Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

Contents lists available at ScienceDirect

Photodiagnosis and Photodynamic Therapy

journal homepage: www.elsevier.com/locate/pdpdt

Photodynamic therapy using zinc phthalocyanine with low dose of diode T

laser combined with doxorubicin is a synergistic combination therapy for
human SK-MEL-3 melanoma cells
Mohammad Amin Doustvandia, Fateme Mohammadnejada, Behzad Mansooria,b,e, Habib Tajallic,d,
Ali Mohammadia,e, Ahad Mokhtarzadeha,f, Elham Baghbania,b, Vahid Khazea,
⁎
Khalil Hajiasgharzadeha, Mahsa Maleki Moghaddama, Michael R. Hambling, Behzad Baradarana,
a
Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
b
Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
c
Research Institute for Applied Physics and Astronomy, University of Tabriz, Tabriz, Iran
d
Biophotonic Research Center, Islamic Azad University, Tabriz Branch, Tabriz, Iran
e
Department of Cancer and Inflammation Research, Institute of Molecular Medicine, University of Southern Denmark, Odense, Denmark
f
Department of Biotechnology, Higher Education Institute of Rab-Rashid, Tabriz, Iran
g
Wellman Center for Photomedicine, Massachusetts General Hospital, Boston, MA, USA

A R T I C LE I N FO A B S T R A C T

Keywords: Chemotherapy is a generally used anticancer strategy for melanoma and it may have improved outcomes in
PDT combination with other approaches. One such strategy is photodynamic therapy (PDT), where a photosensitizer
Diode laser (PS) generates reactive oxygen species (ROS) after illumination of target cells. Interestingly, in low doses and
Zinc phthalocyanine high doses of light sources, special cellular responses can be induced. Regarding this fact, in this study, the
Doxorubicin
combination of zinc phthalocyanine (ZnPc)-PDT and Doxorubicin (DOX) was applied at low and high dose of
Combination therapy
diode laser to treat SK-MEL-3 cells. Cytotoxic effects were determined by MTT assay for assessment synergistic
Synergism
SK-MEL-3 cell line effects were estimated by calculation of Combination Index (CI); that synergistic effects were observed in most
Melanoma groups. In low dose of laser irradiation higher synergism effects were observed. Significant changes of ROS were
not observed with combinations, but autophagy, subG1 and G2/M phase cell cycle arrest, decreased cell mi-
gration ability and apoptosis induction were significantly increased compared to either treatment alone. The
expression of caspase-8, -9, -3 and Bcl-2 genes revealed caspase-dependent apoptosis in all groups. Moreover,
ZnPc-PDT and chemo-PDT down-regulated the expression of MMP-9 and Vimentin genes that impaired cell
migration. In conclusion, it can be suggested that pre-treatment with ZnPc-PDT has high effects to sensitize SK-
MEL-3 cells to DOX, in particular with low dose of diode laser.

1. Introduction strategies of melanoma treatment are surgery, radiation therapy and

chemotherapy [2]. Chemotherapy is a commonly used anticancer ap-
Malignant Melanoma is the most common aggressive skin cancer proach and has been significantly developed to date [3]. Nevertheless,
worldwide. As reported by the American Cancer Society, about 91,270 serious side effects and drug-resistance can lead to limited therapeutic
new cases of melanoma were approximated to be detected in 2018. outcomes of chemotherapy in most kinds of cancers such as melanoma
About 9,320 Americans are estimated to die from melanoma in 2018 [4–6]. Owing to the heterogeneity and rapid proliferation of melanoma
[1]. Heavy prices are spent every year on research in order to treat cells along with the high probability of melanoma invasion and me-
melanoma or improve the quality of life in patients. The most common tastasis [5], any single treatment approach is generally not sufficient to

⁎
Corresponding author at: Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, 5166614766, Iran.
E-mail addresses: [email protected] (M.A. Doustvandi), [email protected] (F. Mohammadnejad),
[email protected] (B. Mansoori), [email protected] (H. Tajalli), [email protected] (A. Mohammadi),
[email protected] (A. Mokhtarzadeh), [email protected] (E. Baghbani), [email protected] (V. Khaze),
[email protected] (K. Hajiasgharzadeh), [email protected] (M.M. Moghaddam), [email protected] (M.R. Hamblin),
[email protected] (B. Baradaran).

https://doi.org/10.1016/j.pdpdt.2019.08.027
Received 1 June 2019; Received in revised form 1 August 2019; Accepted 23 August 2019
Available online 24 August 2019
1572-1000/ © 2019 Elsevier B.V. All rights reserved.
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

