities of purified gliadins by hy-
drophobic interaction chromatography, reversed-phase high performance chromatography and
a polar ligand binding. J Cereal Sci 5:215–231
Pozniak CJ, Knox RE, Clarke FR, Clarke JM (2007) Identification of QTL and association of a
phytoene synthase gene with endosperm colour in durum wheat. Theor Appl Genet 114:525
Qi PF, Wei YM, Ouellet T, Chen Q, Tan Z, Zheng YL (2009) The gamma-gliadin multigene
family in common wheat ( Triticum aestivum) and its closely related species. BMC Genomics
10:168
Ragupathy R, Naeem HA, Reimer E, Lukow OM, Sapirstein HD, Cloutier S (2008) Evolution-
ary origin of the segmental duplication encompassing the wheat Glu-B1 locus encoding the
over expressed Bx7 (Bx7OE) high molecular weight glutenin subunit. Theor Appl Genet
116:283–296
Ram S, Sharma S, Verma A, Tyagi BS, Pena RJ (2011) Comparative analyses of LMW glutenin
alleles in bread wheat using allele specific PCR and SDS-PAGE. J Cereal Sci 54:488–493
Ram S, Verma A, Sharma S (2010) Large variability exist in phytase levels among indian wheat
varieties and synthetic hexaploids. J Cereal Sci 52:486–490
Rasheed A, Mahmood T, Kazi AG, Ghafoor A, Mujeeb-Kazi A (2012) Allelic variation and com-
position of HMW-GS in advanced lines derived from D-genome synthetic hexaploid/bread
wheat ( Triticum aestivum L.). J Crop Sci Biotechnol 15:1–7
Rawat N, Neelam K, Tiwari VK, Randhawa GS, Friebe B, Gill BS, Dhaliwal HS (2011) Develop-
ment and molecular characterization of wheat—Aegilops kotschyi addition and substitution
lines with high grain protein, iron, and zinc. Genome 54:943–953
Rawat N, Tiwari VK, Neelam K, Randhawa GS, Singh K, Chhuneja P, Dhaliwal HS (2009) Devel-
opment and characterization of wheat-Aegilops kotschyi amphiploids with high grain iron and
zinc. Plant Genet Resour 7:271–280
Rehman A, Evans N, Gianibelli MC, Rose RJ (2008) Allelic variation in high and low molecular
weight glutenins at the Glu-Dt locus of Aegilops tauschii as a potential source for improving
bread wheat quality. Aus J Agric Res 59:399–405
Reif JC, Gowda M, Maurer HP, Longin CFH, Korzun V, Ebmeyer E, Bothe R, Pietsch C, Wurs-
chum T (2011) Association mapping for quality traits in soft winter wheat. Theor Appl Genet
122:961–970
Reynolds MP, Foulkes JM, Slafer GA, Berry P, Parry MAJ, Snape J, Angus WJ (2009) Raising
yield potential in wheat. J Exp Bot 60:1899–1918
Saito M, Vrinten P, Ishikawa G, Graybosch R, Nakamura T (2009) A novel codominant marker for
selection of the null Wx-B1 allele in wheat breeding programs. Mol Breed 23:209–217
Schwarz G, Felsenstein FG, Wenzel G (2004) Development and validation of a PCR-based marker
assay for negative selection of the HMW glutenin allele Glu-B1–1d (Bx-6) in wheat. Theor
Appl Genet 109:1064–1069
Shang HY, Wei YM, Long H, Yan ZH, Zheng YL (2005) Identification of LMW glutenin-like
genes from Secale sylvestre Host. Russian J Genet 41:1372–1380
Shewry PR, Halford NG (2002) Cereal seed storage proteins: structures, properties and role in
grain utilization. J Exp Bot 53:947–958
Shewry PR, Halford NG, Belton PS, Tatham AS (2002) The structure and properties of gluten: an
elastic protein from wheat grain. Phil Trans R Soc Lond B 357:133–142
Shewry PR, Halford NG, Tatham AS (1989) The high molecular weight subunits of wheat, barley
and rye: genetics, molecular biology, chemistry and role in wheat gluten structure and function-
ality. Oxford Surv. Plant Mol Cell Biol 6:163–219
Shewry PR, Tatham AS (1990) The prolamin storage proteins of cereal seeds: structure and evolu-
tion. Biochem J 267:1–12
Shewry PR, Tatham AS (1997) Disulphide bonds in wheat gluten proteins. J Cereal Sci 25:207–227
Shewry PR, Tatham AS, Forde J, Kreis M, Miflin BJ (1986) The classification and nomenclature
of wheat gluten proteins: a reassessment. J Cereal Sci 4:97–106
Shewry, PR, Halford NG, Tatham AS (1992) High molecular weight subunits of wheat glutenin. J
Cereal Sci 15:105–120
Simeone MC, Gedye KR, Mason-Gammer R (2006) Conserved regulatory elements identified
from a comparative puroindoline gene sequence survey of Triticum and Aegilops diploid taxa.
J Cereal Sci 44:21–33
Simmonds N (1995) The relation between yield and protein in cereal grain. J Sci Food Agric
67:309–315
Singh NK, Shepherd KW (1985) The structure and genetic control of a new class of disulphide-
linked proteins in wheat endosperm. Theor Appl Genet 7:79–92
Singh NK, Shepherd KW (1988) Linkage mapping of genes controlling endosperm storage proteins
in wheat. 1. Genes on the short arms of group 1 chromosomes. Theor Appl Genet 75:628–641
Sobko TA (1984) Identification of a new locus which controls the synthesis of alcohol-soluble
protein in the endosperm of winter common wheat. J Agric Sci 7:78–80
Sourdille P, Perretant MR, Charmet G, Leroy P, Gautier M.-F, Joudrier P, Nelson JC, Sorrells ME,
Bernard M (1996) Linkage between RFLP markers and genes affecting kernel hardness in
wheat. Theor Appl Genet 93:580–586
Sreeramulu G, Singh NK (1997) Genetic and biochemical characterization of novel low molecular
weight glutenin subunits in wheat ( Triticum aestivum L.) Genome 40:41–48
Sun DJ, He ZH, Xia XC, Zhang LP, Morris CF, Appels R, Ma WJ, Wang H (2005) A novel STS
marker for polyphenol oxidase activity in bread wheat. Mol Breed 16:209–218
Sun M, Yan Y, Jiang Y, Xiao Y, Hu Y, Cai M, Li Y (2004) Molecular cloning and comparative
analysis of a y-type inactive HMW glutenin subunit gene from cultivated emmer wheat ( Triti-
cum dicoccum L.). Hereditas 141:46–54
Symes KJ (1965) The inheritance of grain hardness in wheat as measured by the particle size in-
dex. Australian J Agric Res 16:113–123
Tatham AS, Shewry PR (1985) The conformation of wheat gluten proteins. The secondary structures
and thermal stabilities of alpha-, beta-, gamma- and omega- gliadins. J Cereal Sci 3:103–113
Tatham AS, Shewry PR (1995) The S-poor prolamins of wheat, barley, and rye. J Cereal Sci
22:1–16
Thomson NH, Miles MJ, Tatham AS, Shewry PR (1992) Molecular images of cereal proteins by
STM. Ultramicroscopy 42–44:1118–1122
Tiwari VK, Rawat N, Neelam K, Randhawa GS, Singh K, Chhuneja P, Dhaliwal HS (2008)
Development of Triticum turgidum subsp. durum-Aegilops longissima amphiploids with high
iron and zinc content through unreduced gamete formation in F1 hybrids. Genome 51:757–766
Tiwari VK, Rawat N, Chhuneja P, Neelam K, Aggarwal R, Randhawa GS, Dhaliwal HS, Keller
B, Singh K (2009) Mapping of quantitative trait loci for grain iron and zinc concentration in A
genome diploid wheat. J Hered 100:771–776
Tranquilli G, Cuniberti M, Gianibelli MC, Bullrich L, Larroque OR, MacRitchie F, Dubcovsky J
(2002) Effect of Triticum monococcum glutenin loci on cookie making quality and on predic-
tive tests for bread making quality. J Cereal Sci 36:9–18
Tranquilli G, Lijavetzky D, Muzzi G, Dubcovsky J (1999) Genetic and physical characterization
of grain texture-related loci in diploid wheat. Mol Gen Genet 262:846–850
Turnbull K-M, Turner M, Mukai Y, Yamamoto M, Morell MK, Appels R, Rahman S (2003) The
organization of genes tightly linked to the Ha locus in Aegilops tauschii, the D-genome donor
to wheat. Genome 46:330–338
Uauy C, Brevis JC, Dubcovsky J (2006a) The high grain protein content gene Gpc-B1 accelerates
senescence and has pleiotropic effects on protein content in wheat. J Exp Bot 57:2785–2794
Uauy C, Distelfeld A, Fahima T, Blechl A, Dubcovsky J (2006b) A NAC gene regulating senes-
cence improves grain Protein, zinc, and iron content in wheat. Science 314:1298–1301
Varshney RK, Graner A, Sorrells ME (2005) Genomics-assisted breeding for crop improvement.
Vensel WH, Adalsteins AE, Kasarda DD (1997) Purification and characterization of the glutenin
subunits of Triticum tauschii, progenitor of the D genome in hexaploid bread wheat. Cereal
Chem 74:108–114
Vogel JP, Garvin DF, Mockler TC. 2010. Genome sequencing and analysis of the model grass
Brachypodium distachyon. Nature 463:763–768
Waines JG. Payne PI (1987) Electrophoretic analysis of the high molecular-weight glutenin sub-
units of Triticum monococcum, T. urartu, and the A genome of bread wheat (T. aestivum).
Wan Y, Wang D, Shewry PR, Halford NG (2002) Isolation and characterization of five novel high
molecular weight subunit of glutenin genes from Triticum timopheevi and Aegilops cylindri-
cal. Theor Appl Genet 104:828–839
Wang JR, Yan Z, Wei YM, Zheng YL (2006) Characterization of high-molecular-weight glutenin
subunits genes from Elytrigia elongata (Host) Nevski. Plant Breed 125:89–95
Wang JW, He XY, He ZH, Wang H, Xia XC (2009a) Cloning and phylogenetic analysis of phy-
toene synthase 1 (Psy1) genes in common wheat and related species. Hereditas 146:208–256
Wang LH, Zhao XL, He ZH, Ma W, Appels R, Pena RJ, Xia XC (2009b) Characterization of low-
molecular-weight glutenin subunit Glu-B3 genes and development of STS markers in common
wheat ( Triticum aestivum L.). Theor Appl Genet 118:525–539
Wang LH, Li GY, Pena RJ, Xia XC, He ZH (2010) Development of STS markers and establish-
ment of multiplex PCR for Glu-A3 alleles in common wheat ( Triticum aestivum L.). J Cereal
Sci 51:305–312
Wieser H (1995) The precipitating factor in coeliac disease. In: Howdle PD (ed.) pp 191–207 in:
clinical Gastroenterology, Int Pract Res. Bailliére Tindall, London
Wrigley CW, Bushuk W, Gupta R (1996) Nomenclature: establishing a common gluten language.
In: Gluten 96. Wrigley CW (ed.) pp 403–407 RACI, Melbourne
Wrigley CW, Shepherd KW (1973) Electrofocusing of grain proteins from wheat genotypes.
Annals NY Acad Sci 209:154–162
Xiong L, Wang J, Zheng Y (2010) Analysis of LMW-GS, α- and β-Gliadin gene coding sequences
from Triticum macha. Agric Sci China 9:163–169
Xu SS, Khan K, Klindworth DL, Nygard G (2010) Evaluation and characterization of high-molec-
ular weight 1D glutenin subunits from Aegilops tauschii in synthetic hexaploid wheat. J Cereal
Sci 52:333–336
Yan LL, Loukoianov A, Blechl A, Tranquilli G, Ramakrishna W, SanMiguel P, Bennetzen JL, Ech-
enique V, Dubcovsky J (2004b) The wheat VRN2 gene is a flowering repressor down-regulated
by vernalization. Science 303:1640–1643
Yan Y, Hsam SLK, Yu JZ, Jiang Y, Ohtsuka I, Zeller FJ (2003a) HMW and LMW glutenin alleles
among putative tetraploid and hexaploid European spelt wheat (Triticum spelta L.) progenitors.
Yan Y, Hsam SLK, Yu JZ, Jiang Y, Zeller FJ (2003b) Allelic variation of the HMW glutenin sub-
units in Aegilops tauschii accessions detected by sodium dodecyl sulphate (SDS-PAGE) acid
polyacrylamide gel (A-PAGE) and capillary electrophoresis. Euphytica 130:377–385
Yan Y, Zheng J, Xiao Y, Yu J, Hu Y, Cai M, Li Y, Hsam SLK, Zeller FJ (2004a) Identification and
molecular characterization of a novel y-type Glu-Dt1 glutenin gene of Aegilops tauschii. Theor
Appl Genet 108:1349–1358
Yan ZH, Wan YF, Liu KF, Zheng YL, Wang DW (2002) Identification of a novel HMW glutenin
subunit and comparison of its amino acid sequence with those of homologous subunits. Chin
Sci Bull 47:220–225
Zhang CY, Dong CH, He XY, Zhang LP, Xia XC, He ZH (2011) Allelic variation at the TaZds-D1
locus on wheat chromosome 2DL and their association with yellow pigment content. Crop Sci
51:1580–1590
Zhang W, Gianibelli MC, Rampling LR, Gale KR (2004) Characterisation and marker develop-
ment for low molecular weight glutenin genes from Glu-A3 alleles of bread wheat ( Triticum
aestivum L). Theor Appl Genet 108:1409–1419
Zhang Y, Wu Y, Xiao Y, Yan J, Zhang Y, Zhang Y, Ma C, Xia X, He Z (2009) QTL mapping for
milling, gluten quality, and flour pasting properties in a recombinant inbred line population
derived from a Chinese soft x hard wheat cross. Crop Pasture Sci 60:587–597
Zhao XL, Xia XC, He ZH, Gale KR, Lei ZS, Appels R, Ma W (2006) Characterization of
three low-molecular-weight Glu-D3 subunit genes in common wheat. Theor Appl Genet
113:1247–1259
Zhao XL, Xia XC, He ZH, Lei ZS, Appels R, Yang Y, Sun QX, Ma W (2007a) Novel DNA varia-
tions to characterize low molecular weight glutenin Glu-D3 genes and develop STS markers in
common wheat. Theor Appl Genet 114:451–460
Zhao XL, Ma W, Gale KR, Lei ZS, He ZH, Sun QX, Xia XC (2007b) Identification of SNPs and
development functional markers for LMW-GS genes at Glu-D3 and Glu-B3 loci in bread wheat
( Triticum aestivum L.). Mol Breed 20:223–231
Zhao L, Zhang K-P, Liu B, Deng Z, Qu H-L, Tian J-C (2010) A comparison of grain protein con-
tent QTLs and flour protein content QTLs across environments in cultivated wheat. Euphytica
174:325–335
Chapter 11
From Agronomy to Molecular Genetics and
Proteomics in an Effort to Improve Nitrogen
Use Efficiency in Crops
Ruby Chandna and Khalid Rehman Hakeem
Abstract Agriculture plays significant role in the sustaining human society among
most of the developing countries. The agricultural practices are dependent on the
application of the nitrogenous fertilizers. The excessive application of nitrogenous
fertilizer contributes enormously to the environmental pollution. So, in today’s sce-
nario there is growing need to reduce N fertilizer applications thereby improving
plant’s N-use efficiency (NUE). Initially, various studies have been carried out to
improve inputs of N fertilizers interaction with soil, water and air but low efficiency
of the plant to make use of available N has initiated biological interferences. In this
article, we will be discussing the possible technologies applied towards understand-
ing the genetic control of nitrogen use efficiency and its improvement in crops. The
classification/identification of suitable target candidates like phenotypes, genotypes
or molecular markers, for the upgrading of NUE poses big confront. Therefore, it
is necessary to understand NUE and its importance with respect to economy and
environment. Also, to figure out the diverse approaches for progress towards NUE
enhancement and possibilities for future development.
Introduction
The rate at which India’s population is growing it is expected to reach up to a

total of 1.5 billion by the year 2030 (FAO 2008).Over the next few decades food
security will be a major concern in India. However, there are limited options to meet
R. Chandna ()
Department of Botany, Jamia Hamdard New Delhi,
K. R. Hakeem
Faculty of Forestry, Universiti Putra Malaysia,
43400 Serdang, Selangor, Malaysia

346 R. Chandna and K. R. Hakeem
Fig. 11.1 Crop production of India in the past 50 years
food production for increasing population, since most of the available is already
under cultivation, and in many areas land cannot be used for intensified produc-
tivity because of rapid urbanization and increasing environmental pollution. To-
gether, all of these issues have forced a great challenge on Indian agriculture for
developing novel approaches that can increase crop productivity on the cultivable
land. Development of high-yielding wheat and rice varieties and use of chemical
fertilizers have made enormous contribution in doubling crop production of India
in the past 50 years. The production of wheat and rice in 1950–1951 was 6.46 and
20.57 million tonnes, respectively, which has increased to 76.2 and 85.9 million
tonnes in 2008–2009 (Directorate of Economics and Statistics 2008) (Fig. 11.1).
In order to increase crop production, the consumption of N fertilizer has increased
up to 10-folds in last 50 years globally (Lian et al. 2005), because high-yielding
present crop varieties have high demands for N. The problem lies in the, nitrogen
use efficiency (NUE) which is as low as 33 % for cereals on global basis (Raun and
Johnson 1999). The unutilized 60–70 % caused severe environmental hazards. It is,
therefore, necessary to control too much input of chemical N fertilizers into the field
by enhancing the NUE of the crops.
N-assimilation Processes in Plants
Nitrate (NO3−) is the major resource of nitrogen for most of the cultivated crops.
The first step in acquisition of nitrate is its uptake by root cells. NO3− reaches the
aerial organs by moving out in the external medium from root cell or by unloading
in the xylem vessel (Kant et al. 2011). NO3− assimilation takes place in leaves and
11 From Agronomy to Molecular Genetics and Proteomics … 347
root; it is first reduced to nitrite in the cytosol by nitrate reductase (NR). Nitrite
gets translocated to the chloroplast and reduced into ammonium by nitrite reductase
(NiR), NH 4+ the end product is finally integrated into the amino acids via the GS/
GOGAT pathway (Mokhele et al. 2012)
Nitrate Reductase (EC 1:6:6:1)
Nitrate reductase (NR) in higher plants is thought to be a homodimer. The estimated

subunit size of the monomers is between 100–120 kDa (Caboche and Rouze 1990).
The monomer size is about 100 kDa. In higher plants each monomer constitutes
three functional domains, each of which has three redox centers formed by FAD,
heme and a molybdenum Co-factor (MoCo). These are present in the steochiom-
etry of 1:1:1 (Caboche and Rouze 1990). These redox centres catalytically transfer
two electrons from NAD(P)H to NO3−. According to Lillo and Ruoff (1992), there
is a second site for NADH, which is occupied in the allosteric, regulating the NR
activity. Thus, electrons are able to move from redox centres in one subunit to the
redox centres in second subunit, hence enabling the total electron transfer from
NADPH to NO3− in heterodimers. NR is found in cytoplasm of shoot and root cells
identified using either cell-fractionation and biochemical techniques or immune cy-
tochemistry (Fedorova et al. 1994). In the cytoplasm of the leaf cells, the NADH
required for the functioning of NR is supplied by either of two shatter mechanisms,
one involving the phosphate translocator located in the chloroplast envelope and
the other involving the malate oxaloacetate translocator located in the envelopes
of mitochondria. In root cells where NR can utilize both NADH and NADPH as
reductants, either the glucose 6-phosphate dehydrogenase or 6-phospogluconate
dehydrogenase, present in the cytoplasm or plastid, can supply NADPH (Bowsher
et al. 1993).
Nitrite Reductase (EC 1. 7.7 .1)
Nitrite reductase (NiR) catalyses the 6 electron transfer reaction from reduced fer-
redoxin to NO2−, leading to the synthesis of NH4+. It is localized inside chloroplasts
of the leaf, also in plastids of the root tissues (Sechley et al. 1992). In both roots
and leaves, the reduced ferredoxinacts as an electron donor. The NiR enzymes are
monomeric proteins of about 63 kDa containing siroheem and a 4Fe-4S centre as
prosthetic groups (Seigel and Wilkerson 1989). Wray 1993 confirmed that the NiR
apoprotein is synthesised as a precursor of transit peptide carrying an N-terminal
extension which helps in recognition of the protein in chloroplast/plastid. This NiR
apoprotein is encoded by nuclear DNA.
Glutamine Synthetase (EC 6.3.1.2)
Glutamine synthetase (GS) catalyzes the critical inclusion of inorganic ammonium

into glutamine. GS catalyzes the ATP-dependent condensation of NH4 + with gluta-
mate to yield glutamine. The native GS protein weighs 350 kDa and is composed
of 8 almost identical subunits (Sechley et al. 1992; Nogueira et al. 2005). In leaves,
it is present in both chloroplasts (GS2) and cytoplasm (GS1) (Scarpeci et al. 2007).
The chloroplast form appears to play role in the assimilation of photorespiratory
NH4+ (Freeman et al. 1990). The root enzyme too, is found in both cytoplasm and
plastids. In pea, the dominant form is plastidic, whereas in maize it is cystosolic
(Sakakibara et al. 1992). Studies carried out to encode the genes for GS has helped
to elucidate the function of each isoform are involved. Chloroplastic GS (GS2) is
believed to be having function in the re-assimilation of photorespiratory conditions
(Freeman et al. 1990). The gene for the cystosolic GS (GS3A in pea) is found to be
active in the phloem of the transgenic tobacco and alfalfa, indicating that it func-
tions primarily to produce glutamine for intercellular transfer (Fei et al. 2003). In
rice plants, cytosolic GS has been reported to be present in vascular bundle. In leaf
tissue, it is active in exporting nitrogen to ‘sink’ tissues (Gallais et al. 2006).
Glutamate Synthase (EC 1.4.7.1 and 1.4.1.14)
Glutamate synthase (glutamine-2-oxoglutarate aminotransferase, GOGAT) is in-

volved in the reductive relocation of the GS to 2-oxoglutarate to create two mol-
ecules of glutamate. One of the glutamate molecules can then be cycled back as the
substrate for the GS reaction. This is GS-GOGAT cycle was defined by Lea and
Miflin (1974). Based on the nature of electron donor, two forms of GOGAT exists,
the ferredoxin-GOGAT and the NAD(P)H-GOGAT (Suzuki and Knaff 2005). In
rice leaves Fd-GOGAT is known to be present in mesophyll cells, consistent with a
job in photorespiratory nitrogen metabolism (Hayakawa et al. 1994). The NAD(P)
H-GOGAT occurs in vascular bundles of developing leaf blades, indicating a role
in the synthesis of glutamate from glutamine that is imported to the vascular bundle
from roots and senescing tissues (Tabuchi et al. 2007).
Glutamate Dehydrogenase (EC 1.4.1.2)
Glutamate dehydrogenase (GDH) is capable either of synthesizing or de-aminating

glutamate (Pahlich 1996). One isoform of the enzyme is localized in the mitochon-
dria. It uses NADH as the electron donor (Sechley et al. 1992). Another form that
has a specific requirement for NAD(P)H is present in the chloroplasts of photosyn-
thetic tissues. Levels of the NADH form of GDH increase with senescence or after
adding NH4 + to the medium (Pahlich 1996). These factors also lead to higher levels
of GDH protein in maize root tissues (Oaks 1994). A primary role of GDH is known
to replenish TCA cycle intermediates through their oxidation to 2-oxoglutarate.
However, in vivo, aspartate amino transferase and glutamate decarboxylase also
maintain the supply of carbon to the citric acid cycle (Kisaka et al. 2007). Glutamate
is deaminated to 2-oxoglutarate in isolated mitochondria; however in the presence
of amino-oxy acetate, glutamate no longer contributes to mitochondrial respiration
(Sechley et al. 1992). This observation indicates that GDH does not oxidize gluta-
mate. Thus, the correct in vivo role of GDH in nitrogen metabolism of higher plants
remains to be defined (Pahlich 1996).
Acquisition of N by Roots and Its Regulation
The nitrate uptake is the foremost step that adds to N use of any plant. The identi-
fication of genes and the proteins responsible for NO3− transport and distribution is
required for enhanced understanding of the mechanisms that takes place within the
plant. Nitrate transport is a proton-symport type of transporter system (Crawford
1995). Nitrate uptake and its release into cells are mediated by nitrate transporter(s)
located into the plasma membrane of the root. Three transporters have been identi-
fied by kinetic measurements in plant roots (Remans et al. 2006). These are consti-
tutive High Affinity Nitrate Transporter (cHATS), inducible High Affinity Nitrate
Transporter (iHATS) and Low Affinity Nitrate Transporter (LATS) (Okamoto et al.
2006; Chandna et al. 2011). Two of these display saturable kinetics; a low capacity
constitutive system and a high capacity inducible system (Okamoto et al. 2006). In
addition, a non-saturating low affinity, high capacity system becomes apparent only
at higher external NO3− concentration (Kronzucker et al. 1995; Cerezo et al. 2000,
2001). The high affinity transport system (HATS) works at low concentrations
(1 µM–1 mM). HATS transporters are constitutively expressed (cHATS) as well as
nitrate-inducible (iHATS), and are subjected to negative feedback regulation by the
products of nitrate assimilation. Both types of HATS happen to active during low N
(< 1 mM) concentration in the medium, they show up-regulation on the availability
of nitrate. Thus, constitutive HATS seems to offer a high affinity and low capacity
passage for nitrate entry in un-induced plants, a 3-fold increase in their expression
is observed on introduction of nitrate (Crawford and Glass 1998). Inducible HATS
are known to be induced on presence of nitrate or nitrite (Orsel et al. 2006). The low
affinity transport system (LATS) is known to work under high external nitrate con-
centrations i.e: > 1 mM (Glass 2003). NO3− uptake appears to increase linearly with
increasing NO3− concentration with no indication of saturation even at 100 mM
(Omata et al. 1989). The linear concentration dependence of the LATS has been
observed in a wide variety of organisms. LATS for NO3− in barley are referred to
as constitutive (Kronzucker et al. 1995). LATS which are constitutive, perhaps also
have a signalling function to play in induction of HATS and other nitrate assimila-
tory genes, which might plays a nutritional role when above a certain threshold.
C and N Interactions in Plants
Carbon (C) and Nitrogen (N) both are important component that play crucial role
in carrying out basic cellular activities of plants. C and its compounds is part of
various carbohydrates like sucrose and glucose. Both the C-skeletons and energy
are provided by carbohydrates during amino acid biosynthesis. N nutrients from
the part of inorganic compounds such as ammonium and nitrate, also participates
in building organic compounds like amino acids. Research has disclosed the tight
coordination between cellular C and N metabolism, suggesting their importance
for plant growth (Xu et al. 2012). CO2 is assimilated through photosynthesis that
results in formation of sucrose and glucose via glycolysis and tricarboxylic acid
cycle to 2-oxoglutarate (2OG) or α-ketoglutarate. Nitrate reductase reduces nitrate
(NO3−) to nitrite (NO2−). NO2 by nitrite reductase finally converting it to ammonium
(NH 4+). 2-oxoglutarate provide C skeleton for the synthesis of glutamate (Glu) by
incorporating NH 4+ formed by photorespiration. NH4+ that is gained from the as-
similation of N is induced in Glu, that results in the formation of glutamine (Gln).
Glu and GlncontributeNH 4+ that is finally used for the synthesis of all other amino
acids, that also includes aspartate (Asp) or asparagine (Asn), which in-turn serves
as NH4 + donor. Proteins particularly enzymes are essential for all cellular functions,
like metabolic reactions, and are involved in C and N metabolism. Therefore, it is
necessary to maintain an appropriate proportion of C and N nutrients (Zheng 2009).
Concepts of Nitrogen Use Efficiency
The term NUE has two basic components: (1) Nitrogen uptake, recovery or acquisi-
tion efficiency (2) Nitrogen use, physiological N use, or internal N use efficiency
The terms NUE has been used as a ratio that considers an output (i.e., grain yield, to-
tal plant dry matter yield, N accumulation in grain, or N accumulation in total plant
dry matter) as a numerator and input (i.e., total N supply, soil N supply or fertilizer
N supply) as a denominator. NUE is based on different parameters of efficiency,
including N uptake, N utilization efficiency, and N-use efficiency, it is expressed as
a ratio of output (biomass produced) and input (total N supplied) (Xu et al. 2012).
Agronomic, Recovery and Physiological efficiency ratios have been widely used to
quantify NUE. Agronomic efficiency of nitrogen (AEN) or partial factor productiv-
ity (PFPN), relates integrative index of total economic outputs relative to the use
of all sources of N. Nitrogen recovery efficiency (REN) measures the efficiency of
the plant to assimilate N provided. Physiological N use efficiency (PEN) defines
the rate at which plant uses N from available N to produce grain (Table 11.1). The
average AEN has a narrow range of 16–22 kg grain increase per kg N applied, stud-
ies have shown it to be smallest in maize and largest in rice. Whereas PFPN has
large differences as observed by Ladha 2005 in Maize and rice having similar PFPN
values of 65–70, whereas wheat had 44 (Ladha 2005). These large differences in
Table 11.1 The key parameters involved in uptake and utilization efficiencies of nitrogen in plants
S.N. Components of NUE Formula
1 NUE NUE = Sw/N
2 Usage index UI = Sw*( Sw/N)
3 Utilization efficiency UtE = Gw/Nt
4 Agronomic efficiecy AE = ( G – G)/Nf
5 Physiological efficiency uptake PE = ( Gwf–Gwc)/Nf – Nc uptake
6 Uptake efficiency UpE = Nt/Ns
7 Apparent plant recovery AR = ( Nt uptake – Nc N nitrogen
uptake)/Nt*100
Sw shoot weight, N total nitrogen content of shoots, Gw grain weight, Ns nitrogen supplied in gram
per plant, Nt total nitrogen in plant, Gwf grain weight with fertilizer, Gwc grain weight without
fertilizer (control), Nf nitrogen fertilizer applied, Nf uptake plant nitrogen with fertilizer, Nc uptake
plant nitrogen unfertilized control, PE physiological N-use efficiency, NUE N-use efficiency
PFPN, indicates that maize and rice are able to produce large economic outputs
with respect to applied N fertilizer. These differences may be due to differences in
(1) internal N requirement for plant growth, (2) ability of the plant to translocation
and distribution of N, (3) flag leaf N import/export and leaf senescence pattern
and (4) plant’s efficiency in converting CO2 to carbohydrate (Ladha et al. 1998).
Proper N-application rates and timing of application are very important to meet
plant N demand and improve NUE. Studies done by Abdin et al. (2005) states that
timing of N fertilizer applications does show noticeable results in plant growth and
N uptake with respect to its application. In addition, the application of the fertilizer
at different growth stages of plants determines NUE, which also showed genotypic
variation (Hirel et al. 2007).The amount of N that is finally available to the plant can
be improved by using various simple techniques like sustained-release fertilizers,
split applications and other nutrient and crop management strategies (Abdin et al.
2005). Nitrogen applications in split doses have shown to enhance the yield, NUE,
and N uptake efficiency in hard red winter wheat under temperate conditions when
compared with fall N applications (Sowers et al. 1994). Nitrogen use efficiency
(NUE) in the perspective of photosynthesis is called as photosynthetic nitrogen use
efficiency (PNUE), which is measured as the rate of carbon assimilation per unit
leaf nitrogen (Kumar et al. 2002).
Analysis of Variation Nitrogen Use Efficiency
Genotypic differences in the NR levels have been studied and reported by Ab-
din et al. (1992) in corn, wheat, barley and sorghum. Hakeem et al. (2011, 2012)
also observed the genotypic differences in the NR levels in rice. Further, Bhatt
et al. (1979) showed in sorghum, a decrease in the height of the plant with the
enhancement of NR activity while such relationship with tall and dwarf cultivars of
wheat were not observed (Abdin and Abrol 1997). Abdin and Abrol 1997 revealed
in Wheat genotypes more than two-fold variation in NR activity was observed, that
might be due to genetic levels of NR enzyme which is heritable. These genetic dif-
ferences in the NR activity are also reflected in N harvest and it may be associated
with improvement in growth and yield in some genotypes. In some of the high NR
genotypes, the grain N concentration was significantly higher. It was observed that
high NR (HNR) genotypes maintained higher levels of NR activity even under low
N levels (Abdin et al. 1992, 1996) this may be because of high levels of NADH that
might enhance NR activity in high NR genotypes (Bauwe and Kolukisaoglu 2003).
The activity was especially maintained at the later stages of growth i.e. at the time
of flag leaf emergence and anthesis (Jain and Abrol 2005). Studies also indicated
that the activity of the NR was regulated at the level of gene expression (Jain and
Abrol 2005; Skiba et al. 2011). Recent studies of the genotypes that differed in the
levels of their NR activity have revealed that not only the single enzyme NR but the
whole N metabolism pathway operates at the elevated level viz. all the enzymes of
the pathway nitrite reductase, glutamine synthetase and glutamate synthase func-
tion at significantly higher levels in the high NR genotypes as compared with the
LNR genotypes, leading to higher accumulation of grain N (Xu et al. 2012). The se-
lection of genotypes with a more efficient mechanism of N uptake and metabolism
is a strategy aimed at increasing N utilization efficiency of the maize crop. Several
trials for efficient use of N under conditions of low N availability have been carried
out with maize (Machado et al. 1992). In order to characterize and select genotypes
for efficient use of N, several authors have used physiological and biochemical
parameters, such as high nitrate in leaves (Mollaretti et al. 1987), enlarged nitrate
reductase activity (Feil et al. 1993), glutamine synthetase activities (Machado and
Magalhães 1995), or increased enlistment of N from leaves and stems to the ker-
nels (Machado et al. 1992). Genetic diversity has several ‘indicators’, which are
measured using various tools such as Mendelian genetic analysis that are employed
to assess disparity in single known gene (qualitative traits), such as resistance to
disease (Smale and McBride 1996) or multivariate traits/quantitative traits. Also,
pair-wise coefficients of parentage are calculated from pedigree information that
serves as genetic diversity indicators of (Cox et al. 1996). Nitrogen use efficiency
is a complex quantitative trait which is governed by many genes depending on the
number of internal and external factors like nutritional and environmental that lim-
its the nitrogen availability.Quantitative genetic studies are associated with molecu-
lar markers provides insight to the identification of Quantitative Trait Loci (QTL)
that is known to be part of the genetic variation of a complex character such as NUE
(Harrison et al. 2004; Hirel et al. 2007) and gives a new turning point in identifica-
tion of agronomic traits.
Crop Management Practices and Source-sink

Relationships for Improving NUE
The strategies developed to work in favour of nitrogen utilization efficiency in-

cluded use of variety of fertilizers and their manner of application also avoiding
runoff and limiting the fertilizer loss from soil. Use of slow-release fertilizers and of
organic manures also minimizes N fertilizer use and their loss. The legumes crop-
ping systems have added advantage of correcting the imbalanced use and nutrient
management (Wang et al. 2012a). Strategies that increase fertilizer N use by crop-
can also be the part of focus by increasing the fertilizer N use during the growing
season since that will decrease the N loss thus, higher NUE (Balasubramanian et al.
2004). Other management practices like soybean-corn rotations, forage-only pro-
duction systems, conservation tillage systems have low N losses and improved NUE
(Wen-Yuan et al. 1996).When differences were studied by Moll et al. 1982 among
corn hybrids after application of N before anthesis, under low N levels, observed
improved NUE. Machado et al (1992) observed that NUE status is parallel that off
water use efficiency (WUE) in corn. Another way is to distribute more of N resourc-
es to the organ of interest, such as grains. Since, the efficiency of protein synthesis is
known to be dependent on the light and dark regulation of aspargine synthase (AS)
of leaf that leads to the elevationsasparagine levels that is an important parameter
used to screen for high grain-protein cultivars of maize and rye (Dembinski et al.
1995). Also, by controlling the expression of the ASN 1 gene that control the ASN
levels might lead to manipulation of the relationship between Asn and seed N status
and enable another way to enhance nutritional quality which needs to be tested.
Biotechnological Inventions for Improving Nitrogen

Use Efficiency
NUE is governed by multigenes that involve huge number of genes and expand be-
yond the key steps of nitrate metabolism and incorporation. The efforts of creating
transgenic that can targets those genes which participating in N uptake, transport,
assimilation, and carbon metabolism. Manipulation of signalling and metabolic
pathway regulatory elements is emerging as an important target for biotechnologi-
cal advancements. Different transgenic experiments that were attempted in a hope
to improve NUE are summarized below and some of the significant work is listed
in Table 11.2.
Nitrate reductase enzyme considered being the rate-limiting step of nitrate as-
similation, but its genetic manipulation in Nicotiana spp. indicated its importance
in other steps as well (Ali et al. 2007). The constitutive NR expression in tobacco
showed 2-fold increase in its activity while a 20 % decrease in foliar nitrate content
was observed. Also an increase in total amino acids contents, but simultaneously
Table 11.2 List of transgenic effort towards improving N-use efficiency (NUE)
Gene Target plant Phenotype observed
Nrt1.1—high affinity nitrate Arabidopsis Increase in constitutive nitrate
transporter uptake but not induced
NR—nitrate reductase N. tabacum Three to four fold drop in NR
protein and activity, no change
in NR transcript
NiR—Nitrite reductase N. plumbaginifolia, NiR activity, no phenotypic
Arabidopsis difference
GS2—chloroplastic glutamine N. tabacum Improved photorespiration capac-
synthetase ity, and increased resistance to
photo-oxidation
Fd-GOGAT—Fd dependent N. tabacum Diurnal changes in NH3
glutamate synthase assimilation
GS1—cytosolic glutamine N. tabacum, P. sativum Enhanced capacity to accumulate
synthetase nitrogen and enhanced growth
under N starvation higher
biomass and leaf proreins
NADH-GOGAT—NADH O. sativa, N. tabacum Enhanced grain filling, increased
dependent glutamate grain weight and higher total C
synthase and N content, increased dry wt
GDH—glutamate N. tabacum Increased biomass and dry weight
dehydrogenase
Dof1—transcription factor Arabidopsis Enhanced growth rate under
N-limited conditions, increase
in amino acid content
ANR1—MADS transcription Arabidopsis Lateral root induction and
factor elongation
no changes in total N, starch and productivity parameters were observed (Quillere

et al. 1994). The transgenics with NR double mutant Nia30 were not able to show
any detectable NR activity. While the when plant was transformed with the Nia2-
cDNA, a decreased in NR activity with enhanced levels of nitrate accumulation
was observed (Hansch et al. 2001). Transformed Nicotiana plumbaginifolia plants
that were constitutively expressing nitrate reductase (NR) showed a momentarily
delayed in drought-induced loss of NR activity, hence permitting speedy recov-
ery of N assimilation. Since NR enzyme is post-translationally controlled by phos-
phorylation and also with binding of 14-3-3 proteins, several attempts to reduce the
inhibitory effect on NR regulation have been made. 56 amino acids were deleted in
the amino terminal domain of NR that was known to impair this type of regulation
in Nicotiana plumbaginifolia (Provan et al. 2000). Over-expression of NR genes
from various plants have been worked on since past ten years (Lea et al. 2006), but
without any important outcome for the improvement in NUE.
In an effort for improving NUE, over expression of NiR genes were studied in
Arabidopsis and tobacco that though increased the NiR transcript levels but showed
decrease in enzyme activity levels. This may be because of post-translational modi-

fications (Shigeto et al. 2006). Till now there is no confirmations fromNiR overex-
pression in terms of improvement in NUE.
Hirel et al. (2005) signified glutamine synthetase (GS) involvement in kernel
production of maize, through QTLs for studying the GS activity in leaf showed
that the GS activity to coincide with QTLs for yield. One QTL was concurrent for
thousand kernels weight with a GS (Gln1-4) locus, and two QTLs conceded for
GS (Gln1-3) locus of thousand kernel weight and yield. This shows the positive
association between kernel yield and GS activity.In another two experiments by
Li et al. 1993 and Martin et al. 2006 identified the two cytosolic GS isoenzymes
(GS1) in maize, and their molecular and physiological properties were examined
using knockout mutation on kernel yield, thereby examining the plants grown un-
der N deficient conditions.Martin et al. 2006 observed the over expressing trans-
genic lines of Gln1-3 in leaves showed rise in kernel number, proving that the
GS1-3 isoenzyme plays an important role in regulating kernel yield under optimal
N-fertilization conditions. Yanagisawa et al. 2004; Coque and Gallais 2006; Hirel
et al. 2007 also observed the GS mutants and the GS-overexpressing lines that were
grown under N-limiting conditions and observed the reduction inkernel number
when compared to wild type. Huang et al. (2005) carried out experiments in wheat
by adding an extra GS gene and observed no overall increase in the amount of GS.
Many other studies in various crop plants like tobacco and rice employed the role
of GS and enhanced N-assimilation efficiency (Oliveria et al. 2002; Man 2005; Sun
et al. 2005; Cai et al. 2009)
Transgenic over-expression and antisense technologies in alfalfa and rice plants
were engaged to alter the expression of NADH-GOGAT (Yamaya et al. 2002). The
studies highlighting the antisense RNA for NADH-GOGAT carried out in transgen-
ic rice plants throws some light towards the possible improvement of the transport
of N via phloem in senescing leaves. Andrews et al. 2004, studied the expression
of NADH-GOGAT in initial growing leaf blades and spikelets, also showed the of
glutamine transported from senescing organs. Tabuchi et al. 2007 showed changes
in various nitrogenous metabolites and decreased leaf protein, rubisco activity and
nitrate contents in Barley mutants having reduced Fd-GOGAT. Genes does emerge
to be good candidates that can be employed for improving NUE, but the use de-
pends on crop and cropping conditions (Shrawat and Good 2008).
Improving NUE Through Manipulation of Signalling

Targets
The failure to improve NUE through over expression of candidate genes in trans-
genic plants involved in nitrate and ammonia assimilation concluded that that meta-
bolic flux of these pathways are being controlled by regulatory switches outside
these pathways. Yet, the exact mechanism involved in nitrate signalling still needs
to be understood. Studies have revealed that nitrate signalling is affected by light,

though there are researches stating the involvement of 14-3-3 proteins also.Ca2+ and
protein kinases/ phosphatise are also known to be associated with nitrate signalling.
They have known to be involved in mediating the expression of NR, NiR and GS2
m RNAs through nitrate signal (Wang et al. 2012b). Krapp et al. (2002) highlighted
the role played by Ca2+ dependent kinases in implicating nitrate and the other in-
volved signals. The role of light as an additional signal in regulation of NR gene
expression has been studied in number of previous studies. Lillo and Appenroth
2001 expressed the role of light in signalling and N-use efficiency, by revealing
the signals being transmitted through photosynthesis and sugars.Castaings et al.
2011 found ANR1 in Arabidopsis thaliana, an N-use efficiency transcription factor
homologous to the MADS box family and also known to play role in signalling.
He showed the nitrate-dependent stimulation leading to lateral-root proliferation
in transgenic plants. However, it is reported that ANR1 does not bring about tran-
scription of all the known nitrate responses even in the root.Transgenic Arabidop-
sis lines over expressing, a maize protein Dof1 was created by Yanagisawa et al.
(2004). Dof1 belonged to Dof family of plant-specific transcription factors that are
known to stimulate C-metabolizing genes. This research revealed the fact that Dof1
transcription factor can carry coordinated expression of nitrate-responsive genes
involved in N and C metabolites. This approach could be one of the new targets for
future metabolic-engineering efforts (Lochab et al. 2007).
Understanding NUE Through Proteomics
Uptake of nutrients from the surroundings in order to maintain energy, metabolism

and growth is the main concern all living organisms. Organism therefore, enfolds
and evolves numerous programs so that they are able to adapt to changing environ-
ment. Such processes are involved in immediate responses that include changes in
metabolites, activation or inhibition of enzymes, slower processes are also involved
like changes in the levels of macromolecules. The online availability of genome se-
quences of model plants has assisted technologies that permit inclusive analysis of
global mRNA profiles, expanding the horizon to screen the transcriptional program-
ming within cells in response to change in their environment (Daran-Lapujade et al.
2004). The use of methods for protein identification has brought about advancement
in studying descriptive analysis of protein patterns. Two-dimensional gel electro-
phoresis (2-DE), has been a turnover in this field that brought about transformation.
Thus, combining metablomics, transcriptomics and proteomics techniques, together
forms a powerful tool for functional genomics analysis, these days effectively used
in plant studies (Kusano et al. 2011; Amiour et al. 2012). Proteomics has proved
itself as a vital tool for analysing the differences occurring in the protein profile
caused due to environmental conditions, gene mutations, introduction or silencing
of genes, fairly being fast, sensitive and productive. Proteomics science has become
an important source for generating information on physiological, biochemical, ge-
netic and architectural aspects. This approach has gained recognition in revealing/
characterising individuals or mutants or lines, estimation of genetic variability, es-
tablishment of genetic distances to be used in phylogentic studies (Thiellement et al.
1999). It has turned out to be most promising technique that is able to characterize
proteins showing differential expression or post-transcriptionally modified during
a complex developmental process like senescence. Application of proteomics has
brought about a great deal of improvement in agricultural production (Xu et al.
2006). It has been revealed by Salon et al. 2001, using proteomics that during seed
filling, supply of N from the mother plant helps in assimilation of proteins in the
seeds. In legumes, this N is accumulated either from exogenous nitrogen supplied
in soil/atmosphere assimilated by the symbiotic fixation or from the nitrogen that
is translocated from vegetative parts. In monocarpic species, nitrogen mobilization
such as in pea, for seed filling is tightly linked to the senescence of vegetative parts,
which is brings about decrease in protein and chlorophyll content, followed by leaf
yellowing.Nitrogen availability and type of nitrogen source also initiate a complex
and still not fully understood metabolic rearrangement (Wek et al. 2004; Wang et al.
2012b). Kolkman et al. 2006, showed that limitations and availability of N results in
the induced proteins belonging to the category ‘metabolism’ reflecting a significant
metabolic rearrangement in yeast enabling it to adapt to the nutrient availability.
Lin et al. 2005 in an effort to understand N metabolism and its regulation studied
the response of nitrogen limitation in cultured Monascus cells and identified pro-
teins playing role during the nitrogen-limited media and C/N ratio. These researches
demonstrates that proteomics provide means of exploring biological processes by
methodical examination of a large number of expressed proteins that bridges se-
quence information and functional genomics.
The developed countries have contributed enormously in research in crop improve-

ments, development of new fertilizers and adapted better management practices.
This have attributed to improved NUE that greatly exceeds from that in developing
countries. Promotion of improved N management practices and technologies might
reduce N losses in the environment. However, efforts to increase NUE at farm level
needs a combination of improved technologies/knowledge and carefully crafted lo-
cal policies that will help in sustaining yield increases. In this Omics era, the trend is
now to search the mechanism/s in detail to understand the nutrient use efficiencies
by the crop plants. Though some basic steps in this path has been taken, there is a
lot of scope to explore the hidden mechanism fully by omics tools.
References
Abdin MZ, Abrol YP (1997) Effect of split nitrogen application on grain nitrogen and nitrogen
harvest of wheat ( Triticum aestivum L.) genotypes. In: T Ando, H Matsumoto, S Moni and S
Seksya (eds) for sustainable food production and environment. Kluwer Academic Publishers,
Dordecht, pp 635–638
Abdin MZ, Kumar PA, Abrol YP (1992) Biochemical basis of variability in nitrate reductase activ-
ity in wheat ( Triticum aestivum L.). Plant Cell Physiol 33:951–956
Abdin MA, Dwivedi RK, Abrol YP (2005) Nitrogen in agriculture. In: Singh RP, Shankar N
and Jaiwal PK (eds) Nitrogen nutrition and plant productivity. Studium Press LLC, Houston,
pp 1–41
Abdin MZ, Bansal KC, Kumar PA, Abrol YP (1996) Effect of split nitrogen application on growth
and yield of wheat ( Triticum aestivum L.) genotypes with different N assimilation potential. J
Agron Crop Sci 176:88–92
Ali A, Sivakami S, Raghuram N (2007) Effect of nitrate, nitrite, ammonium, glutamate, glutamine
and 2-oxoglutarate on the RNA levels and enzyme activities of nitrate reductase and nitrite
reductase in rice. Physiol Mol Biol Plants 13:17–25
Amiour N, Imbaud S, Clément G, Agier N, Zivy M, Valot B, Balliau T, Armengaud P, Quilleré I,
Cañas R, Tercet-Laforgue T and Hirel B (2012) The use of metabolomics integrated with tran-
scriptomic and proteomic studies for identifying key steps involved in the control of nitrogen
metabolism in crops such as maize. J Exp Bot 63:5017–5033
Andrews M, Lea PJ, Raven JA, Lindsey K (2004) Can genetic manipulation of plant nitrogen as-
similation enzymes result in increased crop yield and greater N-use efficiency? An assessment.
Ann App Biol 145:25–40
Balasubramanian V, Alves B, Aulakh MS, Bekunda M, Cai ZC, Drinkwater L, Mugendi D, Van
Kessel C, Oenama O (2004) Crop, environmental and management factors affecting N use
efficiency. In: Mosier AR, Syers JK and Freney JR (eds) Agricultural and the N cycle: assess-
ing the impacts of fertilizer use on food production and the environment. SCOPE 65, Paris,
pp 19–33
Bauwe H, ner Kolukisaoglu UÈ (2003) Genetic manipulation of glycine decarboxylation. J Exp
Bot 54:1523–1535
Bhatt TN, Sasisekharan V, Vijayan M (1979) An analysis of side-chain conformation in proteins.
Int J Peptide Protein Res 13:170
Bowsher CG, Hucklesby DP, Emes MJ (1993) Induction of ferrodoxin-NADP + oxidoreductase
and ferrodoxin synthesis in pea root plastids during nitrate assimilation. Plant J 3:463–467
Caboche M, Rouzé P (1990) Nitrate reductase: a target for molecular and cellular studies in higher
plants. Trends Genet 6:187–192
Cai H, Zhou Y, Xiao J, Li X, Zhang Q, Lian X (2009) Overexpressed glutamine synthetase
gene modifies nitrogen metabolism and abiotic stress responses in rice. Plant Cell Rep
28:527–537
Castaings L, Marchive C, Meyer C, Krapp A (2011) Nitrogen signalling in Arabidopsis: how to
obtain insights into a complex signalling network. J Exp Bot 62:1391–1397
Cerezo M, Flors V, Legaz F, Garcia-Agustin P (2000) Characterization of the low affinity transport
system for NO3− uptake by Citrus roots. Plant Sci 160:95–104.
Cerezo M, Tillard P, Filleur S, Munos S, Daniel-Vedele F, Gojon A (2001) Major alterations of the
regulation of root NO3− uptake are associated with the mutation of NRT2.1 and NRT2.2 genes
in Arabidopsis. Plant Physiol 127:262–271
Chandna R, Kaur G, Iqbal M, Khan I, Ahmad A (2011) Differential response of wheat genotypes
to applied nitrogen: biochemical and molecular analysis. Arch Agro Soil Sci. doi:10.1080/03
650340.2011.555761
Coque M, Gallais A (2006) Genomic regions involved in response to grain yield selection at high
and low nitrogen fertilization in maize. Theo App Genet 112:1205–1220
Cox T, Murphy JP, Rodgers DM (1996) Changes in genetic diversity in the red winter wheat re-
gions of the United States. Proc Natl Acad Sci 83:5583–5586
Crawford NM (1995) Nitrate: nutrient and signal for plant growth. Plant Cell 7:859–868
Crawford NM, Glass ADM (1998) Molecular and physiological aspects of nitrate uptake in plants.
Trends in Plant Sci 3:389–395
Daran-Lapujade P, Jansen ML, Daran JM, van Gulik W, de Winde JH, Pronk JT (2004) Role of
transcriptional regulation in controlling fluxes in central carbon metabolism of Saccharomyces
cerevisiae. A chemostat culture study. J Biol Chem 279:9125–9138
Dembinski E, Bany S, Raczynska-Bojanowska K (1995) Asparagine and glutamine in the leaves
of high and low protein maize. Acta Physiol Plant 17:361–365
Directorate of Economics and Statistics (2008) The statistical hand book. New Delhi
FAO (2008) Yearbook. Food and Agriculture Organization, India
Fedorova E, Greenwood JS, Oaks A (1994) In situ localization of nitrate reductase in maize roots.
Planta 194:279–286
Fei H, Chaillou S, Hirel B, Mahon JD, Vessey JK (2003) Overexpression of a soybean cytosolic
glutamine synthetase gene linked to organ-specific promoters in pea plants grown in different
concentrations of nitrate. Planta 216:467–474
Feil B, Thiraporn R, Stamp P (1993) In vitro nitrate reductase activity of laboratory-grown seed-
lings as an indirect selection criterion for maize. Crop Sci Madison 33:1280–1286
Freeman J, Marquez AJ, Wallsgrove RM, Sarrelainen R, Forde BG (1990) Molecular analysis of
barley mutants efficient in chloroplast glutamine synthetase. Plant Mol Biol 14:297–311
Gallais A, Coque M, Quilleré I, Prioul JL, Hirel B (2006) Modelling post-silking N-fluxes in maize
using 15 N-labelling field experiments. New Phytol 172:696–707
Glass ADM (2003) Nitrogen use efficiency of crop plants: physiological constraints upon nitrogen
absorption. Crit Rev Plant Sci 22:453–470
Hakeem KR, Ahmad A, Iqbal M, Gucel S, Ozturk M (2011) Nitrogen-efficient rice cultivars can
reduce nitrate pollution. Env Sci Poll Res 18:1184–1193
Hakeem KR, Chandna R, Ahmad A, Iqbal M (2012). Physiological and molecular analysis of ap-
plied nitrogen in rice ( Oryza sativa L.) genotypes. Rice Sci 19(1)
Hansch R, Fessel DG, Witt C, Hesberg C, Hoffman C, Walch-Liu P, Engels C, Kruse J, Ren-
nenberg H, Kaiser W, Mendel RR (2001) Tobacco plants that lack expression of functional
nitrate reductase in roots show changes in growth rates and metabolites accumulation. J Exp
Bot 52:1251–1258
Harrison J, Hirel B, Limami A (2004) Variation in nitrate uptake and assimilation between two
ecotypes of Lotus japonicus L. and their recombinant inbred lines. Physiol Planta 120:124–131
Hayakawa T, Nakamura T, Hattori F, Mae T, Ojima K, Yamaya T (1994) Cellular localization of
NADH-dependent glutamate synthase protein in vascular bundles of unexpanded leaf blades
and young grains of rice plants. Planta 193:455–460
Hirel B, Le Gouis J, Ney B, Gallais A (2007) The challenge of improving nitrogen use efficiency in
crop plants: towards a more central role for genetic variability and quantitative genetics within
integrated approaches. J Exp Bot 58:2369–2387
Hirel B, Martin Tercé-Laforgue T, Gonzalez-Moro MB, Estavillo JM (2005) Physiology of maize.
I. A comprehensive and integrated view of nitrogen metabolism in a C4 plant. Physiol Planta
124:167–177
Huang QM, Liu WH, Sun H, Deng X, Su J (2005) Agrobacterium tumefaciens mediated transgenic
wheat plants with glutamine synthetases confer tolerance to herbicide. J Plant Ecol 29:338–344
Jain V, Abrol YP (2005) Regulation of nitrate reductase activity by phytohormones in wheat. J
Kant S, Bi Y M, Rothstein SJ (2011) Understanding plant response to nitrogen limitation for the
improvement of crop nitrogen use efficiency. J Exp Bot 62:1499–1509
Kisaka H, Kida, T, Miwa T (2007) Transgenic tomato plants that overexpress a gene for NADH-
dependent glutamate dehydrogenase (legdh1). Breed Sci 57:101–106
Kolkman A, Daran-Lapujade P, Fullaondo A, Olsthoorn MMA, Pronk JT, Monique S, Heck

