Islamic Verse

In the name of Allah, the Most Gracious,
the Most Merciful

O man! What has seduced thee from Thy Lord Most
Beneficent? – Him who created thee, fashioned thee in due
proportion, and gave thee a just bias, in whatever form He
wills, does He put thee together. Nay! But ye do reject the
judgment! But verify over you, - (Are appointed angles) to
protect you, - kind and honorable, - writing down (your
deeds): They know all ye do.
Al-Quran (Al-Infitar, J30: A6-12
PREVALENCE OF VARIOUS TYPES OF
MITOCHONDRIAL DNA MUTATION IN TYPE 2
DIABETES MELLITUS IN PAKISTAN
Candidate: DR. MARYAM SHARIF

MBBS (Pb), MPhil (NUST)
Trainee PhD Biochemistry
1729-AFPGMI/Ph.D – 2004
Army Medical College, Rawalpindi
Supervisor: MAJ GEN ABDUL KHALIQ NAVEED

MBBS, MPhil, PhD, FCPS (Chem Path)
Professor & Head of Department
Dept of Biochemistry and Molecular Biology
Army Medical College, Rawalpindi
PREVALENCE OF VARIOUS TYPES OF MITOCHONDRIAL DNA
MUTATION IN TYPE 2 DIABETES MELLITUS IN PAKISTAN
By
DR. MARYAM SHARIF

Department of Biochemistry and Molecular Biology
Faculty of Biological Sciences
Armed Forces Post Graduate Medical Institute
Rawalpindi, Pakistan
2010
PREVALENCE OF VARIOUS TYPES OF MITOCHONDRIAL DNA
MUTATION IN TYPE 2 DIABETES MELLITUS IN PAKISTAN
A Thesis
Submitted to
The Faculty of Biological Sciences

Quaid-i-Azam University, Islamabad
in the partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY
IN
BIOCHEMISTRY
By
DR. MARYAM SHARIF
Department of Biochemistry and Molecular Biology
Faculty of Biological Sciences
Armed Forces Post Graduate Medical Institute
Rawalpindi, Pakistan
2010
CERTIFICATE
The Department of Biochemistry, Armed Forces Post Graduate Medical Institute
(AFPGMI) Rawalpindi and Quaid-i-Azam University, Islamabad, accepts this thesis
submitted by Dr Maryam Sharif in its present form, as satisfying the thesis
requirements for the degree of “Doctor of Philosophy (PhD) in Biochemistry”.
Chairman/Supervisor: ________________________
Prof. Maj Gen Abdul Khaliq Naveed
External Examiner: ________________________

Prof. M. Ataur Rehman
External Examiner: ________________________

Prof. Abdul Baseer
Dated: ________________________
DECLARATION
I hereby declare that the work presented in this thesis is my own effort, except where
otherwise acknowledged and that the thesis is my own composition. No part of this
thesis has been previously presented for any other degree.
DR. MARYAM SHARIF

Dedicated to
my beloved parents
CONTENTS PAGE NO
Acknowledgements I
List of Abbreviations III
List of Figures VII
List of Tables XIII
Abstract XV
Chapter No.1 : Introduction 1
¾ Diabetes Mellitus
• Classification of diabetes mellitus 2
• Diagnosis of diabetes mellitus: 3

• Pathogenesis of type 2 diabetes mellitus 3
¾ Mitochondria - An Overview 4
• Mitochondrial DNA 5
• Replication of Mitochondrial DNA 7

• Mitochondrial DNA inheritance and copy number 8
• Mitochondrial functions 11
• Mitochondrial DNA genes 12
• Mitochondrial DNA mutations 16
• Mitochondrial DNA mutations and diseases 17
• Role of Mitochondrial DNA mutations in the development
20
of Type 2 Diabetes Mellitus
• Mitochondrial tRNALeu(UUR) gene A3243G mutation in
22
type 2 diabetes mellitus
• Clinical aspects of type 2 diabetes mellitus with A3243G
25
mutation in tRNALeu(UUR) gene
¾ OBJECTIVE OF PRESENT STUDY 27
¾ STATISTICAL ANALYSIS 28
CONTENTS PAGE NO
Chapter No.2 : Materials and Methods 29
¾ BLOOD SAMPLING 30
¾ MOLECULAR STUDIES 30
• Total Genomic DNA Extraction 30
• Polymerase Chain Reaction (PCR) 32
• Horizontal Gel Electrophoresis 33
• PCR – RFLP analysis 34
• DNA sequencing 34
¾ METABOLIC STUDIES
• Estimation of Plasma Glucose 36
• Determination Of Glycosylated Hemoglobin 37
• Plasma Urea Estimation 39
• Plasma Cholesterol Estimation 41
• Plasma Triglyceride Estimation 42

• Detection of Glucose in Urine 44
¾ CLINICAL EXAMINATION FOR DEAFNESS 45
¾ BODY MASS INDEX (BMI) 45
Chapter No.3 : Results

¾ MUTATION ANALYSIS: 46
• Detection of A3243G mutation 47
¾ METABOLIC STUDIES 62
¾ CLINICAL STUDIES: DEAFNESS 67

Chapter No.4 : Discussion
• A3243G mutation in the region of tRNALeu(UUR) gene in
71
Pakistani population
• A3243G mutation in the region of tRNALeu(UUR) gene in

75
Asian population
CONTENTS PAGE NO
• Age and sex 76
• Impaired hearing 77
• Insulin dependence 81
• Body mass index 83
• Hyperglycemia 84
• Plasma triglycerides and cholesterol profile 85
• Plasma urea level 86

¾ LIMITATIONS/ SUGGESTION OF THE STUDY 89
¾ CONCLUSION 90
Chapter No.5 : References 90
Chapter No.6 : Appendices 117

ACKNOWLEDGMENTS
Praise be to ALLAH the Cherisher and Sustainer of the worlds: Who granted
man with knowledge from His unseen treasures. All regards and respects are for
the Holy Prophet Hazrat MUHAMMAD (SalAllahu ‘alaihi wa sallam), whose
blessings and teachings flourished my thoughts and thrived my ambitions.
No works can suffice to express my indebtedness to my supervisor, Dr. Abdul

Khaliq Naveed for his brilliant versatility, devoted guidance and for being so
supportive and dependable, for his unflinching support and immense patience at
all stages of this work. I am also grateful to him for being extremely supportive
of all research activities going on in this department.
Special thanks are extended to Dr. Ashraf Chaudhary for his technical
assistance and guidance in statistical analysis of this research work.
I am thankful to my senior PhD Scholar Dr Muhammad Naeem and all my lab

fellows for their cooperation and a nice company. Thanks are also due to Mr.
Irfan, for his cooperation and guidance in the lab.
My heartfelt gratitude is reserved for my kids, Maheen, Minahil and Haroon,

for their prayers and sacrifice throughout my research work. I am grateful to my
husband, Abdul Wahid, for his always encouragement and appreciation for
higher studies.
I
The biggest assets of my life are my beloved parents. I have no words to pay
tribute to them. Nothing I have for their efforts for me. It is due to their prayers
that I am successful in my educational career and I owe their prayers for success
in my life. May ALLAH bestow them with His blessings.
Dr Maryam Sharif
II
LIST OF ABBREVIATIONS
A Adenine
A Absorbance
4-AA 4 – Aminoantipyrine
A Sample Absorbance of Sample
AStandard Absorbance of Standard
ADP Adenosine Diphosphate
ADPS N-ethyl-N-propyl-m-anisidine
ATP Adenosine Triphosphate
BMI Body Mass Index
bp Base Pair
CoQ Coenzyme Q
C Cytosine
Ca Calcium
CE Cholesterol Esterase
CO2 Carbon Dioxide
CStandard Concentration of Standard
CVD Cardiovascular Disease
D Daltons
III
D – Loop Displacement Loop
DM Diabetes Mellitus
DNA Deoxy Ribonucleic Acid
EDTA Ethylene Diamine Tetra Acetic acid
FADH Reduced Flavin Adenine Dinucleotide
G Guanine
g Gram
GAD Glutamic Acid Carboxylase
HbA1c Glycosylated Hemoglobin.
H – Strand Heavy Strand

LDL Low Density Lipoprotein
L – Strand Light Strand
Leu Leucine
LPL Enzyme lipoprotein lipase
µg Microgram
µl Microlitres
MDA Multiple Displacement Amplification
MIDD Maternally Inherited Diabetes and Deafness
mmo1/L Millimole per Liter
Mt Mitochondrial
MELAS Mitochondrial myopathy, encephalopathy, lactic acidosis and

