Journal of Infection and Public Health 11 (2018) 314–320

Contents lists available at ScienceDirect

Journal of Infection and Public Health

journal homepage: http://www.elsevier.com/locate/jiph

Molecular characterization of lower vaginal swabs for Human

papilloma virus in association with Chlamydia trachomatis infection in
Cameroonian Women
Pythagore Fogue a,1 , Geraldo Djeudong b,1 , George Bouting b , Elom Aglago c ,
Gustave Simo a,∗ , Smiths Lueong a,∗
a
Molecular Parasitology and Entomology Unit (MPEU), Department of Biochemistry, University of Dschang, BP 67, Dschang, Cameroon
b
Biochemistry Laboratory, Dschang District Hospital, P.O Box 43, Dschang, Cameroon
c
Joint Unit of Research URAC 39, Ibn Tofail University—CNESTEN, Rabat, Morocco

a r t i c l e i n f o a b s t r a c t

Article history: Human papilloma virus (HPV) infection is an etiological factor for cervical cancer development and
Received 10 November 2016 Chlamydia trachomatis (Ct) is considered as a cofactor. Understanding the dynamics of HPV and Ct
Received in revised form 10 August 2017 infection could help to explain the incidence of early onset of cervical cancer (CC) observed in Cameroon.
Accepted 14 August 2017
Lower vaginal swabs and sera from sexually active women were analyzed for HPV and Ct infection in
association with risk factors. Questionnaires were used to document patients’ lifestyle and risk factors.
Keywords:
A total of 206 women participated in the study average 28.1 ± 8 years (16–50 years). HPV prevalence
HPV
was 23.3% with subtypes 16 and 18 at respectively 2.9% and 1%. Ct infection totalised 40.8%, of which
Chlamydia trachomatis
Risk factor
23.8% were HPV- Ct co-infections. HPV infection was inversely associated with age (p = 0.028). We found
Co-infection a positive association between Ct infection and the number of sex partners (p = 0.012) and a negative
Cervical cancer association with parity (p = 0.032). There was no significant association between HPV and Ct infections.
Cameroon High rates of HPV and Ct infections could be an indicator of cervical cancer risk in the near future.
There is therefore an urgent need for sensitization as well as implementation of appropriate preventive
measures.
© 2017 The Authors. Published by Elsevier Limited on behalf of King Saud Bin Abdulaziz University
for Health Sciences. This is an open access article under the CC BY-NC-ND license (http://
creativecommons.org/licenses/by-nc-nd/4.0/).

Introduction vagina, anus and oropharynx), and of the 12.7 million human
cancers reported in 2012, some 610,000 cases could clearly be
Human papilloma viruses (HPV) infections are among the most attributed to HPV infection [4]. The numbers differ for different geo-
prevalent sexually transmitted infections in men and women in graphical regions, and are directly related to development index.
developing countries [1]. Meanwhile several HPV subtypes are For example, the HPV-attributable fraction of human cancers in
known, a subset is highly associated with risk of cervical cancer sub-Saharan Africa is estimated to be around 14.2%, 15.4% in India
development [2,3]. Recent estimates indicate that worldwide bur- and about 1.6% in North America [4]. Considering the lack of ade-
den of HPV infections stands between 11% and 12% with large quate and systematic HPV screening and vaccination programs in
geographical differences. The highest incidence rates are observed most less developed regions, the numbers could be even higher.
in sub-Saharan Africa (24%), Eastern Europe (21%) and Latin Amer- HPV is therefore a clear public health problem in most develop-
ica (16%) [4]. Of all HPV subtypes, HPV 16 and 18 are the most ing regions and despite the lack of reliable epidemiological data, its
prevalent high risk subtypes with global incidence rates of 3.2% and health impact is by no means minimised.
1.4% respectively [5]. The carcinogenicity of HPV has been defini- Chlamydia trachomatis (Ct) on the other hand, is a major
tively established for six human cancers (cervical, penis, vulva, co-factor for HPV-driven cervical cancer and is known to be respon-
sible for other diseases such as chronic inflammatory diseases
[6]. According to recent reports, the global burden of CT infec-
tion is about 4.2% in women and 2.7% in men, representing some
∗ Corresponding authors. 130 million annual new cases [7]. Of the world Ct burden, more
E-mail addresses: [email protected] (G. Simo), [email protected] (S. Lueong). than two thirds occur in developing countries, with above 80%
1
These authors contributed equally and should be considered as first authors.

https://doi.org/10.1016/j.jiph.2017.08.010
1876-0341/© 2017 The Authors. Published by Elsevier Limited on behalf of King Saud Bin Abdulaziz University for Health Sciences. This is an open access article under the
CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320 315