AJR (2006) Proteome analysis of yeast response to various nutrient limitations. Mol Syst Biol
2:1–26
Krapp A, Ferrario-Mery S, Touraine B (2002) Nitrogen and signalling. In: Foyer CH and Noctor G
(eds) Photosynthetic nitrogen assimilation and associated carbon and respiratory metabolism.
Kluwer Academic Publishers, Netherlands, pp 205–225
Kronzucker HJ, Siddiqi MY, Glass ADM (1995) Kinetics of NO3− influx in spruce. Plant Physiol
109:319–326
Kumar PA, Parry MAJ, Mitchell RAC, Ahmad A, Abrol YP (2002) Photosynthesis and nitrogen
use-efficiency. In: Foyer CH and Noctor G (eds) Photosynthetic nitrogen assimilation and asso-
ciated carbon and respiratory metabolism. Kluwer Academic Publishers, Dordecht, pp 23–34.
Kusano M, Fukushima A, Redestig H, Saito K (2011) Metabolomic approaches toward under-
standing nitrogen metabolism in plants. J Exp Bot 62:1439−1453
Ladha JK (2005) Improving the recovery efficiency of fertilizer nitrogen in cereals. J India Soc
Soil Sci 53:472–483
Ladha JK, Kirk GJD, Bennett J, Peng S, Reddy CK, Reddy PM, Singh U (1998) Opportunities
for increased nitrogen use efficiency from improved lowland rice germplasm. Field Crops Res
56:41–71
Lea PJ, Miflin BJ (1974) An alternative route for nitrogen assimilation in plants. Nature
251:680–685
Lea US, Leydecker MT, Quilleré I, Meyer C, Lillo C (2006) Posttranslational regulation of nitrate
reductase strongly affects the levels of free amino acids and nitrate, whereas transcriptional
regulation has only minor Influence. Plant Physiol 140:1085–1094
Li MG, Villemur R, Hussey PJ, Silflow CD, Gantt JS, Snusta DP (1993) Differential expression of
six glutamine synthetase genes in Zea mays. Plant Mol Biol 23:401–407
Lian X, Xing Y, Yan H, Xu C, Li X, Zhang Q (2005) QTLs for low nitrogen tolerance at seedling
stage identified using a recombinant inbred line population derived from an elite rice hybrid.
Lillo C, Ruoff P (1992) Hysteretic behavior of nitrate reductase: evidence of an allosteric site for
reduced pyridine nucleotides. J Biol Chem 267:13456–13459
Lillo C, Appenroth KJ (2001) Light regulation of nitrate reductase in higher plants: which photo-
receptors are involved? Plant Biol 3:455–465
Lin B, White JT, Lu W, Xie T, Utleg AG, Yan X, Yi EC, Shannon P, Khrebtukova I, Lange PH,
Goodlett DR, Zhou D, Vasicek TJ, Hood L (2005) Evidence for the presence of disease-per-
turbed networks in prostate cancer cells by genomic and proteomic analyses: a systems ap-
proach to disease. Cancer Res 65:3081–91.
Lochab S, Pathak RR, Raghuram N (2007) Molecular approaches for enhancement of nitrogen use
efficiency in plants. In: Abrol YP, Raghuram N and Sachdev MS (eds) Agricultural nitrogen
use and its environmental implications. IK International, New Delhi, pp 327–350
Machodo AT, Magalhães JR (1995) Melhoramento de milho para uso eficiente de N sob condições
de estresse. In: SIMPÓSIO INTERNACIONAL SOBRE ESTRESSE AMBIENTAL: O MIL-
HO EM PERSPECTIVA, 1992, Belo Horizonte. Anaislysis Sete Lagoas, Embrapa-CNPMS,
pp 321–342
Machado AT, Magalhães JR, Magnavaca R, Silva MR (1992) Determinação da atividade de enzi-
mas envolvidas no metabolismo do N em diferentes genótipos de milho. Revista Brasileira de
Fisiologia Vegetal, Brasília, v. 4, n. 1, pp 45–47
Man HM, Boriel R, El-Khatib R, Kirby EG (2005) Characterization of transgenic poplar with
ectopic expression of pine cytosolic glutamine synthetase under conditions of varying nitrogen
availability. New Phytol 167:31–41
Martin A, Lee J, Kichey T, Gerentes D, et al (2006) Two cytosolic glutamine synthetase isoforms
of maize ( Zea mays L.) are specifically involved in the control of grain production. The Plant
Cell 18:3252–3274
Mokhele B, Zhan X, Yang G, Zhang X (2012) Review: nitrogen assimilation in crop plants and its
affecting factors. Can J Plant Sci 92:399–405
Moll RH, Kamprath EJ, Jackson WA (1982) Analysis and interpretation of factors which contrib-
ute to efficiency of nitrogen utilization. Agro J 74:562–564
Mollaretti G, Bosio M, Gentinetta E, Motto M (1987) Genotypic variability for N related traits in
maize. Identification of inbread lines with high or low levels on NO3− N in the stalks. Maydica
32:309–323
Nogueira EDM, Olivares FL, Japiassu JC, Vilar CV, Vinagre F, Baldini JI, Hemerly AS (2005)
Characterisation of glutamine synthetase genes in sugarcane genotypes with different rates of
biological nitrogen fixation. Plant Sci 169:819–832
Oaks A (1994) Primary nitrogen assimilation in higher plants and its regulation. Can J Bot 72:739–750
Okamoto M, Kumar A, Li W, Wang Y, Siddiqi MY, Crawford NM, Glass ADM (2006) High-
affinity nitrate transport in roots of Arabidopsis depends on expression of the NAR2-like gene
AtNRT3.1. Plant Physiol 140:1036–1046
Oliveria IC, Brears T, Knight TJ, Clark A, Coruzzi GM (2002) Overexpression of cytosolic gluta-
mate synthethase in Arabidopsis thaliana. Plant Physiol 121:301–309
Omata T, Ohmori M, Arai N, Ogawa T (1989) Genetically engineered mutant of the cyano-
bacterium Synechococcus PCC 7942 defective in nitrate transport. Proc Nat Acad Sci USA
86:6612–6616
Orsel M, Chopin F, Leleu O, Smith SJ, Krapp A, Daniel-Vedele F, Miller AJ (2006) Characteriza-
tion of a two-component high-affinity nitrate uptake system in Arabidopsis. Physiology and
protein-protein interaction. Plant Physiol 142:1304–1317
Pahlich E (1996). Remarks concerning the dispute related to the function of plant glutamate dehy-
drogenase: commentary. Can J Bot 74:512–515
Provan F, Aksland LM, Meyer C, Lillo C (2000). Deletion of the Nitrate Reductase N-terminal
domain still allows binding of 14-3-3 proteins but affects their inhibitory properties. Plant
Physiol 123:757–764
Quillere I, Dufosse C, Roux Y, Foyer CH, Caboche M, Morot-Gaudry JF (1994) The effects of
deregulation of NR gene expression on growth and nitrogen metabolism of Nicotiana plum-
baginifolia plants. J Exp Bot 45:1205–1211
Raun WR, Johnson GV (1999) Improving nitrogen use efficiency for cereal production. Agron J
91:357–363.
Remans T, Nacry P, Pervent M, Filleur S, Diatoff E, Mounier E, Tillard P, Forde BG, Gojon A
(2006) The Arabidopsis NRT1.1 transporter participates in the signalling pathway triggering
root colonization of nitrate rich patches. Proc Natl Acad Sci U S A 103:19206–19211
Sakakibara H, Kawabata S, Takahashi H, HaseT, Sugiyama T (1992) Molecular cloning of the
family of glutamine synthetase genes from maize: expression of genes for glutamine synthe-
tase and ferredoxin-dependent glutamate synthase in photosynthetic and non-photosynthetic
tissues. Plant Cell Physiol 33:49–58
Salon C, Munier-Jolain NG, Duc G, Voisin AS, Grangirard D, Larmure A, Emery RJN, Ney B
(2001) Grain legume seed filling in relation to nitrogen acquisition: a review and prospects
with particular reference to pea. Agronomie 21:539–552
Scarpeci TE, Marro ML, Bortolotti S, Boggio SB, Valle EM (2007) Plant nutritional status modu-
lates glutamine synthetase levels in ripe tomatoes ( Solanum lycopersicum cv. Micro-Tom). J
Sechley KA, Yamaya T, Oaks A (1992) Compartmentation of nitrogen assimilation in higher
plants. Int Rev Cytol 134:85–163.
Seigel LM, Wilkerson JO (1989) In: Wray JL and Kinghorn JR (eds) Molecular and Genetic as-
pects of nitrate assimilation. Oxford Science Publications, Oxford, pp 263–283
Shigeto J, Yoshihara S, Adam Suaad EH, Sueyoshi K, Sakamoto A, Morikawa H, Takahashi M
(2006) Genetic engineering of nitrite reductase gene improves uptake and assimilation of nitro-
gen dioxide by Rhaphiolepis umbellate (Thunb.) Makino. Plant Biotech 23:111–116
Shrawat AK, Good AG (2008) Genetic engineering approaches to improving nitrogen use effi-
ciency. ISB News Report, May 2008
Skiba MW, George TS, Baggs EM, Daniell TJ (2011) Plant influence on nitrification. Biochem
Soc Trans 39:275−278
Smale M, McBride T (1996) Understanding global trends in the use of wheat diversity and inter-
national flows of wheat genetic resources. Part 1 of CIMMYT 1995/96 world wheat facts and
trends: understanding global trends in the use of wheat diversity and international flows of
wheat genetic resources. Mexico, D.F.: CIMMYT (Centro Internacional de Mejoramiento de
Maiz y Trigo—International Center for the Improvement of Wheat and Maize)
Sowers KE, Pan WL, Miller BC, Smith JL (1994) Nitrogen use efficiency of split nitrogen applica-
tions in soft white winter wheat. Agron J 86:942–948
Sun H, Huang QM, Su J (2005) Overexpression of glutamine synthetase confers transgenic rice
herbicide resistance. High Technol Lett 11:75–79
Suzuki A, Knaff DB (2005) Glutamate synthase: structural, mechanistic and regulatory properties,
and role in the amino acid metabolism. Photosyn Res 83:191–217
Tabuchi M, Abiko T, Yamaya T (2007) Assimilation of ammonium ions and reutilization of nitro-
gen in rice ( Oryza sativa L.). J Exp Bot 58:2319–2327
Thiellement H, Bharmann N, Damerval C (1999) Proteomics for genetic and physiological studies
in plants. Electropho 20:2013–2026
Wang X, Bian Y, Cheng K, Zou H, Sun SS-M, He J-X (2012a) A comprehensive l differential
proteomic study of nitrate deprivation in Arabidopsis reveals complex regulatory networks of
plant nitrogen responses. J Proteome Res 11:2301−2315
Wang YY, Hsu PK, Tsay F-Y (2012b) Uptake, allocation and signalling of nitrate. Trend Plant Sci
17:458–467
Wek RC, Staschke KA, Narasimhan J (2004) Regulation of the yeast general amino acid control
pathway in response to nutrient stress. In: Winderickx JG (ed) Nutrient-induced responses in
eukaryotic cells. Springer-Verlag, Berlin, pp 171–199
Wen-Yuan H, Shank D, Herwitt TI (1996) On-farm costs of reducing residual Nitrogen on crop-
land vulnerable to nitrate leaching. Rev Agri Eco 18:325–339
Wray JL (1993) Molecular biology, genetics and regulation of nitrite reductase in higher plants.
Xu G, Fan X, Miller AJ (2012) Plant nitrogen assimilation and use efficiency. Ann Rev Plant Biol
63:153–182
Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S, Ismail AM, Bailey-Serres J,
Ronald PC, Mackill DJ (2006).Sub1A is an ethylene-response-factor-like gene that confers
submergence tolerance to rice. Nature 442:705–708
Yamaya T, Obara M, Nakajima H, Sasaki S, Hayakawa T, Sato T (2002) Genetic manipulation and
quantitative-trait loci mapping for nitrogen recycling in rice. J Exp Bot 53:917–925
Yanagisawa S, Akiyama A, Kisaka H, Uchimiya H, Miwa T (2004) Metabolic engineering with
Dof1 transcription factor in plants: improved nitrogen assimilation and growth under low ni-
trogen conditions. Proc Natl Aca Sci U S A 101:7833–7838
Zheng Z-L (2009) Carbon and nitrogen nutrient balance signalling in plants. Plant Signal Behav
4:584–591
Chapter 12
Arsenic Toxicity and Tolerance Mechanisms
in Plants: An Overview
Saiema Rasool, Muneeb U. Rehman, Mohamed Mahgoub Azooz,

Muhammad Iqbal, Tariq Omar Siddiqi and Parvaiz Ahmad
Abstract Heavy metal stress is increasing at an alarming rate in agricultural soils

through out the world. Heavy metal (Cd, Cu, Zn, Ni, Co, Cr, Pb and As) toxicity
have been reported to be responsible for the reduced crop production. Among the
heavy metals arsenic (As) is non-essential and toxic to both plants and animals. As
can exist in environment in the form of oxidized arsenate (AsV) and reduced arse-
nite (AsIII). As stress has become a global concern, the uptake of As in the plants
through contaminated soil will make its entry into the human food chain. As toxicity
can lead to skin, bladder, lung and prostate cancer. Soil contaminated with As is the
main source of arsenic in drinking water. Uptake of As by plants is very important
in understanding its physiological effects and its metabolism within plants. How
plants respond to the arsenic stress in plants is a major concern to biologists. As per
the published literature numerous physiological processes are affected by the As
P. Ahmad ()
Department of Botany, A. S. College, University of Kashmir, Srinagar 190008, India
S. Rasool · M. Iqbal · T. O. Siddiqi
Department of Botany, Faculty of Science, Jamia Hamdard, New Delhi 110062, India
M. Iqbal
T. O. Siddiqi
M. U. Rehman
Department of Medical Elementology and Toxicology,
Faculty of Science, Jamia Hamdard, New Delhi 110062, India
M. M. Azooz
Department of Biological Sciences, Faculty of Science,
King Faisal University, Ahsaa, Saudi Arabia

364 S. Rasool et al.
toxicity. As is also responsible for oxidative stress in plants through the generation
of reactive oxygen species (ROS) which attack the biomolecules like, membranes
proteins, carbohydrates, nucleic acids etc. At the same time activity of enzymatic
and non-enzymatic antioxidants are increased which helped the plant to withstand
the toxicity of As. The present chapter throws light on the arsenic toxicity in plants
and their tolerance mechanism in plants. The chapter also highlights the generation
of reactive oxygen species and antioxidants during As stress.
Introduction
In human history, metal pollutants have been their part. However, due to the onset
of industrial revolution, the biosphere has been intensely polluted by toxic metals
leading to the major environmental and health problems (Bhattacharya et al. 2012;
Lui et al. 2012). Arsenic (As) is of major concern among all the metal pollutants
because it is a persistent bioaccumulative carcinogen (Kaur et al. 2011). The an-
thropogenic activities have increased many folds the level of arsenic as humans
constantly endeavored to improve quality of life when compared to the naturally
occurring elements occurring in the earth’s crust (Moreno-Jimenez et al. 2012). The
global input of arsenic to soil by human activities was estimated between 52,000
and 1,12,000 t per year (Chandra and Srivastava 2003). Severe problems like vege-
tation loss, contamination of ground water, and toxicity of arsenic in animals, plants
and have been caused by arsenic contamination (Fowler 1983; Zhao et al 2010).
Although several studies have reported the detoxification of arsenic ions through
metal binding peptides (Schmoger et al. 2000; Bondada and Ma 2002), due to the
lack of literature regarding to the role of ascorbate -glutathione pathway in cellular
defense against arsenic in plants.
Heavy metals produce oxidative-stress possibly by free-radical generation and
active oxygen species (Hall 2002). The reaction of these oxyradicals with proteins,
lipids, pigments and nucleic acids causes lipid peroxidation, membrane damage
and inactivation of enzymes, thus affecting the cell viability. Two major roles are
played by active oxygen species: (1) exacerbating damage and (2) signaling the
activation of defence responses. Recently these two functions have been verified by
several abiotic stress responses (Dat et al. 2000). In higher vascular plants, change
in cellular metabolism is required to counteract with heavy metal stresses. Various
antioxidant enzymes like superoxide dismutase (SOD), catalase (CAT), ascorbate
peroxidase (APX) and glutathione reductase (GR) of the ascorbate glutathione path-
way is the main mechanism for ROS quenching under heavy metal stress. (Clijsters
et al. 1999). Apart from these enzymes, low molecular weight antioxidants metabo-
lites like ascorbate and reduced glutathione (GSH) also play an important role in
plants by protecting them from oxidative. Antioxidant responses to arsenic in higher
plants have not been studied so far.
12 Arsenic Toxicity and Tolerance Mechanisms in Plants: An Overview 365
Occurrence and Distribution of Arsenic
In relation to the other element, arsenic ranks twentieth in abundance and is natu-
ral constituent on earth’s crust. In continental crust, the average As content varies
between 1 and 2 mg As/kg. It is distributed in a variety of minerals but occurs
commonly as arsenides of copper, iron, lead, silver and gold or as sulfides. Realgar
(As4S4) and orpiment (As2S3) are the two common As sulphides where As occurs
in oxidized form in the mineral arsenolite (As2O3). Loellingite (FeAs2), safforlite
(CoAs), niccolite (NiAs), rammelesbergite (NiAs2), arsenopyrite (FeAsS), Cobal-
lite (CoAsS), enargite (CU3), (As2S4), gerdsorfite (NiAsS), glucodal [(CO, Fe)AsS]
and elemental As are other naturally occurring As-bearing minerals.
Sources
From its origin in the earth’s crust, As can enter the environment through natural
and anthropogenic processes. Two principal pathways of As emission in the envi-
ronment, are (a) natural processes and (b) industrial activities. In natural environ-
ment, arsenic is released through natural processes such as weathering and volcanic
eruptions and as a suspended particulate arsenic may be transported over long dis-
tances through air or water. However, the most important source of As emission is
industry and accounts for widespread section, we discuss these two principal modes
of As emissions and their comparison among these two courses.
Natural Sources
Mean global atmospheric emission of As from natural sources is about 12.2 Gg.

These sources include wind bloom dust from weathered continental crust, forest
fires, volcanoes, sea spray, hot springs, and geysers. Emissions of As from volca-
nic eruptions very considerably as high as 8.9 Gg 1 year from Mount Saint Helens
in the united states to about 0.04 Gg 1 year from poas in Costa Rica. Arsenic
emission through volcanic ca.2.3 Gg/year compared to nearly 0.01 Gg/year as
volatile forms.
Anthropogenic Sources
The major producers of As2O3 (“white arsenic”) are the United States, Sweden,
France, the former USSR, Mexico and South West Africa. The As compounds
such as monosodium methylarsonate (NaCH3HAsO3), disodium methyle arsonate
(Na2CH3, AsO3), and diethylarsenic acid [(CH3)2AsO(OH)] are widely used as

agricultural insecticides, larvicides, and herbicides. Sodium arsenite (NaH2AsO4) is
used for aquatic weed control and for sheep and cattle dips. Arsenic acid (H3AsO4)
is used to defoliate cotton balls prior to harvesting and as a wood preservative.
As2O3 is used in the manufacture of pharmaceuticals. Elemental As is mainly used
in Pb, Cu, Sb, Sn, Al, and Ga alloys.
Mining, smelting and are beneficiation, pesticides, fertilizers and chemical in-
dustries, thermal power plants using coal, wood preservation industries using CCA
and incineration of preserved wood wastes contribute to significant influx of As to
the environment. Global emission of As in the atmosphere has been estimated to
be 0.019 Gg (0.012–0.026 Gg), but in soil and aquatic environment, the estimated
figures are 0.082 and 0.042 Gg, respectively. However, there has been a substantial
decrease in the atmospheric emission of As in Europe, from Circa 0.005 Gg in 1986
to 0.00031 Gg in 1995.
Mining and Ore Beneficiation
Elevated concentration of As, as well as other metals such as cadmium copper,

nickel and zinc are commonly encountered in the acid mine effluents. The principal
source of As in mine tailings is the oxidation of arsenopyrite (FeAsS) following the
reaction.
FeAsS(s) + 13 Fe3+ + 8H2O = 14 Fe2+ + SO24 + 13H+ + H3AsO4
Arsenopyrite can be oxidized by both O2 and Fe, but the rate of oxidation by FeIII is
faster than pyrite. The rate of this reaction was reported as 1.7 µ mal/m2, a reaction
faster than a similar oxidation reaction for pyrite. Under extremely acidic environ-
ment, with a pH of about 1.5 and an aqueous As concentration at > 10 m mol/l,
As precipitates as scordite (FeAsO4.2H2O). Under acidic conditions (pH < 3), AsV
may substitute SO4 in the structure of Jarosite [KFe3(SO4)2(OH)6] in different mine
wastes. Adsorption of As on Fe(OH)3 surfaces was found to be the principal sink
for As in studies of acid mine drainage. However, the adsorption of As by Fe(OH)3
may be only transient as changes in redone conditions (Eh) and pH may result in
dissolution of Fe(OH)3 with consequent mobilization of As. Effluents and water in
tailings ponds are often treated with lime to increase pH levels to stabilize the dis-
solved As and other metals as precipitates.
Agriculture
Over hundreds of years, inorganic arsenicals (arsenic trioxide, arsenic-acid, arse-

nates of calcium, Cu, Pb, and Na and arsenites of Na and K) have been widely used
in pigments, pesticides, insecticides, herbicides and fungicides. At present, As is
no longer used in agriculture in the west, but persistence of the residue of the inor-
ganic arsenicals in soil is an issue of environmental concerns. Studies by Kenyon
et al. 1979 and Aten et al. 1980 have indicated elevated concentrations of As in
vegetables grown in soils contaminated by lead arsenate used as an insecticide in
apple orchards. The recalcitrant nature of arsenical herbicides has, however, been
observed in agricultural soils particularly around old orchards. Biomethylation of
As is a mechanism through which a significant quantity of methylarsines may be
released into the atmosphere following the application of As compounds to the soil.
A relatively faster production of dimethyl and trimethylarsinics has been reported
from grasslands treated with methylarsenic compounds while grass treated with
sodium arsenite indicated slow release of methylorsene into the atmosphere.
Wood Preservation
The extensive contamination of soils and aquatic environments has been due to the
use of CCA and other As-based chemicals in wood preservation industries. The wood
preservative chemical like CCA has attained wide scale industrial application due
to biocidic characteristics of CuII and Asv. The preservative chemical used for pres-
sure impregnation comprises a water-based mineral of diachronic acid (H2Cr2O7)
arsenic acid (H3AsO4) and CuII as divalent cation at variable proportions. Cr is
used to bind As and Cu into the cellular structure of the wood. Fixation of CCA is
dependent on the transformation of CrIII to CrIII, a reaction that is dependent on the
temperature and water content of the wood. CrIII forms insoluble complexes with
both As and Cu. Further stabilization of these complexes takes place after complete
fixation of the As and Cu in the wood tissues and minimizes the risk of leaching of
the CCA components from processed wood. Among the active ingredients of CCA
wood preservatives. As is most mobile and toxic to a broad range of organisms
including human beings.
Chemistry of Arsenic in Soil
The natural content of As in soils varies significantly but is mostly in a range below
10 mg/kg. The background concentration of As in soils is governed by the lithalogy
of the parent rocks. As concentration in Swedish tills (< 0.06 mm) range between < 5
and 175 mg/kg with a medium value of 8 mg 1 kg (Selenics, Personal Communica-
tion 2000). Availability and dispersal of As in the soil environment are influenced
by several factors. Rainfall, surface runoff, rate of infiltration, and the groundwater
level like climatic and geographic characteristics and their fluctuations affect the
mobility and distribution of As. The speciation and mobility of As in soils also
depends upon the soil physical characteristics like grain size and mineralogy and
chemical characteristics such as redox potential (Eh) and pH conditions of the soils.
Physical Characteristics of Arsenic
• Arsenic is tin white tarnishes to dark grey or black in colour.

• It is metallic but tarnishes to dull in luster.
• Its crystals are opaque.
• Crystals are rare pseudocubic rhombohediral and acircular radial aggregates.
It is usually found in fine-grained masses with concentric bands or botryoidal
crusts. Allied minerals of arsenic are barite, cinnabar and neckline. Others are
poisonous.
• Arsenic is found to occur in France, Kangsberg, Norway, Somany and Harz
Mountains, Germany, Honshu, Japah, England, Italy, and Santa Cruz, Arizona
and New Jersey, USA.
• Best field indicators are tarnish, density, softness, crystal habits, color, garlic,
small and association.
Behaviour of Arsenic
Both arsenic and phosphorus have similar chemical properties, therefore they act
similarly in soil. Phosphorous and arsenic competes for soil fixation sites and for
plant uptake (Adriano 1986). By decreasing soil phosphorus level the phytotoxicity
of arsenic increases (Rumberg et al. 1960). Other experiments showed that addi-
tional phosphorus may increase arsenic phytotoxicity by releasing more arsenic into
solution (Jacobs and Keeney 1970).
Availability of Arsenic
Arsenic availability cannot be determined by the total arsenic concentration in soils

(Adriano 1986). Even though a limited quantity of arsenic in soil is readily mobile
and the rest is not available to plants because it is associated with iron (Fe) and
almunium (Al).
In soil the solubility of reduced form of arsenic (arsenite) is more oxidized form
(arsenate). Soluble arsenic concentration is directly proportional to the plant arsenic
toxicity, (Kabata-Pendias and Pendias 2001; Sturchio et al. 2011).
Many soil factors like soil pH affect the arsenic availability (Adriano 2001).
Therefore, soil pH is important because it plays a vital role in arsenic speciation and
leachability. The optimum adsorption for arsenite is approximately at pH 7.0 while
as arsenate adsorbs at pH 4.0 (Pierce and Moore 1982). On the whole, low soil pH,
clays makes the amorphous silicates and metal oxides protonated and is then able to
absorb arsenic anions present in the soil. Arsenic is less mobile at low pH as most
arsenic is present as arsenate in soils and at this pH there are high concentrations of
arsenic- binding species such as iron and aluminum. With the increase in pH proton-
ated sites allow the arsenic to become more mobile.
Arsenic does not have the capability to form a strong association with calcium
(calcite) at higher pH. According to Woolson (1983) under high arsenic concentra-
tions this association may be found where calcium is the secondary preference over
aluminum. Acidic conditions i.e. lower pH allows the calcite to be dissolved and the
arsenic is released.
The other aspect that affects the arsenic availability is soil texture (Adriano
2001). Soil surface area is affected by soil texture e.g. textured soils (silt and clays)
have much more surface area than sandy soils therefore they are more reactive.
Higher amounts of trace elements are likely to be retained by fine textured soils
as compared to sandy soils (Chen et al. 1999). Fine textured soils have higher cat-
ion enhance capacity (CEC) apart from increased surface area. Higher retention of
cationic species like copper is caused due to higher cationic enhancement capacity
(Chen et al. 1999).
High organic matter (OM) is found in finer textured soils with a higher CEC,
compared to sandy soils with low CEC. Often, higher organic matter leads to higher
cationic enhance capacity. In fine textured soils the pH dependent charge condi-
tions also favours the organic matter accumulation and retention. Retention of both
anionic and cationic species increases in organic matter because cations bridge with
the iron and aluminum, resulting in anion retention and the dissociation of organic
matter complexes in response to change in pH.
Sandy textured soils increases the arsenic toxicity in plants and arsenic mobil-
ity compared to soils with the clayed textures (Jacobs and Keeney 1970; Adriano
1986). Presence of aluminium and iron oxides play a vital role in the ability of soil
to retain arsenic (Adriano 2001; Jacobs and Keeney 1970). Moreover, concentra-
tions of iron and phosphorus influences arsenic concentrations in florida soils (Chen
et al. 2002). In sand grains the phophorus with clay coatings increases the retention
of elements as compared to bare quartz grains (Harris et al. 1987a, b). Metal oxides
and alumino-silicates are coating compounds that have higher affinity for trace ele-
ments such as arsenic soil horizons (i.e, albic horizons in spodosols) that have been
exposed to extreme weathering and leaching. And the weathering results in sand
grains that are exposed to clay coatings (Harris et al. 1987a, b). Rhue et al. (1994)
found that these horizons are able to retain these clay coatings and they exhibit
higher retention as compared to those that did not retain their coatings.
Arsenic Uptake
Plants metabolize the elements through the plasma membrane of the roots. Electro-
chemical potential is created by H+-ATPases across the membrane (Kennedy and
Gonsalves 1987; Palmgren 2001). Membrane potential is depolarized by plasma
membrane and acidifies the cytoplasm by the excess of positively charged ions
passing through it (Cumming and Taylor 1990: Axelsen and Palmgren 2001). Mem-
brane potential is disturbed by the arsenates of Pb and Zn (Barlian-Aidid and Oka-

moto 1992) e.g. low Zn concentration in the plasma membrane of roots of Zea mays
and enhances the H+ATPase activity by competing with Mg (Axelsen and Palmgren
2001), but 3 mM of Zn is inhibitory. Whereas lead does not activate the ATPase
but depolarizes the membrane potential slowly (Kennedy and Gonsalves 1987). In
Lemma gibba arsenate depolarization is dependent on the phosphate level (Ulrich-
Eberius et al. 1989), and in Impatients balbaniana stem sections Pb (0.5 mM) xy-
lem parenchyma membrane potential is depolarized (Barlian-Aidid and Okamoto
1992). Recent studies have confirmed the phosphate and arsenate competition at
the uptake level (Clements and Munson 1947) e.g. in Oryza sativa (Abedin et al.
2002), Halcustantus (Hartley-Whitaker et al. 2001a, b), L. gibba (Ulrich-Eberius
et al. 1989), Brassica juncea (Pickering et al. 2000) and pteris ferns (Zhao et al.
2002). Uptake metabolism of As in plants has been reviewed by Meharg and Hart-
ley-Whitaker (2002). Negative charged root cells absorb anions instead of moving
them in to apoplastic space of the root cortex (Clarckson 1996). Uptake of arsenic
is characterized as proton anion co-transport in Lemna gibba (Ulrich-Eberius et al.
1989). Uptake system is shared by arsenate and phosphate in higher plants (Abedin
et al. 2002), mycorrhizae (Sharples et al. 2000) and bacteria (Bruins et al. 2000),
and the further details are being investigated (Meharg and Hartley-Whitaker 2002).
Accumulation of arsenate follows the Michaelis-Menten kinetics in which concen-
tration range coincides with the level of activity of the high affinity phosphate up-
take (Sharples et al. 2000; Abedin et al. 2002). In micro-organisms, two types of
arsenate transporters have been recognized operating in the pumping arsenite either
into the vacuole or in efflux from cells (Rosen 1999; Ali et al. 2009). It means that
accumulation, uptake and toxicity, varies within and between plant species and in
general more the As in soil higher will be the concentration in plants (Banejad and
Olyaie 2011).
Arsenic Tolerance and Toxicity
Contaminated and naturally enriched soils will be used for agriculture in future
with higher concentrations of one or more elements (Abedin et al. 2002). Met-
al resistance enhancement in crop varieties is important only as long as the food
plants with metal concentration do not exceed health levels. The variable response
of crop plants to soil toxicants extends itself to their nutrient efficiency (Aniol and
Gustafson 1989). Tolerance “represents a genotype environment interaction” (Mac-
nair 1993) and the plants have been divided into two groups such as accumulators
or excluders (Baker 1987; Tangahu et al. 2011). According to Aniol and Gustafson
1989 many crop plants are accumulators. Excluder plant reduces the elements up-
take, Baker (1987). Exclusion capacity in higher plants is poor or absent (Ernst,
1976), while as in bacteria (Nies and Silver 1995) and some mycorrhiza (Sharples
et al. 2000) are able to efflux toxicants. Tolerance is under genetic control, although
the number of genes from one to smaller or larger number of genes varies and the
action may be influenced by modified genes (Macnair 1993; Schat et al. 1996).
Tolerance may be constitutive and adaptive i.e depending upon external factor and
both types are interlinked (Macnair 1993). For example, an increase in soil toxic-
ity leads to selection pressure, which plays an important role in tolerance (Schat
et al. 1996). Metal tolerance can be separate i.e regulated by separated genes for
each metal tolerance or co-tolerance (Pleiotropy), although the multiple tolerance
developed by plant is by growing them on soils with more than one metal (Macnair
1993) e.g., Silene vulgar population originating from metalliferous sites in Ireland
and Germany and from non-metalliferous site in Netherlands, two main co-additive
gene control of Zn tolerance in this species (Schat et al. 1996). The understand-
ing of cellular level processes has been progressed by metal trafficking proteins,
but the relationship between tolerance to toxic metals or metalloids and element
homeostasis of the entire organism is less known (Clemens 2001). Parameters like
yield reduction, shoot and root length or fresh and dry matter describes the toxic-
ity (Berry and Wallace 1981; Odjegba 2012), but the reversibility of plasmolysis
enzyme activities, chlorophyll contents and other physiological parameters are also
employed (Baker and Walker 1989). Several indices have been developed for the
measurement of tolerance and toxicity. The relationship between root growth with
and without a toxic element is expressed by tolerance index (TI). The dose CD50
toxicant causes the reduction, it may be expressed as EC10 to EC50 i.e. ‘effective
concentrations (EC) to lower the yield by 10–50 % (Ernst 1997a; Kooijman 1997).
Macnicol and Beckett (1985) found that critical tissue toxicant concentration can
also be used e.g. in soybean and cabbage soil culture, 10 % toxicity occurs at the
upper critical tissue by the As level between 1 and 4 mgAs kg–1 plant shoot and leaf
dry weight. For soybean, bush beans and pea, the values for the essential micronu-
trient like Zn are higher and the values are 450, 250, and 380–500 mgZnkg–1 for
shoot or leaf dry weight (Macnicol and Beckett 1985).
Physiological Response Mechanisms
Modes of action of plants under exposure instead of the term tolerance mechanism
are used in the meaning of ‘response mechanism’. Tolerance or toxicity mecha-
nisms are not fully defined as yet (Schat et al. 1996), and tolerance mechanism also
includes responses like altered permeability, enhanced metal binding capacity of
the root apoplasm and root exudates. Cellular mechanism includes the synthesis
of phytochelatins, organic acids, proteins and membrane adjusting functions togeth-
er with the synthesis of specific transporters (Hall 2002). Still the question arises as
which mechanism provides contribution to the primary and secondary responses.
These mechanisms shows the element and plant species dependency and more than
one mechanism is active simultaneously in a species (Macnair 1993). Recently
Fodor (2002) has reviewed heavy metal responses of higher plants.
Phytochelatins
Synthesis of phytochelatins (PCs) and metallothioniens (MTs) is the response of

plants applied with the high concentration of metals or metalloids. Due to their sim-
ilarity with metallothioniens, phytochelatins have been called as class III metallo-
thioniens (Cobbett and Goldsbrough 2002). The distribution task between PCs and
MTs is repeatedly reviewed (Cobbett 2000; Cobbett and Goldsbrough 2002). At
present, PCs primarily functions in detoxification while as MTs have been given
other roles, e.g. in chaperoning the metallic element translocation. MTs belong to
the gene family and PCs are enzymatically produced (Cobbett and Goldsbrough
2002). The small molecular weight phytochelatins are cysteine rich polypeptides
with n = 2–11 (Reddy and Prasad 1990) or n = 2–5 (Cobbett and Goldsbrough 2002).
They were first detected in cell suspension culture of Rauwalfia serpentina exposed
to 0.2 mM CdSO4 (Grill et al. 1985). Phytochelatins are synthesized in response to
Cd, Au, Cu, Ag, Ni, Pb, Sb, Sn, Hg, Te and Zn (Grill et al. 1987) and selenate and
arsenate (Grill et al. 1986). The proposed sequence to the intensity of induction in
metal specific is: Hg > Cd > As > Te > Ag > Cu > Ni > Sb > Au > Sn > Se > Bi > Pb
> W > Zn (Ernst 1997b). Many exceptions to this sequence raised, e.g. Pb is strong
inducer of phytochelatins in some legumes (Piechalak et al. 2002). To confirm this
the sequence of the root culture of Rubia tinctorium; Ag > Cd > Pb > Hg > As (III)
> Cu > As (V) > Zn > Pd > In > Ga > Se > Ni has been suggested (Maitani et al.
1996). Phytochelatins production leads to toxicity rather than tolerance (Ebbs et al.
2002). Current studies revealed that phtochelatins do not contribute to Zn, Cd (Ebbs
et al. 2002; Schat et al. 2002) or Cu tolerance (Schat et al. 2002). In the root cells
of Silene cucubalus the Cu tolerance is associated with the glutathione level, i.e by
restricting the influx of Cu to these cells and PC synthesis reduction (De Vos et al.
1992). Apart from toxic element inactivation, PCs perform other functions as well
like micronutrient homeostasis (Schat et al. 2002), sulphur metabolism (Tomasze-
wska et al. 1996) maintainance of enzyme activity (Kneer and Zenk 1992) translo-
cation of metals (Cobbett and Goldsbrough 2002) and transport and storage of As
(Hartley-Whitaker et al. 2001b). It has been anticipated that PCs primary function
is homeostasis and inactivation is secondary (Steffens 1990). In higher plants and
microorganisms, the trafficking of PC-complex metals in energy consuming across
tonoplast, the transport is mediated by ABC-type cassette binding ATPase (Nies and
Silver 1995). Avena sativa roots have shown that these ATPases transport Cd-PCs
in tonoplast vesicles in the presence of Mg2+ (Salt and Rauser 1995). Most likely,
higher plants have a gene homologue to the hunt gene that regulates the production
of these transporter proteins in Schizosaccharomyces pombe (Ortiz et al. 1992).
Five types of PCs have been known on the basis of C-terminal amino-acid and the
length of the chain (PC0-PC4) (Rauser 1995). In addition to PCs, i.e. the polymer
of glutamyl-cysteinyl glycine, homo phytochelatins (h-PCs), polymer of glutamyl-
cysteinyl alanine occurs in legumes (Piechalak et al. 2002). Evidences point towards
glutathione and homoglutathione acts as precursor of PCs and h-PCs (Cobbett and
Goldsbrough 2002). The polymerization of glutathione and PC synthase the metal
of PC reaction is catalysed by glutamyl-cysteine synthetase (Piechalak et al. 2002).

PC-metal complex regulates the PC synthase (Cobbett 2000). In many plants
PC synthase is present in the cytoplasm and also in the roots of Pisum sativum
(Klapheck et al. 1995) metal ion is most likely to be activated although de novo
synthesis may occur (Cobbett 2000).
Oxidative Stress and Antioxidative System in Plants
Oxidative stress is an essential regulated process, as the equilibrium between the

oxidative and antioxidative capacities determines the fate of the plant. The antioxi-
dant defence system provides sufficient protection against active oxygen and free
radicals under non-stressful conditions. Natural and anthropogenic both stresses
provoke the high production of toxic oxygen derivatives. In this condition, the re-
sponse of the capacity of the antioxidative defence system is increased, but in many
situations the response is moderate. In addition, important sites like reaction center
and apoplastic space have very little protection against this oxidative damage.
About two billion years ago, ROS have been the unwanted companions of aero-
bic metabolism. Apart from molecular oxygen (O2), partially reduced or activated
derivatives of oxygen (O2–1, H2O2 and HO) are highly reactive and toxic and cause
the oxidative destruction of cells. This results that evolution of all aerobic organism
has been dependent on the development of efficient ROS scavenging mechanisms.
Recently new rate for ROS was known like the control and regulation of biological
processes such as cell death, stress responses, hormonal signaling and development.
Therefore the understandings of ROS suggest its dual role in plant biology:
• Toxic products of aerobic metabolism
• Key regulators of metabolic and defense
The ROS Cycle
Rate of ROS in different cellular compartments is determined by the relationship be-

tween multiple ROS-producing pathways and ROS scavenging mechanisms. ROS
signal transduction pathways control these mechanisms and form the ‘basic ROS
cycle’. This pathway monitors the level of ROS, produced by aerobic metabolism,
and controls the expression and ROS-scavenging pathways during normal growth
and development. The ROS cycle also performs good metabolic timing e.g. Photo-
synthesis control to reduce the production rate of ROI. The ROS source in plants be-
longs to the aerobic metabolic reactions, such as photosynthesis and respiration and
others belong to pathways enhanced during abiotic stresses like photorespiration.
Recently, NADPH oxidase, amino-oxidases and cell wall bound peroxidases were
identified to be the new sources of ROS in plants. They participate and are tightly
regulated in control processes like stress responses, programmed cell death and
pathogen defense pathways. The estimated constant rate of 240 µMO2 and steady
level of 0.5 µH2O2 for ROS production in cells are optimal growth conditions. On
the other hand, stresses that destroy the cellular homeostasis of cells result in the
enhancement production of ROS (i.e. up to 720 µMO2 and steady state level of
5–15 µMH2O2). These stresses consist of salt, drought, chilling, heavy metal, heat
shock, UV radiations, desiccation and air pollutants such as ozone and SO2, nutrient
deprivation, mechanical stress, pathogen attack and high light. Stress enhanced the
production of ROS that creates threat to cells and these conditions also enhance the
expression of ROS scavenging enzymes.
Under stress conditions, ROS are produced by cells (e.g. by NADPH oxidase)
and the signals for the defence pathways are also produced. Therefore, ROS may
be considered as the cellular byproduct of stress metabolism as well as secondary
messenger for signal transduction pathway in stress response.
Plant cells require different mechanisms to regulate their intracellular ROS con-
centrations by scavenging ROS because ROS are toxic and participate in key signal
events as well. These include superoxide dismutase (SOD), ascorbate peroxidase
(APX) and catalase (CAT). The equilibrium between SOD and APX activity in cells
is considered to be crucial for estimating the steady state level of O2–1 and H2O2.
And the balance with metal ions like Fe and Cu by ferritin and copper binding pro-
teins is also important to prevent formation of highly toxic OH by metal-dependent
Haber-Wiess or Fenton reaction. Other antioxidants important for the defence of
plants against oxidative stress are ascorbic acid and glutathione that are found at
high concentrations in chloroplasts and other cellular compartments. Though the
ROS scavenging enzymes expression increases the tolerance of plants under abiotic
stress. However, in chloroplasts and mitochondria a group of enzymes called alter-
native oxides also decreases the ROS production in cells by alternative channelling
of electrons in electron transport chain.
In this review article, arsenic occurrence, distribution, sources, chemistry, physi-

ological response mechanism and oxidative stress were discussed. We found that
arsenic from both natural and anthropogenic sources have been considered as one of
the most toxic element affecting millions of people in the world. And several prob-
lems like vegetation loss, contamination of ground water and toxicity in animals,
plants has been due to arsenic contaminations. From many published reports, it is
now clear that arsenic induces cellular toxicity by damaging the oxidative defense
mechanism that can be prevented by the phytochelation method. But we need more
sound information related to arsenic as treatments of residues from smelting or
mining, preventing the use of agrochemicals containing As or simple methods for
soil/water testing in field or laboratory which will allow us in making decision for
remediation and an adequate disposal plan.
It is clear now that still we are far away from having a safe, specific and effective
chelating agent for the treatment of metal poisoning. Several factors must be con-
sidered in order to accomplish a high performance of remediation result. Phytore-
mediation is the most thriving way to remediate arsenic contaminated environment,
as it has many advantages as compared to other conventional technologies.
References
Abedin MJ, Feldmann J, Meharg AA (2002) Uptake kinetics of arsenic species in rice plants. Plant
Physiol 128:1120–1128
Adriano DC (2001) Trace elements in the terrestrial environment. Springer, New York,
Adriano DC (1986) Trace elements in the terrestrial environment. Springer, New York,
Ali W, Isayenkov SV, Zhao FJ, Maathuis F (2009) Arsenite transport in plants. Cell Mol Life Sci
66:2329–2339
Aniol A, Gustafson JP (1989) Genetics of tolerance in agronomic plants. In: Shaw AJ (ed) Heavy
metal tolerance in plants: evolutionary aspects. CRC Press, Florida, pp 255–267
Aten CF, Bourke JB, Martini JH et al (1980) Arsenic and lead in an orchard environment. Environ
Toxicol 24:108−115
Axelsen K, Palmgren M (2001). Inventory of the superfamily of P-type ion pumps in Arabidopsis.
Baker AJM (1987) Metal tolerance. New Phytol 106(Suppl):93–111
Baker AJM, Walker PL (1989) Physiological responses of plants to heavy metals and the quantifi-
cation of tolerance and toxicity. Chem Speciat Bioavailab 1:7–17
Banejad H, Olyaie E (2011) Arsenic toxicity in the irrigation water-soil-plant system: a significant
environmental problem. J Am Sci 7(1):125–131
Barlian-Aidid S, Okamoto H (1992) Effects of lead, cadmium and zinc on the electric membrane
potential at the xylem/symplast interface and cell elongation of Impatiens balsamina. Environ
Exp Bot 32:439–448
Berry WL, Wallace A (1981) Toxicity: the concept and relationship to the dose response curve. J
Plant Nutr 3:13–19
Bhattacharya S, Goswami MR, Dhar A, Chattopadhyay D, Mukhopadhyay A, Ghosh UC (2012)
Effects of arsenic stress on germination, seedling growth and peroxidase activity in pea seeds
and kidney bean seeds. J Universal Pharm Life Sci 2(3):760–770
Bondada B, Ma LQ (2002) Tolerance of heavy metals in vascular plants: arsenic hyperaccumula-
tion by Chinese brake fern ( Pteris vittata L.), In: Nayar BK, Chandra S, Srivastava M (eds)
Pteridology in New Millennium, Kluwer Academy Publishers, 397–420
Bruins MR, Kapil S, Oehme FW (2000) Microbial resistance to metals in the environment. Eco-
toxicol Environ Safety 45B:198–207
Chandra S, Srivastava M (2003) Pteridology in the new millennium. Kluwer Academic Publishers,
Netherlands
Chen M, Ma LQ, Harris WG (1999) Baseline concentrations of 15 trace elements in Florida sur-
face soils. J Environ Qual 28:1173–1181
Chen T, Wei C, Huang Z, Huang Q, Lu Q, Fan Z (2002) Arsenic hyper-accumulator Pteris vittata
L. and its arsenic accumulation. Chinese Sci Bull 47:902–905
Clarkson DT (1996) Root structure and sites of ion uptake. In: Waisel Y, Eshel A, Kafkafi U (eds)
Plant roots. The hidden half, Marcel Dekker, New York, pp 483–510
Clemens S (2001) Molecular mechanisms of plant metal tolerance and homeostasis. Planta
212:475–486
Clements HF, Munson J (1947) Arsenic toxicity studies in soil and in culture solution. Pacific Sci
1:151–171
Clijsters H, Cuypers A, Vangronsveld J (1999) Physiological responses to heavy metals in higher

plants; defence against oxidative stress. Z Naturforsch 54c:730–734
Cobbett C, Goldsbrough P (2002) Phytochelatins and metallothioneins: roles in heavy metal de-
toxification and homeostasis. Annu Rev Plant Biol 53:159–182
Cobbett CS (2000) Phytochelatins and their roles in heavy metal detoxification. Plant Physiol
123:825–832
Cumming JR, Taylor GJ (1990) Mechanisms of metal tolerance in plants: physiological adapta-
tions for exclusion of metal ions from the cytoplasm. In: Alscher RG, Cumming JR (eds) Stress
responses in plants: adaptation and acclimation mechanisms. Wiley, New York, pp 329–356
Dat J, Vandenabeele S, Vranová E, Van Montagu M, Inzé D, Van Breusegem F (2000) Dual action
of the active oxygen species during plant stress responses. Cell Mol Life Sci 57:779–795
De Vos CHR, Vonk MJ, Vooijs R, Schat H (1992) Glutathione depletion due to copper-induced
phytochelatin synthesis causes oxidative stress in Silene cucubalus. Plant Physiol 98:853–858
Ebbs S, Lau I, Ahner B, Kochian L (2002) Phytochelatin synthesis is not responsible for Cd toler-
ance in the Zn/Cd hyperaccumulator Thlaspi caerulescens (J. & C. Presl). Planta 214:635–640
Ernst W (1976) Physiological and biochemical aspects of metal tolerance. In: Mansfield TA (ed)
Effects of air pollutants on plants. Cambridge University Press, Cambridge, pp 115–133
Ernst WHO (1997a) Population dynamics of plants under exposure and the selection of resistance.
In: Schüürmann G, Markert B (eds) Ecotoxicology. Ecological fundamentals, chemical expo-
sure, and biological effects. Wiley, New York, pp 117–132
Ernst WHO (1997b) Effects of heavy metals in plants at the cellular and organismic level. In:
Schüürmann G, Markert B (eds) Ecotoxicology. Ecological fundamentals, chemical exposure,
and biological effects. Wiley, New York, pp 587–620
Fodor F (2002) Physiological responses of vascular plant to heavy metals. In: Prasad MNV, Str-
zalka K (eds) Physiology and biochemistry of metal toxicities and tolerance in plants. Kluwer
Academic Publishers, Dordrecht, pp 149–177
Fowler BA (1983) Biological and environmental effects of arsenic. Elsevier Sci. Publ., Amsterdam
Grill E, Gekeler W, Winnacker E-L, Zenk HH (1986) Homo-phytochelatins are heavy metal-bind-
ing peptides of homo-glutathione containing Fabales. FEBS Lett 205:47–50
Grill E, Winnacker E-L, Zenk MH (1985) Phytochelatins: the principal heavy-metal complexing
peptides of higher plants. Science 230:674–676
Grill E, Winnacker E-L, Zenk MH (1987) Phytochelatins, a class of heavy-metal-binding pep-
tides from plants, are functionally analogous to metallothioneins. Proc Natl Acad Sci USA
84:439–443
Hall JL (2002) Cellular mechanisms for heavy metal detoxification and tolerance. J Exp Bot
53:1–11
Harris WG, Carlisle VW, Chesser SL (1987a) Clay mineralogy as related to morphology of Florida
soils with sandy epipedons. Soil Sci Soc Am J 51:1673–1677
Harris WG, Carlisle VW, van Rees KCJ (1987b) Pedon zonation of hydroxy-interlayered minerals
in Ultic Haplaquods. Soil Sci Soc Am J 51:1367–1372
Hartley-Whitaker J, Ainsworth G, Meharg AA (2001a) Copper and arsenate induced oxidative
stress in Holcus lanatus L. clones with differential sensitivity. Plant Cell Environ 24:713–722
Hartley-Whitaker J, Ainsworth G, Vooijs R, Ten Bookum W, Schat H, Meharg AA (2001b) Phy-
tochelatins are involved in differential arsenate tolerance in Holcus lanatus. Plant Physiol
126:299–306
Jacobs LW, Keeney DR (1970) Arsenic-phosphorus interactions in corn. Commu Soil Sci Plant
Analy 1:85–93
Kabata-Pendias A, Pendias H (2001) Trace elements in soils and plants. CRC Press, Boca Raton,
p 413
Kaur S, Kamli MR, Ali A (2011) Role of arsenic and its resistance in nature. Can J Microbiol
57(10):769–774
Kennedy CD, Gonsalves FAN (1987) The action of divalent zinc, cadmium, mercury, copper and
lead on the trans-root potential and H+efflux of excised roots. J Exp Bot 38:800–817
Kenyon DJ, Elfving DC, Pakkala IS, Bache CA, Lisk DJ (1979) Residues of Lead and Arsenic in
crops cultured on old orchard soils. Bul Environ Contam Toxicol 22:221−223
Klapheck S, Schlunz S, Bergmann L (1995) Synthesis of phytochelatins and homophytochelatins
in Pisum sativum L. Plant Physiol 107:515–521
Kneer R, Zenk MH (1992) Phytochelatins protect plant enzymes from heavy metal poisoning.
Kooijman SALM (1997) Process-oriented descriptions of toxic effects. In: Schüürmann G, Mark-
ert B (eds) Ecotoxicology. Ecological fundamentals, chemical exposure, and biological effects.
Wiley, New York, pp 483–520
Lui Yl, Xu Y, Ke-Bing D, Tu BK (2012) Absorption and metabolism mecha-
nisms of inorganic arsenic in plants: a review. Ying Yong Sheng Tai Xue Bao
23(3):842–848
Macnair MR (1993) The genetics of metal tolerance in vascular plants. New Phytol 124:541–559
Macnicol RD, Beckett PHT (1985) Critical tissue concentrations of potentially toxic elements.
Maitani T, Kubota H, Sato K, Yamada T (1996) The composition of metals bound to Class III
metallothionein (phytochelatin and its desglycyl peptide) induced by various metals in root
cultures of Rubia tinctorum. Plant Physiol 110:1145–1150
Meharg AA, Hartley-Whitaker J (2002) Arsenic uptake and metabolism in arsenic resistant and
non-resistant plant species. New Phytol 154:29–43
Moreno-Jimenez E, Esteban E, Penalosa JM (2012) The fate of arsenic in soil-plant systems. Rev
Environ Contam Toxicol 215:1–37
Nies DH, Silver S (1995) Ion efflux systems involved in bacterial metal resistances. J Indust Micro
biol 14:186–199
Odjegba VJ (2012) Exogenous salicylic acid alleviates arsenic toxicity in Arabidopsis thaliana.
Indian J Innovations Dev 1(7):516–522
Ortiz DF, Kreppel L, Speiser DM, Scheel G, McDonald G, Ow DW (1992) Heavy metal toler-
ance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.
EMBO J 11:3491–3499
Palmgren M (2001) Plant plasma membrane H+-ATPase: powerhous for nutrient uptake. Ann Rev
Plant Physiol Mol Biol 52:817–845
Pickering IJ, Prince RC, George MJ, Smith RD, George GN, Salt DE (2000) Reduction and coor-
dination of arsenic in Indian mustard. Plant Physiol 122:1171–1178
Piechalak A, Tomaszewska B, Baralkiewicz D, Malecka A (2002) Accumulation and detoxifica-
tion of lead ions in legumes. Phytochemistry 60:153–162
Pierce ML, Moore CB (1982) Adsorption of arsenite and arsenate on amorphous iron hydroxide.
Water Residue 16:1247–1253
Rauser WE (1995) Phytochelatins and related peptides. structure, biosynthesis, and function. Plant
Physiol 109:1141–1149
Reddy GN, Prasad NMV (1990) Heavy metal-binding proteins/peptides: occurrence, structure,
synthesis and functions. A review. Environ Exp Bot 30:251–264
Rhue RD, Harris WG, Kidder G, Brown RB, Littell RC (1994) A soil based phosphorous retention
index for animal waste disposal on sandy soil. Final project report. Florida Depart Environ
Protec EPA grant no.9004984910
Rosen BP (1999) Families of arsenic transporters. Trends Microb 7:207–212
Rumberg CB, Engel RE, Meggitt WF (1960) Effect of phosphorus concentration on the absorption
of arsenate by oats from nutrient solution. Agronomy J 52:452–453
Salt DE, Rauser WE (1995) MgATP-dependent transport of phytochelatins across the tonoplast of
oat roots. Plant Physiol 107:1293–1301
Schat H, Llugany M, Vooijs R, Hartley-Whitaker J, Bleeker PM (2002) The role of phytochelatins
in constitutive and adaptive heavy metal tolerances in hyperaccumulator and non-hyperaccu-
mulator metallophytes. J Exp Bot 53:2381–2392
Schat H, Vooijs R, Kuiper E (1996) Identical major gene loci for heavy metal tolerances that have
independently evolved in different local populations and subspecies of Silene vulgaris. Evolu-
tion 50:1888–1895
Schmoger ME, Oven M, Grill E (2000) Detoxification of arsenic by phytochelatins in plants. Plant
Physiol 122:793–801
Sharples JM, Meharg AA, Chambers SM, Cairney JWG (2000) Mechanism of arsenate resistance
in the ericoid mycorrhizal fungus Hymenoscyphus ericae. Plant Physiol 124:1327–1334
Steffens JC (1990) The heavy metal-binding peptides of plants. Annu Rev Plant Physiol Plant Mol
Biol 41:553–575
Sturchio E, Boccia P, Meconi C, Zanellato M, Marconi S, Beni C, Aromolo R, Ciampa A, Diana G,
Valentini M (2011) Effects of arsenic on soil-plant systems. Chem Ecol 27(1):67–78
Tangahu BV, Sheikh Abdullah SR, Basri H, Idris M, Anuar N, Mukhlisin M (2011) A Review on
Heavy metals (As, Pb, and Hg) uptake by plants through phytoremediation. Int J Chem Engi-
neer 2011: doi:10.1155/2011/939161
Tomaszewska B, Tukendorf A, Baralkiewicz D (1996) The synthesis of phytochelatins in lupin
roots treated with lead ions. Sci Legume 3:206–217
Ullrich-Eberius CI, Sanz A, Novacky AJ (1989) Evaluation of arsenate and vanadate associated
changes of electrical membrane potential and phosphate transport in Lemna gibba G1. J Exp
Bot 40:119–128
Woolson EA (1983) Emissions, cycling, and effects of arsenic in soil ecosystems. Elsevier, Am-
sterdam, pp 52–125
Zhao F, MecGrath SP, Meharg AA (2010) Arsenic as a food chain contaminant: mechanisms of
uptake and metabolism and mitigation strategies. Ann Rev Plant Biol 61:535–559
Zhao FJ, Dunham SJ, McGrath SP (2002) Arsenic hyperaccumulation by different fern species.
New Phytol 156:27–31
Chapter 13
Arsenic Stress in Plants: An Inside Story
Iti Sharma
Abstract Arsenic (As) toxicity is a global concern due to increasing contamina-

tion of metalloid in water, soil and crops especially in South East Asia. Arsenic
poses a serious threat of food chain contamination by accumulating in various crops
through the phosphate transporters as a phosphate analogue. After accumulating
in plant tissues arsenic interferes with various metabolic processes and thereby
adversely affects the plant metabolism, and ultimately leads to reduced plant pro-
ductivity. Alteration of phosphate, nitrogen, sulfur metabolism and disorder in
major physiological reactions like respiration, photosynthesis and transpiration are
responsible for metabolic dysfunction of plants exposed to arsenic. This chapter
discusses recent advances in plant arsenic interaction at molecular, biochemical and
physiological levels. It is necessary to develop a detailed biochemical understand-
ing about interaction of arsenic with plants to limit detrimental effects of arsenic on
crops and also for better agronomic production.
Introduction
Arsenic (As) is an environmental and food chain contaminant. The toxicity of arse-
nic was known as early as in 300 B.C. It has been used at least from the 12th century
A.D in metallic form. It bears a sinister connotation linked to suicides, witchcraft
and murder and it was a source of despair and inspiration to alchemists wishing
to transform metals into gold (Azcue and Nriagu 1994). Arsenic is a metalloid of
group VA in the periodic system. It is a natural constituent of the lithosphere and oc-
curs in some 200 minerals, frequently as mixed sulphides. Metal oars such as lead,
gold, zinc and copper, volcanic eruptions and sea spray liberate arsenic naturally,
and it can be methylated, demethylated and volatilized by soil bacteria (Matscullat
2000). Anthropogenic sources of arsenic pollution are spreading of herbicides or
pesticides, coal combustion and timber preservatives. High-temperature urban
I. Sharma ()
Department of Bioscience and Biotechnology,
Banasthali University,
Banasthali 304022, India