stroke like episodes syndrome
IV
NAD+ Oxidized Nicotinamide Adenine Dinucleotide
NADH Reduced Nicotinamide Adenine Dinucleotide
NCEP National Cholesterol Education Program
NIDDM Non-insulin dependent diabetes mellitus
np Nucleotide Pair
OGTT Oral Glucose Tolerance Test
OXPHOS Oxidative Phosphorylation
PCR Polymerase Chain Reaction
PIPES Piperazine-N, N-bis(2-Ethanesulfonic Acid)
RC Respiratory Chain
RFLP Restriction Fragment Length Polymorphism
POD Peroxidase
rRNA Ribosomal Ribonucleic Acid
SD Standard Deviation
s.e.m Standard Error of Mean
SLS Sample Loading Solution
T Thymine
TBE Tris Borate Ethylene Diamine Tetra Acetic acid
TC Total Cholesterol
TG Triglyceride
tRNA Transfer Ribonucleic Acid
V
T2DM Type 2 diabetes mellitus
U Unit
UV Ultraviolet light
VHbA1c Volume of Glycosylated hemoglobin.
VHb TOTAL Volume of total hemoglobin
WHO World Health Organization
VI
LIST OF FUGURES
Figure Page No
1.1 Mitochondria - Inner Structure 6
1.2 Maternal Mitochondrial DNA inheritance 10
1.3 Mitochondrial Functions 13
1.4 Human Mitochondrial DNA Genes. 15
1.5 Pathological mutations in tRNALeu (UUR) 18
3.1 Electropherogram of Ethidium bromide stained 2 % agarose 48
gel for total gnomic DNA of Patients with type 2 diabetes
mellitus with no complaint of deafness
gel for total gnomic DNA of Patients with type 2 diabetes
mellitus with deafness
gel for total gnomic DNA of first degree relatives of Patients
with type 2 diabetes mellitus with no compliant of deafness
VII
gel for total gnomic DNA of first degree relatives of first
degree relatives of Patients with type 2 diabetes mellitus with
deafness
gel for total gnomic DNA of first degree relatives of control
group
gel for Amplified mitochondrial DNA of Patient with type 2
diabetes mellitus with deafness
gel for Amplified mitochondrial DNA of Patient with type 2
diabetes mellitus with no complaint of deafness
gel for Amplified mitochondrial DNA of first degree relatives
of Patient with type 2 diabetes mellitus with deafness
gel for Amplified mitochondrial DNA of first degree relatives
of Patient with type 2 diabetes mellitus with no complaint of
deafness
VIII
gel for Amplified mitochondrial DNA of control group
gel for amplified 422 bp segment of mitochondrial DNA in
Patients with type 2 diabetes mellitus with deafness
Patients with type 2 diabetes mellitus with no complaint of
deafness
gel for amplified 422 bp segment of mitochondrial DNA of
first degree relatives of Patients with type 2 diabetes mellitus
with deafness
gel for amplified 422 bp segment of mitochondrial DNA of
first-degree relatives of Patients with type 2 diabetes mellitus
with no complaint of deafness.
control group
IX
gel for Apa I – digestion of 422 bp segment of mitochondrial
DNA showing no cleavage and absence of A3243G mutation
in Patients with type 2 diabetes mellitus with no complaint of
deafness
in Patients with type 2 diabetes mellitus with deafness
in first degree relatives of Patients with type 2 diabetes
mellitus with deafness
in first degree relatives of Patients with type 2 diabetes
mellitus with no complaint of deafness
X
in control group
3.21 Sequence alignment showing absence of A to G substitution at 57
3243 position in mtDNA of the Patient with T2DM with
complaint of deafness.
3243 position in mtDNA of the Patient with T2DM with no
complaint of deafness.
3243 position in mtDNA of the first degree relative of patient
with T2DM with deafness:
3243 position in mtDNA of the first-degree relative of patient
with T2DM with no complaint of deafness:
3243 position in mtDNA of the control group.
3.26 Comparison of means of, Plasma Glucose, HbA1c and plasma 64
urea among various study groups.
XI
3.27 Comparison of means of, Plasma cholesterol and plasma 66
triglyceride among various study groups.
3.28 Comparison of Means of BMI among various study groups. 69
XII
LIST OF TABLES
Table Page No
3.1 Comparison of Age of onset of T2DM and deafness, plasma 63
glucose and Glycosylated hemoglobin levels of patients with
type 2 diabetes mellitus and first-degree relatives of diabetics
with control group
3.2 Comparison of plasma urea, plasma cholesterol and plasma 65
triacylglycerol level of patients with type 2 diabetes mellitus
and first-degree relatives of diabetics with control group.
3.3 Comparison of Body Mass Index (BMI), deafness, Glycosuria 68
and dependence on insulin therapy of patients with type 2
diabetes mellitus and first-degree relatives of diabetics with
control group.
6.1 Sex, age, age of onset of diabetes mellitus and plasma glucose 117
levels of the patients with T2DM, group A
6.2 Plasma Glycosylated hemoglobin level, plasma urea, plasma 121
cholesterol and plasma triglyceride level of the patients with
T2DM, group A
XIII
6.3 BMI, deafness, age of onset of deafness, glycosuria and type 125
of therapy of the patients with T2DM, group A
6.4 Sex, age, plasma glucose levels and Glycosylated hemoglobin 129
level of the first-degree relatives of the patients with T2DM,
group B
6.5 Plasma urea level, Body mass index (BMI), presence of 133
Glycosuria and complaint of deafness of the first-degree
relatives of the patients with T2DM, group B
6.6 Glycosuria and deafness in the first-degree relatives of the 137
diabetic patients, group B
6.7 Sex, age, plasma glucose levels and Glycosylated hemoglobin 141
level of non – diabetic subjects with no family history of
diabetes mellitus, group
6.8 Plasma urea, plasma cholesterol, plasma triglyceride level and 145
BMI of non – diabetic subjects with no family history of
diabetes mellitus, group C
6.9 Glycosuria and complaint of deafness of non – diabetic 149
subjects with no family history of diabetes mellitus, group C
XIV
Abstract
ABSTRACT
XV
Two basic abnormalities have been observed in the development of T2DM which include
impaired synthesis and release of insulin secretion by β cells of pancreas and decreased
insulin sensitivity. For the last 10 – 20 years, with more advancement in the studies and
techniques, basic concepts about exact mechanism involved in the pathogenesis of T2DM
have been modified, but the progression in this domain has been facing many difficulties. In
spite of a lot of hard work the basic fundamental molecular events are still to be explored
completely. Studies have shown that the individuals carrying diabetogenic mitochondrial
DNA (mtDNA) mutations have decreased insulin response and impaired glucose tolerance. It
was proposed that ATP generating mitochondrial oxidative phosphorylation system, in the
pancreatic β cells, plays a pivotal role in the synthesis and release of insulin in reaction to
elevated blood glucose level. Mitochondria contain their own DNA which is
extrachromosomal and distinguishable from the nuclear genomic DNA. Total mitochondrial
DNA content accounts for up to 0.5% of the total genomic DNA in a nucleated somatic cell.
Mitochondrial DNA (mtDNA) has been described to have only "Maternal Inheritance".
Therefore, if there is any mutation in the maternal mtDNA, it will be transmitted to all of her
siblings. But if father has mutant mtDNA, it is neither transmitted nor influences his children.
Human mitochondrial DNA comprises of 37 genes, 13 of which code for polypeptides
forming part of the OXPHOS system. Whereas, the other 24 genes code for 22 transfer
ribonucleic acids (tRNAs) and 2 ribosomal ribonucleic acids (rRNAs), 12S rRNA and 16S
rRNA. Thirteen messenger ribonucleic acids (mRNAs) are also produced.
Mitochondrial DNA has 10 times higher chance to develop a mutation as compared to
nuclear genome. MtDNA mutations accumulate sequentially through maternal lineage and
can be detected in almost every gene of the mitochondrial DNA. MtDNA mutations are
linked with a variety of diseases, ranging from rare muscular syndromes to common disorders
like diabetes mellitus and Alzheimer’s disease. These pathogenic mtDNA mutations disrupt
XVI
the OXPHOS system affecting the energy supply to the cells. The energy supply deficit leads
to the development of a disease state. Beta cells of pancreas require more energy and hence
are liable to be affected more due to any disruption in OXPHOS system. MtDNA mutations
are linked with diabetes mellitus as these mutations lead to defective release of insulin from
the beta cells. However, insulin sensitivity is normal. Diabetes mellitus is a common and the
predominant hallmark associated with various mitochondrial diseases. The most common
diabetogenic heteroplasmic point mutation in mtDNA tRNA gene is A3243G. It is considered
to affect transcription and translation of mtDNA encoded tRNALeu(UUR). It was found to be a
major cause of maternally inherited diabetes accompanied with sensorineural hearing defect –
a new subtype of diabetes mellitus which was given the name of “Maternally Inherited
Diabetes and Deafness (MIDD)”. A3243G point mutation in the tRNALeu(UUR) gene is
considered to be strongly linked with the pathogenesis of MIDD. Many other mtDNA
mutations are capable to make the human beings more susceptible to develop diabetes.
Approximately twenty (20) mtDNA mutations have been detected and found to be associated
with maternally inherited diabetes mellitus like homoplasmic mutations i.e. G1888A,
T4216G, A4917G and T14709C. Out of these twenty mutations, A3243G mutation is
constantly identified in 0.1–1.5 % of the diabetics Moreover, for some reason, the cells in the
cochlear portion of the ear are also found to be more susceptible to energy deficiency. Hence,
any disruption in ATP production can also affect the normal hearing power of the patients
with mitochondrial diabetes. This leads to the development of “Sensory-neural deafness”
along with diabetes. Hence, due to the combination of these two defects, this disease got its
present name of MIDD, “Maternally Inherited Diabetes and Deafness”. MtDNA A3243G
mutation leads to an overall decrease in the tRNALeu(UUR), defective aminoacylation and
absence of proper post translational modification of tRNA and proteins encoded by mtDNA.
XVII
In Pakistan, no information and study was available to evaluate the types of mitochondrial
DNA mutation seen more frequently in population affected with type 2 diabetes mellitus.
This study was conducted to ascertain the prevalence of the A3243G substitution in a
mitochondrial tRNALeu(UUR) gene in type 2 diabetes mellitus. We could not identify any A-to-
G mutation at position 3243 of mitochondrial leucine tRNA gene in the patients with
maternally inherited mitochondrial diabetes phenotype as well as first degree relatives of
these diabetics. In conclusion, the A3243G mutation in mitochondrial tRNALeu(UUR) gene was
not found to be a frequent cause of T2DM in Pakistani population.
Unfortunately, the heteroplasmy of the mutation is the lowest in the peripheral blood
leukocytes and the highest in the affected tissues. In our study, peripheral blood leukocytes
were used to isolate total and then mitochondrial genome. So, the chance to detect this
mutation was lower in leukocytes and it might have hampered the detection of this mutation.
Moreover, ~0.7% decline in the heteroplasmy levels in leukocytes is seen per year.
Anyhow we believe that the results of our study in collaboration with the earlier studies can
cater a guideline for further research. More precise techniques can be developed to identify
novel mutations as well as to analyze post mitotic tissues.
XVIII
• The work presented in the thesis has been published in the following articles:
1. Wahid M, Naveed AK. (2009) Maternally Inherited type 2 Diabetes and
Deafness: Clinical and Molecular Aspect in Pakistan. JRMC; 13(1): 7 – 11.
(Journal of Rawalpindi Medical College)
2. Naveed AK, Wahid M, Naveed A. (2009) Mitochondrial tRNAUUR(Leu) gene
mutation & Maternally Inherited Diabetes Mellitus in Pakistani Population.
Int.J.Diab. Mellitus; 1(1): 11 – 15.
(International Journal of Diabetes Mellitus)
• The research work was Presented ” in “PIMS Symposium, 2007” held on 16th – 18th
Oct, 2008 at Pakistan Institute of Medical Sciences, Islamabad as “Mitochondrial
tRNAUUR(Leu) gene mutation & Maternally Inherited Diabetes Mellitus in Pakistani
Population”.
XIX
Chapter 1 Introduction
Diabetes Mellitus:
A dwarfish thief today, diabetes, is a menace that haunts the society, thriving every single
moment. The time isn’t far when it emerges as a pernicious giant, seizing the world in its deadly
clutches and becoming a severe challenge for physicians everywhere. Diabetes Mellitus (DM) is
a frequently occurring, multifactorial disorder. It has been estimated that approximately 10% of
the population in Japan and Western countries is victim of this disease (1). The pandemic
frequency of diabetes mellitus is continuously cropping up. Increased prevalence of DM has
been observed in Asian countries especially India (2). In order to check this trend, a National
survey was conducted in India and it was estimated that approximately 12% of population settled
in the urban areas was suffering from this disease (3, 4). However, DM has not only affected the
Asian population but people living in China and Australia are also affected by this major health
problem (1, 5). This increased occurrence in Asian population can be attributed to high incidence
of increased body weight, sedentary life style or other environmental factors. Moreover, surveys
and studies have promoted the information that the countries where most of the population lives
below poverty line, diabetes is more commonly observed. In such countries death rate is higher
in diabetics due to more complications of diabetes like infections and cardiovascular pathologies
(6). However, clinical features of the diabetic patients were analyzed and a new trend of low
body mass index and early onset of diabetes has been observed for the last few years. An Indian
study has further supported the trend to develop diabetes at an early age (7). The involvement of
molecular element in the development of type 2 diabetes in younger age group has been a hot
point of research for several decades and has yet to be explored (8).
World Health Organization published a data in 2000, according to which at least 171 million
people worldwide suffered from diabetes, or 2.8% of the population was diabetic. Unfortunately
1
Prevalence of Mitochondrial DNA Mutation in T2DM in Pakistan
the incidence of diabetes is increasing even more rapidly. According to this increasing trend it is
expected that by the year 2030, almost 342 million people would be affected. Although diabetes
mellitus occurs throughout the world, but developing countries with poor and inadequate health
facilities are affected more often, especially type 2 diabetes mellitus. The greatest increase in the
prevalence of diabetes in Asia and Africa is expected, and most of the diabetic patients will
likely be found in these countries by the year 2030. Recently, Indian study has also reported that
prevalence of T2DM has been increased in adolescents and young patients (9, 10). Previous
studies carried out in South Africa, on Indians settled in there, have reported a high prevalence of
T2DM in younger age group (11). Similarly a study from the United Kingdom has also reported
the increased prevalence of T2DM in Indian children and young adult settled in UK, as compared
with white local diabetics (12).
It has been estimated that every tenth person is liable to become a victim of diabetes at any stage
of life. Some studies has reported that the total number of diabetics of age more than twenty
years worldwide is expected to rise in a generation, from 171,228 in 2000 to 366,212 by 2030,
especially T2DM (13).
Classification of diabetes mellitus:
Recommended classification by WHO study group of diabetes mellitus classifies diabetes
mellitus as Insulin dependent diabetes mellitus (IDDM) or type 1 diabetes mellitus (T1DM),
Non-insulin dependent diabetes mellitus (NIDDM) or type 2 diabetes mellitus (T2DM),
gestational diabetes, malnutrition related diabetes mellitus and other types of diabetes associated
with certain metabolic syndromes like pancreatic diseases, diseases of hormonal etiology, etc
(14, 15). Both types of diabetes mellitus i.e. type 1 diabetes mellitus (T1DM) and type 2 diabetes
mellitus (T2DM), are heterogeneous disorders showing involvement of several mechanisms in