of cases remaining asymptomatic. Based on available data, inci- from the Dschang district hospital review board and the Cameroon
dence may go from 8% to more than 37% in some instances [8]. Bioethics Initiative (CAMBIN).
Besides rare and sporadic Chlamydia testing implemented in some
countries, such high prevalence rates of asymptomatic infection Methods
lay firm grounds for proper transmission and does in no way min-
imise the role of Ct as a risk factor for HPV and HIV infections Sampling
[9,10]. As a result of conflicting reports, the role of Ct infection
in the development of HPV-driven cervical cancer still needs to Participants were recruited between June 2015 and April 2016.
clearly be elucidated. Some studies have reported independent Prior to that, the goal of the study was clearly explained to partic-
association of Ct with squamous cell carcinoma [11] while others ipants, and when consent was given, subjects were included into
report no significant association [12]. Nonetheless, Ct implication the study. A detailed questionnaire was administered to all par-
in cancer development is much more established. Moreover, apart ticipants to document their lifestyle patterns. All participants who
from its potential implication in cervical cancer development, Ct could not read or write were assisted by the medical personnel,
has been shown to have several reproductive health implications and the questions in some cases were well explained in the local
such as neonatal morbidity, pelvic inflammatory disease, infertility languages. Low vaginal swabs were collected from participants
and ectopic pregnancies as well as other genital cancers [13]. HPV for the molecular detection of HPV and the blood samples were
and Ct coinfections would therefore form a perfect lethal cocktail used for the detection of Chlamydia infection by enzyme-linked
with unprecedented potentials of driving cervical cancer and other immunosorbent assay (ELISA). Biological material from all swabs
health-related problems. It is therefore evident, that such coinfec- were immediately collected into a tube containing 1 ml of sterile
tions represent major public health issues, especially in low income saline (0.9% NaCl) and kept frozen at −20 ◦ C until they were used
settings thereby increasing the risk of cervical cancer development. for DNA extraction. Serum samples were prepared from the blood
The global burden of cancer is being shifted to less developed and aliquoted before being stored at −20 ◦ C. The swab samples were
countries [14] with about 57% of cancer cases registered in these transferred from the biochemistry laboratory of the Dschang dis-
regions and 65% of cancer-related deaths. Cervical cancer is the trict Hospital, to the Molecular parasitology and entomology Unit at
second most diagnosed and third leading cause of female cancer- the University of Dschang for molecular analyses. Chlamydia infec-
related deaths in developing countries. The highest incidence tion test was performed at the district hospital
rates occur in sub-Saharan Africa, Latin America, and Melanesia Primer sequences used in the study.
accounting for 90% of the World’s cervical cancer deaths [14]. The Primer name Sequence 5 → 3 Tm (◦ C) Amplicon size (bp)
geographical disparities in CC incidence could be explained by dif-
My09 cgtccmarrggawactgatc 52.5 450
ferences in the implementation of screening programs for early My11 gcmcagggwcataayaatgg 55.8
detection of precancerous lesions and HPV infections. In countries HPV16F ttaggcagcacttggccaacca 62 207
where systematic screening programs have been implemented, CC HPV16R taatccgtcctttgtgtgagct 67
incidence has reduced by up to 65% as it is the case in Norway [14]. HPV18F tcgcgtcctttatcacagggcga 63 274
HPV18R tgcccaggtacaggagactgtg 66
CC is one of the most prevalent female cancers world-wide and
representing about 23% of all preventable cancer-related deaths
in low and middle income countries [15]. Despite the fact that CC DNA extraction
can be prevented by vaccination, no systematic vaccination pro-
grams have been implemented in Cameroon, as it is the case in For molecular diagnosis of HPV infections, DNA was extracted
many developing countries worldwide. In this context, cervical following the hexadecyltrimethylammonium bromide (CTAB)
cancer prevention through behavior change remains the only alter- based method previously described [16] with some modifications.
native. Pushing for more investigation on infection risk factors in Briefly, frozen samples were thawed and 200 ␮l were pipetted into
the Cameroonian population would provide alternative measures a new Eppendorf tube. The samples were centrifuged at 10,000 rpm
to reduce disease burden. on a benchtop centrifuge. The resulting pellet was washed twice
The present study evaluates the prevalence of HPV and Ct infec- in 500 ␮l of deionized water and re-suspended in 500 ␮l of CTAB
tions among sexually active women attending the Dschang district buffer (CTAB 2%; 0.1 M Tris, pH 8; 0.02 M EDTA pH 8; 1.4 M NaCl).
hospital, in Cameroon. The study evaluates the risk of infection- Samples were then incubated at 60 ◦ C for 30 min for complete
related cervical cancer and report the incidence rate of Chlamydia lysis and DNA was isolated from the lysate by means of a mixture
and HPV infections among sexually active women in the popula- of chloroform/isoamyl alcohol (24/1; V/V) extraction followed by
tion. precipitation with sodium acetate in isopropanol (V/V). After cen-
trifugation at 13000 rpm for 15 min, the pellet was rinsed with 70%
Study site and population ethanol, air-dried, and re-suspended in 25 ␮l distilled sterile water.
The DNA samples were diluted 25 folds and stored at −20 ◦ C until
The study was performed in Dschang, the divisional headquarter PCR amplification.
of the Menoua division of the west region of Cameroon. Dschang is
a University town with several colleges and higher education insti- Detection of HPV by PCR
tutes that cohabit in the city, making it an attractive commercial
centre and constituting a very dynamic and active population. With Molecular identification of HPV was achieved by polymerase
a total area of 450 km2 it has a total population of about 102,000 chain reaction (PCR) using the MY09/MY11 consensus L1 primers
inhabitants involved in different works of life. Most inhabitants for all HPV subtypes [17] with some modifications. Briefly, a PCR
can be categorized under one of the following professional cate- master mix comprising of 1× Q5 high fidelityTM reaction buffer
gories: house wives, students, traders and employees of the public (New England Biolabs), 0.4 ␮M of each primer, 400 ␮M dNTPs and
sector. The transmission of sexually transmitted infections (STIs) 0.5U of Q5 high fidelity DNA polymerase were prepared and dis-
could be high within such a population. Participants were randomly tributed into PCR tubes. DNA samples (2.5 ␮l) were then added to
recruited during visits to the hospital for routine gynaecological the tubes and placed onto a Prime thermocycler (TECHE). Ampli-
check-ups. All participants consented to participate in the study by fication was performed using the following conditions; initial
signing an informed consent form. Ethical clearance was obtained denaturation at 98 ◦ C for 2 min, followed by 40 cycles each com-
316 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320