380 I. Sharma
waste combustion generates particulate emissions of arsenic, that contribute to dry

(particles) and wet deposits (rain) (Melanen et al. 1999). Inorganic arsenic is a po-
tent human carcinogen, associated with increased risk for cancer of the skin, lungs,
urinary bladder and kidneys, as well as hyperkeratosis, pigmentation changes, and
effects on the circulatory and nervous systems. It is also known to generate oxida-
tive stress in humans (Benton et al. 2011).
Distribution of Arsenic in World
Arsenic contamination has become a problem in many parts of the world. The World
Health Organization (WHO) has set a guideline of 10 µg As L−1 as the drinking water
standard (WHO 2008). However, As concentrations in the range of > 1,000 µg L−1
have been reported from various places throughout the world (Tuli et al. 2010).
Especially Australia, Canada, Japan, Mexico, Thailand, United Kingdom, United
States, Argentina, Bangladesh, Cambodia, Chile, China, Ghana, Hungary, Inner
Mongolia, Mexico, Nepal, New Zealand, Philippines, Taiwan, the United States
and Vietnam are reported as highly contaminated countries (WHO 2002).
In India sever contamination of arsenic in ground water has been reported in West
Bangal (69 times more arsenic than WHO standard) whereas Jharkhand, Assam, Bi-
har, Utter Pradesh, Manipur and Chhattisgarh are some other states well effected by
arsenic toxicity. In Rajasthan also, arsenic bearing groundwater has been reported
in the vicinity of Cu (Khetri) and Zn mines (Zawar). It has been reported that agri-
cultural land contains ≤ 10 mg kg−1 in non-contaminated soil whereas it increases
up to 1,000–3,000 mg kg−1 in contaminated soil (Panda et al. 2009). Growing crops
in arsenic contaminated soil and irrigation with arsenic contaminated water effects
the crops in terms of growth, yield, biomass production and arsenic accumulation
which can directly leads to food chain contamination.
Arsenic Species Found in the Environment
The oxidation states and electron orbital of arsenic is similar to those of phospho-
rus. Arsenic forms alloys with various metals and covalent bonds with carbon, hy-
drogen, oxygen, and sulfur. In nature, arsenic exists predominantly in inorganic
form as trivalent arsenite (III) or pentavalent arsenate (V). The major species found
in the environment are arsenite As(III), arsenate As(V), mono methylarsonic acid
(MMA), dimethyal arsenic acid (DMA), arseno betain and arseno choline (Tangahu
et al. 2011). In the environment arsenic is present in both organic and inorganic
forms. The inorganic species arsenate As(V) and arsenite As(III) are more abundant
in soil as compare to organic species, monomethyarsonic (MMA), Dimethylarse-
nic (DMM) etc. (Takamatsu et al. 1982). These forms have different physical and
chemical characteristics resulting in various degrees of mobility, bioavailability and
13 Arsenic Stress in Plants: An Inside Story 381
toxicity. In general inorganic arsenic species are more toxic than organic arsenic
species (Adriano 2001).
Arsenic accumulation and speciation in plants are affected by root aeration and
porosity (Wu et al. 2011). Behavior of arsenic in soil and also in plants is differ-
ent due to its dynamic and complex chemical species with inter conversable forms
regulated by biotic and abiotic process (Fig. 13.1).
This chapter evaluates all the changes in plants at physiological, biochemical and
molecular level to better understand toxicity and resistance mechanisms in plants.
Interaction of Arsenic with Plants
Uptake of Arsenic in Plants
Different soil parameters like pH and redox state has a major influence on the toxic-
ity of arsenic species due to altered availability (solubility and mobility). The up-
take of arsenic affected by some factors such as soil type, nutrient supply, pH of the
medium and mugineic acid which is excreted by some graminaceous (grassy) plants
(Sultana and Katsuichiro 2011). Among all factors phosphorus and pH are the most
important ones influencing plant growth and As uptake. As(V) has been shown to
be taken up by the high affinity phosphate uptake system (Ullrich-Eberius et al.
1989) while As(III) uptake is thought to be through aquaporins in the roots (Meharg
and Jardine 2003) while low level uptake of organic As species, such as MMA and
DMA has also been observed in rice but the underlying transport pathways are un-
known (Meharg 2004). Recently, Arsenic transformation and volatilization is also
investigated. The uptake of As species into rice roots is in the order of arsenate
[As(V)] > monomethylarsonic acid [MMAs(V)] > dimethylarsinic acid [DMAs(V)]
> trimethylarsine oxide (TMAs(V)O), but the order of the root-to-shoot transport
index (Ti) is reverse. The volatilization of trimethylarsine (TMAs) from rice plants
is also observed when plants were treated with TMAs(V)O but not with As(V),
DMAs(V) and MMAs(V) (Jia et al. 2012). Lomax et al. (2012) has reported a latest
finding on the basis of GeoChip analysis of microbial genes in a Bangladeshi paddy
soil that plants are unable to methylate inorganic As, and instead take up methylated
As produced by microorganisms. Recently, specific accumulation patterns were ob-
served among growth habitat and plant groups, it was found that submerged plants
have a higher accumulation than emergent and terrestrial plants. Whereas ( Oryza
sativa) grown in multiple sites (Norton et al. 2012).
Once arsenic enters inside root cells, As(V) is quickly reduced to As(III) and
become complexed with phytochelatines. Phosphorus nutrition influences As(V)
uptake and toxicity in Gymnosperms had a high [As](shoot): [As](root) ratio (Bergqvist
2012). Statistically significant effect of year, location and flooding management
are also reported as an important factors to develop variation in grain arsenic
evaluated in a varied section of rice plants, whilst silicon has similar influences
382 I. Sharma
Fig. 13.1 Various forms of arsenic present in the environment. (Adapted from http: elements.
geoscienceworld.org)
on As(III). Phytotoxic effects commonly observed from As exposure includes

growth inhibition, chlorophyll degradation, nutrient depletion and oxidative stress
(Moreno-Jiménez et al. 2012). As(III) can react with sulphahydryl groups of en-
zymes and proteins, which lead to loss of function and can cause cell death. As(V)
can compete with phosphate, replacing it in key molecules, including ATP (Scott
et al. 1993; Meharg and Hartley-Whitaker 2002; Quaghebeur and Rengel 2003).
Exposure of plants to inorganic As leads to the synthesis of phytochelatins that
complex with As(III), those complexes or as alone, being transported across the
tonoplast by ABC-type transporters or can be efflux from the cytoplasm by As(III)
efflux transporters. Once arsenic enters in plant cell it causes various changes in
normal metabolic activities. The changes occur due to arsenic toxicity and also in
process to cope up from arsenic toxicity to some extent. But at higher concentration
of arsenic toxicity plants fails to counterbalance between toxicity and resistance.
Anatomical Changes in Plants Exposed to Arsenic
Arsenic causes many physiological changes and damages in plants (Wells and
Gilmor 1997). There are several anatomical parameters, in which reduction in
growth is the earliest As toxicity response. Arsenic affects root growth more se-
verely than shoot growth possibly due to the retention of As in the roots in higher
amount than in the stem. Stoeva et al. (2005) also reported that arsenic accumulated
mainly in the root system and to a lesser extent in the overgrown organs. This also
confirmed from the study of mung bean and Anadenanthera Peregrina (Pal et al.
2006; Gomes et al. 2012). There is however, contrasting reports showing that the
effect of arsenic on stem and root growth varies depending on the plant species,
level of contamination and plant tissue ability to As. Arsenic also inhibits fresh and
dry biomass accumulation (Wells and Gilmor 1997) which may be possibly due to
plant growth inhibition. From the study of mung bean it is also observed that reduc-
tion in root elongation is accompanied by the anatomical changes, which occurs on
exposure to arsenic toxicity (Pal et al. 2006). The anatomical changes are severe
decrease or completely loss of root hairs, damage to epidermal cells and the cortex,
with those cells losing their shape and showing signs of shriveling and disintegra-
tion while the untreated epidermal root cells are intact and the root hairs are turgid.
Further compared to the control roots, where the stele is in a tetrarch condition,
there is a lack of complete differentiation and pith formation in arsenic treated root
cells. Also, arsenic cause necrosis and reduction of the number of raminification in
root system (Stoeva et al. 2005). According to a study by Kopittke et al. (2012) the
accumulation of As causes permanent damage to the meristem but root border cells
accumulates high levels of As and limiting its movement into the root. When roots
are counteract with arsenic in soil environment a greater diffusion of oxygen from
the roots indicates increased root oxidizability (RO). This is considering as avoid-
ance from the toxicity. The TIC, salt used to measure RO, which absorbs electrons
from the mitochondrial transport chain and correlates positively with the respiratory
activity, in term associated with enhanced RO is also an indicator of higher reactive
oxygen species generation (Singh et al. 2007).
Besides roots, above ground part of plant is also affected by arsenic toxicity.
There is reduction in leaf area, necrosis and chlorosis of leaf tips are occurred on
arsenic toxicity (Stoeva et al. 2005). Arsenic also changes the osmotic adjustment
384 I. Sharma
of plant. The leaf water potential decreases while the relative water content (RWC)
slightly decreases in toxic condition. All these changes, collectively lead to the
changes in important physiological activities of plant like photosynthesis, transpira-
tion, stomatal conductance etc.
Arsenic causes a reduction in photosynthetic rate (Miteva and Merakchiyska
2002). The reduced photosynthetic rate can be due to the many factors like result of
disturbance in assembling of the pigment protein complex and thylakoid membrane.
Arsenic can release protein; lipid and element components of thylakoid membrane
indispensable for photosynthesis activity of proteins especially connected with the
water splitting system and of lipid, glactolipid probably connected with PSII are lib-
erated. Another reason for decreasing the photosynthesis rate could be disturbance
in the pigment apparatus. The photosynthesis pigments are some of the most impor-
tant internal factor which in certain cases is able to limit the photosynthesis rate. It
is believed that they are target of toxic As effect (Miteva and Merakchiyska 2002).
There is considerable decrease of chlorophyll and carotenoid contents on exposure
to arsenic (Stoeva et al. 2005). Also photosynthetic reactions are closely related
with stomata behavior, due to closure of stomata in stress condition, diminish or
cessation of CO2 uptake, by which photosynthetic rate also reduced (Biehler et al.
1996). The insufficient water supply in tissue may also induce photo inhibition,
which influence rate of electron transport. The transpiration processes also reduced
on exposure to arsenic probably is a result of the disturbed uptake and transport of
water, caused by the changes in root system. (Stoeva et al. 2005). As(V) affect cell
wall, primary and secondary metabolism, abscisic acid metabolism and germination
of the seedlings whereas, As(III) mainly affects hormonal and signaling processes
(Chakrabarty et al. 2009). Anarchy in mitotic and labeling index, mitotic arrays of
microtubules, increased percentage of metaphase and DNA fragmentation are also
observed in roots of Pisum sativum exposed arsenic (Faria et al. 2010).
Biochemical Changes in Plants Exposed to Arsenic
At biochemical level plants shows many changes during exposure to arsenic. Some
of the constituents are decreased due to toxicity of arsenic and some are increased to
combat from detrimental effects of toxicant. Arsenate acts as a phosphate analogue
and is transported across the plasma membrane via phosphate co-transport system
(Ullrich-Eberius et al. 1989). Once inside the cytoplasm it competes with phosphate
from several vital reactions like in the glycolysis (metabolism of glucose) the con-
version of 1, 3 bisphosphoglycerate to 3 phosphoglycerate, ATP molecule is formed
by using inorganic phosphate but in the toxicity of arsenic, arsenate competes with
phosphate and give l-arseno-3 phosphoglycerate which hydrolyses spontaneously
to 3 phosphoglycerate without forming ATP so deprives the cell from the energy
sources. Also arsenate can replace phosphate group from DNA causing disorganize
the structure of nucleic acid which effects directly to gene function. Similarly arse-
nite is a well known thiol reagent that combines rapidly with dithiol groups on pro-
Table 13.1 Enzymes affected by arsenic toxicity in plants

Mode of as toxicity Target enzyme References
Phosphate replacement F1-F0 ATP synthases Gresser (1981)
with arsenic
GDPH (glycolytic enzyme) Orsit and Cleland (1972)
Aspartate-β-semialdehyde Kish and Viola (1999)
dehydrogenase
Purine Nucleoside Phosphorylase Park and Agrawal (1972)
(PNP)
Binding with thiol groups Dihydrolipomide (Co-factor of pyru- Bergquist et al. (2009)
vate dehydrogenase complex (mt
PDC, pt PDC)
Gly decarboxylase complex (GDC) Peters et al. (1946)
Branched Chain 2-oxoaciddecarboxyl- Bergquist et al. (2009)
ase complex (BCOADC)
teins and act as an effective inhibitor of enzymes requiring free sulfahydryl groups
(Webb et al. 2003). Thus phosphate replacement and inactivation of enzymes by
binding with their thiol groups are the main modes of arsenic toxicity (Table 13.1).
Arsenic interferes with various events of respiratory cycle. Arsenite act as an
inhibitor of α-ketoglutrate dehydrogenase enzyme in TCA cycle, causing the accu-
mulation of substrate α-ketoglutrate and no product formation (succinyl Co-A). The
nutrient uptake is also affected due to arsenic toxicity. Phosphorus uptake decreases
with increasing arsenic concentration due to similarity with arsenate. Also uptake of
nitrate is reduced on exposure to arsenic. The uptake of nitrate and further assimila-
tion to ammonium is also altered, possibly due to interference of arsenic with the
involving enzymes, nitrate reductase and nitrite reductase (Table 13.2).
Arsenic Induced Oxidative Stress in Plants
There is significant evidence that exposure to inorganic arsenic species (ROS)

results in the generation of reactive oxygen species caused oxidative damages to
plants (Sharma 2012). This probably occurs through the conversion of arsenate
to arsenite, a process which readily occurs in plants. After this reduction, arsenic
may be potentially further metabolized to methylated species leading to further
oxidative stress (Zaman and Pardini 1996) because methylation is thought to be
redox driven and such reactions could give rise to reactive oxygen species (ROS).
However there is no sufficient evidence for methylation in higher plants but it can
be seen in the cell suspension of Cathranthus roseus (Cullen and Hettipathirana
1994) and in phosphate starved tomato plants (Nissen and Benson 1982). Also Wu
et al. (2002) has been shown in vitro methylation of arsenic in cell extracts from
bent grass ( Agrostis tenuis). These reactive oxygen species causes peroxidation of
lipid by reacting with lipid bilayer and thereby leading to membrane leakage. Lipid
peroxidation can be measured in terms of MDA content. An increase in MDA con-
Table 13.2 Alterations in some vital biochemical processes of the plants exposed to arsenic
386
Biochemical reaction Steps of the reaction Plant species References

altered by arsenic
Photosynthesis
Light reaction Decrease in chlorophyll content Alfalfa Porter and Sheridan (1981)
Oat Stoeva and Bineva (2003)
Pteris vittata Singh et al. (2006)
Rice Rahman et al. (2007)
Duck weed Duman et al. (2010)
Decrease in PS II activity Oat Stoeva and Bineva (2003)
By Decrease in electron flow from thylakoid membrane
Photophosphorylation Replacement of Pi with As in ATP Spinach Avron and Jagendorf (1959)
Pea Watling-Payne and Selwyn (1974)
Dark reaction Decrease the amount of Rubisco large subunit content Rice Ahsan et al. (2010)
AsIII inhibits the light activation of photosynthetic CO2 fixation Pea Marques and Anderson (1986)
Inhibition of maltose libration from starch by inhibiting amylo- Wheat Liu et al. (2005)
lytic activity
Substitution of Pi in glucose 1-Po4 by glucose 1-As(V) Pea Levi and Preiss (1978)
Decrease in glceraldehyde -3-Phosphate dehydrogenase activity Rice Ahsan et al. (2010)
Decrease in seduheptulose-1,7-bisphosphatase, malate dehydro- Pteris vittata Bona et al. (2010)
genase triose-phosphate isomerase, and a subunit of pyruvate
dehydrogenase
Photorespiration Inactivation of GDP, BCOADC, mt PDC, Pt PDC, OGDC Arabidopsis Chen et al. (2010)
complex
Activation of alternative photorespiration in chloroplast and Barley Amaranthus Wingler et al. (1999)
mitochondria edulis
Respiration
Glycolysis Decrease in glyceraldehyde -3-phosphate dehydrogenase Rice Ahsan et al. (2010)
activity
I. Sharma
Table 13.2 (Continued)
altered by arsenic
Replacement of 1,3 diphoshogyceric acid with 3-arseno glcerate Arabidopsis thaliana Abercrombie et al. (2008)
(uncoupling of ATP synthesis)
Rice Norton et al. (2008) and Chakrab-
arty et al. (2009)
Citric acid cycle As III blocks the enzymes mt PDC, OGDC, GDC,PDC and Potato Araújo et al. (2008)
block the respiration and its products
Disturbance in glycolytic and citric acid cycle metabolite pool Maize Requejo and Tena (2005)
by Increase in abundance of the succinyl-CoA synthetase α
subunit
Decrease activity of mt PDC resulting in 2-oxoglutarate and Arabidopsis thaliana Chen et al. (2010)
pyruvate metabolism
13 Arsenic Stress in Plants: An Inside Story
Loss of melate dehydrogenase and ATP synthase FAd subunit maize Requejo and Tena (2005)
Inhibition of dark respiration alfalfa Porter and Sheridan (1981)
Respiratory O2 consumption was more resistant to As V supply, Rice Marin et al. (1993)
than photosynthetic O2 evolution
AsV-dependent uncoupling of ATP synthesis and formation of Brassica oleracea L. Wickes and Wiskich (1975)
ADP-As V from electron transport chain Beta vulgaris L.
Failed to induce AOX transcripts during microarray studies Arabidopsis Abercrombie et al. (2008)
Rice Norton et al. (2008) and Chakrab-
arty et al. (2009)
A homolog to the Arabidopsis NDA1 alternative NAD (P) H Rice Chakrabarty et al. (2009)
dehydrogenase induced at the transcript level by both AsV
and AsIII
Mitochondrial substrate carrier protein dicarboxylate Arabidopsis Abercrombie et al. (2008)
carrier2(DIC2) get repressed
Decreased amount of mitochondrial ATP synthatase subunit Agrostis tenuis Duquesnoy et al. (2009)
387
Table 13.2 (Continued)
388

altered by arsenic
Nitrogen metabolism Symbiotic N2 fixation in legumes by Rhizobium Alfalfa Porter and Sheridan (1981)
Decrease the number of root nodules, root necrosis, root hair Medicago sativa Pajuelo et al. (2008)
damage, short length of root zone
Decreased amount of transcript for NO3 and NH4+ transporters Rice Norton et al. (2008)
Decrease in protein content Rice Dwivedi et al. (2010)
P. ensiformis Singh et al. (2006)
P. vittata Mascher et al. (2002)
Red clover maize Stoeva et al. (2005)
Sulfur metabolism Induction of GSH and PC biosynthesis Arabidopsis Muñoz-Bertomeu et al. (2009)
Decrease in cellular Cys pools Arabidopsis thaliana Sung et al. (2009)
I. Sharma
Fig. 13.2 Major plant physiological reactions severely affected by exposure to arsenic
tent indicates the occurrence of membrane damage due to peroxidation of polyun-

saturated fatty acids, resulting in the generation of ROS and subsequent oxidative
stress. There are several reports that confirm that MDA content increase on expo-
sure to arsenic (Stoeva et al. 2005; Srivastava et al. 2007).
The amount of soluble protein content is reduced in the arsenic toxicity. In the
study of Stoeva et al. (2005) oat root has been shown that protein content decreased
linearly on increasing the arsenic concentration which may be most probably a
result of the reduced anabolic or the accelerated catabolic processes. The protein
degradation to amino acids is in fact an adaptation of the cells to the carbohydrate
deficiency. On the other hand, the accelerated catabolism is probably due to the con-
siderable disturbance in the membrane systems, in response to metal phytotoxicity
(Fig. 13.2).
As well as different mechanisms of heavy metal toxicity, several defense
strategies related to metal tolerance in plants have also been well characterized.
Similarly plants have also several detoxification mechanisms related to arsenic
toxicity, these are suppression of high affinity arsenate/phosphate uptake systems,
reduction of arsenate to arsenite, chelation of arsenite to metal binding peptides,
induction of different antioxidant enzymes such as superoxide dismutase (SOD),
ascorbate peroxidase (APX), catalase (CAT), and nonenzymatic antioxidants like
glutathione, ascorbate, tochopherol etc., effluxation of arsenic from cytoplasm, and
390 I. Sharma
Fig. 13.3 Possible mechanism of arsenic induced oxidative stress and antioxidant defense system.
(Adopted from Sharma 2012)
finally sequestration of arsenic in vacuoles (Sharma et al. 2007). Increasing activ-

ity of Guaiacol peroxidase, Catalase, Ascorbate peroxidase contributes to high ac-
cumulation of the arsenic species by the plants (Srivastava et al. 2011). Similarly,
another non enzymatic antioxidant of glutathione-ascorbate cycle like ascorbate
(AsA) and dehydroascorbate (DAsA), were also analyzed in some plants during
As(V) exposure. As(V) treatment caused an increase in the ratio of AsA/DAsA in
P. vitatta, P. ensiformis, H. verticillata, and O. sativa (Singh et al. 2006; Srivastava
et al. 2011; Tripathi et al. 2012b) indicating the significant role of ascorbate in As
induced stress tolerance. Also Requejo and Tena (2005) confirmed that the level
of these enzyme increased because these are involved in cellular homeostasis for
redox perturbation by the study of proteome analysis in maize roots (Fig. 13.3).
Reduction of arsenate to arsenite is catalyzed by enzyme arsenate reductase,
it is also considered as a mechanism involved in detoxification because arsenite
can bind with phytochelatins. Arsenate reduction is coupled to NADP (NADPH)
oxidation via the reduction of oxidized glutathione by glutathione reductase (GR)
and with the resulting glutathione (GSH) serving as the electron donor for arsenate
reductase (Ellis et al. 2006).
The activity of arsenate reductase (AR) is well studied in yeast (Rosen 2002).
Root extracts from the arsenic hyperaccumulator fern Pteris vittata also show the
ability to reduce arsenate to arsenite by same enzyme; this reaction is similar to

yeast in terms of arsenate reduction, substrate specificity and sensitivity towards
inhibitors.
In the resistance mechanism of arsenic the level of phytochelatins is increased
because arsenite binds with phytochelatins. Phytochelatins are heavy metal bind-
ing peptides derived from glutathione (GSH) with the general structure (γ-glu-
cys)nGly. The biosynthesis of phytochelatins involves the transpeptidation of
γ-glutamyl-cysteinyl dipeptides from GSH by the action of constitutively expressed
phytochelatins synthetase (Grill et al. 1987). Recent studies have confirmed that
As(III) is complexed with phytochelatins in a range of terrestrial plant species, sug-
gesting that phytochelatins play an important role in decreasing the toxicity of ar-
senic in crops (Hartley-Whitaker et al. 2001; Zhang et al. 2012). Recently, Duana
et al. (2011) has suggest that PC complexation of arsenite in rice leaves reduces As
translocation from leaves to grains, and implicate that manipulation of PC synthesis
might mitigate As accumulation in rice grain. Similarly induced levels of PCs were
also observed in O. sativa (Tripathi et al. 2012a) under As stress.
Molecular Changes in Plants Exposed to Arsenic
There are several molecular responses by plants towards exposure to arsenic, due
to both arsenic toxicity and also due to arsenic tolerance. Arsenic affects the ex-
pression of many genes that are involved in various essential cellular processes
in plants. A number of genes involved in cell growth, cellular morphogenesis and
cell cycle are down regulated on exposure to arsenic. From the study of the rice
genome, two expansion genes (OsOlg14660 and Os04g46650), two tubulin genes
(Os03g45920 and Os03g56810), an actin gene (OsOlg64630) and two microtubule
genes (Os03g13460 and Os09g27700) which are involved in cell cycle and cell
growth are less expressed when exposed to arsenic at low concentration for long
term exposure (Norton et al. 2008). In As(V)-treated rice seedling, a triose-phos-
phate/Pi translocator gene was transcriptionally up-regulated (Chakrabarty et al.
2009). This protein would be expected to transport Pi and As(V) across the plastid
inner membrane in exchange for triose-phosphate. The effect of As exposure on
genome-wide expression was also examined in rice (Yu et al. 2012). An As tolerance
gene has been identified and mapped to chromosome 6 in rice (Tripathi et al. 2012a).
A signaling molecule Nitric oxide, was also found to be induced during As(V) stress
condition in A. thaliana (Leterrier et al. 2012).
The genes responsible for the expression of nutrient uptake transporters are re-
sponding differentially in arsenic toxicity. Norton et al. (2008) has also revealed that
genes for transporters of various nutrients differentially expressed in rice genome.
For phosphate, chloride, ammonium and nitrate transporters are down regulated
which possibly cause nutrient deficiency in plants while sulphate transporters are
up regulated, this is may be due to increased uptake of sulphur for the synthesis of
392 I. Sharma
glutathione which is precursor of phytochelatins because chelation capacity of a

plant is increased under metal toxicity (Cherian and Oliveira 2005). As previously
describes that As(III) is taken up by aquaporins, two genes for these aquaporins in
rice (Os05g14240 and Os12g10280) are also down regulated in the study of Norton
et al. (2008). It is also reported that lower expression of genes expression of PHT1
encoding phosphate transporters contributes to arsenic tolerance and accumulation
in shrub willow (Puckett et al. 2011). The differential expression pattern of sul-
phate transporters were observed after As(V) exposure (Kumar et al. 2011). Three
members of rice PIP subfamily of aquaporins have been recently reported to medi-
ate As(III) transport (Mosa et al. 2012). Overexpression of OsPIP2;4, OsPIP2;6,
and OsPIP2;7 proteins in Arabidopsis resulted in increased As(III) resistance (Ma-
ciaszczyk-Dziubinska et al. 2012).
By analyzing maize root proteome Requejo and Tena (2005) revealed that oxi-
dative stress is the main contributing factor to plant arsenic toxicity. They reported
that three superoxide dismutase, two glutathione peroxidase, one peroxidation and
one p-benzoquinone are up regulated and these are involved in cellular homeosta-
sis for redox perturbation. Conversely, recently by the study of rice genome very
surprising results came in which enzymes involved in detoxifying various reactive
oxygen species and free radicals, gives no response to low concentration of arsenic
for long term exposure (Norton et al. 2008). Only some of the Tau classes of GSTs
(Glutathione-S-transferase) showed remarkable changes in expression which was
only agreement with Mylona et al. (1998).
As part of arsenic detoxification, the majority of arsenate is reduced to arsenite
by the enzyme arsenate reductase (AR). Recently, AR genes have been identified
in plants, including Arabidopsis thaliana (AtAsr/AtACR2), Holcus lanatus (HI-
Asr) and Pteris vittata (PvACR2) (Dhankher et al. 2006; Bleeker et al. 2006; Ellis
et al. 2006). The Arabidopsis, fungal, protist ACR2 sequences show homology a
region within the CDC25 super family of protein tyrosine phosphatases (PTPase)
that also contains the conserved HCXs-R motif and also has similar catalytic ac-
tivity like arsenate reductase. The arsenic detoxification gene is well studied in
yeast in which three genes in cluster ACR1, ACR2, ACR3 are present for As toler-
ance. ACRI encodes a transcription factor, ACR2 encodes an arsenate reductase and
ACR3 encodes a plasma membrane As(III) efflux transporter (Ghosh et al. 1999;
Rosen 2002).
Many studies showed that alteration in the expression of arsenate reductase
genes leads to the more arsenic tolerance in plants. Dhankher et al. (2006) cloned
an Arsenate reductase gene from Arabidopsis thaliana (At ACR2) and silenced its
expression in root (because of it appears that in most plants, arsenite is sequestered
in roots, preventing it from moving up into stems, leaves and reproductive organs
but to enhance phytoremediation it should be stored in aboveground tissues) and
obtaining RNAi transgenics that accumulated 10–16 fold more arsenic in the shoots
and retained less root As compared with WT plants when grown in the presence of
low levels of As(V). However transgenic lines are more sensitive than WT plants
when exposed to high concentrations of As(V), probably because of the negative

effects of As(V) on phosphate metabolism. By contrast, Bleeker et al. (2006) found
that in Arabidopsis (equivalent to AtACR2) loss of function mutants are more As
sensitive than WT plants, even to low levels of As(V) and when they over expressed
AtASR the plant showed enhance tolerance to mildly toxic levels of As(V) to more
toxic As(III). Recently two arsenate reductase genes have been identified in rice
(OsArs 1, Oslog39860 and OsArs2, Os03g0 1770) (Duan et al. 2007). But interest-
ingly, besides their major role in arsenic detoxification these genes are not differ-
entially regulated on exposure to arsenic in the whole rice genome study (Norton
et al. 2008).
Further arsenite binds with phytochelatins as described earlier in respect to re-
ducing arsenic toxicity. Overexpression of genes involving in phytochelatins syn-
thesis, like phytochelatins synthatase, γ-glutamylcystein synthatase and glutathione
synthetase provides tolerance to arsenic toxicity. Li et al. (2004) overexpressed the
AtPCSI resulted in a substantial increase in arsenic resistance, with a 20–100 times
greater biomass in transgenic plants after exposure to arsenic, but led to Cd hy-
persensitivity. In contrasts in the study of Picault et al. (2006) overexpression of
cytoplasmic AtPCS 1 markedly increased tolerance in transgenic plants to arsenic,
whereas chloroplast-targeted overexpression of the same gene resulted in decreased
tolerance of transgenic plants to arsenic. This is may be due to the limiting supply of
essential metabolites such as cystein, γ-glutamylcystein and glutathione, which are
needed for the production of phytochelatins. Because of phytochelatins production
on exposure to arsenic leads to depletion of GSH, overexpression of components
involved in GSH biosynthesis, such as γ-glutamylcystein synthetase (γ ECS) and
glutathione synthetase (GS), will lead to increased tolerance to arsenic. Li et al.
(2005) overexpressed γ ECS in Arabidopsis thaliana and found a 3–20 fold greater
production of γ-glutamylcystein, glutathione and phytochelatins in plants exposed
to arsenic. These studies shows that the expression of all these genes play important
role in balance between toxicity and resistance to arsenic.
As part of the detoxification mechanism, Arsenic can be effluxed from the cy-
toplasm through As(III)-efflux transporters and can be sequestered in vacuoles by
ABC type transporters. The genes for these transporters are not well identified in
plants till now but it has homology to yeast. In yeast in ACR gene cluster, ACR3
gene encoded a plasma membrane As(III)-efflux transporter, for the removal of
cytosolic arsenic and an ABC type transporter, yeast cadmium factor (YCF I) is
located at the vacuolar membrane by which arsenic sequester in vacuoles (Rosen
2002). Ali et al. (2012) reported that heterologous expression of the yeast arsenite
efflux system ACR3 improves Arabidopsis thaliana tolerance to arsenic stress.
In general, the expression of genes that encode various transporters is higher in
hyperaccumulater plants than non-accumulators (Krammer 2005). By some stud-
ies it is confirm that by increase in the over expression of these transporters can
increase the tolerance of arsenic. Ellis et al. (2006) isolate and characterized arse-
nate reductase (PvACR2) and arsenite transporter (PvACR3) from pteris vittata that
394 I. Sharma
can suppress the arsenic sensitivity. The expression of PvACR3 in Pteris vittata is
rapidly increased within 24 h after exposure to arsenate. But to date, there is lack
of information regarding these type of transporters mediated arsenic detoxification
in higher plants and effect on their expression in arsenic toxicity. Little informa-
tion are present upon the expression of these transporter from the study of whole
genome analysis in rice that three genes with the predicted putative function of an
ABC transporter family protein (Os 04g49890, Os04g52900, and Os11g05700) is
up regulated in the arsenic toxicity. Phylogenetic analysis of these ABC transporters
gene sequences revealed that they are also MRP transporter. MRPs are a subclass
of that ATP-binding cassette (ABC) transporter, which are involved in the transport
of glutathione conjugated compounds into the vacuoles of plants (Rea et al. 1998).
And also a single gene with an annotated putative function of a glutathione conju-
gate transporter (Os04g 1321 0) is also upregulated on exposure to arsenic (Norton
et al. 2008).
A number of genes involved in N transport also appear to alter expression in
response to As. Amino acid transporters are down- regulated in response to As(V)
in roots and seedlings of rice (Norton et al. 2008; Chakrabarty et al. 2009). How-
ever, amino acid transporter gene transcript levels were not influenced by As(III)
(Chakrabarty et al. 2009). Peptide and oligopeptide transporters have also been re-
ported to be As(V) responsive in rice, but reports disagree on the direction (Norton
et al. 2008; Chakrabarty et al. 2009).
Arsenic is also known to interfere with sulfur metabolism. It is reported at mo-
lecular level that in As(V)-treated rice, up to five sulfate transporter genes are up-
regulated in roots (Norton et al. 2008), and at least one sulfate transporter is up-reg-
ulated in Arabidopsis (Sung et al. 2009). As(III) also induces a sulfate transporter
gene in rice and B. juncea seedlings (Chakrabarty et al. 2009). Although it is not yet
clear whether As(V) and As(III) influence the expression of these transporters in the
same way, but at least one of the transporter genes is induced by both forms of As
(Chakrabarty et al. 2009). During transfer of sulfate from soil to plant once sulfate
is reduced to sulfide, the sulfide is combined with O-acetylserine to form Cys in a
reaction catalyzed by O-acetylserine(thiol)-lyase also known as Cys synthase. It ap-
pears that As(V) and As(III) exposure may cause a down-regulation of (OAS-TL),
(OAS-TL)in As-sensitive plants. OAS-TL protein disappeared from maize shoots
exposed to As (Requejo and Tena 2006), while OAS-Tl activity was repressed in an
As-sensitive line of B. juncea (Srivastava et al. 2009).
Moreover, in rice, several methyl transferase genes are induced by As(V)-treat-
ment (Norton et al. 2008). Two of these are homocysteine S-methyltransferases,
which catalyze the formation of S-adenosyl-l-homocysteine and Met from S-ade-
nosylmethionine and l-homocysteine.The enzyme is involved in the synthesis of
S-methylmethionine (Ranocha et al. 2001), and may play a key role in maintaining
a pool of soluble Met, in the cycling of methyl groups within cells, or as a phloem-
mobile form of Met that can be used to translocate sulfur derived from protein
degradation (Bürstenbinder and Sauter 2012).
Arsenic contamination in food chain is challenging issue for researchers. Various

aspects of the study include biochemical, molecular, physiological and anatomi-
cal changes appeared in the plants as a result of arsenic exposure. Moreover, there
are new findings regarding methylation of inorganic arsenic, uptake mechanism
and accumulation of arsenic in plant. The role of transporters in uptake and vacu-
olar localization reveal that these processes are the key to understand As-resistance.
There is considerable knowledge gap regarding arsenic mediated hindrance in plant
physiological reactions, nutrient uptake, pathway of oxidative stress and effect on
crop yield. This basic information will be significant in phytoremediation studies
to eradicate the arsenic contamination from agricultural soil. We can acquire new
insight about arsenic and plant interaction by using molecular advances and sophis-
ticated analytical technologies. So, research should focus on combing physiology
and genetics to breed plants with low arsenic in edible plant parts and productivity.
Acknowledgements I thank to Professor Aditya Shastri, Director, Banasthali University for his
kind support and necessary facilities for carrying out the present study. The sincere cooperation
and support of my mentor Dr. Bhumi Nath Tripathi is also gratefully acknowledged. The work
was financially supported by Department of Science and Technology (DST), Govt. of India, New
Delhi, in the form of Women Scientist-A Scheme (WOS-A).
References
Abercrombie JM, Halfhill MD, Ranjan P, Rao MR, Saxton AM, Yuan JS, Stewart CNJr (2008)
Transcriptional responses of Arabidopsis thaliana plants to As(V) stress. BMC Plant Biol 8:87
Adriano DC (2001) Trace elements in the terrestrial environment. Springer, New York
Ahsan N, Lee DG, Kim KH, Alam I, Lee SH, Lee KW, Lee H, Lee BH (2010) Analysis of arsenic
stress-induced differentially expressed proteins in rice leaves by two-dimensional gel electro-
phoresis coupled with mass spectrometry. Chemosphere 78:224–231
Ali W, Isner JC, Isayenkov SV, Liu W, Zhao FJ, Maathuis FJM (2012) Heterologous expression
of the yeast arsenite efflux system ACR3 improves Arabidopsis thaliana tolerance to arsenic
stress. New Phytol 194:716–723
Araújo WL, Nunes-Nesi A, Trenkamp S, Bunik VI, Fernie AR (2008) Inhibition of 2-oxoglutarate
dehydrogenase in potato tuber suggests the enzyme is limiting for respiration and confirms its
importance in nitrogen assimilation. Plant Physiol 148:1782–1796
Avron M, Jagendorf A (1959) Evidence concerning the mechanism of adenosine triphosphate for-
mation by spinach chloroplasts. J Biol Chem 234:967–972
Azcue JM, Nriagu JO (1994) Arsenic: historical perspectives. In: Nriagu JO (ed) Arsenic in the
environment. Part I: cycling and characterization. John Wiley & Sons, New York, pp 1–15
Benton MA, Rager JE, Smeester L, Fry RC (2011) Comparative genomic analyses identify com-
mon molecular pathways modulated upon exposure to low doses of arsenic and cadmium.
BMC Genomics 12:173
Bergqvist C (2012) Arsenic accumulation and speciation in plants from different habitats. Appl
Geochem 27(3):615–622
Bergquist ER, Fischer RJ, Sugden KD, Martin BD (2009) Inhibition by methylated organo arseni-
cals of the respiratory 2-oxo-acid dehydrogenases. J Organomet Chem 694:973–980
396 I. Sharma
Biehler K, Migge A, Fock H (1996) The role the malate dehydrogenase in dissipating excess
energy under water stress in two wheat species. Photosynthetica 32:431–438
Bleeker PM, Hakvoort HWJ, Bliek M, Souer E, Schat H (2006) Enhanced arsenate reduction by a
CDC25-like tyrosine phosphatase explains increased phytochelatin accumulation in arsenate-
tolerant Holcus lanatus. Plant J 45:917–929
Bona E, Cattaneo C, Cesaro P, Marsano F, Lingua G, Cavaletto M, Berta G (2010) Proteomic
analysis of Pteris vittata fronds: two arbuscular mycorrhizal fungi differentially modulate
protein expression under arsenic contamination. Proteomics 10:3811–3834
Bürstenbinder K, Sauter M (2012) Early events in the ethylene biosynthetic pathway—regulation
of the pools of methionine and S-adenosylmethionine. In: McManus MT (ed) Annual plant
reviews, vol. 44. Wiley, Hoboken pp 19–52
Chakrabarty D, Trivedi PK, Misra P, Tiwari M, Shri M, Shukla D, Kumar S, Rai A, Pandey A, Ni-
gam D, Tripathi RD, Tuli R (2009) Comparative transcriptome analysis of arsenate and arsenite
stresses in rice seedlings. Chemosphere 74:688–702
Chen W, Chi Y, Taylor, NL, Lambers H, Finnegan PM (2010) Disruption of ptLPD1or ptLPD2,
genes that encode isoforms of the plastidial lipoamide dehydrogenase, confers arsenate hyper-
sensitivity in Arabidopsis. Plant Physiol 153:1385–1397
Cherian S, Oliveira MM (2005) Transgenic plants in phytoremediation: recent advances and new
possibilities. Environ Sci Technol 39:9377–9390
Cullen WR, Hettipathirana DI (1994) Application of whole cell NMR techniques to study the
interaction of arsenic compounds with Catharanthus roseus cell suspension cultures. Appl Or-
ganomet Chem 8:463–471
Dhankher OP, Rosen BP, McKinney EC, Meagher RB (2006) Hyperaccumulation of arsenic in
the shoots of Arabidopsis silenced for arsenate reductase (ACR2). Proc Natl Acad Sci USA
103:5413–5418
Duan G, Zhou Y, Tong Y, Mukhopadhyay R, Rosen BP, Zhu Y (2007) A CDC25 homologue from
rice functions as an arsenate reductase. New Phytol 174:311–321
Duana GL, Hu Y, Liu Wen-Ju, Kneer R, Zhao F-J, Zhu Y-G (2011) Evidence for a role of phyto-
chelatins in regulating arsenic accumulation in rice grain. Environ Exp Bot 71:416–421
Duman F, Ozturk F, Aydin Z (2010) Biological responses of duck weed ( Lemna minor L.) exposed
to the inorganic arsenic species As(III) and As(V): effects of concentration and duration of
exposure. Ecotoxicology 19:983–993
Duquesnoy I, Goupil P, Nadaud I, Branlard G, Piquet-Pissaloux A, Ledoigt G (2009) Identifica-
tion of Agrostis tenuis leaf proteins in response to As(V) and As(III) induced stress using a
proteomics approach. Plant Sci 176:206–213
Dwivedi S, Tripathi RD, Tripathi P, Kumar A, Dave R, Mishra S, Singh R, Sharma D, Rai UN,
Chakrabarty D, Trivedi PK, Adhikari B, Bag MK, Dhankher OP, Tuli R (2010) Arsenate ex-
posure affects amino acids, mineral nutrient status and antioxidants in rice( Oryza sativa L.)
genotypes. Environ Sci Technol 44:9542–9549
Ellis DR, Gumaelius L, Indriolo E, Pickering I, Banks JA, Salt DE (2006) A novel arsenate reduc-
tase from the arsenic hyperaccumulating Pteris vittata. Plant Physiol 141:1544–1554
Faria D, Wanda C, Mucciarelli M, Fusconi A, (2010) Arsenate toxicity on the apices of Pisum sati-
vum L. seedling root: effect on mitotic activity, chromatin integrity and microtubules. Environ
Exp Bot 69(1):17–23
Ghosh M, Shen J, Rosen BP (1999) Pathways of As(III) detoxification in Saccharomyces cerevi-
siae. Proc Natl Acad Sci USA 96:5001–5006
Gomes MP, Carvalho M, Marques TCLSáe Melo, Duarte DM, Nogueira COG, Soares AM, Garcia
QS (2012) Arsenic-sensitivity in Anadenanthera Peregrina eue to arsenic-induced lipid per-
oxidation. Int J Appl Sci Technol 2(2):55–63
Gresser MJ (1981) ADP-arsenate formation by submitochondrial particles under phosphorylating
conditions. J Biol Chem 256:5981–5983
Grill E, Winnacker EL, Zenk MH (1987) Phytochelatins a class of heavy-metal-binding peptides
from plants are functionally analogous to metallothioneins. Proc Natl Acad Sci USA 84:439–443
Hartley-Whitaker J, Ainsworth G, Meharg AA (2001) Copper and arsenate-induced oxidative

stress in Holcus lanatus L. clones with differential sensitivity. Plant Cell Environ 24:713–722
Jia Y, Huang H, Sun GX, Zhao FJ, Zhao FJ, Zhu YG (2012) Pathways and relative contributions to
arsenic volatilization from rice plants and paddy soil. Environ Sci Technol 46(15):8090–8096
Kish MM, Viola RE (1999) Oxy anion specificity of aspartate beta-semialdehyde dehydrogenase.
Inorg Chem 38:818–820
Kopittke PM, Jonge MD, Menzies NW, Peng W, Donner E, McKenna BA, Paterson D, Howard
DL, Lombi E (2012) Examination of the distribution of arsenic in hydrated and fresh cowpea
roots using two- and three-dimensional techniques. Plant Physiol 159(3):1149–1158
Krammer U (2005) Phytoremediation: novel approaches to cleaning up polluted soils. Curr Opin
Kumar S, Asif MH, Chakrabarty D, Tripathi RD, Trivedi PK (2011) Differential expression and
alternative splicing of rice sulphate transporter family members regulate sulphur status during
plant growth, development and stress conditions. Funct Integr Genomics 11:259–273
Leterrier M, Airaki M, Palma JM, Chaki M, Barroso JB, Corpas FJ (2012) Arsenic triggers the
nitric oxide (NO) and S-nitrosoglutathione (GSNO) metabolism in Arabidopsis. Environ Poll
166:136–143
Levi C, Preiss J (1978) Amylo pectin degradation in pea chloroplast extracts. Plant Physiol
61:218–220
Li Y, Dhankher OP, Carreira L, Lee D, Chen A, Schroeder JI, Balish RS, Meagher RB (2004)
Overexpression of phytochelatin synthase in Arabidopsis leads to enhanced arsenic tolerance
and cadmium hypersensitivity. Plant Cell Physiol 45:1787–1797
Li Y, Dhankher OP, Carreira L, Balish R, Meagher R (2005) Engineered overexpression of g-glu-
tamylcysteine synthetase in plants confers high level arsenic and mercury tolerance. Environ
Toxicol Chem 24:1376–1386
Liu X, Zhang S, Shan X, Zhu YG (2005) Toxicity of arsenate and arsenite on germination, seedling
growth and amylolytic activity of wheat. Chemosphere 61:293–301
Lomax C, Liu WJ, Wu L, Xue K, Xiong J, Zhou J, McGrath SP, Meharg AA, Miller AJ, Zho FJ
(2012) Methylated arsenic species in plants originate from soil microorganisms. New Phytol
193(3):665–672
Maciaszczyk-Dziubinska E, Wawrzycka D, Wysocki R (2012) Arsenic and antimony transporters
in eukaryotes. Int J Mol Sci 13(3):3527–3548
Marin AR, Masscheleyn PH, Patrick WH (1993) Soil redox-pH stability of arsenic species and its
influence on arsenic uptake by rice. Plant Soil 152:245–253
Marques IA, Anderson LE (1986) Effects of arsenite, sulfite, and sulfate on photosynthetic car-
bon metabolism in isolate pea ( Pisum sativum L.,cv Little Marvel) chloroplasts. Plant Physiol
82:488–493
Mascher R, Lippmann B, Holzinger S, Bergmann H (2002) Arsenate toxicity:effects on oxidative
stress response molecules and enzymes in red clover plants. Plant Sci 163:961–969
Matscullat J (2000) Arsenic in the geosphere-a review. Sci Total Environ 249:297–312
Meharg AA (2004) Arsenic in rice—understanding a new disaster for SouthEast Asia. Trends Plant
Sci 9:415–417
Meharg AA, Hartley-Whitaker J (2002) Arsenic uptake and metabolism in arsenic resistant and
non resistant plant species. New Phytol 154:29–43
Meharg AA, Jardine L (2003) Arsenite transport into paddy rice ( Oryza sativa) roots. New Phytol
157:39–44
Melanen M, Ekqvist M, Mukherjee AB, Aune la-Tapola L, Verta M, Salmikan gas T (1999)
Raskasmetallien päästöt ilmaan Suomes sa 1990)-luvulla. Suomen Ym päristö Suomen Ym
päristökeskus, Edita (distributor), Hel sin ki 329, 92 pp
Miteva E, Merakchiyska M (2002) Response of chloroplasts and photosynthetic mechanism of
bean plants to excess arsenic in soil. Bulg J Agric Sci 8:151–156
Moreno-Jiménez E, Esteban E, Penalosa JM (2012) The fate of arsenic in soil-plant systems. Rev
Environ Contam Toxicol 215:1–37
398 I. Sharma
Mosa KA, Kumar K, Chhikara S, McDermott J, Liu Z, Musante C, White JC, Dhankher OP (2012)
Members of rice plasma membrane intrinsic proteins subfamily are involved in arsenite perme-
ability and tolerance in plants. Transgenic Res. doi:.1007/s11248-012-9600-8.
Muñoz-Bertomeu J, Cascales-Miñana B, Mulet JM, Baroja-Fernández E, Pozueta-Romero J, Kuhn
JM, Segura J, Ros R (2009) Plastidial glyceraldehyde-3-phosphate dehydrogenase deficiency
leads to altered root development and affects the sugar and amino acid balance in Arabidopsis.
Mylona PV, Polidoros AN, Scandalios JG (1998) Modulation of antioxidant responses by arsenic
in maize. Free Radical Biol Med 25:576–585
Nissen P, Benson AA (1982) Arsenic metabolism in freshwater and terrestrial plants. Physiol Plan-
tarum 54:446–450
Norton GJ, Lou-Hing Daniel E, Meharg AA, Adam H (2008) Rice-arsenate interactions in hydro-
ponics: whole genome transcriptional analysis. J Exp Bot 59:2267–2276
Norton GJ, Pinson SR, Alexander J, McKay S, Hansen H, Duan GL, Rafiqul Islam M, Islam S,
Stroud JL, Zhao FJ, McGrath SP, Zhu YG, Lahner B, Yakubova E, Guerinot ML, Tarpley L,
Eizenga GC, Salt DE, Meharg AA, Price AH (2012) Variation in grain arsenic assessed in a
diverse panel of rice ( Oryza sativa) grown in multiple sites. New Phytol 193(3):650–664
Orsit BA, Cleland WW (1972) Inhibition and kinetic mechanism of rabbit muscle glyceraldehyde-
3-phosphate dehydrogenase. Biochemistry 11:102–109
Pajuelo E, Rodríguez-Llorente ID, Dary M, Palomares AJ (2008) Toxic effects of arsenic on Sino
rhizobiume-Medicago sativa symbiotic interaction. Environ Pollut 154:203–211
Pal M, Horvath E, Janda T, Paldi E, Szalai G (2006) Physiological changes and defence mecha-
nisms induce by cadmium stress in maize. J Plant Nutr Soil Sci 169:239–246
Panda SK, Upadhyay RK, Nath S (2009) Arsenic stress in plants. J Agron Crop Sci. doi: 10.1111/
j1439-037X.2009.00407.x
Park RE Jr, Agrawal RP (1972) Purine nucleoside phosphorylase. In: Boyer PD (ed) The enzymes.
Academic Press, New York, pp 483–514
Peters RA, Sinclair HM, Thompson RHS (1946) An analysis of the inhibition of pyruvate oxida-
tion by arsenicals in relation to the enzyme theory of vesication. Biochem J 40:516–524
Picault N et al (2006) Chloroplast targeting of phytochelatin synthase in Arabidopsis: effects on
heavy metal tolerance and accumulation. Biochimie 88:1743–1750
Porter JR, Sheridan RP (1981) Inhibition of nitrogen fixation in alfalfa by arsenate, heavy metals,
fluoride, and simulated acid rain. Plant Physiol 68:143–148
Puckett EE, Serapiglia MJ, DeLeon AM, Long S, Minochac R, Smart LB (2011) Differential
expression of genes encoding phosphate transporters contributes to arsenic tolerance and accu-
mulation in shrub willow (Salix spp.). Environ Exp Bot. doi:10.1016/j.envexpbot.2011.07.008
Quaghebeur M, Rengel Z (2003) The distribution of arsenate and arsenite in shoots and roots of
Holcus lanatus is influenced by arsenic tolerance and arsenate and phosphate supply. Plant
Physiol 132:1600–1609
Rahman MA, Hasegawa H, Rahman MM, Islam MN, Miah M AM, Tasmen A (2007) Effect of
arsenic on photosynthesis, growth and yield of five widely cultivated rice ( Oryza sativa L.)
varieties in Bangladesh. Chemosphere 67:1072–1079
Ranocha P, McNeil SD, Ziemak MJr, Li C, Tarczynski MC, Hanson Adb (2001) The S-methylme-
thionine cycle in angiosperms:ubiquity, antiquity and activity. Plant J 25:575–584
Rea PA, Li Z, Lu Y, Drozdowicz YM, Martinoia E (1998) From vacuolar GS-X pumps to multi
specific ABC transporters. Ann Rev Plant Biol 49:727–760
Requejo R, Tena M (2005) Proteome analysis of maize roots reveals that oxidative stress is a main
contributing factor to plant arsenic toxicity. Phytochemistry 66:1519–1528
Requejo R, Tena M (2006) Maize response to acute arsenic toxicity as revealed by proteome analy-
sis of plant shoots. Proteomics 6:156–162
Rosen, BP (2002) Biochemistry of arsenic detoxification. FEBS Lett 529:86–92
Scott N, Hatlelid KM, MacKenzie NE, Carter DE (1993) Reactions of arsenic(III) and arsenic(V)
species with glutathione. Chem Res Toxicol 6:102–106
Sharma I, Singh R, Tripathi BN (2007) Biochemistry of arsenic toxicity and tolerance in plants.
Biochem Cell Arch 7:165–170
Sharma I (2012) Arsenic induced oxidative stress in plants. Biologia 67(3):447–453
Singh HP, Batish DR, Kohali RK, Arora K (2007) Arsenic- induced root growth inhibition in
mung bean (Phaseolus aureus Roxb.) is due to oxidative stress resulting from enhanced lipid
peroxidation. Plant Growth Regul 53:65–73
Singh N, Ma LQ, Srivastava M, Rathinasabapathi B (2006) Metabolic adaptations to arsenic in-
duced oxidative stress in Pteris vittata L. and Pteris ensiformis L. Plant Sci 170:274–282
Srivastava S, Mishra S, Trtpathi RD, Dwivedi S, Trivedi PK, Tandon PK (2007) Phytochelatins
and antioxidant systems respond differentially during arsenite and arsenate stress in Hydrilla
verticillata (L.f.) Royle. Environ Sci Technol 41:2930–2936
Srivastava S, Srivastava AK, Suprasanna P, D’Souza SF (2009) Comparative biochemical and
transcriptional profiling of two contrasting varieties of Brassica juncea L. in response to arse-
nic exposure reveals mechanisms of stress perception and tolerance. J Exp Bot 60:3419–3431
Srivastava S, Shrivastava M, Suprasanna P, Souza SFD (2011) Phytofiltration of arsenic from simu-
lated contaminated water using Hydrilla verticillata in field conditions. Ecol Eng 37:1937–1941
Stoeva N, Berova M, Zlaten Z (2005) Effect of arsenic on some physiological parameters in bean
plants. Biologia Plantarum 49:293–296
Stoeva N, Bineva T (2003) Oxidative changes and photosynthesis in oat plants grown in As-con-
taminated soil. Bulg J Plant Physiol 29:87–95
Sultana R, Katsuichiro K (2011) Potential of barnyard grass to remediate arsenic-contaminated
soil. Weed Biol Manag 11:12–17
Sung DY, Kim TH, Komives EA, Mendoza-Cózatl DG, Schroeder JI (2009) ARS5 is a component
of the 26S proteasome complex, and negatively regulates thiol biosynthesis and arsenic toler-
ance in Arabidopsis. Plant J 59:802–812
Takamatsu T, Aoki H, Yoshida T (1982) Determination of arsenate, arsenite, monomethylarsonate,
and dimethylarsinate in soil polluted with arsenic. Soil Sci 133:239–246
Tangahu BV, Abdullah SRS, Basri H, Idris M, Anuar N, Mukhlisin M (2011) A review on heavy met-
als (As, Pb, and Hg) uptake by plants through phytoremediation. Int J Chem Eng 939161:1–31
Tripathi RD, Tripathi P, Dwivedi S, Dubey S, Chatterjee S, Chakrabarty D, Trivedi PK (2012a)
Arsenomics: omics of arsenic metabolism in plants. Front Physiol 3(275):1
Tripathi P, Mishra A, Dwivedi S, Chakrabarty D, Trivedi PK, Singh RP, Tripathi RD (2012b) Dif-
ferential response of oxidative stress and thiol metabolism in contrasting rice genotypes for
arsenic tolerance. Ecotoxicol Environ Saf 79:189–198
Tuli R, Chakrabarty D, Trivedi PK and Tripathi RD (2010) Recent advances in arsenic accumula-
tion and metabolism in rice. Mol Breed 26:307–323
Ullrich-Eberius CI, Sanz A, Novacky AJ (1989) Evaluation of arsenate and vanadate-associated
changes of electrical membrane potential and phosphate transport in Lemna gibba G I. J Exp
Bot 40:119–128
Watling-Payne AS, Selwyn MJ (1974) Inhibition and uncoupling of photophosphorylation in iso-
lated chloroplasts by organotin, organomercury and diphenyleneiodonium compounds. Bio-
chem J 142:65–74
Webb S.M, Gaillard JF, Ma LQ, Tu C (2003) XAS speciation of arsenic in a hyperaccumulating
fern. Environ Sci Technol 37:754–760
Wells BR, Gilmor J (1997) Sterility in rice cultivars as influenced by MSMA rate and water man-
agement. Agron J 69:451–454
WHO (2002) United Nations synthesis report on arsenic in drinking water. http://www.who.int/
water_sanitation_health/Arsenic/ArsenicUNRep6. Accessed 01 July 2002
WHO (2008) Guidelines for drinking-water quality, 3rd edition incorporating 1st and 2nd
addenda,vol. 1. Recommendations. World Health Organization, Geneva, pp 306–308b.
http:// www.who.int/water_sanitation_health/dwq/GDW12rev1and2.pdf. Accessed 10 Oct 2012
Wickes WA, Wiskich JT (1975) Arsenate uncoupling of oxidative phosphorylation in isolated
plant mitochondria. Aust J Plant Physiol 3:153–162
400 I. Sharma
Wingler A, Lea PJ, Leegood RC (1999) Photorespiratory metabolism of glyoxylate and formate in
glycine-accumulating mutants of barley and Amaranthus edulis. Planta 207:518–526.
Wu C, Ye Z, Shu W, Zhu Y, Wong M (2011) Arsenic accumulation and speciation in rice are af-
fected by root aeration and variation of genotypes. J Exp Bot 1–10. doi:10.1093/jxb/erq462
Wu JH, Zhang R, Lilley RM (2002) Methylation of arsenic in vitro by cell extract from bentgrass
(Agrostis tenuis): effect of acute exposure of plants to arsenate. Funct Plant Biol 29:73–80
Yu LJ, LuoYF, Liao B, Xie LJ, Chen L, Xiao S, Li JT, Hu SN, Shu WS (2012) Comparative tran-
scriptome analysis of transporters, phytohormone and lipid metabolism path ways in response
to arsenic stress in rice (Oryzasativa). New Phytol 195:97–112
Zaman K, Pardini RS (1996) An overview of the relationship between oxidative stress and mer-
cury and arsenic. Toxic Subst Mech 15:151–181
Zhang X, Uroic MK, Xie WY, Zhu YG, Chen BD, McGrath SP, Feldmann J, Zhao FJ (2012)
Phytochelatins play a key role in arsenic accumulation and tolerance in the aquatic macrophyte
Wolffia globosa. Environ Pollut 165:18–24
Chapter 14
In vitro Production of Secondary Metabolites
Using Elicitor in Catharanthus roseus:
A Case Study
Zahid Hameed Siddiqui, Abdul Mujib, Mahmooduzzafar, Junaid Aslam,

Khalid Rehman Hakeem and Talat Parween
Abstract Secondary metabolites are mainly derived from plants and are used by
humans from time immemorial. A plant cell, tissue, and organ culture has an inher-
ent capacity to manufacture valuable chemical compounds as the parent plant does
in nature. In vitro plant materials are one of the good sources for the production
of secondary metabolite and elicitation can be used as one of the important tool
in order to improve the synthesis of these compounds. In a variety of plant cell
cultures, elicitors have increased production of terpenoid indole alkaloids, isoflavo-
noid phytoalexins, serquiterpenoid phytoalexin, coumarins etc. Although elicitation
has been carried out in large number of medicinal plants, we extensively studied it
in Catharanthus roseus, because it is an important source of anticancer compounds
Vinblastine (VLB) and Vincristine (VCR). The use of elicitor is also important in
order to meet the market demands, for reducing production costs and for in-depth
investigation of biochemical and metabolic pathways. This information helps us
in manipulation of biosynthetic pathways which can be used as a powerful tool to
make natural product-like compounds.
Z. H. Siddiqui ()
Department of Botany, Zakir Husain Delhi College, University of Delhi,
Jawahar Lal Nehru Marg, New Delhi 110002, India
A. Mujib · Mahmooduzzafar
Department of Botany, Hamdard University, New Delhi 110062, India
Mahmooduzzafar
J. Aslam
Department of Biotechnology, Hamdard University, New Delhi 110062, India
K. R. Hakeem
T. Parween
Department of Bioscience, Jamia Millia Islamia, New Delhi 110025, India

