Research Article

Neuroprotective Effect of Optimized Yinxieling Formula in

6-OHDA-Induced Chronic Model of Parkinson’s Disease
through the Inflammation Pathway

Renrong Wei ,1 Cuiping Rong ,1 Qingfeng Xie ,1,2 Shouhai Wu,1,2 Yuchao Feng,1,2
Ruihua Wang,1,2 Zhenhui Dai,1 and Tongxiang Lin 1,2,3
1
Guangzhou University of Chinese Medicine, Second Clinical Medical College, 232 Waihuan Road East, Guangzhou,
Guangdong 510006, China
2
Guangdong Provincial Academy of Chinese Medical Sciences & Guangdong Provincial Hospital of Chinese Medicine,
Center for Regenerative and Translational Medicine, 111 Dade Road, Guangzhou, Guangdong 510120, China
3
Fujian Agriculture and Forestry University, College of Animal Sciences, 15 Shangxiadian Road., Fuzhou, Fujian 350002, China

Correspondence should be addressed to Tongxiang Lin; [email protected]

Received 21 August 2019; Revised 24 October 2019; Accepted 21 November 2019

Academic Editor: Filippo Fratini

Copyright © 2019 Renrong Wei et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Parkinson’s disease (PD) is characterized by progressive degeneration of dopaminergic neurons in the substantia nigra (SN)-
striatum circuit, which is associated with glial activation and consequent chronic neuroinflammation. Optimized Yinxieling
Formula (OYF) is a Chinese medicine that exerts therapeutical effect and antiinflammation property on psoriasis. Our previous
study has proven that pretreatment with OYF could regulate glia-mediated inflammation in an acute mouse model of PD induced
by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine. Given that PD is a chronic degeneration disorder, this study applied another
PD animal model induced by striatal injection of 6-hydroxydopamine (6-OHDA) to mimic the progressive damage of the SN-
striatum dopamine system in rats. The OYF was administrated in the manner of pretreatment plus treatment. The effects of the
OYF on motor behaviors were assessed with the apomorphine-induced rotation test and adjusting steps test. To confirm the effect
of OYF on dopaminergic neurons and glia activation in this model, we analyzed the expression of tyrosine hydroxylase (TH) and
glia markers, ionized calcium-binding adapter molecule 1 (Iba-1), and glial fibrillary acidic protein (GFAP) in the SN region of the
rat PD model. Inflammation-associated factors, including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-6, in-
ducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2), were further evaluated in this model and in interferon-c-
(INF-c-) induced murine macrophages RAW264.7 cells. The results from the in vivo study showed that OYF reversed the motor
behavioral dysfunction in 6-OHDA-induced PD rats, upregulated the TH expression, decreased the immunoreactivity of Iba-1
and GFAP, and downregulated the mRNA levels of TNF-α and COX-2. The OYF also trended to decrease the mRNA levels of IL-
1β and iNOS in vivo. The results from the in vitro study showed that OYF significantly decreased the mRNA levels of TNF-α, IL-
1β, IL-6, iNOS, and COX-2. Therefore, this study suggests that OYF exerts antiinflammatory effects, which might be related to the
protection of dopaminergic neurons in 6-OHDA-induced chronic neurotoxicity.

1. Introduction function [1, 2]. In addition to dopaminergic neurons loss, other

pathological features have been identified in PD patients, in-
Parkinson’s disease (PD) is a common neurodegenerative cluding glial reaction and inflammation [3]. A recent meta-
disorder and is characterized by dopaminergic neurons analysis has demonstrated that PD is accompanied by higher
damage in the substantia nigra (SN) and dopamine (DA) peripheral cytokine levels, such as interleukin-6 (IL-6), IL-1β,
deficiency in the striatum (receive SN dopaminergic nerve tumor necrosis factor (TNF), and C-reactive protein [4]. In the
terminals projection), which could result in abnormal motor brain, many inflammatory molecules were also found to be
2 Evidence-Based Complementary and Alternative Medicine