prised of a denaturation step at 98 ◦ C for 30 s, primer annealing at Table 1

General characteristics of the studied population.
57 ◦ C, an extension at 72 ◦ C for 1 min and a final extension at 72 ◦ C
for 10 min. Variables Mean ± SD, frequency or median (25–75 IQ)
For the identification of high risk HPV subtypes (HPV16 and HPV Age 28.1 ± 8.0
18), subtype specific primers in a similar PCR mix was prepared. Partnership status
The cycling conditions for the amplification of HPV 18 DNA were: Yes 160 (77.6%)
initial denaturation at 98 ◦ C for 2 min, followed by 40 cycles each No 46 (22.4%)

comprising of a denaturation step at 98 ◦ C for 30 s, primer annealing Education level

at 64 ◦ C, an extension at 72 ◦ C for 1 min and a final extension at 72 ◦ C Primary 62 (30%)
Secondary 98 (47.6%)
for 10 min. Amplification using the HPV 16 primers was done using
Tertiary 46 (22.3%)
a touch down approach with an upper temperature of 53 ◦ C and
lower temperature of 50 ◦ C. The human ␤-globin gene was used Occupation
Housewives & others 53 (24.7%)
as internal control using the GH20/PC04 primer pair as described
Students 61 (30%)
previously [18]. Amplicons were resolved on a 2% agarose gel and Traders 49 (23.8%)
documented on a UVITEC Cambridge gel documentation system. Public employees 43 (20%)
Age at first sex 17.9 ± 2.9
Diagnosis of Chlamydia trachomatis infection Contraception
Internal devices and injectable 70 (34.0%)
Serological diagnosis was used to assess Ct infection status of Condom 127 (61.7%)
each participant. Blood samples collected from participants were Sexual activity
used for serum preparation, and the Calbiotech CT IgG or IgM test kit Yes 200 (97.08%)
was used to identify Ct infections following manufacturer’s instruc- No 6 (2.9%)

tions. Briefly, serum samples were diluted 21 fold in sample diluent Chlamydia infection
and 100 ␮l of diluted serum was coated onto ELISA strips at room Positive 84 (40.8%)
temperature for 30 min. Samples were then discarded and strips Negative 122 (59.2%)

washed three times in 300 ␮l of 1× wash buffer, followed by incu- HPV infection
bation with the enzyme conjugate at room temperature for 10 min. Positive 48 (23.3%)
Negative 158 (76.7%)
The strips were again washed as described above and incubated
with 100 ␮l of TMB substrate for 10 min at room temperature. The HPV 16
reaction was then terminated by the addition of 100 ␮l of stop solu- Positive 6 (2.9%)
Negative 200 (97.1%)
tion and the optical density was read in a DIALAB ELx800 plate
reader. HPV 18
Positive 2 (1.0%)
Negative 204 (99.0%)
Statistical analysis

Mean ± standard deviation, frequencies and percentages were

used respectively for continuous and variables categorical. Logis- were aware of the protection provided by condoms but did not
tic regression at a univariate level was performed to determine the report their use. Those who reported not using condoms were
association between HPV or Ct and the risk factors. HPV and Ct pos- married and 4.3% (9/206) of the participants provided no infor-
itivity were considered as dependent variables. The independent mation on condom awareness and/or use (Table 1). The level of
variables were age (<24, >30 and in-between), pregnancy status, education of the study population ranged from primary education
partnership status, education level (primary, secondary, univer- (30%) through secondary education (47.6%) to tertiary education
sity), income (low, medium, and high), age at first sexual activity (22.4%). The socioeconomic status of the participants was assessed
(<16, >18, and in-between), number of partners (< = 1, >3, and in- by means of self-reported activities. About 20% (43/206) of the par-
between), use of condom as contraceptive, and number of children. ticipants were employees of the public service, 23.8% (49/206) were
The results were reported as prevalence of cases and controls, odds traders (high income group), 30% (61/206) were students (medium
ratio, and the corresponding p-value. Logistic regression was also income group) and about 24.7% (51/206) were house wives or
used to assess the association between the infection by Chlamydia unemployed.
and the HPV. Because of the small number of HPV16 and HPV18
cases, we did not investigate separate risk factors. A p-value <0.05
was considered for significance. All the analyses were performed Chlamydia trachomatis infection
using STATA 14 (StataCorp LP, College Station, TX).
For the 206 women enrolled in this study, 84 (40.8%) were
Results infected by Ct. Logistic regression showed that only the number of
sex partners was positively associated with Ct infections (p = 0.01)
Population characteristics (Tables 2 and 3). The risk to be infected by Ct increased with the
number of sexual partners. For instance, the value of OR was 1 for
For all study participants (n = 206), the age range was between < = 1 sexual partner and 2.31(1.09–4.92) for 2 and 3 sex partners
16–50 years and the mean age was 28 ± 8 years with more than (Table 2). In a multivariable logistic regression, parity appeared to
97% (200/206) of whom declared having regular sexual activity be negatively associated with Chlamydia especially when number
(Table 1). About 77.6% (160/206) of women had stable sexual of partner was not included in the analysis (p = 0,032, not showed in
partner(s) while 22.3% (46/206) of them did not. The number of the results). Although not statistically significant (p = 0.14), the age
partners varied considerably, with 25% (52/206) having a single at first sexual intercourse was negatively correlated with risk of Ct
partner and 34.9% (72/206) reporting more than 4 sex partners. infection (OR = 1 for sex before or at the age of 16 years and OR = 0.52
All women knew about condoms as a contraceptive method and for first sex after 18 years). Both educational status and the use of
61.7% (127/206) made use of it while about a third (34%) of them condoms were not significantly associated with Ct infection.
 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320 317