402 Z. H. Siddiqui et al.
Introduction
Plants with medicinal properties (secondary metabolites) have been used by humans
to treat infections, health disorders, and illness since the early days of mankind
(Lovkova et al. 2001; Wyk and Wink 2004; Toso 2010). Plants and plant cell cul-
tures have served as resources for flavours (food additives), aromas and fragrances,
cosmetics (cosmeceuticals), biobased fuels, insecticides, perfumes, fine chemicals
and bioactive compounds (Balandrin and Klocke 1988) and are collectively known
as secondary metabolites. These compounds are also well known to play a key
role in the adjustment of plants to their surroundings (Rao and Ravishankar 2002).
During the last 50 years research work on plant secondary metabolites has been
increasing because the daily lives including health care are essentially depends on
these plant products (Mulabagal and Tsay 2004). Therefore, in order to achieve the
market demand, cultivation of medicinal plants and in vitro production of plant
secondary metabolites are the only sustainable ways.
Plant cell, tissue, and organ cultures has an inherent capacity to manufacture
valuable chemical compounds as the parent plant does in nature which has been
recognized since the commencement of in vitro technology. In vitro plant materials
are one of the good sources for the production of secondary metabolite and also pro-
vide an excellent environment for in-depth investigation of biochemical and meta-
bolic pathways (Mulabagal and Tsay 2004; Karuppusamy 2009). In vitro studies
including plant tissues and suspension cultures are continued in diverse directions
for the commercial production of secondary metabolites (Ramawat and Merillon
2007; Ghorpade et al. 2011). The accumulation of secondary compounds during
plant cell cultures varies significantly due to the elements of the culture medium
and environmental conditions (Stafford et al. 1986). Various efforts have been made
to circumvent these biological and technological limitations (Lee and Shuler 1991).
Robins (1994) reported different strategies in order to improve the synthesis of sec-
ondary metabolites in suspension cultures. Different media have been employed for
different species and the use of biotic and abiotic elicitors has also been engaged
because of their strong and rapid improving effects on indole alkaloid synthesis
(Moreno et al 1995). There are many reports of cell culture in which secondary
metabolites has been produced, such as solasodine production from calli of Sola-
num eleagnifolium and from root cultures of Senecio production of pyrrolizidine
alkaloids (Nigra et al. 1987; Toppel et al. 1987) and production of anthraquinones
in cell cultures of Rubia tinctorum(Abd El-Mawla 2012). Jha et al. (1988) separated
cephaelin and emetine from callus cultures of Cephaelis ipecacuanha and quinoline
alkaloids in considerable amount was separated from Cinchona ledgeriana cell sus-
pension cultures (Scragg et al. 1992). In C. roseus, Zhao et al. (2001e) reported en-
hanced alkaloid biosynthesis in suspension culture, Ravishankar and Grewal (1991)
reported production of diosgenin in callus culture of Dioscorea deltoidea by assess-
ing the effect of media constituents and nutrient stress. Cardenolides biosynthesis
was noted to be maximum in the hairy root culture of Digitalis lanata as compared
to leaf (Pradel et al. 1997) and in vitro synthesis of azadirachtin and nimbin was less
14 In vitro Production of Secondary Metabolites Using Elicitor in Catharanthus roseus … 403
in field grown plant as compared to cultured shoots and roots of Azadirachta indica
(Srividya and Devi 1998). It has also been found that because of the source and the
type of explants lepidine content in Lepidium sativum vary considerably (Pande
et al. 2002). It shows that biosynthetic efficiency of populations varies; therefore
we should select a high yielding variety as a starting material (Tripathi and Tripathi
2003). The basic prerequisite in all this is a good yield of the compound, and cheap
cost compared to the natural synthesis by the plants.
Elicitation can be used as one of the important strategy in order to get better pro-
ductivity of the bioactive secondary products (Chong et al. 2005; Smetanska 2008;
Sharma et al. 2011; Hussain et al. 2012) and reducing production costs (Miao et al.
2000; Zhang et al. 2003). There are reports where elicitors have increased produc-
tion of isoflavonoid phytoalexins (Smith and Banks 1986), serquiterpenoid phyto-
alexin (Threlfall and Whitehead 1988), coumarins (Hamerski et al. 1990), podo-
phyllotoxin (Muranaka et al. 1992), azadirachtin (Prakash and Srivastava 2008),
terpenoids (Gao et al. 2011), hypericins (hypericin and pseudohypericin) and hyper-
forin (Coste et al. 2011), capsaicinoid (Gururaj et al. 2012), tanshinone (Kai et al.
2012), vascicine (Bhambhani et al. 2012) and resistance to pathogens (Benhamou
et al. 2001). Mihai et al. (2011) reported that biotic and abiotic elicitors stimulate
biosynthesis and increase of resveratrol in Vitis vinifera callus cultures. Ahmed et al.
(2012) reported that different concentration fungal extract ( Aspergillus niger and
Penicillium notatum), yeast extract and chitosan enhance the synthesis of psoralen
in Psoralea corylifolia suspension cultures.
The other side of the elicitation has also been used to elucidate the complex
metabolic pathways (Moreno et al. 1996), to characterize the interaction between
biotic and abiotic stress responses at a molecular level (Atkinson and Urwin 2012).
There are also studies which have been published to mark the effects of elicitors on
enzymes of secondary metabolism (Zenk 1991), important signal molecules that
mediate plant resistance reactions (Gao et al. 2012; Bux et al. 2012), oxidative burst
(Davis et al. 1993) phytoalexin signal transduction (Preisig 1994) and anion chan-
nels (Zimmermann et al. 1998). Beside that elicitors can be used to study the chemi-
cal nature and signaling pathways of natural substances discharged by microbes,
herbivores, and plants during pathogenic contamination, herbivory, symbiosis and
allelopathic interactions (El- Samra et al. 2011; Maffei et al. 2012).
Elicitors and Elicitation
Earlier the term elicitor was used for molecules, which induced the production of
phytoalexins, but it is now simplified as a compound which promotes various kinds
of plant defense system (Hahn 1996; Nürnberger 1999). Further an elicitor may also
be defined as a material which, instigate or advances the biosynthesis of specific
compounds when added in small amount to a living cell system. In this way elicita-
tion can be explained as the stimulated or improved biosynthesis of compounds due
to addition of trace amounts of elicitors (Radman et al 2003, Angelova et al. 2006).
On the basis of their origin, structure and type, elicitors can be classified as biotic
and abiotic (Eilert 1987; Barz et al. 1988). There is one more benefit of the use
of elicitors is that they also encourage release of the metabolites into the medium
(Pitta-Alvarez et al. 2000).
Biotic Elicitors
These are chemically complex biological compounds with unknown composition

like microbial cell-wall preparations and yeast extract. In some cases, and particu-
larly in recent years, elicitors with known chemical structure have been selected
which helped in more detailed investigation of the elicitation process. Carbohy-
drates and proteins are examples of such defined elicitors (Radman et al. 2003).
Different workers further classified these substances on the basis of their similarity.
Material from living organisms include different polysaccharides from plant cell
walls (pectin or cellulose) and microbial extracts (chitin or glucans) and glycopro-
teins (Eilert 1987; Nishi 1994; Benhamou 1996; Shirsau et al. 1997); phytoalexins:
which are low-molecular-mass antimicrobial secondary compounds synthesized by
plants in reaction of fungal or bacterial attack and physical damage. Protein kinase:
regulate growth and cellular development by phosphorylating a number of target
proteins; calmodulin: intracellular Ca2 + -binding proteins consisting of at least two
different peptides, with four Ca2 + binding sites; calmodulin has no enzyme activity
of its own, but acts by binding to other proteins (Radman et al 2003, Angelova et al.
2006). Recently Siddiqui et al. (2010) described fungal elicitor as a potent approach
for enhancing secondary metabolites in cultured cells.
Abiotic Elicitors
As compared to biotic elicitors the use of abiotic elicitors in plant cell cultures
has received less interest (Radman et al 2003, Angelova et al. 2006). Abiotic elici-
tor or stress agents are non-biological substances which includes different kinds of
inorganic salts and physical factors like UV radiation, heavy metal salts (Cu and
Cd ions), Ca2 + , high pH and other chemical compounds with diverse mechanism of
action (Eilert 1987; Radman et al 2003). Recently Zuccarini (2009) reviewed ozone
as a fungal elicitor. Addition of AgNO3 and CdCl2 to the cultures of Brugmansia
candida (angel’s trumpet) enhanced significantly the accumulation and release of
these alkaloids, but CdCl2 inhibited the growth of the hairy roots (Pitta-Alvarez
et al. 2000). Wu et al. (2001) investigated the synthesis of taxol in cell cultures
of Taxus sp. under the influence of the rare-earth metal lanthanum and reported
a considerable augmentation (280 %) of taxol. Although elicitation has been car-
ried out in large number of medicinal plants but for this chapter we extensively
studied it in C. roseus. There is a great importance of this plant as it is an important
source of anticancer compounds with activity against various kinds of carcinoma

(Svoboda and Blake 1975; Schmeller and Wink 1998) along with it also houses
a large number of Terpenoid indole alkaloids (TIAs) (Svoboda and Blake 1975;
Van der Heijden et al. 1989; 2004), which possess pharmacological activity against
different other diseases. The aerial parts of the plant contain 0.2–1 % alkaloids
(Bruneton 1993). About 130 alkaloids have been isolated from C. roseus, of par-
ticular interest is a group of 20 dimeric alkaloids (Evans 1996). However of this
large number of chemical compounds, only few (~ 11) are regularly investigated
and even lesser (~ 8) are commercially available (Hisiger and Jolicoeur 2007). VCR
and VLB are two most important alkaloids which can be found in C. roseus and are
known for their antineoplastic activity. Ajmalicine and serpentine are the antihyper-
tensive agents (Shanks et al. 1998), used to combat heart arrhythmias and improves
the blood circulation in the brain (Moreno et al. 1995; Schmeller and Wink 1998).
Other alkaloidal fractions from the leaves including vindoline are antibacterial in
nature. Pericalline, perivine, VLB, VCR, carosine etc. show antiviral activity in vi-
tro against vaccinia and polio type III viruses with pericalline being the most effec-
tive. Vincolidine, lochrovicine, catharanthine and vindoline shows diuretic activity.
In different Indian system of medicine it is used as an antidiabetic agent (Singh et al.
2001), catharanthine, leurosine, lochnerine, tetrahydroalstonine, vindolineproduce
varying degrees of lowering of blood sugar in rats. An alkaloidal mixture obtained
from flowers showed significant hypoglycaemic activity in rabbits (Wealth of India
1992). Velban® is a trade name for Vinblastine sulphate and is employed mainly
for the treatment of Hodgkin’s disease in addition lymphosarcoma, choricarcinoma
and carcinoma of the lungs, breast and other organs in acute and chronic leukemia.
Oncovin® sold as Vincristine sulphate, arrests mitosis in metaphase and is very suc-
cessful for the treatment of acute leukemia in children and lymphocytic leukemia.
It is also administered against Hodgkin’s disease, Wilm’s tumour, rhabdosarcoma,
reticulum cell sarcoma and neuroblastoma. VCR is superior to VLB in the treat-
ment of lymphosarcoma and has greater toxicity (Wealth of India 1992). In terms of
production of VLB and VCR, India ranks third in the world and is exporting these
alkaloids to European countries. High demand and low yield of these alkaloids in
the plant has led to research for alternative means for their production.
Elicitation of C. roseus
The use of a variety of biotic and abiotic elicitors or signal molecules in cell cultures
frequently increases the yield of certain secondary compounds, perhaps due to their
role in defense (Zhao and Verpoorte 2007; Aijaz et al. 2011). The biosynthesis of
secondary metabolites in C. roseus cell cultures was lucidly reviewed by Moreno
et al. (1995) and important factors affecting the production of indole alkaloids were
discussed. Further Moreno et al. (1996) studied the suspension cultures of C. roseus
cell under the influence of fungal filtrate of Phytium aphanidermatum as an elici-
tor. Although there was no enhancement in alkaloid synthesis was observed but the
authors studied the result of elicitation on different metabolic pathways and summa-
rized that the biosynthesis of phenolics and the pathway to tryptamine are the two
important fluxes of intermediates in C. roseus cell cultures. There are reports which
suggest that indole alkaloids production is also affected by abiotic stresses of sorbi-
tol and mannitol (osmotic stress) whereas NaCl and KCl were employed to create
salt stress (Moreno et al. 1995; Zhao et al. 2000b). Zhao et al. (2000a) employed
metal stress with the help of vanadyl sulphate, sodium orthovanadate and some rare
earth elements whereas (Zhao et al. 2000c; 2001c) stimulated with various chemi-
cals. Fungal elicitors and hormones were used by (Namdeo et al. 2000; Zhao et al.
2001d; El-Sayed and Verpoorte 2004). Thus elicitation of C. roseus cell cultures not
only enhances indole alkaloid biosynthesis in short time, but it is also responsible
for the excretion of the products into the medium (Zhao and Verpoorte 2007).
Rijhwani and Shanks (1998) reported the effects of pectinase and methyl jasmo-
nate elicitor on growth and levels of several alkaloids in C. roseus. When pectinase
(72 units) was added about 150 % increase in tabersonine was observed whereas
due to addition of jasmonic acid (JA) a progressive increase of 60, 80, 150 and
500 % was observed respectively in serpentine, ajmalicine, lochnericine hörham-
mericine. The production of ajmalicine or catharanthine in cell suspension cultures
of C. roseus was enhanced by cerium (CeO2 and CeCl3), yttrium (Y2O3) and neo-
dymium (NdCl3). The yield of ajmalicine in these treated-cultures reached 51 mg/l
(CeO2), 40 mg/l (CeCl3), 41 mg/l (Y2O3) and 49 mg/l (NdCl3) while catharanthine
production reached to 36 mg/l (CeO2) and 31 mg/l (CeCl3). In these treatments a
main part of improved alkaloids was released into medium (Zhao et al. 2000a).
When 14–1 bioreactor was compared with shake flask culture of C. roseus cell
line a 80 % decrease in total alkaloid production was observed, but in the same cul-
ture when 1 mM trans-cinnamic acid was added the original alkaloid amounts was
restored (Godoy-Hernandez et al. 2000). Zhao et al. (2001b) reported that indole
alkaloid biosynthesis in C. roseus cell cultures due to the action of elicitor is asso-
ciated to Ca2 + influx and the oxidative burst and up to some extent indole alkaloid
accumulation was inhibited by calcium channel blockers which could be improved
by re-addition of calcium chloride.
In C. roseus cell suspension culture Zhao et al. (2001a, b) employed biotic
elicitors derived from 12 fungi in order to test their effect on indole alkaloid pro-
duction. They reported that different indole alkaloids were stimulated by different
fungal mycelium homogenates and an improvement (2–5-fold high than control)
in alkaloid synthesis was observed. Ten Hoopen et al. (2002) marked the effect of
temperature on growth and ajmalicine production and reported that 27.50 C was
optimum temperature for biomass and secondary metabolite production. In shake
flasks and bioreactors an improved catharanthine synthesis in C. roseus cell cultures
was observed by combined elicitor treatment (Zhao et al. 2001a). A combination
of fungal preparations and chemicals enhanced the alkaloid accumulation, a high-
est yield of ajmalicine with an enhanced catharanthine accumulation was observed
in a combination of tetramethyl ammonium bromide and mycelial homogenate of
Aspergillum niger. The combination of malate and sodium alginate proved to be
beneficial for the highest yield of catharnthine with a high yield of ajmalicine pro-
duction. Later the process was optimized and refined by the authors (Zhao et al.
2001b), after 10 days of C. roseus cells in shake flasks and in bioreactor they re-
ported 25 mg/l, 32 mg/l and 22 mg/l catharanthine yields in 500 ml flasks, 1,000 ml
flasks and in 20 l airlift bioreactor, respectively. The defense responses, such as lipid
peroxidation was believed to be stimulated by the combination of malate and algi-
nate treatment in all C. roseus culture processes which further mediate the catharan-
thine production via the jasmonate pathway. El-Sayed and Verpoorte (2002) tested
2, 4-D and abscisic acid (phytohormones), salicylic acid (SA) and MJ on growth
and accumulation of secondary metabolites in C. roseus cell suspension culture
upon feeding with the precursors loganin and tryptamine. Among the tested treat-
ments only MJ enhanced the accumulation of alkaloids whereas due to addition of
abscisic acid catabolism of strictosidine was delayed.
Zheng and Wu (2004) treated the C. roseus cell with different Cadmium (Cd)
concentration (0.05 to 0.4mM) and ajmalicine yield was monitored. They reported
that due to Cd treatment a higher yield of ajmalicine was recorded because of the in-
creased level of tryptophan decarboxylase (Tdc) transcript, the cellular tryptamine
concentration, and ajmalicine excretion. The effect of different elements namely Co,
Zn, Ni, Mn, Cr, W, Cu, B, V, Fe, and Mo and various hormones including natural
and synthetic auxins, cytokinins, and gibberellin on the production and accumula-
tion of indole alkaloids in C. roseus was investigated (Lovkova et al. 2005) studied.
These compounds modified different phases in the biosynthesis of catharanthine
and vindoline and up to a certain extent a feasible mechanism of the effect of Zn and
auxin on this process were simplified. In C. roseus cell suspension cultures indole
alkaloid production through a protein kinase-dependent signal pathway was stimu-
lated using nitric oxide (Xu and Dong 2005) whereas CaCl2 enhanced MJ-induced
ajmalicine production in C. roseus (Lee-parson and Ertürk 2005). About 160 % in-
crease in ajmalicine production was noted in C. roseus cultures and the synthesis
depends on intracellular Ca2 + concentration. When Ca2 + influx was increased after
a certain level by the addition of extracellular Ca2 + , ajmalicine production was de-
clined, similarly a decrease in the accumulation of alkaloids was noted down when
Ca2 + influx was dropped off.
For the production of ajmalicine in C. roseus cultures different strategies of op-
timizing gas compositions were used (Lee-Parsons 2007). Guo et al. (2007) con-
ducted an experiment to study the effect of various temperatures on variation of
alkaloid metabolism in C. roseus seedlings. The authors observed that with relation
to the treatment time, at high temperature biosynthesis of different alkaloids were
elevated in C. roseus seedlings. In C. roseus cell suspension culture a low dose of
UV-B irradiation was applied (Ramani and Jayabaskaran 2007), which stimulated
the transcription of genes encoding tryptophan decarboxylase ( Tdc) and strictosi-
dine synthetase (Str) and induced enhanced amount of catharanthine. In another ex-
periment Ramani and Chelliah (2008) evaluated the influence of UV-B treatment on
cell suspension culture of C. roseus in different growth phase. The results suggested
that in stationary phase cultures the response to UV-B irradiation was more than the
late exponential phase. There was a 3 and 12-fold enhancement in catharanthine and
vindoline respectively. An efficient and promising protocol for achievement and
enhancement of anthocyanin production from calli cultures of C. roseus was de-

veloped by Taha et al. (2008). The highest values 78.73 μg/gm of total anthocyanin
production were recorded with Catharanthus calli cultures, when the MS medium
was amended with 3 and 0.5 μM of L-phenylalanine and CaCl2 respectively.
Binder et al. (2009) recorded a considerable enhancement in the production of
TIAs on C. roseus hairy roots by exposing UV-B light. Alkaloid concentrations
were analyzed up to 168 h after UV-B exposure that shows a considerable increase
in the accumulation of lochnericine and considerable decrease in the accumulation
of hörhammericine over time. In in vitro cell suspension, rootless shoot cultures and
hairy roots of C. roseus effects of different abiotic agents like SA, ethylene and MJ
on alkaloid accumulation was described (Vázquez-Flota et al. 2009). Jasmonate and
ethylene treatments promoted ajmalicine accumulation; catharanthine and ajmali-
cine were stimulated by jasmonate in hairy roots, catharanthine accumulation was
only induced by ethylene. In shoot cultures a positive vindoline accumulation was
noticed under the influence of jasmonate and ethylene whereas in any of the studied
in vitro culture systems, SA did not spot any effect. Ruiz-May et al. (2009) noted
enhanced accumulation of alkaloids (ajmalicine, serpentine, ajmaline and cathar-
anthine) in C. roseus hairy roots with different concentrations of MJ elicitation.
Senoussi et al. (2009) reported that the lack of oxygenation in the culture medium
provoked a very strong inhibition in accumulation of alkaloids and the addition
of BA to the culture medium restored accumulation by increasing the ajmalicine
production and eliminated the inhibitory effect of hypoxia. In Egyptian C. roseus,
suspension culture was induced from leaf explants and the influences of different
amino acids (L-tryptophan L-glutamine; L-asparagine; L-cystine and L-arginine)
at different concentrations were examined for enhanced production of indole al-
kaloids. With modified MS medium containing 300 mg/l of either L-glutamine or
L-typtophan the highest biomass and indole alkaloids production were achieved
(Taha et al. 2009). Poutrin et al. (2009) demonstrated that calcium regulated the
auxin-dependent monoterpenoid indole alkaloid (MIA) biosynthesis in C. roseus.
Mustafa et al. (2009) examined the metabolic profile of C. roseus suspension using
NMR spectroscopy and multivariate data analysis under the effect of SA. The data
revealed that in SA treated cells high level of sugars (glucose and sucrose) were
accumulated after treatment and/thereafter an active variation in tryptamine, amino
acids and phenylpropanoids were observed. VCR production in callus culture of C.
roseus was affected by auxin and cytokinin (Kalidass et al. 2010). The accumulation
of VLB, vindoline and catharanthine in C. roseus was monitored under the influence
of several agents (Pan et al. 2010). A noteworthy increase in VLB, vindoline and
catharanthine was recorded down under SA and ethylene treatments, while abscisic
acid and gibberellic acid had shown a negative effect on the accumulation of the
same alkaloids. MJ treatment was not effective on the synthesis of these alkaloids
and chlormequat chloride lowered the concentration of vindoline and catharanthine
but it improved the accumulation of VLB. In the presence of flavin mononucleotide
and manganese ions coupling reaction between catharanthine and vindoline occurs
non-enzymatically at NUV light irradiation in vitro (Asano et al. 2010). It was also
noted that the catharanthine and vindoline synthesis reduced and those of dimeric
indole alkaloids were enhanced under NUV light at 40 C in C. roseus. A homogenate
of Pythium aphanidermatum and MJ was studied on in vitro cultures of C. roseus
(cv. ‘Dhawal’) (Shukla et al. 2010). Due to elicitation transcriptional upregulation
of strictosidine beta-D:-glucosidase (SGD) occur which in turn improved the syn-
thesis of total alkaloids but did not produce vindoline. Recently in a pot experiment
foliar application of SA was conducted, to find out the unfavorable effects of water
stress on periwinkle and its amelioration by SA (Idrees et al. 2011). The result sug-
gested that SA (10−5M) foliar application minimized destructive effects of stress
and enhanced growth parameters and simultaneously improved the anticancerous
compound VCR and VLB in stressed plants. Aslam et al. (2011) reported effects of
freezing and non-freezing temperature on somatic embryogenesis and vinblastine
synthesis in C. roseus. At 15ºC temperature maximum numbers of embryos were
produced whereas the same were matured in maximum number at 4ºC. They also
reported that VLB synthesis was temperature dependent. By using cyclodextrins
and methyljasmonate along with a short exposure of UV enhanced the ajmalicine
accumulation in suspension culture of C. roseus (Almagro et al. 2011). In C. roseus
(Guo et al. 2012) studied the physiological responses of different nitrogen forms
including varying ratio of nitrate to ammonium (1:0, N1; 1:1, N2; 1:3 N3). After
long term incubation in N2 nitrogen solution catharanthine and VLB synthesis was
increased to two folds than in N1 or N3 nitrogen solution.
Mechanism of Elicitor Action
In order to find out the mechanism of elicitor action in plants a thorough research
has been dedicated (Angelova et al. 2006; Siddiqui et al. 2010), however, the in-
duction mechanisms conveyed by fungal elicitors and the plant signals, as a whole,
is still undefined (Djonović et al. 2007). While understanding the mechanism a
general outline for the biotic elicitation in plants may be abridged by different work-
ers on the basis of elicitor-receptor interaction (Zhao et al. 2005; Namdeo 2007).
Elicitors are of very large array of structure, and can be transmitted by the pathogen
(exogenous elicitors) or formed by the plant as a result of the plant–pathogen inter-
action (endogenous elicitors); in both cases, they stimulate the defense reaction of
the plant (Ebel and Cosio 1994). After pathogen or elicitor recognition, sequences
of cytological variation and biochemical reactions have been identified in plant
cells. The cytological variations include papilla formation, increased cytoplasmic
streaming and nuclear migration, which are connected with depolymerization of
microtubules and microfilaments (Kombrink and Schmelzer 2001). The biochemi-
cal reactions include transformation in the H + , K + , Cl−, and Ca2 + fluxes across
the plasma membrane, and the development of reactive oxygen species (ROS) that
occur within 2–5 min after treatment of elicitor (Low and Merida 1996; Nürnberger
1999), oxidative cross linking of cell wall proteins, formation of phytoalexins, hy-
drolytic enzymes, incrustations of cell wall proteins with phenolics and hypersensi-
tive death of plant cell (Namdeo 2007).
The first step during the contact between a pathogen and its host is species specif-
ic in which elicitor binds to plasma membrane receptor for the process of elicitation
(Braun and Walker 1996; Hanania and Avni 1997), after that the genes of avirulence
brought by the pathogen (the elicitors) faces resistance from the host genes of resis-
tance. After proper recognition of the elicitors by the proper receptors of the plant,
defenses mechanism comes into play and they activate its genes of resistance (Hahn
1996; Montesano et al. 2003) through a series of complex reaction which is still un-
der investigation and might not be similar for all type of elicitors but it might give an
insight about their mechanism of action (Radman et al. 2003, Namdeo 2007). After
binding of the elicitor to plasma membrane a rapid ion fluxes across the membrane
occur (Mathieu et al. 1991). As per other reports (Gelli et al. 1997; Pitta-Alvarez
et al. 2000; Mithöfer et al. 2001) an influx of Ca2 + to the cytoplasm from the extra-
cellular environment and intracellular Ca2 + reservoir and stimulation of K + and Cl−
efflux take place (Ivashikina et al. 2001). It is followed by speedy changes in pro-
tein phosphorylation and protein kinase activation pattern upon elicitor treatment
(Yang et al. 1997; Roemis 2001); activation of protein kinases, in turn activate the
mitogen-activated protein kinase (MAPK), MAP-kinases and calcium-dependant
kinases catalyze mostly the Thr-Ser phosphorylation in the target proteins (Roemis
2001). The MAP kinase cascade involves MAP kinase kinase kinase (MAPKKK)
proteins phosphorylating MAP kinase kinases that in turn phosphorylate MAP ki-
nases. Upon activation, MAPKs are transported to the nucleus where they phos-
phorylate specific transcription factors. Activation of G-protein by some workers
(Tyler 2002; Luan 1998; Roos et al. 1998) suggested their involvement in the early
responses to elicitors (Legendre et al. 1992), followed by the production of second-
ary messengers Ins (1, 4, 5) P3 and diacylglycerol (DAG) (Mahady et al. 1998) me-
diating intracellular Ca2 + release, nitric oxide (Delledonne et al. 2002; Huang et al.
2002) and octadecanoid signalling pathway (Piel et al. 1997). Later on AOS and cy-
tosol acidification is carried out by activation of NADPH oxidase (Leburun-Garcia
et al. 1999) and reorganization of cytoskeleton take place (Kobayashi et al. 1995)
and production of ROS like superoxide anion and H2O2 (Low and Merida 1996). It
is followed by accumulation of pathogenesis-related proteins (PR proteins) (Mittler
et al. 2004). Earlier Bol et al. (1990) and Bowles (1990) reported individually about
the increase in PR proteins in response to elicitor. PR protein included chitinases,
glucanases, endoploygalactouranases that contribute to the release of signaling pec-
tic oligomers, hydroxyproline rich glycoproteins and protease inhibitors (Van Loon
and Van Strien 1999). In hyper sensitive responses cell death occurs at the infection
site (Luan 1998) and changes in the cell wall organization (lignification of the cell
wall, callus deposition) take place (Kauss et al 1989). These all consequences are
responsible for the transcriptional activation of the corresponding defence response
genes (Memelnik et al. 2001; Huang et al. 2002) and accumulation of phytoalexins
and tannins (Pedras et al. 2002) which stimulate the production of jasmonic and SA
as secondary messengers (Memelink et al. 2001; Katz et al. 2002) and plant cell
acquired systematic resistance (Lebrun-Garcia et al. 1999). It is known that the se-
quence of these events and arrangements is a very complex process and is still under
investigation. It is further reported that this sequence of events is not followed by

all elicitors, in some peptide elicitors plasma-membrane receptors are active (Ne-
nnstiel et al. 1998), certain peptides of bacterial origin act themselves as messenger
of invasion signals and get transported to distal tissues. The systemic necrosis due
to these proteins is not stimulated by rapid secondary signaling, but by transporta-
tion of the elicitor inside the tissue (Devergne et al. 1992). On the basis of available
information, we summarize the following role/involvement of elicitor in the course
of essential events in secondary metabolism.
• Binding of the elicitor to plasma membrane receptor.
• Changes in Ca2 + influx to the cytoplasm from extracellular and intracellular
pools.
• Decrease of pH of the cytoplasm and activation of NADPH oxidases, protein
phosphorylation patterns and protein kinase activation.
• Changes in cell wall structure (lignification) and in generating reactive oxygen
species.
• Synthesis of JA and SA as secondary messengers.
• Activation of genes that produce defence-related proteins, plant defence mol-
ecules like phytoalexins and other secondary compounds including alkaloids.
In the same way elicitor-based signaling model has been proposed recently for en-
hanced activation of gene expression in C. roseus (Fig. 14.1) where alkalization
of the medium by influxing proton molecule (particularly by calcium) was carried
out by yeast elicitor. This in turn stimulates the octadecanoid pathway and synthe-
sis o JA takes place. JA act as secondary messenger and influences the synthesis
of nuclear proteins ORCA2 and ORCA3. These proteins interact with TDC- and
‘JA-responsive STR’ promoter of several biosynthetic genes and activate their gene
expression (Memelink et al. 2001). Due to ‘elicitor-receptor’ mediated signaling, a
large number of key gene’s activities such as Tdc, Str, geraniol 10 dehydrogenase
( Gh), anthranilate synthetase ( As) increased (Van der Fits and Memelink 2000). We
also believe that this architecture will evolve in future as refinement of cell biology
and molecular biology approaches will allow further and full dissection of plant cell
signaling pathways that effectively regulate elicitation events in C. roseus.
C. roseus is a very important plant due to large number of alkaloids which are used
in treatment of various diseases including antineoplastic agents VLB and VCR.
Present review provides an overview of external stress stimuli used for eliciting C.
roseus cell to undergo a complex network of reactions which ultimately lead to the
synthesis and accumulation of secondary metabolites. These secondary metabolites
help out the plant to endure in stress challenge. They are also under high demands
due to their pharmacological activities but due to the poor understanding of plant
Fig. 14.1 Model for the elicitor mediated signal transduction leading to activation of genes in
indole alkaloid synthesis pathways. (Modified from Memelink et al. 2001)
secondary metabolism, production is still far behind the target. By unraveling the
signaling network would help in specific and competent engineering of the produc-
tion of target secondary metabolites. The elicitation approaches not only enhances
the synthesis of secondary metabolites in the plant system, it also helps us in bet-
ter understanding and identifying the rate-limiting steps of complex biosynthetic
pathways existing in secondary metabolite synthesis which in turn can contribute
towards better productivity by utilizing metabolic engineering aspects.
Acknowledgements The first author is thankful to Council of Scientific and Industrial Research
(CSIR) for receiving Senior Research Fellowship (SRF).
References
Abd El-Mawla, AMA (2012) Influence of certain abiotic elicitors on production of anthraquinones
in cell cultures of Rubia tinctorum. Spatula DD 2:89–94
Ahmed SA, Baig MMV (2012) Elicitor enhanced production of psoralen in suspension cultures of
Psoralea corylifolia L. www.apjtb.com/press/2012/B691.doc
Aijaz A, Jain S, Hariharan AG (2011) Effect of elicitation on the production of phyto-constituents
through plant tissue culture technique—a review. Int. J Drug Disc Herb Res 1:84–90
Almagro L, López Perez AJ, Pedreño MA (2011). New method to enhance ajmalicine production in
Catharanthus roseus cell cultures based on the use of cyclodextrins. Biotech Lett 33(2):381–385
Angelova Z, Georgiev S, Roos W (2006) Elicitation of plants. Biotech. Equip 20:72–83
Asano M, Harada K, Yoshikawa T, Bamba T, Hirata K (2010) Synthesis of anti-tumor dimeric
indole alkaloids in Catharanthus roseus was promoted by irradiation with near-ultraviolet light
at low temperature. Biosci Biotechnol Biochem 74:386–389
Aslam J, Mujib A, Sharma MP (2011) Influence of freezing and non-freezing temperature on
somatic embryogenesis and vinblastine production in Catharanthus roseus (L.) G. Don. Acta
Physiol Plant 33(2):473–480
Atkinson NJ, Urwin PE (2012) The interaction of plant biotic and abiotic stresses: from genes to
the field. J Exp Bot. doi:10.1093/jxb/ers100
Balandrin MF, Klocke JA (1988) Medicinal, aromatic and industrial materials from plants. In:
Bajaj YPS (ed) Biotechnology in agriculture and forestry, Vol. 40. Springer-Veralg, Berlin,
pp 1–35
Barz W, Daniel S, Hinderer, W, Jaques U, Kessmann H, Koster J, Tiemann K (1988) Elicita-
tion and metabolism of phytoalexins in plant cell cultures. In: Pais M, Mavituna F, Novais J
(eds) “Plant cell biotechnology”. “Biotechnology”. NATO ASI series. Springer-Verlag, Berlin,
pp 211–230
Benhamou N (1996) Elicitor induced plant defence pathways. Trends Plant Sci 1:233–240
Bhambhani S, Karwasara VS, Dixit VK, Banerjee S (2012) Enhanced production of vasicine in
Adhatoda vasica (L.) Nees. cell culture by elicitation. Acta Physiol Plant 34:1571–1578
Binder BY, Peebles CA, Shanks JV, San, KY (2009) The effects of UV-B stress on the production of
terpenoid indole alkaloids in Catharanthus roseus hairy roots. Biotechnol Prog 25(3):861–866
Bol JF, Linthorst HJM, Cornelissen BJC (1990) Plant pathogenesis-related proteins induced by
virus infection. Annual Rev Phytopath 28:113–138
Bowles DJ (1990) Defense-related proteins in higher plants. Annual Rev Biochem 59:873–907
Braun DM, Walker JC (1996) Plant transmembrane receptors: new pieces in the signalling puzzle.
Trends Biochem Sci 21:70–73
Bruneton J (1993) Pharmacognosy phytochemistry medicinal plants, 2nd edn. Lavoisier Publish-
ers, Paris
Bux H, Ashraf M, Rasheed A, Poudyal DS, Kazi AG, Afzaal M (2012) Molecular basis of disease
resistance in cereal crops: an overview. In: Ashraf M, Öztürk M, Ahmad MSA, Aksoy A (eds)
Crop production for agricultural improvement. Springer, Netherlands, pp 477–489
Chong TM, Abdullah MA, Lai QM, Nor AFM, Lajis NH (2005) Effective elicitation factors in
Morinda elliptica cell suspension culture. Process in Biochem 40:3397–3405
Coste A, Vlase L, Halmagyi A, Deliu C, Coldea G (2011) Effects of plant growth regulators and
elicitors on production of secondary metabolites in shoot cultures of Hypericum hirsutum and
Hypericum maculatum. Plant Cell Tiss and Org Cult 106:279–288
Davis D, Merida J, Legendre L, Low PS, Heinstein P (1993) Independent elicitation of the oxida-
tive burst and phytoalexin formation in cultured plant cells. Phytochemistry 32:607–611
Delledonne M, Murgia I, Ederle D, Sbicego PF, Biondani A, Polverari A, Lamb C (2002) Reac-
tive oxygen intermediates modulate nitric oxide signaling in the plant hypersensitive disease-
resistance response. Plant Physiol Biochem 40:605–610
Devergne J-C, Bonnet P, Panabiers F, Blein JP, Ricci P (1992) Migration of the fungal protein
cryptogein within tobacco plants. Plant Physiol 99:843–847
Djonović S, Walter A, Vargas, Michael V, Kolomiets, Michelle, Horndeski, Wiest A, Charles MK
(2007) A proteinaceous elicitor Sm1 from the beneficial fungus Trichoderma virens is required
for induced systemic resistance in Maize. Plant Physiol 145:875–889
Ebel J, Cosio EG (1994) Elicitors of plant defense responses. Int Rev Cytol 148:1–36
Eilert U (1987) Elicitation: methodology and aspects of application. In: Vasil IK, Constabel F (eds)
Cell culture and somatic cell genetics of plants, Vol 4. Academic Press, San Diego, pp 153–196
El-Samra, I.A. Amer MA, Abd-El-Hamid MR, Kabeil SS, El-Alwany AM (2011) Chemical reac-
tion in tomato plants in response to a biotic elicitors treatments. Nature and Science 9:169–185
El-Sayed M, Verpoorte R (2002) Effect of phytohormones on growth and alkaloid accumulation

by a Catharanthus roseus cell suspension cultures fed with alkaloid precursors tryptamine and
loganin. Plant Cell Tiss Org Cult 68:265–270
El-Sayed M, Verpoorte R (2004) Growth, metabolic profiling and enzymes activities of Cathar-
anthus roseus seedlings treated with plant growth regulators. Plant Growth Regul 44:53–58
Evans WC (1996) Trease and evans, pharmacognosy, 14th ed. Harcourt Brace and Company, Asia
Pvt Ltd
Gao F-k, Yong Y-h, Dai C-c (2011) Effects of endophytic fungal elicitor on two kinds of terpe-
noids production and physiological indexes in Euphorbia pekinensis suspension cells. J Med
Plants Res 5(18):4418–4425
Gao F-K, Ren C-G, Dai C-C (2012) Signaling effects of nitric oxide, salicylic acid, and reactive
oxygen species on isoeuphpekinensin accumulation in Euphorbia pekinensis suspension cells
induced by an endophytic fungal elicitor. J Plant Growth Regul. doi:10.1007/s00344-012-
9258-8
Gelli A, Higgins VJ, Blumwald E (1997) Activation of plasma membrane Ca2 + membrane chan-
nels by race specific fungal elicitors. Plant Physiol 113:269–279
Ghorpade R P, Chopra A, Nikam TD (2011) Influence of biotic and abiotic elicitors on four major
isomers of boswellic acid in callus culture of Boswellia serrata Roxb. Plant Omics. 4:169–176
Godoy-Hernandez GC, Vazquez-Flota FA, Loyola-Vargas VM (2000) The exposure to trans-cin-
namic acid of osmotically stressed Catharanthus roseus cells cultured in a 14–1 bioreactor
increases alkaloid accumulation. Biotechnol Lett 22:921–925
Guo X-R, Yang L, Yu J-H, Tang Z-H, Zu Y-G (2007) Alkaloid variations in C. roseus seedlings
treated by different temperatures in short term and long term. J Forestry Res 18:313–315
Guo X-R, Zu Y-G, Tang Z-H (2012) Physiological responses of Catharanthus roseus to different
nitrogen forms. Acta Physiol Planta 34(2):589–598
Guoyin Kai G, Liao P, Xu H, Wang J, Zhou C, Zhou W, Qi Y, Xiao J, Wang Y, Zhang L (2012)
Molecular mechanism of elicitor-induced tanshinone accumulation in Salvia miltiorrhiza hairy
root cultures. Acta Physiol Plant 34(4):1421–1433
Gururaj HB, Giridhar P, Ravishankar GA (2012) Laminarin as a potential non-conventional elici-
tor for enhancement of capsaicinoid metabolites. Asian J Plant Sci Res 2:490–495
Hahn MG (1996) Microbial elicitors and their receptors in plants. Annual Rev Phytopath 34:387–412
Hamerski D, Beier RC, Kneusel RE, Matern U, Himmelspacht K (1990) Accumulation of couma-
rins in elicitor-treated cell suspension cultures of Ammi majus. Phytochemistry 29:1137–1142
Hanania U, Avni A (1997) High affinity binding site for the ethylene inducing xylanase elicitor on
Nicotiana tabacum membrane. Plant J 12:113–120
Hisiger S, Jolicoeur M (2007) Analysis of Catharanthus roseus alkaloids by HPLC. Phytochem
Rev 6:207–234
Huang X, Kiefer E, Von Rad, U, Ernst D, Foissner I, Durner J (2002) Nitric oxide burst and nitric
oxide-dependent gene induction in plants. Plant Physiol Biochem 40:625–631
Hussain MS, Fareed S, Ansari S, Rahman MA, Ahmad IZ, Saeed M (2012) Current approaches
toward production of secondary plant metabolites. J Pharm Bioallied Sci 4:10–20
Ivashikina N, Becker D, Ache P, Meyerhoff O, Felle HH, Hedrich R (2001) K+ channel profile and
electrical properties of Arabidopsis root hairs. FEBS Letters 508:463–469
Jha, S, Sahu, NP, Mahato, SB (1988) Production of the alkaloids emetine and cephaeline in callus
cultures of Cephaelis ipecacuanha. Planta Medica 54:504–506
Kalidass C, Mohan VR, Arjunan Daniel A (2010) Effect of auxin and cytokinin on vincristine
production by callus cultures of Catharanthus roseus L. (Apocynaceae). Trop Subtrop Agroeco
12:283–288
Karuppusamy S (2009) A review on trends in production of secondary metabolites from higher
plants by in vitro tissue, organ and cell cultures. J Medi Plants Res 3:1222–1239
Katz V, Fuchs A, Conrath U (2002) Pretreatment with salicylic acid primes parsley cells for en-
hanced ion transport following elicitation. FEBS Letters 520:53–57
Kauss H, Jeblick W, Domard A (1989) The degrees of polymerization and N-acetylation of chito-
san determine its ability to elicit callus formation in suspension cells and protoplasts of Cathar-
anthus roseus. Planta 178:385–392
Kobayashi I, Murdoch LJ, Kunoch H, Hardham AR (1995) Cell biology of early events in the plant
resistance response to infection by pathogenic fungi. Canadian J Botany 73:418–425
Kombrink E, Schmelzer E (2001) The hypersensitive response and its role in local and systemic
disease resistance. European J Plant Path 107:69–78
Lebrun-Garcia A, Bourque S, Binet MN, Ouaked F, Wendehenne D, Chiltz A, Schaffner A, Pugin
A (1999) Involvement of plasma membrane proteins in plant defense responses. Analysis of the
cryptogein signal transduction in tobacco. Biochimie 81:663–668
Lee CWT, Shuler ML (1991) Different flask closures alter gas phase composition and ajmalicine
production in Catharanthus roseus cell suspensions. Biotech Techn 5:173–178
Lee-Parsons CWT (2007) Gas composition strategies for the successful scale-up of Catharanthus
roseus cell cultures for the production of Ajmalicine. Phytochem Rev 6:419–433
Lee-Parsons CWT, Ertürk S (2005) Ajmalicine production in methyl jasmonate-induced Cathar-
anthus roseus cell cultures depends on Ca2 + level. Plant Cell Rep 24:677–682
Legendre L, Heinstein PF, Low PS (1992) Evidence for participation of GTP-binding proteins in
elicitation of the rapid oxidative burst in cultured soybean cells. J Biol Chem 267:20140–20147
Lovkova MY, Buzuk GN, Sokolova SM, Kliment’eva NI (2001) Chemical features of medicinal
plants (Review). App Biochem Micro 37:229–237
Lovkova M Y, Buzuk GN, Sokolova SM, Buzuk LN (2005) Role of elements and physiologi-
cally active compounds in the regulation of synthesis and accumulation of indole alkaloids in
Catharanthus roseus L. App Biochem Micro 41:299–305
Low PS, Merida JR (1996) The oxidative burst in plant defense: function and signal transduction.
Physiol Planta 96:533–542
Luan S (1998) Protein phosphatases and signaling cascades in higher plants. Trends Plant Sci
3:271–275
Maffei ME, Arimura G-I, Mithöfer A (2012) Natural elicitors, effectors and modulators of plant
responses. Nat Prod Rep doi:10.1039/C2NP20053H
Mahady GB, Liu C, Beecher WW (1998) Involvement of protein kinase and G proteins in the
signal transduction of benzophenanthridine alkaloid biosynthesis. Phytochemistry 48:93–102
Mathieu Y, Kurkdjian A, Xia H, Guern J, Koller, A, Spiro MD, Spiro M, O’Neill M, Albersheim P,
Darvill A (1991) Membrane responses induced by oligogalacturonides in suspension-cultured
tobacco cells. Plant J 1:333–343
Memelnik J, Verpoorte R, Kijne JW (2001) ORC Anization of jasmonate-responsive gene expres-
sion in alkaloid metabolism. Trends Plant Sci 6:212–219
Miao ZQ, Wei ZJ, Yuan, YJ (2000) Sheng Wu Gong Cheng Xue Bao Chinese. J Biotech 16:509–513
Mihai A, Cristina S, Helepciuc F, Brezeanu A, Stoian G (2011) Biotic and abiotic elicitors induce
biosynthesis and accumulation of resveratrol with antitumoral activity in the long—term Vitis
vinifera L. callus cultures. Romanian Biotech Lett 16:6683–6689
Mithöfer A, Fliegmann J, Daxberger A, Ebel C, Neuhaus-Url G, Bhagwat AA, Keister DL, Ebel J
(2001) Induction of H2O2 synthesis by β-glucan elicitors in soybean is independent of cytosolic
calcium transients. FEBS Letters 508:191–195
Mittler R, Vanderauwera S, Gollery M, Van BF (2004) Reactive oxygen gene network of plants.
Mohd Idrees M, Naeem M, Aftab T, Khan MMA, Moinuddin (2011) Salicylic acid mitigates sa-
linity stress by improving antioxidant defence system and enhances vincristine and vinblas-
tine alkaloids production in periwinkle [Catharanthus roseus (L.) G. Don]. Acta Physiol Plant
33(3):987–999
Montesano M, Brader G, Palva ET (2003) Pathogen derived elicitors: searching for receptors in
plants. Mol Plant Path 4:73–79
Moreno PRH, Poulsen C, Van Der Heijden R, Verpoorte R (1996) Effects of elicitation on differ-
ent secondary metabolic pathways in Catharanthus roseus cell suspension cultures. Enzyme
Microb Technol 18:99–107
Moreno PRH, Van Der Heijden R, Verpoorte R (1995) Cell and tissue cultures of Catharanthus
roseus: a literature survey. 2. Updating from1988 to 1993. Plant Cell Tiss Org Cult 42:1–25
Mulabagal V, Tsay H-S (2004) Plant cell cultures—an alternative and efficient source for the pro-
duction of biologically important secondary metabolites. Inter J App Sci Eng 2(1):29–48
Muranaka T, Ohakawa H, Yamada Y (1992) Scopalamine release into media by Duboisia leich-
hardtti hairy root clones. Appl Microbial Biotechnol 37:554–559
Mustafa NR, Kim HK, Choi YH, Verpoorte R (2009) Metabolic changes of salicylic acid-elicited
Catharanthus roseus cell suspension cultures monitored by NMR-based metabolomics. Bio-
technol Lett 31:1967–1974
Namdeo A, Patil S, Fulzele DP (2000) Influence of fungal elicitors on production of ajmalicine by
cell cultures of Catharanthus roseus. Biotechnol Prog 18:159–162
Namdeo AG (2007) Plant cell elicitation for the production of secondary metabolites: A review.
Pharmacog Rev 1:69–79
Nennstiel, D, Scheel D, Nürnberger T (1998) Characterization and partial purification of an oligo-
peptide elicitor receptor from parsley ( Petroselinum crispum). FEBS Lett 431:405–410
Nigra HM, Caso OH, Guilietti AM (1987) Production of solasodine by calli form different parts of
Solanum eleaginifolium Cav. Plants. Plant Cell Rep 6:135–137
Nishi A (1994) Effect of elicitors on the production of secondary metabolites. In: Ryu DDY, Fu-
rasaki S (eds) Advances in plant biotechnology. Amsterdam: Elsevier Science, pp 135–151
Nürnberger T (1999) Signal perception in plant pathogen defence. Cell Mol Life Sci 55:167–182
Pan Q, Chen Y, Wang Q, Yuan F, Xing S, Tian Y, Zhao J, Sun X, Tang K (2010) Effect of plant
growth regulators on the biosynthesis of vinblastine, vindoline and catharanthine in Catharan-
thus roseus. Plant Growth Regul 60:133–141
Pande D, Malik S, Bora M, Srivastava PS (2002) Rapid protocol for in-vitro micropropagation of
Lepidium sativum Linn and enhancement in the yield of lepidine. In-vitro Cell Dev Bio Plant
38:451–456
Pedras MSC, Nycholat CM, Montaut S, Xu Y, Khan AQ (2002) Chemical defenses of crucifers:
elicitation and metabolism of phytoalexins and indole-3-acetonitrile in brown mustard and
turnip. Phytochemistry 59:611–625
Piel J, Atzorn R, Gabler R, Kuhnemann F, Boland W (1997) Cellulysin from the plant parasitic
fungus Trichoderma viride elicits volatile biosynthesis in higher plants via the octadecanoid
signalling cascade. FEBS Letters 416:143–148
Pitta–Alvarez SI, Spollansky TC, Giulietti AM (2000) The influence of different biotic and abiotic
elicitors on the production and profile of tropane alkaloids in hairy root cultures of Brugmansia
candida. Enzyme Microb Technol 26:252–258
Poutrain P, Mazars C, Thiersault M, Rideau M, Pichon O (2009) Two distinct intracellular
Ca2 + -release components act in opposite ways in the regulation of the auxin-dependent MIA
biosynthesis in Catharanthus roseus cells. J Exp Bot 60:1387–1398
Pradel H, Dumkelehmann U, Diettrich B, Luckner M (1997) Hairy root cultures of Digitalis la-
nata. secondary metabolism and plant regeneration. J Plant Physiology 151:209–215
Prakash G, Srivastava AK (2008) Statistical elicitor optimization studies for the enhancement
of azadirachtin production in bioreactor Azadirachta indica cell cultivation. Biochem Engi J
40:218–226
Preisig CL, Moreau RA (1994) Effects of potential signal transduction antagonists on phytoalexin
accumulation in tobacco. Phytochemistry 36:857–863
Radman R, Saez T, Bucke C, Keshavarz T (2003) Elicitation of plants and microbial cell systems.
Biotech Applied Biochem 37:91–102
Ramani S, Chelliah J (2008) Enhanced catharanthine and vindoline production in suspension cul-
tures of Catharanthus roseus by ultraviolet-B light. J Mol Signal 3:9–14
Ramani S, Jayabaskaran C (2007) UV-B-induced signaling events leading to enhanced-production
of catharanthine in Catharanthus roseus cell suspension cultures. BMC Plant Biol 7:61–78
Ramawat KG, Merillon JM (2007) Biotechnology; Secondary metabolites; Plants and microbes,
2nd edn. Science Publishers, Enfield
Rao RS, Ravishankar GA (2002) Plant cell cultures: chemical factories of secondary metabolites.
Biotech Advan 20:101–153
Ravishankar GA, Grewal S (1991) Development of media for growth of Dioscorea deltoidea cells
and in-vitro diosgenin production: Influence of media constituents and nutrient stress. Biotech
Lett 13:125–130
Rijhwani SK, Shanks JV (1998) Effect of elicitor dosage and exposure time on biosynthesis of
indole alkaloids by Catharanthus roseus hairy root culture. Biotechnol Prog 14:442–449
Robins RI (1994) Secondary products from cultured cells and organs: Molecular and cellular ap-
proaches. In: Dixon RA, Gonzales, RA (eds) Plant Cell Culture. IRI Press, NY
Roemis T (2001) Protein kinases in the plant defence response. Curr Opi Plant Biol 4:407–414
Roos W, Evers S, Hieke M, Tschöpe M, Schumann B (1998) Shifts of intracellular pH distribution
as a part of signal mechanism leading to the elicitation of benzophenanthridine alkaloids. Plant
Physiol 118:349–364
Ruiz-May E, Galaz-Ávalos RM, Loyola-Vargas VM (2009) Differential secretion and accumula-
tion of terpene indole alkaloids in hairy roots of Catharanthus roseus treated with Methyl
Jasmonate. Mol Biotechnol 41:278–285
Schmeller T, Wink M (1998) Utilization of alkaloids in modern medicine. In: Roberts MF, Wink
M (eds) Alkaloids. Biochemistry, ecology, and medicinal applications. Plenum Press, New
York, pp 435–459
Scragg AH (1992) Bioreactors for mass cultivation of plant cells. In: Fowler MW, Warren GS (eds)
Plant biotechnology. Peragmon Press, England, pp 45–62
Senoussi MM, Bassa Nora B, Joêl C (2009) Impact of hypoxia on the growth and alkaloid accumu-
lation in Catharanthus roseus cell suspension. Acta Physiol Plant 31:359–362
Shanks JV, Bhadra R, Morgan J, Rijhwani S, Vani S (1998) Quantification of metabolites in the
indole alkaloid pathways of Catharassnthus roseus: implications for metabolic engineering.
Biotechnol Bioeng 58:333–338
Sharma M, Sharma A, Kumar A, Basu SK (2011) Enhancement of secondary metabo;ites in cul-
tured plant cells through stress stimulus. American J Plant Physiol 6:50–71
Shirsau K, Nakajima H, Krishnamachari RV, Dixon RA, Lamb C (1997) Salicylic acid potentiates
an agonist-dependent gain control that amplifies pathogen signals in the activation of defense
mechanisms. Plant Cell 9:261–270
Shukla AK, Shasany AK, Verma RK, Gupta MM, Mathur AK, Khanuja SP (2010) Influence of cel-
lular differentiation and elicitation on intermediate and late steps of terpenoid indole alkaloid
biosynthesis in Catharanthus roseus. Protoplasma 242:35–47
Siddiqui ZH, Mujib A, Ahmad MM, Ali A (2010) Fungal elicitors: A potent approach for enhanc-
ing secondary metabolites in cultured cells. In: Gupta VK, Tuohy M, Gaur RK (eds) Fungal
biochemistry and biotechnology. Lap Lambert Academic Publishing AG & CO. KG, Germany,
pp 88–104
Singh SN, Vats P, Suri S et al. (2001) Effect of an antidiabetic extract of Catharanthus roseus
on enzymatic activities in streptozotocin induced diabetic rats. J Ethnopharmacol 76:269–277
Smetanska I (2008) Production of secondary metabolites using plant cell cultures. Advances in
Biochem Engi Biotech 111:187–228
Smith DA, Banks SW (1986) Biosynthesis, elicitation and biological activity of isoflavonoid phy-
toalexins. Phytochemistry 25:979–995
Srividya N, Devi BPS (1998) Azadirachtin and nimbin content in in-vitrocultured shoots and roots
of Azadirachta indica A. Juss. Indian J of Plant Physiol 3:129–134
Stafford A, Morris P, Fowler MW (1986) Plant cell biotechnology: a perspective. Enzyme Microb
Technol 8:578–597
Svoboda GH, Blake DA,(1975) The phytochemistry and pharmacology of Catharanthus roseus
(L.) G. Don. In: Taylor WI, Farnsworth NR (eds) The Catharanthus alkaloids. Marcel Dekker,
Inc., New York, pp 45–83
Taha HS, Abd El-Rahman RA, Abd-El-Kareem FM, Aly UE (2008) Successful application for
enhancement and production of anthocyantn pigment from calli cultures of some ornamental
plants. AJBAS 2:1148–1156
Taha HS, El-Bahr MK, Seif-El-Nasr MM (2009) In vitro studies on Egyptian Catharanthus roseus
(L.) G. Don. IV: Manipulation of some amino acids as precursors for enhanced indole alkaloids
production in suspension cultures. AJBAS 3:3137–3144
Ten Hoopen HJG, Vinke JL, Moreno PRH, Verpoorte R, Heijnen JJ (2002) Influence of tempera-
ture on growth and ajmalicine production by Catharanthus roseus suspension culture. Enzyme
Microb Technol 30:56–65
Threlfall DR, Whitehead IM (1988) Co-ordinated inhibition of squalene synthetase and induc-
tion of enzymes of sesquiterpenoid phytoalexin biosynthesis in cultures of Nicotiana tabacum.
Toppel G, Witte L, Riebesehl B, Von Borstel K, Hartman T (1987) Alkaloid patterns and biosyn-
thetic capacity of root cultures from some pyrrolizidine alkaloid producing Senecio spp. Plant
Cell Rep 6:466–469
Toso RD (2010) Plant cell culture technology: a new ingredient source. Personal care 2:35–38
Tripathi L, Tripathi JN (2003) Role of biotechnology in medicinal plants. Trop J Pharma Res
2(2):243–253
Tyler BM (2002) Molecular basis of recognition between phytophthora pathogens and their hosts.
Annual Rev Phytopath 40:137–167
Van Der Fits L, Memelink J (2000) ORCA3, a jasmonate-responsive transcriptional regulator of
plant primary and secondary metabolism. Science 289:295–297
Van Der Heijden R, Jacobs DI, Snoeijer W, Hallared D, Verpoorte R (2004) The Catharanthus
alkaloids: pharmacognosy and biotechnology. Curr Med Chem 11:607–628
Van Der Heijden R, Verpoorte R, Ten Hoopen HJG (1989) Cell and tissue cultures of Catharanthus
roseus (L.) G. Don: a literature survey. Plant Cell Tiss Org Cult 18:231–280
Van Loon LC, Van Strien EA (1999) The families of pathogenesis-related proteins, their activities,
and comparative analysis of PR-1 type proteins. Physiol Mol Plant Patho 55:85–97
Vázquez-Flota F, Hernández-Domínguez E, de Lourdes Miranda-Ham M, Monforte-González M
(2009) A differential response to chemical elicitors in Catharanthus roseus in vitro cultures.
Biotechnol Lett 31:591–595
Wealth of India (1992) A dictionary of Indian raw materials and industrial products. Volume-3
(Revised) Ca-Ci, Publication and information directorate, Council of scientific and industrial
research, New Delhi
Wu J, Wang C, Mei X (2001) Stimulation of taxol production and excretion in Taxus spp. cell
cultures by rare earth chemical lanthanum. J Biotechnol 85:67–73
Wyk BEV, Wink M (2004) Medicinal plants of the world. Pretoria, Briza.
Xu M, Dong J (2005) Nitric oxide stimulates indole alkaloid production in Catharanthus roseus
cell suspension cultures through a protein kinase-dependent signal pathway. Enzyme Microb
Technol 37:49–53
Yang J, Yu M, January YN, January LY (1997) Stabilization of ion selectivity alters by pore loop
ion pairs in an inwardly rectifying potassium channel. Proc Nat Acad Sci USA 94:1568–1572
Zenk MH (1991) Chasing the enzymes of secondary metabolism: Plant cell cultures as a pot of
gold. Phytochemistry 30:3861–3863
Zhang C, Jian-Yong W (2003) Ethylene inhibitors enhance elicitor-induced paclitaxel production
in suspension cultures of Taxus spp. Cells. Enzyme Microb Technol 32:71–77
Zhao J, Verpoorte R (2007) Manipulating indole alkaloid production by Catharanthus roseus cell
cultures in bioreactors: from biochemical processing to metabolic engineering. Phytochem
Rev 6:435–457
Zhao J, Davis LC, Verpoorte R (2005) Elicitor signal transduction leading to production of plant
secondary metabolites. Biotechnol Adv 23:283–333
Zhao J, Zhu WH, Hu Q (2000a) Promotion of indole alkaloid production in Catharanthus roseus
cell cultures by rare earth elements. Biotech Lett 22:825–828
Zhao J, Zhu WH, Hu Q, Guo YQ (2000b) Improvement of indole alkaloid production in Cathar-
anthus roseus cell cultures by osmotic shock. Biotechnol Lett 22:1227–1231
Zhao J, Zhu WH, Hu Q, He XW (2000c) Improved indole alkaloid production in Catharanthus

roseus suspension cell cultures by various chemicals. Biotechnol Lett 22:1221–1226
Zhao J, Hu Q, Zhu WH (2001a) Enhanced catharanthine production in Catharanthus roseus cell
cultures by combined elicitor treatment in shake flasks and bioreactors. Enzyme Microb Tech-
nol 28:673–681
Zhao J, Hu Q, Guo Y-Q, Zhu W-H (2001b) Elicitor-induced indole alkaloid biosynthesis in
Catharanthus roseus cell cultures is related to Ca2 + influx and the oxidative burst. Plant Sci
161:423–431
Zhao J, Hu Q, Guo YQ, Zhu WH (2001c) Effects of stress factors, bioregulators and precursors on
indole alkaloid production in the compact callus clusters culture of Catharanthus roseus. Appl
Microbiol Biotechnol 55:693–698
Zhao J, Hu Q, Zhu WH (2001d) Selection of fungal elicitors to increase inadole alkaloid accumu-
lation in Catharanthus roseus suspension cell cultures. Enzyme Microb Technol 28:666–672
Zhao J, Zhu WH, Hu Q, Guo YQ (2001e) Compact callus cluster suspension cultures of Catharan-
thus roseus with enhanced indole alkaloid biosynthesis. In-vitro Cell Dev Biol Plant 37:68–72
Zheng Z, Wu M (2004) Cadmium treatment enhances the production of alkaloid secondary me-
tabolites in Catharanthus roseus. Plant Sci 166:507–514
Zimmermann S, Frachisse JM, Thomine S, Barbier-Brygoo H, Guern J (1998) Elicitor-induced chlo-
ride efflux and anion channels in tobacco cell suspensions. Plant Physiol Biochem 36:665–674
Zuccarini P (2009) Tropospheric ozone as a fungal elicitor. J Biosci 34:125–138
Chapter 15
Handling Soybean ( Glycine max L.) Under Stress
Mohammad Miransari
Abstract Soybean is among the most important leguminous plants with the abil-
ity to establish symbiotic association with the N-fixing bacteria, Bradyrhizobium
japonicum. With respect to the environmental and economical significance of N fix-
ation, there has been extensive research work regarding the production of legumes
including soybean under different conditions. Soils are usually subjected to some
kind of stress including salinity, acidity and suboptimal root zone temperature. One
of the most important processes, affecting the performance of soybean under stress
is the inhibited exchange of the signal molecules, specifically genistein, between
the host legume and B. japonicum during the initiation of symbiosis. Interestingly,
inoculation of B. japonicum with the signal molecule genistein has partially or
completely alleviated the stress. It is also of significance to determine the right
combination of N-fertilization and rhizobium inoculums when planting leguminous
including soybean. The use of breeding techniques may also be among the effective
methods of improving soybean performance under stress. In this chapter some of
the most important advances regarding the performance of soybean under different
conditions including stress with respect to the molecular techniques are reviewed.
Some future perspectives are also presented, the production of tolerant plants and
microbes are among the most important ones.
Introduction
Soybean ( Glycine max L.) is a crop plant belonging to the leguminous family and
is widely cultivated in different parts of the world. It is a source of food, with high
protein rate, containing useful nutrients. It is the major leguminous crop plant rep-
resenting 50 % of the crop legume production and 68 % of the total crop production
in the world. It is able to develop symbiotic association with the bacteria from the
rhizobium family, Bradyrhizobium japonicum, fixing atmospheric N2. The amount
M. Miransari ()
AbtinBerkeh Limited Co., Imam Blvd., Shariati Blvd., #107, 3973173831, Tehran, Iran
Mehrabad Rudehen, Imam Ali Blvd., Mahtab Alley, 55, 3978147395, Tehran, Iran