destroy the entire tumor [7]. Combination therapy using two or more The cellular uptake of ZnPc was determined by fluorescence intensity
therapeutic agents either simultaneously or sequentially has been ex- measurement by using flow cytometry (MacsQuant10 Analyser, Mil-
plored since the 1960s, in order to improve the effectiveness of cancer tenyi Biotech, Germany). After reaching almost 75% confluency of
therapy [8–10]. Combination therapy shows better therapeutic results cells, they were seeded in 6-well-plate and was kept for 24 h in the
when compared to single therapies, especially in reducing drug-re- incubator. The culture medium with different concentrations
sistance and preventing cancer recurrence. Combination therapy can (0.00002–9 μM) of ZnPc was added to each group. Subsequently, the
also decrease side effects and improve the survival rate in cancer pa- cells were further incubated for 24 h in the incubator, respectively
tients [7]. followed by washed thrice with PBS (Phosphate Buffered Saline),
The combination of chemotherapy with photodynamic therapy trypsinized and centrifuged at 1300 rpm for 8 min, and suspended with
(PDT) has received significant attention as a promising approach to PBS.
treat cancer [11–13]. PDT is an effective minimally-invasive approach
to the treatment of cancers of different types and sites as well as non- 2.3. Cytotoxicity effects of PDT with ZnPc and chemotherapy with DOX
cancerous diseases. Excellent therapeutic results and capability of the
parallel application of PDT with other treatments make it attractive For invitro treatment with PDT, firstly, the cells were seeded in 96-
[14]. PDT is based on local or systemic administration of a photoactive well plates and were kept for 24 h in the incubator. Then, the cells were
agent (photosensitizer), which is selectively accumulated in the tumor. treated with different concentrations of ZnPc (0.00002–9 μM) for
The photosensitizer molecules absorb light of the specific wavelength overnight. Next, the cells were washed thrice with PBS and added fresh
and produce reactive oxygen species (ROS) inducing a biological cas- culture medium to wells. Finally, the cells were exposed by 675-nm
cade leading to selective death of the targeted cells. In the treatment of light using a diode laser at low and high dose of laser (5 J/cm2 with
melanoma with PDT immediately suggests the question of the interac- duration of irradiation ˜ 12(s) and 20 J/cm2 with duration of irradiation
tion of light with endogenous molecules of skin (such as melanin and ˜ 50(s)) in the dark room. Similarly, to determine the DOX cytotoxicity,
hemoglobin) which absorb light. The most appropriate wavelength for the cells were treated with DOX at different concentrations
PDT is 600–800 nm, which is known as the “therapeutic window”. (0.00002–9 μM) for 24 h. For MTT assays, 24 h after laser irradiation
Melanin and hemoglobin exhibit absorption across the visible region of and DOX treatment, 50 μl (2 mg/ml) of MTT solution (methylthiazole
the spectrum, but both fall to a minimum level in the therapeutic tetrazolium, Sigma Aldrich, USA) was added to all groups and in-
window [15,16]. cubated at 37 °C for 4 h. Next, 200 μl DMSO was added to all wells and
Research over the last decades has shown that the use of two or incubated for 30 min at 37 °C.
more therapeutic approach in cancer treatment has more effective re- Optical density (OD) of all wells was assessed by an ELISA reader
sults than the single therapy approach. Notwithstanding the success of (Sunrise ELISA Plate Reader, Tecan, Salzberg, Austria).
combined chemotherapy with DOX and ZnPc-PDT (chemo-PDT,) iden-
tify the most important factors and innovative methods are yet being 2.4. PDT in combination with DOX (chemo- PDT)
researched and needed to improve the effective use of chemo-PDT in
clinical oncology. Although PDT and chemotherapy have shown high To determine probable synergetic effects of cytotoxicity of PDT and
potential for cancer therapy, both strategies have complex limitations, DOX, firstly, the cells were treated with two doses of ZnPc-PDT (IC25
such as high side effects and drug-resistance (for chemotherapy) and and IC50) and immediately afterward the cells were incubated with
difficulty in the light delivery of some internal tumors (for PDT). DOX (0.00002–9 μM) for overnight. The MTT assays were performed
Biological mechanisms and effective factors of chemo-PDT effectiveness 24 h after incubation with DOX.
are extremely intricate and not completely identified to date. In this
regard, the purpose of this work are (I) the comparative study of effects 2.5. Measurement of reactive oxygen species
of low and high dose of light source in combination ZnPc-PDT with
DOX to investigate the role of light source in chemo-PDT synergistic To assess reactive oxygen species (ROS), the cells were classified
outcomes; (II) the comparative study of cellular and molecular me- into different groups. The first group, defined as the control group,
chanisms after chemo-PDT to highlighting significant results. So, we received neither PDT nor DOX. The second group was treated with PDT
characterizing these mechanisms aimed at maximizing therapeutic without DOX, the third group, was treated only with DOX without PDT.
outcomes with minimum invasive effects by employing the advantages The final group, defined as chemo-PDT, was treated with both PDT and
of both strategies. DOX. Then, cells were treated with DCFH-DA (100 μM, Sigma Aldrich,
USA) at the incubator for 40 min. After the cells were washed thrice
2. Materials and methods with PBS, the generation of ROS was measured using a flow cytometer
(MacsQuant Analyser 10, Miltenyi Biotech, Germany).
2.1. Cell line and cell culture
2.6. Detection of autophagic cells with monodansyl cadaverine (MDC)
Human melanoma cell line (SK-MEL-3) was obtained from the staining
Pasteur Institute of Iran. The cells were cultured in Roswell Park
Memorial Institute (RPMI) 1640 medium supplemented with 10% fetal To perform all experiments in this work, cells were categorized si-
bovine serum (Gibco, USA) and 1% antibiotics (penicillin /strepto- milar to that in the ROS assays. Therefore, the MDC (Sigma Aldrich,
mycin, Gibco, USA). Subsequently, cells were incubated in the in- USA) staining was performed for the measurement of autophagic cells
cubator at 37 °C under an atmosphere of 5% CO2 and 95% humidity. after treatments. Briefly, 24 h after treatments, the cells were washed
with PBS and incubated with MDC at concentration of 50 μM for 10 min
2.2. In vitro cellular uptake of ZnPc at 37◦C. After incubation, the cells were washed thrice with PBS and
evaluation of autophagic cells was investigated using a live cells ima-
According to our previously reported article [17], DMSO was used ging system (Citation 5, Biotek, CA) and a flow cytometer (MacsQuant
to make ZnPc dissolve in the culture medium. The total concentration Analyser 10, Miltenyi Biotech, Germany).
of DMSO in the stock solution (18 μM) was reached 2% (v/v) in
RPMI1640. In this sense, ZnPc was firstly dissolved in DMSO and 2.7. Detection of acidic organelles
RPMI1640 by sonication, and then all the concentrations
(0.00002–9 μM) tried in the experiments were diluted using RPMI1640. Acidic organelles were monitored by using LysoTracker Red DND-

89
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

99 (Invitrogen, USA). For this, after described treatments, cells were ethanol and suspended in PBS containing RNase A (Carl Roth,
incubated with 50 nM Lysotracker Red DND-99 in culture medium for Karlsruhe, Germany) at 37 °C for 30 min. Next, the cells were again
35 min at 37 °C. After 35 min, the LysoTracker Red was removed and centrifuged and the PI staining solution (0.01% Triton X-100, 0.01% PI)
washed thrice with PBS. Finally, acidic organelles were observed im- was added for 10 min in the dark-room and the cell cycle distribution
mediately by using a live cells imaging system (Citation 5, Biotek, CA). was analyzed.