2
their pathogenesis (16). The important etiological factors seem to be autoimmune destruction of
β cells (beta cells) of pancreas in T1DM, whereas several variations in genes like genes
responsible for insulin synthesis and secretion, peripheral receptor genes for insulin are believed
to cause T2DM. Two basic abnormalities have been observed in the development of T2DM
which include impaired synthesis and release of insulin secretion by β cells of pancreas and
decreased insulin sensitivity (17).
Diagnostic criteria for diabetes mellitus:
In 2008, a panel of experts from the American Diabetes Association has issued a revised
criterion to diagnose diabetes mellitus (18). According to this criterion, diagnosis of diabetes
mellitus is confirmed with the help of clinical symptoms and Oral Glucose Tolerance Test i.e.
after an overnight fast, fasting blood glucose is estimated. Then 75 g glucose is given orally and
a series of blood samples are taken for blood glucose measurement. At fasting glucose more than
7 mmol/L (126 mg/dl) and random blood glucose level more than 11.1 mmol/L (200 mg/dl),
diagnosis of diabetes mellitus is confirmed. However, if random blood glucose level is between
140 – 199 mg/dl (7.8 to 11.0 mmol/L) condition is considered as Impaired Glucose Tolerance
(IGT) (19).
Pathogenesis of type 2 diabetes mellitus:
For the last 10 – 20 years, with more advancement in the studies and techniques, basic concepts
about exact mechanism of pathogenesis of T2DM have been modified, but the progression in this
domain has been facing many difficulties making the situation as complicated as “untying the
Gordian knot of mythology”. T2DM is a disorder which is identified by relative insulin
deficiency due to gradual decline in the efficiency of β cells of pancreas. Hence plasma insulin
concentration is not in an amount sufficient to maintain normal plasma glucose level as well as
3
normal carbohydrate and lipid metabolism. Typically, along with insufficient insulin secretion,
insulin resistance also develops. Insulin resistance may be a consequence of aging, obesity and
reduced exercise and physical activity. Underlying molecular events responsible for this disease
have been studied thoroughly for the last three to four decades but unfortunately in spite of a lot
of hard work the basic fundamental events are still to be explored completely (20, 21, 22).
Several studies have shown that genetic defects are involved both in glucose induced insulin
secretion by pancreatic beta cells and peripheral tissues insulin sensitivity/ insulin receptors.
Research work of Tsuruzoe et al. (1998) in Japan (23) has shown that the individuals carrying
diabetogenic genetic defects have decreased insulin response and impaired glucose tolerance
even in the pre-clinical period i.e. before the development of diabetes mellitus. Recently several
reports have also described the possible role of mitochondrial DNA (mtDNA) mutations to
produce T2DM. Mitochondrial oxidative phosphorylation (OXPHOS) is a process to keep the
cells alive and functional. It was proposed that OXPHOS, in the pancreatic β cells, plays a
pivotal role in the synthesis and release of insulin in reaction to elevated blood glucose level
(24).
Mitochondria:
The earliest reports on intracellular organelles, representing mitochondria, go back to 150 years
ago. The name “mitochondrion” was given to energy producing organelle for the first time 100
years ago. Its name was derived from two Greek words, i.e. "mitos" (thread) and "chondros"
(granule). Ubiquitous intracellular organelles, mitochondria, are involved in many metabolic
pathways and have an important function of energy generation by the cell. Two main processes –
glycolysis and oxidative phosphorylation – are responsible for ATP generation. Aerobic
4
glycolysis contributes only ~ 2% to the total ATP generated. OXPHOS is the most important
reaction taking place in the islets of Langerhans in pancreas.
Mitochondria are sausage (long tube like) or oval shaped structures, bounded by two membranes,
outer and inner membranes. The smooth outer membrane is relatively porous and permeable to
most of the molecules with molecular weights less than 10,000 Daltons. The inner membrane is
projected inwards and thrown into folds called cristae. The space enclosed by the inner
membrane is called mitochondrial matrix. This inner membrane is embedded with molecular
complexes called respiratory assemblies or respiratory chain, where ATP is synthesized. The
space between outer and inner membranes is called inter-membranous space (figure 1.1). This
space contains several enzymes which are involved in the nucleotide metabolism. Whereas
mitochondrial matrix is a gel- like substance and contains high concentrations of enzymes, ions,
and small organic molecules. These are involved in energy yielding metabolic processes like
fatty acids synthesis, urea cycle etc. Mitochondria are capable of independent fission. The
number of mitochondria per cell varies with the activity of the cell; more active the cell, more is
the number of mitochondria (25, 26).
Mitochondrial DNA:
Mitochondria contain their own DNA which is extrachromosomal and can be distinguished from
the nuclear genomic DNA. This is called “Mitochondrial DNA”, (or mtDNA for short). The
presence of DNA in mitochondria was first demonstrated by electron microscopy by Nass and
Nass in 1963 (27). Mitochondrial DNA (mtDNA) is a closed circular molecule and exists in the
mitochondrial matrix. Its complete nucleotide sequence has been established by Anderson
in 1981 (28)
5
Figure 1.1: Mitochondria
6
It measures 16,569 nucleotide base pairs (bp) in overall length. It consists of two strands,
HEAVY STRAND (H – Strand) which is rich in Purines i.e. Guanine and Adenine, and LIGHT
STRAND (L – Strand) which is rich in Pyrimidines i.e. Thymine and Cytosine. The assigned
words “Heavy” and “Light” refer to the difference in mobility of the separated DNA strands in
alkaline chloride medium during electrophoresis. Mitochondrial DNA is double stranded, except
a small portion that is triple stranded due to additional synthesis of a segment of mtDNA, 7S,
called D – Loop or Displacement Loop. It lacks any known coding DNA region. A cell contains
103 – 104 molecules of mitochondria. Each mitochondrion has 2 – 10 copies of DNA (Shay et al,
1990) (29). Total mitochondrial DNA content accounts for up to 0.5% of the total genomic DNA
in a nucleated somatic cell. Human mitochondrial genome is one of the most compact pieces of
genetic information (30).
Ninety-three percent of the mtDNA sequence is the CODING SEQUENCE. There is no intron
in mtDNA and some of its genes are even overlapping. MtDNA has only 1000 bp long non-
coding sequence in its short regulatory region i.e. displacement loop (D-loop) (31).
Replication of Mitochondrial DNA:
Human mtDNA has single origin of replication which has been physically separated into two
halves, each controlling synthesis of one of the daughter DNA strands. The origins of replication
for light and heavy strands lie in the D – Loop. The mitochondrial genome is replicated in two
phases. The replication starts at the point of replication in heavy-strand and continues clockwise
around the mtDNA. The second strand is replicated in the opposite direction, starting from the
light-strand replication origin. Therefore, replication is bidirectional but asynchronous (32, 33).
7
Mitochondrial DNA inheritance and copy number:
The inheritance of mtDNA does not follow the established Mendelian inheritance pattern of
nuclear genes, but follows a vertical non-Mendelian pattern. Mitochondrial DNA (mtDNA) has
been described to have only "Maternal Inheritance". (34, 35). Pattern of maternal inheritance of
mtDNA is shown in figure 1.2. The idea of maternal inheritance pattern adapted by
mitochondrial DNA makes it possible for any particular mitochondrial diseases to be traced from
maternal lineage. The unique inheritance pattern of mtDNA indicates that mutant codons
responsible for the pathogenesis of the mitochondrial diseases are inherited only from mother. As
it is a general belief that half of the nuclear genome is inherited from mother and other half from
the father, but the case is different for mitochondrial DNA. It is well established fact that mtDNA
is exclusively inherited from mother. Therefore, if there is any mutation in the maternal mtDNA,
it will be transmitted to all of her offspring. Thorough research work on the molecular events
involved in the formation and development of embryo have indicated that ovum usually contains
100,000 to 200,000 mtDNA copies as compared to few hundred copies of mtDNA in the
spermatozoa. In addition, the mitochondria of sperm, fertilizing the ovum, are present in the tail
of the sperm which gets detached through an active process (36, 37) and due to this detachment
mitochondria do not enter in to the ovum. Finally, the fertilized egg contains only maternal
mtDNA. If this mtDNA is mutant, it will affect the child irrespective of the gender of the
offspring. Hence, it can be concluded from the available knowledge that mtDNA mutations can
only be transmitted from mother and not from father. So if father has mutant mtDNA, it is
neither transmitted nor influences his children (38).
Likewise, only the daughters will pass mtDNA mutation on to all the members of the next
generation, and so on. Therefore, even if a male child has a mutation in his mitochondrial DNA,
8
it will not be passed on to his offspring. In contrast, a woman with a mitochondrial DNA
mutation can pass it on to all of her children.
Situation is puzzling due to the truth that though one cell contains one nucleus and one set of
chromosomal DNA, but at the same time possesses hundreds of mitochondria along with many
copies of mitochondrial DNA (mtDNA) (39). Hence, if mtDNA mutations affect few copies, the
other copies of mtDNA are not affected and carry no mutation. The ratio between the mutant and
correct copies of mtDNA (heteroplasmy) is important in the determination of the clinical
presentation of the mitochondrial disease like age of onset and intensity of the symptoms of the
disease. Moreover, before the process of mitosis starts, the nuclear genome of the cell is
duplicated and at the time of division, each daughter cell gets identical half of the nuclear
genome. This is not true for mitochondrial DNA. At the time of cell division, each daughter cell
gets half of the actual number of mitochondria, which are then duplicated to restore the actual
number. Hence mitochondrial DNA is randomly distributed between two daughter cells and each
cell contains different sets of mutant and correct copies of mtDNA (40). So the precise
distribution of normal and mutant mtDNA among daughter cells cannot be predicted. It is quite
possible that a cell may abruptly get abundant amount of defective mtDNA. In this situation,
during the egg formation by ovarian cells, accidentally an egg can get a high amount of the
mutant mtDNA. This is why the age at which the disease begins and intensity of the symptoms
vary among individuals. Moreover there may be dominance of the disease in one generation and
complete absence in the next (31, 35).
9
Figure 1.2: Maternal inheritance pattern of Mitochondrial DNA
10
Mitochondrial functions:
The main function of mitochondria is to generate energy rich compound, Adenosine
Triphosphate (ATP). Thus, this organelle has rightly been called the "power plant" of the cell.
The machinery responsible to carry out this function is called the Mitochondrial Respiratory
Chain (RC). Various metabolically active substrates are oxidized by the RC to provide energy
for biological activities of the cells (figure 1.3). The inner mitochondrial membrane can be
disrupted into five separate enzyme complexes, called complex I, II, III, IV and V. Complex I to
IV each contain part of the electron transport chain, whereas complex V catalyzes ATP
synthesis.
Each complex accepts or donates electrons to relatively mobile electron carriers, such as
coenzyme Q and cytochrome c. Each carrier of electron transport chain can receive electrons
from an electron donor and can subsequently donate electrons to the next carrier in the chain,
ultimately to combine with oxygen and protons to form water. This requirement for oxygen
makes the electrons transport process the “Respiratory chain”, which accounts for the greatest
portion of the body’s utilization of oxygen. With the exception of coenzyme Q, all members of
RC are proteins. These may function as enzymes as in the case of various dehydrogenses, may
contain iron as a part of iron – sulfur center or may contain copper, as in cytochrome a + a3. Free
energy is released as electrons are transferred along the electron transport chain. NADH is a
strong electron donor and molecular oxygen is an avid electron acceptor (41, 42).
However, the flow of electrons from NADH to oxygen does not directly result in ATP synthesis.
Two electrons of NADH are transported from the cytosol into the mitochondria using shuttle
mechanisms. Three energy rich phosphate compounds i.e. ATP are generated from the oxidation
of one molecule of NADH. In addition, in pancreatic β cells, mitochondria are also responsible
11
for the secretion of insulin, induced by raised plasma glucose. Due to oxidative phosphorylation
taking place in the mitochondria, the intracellular ATP/ADP ratio changes and triggers the
exocytosis of insulin containing secretory granules (17, 26).
Mitochondrial DNA genes:
Human mitochondrial DNA comprises of 37 genes, 13 of which code for polypeptides forming
part of the OXPHOS system. Whereas, the other 24 genes code for 22 transfer ribonucleic acids
(tRNAs) and 2 ribosomal ribonucleic acids (rRNAs), 12S rRNA and 16S rRNA. Thirteen
messenger ribonucleic acids (mRNAs) are also produced.
The remainder of the OXPHOS system components are encoded in the nuclear genome,
synthesized in the cytosol and then incorporated into the mitochondrial OXPHOS system (43).
The mitochondrial RC is composed of approximately 100 different polypeptides, codons for 13
out of 100 polypeptides are located on mitochondrial genes (as shown in figure 1.4), whereas the
others are encoded by nuclear genes.
All complexes of the RC, except complex II, have a double source of genetic origin. One to
seven subunits of these complexes are encoded only by mitochondria. Moreover, it is also
postulated that many hundred genes of chromosomal DNA are required to accomplish different
tasks of the RC. Mitochondrial proteins account for 3% of total cellular proteins (44, 45, 46).
12
Figure 1.3: Mitochondrial Functions
13
All of the human mtDNA encoded 37 genes, are initially synthesized on two precursor
transcripts i.e. one encoded by the L-strand and the other by the H-strand. Of the 37 genes, 28 are
encoded by the H-strand whereas only eight tRNAs and one mRNA (ND6) are encoded by the
L-strand. Human mtDNA contains only two promoter regions for RNA transcription; both are
located within a 150-bp region in the D-loop containing conserved sequence blocks. One
promoter controls transcription of the H-strand, whereas the other controls transcription of
L-strand (47, 48).
The mitochondrial matrix also accommodates many indistinguishable copies of the mtDNA,
mitochondrial ribosomes, transfer RNAs and distinct enzymes needed for mitochondrial genes
expression (49).
14
Figure 1.4: Human Mitochondrial DNA Genes.
15
Mitochondrial DNA mutations:
Mitochondrial DNA is frequently exposed to extempore mutations i.e. 10 times higher as
compared to nuclear genome (50). There are several possible causes of this high mutation rate,
like free toxic radicals are generated by the process of oxidative phosphorylation and cause
oxidative damage.
Moreover, mtDNA does not have a protection by Histones and lack the nucleotide excision
repair system, as present in the nuclear genome. This makes mitochondria less efficient in
repairing DNA damage. The mtDNA mutation rate is further increased by environmental factors
and nuclear genes mutation involved in the accurate maintenance of mtDNA.
MtDNA mutations accumulate sequentially through maternal lineage and can be detected in
almost every gene of the mitochondria (51, 52). Two to ten copies of mtDNA are present in
every mitochondrion. Every cell comprises of many hundred of mitochondria. Hence, correct
and altered mitochondrial DNA can exist together at the same time in a single cell. This
coexistence of both types of mtDNA is called heteroplasmy. Fortunately, it permits an otherwise
fatal variation to continue without producing drastic fatal effects.
In normal condition, the mtDNA molecules of one individual are identical (Homoplasmy).
Homoplasmy allows either completely correct or completely mutant mtDNA to exist in the cell
at one time (53, 54, 55, 56).
16
Mitochondrial DNA mutations and diseases:
MtDNA mutations are linked with a variety of diseases, ranging from rare muscular syndromes
to common disorders like diabetes mellitus and Alzheimer’s disease (Wallace 1994) (57).
Mitochondrial diseases can be defined as “a collection of diseases resulting due to mtDNA
mutations, defective oxidative phosphorylation system (OXPHOS system) and lack
of ATP” (58).
Conspicuously, the most of the recognized mutations leading to mitochondrial diseases have
been located and identified in mtDNA not in the chromosomal DNA. Some of these mutations
have been shown in Fig 1.5. Mitochondrial defects occur in a broad range of degenerative
disorders, aging and carcinomas. Luft et al. (1962) (59) introduced the concept that mtDNA
mutations, when present, lead to the alteration in the oxidative phosphorylation system and
subsequently the development of disorders. These pathogenic mtDNA mutations disrupt the
OXPHOS system and the energy supply to the cell is affected. The energy supply deficit leads to
the development of disease state. But this situation is hard to put up with the concept that
deficient ATP generation is the only reason responsible for mitochondrial diseases. In advance of
1988, before the recognition of first mtDNA mutation (60, 61), several disorders were
transitionally categorized as mitochondrial diseases on the basis of unusual morphological or
biochemical hallmarks of mitochondria or its unique inheritance pattern.
The early proof of the role of mitochondrial DNA in the pathogenesis of some diseases, was
given by two findings, detection of mtDNA deletion mutation in the mitochondrial myopathies
and a mtDNA missense mutation in Leber's hereditary optic neuropathy (62). Later on, another
mtDNA mutation responsible for mitochondrial encephalomyopathies was also
described (63, 64).

17
MIDD,
Fig: 1.5
18
Inputs of facts and figures related to pathogenic mtDNA mutations have gathered at a heart
stirring place since the first pathogenic mtDNA mutation was discovered. Illustration of the
entire human mtDNA sequence and cognition of its pathogenic mutations has made it easy and
simple to appreciate the clinical implications of mtDNA mutations.
Virtually all organ systems of the body can be affected by mitochondrial dysfunction. Some
components of OXPHOS system are encoded by nuclear DNA while other by mtDNA. Hence, if
there is some abnormality in the DNA of two sources or anything wrong with transcription, the
ultimate result will be disruption of normal functioning of the oxidative phosphorylation system.
The resulting ATP deficit has harmful influences on various body tissues and systems.
Mitochondrial diseases can be caused by point mutations, deletions and duplications, which
abolish the function of genes in the densely packed mitochondrial genome (65).
The minimum amount of mutant mtDNA needed to produce a clinically apparent mitochondrial
disease is called THRESHOLD EFFECT. It depends on the precise adjustment between energy
provision and requirement of the tissues. It fluctuates among individuals, various systems and
inside a same tissue.
This fact describes the important contribution of mitochondria in the development of major
human diseases. For all practical purposes, all of the cells, tissues and systems of the body bank
on oxidative energy supply. Therefore, these are readily influenced by any disruption in the
OXPHOS system due to mtDNA mutations. Mitochondria of the subjects, with mitochondrial
disease, often have a combination of faulty and correct type mtDNA (Heteroplasmy) (66, 67,
68). But the percentage of mutant DNA varies both between and within these individuals. As
during the process of cell division, different amounts of mutant mtDNA are delivered to the
daughter cells (called as vegetative segregation). Hence, different levels of mutant mtDNA are
seen in the adjacent cells during embryonic development as well as between cells continuing to
19
proliferate throughout life. Unlike nuclear DNA, mtDNA replicates continuously, even in non –
dividing (postmitotic) cells. Endocrine manifestations also develop and seen more frequently in
mitochondrial diseases, with a relatively high incidence of diabetes mellitus. Patients with
mitochondrial diseases usually first seek medical advise because of the systemic manifestations,
like diabetes mellitus (69, 70).
Role of mtDNA mutations in Type 2 Diabetes Mellitus:
Beta cells of pancreas are metabolically more effectual and hence more liable to get affected due
to any disruption in OXPHOS system. MtDNA mutations linked Diabetes mellitus develops due
to defective release of insulin from the beta cells, not due to insulin resistance. Several steps and
mechanisms take part in the accurate release of insulin from beta cells. A glucose transporter
GLUT-2 transports the glucose into the β cells where by its phosphorylation glucose – 6 –
phosphate is formed. This is a rate regulatory step catalyzed by the enzyme glucokinase. With
the help of oxidative glycolysis, pyruvate is formed. Pyruvate enters into the mitochondria and is
completely oxidized to carbon dioxide and water. This process generates ATP and ATP/ADP
ratio becomes high. This increased ratio, in turn, causes closure of potassium channels and de-
polarization of the cell membrane and voltage-gated Calcium channels are opened. Calcium ions
are transported into the cells. The level of calcium ions rises inside the cells and this raised level
stimulates the release of Insulin. Moreover, high Ca level also regulates the rate of Citric Acid
cycle (TCA) taking place within the mitochondria (71, 72).
It was postulated that mtDNA mutations lead to improper oxidation of glucose. Hence instead of
pyruvate, lactate is produced. More lactate reaches liver and, by the process of gluconeogenesis,
converted back to glucose. This leads to raised blood glucose level (73, 74, 75). However,
20
according to consequential studies, two main factors were detected to be implicated in maternally
inherited diabetes, first one was accelerated gluconeogenesis and the other was the defect
primarily in the β cells of pancreas. So the ability of the cells to secrete insulin gets impaired.
Diabetes mellitus is a common and the predominant hallmark associated with various
mitochondrial diseases. Fortunately diabetes can be treated effectively and blood glucose level
can be controlled by appropriate therapy. It is considered as a prominent manifestation of
mtDNA mutation. The most common diabetogenic heteroplasmic point mutation in mtDNA
tRNA gene is A3243G. It is considered to affect transcription and translation of mtDNA. It was
found to be a major cause of maternally inherited diabetes accompanied with sensorineural
hearing defect – a new subtype of diabetes mellitus which was given the name of “Maternally
Inherited Diabetes and Deafness (MIDD)”. A3243G point mutation in the tRNALeu(UUR) gene is
considered to be strongly linked with the pathogenesis of MIDD (76).
Transfer RNAs or tRNAs are small RNA molecules. These transport and incorporate amino
acids to the growing peptide chain during translation. The tRNALeu(UUR) transports Leucine.
Whereas, mtDNA gene encoding the tRNA(Leu) is called MTTL1. The A3243G gene mutation is
present on the MTTL1 gene. Mutations in tRNA genes cause mitochondrial dysfunction by
lowering the rate of mitochondrial translation due to early ending of growing polypeptide and
subsequent formation of truncated polypeptides (77).
A3243G gene mutation was first described in the patients who presented with mitochondrial
encephalomyopathy with lactic acidosis and stroke like episodes (MELAS) but later on also
found to be implicated in MIDD. Patients with maternally inherited diabetes usually present with
the complaint of early onset of diabetes i.e. age ≤ 40 yrs. Patients also present with frequent
21
failure in the therapy with oral hypoglycemic drugs and demand insulin therapy
instead (78).
According to one study (79), there would be approximately 978,000 carriers of A3243G
mutations worldwide. Hence, we can conclude, from all observations, that mitochondrial
dysfunction due to mtDNA mutations is linked with the development of maternally inherited
type 2 diabetes mellitus (80, 81). Many other mtDNA mutations are capable to make the human
beings more susceptible to develop diabetes. Approximately twenty (20) mtDNA mutations have
been detected and found to be associated with maternally inherited diabetes mellitus like
homoplasmic mutations i.e. G1888A, T4216G, A4917G and T14709C. Out of these twenty
mutations, A3243G mutation is constantly identified in 0.1–1.5 % of the diabetics (82).
Mitochondrial tRNALeu(UUR) gene A3243G mutation in type 2 diabetes mellitus:-
The linkage of mtDNA tRNALeu(UUR) gene mutations with the development of numerous diseases
has already been proven, but the exact pathogenic mechanisms are largely undisclosed. The
mtDNA A3243G mutation impairs crucial mitochondrial metabolic events required for the
proper functioning of the cells, such as glucose induced insulin secretion. The A3243G
tRNALeu(UUR) mutation causes impaired mtDNA transcription, in spite of accurate process of
translation. This affects the component proteins of OXPHOS system. A3243G mutation results in
the loss of mitochondrial function in vivo. At some stage, this mutation also causes maternally
inherited diabetes or MELAS in those subjects who carry this mutation and remain symptom free
for a long time (83).
The persons showing higher degree of heteroplasmy will develop more intense clinical
symptoms at an early age, as compared to those individuals who have lower degree of
22
heteroplasmy. As the A3243G mutation affects only few copies of the mtDNA, whereas
remaining copies are accurate, so heteroplasmy level is usually low. Indeed there are many
carriers this specific mutation and they remain symptom free due to very low grade of
heteroplasmy.
Although, in a patient, various body tissues are used to indicate the degree of heteroplasmy e.g.
peripheral leucocytes or post mitotic tissue, but it really varies at the level of individual cell (84).
As the insulin producing cells in the Pancreas are sensitive to ATP/ADP ratio, hence any
alteration in the production of ATP by the mitochondria will influence the secretion of insulin as
well. This describes the considerable role of mtDNA A3243G mutation in the development of
diabetes in these people.
Moreover, for some reason, the cells in the cochlear portion of the ear are also found to be more
susceptible to energy deficiency. Hence, any disruption in ATP production can also affect the
normal hearing power of the patients with mitochondrial diabetes. This leads to the development
of “Sensory-neural deafness” along with diabetes. Hence, due to the combination of these two
defects, this disease got its present name of MIDD, “Maternally Inherited Diabetes and
Deafness” (85).
Biochemically, A3243G mutation in tRNALeu(UUR) gene of the mtDNA appears to interfere not
only with the synthesis of tRNALeu(UUR), but also with the binding of the transcription termination
factor, thereby causing defects in the synthesis of proteins encoded by mtDNA. A3243G
mutation can lead to decrease availability of charged tRNALeu(UUR). Hence it can be well
imagined that this mtDNA mutation will also alter translation quantitatively (86). The proteins,
encoded by mtDNA, form the subunits of mitochondrial respiratory chain complexes. The
23
defects in the synthesis of these proteins can disturb these complexes and result in the failure of
ATP production and impaired release of insulin from the β cells of pancreas. Biochemically, this
mutation alters the sensitivity of pancreatic cells to hyperglycemia and halts efficient release of
insulin. This mutation also disturbs the synthesis of OXPHOS subunits which are encoded by
mtDNA. The decrease in the OXPHOS components, due to mtDNA A3243G mutation, impairs
the normal functioning of OXPHOS system (87). Such variation in the tRNA gene mainly affects
translation, either its rate or the end product (88).
Anyhow, the fundamental mechanism by which this happens is still an important issue to be
investigated by the researchers.
It is seen that the A3243G mutation slightly changes the morphology of the tRNA. Because of
this altered structure, the tRNA is not capable to recognize the correct amino acid i.e. Leucine.
Hence, aminoacylation becomes defective. Moreover the defect may be in the form of failure to
provide the amino acid Leucine to the Ribosome when required. Instead another wrong amino
acid gets incorporated in to the newly formed polypeptide. As a consequence of wrong
substitution the mtDNA encoded 13 proteins are not synthesized accurately.
Unfortunately these proteins are linked with oxidation of nutrients and generation of energy rich
phosphate compounds, hence ultimately the cells get “starved” of power supply. To conclude,
mtDNA A3243G mutation leads to an overall decrease in the tRNALeu(UUR), defective
aminoacylation and inefficient post translational modification of tRNA and proteins (89, 90, 91).
This is how mitochondrial dysfunction, due to A3243G mutation, is strongly linked with the
development of maternally inherited type 2 diabetes. However, it is still uncertain how the
defects in mitochondrial oxidative phosphorylation in pancreatic β–cells could affect their