Table 2
Odds ratio for Chlamydia trachomatis and HPV infections.

Chlamydia HPV
Cases Controls ORa (95%CI) p Value Cases Controls ORa (95%CI) p Value

N 84 122 – – 48 158 – –
Age
Between 16–24 35 48 1 0.92 26 57 1 0.028
Between 25–29 21 33 0.87 (0.43–1.76) 13 41 0.70 (0.32–1.51)
Superior to 30 27 41 0.90 (0.47–1.73) 9 59 0.33 (0.14–0.78)

Partnership status
Yes 67 93 1.22 (0.63–2.42) 0.55 15 127 1 0.10
No 17 29 1 33 31 1.86

Education level
Primary 11 12 1 0.74 4 19 1 0.71
Secondary 36 52 0.76 (0.30–1.90) 20 68 1.39 (0.43–4.58)
University 37 58 0.70 (0.28–1.74) 24 71 1.61 (0.50–5.19)

Occupation
Housewives 16 34 1 0.33 8 42 1 0.35
Students 44 59 1.58 (0.78–3.23) 26 77 1.77 (0.73–4.26)
Others 24 29 1.75 (0.79–3.93) 14 39 1.88 (0.71–4.98)

Age at first sex

Inferior to 16 41 51 1 0.14 25 67 1 0.45
Between 16 and 18 27 32 1.05 (0.54–2.02) 11 48 0.61 (0.28–1.37)
Superior to 18 15 36 0.52 (0.25–1.07) 11 40 0.74 (0.33–1.66)

Number of partners
Inferior < = 1 14 42 1 0.012 13 43 1 0.70
Between 2 and 3 34 44 2.31 (1.09–4.92) 16 62 0.85 (0.37–1.95)
Superior to 3 36 36 3.0 (1.40–6.42) 19 53 1.18 (0.53–2.67)

Contraceptive condom
Yes 49 78 0.78 (0.44–1.39) 0.42 35 92 1 0.062
No 35 44 1 13 66 0.52 (0.25–1.05)

Number of children
No child 44 56 1 0.36 31 69 1 0.36
Child = 1 17 21 1.03 (0.48–2.18) 7 31 1.03 (0.49–2.18)
Child > = 2 23 25 0.65 (0.34–1.23) 10 58 0.65 (0.34–1.23)

HPV
Yes 20 28 1 0.89 – – – –
No 64 94 0.95 (0.49–1.84) – – – –

HPV infection relation between Ct infections and Age at first sex was still found
without significant association (p = 0.065). Among women in the
Molecular detection of HPV infections revealed that 23.3% age group of 25–30 years, students and unemployed participants
(48/206) of all women were positive for HPV infections (Table 2). were at higher risk of Ct infections with OR (95%CI) values of 3.27
The incidence of HPV 16 and HPV 18 subtypes were 2.9% and (0.55–19.5) and 5.14 (0.82–32.3) respectively Table 3 Parity on the
1% respectively and did occur predominantly in young women. other hand, showed a negative correlation with Ct infection and
Of all seven risk factors assessed (Table 2), there was a signifi- participants having more than 2 children were least likely to be
cant (p = 0.028) inverse relation between age and HPV infection. infected by Ct with an OR (95%CI) value of 0.04 (0.06–2.70).
Unexpectedly, there was a positive, but statistically not significant
(p = 0.062) increased risk of HPV infection in subjects who used con- Education and sexual behavior
doms for contraception than those who do not. Moreover, there was
an increased risk of HPV infection in women who declared having Although 61.7% (127/206) of participants reported the use of
no stable sex partner as opposed to those who had stable sex part- condoms during sexual intercourse, the use of condoms was only
ners. For the 84 (40.8%) Ct positive women, 20 (23.8%) were positive as a means of contraception. Those who did not use condoms used
for HPV infection. There was however no statistically significant either oral or injectable contraceptives. When those who reported
association between HPV and Ct infections as well as educational the use of condoms were asked if they had unique sex partners, it
and socioeconomic status. turned out, that of all those who did use condoms, 25.6%, 22.4%,
19.2%, 11.2% and 21.6% had one, two, three, four and more than
Infection risk factors four sex partners respectively. On the other hand, for those who
reported not using condoms, 27.3%, 14.3%, 16.7%, 10.7% and 31.0%
Age and infection had one two, three, four and more than four sex partners respec-
To further understand the role of population strata on infection tively. This indicates that stability in number of sex partners cannot
status, we stratified the study population into three age groups: explain the decision of whether or not to use condoms. For all those
16–24 years, 25–30 years and above 30 years (Table 3). For the who declared using condoms, only 5.6% of them had only been to
first age subgroup (16–24 years), a significant positive associa- primary school, while 41.6% and 52.8% had attended secondary and
tion was observed between the number of sex partners and Ct tertiary education respectively. However, of all those who did not
infections (p = 0.01). For women above 30 years, an inverse cor- use condoms but other contraceptives, up to 20% attended only
318 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320