involved in PD, including IL-1β, inducible nitric oxide synthase GFAP antibody were obtained from Abcam (Cambridge, UK).
(iNOS), and cyclooxygenase-2 (COX-2) [5]. The expression of Immunohistochemical kit (containing hydrogen peroxide,
iNOS could lead to the production and release of nitric oxide blocking solution, horseradish peroxidase- (HRP-) conjugated
(NO), which may mediate neurotoxicity and be harmful to secondary antibody, and 3,3-diaminobenzidine (DAB)) was
dopaminergic neurons [6, 7]. These proinflammatory cytokines purchased from UNIV (Shanghai, China). SYBR Green
or neurotoxic substances could be induced by activation of Supermix was obtained from Bio-Rad (USA).
astrocytes and microglia [8, 9]. Since inflammatory response
and glial cells activation are associated with PD process,
2.2. OYF and Preparation of OYF Containing Serum
antiinflammatory therapy might be a promising therapeutic
(OYFCS). The OYF is composed of seven Chinese herbs at a
intervention for PD [9].
specific ratio (Table 1). OYF used for animal experiments was
Optimized Yinxieling Formula (OYF) is a Chinese medicine
prepared by the Guangdong Provincial Hospital of Chinese
compound modified from the Yinxieling formula, which has
Medicine.
been proven to have therapeutical effect and antiinflammation
To prepare OYFCS for the in vitro experiment, adult
property on psoriasis [10]. The OYF consists of Curcuma
male Sprague Dawley rats (250 ± 20 g) were used. The ani-
zedoaria, Sarcandra glabra, dark plum fruit, Rhizoma Smilacis
mals were bought from the Beijing Vital River Laboratory
Glabrae, Lithospermum erythrorhizon, Paeonia lactiflora, and
Animal Technology Co., Ltd. (Beijing, China). All animal
Glycyrrhiza uralensis [11]. It has been reported that OYF (also
experiments were approved and carried out in accordance
called PSORI-CM01) could improve psoriasis [12, 13]. The
with the Institutional Animal Care Guidance of Guangzhou
underlying mechanisms might be through downregulating the
University of Chinese Medicine (approval number:
keratinocyte cyclin B2 or nuclear factor-kappa B (NF-κB), thus
2018004). The rats were orally administrated with OYF
inhibiting cell proliferation or the release of the inflammatory
(6.45 g/kg) or saline for 3 days. The blood samples were
cytokine and chemokine in the keratinocyte [13, 14]. Taken
collected from the abdominal aorta of rats under anesthesia
together, these studies suggest that OYF may have antiin-
and centrifuged at 3000 r/min for 15 minutes. The serums
flammation property. Given that neuroinflammation plays a
were separated and incubated at 56°C for 30 minutes.
crucial role in PD pathology [5], we previously applied the 1-
0.22 μm filters were applied to prepare the serum. The final
methyl-4-phenyl-1,2,3,6-tetrahydropyridine- (MPTP-) induced
OYFCS or control serums were stored at − 20°C until use.
mice model to study the effect of OYF in the PD model and
found that OYF attenuated SN dopaminergic neuron damage
and exhibited antiinflammatory effects [15]. Though the MPTP- 2.3. 6-OHDA-Induced PD Rat Model and OYF
induced model is widely used to mimic the PD hallmarks, such Administration. Male Sprague Dawley rats (250 ± 10 g) were
as tyrosine hydroxylase (TH, a key enzyme in the DA bio- purchased from the Beijing Vital River Laboratory Animal
synthesis) immunoreactive neuron loss, this process is acute and Technology Co., Ltd. (Beijing, China) and housed in cages
may be insufficient for permanent impairment of the SN- under constant temperature (20–22°C) and a 12/12 h light-
striatum pathway [16]. Since the SN-striatum DA pathway dark cycle. Chow and water were available freely. After
dysfunction is associated with PD pathology, in this study, we acclimating to the environment for 7 days, the APO-induced
further applied striatal injection of the 6-hydroxydopamine- (6- rotation test (the method is described in Section 2.4) was
OHDA-) induced rat model of PD, in which the loss of the SN- conducted before operation [20], and only rats without
striatum DA pathway is progressive to evaluate the effects of rotation were used for stereotaxic injection.
OYF on motor behavioral alterations in PD. In addition, the All rats were randomly divided into three groups (n � 12 per
underlying mechanisms based on neuroinflammation were group): sham group (vehicle injection and intragastric admin-
investigated through in vivo and in vitro experiments. istration with distilled water), 6-OHDA group (6-OHDA in-
Interferon-c- (IFN-c-) induced murine macrophage jection and intragastric administration with distilled water), and
RAW264.7 is a widely used inflammatory model. RAW264.7 6-OHDA + OYF group (6-OHDA injection and intragastric
cell line was used to investigate inflammatory-related administration with 12.9 g/kg OYF). All oral treatments began 1
mechanisms by other researches [17, 18], including the PD week before surgery and continued for another 8 weeks after
associated study [19]. In our study, we hypothesized that the surgery. All rats received treatment once a day.
inflammatory mechanism might be involved in the effects of The stereotaxic injections began 2 h after the seventh
OYF. Thus, IFN-c-induced RAW264.7 was used as an in- dose of OYF oral pretreatment. The rats were anaesthetized
flammatory model in vitro. with 3% pentobarbital sodium (50 mg/kg, i.p) and placed in
a stereotaxic apparatus (RWD Life Science Co., Ltd.,
2. Materials and Methods Shenzhen, China). 6-OHDA (5 g/L, dissolved in normal
saline with 0.02% of ascorbic acid) was injected unilaterally
2.1. Reagents. 6-OHDA, apomorphine (APO), and ascorbic into two sites of the right striatum (coordinates from the
acid were purchased from Sigma Aldrich (St. Louis, MO, USA). bregma: site 1: anteroposterior: 0.0 mm, mediolateral:
INF-c was bought from Sino Biological Inc. (Beijing, China). − 3.2 mm, and dorsoventral: − 7.0 mm; site 2: anteroposterior:
Fetal bovine serum (FBS) and Roswell Park Memorial Institute − 1.2 mm, mediolateral: − 4.0 mm, and dorsoventral:
(RPMI) 1640 medium were obtained from HyClone (Logan, − 7.0 mm) with a microsyringe at a rate of 1 μL/min. Each site
UT, USA) and Invitrogen (Carlsbad, CA, USA), respectively. was injected with 2 μL 6-OHDA. After injection, the
Rabbit anti-TH antibody, rabbit anti-Iba1 antibody, and anti- microsyringe was kept in the place for 10 min and slowly
Evidence-Based Complementary and Alternative Medicine 3

Table 1: OYF components. streptomycin in an atmosphere under the condition of 37°C

Components Ratio
and 5% CO2. RAW264.7 cells were cultured with different
doses of OYFCS (2.5, 5, and 10%) or vehicle for 2 h, followed
Curcuma zedoaria 3
Glycyrrhiza uralensis 2
by IFN-c (50 U/mL) for 24 h [23]. The control group cells
Dark plum fruit 5 were exposed to the vehicle alone. Then, the cells were
Lithospermum erythrorhizon 2 collected for real-time PCR experiment.
Paeonia lactiflora 3
Sarcandra glabra 5
Rhizoma Smilacis Glabrae 5 2.7. Immunohistochemistry. The brain tissues were dehy-
drated, embedded with paraffin, and cut into 5 μm-thick
coronal sections with a microtome (Leica, Germany). The
retracted. The sham group rats were injected with the vehicle sections were dewaxed, hydrated, and then heated with the
(normal saline with 0.02% of ascorbic acid). citric acid buffer (pH 6.0) for antigen retrieval. 3% hydrogen
peroxide was utilized to inactivate endogenous peroxidase
for 15 min. The sections were washed thrice in the phosphate
2.4. Behavioral Tests buffered saline (PBS) and incubated with a blocking solution
for 5 min at room temperature. Primary antibodies (TH 1 :
2.4.1. APO-Induced Rotation Test. APO-induced rotation
1000, Iba-1 1 : 2000, and GFAP 1 : 1000) were added onto the
test was performed according to the protocol described by
sections and incubated for 20 minutes at 37°C. The sections
Ungersteadt [21] with minor modifications. The APO-in-
were then washed with the PBS solution three times (5 min
duced rotation test was conducted before stereotaxic in-
each time) and incubated with a primary antibody enhancer
jection [20] to exclude other potential factors which might
for 10 min, followed by another three washes with PBS.
influence the results. After 6-OHDA injection, the APO-
HRP-conjugated secondary antibodies were added for a 10-
induced rotation test was performed to evaluate the effects of
minute reaction at room temperature. The sections were
treatments on week 2, 4, 6, and 8, respectively. APO was
washed with PBS three times before combined with DAB for
dissolved in normal saline containing 0.02% of ascorbic acid.
5 min. Finally, the sections were washed with water and
The rats were subcutaneously injected with 0.5 mg/kg APO
dehydrated by gradient ethanol. Images were captured by
[22] and allowed to habituate for 5 min. The number of
using an Olympus BX61 microscope. Four sections of the
contralateral rotation was recorded during a 30-min test
midbrain were chosen randomly, with a total of 12 sections
session.
per rat. The number of positive-staining cells (for TH and
Iba-1) or the positive staining area (for GFAP) in the SN
2.4.2. Adjusting Steps Test. Adjusting steps test was per- region was analyzed by using the ImageJ software. For TH,
formed to assess the motor function of the forelimbs on the ratio of TH-positive cells in the ipsilateral to in the
week 8 after the 6-OHDA lesion. Before the test, the rats contralateral SN was calculated [22] and then was nor-
were handled by the experimenter several times to accustom malized to that of the sham group. For GFAP, the percentage
for 2 days. During the test, the hind limbs, hind part, and one of positive-staining area to the image area was calculated.
forelimb of the rat were held by the experimenter above the
surface, while another forelimb was allowed to touch the
surface. The rat was moved forehand or backhand slowly (5 s 2.8. Total RNA Extraction and Real-Time PCR. Total RNA
for 0.9 m), which resulted in adjusting stepping. The number was extracted from the ipsilateral SN of the midbrain tissue
of the steps was recorded for both forelimbs. For each or from RAW264.7 cells with the TRIZOL reagent (Invi-
forelimb, the test was repeated twice each day and lasted for trogen, USA) according to the manufacturer’s instructions.
3 days consecutively. The average number of steps in the GoScript Reverse Transcription System (Promega, USA) was
forehand and backhand directions was calculated, used for cDNA synthesis. From this reaction, 5 μl was used as
respectively. a template for further real-time PCR reaction with iTaq
Universal SYBR Green Supermix (Bio-Rad, USA) according
to the manufacturer’s instruction. All primers used in real-
2.5. Brain Tissue Preparation. After behavioral tests, the rats time PCR reactions are listed in Tables 2 and 3. The real-time
were anaesthetized with 3% pentobarbital sodium (50 mg/ PCR reactions were performed with the real-time PCR
kg, i.p) and perfused transcardially with chilled normal system (Bio-Rad, CFX96, USA). A triplicate analysis was
saline. The brains were isolated rapidly and stored at − 80°C employed for each sample. The real-time PCR system was
until real-time PCR experiment was performed. For the used to analyze the results (β-actin was used as the internal
immunohistochemistry experiment, the rats were perfused control).
with 4% paraformaldehyde (PFA) after normal saline per-
fusion. The brains were isolated and fixed in 4% PFA.
2.9. Statistical Analysis. The SPSS 21 software was used for
the statistical analysis. All values are presented as the
2.6. Cell Culture and Treatment. Murine macrophages mean ± standard deviation (SD). Differences were analyzed
RAW264.7 cells were cultured in RPMI 1640 medium using one-way analysis of variance (ANOVA), followed by
supplemented with 10% FBS and 100 U/ml penicillin- least significant difference (LSD) test or Games–Howell test
4 Evidence-Based Complementary and Alternative Medicine