2.8. Detection of apoptotic cells 2.11. Wound healing assay

2.8.1. Annexin V/PI assay To investigate the migration and invasion capability of SK-MEL-3
The rate of apoptosis after desired treatments was assessed by flow cells, after carrying out the above-mentioned treatments, the cells were
cytometry (MacsQuant Analyser10, Miltenyi Biotech, Germany) using scratched by sterile yellow pipette tips across the cell monolayer to
ApoFlowEx® FITC Kit (EXBIO, Czech Republic). 24 h after treatments, form an artificial wound gap. At different times after treatment (from
the SK-MEL-3 cells were trypsinzed and centrifuged at 1300 rpm for 0 h to 24 h) the cells on the plate were photographed under the inverted
8 min. The cells were suspended in binding buffer, then added 5 μl of microscope (Optika, Italy) and the migration ability of SK-MEL-3 cells
Annexin-V- FITC and kept for 15 min at room temperature in the dark. was determined.
Afterward, the cells were again centrifuged at 1300 rpm for 8 min and
resuspended in binding buffer and were added 5 μl of PI. Finally, per-
centages of apoptotic cells were determined by using flow cytometry. 2.12. Statistical analysis

Data were presented as means ± standard deviation (SD) of at least

2.8.2. DAPI staining
three independent experiments. Significant differences were detected
The fragmentation of the nucleus was also observed by the live cells
by one-way and/or two-way ANOVA followed by Dunnett’s multiple
imaging system (Citation 5, Biotek, CA). The cells were treated as de-
comparisons test implemented by GraphPad Prism 6 statistical
scribed above, then, the cells were fixed with 4% paraformaldehyde for
(Software, La Jolla, CA, USA). A p value < 0.05 was considered sta-
20 min. After thrice washes with PBS, cells were penetrable by 0.01%
tistically significant.
Triton-X-100 for 15 min. After another thrice washes with PBS, cells
The interactions between ZnPc-PDT and DOX were evaluated with
were stained with DAPI nuclear stain solution for 10 min in the dark
the Chou-Talalay method. For, x% toxicity, the combination index (CI)
room and observed under live cells imaging system.
values were calculated based on the equation stated below:

2.9. Quantitative real-time PCR analysis CI = (D)1 / (DX)1 + (D)2 / (DX)2 + (D)1. (D)2 / (DX)1% (DX)2

Following the mentioned treatments, quantitative real-time PCR

(qRT-PCR) was performed. Total RNA was extracted with the use of the 3. Results and discussion
GeneAll RiboEx LS RNA extraction kit (GeneAll Biotech, Korea). Then,
mRNAs were reverse transcribed toward cDNA with cDNA Synthesis Kit The role of the light source used in PDT is highly complex and re-
(BioFact, Korea), using the manufacturer's protocols. qRT-PCR tests markable. So, characterizing roles of the light source in synergistic ef-
were performed by using a standard SYBR Green PCR master mix fects of combination therapy leads to design better PDT and chemo-PDT
(Ampliqon, Denmark) protocol in the Roche Light Cycler 96 system. protocols that extensively improve these efficiencies. Although the use
GAPDH was used as a reference for caspase -8, -9, -3, Bcl2, MMP-9 and of chemotherapy and PDT are clinically extended, the mechanisms
Vimentin. The relative expression levels of genes were normalized with underlying cancer cells death after chemo-PDT and effective factors are
an internal control (GAPDH) by using 2−ΔΔCt cycle threshold method. not completely characterized. In fact, one of the main areas of studies in
Sequences of primers are shown in Table 1. the cancer treatment has been reported of cellular and molecular
pathways after treatment, in relation to migration and invasion ability,
2.10. Cell cycle assay cell cycle regulation, genes expression, autophagy, apoptosis and ne-
crosis. Some of these pathways are activated by PDT, chemotherapy
The cell cycle distribution was analyzed after treatments with flow and as well as chemo-PDT [18–20]. Researches and an understanding of
cytometry (MacsQuant Analyser10, Miltenyi Biotech, Germany). The the role of effective factors in PDT, chemotherapy and chemo-PDT on
cells were washed thrice with PBS and fixed by 75% (v/v) ethanol at cellular and molecular pathways, may to result in the optimization of
4 °C for overnight. Then, fixed cells were centrifuged for removal of chemo-PDT as a cancer treatment modality.

Table 1 3.1. Invitro cellular uptake of ZnPc

Primers sequences.
Genes Primer sequences The efficacy of PDT, to a great extent, depends on cellular uptake
and intracellular accumulation of photosensitizer [21–23]. ZnPc tends
Bcl-2 Forward: 5´ CCTGTGGATGACTGAGTACC 3´
to self-aggregation in biological media and aggregation decreases the
Reverse: 5´ GAGACAGCCAGGAGAAATCA 3´
Caspase-8 Forward: 5´ GGTCTGAAGGCTGGTTGTTC 3´ photosensitizing capability and uptake of ZnPc. The aggregation of the
Reverse: 5´ AATCTCAATATTCCCAAGGTTCAAG 3´ ZnPc could be reduced in such solvents as DMF and DMSO (di-
Caspase-9 Forward: 5´ CCGGAATCCTGCTTGGGTATC 3´ methylsulfoxide) [24]. It is noteworthy mentioning that ZnPc has a
Reverse: 5´ CATCGGTGCATTTGGCATGTA 3´
strong absorption peak at 675 nm and the intensity of fluorescence has
Caspase-3 Forward: 5´ TGTCATCTCGCTCTGGTACG 3´
Reverse: 5´ AAATGACCCCTTCATCACCA 3´ a positive correlation with the uptake of ZnPc [25]. So, to enquire
Vimentin Forward: 5´ GCGCACAAATCCCTTCTACC 3´ whether ZnPc was uptaken by cells, flow cytometry was used in the try
Reverse: 5´ ATCCGTGTAGCACATTCTGTCC 3´ out. The SK-MEL-3 cells were treated with different concentration of
MMP-9 Forward: 5´ GGTTCTTCTGCGCTACTGCTG 3´ ZnPc without laser irradiation. After 24 h, the intensity of ZnPc fluor-
Reverse: 5´ GTCGTAGGGCTGCTGGAAGG 3´
escence was measured and shown in Fig. 1. We found that ZnPc was
GAPDH Forward: 5´ CCTCGTCCCGTAGACAAAA 3´
Reverse: 5´ AATCTCCACTTTGCCACTG 3´ extensively taken up with cells and it was in of concentration-depen-
dent manner.