Table 3
Odds ratio for Chlamydia trachomatis and HPV infections stratified by age.

Chlamydia HPV

16–24 25–29 More than 30 16–24 25–29 More than 30

a b
OR pVal OR pVal OR pVal OR pVal OR pVal OR pVal

Partnership status
Yes 1 (*Ref) 0.34 1 (Ref) 0.78 1 (Ref) 0.99 1 (Ref) 0.35 1 (Ref) 0.65 1 (Ref) 0.66
No 0.63 (0.24–1.65) 0.83 (0.24–2.95) 1.01 (0.16–6.50) 1.60 (0.60–4.26) 1.38 (0.35–5.46) 1.72 (0.17–17.4)

Education level
Primary 1 (Ref) 0.68 1 (Ref) 0.44 1 (Ref) 0.76 1 (Ref) 0.92 1 (Ref) 0.76 1 (Ref) 0.49
Secondary 0.34 (0.03–4.18) 0.91 (0.11–7.72) 0.70 (0.21–2.36) 0.95 (0.35–2.56) 0.82 (0.22–2.99) 3.21 (0.35–29.2)
University 0.36 (0.03–4.21) 0.45 (0.05–3.72) 1.03 (0.26–4.0) 1 (Ref) 1 (Ref) 1.88 (0.15–22.9)

Occupation
Housewives 1 (Ref) 0.44 1 (Ref) 0.17 1 (Ref) 0.93 1 (Ref) 0.25 1 (Ref) 0.53 1 (Ref) 0.10
Students 1.97 (0.62–6.29) 3.27 (0.55–19.5) 0.83 (0.24–2.78) 0.24 (0.14–1.285) 1.60 (0.37–7.02) 0.24 (0.04–1.44)
Others 2.18 (0.57–8.41) 5.14 (0.82–32.3) 0.79 (0.21–2.92) 0.35 (0.09–1.40) 1 (–) 1 (–)

Age at first sex

12–16 years 1 (Ref) 0.38 1 (Ref) 0.75 1 (Ref) 0.065 1 (Ref) 0.22 1 (Ref) 0.80 1 (Ref) 0.13
16–18 years 0.81 (0.28–2.35) 0.71 (0.16–3.23) 0.24 (0.06–0.86) 0.36 (0.11–1.17) 1.78 (0.32–10.0) 0.14 (0.01–1.29)
Above 18 years 0.47 (0.16-1.43) 0.61 (0.17–2.21) 0.38 (0.11–1.26) 0.65 (0.21–1.96) 1.20 (0.25–5.71) 0.41 (0.08–1.98)

Number of partners
Inferior < = 1 1 (Ref) <0.01 1 (Ref) 0.76 1 (Ref) 0.27 1 (Ref) 0.63 1 (Ref) 0.60 1 (Ref) 0.69
Between 2 and 3 3.05 (1.06–8.80) 1.50 (0.24–9.42) 2.80 (0.62–12.9) 0.73 (0.25–2.14) 1.58 (0.15–16.3) 1.95 (0.18–20.8)
Superior to 3 6.5 (1.84–22.9) 1.92 (0.31–12.1) 3.02 (0.70–13.0) 1.33 (0.41–4.37) 2.63 (0.26–26.1) 2.50 (0.26–23.7)

Contraceptive condom
Yes 1 (Ref) 0.77 1 (Ref) 0.18 1 (Ref) 0.78 1 (Ref) 0.69 1 (Ref) 0.23 1 (Ref) 0.18
No 1.16 (0.42–3.21) 2.28 (0.68–7.70) 1.15 (0.42–3.20) 1.25 (0.43–3.62) 0.39 (0.08–2.03) 0.38 (0.09–1.58)

Number of children
No child 1 (Ref) 0.95 1 (Ref) 0.27 1 (Ref) 0.37 1 (Ref) 0.63 1 (Ref) 0.60 1 (Ref) 0.69
Child = 1 1.05 (0.33–3.39) 1.11 (0.31–4.03) 0.35 (0.08–1.56) 0.73 (0.24–2.14) 1.58 (0.15–16.3) 1.95 (0.18–20.8)
Child > = 2 1.41 (0.19–10.6) 0.04 (0.06–2.70 0.38 (0.09–1.51) 1.33 (0.41–4.37) 2.63 (0.26–26.1) 2.5 (0.26–23.7)