Table 2: Primers applied in the real-time PCR for in vivo 800

experiment.
Genes Primers (5′–3′)

Contralateral rotations
600
Forward CCTTCCAGTACAAGCACGGT

(during 30 min)
TH
Reverse TGGGTAGCATAGAGGCCCTT
∗
Forward CTCAGCCATGCAGCAAATCC 400
COX-2 ∗∗
Reverse GGGTGGGCTTCAGCAGTAAT ∗∗
Forward TAGTCAACTACAAGCCCCACG
iNOS 200
Reverse AGTCACATGCAGCTTGTCCA
Forward ACCCACACCGTCAGCCGAT
TNF-α
Reverse CAGAGCAATGACTCCAAAGTAGACC
0
Forward AGAGCATCCAGCTTCAAATCTCAC 2 4 6 8
IL-1β
Reverse AGGTGCTTGGGTCCTCATCCT Week
Forward AGCCACTGCCTTCCCTACTTC
IL-6 Sham
Reverse CTGTTGTGGGTGGTATCCTCTGT
6-OHDA
Forward AGATCAAGATCATTGCTCCTCCT 6-OHDA + OYF
β-Actin
Reverse ACGCAGCTCAGTAACAGTCC
Figure 1: Effect of OYF on APO-induced rotational behavior in 6-
OHDA-induced PD rats. The number of contralateral rotations was
Table 3: Primers applied in the real-time PCR for in vitro counted on week 2, 4, 6, and 8 after 6-OHDA injection into the
experiment. right striatum. Values are expressed as mean ± SD. n � 12 per
group. ∗ P < 0.05 and ∗∗ P < 0.01 vs. the 6-OHDA group.
Genes Primers (5′–3′)
Forward GTCTCAGAGCAGGATACCAAGC 3.2. Effect of OYF on Motor Function of Forelimbs in 6-
TH
Reverse CTCTCCTCGAATACCACAGCC OHDA-Induced PD Rats. On week 8 after 6-OHDA lesion
Forward TTCAACACACTCTATCACTGGC into the right striatum, the 6-OHDA group showed a sig-
COX-2
Reverse AGAAGCGTTTGCGGTACTCAT nificant reduction in adjusting steps with the contralateral
Forward GTTCTCAGCCCAACAATACAAGA forelimb in forehand direction (P < 0.01) and backhand
iNOS direction (P < 0.01) compared with the sham group (Fig-
Reverse GTGGACGGGTCGATGTCAC
Forward CCCTCACACTCAGATCATCTTCT ure 2). OYF treatment significantly increased the number of
TNF-α adjusting steps with the contralateral forelimb when com-
Reverse GCTACGACGTGGGCTACAG
Forward GCAACTGTTCCTGAACTCAACT pared to the 6-OHDA group (Figure 2, (P < 0.01)). In con-
IL-1β tract, no significant difference between groups was observed
Reverse ATCTTTTGGGGTCCGTCAACT
Forward TAGTCCTTCCTACCCCAATTTCC with the ipsilateral forelimb in both directions (Figure 2).
IL-6
Reverse TTGGTCCTTAGCCACTCCTTC
Forward GGCTGTATTCCCCTCCATCG
β-Actin 3.3. Effect of OYF on DA Neurons in 6-OHDA-Induced PD
Reverse CCAGTTGGTAACAATGCCATGT
Rats. Given that the striatum receives DA neuron input
from the SN region and that TH is a marker of DA neuron,
we detected TH protein and mRNA levels in SN with im-
as post hoc testing. A P value of less than 0.05 was con-
munohistochemical staining and real-time PCR. As shown
sidered statistically significant.
in Figures 3(a) and 3(b), the ratio of TH-positive cells in the
SN (ipsilateral to contralateral) was significantly decreased
3. Results in the 6-OHDA group (50.4 ± 7.7%) compared to the sham
group (P < 0.01). OYF administration increased the ratio by
3.1. Effect of OYF on APO-Induced Rotation in 6-OHDA- about 21% compared to the 6-OHDA group (P < 0.01).
Induced PD Rats. Before stereotaxic injection, none of the Similar to the results of immunohistochemical staining, the
rats showed lateral rotation in the APO-induced rotation TH mRNA level in the 6-OHDA group was downregulated
test. Thus, none of the rats was excluded. After 6-OHDA to about 44% compared to the sham group (Figure 3(c),
injection into the striatum, the hypersensitivity of the P < 0.01). OYF significantly upregulated the TH mRNA level
lesioned striatum was assessed by APO-induced rotation compared to the 6-OHDA group (Figure 3(c), P < 0.01).
on week 2, 4, 6, and 8. As shown in Figure 1, no rotation
was observed in the sham group rats and the total con-
tralateral rotations in the 6-OHDA group were increased. 3.4. Effects of OYF on Glial Cell Activation in 6-OHDA-In-
The number of contralateral rotations in the OYF treat- duced PD Rats. Ionized calcium-binding adapter molecule 1
ment group was significantly reduced on week 2 (P < 0.01), (Iba-1) and glial fibrillary acidic protein (GFAP) are the
week 4 (P < 0.05), and week 8 (P < 0.01) as compared to the markers of microglia and astrocytes, respectively. The
6-OHDA group. OYF also attenuated the contralateral number of Iba-1-positive cells in the ipsilateral SN of 6-
rotations on week 6 although without significant OHDA group was significantly higher than that of the sham
difference. group (Figure 4(b), P < 0.01), especially in the SN reticulate
Evidence-Based Complementary and Alternative Medicine 5