422 M. Miransari
of N fixed by soybean is annually equal to 16.4 Tg, accounting for 77 % of the total
N fixed by leguminous plants. With respect to the importance of soybean as a source
of food for human and because N-fixation can contribute to a large part of neces-
sary N for plant use, there has been extensive research work regarding the process
of N-fixation in leguminous plants. Enhancing the efficiency of N-fixation can sig-
nificantly increase crop yield and is of environmental and economical significance
(Herridge et al. 2008).
The process of symbiotic N-fixation is between some soil bacteria, collectively
called rhizobium, and the leguminous plants in which the atmospheric N2 is fixed
by the bacteria and reduced to ammonia. The ammonia is then assimilated by the
host plant into the structure of amino acids and proteins. The process of N-fixation
between rhizobium and leguminous plants is specific, indicating that only one strain
of rhizobium is able to colonize the host plant roots and form nodules. Nodules are
the place of rhizobium residence and hence N fixation (Hungria et al. 2005; Wang
et al. 2011).
Between a hundred to a few hundred kg ha−1 atmospheric N2 is fixed by rhizo-
bium, providing a major part of necessary N for plant use. For example, in soy-
bean, 50–60 % of necessary N is supplied by biological N fixation (Salvagiotti et al.
2008). Although chemical fertilization can quickly supply the necessary nutrients
for plant use, it has also some disadvantages including: (1) adversely affecting soil
structure, and (2) being subjected to leaching and hence resulting in the pollution
of water resources. This is why biological nitrogen fixation is important, as it can
inhibit such un-favorable effects of chemical fertilization on the soil properties, and
hence on the environment (Evans 1993; Salvagiotti et al. 2008).
Usually rhizobium can be found in the soil, especially under soil optimal condi-
tions; however, its population may not be adequate to efficiently inoculate the host
plant. For this reason, use of bacterial inoculum can be a useful method to inoculate
the host plant with appropriate bacterial population. Inoculums have a carrier with
a high bacterial population, used to inoculate seeds before planting or at the time
of planting. The bacterial inoculum must have the ability to compete with the soil
bacteria, adapted to the soil conditions (Miransari 2010, 2011).
Exploiting the potential genetic of plant and climate properties are among the
most efficient methods, resulting in the enhancement of soybean yield (Salvagiotti
et al. 2008). Although soybean is not a tolerant crop plant under stress, different
methods have been tested to increase its tolerance under different stresses includ-
ing salinity and drought, acidity, high amount of mineral N and sub-optimal root
temperature. Among the most important hypotheses that have been successfully
tested and approved by researchers is that soil stresses disrupt the process of mo-
lecular communications between rhizobium and the host plant. In the initial stages
of N-fixation the two symbionts, rhizobium and host plant must exchange signal
molecules to realize their presence and start the process of N-fixation. The disrup-
tion of such signaling exchange between the two symbionts can inhibit N-fixation
by rhizobium and the host plant (Miransari et al. 2007, 2008, 2009).
Preincubation of Bradyrhizobium japonicum with the signal molecules, from the
flavonoids biochemical group, have been shown to be a useful method to alleviate
15 Handling Soybean ( Glycine max L.) Under Stress 423
soil stresses on the process of N2-fixation. In the case of soybean symbiotic bacteria,
Bradyrhizobium japonicum, geneistin is among the dominant signal molecules, pro-
duced by the host plant root. Pretreatment of Bradyrhizobium japonicum with ge-
nistein can partially or completely alleviate the stress on the process of N-fixation.
In this case, the bacterial genes become activated under the stress and proceed with
the next stages of N-fixation process (Zhang and Smith 1995). Accordingly, some
of the most recent findings regarding the methods used to alleviate soil stresses on
soybean growth and yield production with some prospects for future research are
presented.
Significance of Biological Nitrogen Fixation
Biological nitrogen fixation and specifically the symbiosis between legume plants
and rhizobium, is one of the most important biological activities, globally. In the
process of symbiotic association between legume plants and rhizobium, the atmo-
spheric N is fixed by the bacteria and turned into available N (NH3) by nitrogenase
enzyme. Depending on the conditions, most part of the N necessary for legume
growth and yield production is supplied by the process of N-fixation. However, it
is likely to enhance the efficiency of N-fixation, especially under stress (Unkovich
and Pate 2000; Yasmin et al. 2006).
With respect to the economical and environmental importance of biological ni-
trogen fixation, it can significantly contribute to the enhanced efficiency of eco-
system including crop production. Although N-chemical fertilization can rapidly
provide the necessary N for plant growth, it is subjected to leaching and hence can
adversely affect the water sources. N-fixation can also be economically consider-
able as there is a high annual rate of expenses, spent for the production and use
of synthetic N (Miransari and Smith 2007, 2008, 2009; Miransari and Mackenzie
2010, 2011a, b).
There are different parameters affecting the process of N-fixation between le-
gume and rhizobium including plant species, bacterial strains, N-chemical fertiliza-
tion and soil and plant properties. There are some legume plant species and rhizo-
bium strains, with specific genotypic properties, which can perform more effec-
tively. Accordingly, some plant-bacterium combinations may be more efficient. Al-
though N-fertilization at seeding can enhance the growth of legume seedlings, high
amounts of N-fertilization can adversely affect the process of N-fixation. Under
optimal soil conditions, the efficiency of N-fixation process can be at the highest,
however, soil stresses can decrease the rate of N-fixation by negatively influencing
both the host plant and the bacteria (Valliyodan and Nguyen 2008; Hamilton et al.
2011; Salah et al. 2011).
Climate properties including light, temperature, precipitation, and concentra-
tion of carbon dioxide can affect both plant and the symbiotic rhizobium. Light is
necessary for the process of photosynthesis and at optimal rates can increase the
424 M. Miransari
photosynthetic process. Legume plants are adapted to mild temperatures and have
the higher rate of N-fixation and yield production at the range of 20–30 °C. Higher
or lower temperatures can reduce plant growth and yield production (Lynch and
Smith 1993). Legume plants can grow well at the optimum soil moisture and hence
precipitation. High or low level of soil moisture can decrease plant growth and yield
production of legume plants (Sakthivelu et al. 2008; Sorensen et al. 2012).
The concentration of CO2 can also affect plant performance by affecting the pro-
cess of photosynthesis. Higher rates of CO2 (500–1000 µmol mol−1) decreased plant
efficiency by decreasing the rate of protein. As a result of elevated CO2 concentra-
tion, the concentration of Rubisco reduces. It is because the expression of photo-
synthetic genes, which are dependent on carbohydrate concentration, is affected.
However, other mechanisms may also cause such alterations (Stitt and Krapp 1999;
Taub et al. 2008). The reduction in the leaf protein concentration can decrease seed
protein concentration, because usually the N content of senescing tissues is trans-
located to plants seeds (Fangmeier et al. 1999; Salon et al. 2001). However, com-
pared with cereals, soybean grains indicated much smaller rates of protein reduc-
tion, which is mostly due to its symbiotic association with rhizobium. Root nodules
are sinks for photosynthates, inhibiting plant leaf to increase the level of hexose,
which can adversely affect Rubisco concentration. The fluctuations in ozone can
also affect plant performance as higher rates of exposure can have negative effects
on plant growth by adversely affecting the structure of leaf mesophyll, and hence
decreased carbon assimilation and photosynthesis rate (Long and Naidu 2002; Garg
and Bhandari 2012).
However, the adverse effects of ozone exposure on plant leaf can be inhibited by
the elevated levels of CO2 resulting in the enhanced protein seed concentration. It
is because ozone can have negative effects on the process of N fixation, and hence
decrease the translocation of photosynthates to the nodules (Pausch et al. 1996; Ti
et al. 2012). Accordingly, elevated CO2 levels may enhance the rate of N-fixation
by increasing the level of C assimilation (De Graaff et al. 2006; Rogers et al. 2006).
Carbon cycling between soil and atmosphere is important affecting different bio-
logical processes such as N-fixation. The higher rate of carbon in soil can contribute
to higher biological activities by soil microbes, improve soil structure and enhance
soil fertility. However, for N-fixing rhizobium the atmospheric carbon may be of
more importance as photosynthesis process assimilates it into carbohydrate. Rhizo-
bium bacteria utilize hydrocarbons, supplied by plant as source of energy for their
activities. Accordingly, higher rate of atmospheric C up to some level can increase
the rate of photosynthesis and hence the process of N-fixation (Townsend et al.
2011; Finzi et al. 2011).
Hence, the process of N-fixation by legume plants and rhizobium is of high
importance significantly contributing to the necessary N for plant growth and yield
production while agriculturally and environmentally sustainable. This process is
affected by different parameters and hence it is pertinent to find methods that can
enhance its efficiency under different conditions including stress.
Soybean, Salinity and Drought
About one milliard hectares of agricultural soils are saline or subjected to some kind
of salinity, worldwide (Flowers and Yeo 1995). Leguminous plants are classified
among sensitive or moderately tolerant plants to salinity (Lauchli 1984). Legume’s
tolerance to salinity differs among different species (Lu et al. 2009) and usually un-
der salinity they excrete ion salt from the leaf or localized the salt in different parts
of the plant. Under high salinity rhizobium are not able to become dormant, and
hence must have the ability to tolerate high salt levels. Parameters including soil
fertility, N source, temperature, drought, relative humidity and physical properties
can affect plant growth under saline conditions (Velagaleti et al. 1990; Munns 2002;
Vercruysse et al. 2011; Meilhoc et al. 2011).
Higher concentration of salt in mature leaf, relative to the young leaf, results in
the senescence of mature leaf. Plant ability to allocate salt to the cellular vacuoles is
among the important parameters determining plant tolerance to salinity. The higher
the plant ability to allocate salt to the vacuoles the higher its tolerance to salinity
is. Plant hormones such as abscisic acid (ABA) can also regulate plant activities
under stress by for example controlling the stomatal activities (Wolf et al. 1990;
Yang et al. 2012). Salt adverse effects on plant growth under salinity also include
cytoplasm malfunctioning, membrane leakage, and loss of turgor and water.
Drought and salinity adversely influence legume-host plant symbiosis by affect-
ing the growth and survival of bacterium, delaying the infection process, suppress-
ing nodule functionality, decreasing the photosynthesis rate, plant growth and N
uptake in the host plant. There are usually interactions between drought/salinity and
rhizobium as there are bacterial strains, which are more tolerant and hence efficient
under stress. Physiological alterations under stress make the plants allocate more
carbon to their roots (Miransari and Smith, 2007; Miransari et al. 2007; 2008).
Researchers hypothesized and proved that addition of genistein (4′,5,7-trihy-
droxyisoflavone), the plant to bacterium signal, under stress, enhanced the activa-
tion rate of bacterial Nod genes resulting in the increased production of nodulation
(Nod) factors by Bradyrhizobium japonicum (Miransari et al. 2006; Wang et al.
2012) and hence faster formation of nodules (Zhang and Smith 1995; Pan and Smith
1998a; b). According to Miransari and Smith (2007, 2008, 2009) the effects of ge-
nistein became greater with time by more effectively influencing N-fixation and
hence plant growth and yield in the second sampling compared with the first sam-
pling. This also indicates that genistein persistence in soil is suitable.
Flavonoids are able to:
1. regulate the polar transport of auxin followed by the imbalance of auxin-cytoki-
nin and initiation of nodule meristem formation (Schmidt et al. 1994),
2. enhance bacterial growth,
3. increase the production of Nod factors by bacteria as a result of higher Nod genes
activation, resulting in the alteration of root morphological properties including
root hair curling and bulging and eventual formation of root nodules by inducing
cellular division at different sites, and
426 M. Miransari
4. increase root exudates of isoflavonoids (Verma et al. 1992; Zhang and Smith
1995; Corradini et al. 2011).
Under stress root growth is less affected than nodulation (Abd-Alla et al. 1998;
Miransari and Smith 2007), because under stress plant must spend more energy to
alleviate the stress rather than developing a symbiotic association with the soil mi-
crobes (Miransari and Smith 2007; Miransari et al. 2007, 2008). Nodules are tissues
with a high energy requirement and hence a part of energy produced by plant must
be allocated to nodules for different activities such as respiration and development
(Zhang and Smith 1995).
Under stress different concentrations of genistein ranging from 5 to 20 µM were
tested and proved to be effective. In addition, the highest concentration of genis-
tein (20 µM) did not adversely affect bacterial N fixation and hence plant growth.
Results indicated that with increasing the level of stress genistein became more ef-
fective. The mathematical equations used to relate genistein concentration to nodu-
lation and plant growth indicated that the most effective concentration of genistein
ranged from 5 to 11 µM. Using multivariate equations, it is possible to predict the
most optimum concentration of genistein under stress with respect to plant response
to genistein affecting plant growth and yield production under field and greenhouse
conditions (Miransari and Smith 2007).
During drought stress, water deficiency can adversely affect plant growth and
yield production. Plant roots absorb water, which moves solutes to different plant
parts for utilization and assimilation, and nutrients from the surrounding soil. Water
is necessary for cellular expansion and development by producing the necessary
turgor for cell growth. During the process of evapo-transpiration, water is evapo-
rated from plant leaf creating the necessary potential for the uptake of water and nu-
trients by plant roots and their movement to different parts of the plant. Hence, with
respect to the importance of water in plant its deficiency can significantly decrease
plant growth and yield production (Asbjornsen et al. 2011).
Under drought plant utilizes different mechanisms to alleviate the stress. Such
mechanisms result in the adjustment of plant growth and production of organic
compounds as osmoprotectants regulating cellular water potential and the uptake
of nutrients. The morphological and physiological alterations in plant growth under
drought can alleviate the stress up to some extent. Yamaghuchi et al. (2010) indi-
cated that different parts of soybean primary roots respond differently to drought
stress. They attributed such a response to the regulation of phenypropanoid metabo-
lism in different parts of the roots and hence the biosynthesis of isoflavonoids. How-
ever, contrary to this alteration, the production of caffeoyl-CoA O-methyltransferse,
which is responsible for the production of lignin, highly increased resulting in the
inhibition of root growth in the specific parts. In addition, different proteins were
produced in the water stressed part of roots to alleviate the oxidative stress.
There are some responsive genes, being induced under salinity. For example, Li
et al. (2008) found that a protein, which is homologous to oxysterol binding protein
in soybean, was expressed under salinity stress resulting in cotyledon senescence.
Under salinity, the isomer of a pathogenic related protein, as a responsive protein to
high rate of salinity and drought was localized in the extracellular space of soybean
roots. In addition, a lucine like protein was also identified in the mature tissues
of soybean shoot under saline conditions. The production of enzyme, acid phos-
phatase, was related to plant response, under salinity by affecting the formation of
reactive oxygen species as well as by affecting the transduction pathways, related
to stress (Liao et al. 2003; Sobhanian et al. 2010). The salt responsive gene, Gm-
DREB2, was expressed under salinity stress, resulting in the production of higher
levels of proline, relative to the wild types, improving plant tolerance to salinity
stress (Chen et al. 2007). It has been indicated that soybean genotypes, which are
tolerant to salinity have the same gene (Lee et al. 2004).
Relative to the wild types, the salt tolerant of soybean genotypes was due to the
inhibition of Cl− transport from the soybean roots to the shoots. However, in the
wild variety the tolerance was more related to the prevention of Na+ movement
from the plant roots to the aerial parts. This indicates that salt tolerance in the ge-
netically modified varieties have been improved relative to wild types (Lee et al.
2009).
Under stresses like salinity and drought the level of proline increases in soybean
nodules, as its synthesis is enhanced. High proline accumulation in the nodules
results in the high ratio of NADP/NADPH and hence the activation of pentose phos-
phate pathway and eventual production of purine. The derivatives of purine can act
as transporters of fixed N. Proline can be the transporter for the redox potential from
plant cytoplasm to the bacteroid, verified by the high activity of pro dehydrogenase
in the bacteroids of root nodules (Kohl 1988, 1990; Verbruggen and Hermans 2008;
Sharma and Yadav 2012).
Although plant morphological and physiological properties are altered by salin-
ity stress, the role of plant hormones is among the most important mechanisms
by which plant can alleviate the stress of salinity (Velitcukova and Fedina 1998).
Accordingly, the production of several proteins during salinity stress is induced by
plant hormones such as jasmonates (Chao et al. 1999; Thaler 1999), salicylic acid
(Hoyos and Zhang 2000) and abscisic acid (Jin et al. 2000; Wang et al. 2001; Kang
et al. 2005; Miransari 2012a).
Yoon et al. (2009) found that salinity stress significantly decreased plant
growth, gibberellins concentration, rate of photosynthesis and transpiration, and
considerably increased ABA production as well as proline accumulation. How-
ever, application of methyl jasmonate (MeJA) significantly alleviated the stress
of salinity on soybean growth, chlorophyll, photosynthesis and transpiration rate,
and proline content, while enhancing the level of ABA and gibberellins (Miran-
sari 2012a).
Calreticulin is a protein, which is able to bind calcium, and hence regulates cal-
cium homeostasis and protein folding in the plant endoplasmic reticulum. Under
salinity, osmotic stress resulted in the down regulation of calreticulin in rice, indi-
cating the role of calcium under salinity stress as the main secondary messenger.
Salinity also down regulated the activity of RuBisco activase, adversely affecting
photosynthesis (Menegazzi et al. 1993; Rokka et al. 2001; Sobhanian et al. 2010).
428 M. Miransari
The flow of cell cycling under stress must be maintained to alleviate the effects
of stress on plant growth. Cellular cycling and integrity is important for cellular
communication and signaling, particularly under stress. Using the proteomic analy-
sis, Sobhanian et al. (2010) indicated the responsive proteins in soybean, which are
expressed during salinity. They found that under salinity, the related proteins are
mostly down regulated. The results of their study showed that NaCl down regulated
the activity of Glyceraldehyde-3-phosphate dehydrogenase at both protein and m-
RNA levels in soybean. In addition, Kinesin is a large family of proteins affecting
microtubule activities and hence cell cycling (Liu et al. 1996) and its up regulation
under saline conditions indicate its role in the alleviation of stress.
Using hydroponic growing medium, Martins et al. (2008) indicated that drought
significantly decreased the mitotic activities of root cells as the expression of the
related genes was altered. Drought stress can markedly decrease the rate of photo-
synthesis, followed by stomatal closure and increased temperature. As a result of
cellular dehydration and increased leaf temperature, electron pathways are changed
during respiration, significantly decreasing the rate of ATP production in mitochon-
dria and hence the rate of photosynthesis (Flexas et al. 2004; Ribas-Carbo et al.
2005).
Plant initiates its response to stress at molecular level resulting in the alteration
of the related genes. For the start of gene expression under stress some transcrip-
tional elements like clone A2B3-2, which is a helix-loop-helix with a putative basic
(bHLH) is necessary. Such bHLH proteins are transcription factors with so many
genes (Dey and Harborne 1997; Lewin 2000; Chen et al. 2002). Accordingly, if the
related transcription factors are modified, it may be likely to enhance plant toler-
ance to stress (Jaglo-Ottosen et al. 1998).
There are carrier proteins, which are able to move carrier monomers in the cel-
lular bilayers (Cleves et al. 1991). Such kinds of proteins are able to influence the
transduction pathways, the related signal molecules, and the movement of mol-
ecules across the cellular membrane (Kapranov et al. 2001). Such proteins can also
regulate different cellular activities including perception, division and development
as well as stomatal activities. However, drought may alter the structure and activi-
ties of such proteins and plant hormones (Martins et al. 2008).
Soybean and Acidity
Acidic and infertile soils including Oxisols and Ultisols are widely distributed in the
humid areas covering about 1.6 × 109 ha of tropical soils worldwide (Sanchez and
Salinas 1981). High rain leaches the alkaline cations in the soil and results in the
high rate of weathering producing iron and aluminum oxides. Soils are subjected
to pH fluctuations usually ranging from 4 to 10. There is a wide range of alkaline
soils adversely affecting plant growth and the process of N-fixation. Under alkaline
conditions low precipitation and the accumulation of anions such as carbonate and
bicarbonate and cations such as calcium and magnesium increases soil pH, affect-
ing different soil processes including microbial activities and nutrient availability
(Joris et al. 2012).
In addition to the high H+ concentration, the high level of Al can also adversely
affect plant growth under acidic conditions. Under such conditions high Al decreas-
es plant growth by reducing root growth, the photosynthetic ability and competing
with nutrients such as N, Mg, P and Fe. In acid soils the reaction of P with Al and
Fe, results in the precipitation of P compounds and hence significantly decreases P
availability (Akaya and Takenaka 2001; Shamsi et al. 2008).
Al presence increased the activities of antioxidant enzymes including malondi-
aldehyde (MDA), super oxidase dismutase (SOD) and peroxidase (POD). Shamsi
et al. (2008) indicated that the differences in soybean genotypes under the high lev-
els of elements such as Al are determined by the root ability to absorb such metals.
Fluctuations in soil acidity can affect the physiological properties such as enzymatic
structure and activities in plants and microbes. Accordingly, neutral pH is the most
optimum acidity for the growth of crop plants and activity of soil microbes (Marti-
nez et al. 2012; Bissoli et al. 2012).
The most suitable method to adjust high soil hydroxyl concentration is the use
of elemental sulfur inoculated with the chemo-autotrophic bacteria, Thiobacillus
spp. These bacteria are able to acquire the energy necessary for their activities by
oxidizing sulfur, resulting in the production of hydrogen and sulfate ions, and hence
decreasing soil pH. Use of tolerant plant species may also be another alternative to
alleviate acidity stress on plant growth and yield production (Miransari and Smith
2007).
Soil acidity can adversely affect the process of N-fixation in leguminous plants
by affecting both the host plant and rhizobium. In a 17-year experiment under acidic
conditions Popescu (1998) found that pH’s less than six decreased soybean yield.
Usually the leguminous family is sensitive to high levels of soil acidity. High soil
acidity decreased root nodulation in white clover (Wood et al. 1984) subclover
(Whelan and Alexander 1986), pea (Lie 1969; Evans et al. 1980), cowpea (Keyser
1979), alfalfa (Munns 1968, 1970) and bean (Wolff et al. 1993; Vassileva et al.
1997) even in the presence of high rhizobial population. Soil acidity, lower than
five, inhibits nodule formation (Appunu and Dhar 2006).
There are plants, which are able to accumulate high rate of alkaline cations in
their tissues, while their growth and performance remains unaffected. Soybean
plants grow the best at pH’s around seven and under high or low acidity their growth
may be adversely affected. Under acidic conditions plants produce lower amounts
of hydrogen ions affecting the uptake of nutrients by plant roots (Marschner 1995).
It can also affect the cytoplasmic pH and hence result in the reduction of shoot and
root growth (Schubert et al. 1990; Yan et al. 1992).
Appunu and Dhar (2006) evaluated the survival of different strains of acid toler-
ant Bradyrhizobium japonicum under high acidity (pH = 4) and found that they can
tolerate high acidity level. Interestingly, the strains showed higher tolerance to acid-
ity in soil than in YEM broth medium. The slow growing Bradyrhizobium are more
tolerant to acidity than the fast growing rhizobium (Cooper et al. 1985; Graham
et al. 1994; Miransari and Smith 2007; Ferreira et al. 2012). All the tolerant spe-
430 M. Miransari
cies were able to noldulate the soybean roots with high differences in nodulation,
nitrogenase activity, N uptake and plant growth (Zhang et al. 2002; Meghvanshi
et al. 2005). Inoculation with the bacterium significantly enhanced the growth and
N uptake of soybean plants.
The most sensitive stages of nodulation to acidity appear to be the early stages
including attachment (Howieson et al. 1993), root morphological changes (Munns
1968; Evans 1980; Miransari et al. 2006) and the formation of infection tread
(Evans 1980; Franco and Munns 1982). The followings may indicate the higher
sensitivity of the early stages of N-fixation to low pH: decreased rhizobial number
and growth, changes in the structure of plant roots adversely affecting bacterial rec-
ognition and higher uptake of some nutrients (Vassileva et al. 1997; Miransari et al.
2006; Miransari and Smith 2007; Ferreira et al. 2012).
The onset of N-fixation is with the exchange of signal molecules between the
bacteria and the host plant. Plant roots produce different products with nutritional
and non-nutritional values acting as secondary metabolites. Secondary metabolites,
which are necessary with a threshold level of 10−12 M have different functioning in
plant including the activation of microbial genes during the process of symbiosis
(Boller 1995).
For the onset of N-fixation the specific host plant produces flavonoids, which are
able to trigger the bacterial chemotaxis response and movement toward the plant
roots. Subsequently, the nodulation genes (Nod genes) in bacteria are activated, re-
sulting in the production of lipochitooligosacharides (LCO) by bacteria (Subrama-
nian et al. 2004). LCO molecules are able to induce morphological changes in the
roots of their host plant by curling or bulging the root hairs, inducing cell cycling,
and stimulation of nodule formation. These stages are followed by the formation
of infection thread, which results in the entrance of bacteria into the plant roots.
Bacteria alter some of the root cellular, morphological and physiological activities,
which can increase the division rate of root cortical cells resulting in the formation
of root nodules (Aguilar et al. 1988; Long 2001; Miransari et al. 2006, Miransari
and Smith 2007, 2008, 2009).
Miransari and Smith (2007) hypothesized that stress results in the disruption of
the signal molecule exchange between the bacteria and the host plant at the onset of
symbiosis under acidity. They also hypothesized and proved that preincubation of
Bradyrhizobium japonicum inoculum with the signal molecule genistein may par-
tially or completely inhibit the adverse effects of stress on the process of N-fixation
under greenhouse and field conditions. By addition of salt or sulfur to the field soil
they adjusted soil salinity and pH to the desired values, followed by the plantation
of soybean seeds, and inoculation with the bacteria preincubated with genistein at
µM levels. Different nodulation and soybean growth and yield parameters were
measured both under salinity and acidity treatments. According to the results, ge-
nistein could alleviate the stress of salinity and acidity on soybean nodulation and
hence N-fixation as well as soybean yield production. The enhancing effects of
genistein on nodulation could be due to increasing the possibility of infection, re-
sulting in the higher number of infections and nodulation (Zhang and Smith 1995).
Under stress the production of signal molecules by soybean root as well as the sen-
sitivity of Badyrhizobium japonicum to the signal molecule is decreased resulting

in the inhibition of N-fixation process. (Miransari and Smith 2007, 2008, 2009).
Soybean and Suboptimal Root Zone Temperature
There are areas in the world, which are subjected to sub optimal root zone tempera-
ture, most of the year. Under such conditions plant growth as well as microbial ac-
tivities is adversely affected. The symbiotic association between the host plant and
the N-fixing bacteria is also influenced by suboptimal root temperature, resulting in
the decline of N-fixation between the two symbionts. Similar to other stresses, sub-
optimal root temperature can also disrupt the initials stages of N-fixation, most im-
portantly the exchange of the signal molecules between the two symbionts (Smith
and Lynch 1993; Miransari 2012b).
The optimum temperature for soybean growth is between 25 and 30 °C (Lynch
and Smith 1993). Falvonoids can act as Nod gene inducers and also enhance plant
resistance to pathogens in soil. Higher rates of flavonoids are produced at higher
temperature by plant roots. Accordingly, under lower temperature higher concen-
tration of signal molecule may be necessary to induce the molecular changes in
rhizobium as the effectiveness of the signal molecule is temperature dependent. The
signal molecule by itself and its concentration can also affect the communications
between the two symbionts (Miransari and Smith 2008; Miransari 2012b).
The activity of nitrogenase enzyme is oxygen dependent and under stress where
plant growth is adversely affected the nodules permeability to oxygen may also
change. This may influence nodule functionality by affecting the activity of nitroge-
nase enzyme (Wei and Layzell 2006). Temperature fluctuations can alter root respi-
ratory demand and its permeability to oxygen. Hence, plant can use such a mecha-
nism to regulate root permeability to oxygen under decreased temperature, which
reduces root permeability to oxygen (Kuzma and Layzell 1994; Wang et al. 2012).
Using intact soil samples in cylinders, collected from the field soil, Miransari and
Smith (2008) stimulated some of the field conditions under greenhouse conditions.
They found that soil texture may also affect the signal communications between the
host plant and rhizobium. This has been attributed mostly to the physical properties
of the different soil textures. According to their results genistein addition was more
effective under loamy and clay textures. Textures with finer particles have a higher
rate of microporosity. Finer soil textures are higher in soil nutrients, because of their
chemical structure and hence can provide more nutrients to the soil microbes as well
as plant roots affecting their activities.
Different microbial activities are affected by soil texture including mineralization
of organic matter, microbial biomass, respiration, nitrification and denitrification
(Hassink 1992). Soils, with a more improved structure, result in the higher produc-
tion of roots exudates influencing microbial activities more effectively. Van Gestel
et al. (1996) indicated that relative to the bacterial population in sandy soils (7 %),
significantly higher bacterial population was found in clay soils (More than 50 %).
432 M. Miransari
There are some kind of interactions between genistein and some plant regula-
tors such as the plant hormone, auxin. Falvonoids can adversely or positively affect
the activity and transport of auxin (Brown et al. 2001). Geneistin may inhibit the
transport of auxin in the plant. It has been indicated that the use of auxin transport
inhibitors in soybean may result in the formation of nodule like organs, and expres-
sion of genes, which induce morphogenesis alteration in the roots resulting in the
formation of root nodules (Fang and Hirsch 1998).
Soybean and N Fertilization
During the past 30 years, soybean yield has increased continuously, due to the im-
provement in the use of genetic techniques and agricultural practices with the yearly
increase of 28 kg ha−1, globally (Specht et al. 1999; Wilcox 2004). Biological N
fixation and mineral N fertilization are the main sources of providing necessary
N for soybean growth. However, biological N fixation by the residing bacteria in
the root nodules and mineral N fertilization can behave antagonistically, especially
when the other soil stresses are not present (Streeter 1988; Soares Novo et al. 1999;
Purcell et al. 2004).
If there is not adequate amounts of N for plant use, plant will re-translocate N
from the leaf to the grains, reducing plant photosynthetic potential and hence crop
production. Van Kessel and Hartley (2000) indicated that rate of yield production
can adjust nitrogenase activity, as higher amounts of yield results in higher nitro-
genase activity. This is especially the case for when soybean plants yield at rates
higher than 4.5 t. ha−1 (Mengel 1994).
In situations where the process of N-fixation is not able to supply the necessary
N for plant growth and yield production, plant response to N-fertilization can be sig-
nificant (Thies et al. 1995). However, usually there are antagonistic effects between
N-fixation and N-fertilization. Nitrate present in the soil can decrease the process
of N-fixation (Herridge and Rose 1994). Even little amounts of N-fertilization can
suppress N-fixation during the first stages of plant growth; however at the same
time N deficiency may delay the onset of nodule formation and hence, N-fixation
by adversely affecting crop growth (Zhang and Smith 2002; Ikeda et al. 2011).
Salvagiotti et al. (2008) analysed a complete set of data regarding N-fixation and
N-fertilization related to different parts of the world. They found that N-fixation
is negatively and exponentially related to N-fertilization when it was applied to
the soil surface at 20 cm. Their economical analyses, with respect to soybean and
N-fertilization pricing, indicated that N-fertilization is advantageous when plant re-
quirements are not met by the process of N-fixation. They accordingly suggested
that to enhance the efficiency of N uptake by plant, future research must indicate
the contribution of each N component including, N-fixation, N-fertilization and
soil N. It is because, if N-fertilization is supplied adequately, while not affecting
N-fixation, it can enhance the efficiency of plant N uptake (Ikeda et al. 2011).
It has been suggested and tested that plants be modified genetically for nitrate
tolerant; however such a method has not been appropriate, because it resulted in the
reduction of crop yield (Salvagiotti et al. 2008). Although the physiological altera-
tions in plant metabolism is one of the main reasons for decreased N-fixation at the
time of N-fertilization, however the other important reason is that the process of
N-fixation is demanding and requires high rate of energy spent by the host plant;
when N-fertilization provides mineral N for plan use, the plant will not be willing
to develop a symbiotic association with the bacteria, adversely affecting the process
of N fixation.
Handling crop plants under stress is among the most important research issues. Soy-
bean is a leguminous crop plant most used by human. Although it is not considered
a tolerant crop plant to stress, research has indicated that it is likely to alleviate the
effects of different stresses such as acidity, salinity, sub optimal roots zone tempera-
ture and N-fertilization on soybean growth and yield using molecular and breeding
methods. Researchers have tested and proved that use of the plant to bacteria signal,
genistein, for the pre incubation of soybean symbiotic bacteria, Bradyrhizobium
japonicum can be useful to alleviate the unfavorable effects of stress on soybean
growth and yield. Identification of tolerant genes in different plant species and in-
serting them in soybean may also be effective to alleviate stress.
Although research work has indicated much detail related to the handling of
soybean under stress, there are more, which must be elucidated. For example, us-
ing proteomic analysis, the production of different proteins under stress must be
indicated and accordingly the related genes be recognized and inserted to produce
tolerant varieties. The other important point is the production of tolerant rhizobium
under stress, which may also be similarly recognized and produced.
References
Abd-Alla MH, Vuong TD, Harper JE (1998) Genotypic differences in dinitrogen fixation response
to NaCl stress in intact and grafted soybean. Crop Sci 38:72–77
Aguilar JM, Ashby AM, Richards JM, Loake GJ, Watson MD, Shaw CH (1988) Chemotaxis of
Rhizobium leguminosarum biovar phaseoli towards flavonoid inducers of the symbiotic nodu-
lation genes. J Genetical Microbiol 134:2741–2746
Akaya M, Takenaka C (2001) Effects of aluminum stress on photosynthesis of Quercus glauca
Thumb. Plant Soil 237:137–146
Appunu C, Dhar B (2006) Symbiotic effectiveness of acid-tolerant Bradyrhizobium strains with
soybean in low pH soil. Afric J Biotechnol 5:842–845
Asbjornsen H, Alvardo-Barrientos MS, Rebel K, Van Osch FP, Rietkerk M, Chen J, Gotsch S, To-
bon C, Geissert DR, Gomez-Tagle A, Kellie V, Dawson TE (2011) Ecohydrological advances
and applications in plant–water relations research: a review. J Plant Ecol 4:3–22
434 M. Miransari
Bissoli G, Niñoles R, Fresquet S, Palombieri S, Bueso E, Rubio L, Sánchez M, Fernández J, Mulet

J, Serrano R (2012) Peptidyl-prolyl cis-trans isomerase ROF2 modulates intracellular pH ho-
meostasis in Arabidopsis. Plant J 70:704–716
Boller T (1995) Chemoreception of microbial signals in plant cells. Ann Rev Plant Physiol Plant
Mol Biol 46:189–214
Brown DE, Rashotte AM, Murphy A, Normanly J, Tague BW, Peer WA, Taiz L, Muday GK (2001)
Flavonoids act as negative regulators of auxin transport in vivo in Arabidopsis. Plant Physiol
126:524–535
Chao WS, Gu YQ, Pautot V, Bray EA, Walling LL (1999) Leucine aminopeptidase RNAs, pro-
teins, and activities increase in response to water deficit, salinity, and the wound signals syste-
min, methyl jasmonate, and abscisic acid. Plant Physiol 120:979–992
Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang H-S, Eulgem T, Mauch F, Luan S, Zou G,
Whitham SA, Budworth PR, Tao Y, Xie RT (2002) Expression profile matrix of Arabidop-
sis transcription factor genes suggest their putative functions in response to environmental
stresses. Plant Cell 14:559–574
Chen M, Wang QY, Cheng XG, Xu ZS, Li LC, Ye XG, Xia LQ, Ma YZ (2007) GmDREB2, a soy-
bean DRE-binding transcription factor, conferred drought and high-salt tolerance in transgenic
plants. Biochem Biophys Res Commun 353:299–305
Cleves AE, Mcgee TP, Bankaitis VA (1991) Phospholipid transfer proteins: a biological debut.
Trends Cell Biol 1:30–34
Corradini E, Foglia P, Giansanti P, Gubbiotti R, Samperi R, Lahana A (2011) Flavonoids: chemical
properties and analytical methodologies of identification and quantitation in foods and plants.
J Nat Prod 25:469–495
Cooper J, Wood M, Bjourson A (1985) Nodulation of Lotus pedunculatus in acid rooting solution
by fast- and slow-growing rhizobia. Soil Biol Biochem 17:487–492
De Graaff M-A, Van Groenigen K-J, Six J, Hungate B, Van Kessel C (2006) Interactions between
plant growth and soil nutrient cycling under elevated CO2: a meta-analysis. Glob Change Biol
12:2077–2091
Dey PM, Harborne JD (1997) Plant Biochemistry. Academic, San Diego, p 554
Evans L, Lewin K, Vella F (1980) Effect of nutrient medium pH on symbiotic nitrogen fixation by
Rhizobium leguminosarum and Pisum sativum. Plant Soil 56:71–80
Evans L (1993) Crop evolution, adaptation, and yield. Cambridge University Press, Cambridge
Fang Y, Hirsch AM (1998) Studying early nodulin gene ENOD40 expression and induction by
nodulation factor and cytokinin in transgenic alfalfa. Plant Physiol 116:53–68
Fangmeier A, De Temmerman L, Mortensen L, Kemp K, Burke J, Mitchell R, van Oijen M, Weigel
HJ (1999) Effects of nutrients on grain quality in spring wheat crops grown under elevated
CO2 concentrations and stress conditions in the European multiple-site experiment ‘ESPACE-
wheat’. Europ J Agron 10:215–229
Finzi AC, Austin AT, Cleland EC, Frey SD, Houlton BZ, Wallenstein MD (2011) Responses and
feedbacks of coupled biogeochemical cycles to climate change: examples from terrestrial eco-
systems. Front Ecol Environ 9:61–67
Flexas J, Bota J, Loreto F, Cornic G, Sharkey TD (2004) Diffusive and metabolic limitations to
photosynthesis under drought and salinity in C3 plants. Plant Biol 6:269–279
Flowers TJ, Yeo AR (1995) Breeding for salinity resistance in crop plants—where next? Aust J
Franco AA, Munns DN (1982) Acidity and aluminum restraints on nodulation, nitrogen fixation,
and growth of Phaseolus vulgaris in solution culture. Soil Sci Soc Am J 46:296–301
Ferreira P, Bmfeti C, Soares B, Moreira F (2012) Efficient nitrogen-ixing Rhizobium strains iso-
lated from amazonian soils are highly tolerant to acidity and aluminium. World J Microbiol
Garg N, Bhandari P (2012) Influence of cadmium stress and arbuscular mycorrhizal fungi on nod-
ule senescence in Cajanus Cajan (L.) MILLSP. Inter J Phytorem 14:62–74
Graham PH, Draeger K, Ferrey ML, Conroy MJ, Hammer BE, Martinez-Romero E, Naarons
SR, Quinto C (1994) Acid pH tolerance in strains of Rhizobium and Bradyrhizobium, and
initial studies on the basis for acid tolerance of Rhizobium tropici UMR1899. Can J Microbiol
40:198–207
Hamilton TL, Lange RK, Boyd ES, Peters JW (2011) Biological nitrogen fixation in acidic high-
temperature geothermal springs in Yellowstone National Park, Wyoming. Environ Microbiol
13:2204–2215
Hassink J (1992) Effects of soil texture and structure on carbon and nitrogen mineralization in
grassland soils. Biol Fert Soils 14:126–134
Herridge DF, Rose IA (1994) Heritability and repeatability of enhanced N2 fixation in early and
late inbreeding generations of soybean. Crop Sci 34:360–367
Herridge DF, Peoples MB, Boddey RM (2008) Global inputs of biological nitrogen fixation in
agricultural systems. Plant Soil 311:1–18
Howieson JG, Robson AD, Bottomley PJ (1993) External phosphate and calcium concentrations,
and pH, but not the products of rhizobial nodulation genes affect the attachment of Rhizobium
meliloti to roots of annual medics. Soil Biol Biochem 25:567–573
Hoyos M, Zhang SQ (2000) Calcium-independent activation of salicylic acid-induced protein ki-
nase and a 40-kilodalton protein kinase by hyper osmotic stress. Plant Physiol 122:1355–1363
Hungria M, Franchini J, Campo R, Graham P (2005) The importance of nitrogen fixation to soy-
bean cropping in South America. In: Werner D, Newton W (eds) Nitrogen fixation in agricul-
ture, forestry, ecology, and the environment. Springer, Netherlands, pp 25–42
Jaglo-Ottosen K, Gilmour SJ, Zarka DG, Schabenberger O, Thomashow MF (1998) Arabdopisis
CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280:104–
106
Joris H, Caires E, Bini A, Scharr D, Haliski A (2012) Effects of soil acidity and water stress on corn
and soybean performance under a no-till system. Plant Soil 365:409−424
Jin S, Chen C, Plant AL (2000) Regulation by ABA of osmotic-stress-induced changes in protein
synthesis in tomato roots. Plant Cell Environ 23:51–60
Ikeda S, Anda M, Inaba S, Eda S, Sato S, Sasaki K, Tabata S, Mitsui H, Sato T, Shinano T, Mina-
misawa K (2011) Autoregulation of nodulation interferes with impacts of nitrogen fertiliza-
tion levels on the leaf-associated bacterial community in soybeans. Appl Environ Microbiol
77:1973–1980
Kang DJ, Seo YJ, Lee JD, Ishii R, Kim KU, Shin DH, Park SK, Jang SW, Lee IJ (2005) Jasmonic
acid differentially affects growth, ion uptake and abscisic acid concentration in salttolerant and
salt-sensitive rice cultivars. J Agron Crop Sci 191:273–282
Kapranov P, Routt SM, Bankaitis VA, Bruijn FJ, Szczyglowski K (2001) Nodule-specific regula-
tion of phosphatidylinositol transfer protein expression in Lotus japonicus. Plant Cell 13:1369–
1382
Keyser H, Munns D, Hohenberg J (1979) Acid tolerance of rhizobia in culture and in symbiosis
with cowpea. Soil Sci Soc Am J 43:719–722
Kohl DH, Schubert KR, Carter MB, Hagedorn CH, Shearer G (1988) Proline metabolism in N2-
fixing root nodules: energy transfer and regulation of purine synthesis. Proc Nat Acad Sci U S
A 85:2036–2040
Kohl DH, Lin JJ, Shearer G, Schubert KR (1990) Activities of the pentose phosphate pathway and
enzymes of proline metabolism in legume root nodules. Plant Physiol 94:1258–1264
Kuzma M, Layzell DB (1994) Acclimation of soybean nodules to changes in temperature. Plant
Physiol 106:263–270
Lauchli A (1984) Salt exclusion: an adaptation of legumes for crops and pastures under saline
conditions. In: Staples RC, Toeniessen GH (eds) Salinity tolerance in plants. Strategies for crop
improvement. Wiley, New York, pp 171–187
Lee GJ, Boerma RH, Villagarcia RM, Zhu X, Carter TE Jr, Li Z, Gibbs MO (2004) A major OTL
conditioning salt tolerance in S-100 and descendent cultivars. Theor Appl Genet 109:610–1619
Lee J, Shannon G, Vuong T, Nguyen H (2009) Inheritance of Salt Tolerance in Wild Soybean
(Glycine soja Sieb. and Zucc.) accession PI483463. J Hered 100:798–801
Lewin B (2000) Genes VII. Oxford University Press, New York, p 990
436 M. Miransari
Li DY, Inoue H, Takahashi M, Kojima T, Shiraiwa M, Takahara H (2008) Molecular characteriza-

tion of a novel salt-inducible gene for an OSBP (oxysterol binding protein)-homologue from
soybean. Gene 407:12–20
Liao H, Wong FL, Phang TH, Cheung MY, Li WYF, Shao G, Yan X, Lam HM (2003) GmPAP3, a
novel purple acid phosphatase-like gene in soybean induced by NaCl stress but not phosphorus
deficiency. Gene 318:103–111
Lie TA (1969) The effect of low pH on different phases of nodule formation in pea plants. Plant
Soil 31:391–406
Liu B, Cyr RJ, Palevitza BA (1996) A Kinesin-like protein, KatAp, in the cells of Arabidopsis and
other Plants. Plant Cell 8:119–132
Long S (2001) Genes and signals in the Rhizobium-legume symbiosis. Plant Physiol 125: 69–72
Long SP, Naidu SL (2002) Effects of oxidants at the biochemical, cell and physiological levels,
with particular reference to ozone. In: Bell JNB, Treshow M (eds) Air Pollution and Plant Life.
Wiley, UK, pp 69–88
Lu K, Cao B, Feng X, He Y, Jiang D (2009) Photosynthetic response of salt-tolerant and sensitive
soybean varieties. Photosynthetica 47:381–387
Lynch DH, Smith DL (1993) Soybean ( Glycine max (L.) Merr.) nodulation and N2 fixation as
affected by period of exposure to a low root zone temperature. Physiologia Plant 88:212–220
Marschner H (1995) Mineral Nutrition of Higher Plants. Academic, London
Martins P, Jordão B, Yamanaka N, Farias J, Beneventi M, Binneck E, Fuganti R, Stolf R, Nepo-
muceno A (2008). Differential gene expression and mitotic cell analysis of the drought tolerant
soybean ( Glycine max L. Merrill Fabales, Fabaceae) cultivar MG/BR46 (Conquista) under two
water deficit induction systems. Genet Mol Biol 31:512–521
Martinez K, Kitko R, Mershon JP, Adcox H, Malek K, Berkmen M, Slonczewski J (2012) Cyto-
plasmic pH response to acid stress in individual cells of Escherichia coli and Bacillus subtilis
observed by fluorescence ratio imaging microscopy. Appl Environ Microbiol 78:3706–3714
Meghvanshi MK, Prasad K, Mahna SK (2005) Identification of pH tolerant Bradyrhizobium ja-
ponicum strains and their symbiotic effectiveness in soybean ( Glycine max (L.) Merr.) in low
nutrient soil. Afric J Biotechnol 4:663
Meilhoc E, Boscari A, Bruand C, Puppo A, Brouquisse R (2011) Nitric oxide in legume-rhizobium
symbiosis. Plant Sci 181:573–581
Mengel K (1994) Symbiotic dinitrogen fixation—its dependence on plant nutrition and its eco-
physiological impact. Z Pflanzenernähr Bodenkd 157:233–241
Menegazzi P, Guzzo F, Baldan B, Mariani P, Treves S (1993) Purification of calreticulin-like
protein(s) from spinach leaves. Biochem Biophys Res Commun 190:1130–1135
Miransari M, Balakrishnan P, Smith DL, Mackenzie AF, Bahrami HA, Malakouti MJ, Rejali F
(2006) Overcoming the stressful effect of low pH on soybean root hair curling using lipochi-
tooligosaccahrides. Commun Soil Sci Plant Anal 37:1103–1110
Miransari M, Smith DL (2007) Overcoming the stressful effects of salinity and acidity on soybean
( Glycine max (L.) Merr.) nodulation and yields using signal molecule genistein under field
conditions. J Plant Nutr 30:1967–1992
Miransari M, Bahrami HA, Rejali F, Malakouti MJ, Torabi H (2007) Using arbuscular mycorrhiza
to reduce the stressful effects of soil compaction on corn ( Zea mays L.) growth. Soil Biol
Biochem 39:2014–2026
Miransari M, Smith DL (2008) Using signal molecule genistein to alleviate the stress of subopti-
mal root zone temperature on soybean-Bradyrhizobium symbiosis under different soil textures.
J Plant Interact 3:287–295
Miransari M, Bahrami HA, Rejali F, Malakouti MJ (2008) Using arbuscular mycorrhiza to reduce
the stressful effects of soil compaction on wheat ( Triticum aestivum L.) growth. Soil Biol
Biochem 40:1197–1206
Miransari M, Smith D (2009) Alleviating salt stress on soybean ( Glycine max (L.) Merr.)––Brady-
rhizobium japonicum symbiosis, using signal molecule genistein. Europ J Soil Biol 45:146–152
Miransari M (2010) Biological fertilization. In: Méndez-Vilas A (ed) Current research, technology
and education topics in applied microbiology and microbial biotechnology. Microbiology book
series––2010 Edition, Spain.
Miransari M, Mackenzie AF (2010) Wheat ( Triticum aestivum L.) grain N uptake as affected by
soil total and mineral N, for the determination of optimum N fertilizer rates for wheat produc-
tion. Commun Soil Sci Plant Anal 41:1644–1653
Miransari M (2011) Soil microbes and plant fertilization. Review article. Appl Microbiol Biotech-
nol 92:875–885
Miransari M, Mackenzie AF (2011a) Development of a soil N-test for fertilizer requirements for
corn ( Zea mays L.) production in Quebec. Commun Soil Sci Plant Anal 42:50–65
Miransari M, Mackenzie AF (2011b) Development of a soil N test for fertilizer requirements for
wheat. J Plant Nutr 34:762–777
Miransari M (2012a) Role of phytohormone signaling during stress. In: Ahmad P, Prasad MNV
(eds) Environmental adaptations and stress tolerance of plants in the era of climate change, 1st
edn. Springer, p 715, ISBN 978-1-4614-0814-7
Miransari M (2012b) Microbial Products and Soil Stresses. In: Maheshwari DK (ed) Bacteria in
agrobiology: stress management. Springer, p 333, ISBN 978-3-642-23464-4
Munns DN (1968) Nodulation of Medicago sativa in solution culture. I. Acid sensitive steps. Plant
Soil 28:129–146
Munns DN (1970) Nodulation of Medicago sativa in solution culture. V. Calcium and pH require-
ments during infection. Plant Soil 32:90–102
Munns R (2002) Comparative physiology of salt and water stress. Plant Cell Environ 25:239–250
Pan B, Smith DL (1998a) Genistein addition to the rhizosphere of soybean ( Glycine max L. Merr.)
at the onset of nitrogen fixation increases nodulation. J Plant Nutr 21:1631–1639
Pan B, Zhang F, Smith DL (1998b) Genistein addition to the soybean rooting medium increases
nodulation. J Plant Nutr 21:1631–1639
Pausch RC, Mulchi CL, Lee EH, Meisinger JJ (1996) Use of 13C and 15N isotopes to investigate
O3 effects on C and N metabolism in soybeans. Part II. Nitrogen uptake, fixation, and partition-
ing. Agric Ecosys Environ 60:61–69
Popescu A (1998) Contributions and limitations to symbiotic nitrogen fixation in common bean
( Phaseolus vulgaris L.) in Romania. Plant Soil 204:117–125
Purcell, L, Serraj R, Sinclair T, De A (2004) Soybean N2 fixation estimates, ureide concentration,
and yield responses to drought. Crop Sci 44:484–492
Ribas-Carbo M, Taylor NL, Giles L, Busquets S, Finnegan PM, Day DA, Lambers H, Medrano
H, Berry JA, Flexas J (2005) Effects of water stress on respiration in soybean leaves. Plant
Physiol 139:466–473
Rogers A, Gibon Y, Stitt M, Morgan PB, Bernacchi CJ, Ort DR, Long SP (2006) Increased C avail-
ability at elevated carbon dioxide concentration improves N assimilation in a legume. Plant
Cell Environ 29:1651–1658
Rokka A, Zhang L, Aro EM (2001) Rubisco activase: an enzyme with a temperature dependent
dual function? Plant J 25:463–471
Sakthivelu G, Devi M, Giridhar P, Rajasekaran T, Ravishankar G, Nedev T, Kosturkova G (2008)
Drought-induced alterations in growth, osmotic potential and in vitro regeneration of soybean
cultivars. Gen Appl Plant Physiol Special Issue 34:103–112
Salah IB, Slatni T, Gruber M, Messedi D, Gandour M, Benzarti M, Haouala R, Zribi K, Hamed
KB, Perez-Alfocea F, Abdelly C (2011) Relationship between symbiotic nitrogen fixation,
sucrose synthesis and anti-oxidant activities in source leaves of two Medicago ciliaris lines
cultivated under salt stress. Environ Exp Bot 70:166–173
Salon C, Munier-Jolain NG, Duc G, Voisin AS, Grandgirard D, Larmure D, Emery RJN, Ney B
(2001) Grain legume seed filling in relation to nitrogen acquisition: a review and prospects
with particular reference to pea. Agronomie 21:539–552
Salvagiotti F, Cassman K, Specht J, Walters D, Weiss A, Dobermann A (2008) Nitrogen uptake,
fixation and response to fertilizer N in soybeans: a review. Field Crops Res 108:1–13
438 M. Miransari
Sanchez PA, Salinas JG (1981) Low-input technology for managing Oxisols and Ultisols in tropi-
cal America. Adv Agron 34:279–406
Schmidt P, Broughton W, Werner D (1994) Nod factors of Bradyrhizobium japonicum and Rhizo-
bium sp. NGR34 induce flavonoid accumulation in soybean root exudate. Mol Plant-Microb
Schubert S, Schubert E, Mengel K (1990) Effect of low pH of the root medium on proton release,
growth, and nutrient uptake of field beans ( Vicia faba). Plant Soil 124:239–244
Shamsi IH, Wei K, Zhang GP, Jilani GH, Hassan MJ (2008) Interactive effects of cadmium and
aluminum on growth and antioxidative enzymes in soybean. Biologia Plant 52: 165–169
Sharma P, Yadav A (2012) Symbiotic characterization of mutants defective in proline dehydroge-
nase in Rhizobium sp. Cajanus under drought stress condition. Europ J Exp Biol 2:206–216
Sobhanian H, Razavizadeh R, Nanjo Y, Ehsanpour A, Rastgar Jazii F, Motamed N, Komatsu S
(2010) Proteome analysis of soybean leaves, hypocotyls and roots under salt stress. Proteome
Sci 8:1–15
Soares Novo MC, Tanaka RT, Mascarenhas HAA, Bortoletto N, Gallo PB, Alves Pereira JCVN,
Teixeira Vargas AA (1999) Nitrogênio e potassio na fixação simbiotica de N2 por soja cultivada
no inverno. Scientia Agricola 56:143–156
Sorensen P, Lett S, Michelsen (2012) Moss-specific changes in nitrogen fixation following two
decades of warming, shading, and fertilizer addition. Plant Ecol 213:695–706
Specht JE, Hume DJ, Kumudini SV (1999) Soybean yield potential—a genetic and physiological
perspective. Crop Sci 39:1560–1570
Stitt M, Krapp A (1999) The interaction between elevated carbon dioxide and nitrogen nutrition:
the physiological and molecular background. Plant Cell Environ 22:583–621
Streeter J (1988) Inhibition of legume nodule formation and N2 fixation by nitrate. CRC Crit Rev
Plant Sci 7:1–23
Subramanian S, Hu Z, Lu G, Odelland JT, Yu O (2004) The promoters of two isoflavone synthase
genes respond differentially to nodulation and defense signals in transgenic soybean roots.
Taub DR, Miller B, Allen H (2008) Effects of elevated CO2 on the protein concentration of food
crops: a meta-analysis. Glob Change Biol 14:565–575
Thaler JS (1999) Jasmonate-inducible plant defenses cause increased parasitism of herbivores.
Nature 399:686–688
Thies JE, Singleton PW, Bohlool BB (1995) Phenology, growth, and yield of field-grown soybean
and bush bean as a function of varying modes of N nutrition. Soil Biol Biochem 27:575–583
Ti C, Pan J, Xia Y, Yan X (2012) A nitrogen budget of mainland China with spatial and temporal
variation. Biocheochem 108:381–394
Townsend AR, Cleveland CC, Houlton BZ, Alden CB, White JWC (2011) Multi-element regula-
tion of the tropical forest carbon cycle. Front Ecol Environ 9:9–17
Unkovich MJ, Pate JS (2000) An appraisal of recent field measurements of symbiotic N2 fixation
by annual legumes. Field Crops Res 65:211–228
Valliyodan B, Nguyen H (2008) Genomics of Abiotic Stress in Soybean. In: Stacey G (ed) Genet-
ics and genomics of soybean. Springer Science + Business Media, New York
Van Gestel M, Merckx R, Vlassak K (1996) Spatial distribution of microbial biomass in micro-
aggregates of a silty-loam soil and the relation with the resistance of microorganisms to soil
drying. Soil Biol Biochem 28:503–510
Van Kessel C, Hartley C (2000) Agricultural management of grain legumes: has it led to an in-
crease in nitrogen fixation? Field Crops Res 65:165–181
Vassileva V, Milanov G, Ignatov G, Nikolov B (1997) Effect of nitrogen fixation of common bean
grown at various calcium and nitrate levels. J Plant Nutr 20:279–294
Velagaleti RR, Marsh S, Kramer D, Fleischman D, Corbin J (1990) Genotypic differences and
nitrogen fixation among soybean ( Glycine max L.) cultivars grown under salt-stress. Tropic
Agric 67:169–177
Velitcukova M, Fedina I (1998) Response of photosynthesis of Pisum sativum to salt stress as af-
fected by methyl jasmonate. Photosynthetica 35:89–97
Verbruggen N, Hermans C (2008) Proline accumulation in plants: a review. Amino Acids 35:753–
759
Vercruysse M, Fauvart M, Jans A, Beullens S, Braeken K, Cloots L, Engelen K, Marchal K, Mich-
iels J (2011) Stress response regulators identified through genome-wide transcriptome analysis
of the (p)ppGpp-dependent response in Rhizobium etli. Genome Biol 12:R17
Verma D (1992) Signals in root nodule organogenesis and endocytosis of Rhizobium. Plant Cell
4:373–382
Wang Y, Mopper S, Hasenstein KH (2001) Effects of salinity on endogenous ABA, IAA, JA and
SA in Iris hexagona. J Chem Ecol 27:327–342
Wang X, Pan Q, Chen F, Yan X, Liao H (2011) Effects of co-inoculation with arbuscular mycor-
rhizal fungi and rhizobia on soybean growth as related to root architecture and availability of
N and P. Mycorrhiza 21:173–181
Wang N, Khan W, Smith DL (2012) Changes in soybean global gene expression after application
of lipo-chitooligosaccharide from Bradyrhizobium japonicum under sub-optimal temperature.
PLoS ONE 7:e31571
Wei H, Layzell DB (2006) Adenylate-coupled ion movement. A mechanism for the control of
nodule permeability to O2 diffusion1[OA]. Plant Physiol 141:280–287
Whelan AM, Alexander M (1986) Effects of low pH and high Al, Mn and Fe levels on the survival
of Rhizobium trifolii and nodulation of subterranean clover. Plant soil 92:363–371
Wilcox JR (2004) World distribution and trade of soybean. In: Boerma HR, Specht JE (eds) Soy-
beans: improvement, Production and Uses, ASA, CSSA, ASSA (2004), pp 1–13
Wolf O, Jeschke WD, Hartung W (1990) Long-distance transport of abscisic acid in NaCl-treated
intact plants of Lupinus albus. J Exp Bot 41:593–600
Wolff AB, Singleton PW, Sidirelli M, Bohlool BB (1993) Influence of acid soil on nodulation and
inter strain competitiveness in relation to tannin concentrations in seeds and roots of Phaseolus
vulgaris. Soil Biol Biochem 25:715–721
Wood M, Cooper JE, Holding AJ (1984) Soil acidity factors and nodulation of Trifolium repens.
Yamaguchi M, Valliyodan B, Zhang J, Lenoble M, Yu O, Rogers E, Nguyen H, Sharp R (2010)
Regulation of growth response to water stress in the soybean primary root. I. Proteomic analy-
sis reveals region-specific regulation of phenylpropanoid metabolism and control of free iron
in the elongation zone. Plant Cell Environ 33:223–243
Yan F, Schubert S, Mengel K (1992) Effect of low root medium pH on net proton release, root res-
piration, and root growth of corn ( Zea mays L.) and broad bean ( Vicia faba L.). Plant Physiol
99:415–421
Yang L, Ji W, Gao P, Li Y, Cai H, et al (2012) GsAPK, an ABA-Activated and Calcium-Indepen-
dent SnRK2-Type Kinase from G. soja, mediates the regulation of plant tolerance to salinity
and ABA stress. PLoS ONE 7:e33838
Yasmin K, Cadisch G, Baggs EM (2006) Comparing 15N labelling techniques for enriching above-
and below ground components of the plant–soil system. Soil Biol Biochem 38:397–400
Yoon Y, Hamayun M, Lee S, Lee I (2009) Methyl jasmonate alleviated salinity stress in soybean.
J Crop Sci Biotechnol 12:63–68
Zhang F, Smith DL (1995) Preincubation of Bradyrhizobium japonicum with genistein accelerates
nodule development of soybean ( Glycine max. (L.) Merr.) at suboptimal root zone tempera-
tures. Plant Physiol 108:961–968
Zhang F, Smith DL (2002) Interorganismal signaling in suboptimum environments: the legume-
rhizobia symbiosis. Adv Agron 76:125–161
Zhang H, Daoust F, Charles TC, Driscoll BT, Prithiviraj B, Smith DL (2002) Bradyrhizobium ja-
ponicum mutants allowing improved nodulation and nitrogen fixation of field grown soybean
in a short season area. J Agric Sci 138:293–300
Chapter 16
Environmental and Economical Opportunities
for the Valorisation of the Genus Atriplex:
New Insights
Maali Benzarti, Kilani Ben Rejeb, Ahmed Debez and Chedly Abdelly
Abstract Atriplex species are members of the Chenopodiaceae. There are more
than 400 species growing naturally in arid and semi arid regions of the world, most
of which are highly tolerant to drought and salt. Atriplex species contain high levels
of protein and economically valuable compounds. These characteristics could make
Atriplex a suitable food for livestock in saline or arid/ semi-arid area. Furthermore,
Atriplex can take up salt ions from saline soil and sequester it into the salt glands at
the leaf surface. This trait is of high significance since it allows them to be used
for revegetation of saline or arid/semi-arid lands. Atriplex species have also been
used for cloning some genes related to drought and salt tolerance. This review is a
new contribution that updates knowledge on the ecological and socio-economical
potential of some plant genus Atriplex.
Introduction
Many arid and semi-arid regions in the world have soils and water resources that are
too saline for most of the common conventional crop systems (Pitman and Lauchli
2002). Halophytes are plants that have been naturally selected in saline environ-
ments and are distinguishable from glycophytes by their capacity to cope with ex-
C. Abdelly () · M. Benzarti · K. B. Rejeb · A. Debez