24
normal functions. It has been estimated the approximately 85% of the individuals who carry
A3243G mutation become victims of diabetes before the age of 40 years. This trend indicates
that A3243G mutation is a potent diabetogenic mutation in carriers. Usually insulin producing
cells bear 30% of mutant mtDNA, whereas 75% mutant mtDNA is needed to alter the
mitochondrial function (92).
However, it can be concluded that mitochondrial dysfunction is associated with impaired glucose
tolerance and development of maternally inherited diabetes. In the A3243G mutation, ability to
pour insulin into the circulation is reduced but insulin resistance has not been observed (93).
Clinical aspects of type 2 diabetes mellitus with A3243G mutation:
The clinical presentation of maternally inherited type 2 diabetes linked with A3243G mutation
has been discussed thoroughly by Guillausseau et al. (2001) (94) and can be summarized as
diabetes having following characteristics:
1. It accounts for 1–2% of diabetics with mitochondrial diabetes phenotype (95).
2. This type of diabetes is usually treated with Insulin, oral hypoglycemics like
Sulphonylureas, or simply by controlling dietary intake of carbohydrate (96).
3. Most of these patients have low or normal body mass index (BMI) and are not obese
(97).
4. Show absence of autoimmune markers as identified in T1DM and there is absence of anti
– GAD (Glutamic Acid Carboxylase) antibodies in blood (98).
5. Usually accompanied with sensorineural hearing defect. The most characteristic audio
graphic curve is sloping.
25
6. Later on cardiomyopathies and other neurological symptoms may be seen in individuals
carrying A3243G mutation.
7. Rarely renal complications may be observed (99).
Therefore we can say that maternally inherited diabetes usually presents clinically with a picture
resembling both types of diabetes i.e. T1DM and T2DM.
Impaired hearing is not a rare abnormality in adults, rather it is a common defect routinely
encountered in the clinics. Mostly the victims of defective hearing are the patients belonging to
the old age group i.e. more than 65 years of age. Studies have reported that several factors and
pathologies are involved in the pathogenesis of hearing defect. Some mutations in genes are seen
to be strongly linked with deafness, but role of environmental factors cannot be over looked
(100). Several studies have shown that impaired hearing is a characteristic feature in the patients
as well as carriers of the A3243G mutation. This can assist the researcher in the recognition of
patients as well as carriers of maternally inherited mitochondrial diabetes due to A3243G
mutation. The process by which the hearing defect is linked with the A3243G mutation is yet to
be explored. Moreover, a variety of other nuclear as well as mitochondrial genes are also
implicated in the defective hearing (100, 101).
During the course of analyzing tRNA genes, numerous other mutations have been recognized
and considered to be important threat to produce diabetes. However the prevalence of these
mutations is very low. Moreover environmental factors, aging process and persistent
hyperglycemia can lead to the accumulation of A3243G mutation in the individuals (102).
To conclude, today, mitochondrial diabetes appears similar to wave in the open sea, mustering
up the strength to collide with the sea shore. In due time, it would certainly become strong
enough to leave devasting effects for the society and far from the control of medical specialists.
26
OBJECTIVE OF PRESENT STUDY:
Diabetes due to mutations of mtDNA is emerging as a one of the most dreadful threats to human
health. As in Pakistan, no information and study is available to evaluate the types of
mitochondrial DNA mutation seen more frequently in population affected with type 2 diabetes
mellitus, this study was conducted to ascertain the prevalence of the most common diabetogenic
mtDNA mutation i.e. A3243G substitution in a mitochondrial tRNALeu(UUR) gene in type 2
diabetes mellitus. As this might help us to determine genotype – phenotype correlation for the
mentioned disease in Pakistani population. Moreover, after finding such mutation in Pakistani
population, modulating mitochondrial gene expression might be an interesting therapeutic
approach to help address these mitochondria based diseases.
27
STATISTICAL ANALYSIS
All statistical calculations were done with computer software programme “Statistical Package for
Social Sciences (SPSS)” for windows, version 15.00. Data was subsequently examined by
Independent – Sample T-test. The results are phrased as mean ± s.e.m. Significance level
(p- value more than 0.05) was taken as statistically significant. Percentage was calculated by
dividing the number of subjects showing positive results with the total no of subjects analyzed in
each categorized group and multiplying the obtained value with 100.
28
Chapter 2 Materials and Methods
This study was carried out in the Centre for Research in Experimental and Applied Medicine
(CREAM) affiliated with the department of Biochemistry and Molecular Biology, Army Medical
College Rawalpindi. This study was retrospective, analytical case control study. Patients
were randomly selected from Military Hospital, Rawalpindi, Combined Military Hospital,
Multan and rural areas near Chakri Road, Rawalpindi. The study was conducted according to the
declaration of Helsinki and Ethics were approved by the National University of Sciences and
Technology (NUST). Written informed consent was taken from all of the subjects, included in
the study, explaining the nature of the project. A questionnaire was used to screen patients.
Subjects were sub-divided into three groups. Fifty patients with type 2 diabetes mellitus,
maternal history of diabetes plus one or more features of mitochondrial diabetes (group 1).
Salient features of mitochondrial diabetes were defined as bilateral sensorineural deafness, onset
of diabetes before the age of 40 years and requirement of insulin therapy, either at the time of
diagnosis or later on. Audiometric services of the hospitals were used to confirm sensorineural
hearing loss. Fifty, healthy and symptom free, first-degree relatives of the patients with type 2
diabetes mellitus were also included (group 2) in the study and 50 non – diabetic controls with no
maternal history of diabetes (group 3) were also selected. Fifty patients showed only maternal
history of diabetes either in mother or grandmother affecting at least three persons in the family
from maternal side. Presence of diabetes in father or grandfather was cautiously ruled out.
Diagnosis of T2DM was based on oral glucose tolerance test (OGTT) and clinical criteria i.e.
early onset of diabetes (30 – 40 yrs of age) treated with oral hypoglycemics or insulin later on.
Fifty controls (Group 3) were selected randomly and presence of diabetes was ruled out by
thorough clinical examination, OGTT and plasma glycosylated hemoglobin measurement.
HbA1c less than 6% was taken as normoglycemic.
29
BLOOD SAMPLING:
Blood samples from affected and normal members of the different study groups were collected
under sterile conditions. The blood was collected in the test tubes containing anticoagulant i.e.
Ethylene Diamine Tetra Acetic Acid (EDTA 1 mg/ml) as an anticoagulant to reduce DNA
degradation and stored at -70 oC. Five ml of whole venous blood was collected. Blood (2ml) was
used for DNA extraction and subsequent molecular studies. 3ml of blood was transferred to an
aliquot for estimation of glycosylated hemoglobin, plasma glucose, plasma urea, plasma
cholesterol and plasma triglycerides levels.
MOLECULAR STUDIES:
Molecular studies were done at Centre for Research in Experimental and Applied Medicine
(CREAM), Army Medical College, Rawalpindi. MtDNA was isolated from peripheral blood
leukocytes of the subjects, and then a mt DNA fragment surrounding the tRNALeu(UUR) gene was
amplified by the technique of polymerase chain reaction (PCR). One set of primers was used in
PCR. These fragments were further subjected to the digestion by restriction endonuclease
enzyme known as ApaI and were subjected to agarose gel electrophoresis. As A to G substitution
creates a recognition site for Apa1 restriction endonuclease enzyme. To find a novel mutation in
specified mtDNA region, mtDNA fragments were directly sequenced with an
autosequencer (103).
EXTRACTION OF TOTAL GENOMIC DNA:
Peripheral blood leucocytes were used as a source of total genomic DNA by Kit method
(GENTRA, USA). Total genomic DNA is of High molecular weight. In this procedure, 300 µl of
whole blood was added to 1.5 ml microfuge tube, after adding 900 µl of RBC lysis solution and
30
incubated at room temperature for 1 min. while incubation, microfuge tube was gently inverted
for 10 times. Then tube was centrifuged for 20 sec at 13,300 rpm in a microfuge (Beckman
TM
Coulter ) and supernatant was removed with a pipette leaving 10 – 20 µl behind. Contents of
tube were vortexed for 10 sec and 300-µl cell lysis solution was added to cause lysis of RBCs in
the presence of DNA stabilizer. Cell lysate was placed on ice for quick cooling and 100 µl of
protein precipitation solution was added to remove proteins. After centrifugation at 13,300 rpm
for 1 min, proteins were precipitated and formed thick brown pellet. To recover genomic DNA,
supernatant was poured into another 1.5 ml microfuge tube already having 300 µl of 100%
propanol, mixed by gently inverting the tube at least 45 – 50 times followed by centrifugation at
13,300 x g for 1 min. Total genomic DNA showed itself as small white pellet. Supernatant was
poured off and 300 µl of 70% Ethanol was used to wash DNA pellet. Ethanol was then removed
carefully and tube was subjected to air dry for 5 min. Finally 100 µl DNA Hydration Solution
was added, vortexed for 5 min and incubated at 65oC for 2 hours.
WHOLE GENOMIC AMPLIFICATION OF HUMAN MITOCHONDRIAL DNA FROM
TOTAL DNA FOLLOWING A STANDARD KIT:
PRINCIPLE:
This standard kit method (QIAGEN REPLI – g MITOCHONDRIAL DNA KIT)) was based on
the principle of Multiple Displacement Amplification (MDA) technology, which carries out
isothermal amplification of the human mitochondrial genome from small DNA samples with the
help of DNA polymerase. The sample DNA was denatured by an incubation in REPLI – g
Mitochondria Reaction Buffer for 5 minutes at 750C. After denaturation had been stopped by
cooling the solution to room temperature REPLI – g Midi DNA Polymerase was added.
Isothermal amplification reaction was carried for 8 hours.

31
Template DNA (10 µl) was added into a 1.5 ml centrifuge tube and its volume was adjusted to
20 µl with RNAase free water. Then 29 µl REPLI – g mitochondrial reaction buffer was added to
denature the DNA template. It was mixed by vortexing and centrifuging briefly. The sample was
incubated for 5 minutes at 750C and then allowed to cool down to room temperature (250C).
REPLI – g Midi DNA Polymerase was thawed on ice and 1 µl was added to the DNA, mixed
and centrifuged briefly. The sample was incubated at 33oC for 8 hours. REPLI – g Midi DNA
Polymerase was inactivated by heating the sample for 3 minutes at 650 C. The sample was
visualized on 1% agarose gel to see the amplification of mtDNA. The sample was stored at 4oC.
POLYMERASE CHAIN REACTION (PCR) OF MITOCHONDRIAL DNA:
The segments of mitochondrial DNA surrounding np 3243 were subjected to PCR for
amplification with the help of AmpliTaq DNA polymerase. Polymerase chain reaction (PCR)
was performed according to standard procedure. The total volume was 50 µl which contained 2
µl of mtDNA, 5 µl of Buffer solution of PCR, 5 µl of MgCl2, 1 µl of dNTPs, 2 µl of Forward
Primer, 2 µl of Reverse Primer, 0.25 µl of Taq Polymerase and 32.75 µl of Deionized water.
Forward Primer was 5’– CGTTTGTTCAACGATTAAAG –3’ covering position 3035 to 3054
and Reverse Primer was 5’– AGCGAAGGGTTGTACTAGCC –3’ covering position 3437 to
3456. The contents were vortexed briefly and tube was placed in thermocycler for conventional
PCR to amplify 422-bp mt. DNA fragment (104). In the start DNA was denatured at 94oC for 5
min. This was followed by PCR (40 cycles), with the following thermal cycling conditions: one
minute at 94oC, one minute at 55oC, one minute at 72oC, then final extension for 10 minutes at
72oC in thermal cycler (Applied Biosystems, USA; Biometra, Germany).
32
The PCR products were subjected to electrophoresis on Ethidium Bromide stained 4 % agarose
gel. Amplified mitochondrial DNA (422-bp) containing nucleotide base pair 3243 was digested
by ApaI and electrophoresed on Ethidium Bromide stained 2 % agarose gel. The PCR products
were sequenced directly (BECKMAN COULTER, USA)
HORIZONTAL GEL ELECTROPHORESIS:
2 % Agarose gel was prepared by melting 1 g of agarose in 50 ml of 1 X TBE buffer
(0.89M Tris-Borate, 0.032 M EDTA, pH 8.3) in a microwave oven for two minutes. Ethidium
Bromide (20 µg / ml) was added in the gel to a final concentration of 0.5 µg/ ml to facilitate
visualization of DNA after electrophoresis. After mixing the PCR products with gel loading
buffer (0.25 % bromophenol blue in 40 % w/v Sucrose in water), slots of the gel were loaded.
Electrophoresis was performed at 100 V for 30 minutes in 1 X TBE buffer. Amplified products
were visualized by placing the gel under UV Transilluminator (Biometra, Germany). A 100 bp
DNA ladder (MBI-Fermantas, England) was also used to verify sizes of the amplified
mitochondrial DNA fragments.
33
PCR – RESTRICTION FRAGMENT LENGTH POLYMORPHISM
(PCR – RFLP) ANALYSIS:
PRINCIPLE:
PCR amplified mitochondrial DNA of 422 – bp length was subjected to the digestion by
restriction enzyme ApaI (Fermentas Life Sciences) to find out A3243G mutation and followed
by electrophoresis on 4 % agarose gel stained with Ethidium Bromide.
PROCEDURE:
PCR reaction mixture (10 µl) was added to 0.1 – 0.5 µg of DNA (amplified 422 bp mt. DNA).
Then 18 µl of nuclease free water was added followed by 2 µl of 10X buffer. Finally, 2 µl of
ApaI was added and mixed gently, spun down briefly and incubated at 37oC for 2 hours. Then
ApaI was inactivated by incubation at 65oC for 20 minutes. Products were electrophoresed on 4
% agarose gel stained with Ethidium Bromide to find out the action of restriction enzyme on the
422 – bp Fragment of mitochondrial DNA. This was followed by direct sequencing of the 422 –
bp Fragment of mitochondrial DNA.
DNA SEQUENCING:
DNA purification was done by standard kit method followed by DNA sequencing PCR.
Polymerase Chain Reaction was performed according to the standard procedure in a total volume
of 20 µl, containing 5 µl of dH2O, 5 µl of DNA template, 2.0 µl of 1.6 µM Sequencing Primer,
and 8.0 µl of DTCS Quick Start Master Mix.
Then PCR was carried out for 30 cycles, with the following thermal cycling conditions:
96oC for 20 sec, 50oC for 20 sec and 60oC for 4 min. PCR was followed by Ethanol
Precipitation. It was performed according to standard procedure in sterile 0.5 ml microfuge