20

15

Adjusting steps
∗∗
∗∗
10 ##

##
5

0
Contra Ipsi Contra Ipsi
Forehand Backhand
Sham
6-OHDA
6-OHDA + OYF
Figure 2: Effect of OYF on motor function of the forelimbs in 6-OHDA-induced PD rats. The number of adjusting steps with the contralateral
(contra) and ipsilateral (ipsi) forelimbs in the forehand direction and the backhand direction on week 8 after 6-OHDA injection into the right
striatum. Values are expressed as mean ± SD. n � 12 per group. ## P < 0.01 vs. the sham group, and ∗∗ P < 0.01 vs. the 6-OHDA group.

Sham 6-OHDA 6-OHDA + OYF

SNc

Contra

SNr

Ipsi

(a)
150 1.5
Ratio of TH+ neurons

Relative TH mRNA
(%, ipsi/contra)

100 1.0
∗∗
expression

∗∗
## ##
50 0.5

0 0.0
Sham 6-OHDA 6-OHDA + OYF Sham 6-OHDA 6-OHDA + OYF
(b) (c)

Figure 3: Effect of OYF on TH expression in the SN of 6-OHDA-induced PD rats. (a) Representative images of TH-positive cells in the
ipsilateral SN, scale bars � 200 μm. (b) The ratio of TH-positive cells in the ipsilateral (ipsi) to in the contralateral (contra) SN. (c) Relative
TH mRNA expression in the ipsilateral SN measured by real-time PCR. Values are expressed as mean ± SD. n � 6 per group. ## P < 0.01 vs.
the sham group, and ∗∗ P < 0.01 vs. the 6-OHDA group. SNc, SN compacta; SNr, SN reticulate.
6 Evidence-Based Complementary and Alternative Medicine

Sham 6-OHDA 6-OHDA + OYF

Iba-1 SNr SNr SNr

SNc SNc SNc

GFAP

SNr SNr SNr

(a)
80 60
##
##
The percentage of GFAP+
Number of Iba-1+ cells

60
staining area (%)

40
∗∗
40 ∗∗

20
20

0 0
Sham 6-OHDA 6-OHDA + OYF Sham 6-OHDA 6-OHDA + OYF
(b) (c)

Figure 4: Effects of OYF on Iba-1 and GFAP expressions in the SN of 6-OHDA-induced PD rats. (a) Representative images of Iba-1 and
GFAP-positive cells in the ipsilateral SN, scale bars � 20 μm (Iba-1) and 50 μm (GFAP). (b) The number of Iba-1-positive cells in the
ipsilateral SN. (c) The percentage of GFAP-positive staining area in the ipsilateral SN. Values are expressed as mean ± SD. n � 6 per group. ## P < 0.01
vs. the sham group, and ∗∗ P < 0.01 vs. the 6-OHDA group. SNc, SN compacta; SNr, SN reticulate.

subarea (Figure 4(a)). OYF decreased Iba-1-positive cells trend compared to the 6-OHDA group. For the IL-6 mRNA
compared to the 6-OHDA group (Figure 4(b), P < 0.01). level, no significant difference was observed among groups
Similar to the Iba-1, a significantly higher number of GFAP- (Figure 5(c)).
positive cells was detected in the ipsilateral SN of the 6- In the in vitro experiment, IFN-c significantly increased
OHDA group compared with the sham group (Figures 4(a) the TNF-α, IL-1β, and IL-6 mRNA levels in RAW264.7 cells
and 4(c), P < 0.01). Conversely, OYF treatment led to a (Figures 5(d)–5(f ), all P < 0.01). OYFCS at the dose of 10%
reduction in GFAP-positive cells as compared to the 6- significantly downregulated the TNF-α, IL-1β, and IL-6
OHDA group (Figure 4(c), P < 0.01). mRNA levels (Figures 5(d)–5(f ); P < 0.05, P < 0.01, and
P < 0.01, respectively).

3.5. Effect of OYF on TNF-α, IL-1β, and IL-6 Expressions in 6-

OHDA-Induced PD Rats and in IFN-c-Induced RAW264.7 3.6. Effects of OYF on iNOS and COX-2 Expressions in 6-
Cells. In the in vivo experiment, the mRNA levels of TNF-α OHDA-Induced PD Rats and in IFN-c-Induced RAW264.7
and IL-1β in the lesioned SN of the 6-OHDA group were Cells. In the in vivo experiment, the mRNA levels of iNOS
significantly upregulated when compared to the sham group and COX-2 in the lesioned SN of the 6-OHDA group were
(Figures 5(a) and 5(b), both P < 0.01). OYF significantly significantly elevated compared to the sham group
attenuated the TNF-α mRNA level compared with the 6- (Figures 6(a) and 6(b), both P < 0.01). Though the difference
OHDA group (Figure 5(a), P < 0.05), without a significant between the OYF group and the 6-OHDA group was not
decrease in the IL-1β mRNA level (Figure 5(b), P > 0.05). significant, iNOS in the OYF group showed a reduction
However, IL-1β mRNA in the OYF group had a decrease trend compared to the 6-OHDA group (Figure 6(a),
Evidence-Based Complementary and Alternative Medicine 7

Relative TNF-α mRNA 5 5 2.0

## ##

Relative IL-1β mRNA

Relative IL-6 mRNA

4 4 1.5
expression

expression

expression
3 3
∗ 1.0
2 2
1 1 0.5

0 0 0.0
Sham

6-OHDA

6-OHDA + OYF

Sham

6-OHDA

6-OHDA + OYF

Sham

6-OHDA

6-OHDA + OYF
(a) (b) (c)
10 ## 15 20
Relative TNF-α mRNA

Relative IL-1β mRNA

##

Relative IL-6 mRNA

8 15
##
∗
expression
expression

expression
10
6
10
4
5 ∗∗ ∗∗
2 5

0 0 0
IFN–γ IFN–γ IFN–γ
– + + + + – + + + + – + + + +
(50U/mL) (50 U/mL) (50 U/mL)
OYFCS (%) – – 2.5 5 10 OYFCS (%) – – 2.5 5 10 OYFCS (%) – – 2.5 5 10
(d) (e) (f )