Laboratoire des Plantes Extrêmophiles, Centre de Biotechnologie de Borj-Cedria (CBBC),
BP 901, 2050 Hammam-Lif, Tunisia
M. Benzarti
A. Debez
K. B. Rejeb
Physiologie Cellulaire et Moléculaire des Plantes, UR5,
EAC 7180 CNRS, Université Pierre et Marie Curie (UPMC),
Case 156, 4 place Jussieu, 75252 Paris cedex 05, France

442 M. Benzarti et al.
cessive levels of ions by various eco-physiological mechanisms. Some halophytes

possess unique adaptations, such as salt glands or bladders that alleviate the delete-
rious effects of high ion concentrations. However, intrinsically cellular processes-
must make the major contribution to the capacity of plants for salt adaptation. At the
molecular level, the higher salt-adaptive plasticity of halophytes may be due to con-
stitutive expression of genes that encode salt-tolerance determinants (Casas et al.
1992) or the better aptitude to regulate the expression of these genes in response to
salt. This hypothesis makes halophytes a source of exclusive genes or new genetic
mechanisms that could be applied in genetic manipulation of crops. Cultivation of
salt-tolerant crops, or halophytes, on saline soil has significant social and economi-
cal potential that needs to be further explored and developed (Debez et al. 2011).
Among the halophytes extensively used in physiological and molecular bio-
logical investigations is the Atriplex genus. The genus Atriplex (Chenopodiaceae)
contains various species distinguishable by different morphology, biological
cycles and ecological adaptations (Le Houérou 1992). Tolerance to salinity, drought,
heavy metals and temperature are important characteristics of species of Atriplex.
However, the value of certain Atriplex species has been recognized by their incor-
poration in the rangelands improvement programs in many salt-affected regions
throughout the world. In this contribution, we review the literature regarding the
ecological and agronomic importance of the plant genus Atriplex in arid and semi
arid regions.
Geographical Distribution of the Genus Atriplex
Atriplex species constitute the largest and most diversified genus of the family Che-
nopodiaceae (Kadereit et al. 2010). Atriplex species (saltbushes) are dominant in
many arid and semi-arid regions of the world, particularly in habitats that combine
relatively high soil salinity with aridity (Ortíz-Dorda et al. 2005). Over 400 spe-
cies of Atriplex have been found to be geographically distributed on all continents.
Atriplex species are mainly found in the deserts and semi-deserts in North America,
South Australia, South Central Asia, West and South East America, and the Medi-
terranean basin. A. nummularia, and A. halimus are the most widely distributed
species of the genus Atriplex. A. halimus is a perennial native shrub of the Mediter-
ranean region (Ortíz-Dorda et al. 2005). This species has two subspecies: the subsp.
halimus, which is present on the northern shores of the Mediterranean basin and the
subsp. schweinfurthii (Boiss.) common on the southern shores of the Mediterranean
basin, North Africa and Near East. A. nummularia occurs naturally in the semi arid
and arid zone of southern and central Australia where it was divided in three subspe-
cies (subsp. nummularia; subsp. Omissa and subsp. Spathulata). Molecular genetic
and taxonomic evidence suggests that Atriplex was transported to Australia during
the late Miocene (Kadereit et al. 2010). A. nummularia is proposed to have evolved
from a common octoploid ancestor A. paludosa ssp. moquiniana (Moq.) Parr-Smith
in the coastal semi-arid fringe of southwestern Australia. Sampson and Byrne
16 Environmental and Economical Opportunities for the Valorisation … 443
(2012) suggested that many species spread and diversified from this zone to exploit
the arid and saline habitats that were increasingly becoming available as a result of
changing climatic conditions through the Pliocene and Pleistocene in inland areas
of Australia. There are two species that are considered to be closely related to A.
nummularia that are found in the arid zones of Western and South Australia, respec-
tively: A. amnicola Paul G. Wilson and A. incrassate F Muell (Sampson and Byrne
2012). A. breweri and A. cansecens are relatively close to A. halimus. Between 1920
and 1930, A. nummularia, A. semibaccata from Australia and A. canescens from
USA were introduced to Tunisia and Morocco (Ben Salem et al. 2010). Only 13
species and subspecies are used for rangeland rehabilitation and fodder production:
A. halimus subsp. halimus, A. halimus subsp. schweinfurthii, A. mollis, A. glauca,
A. leucoclada, A. nummularia, A. canescens subsp. canescens, A. canescens subsp.
linearis, A. amnicola, A. undulata, A. repanda, A. semibaccata, and A. barclayana
(Ben Salem et al. 2010).
he Importance of Atriplex Species for Saline Soil

T
Reclamation
Salt affected soils are widely spread in many arid and semi-arid regions of the world
and increasingly threatening agricultural expansion and productivity. Yet, in many
arid environments, high quality water in not available to support the establishment
of plants for revegetation projects. The removal of sodium salts from saline soils by
halophytes plants, as alternative for costly chemical amendments, has emerged as an
efficient low cost technology (Gharaibeh et al. 2011). It is well known that Atriplex
species actively accumulate soluble salts in leaves, especially sodium, in association
with a drought tolerance mechanism. For this reason it is also considered as an ex-
cellent species for reducing soil salinity in drylands, if cut and collected (Ben Salem
et al. 2005). It was found that the dehydrated A. halimus accumulated more Na+ than
the control plants even without the addition of NaCl to the stressed plants (Martinez
et al. 2003). Glenn and Brown (1998) concluded that tolerance of A. canescens to
water and salt stress was linked through a common mechanism of accumulating
Na+ for osmotic adjustment. By comparing salinity tolerance of three Atriplex spe-
cies in well-watered and drying soil Glenn et al. (2012) found that A. hortensis was
able to complete its life cycle on drying soil with a final salt content 85 g/l NaCl. A.
lentiformis was able to survive on drying soils with salinities five times higher than
seawater, whereas A. canescens had high survival on drying soils but was less salt
tolerant than either A. hortensis or A. lentiformis. It has been demonstrated that there
is a relationship between the habitat of the Mediterranean xero-halophyte species A.
halimus and the strategy adopted for NaCl and osmotic stress resistance. The coastal
(Monastir, salt-affected site) population is more tolerant of salinity than the inland
(Sbikha, non saline semi-arid area) population and displays a higher ability to ac-
cumulate glycinebetaine (GB) in response to this constraint. In contrast, the inland
population, exposed in its natural habitat to transient periods of drought, is more
resistant to osmotic stress induced by 15 % PEG, and mainly accumulates proline in
response to this treatment (Ben Hassine et al. 2008). Some Atriplex species grown
under rangeland conditions has leaf ash concentrations of 13–27 % (Welch 1978;
Hyder 1981; Berrett-Lennard 2002) and Atriplex species grown in saline soils can
have leaf ash concentrations up to 39 % (Malcolm et al. 1988). Khan et al. (2000)
reported that A. halimus was more salt-tolerant than A. calotheca and A. nitens,
when grown at 750 mM NaCl (− 40, − 67 and − 80 % of biomass production) but in-
terestingly, all three species were able to survive at this salt concentration. Recently,
Benzarti et al. (2012) found that A. portulacoides was able to grow in medium con-
taining 1,000 mM NaCl without displaying salt-induced toxicity symptoms. The
salinity resistance of some Atriplex species is often attributed to the presence of
vesiculated trichomes covering the leaf surface and containing large amounts of
salt (Smaoui et al. 2011). These trichomes play a significant role in removing salt
from the the leaf tissues, thereby preventing the accumulation of toxic salts in the
parenchyma and vascular tissues. For many Atriplex species, more than 50 % of the
salt transported to the shoots is excreted via these epidermic trichomes (Belkheiri
and Mulas 2011). These attributes have led some workers to suggest that Atriplex
species could be grown to remove salt from the soil (Barrett-Lennard 2002).
Atriplex species ( A. canescens) has been especially recommended for arid zone
restoration projects (Fitzsimmons et al. 1998). In a field experiment Chisci et al.
(2001) demonstrated the use of A. halimus in improving physical characteristics of a
clay soil in Italy and to provide environmental protection by controlling runoff and
reducing soil erosion on slopes. Atriplex plant litter can modify the top soil salinity,
along with other soil properties. Maganhotto de Souza Silva et al. (2008) found that
soils cultivated with A. nummularia and irrigated with saline effluents, in semi-arid
conditions in Brazil, improved their fertility (organic carbon, nitrogen and phospho-
rus contents) and microbiological properties (enzymes activity). Sameni and Solei-
mani (2007) studied the distribution of salinity and of some soil physico-chemical
properties, observing significant changes in salinity and pH and found that A. num-
mularia may actually facilitate growth of plants under their canopy. The work by
Zucca et al. (2011) in a study site in Morocco also confirmed that the significant
relationship between soil properties and A. nummularia development can be mostly
observed within the first 10 cm. A. nummularia is one of the most important species
used for the revegetation of degraded land in low rainfall areas. Slavich et al. (1999)
planted A. nummularia as a vegetative cover in a salt affected land in southeast Aus-
tralia. Brown et al. (1999) showed that A. barclayana could be used as a biofilter to
remove nutrients from saline aquaculture effluents. Gharaibeh et al. (2011) showed
that amelioration of a calcareous saline sodic soil can be achieved efficiently by
growing A. halimus without applying an amendment. Planting A. halimus reduced
soil sodicity and electrical conductivity considerably to values comparable to that
of gypsum treatments.
The Atriplex species may also be used for wildfire prevention purposes. The
high salt concentration found in its leaves increases their moisture content, which
makes this species behave as a fire retardant in the event of wildfire (Montgomery
and Cheo 1969).
Table 16.1 Potential candidates for phytoremediation approach

Species Metal contaminants Reference
A. halimus Cd/Zn/Pb Lutts et al. 2004
A. portulacoides Cd/Cu/Zn/Fe/Ti Luque et al. 1999; Rebordea and Caçador
2007; Cambrollé et al. 2012a, b
A. canescens Cd/Cr Sawalha et al. 2006
A. hortensis spp purpurea Pb/Zn Kachout et al. 2012
A. hortensis spp rubra Cu/Ni Kachout et al. 2012
A. atacamensis Phil Ar Vromman et al. 2011
A. conodocarpa Hg Lomonte et al. 2010
A. palula Se Vickerman et al. 2002
A. spongiosa Se Vickerman et al. 2002
he Importance of Atriplex Species in Heavy Metal

T
Phytoremediation
The contamination of soil by heavy metals is one of the most serious environmental
problems and has significant implications for human health. The clean up of heavy
metals contaminated soils is one of the most difficult tasks for environmental engi-
neering. In most cases, traditional physiochemical methods are quite expensive and
may lead to soil alterations (Gardea-Torresdey et al. 2005). Phytoremediation based
on the use of plants to remove or degrade inorganic and organic pollutants, has
been proposed as a promising, environmentally friendly and relatively cheap. The
success of phytoremediation depends upon the identification of suitable plant spe-
cies those hyperaccumulate heavy metals. The use of deep-rooting xero-halophyte
species is may be of special interest in this context to remediate salty contaminated
area, especially in arid and semi-arid regions. Several species of the genus Atriplex,
which are naturally salt- and drought-tolerant have been also suggested as poten-
tial candidates for a phytoremediation approach (Table 16.1) because of their high
biomass production associated with a deep root system. A. portulacoides was sug-
gested as a suitable species for the phytoremediation owing to the high translocation
rates of Cd and Cu towards the aboveground tissues (Reboreda and Caçador 2007).
A. portulacoides can tolerate external Cu levels of up to 15 mmol/l (1,000 mg Cu/l)
without suffering adverse physiological effects (Cambrollé et al. 2012a). Further-
more, despite the fact that Cu concentrations of between 20 and 100 mg Cu/kg
DW in leaf tissue are generally considered excessive or toxic (Kabata-Pendias and
Pendias 2001), growth parameters of this species are unaffected by leaf tissue con-
centrations as high as 80 mg Cu/kg DW. A. portulacoides is able to survive with
external Cu levels of 35 mmol/l and can be found growing in sediments that con-
tain 300–3,000 ppm Cu. Sousa et al. (2008) stated that compartmentalization and
detoxification mechanisms are crucial to allow A. portulacoides to tolerate high
levels of heavy metals, and found that this species is able to retain a considerable
quantity of metals in the root cell wall. Cambrollé et al. (2012b) reported also that
this salt-marsh shrub may represent a valuable tool in the restoration of Zn-polluted
areas since the plant can tolerate high tissue concentrations of Zn without suffer-
ing adverse physiological effects, and can produce a significant amount of biomass
while sequestrating high concentrations of this metal. Other species that belong to
the Atriplex genus, such as Atriplex halimus, have already been studied for their
level of resistance to heavy metals (Cd, Zn, Pb). These species have been recom-
mended as a promising species for the phytoremediation of heavy-metal contami-
nated areas based on their high biomass production, deep root systems and ability to
tolerate high concentrations of toxic elements (Lutts et al. 2004; Lefèvre et al. 2009;
Manousaki and Kalogerakis 2009). Precipitation of heavy-metal with oxalate and/
or its excretion into trichomes and increased synthesis of glycine betaine may con-
tribute to the tolerance of A. halimus. Among the heavy metals frequently present
in contaminated soils, mercury is arguably of the greatest environmental and public
health concern. A. conodocarpa proved to be the most suitable candidates for mer-
cury phytoextraction because of its ability to translocate mercury from roots to the
above-ground tissues (Lomonte et al. 2010). Vickerman et al. (2002) evaluated 30
Atriplex lines for potential habitat improvement and phytoremediation of selenium
contaminated sites. A. patula was found to be one of the top selenium accumula-
tors and grew well in saline soil. A. atacamensis Phil has been proposed as possible
candidates for phytoremediation of Ar (Vromman et al. 2011).
Atriplex Species Forage Production
The main limitations to animal production in the arid and semi-arid regions, is the
scarcity of green forage. The use of native or introduced halophytes for livestock
production is an important issue in many semi-arid and arid areas. Several halo-
phytes plants have been used as fodder crops under saline conditions in order to
produce green forage during the dry season (El Shaer 2010). These include planting
perennial salt marsh plant species, mainly Atriplex species, in numerous regions. In
several experiments, the Mediterranean Atriplex species has been the most success-
ful shrub species in terms of establishment and productivity. Research conducted in
north-east Morocco showed an average production of 920 Kg DM/ha (1,000 plants/
ha density), with variations from 406 to 2,140 Kg DM/ha depending on the spe-
cies studied. A. vesicaria, A. semibaccata, A. nummularia and A. paludosa scored
the high levels of production. Other reports indicate that forage production from a
2-year old Atriplex plantation was 5 t under 150 and 200 mm rainfall.
The pastoral value of fodder shrubs depends not only upon their biomass but
also upon their nutritive value and their palatability and digestibility (Salem et al.
2012). The low concentrations of metabolizable energy and high concentrations of
soluble salt in herbage of Atriplex species as well as the presence of anti-nutritional
compounds, including tannins, flavonoids, oxalate tends to reduce fodder palatabil-
ity and feed intake of sheep and goats. Several methods have been devised to lessen
adverse effects of phenols and to alleviate deleterious effects of sodium chloride
found in tree and shrub fodder foliages. These include treatment with alkalis such
as urea, ammonia and calcium hydroxide and oxidizing agents such as potassium
dichromate. Addition of exogenous enzymes is also a method to improve the nutri-
tive value of tree leaves. The study of Salem et al. (2012) showed that there are ben-
eficial impacts of sun-drying and/or dietary exogenous enzyme addition for sheep
fed A. halimus.
Despite the limited nutritional values, the use of Atriplex species as an important
component of the diet should be considered in arid and semi-arid regions since
this plant produces 2.5–20 t of dry matter per hectare per year and it is available
most of the year. Given the low nutritional value of the Atriplex species, various
authors have proposed supplementing them with other types of feed like barley
grain, barly straw or spineless cactus so that the animals could obtain the energy
from the hay and grain, and the protein and minerals from Atriplex species. Abu-
Zanat (2005) reported that grazing a combination of salt-tolerant grasses, legumes
and Atriplex species improved feeding value and maximize animal production (feed
intake and growth rates) from saline land. Norman et al. (2008) reported that 170 g/
day of grain was the minimum required to ensure sheep fed A. nummularia and A.
amnicola maintained live weight. In the study of Ben Salem et al. (2005) lambs
fed A. nummularia and supplemented with barley achieved a growth rate of 67 g/
day over an 85-day period. Data presented by van der Baan et al. (2004) clearly
demonstrate that supplementation with grains such as barley or maize significantly
increases the digestibility of A. nummularia and this leads to an increase in growth
rate of ruminant. Mixing alfalfa with Atriplex as green fodders to sheep may in-
crease the palatability and consequently intake and utilization of Atriplex which
lead to improvement of the performance of animal. Abu-Zanat (2005) reported that
it is possible to replace up to 50 % of alfalfa hay by A. nummularia without negative
effects on intake and digestibility of dry matter by Awassi lambs. Jacobs and Smith
(1977) reported significant differences in chemical composition between ( Atriplex
nummularia, A. Canescens, A. Brewerii and A. Lentiformis) species and between
seasons. Kandil and El-Shaer (1989) reported that Atriplex nummularia had higher
nutritive value in spring and winter than in summer and autumn. Riasi et al. (2008)
reported that A. dimorphostegia have more number of beneficial chemical nutritive
components and digestible values than Suaeda arcuata as forage for ruminants.
Farmers in some arid areas of the world have already begun to cultivate Atriplex as
a salt-tolerant forage crop on lands where other crops are difficult to grow.
haracterization of Bioactive Compounds from Some

C
Atriplex Species
Several salt marsh plants have traditionally been used for medical, nutritional, and
even artisanal purposes. Currently, an increasing interest is granted to these species
because of their high content in bioactive compounds (Ksouri et al. 2011). Various
Atriplex species have medicinal values, e.g. A. semibaccata has been used as an
antifungal agent and A. vestita in the traitement of bronchitis. A. hortensis has been
Table 16.2 Some Atriplex species and their isolated compounds

Species Chemical content Reference
A. portulacoides Phenolic compounds Boughalleb et al. 2009
A. inflata Phenolic compounds Boughalleb et al. 2009
A. halimus Tanins, alkaloids, saponins, ascorbic acid Benhammou et al. 2009
A. lentiformis Quercetin 6,4′-dimethoxy-3-fructo rhamnoside, Awaad et al. 2012
quercetin 4′-methoxy-3-fructo rhamnoside,
kaempferol-4′-methoxy-rutinoside, kaemp-
ferol 7-rhamnoside, kaempferol 3,7-dirhamno-
side, quercetin and kaempferol
A. nummularia Vit E, Vit A, saponins, polypodine, 20 Keckeis et al. 2000
hydroxyecdysone
A. hortensis Kaempferol 3-O-sulphate-7-O arabinopyranoside Bylka et al. 2001
quercetin 3-O-sulphate-7-O-arabinopyranoside
A. littoralis Patuletin 3-O-β-D-glucopyranoside, patule- Bylka 2004
tin 3-O[5′′′-O-feruloyl-β-D-apiofuranosyl
(1′′′→2′′)-β-D-glucopyranoside
A. farinosa Naringin, naringenin 7-O-glucoside, isorhamnetin Al-Jaber et al. 1992
3-O-rhamnosyl (1-6) glucopyranoside and
isorhamnetin 7-O-glucopyranoside
A. stocksii Ursolic acid, oleanolic acid, β-amyrin, Siddiqui et al. 1994
β-sitosterol, stigmasterol, atriplexinol
regarded as a source of Vit A (Siddiqui et al. 1994). The arial parts of A. hortensis
were used in flak medicine against diseases of respiratory tract, digestive and uri-
nary systems, and due to their analgestic properties, in rheumatism (Bylka et al.
2001). A. halimus is effective in the treatment of type II diabetic patients (Bakh-
tiuary 2011) and it used in veterinary medicine to combat internal parasites. Extracts
of A.confertifolia has significant bioactivity against human breast cancer cell lines;
the bioactivity of A. confertifolia extract on these cells was compared to a FDA-
approved cancer drug (Onxol®) and an industry-standard leukocyte control cell line.
A dose-response curve of the extracts displayed significant cell death similar to
Onxol® (Capua et al. 2010). Boughalleb et al. (2009) reported that many Atriplex
species ( A. inflate and A. portulacoides) may contain phytochemical compounds
with fungicide properties.
Several studies attributed the anti-carcinogenic, anti-inflamatory, antifongique
and antioxydants activities potential of plant extracts to their bioactive compounds
compositions (Ksouri et al. 2011). Chemical investigation of the species of the
genus Atriplex (Table 16.2) showed the presence of saponin glycosides, alkaloids,
ascorbic acid and phytoecdysteroids (Keckeis et al. 2000). Benhammou et al.
(2009) reported that A. halimus leaves and stems were characterized by the pres-
ence of the flavonoids, the tannins, the alkaloids and the sponins where the leaves
exhibited the higher yields. Bylka et al. (2001) isolated from leaves of A. hortensis
tow relatively rare sulphated flavonoids: kaempferol 3-O-sulphate-7-O-arabinopy-
ranoside and quercetin 3-O-sulphate-7-O-arabinopyranoside (belong the group of
compounds easily soluble in water) and a new acetylated flavonol glycoside from
Table 16.3 Genes isolated from some Atriplex species

Species Gene Gene Bank Product Reference
A. gmelini AgNHX1 AB038492 Antiporter Na /H
+ +
Hamada et al. 2001
A. nummularia AnGAPDH U02886.1 Glyceraldehyde-3-phosphate Niu et al. 1994
dehydrogenase
AnCMO AB112481 Choline monooxygenase Tabuchi et al. 2005
AnPEAMT AB196771 Phosphoethanolamine Tabuchi et al. 2005
N-methyltransferase
AnSAMS AB183565 S-adenosyl-L-methionine Tabuchi et al. 2005
synthase 5
H+-ATPase – PM H+-ATPase Niu et al. 1993
A. hortensis AhCMO AF270651 Choline monooxygenase Zhang et al. 2009;
Shen et al. 2002
AhBADH DQ497233 Betaine aldehyde
dehydrogenase
A. prostrata ApCMO AY082068 Choline monooxygenase Wang et al. 2004
A. centralasi- AcBADH AY093684 Betaine aldehyde Yin et al. 2002
atica dehydrogenase
A. halimus AsDBRE JF451138 DRE binding transcription Khedr et al. 2011
factor
A. littoralis (Bylka 2004). Other earlier works suggested the presence the narin-
gin, naringenin 7-O-glucoside, isorhamnetin 3-O-rhamnosyl (1–6) glucopyranoside
and isorhamnetin 7-O-glucopyranoside in A. farinose (Al-Jaber et al. 1992). More
recently, two new flavonoids, quercetin 6,4′-dimethoxy-3-fructo-rhamnoside and
quercetin 4′-methoxy-3-fructo-rhamnoside in addition to another five known com-
pounds were isolated from A. lentiformis (Torr.) S. Wats (Awaad et al. 2012). All of
the extracts and the isolated compounds were tested for their antioxidant activity,
the two new compounds were found to have the highest antioxidant activity with
no side effect.
I solation and Characterization of Genes

from Atriplex Species
Atriplex species are among the most salt tolerant higher plants. And the elucidation
of its salt tolerance mechanisms is of significance for generating salt tolerant crops
via selective breeding or genetic engineering. Studying the regulation of stress in-
ducible genes can lead to understanding of the mechanisms by which halophytes
maintain growth and thrive under abiotic stress. Several stress related genes have
been isolated from these halophytes (Table 16.3). Both glycophytes and halophytes
cannot tolerate large amounts of salt in the cytoplasm. Plants maintain a low con-
centration of Na+ in the cytosol by active exclusion of Na+ ions into the apoplast
and vacuole by using specific plasma membrane and tonoplast Na+/H+ antiporter
(NHX1) (Shi and Zhu 2002). In particular, the vacuolar Na+/H+ antiporter had been
demonstrated to play a key role in salt tolerance of plants (Blumwald et al. 2000).
The greater salt tolerance in Atriplex species is related to the transport to shoots of
high quantities of Na+ concomitant to an efficient vacuolar compartmentation of
this ion, which prevents the ionic damage to the cytoplasm. The vacuolar Na+/H+
antiporter genes has been characterized and identified from A. gmelili ( AgNHX1)
(Hamada et al. 2001). The analysis and comparison of these genes showed that
they were highly homologous with similar structural and conserved domains. Ohta
et al. (2002) demonstrated that transgenic rice plants overexpressing AgNHX1 gene
could survive after short period of high concentration salt exposure (300 mM NaCl
for 3 days). Evacuation of Na+ from the cytoplasm is energy-dependent. A partial
sequence of an isoform of the plasma membrane PM-H+-ATPase was been isolated
from A. nummularia. Increased H+-ATPase mRNA abundance was reported in A.
nummularia when NaCl adapted (342 mM NaCl) cells were re-exposed to NaCl
after having been grown in media without additional NaCl (Niu et al. 1993). Which
provide evidence that enhanced H+-transport activity by NaCl in A. nummularia
is mediated at least in part by transcriptional or post-transcriptional processes that
result in higher mRNA accumulation.
Exposure to saline and drought stress results in the accumulation in the cytosol of
low-molecular mass compounds, termed as compatible solutes, which do not inter-
fere with normal biochemical reactions. It has been frequently reported that GB acts
as the main stress-induced agent involved in the osmotic adjustment and protection
of cellular structure in plant species belonging to the Chenopodiaceae (Rhodes and
Hanson 1993). GB facilitates osmotic adjustment by lowering the internal osmotic
potential that contributes to the water stress tolerance ability. In addition, it stabi-
lizes both PSII complex and RuBisCO during photosynthesis under stress condi-
tions (Sakamoto and Murata 2000). Yang et al. (2007) reported that genetically
engineered tobacco with the ability to accumulate GB showed a higher content of
ascorbate and reduced glutathione as well as an increase in the activity of superox-
ide dismutase (SOD). The positive effect of exogenous glycine betaine application
in plant growing under salinity stress has been proven. Plant cell could be pro-
tected from the adverse effect of salinity induced oxidative stress by the exogenous
application of glycine betaine (Demiral and Türkan 2004). In A. nummularia GB
play a major role in cytosol osmotic adjustment in both leaves and roots, regardless
of NaCl presence (Silveira et al. 2009). In higher plants, the first and second steps in
the biosynthesis of GB are catalyzed by a rate-limiting enzyme choline monooxy-
genase (CMO) and betaine aldehyde dehydrogenase (BADH), respectively (Saka-
moto and Murata 2000). CMO gene from A. hortensis ( AhCMO) has been isolated
and used for GB production in tobacco (Shen et al. 2002) and cotton plants (Zhang
et al. 2009) to improve its abiotic stress tolerance. CMO homologs have been also
identified in A. prostrate (Wang and Showalter 2004) and A. nummularia (Tabuchi
et al. 2005). The gene encoding the second enzyme, BADH, has been cloned from
A. hortensis ( AhBADH) and introduced into rice, wheat, and turf grass (Xiao et al.
1995; Guo et al. 1997, 2000) and improvement of salt tolerance in transgenic plants
was observed during growth. Similar result was also achieved in transgenic trifoli-
ate orange (Fu et al. 2011). The enhanced salt tolerance was correlated, at least in
part, with reduced lipid peroxidation, greater abundance in photosynthetic proteins,
stimulation of K+ uptake, and low Na+/K+ ratios. The BADH gene that originated
from A. hortensis was also transformed into the most important forage crop alfalfa
with Agrobacterium-mediated transformation method. The transgenic plants grew
vigorous in salt stress condition, whereas the wild type plants was retarded and
did not survive. The expression of BADH gene in alfalfa genome enhanced its salt
tolerance through improved membrane protection as measured by relative electrical
conductivity and malondialdehyde (MDA) content, scavenge of free radicals by
increase of peroxidase (POD) and SOD activities, and the osmotic adjustment
(Liu et al. 2011).
Transcription factor genes play important roles in stress survival by serving as
master regulators of sets of downstream stress-responsive genes via binding to spe-
cific elements ( cis-elements) in target genes. Functional analysis of the promoter
regions of some of stress-inducible genes has led to identification of the cis-element
DRE (Dehydration-responsive element), which is responsible for dehydration-
inducible transcription (Yamaguchi-Shinozaki and Shinozaki 1994). Full-length
DRE-binding transcription factor ( AhDREB1) gene has been isolated from A.
hortensis (Shen et al. 2003). In transgenic tobacco, AhDREB1 led to the accu-
mulation of its putative downstream genes and these transgenic lines showed an
increased stress tolerance, suggesting that the AhDREB1 protein functions as a
DRE-binding transcription factor and play roles in the stress tolerant response of A.
hortensis. DREB in A. halimus ( AsDBRE) is regulated by the osmotic component
but not by the ionic one of salt stress (Khedr et al. 2011). It seemed that DREB
was not involved in the regulation of sodium manipulating genes like NHX1, SOS1
or H +-PPase. Moreover, DREB could be involved directly of indirectly in CMO
regulation because of timing of induction. Also, DREB was the most up-regulated
gene under salt (fivefold) and drought (twofold) conditions, which reinforced the
importance of this gene in A. halimus tolerance to stress. Moreover, its constitutive
expression under normal conditions also indicated its involvement in other growth
and developmental programs (Khedr et al. 2011).
Microsatellites are widely used in population genetic studies and may prove to
be useful in studies of closely related species to infer relationships when sequence
variation is very low or there are few or no genome resources available. Ortíz-Dorda
et al. 2005 has evaluated the genetic structure of 51 populations of A. halimus from
the Mediterranean Basin using RAPD (random amplified polymorphic DNA)-PCR
technique. The authors found that there are a clear intrapopulational diversity of
A. halimus. Such heterogeneity could be exploited to select clones or develop syn-
thetic populations with a combination of good traits such as high palatability, high
edible biomass production, and good adaptability to environmental limiting factors
in semi-arid Mediterranean environments. 12 polymorphic loci were isolated in A.
nummularia (Byrne et al. 2008) which will be useful to describe levels of genetic
variability across the range of the species and in a breeding programme.
Xu et al. (2011) investigate the physiological responses and differential gene
expression caused by salinity exposure in A. centralasiatica plants grown from
two different seed morphs. A. centralasiatica widely distributed in China produce
tow type of seeds, yellow and brown seeds. Seedlings derived from yellow seeds
showed a greater salt tolerance than those derived from brown seeds. By using sup-
pression subtractive hybridization (SSH) and subsequent microarray and RT-PCR
analysis to isolate and compare genes that were differentially expressed, the authors
suggest a major contribution of gene regulation to the salt resistant phenotype of
seedlings derived from yellow seeds. These genes encoded proteins related to os-
motic and ionic homeostasis, redox equilibrium and signal transduction. This study
clearly links physiological responses with differential gene expression in seedlings
derived from dimorphic seeds. Such dimorphism offers the advantage to halophytic
plants to survive in highly variable environments.
Conclusion and Future Perspective
The global distribution of the genus Atriplex in arid and semi-arid areas and its abi-
otic stress tolerance combined with the utility of Atriplex species for restoration, re-
mediation and forage for livestock have helped these plants to rank among the most
widely studied native halophytes species. The major limitation of use Atriplex in
livestock production is its high salt concentration. Atriplex species are best consid-
ered as a supplement rather forage. The plant used for these purposes are primarily
wild type and there are little information available on the nutritive value of Atriplex
species growing in greenhouse and irrigated with different concentration of NaCl.
Strategies need to be devised to minimize the salt contents in the Atriplex leaves.
Although the biochemistry of Atriplex species tends to establish that they may be
a source of novel compounds along with providing a new source for many already
know biologically active compounds. Data of chemical composition of Atriplex
species is still not completed.
Atriplex species are well adapted to both salt and drought stress and can serve
as model species to understand the mechanisms of tolerance in plant (Flowers and
Colmer 2008). Very little research has been carried out to identify the molecular
mechanisms directly responsible for the specific tolerance of Atriplex species to
abiotic stress. In this way, Atriplex may serve as a particularly useful model plant
for studies of regulatory mechanisms related to the activation of the GB biosyn-
thetic pathway in response to environmental stress.
With over 400 species of this genus, a significant opportunity then exists to ex-
plore the potential of other locally adapted Atriplex species. Research is required to
select and breed potentially useful plants and identify the best species combining
nutritional, agronomic and environmental potential.
Acknowledgments This work was supported by the Tunisian Ministry of Higher Education and
Scientific Research (LR10CBBC02).
References
Abu-Zanat MMW (2005) Voluntary intake and digestibility of saltbush by sheep. Asian Aust J
Anim Sci 18:214–220
Al-Jaber NAA, Mujahid TG, Al-Hazmi HMG (1992) Secondary metabolites of chenopodiaceace
species. J Chem Scoc Pak 14:76–83
Awaad AS, Maitland DJ, Donia AERM, Alqasoumi SI, Soliman GA (2012) Novel flavonoids with
antioxidant activity from a Chenopodiaceous plant. Pharmaceutical Biol 50:99–104
Bakhtiuary Z (2011) Herbal Medicines in Diabetes. IJDO 3:88–95
Barrett-Lennard EG (2002) Restoration of saline land through revegetation. Agric Water Manag
53:213–226
Belkheiri O, Mulas M (2011) The effects of salt stress on growth, water relations and ion accumu-
lation in two halophyte Atriplex species. Environ Exp Bot (in press). http://dx.doi.org/10.1016/j
Ben Hassine A, Ghanem ME, Bouzid S, Lutts S (2008) An inland and a coastal population of the
Mediterranean xero-halophyte species Atriplex halimus L. differ in their ability to accumulate
proline and glycinebetaine in response to salinity and water stress. J Exp Bot 59:1315–1326
Ben Salem H, Nefzaoui A, El-Mastouri A, Ben Salem L (2005) Nutritive value, behavior, and
growth of Barbarine lambs fed on oldman saltbush ( Atriplex nummularia L.) and supplemented
or not with barley grains or spineless cactus ( Opuntia ficus-indica F. inermis) pads. Small
Rumin Res 59:229–237
Ben Salem H, Norman HC, Nefzaoui A, Mayberry DE, Pearce KL, Revell DK (2010) Potential
use of oldman saltbush ( Atriplex nummularia Lindl.) in sheep and goat feeding. Small Rumin
Res 91:13–28
Benhammou N, Fawzia AB, Tatjana KP (2009) Antioxidant activity of methanolic extracts and
some bioactive compounds of Atriplex halimus. Comptes Rendus Chimie 12:1259–1266
Benzarti M, Ben Rejeb K, Debez A, Messedi D, Abdelly C (2012) Photosynthetic activity and leaf
antioxidative responses of Atriplex portulacoides subjected to extreme salinity. Acta Physiol
Plant. doi:1007/s11738-012-0963-5
Blumwald E, Aharon GS, Apse MP (2000) Sodium transport in plant cells. Biochim Biophys Acta
1465:140–151
Boughalleb N, Trabelsi L, Harzallah-Skhiri F (2009) Antifungal activity from polar and non-polar
extracts of some Chenopodiaceae wild species growing in Tunisia. Nat Prod Res 23:988–997
Brown JJ, Glen EP, Fitzsimmons KM, Smith S (1999) Halophytes for the treatment of saline aqua-
culture effluent. Aquaculture 175:255–268
Bylka W (2004) A new acylated flavonol diglycosides from Atriplex littoralis. Acta Physiol Plant
24:393–398
Bylka W, Stobiecki M, Franski R (2001) Sulphated flavonoid glycosides from leaves of Atriplex
hortensis. Acta Physiol Plant 23:285–290
Byrne M, Hankinson M, Sampson JF, Stankowski S (2008) Microsatellite markers isolated from a
polyploidy saltbush, Atriplex nummularia Lindl. (Chenopodiaceae). Mol Ecol Resour 8:1426–
1428
Cambrollé J, Mancilla-Leytón JM, Muñoz-Vallés S, Luque T, Figueroa ME (2012a) Tolerance
and accumulation of copper in the salt-marsh shrub Halimione portulacoides. Mar Pollut Bull
64:721–728
Cambrollé J, Mancilla-Leytón JM, Muñoz-Vallés S, Luque T, Figueroa ME (2012b). Zinc tolerance
and accumulation in the salt-marsh shrub Halimione portulacoides. Chemosphere 86:867–874
Capua CJ, Hopson NP, Malcolm MGS, Johnston GR, KimL GB, Lee CM, Booth GM (2010).
Cytotoxicity of Atriplex confertifolia. J Toxicol 1–7. doi:10.1155/2010/976548
Casas AM, Nelson DE, Raghothama KG, D’Urzo MP, Singh NK, Bressan RA, Hasegawa PM
(1992) Expression of osmotin-like genes in the halophyte Atriplex nummularia L. Plant Physi-
ol 99:329–337
Chisci GC, Bazzoffi P, Pagliai M, Papini R, Pellegrini S, Vignozzi N (2001) Association of Sulla
and Atriplex shrub for the physical improvement of clay soils and environmental protection in
central Italy. Agric Ecosyst Environ 84:45–53
Debez A, Huchzermeyer B, Abdelly C, Koyro HW (2011) Current challenges and future oppor-
tunities for a sustainable utilization of halophytes. In: Öztürk M et al (ed) Sabkha ecosystems,
tasks for vegetation science 34. Vol 46, pp 59–77
Demiral T, Türkan I (2004) Does exogenous glycinebetaine affect antioxidative system of rice
seedlings under NaCl treatment. J Plant Physiol 6:1089–1100
El Shaer HM (2010) Halophytes and salt-tolerant plants as potential forage for ruminants in the
Near East region. Small Rumin Res 91:3–12
Fitzsimmons K, Lovely C, Glenn E (1998) Growth differences among widely separated geo-
graphic accessions of fourwing saltbush ( Atriplex canescens) in the Great Basin Desert, New
Mexico, USA. Arid Soil Res Reah 12:87–94
Flowers TJ, Colmer TD (2008) Salinity tolerance in halophytes. New Phytol 179:945–963
Fu X-Z, Khan EU, Hu S-S, Fan Qi-J, Liu Ji-H (2011) Overexpression of the betaine aldehyde
dehydrogenase gene from Atriple hortensis enhances salt tolerance in the transgenic trifoliate
orange (Poncirus trifoliate L. Raf.). Environ Exp Bot 74:106–113
Gardea-Torresdey JL, Peralta-Videab JR, de la Rosa G, Parsons JG (2005) Phytoremediation of
heavy metals and study of the metal coordination by X-ray absorption spectroscopy. Coord
Chem Rev 249:1797–1810
Gharaibeh MA, Eltaif NI, Albalasmeh AA (2011) Reclamation of highly calcareous saline sodic
soil using Atriplex halimus and by-product gypsum. Int J Phytoremediation 13:873–883
Glenn EP, Brown JJ (1998) Effects of soil salt levels on the growth and water use efficiency of
Atriplex canescens (Chenopodiaceae) varieties in drying soil. Am J Bot 85:10–16
Glenn EP, Nelson SG, Ambrose B, Martinez R, Soliz D, Pabendinskas V, Hultine K (2012) Com-
parison of salinity tolerance of three Atriplex spp. in well-watered and drying soils. Environ
Exp Bot 83:62–72
Guo BH, Zhang YM, Li HJ, Du LQ (2000) Transformation of wheat with a gene encoding for the
betaine aldehyde dehydrogenase (BADH). Acta Bot Sin 42:279–283
Guo Y, Zhang L, Xiao G, Chen SY (1997) Expression of the BADH gene and salinity tolerance in
rice transgenic plants. Sci China 27:151–155
Hamada A, Shono M, Xia T, Ohta M, Hayashi Y, Tanaka A, Hayakawa T (2001) Isolation and
characterization of a Na+/H+antiporter gene from the halophyte Atriplex gmelini. Plant Mol
Biol 46:35–42
Hyder SZ (1981) Preliminary observations on the performance of some exotic species of Atriplex
in Saudi Arabia. J Range Manage 34:208–210
Jacobs GA, Smith CJ (1977) Utilization of four Atriplex species by sheep. Agroanimalia 9:37–43
Kabata-Pendias A, Pendias H (2001) Trace elements in soils and plants. CRC Press, Florida
Kachout SS, Ben Mansoura A, Mechergui R, Leclerc JC, Rejeb MN, Ouerghi Z (2012) Accumula-
tion of Cu, Pb, Ni and Zn in the halophyte plant Atriplex grown on polluted soil. J Sci Food
Agric 92:336–342
Kadereit G, Mavrodiev EV, Zacharias EH, Sukhorukov AP (2010) Molecular phylogeny of Atripli-
ceae (Chenopodioideae, Chenopodiaceae): implications for systematics, biogeography, flower
and fruit evolution, and the origin of C4 photosynthesis. Am J Bot 97:1664–1687
Kandil HM, El-Shaer HM (1989) The utilization of Atriplex nummularia by goats and sheep in
Sinai. Proceedings of international symposium on the constraints and possibilities of ruminant
production in the dry tropics, Cairo, Egypt, pp 71–73
Keckeis K, Sarker SD, Dinan LN (2000) Phytoecdysteroids from Atriplex nummularia. Fitoterapia
71:456–458
Khan MA, Ungar IA, Showalter M (2000) Effects of salinity on growth, water relation and ion
accumulation of the subtropical perennial Halophyte, Atriplex griffithii var. stocksii. Ann Bot
85:225–232
Khedr AHA, Serag MS, Nemat-Alla MM, Abo-Elnaga AZ, Nada RM, Quick WP, Abogadallah
GM (2011) A DREB gene from the xero-halophyte Atriplex halimus is induced by osmotic but
not ionic stress and shows distinct differences from glycophytic homologues. Plant Cell Tiss
Organ Cult 106:191–206
Ksouri R, Ksouri WM, Jallali I, Debez A, Magné C, Hiroko I, Abdelly C (2011) Medicinal halo-
phytes: potent source of health promoting biomolecules with medical, nutraceutical and food
applications. Crit Rev Biotechnol. doi:10.3109/07388551.2011.630647
Le Houérou HN (1992) The role of saltbushes ( Atriplex spp.) in arid land rehabilitation in the
Mediterranean Basin: a review. Agrofor Syst 18:107–148
Lefèvre I, Marchal G, Meerts P, Corréal E, Lutts S (2009) Chloride salinity reduces cadmium
accumulation by the Mediterranean halophyte species Atriplex halimus L. Environ Exp Bot
65:142–152
Liu Z-H, Zhang H-M, Li G-L, Guo X-L, Chen S-Y, Liu G-B, Zhang Y-M (2011) Enhancement of
salt tolerance in alfalfa transformed with the gene encoding for betaine aldehyde dehydroge-
nase. Euphytica 178:363–372
Lomonte C, Sgherri C, Baker AJM, Kolev SD, Navari-Izzo F (2010) Antioxidative response of
Atriplex codonocarpa to mercury. Environ Exp Bot 69:9–16
Luque CJ, Castellanos EM, Castillo JM, Gonzalez M, Gonzalez-Vilches MC, Figueroa ME (1999)
Metals in halophytes of a contaminated estuary (odiel saltmarshes, SW Spain). Mar Pollut Bull
38:49–51
Lutts S, Lefèvre I, Delpérée C, Kivits S, Dechamps C, Robledo A et al (2004) Heavy metal
accumulation by the halophyte species Mediterranean saltbush. J Environ Qual 33:1271–1279
Maganhotto de Souza Silva CM, Vieira RF, Oliveira PR (2008) Salinity, sodicity and microbio-
logical properties of an Ultisol cultivated with saltbush and irrigated with saline effluents.
Pesqui Agropecu Bras 43:1389–1396
Malcolm CV, Clarke AJ, D’Antuono MF, Swaan TC (1988) Effects of plant spacing and soil condi-
tions on the growth of five Atriplex species. Agric Ecosyst Environ 21:265–279
Manousaki E, Kalogerakis N (2009) Phytoextraction of Pb and Cd by the Mediterranean saltbush
( Atriplex halimus L.) metal uptake in relation to salinity. Environ Sci Poll Res 16:844–854
Martinez JP, Ledent JF, Bajji M, Kinet JM, Lutts S (2003) Effect of water stress on growth, Na and
K accumulation and water use efficiency in relation to osmotic adjustment in two populations
of Atriplex halimus L. Plant Growth Regul 41:63–73
Montgomery KR, Cheo PC (1969) Moisture and salt effects on fire retardance in plants. Am J Bot
56:1028–1032
Niu X, Wang W, Bressan RA, Hasegawa PM (1994) Molecular cloning and expression of a glyc-
eraldehydes-3-phosphate dehydrogenase gene in a desert halophyte, Atriplex nummularia L.
Niu X, Zhu JK, Narasimhan ML, Bressan RA, Hasegawa PM (1993) Plasma- membrane H+-
ATPase gene expression is regulated by NaCl in cells of the halophyte Atriplex nummularia
L. Planta 190:433–438
Norman HC, Masters DG, Wilmot MG, Rintoul AJ (2008) Effect of supplementation with grain,
hay or straw on the performance of weaner Merino sheep grazing old man ( Atriplex nummu-
laria) or river ( Atriplex amnicola) saltbush. Grass Forage Sci 63:179–192
Ohta M, Hayashi Y, Nakashima A, Hamada A, Tanaka A, Nakamura T, Hayakawa T (2002) Intro-
duction of a Na+/H+antiporter gene from Atriplex gmelini confers salt tolerance to rice. FEBS
Letters 532:279–282
Ortíz-Dorda J, Martínez-Mora C, Correal E, Simón B, Cenis JL (2005) Genetic Structure of Atri-
plex halimus Populations in the Mediterranean Bassin. Ann Bot 95:827–834
Pitman MG, Lauchli A (2002) Global impact of salinity and agricultural ecosystems. In: Lauchli
A, Luttge V (eds) Salinity: environment plants molecules. Kluwer, The Netherlands, pp 3–20
Reboreda R, Caçador I (2007) Halophyte vegetation influences in salt marsh retention capacity for
heavy metals. Environ Pollut 146:147–154
Rhodes D, Hanson AD (1993) Quaternary ammonium and tertiary sulfonium compounds in higher
plants. Annu Rev Plant Physiol Plant Mol Biol 44:357–384
Riasi A, Mesgaran MD, Stern MD, Moreno MJR (2008) Chemical composition, in situ ruminal de-
gradability and post-ruminal disappearance of dry matter and crude protein from the halophytic
plants Kochia scoparia, Atriplex dimorphostegia, Suaeda arcuata and Gamanthus gamacar-
pus. Anim Feed Sci Technol 141:209–219
Sakamoto A, Murata N (2000) Genetic engineering of glycinebetaine synthesis in plants: current
status and implications for enhancement of stress tolerance. J Exp Bot 51:81–88
Salem AZM, Hassan AA, Khalil MS, Gado HM, Alsersy H, Simbaya J (2012) Effects of sun-
drying and exogenous enzymes on nutrients intake, digestibility and nitrogen utilization in
sheep fed Atriplex halimus foliages. Anim Feed Sci Tech 171:128–135
Sameni AM, Soleimani R (2007) Effect of salinity and some chemical properties of the under-
and intercanopy soils on range plants in a dry region of Southern Iran. Commun Soil Sci Plan
38:15–33
Sampson JF, Byrne M (2012) Genetic diversity and multiple origins of polyploidy Atriplex num-
mularia Lindl. (Chenopodiaceae). Biol J Linn Soc 105:218–230
Sawalha MF, Peralta-Videa JR, Romeor-Gonzalez J, Gardea–Torresdey JL (2006) Biosorption of
Cd(II), Cr(II), and Cr(VI) by Saltbush ( Atriplex Carnescens) biomass: thermodynamic and
isotherm studies. Colloid Interf Sci 300:100–104
Shen YG, Du BX, Zhang WK, Zhang JS, Chen SY (2002) AhCMO, regulated by stresses in
Atriplex hortensis, can improve drought tolerance in transgenic tobacco. Theor Appl Genet
105:815–821.
Shen YG, Zhang WK, Yan DQ, Du BX, Zhang JS, Liu Q, Chen SY (2003) Characterization of
a DRE-binding transcription factor from a halophyte Atriplex hortensis. Theor Appl Genet
107:155–161
Shi H, Zhu JK (2002) Regulation of expression of the vacuolar Na+/H+antiporter gene AtNHX1 by
salt stress and abscisic acid. Plant Mol Biol 50:543–550
Siddiqui BS, Ahmed S, Ghiasuddin M, Khan AU (1994) Triterpenoids of Atriplex stocksii. Phyto-
chemistry 37:1123–1125
Silveira JAG, Araújo SAM, Lima GPMS, Viégas RA (2009) Roots and leaves display contrasting
osmotic adjustment mechanisms in response to NaCl-salinity in Atriplex nummularia. Environ
Exp Bot 66:1–8
Slavich PG, Smith KS, Tyerman SD, Walker GR (1999) Water use of grazed saltbush plantations
with saline watertable. Agricu Water Manag 39:169–185
Smaoui A, Barhoumi Z, Rabhi M, Abdelly C (2011) Localization of potential ion transport path-
ways in vesicular trichome cells of Atriplex halimus L. Protoplasma 48:363–372
Sousa AI, Caçador I, Lillebø, AI, Pardal MA (2008) Heavy metal accumulation in Halimione portu-
lacoides: intra- and extra-cellular metal binding sites. Chemosphere 70:850–857
Tabuchi T, Kawaguchi Y, Azuma T, Nanmori T, Yasuda T (2005) Similar regulation patterns
of choline monooxygenase, phosphoethanolamine N-methyltransferase and S-adenosyl-L-
methionine synthetase in leaves of the halophyte Atriplex nummularia L. Plant Cell Physiol
46:505–513
van der Baan A, van Niekerk WA, Rethman NFG, Coertze RJ (2004) The determination of digest-
ibility of Atriplex nummularia cv. De Kock (Oldman’s Saltbush) using different in invitro
techniques. South Afr J Anim Sci 34:95–97
Vickerman DB, Shannon MC, Banuelos GS, Grieve CM, Trumble JT (2002) Evaluation of Atri-
plex lines for selenium accumulation, salt tolerance and suitability for a key agricultural insect
pest. Environ Poll 120:463–473
Vromman D, Flores-Bavestrello A, Šlejkovec Z, Lapaille S, Teixeira-Cardoso C, Briceño M, Ku-
mar M, Martínez J-P, Lutts S (2011) Arsenic accumulation and distribution in relation to young
seedling growth in Atriplex atacamensis Phil. Sci Total Environ 412–413:286–295
Wang LW, Showalter AM (2004) Cloning and salt-induced, ABA-independent expression of

choline mono-oxygenase in Atriplex prostrata. Physiol Plant 120:405–412
Welch BL (1978) Relationships of soil salinity, ash, and crude protein in Atriplex canescens. J
Range Manage 31:132–133
Xiao G, Zhang GY, Liu FH, Chen SY (1995) The study of the BADH gene in Atriplex hortensis.
Chin Sci Bull 40:741–745
Xu J, Yin H, Yang L, Xie Z, Liu X (2011) Differential salt tolerance in seedlings derived from
dimorphic seeds of Atriplex centralasiatica: from physiology to molecular analysis. Planta
233:859–871
Yamaguchi-Shinozaki K, Shinozaki K (1994) A novel cis-acting element in an Arabidopsis gene
is involved in responsiveness to drought, low-temperature, or high-salt stress. The Plant Cell
6:251–264
Yang X, Wen X, Gong H, Lu Q, Yang Z, Tang Y, Liang Z, Lu C (2007) Genetic engineering of the
biosynthesis of glycinebetaine enhances thermotolerance of photosystem II in tobacco plants.
Planta 225:719–733
Yin X, Zhao Y, Luo D, Zhang H (2002) Isolating the promoter of a stress-induced gene encoding
betaine aldehyde dehydrogenase from the halophyte Atriplex centralasiatica Iljin. Biochim
Biophys Acta 1577:452–456
Zhang H, Dong H, Li W, Sun Y, Chen S, Kong X (2009) Increased glycine betaine synthesis and
salinity tolerance in AhCMO transgenic cotton lines. Mol Breed 23:289–298
Zucca C, Julitta F, Previtali F (2011) Land restoration by fodder shrubs in a semi-arid agro-pastoral
area of Morocco. Effects on soils. Catena 87:306–312
Chapter 17
Dealing with Environmental Stresses: Role
of Polyamines in Stress Responses
Rinukshi Wimalasekara and Günther F. E. Scherer
Abstract Extreme environmental conditions including drought, high- and low-

temperatures, high salinity, mineral deficiency and heavy metal toxicity severely
affect crop loss worldwide. Improvement of plants for enhanced resistance to
adverse climatic conditions is a key issue in sustainable crop production, strength-
ening the global food safety. Understanding stress tolerance mechanisms of plants
are a prime importance in crop improvement. Among the array of components
involved, plant polyamines (PAs) are identified as one such group of components
that play an important role in diverse environmental stress responses. PAs are small
organic cations containing two or more amino groups. These are growth regula-
tors present widely in all living organisms with varying quantities ranging from
micromolar to milimolar. In plants, the most abundantly found PAs are di-amine
putrescine, tri-amine spermidine and tetra-amine spermine. Accumulation of long
chain and conjugated forms of PA occur under some environmental and growth con-
ditions. Biosynthesis, transport, degradation and conjugation determine the level
of PAs and vary throughout a plant life cycle. Catabolism of PAs by amine oxi-
dases is trivial in the regulation of cellular levels of PAs. Apart from the essential
functions in growth and development, PAs play a key role in environmental stress
responses such as drought, chilling, salinity, mineral deficiencies such as potassium,
nitrogen and magnesium deficiency, heavy metal toxicity, mechanical injuries and
defence signalling against pathogens. Differential transcriptional regulation of sev-
eral stress-related genes in PA-overexpressed transgenic plants suggests potential
signalling function of PAs in stress responses. Genetic manipulation of crop plants
for altered regulation of PA biosynthesis/catabolism may lead to improved stress
tolerance potential. This article summarizes the recent findings on the involvement
R. Wimalasekara () · G. F. E. Scherer