HPV
Positive 1 (Ref) 0.64 1 (Ref) 0.97 1 (Ref)
Negative 1.25 (0.48–3.22) 1.02 (0.28–3.69) 0.48 (0.12–1.96)
a
OR = odds ratio.
b
pVal = p value.

primary education while 46.25% and 33.75% attended secondary reported varying prevalence rates in other developing nations; 9.6%
and tertiary education respectively. We later assessed if any rela- in Kano Nigeria [24], 5.5% in Qatar [25] and 10.7% in Brazil [26]. With
tionship did exist between the number of sex partners and the an estimated global prevalence of 4.2% [7], the prevalence of Ct in
level of education. We found, that although there was no differ- the study population was more than 10 folds higher. In Nigeria,
ence in the percentage of women who had one, two, three, or multiple sex partners among university students was the prevail-
four sex partners for all educational levels considered, the per- ing risk factor associated with Ct infection as it is the case in our
centage of women with more than four sex partners and who study. The low infection rate of Ct in some Countries like Qatar could
attended only primary education was twice that of those who be explained by some socio-cultural factors such as sexual activity
attended tertiary education. Similarly, age at first sexual inter- which is tightly controlled and multiple sex partners considered as
course was lower for women who attended only primary education a taboo. Compared with other areas of high STI prevalence such as
(16.5 ± 2.2 years) compared to those who attended tertiary educa- rural Kwazulu-natal in South Africa, Ct prevalence is more than 3
tion (18.1 ± 4.4 years). times higher. However, similar associated risk factors (early onset
of sexual activity and multiple partners) were found to be asso-
ciated with high risk of Ct infection [27]. Behavioral factors, most
Discussion
importantly high risk sexual behaviors could explain the observed
Ct incidence rates. The impact of behavioral factors is further exem-
Cervical Cancer is one of the leading causes of cancer-related
plified, by the fact that age at first sex was inversely correlated with
deaths and is among the most preventable cancers [20]. In this
in infection.
study, the incidence of HPV and Chlamydia infections were evalu-
We observed a prevalence rate of 23, 3% HPV, of which HPV
ated among sexually active women attending the Dschang district
16 and HPV 18 represented 2.9% and 1% respectively. Globally, a
hospital. The study population had an average age of 28.1 ± 8 years;
prevalence rate of between 11 and 12% has been reported with
reflecting the highly active nature of the population characterized
geographical discrepancies that are inversely related with develop-
by multiple secondary and high schools cohabiting with one state
mental index [35]. Sub-Saharan African, Eastern Europe and Latin
University and a few other private higher institutes of learning. We
America are the most affected, with prevalence rates of 24% for the
observed an infection rate of 40.8% for Ct, which was positively
former and 16% for the latter [35]. An observed prevalence of 23.3%
correlated with number of sex partners and showed a negative
is therefore similar to the regional mean and has been observed
correlation with age at first sexual intercourse. In a similar study
in some areas of Brazil and South Africa. In fact, among University
performed in Nigeria among undergraduate students, the preva-
students in Brazil a prevalence of 25.3% was reported [28]. In India,
lence rate was about 30% [22]. Another study in India reported 23%
prevalence rates of 9.9% and 12.6% have been observed in sepa-
prevalence [23] in a similar study population. Other studies have
 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320 319