Figure 5: Effects of OYF on TNF-α, IL-1β, and IL-6 mRNA levels in in vivo and in vitro. Relative mRNA expression of TNF-α (a), IL-1β (b),
and IL-6 (c) in the ipsilateral SN of rats. Relative mRNA expression of TNF-α (d), IL-1β (e), and IL-6 (f ) in IFN-c-induced RAW264.7 cells.
Values are expressed as mean ± SD. n � 5-6 per group in the in vivo experiment, n � 3 per group in the in vitro experiment. ## P < 0.01 vs. the
sham group or the control group, and ∗ P < 0.05 and ∗∗ P < 0.01 vs. the 6-OHDA group or the IFN-c group.

10 ## 3
##
Relative COX-2 mRNA
Relative iNOS mRNA

8
2 ∗∗
expression

expression

4
1
2

0 0
Sham 6-OHDA 6-OHDA + OYF Sham 6-OHDA 6-OHDA + OYF
(a) (b)
80 40 ##
##
Relative COX-2 mRNA

∗
Relative iNOS mRNA

60 ∗ 30
∗
expression

expression

40 20

∗∗ ∗∗
20 10

0 0
IFN-γ (50U/mL) – + + + + IFN-γ (50U/mL) – + + + +
OYFCS (%) – – 2.5 5 10 OYFCS (%) – – 2.5 5 10
(c) (d)

Figure 6: Effects of OYF on iNOS and COX-2 expression in in vivo and in vitro. Relative mRNA levels of iNOS (a) and COX-2 (b) in the
ipsilateral SN of rats. Relative mRNA levels of iNOS (c) and COX-2 (d) in IFN-c-induced RAW264.7 cells. Values are expressed as
mean ± SD. n � 5-6 per group in the in vivo experiment, and n � 3 per group in the in vitro experiment. ## P < 0.01 vs. the sham group or the
control group, and ∗ P < 0.05 and ∗∗ P < 0.01 vs. the 6-OHDA group or the IFN-c group.
8 Evidence-Based Complementary and Alternative Medicine

P > 0.05). The OYF treatment downregulated the COX-2 location to generate the PD model [29]. Unilateral injection
mRNA level compared with the 6-OHDA group of 6-OHDA in the striatum not only reduced TH (a do-
(Figure 6(b), P < 0.05). paminergic neuron marker) immunoreactivity, but also
In the in vitro experiment, IFN-c significantly increased enhanced expressions of GFAP (astrocyte marker), OX-42
the iNOS and COX-2 mRNA expressions in RAW264.7 cells (microglia marker), and iNOS in both the striatum and SN
compared with the sham group (Figures 6(c) and 6(d), both [30], suggesting that striatal injections of 6-OHDA could
P < 0.01). The iNOS mRNA levels were reversed in all progressively destroy dopaminergic neurons in SN [16].
OYFCS treatment groups compared to the IFN-c group After unilateral injection of 6-OHDA into the striatum, the
(Figure 6(c), P < 0.05, P < 0.05, and P < 0.01 for 2.5%, 5%, number of TH-positive neurons in the SN dropped to 39%,
and 10% dose of OYFCS, respectively). OYFCS at the doses 44%, 34%, and 52% of contralateral values at 2, 4, 8, and 16
of 2.5% and 10% significantly reduced the COX-2 mRNA weeks, respectively [31]. This study suggests that the loss of
expressions compared to the IFN-c group (Figure 6(d), TH-positive neurons may remain at a relatively high level
P < 0.05 and P < 0.01). at 2 to 8 weeks postlesion. Therefore, we utilized unilateral
injection of 6-OHDA into the striatum as the PD model
4. Discussion and chose 8 weeks as the end point to further confirm the
effects of OYF in PD in our study.
Dopaminergic neuron loss and DA deficiency are key Dopaminergic neuron loss in the SN is an important
pathological features of PD that lead to motor dysfunctions. pathological feature in PD. Our data showed that unilateral
Though DA replacement therapy reduces clinical symptoms, injection of 6-OHDA in the striatum led to motor dys-
it cannot slow the neurodegenerative process. Neuro- function (Figures 1 and 2) and reduction in TH expression in
inflammation and immune dysregulation play important SN (Figure 3), which is consistent with other research studies
roles in the PD pathology [24, 25]. Hence, inflammatory and [30]. As reported by Blandini et al., APO-induced rotations
immune pathways might be potential therapeutic targets for were present stably and TH-positive cell loss in the ipsilateral
PD. In the present study, we investigated the effects of OYF SNc was about 51.8% at the fourth week after intrastriatal
on motor behaviors and inflammation-related mechanisms injection of 6-OHDA [22]. OYF treatment attenuated the
in the 6-OHDA-induced rat model of PD and in IFN- abnormal movements and the loss of TH-positive neurons
c-induced RAW264.7 cells. (Figures 1–3), suggesting OYF might have protective effect
OYF is a Chinese medicine formula that has been used on dopaminergic neurons thus improving the motor
for treating psoriasis and shows therapeutical effect [10]. function. It has been reported that TH-positive neurons
Previous studies of applying OYF in the treatment of could be injured by glia-mediated inflammation [32]. Re-
psoriasis also reported an improvement effect [12, 13], active microglia is a prominent pathological feature of PD
which might be via the regulation of keratinocyte cyclin B2, since an increase of microglia markers (such as HLA-DR and
inflammatory cytokine, and chemokine release [13, 14]. Iba1) was detected in the SN of PD patients [33, 34]. Fur-
Psoriasis is an autoimmune disease accompanied by thermore, MPTP-induced PD monkeys also showed reactive
chronic recurrent inflammatory skin symptoms. A resent microglia years after MPTP exposure, suggesting a chronic
genome-wide association study has identified several neuroinflammation process in PD [35]. In addition, MPTP
shared loci (including HLA-DRB5, LRRK2, and MAPT) enhanced GFAP immunoreactivity in the SN of mice [36].
between PD and 7 autoimmune diseases (including pso- Thus, these studies indicated the activation of glia in PD. In
riasis, rheumatoid arthritis, and so on), suggesting that our study, the 6-OHDA lesion increased the immunore-
there were some common genetic risks between PD and activity of GFAP and Iba-1 in the SN (Figure 4). 1-week
autoimmune diseases [26]. A population-based 5-year pretreatment plus 8-week treatment with OYF significantly
follow-up study in patients with psoriasis indicated that inhibits the expression of GFAP and Iba-1 (Figure 4), in-
psoriasis is associated with an increased risk of parkin- dicating that OYF might suppress the glia activation. On the
sonism [27]. Other population-based cohort studies also contrary, glia activation may further affect the neuronal
showed that psoriasis patients had significantly higher risk activity. For example, activated microglia induced neuro-
of developing PD, suggesting a potential relation between toxic reactive astrocytes and resulted in neuronal death [37].
PD and psoriasis [28]. Given that inflammation is the Inhibition of microglia-induced neurotoxic reactive astro-
common pathology of PD and psoriasis and that the OYF cytes showed neuroprotective effect in PD models [38].
had antiinflammation property in treating psoriasis, our Therefore, in addition to the direct impairment of 6-OHDA,
previous study investigated the effects of OYF in the glia activation might play a potential role in the loss of TH-
MPTP-induced PD mouse model and found that OYF positive neurons.
attenuated the loss of dopaminergic neurons in SN and Activation of glia can result in the production of
alleviated the inflammatory response [15]. In addition to proinflammatory factors, including TNF-α, IL-1β, and IL-6,
the MPTP-induced model, there are other commonly used elevated levels of which were found in blood from patients
animal models of PD that employ toxins, including 6- with PD as well as from the animal model of PD [36]. Our
OHDA, which is similar to DA in structure and can spe- data showed that striatal injection of 6-OHDA increased the
cifically kill dopaminergic neurons and their terminals [16]. mRNA levels of TNF-α and IL-1β, but not IL-6 in the SN
However, 6-OHDA cannot cross the blood brain-barrier (Figure 5). OYF treatment reduced the TNF-α mRNA level
and need to be directly injected into a specific brain and trended to decrease IL-1β mRNA (Figure 5).
Evidence-Based Complementary and Alternative Medicine 9