34
tubes. Freshly prepared Stop Solution (2 µl of 3M Sodium Acetate (pH 5.2), 2 µl of 100 mM
Na2+- EDTA (pH 8.0) 1µl of 20 mg/ml Glycogen) was added to each of the labeled tubes.
Sequencing reaction was transferred to the appropriately labeled 0.5 ml microfuge tube and
mixed thoroughly followed by addition of 60 µl of chilled 95 % (v/v) ethanol/dH2O. Tube was
centrifuged immediately at 14,000 rpm at 4 oC for 15 min. DNA pellet was visible. Supernatant
was removed carefully with a micropipette. The pellet was rinsed 2 times with chilled 200-µl 70
% (v/v) ethanol/dH2O. For each rinse, centrifugation was done at 14,000 rpm at 4 oC for 2 min.
after centrifugation the supernatant was removed carefully with a micropipette. Then tube was
vacuum dried for 10 minutes and sample was resuspended in 40 µl of the sample loading
solution (SLS).
The resuspended samples were transferred to the appropriate wells of the sample plate and
overlaid with one drop of light mineral oil. The sample plate was loaded into the instrument and
desired sequencing procedure was started.
35
METABOLIC STUDIES
ESTIMAT1ON OF PLASMA GLUCOSE:
Plasma glucose was estimated by enzymatic colorimetric method using glucose oxidase enzyme
to oxidize glucose (105, 106).
PRINCIPLE:
This method is based on the oxidation of glucose in the presence of enzyme glucose oxidase. In
this reaction, oxidation of glucose leads to the formation of gluconic acid and hydrogen peroxide,
which is liberated. The liberated hydrogen peroxide reacts with phenol and 4 – aminophenazone
to form a red – violet quinoneimine. This reaction is catalyzed by the enzyme peroxidase. The
quantity of quinoneimine formed determines the amount of glucose in the sample.
REAGENTS:
a. Reagent RI: 70 mmol/L of phosphate buffer (pH 7.5), 5 mmol / L of phenol, 10 U / ml of
enzyme glucose oxidase, 1 U / ml of peroxidase and 0.4 mmol/L of 4– aminophenazone.
b. Standard: 5.55 mmol / L of glucose
PROCEDURE:
Three cuvettes of 1 cm light path were taken and labeled as blank, sample and standard. 1.0 ml
of working reagent (R1) was added to all of the three cuvettes. Then 10 µl of distilled water was
added to “blank”, 10µl of sample to “sample” and l0 µl of standard was added to “standard”
cuvettes. Contents in the cuvettes were mixed and incubated for 10 minutes at 37 °C.
The absorbance of sample and reagent was measured against blank reagent at 510 nm
wavelength.
36
CALCULATION:
Plasma glucose (mmol/L) = Absorbance of sample x 5.55

Absorbance of standard
DETERMINATION OF GLYCOSYLATED HEMOGLOBIN:
Glycosylated hemoglobin (HbA1c) was determined by micro column method (ion exchange
chromatography) (107).
PRINCIPLE:
In ion exchange chromatography, first of all a hemolysate of the sample is prepared. The labile
component of the hemolysate was removed with the help of cationic exchange resin. Solutions
were exchanged for anionic groups on the resin. Only charged components (ions) can be
separated by ion exchange chromatography. Glycosylated hemoglobin was particularly isolated
and the HbAla + HbAlb fraction was removed, and was determined by direct reading on Microlab
Spectrophotometer at wavelength of 415 nm.
REAGENT CONCENTRATION:
R1:
Potassium phthalate 50 mmol/l
Sodium azide 0.95g/l
Detergent 5 g/l
37
R2:
Phosphate buffer (pH 6.5) 30 mmol / l
Sodium azide 0.95 g / l
R3:
Phosphate buffer (pH 6.5) 72 mmo1 /l
Sodium azide 0.95 g / l
Micro columns:
Accomodates a pre-weighed quantity of resin weighed same to the phosphate buffer 72 mmol/l
(pH 6.5) and sodium azide 0.95 g/l. Micro columns and reagents of the same lot were used.
PROCEDURE:
The temperature of the columns and the reagents was brought to the room temperature
(21 – 26 °C). To prepare the hemolysate, 50 µl of the blood sample and 200 µl of reagent “R1”
were taken in a test tube and shaken thoroughly. Then the test tube was left for 15 minutes.
Upper cap of the column was removed and then snapped the tip off the bottom. flat end of the
pipette was used to push the upper disc down to the resin surface. Precaution was taken to avoid
compressing it. The column was emptied completely by allowing the liquid to run out of it.
To separate HbAlc, 50 µl of the hemolysate was taken in a pipette carefully on the upper filter
and column was allowed to drain to waste. Then to remove the sample residue left above the
upper disc, 200 µl of reagent “R2” was added and the column was allowed to drain to waste. The
column was placed over a test tube and 4 ml of Reagent “R3” was added and elute was collected
which was HbAlc fraction. The test tube was shaken thoroughly and absorbance (A) of the HbAlc
(AHbA1c) fraction at 415 nm against distilled water was read.

38
To calculate HbTOTAL, 12 ml of R3” and 50 µI of the hemolysate was taken in a test tube and was
shaken thoroughly. Then the absorbance AHb TOTAL was read against distilled water.
CALCULATION:
% HbA1c = AHbA1c x AHbA1c x 100

AHb TOTAL x VHb TOTAL
The volume of HbA1c (VHbA1c) was 4 m1, the volume of Hb TOTAL (VHb TOTAL) was 12 ml. the
following formula was deduced for the calculation of the concentration:
AHbAlc_ x 100 = % HbAlc

AHb TOTAL 3
PLASMA UREA ESTIMATION:
METHOD:
Berthelot method (Enzymatic-Kinetic UV determination of urea in blood) (108).
PRINCIPLE:
This method is based on the hydrolysis of urea in the presence of enzyme urease to produce
ammonia and CO2. The ammonia produced combines with α – ketoglutarate, in the presence of
enzyme glutamate dehydrogenase and reduced form of nicotinamide adenine dinucleotide
(NADH), to yield glutamate and oxidized form of nicotinamide adenine dinucleotide (NAD+).
The decrease in extinction due to decrease in NADH in unit time is proportional to the urea
concentration.
UREA + H2O + 2H+ UREASE 2NH4+ + CO2

GLDH
2NH4+ + 2α – Ketoglutarate + 2NADH H2O + 2 NAD+ + 2 L- Glutamate
39
REAGENTS:
• Reagent A: TRIS buffer at pH 7.8 and α – ketoglutarate
• Reagent B: Enzyme urease 3750 U/L , enzyme glutamate dehydrogenase 6000U/L and
NADH 0.32 mmol/L
• Standard: Urea 50 mg/dl
PREPARATION OF WORKING REAGENT:
Reagent B (20 ml) was mixed with 80 ml of Reagent A in a vial and kept at a temperature 4 °C
and protected from light.
PROCEDURE:
Two cuvettes of 1 cm light path were taken and labeled as “sample” and “standard”. Sample
(10 µl) was taken in cuvette labeled as “sample” and 10 µl of standard was taken in the cuvette
labeled as “standard”. Then 1ml of working reagent was added to both cuvettes and extinction
was measured as E1 after 30 seconds and E2 after 90 seconds.
CALCULATONS:
Urea concentration (mg/dl) = ∆E of sample x Standard concentration

∆E of standard
40
PLASMA CHOLESTEROL ESTIMATION:
METHOD:
Enzymatic colorimetric method (109, 110).
PRINCIPLE:
This method involves the use of three enzymes: Cholesterol Esterase (CE), Cholesterol Oxidase
(CO), and peroxidase (POD). In the presence of the former, the mixture of ADPS (N-ethyl-N-
propyl-m-anisidine) and 4– aminoantipyrine (4-AA) are condensed by hydrogen peroxide to
form a quinoneimine dye proportional to the concentration of cholesterol in the sample.
REAGENTS:
Monoreagent:
PIPES 200 mmol/L pH 7.0, Sodium cholate 1 mmol/L, cholesterol esterase >250 U/L,
cholesterol oxidase >250 U/L, peroxidase > 1KU/L, 4 – aminoantipyrine 0.33 mmol/L, ADPS
0.4 mmol/L, non-ionic tensioactives 2g/L (w/v). Biocides.
Cholesterol Standard:
Cholesterol 5.18 mmol/l
Organic matrix based primary standard.
PROCEDURE:
Three labeled tubes (blank, sample, standard) were taken. 1.0 ml of Monoreagent was added to
all the tubes. Sample (10 µl) was added to sample tube and 10 µl of Cholesterol standard was
added to standard tube. Contents were mixed and incubated for 5 minutes at 37oC. Absorbance
was recorded at 550 nm against the reagent blank.

41
CALCULATONS:
Total Cholesterol (mg/dl) = A Sample X ConcStandard

AStandard
Total cholesterol (mmol/L) = mg/dl X 0.0259
PLASMA TRIGLYCERIDE ESTIMATION:
METHOD:
Enzymatic colorimetric method (111, 112, 113).
PRINCIPLE:
Enzyme lipoprotein lipase (LPL) hydrolyzes triglycerides to form glycerol and then oxidize to
form Dihydroxyacetone phosphate and hydrogen peroxide. The hydrogen peroxide reacts with 4-
aminoantipyrine and 4-chlorophenol to produce a red dye. The enzyme needed is peroxidase. In
the presence of buffer, 4-chlorophenol and enzymes, following chain of reactions takes place.
Lipases
Triglycerides + 3H2O Glycerol + 3 RCOOH
GK Glycerol – 3 – phosphate + ADP

Glycerol + ATP
GPO
Glycerol–3–phosphate + O2 Dihydroxyacetone phosphate + H2O2
POD
H2O2 + 4-Aminantipyrine + 4-chlorophenol Quinoneimine + HCl + H2O
42
REAGENTS:
MONOREAGENT:
PIPES buffer (pH 7.5) [piperazine-N, N-bis(2-ethanesulfonic acid)]: 50 mmol/l;
4-chlorophenol: 5.0
Magnesium ions 4.5 mmol/l
4-aminoantipyrine 0.25
ATP 2
Lipases > 1.3 U/ml
Peroxidase > 0.5 U/mL
Glycerol Kinase > 0.4 U/mL
Glycerol – 3 – Phosphate oxidase > 1.5 U/Ml
STANDARD:
Triglycerides 2.28 mmol/l (200 mg/l)
PROCEDURE:
Two cuvettes were labeled as sample and standard. In one cuvette sample (10 µl) and to the other
cuvette standard (10 µl) was added. Then working reagent (1000 µl) was added to both the
cuvettes. Contents were mixed and incubated for 10 minutes at 25 oC. Absorbance of the sample
and the standard was measured against the reagent blank within 60 minutes.
43
CALCULATONS:
conc. (mg/dl) = ∆Asample x 200