rate studies, with HPV 16 and HPV 18 representing 0.6% and 1.4% Conclusion
respectively [29,30]. In Nigeria and Ghana, the prevalence rates of
HPV were 37% and 10.7% respectively [31,32]. The prevalence of We investigated the incidence of HPV and Ct infections in associ-
HPV in the study population is therefore among the highest inci- ation with risk factors among sexually active Cameroonian women.
dence rates reported in different populations, and two fold higher Our study showed that there is a very high prevalence of Ct and HPV
than global rates but close to regional rates (24%) except in some single infections as well as co-infections in the study population and
areas of rural South Africa with up to 76% incidence rates [33,21]. sexual behaviors seem to partly explain the observed trends. Such
This high prevalence could be explained by behavioral and lifestyle high rates of co-infections suggest significant risk of cervical neo-
factors. Indeed, several studies have reported high HPV prevalence plasia or precancerous lesions which would represent an important
rates young women [28–32,34–36] and this could reflect sexual public health issue in the near future. This study presents compre-
behaviors. In a recent report in South Africa, stability of sex part- hensive analysis of HPV and Ct infection in Cameroon and highlights
ners and risk behaviors have been associated with extreme risk of the possible implication of these infections in the development
HPV infections [34]. Considering high risk HPV subtypes, the inci- of cervical cancer. The results generated here open the doors for
dence rates of HPV 16 and HPV 18 in our study were similar to global further investigations on HPV and Ct infections in other parts of
reports [21]. Despite this, some regional studies have pointed to a Cameroon.
higher prevalence of other high risk HPV subtypes such as HPV 18,
HPV 45 and HPV 35 [43]. It is therefore probable, that the incidence Funding
of other high risk HPV subtypes is higher in the study population
either as unique infections or mixed infections. No funding sources.
Co-infections with HPV and Ct were found in 20 (23.8%) of Ct
infected individuals. In Italy, coinfection rates of 2.7% and 60.4% Competing interests
were reported in different population groups [34,37]. In both cases,
majority of the infections were asymptomatic Ct infections and None declared.
sexual behaviors were strongly associated with infection. Using
logistic regression models, we found a significant positive corre- Ethical approval
lation between number of sex partners and Ct infection, as well
as a negative correlation between age at first sex with HPV and Not required.
Chlamydia infections. This can be explained by the fact that most
of those who attain higher education are aware of sex transmitted Acknowledgments
infections and the risks resulting from such diseases. The signifi-
cant high infection rate of HPV in younger adolescents and inverse This study was supported by the University of Dschang and
correlation between the use of condoms and the risk of Ct infections Dschang District Hospital, the Molecular Parasitology and Entomol-
in this group of women corroborate with results observed in India ogy Unit: University of Dschang.
[30,38]. There was a significant negative correlation between parity
and Ct infection especially when the number of partners was not References
considered. This could be explained in part by the fact that most
of those who had children were married and in most cases, may [1] Giuliano AR, et al. High HIV, HPV, and STI prevalence among young Western
have a unique sex partner. The increased rate of Ct infection among Cape, South African women: EVRI HIV prevention preparedness trial. J Acquir
Immune Defic Syndr 2015;68(2):227–35.
women with multiple sex partners could be expected, and is further [2] Kim MJ, Kim JJ, Kim S. Type-specific prevalence of high-risk human papillo-
enhanced by the fact that most of them do not used condoms. As mavirus by cervical cytology and age: data from the health check-ups of 7014
previously reported [39], the use of condoms is perceived as a bar- Korean women. Obstet Gynecol Sci 2013;56(2):110–20.
[3] Mazanowska N, et al. Prevalence of cervical high-risk human papillomavirus
rier to full sexual pleasure and may discourage adepts of this theory infections in kidney graft recipients. Ann Transplant 2013;18:656–60.
from using condoms thereby increasing risk of Ct infection. Besides, [4] Forman D, et al. Global burden of human papillomavirus and related diseases.
although the use of condoms was high in our cohort, they are used Vaccine 2012;30(Suppl. 5):F12–23.
[5] Bruni L, et al. Cervical human papillomavirus prevalence in 5 continents: meta-
for contraception and not for the prevention of STI. In cases where analysis of 1 million women with normal cytological findings. J Infect Dis
there is no clear risk of pregnancy, most women would therefore 2010;202(12):1789–99.
prefer not to use them thereby increasing risk of infection. [6] Bellaminutti S, et al. HPV and Chlamydia trachomatis co-detection in young
asymptomatic women from high incidence area for cervical cancer. J Med Virol
Considering the impact of HPV and Ct coinfection on the devel-
2014;86(11):1920–5.
opment of cervical cancer, coupled with inexistence of systematic [7] Newman L, et al. Global estimates of the prevalence and incidence of four cur-
screening, high rates of HPV and Ct infections could be sugges- able sexually transmitted infections in 2012 based on systematic review and
tive of urgent need for action. Given that most participants were global reporting. PLoS One 2015;10(12):e0143304.
[8] Patel AL, et al. Prevalence of Chlamydia infection among women visiting a
aged below 30 (the HPV vulnerable group), the observation of gynaecology outpatient department: evaluation of an in-house PCR assay for
high cervical cancer incidence among women in Cameroon could detection of Chlamydia trachomatis. Ann Clin Microbiol Antimicrob 2010;9.
be explained by early infection with HPV and/or Ct. This in turn [9] Sturm-Ramirez K, et al. Molecular epidemiology of genital Chlamydia tra-
chomatis infection in high-risk women in Senegal, West Africa. J Clin Microbiol
results from an arsenal of different factors including, but not lim- 2000;38(1):138–45.
ited to early onset of sexual intercourse, multiple sex partners, low [10] Smith JS, et al. Evidence for Chlamydia trachomatis as a human papillomavirus
educational standards and high risk behavioral factors. There is cofactor in the etiology of invasive cervical cancer in Brazil and the Philippines.
J Infect Dis 2002;185(3):324–31.
therefore an urgent need to put in place screening programs, but [11] Madeleine MM, et al. Risk of cervical cancer associated with Chlamydia tra-
most importantly population sensitization if the current trends of chomatis antibodies by histology: HPV type and HPV cofactors. Int J Cancer
cervical cancer in Cameroon need to be reversed. These sugges- 2007;120(3):650–5.
[12] Safaeian M, et al. Chlamydia trachomatis and risk of prevalent and inci-
tions are strengthened by the fact that cervical cancer is the second dent cervical premalignancy in a population-based cohort. J Natl Cancer Inst
most diagnosed female cancer in Cameroon with an incidence rate 2010;102(23):1794–804.
of about 13.8%. Moreover, cervical cancer constitute the most pre- [13] Menon S, et al. Human and pathogen factors associated with Chlamy-
dia trachomatis-related infertility in women. Clin Microbiol Rev
dominant genital cancers (86%) [40,41] and more than half of the
2015;28(4):969–85.
cases occur among sexually active women [33]
320 P. Fogue et al. / Journal of Infection and Public Health 11 (2018) 314–320