Institute of Floriculture and Wood Science, Section of Molecular Developmental Physiology,
Leibniz University of Hannover, Herrenhäuser Str. 2, 30419, Hannover, Germany
G. F. E. Scherer

460 R. Wimalasekara and G. F. E. Scherer
of PAs in abiotic stress responses in plants and possible means of manipulating PAs
in the crop plants for enhanced stress tolerance.
Introduction
The impact of extreme climatic conditions such as atmospheric warming, desertifi-

cation and soil salinisation on agriculture is growing, causing substantial crop loss
worldwide. Climate change also modifies the risks of pest and pathogen outbreak,
negatively affecting crop productivity. Devastating climate coupled with population
growth exerts constant pressure on crop production, demanding more attention to
find ways and means of crop adaptability to challenging environmental conditions.
In order to secure the food requirements in changing climate scenario new technolo-
gies, efficient and sustainable farming practices have to be taken into consideration.
Plants are continuously being exposed to abiotic stress conditions such as
drought, heat, chilling, freezing and high salinity and biotic stresses like pathogen
invasion, insect predations and weeds. Understanding the mechanisms that trigger
stress damage and adaptive machinery of plants to various stress situations is of
prime importance in the progress of agriculture industry. Adaptation and acclima-
tion to stresses is a result of a combination of events occurring at the anatomical
and morphological levels to the cellular, biochemical and molecular levels. Signal
transduction pathways that link the perception of stress signals with the appropri-
ate cellular responses leading to stress tolerance are extensively studied (Taiz and
Zeiger 2006) and profound knowledge in all these aspects is needed in production
of plants with improved stress tolerance.
Among array of components involved, polyamines (PAs) are one of the compo-
nents that play significant functions in plant stress responses. PAs are small organic
cations containing two or more amino groups and known to be essential growth
regulators present ubiquitously in both prokaryotic and eukaryotic cells (Evans and
Malmberg 1989; Buchanan et al. 2000; Martin-Tanguy 2001). The most abundant
free PAs in plants are di-amine putrescine (put), tri-amine spermidine (spd) and tetra-
amine spermine (spm). PAs occur as free form or as conjugated forms attached to
proteins, nucleic acids, hydroxycinnamic acid forming phenol amides, anionic com-
ponents of phospholipids and cell wall components such as pectic polysaccharides
(Buchanan et al. 2000; Kakkar et al. 2000; Martin-Tanguy 2001; Kakkar and Sawh-
ney 2002; Takahashi and Kakehi 2010). The equilibrium between free and conju-
gated forms of PAs is crucial in development and their titer fluctuates in response
to environmental conditions (Torrigiani et al. 1987; Galston and Sawhney 1990). In
plants the PA content varies from micromolar to more than milimolar amounts.
The functions of PAs in growth and development (Kakkar et al. 2000; Martin-
Tanguy 2001; Kakkar and Sawhney 2002; Kusano et al. 2008; Hussain et al. 2011)
and in biotic and abiotic stress responses (Walter 2003; Alcázar et al. 2006b, 2010a;
Groppa and Benavides 2008; Hussain et al. 2011; Marco et al. 2011; Nambeesan
17 Dealing with Environmental Stresses: Role of Polyamines in Stress Responses 461
et al. 2012; Shelp et al. 2012) are extensively reviewed. PAs are crucial components
in embryogenesis (Evans and Malmberg 1989; Galston et al. 1997; Kakkar et al.
2000; Bertoldi et al. 2004; Silveira et al. 2006; Pieruzzi et al. 2011), differentiation
and morphogenesis (Kusano et al. 2007a, 2008; Hassannejad et al. 2012; Takano
et al. 2012; Yoshimoto et al. 2012), floral initiation and development and fruit de-
velopment (Galston et al. 1997; Bagni and Tassoni 2001; Kusano et al. 2007a, 2008)
and senescence (Evans and Malmberg 1989; Takahashi and Kakehi 2010). Involve-
ment of PAs in several types of abiotic stress responses such as salinity (Alcázar
et al. 2006b; Liu et al. 2007; Alet et al. 2012; Hu et al. 2012), drought (Galston et al.
1997; Alcázar et al. 2006b; Groppa and Benavides 2008; Wang et al. 2011), extreme
temperature tolerance (Evans and Malmberg 1989; Urano et al. 2003; Zhang et al.
2011; Cheng et al. 2012; Cvikrová et al. 2012; Lee et al. 2012;), and in mineral
deficiencies and heavy metal toxicity (Martin-Tanguy 2001; Alcázar et al. 2010a;
Shevyakova et al. 2011; Kumar et al. 2012) is extensively described.
PA catabolism is an important process in regulating PA levels in cells. In plants,
copper-binding diamine oxidases (CuAO/DAO) and flavin adenine dinucleotide
(FAD)-binding polyamine oxidases (PAO) have diversified roles in growth cycle
and in environmental stress tolerance (reviewed in Cona et al. 2006; Moschou et al.
2008b). CuAO/DAO and PAO are involved in cell wall strengthening and rigidity
during cell growth and development (Paschalidis and Roubelakis-Angelakis 2005;
Cona et al. 2006; Delis et al. 2006; Tisi et al. 2011). In dormancy alleviation, dif-
ferential regulation of genes involved in reactive oxygen species (ROS) production
including amine oxidases is observed (Oracz et al. 2009). Further, association of
PAO in developmental programmed cell death is reported (Paschalidis and Roube-
lakis-Angelakis 2005; Cona et al. 2006). Differential regulation of PAO genes and
concomitant accumulation of proline accompanied with enhanced H2O2 production
leading to salt tolerance is reported in some plant species (reviewed in Cona et al.
2006; Alcázar et al. 2010a; Campestre et al. 2011). Induction of PAO is described
in water deficient conditions leading to stomatal regulation by ABA signalling
(Moschou et al. 2008b) and osmotic stress tolerance (Aziz et al. 1997; Moschou
et al. 2008b). Evidences indicate that H2O2 induced by DAO and PAO activity has a
function in plant-pathogen/elicitor defence responses (reviewed in Cona et al. 2006;
Moschou et al. 2008b; Wimalasekara et al. 2011a).
Biosynthesis of Polyamines
The intracellular levels of PAs are determined by their biosynthesis, degradation and
conjugation. Spatial and temporal variations of intracellular PA levels are reported
in many plant species. The initial step of the biosynthesis of PAs is the formation
of di-amine put. Biosynthesis of put in plants occurs through two distinct pathways
either directly from ornithine by ornithine decarboxylase (ODC) or from arginine
by arginine decarboxylase (ADC) followed by two successive reactions catalysed
by agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase
Fig. 17.1 Schematic representation of PA biosynthetic pathways in plants. ADC arginine decar-
boxylase, AIH agmatine iminohydrolase, CPA N-carbamoylputrescine amidohydrolase, ODC
ornithine decarboxylase, SPDS spermidine synthase, SPMS spermine synthase, SAM synthase
S-adenosylmethionine synthase, SAMDC S-adenosylmethionine decarboxylase, ACC synthase
1-amino-cyclopropane-1-carboxylic-acid synthase, ACC oxidase 1-amino-cyclopropane-1-
carboxylic-acid oxidase. (Adapted from Wimalasekara et al. 2011a)
(CPA). The tri-amine spd and tetra-amine spm are synthesised by successive ad-
dition of aminopropyl groups to put and spd respectively in reactions catalyzed by
spermidine synthase (SPDS) and spermine synthase (SPMS) (Slocum et al. 1984;
Tiburcio et al. 1997). The aminopropyl groups are produced from decarboxylation
of S-adenosylmethionine (SAM) catalyzed by SAM decarboxylase (SAMDC) (Slo-
cum et al. 1984; Tiburcio et al. 1997) (Fig. 17.1). The presence of ODC pathway
and characterization of genes coding for ODC is reported from many plant species
(Michael et al. 1996). However, Arabidopsis lacks ODC pathway and biosynthesis
of put occurs exclusively through the ADC pathway (Hanfrey et al. 2001). ADC1
and ADC2 are the two genes that encode ADC of Arabidopsis and they are shown
to be expressed in a tissue specific manner (Soyka and Heyer 1999). Arabidopsis
has single genes that code for AIH and CPA (Janowitz et al. 2003; Piotrowski et al.
2003), two genes namely SPDS1 and SPDS2 that code for spermidine synthase
(Panicot et al. 2002), genes SPMS and ACL5 coding, spermine synthase (Hanzawa
et al. 2000) and at least four genes coding SAM decarboxylase (Urano et al. 2004).
In some plant species, subcellular compartmentalization of ADC pathway is re-
ported which probably lead to a concentration gradient of put in a cell (Borrell et al.
1995; Bortolotti et al. 2004). A number of studies indicate that genes coding for PA
biosynthesis is highly regulated by an array of abiotic and biotic factors and PA me-
tabolism interacts largely with other metabolic pathways (Bouchereau et al. 1999;
Soyka and Heyer 1999; Urano et al. 2003; Alcázar et al. 2006b, 2010a).
Catabolism of Polyamines
PA catabolism is an important process that regulates the intra-cellular levels of

PA. PAs are oxidatively catabolised by copper-binding diamine oxidases (CuAO)/
diamine oxidases (DAO) and FAD-binding polyamine oxidases (PAO) which are
commonly found in all living organisms (Buchanan et al. 2000; Bagni and Tassoni
2001; Cona et al. 2006). Plant CuAO/DAO preferentially catalyses the oxidation of
di-amine put, at the primary amine group producing 4-aminobutanal with concomi-
tant production of NH3 and H2O2. Resulting 4-aminobutanal is further converted
to γ-aminobutyric acid (GABA) via Δ1-pyrroline. PAOs preferentially catalyse the
oxidation of spd and spm at the secondary amine group producing 4-aminobutanal
and N-(3-aminopropyl)-4 aminobutanal, respectively, with concomitant production
of 1,3-diaminopropane (DAP) and H2O2 (Buchanan et al. 2000; Cona et al. 2006;
Moschou et al. 2008b, c) (Fig. 17.2). Experimental evidences indicate that CuAO/
DAO and PAO have important regulatory function in plant growth and in stress tol-
erance by modulating the levels of PAs and their reaction products. They are impor-
tant regulators of ROS and GABA synthesis, which are key metabolites involved
in various physiological processes. Both CuAO/DAO and PAO have species and
tissue specific regulatory functions and sptio-temporal expression patterns (Cona
et al. 2006). CuAO/DAO encoding genes have been isolated and characterized from
some plants for example, from Arabidopsis (Moller and McPherson 1998), chick
pea (Rea et al. 1998) and pea (Tipping and McPherson 1995). PAOs are identified
from many plant species particularly in monocots (Sebela et al. 2001). Gene family
of PAO from maize which consist of three members and proteins are bound to cell
walls (Tavladoraki et al. 1998) and symplast localized barley PAO family consisting
of two genes (Cervelli et al. 2001) are widely been studied. In Arabidopsis, twelve
CuAO/DAO and five PAO coding genes have been identified and characterized.
The proteins are localized in apoplast and in peroxisomes (Alcázar et al. 2006b;
Cona et al. 2006; Tavladoraki et al. 2006). Studies on gain and loss of function mu-
tants especially in Arabidopsis have provided new insights into molecular mecha-
nisms of PA function and PA interaction with other signal transduction pathways.
These findings with special emphasis on abiotic stress tolerance are discussed in
detail in the following sections.
Abiotic Stresses
Experimental evidences indicate that differential regulation of plant PA biosynthe-

sis, conjugation and catabolism are important in dealing with stress tolerance in
response to a variety of environmental stresses ranging from drought, salinity, tem-
perature extremes, mineral deficiency to wounding (reviewed in Cona et al. 2006;
Groppa and Benavides 2008; Moschou et al. 2008b; Alcázar et al. 2010a; Angelini
et al. 2010; Wimalasekara and Scherer 2010; Wimalasekara et al. 2011a). The bal-
ance between PA catabolism and anabolism is shown to play a significant role in
Fig. 17.2 Schematic representation of PA catabolic pathways in plants. Copper-binding diamine

oxidases (CuAO)/diamine oxidases ( DAO) catalyses the oxidation of di-amine putrescine, at the
primary amine group producing hydrogen peroxide (H2O2), ammonia (NH3) and 4-aminobutanal
as reaction products. Polyamine oxidase ( PAO) catalyses the oxidation of spermidine and sperm-
ine at the secondary amine group producing 4-aminobutanal and N-(3-aminopropyl)-4 aminobu-
tanal respectively, in addition to 1,3-diaminopropane and H2O2. 4-aminobutanal produced through
putrescine and spermidine oxidation is further converted to γ-aminobutyric acid (GABA) via
Δ1-pyrroline. Besides terminal catabolic pathway, back-conversion pathway takes place produc-
ing spermidine and putresine. H2O2 and 3-aminopropanal is produced as reaction products in the
polyamine back conversion pathway. (Modified from Angelini et al. 2010)
PA-mediated stress tolerance. A number of recent studies indicate that cross talk of
PA signalling with other signalling pathways in a variety of abiotic stress responses
(Alcázar et al. 2010a).
Salt Stress
Plant growth is restricted when the soil contains excess amounts of minerals. Salin-
ity affects a considerable amount of crop loss worldwide specifically in arid and
semiarid regions. Salt injury is caused by decrease in water potential and by accu-
mulation of ions to toxic levels. Tolerance levels to soil salinity differ dramatically
among plant species. The mechanisms by which plants tolerate salinity are complex
involving molecular synthesis, enzyme induction and membrane transport. Over

the years, attempts were made to enhance the salt tolerance of several salt sensitive
crop species using classical plant breeding and molecular biological approaches
(Taiz and Zeiger 2006).
Significance of PAs, CuAO/DAO and PAO in salt stress tolerance is described in
several plant species (reviewed in Alcázar et al. 2006b, 2010a; Cona et al. 2006; Liu
et al. 2007). Accumulation of increased amounts of PAs in rice, tobacco and Arabi-
dopsis is reported to enhance the tolerance to high salinity conditions. In salt-tolerant
cultivars of rice, accumulated amount of spd and spm was higher than in the salt-
sensitive rice cultivars while the latter showed higher amounts of put accumulation
(Basu and Ghosh 1991). The quantification of PA levels in salt-sensitive rice culti-
vars showed that salt-sensitivity is related with the differences in PA accumulation
in the shoot system under high salinity, specifically put to a higher level and spd and
spm to lower levels (Krishnamurthy and Bhagwat 1989). In salt-tolerant cultivars of
rice, root plasma membranes were rich in spd and spm while in salt-sensitive culti-
vars root plasma membranes were rich in put (Roy et al. 2005). In barley seedlings,
salt injuries caused by high concentration of NaCl could be partially attenuate by
exogenous application of put and spd (0.5 mM) (Zhao and Qin 2004). In roots and
leaves of Lupinus luteus growing on high salinity conditions, accumulated increased
amounts of PAs bound to microsomal membranes implying less injuries caused by
salt stress (Legocka and Kluk 2005). There are more reports on adverse salinity-me-
diated increase in PA amounts in a number of plant species. For example, an increase
in free, acid-soluble bound and total spm was observed in leaf tissues of sunflower
exposed to increasing concentrations of NaCl (Mutlu and Bozcuk 2005), In spinach,
lettuce, melon, pepper, broccoli, tomato and wheat high salt concentrations resulted
in substantial accumulation of spd and spm (El-Shintinawy 2000; Zapata et al. 2004).
Experimental evidences indicate that salt stress induced PA-mediated responses
mainly rely on the activation of arginine decarboxylase ( ADC2) and amine oxi-
dases. In Arabidopsis, strikingly increased expression level of ADC2 and spermine
synthase ( SPMS) was observed under high salinity (Soyka and Heyer 1999). Fur-
ther, mutants defect in PA biosynthesis displayed increased sensitivity to salt stress
(Soyka and Heyer 1999; Yamaguchi et al. 2006). External supplementation of spm
to spm-deficient mutants suppressed the salt sensitivity of these mutants (Yamagu-
chi et al. 2006). Arabidopsis mutants spe1-1 and spe2-1 with reduced ADC activ-
ity showed no accumulation of PAs in response to salt treatment, demonstrating
the importance of ADC activity in salt tolerance (Kasinathan and Wingler 2004).
Moreover, rice over-expressing oat ADC showed increased plant biomass under
salinity indicating higher PA production by enhanced ADC activity (Roy and Wu
2001). In another study, salt stress resulted in an induction of AtADC2 transcripts
in Arabidopsis correlating with the accumulation of free put (Urano et al. 2004).
Rice varieties exposed to high salinity showed an increase in transcript levels of
S-adenosylmethionine decarboxylase ( SAMDC1) and in the salt-tolerant variety,
transcription of SAMDC1 was higher than in the salt-sensitive variety (Li and Chen
2000). These experimental evidences indicate an obvious protective function of spd
and spm in salt stress tolerance. Presence of a pool of put may be a prerequisite
to spd and spm synthesis. spm and spd prevented the leakage of electrolytes and
amino acids from roots and shoots of rice proposing a positive correlation between
salt tolerance and increased accumulation of PAs (Chattopadhayay et al. 2002). The
protective function of PAs in salt stress may be at least partly due to rigidifying
microsomal membrane surfaces leading to stabilization against NaCl and osmotic
stress (Legocka and Kluk 2005).
PA effect on salt-stress tolerance can also be attributed to the differential regula-
tion of catabolism of PA by DAO and PAO (Moschou et al. 2008b; Angelini et al.
2010). The catabolic products of PA such as 4-aminobutanal, H2O2 and GABA are
associated with various physiological processes involved in stress responses includ-
ing salt stress tolerance. Enhanced DAO/CuAO and PAO activities was observed
in the salt stressed oat seedlings and tomato leaf discs followed by accumulation of
proline and proline accumulation was hindered when these plants were treated with
DAO/CuAO inhibitors (Alcázar et al. 2010b).
In high salinity exposed soybean roots increase in CuAO and GABA activities
was seen with concomitant decrease in put, cadaverine and spd levels (Xing et al.
2007). Decrease in CuAO activity, recovery of PA levels and a simultaneous reduc-
tion of GABA level was found in soybean during the recovery from NaCl stress pro-
posing that GABA derived from PA catabolism is probably involved in salt-stress
mediated defence reactions (Xing et al. 2007). Increased amounts of H2O2 produced
by DAO/CuAO and PAO activities lead to PCD and expression of defence genes
suggesting importance of amine oxidases in salt stress responses. Maize ZmPAO
overexpressing tobacco plants showed high quantities of spd followed by increased
activity of apoplastic PAO. As a result, an elevated amount of H2O2 was produced
and PCD was induced (Moschou et al. 2008a). In contrast, tobacco plants down-
regulating endogenous PAO accumulated lower amounts of H2O2 in response to salt
stress exhibiting less PCD than wild type plants (Moschou et al. 2008a). Induction
of several stress-responsive genes could be observed as a result of apoplastic PA
catabolism by PAO (Moschou et al. 2008a). Moreover, downstream signalling sub-
stances such as mitogen activated protein kinases (MAPK) were induced by H2O2
produced through PAO activity. In maize, salt stress induced ROS generated by
PAO was involved in signalling the adaptive responses to high salinity (Rodríguez
et al. 2009). These studies indicate that ratio of PA catabolism and anabolism is
crucial in salt stress tolerance.
Taken together, increased PA levels represent a salt-stress induced protective
function in many different plant species. Genetic modification of PA biosynthesis
and catabolism pathways is useful in enhancing salt-tolerance function of model
plants as well as in crop plants.
Water Stress
Drought has a direct effect on agriculture leading to crop losses in different mag-
nitudes in many parts of the world. Far beyond the crop loss, drought causes many
socio-economic impacts and even famine in some less developed countries. It is

being predicted that wide spread drought conditions may happen more regularly,
severely and last for extended periods in coming decades as a result of global warm-
ing and climate change. Strategies for efficient management of droughts include
strategic management of agriculture. Apart from efficient practices for water and
soil management and crop planning, several attempts have been paid to improve the
drought tolerant capacity of plants especially important crop plants by conventional
as well as by modern genetic engineering techniques.
Drought resistance mechanisms vary with climate and soil conditions and the
capacity of drought resistant vary greatly among plant species. Plants exhibit vari-
ous responses to water stress such as inhibition of leaf expansion which occur as a
result of decrease in turgor, limits in photosynthesis, leaf abscission, increased wax
deposition on the leaf surface, altered energy dissipation from leaves, root exten-
sion into deeper wetter soil and stomatal closure. Sensing of water deficiency and
signal transduction leads to the induction of genes responsible for acclimation and
adaptation to stress. Several of these genes encode enzymes associated with os-
motic adjustment (Taiz and Zeiger 2006). Considerable effort have been directed
towards identifying traits associated with drought resistance of crop plants and with
the availability of molecular techniques crops have been modified for improved
drought resistance.
Among the many components, PAs are identified as one such component hav-
ing regulatory function in water stress. In water stressed plants endogenous levels
of PAs are considerably increased confirming stress-specific roles of PAs (Galston
et al. 1997; Groppa and Benavides 2008). For example, in wheat seedlings exposed
to drought, PAs especially spd accumulated to a higher level in comparison to the
control plants (Kubis and Krzywanski 1989), chickpea plants responded to onset
of drought by increasing the endogenous spd levels and total PA content in the
roots (Nayyar and Chander 2004; Nayyar et al. 2005), and in water stressed V. faba
leaves, free spd levels increased considerably (Liu et al. 2000). The Arabidopsis
double mutant acl5/spms that produce lower spm is hypersensitive to drought stress
(Kusano et al. 2007b). Manipulation of PA biosynthesis pathway caused altered
drought resistant capacities in many plant species. In Arabidopsis, overexpression
of ADC2 increased put levels and drought tolerance was enhanced by stimulation
of stomatal closure (Alcázar et al. 2010b). Rice plants overexpressing ADC gene of
oat showed improved drought tolerance by increasing put levels and reducing chlo-
rophyll loss (Capell et al. 1998, 2004). Up-regulation of ADC gene was observed
in the osmotically-stressed oat leaves, indicating increased PA synthesis leading to
stress tolerance (Galston et al. 1997). Overexpression of S-adenosyl methionine
decarboxylase in Arabidopsis lead to increased spm levels and enhanced the expres-
sion of a key ABA biosynthesis gene NCED3 (Alcázar et al. 2006a). During drought
conditions, accumulation of put was impaired in the ABA-deficient and ABA-in-
sensitive mutants (Alcázar et al. 2006a). During water stress, ABA is known to
modulate PA metabolism by up-regulating the expression of ADC2, spermidine syn-
thase ( SPDS1) and spermine synthase ( SPMS) genes (Alcázar et al. 2006a). A study
by Lie et al. (2000) revealed that physiological function of elevated PA levels during
water stress tolerance was attributed to PA-mediated regulation of inward K + chan-
nel in the plasma membrane of guard cells and modulation of stomatal aperture.
Further, these findings indicate that PAs target a putative guard cell K + channel
KAT1-like inward K + channels in guard cells and modulate stomatal movements,
providing evidence for presence of link among stress conditions, polyamine levels,
and stomatal regulation (Lie et al. 2000). When dehydrated in vitro grown Citrus
reticulata plants were treated with exogenous spm, stomatal closure was promoted
and exhibited a less wilted phenotype, reduction of water loss and electrolyte leak-
age compared to spm untreated plants (Shi et al. 2010), again indicating a function
of PA in stomatal regulation.
The importance of PA catabolism in water stress responses is described in many
plant species (reviewed in Cona et al. 2006; Moschou et al. 2008b; Angelini et al.
2010). Osmotic stress tolerance of rape leaf discs and whole rape seedlings sub-
jected to drought is linked to increased amounts of put and DAP which is a product
of PAO activity (Aziz et al. 1997). Experimental evidence of Toumi et al. (2010)
indicated that drought-tolerant grapevine has increased PAO activity as compared
to drought-sensitive variety. H2O2 produced by PA oxidation reaction was involved
in signalling cascade of drought tolerance (Toumi et al. 2010). DAO/CuAO and
PAO are considered as important controllers of ABA signalling pathway in stomatal
regulation (Lie et al. 2000; An et al. 2008; Moschou et al. 2008a, b). In Arabidop-
sis, induction of AtPAO2, AtPAO3 and AtPAO4 by ABA suggests a role of PAO in
ABA signalling (Moschou et al. 2008a). Gene expression analysis demonstrated
that PAO2 of Arabidopsis is upregulated during drought stress and shows similar
expression kinetics as the ABA-inducible RD29A and RD22 genes supporting a role
of PAO2 in drought resistance (Alcázar et al. 2011). An et al. (2008) showed that
exogenous application of ABA to the Vicia faba leaf epidermis caused stimulation
of apoplast CuAO activity followed by increased H2O2 production finally leading
to induced stomatal closure. When CuAO inhibitors were applied these processes
were impaired. These factors indicate that CuAO in V. faba guard cells is an es-
sential enzymatic source for H2O2 production in ABA-induced stomatal closure.
For the ABA-induced stomatal closure, second messengers such as Ca2 +, ROS,
and nitric oxide (NO) are also important. CuAO/DAO and PAO may be important
in regulating the other signalling substances probably via generation of H2O2 in
stress situations like water stress. Involvement of DAO in the ABA induced H2O2
production in roots of rice seedling is reported (Lin and Kao 2001). Biosynthe-
sis of H2O2 by ABA-stimulated CuAO activity resulted in root growth inhibition
by cell wall stiffening by peroxidases (Lin and Kao 2001). Involvement of a
copper amine oxidase gene, COPPER AMINE OXIDASE1 ( CuAO1) of Arabidop-
sis was tested for its role in ABA mediated stress responses using the knockouts
cuao1-1 and cuao1-2 (Wimalasekara et al. 2011b). Compared to WT, the knock-
outs showed less sensitivity to ABA during germination, seedling establishment
and root growth inhibition characterizing knockouts as ABA-insensitive. Fur-
ther, PA-induced and ABA-induced NO production in cuao1-1 and cuao1-2 were
impaired suggesting a function of CuAO1 in PA and ABA-mediated NO production
(Wimalasekara et al. 2011b).
Heat and Cold Stress
Global warming is becoming a worldwide concern and over the last 25 years an in-
creasing rate of warming has taken place. Regional temperature anomalies, extreme
high temperature with frequent heat waves and extreme cold weather conditions
are also inevitable. Influence of unusually high and low temperatures on agricul-
ture, forestry and fisheries are enormous finally leading to socio-economic impacts
around the world. High temperature on crop production most of the times affect
Asia and Africa. Prolonged winter and irregular low temperature conditions affect
agriculture in many European and American countries. In terms of agriculture, apart
from mitigation measures, adaptation mechanisms to such adverse impacts include
development of cultivation techniques and development of resistant crop varieties.
Most plants are unable to survive extended exposure to temperatures above 45°C
while succulent plants are adapted to high temperatures tolerating temperatures of
60–65°C. High temperatures most of the times lead to heat stress and heat shock and
often the water and temperature stresses are interrelated. Heat stress inhibits pho-
tosynthesis and impairs membrane function and protein stability. Adaptive mecha-
nisms to heat stress include responses that decrease light absorption by the leaves,
heat shock protein synthesis which act as molecular chaperons in stabilizing and
correcting protein folding and biochemical responses leading to pH and metabolic
homeostasis (Taiz and Zeiger 2006).
Chilling and freezing stresses are triggered by low temperature. Typical chilling
injuries such as slow growth, leaf lesions and wilting are caused primarily by loss of
membrane properties ensuing from changes in membrane. Freezing injury is linked
basically to damage caused by formation of ice crystals within cells. Mechanisms
that confer freeze resistant include dehydration and supercooling of leaves, which
limit the growth of ice crystals to extracellular spaces. Cold stress leads to osmotic
stress and activate osmotic stress-related signalling pathways and accumulation of
proteins involved in cold acclimation (Taiz and Zeiger 2006).
Several plant species including important crop species have been produced for
better tolerance to high and low temperature regimes by modifying physiological
and biochemical pathways concerned. There are number of reports showing differ-
ential accumulation of PAs in response to high and low temperatures (reviewed in
Kakkar and Sawhney 2002; Alcázar et al. 2006b, 2010a; Cona et al. 2006; Groppa
and Benavides 2008; Moschou et al. 2008b; Gill and Tuteja 2010; Wimalasekara
et al. 2011a). Importance of put accumulation in freezing temperature tolerance
in Arabidopsis and transcriptional upregulation of ADC1 and ADC2 upon cold
treatment is described (Cuevas et al. 2008, 2009). Compared to wild type plants,
mutants adc1 and adc2 displayed higher sensitivity to freezing and treating with
put complemented the stress sensitivity (Cuevas et al. 2008, 2009). Moreover, this
study revealed that detrimental consequences of put depletion during cold stress are
due, at least in part, to alterations in the levels of ABA by modulating expression of
ABA biosynthesis genes (Cuevas et al. 2008, 2009). Complementation analysis of
adc1 mutants with ABA and reciprocal complementation of aba2-3 mutant with put
revealed that diamine control the levels of ABA in response to cold by modulating
ABA biosynthesis (Cuevas et al. 2008, 2009). In another study, PA levels specially
put levels increased in chickpea subjected to chilling temperature (Nayyar 2005).
Accumulation of put occurs as a rapid reaction to low temperature as seen in poplar
seedlings grown at 4°C (Renaut et al. 2005). Supplementation of growth medium
with spd prior to the cold treatment resulted higher cold tolerance in cucumber (He
et al. 2002). In cold-tolerant cultivars of cucumber, markedly increased level of spd
was observed during chilling as opposed to the cold sensitive cultivars (Shen et al.
2000). OsSPDS2, a novel SPDS gene from rice was involved in chilling responses
in rice roots (Imai et al. 2004). Further, Arabidopsis plants overexpressing Cucur-
bita ficifolia SPDS1 showed increased tolerance to chilling and freezing tolerance
(Kasukabe et al. 2004). Microarray analysis revealed that increased transcription
of several stress responsive genes in the transgenic plants under chilling stress sug-
gesting an important role for spd as a signaling compound or as a regulator of stress
signaling pathways, leading to developed stress tolerance mechanisms (Kasukabe
et al. 2004).
Altered regulation of PA biosynthesis is observed as one of the mechanisms in-
volved in high-temperature tolerance. Overexpression of SAMDC (from Saccharo-
myces cerevisiae) in tomato caused 1.7–2.4 fold higher levels of spd and spm pro-
duction under high temperature stress, enhanced antioxidant enzyme activity and
the protection of membrane lipid peroxidation (Cheng et al. 2009). The levels of
free and conjugated PAs and ADC were higher in calli of heat-tolerant rice cultivars
than in heat-sensitive cultivars under non-stressed conditions. Heat stress caused
greater accumulation of free and conjugated polyamines in calli of the heat-tolerant
cultivar (Roy and Ghosh 1996). PA catabolism was also associated with heat stress
as shown by increased PAO activity in heat-tolerant rice cultivars (Roy and Ghosh
1996). In another study, tobacco plants over-producing proline showed a transient
increase in the levels of free and conjugated Put and in the levels of free spd, nor-
spermidine (N-Spd) and spm after a 2-h lag phase (Cvikrová et al. 2012). The find-
ings indicate that proline and PA biosynthetic pathways act together in dealing with
heat stress conditions.
All these experimental results indicate that transgenic approach, which increases
PA biosynthesis could be a good strategy to improve the high and cold temperature
tolerance.
Oxidative Stress
Oxidative stress is induced by various abiotic factors such as hyperoxia, light,

drought, high salinity, cold, metal ions, pollutants, xenobiotics and toxins, biotic
factors like pathogen infection and developmental transitions such as seed matura-
tion and aging of plant organs. Oxidative stress produces ROS in plant cells (Grene
2002). Under physiological steady state, ROS are scavenged by antioxidative de-
fence components that are often confined to particular cell compartments. In some
instances, plants generate ROS as defence responses to various stresses. If the equi-
librium between ROS production and scavenging is disturbed it is harmful to the
plants (Apel and Hirt 2004). The most important ROS scavenging enzymes are
superoxide dismutase (SOD), ascorbate peroxidase (APX), glutathione peroxidase
(GPX), and catalase (CAT).
PAs play a role in oxidative stress tolerance by functioning as antioxidants under
some environmental conditions (Groppa et al. 2001, Chattopadhayay et al. 2002;
Kakkar and Sawhney 2002). Few examples are, leaf injury of the ozone-sensitive
tobacco cultivar Bel W3 caused by ozone treatments was minimized when put, spd
or spm was applied to the root system (Bors et al. 1989) and it was suggested that
the antioxidative effect is due to a combination of their anionic and cationic-binding
properties in radical scavenging function (Bors et al. 1989). Løvaas (1997) reported
that PAs are involved in preventing photooxidative damage. But there are contrdict-
ing evidences regarding lack of antioxidant activity of PAs.
A study using vesicles prepared with mixed soy bean phospholipids showed
that PA mediated inhibition of lipid peroxidation by metal-catalysed the oxida-
tive reactions (Tadolini et al. 1988). H2O2 produced as a result of catabolism of
PA by CuAO/DAO and PAO act as a signalling molecule that promotes activa-
tion of defence responses but it can also act as a prooxidant agent (Groppa and
Benavides 2008).
Mineral Deficiency and Heavy Metal Stress
Both, natural and agricultural ecosystems are most of the times known to have
sub-optimal levels of mineral nutrients (Lynch and Clair 2004). Mineral stress con-
ditions cause important, complex, and poorly understood interactions with global
climate change. Factors such as changes in rainfall, temperature, solar radiation and
atmospheric CO2 concentration have significant impact on soil nutrient status and
soil erosion rates. Inadequate supply of minerals to the plants results in nutritional
disorders manifested by characteristic deficiency symptoms. Presence of excess
minerals in the soil mostly associated with accumulation of heavy metals such as
zinc, copper, cobalt, nickel, mercury, lead and cadmium causing severe toxicity in
plants (Taiz and Zeiger 2006). In plants metal toxicity arise from the binding of
metals to sulphydryl groups of proteins inhibiting enzymes activities or altering
protein structure (Van Assche and Clijsters 1990), stimulation of ROS formation
leading to oxidation of macromolecules and oxidative stress (Sandalio et al. 2001).
The presence of excess minerals in soil also leads to saline conditions in which
plant growth is restricted. Most of the times mineral deficiency and toxic stresses in
plants are not clearly identifiable with other stress conditions making it even more
complicated to predict and find solutions in improving crop yield. Genetic variation
among plants has a significant influence in dealing with mineral stresses. Plants
display variable morphological, physiological and biochemical adoptive responses
in dealing with particular mineral deficient condition and heavy metal toxicity.
Considerable efforts have been made to improve the yield of plants subjected to
these stresses by modifying the soil, selecting and breeding genotypes and by ge-
netic modification.
Mineral deficient conditions influence differential regulation of hormones and
growth promoting substances. Altered metabolism of PAs in response to K +, Mg +
and PO4 + deficiencies are reported (reviewed in Groppa and Benavides 2008).
K + deficiency-induced PA metabolism is mostly studied. Young and Galston (1984)
showed that accumulation of put under K-deficiency by long term growing of oat
plants on a low-K nutrient medium. ADC and ODC activities in entire K-deficient
shoots were 6-fold and 2-fold greater than in the K-sufficient grown plants respec-
tively (Young and Galston 1984). Arabidopsis thaliana responded to K-deficiency
by increasing ADC activity upto 10-fold over unstressed plants with a correspond-
ing increase in put levels up to 20-fold (Watson and Malmberg 1996). Important
function of put in maintaining cation-anion balance in plant tissues is well known
(reviewed in Bouchereau et al. 1999). In birch leaves, increased amounts of put and
DAP, a product of PAO activity was found in K-deficient situations (Sarjala and
Kaunisto 2002). Put accumulation is considered as a good indicator of K-deficiency
of forest trees (Kaunisto and Sarjala 1997; Sarjala and Kaunisto 2002). In tobacco
plants a short-term boron deficiency caused an increase in free put in roots and con-
jugated put in leaves indicating a possible link between boron and PA levels (Cama-
cho-Cristóbal et al. 2005). Source of Nitrogen dependent PA accumulation has been
reported in wheat and pepper. Significant increase in put content was observed in
ammonium nutrition and to a lesser extent in urea nutrition (Houdusse et al. 2005).
However, put content was significant reduced with nitrate nutrition (Houdusse et al.
2005). Proline content of the plants also showed a similar pattern as put content but
to a lesser degree (Houdusse et al. 2005). They hypothesized that put biosynthesis
might be related to proline degradation by a specific pathway related to ammonium
detoxification. It is also reported that Mg and N deficiencies induced changes in PA
content in grapevine (Evans and Malmberg 1989).
Changes in PA metabolism occur by metal toxicity (Groppa et al. 2001, 2003,
2007; Lin and Kao 1999). Increased accumulation of total PAs was observed when
tobacco BY-2 cells were exposed to 0.05 mM Cd2 + for 3 days (Kuthanová et al.
2004). Among all the PAs, put content was significantly higher and DAO activity
was also stimulated (Kuthanová et al. 2004). Treating mungbean seedlings with
CdCl2 (0.1–1.5 mmol/L) resulted decreased DAO activities and subsequently re-
stricted the accumulation of endogenous PAs (Choudhary and Singh 2000). Groppa
et al. (2003) reported that PA metabolism is differentially regulated by Cd2 + and
Cu2 + in sunflower and wheat leaves. Both metals increased put content in wheat
leaves but reduced put content in sunflower leaves. Treating wheat leaves with Cd2 +
raised the ADC and ODC activities while Cu2 + raised only ODC activity (Groppa
et al. 2003). Groppa et al. (2007) showed that both ADC and ODC activities in
shoots of sunflower plants were increased by 1 mM Cd, whereas 1 mM Cu en-
hanced only ADC activity. A protective role of PAs in Cd2 + and Cu2 +-induced oxi-
dative stress in sunflower leaves is described (Groppa et al. 2001). Pre-treatment
with 1 mM spd and spm prevented the Cd2 + and Cu2 +-mediated reduced activities
of glutathione reductase (GR) and superoxide dismutase activities (Groppa et al.
2001). In accordance, Tang et al. 2005 showed increased tolerance of Typha latifola
under Cd2 + stress by exogenous addition of spd, primarily by increasing GR activity
and GSH level.
Taken together all these experimental evidences indicate a function of PA in
mineral deficiency and heavy metal toxicity stress responses although the molecular
mechanism is not well understood.
Mechanical Stress
Mechanical damage/wounding caused by abiotic factors such as rain and wind, and
by biotic factors such as pathogen attack and insect bite is a continuous threat to
plants and it leads to a reduction in crop yield. Mechanical stress initiates signalling
pathways and known to generate signalling substances for example jasmonic acid,
salicylic acid, NO and H2O2 for the induction of wound-responsive genes.
Recent studies indicate that PAs are also involved in mechanical stress respons-
es. In mechanically injured Arabidopsis and oilseed rape a significant increase of
put levels was observed (Perez-Amador et al. 2002; Cowley and Walters 2005).
In response to mechanical wounding and methyl jasmonate treatment, Arabidopsis
showed increased expression of ADC2 and a transient increase in the level of free
put (Perez-Amador et al. 2002). Moreover, after wounding a decrease in the level
of free spm, coincident with the increase in put was observed (Perez-Amador et al.
2002). Cowley and Walters (2005) showed that mechanical wounding of the oilseed
rape leaves led to significant, but transient, increases in ADC activity and decrease
in DAO activity both locally and systemically (Cowley and Walters 2005). Several
reports provide evidences regarding the wound-healing function of CuAO/DAO and
PAO (reviewed in Angelini et al. 2010). In chickpea seedlings mechanical wound-
ing induced a rapid increase in CuAO expression levels and treatment of plants with
CuAO inhibitor decreased the accumulation of H2O2 and lignosuberization along
the lesion (Rea et al. 2002). In Zea mays, involvement of PAO in increased H2O2
biosynthesis during wounding was observed and wound healing was accelerated by
the deposition of lignin and suberin along the wound area (Angelini et al. 2008).
Importance of PAO-mediated H2O2 in wound healing was observed and it was re-
vealed that lignin and suberin deposition along the wound area was accelerated by
increased PAO activity (Angelini et al. 2008). Furthermore, CuAO involvement in
wound healing is demonstrated in pea seedlings and injury induced an increase of
CuAO and peroxidase activities and increased levels of put, cadevarine, spd and
GABA (Petrivalský et al. 2007). In general, the function of CuAO/DAO and PAO in
wound healing is considered to be due to the intensified lignin and suberine deposi-
tion as a consequence of H2O2 release.
Other Stresses
Increased levels of UV radiation and ozone and herbicide are some of the factors
that impose stress in plants and they have developed various physiological and bio-
chemical adaptations to deal with these stress conditions. A number of components
in plants involved in the stress tolerance reactions are identified. PAs, CuAO/DAO
and PAO are among these components playing a role in these stress responses (re-
viewed in Groppa and Benavides 2008).
Increasing UV radiation in the atmosphere is a reality in Antarctic regions. A few
of the examples of association of PA in UV stress are: in response to UV-B radiation
total free PAs was decreased and conjugated PAs increased in Phaseolus vulgaris
plants (Smith et al. 2001), in cucumber leaves UV-B radiation resulted in decreased
total PA content concomitant with increased electrolyte leakage and weakening of
plant growth (An et al. 2004), in tobacco cultivars subjected to UV-B radiation, PAs
especially put was increased and after extended periods of UV-B exposure PA levels
declined (Lutz et al. 2005). The influence of UV-B on PA metabolism is an indicator
that plants indeed sense UV-B as a stress that also may affect crop yield.
Increasing ozone content in the biosphere is a great problem, which contributes
to global crop losses and forest decline. For the year 2000 global crop yield loss
due to ambient ozone was estimated to be worth $14–26 billion, and 40 % of this
damage occurred in China and India (Van Dingenen et al. 2009). Exposure to ozone
results in foliar injury, impaired photosynthesis, reduced growth and yield, and an
accelerated onset of senescence in plants (Langebartels et al. 1991). Plants have
evolved preventive mechanisms to minimize the damages caused by ozone. They
can limit entry of ozone to interior through stomatal closure or they have tolerance
mechanisms, which include the detoxification of ozone diffused into the leaf inte-
rior through chemical reactions with ascorbic acid or enzymatic conversion to H2O2
(Chen et al. 2003). Since the toxicity of ozone results mainly from oxidative stress,
protecting plants through application of antioxidants is being investigated. PAs ex-
ert several functions, which counteract ozone effects (Langebartels et al. 1991).
Accumulation of PAs in response to ozone exposure and protection against ozone-
derived oxidative damage has been reported from different plant species for exam-
ple from barley (Rowland-Bamford et al. 1989), wheat (Raab and Weinstein 1990)
and tobacco (Langebartels et al. 1991). Increased ADC activity and accumulation of
free and conjugated put was observed in tobacco cultivar Bel B (Langebartels et al.
1991). In accordance with this study, Van Buuren et al. (2002) showed that accu-
mulation of free put in both tobacco cultivars, ozone-resistant and ozone-sensitive
when exposed to ozone. In tissues undergoing cell death in ozone-sensitive cultivar,
accumulation of conjugated put and transient increase of ADC and ODC activity
was observed (Van Buuren et al. 2002). The protective function of PAs in ozone
damage may be due to the control of the cellular redox state, though the precise
mode of action remains unknown (Van Buuren et al. 2002).
A large number of herbicides are widely used in agriculture. Some experimental

evidences exist on the relationship of PAs and herbicides such as paraquat, an inten-
sively used oxidative stress inducer (Groppa and Benavides 2008). In Arabidopsis,
treated with paraquat, there was an increase in put, but not spd and spm (Benavides
et al. 2000). Exogenous addition of PAs was effective in protection against paraquat
toxicity to various degrees in Arabidopsis (Benavides et al. 2000) and in maize
leaves (Durmus and Kadioglu 2005). These results suggested that PAs protective
function may be due to the antioxidative function.
Taken together, PAs are growth regulators present in plants implicated in vast
number of physiological processes in growth and development and abiotic and bi-
otic stress responses (reviewed in Bouchereau et al. 1999; Groppa and Benavides
2008; Alcázar et al. 2010a; Wimalasekara et al. 2011a). As discussed in this review,
differential regulation of PA biosynthesis and catabolism play important roles in
responding to several types of abiotic stresses leading to stress tolerance. Availabil-
ity of information about key genes in biosynthetic and catabolic pathways provide
useful information in manipulating the same for the production of gain and loss of
function mutants which in turn provide the underlying molecular mechanism of PA
functions. For example, overexpression of PA biosynthetic genes, ADC1 and ADC2
was successful in generating several plant species ranging from the model plant
Arabidopsis to the important crop plant rice that exhibited enhanced tolerance to a
variety of stresses. Further, transgenic plants ( Arabidopsis, rice, pear) overexpress-
ing spd and spm synthase genes SPDS and SPMS showed enhanced tolerance to a
number of abiotic stresses (Groppa and Benavides 2008; Alcázar et al. 2010a). In
most of the cases, these transgenic plants showed tolerance to a broad spectrum of
abiotic stresses suggesting interaction in mechanisms of stress resistance common
in different stress types.
Importance of PA catabolic enzymes CuAO/DAO and PAO in plant development
and stress tolerance is extensively reviewed (Cona et al. 2006; Kusano et al. 2008;
Moschou et al. 2008b; Angelini et al. 2010; Wimalasekara et al. 2011a). For ex-
ample, overexpression of CuAO in tobacco showed enhanced tolerance to salt stress
(Moschou et al. 2008b) and overexpression of ZmPAO in tobacco showed enhanced
wound-healing response (Angelini et al. 2008). Most of the PA catabolic functions
are associated with H2O2 that is produced by the activity of CuAO/DAO and PAO.
In most of the instances, H2O2 produced in this manner is involved in reactions
occurring during stress-induced cell wall modifications, in PCD, and as a second
messenger in signalling stomatal regulation. Several experimental evidences exist
regarding the roles of CuAO/DAO and POA in biotic stress tolerance especially in
triggering the hypersensitive response and CPD (reviewed in Walter 2003; Angelini
et al. 2010; Moschou et al. 2008a). Transfer of the knowledge obtained from rather
limited plant species over to valuable crop species will be a future challenge in the
agriculture industry despite the many constrains that exist.
Conclusion and Future Perspective
Plant growth is highly affected by the adverse environmental conditions such as