∆Astandard
conc. (mmol/L) = ∆Asample x 2.28

∆Astandard
DETECTION OF GLUCOSE IN URINE:
PRINCIPLE:
The detection of glucose in urine was based on Glucose Oxidase–Peroxidase–Chromogen
reaction (114).
Glucose + Oxygen (air) Gluconic acid + Hydrogen peroxide
Hydrogen peroxide + Chromogen Oxidized chromogen (blue) + Water
REAGENTS:
Glucose oxidase 2.1 %
Peroxidase 0.9 %
O-tolidine- hydrochloride 0.5 %
METHOD:
The multitest urine chemistry dipstick was removed from the container and the container was
closed immediately with original cap. Test strip was immersed in the urine for two seconds to
cover the reagent areas completely. Excess of urine from the strip was removed by wiping the
edge of the strip on the absorbent paper. The strip was held in horizontal position during
44
incubation to prevent interaction between adjacent test areas. Color of the reagent areas on the
strip were compared with the corresponding color chart on the container, 60 seconds after
immersion, and interpreted.
CLINICAL EXAMINATION FOR DEAFNESS:
Audiography was performed for the detection of type and extent of hearing loss (115, 116).
BODY MASS INDEX (BMI):
Body weight (Kg) and height (cm) was determined and BMI was calculated. Body mass index
(BMI) of 20 – 25 kg/m2 was considered as normal. A person was considered obese if his body
mass index (BMI) was 30 kg/m2 or more and a BMI value less than 18.5 kg/m2 was taken as low
(117).
BMI was determined by the following formula.
BMI = Weight (Kg)
Height ( m2 )
45
Chapter 3 Results
Fifty patients of Type 2 diabetes mellitus with a maternal history of diabetes mellitus (Group 1),
fifty first-degree relatives of the patients with T2DM (Group 2) and fifty normal, healthy and
non-diabetic subjects (Group 3), with no maternal history of diabetes mellitus were thoroughly
investigated and underwent a standard 75g oral glucose tolerance test (OGTT) to confirm
diagnosis of T2DM. Group 1 comprised of 36% females and 64 % males. There were 40 %
females and 60 % males in group 2, and 46 % females and 54 % males in group 3. Blood
samples were analyzed for estimation of plasma glucose, HbA1c, plasma urea, plasma cholesterol
and triglyceride (TG). The data of body height in meters and weight in kilograms was also
collected to find out body mass index (BMI). The classification and diagnosis of diabetes and
impaired glucose tolerance were established by standard WHO diagnostic criteria.
46
Chapter 3 Results
MOLECULAR STUDIES:
DETECTION OF A3243G MUTATION:
The amplified PCR product of mtDNA was 422 bp in length. After digestion with restriction
endonuclease enzyme, ApaI, it was to be separated into 210 bp and 212 bp fragments if it had a
substitution of A to G at np 3243 to constitute the recognition site for ApaI.
We could not identify any A-to-G mutation at position 3243 of mitochondrial leucine tRNA gene
in 50 patients, 50 normal subjects with no family history of diabetes and even in 50 non-diabetic
first-degree relatives of the patients with a maternal inheritance of diabetes. The initial negative
results of the less sensitive method i.e. ApaI digestion technique, were confirmed by direct
sequencing. Results of selected few cases are shown in figures 3.1 to 3.25.
47
Chapter 3 Results
1 2 3 4 5 6 7
Figure 3.1: Electropherogram of Ethidium bromide stained 2 % agarose gel for total
genomic DNA of Patients with type 2 diabetes mellitus with no complaint of deafness
(Lane 1 to Lane 16)
1 2 3 4 5 6 7
genomic DNA of Patients with type 2 diabetes mellitus with deafness (Lane 1 to Lane 11)
1 2 3 4 5 6 7
genomic DNA of first degree relatives of the patients with type 2 diabetes mellitus with no
compliant of deafness (Lane 1 to Lane 7)
48
Chapter 3 Results
1 2 3 4 5 6 7 8 9 10 11 12 13
genomic DNA of first degree relatives of the patients with type 2 diabetes mellitus and
deafness (Lane 1 to Lane 13)
1 2 3 4 5 6 7
genomic DNA of control group (Lane 1 to Lane 7)
49
Chapter 3 Results
1kb DNA
1 2 3 4 5 6 7 8 9 Ladder
16569 bp
1000 bp
Figure 3.6: Electropherogram of Ethidium Bromide stained 2 % agarose gel for
mitochondrial DNA of the patients with type 2 diabetes mellitus and deafness
(Lane 1 to 9)
1 kb DNA
1 2 3 4 5 6 7 Ladder
16569 bp 1000 bp
Figure 3.7: Electropherogram of Ethidium Bromide stained 2 % agarose gel for
mitochondrial DNA of Patients with type 2 diabetes mellitus and no complaint of deafness
(Lane 1 to 7)
1kb DNA
1 2 3 4 5 6 7 8 9 Ladder
16569 bp 1000 bp
Figure 3.8: Electropherogram of Ethidium bromide stained 2 % agarose gel for
mitochondrial DNA of the first degree relatives of the patients with type 2 diabetes mellitus
and deafness (Lane 1 to 11)
50
Chapter 3 Results
1kb DNA
1 2 3 4 5 Ladder
16569 bp 1000 bp
mitochondrial DNA of the first degree relatives of the patients with type 2 diabetes mellitus
and no complaint of deafness (Lane 1 to 6)
1kb DNA
1 2 3 4 5 6 7 Ladder
16569 bp 1000 bp
mitochondrial DNA of the control group (Lane 1 to 8).
51
Chapter 3 Results
100 bp DNA
1 2 3 4 5 6 Ladder
422 bp 500 bp
Figure 3.11: Electropherogram of Ethidium bromide stained 4 % agarose gel for amplified
422 bp segment of mitochondrial DNA in Patients with type 2 diabetes mellitus and
deafness (Lane 1 to 8)
100 bp DNA
1 2 3 4 5 6 7 Ladder
422 bp 500 bp
422 bp segment of mitochondrial DNA in Patients with type 2 diabetes mellitus with no
complaint of deafness (Lane 1 to 7)
100bp DNA
1 2 3 4 5 6 7 Ladder
422 bp 500 bp
422 bp segment of mitochondrial DNA of first degree relatives of Patients with type 2
diabetes mellitus with deafness (Lane 1 to 8)
52
Chapter 3 Results
100 bp DNA
1 2 3 4 Ladder
422 bp 500 bp
422 bp segment of mitochondrial DNA of first degree relatives of the patients with type 2
diabetes mellitus and no complaint of deafness (Lane 1 to 4)
100 bp DNA
1 2 3 4 Ladder
422 bp 500 bp
422 bp segment of mitochondrial DNA of the control group (Lane 1 to 8)
53
Chapter 3 Results
100 bp DNA
1 2 3 4 5 6 Ladder
422 bp 500 bp
Figure 3.16: Electropherogram of Ethidium bromide stained 4% agarose gel for
ApaI – digestion of 422 bp segment of mitochondrial DNA showing no cleavage and
absence of A3243G mutation in the patients with type 2 diabetes mellitus with no
complaint of deafness (Lane 1 to 6).
100 bp DNA
1 2 3 4 5 6 7 Ladder
422 bp 500 bp
absence of A3243G mutation in Patients with type 2 diabetes mellitus and deafness
(Lane 1 to 7).
54
Chapter 3 Results
100 bp DNA
1 2 3 Ladder
422 bp 500 bp
absence of A3243G mutation in first degree relatives of the patients with type 2 diabetes
mellitus and deafness (Lane 1 to 6).
100 bp DNA
1 2 3 4 Ladder
422 bp 500 bp
absence of A3243G mutation in first degree relatives of the patients with type 2 diabetes
mellitus and no complaint of deafness (Lane 1 to 7).
55
Chapter 3 Results
100 bp DNA
1 2 3 4 5 Ladder
422 bp 500 bp
absence of A3243G mutation in the control group (Lane 1 to 8).
56
Chapter 3 Results
Figure 3.21: Sequence alignment showing no A to G substitution at 3243 position in mtDNA
of the Patient with T2DM and deafness.
57
Chapter 3 Results
Figure 3.22: Sequence alignment showing no A to G substitution at 3243 position in
mtDNA of the Patient with T2DM with no complaint of deafness.
58
Chapter 3 Results
Figure 3.23: Sequence alignment showing no A to G substitution at 3243 position in mtDNA of
the first degree relative of the patient with T2DM and deafness.
59
Chapter 3 Results
Figure 3.24: Sequence alignment showing no A to G substitution at 3243 position in
mtDNA of the first degree relative of the patient with T2DM and no complaint
of deafness.
60
Chapter 3 Results
Figure 3.25: Sequence alignment showing no A to G substitution at 3243 position in mtDNA
of the control group.
61
Chapter 3 Results
METABOLIC STUDIES:
The details of the results for individual cases are given in appendix tables I to 9. The
results have been summarized and means and s.e.m. (standard error of means) of control subjects
and different study groups are shown in tables 1 to 3 and figures 3.26 to 3.28.
Table 3.1 shows the distribution of age of onset of diabetes mellitus, age of onset of
deafness, plasma glucose and glycosylated hemoglobin levels among various study groups.
Mean age at which the patients developed diabetes mellitus was found to be 35.86 years. Mean
age at which the patients developed deafness was found to be 47.06 years. Mean plasma glucose
and glycosylated hemoglobin level in patients of maternally inherited type 2 diabetes mellitus
was significantly higher (p< 0.001) as compared with control group. These comparisons are
shown in figure 3.26. Whereas no significant statistical difference in plasma glucose and
glycosylated hemoglobin was observed in comparison of first-degree relatives of diabetic
patients with control group.
Table 3.2 shows the variation of plasma urea, plasma cholesterol and plasma triglyceride levels
among control subjects and other study groups. Plasma urea, plasma cholesterol and plasma
triglyceride level of patients with maternally inherited type 2 diabetes mellitus was significantly
higher (p< 0.001) as compared with control subjects. This comparison is shown in figure 3.27.
62
Chapter 3 Results
TABLE – 3.1
Comparison of Age of onset of maternally inherited T2DM, Age of onset of deafness (mean ±
standard deviation (SD), plasma glucose and glycosylated hemoglobin levels (mean ± s.e.m) of
patients with maternally inherited T2DM and first-degree relatives of diabetics with control
group. The number of patients is given in parenthesis.
Age of onset Age of onset of

Glycosylated
of T2DM deafness Plasma glucose
Group hemoglobin
(years) (years) (mmol/L)
(%)
(mean + SD) (mean + SD)
Diabetics
35.86 + 5.23 47.06 + 6.32 13.36 + 0.94*** 9.39 + 0.43***
(50)
First-degree
relatives of
5.01 + 0.09 5.34 + 0.09
diabetics
-------- --------
(50)
Non – Diabetic
Controls 5.13 + 0.08 5.55 + 0.10
-------- --------
(50)
***p <0.001 as compared with normal control subjects (highly significant).
63
Chapter 3 Results
25
20
13.36
15
mmol/L
9.39
9.12
10
5.67
5.55
5.34
5.13
5.09
5.01
0
Plasma Glucose HbA1c Plasma Uea
T2DM 1st Degree Relative Control
FIGURE 3.26: Comparison of means of, Plasma Glucose, HbA1c and plasma urea among
various study groups.
64
Chapter 3 Results
TABLE – 3.2
Comparison of Plasma Urea, Plasma Cholesterol and Plasma Triglyceride level of the patients
with maternally inherited T2DM and first-degree relatives of diabetics with control group
The number of patients is given in parenthesis.
The values are mean ± s.e.m.
Group plasma urea plasma cholesterol Plasma

(mmol/L) (mmol/L) Triglyceride
(mmol/L)
Diabetics
(50) 9.12 + 0.65*** 6.054 + 0.24*** 1.78 + 0.04***
First-degree
relatives of
5.09 + 0.19 4.44 + 0.13 1.31 + 0.03
diabetics
(50)
Non – Diabetic
Controls 5.67 + 0.24 4.78 + 0.15 1.32 + 0.04
(50)
***p = 0.001 or <0.001 as compared with normal control subjects (highly significant).
65
Chapter 3 Results
15.00
10.00
mmol/L
6.05
4.44 4.78
5.00
1.78
1.31 1.32
0.00
Plasma Cholesterol Plasma Triglyceride
T2DM 1st Degree relative Control
FIGURE 3.27: Comparison of means of Plasma cholesterol and plasma triglyceride
among various study groups.
66
Chapter 3 Results
Comparison of Body Mass Index (BMI) of patients with phenotype of maternally inherited
T2DM and first-degree relatives of diabetics with control group is shown in table 3.3. In patients
with maternally inherited T2DM, BMI was significantly less (p< 0.001) as compared with
control subjects. Whereas no significant statistical difference in BMI was observed in
comparison of first-degree relatives of diabetic patients with control group. This comparison is
shown in figure 3.28.
Table 3.3 also shows presence or absence of glycosuria in different study groups. It also shows
the frequency of deafness and dependence on insulin therapy in patients with maternally
inherited T2DM. Deafness was observed in 78 % patients with T2DM, whereas 80 % patients
presented with glycosuria. Out of 50 patients, 76% were dependent on insulin therapy for their
control of plasma glucose level, whereas 24% were able to maintain normal plasma glucose level
with the help of oral hypoglycemic drugs.
DEAFNESS:
Bilateral neurosensory hearing loss was present in 39 of 50 patients (78 %) and was clinically
significant. Hearing loss was documented by audiography. Only four patients required a prosthetic
hearing aid. Mean age at the diagnosis of deafness was found to be 47.06 years. Diabetes was the
first clinical manifestation of the disease in all of the patients, not the hearing loss. Eleven patients
did not present with any complaint of deafness.
67
Chapter 3 Results
TABLE – 3.3
Comparison of Body Mass Index (BMI), deafness, Glycosuria and dependence on insulin
therapy of patients with type 2 diabetes mellitus and first-degree relatives of diabetics with
control group. The number of patients is given in parenthesis.
The values are mean ± s.e.m.
Group BMI Deafness Glycosuria Insulin