Furthermore, in the in vitro experiment, IFN-c stimulation Disclosure

upregulated TNF-α, IL-1β, and IL-6 mRNA levels in
RAW264.7 cells, whereas a high dose of OYFCS reversed the Renrong Wei and Cuiping Rong are the co-first authors.
elevated levels (Figure 5). These results were similar to our
previous study in the MPTP-induced mice model and in LPS- Conflicts of Interest
induced BV-2 cells [15]. Taken together, these results suggest
that OYF exerts an antiinflammation effect in the PD model. The authors declare no conflicts of interest.
Proinflammatory cytokines, such as IFN-c, IL-1β, and
TNF-α, might be involved in the induction of iNOS [6]. IL- Authors’ Contributions
1β increased the transcription of the gene encoding TNF-α
[39]. Decreasing TNF-α level reduced movement symptom Renrong Wei and Cuiping Rong contributed equally to this
in the PD animal model [40]. In addition, IL-1β and IFN-c article.
regulated the transcriptional activity of the iNOS gene [41].
iNOS stimulated the degeneration of dopaminergic neurons Acknowledgments
in the MPTP-induced PD model [42]. On the other hand,
iNOS-derived NO regulated COX-2 activity [43], which This work was supported by the Science and Technology
might be caused by a mechanism of iNOS binded to Research Project of Guangdong Provincial Hospital of
S-nitrosylated COX-2 [44]. Thus, COX-2 is a potential Chinese Medicine (no. YN2019MJ14 to Tongxiang Lin),
downstream effecter of iNOS [45]. COX-2 induced micro- Science and Technology Department of Guangdong Prov-
glial activation and triggered the release of inflammatory ince China (no. 2015A020212032 to Tongxiang Lin), and
mediators (such as TNF-α, IL-1β, and IL-6), resulting in Fujian Agriculture and Forestry University (no. KFA1749A
dopaminergic neuron damage in Zn-induced parkinsonism to Tongxiang Lin). This work was also supported by the
[46]. Though COX-2 is induced in the glia in response to National Natural Science Foundation of China (no.
inflammation, in neurons it is induced in response to 31271595 to Tongxiang Lin) and Key Project of Chinese
excitatory synaptic activity [47]. Mice lacking COX-2 National Programs for Fundamental Research and Devel-
showed increase in TH-positive neuron survival in the SN opment (973 Programs) (no. 2013CB9669002 to Tongxiang
in the MPTP-induced model [48], whereas COX-2 in- Lin).
hibitors enhanced human neuroblastoma cell death in-
duced by MPTP [49]. In 6-OHDA model, COX-2 was References
induced in two neuronal cell lines, leading to upregulation
of IL-1β [50]. The iNOS, NO, and COX-2 are important [1] C. M. Long-Smith, A. M. Sullivan, and Y. M. Nolan, “The
inflammatory mediators involved in PD pathology [7, 51]. To influence of microglia on the pathogenesis of Parkinson’s
disease,” Progress in Neurobiology, vol. 89, no. 3, pp. 277–287,
confirm whether the antiinflammation effect of OYF involves
2009.
iNOS and COX-2, we investigated these inflammatory [2] L. V. Kalia and A. E. Lang, “Parkinson’s disease,” The Lancet,
modulators in this study. The results showed that 6-OHDA vol. 386, no. 9996, pp. 896–912, 2015.
lesion increased the mRNA levels of iNOS and COX-2 in the [3] S. Hunot and E. C. Hirsch, “Neuroinflammatory processes in
SN (Figure 6), and OYF significantly downregulated the Parkinson’s disease,” Annals of Neurology, vol. 53, no. S3,
COX-2 level (Figure 5). OYF had a trend to decrease the iNOS pp. S49–S60, 2003.
mRNA levels in MPTP and 6-OHDA models. Additionally, [4] X.-Y. Qin, S.-P. Zhang, C. Cao, Y. P. Loh, and Y. Cheng,
OYFCS also significantly reduced the elevated levels of iNOS “Aberrations in peripheral inflammatory cytokine levels in
and COX-2 induced by IFN-c in RAW264.7 cells (Figure 6). Parkinson disease: a systematic review and meta-analysis,”
Thus, iNOS and COX-2 may be involved in the antiin- JAMA Neurology, vol. 73, no. 11, pp. 1316–1324, 2016.
[5] Y. M. Nolan, A. M. Sullivan, and A. Toulouse, “Parkinson’s
flammation effect of OYF in PD.
disease in the nuclear age of neuroinflammation,” Trends in
Molecular Medicine, vol. 19, no. 3, pp. 187–196, 2013.
5. Conclusions [6] E. C. Hirsch and S. Hunot, “Nitric oxide, glial cells and
neuronal degeneration in parkinsonism,” Trends in Phar-
In summary, this study showed that OYF reversed the motor macological Sciences, vol. 21, no. 5, pp. 163–165, 2000.
behavioral dysfunction in 6-OHDA-induced rats, which [7] L. Zhang, V. L. Dawson, and T. M. Dawson, “Role of nitric
might be partly through attenuating dopaminergic neuron oxide in Parkinson’s disease,” Pharmacology & Therapeutics,
loss, inhibiting activation of astrocytes and microglia, and vol. 109, no. 1-2, pp. 33–41, 2006.
downregulating inflammatory factors. It suggests that OYF [8] M. A. Mena and J. Garcı́a de Yébenes, “Glial cells as players in
might be a potential antiinflammatory agent for preventing parkinsonism: the “Good,” the “Bad,” and the “Mysterious”
or treating PD. However, further research studies are still glia,” The Neuroscientist, vol. 14, no. 6, pp. 544–560, 2008.
[9] H.-M. Gao, B. Liu, W. Zhang, and J.-S. Hong, “Novel anti-
needed to better understand the mechanism of OYF in PD.
inflammatory therapy for Parkinson’s disease,” Trends in
Pharmacological Sciences, vol. 24, no. 8, pp. 395–401, 2003.
Data Availability [10] Y.-J. Dai, Y.-Y. Li, H.-M. Zeng et al., “Effect of Yinxieling
decoction on PASI, TNF-α and IL-8 in patients with psoriasis
The data are available from the corresponding author upon vulgaris,” Asian Pacific Journal of Tropical Medicine, vol. 7,
request. no. 8, pp. 668–670, 2014.
10 Evidence-Based Complementary and Alternative Medicine