drought, high salinity, extreme temperature regimes, mineral deficiencies and metal
toxicity causing decreased crop yields. The dynamic climate changes have great im-
pacts on global food security, emphasising vital solution for the crop improvement
by enhancing the stress tolerance. Despite the improvement of conventional meth-
ods, considerable attention has been paid to the utilization of recent advancements
such as transgenic approach, marker assisted screening methods and breeding in
enhancing plant performance under stress conditions.
Apart from essential growth regulatory functions, plant PAs are known to play
important role in stress tolerance by modulating the PA levels. Considerable evi-
dences exist for the natural variations of PAs in different cultivars/accessions cor-
relating with stress situations (Bouchereau et al. 1999). As described in this article,
PA biosynthesis and catabolism are genetically manipulated in some plant species
especially in model plants for enhanced environmental stress tolerance ranging
from drought, salinity, temperature extremes, mineral deficiency to wounding. Fur-
ther investigations are necessary in understanding the molecular mechanisms of
PA action in response to multiple stress situations. Broader insight is also required
on the interacting components and signalling pathways in the PA metabolism and
catabolism to fully uncover the protective function of PAs for subsequent successful
utilization in enhanced crop performance. Advanced techniques including microar-
ray, proteomics and metabolomics will be helpful in gaining detailed understanding.
Future challenge is to transfer knowledge obtained especially from model plants to
a variety of important crop species for enhanced tolerance to adverse environmental
stresses finally aiming at increased crop yields.
References
Alcázar R, Cuevas JC, Patrόn M, Altabella T, Tiburcio AF (2006a) Abscisic acid modulates poly-
amine metabolism under water stress in Arabidopsis thaliana. Physiol Plant 128:448–455
Alcázar R, Marco F, Cuevas JC, Patrόn M, Fernando P, Carraso A, Tiburcio AF, Altabella T (2006b)
Involvement of polyamines in plant responses to abiotic stress. Biotechnol Lett 28:1867–1876
Alcázar R, Altabella T, Marco F, Bortolotti C, Reymond M, Koncz C, Carrasco P, Tiburcio AF
(2010a) Polyamines: molecules with regulatory functions in plant abiotic stress tolerance.
Planta 231:1237–1249
Alcázar R, Planas J, Saxena T, Zarza X, Bortolotti C, Cuevas JC, Bitrian M, Tiburcio AF, Alta-
bella T (2010b) Putrescine accumulation confers drought tolerance in transgenic Arabidopsis
plants overexpressing the homologous Arginine decarboxylase 2 gene. Plant Physiol Biochem
48:547–552
Alcázar R, Bitrian M, Bartels D, Koncz C, Altabella T, Tiburcio AF (2011) Polyamine metabolic
canalization in response to drought stress in Arabidopsis and the resurrection plant Craterostig-
ma plantagineum. Plant Signal Behav 6:243–250
Alet AI, Sánchez DH, Cuevas JC, Marina M, Carrasco P, Altabella T, Tiburcio AF, Ruiz OA (2012)
New insights into the role of spermine in Arabidopsis thaliana under long-term salt stress. Plant
Sci 182:94–100
An LZ, Liu GX, Zhang MX, Chen T, Liu YH, Feng HY, Xu SJ, Qiang WY, Wang XL (2004) Effect
of enhanced UV-B radiation on polyamine content and membrane permeability in cucumber
leaves. Russ J Plant Physiol 51:658–662
An Z, Jing W, Zhang W (2008) Hydrogen peroxide generated by copper amine oxidase is involved
in abscisic acid-induced stomatal closure in Vicia faba. J Exp Bot 59:815–825
Angelini R, Tisi A, Rea G, Chen MM, Botta M, Federico R, Cona A (2008) Involvement of poly-
amine oxidase in wound healing. Plant Physiol 146:162–177
Angelini R, Cona A, Federico R, Fincato P, Tavladoraki P, Tisi A (2010) Plant amine oxidases “on
the move”: an update. Plant Physiol Biochem 48:560–564
Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduc-
tion. Annu Rev Plant Biol 55:373–399
Aziz A, Martin-Tanguy J, Larher LF (1997) Plasticity of polyamine metabolism associated with high
osmotic stress in rape leaf discs and with ethylene treatment. Plant Growth Regul 21:153–163
Bagni N, Tassoni A (2001) Biosynthesis, oxidation and conjugation of aliphatic polyamines in
higher plants. Amino Acids 20:301–317
Basu R, Ghosh B (1991) Polyamines in various rice genotypes with respect to NaCl salinity.
Physiol Plant 82:575–581
Benavides MP, Gallego SM, Comba ME, TomaroML (2000) Relationship between polyamines
and paraquat toxicity in sunflower leaf discs. Plant Growth Regul 31:215–224
Bertoldi D, Tassoni A, Martinelli L, Bagni N (2004) Polyamines and somatic embryogenesis in
two Vitis vinifera cultivars. Physiol Plant 120:657–666
Borrell A, Culiañez-Macià FA, Altabella T, Besford RT, Flores D, Tiburcio AF (1995) Arginine
decarboxylase is localized in chloroplasts. Plant Physiol 109:771–776
Bors W, Langebartels C, Michel C, Sandermann JH (1989) Polyamine as radical scavengers and
protectants against ozone damage. Phytochemistry 28:1589–1595
Bortolotti C, Cordeiro A, Alcazar R, Borrell A, Culiañez-Macià FA, Tiburcio AF, Altabella T
(2004) Localization of arginine decarboxylase in tobacco plants. Physiol Plant 120:84–92
Bouchereau A, Aziz A, Larher F, Martin-Tanguy J (1999) Polyamines and environmental chal-
lenges: recent development. Plant Sci 140:103–125
Buchanan B, Gruissem W, Jones R (2000) Biochemistry and molecular biology in plants. Ameri-
can Society of Plant Physiologists, Maryland, pp 1–90
Camacho-Cristóbal JJ, Maldonado JM, Gonzláez-Fontes A (2005) Boron deficiency increases pu-
trescine levels in tobacco plants. J Plant Physiol 162:921–928
Campestre MP, Bordenave CD, Origone AC, Menéndez AB, Ruiz OA, Rodríguez AA, Maiale SJ
(2011) Polyamine catabolism is involved in response to salt stress in soybean hypocotyls. J
Capell T, Escobar C, Liu H, Burtin D, Lepri O, Christou P (1998) Overexpression of the oat ar-
ginine decarboxylase cDNA in transgenic rice ( Oryza sativa L.) affects normal development
patterns in vitro and results in putrescine accumulation in transgenic plants. Theor Appl Gen
97:246–254
Capell T, Bassie L, Christou P (2004) Modulation of the polyamine biosynthetic pathway in trans-
genic rice confers tolerance to drought stress. Proc Natl Acad Sci USA 10:9909–9914
Cervelli M, Cona A, Angelini R, Polticelli F, Federico R, Mariottini P (2001) A barley polyamine
oxidase isoform with distinct structural features and subcellular localization. Eur J Biochem
268:3816–3830
Chattopadhayay MK, Tiwari BS, Chattopadhayay G, Bose A, Sengupta DN, Ghosh B (2002) Pro-
tective role of exogenous polyamines on salinity-stressed rice (Oryza sativa) plants. Physiol
Plant 116:192–199
Chen Z, Young TE, Ling J, Chang S-C, Gallie DR (2003) Increasing vitamin C content of plants
through enhanced ascorbate recycling. Proc Natl Acad Sci USA 100:3525–3530
Cheng L, Zou YJ, Ding SL, Zhang JJ, Yu XL, Cao JS, Lu G (2009) Polyamine accumulation
in transgenic tomato enhances the tolerance to high temperature stress. J Integr Plant Biol
51:489–499
Cheng L, Sun RR, Wang FY, Peng Z, Kong FL, Wu J, Cao JS, Lu G (2012) Spermidine affects the
transcriptome responses to high temperature stress in ripening tomato fruit. J Zhejiang Univ
Sci B 13:283–297
Choudhary A, Singh RP (2000) Cadmium-induced changes in diamine oxidase activity and poly-
amine levels in Vigna radiata Wilczek seedlings. J Plant Physiol 156:704–710
Cona A, Rea G, Angelini R, Federico R, Tavladoraki P (2006) Functions of amine oxidases in plant
development and defense. Trends Plant Sci 11:80–88
Cowley T, Walters DR (2005) Local and systemic changes in arginine decarboxylase activity,
putrescine levels and putrescine catabolism in wounded oilseed rape. New Phytol 165:807–811
Cuevas JC, Lopez-Cobollo R, Alcázar R, Zarza X, Koncz C, Altabella T, Salinas J, Tiburcio AF,
Ferrando A (2008) Putrescine is involved in Arabidopsis freezing tolerance and cold acclimation
by regulating abscisic acid levels in response to low temperature. Plant Physiol 148:1094–1105
Cuevas JC, Lopez-Cobollo R, Alcazar R, Zarza X, Koncz C, Altabella T, Salinas J, Tiburcio AF,
Ferrando A (2009) Putrescine as a signal to modulate the indispensable ABA increase under
cold stress. Plant Signal Behav 4:219–220
Cvikrová M, Gemperlová L, Dobrá J, Martincová O, Prásil IT, Gubis J, Vanková R (2012) Effect
of heat stress on polyamine metabolism in proline-over-producing tobacco plants. Plant Sci
182:49–58
Delis D, Dimou M, Flemetakis IE, Aivalakis G, Katinakis P (2006) A root- and hypocotyl-specific
gene coding for copper-containing amine oxidase is related to cell expansion in soybean seed-
lings. J Exp Bot 57:101–111
Durmus N, Kadioglu A (2005) Spermine and putrescine enhance oxidative stress tolerance in
maize leaves. Acta Physiol Plant 27:515–522
El-Shintinawy F (2000) Photosynthesis in two wheat cultivars differing in salt susceptibility. Pho-
tosynthetica 38:615–620
Evans PT, Malmberg RL (1989) Do polyamines have roles in plant development? Annu Rev Plant
Physiol Plant Mol Biol 40:235–269
Galston AW, Sawhney RK (1990) Polyamines in plant physiology. Plant Physiol 94:406–410
Galston AW, Kaur-Sawhney R, Altabella T, Tiburcio AF (1997) Plant polyamines in reproductive
activity and response to abiotic stress. Bot Acta 110:197–207
Gill SS, Tuteja N (2010) Polyamines and abiotic stress tolerance in plants. Plant Signal Behav
5:26–33
Grene R (2002) Oxidative stress and acclimation mechanisms in plants. In Arabidopsis Book.
American Society of Plant Biologists, Rockville, pp 1–20
Groppa MD, Benavides MP (2008) Polyamines and abiotic stress: recent advances. Amino Acids
34:35–45
Groppa MD, Tomaro ML, Benavides MP (2001) Polyamines as protectors against cadmium or
copper-induced oxidative damage in sunflower leaf discs. Plant Sci 161:481–488
Groppa MD, Benavides MP, Tomaro ML (2003) Polyamine metabolism in sunflower and wheat
leaf discs under cadmium or copper stress. Plant Sci 164:293–299
Groppa MD, Ianuzzo MP, Tomaro ML, Benavides MP (2007) Polyamine metabolism in sunflower
plants under long-term cadmium or copper stress. Amino Acids 32:265–275
Hanfrey C, Sommer S, Mayer MJ, Burtin D, Michael AJ (2001) Arabidopsis polyamine biosynthe-
sis: absence of ornithine decarboxylase and the mechanism of arginine decarboxylase activity.
Plant J 27:551–560
Hanzawa Y, Takahashi T, Michael AJ, Burtin D, Long D, Pineiro M, Coupland G, Komeda Y
(2000) ACAULIS5, an Arabidopsis gene required for stem elongation, encodes a spermine
synthase. EMBO J 19:4248–4256
Hassannejad S, Bernard F, Mirzajani F, Gholami M (2012) SA improvement of hyperhydricity
reversion in Thymus daenensis shoots culture may be associated with polyamines changes.
He L, Nada K, Tachibana S (2002) Effects of spd pretreatment through the roots on growth and
photosynthesis of chilled cucumber plants ( Cucumis sativus L.). J Jpn Soc Hort Sci 71:490–498
Houdusse F, Zamarreno AM, Garnica M, Garcia-Mina J (2005) The importance of nitrate in ame-
liorating the effects of ammonium and urea nutrition on plant development: the relationships
with free polyamines and plant proline contents. Func Plant Biol 32:1057–1067
Hu X, Zhang Y, Shi Y, Zhang Z, Zou Z, Zhang H, Zhao J (2012) Effect of exogenous spermidine
on polyamine content and metabolism in tomato exposed to salinity-alkalinity mixed stress.
Hussain SS, Ali M, Ahmad M, Siddique KH (2011) Polyamines: natural and engineered abiotic
and biotic stress tolerance in plants. Biotechnol Adv 29:300–311
Imai R, Ali A, Pramanik MDHR, Nakaminami K, Sentoku N, Kato H (2004) A distinctive class
of spermidine synthase is involved in chilling response in rice. J Plant Physiol 161:883–886
Janowitz T, Kneifel H, Piotrowski M (2003) Identification and characterization of plant agmatine
iminohydrolase, the last missing link in polyamine biosynthesis of plants. FEBS Lett 544:258–261
Kakkar RK, Nagar PK, Ahuja PS, Rai VK (2000) Polyamines and plant morphogenesis. Biol Plant
43:1–11
Kakkar RK, Sawhney VK (2002) Polyamine research in plants-a changing perspective. Physiol
Plant 116:281–292
Kasinathan V, Wingler A (2004) Effect of reduced arginine decarboxylase activity on salt toler-
ance and on polyamine formation during salt stress in Arabidopsis thaliana. Physiol Plant
121:101–107
Kasukabe Y, He L, Nada K, Misawa S, Ihara I , Tachibana S (2004) Overexpression of spermidine
synthase enhances tolerance to multiple environmental stresses and up-regulates the expres-
sion of various stress-regulated genes in transgenic Arabidopsis thaliana. Plant Cell Physiol
45:712–722
Kaunisto S, Sarjala T (1997) Critical needle potassium concentrations indicated by diamine putres-
cine in Norway spruce growing on peat soils. Silva Fennica 31:383–390
Krishnamurthy R, Bhagwat KA (1989) Polyamines as modulators of salt tolerance in rice culti-
vars. Plant Physiol 91:500–504
Kubis J, Krzywanski Z (1989) The dynamics of polyamine accumulation in spring wheat leaves
during increasing water stress. Acta Physiol Plant 11:157–164
Kumar M, Bijo AJ, Baghel RS, Reddy CR, Jha B (2012) Selenium and spermine alleviate cad-
mium induced toxicity in the red seaweed Gracilaria dura by regulating antioxidants and DNA
methylation. Plant Physiol Biochem 51:129–138
Kusano T, Yamaguchi K, Berberich T, Takahashi Y (2007a) Advances in polyamine research. J
Plant Res 120:345–350
Kusano T, Yamaguchi K, Berberich T, Takahashi Y (2007b) The polyamine spermine rescues Ara-
bidopsis from salinity and drought stresses. Plant Signal Behav 2:251–252
Kusano T, Berberich T, Tateda C, Takahashi Y (2008) Polyamines: essential factors for growth and
survival. Planta 228:367–381
Kuthanová A, Gemperlová L, Zelenková S, Eder J, Macháčková I, Opatrný Z, Cvikrová M (2004)
Cytological changes and alterations in polyamine contents induced by cadmium in tobacco
BY-2 cells. Plant Physiol Biochem 42:149–156
Langebartels C, Kerner K, Leonardi S, Schraudner M, Trost M, Heller W, Sandermann H Jr (1991)
Biochemical plant responses to ozone. I. Differential induction of polyamine and ethylene
biosynthesis in tobacco. Plant Physiol 95:882–889
Lee YP, Babakov A, de Boer B, Zuther E, Hincha DK (2012) Comparison of freezing tolerance,
compatible solutes and polyamines in geographically diverse collections of Thellungiella sp.
and Arabidopsis thaliana accessions. BMC Plant Biol 12:131
Legocka J, Kluk A (2005) Effect of salt and osmotic stress on changes in polyamine content and
arginine decarboxylase activity in Lupinus luteus seedlings. J Plant Physiol 162:662–668
Li ZY, Chen SY (2000) Differential accumulation of the S-adenosylmethionine decarboxylase tran-
script in rice seedlings in response to salt and drought stresses. Theor Appl Genet 100:782–788
Lie K, Fu H, Bei Q, Luan S (2000) Inward potassium channel in guard cells as target for polyamine
regulation of stomatal movements. Plant Physiol 124:1315–1326
Lin CH, Kao CH (1999) Excess copper induces an accumulation of putrescine in rice leaves. Bot
Bull Acad Sin 40:213–218
Lin CC, Kao CH (2001) Abscisic acid induced changes in cell wall peroxidase activity and hydro-
gen peroxide level in roots of rice seedlings. Plant Sci 160:323–329
Liu K, Huihua F, Bei O, Luan S (2000) Inward potassium channel in guard cells as a target for
polyamine regulation of stomatal movements. Plant Physiol 124:1315–1326
Liu J-H, Kitashiba H, Wang J, Ban Y, Moriguchi T (2007) Polyamines and their ability to provide
environmental stress tolerance to plants. Plant Biotech 24:117–126
Løvaas E (1997) Antioxidative and metal-chelating effects of polyamines. Adv Pharmacol 38:119–149
Lutz C, Navakoudis E, Seidlitz HK, Kotzabasis K (2005) Simulated solar irradiation with en-
hanced UV-B adjust plastid- and thylakoid-associated polyamine changes for UV-B protection.
Biochim Biophys Acta 1710:24–33
Lynch JP, Clair SB (2004) Mineral stress: the missing link in understanding how global climate
change will affect plants in real world soils. Field Crops Research 90:101–115
Marco F, Alcázar R, Tiburcio AF, Carrasco P (2011) Interactions between polyamines and abiotic
stress pathway responses unraveled by transcriptome analysis of polyamine overproducers.
OMICS 15:775–781
Martin-Tanguy J (2001) Metabolism and function of polyamines in plants: recent development
(new approaches). Plant Growth Reg 34:135–148
Michael AJ, Furze JM, Rhodes MJC, Burtin D (1996) Molecular cloning and functional identifca-
tion of a plant ornithine decarboxylase cDNA. Biochem J 314:241–248
Moller SG, McPherson MJ (1998) Developmental expression and biochemical analysis of the
Arabidopsis atao1 gene encoding an H2O2-generating diamine oxidase. Plant J 13:781–791
Moschou PN, Paschalidis KA, Delis ID, Andriopoulou AH, Lagiotis GD, Yakoumakis DI, Roube-
lakis-Angelakis KA (2008a) Spermidine exodus and oxidation in the apoplast induced by abi-
otic stress is responsible for H2O2 signatures that direct tolerance responses in tobacco. Plant
Cell 20:1708–1724
Moschou PN, Paschalidis KA, Roubelakis-Angelakis KA (2008b) Plant polyamine catabolism:
The state of the art. Plant Signal Behav 3:1061–1066
Moschou PN, Sanmartin M, Andriopoulou AH, Rojo E, Sanchez-Serrano JJ, Roubelakis-Angela-
kis KA (2008c) Bridging the gap between plant and mammalian polyamine catabolism: a novel
peroxisomal polyamineoxidase responsible for a fullback-conversion pathway in Arabidopsis.
Mutlu F, Bozcuk S (2005) Effects of salinity on the contents of polyamines and some other com-
pounds in sunflower plants differing in salt tolerance. Russ J Plant Physiol 52:29–34
Nambeesan S, AbuQamar S, Laluk K, Mattoo AK, Mickelbart MV, Ferruzzi MG, Mengiste T,
Handa AK (2012) Polyamines attenuate ethylene-mediated defense responses to abrogate re-
sistance to Botrytis cinerea in tomato. Plant Physiol 158:1034–1045
Nayyar H (2005) Putrescine increases floral retention, pod set and seed yield in cold stressed
chickpea. J Agron Crop Sci 191:340–345
Nayyar H, Chander S (2004) Protective effects of polyamines against oxidative stress induced by
water and cold stress in chickpea. J Agron Crop Sci 190:355–365
Nayyar H, Kaur S, Singh S, Kumar S, Singh KJ, Dhir KK (2005) Involvement of polyamines in the
contrasting sensitivity of chickpea ( Cicer arietinum L.) and soybean ( Glycine max L. Merrill.)
to water deficit stress. Bot Bull Acad Sin 46:333–338
Oracz K, Bouteau HM, Kranner I, Bogatek R, Corbineau F, Bailly C (2009) The mechanisms in-
volved in seed dormancy alleviation by hydrogen cyanide unravel the role of reactive oxygen
species as key factors of cellular signaling during germination. Plant Physiol 150:494–505
Panicot M, Minguet EG, Ferrando A, Alcázar R, Blázquez MA, Carbonell J, Altabella T, Koncz C,
Tiburcio AF (2002) A polyamine metabolon involving aminopropyl transferases complexes in
Arabidopsis. Plant Cell 14:2539–2551
Paschalidis KA, Roubelakis-Angelakis KA (2005) Sites and regulation of polyamine catabolism
in the tobacco plant. Correlations with cell division/expansion, cell cycle progression and vas-
cular development. Plant Physiol 138:2174–2184
Perez-Amador MA, Leόn J, Green PJ, Carbonell J (2002) Induction of the arginine decarboxylase
ADC2 gene provides evidence for the involvement of polyamines in the wound responses in
Arabidopsis. Plant Physiol 130:1454–1463
Petrivalský M, Brauner F, Luhová L, Gagneul D, Sebela M (2007) Aminoaldehyde dehydroge-
nase activity during wound healing of mechanically injured pea seedlings. J Plant Physiol
164:1410–1418
Pieruzzi FP, Dias LL, Balbuena TS, Santa-Catarina C, dos Santos AL, Floh EI (2011) Polyamines,
IAA and ABA during germination in two recalcitrant seeds: Araucaria angustifolia (Gymno-
sperm) and Ocotea odorifera (Angiosperm). Ann Bot 108:337–345
Piotrowski M, Janowitz T, Kneifel H (2003) Plant C–N hydrolases and the identification of a plant
N-carbamoylputrescine amidohydrolase involved in polyamine biosynthesis. J Biol Chem
278:1708–1712
Raab MM, Weinstein LH (1990) Polyamine and ethylene metabolism in Triticum aestivum
(var. vona). In HE Flores, RN Arteca, JC Shannon (eds) Polyamines and ethylene: biochemistry,
physiology, and interactions. American Society of Plant Physiologists, Rockville, pp 408–410
Rea R, Laurenzi M, Tranquili E, D’Ovidio R, Federico R, Angelini R (1998) Developmentally and
wound-regulated expression of the gene encoding a cell wall copper amine oxidase in chickpea
seedlings. FEBS Lett 23:177–182
Rea R, Metoui O, Infantino A, Federico R, Angelini R (2002) Copper amine oxidase expression
in defence responses to wounding and Ascochyta rabiei invasion. Plant Physiol 128:865–875
Renaut J, Hoffmann L, Hausman JF (2005) Biochemical and physiological mechanisms related to
cold acclimation and enhanced freezing tolerance in poplar plantlets. Physiol Plant 125:82–94
Rodríguez AA, Maiale SJ, Menéndez AB, Ruiz OA (2009) Polyamine oxidase activity contributes
to sustain maize leaf elongation under saline stress. J Exp Bot 60:4249–4262
Rowland-Bamford AJ, Borland AM, Lea PJ, Mansfield TA (1989) The role of arginine decarbox-
ylase in modulating the sensitivity of barley to ozone. Environ Pollut 61:95–106
Roy M, Ghosh, B (1996) Polyamines, both common and uncommon, under heat stress in rice
( Oryza sativa) callus. Physiol Plant 98:196–200
Roy M, Wu R (2001) Arginine decarboxylase transgene expression and analysis of environmental
stress tolerance in transgenic rice. Plant Sci 160:869–875
Roy P, Niyogi K, SenGupta DN, Ghosh B (2005) Spermidine treatment to rice seedlings recov-
ers salinity stress-induced damage of plasma membrane and PM-bound H + -ATPase in salt-
tolerant and salt-sensitive rice cultivars. Plant Sci 168:583–591
Sandalio LM, Dalurzo HC, Gόmez M, Romero-Puertas MC, del Río LA (2001) Cadmium-induced
changes in the growth and oxidative metabolism of pea plants. J Exp Bot 52:2115–2126
Sarjala T, Kaunisto S (2002) Potassium nutrition and free polyamines of Betula pendula Roth and
Betula pubescens Ehrh. Plant Soil 238:141–149
Sebela M, Radová A, Angellini R, Tavladoraki P, Frébort I, Pec P (2001) FAD-containing poly-
amine oxidases: a timely challenge for researchers in biochemistry and physiology of plants.
Plant Sci 160:197–207
Shelp BJ, Bozzo GG, Trobacher CP, Zarei A, Deyman KL, Brikis CJ (2012) Hypothesis/review:
contribution of putrescine to 4-aminobutyrate (GABA) production in response to abiotic stress.
Plant Sci 193–194:130–135
Shen W, Nada K, Tachibana S (2000) Involvement of polyamines in the chilling tolerance of
cucumber cultivars. Plant Physiol 124:431–440
Shevyakova NI, Il’ina EN, Stetsenko LA, Kuznetsov VV (2011) Nickel accumulation in rape
shoots (Brassica napus L.) increased by putrescine. Int J Phytoremediation 13:345–356
Shi J, Fu X-Z, Peng T, Huang X-S, Fan Q-J, Liu J-H (2010) Spermine pretreatment confers dehy-
dration tolerance of citrus in vitro plants via modulation of antioxidative capacity and stomatal
response. Tree Physiol 30:914–922
Silveira V, Santa-Catarina C, Tun NN, Handro W, Scherer GFE, Handro W, Guerra M, Floh EIS
(2006) Polyamine effects on the endogenous polyamine contents, nitric oxide release, growth
and differentiation of embryonic suspension cultures of Araucaria angustifolia (Bert.) O. Ktze.
Slocum RD, Kaur-Sawhney R, Galston AW (1984) The physiology and biochemistry of

polyamines in plants. Arch Biochem Biophys 235:283–303
Smith J, Burrit D, Bannister P (2001) Ultraviolet-B radiation leads to a reduction in free
polyamines in Phaseolus vulgaris L. Plant Growth Regul 35:289–294
Soyka S, Heyer AG (1999) Arabidopsis knockout mutation of ADC2 gene reveals inducibility by
osmotic stress. FEBS Lett 458:219–223
Tadolini B (1988) Polyamine inhibition of lipid peroxidation. Biochem J 249:33–36
Taiz L, Zeiger E (2006) Plant physiology. Sinauer Association Inc. USA, pp 671–703
Takahashi T, Kakehi J (2010) Polyamines: ubiquitous polycations with unique roles in growth and
stress responses. Ann Bot 105:1–6
Takano A, Kakehi J, Takahashi T (2012) Thermospermine is not a minor polyamine in the plant
kingdom. Plant Cell Physiol 53:606–616
Tang CF, Liu YG, Zeng GM, Li X, Xu WH, Li CF, Yuan XZ (2005) Effects of exogenous sper-
midine on antioxidant system responses of Typha latifolia L. under Cd2 + stress. J Integ Plant
Biol 47:428–434
Tavladoraki P, Schininà ME, Cecconi F, Di Agostino S, Manera F, Rea G, Mariottini P, Federico
R, Angelini R (1998) Maize polyamine oxidase: primary structure from protein and cDNA
sequencing. FEBS Lett 426:62–66
Tavladoraki P, Rossi MN, Saccuti G, Perez-Amador MA, Polticelli F, Angelini R, Federico R
(2006) Heterologous expression and biochemical characterization of a polyamine oxidase from
Arabidopsis involved in polyamine back conversion. Plant Physiol 141:1519–1532
Tiburcio AF, Altabella T, Borrel A, Masgrau C (1997) Polyamine metabolism and its regulation.
Physiol Plant 100:664–674
Tipping AJ, McPherson MJ (1995) Cloning and molecular analysis of the pea seedling copper
amine oxidase. J Biol Chem 270:16939–16946
Tisi A, Federico R, Moreno S, Lucretti S, Moschou PN, Roubelakis-Angelakis KA, Angelini R,
Cona A (2011) Perturbation of polyamine catabolism can strongly affect root development and
xylem differentiation. Plant Physiol 157:200–215
Torrigiani P, Altamura MM, Pasqua G, Monacelli B, Serafini-Fracassini D, Bagni N (1987) Free
and conjugated polyamines during de novo floral and vegetative bud formation in thin cell lay-
ers of tobacco. Physiol Plant 70:453–460
Toumi I, Moschou PN, Paschalidis KA, Bouamama B, Salem-fnayou AB, Ghorbel AW, Mliki A,
Roubelakis-Angelakis KA (2010) Abscisic acid signals reorientation of polyamine metabolism
to orchestrate stress responses via the polyamine exodus pathway in grapevine. J Plant Physiol
167:519–525
Urano K, Yoshiba Y, Nanjo T, Igarashi Y, Seki M, Sekiguchi F, Yamaguchi-Shinozaki K, Shinozaki
K (2003) Characterization of Arabidopsis genes involved in biosynthesis of polyamines in abi-
otic stress responses and developmental stages. Plant Cell Environ 26:1917–1926
Urano K, YoshibaY, Nanjo T, Ito T, Yamaguchi-Shinozaki K, Shinozaki K (2004) Arabidopsis
stress-inducible gene for arginine decarboxylase AtADC2 is required for accumulation of pu-
trescine in salt tolerance. Biochem Biophys Res Commun 313:369–375
Van Assche F, Clijsters H (1990) Effects of metals on enzyme activity in plants. Plant Cell Environ
13:195–206
Van Buuren ML, Guidi L, Fornal S, Ghetti F, Franceschetti M, Soldatini GF, Bagni N (2002)
Ozone-response mechanisms in tobacco: implications of polyamine metabolism. New Phytol
156:389–398
Van Dingenen R, Dentener FJ, Raes F, Krol MC, Emberson L, Cofala J (2009). The global impact
of ozone on agricultural crop yields under current and future air quality legislation. Atmosp
Environ 43:604–618
Walter DR (2003) Resistance to plant pathogens: possible roles for free polyamines and polyamine
catabolism. New Phytol 159:109–115
Wang BQ, Zhang QF, Liu JH, Li GH (2011) Overexpression of PtADC confers enhanced dehy-
dration and drought tolerance in transgenic tobacco and tomato: effect on ROS elimination.
Biochem Biophys Res Commun 413:10–16
Watson MB, Malmberg RL (1996) Regulation of Arabidopsis thaliana (L.) Heynh arginine decar-
boxilase by potassium deficiency stress. Plant Physiol 111:1077–1083
Wimalasekara R, Scherer GFE (2010) Polyamines and cytokinin: is nitric oxide biosynthesis the
key to overlapping functions? In: Hayat S, Mori M, Pichtel J, Ahmad A (eds) Nitric oxide in
plant physiology. Wiley-Vch, Weinheim pp 65–76
Wimalasekara R, Tebartz F, Scherer GFE (2011a) Polyamines, polyamine oxidases, and nitric
oxide (NO) in development, biotic and abiotic stresses. Plant Sci 181:593–603
Wimalasekara R, Villar C, Begum T, Scherer GFE (2011b) COPPER AMINE OXIDASE1 ( CuAO1)
of Arabidopsis thaliana contributes to abscisic acid- and polyamine-induced nitric oxide bio-
synthesis and abscisic acid signal transduction. Mol Plant 4:663–678
Xing SG, Jun YB, Hau ZW, Liang LY (2007) Higher accumulation of gamma-aminobutyric acid
induced by salt stress through stimulating the activity of diamine oxidases in Glycine max (L.)
Merr.roots. Plant Physiol Biochem 45:560–566
Yamaguchi K, Takahashi T, Imai A, Miyazaki A, Takahashi T, Michael A, Kusano T (2006)
The polyamine spermine protects against high salinity stress in Arabidopsis. FEBS Lett
580:67783–6788
Yoshimoto K, Noutoshi Y, Hayashi K, Shirasu K, Takahashi T, Motose H (2012) A chemical
biology approach reveals an opposite action between thermospermine and auxin in xylem
development in Arabidopsis thaliana. Plant Cell Physiol 53:635–645
Young ND, Galston AW (1984) Physiological control of arginine decarboxylase activity and
potassium-deficient oat shoots. Plant Physiol 76:331–335
Zapata PJ, Serrano M, Pretel MT, Amorόs A, Botella MA (2004) Polyamines and ethylene changes
during germination of different plant species under salinity. Plant Sci 167:781–788
Zhang X, Shen L, Li F, Meng D, Sheng J (2011) Methyl salicylate-induced arginine catabolism is
associated with up-regulation of polyamine and nitric oxide levels and improves chilling toler-
ance in cherry tomato fruit. J Agric Food Chem 59:9351–9357
Zhao FG, Qin P (2004) Protective effect of exogenous polyamines on root tonoplast function
against salt stress in barley seedlings. Plant Growth Regul 42:97–103
Index
γ-Aminobutyric acid (GABA), 463, 466, 473 Agrobacterium rhizogenes, 2–8, 10, 12, 14,
2,4-Dichlorophenoxyacetic acid (2,4-D), 126, 15, 20, 24, 25
407 Ri plasmid, 6, 10
5-Enolpyruvylshikimate-3-phosphate synthase Ti plasmid, 5
(EPSPS), 134 Agrobacterium tumefaciens, 2, 3, 5, 6, 10,
124, 131, 134
A Ti plasmid, 5, 9
Aarrouf, J., 4, 24 Agrobacterium vitis, 2
Abarca-Grau, A. M., 5 Agrobacterium-mediated transformation, 2,
Abd El-Mawla, A. M. A., 402 23, 25, 451
Abiotic stress, 135, 295, 302, 461 Agropine-type opines, 7
drought, 4, 135, 138, 240, 277, 295, 302, Agropine-type Ri plasmid, 8, 9, 11, 12, 18
422, 442, 460, 461, 463, 470, 476 Aharoni, A., 301
heavy metals, 4, 374 Alcázar, R., 460–469, 475
high temperature, 135 Alkaloids, 17, 402, 404, 406–408, 411, 448
salinity, 4, 135, 138, 213, 221, 240, 295, Alpizar, E., 4, 10
302, 422, 442, 460, 461, 463, 470, 476 Altamura, M. M., 15
temperature, 138, 277, 295, 302, 422, 442, Amaranthus dubius, 195
460, 461, 463, 476 Amaranthus palmeri, 134
UV radiations, 135 AMF–nematode interactions, 229
Abiotic stress tolerance, 24, 50, 68, 72, 73, Amine oxidases, 461, 465, 466
107, 191, 210, 211, 260, 270 Amplified fragment length polymorphism
in halophytes, 449, 452 (AFLP), 58, 273, 320
in seeds, 245 Analysis of co-variance (ANCOVA), 59
in transgenic crops, 123, 151 Analysis of variance (ANOVA), 59, 168
PAs, 475 Ansorge, W. J., 55
ROS, 373 Antagonism, mechanisms of, 281
using ABA, 283 Antidiabetic agent, 405
using AMF, 210, 227, 230 Antioxidants, 298, 300, 364, 389
using isoprenoids, 297, 299 Aoki, S., 11, 21, 22
Abscisic acid (ABA), 12, 17, 283, 301, 384, Aoyagi, K., 17
407, 408, 425, 427 Arabidopsis thaliana, 50, 52, 71, 169, 170,
Acifluorfen, 135 178, 181, 301, 391–393, 472
Ackermann, C., 3 Arabidopsis thaliana tilling array express
Actinobacteria species, 284 (At-TAX), 72
Actinomycetes, 190, 197 Arbuscular mycorrhizal fungi (AMF), 209,
Adriano, D. C., 368, 369 210, 226
Agriculture, 2, 131, 191, 203, 278, 367, 460, Ari, S., 4, 23
466, 475 Arican, E., 24
K. R. Hakeem et al. (eds.), Crop Improvement, DOI 10.1007/978-1-4614-7028-1, 485

486 Index
Arsenic (As) Birch, R. G., 23

as metal pollutants, 364 Blair, M. W., 57
characteristics of, 368 Block, M., 23
occurrence and distribution of, 365, Blue-green algae/cyanobacteria, 194
367–369, 379–381 Boll, M., 24
Arsenic acid (H3 As O4), 366 Boller, T., 430
Arsenic detoxification, 364, 389, 390, Bonhomme, V., 12, 16, 17
392–394 Bouchez, D., 18
Arsenic toxicity Bradyrhizobium japonicum, 194, 421–423,
in ground water, 380 425, 429–431, 433
in plants, 368, 369, 380, 381, 383–385, Brevet, J., 11
391–395 Britton, M. T., 19, 21
Arsenopyrite (FeAsS), 365, 366 Bromoxynil, 135
Arthrobotrys oligospora, 200 Broothaerts, W., 2
Aspergillus niger, 403, 406 Bulgakov, V. P., 4, 6, 16, 17
Atriplex, 441–447, 449, 452
Auxin, 9, 12, 14, 16, 17, 19, 20, 194, 196, C
407, 408, 432 Cai, G., 24
Auxin biosynthesis, 9–12, 21 Caicedo, A. L., 56
Azlan, G. J., 24 Calmodulin, 274, 404
Azorhizobium caulinodans, 191, 194 Camilleri, C., 10, 18, 21
Azospirillum spp., 191, 195, 198 Capillary electrophoresis (CE), 88
Azotobactor chrococcum, 196 Capone, I. L., 8, 15, 16, 21, 22
Cardarelli, M., 8–12, 15, 16, 20, 21
B Carotenoid, 330, 384
Bacillus circulans, 200 Casanova, E., 3, 12, 17
Bacillus megaterium, 200 Casse-Delbart, F., 10, 11
Bacillus polymyxa, 200, 201 Catharanthine, 405–409
Bacillus sircalmous, 200 Catharanthus roseus, 385, 401, 402,
Bacillus subtilis, 200, 214 404–409, 411
Bacillus thuringiensis, 131, 133 cDNA-AFLP, 274, 284, 285
Bacillus thuringiensis (Bt) endotoxins, 131 Chandra, S., 3, 5, 9–11, 23, 273, 274, 364
Bacteroids, 193, 427 Charlwood, B. V., 3
Balandrin, M. F., 3, 402 Charlwood, K. A., 3
Bandyopadhyay, M., 4 Charyulu, P. B. B. N., 195
Bansal, H. C., 156 Chemical fertilizers, 189–191, 198, 202, 203
Bedini, S., 215, 216 Chemical mutagenesis, 152, 155, 162,
Bellincampi, D., 15, 16 170, 175
Ben Salem, H., 443, 447 Chen, F., 330
Benavides, M. P., 460, 461, 463, 467, 469, Chen, H., 332
471, 472, 474, 475 Chen, H. J., 131
Bensaddek, L., 4, 7, 9, 12 Chen, J. B., 316
Bernard, S. M., 64 Chen, M., 369, 427
Bettini, P., 18 Chen, Q, 333
Bhaskara Rao, K. V., 195 Chen, S., 75, 78, 82
Binns, A. N., 3, 15, 19 Chen, S. Y., 465
Bioactive compound, 402, 447, 448 Chen, T., 369, 428
Biofertilizers, 189–191, 195, 198, 199, Chen, X., 220, 252
202, 203 Chen, Y. H., 257
Biofertilizers, nitrogen fixing, 194 Chen, Y. P., 199
Bio-fertilizers, nitrogen fixing, 192 Chen, Z., 474
Bioinformatics, 50, 86, 334 Cheng, M., 24, 461, 470
Biotic stress, 24, 210, 240–242, 245 Cheng, Y., 79
Index 487
Chilton, M. D., 9, 24 Dommisse, E. M., 25

Chimeric repressor silencing technology Doran, P. M., 4, 128
(CRES-T), 102 Downs, C. G., 4
Chimiotactism, 5 Drewes, F. E., 24
Cho, H. J., 24 Drosophila melanogaster, 153
Christensen, B., 9–11 Drought, 4, 135, 138, 162, 213, 214, 220–222,
Christey, M. C., 4, 11, 18, 24, 25 240, 277, 295, 302, 374, 422, 425–428,
Christie, P. J., 6 442, 443, 450, 460, 461, 463, 466, 467,
Christou, P., 23 470, 476
Chromatin immunoprecipitation (ChIP), 72 Du, M., 4
Chuck, G., 22 Duckely, M., 6
Citovsky, V., 3, 6 Durand-Tardif, M., 15, 17, 21
Collier, R., 24
Collins, M. D., 2 E
Collision-induced dissociation (CID), 76 ECOTILLING, 150, 175, 179–181
Comai, L., 10, 100, 180, 181 efficacy of, 180
Conn, H. J., 2 Electron transport chain, 374
Conventional breeding methods, 23, 124–126, Electronic fluorescent pictograph (eFP), 71
131, 135, 149, 172, 181, 239, 240, 244, Electroporation, 23
270 Elicitation, 228, 403, 404, 406, 408–410, 412
Cooper, J., 429 Elicitor, 79, 278, 402–406, 409–411
Cotter, J., 133 Embryo abortion, 126
Crop biotechnology, 2, 50 Embryo culture, 126
Crop improvement, 51, 124, 125, 128, 130, Environmental stress, 79
135, 151, 152, 157, 167, 168, 170, 172, Ephritikhine, G., 16
173, 181, 240 Erwinia cartovora, 133
Crown gall disease, 2, 3 Escherichia coli, 85, 174
Cumming, J. R., 369 Estramareix, C., 11
Cylindrosporium concentricum, 133 Estruch, J. J., 16, 17
Cytokinin, 12, 19, 21, 196, 407, 408 EST-SSRs, 275, 276, 285, 286
Ethyl methane sulfonate (EMS), 99, 156, 176
D Ethylene (ET), 278
David, C., 9 Expressed sequence tags (EST), 58, 324
Davioud, E., 8
De Bodt, S., 56 F
De Ley, J., 2 Faiss, M., 17
De Paolis, A., 10 Fauquet, C. M., 23
Dehio, C., 14, 15 Fenton reaction, 374
Delbarre, A., 16 Filetici, P., 3, 8, 11
Dessaux, Y., 7 Filichkin, S. A., 5
Diaz, C. L., 4 Filippini, F., 15, 16
Diethyl sulfate (DES), 162 Firmicutes, 284
Difference gel electrophoresis (DIGE), 77, Fladung, M., 24
108 Flavin adenine dinucleotide (FAD), 20
Diouf, D., 4 Flores, H. E., 3
Diplontic selection, 170 Fourier transformation ion cyclotron
Disease resistance plants, 128, 153, 166, resonance mass spectrometry (FT-ICR
258, 260 MS), 77
Diversity array technology (DArT), 64 Frundt, C., 21
DNA damage, complexity of, 157, 158 Fungicides, 196, 202, 278, 366
DNA fingerprinting, 124 Fusarium graminearum, 133, 242, 276, 277,
DNA methylation, 64, 72, 174 281
Dodueva, I. E., 20, 21 Fusarium head blight (FHB), 134, 249
488 Index
Fusarium oxysporum, 276, 277 Han, Z., 275

Fusarium solani, 133 Hansen, G., 6, 9, 10, 21, 22
Fusarium verticillioides, 276, 277, 281 Haploidy, 260
Harmon, A. C., 75, 78
G HarvEST software, 62
Galston, A. W., 472 Hasancebi, S., 4
Gartland, J. S., 7, 8 Hauptmann, R. M., 23
Gas chromatography (GC), 88 Heat, 162, 240, 297, 299, 300, 374, 460, 469
Gaudin, V., 5, 10, 24 Heat shock proteins (HSP), 216
Gelvin, S. B., 2, 3, 5, 6, 9, 23 Heavy ion beams (HIB), effects of, 158
Gene mutations, 96, 155 Heavy metals, 215, 223–225, 364, 442, 445,
Gene transfer methods, 23 446, 471
Genetic engineering, 2, 24, 63, 125, 130, 138, Helfer, A., 20
301, 449 Hemipteran vectors, 17
Genetically moand thedified crops, 50 Herbicide resistance plants, 128, 131, 134, 135
Genetically modified crops, 2, 23–25, 124, Hernalsteens, J. P., 25
130, 131, 164, 427, 433, 450 Hiei, Y., 23
Genomics, 58, 60, 84, 102, 107, 149, 169, 173, High-performance/ultra performance liquid
276, 279, 280, 308, 324, 333 chromatography (LC), 88
Gepts, P., 2 High-resolution melt analysis (HRM), 150,
Germplasm preservation, 130 178, 179
Gibberellic acid (GA), 12, 15, 199, 408 Hildebrand, E., 2, 3
Giri, A., 3, 7, 11, 24 Hildebrand, U., 225
Giri, B., 221, 225 Hirotaka, K., 4
Giri, C. C., 3 Histone H3, 275
Global warming, 239, 240, 259, 467, 469 Hodges, L. D., 6
Glomalin-related soil protein (GRSP), 215 Hodgkin’s disease, 405
Glomus intraradices, 214 Holefors, A., 9, 19
Glufosinate, 135 Hong, S. B., 5, 12
Glycine betaine, 222, 443, 446, 450 Hordeum vulgare, 62, 153, 169
Glycine max L., 421 Huffman, G. A., 9–11
Glyphosate, 134, 135 Hwang, C. F., 4, 24
Glyphosate resistant (GR) plants, 134 Hydroxyl amine (HA), 156
Gorpenchenko, T. Y., 17
Graham, P. H., 429 I
Grant, J. E., 9, 10 In vitro fertilization, 125
Grant, P. G., 134 Indole-3-acetic acid (IAA), 10, 20, 199
Greene, E. A., 178 International Gibberella zeae Genomics
Gregory, S. G., 270 Consortium (IGGR), 277
Grewal, S., 402 International Structural Genomics
Growth regulators, Organization (ISGO), 82
role of, 301, 460, 475, 476 Inze, D., 9
Gutierrez-Pesce, P., 310, 331 Ishizaki, T., 12
Guyon, P., 5 Isogai, A., 8
Gynogenesis, 127 Isoprenoids, 296, 297, 299–301
Isotope-coded affinity tags (ICATs), 77, 108
H
Haas, B. J., 56 J
Haber–Wiess reaction, 374 Jacobs, G. A., 447
Hairy root, 2–6, 9–12, 15, 16, 19, 22, 24, 25, Jacobs, L. W., 368, 369
402, 404, 408 Jacobs, M., 19
Hammerschlag, F. A., 24 Jasmonic acid (JA), 278, 406
Han, B., 56 Jouanin, L., 9–11, 19, 21
Han, K. H., 24
Index 489
K Lipid peroxidation, 227, 364, 385, 407, 451,

Kahl, G., 5 470, 471
Kalanchoe daigremontiana, 14 Lotus japonicas, 178
Keil, M., 3
Keller, C. P., 16 M
Kersters, K., 2 Mace, E. S., 64
Kifle, S., 4, 24 Mackenzie, A. F., 423
Kim, K. Y., 200 Mahdi, S. S., 190, 191
Kim, Y. J., 24 Margulies, M., 55
Kiselev, K. V., 16 Marker-assisted selection (MAS), 57, 107,
Kiyokawa, S., 12 108, 260, 476
Klee, H. J., 20 Markov clustering (MCL), 59, 65, 105
Kobayashi, I., 410 Marschner, H., 429
Kobayashi, T., 4 Martin-Tanguy, J., 12, 14, 15, 17, 460, 461
Kosuge, T., 10 Mass spectrometry (MS), 73, 76
Krattiger, A., 133 Massive parallel signature sequencing
Krolicka, A., 24 (MPSS), 67
Kuiper, H. A., 23 Matrix-assisted laser desorption ionization
Kumar, C. S., 98 (MALDI), 76
Kumar, M., 461 Maurel, C., 12, 14–17
Kumar, S., 392 Mauro, M. L., 18
Kumar, S. R., 196 McCullen, C. A., 3
Kumar, V., 2, 4, 9 Medford, J., 21
Messner, B., 24
L Metabolomics, 51, 87, 88, 90, 95, 108, 282
Laccaria bicolor, 281, 282 Metatranscriptomics, 283, 284
Lahners, K., 10 Methylcytosine immunoprecipitation (mCIP)
Lambert, C., 10 method, 72
Leach, F., 17 Meyer, A., 2, 9–12, 15–18, 22
Leaf chlorosis, 301, 383 Meyers, B. C., 258, 259
Lee, B., 280 Microbial insecticides, 131, 132
Lee, C. W. T., 402 Micropropagation, 124, 128, 129, 149
Lee, G. J., 427 MicroRNAs (miRNAs), 63, 107, 302
Lee, J., 427 Miflin, B., 23
Lee, K. D., 199 Miller, R. M., 221
Lee, S., 3–5, 12, 14 Milly, P. C. D., 2
Lee, Y., 60 Miransari, M., 422, 423, 425–427, 429–431
Lee, Y. K., 331 Mishra, B. K., 193
Lee, Y. P., 332, 461 Mishra, B. N., 11
Leghaemoglobin, 193 Mitogen-activated protein kinase (MAPK),
Legume–pathogen interactions, 24 280, 410, 466
Lemcke, K., 18, 19, 21, 22 Moreno, P. R. H., 402, 403, 405, 406
Lessard, P. A., 23 Moriguchi, K., 6
Levesque, H., 12, 20–22 Moritz, T., 12
Li, D., 4 Mugnier, A. J., 24
Li, D. Y., 332 Mugnier, J., 4
Li, F., 57 Multi dimensional scaling (MDS), 59, 65
Li, W., 393 Multidimensional protein identification
Li, X. H., 332, 426 technology (MudPIT), 77
Li, Y., 393 Murugesan, S., 3
Li, Z. Y., 465 Mycorrhizae, 201, 210, 213, 223, 229, 370
Limami, A., 8 Mycorrhizal helper bacteria (MHB), 212
490 Index
N Park, P. J., 72
Nader, B. L., 4 Parker, G. D., 319, 330
Nakamura, H., 99 Parker, I. M., 270
Nakamura, T., 9, 330 Parkinson, H., 70
Nakano, M., 67 Payne, P. I., 309, 310, 331
Navarrete, G. E., 7, 9 Pellegrineschi, A., 3
Necrosis, 16, 19, 244, 297, 383, 411 Penicillium notatum, 403
Nematodes, 4, 24, 133, 197, 202, 227–229, Petersen, S. G., 9, 12
258 Petit, A., 7, 8
Nemoto, K., 10 Phelep, M., 9
Neuroblastoma, 405 Phenome analysis, 96
Nicotiana tabacum L., 11, 14, 15, 17–19, 21, Phenotype gap, 169, 170
22, 300 Phillips, G. C., 298
Nilsson, O., 9, 12, 16, 17 Phoma lingam, 133
Nitrogen fixation, Phosphorous solublising microorganisms
non symbiotic, 192, 195, 196 (PSM), 198–200
symbiotic, 24, 190–192, 194, 422, 423 Photorhabdus luminescens, 132
N-methyl-N-nitroso-urea (MNH), 171 Photosynthesis, 134, 191, 195, 198, 214, 220,
NMR spectroscopy, 85, 96, 408 296, 373, 384, 423–425, 428
Phytium aphanidermatum, 405
O Phytoalexins, 210, 229, 230, 278, 401, 403,
O’Connor, P. J., 218 404, 409, 410
Olempska-Beer, Z. W. S., 23 Phytophthora infestans, 133
Omics resources, 50 Phytoremediation, 25, 191, 225, 392, 395,
Oncovin®, 405 445, 446
Ooms, G., 11 Phytozome, 53
Oono, Y., 17, 24 Plagiotropism, 15
Opine catabolism genes, 5 Plant biotechnology, 124
Osmotic adjustment, 222, 383, 443, 450, 467 application of, 2, 24, 123, 124, 130, 131
Otten, L., 20 Plant breeding, 2, 4, 56, 57, 99, 100, 126, 130,
Ouartsi, A., 8, 20 135, 150, 154, 163, 172
Oxidative stress, 380, 382, 470, 474 Plant growth promoting rhizobacteria (PGPR),
by chemical inducer, 475 190, 191, 197, 198, 210–214
due to salinity, 221, 450 Plant volatile organic compounds, 296, 303
enzymes, 230 Plant–fungi interaction, 273
ROS generation, 227, 296–298, 373, 385, Plant–Fusarium interactions, 282
389, 392, 471 Plant–microbe interactions, 24, 198, 274, 280,
Oxidative stress tolerance, 282, 283
in transgenic plants, 300 Plants defense mechanism,
Oxidative stress tolerances, during oxidative stress, 299, 300, 374
VOCs, 297 Polio type III viruses, 405
Özcan, S., 2 Polyamine (PA), 15, 17, 460, 468, 470
Ozyigit, I. I., 2, 3, 5–7, 23 anabolism of, 466
catabolism of, 461, 463, 466, 468, 470
P Polymerase chain reaction (PCR), 15, 57, 58,
Pal, A., 15, 383 175, 176, 179, 181, 273
Palazon, J., 16, 17 Porter, J., 8, 24
Pan, B., 425 Posttranscriptional gene silencing (PTGS),
Pan, Q., 408 101, 174
Panicot, M., 462 Powell, W., 275
Panse, V. G., 169 Prinsen, E., 15
Paradi, I., 223 Programmed cell death (PCD), 258, 466, 475
Index 491
Proline, 18, 222, 315, 427, 444, 461, 472 Salinity, 4, 135, 138, 213, 221, 225, 240, 295,
Protein analysis through evolutionary 302, 422, 425–427, 433, 442–444, 452,
relationships (PANTHER), 87 460, 461, 463, 466, 470, 476
Protein–protein interaction, 280 Savka, M. A., 7
Proteobacteria, 2, 284 Schmelzle, K., 81
Proteomics, 51, 73, 75, 76, 79, 81, 85, 86, Schmulling, T., 9, 11, 12, 16–19, 21, 22, 24
280, 311 Scorza, R., 12, 24
Pseudomonas fluorescens, 201 SDS-PAGE, 75, 311, 313
Pseudomonas mendocina, 214 Secondary metabolites, 4, 16, 17, 270, 274,
Pseudomonas putida, 198 278, 401, 402, 404, 405, 407, 411, 412,
Pseudomonas striata, 200, 201 430
Psoralea corylifolia, 403 Sentoku, N., 22
Sequence-tagged sites (STS), 56
Q Serial analysis of gene expression (SAGE),
Quandt, H. J., 4 67, 107, 280
Quantitative trait loci (QTLs), 50, 276 Sevon, N., 9, 10
Shen, W. H., 11, 12, 16, 56, 450, 451, 470
R Shkryl, Y. N., 16, 17
Random amplified polymorphic DNA Shoja, H. M., 16, 17, 20
(RAPD), 57, 126, 274, 320, 451 Shoot apical meristem (SAM), 22
Ranjan, R., 11 Short interfering RNAs (siRNAs), 63, 107
Rao, A. Q., 3, 5 Signal transduction, 258, 298, 373, 403, 452,
Rao, S. R., 4, 5, 402 460, 467
Ravishankar, G., 4, 5, 402 Simple sequence repeats (SSR), 55, 58
Reactive oxygen species (ROS), 210, 221, Single nucleotide polymorphisms (SNPs), 56,
226, 283, 296, 385, 392, 409, 58, 62, 64, 176, 179, 324
427, 461 Sinha, N., 22
Ream, W., 3 Sinkar, V., 6, 9
Recombinant DNA technology, 2, 23, 138 Slightom, J. L., 6, 11, 19, 20
Remeeus, P. M., 4, 24 Smigocki, A. C., 24
Resistance, 2, 4, 17, 23, 24, 131, 133, 135, Smith, D. L., 423, 425, 426, 429–431
168, 191, 211, 220, 221, 227, 229, 245, Smulders, M. J. M., 9
247, 249, 250, 253–258, 278, 283, 370, Sodium arsenite (Na H2 As O4), 366
391, 403, 410, 443 Sodium azide (NaN3), 171
Respiration, 196, 373, 428 Soil borne pathogen, 227, 251
Restriction fragment length polymorphism Solanum melongena L., 131
(RFLP), 57, 273, 319, 320 Somaclonal variation, 99, 123, 127–130, 152
Retinoblastoma (RB), 22 Soybean TFD, 106
Rhizobium leguminosarum, 194, 198 Spano, L., 12, 19, 24
Rhizoctonia solani, 133, 284 Specq, A., 21
Ri plasmid, 3–12, 15, 19, 22 Spena, A., 12, 15, 16, 19, 24
Riker, A. J., 2 Spontaneous mutations, 99, 152, 155, 170
Rossi, L., 6 Stable isotope labeling with amino acids in
Rugh, C. L., 4 cell cultures (SILAC), 78
Ryder, M. H., 8, 9 Staden, J. V., 24
Stead, D. E., 3
Stieger, P. A., 20, 22
S Striga hermonthica, 134, 135
S-adenosylmethionine (SAM), 394, 462 Sun, L-Y., 15, 330, 331
Saha, P., 17, 275 Suzuki, K., 8
Saito, K., 87, 93, 330 Suzuki, M., 12
Salicylic acid (SA), 278, 407 Symbiosis, 178, 192, 193, 197, 212, 217,
Saline soil, 213, 442–444, 446 220–223, 225, 227–230, 423, 425, 430
492 Index
Symbiosomes, 193 Turgut Kara, N., 4, 23

Synthetic/artificial seed, 129, 130 Tzfira, T., 2
Syono, K., 11, 21, 22
U
T Umber, M., 20
Talano, M. A., 24 Uozumi, N., 4
Tanaka, N., 16, 52, 62 Uptake of,
Targeting induced local lesions in genomes arsenic, 370, 381, 389, 395
(TILLING), 100, 108, 149, 175, 176, carbon dioxide, 384
178, 180, 334 chlorine, 296
Taylor, B. H., 9, 10 nutrients, 385, 391, 426
Taylor, C. G., 3, 5, 8, 9, 12, 15, 16, 19, 21, phosphate, 370, 389
22, 24 phosphorus, 171
Taylor, G. J., 369 potassium, 451
Taylor, N. E., 178 sodium, 296
Taylor, N. J., 23
Tempe, J., 7, 11 V
Tepfer, D., 3, 9, 10, 24, 25 Vain, P., 23
Terpenoid indole alkaloids (TIAs), 401, 405, van Altvorst, A. C., 12, 15
408 van der Salm, T. P. M., 10
Thionins, 133 van Onckelen, H., 10
Thomashow, L. S., 9, 10 Van Volkenburgh, E., 16
Threlfall, D. R., 403 Vansuyt, G., 14, 15
Ti plasmid, 5, 6, 9, 11 Veena, V., 3, 5, 8, 9, 12, 15, 16, 19, 21, 22, 24
TIGR, 60, 72 Velban®, 405
Tobacco mosaic virus (TMV), 133 Verticillium dahliae, 133
Tomilov, A., 5 Vesicular arbuscular mycorrhiza (VAM), 202
Trans-acting siRNAs (ta-siRNAs), 63, 107 Vilaine, F., 10–12, 19
Transcriptome analysis, 68, 72 Vinblastine (VLB), 401, 405, 408, 409, 411
Transfer-DNA (T-DNA), 4–7, 9, 10, 12, 15, Vinblastine sulphate, 405
17, 19, 20, 98, 174 Vincolidine, 405
Transgenic plants, 14–18, 20, 21, 24, 25, 50, Vincristine (VCR), 401, 405, 408, 409, 411
102 Vincristine sulphate, 405
in phytoremediation, 25 Vindoline, 405, 407, 408
resistance to heavy metals, 393 Virus-induced gene silencing (VIGS), 101,
resistances to herbicides, 135 109
resistances to insects, 23, 131
resistances to oxidative stress, 300, 302, W
450, 451, 470, 475 Waines, J. G., 310, 331
resistances to virus, 133 Ward, D. V., 6
Transposable elements (TEs), 276 Weising, K., 5
Trichloroacetic acid (TCA), 75 Weller, S. A., 3, 197
Trichoderma harzianum, 198 White, D. G., 277
Trichothecene mycotoxin deoxynivalenol White, F. F., 7, 10–12, 15, 19
(DON), 134 White, F. M., 81
Trichothecenes, 134, 277 White, G., 275
Triticeae full-length CDS database (TriFLDB), White, L. O., 2
60 Whitehead, I. M., 403
Triticeae mapped EST database (TriMEDB), Whitelaw, M. A., 200
60 Wide hybridization, 125, 126, 244
Triticum aestivum, 62, 169, 239, 240, 308, 332 Willems, A., 2
Trovato, M., 18 Willmitzer, L., 10
Index 493
Wilm’s tumour, 405 Zhang, C. Y., 330

Woese, C. R., 2 Zhang, F., 126, 423, 425, 426, 430, 432,
450, 461
X Zhang, H., 255, 279
X-ray crystallography, 86 Zhang, Q, 126
Zhang, Q., 52, 222
Y Zhang, S. Q., 427
Yadav, N. S., 5, 427 Zhang, W., 66, 312, 313, 324
Yamada, T., 20 Zhang, X., 50, 72, 125, 190, 391
Yan, W., 82 Zhang, Y., 63, 86
Yang, D. C., 171, 199, 222, 254, 410, 425, 450 Zhu, J. P., 6
Yasuda, H., 23 Zhu, X. C., 226
Yokoyama, R., 17, 84 Zhu, Y. G., 221
Yoon, Y., 427 Zhu, Z., 257
Yoshimoto, K., 461 Ziemienowicz, A., 5
Young, C. C., 199 Zimmermann, P., 71
Young, N. D., 472 Zimmermann, S., 403
Yusibov, V. M., 6 Zuker, A., 17
Zunino, M. P., 298
Zupan, J. R., 5, 6
Z Zvirin, T., 274
Zambryski, P., 5, 6, 23
Zhang, C., 403

Hakeem Et Al., 2013

Uploaded by

Copyright:

Available Formats

Hakeem Et Al., 2013

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Hakeem Et Al., 2013

Uploaded by

Copyright:

Available Formats

Crop Improvement

Khalid Rehman Hakeem • Parvaiz Ahmad

Dr. Parvaiz Ahmad

ISBN 978-1-4614-7027-4 ISBN 978-1-4614-7028-1 (eBook)

Library of Congress Control Number: 2013939183

© Springer Science+Business Media, LLC 2013

Printed on acid-free paper

Springer is part of Springer Science+Business Media (www.springer.com)

Prof. Dr. Ahmet Ruhi Mermut

Dr. Khalid Rehman Hakeem

2 Bioinformatic Tools in Crop Improvement . . . . . . . . . . . . . . . . . . . . . . 49

3 Crop Improvement Through Plant Tissue Culture. . . . . . . . . . . . . . . . 123

4 Mutagenesis—A Potential Approach for Crop Improvement . . . . . . . 149

5 Role of Bio-fertilizers in Crop Improvement. . . . . . . . . . . . . . . . . . . . . 189

 ariability in Fusarium species Causing

10 An Overview of Omics for Wheat Grain Quality Improvement . . . . . 307

11 From Agronomy to Molecular Genetics and Proteomics in an

12 Arsenic Toxicity and Tolerance Mechanisms in Plants:

13 Arsenic Stress in Plants: An Inside Story. . . . . . . . . . . . . . . . . . . . . . . . 379

14 In vitro Production of Secondary Metabolites Using

15 Handling Soybean ( Glycine max L.) Under Stress. . . . . . . . . . . . . . . . . 421

16 Environmental and Economical Opportunities for the

17 Dealing with Environmental Stresses: Role

Dr. Khalid Rehman Hakeem, PhD is Post Doctorate Research Fellow at

1990–1998. His main research areas are Eco-Physiology, Phytoremediation, Sabkha

Bilal Ahmad Padder Division of Plant Pathology, SKAUST-K, Srinagar 191121,

Lou F. De Filippis Centre for Environmental Sustainability (CENS), Department

Mohammad Miransari AbtinBerkeh Limited Co., Imam Blvd., Shariati Blvd.,

Khalid Rehman Hakeem P.G Programme in Bioresources, Department of Botany,

Mushtaq Ahmad Teli Division of Plant Pathology, SKAUST-K, Srinagar 191121,

Ibrahim Ilker Ozyigit, Ilhan Dogan and Ebru Artam Tarhan

Abstract The history of Agrobacterium-related plant biotechnology goes back for

The increase in demand for food is dramatic with an expanding population

I. I. Ozyigit () · E. Artam Tarhan

K. R. Hakeem et al. (eds.), Crop Improvement, DOI 10.1007/978-1-4614-7028-1_1, 1

Characteristics of Agrobacterium rhizogenes

Fig. 1.1 Scanning electron

Hairy Root Disease

Fig. 1.3 Scanning Electron

The Mechanism of Hairy Root Formation

Fig. 1.4 Schematic representation of Mannopine type Ri plasmid of A. rhizogenes

T-DNA makes up a small region (approximately 200 kb) of Ti/Ri plasmids which

Fig. 1.5 Schematic representation of Agropine type Ri plasmid of A. rhizogenes

The most common A. rhizogenes strains which represented by Ri plasmids are

Independent transformations of both left T-DNA (TL-DNA) (about 15–20 kb) and

Fig. 1.6 Schematic represen-

Fig. 1.7 Schematic representation of gene locations on TL-DNA

Table 1.1 (continued)

transgenic clones show 40–60 % reduction of GA content compared to wild-type

observations firstly suggested that there is a similarity between the auxin-mediated

rolBTR (rolB Homologue in TR-DNA)

Expression of ORF3n in transgenic N. tabacum caused retarded flowering, less

ORF13 and ORF14

Furthermore, endoreduplication was reduced in ORF13 plants (Meyer et al. 2000),

A. rhizogenes and Crop Biotechnology

Conclusion and Future Perespective

This chapter deals with current research on A. rhizogenes-mediated transformation

Table 1.2 (continued)

Table 1.2 (continued)

Table 1.2 (continued)

ariability in Fusarium species Causing

10 An Overview of Omics for Wheat Grain Quality Improvement . . . . . 307

11 From Agronomy to Molecular Genetics and Proteomics in an

12 Arsenic Toxicity and Tolerance Mechanisms in Plants:

14 In vitro Production of Secondary Metabolites Using

16 Environmental and Economical Opportunities for the

17 Dealing with Environmental Stresses: Role