90
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

Table 2
IC50 and IC25 values of DOX, ZnPc-PDT and chemo-PDT against SK-MEL-3
cells.
Sample IC50 values (μM) IC25 values (μM)

ZnPc (μM) DOX (μM) ZnPc (μM) DOX (μM)

DOX _ 7.764 ± 0.01 _ _

ZnPc-PDT,5 J/cm2 0.145 ± _ 0.012 ± _
0.01 0.01
ZnPc-PDT, 20 J/cm2 0.062 ± _ 0.007 ± _
0.01 0.01
Chemo-PDT, 5 J/cm2 0.012 ± 0.0005 ± _ _
0.01 0.01
Chemo-PDT, 20 J/cm2 0.007 ± 0.0018 ± _ _
0.01 0.01

Fig. 1. Invitro cellular uptake of ZnPc. The cells were incubated with 0,
3.3. Cytotoxicity and synergism effects of chemo- PDT using ZnPc and DOX
0.00002, 0.0002, 0.002, 0.02, 0.2, 2 and 9 μM of ZnPc for 24 h and fluorescence
intensity showed extensive cellular uptake of ZnPc in concentration-dependent
manner.
In this study, the IC50 and IC25 values of ZnPc-PDT have then se-
lected for the determination Combination Index (CI) studies. The CI was
calculated using the Chou-Talalay method. The estimation of CI values
3.2. Cytotoxicity effects of ZnPc-PDT and DOX alone allows a quantitative definition for antagonism (CI > 1.0); additive
effects (CI = 1.0) and synergism (CI < 1.0) [26]. Cytotoxic effects of
Based on the cellular uptake of ZnPc studies, the PDT with ZnPc and chemo-PDT were determinate by the MTT test and set as the IC50 va-
chemotherapy with DOX were evaluated. The MTT results (Fig. 2) of lues of chemo-PDT on SK-MEL-3 cells (Fig. 2C). Synergistic outcomes
cytotoxicity assessment of DOX and ZnPc-PDT after 24 h incubation, led after the combination of ZnPc-PDT in low and high dose of laser (5,
to induction of concentration-dependent cell death. 20 J/cm2) with DOX were observed in combination groups (CI < 1.0)
The IC50 and IC25 values of ZnPc in low and high dose of laser (5 (Fig. 2D). But, in the low dose of laser (5 J/cm2) higher synergism ef-
and 20 J/cm2) were 0.145 ± 0.01, 0.062 ± 0.01 and 0.012 ± 0.01, fects were observed; thus, in this dose of chemo-PDT, the synergism
0.007 ± 0.01 μM (Table 2), respectively. Also, the IC50 value of DOX effects were more promising in SK-MEL-3 cells. In fact, pre-treatment
after 24 h was 7.764 ± 0.01 μM (Table 2). In addition, the MTT results with ZnPc-PDT at low dose of laser can lead to more reduced the dose of
showed that light source without ZnPc and ZnPc without light source DOX used in chemotherapy and increased the sensitivity of SK-MEL-3
had no palpable phototoxic and cytotoxic effects on cells. The obtained cells to the very low concentrations of the DOX. Accordingly, we can
data were indicating the high phototoxic effects of ZnPc and cytotoxic reduce the serious side effects of DOX, which has a positive correlation
effects of DOX at low concentrations. with its concentration, and significantly reduced the resistance of
melanoma cells to this chemo-drug.

Fig. 2. The cytotoxic effects of ZnPc-PDT, light

source, DOX, chemo-PDT and Combination
Index: (A) Cell viability in presence of different
concentrations of ZnPc (with or without light
sources); (B) The effects of light sources
(without ZnPc) with 5 and 20 J/cm2 fluence;
(C) Cell viability in presence of different con-
centrations of DOX (without ZnPc-PDT) and
Cytotoxic effects of ZnPc-PDT (5 and 20 J/cm2)
with different concentrations of DOX (chemo-
PDT); The results are expressed as mean ± SD
(n = 3); *p < 0.02, **p < 0.0001 versus
control; (D) Combination Index of chemo-PDT
for determination of antagonism (CI > 1.0);
additive effects (CI = 1.0) and synergism
(CI < 1.0) were calculated according to
Combination Index (CI) studies [26].

91
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

Fig. 3. ROS generation after treatment with DOX, ZnPc-PDT and chemo-PDT. (A) Flow cytometry histograms. Control (a); cells were treated with DOX (0.0005 (b)
and 0.0018 (c) μM), ZnPc-PDT (5 (d) and 20 (e) J/cm2) and chemo-PDT (5 J/cm2 with 0.0005 μM of DOX (f) and 20 J/cm2 with 0.0018 μM of DOX (g)). 24 h after
treatment cells were stained with DCFH-DA and fluorescence intensity was measured by flow cytometry. (B) ROS generation represent as mean ± SD (n = 3);
**P < 0.0001 compared with control group.

