Scribd Logo
Upload

Welcome to Scribd!

  • 80 views

    Worksheet 8.1 - BiotechnologyandGMO (AutoRecovered)

    Uploaded by

    Jevan Monte Racaza
    The document contains a student's activity report that includes: 1. Research terms related to genetics and diseases. 2. Using BLAST, the student identified a given nucleotide sequence codes for the insulin protein. Mutations to this gene can cause diabetes. 3. If able to do gene modification, the student would strengthen the umami receptor gene in pandas to help the endangered species survive without full human care and support natural dietary adaptations.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd

    Worksheet 8.1 - BiotechnologyandGMO (AutoRecovered)

    Uploaded by

    Jevan Monte Racaza
    80 views3 pages
    The document contains a student's activity report that includes: 1. Research terms related to genetics and diseases. 2. Using BLAST, the student identified a given nucleotide sequence codes for the insulin protein. Mutations to this gene can cause diabetes. 3. If able to do gene modification, the student would strengthen the umami receptor gene in pandas to help the endangered species survive without full human care and support natural dietary adaptations.

    Original Description:

    j,.jmn ,lh

    Original Title

    Worksheet 8.1_BiotechnologyandGMO (AutoRecovered)

    Copyright

    © © All Rights Reserved

    Available Formats

    DOCX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    The document contains a student's activity report that includes: 1. Research terms related to genetics and diseases. 2. Using BLAST, the student identified a given nucleotide sequence codes for the insulin protein. Mutations to this gene can cause diabetes. 3. If able to do gene modification, the student would strengthen the umami receptor gene in pandas to help the endangered species survive without full human care and support natural dietary adaptations.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    80 views3 pages

    Worksheet 8.1 - BiotechnologyandGMO (AutoRecovered)

    Uploaded by

    Jevan Monte Racaza
    The document contains a student's activity report that includes: 1. Research terms related to genetics and diseases. 2. Using BLAST, the student identified a given nucleotide sequence codes for the insulin protein. Mutations to this gene can cause diabetes. 3. If able to do gene modification, the student would strengthen the umami receptor gene in pandas to help the endangered species survive without full human care and support natural dietary adaptations.

    Copyright:

    © All Rights Reserved
    Download as DOCX, PDF, TXT or read online from Scribd
    Download as docx, pdf, or txt
    of 3

    Name : Angelo Racaza_________________________________________ Date: 05-24-

    2021_________

    Year and Section: 1st Year STS-D1___________Group No. _________ Score:

    Professor/Instructor: Clyde Salanatin_______________________

    ACTIVITY 21

    A. Research on the following terms:

    1. Chargaff’s rule
    2. Restriction Enzyme
    3. Sexual incompatibility barrier
    4. Gene pole
    5. Osteoarthritis
    6. Aortic aneurysm
    7. Duchenne muscular dystrophy
    8. Huntington disease
    9. Fragile X-syndrome
    10.Breast cancer disposition gene BRCA 1 and BRCA 2
    11.p53 gene
    12.amalgamation
    13.mitigation
    14.DNA barcodes
    15.transcriptomics

    B. Identification of unknown gene

    The researcher had isolated the human gene with the following nitrogenous base
    sequence:

    AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGT
    GGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCG

    Using the Basic Local Alignment Search Tool (BLAST), determine the protein that
    is coded by the nucleotide sequence.

    Direction:

    1. Open the website of BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi), and click the


    “Nucleotide Blast” (pointed by the arrow).
    2. Click the “blastn” (upper left arrow).
    3. Enter the given nucleotide sequence in the box (pointed by the left arrow).
    4. Scroll down and click "BLAST". Wait for a few seconds or minutes while the
    software is analyzing your entry.
    Answer the following:

    a. Request ID (RID): ATF1A5T9016


    b. Query ID: lcl|Query_40513
    c. Molecule Type: dna
    d. Query Length: 140
    e. Description: None
    f. Program: BLASTN
    g. Name of the protein coded by the sequence- Insulin
    h. List at least five organisms that possess that gene. Rhesus Monkey, Silvery
    Gibbon, Western Gorilla, Sumatran Orangutan and Mandrill
    i. What is the function of the protein? Insulin regulates the amount of nutrients
    circulating in your bloodstream. Although insulin is mostly implicated in blood
    sugar management, it also affects fat and protein metabolism.
    j. What happened to the person when a gene that codes for that protein mutates?
    The possibility of insulin gene mutations, which reduce insulin biosynthesis and
    therefore do not show hyperinsulinemia, has been speculated. The person with
    this kind of gene mutation suffers from biologically inactive or structurally
    abnormal insulin or its precursor, proinsulin, thought to be one of the possible
    causes of diabetes mellitus.
    k. How that person’s disorder could be treated? This disorder can be treated
    through monitoring their blood glucose levels, dietary management, maintaining
    physical activity, keeping weight and stress under control, monitoring oral
    medications and, if required, insulin use via injections or pump.

    C. If you know how to do recombinant DNA technology, what organism you want to
    modify, and why? You can use extra sheets to answer.
    If I am a scientific expert in this field, I would probably modify panda bears
    simply because they are too much domesticated to the point their natural sense for
    survival is absent since birth fully relying for humans’ care to survive. Their diet is
    primarily composed of only bamboo and are terrible parents making their specie
    prone to extinction if not because of our help and our decision to keep them around
    as they were too cute to be extinct. I would strengthen their gene called T1R1, which
    is the one that lets the tongue detect umami. This could indicate a lack of inbreeding
    and a high level of genetic diversity in the panda population, which would help in
    the survival of the species, despite the small size of the panda population. In this
    way, I believe that I can open the

    You might also like