[11] S.-D. Chen, C.-J. Lu, and R.-Z. Zhao, “Identification and [25] Z. Chen, S. Chen, and J. Liu, “The role of T cells in the
quantitative characterization of PSORI-CM01, a Chinese pathogenesis of Parkinson’s disease,” Progress in Neurobiol-
medicine formula for psoriasis therapy, by liquid chroma- ogy, vol. 169, pp. 1–23, 2018.
tography coupled with an LTQ orbitrap mass spectrometer,” [26] A. Witoelar, I. E. Jansen, Y. Wang et al., “Genome-wide
Molecules, vol. 20, no. 1, pp. 1594–1609, 2015. pleiotropy between Parkinson disease and autoimmune dis-
[12] C.-j. Lu, Y. Xiang, X.-l. Xie, M.-l. Xuan, and Z.-h. He, “A eases,” JAMA Neurology, vol. 74, no. 7, pp. 780–792, 2017.
randomized controlled single-blind clinical trial on 84 out- [27] J.-J. Sheu, K.-H. Wang, H.-C. Lin, and C.-C. Huang, “Psoriasis
patients with psoriasis vulgaris by auricular therapy combined is associated with an increased risk of parkinsonism: a
with optimized Yinxieling formula (psoriasis optimizer),” population-based 5-year follow-up study,” Journal of the
Chinese Journal of Integrative Medicine, vol. 18, no. 3, American Academy of Dermatology, vol. 68, no. 6, pp. 992–
pp. 186–191, 2012. 999, 2013.
[13] J. A. Wei, L. Han, C. J. Lu et al., “Formula PSORI-CM01 [28] J. H. Lee, K. Han, and H. Y. Gee, “The risk of Parkinson’s
eliminates psoriasis by inhibiting the expression of kerati- disease in patients with psoriasis: a nationwide population-
nocyte cyclin B2,” BMC Complementary and Alternative based cohort study,” Journal of the European Academy of
Medicine, vol. 16, no. 1, p. 255, 2016. Dermatology and Venereology, vol. 33, p. 22, 2019.
[14] L. Han, J. Sun, C.-j. Lu et al., “Formula PSORI-CM01 inhibits [29] I. Stojkovska, B. M. Wagner, and B. E. Morrison, “Parkinson’s
the inflammatory cytokine and chemokine release in kera- disease and enhanced inflammatory response,” Experimental
tinocytes via NF-κB expression,” International Immuno- Biology and Medicine, vol. 240, no. 11, pp. 1387–1395, 2015.
pharmacology, vol. 44, pp. 226–233, 2017. [30] M. A. Mori, A. M. Delattre, B. Carabelli et al., “Neuro-
[15] R. Wei, J. OuYang, W. Lin, and T. Lin, “Curative anti-in- protective effect of omega-3 polyunsaturated fatty acids in the
flammatory properties of Chinese optimized Yinxieling for- 6-OHDA model of Parkinson’s disease is mediated by a re-
mula in models of Parkinson’s disease,” Evidence-Based duction of inducible nitric oxide synthase,” Nutritional
Complementary and Alternative Medicine, vol. 2018, Article Neuroscience, vol. 21, no. 5, pp. 341–351, 2018.
ID 6142065, 12 pages, 2018. [31] H. Sauer and W. H. Oertel, “Progressive degeneration of
[16] G. E. Meredith, P. K. Sonsalla, and M.-F. Chesselet, “Animal nigrostriatal dopamine neurons following intrastriatal ter-
models of Parkinson’s disease progression,” Acta Neuro- minal lesions with 6-hydroxydopamine: a combined retro-
pathologica, vol. 115, no. 4, pp. 385–398, 2008. grade tracing and immunocytochemical study in the rat,”
[17] T. Murata, S. Kohno, C. Ito et al., “Inhibitory effect of car- Neuroscience, vol. 59, no. 2, pp. 401–415, 1994.
bazolequinone derivatives on lipopolysaccharide and in- [32] K. Saijo, B. Winner, C. T. Carson et al., “A Nurr1/CoREST
terferon-c-induced nitric oxide production in mouse pathway in microglia and astrocytes protects dopaminergic
macrophage RAW264.7 cells,” Journal of Pharmacy and neurons from inflammation-induced death,” Cell, vol. 137,
Pharmacology, vol. 65, no. 8, pp. 1204–1213, 2013. no. 1, pp. 47–59, 2009.
[18] D. Leonoudakis, A. Rane, S. Angeli et al., “Anti-inflammatory [33] K. J. Doorn, T. Moors, B. Drukarch, W. van de Berg,
and neuroprotective role of natural product securinine in P. J. Lucassen, and A.-M. van Dam, “Microglial phenotypes
activated glial cells: implications for Parkinson’s disease,” and toll-like receptor 2 in the substantia nigra and hippo-
Mediators of Inflammation, vol. 2017, Article ID 8302636, campus of incidental Lewy body disease cases and Parkinson’s
11 pages, 2017. disease patients,” Acta Neuropathologica Communications,
[19] M. Li, F.-r. Dai, X.-p. Du, Q.-d. Yang, and Y. Chen, “Neu- vol. 2, no. 1, p. 90, 2014.
roprotection by silencing iNOS expression in a 6-OHDA [34] P. L. McGeer, S. Itagaki, B. E. Boyes, and E. G. McGeer,
model of Parkinson’s disease,” Journal of Molecular Neuro- “Reactive microglia are positive for HLA-DR in the substantia
science, vol. 48, no. 1, pp. 225–233, 2012. nigra of Parkinson’s and Alzheimer’s disease brains,” Neu-
[20] A. P. Signore, Z. Weng, T. Hastings et al., “Erythropoietin rology, vol. 38, no. 8, p. 1285, 1988.
protects against 6-hydroxydopamine-induced dopaminergic [35] P. L. McGeer, C. Schwab, A. Parent, and D. Doudet, “Presence
cell death,” Journal of Neurochemistry, vol. 96, no. 2, of reactive microglia in monkey substantia nigra years after 1-
pp. 428–443, 2006. methyl-4-phenyl-1,2,3,6-tetrahydropyridine administration,”
[21] U. Ungerstedt, “Postsynaptic supersensitivity after 6-hy- Annals of Neurology, vol. 54, no. 5, pp. 599–604, 2003.
droxy-dopamine induced degeneration of the nigro-striatal [36] G. D. Manocha, A. M. Floden, K. L. Puig et al., “Defining the
dopamine system,” Acta Physiologica Scandinavica, vol. 82, contribution of neuroinflammation to Parkinson’s disease in
no. S367, pp. 69–93, 1971. humanized immune system mice,” Molecular Neuro-
[22] F. Blandini, G. Levandis, E. Bazzini, G. Nappi, and degeneration, vol. 12, no. 1, p. 17, 2017.
M.-T. Armentero, “Time-course of nigrostriatal damage, basal [37] S. A. Liddelow, K. A. Guttenplan, L. E. Clarke et al., “Neu-
ganglia metabolic changes and behavioural alterations fol- rotoxic reactive astrocytes are induced by activated micro-
lowing intrastriatal injection of 6-hydroxydopamine in the glia,” Nature, vol. 541, no. 7638, pp. 481–487, 2017.
rat: new clues from an old model,” European Journal of [38] S. P. Yun, T. I. Kam, N. Panicker et al., “Block of A1 astrocyte
Neuroscience, vol. 25, no. 2, pp. 397–405, 2007. conversion by microglia is neuroprotective in models of
[23] S.-J. Cho, J.-E. Huh, J. Song, D.-K. Rhee, and S. Pyo, “Ikaros Parkinson’s disease,” Nature Medicine, vol. 24, no. 7,
negatively regulates inducible nitric oxide synthase expression pp. 931–938, 2018.
in macrophages: involvement of ikaros phosphorylation by [39] S. J. Burke, D. Lu, T. E. Sparer, M. D. Karlstad, and J. J. Collier,
casein kinase 2,” Cellular and Molecular Life Sciences, vol. 65, “Transcription of the gene encoding TNF-α is increased by IL-
no. 20, pp. 3290–3303, 2008. 1β in rat and human islets and β-cell lines,” Molecular Im-
[24] L. Chen, M. Mo, G. Li et al., “The biomarkers of immune munology, vol. 62, no. 1, pp. 54–62, 2014.
dysregulation and inflammation response in Parkinson dis- [40] L. Boi, A. Pisanu, N. Greig et al., “Immunomodulatory drugs
ease,” Translational Neurodegeneration, vol. 5, no. 1, p. 16, alleviate L-dopa-induced dyskinesia in a rat model of Par-
2016. kinson’s disease,” Movement Disorders, 2019.
Evidence-Based Complementary and Alternative Medicine 11