No IC50 and CI values could be appointed for the combination of investigated whether DOX and ZnPc-PDT induces autophagy in SK-
DOX and IC50 s values of ZnPc-PDT due to high toxicity to the chemo- MEL-3 cells. The results of the live cells imaging system and flow cy-
PDT with ZnPc and DOX. Therefore, the IC50 s values of ZnPc-PDT have tometry instrument (Fig. 4) showed that DOX and ZnPc-PDT alone had
not been assayed in the further combination analyze with ZnPc-PDT no/ negligible palpable effects on autophagy activity. As well as, we
and DOX. investigated the effects of chemo-PDT on autophagy activity in cells.
The results showed that the autophagy was activated in chemo-PDT
3.4. Production of ROS groups after 24 h. Interestingly, in the high dose of laser nearly higher
rate of autophagy were observed; thus, in this dose of PDT, the au-
The light source of PDT must exhibit appropriate spectral char- tophagy was more significantly increased than low dose of laser. So, we
acteristics that were matched with the maximum absorption wave- can understand the intricacy role of laser doses effects on the in-
length of the ZnPc applied in order to generate sufficient ROS toward tracellular responses. The term “double-edged sword” is mentioned in
producing cytotoxic effects [27]. So, the ZnPc-PDT can obviously in- many scientific articles and describes the role of autophagy in cancer
duce production of ROS, but, the production of ROS in chemo-PDT need that is very complex and paradoxical. Due to the paradoxical role of
to be clarified. 24 h after treated of cells in dark, the production of ROS autophagy in cancer progression, the researches for determinate the
was determined by flow cytometry. The chemotherapy group with the definite role of autophagy in cancer treatment is still in beginning steps
DOX showed no production of ROS compared to the control group [31]. Accordingly, our data indicate that autophagy induced by chemo-
(Fig. 3). On the other hand, the generation of ROS after ZnPc-PDT PDT in SK-MEL-3 cells be able to serves as a pro-survival process and/or
groups was significant compared to the control group, in particular, pro-death mechanism.
high dose of the laser. Also, the Chemo-PDT groups showed no pro-
duction of ROS compared to the ZnPc-PDT groups. In fact, the combi- 3.6. Acidic organelles were significantly increased after chemo- PDT with
nation of ZnPc-PDT and DOX led to a significantly generation of ROS; ZnPc and DOX
but, there were insignificant changes between the ZnPc-PDT groups and
the chemo-PDT groups. Therefore, synergistic effects were not observed In the process of autophagy flux, the acidic state of the lysosome is a
in the generation of ROS after chemo-PDT. critical factor for activation of lysosomal enzymes [32]. In fact, de-
creased lysosomal acidity levels damage numerous vital cellular and
3.5. Chemo-PDT with ZnPc and DOX activated autophagy molecular processes including the final steps of autophagy where au-
tophagosomes fuse with lysosomes [33,34]. If chemo-PDT activated
One of the cellular and molecular pathways can be induced by PDT autophagy flux, the lysosomal acidity must be significantly increased
and chemotherapy is autophagy [28,29]. Autophagy is a self-de- after the chemo-PDT stress was imposed. So, for improved evidence of
gradative mechanism and lysosomal action for the recycling of orga- activated autophagy in chemo-PDT groups, we used Lysotracker Red
nelles and proteins in live cells. Autophagy is an essential biological DND-99 to determine the pH of lysosome qualitatively.
process and required for maintaining homeostasis and it participates in Therefore, in the present study, the red fluorescent intensity
many aspects of proliferation, development, differentiation, metabo- changes of lysosome were monitored. Upon to the data (Fig. 4D) of
lism, and aging of cells. Also, it can be activated by various conditions LysoTracker Red DND-99 staining, it is obvious that the red fluorescent
including lack of nutrients substances and oxidative stress [30]. So, we intensity of lysosome in DOX and ZnPc-PDT investigated groups, was no

92
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

Fig. 4. Activation of autophagy after chemo-PDT. (A) Flow cytometry histograms. Control (a); cells were treated with DOX (0.0005(b) and 0.0018 (c) μM), ZnPc-PDT
(5 (d) and 20 (e) J/cm2) and chemo-PDT (5 J/cm2 with 0.0005 μM of DOX (f) and 20 J/cm2 with 0.0018 μM of DOX (g)). 24 h after treatment, cells were stained with
MDC and fluorescence intensity was measured by flow cytometry. (B)The values are represented as mean ± SD (n = 3); **P < 0.001, ****P < 0.0001 compared
with control group. (C) Representative images of autophagic cells (Green) detected by live cells imaging system. (D) Lysosomal acidic environment (Red) was
detected after treatment with DOX, ZnPc-PDT and chemo-photodynamic by Lysotracker Red DND-99 staining live and cells imaging system on SK-MEL-3 cells.

significant changes in comparison to control group. Following by ex- To further confirm the apoptosis induced by ZnPc-PDT, DOX and
amining the changes of red fluorescent intensity of lysosome at chemo- chemo-PDT groups, DAPI staining was carried out. The results of DAPI
PDT groups, it was found that autophagy in combination groups by an staining confirmed again that chemo-PDT triggered high levels of cell
increase of lysosomal acidity. Finally, we can say that chemo-PDT with apoptotic response compared with the ZnPc-PDT and DOX groups.
ZnPc and DOX can induce an autophagy flux in treated cells after 24 h, Fig. 5C showed that the cells with nuclear fragmentation in DAPI
in particular high dose of the laser. staining were observed in all treatments. Compared with the ZnPc-PDT
and DOX groups, fragmentation of nuclear was significantly increased
3.7. Chemo- PDT with ZnPc and DOX increased apoptosis on SK-MEL-3 cell in chemo-PDT groups. These results showed that ZnPc-PDT and DOX
line induced apoptosis and with the combination of ZnPc-PDT and DOX, the
induction of apoptosis was increased obviously.
Recent studies have reported that the generation of ROS may play a
key role in sensitization to chemotherapy drugs in cancer cells [35]. 3.8. Caspase-8, -9, -3 and Bcl-2 genes expression
Basically, the ROS generated by PDT is able to destroy cancer cells
directly by necrosis and/or apoptosis cell death [36]. We investigated the molecular pathways responsible for the acti-
To evaluate the levels of apoptosis induced by chemo-PDT with vation of apoptosis. Apoptosis can be initiated by two classic pathways,
ZnPc and DOX, we used ApoFlowEx® FITC Kit. As shown in Fig. 5, intrinsic and extrinsic. The most generally observed pathways of
apoptotic cells in chemo-PDT groups were observed, which were sig- apoptosis involve the trigger of a cascade of caspases, basically cas-
nificantly higher in the ZnPc-PDT and DOX groups. So, we can say that pases-8, -9, and -3, that cleave a series of proteins leading to the cas-
chemo-PDT can induce significantly high levels of apoptosis and remain pase-dependent apoptosis [17]. Nevertheless, appearing document
the levels of necrosis insignificant. from an increasing number of experimental results indicates a pathway