[14] Torre LA, et al. Global cancer statistics, 2012. Ca-a Cancer J Clin [28] Vieira RC, et al. Prevalence of type-specific HPV among female university stu-
2015;65(2):87–108. dents from northern Brazil. Infect Agent Cancer 2015;10:21.
[15] Simard EP, Jemal A. Commentary Infection-related cancers in low- and [29] Dutta S, et al. Prevalence of human papillomavirus in women without cer-
middle-income countries: challenges and opportunities. Int J Epidemiol vical cancer: a population-based study in Eastern India. Int J Gynecol Pathol
2013;42(1):228–9. 2012;31(2):178–83.
[16] Healey A, et al. Protocol: a simple method for extracting next-generation [30] Sharma K, et al. Higher prevalence of human papillomavirus infection in ado-
sequencing quality genomic DNA from recalcitrant plant species. Plant Meth- lescent and young adult girls belonging to different Indian tribes with varied
ods 2014;10. socio-sexual lifestyle. PLoS One 2015;10(5):e0125693.
[17] Finan RR, et al. Detection of human papillomavirus (HPV) genotypes in cervico- [31] Akarolo-Anthony SN, et al. Age-specific prevalence of human papilloma virus
vaginal scrapes of women with normal and abnormal cytology. Clin Microbiol infection among Nigerian women. BMC Public Health 2014;14:656.
Infect 2001;7(12):688–92. [32] Domfeh A, et al. Cervical human papillomavirus infection in Accra, Ghana.
[18] de Abreu ALP, et al. Short report: molecular detection of HPV and Chlamydia Ghana Med J 2008;42(2):71–8.
trachomatis infections in Brazilian women with abnormal cervical cytology. [33] Ebrahim S, et al. High burden of human papillomavirus (HPV) infection among
Am J Trop Med Hyg 2012;87(6):1149–51. young women in KwaZulu-Natal, South Africa. PLoS One 2016;11(1):e0146603.
[20] Misganaw A, et al. Epidemiology of major non-communicable diseases in [34] Panatto D, et al. Chlamydia trachomatis prevalence and Chlamydial/HPV
Ethiopia: a systematic review. J Health Popul Nutr 2014;32(1):1–13. co-infection among HPV-unvaccinated young Italian females with normal
[21] Denny L, et al. Human papillomavirus prevalence and type distribution in inva- cytology. Hum Vaccin Immunother 2015;11(1):270–6.
sive cervical cancer in sub-Saharan Africa. Int J Cancer 2014;134(6):1389–98. [35] Forman D, et al. Global burden of human papillomavirus and related diseases.
[22] Arinze AU, Onyebuchi NV, Isreal J. Genital chlamydia trachomatis infection Vaccine 2012;30(Suppl. 5):F12–23.
among female undergraduate students of University of Port Harcourt, Nigeria. [36] Vaccarella S, et al. Worldwide trends in cervical cancer incidence:
Niger Med J 2014;55(1):9–13. impact of screening against changes in disease risk factors. Eur J Cancer
[23] Patel AL, et al. Prevalence of Chlamydia infection among women visiting a 2013;49(15):3262–73.
gynaecology outpatient department: evaluation of an in-house PCR assay for [37] Seraceni S, et al. High prevalence of hpv multiple genotypes in women with
detection of Chlamydia trachomatis. Ann Clin Microbiol Antimicrob 2010:24. persistent Chlamydia trachomatis infection. Infect Agent Cancer 2014;9:30.
[24] Nwankwo EO, Sadiq MN. Prevalence of Chlamydia trachomatis infection among [38] Ikeme AC, et al. Seroprevalence of Chlamydia trachomatis in Enugu, Nigeria.
patients attending infertility and sexually transmitted diseases clinic (STD) in Niger J Clin Pract 2011;14(2):176–80.
Kano, North Western Nigeria. Afr Health Sci 2014;14(3):672–8. [39] Sobze Sanou M, et al. Condom perception and prevention of HIV/AIDS infection
[25] Al-Thani A, et al. Prevalence of Chlamydia trachomatis infection in the general in Cameroon: appraisal of knowledge, attitudes and practices among level one
population of women in Qatar. Sex Transm Infect 2013;89(Suppl. 3):iii57–60. students of the University of Dschang. Ig Sanita Pubbl 2013;69(2):183–94.
[26] Piazzetta RC, et al. Prevalence of Chlamydia trachomatis and Neisseria gonor- [40] Engbang JP, et al. Histo-epidemiological aspects of genital cancers in women in
rhoea infections in sexual actives young women at a southern Brazilian city. the Littoral Region, Cameroon. Pan Afr Med J 2015;21:116.
Rev Bras Ginecol Obstet 2011;33(11):328–33. [41] Atashili J, et al. Age trends in the prevalence of cervical squamous intraepithelial
[27] Naidoo S, et al. High prevalence and incidence of sexually transmitted infec- lesions among HIV-positive women in Cameroon: a cross-sectional study. BMC
tions among women living in Kwazulu-Natal, South Africa. AIDS Res Ther Res Notes 2012;5:590.
2014;11:31.