[41] S. J. Burke, B. L. Updegraff, R. M. Bellich et al., “Regulation of

iNOS gene transcription by IL-1β and IFN-c requires a
coactivator exchange mechanism,” Molecular Endocrinology,
vol. 27, no. 10, pp. 1724–1742, 2013.
[42] G. T. Liberatore, V. Jackson-Lewis, S. Vukosavic et al., “In-
ducible nitric oxide synthase stimulates dopaminergic neu-
rodegeneration in the MPTP model of Parkinson disease,”
Nature Medicine, vol. 5, no. 12, pp. 1403–1409, 1999.
[43] K. Shinmura, Y.-T. Xuan, X.-L. Tang et al., “Inducible nitric
oxide synthase modulates cyclooxygenase-2 activity in the
heart of conscious rabbits during the late phase of ischemic
preconditioning,” Circulation Research, vol. 90, no. 5,
pp. 602–608, 2002.
[44] S. F. Kim, D. A. Huri, and S. H. Snyder, “Inducible nitric oxide
synthase binds, S-nitrosylates, and activates cyclooxygenase-
2,” Science, vol. 310, no. 5756, pp. 1966–1970, 2005.
[45] Q. Li, Y. Guo, W. Tan et al., “Cardioprotection afforded by
inducible nitric oxide synthase gene therapy is mediated by
cyclooxygenase-2 via a nuclear factor-κB-dependent path-
way,” Circulation, vol. 116, no. 14, pp. 1577–1584, 2007.
[46] A. K. Chauhan, N. Mittra, D. K. Patel, and C. Singh,
“Cyclooxygenase-2 directs microglial activation-mediated
inflammation and oxidative stress leading to intrinsic apo-
ptosis in Zn-induced parkinsonism,” Molecular Neurobiology,
vol. 55, no. 3, pp. 2162–2173, 2018.
[47] N. S. Woodling, D. Colas, Q. Wang et al., “Cyclooxygenase
inhibition targets neurons to prevent early behavioural de-
cline in Alzheimer’s disease model mice,” Brain, vol. 139,
no. 7, pp. 2063–2081, 2016.
[48] S. Hunot, M. Vila, P. Teismann et al., “JNK-mediated in-
duction of cyclooxygenase 2 is required for neuro-
degeneration in a mouse model of Parkinson’s disease,”
Proceedings of the National Academy of Sciences, vol. 101,
no. 2, pp. 665–670, 2004.
[49] R. Niranjan, K. P. Mishra, and A. K. Thakur, “Inhibition of
cyclooxygenase-2 (COX-2) initiates autophagy and potenti-
ates MPTP-induced autophagic cell death of human neuro-
blastoma cells, SH-SY5Y: an inside in the pathology of
Parkinson’s disease,” Molecular Neurobiology, vol. 55, no. 10,
pp. 8038–8050, 2018.
[50] X. Kang, J. Qiu, Q. Li et al., “Cyclooxygenase-2 contributes to
oxidopamine-mediated neuronal inflammation and injury via
the prostaglandin E2 receptor EP2 subtype,” Scientific Reports,
vol. 7, no. 1, p. 9459, 2017.
[51] P. Teismann, K. Tieu, D.-K. Choi et al., “Cyclooxygenase-2 is
instrumental in Parkinson’s disease neurodegeneration,”
Proceedings of the National Academy of Sciences, vol. 100,
no. 9, pp. 5473–5478, 2003.