93
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

Fig. 5. DOX, ZnPc-PDT and chemo-PDT induced apoptosis (A) apoptosis and necrosis were determined at 24 h after treatments by flow cytometry. (a) control; cells
were incubated with (DOX (0.0005 (b) and 0.0018 (c) μM), ZnPc-PDT (5 (d) and 20 (e) J/cm2) and chemo-PDT (5 J/cm2 with 0.0005 μM of DOX (f) and 20 J/cm2
with 0.0018 μM of DOX (g)). (B) Data are means ± SD of three independent experiments and **p < 0.0001 versus control. (C) Staining of apoptotic nuclei by DAPI.
(D) Caspase-8, Caspase-9, Caspase-3 and Bcl-2 genes expression in DOX, ZnPc-PDT and chemo-PDT were determined by qRT-PCR. Significant difference between
Control and a treatment was indicated by *p < 0.05, **p < 0.01, ***p = 0.0001 and ****p < 0.0001 versus control.

94
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

in which apoptosis can active independently of caspases activation population.

[37]. In this field, we have previously reported that in the lower dose of As shown in Fig. 6, flow cytometry results demonstrated that the
light source, the apoptosis pathway was probably caspase-independent control cells, primarily distributed of 0.99% in subG1, 93.70 in G0/G1,
[17]. In this study, apoptosis inducer molecular pathways after ZnPc- 2.55% in S and 2.91% in G2/M phase, were approximately viable and
PDT, DOX and chemo-PDT were investigated on the SK-MEL-3 cells. As no cell death occurred. DOX groups were not showed significant dif-
shown in Fig. 5D, following ZnPc-PDT, DOX and chemo-PDT treatment, ferences to this distribution, except for a relatively small increase in the
we observed that the expression of caspase -9, -3 were significantly subG1 and G2/M phase of the cell cycle were found in the cells. While,
increased in SK-MEL-3 cells (except a lower dose of DOX). Also, we after treatment with ZnPc-PDT, more cells were significantly appeared
examined the gene expression changes of caspase -8. We observed that in subG1(18.20% in 5 J/cm2 and 12.80% in 20 J/cm2) and G2/M
the gene expression of caspase -8 in all groups was significantly reduced (11.70% in 5 J/cm2 and 16.50% in 20 J/cm2) phase. Interestingly, we
in comparison to the control group (except a lower dose of DOX). The found that highly subG1 (41.8% in 5 J/cm2 and 33.6% in 20 J/cm2) and
qRT-PCR results demonstrated that the caspase-dependent apoptosis G2/M (31.2% in 5 J/cm2 and 40.4% in 20 J/cm2) arrest was induced
pathway was evidently activated in all groups, except lower dose of after chemo-PDT and it can stop the mitosis cell division strongly in SK-
DOX that the increase was not significant. Also, we examined the gene MEL-3 cells. Upon to the results of cell cycle distribution, we can ob-
expression changes of Bcl-2 as an anti-apoptotic gene. As expected, we serve the high effects of chemo-PDT on SK-MEL-3 cell cycle arrest.
observed that the gene expression of Bcl-2 in all investigated groups
was significantly reduced in comparison to the control group.
Therefore, we can conclude that the low dose of the light source 3.10. Chemo- PDT with ZnPc and DOX decreased cell migratory ability
maybe was not the only parameter involved in the activation of cas-
pase-independent apoptosis in SK-MEL-3 cells. According to this, we Cell migration is an acute factor in the process of tumor metastasis
can comprehend the very complex role of light source on the activation [40]. So, to further study the chemo-PDT potential, we evaluated its
of caspase-dependent and caspase-independent apoptosis pathways and results on cell migration. In this regard, we found that cells of control
so more researches are needed in this field. and DOX groups almost totally covered the wound-scratch after 24 h
(Fig. 7). It was indicative of high migratory ability of SK-MEL-3 cells.
Also, we investigated whether ZnPc-PDT has inhibition effects on in-
3.9. Cell cycle arrest after chemo- PDT with ZnPc and DOX vasion and migration ability in SK-MEL-3 cells. After treated with ZnPc-
PDT, the capacity of migration ability of the SK-MEL-3 cells was sig-
The cell cycle is the essential biological event having organized nificantly decreased in the ZnPc-PDT groups compared with the control
regulation in normal cells, which nearly generally become disturbed in group. We further determined the cell migration ability after treatment
cancer cells [38]. The arrest of the cell cycle is a critical event, and its with chemo-PDT. Outcomes of the wound-healing assay were certified
consequences are very complex. Cell cycle arrest induced by anticancer that these chemo-PDT has higher ability to suppress SK-MEL-3 cell
treatments in some cases can result to activation apoptosis [39]. Thus, migration ability.
the potential effects of ZnPc-PDT, DOX and chemo-PDT on cell cycle To create the results more convincing, we investigated genes ex-
arrest of SK-MEL-3 cells have been under focused. pression levels of MMP-9 and Vimentin which may be related to SK-
In this regard, we examined the arrest of the cell cycle after treat- MEL-3 cell migration.
ment and cell cycle distribution was determined by flow cytometry. The Our results showed (Fig. 7B), the gene expression of MMP-9 in ZnPc-
results of cell cycle analysis allowed to allocate the cells to either PDT and chemo-PDT groups was significantly reduced in comparison to
subG1(fragmented DNA, apoptosis), G0/G1, S and G2/M phase control group, which was significant at 5 J/cm2 dose of laser in chemo-

Fig. 6. Cell cycle distribution after treatment with DOX, ZnPc-PDT and chemo-PDT. (A) Cell cycle distribution was determined at 24 h after treatments by PI staining
and flow cytometry. (a) Control; Cells were incubated with (DOX (0.0005 (b) and 0.0018 (c) μM), ZnPc-PDT (5 (d) and 20 (e) J/cm2) and chemo-PDT (5 J/cm2 with
0.0005 μM of DOX (f) and 20 J/cm2 with 0.0018 μM of DOX (g)). (B)Data present three independent experiments versus control.