(%) (%) Therapy
(%)
Diabetics
(50) 20.26 + 0.39*** 78% 80 % 76 %
First-degree
relatives of
24.20 + 0.52 NIL NIL NIL
diabetics
(50)
Non – Diabetic
Controls 24.52 + 0.53 NIL NIL NIL
(50)
***p = .001 or < 0.001 as compared with normal control subjects (highly significant).
68
Chapter 3 Results
40
30
24.20 24.52
20.26
mmol/L
20
10
0
BMI
T2DM 1st Degree Relative Control
FIGURE 3.28: Comparison of Means of BMI among various study groups.
69
Chapter 4 Discussion
Type 2 diabetes is considered to be the most serious health problem worldwide (118). This rapid
increase in the incidence of T2DM is a constant threat to the people of developed as well as
developing countries. Mutations of mtDNA, particularly in tRNA genes encoded by mtDNA, are
emerging surprisingly as a major cause of maternally inherited type 2 diabetes mellitus in
developed countries. It has been estimated that mitochondrial DNA mutations are responsible for
producing diseases at least one in 1500 adult and are associated with particular disease states,
labeled as “mitochondrial diseases” (119).
A new concept of “Mitochondrial diabetes” has been introduced over the last two to three
decades. It is usually considered as an unremarkable form of diabetes. Clinically, mitochondrial
diabetes can share the symptoms of both types of diabetes mellitus i.e. T1DM & T2DM. Clinical
representation depends mostly on the severity of insulinopenia or involvement of genetic factors.
Final proof, whether it is maternally transmitted mitochondrial diabetes or not, can only be
provided by complete genetic analysis of entire mitochondrial DNA.
It is a well established fact that in some families, diabetes mellitus (particularly type 2 diabetes),
follows a maternal inheritance pattern (120). Therefore, we can say that the mitochondrial DNA
mutations may play an important role in the pathogenesis of diabetes. A few mtDNA mutations
have been identified to be strongly linked with the development of diabetes. Among known
(Leu) UUR
mtDNA mutations, A3243G mutation in tRNA gene is the most commonly detected
mutation (121).
70
MtDNA A3243G mutation in tRNALeu(UUR) gene in Pakistani population:
Pakistani population provides a valuable genetic resource for mapping mtDNA mutations, as this
population has still not been explored with respect to any mitochondrial disease as compared to
other populations in advanced countries like Japan etc. The prevalence of mtDNA A3243G
mutation is yet to be determined in the Pakistani population.
Due to development of more sensitive techniques, the detection of A3243G mutation is easy to
be carried out in the laboratories. It has been detected in mitochondrial diabetes, however its
prevalence is only 1 – 2 % among diabetics (122). In present study, we selected those patients
who clinically presented with the phenotype of maternally inherited type 2 diabetes mellitus to
find out the prevalence of the pathogenic mtDNA A3243G mutation in the tRNALeu(UUR) gene.
We tried to find out the association of T2DM, plus two or more known characteristic features of
mitochondrial diseases, with mtDNA A3243G mutation in Pakistani population. Characteristic
features of mitochondrial diabetes, considered in this study, were pure maternal transmission of
diabetes, normal or low BMI, deafness and insulin dependence. A diagnosis of maternally
inherited type 2 diabetes mellitus was made using a combination of maternal family history of
diabetes, clinical assessment, WHO diagnostic criteria for diabetes and laboratory testing.
Previous studies have proved that almost all carriers of this mutation can develop diabetes at any
stage of their life (123). Hence, first degree relatives of the patients with phenotype of maternally
inherited type 2 diabetes mellitus were also included in this study as an additional group.
Non– diabetic controls, patients with type 2 diabetes and first degree relatives of type 2 diabetics
were scanned for the detection of mitochondrial DNA tRNALeu(UUR) gene (3035 – 3456, 422 bp
fragment) mutation. However, we were unable to detect mtDNA A3243G mutation in
tRNALeu(UUR) gene in any patient, first degree relative of the patients as well as control subjects.
71
This indicates that the variation or mutation within mtDNA bp sequence 3035 – 3456 was not the
major cause of type 2 diabetes mellitus in this selected group of study. We were unable to
identify A3243G mutation in the patients, controls and even the in first degree relatives of those
diabetics who were diagnosed as maternally inherited type 2 diabetes and presented with
defective hearing ability along with insulin dependence.
Similar studies were carried on the patients with maternally inherited diabetes in Poland (124)
and Argentina (125). Both of these studies could not detect even a single A3243G mutation in
mitochondrial DNA. Hence, our results further strengthen the findings of these studies.
However, it is really difficult to reach a conclusion as interaction of wide range of genetic and
environmental factors has been involved in the development of T2DM. Several variants in
mitochondrial DNA can be a significant cause of T2DM. This is due to the fact that ATP is
required in the synthesis and secretion of insulin. This is why, according to the latest trend,
mitochondrial DNA mutations have become the most exciting spots in the diabetes research
field. Several studies have proved that mtDNA variations can lead to diabetes along with other
clinical features of mitochondrial disease. According to the previous literature, the mitochondrial
DNA mutations were frequently identified in type 2 diabetes mellitus especially in the bp
sequence of tRNALeu(UUR) gene. The most frequently detected point mutation is mtDNA A3243G
mutation and its link with diabetes is also well established (126, 127). It was firstly identified and
described in the patients diagnosed as MELAS (Mitochondrial myopathy, encephalopathy, lactic
acidosis and stroke like episodes syndrome) (128). But the exact incidence, clinical features, and
mechanism of development of diabetes due to mtDNA A3243G mutation is largely unknown.
Regarding clinical picture, some overlap of signs and symptoms of type 1 and 2 diabetes mellitus
has been observed (129). Common clinical features, like diabetes, neurosensory hearing loss, a
72
normal or low BMI, short stature, presence of macular, neuromuscular and psychiatric
disturbances, have been linked to the mitochondrial defects resulting in impaired oxidative
phosphorylation (130, 131).
But the situation is a little more complicated. Coordinated action of two genetic sources has been
involved in the biogenesis of functional mitochondria i.e. nuclear genome and mitochondrial
genome. So any defect in one of these genetic sources may contribute in the pathogenesis of
diseases which are mitochondrial in origin (132). This would suggest that mutations in nuclear
genome, inherited from the father or the mother, may lead to significantly higher risk of the
T2DM in Pakistani population. The situation is hard to understand due to the reality that every
cell possesses a large number of mitochondria and a single mitochondrion has multiple copies of
the mtDNA. Hence, the level of heteroplasmy also varies among different tissues. Heteroplasmy
is the highest in postmitotic tissues like pancreas, brain and skeletal muscles, and the lowest in
rapidly dividing cells, such as blood leukocytes – being the commonest source of mtDNA
isolation (133,134,135).
Main role of mitochondrial respiratory chain is to generate energy rich phosphate compound,
ATP. The mitochondrial and nuclear DNA, contained within each cell, encode various proteins.
Some of the proteins encoded by mtDNA also form the components of the OXPHOS system.
Whereas, nuclear DNA encodes the remaining protein components of the respiratory chain as
well as proteins needed for the repair of mtDNA (136, 137). This means that defective
mitochondrial functions can be a consequence of mutation either in mitochondrial or nuclear
DNA (138). In female, mtDNA mutations also affect the mitochondria in the ovarian cells. This
means that the mutation carried by ovum, containing mutant mitochondria, can be transmitted to
all of her offspring. This transmission can produce a mitochondrial disease in the offspring of
73
affected mother. However, severity of the disease transmitted is strongly related with the fact that
how many mutant mitochondria have been transferred to the next generation.
Two rRNA, 22 tRNA and 13 protein coding genes form the total gene content of the
mitochondrial DNA and these contents are completely involved in the synthesis of various
components of oxidative phosphorylation system. Therefore, if there is any mutation in the
mitochondrial DNA, it will affect the mitochondrial OXPHOS system and interfere with the
generation of energy rich compound, ATP. Previous studies have reported approximately twenty
pathogenic point mutations in the mitochondrial tRNALeu(UUR) gene (139, 140). Mitochondrial
DNA tRNALeu(UUR) gene mutations produce various diseases but the clinical presentation has
been found to vary significantly (141, 142).
It has been seen that in mitochondrial tRNALeu(UUR) gene mutation, there is impaired synthesis of
tRNA(UUR)Leu. But at the same time, synthesis of the mitochondrial proteins is also affected
because of defective translation process at UUR codons of the mitochondrial mRNA. The level
of tRNALeu(UUR) have also been observed to be decreased in the patients with tRNALeu(UUR) gene
mutation. Low tRNALeu(UUR) level indicates that the degradation of tRNALeu(UUR is enhanced due
to its decreased affinity towards Leucyl– tRNA synthetase (143, 144).
According to recent literature review, different ethnic groups and patients with diabetes with
different modes of clinical features show variable prevalence of A3243G (145, 146).
It should not be excluded that variations involving other genes can also contribute a lot in the
etiology of mitochondrial diabetes. Whole of the mitochondrial genome is susceptible to show
pathogenic mutations. Hence comprehensive and thorough detection of mitochondrial DNA
mutation requires sequencing of the entire mtDNA molecule (147). Individual susceptibility to
develop mitochondrial disease depends on the identification of genes. By identifying such genes
74
positive steps can be taken to probe into the basic molecular events implicated in the
development of T2DM. This will help the doctors dealing with diabetics to develop more
sensitive and accurate preventive as well as therapeutic methods.
As a matter of fact, reliable and accurate detection of mitochondrial DNA mutations seen in
T2DM requires analysis of thousands of well defined diabetics. Large cohort studies and samples
are required to be analyzed to get exact data of the disease and to identify the suspected
diabetogenic gene mutation. We selected and studied fifty diabetic patients from the affected
pedigrees, with strong maternal history of diabetes. Our extensive quest for mtDNA A3243G
mutation permits us to deduce that mechanisms other than mtDNA mutation must have been
implicated in the maternal transmission as well as pathogenesis of diabetes in these families.
A3243G mutation near the region of tRNALeu(UUR) gene in Asian population:
Adequate research work on the prevalence of A3243G mutation is still lacking in Asian
countries. However, rising prevalence of type 2DM in Asian countries cannot be over looked
(148). Few studies on the people of India and on Asian minorities present in Western countries
have given some idea about the prevalence of A3243G mutation (3, 4, 149). Recently Sahu RP.
et al (2007) carried out observational cohort study on young patients with T2DM and found
mitochondrial A3243G mutation in one (~1%) subject (149). However, according to two
previous research studies on South Indian adult patients with T2DM, this mutation was not
detected (150).
In conclusion, although previous clinical observations and studies have suggested some role of
mitochondrial dysfunctions in the progression of type 2 diabetes mellitus, the A3243G mutation
in mitochondrial tRNALeu(UUR) gene cannot be labeled as a main contributing etiological factor of
T2DM in Pakistani population. The observed clinical hallmarks of diabetes might be the
75
outcome of a combination of several other mechanisms or factors involved in the pathogenesis of
T2DM. Further screening of larger study group is required to fully determine the exact
prevalence of this mutation in Pakistani population.
AGE AND SEX:
Out of fifty patients with a phenotype of maternally inherited diabetes, 32 were males and 18
were females. Hence, in our study males were found to be affected more as compared with the
females.
Mean age at which the patients developed diabetes mellitus, in our study, was found to be 35.86
years. Previous studies in Asia have also confirmed a new trend of early onset of diabetes in
Asian population i.e. at least ten to twenty years earlier as compared to the developed Western
countries (151). Two reports, one from UK (12, 152) and the other one from US (153) have also
shown an early onset of diabetes, especially in the minority population, including the Asians.
According to a report from American Diabetes Association, a high frequency of early onset of
diabetes in the Indians settled in America and Canada, Hispanics, African people settled in
America, Japanese, Asian and Middle-Eastern populations was observed (154). It is worth
mentioning that these are ethnic minority populations settled in America. Our data further
confirms this trend of early onset of diabetes. Moreover, the present study also focuses attention
on the reality that onset of type 2 diabetes in younger age occurs even in developing countries. In
the view of the like minded reports from the developed countries, absence of obesity, maternal
history and early onset of diabetes seems to be positively related with the T2DM in Asian
population (149, 151).
76
IMPAIRED HEARING:
It is not bias to say that ears are the best gift of nature but unfortunately its proper care is mostly
undervalued. Most common ear defect encountered daily in the hospitals is impaired hearing or
deafness. Deafness is primarily of three types, conductive, perceptive (neurosensory) and mixed
deafness. As conductive deafness usually results due to middle ear diseases, hence it is also
called middle ear deafness. Since each cause of conductive deafness obstructs the passage of
sound waves to the internal ear, this deafness is also called obstructive deafness (155, 156). The
common factors or pathological conditions leading to the development of this type of deafness
includes wax, boil, fungus in the external meatus, diseases of the middle ear and Eustachian tube
and osteosclerosis in which the stapes gets fixed in the oval window (157).
Sensorineural hearing loss is that type of hearing impairment in which the fault lies in the
perception of sound. The pathology involved lies somewhere between the membranous cochlea
and the hearing centre in the superior temporal gyrus. As in most of the cases the defect lies in
membranous cochlea which is a part of the inner ear, this is also called “inner ear deafness” or
“sensory deafness” (158).
In mixed deafness, both conductive and perceptive elements are present (159).
We used this criterion to find out the type of hearing defect and found that 39 patients (78%)
presented with sensorineural hearing loss. Thorough clinical examination and audiometry
revealed that deafness was present bilaterally, involving both of the ears. Patients presented with
deafness for loud sounds which is a characteristic feature of sensorineural hearing defect.
Moreover, any discharge from the ear and otalgia was not observed. Clinically deafness was
assessed according to the degree of hearing loss. Normal hearing ability is up to 10 Db. Slight to
77
moderate hearing impairment was detected in our patients who presented with the hearing loss of
30 – 50 Db.
As several environmental and genetic factors can contribute in imperfect hearing, hence it is
difficult to reach a definite conclusion at this moment. Genetic causes expected to be responsible
of maternally inherited diabetes phenotype could not be explored. So other factors must be given
a thought.
As far as the genes related with hearing loss are concerned, very inadequate data is available yet.
However, mutations at some point in the genomic DNA have been detected in the patients with
impaired hearing. Mitochondrial DNA mutations have also been found to play an important role
in the pathogenesis of both inherited and acquired hearing loss. Carriers of mitochondrial DNA
A1555G mutation develop defect in hearing ability, when exposed to aminoglycoside antibiotic.
However, almost all of the diseases produced by mutations in the mtDNA are usually
accompanied by impaired hearing, mostly sensorineural in nature. A7445G Mutation in the
tRNASer gene, 7472insC and T7511C mutations in mtDNA are also found to be responsible for
the development of non-syndromic hearing loss (159, 160).
The basic differentiating feature which distinguishes mitochondrial diabetes from T2DM is the
presence of maternal inheritance of diabetes in association with a defective hearing affecting
both of the ears. In mitochondrial diabetes, prominent hearing defect is mainly an intensifying
sensorineural hearing defect. The most characteristic shape of the audiometric curve is a sloping
curve, with flat profiles in advanced cases (158). The rate of advancement and intensity of the
hearing loss rely upon the degree of heteroplasmy of the mitochondrial deoxyribonucleic acid.
78
As in our study, mitochondrial DNA mutation was not found to be a main inducer of maternally
inherited diabetes associated with other features of mitochondrial diabetes, so other pathogenic
factors responsible for impaired hearing must be taken in to account (163).
As in developed countries, no distinct environmental cause could be found in more than fifty
percent cases of deafness. Hence in these patients genetic cause may be the main factor behind
this situation. But these facts and figures should be considered with caution, as standards of
public health care and awareness are improving. With better awareness about the role of
environmental factors in the occurrence of impaired hearing, their role as causative agents will
become less important (164, 165). Then the significance of nuclear and mitochondrial genomic
variations in the development of hearing impairment is expected to rise markedly.
Finally, the cases in which hearing loss is seen in old age, the defective hearing usually results
from an interaction of both genetic and environmental factors. This is why the epidemiological
data showing the genetic cause of hearing loss is still lacking.
As per literature, impaired hearing loss can also be categorized syndromic or non-syndromic.
"Syndromic hearing loss" is the hearing defect which is associated with some specific
syndromes. Approximately 30% of clinically presented cases of deafness have been diagnosed as
syndromic deafness. Several modes are related with the transmission of Syndromic hearing loss,
including mtDNA mutation inheritance (166).
The other category includes non syndromic hearing loss. This condition develops due to some
mutations in various genes. First gene involved in deafness was identified in 1955. Since than
approximately 30 genes have been located and identified to be involved in the pathogenesis of
hearing loss. Some of these isolated genes are responsible for the production of channel proteins.
79
KCNQ4 mutation in these genes causes hearing defect. Some genes are responsible for the
production of the muscle proteins (myosine). MYO6, MYO7A and MYO15 mutations in these
genes cause hearing loss. Some are involved in the process of transcription. POU3F4, POU4F3
and TFCP2L3 mutations in these genes cause impaired hearing. Whereas the exact function of
some genes carrying pathogenic mutations is yet to be explored.
Role of autoimmune diseases in the pathogenesis of defective hearing cannot be overlooked.
Moreover, aging has a great effect to reduce hearing power of a person.
Internationally, it is documented that 30% of the population has been suffering from impaired
hearing. It was also observed that number of patients having sensorineural hearing defect was
almost double in developed countries as compared to the developing countries. This might be
due to more improved health care facilities and awareness about environmental factors leading to
reduced hearing ability (167).
Keeping all the contributory factors of hearing loss in mind we can say that impaired hearing is a
multifactorial disorder. To our knowledge, any possible mechanism leading to the maternal
transmission of diabetes and deafness, both, has not been detected and explained. Hence we can
say that 27 patients presenting with maternally inherited 2 diabetes phenotype and deafness must
have carried two different pathological scenarios. One mechanism led to early onset of diabetes
and the other one caused impaired hearing. However, the possible role of other genetic factors
cannot be excluded at this moment. Deafness may be due to some other genetic causes or
combination and interaction of both environmental and genetic factors.
Due to unique inheritance of mtDNA and interaction of the environmental factors, detection and
identification of the genes and mechanism responsible for the maternal transmission of type 2
80