95
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

Fig. 7. The effects of DOX, ZnPc-PDT and chemo-PDT treatment cell migration. (A) After treatments, the cells were scratched and scratch areas were observed
(0 h–24 h) and photographed by inverted microscope. (B) The effect of DOX, ZnPc-PDT and chemo-PDT treatment on Vimentin and MMP-9 on SK-MEL-3. Data are
presented as means ± SD of three independent experiments and *p < 0.05, ****p < 0.0001 versus control.

PDT groups compared with the ZnPc-PDT. Also, the gene expression of vitro) and in mice (in vivo) for the co-delivery of DOX and ZnPc. All
Vimentin (Fig. 7B) in ZnPc-PDT and chemo-PDT groups was sig- results showed increased cell death mainly through apoptosis and these
nificantly reduced in comparison to control group, which was sig- polymeric micelles are promising nanoplatforms for the co-delivery of
nificant at 20 J/cm2 dose of laser in chemo-PDT groups compared with DOX and ZnPc for combination therapy [7]. Several studies have been
the ZnPc-PDT. published to co-delivery of DOX and ZnPc-PDT with different nano-
Metastasis of melanoma is one of the leading causes of deaths from particles and methods. While, based on our study, pre-treatment with
skin cancer and decrease rate of metastasis is the core of many research ZnPc-PDT has the high effects to more sensitize SK-MEL-3 cells to DOX,
in the treatment of the melanoma. In this regard, these results certified in particular low dose of diode laser.
that ZnPc-PDT and chemo-PDT have high ability to suppress melanoma In the present study, we found that pre-treatment with ZnPc-PDT at
cell migration. low dose of laser has shown the higher effects to sensitize melanoma
cells toward the lower concentration of DOX. In another word, our
4. Conclusion studies proved low/insignificant effects of DOX in lower concentration,
while in combinatorial ZnPc-PDT, chemo-PDT can inverse some me-
Chemotherapy has always played and still play vital roles in mela- chanisms of resistance to DOX with triggering several anticancer bio-
noma treatment. Chemo-PDT is a powerful combination therapeutic logical processes including autophagy activation, cell cycle arrest, re-
approach with two anticancer strategies (PDT and chemotherapy) that duced cell migration ability and increase apoptosis.
can decrease the rate of metastasis and initiate melanoma cells death. Moreover, we found that pre-treatment with ZnPc-PDT at high dose
In 2016, studies by Tahmasebi et al. on melanoma cell line de- of laser has shown approximately higher effects on activation of bio-
monstrated that the melanoma cells incubated with 5-Aminolevulinic logical pathways such as autophagy in melanoma cells. So, the applied
acid (5-ALA) and 5-fluorouracil(5-FU), enhanced the efficiency of 5- light sources have a predominant role in determining the CI and mo-
ALA-PDT [41]. lecular pathways of chemo-PDT that can be useful for melanoma
In 2018, Gao et al. investigated the effect of polymeric micelles treatment with non-invasive and fewer side effects.
nanoplatforms on HepG2 human hepatocellular carcinoma cells (in Many of strategies have been examined to enhance the efficacy of

96
M.A. Doustvandi, et al. Photodiagnosis and Photodynamic Therapy 28 (2019) 88–97

chemotherapy drugs, such as; autophagy activators, cell cycle and cell chemotherapy-mediated G2 checkpoint abrogation, Cancer Res. 67 (1) (2007)
migration inhibitors, apoptosis inducers agents and nanoparticles. 339–345.
[20] T. Yan, et al., pH-Sensitive mesoporous silica nanoparticles for chemo-photo-
Based on this study, PDT is a manageable and powerful anti-cancer dynamic combination therapy, Colloids Surf. B Biointerfaces 161 (2018) 442–448.
treatment that may provide a replacement for most of these combina- [21] Z. Luksiene, Hypericin as novel and promising photodynamic therapy tool: studies
torial factors. However, further investigations for the exact illumination on intracellular accumulation capacity and growth inhibition efficiency, Medicina
Kaunas (Kaunas) 39 (7) (2003) 677–682.
of chemo-PDT mechanisms in different cancers are still needed. [22] R. Ritz, et al., In vitro comparison of hypericin and 5-aminolevulinic acid-derived
protoporphyrin IX for photodynamic inactivation of medulloblastoma cells, PLoS
Funding One 7 (12) (2012) e51974.
[23] H.-L. Xu, et al., Anti-proliferative effect of Juglone from Juglans mandshurica
Maxim on human leukemia cell HL-60 by inducing apoptosis through the mi-
Michael R Hamblin was supported by USNIH grant R01AI050875. tochondria-dependent pathway, Eur. J. Pharmacol. 645 (1–3) (2010) 14–22.
[24] J. Nackiewicz, M. Kliber-Jasik, M. Skonieczna, A novel pro-apoptotic role of zinc
octacarboxyphthalocyanine in melanoma me45 cancer cell’s photodynamic therapy
References
(PDT), J. Photochem. Photobiol. B, Biol. 190 (2019) 146–153.
[25] W. Lü, et al., Synthesis and photoactivity of pH-responsive amphiphilic block
[1] American Cancer Society, Cancer Facts & Figures 2018, American Cancer Society, polymer photosensitizer bonded zinc phthalocyanine, Sci. China Chem. 55 (6)
Atlanta, 2018. (2012) 1108–1114.
[2] Z. Chen, et al., Zinc phthalocyanine conjugated with the amino-terminal fragment [26] J.C. Ashton, Drug combination studies and their synergy quantification using the
of urokinase for tumor-targeting photodynamic therapy, Acta Biomater. 10 (10) chou–Talalay method, Cancer Res. 75 (11) (2015) 2400.
(2014) 4257–4268. [27] K. Plaetzer, et al., Photophysics and photochemistry of photodynamic therapy:
[3] H. Lee, et al., Combination of chemotherapy and photodynamic therapy for cancer fundamental aspects, Lasers Med. Sci. 24 (2) (2009) 259–268.
treatment with sonoporation effects, J. Control. Release (2018). [28] E. Buytaert, et al., Deficiency in apoptotic effectors Bax and Bak reveals an au-
[4] L.N. Abdullah, E.K.-H. Chow, Mechanisms of chemoresistance in cancer stem cells, tophagic cell death pathway initiated by photodamage to the endoplasmic re-
Clin. Transl. Med. 2 (1) (2013) 3. ticulum, Autophagy 2 (3) (2006) 238–240.
[5] M. Aris, M.M. Barrio, Combining immunotherapy with oncogene-targeted therapy: [29] J.J. Reiners, et al., Assessing autophagy in the context of photodynamic therapy,
a new road for melanoma treatment, Front. Immunol. 6 (2015) 46. Autophagy 6 (1) (2010) 7–18.
[6] Y. Huang, W. Sadée, Membrane transporters and channels in chemoresistance and- [30] S. Li, et al., Autophagy activation alleviates nonylphenol-induced apoptosis in
sensitivity of tumor cells, Cancer Lett. 239 (2) (2006) 168–182. cultured cortical neurons, Neurochem. Int. 122 (2019) 73–84.
[7] D. Gao, P.-C. Lo, Polymeric micelles encapsulating pH-responsive doxorubicin [31] M. Russo, G.L. Russo, Autophagy inducers in cancer, Biochem. Pharmacol. 153
prodrug and glutathione-activated zinc (II) phthalocyanine for combined che- (2018) 51–61.
motherapy and photodynamic therapy, J. Control. Release (2018). [32] C. Settembre, et al., Signals from the lysosome: a control centre for cellular clear-
[8] U. Gatzemeier, et al., Randomized phase II trial of gemcitabine–cisplatin with or ance and energy metabolism, Nat. Rev. Mol. Cell Biol. 14 (5) (2013) 283.
without trastuzumab in HER2-positive non-small-cell lung cancer, Ann. Oncol. 15 [33] H.L. Best, et al., Characterisation of early changes in ovine CLN5 and CLN6 batten
(1) (2004) 19–27. disease neural cultures for the rapid screening of therapeutics, Neurobiol. Dis. 100
[9] C.-M.J. Hu, L. Zhang, Nanoparticle-based combination therapy toward overcoming (2017) 62–74.
drug resistance in cancer, Biochem. Pharmacol. 83 (8) (2012) 1104–1111. [34] C. Zhang, et al., Inhibition of autophagic degradation process contributes to
[10] M.C. Li, et al., Effects of combined drug therapy on metastatic cancer of the testis, Claudin-2 expression increase and epithelial tight junction dysfunction in TNF-α
Jama 174 (1291) (1960) p. 1960-1299. treated cell monolayers, Int. J. Mol. Sci. 18 (1) (2017) 157.
[11] N.P. Brodin, C. Guha, W.A. Tomé, Photodynamic therapy and its role in combined [35] C. Lange, P. Bednarski, Evaluation for synergistic effects by combinations of pho-
modality anticancer treatment, Technol. Cancer Res. Treat. 14 (4) (2015) 355–368. todynamic therapy (PDT) with temoporfin (mTHPC) and Pt (II) complexes carbo-
[12] A. Khdair, et al., Nanoparticle-mediated combination chemotherapy and photo- platin, cisplatin or oxaliplatin in a set of five human cancer cell lines, Int. J. Mol.
dynamic therapy overcomes tumor drug resistance in vitro, Eur. J. Pharm. Sci. 19 (10) (2018) 3183.
Biopharm. 71 (2) (2009) 214–222. [36] C.A. Robertson, D.H. Evans, H. Abrahamse, Photodynamic therapy (PDT): a short
[13] W. Park, et al., Advanced smart-photosensitizers for more effective cancer treat- review on cellular mechanisms and cancer research applications for PDT, J.
ment, Biomater. Sci. 6 (1) (2018) 79–90. Photochem. Photobiol. B, Biol. 96 (1) (2009) 1–8.
[14] D. Luo, et al., Chemophototherapy: an emerging treatment option for solid tumors, [37] N.B.R. Vittar, et al., Caspase-independent apoptosis, in human MCF-7c3 breast
Adv. Sci. 4 (1) (2017) 1600106. cancer cells, following photodynamic therapy, with a novel water-soluble phtha-
[15] Q. Chen, et al., Photodynamic therapy guidelines for the management of oral leu- locyanine, Int. J. Biochem. Cell Biol. 42 (7) (2010) 1123–1131.
coplakia, Int. J. Oral Sci. 11 (2) (2019) 14. [38] G.I. Evan, K.H. Vousden, Proliferation, cell cycle and apoptosis in cancer, Nature
[16] M. Wainwright, H. Smalley, C. Flint, The use of photosensitisers in acne treatment, 411 (6835) (2001) 342.
J. Photochem. Photobiol. B, Biol. 105 (1) (2011) 1. [39] M. Devès, F. Bourrat, Transcriptional mechanisms of developmental cell cycle ar-
[17] M.A. Doustvandi, et al., The interaction between the light source dose and caspase- rest: problems and models, Seminars in Cell & Developmental Biology, Elsevier,
dependent and-independent apoptosis in human SK-MEL-3 skin cancer cells fol- 2012.
lowing photodynamic therapy with zinc phthalocyanine: a comparative study, J. [40] S. Yang, et al., Hinokiflavone induces apoptosis in melanoma cells through the ROS-
Photochem. Photobiol. B, Biol. 176 (2017) 62–68. mitochondrial apoptotic pathway and impairs cell migration and invasion, Biomed.
[18] E. Buytaert, M. Dewaele, P. Agostinis, Molecular effectors of multiple cell death Pharmacother. 103 (2018) 101–110.
pathways initiated by photodynamic therapy, Biochimica et Biophysica Acta (BBA)- [41] H. Tahmasebi, et al., Enhancing the efficiency of 5-aminolevulinic acid-mediated
Reviews on Cancer 1776 (1) (2007) 86–107. photodynamic therapy using 5-fluorouracil on human melanoma cells,
[19] C. Vogel, C. Hager, H. Bastians, Mechanisms of mitotic cell death induced by Photodiagnosis Photodyn. Ther. 13 (2016) 297–302.

97