diabetes mellitus and deafness is difficult to describe. However, the journey to explore more
genes involved in the development of hearing defects is going on, as several genes are yet to be
identified (168).
The recognition and isolation of such genes requires more precise clinical characterization of the
patients. This characterization should include the information about the phenotype of deafness
including age of onset, severity, audiometric study, dynamics and the familial phenotypic
mutations.
INSULIN DEPENDENCE:
Thirty eight out of fifty patients (76%) showed the dependence on insulin for the control of
normal blood glucose level at later stage of diabetes. In these patients, later on, treatment with
oral hypoglycemic agents was found to be ineffective in controlling blood glucose level. This
study found statistically insignificant difference in the mean blood glucose level among patients
on oral hypoglycemic and those on insulin therapies. Patients required insulin therapy due to
progressively worsening hyperglycemia of T2DM, in spite of getting treated with oral
hypoglycemic drugs. However, in present study hyperglycemia was still found to be
uncontrolled. Insulin dependence might have resulted due to progressive increase in insulin
requirement. It is a well documented fact that persistent hyperglycemia leads to the development
of insulin resistance, further decrease in insulin production or both (169). Pronounced age-
dependent deterioration of beta pancreatic cells is seen in mitochondrial diabetes leading to
decreased insulin production and enhanced requirement of insulin therapy (170). Obesity is
usually the main cause of insulin resistance in diabetics. However, the patients in our study had
low BMI as compared with controls, so there must be some other cause of insulin dependence
81
like pancreatic beta cells defect that has limited their ability to secrete or produce insulin. In most
cases, the nature and cause of beta cells defect and deterioration is not known.
This situation indicates the involvement of additional processes, too. Besides, we believe that
mtDNA defects impairing generation of energy rich phosphate compounds can cause diabetes.
However, in present study role of ATP and other by products of mitochondrial OXPHOS like
reactive oxygen radicals, in the development of diabetes cannot be overlooked. As mitochondrial
OXPHOS system is mandatory for the insulin secretion from pancreatic beta cells (171). There is
affirmation that worsening hyperglycemia is a predominant feature of maternally inherited
diabetes. Moreover, pancreatic beta cells are also found to be deteriorated and defective, leading
to insulinopenia and raised plasma glucose level. Peripheral insulin resistance is not observed as
is usually seen in the case of T2DM (172). An underlying genetic mutation in the genes might be
responsible for this impairment, impairing the pancreatic beta cell glucose sensitivity.
Alternatively, it is also reported that hypertriglyceridaemia and raised cholesterol (as observed in
present study) also has deleterious effects on beta cell function (173). There is also evidence that
aggregate of insulin producing cells of pancreas reduces in the patients with T2DM as compared
to the non diabetics and this could have a congenital reason (174). As it might have resulted from
an initial failure to produce adequate number of beta cells during the development of fetus or
increase in beta cell death (175). This decline in insulin production capacity leads to eventual
failure to respond to oral hypoglycemic therapy and insulin therapy is required (176, 177). Hence
there are many possibilities which may be held responsible for the dependence on insulin therapy
seen in our study.
82
BODY MASS INDEX (BMI, weight/height2 as kg/m2):
According to other studies, an excessive deposition of fat leading to obesity has commonly been
found in type 2 diabetics. Obesity is strongly related to the insulin resistance and hyperglycemia.
It means if obesity is absent or Body Mass Index is within normal limits, insulin sensitivity will
be normal, provided other defects of insulin receptors are not present. In present study, low BMI
in patients with phenotype of maternally inherited type 2 diabetes mellitus surely indicates that
nothing was wrong with insulin sensitivity in these patients and the primary defect would have
lied in the insulin secretion. Some other diabetogenic mutations in mitochondrial DNA can also
result in a gradual decline in insulin secretion by the pancreas. In a recent study, it was
documented that another common mitochondrial DNA mutation i.e. 16189 mutation, is also
maternally inherited and associated with type 2 diabetes and low BMI (178, 179). Although we
recognize that the power to detect differences in this study was too small and any proof to show a
definite association between maternally inherited diabetes phenotype and low BMI was difficult
to provide, the study nevertheless provides a support for the hypothesis that mtDNA mutation
may be an important genetic factor contributing to the weight loss in maternally inherited
diabetes. However, other than genetic reasoning of low BMI, we cannot overlook the
significance of other factors, like severity of insulinopenia, hyperglucagonemia, lack of dietary
education, low socioeconomic status and failure to take recommended balanced diet due to
poverty (180, 181). As in our study, most of the patients were from poor families with low
socioeconomic status, so high degree of insulinopenia or protein energy malnutrition might be a
cause of Low BMI in these patients, particularly insulin dependent subjects.
83
HYPERGLYCEMIA:
An interaction of insulin and glucagon is responsible to maintain the normal blood glucose level.
Whenever there is deficiency of insulin, blood glucose level rises. If the insulin deficiency
persists for a longer time period, it leads to the development of diabetes mellitus. Depending
upon the severity of insulin deficiency and number and sensitivity of insulin receptors, diabetes
can be classified as T1DM and T2DM.
Recent study has shown that the type 2 diabetic patients of normal BMI often present with severe
hyperglycemia and evidence of insulin resistance is usually absent (182). The present study also
documented marked hyperglycemia in the type 2 diabetic patients with low BMI. The
increased concentration of plasma glucose (hyperglycemia), due to increased production and
decreased peripheral utilization of glucose, is the specific sign of diabetes mellitus (183). Plasma
HbA1c concentration was also measured to evaluate diabetic control for the 4 – 6 week period
before the measurement. Significantly high plasma HbA1c level indicated the poor status of
glycaemic control in the subjects over the previous months. Glycosuria was also noticed in
patients with T2DM as renal capacity for glucose reabsorption was exceeded. Similar
observations had been noted previously for plasma glucose level in diabetes mellitus (184).
HbA1c is a reflection of effectiveness of the control of blood glucose level during the previous
2 – 3 months. This opens an opportunity to change therapy if needed. Plasma glucose level
correlates with HbA1c in T2DM, since fluctuations in blood glucose are not as severe as in Type
1 Diabetic patients. Raised level of HbA1c is due to persistently high fasting and prandial blood
glucose levels (185, 186).
84
PLASMA TRIGLYCERIDES AND CHOLESTEROL PROFILE:
Dyslipidaemia or Hyperlipidemia is a condition characterized by high plasma lipid level i.e. an
increase in total and LDL cholesterol as well as triglycerides. It has been established as a
characteristic feature of T2DM in earlier studies (187, 188). An electrifying rise in the incidence
of T2DM accompanied with dyslipidaemia is assumed to occur in the near future. Thus, the
possibility to develop ischemic heart disease due to hyperlipidemia will also be greater in the
diabetics than non-diabetics (189, 190). Therefore, the management of hyperlipidemia can
reduce the risk of cardiovascular diseases in diabetic population. We used the criterion
established by National Cholesterol Education Program (NCEP) to analyze plasma cholesterol
level. We considered plasma cholesterol level less than 200 mg/dl as normal, 200 – 240 mg/dl as
borderline, and more than 240 mg/dl as significantly high or hypercholesterolemia (191). In our
study, plasma cholesterol level in patients with T2DM was found to be borderline high.
Moreover, the pattern of moderately raised triglycerides, seen in diabetics, was found to be
statistically significant as compared to control group. Increase plasma TG level is common in
T2DM as proved by various research based studies. Several studies have suggested the
importance of raised serum triglyceride levels in people with diabetes. Moreover, majority of
studies have reported the finding of hypertriglyceridaemia as the major indicator of
dyslipidaemia in the type 2 diabetics. As hyperglycemia leads to raised plasma triglyceride levels
in diabetic patients, hence, severity of hyperglycaemia strongly determines the degree of
hypertriglyceridaemia (192, 193). In present study, the reason for moderately raised TG level
might be uncontrolled hyperglycemia and improper management of T2DM. This is due to
unawareness of the community about significance of controlled lipid profile and the
consequences of dyslipidemia because most of the patients included in the present study were
85
uneducated. Low literacy rate and poverty is a great barrier for better understanding of the
disease by the diabetics and its effective management.
According to several studies, hypertriglyceridaemia was reported to be a significant finding of
T2DM and was found to be the predominant feature of dyslipidaemia seen in 60% of the
patients. Whereas, low levels of HDL Cholesterol were also seen in 52% of diabetics (194, 195,
196, 197). This study supports the above mentioned findings by showing that
hypertriglyceridaemia was predominant in type 2 diabetics. In our study total cholesterol was
also found to be significantly higher as compared to non – diabetic control group and even first
degree relatives of the patients. Abbasi MA et al (2007) carried out a study in Pakistan and
reported raised levels of total cholesterol and LDL as the only main finding in the diabetics,
particularly T2DM (198). Our results further strengthen these findings of the previous studies in
our region (199, 200, 201).
PLASMA UREA LEVEL:
Diabetes is already a major health concern in all countries and type 2 diabetes is undergoing a
major escalation, not only in developed countries, but also in developing countries, including
Pakistan. Diabetes is usually accompanied with damage to the renal tissue at later stage of its
course. This damage to the renal tissue leads to Diabetic Nephropathies. In our country the
population has been newly exposed to the Westernized lifestyle, followed by increased incidence
of T2DM. Diabetes is now one of the leading causes of end-stage kidney disease in Western
countries (202, 203).
In present study, plasma urea level in patients with T2DM was found to be significantly higher
as compared with first-degree relatives and controls. As insulin deficiency is the predominant
feature of diabetes and it is a well recognized fact that tissue protein synthesis decreases in the
86
absence of insulin. This decrease is partly due to diminished transport of amino acids into the
muscle. Insulin deficiency always leads to increased production of glucagon. Glucagon is an
insulin antagonist. Hyperglucagonemia enhances protein catabolism and promotes
gluconeogenesis (204, 205). In type 2 diabetes, either maternally inherited mitochondrial or due
to other cause, impaired insulin secretion and hyperglucagonemia cause enhanced protein
degradation and negative nitrogen balance (206). Chronic renal tissue complications are usually
encountered in the course of diabetes mellitus. In addition to increase protein degradation,
diabetes also produces harmful effects on kidneys and subsequently development of
nephropathies. The prevalence of nephropathy in Asian patients with type 2 diabetes mellitus is
poorly defined. These generally occur after several years of diabetes and affect the small blood
vessels in the kidneys, eyes and nerves, leading to the development of microangiopathy. Extent
of microangiopathy is believed to be strongly related to the duration and severity of
hyperglycemia (207). Diabetic nephropathy (DN) occurs in approximately one third of
individuals with type 2 diabetes (208). Diabetic nephropathy is a clinical syndrome characterized
by persistent albuminuria, raised plasma urea level, decline in GFR (Glomerular filtration rate),
raised arterial blood pressure and increased risk for cardiovascular diseases. This leads to more
rapid progression to develop other secondary complications like retinopathy, neuropathy,
diabetic foot and high blood pressure. Patients with diabetes account for approximately one-third
of all end stage renal failure (ESRD) cases and a great increase in the number is observed due to
growing incidence of diabetes. Out of 14 million diabetic patients in the U.S, 90–95% of patients
were diagnosed as type 2 diabetes. On analysis of the data of diabetics with nephropathy on
chronic dialysis, majority of the patients were found to have type 2 diabetes (60%) (209).
According to the first reports of DN in late 19th and early 20th centuries, it was detected in the
patients with type 2 diabetes. The prevalence of renal failure along with uremia in diabetes
87
increases with increase in duration of diabetes. The socioeconomic status of patients also effect
development of diabetes and DN. According to previous investigations, low income employees
and small shopkeepers were found more susceptible to develop diabetes (206, 209). Results from
the present study also agree with the above results.
88
LIMITATIONS/ SUGGESTION OF THE STUDY:
In spite of extensive work, our study had certain limitations. Complete screening of
mitochondrial region encompassing tRNALeu(UUR) gene was done to detect A3243G mutation in
the subjects who were most likely to carry this mutation. We know that the percentage of mutant
mtDNA varies from tissue to tissue. Unfortunately, the heteroplasmy of the mutation is the
lowest in the peripheral blood leukocytes and the highest in the affected tissues. In our study,
peripheral blood leukocytes were used to isolate total and then mitochondrial genome. So, the
chance to detect this mutation was lower in leukocytes and it might have hampered the detection
of this mutation. Moreover, ~0.7% decline in the heteroplasmy levels in leukocytes is seen per
year. In this regard, the pancreas would be the best source of tissue for the examination and the
detection of A3243G mutation in patients with diabetes. However, pancreatic biopsy is not a
desirable part of routine screening. Moreover, it is virtually impossible.
Moreover, ß-Cell autoantibodies should also be performed in all those presenting with onset of
maternally inherited type 2 diabetes mellitus at ages 30–45 years. Phenotypically defined
subjects can be targeted to Genetic investigations. The finding of a possible specific etiology will
allow effective and proper management of the disease and can give patients valuable information
about their condition.
Direct sequencing of isolated mitochondrial proteins may also be done to detect any alteration in
the primary structure of proteins and their possible involvement in maternally inherited diabetes.
Further study of families with non-syndromic monogenic hearing loss should lead to the better
understanding of association of hearing loss and maternally inherited diabetes mellitus.
89
We believe that the results of our study in collaboration with the earlier studies can cater a
guideline for further research. More precise techniques can be developed to identify novel
mutations as well as to analyze post mitotic tissues. This will be of great value because post
mitotic tissues show highest level of heteroplasmy and make the situation more reliable and
fruitful for the researcher. By this effort it would be easy to screen all those patients who are
strongly suspected to carry mitochondrial DNA mutation. Moreover, specialized centers with
such techniques can be used to carry out extensive investigation for other mtDNA defects. The
entire mtDNA molecule should be sequenced to rule out the presence of known and novel
mutations as well.
All those patients presented with diabetes, hearing loss and suspected to carry any kind of
mtDNA mutation should undergo thorough genetic evaluation. Correlation of diabetes, type of
hearing defect and other features of mitochondrial disease should be established. This should be
followed by careful search for possible genetic component.
By establishing a specific etiological diagnosis, it will be beneficial to the diabetics in terms of
treatment, prognosis, and providing information to relatives. Knowledge of genetic subgroups
has already enabled us to give appropriate treatment i.e. those with HNF –1α MODY are treated
with sulfonylureas, and those with lipodystrophy syndromes with thiazolidinedione and leptin
treatment.
Finally, the association of maternally inherited type diabetes with A3243G mutation needs to be
confirmed by scrutinizing larger sample of Pakistani diabetics with phenotype of mitochondrial
T2DM.
90
CONCLUSION:
We can conclude that there is positively no diabetic to look for inherited mtDNA A3243G
mutation in families having clear evidence of maternal inheritance of diabetes along with two or
more specific features of mitochondrial diabetes. Maternally inherited diabetes may be
etiologically heterogeneous. Other factors, such as a change in lipid profiles, other nuclear and
mitochondrial genetic factors might also have contributed to the pathogenesis of diabetes and
other associated features. Hence analysis of these possibilities cannot be excluded and require
additional studies.
91
Chapter 5 References
1. Dunstan DW, Zimmet PZ, Welborn TA, De Courten MP, Cameron AJ, Sicree RA,
Dwyer T, Colagiuri S, Jolley D, Knuiman M, Atkins R, Shaw JE. (2002). The rising
prevalence of diabetes and impaired glucose tolerance: the Australian Diabetes, Obesity
and Lifestyle Study. Diabetes Care 25:829–834.
2. Mohan V, Deepa M, Deepa R, Shanthirani CS, Farooq S, Ganesan A, Datta M. (2006).
Secular trends in the prevalence of diabetes and impaired glucose tolerance in urban
South India: the Chennai Urban Rural Epidemiology Study (CURES-17). Diabetologia
49:1175–1178.
3. Ramachandran A, Snehalatha C, Kapur A, Vijay V, Mohan V, Das AK, Rao PV,
Yajnik CS, Prasanna Kumar KM, Nair JD. (2001). High prevalence of diabetes and
impaired glucose tolerance in India: National Urban Diabetes Survey. Diabetologia 44:
1094–1101.
4. Gu D, Reynolds K, Duan X, Xin X, Chen J, Wu X, Mo J, Whelton PK, He J. (2003).
Prevalence of diabetes and impaired fasting glucose in the Chinese adult population:
International Collaborative Study of Cardiovascular Disease in Asia (InterASIA).
Diabetologia 46:1190–1198.
5. Lester FT: (1993). Clinical features, complications and mortality in type 2 (non-insulin
dependent) diabetic patients in Addis Abeba, Ethiopia, 1976–1990. Ethiop Med J
31:109–126.
6. Ramachandran A, Snehalatha C, Satyavani K, Sivasankari S, Vijay V. (2003). Type 2
diabetes in Asian-Indian urban children. Diabetes Care 26:1022–1025
7. The DECODE-DECOD. (2003). A Study Group on behalf of the Europe Diabetes
Epidemiology Group and the International Diabetes Epidemiology Group Age, body
92
mass index and type 2 diabetes mellitus: associations modified by ethnicity.
Diabetologia 46:1063 – 1070.
8. Stern MP. (2002). The search for type 2 diabetes susceptibility genes using whole-
genome scans: an epidemiologist’s perspective. Diabete Metab Res Rev 18: 106 – 113.
9. Wild S, Roglic G, Green A, Sicree R, King H (May 2004). "Global prevalence of
diabetes: estimates for the year 2000 and projections for 2030". Diabetes Care 27 (5):
1047–53.
10. Bhatia V, Arya V, Dabadghao P, Balasubramaniam K, Sharma K, Verghese N, Bhatia
E. (2004). Etiology and outcome of childhood and adolescent diabetes mellitus in North
India. J Pediatr Endocrinol Metab. 17: 993 – 999.
11. Asmal AC, Dayal B, Jialal I, Leary WP, Omar MAK, Pillay NL, Thandroyen FT.
(1981). Non-insulin-dependent diabetes mellitus with early onset in Blacks and Indians.
S Afr Med J. 60: 93 – 96.
12. Feltbower RG, McKinney PA, Campbell FM, Stephenson CR, Bodansky HJ. (2003).
Type 2 and other forms of diabetes in 0–30 year olds: a hospital based study in Leeds,
UK. Arch Dis Child 88:676 – 679.
13. Vikram NK, Tandon N, Misra A, Srivastava MC, Pandey RM, Mithal A, Sharma S,
Ajmani A, Madhu SV, Batra CM, Gupta N. (2005). Correlates of type 2 diabetes
mellitus in children, adolescents and young adults in north India: a multisite
collaborative case-control study. Diabet Med 23: 293 – 298.
14. Mayfield J. (1998). Diagnosis and Classification of Diabetes Mellitus: New Criteria.
American Family Physician. 1355 – 72.
15. (2003). Report of the expert committee on the diagnosis and classification of diabetes
Mellitus. Diabetes Care. 26, 15-20.

93
16. Zimmet, P., Alberti, K.G.M.M. and Shaw, J. (2001). Global and societal implications of
the diabetes epidemic. Nature. 414, 782 – 787.
17. Das KVK. (2002). Textbook of medicine. New Delhi: Medical Publishers. 4, 429 – 46.
18. American Diabetes Association. (2008) Standards of medical care in diabetes. Diabetes
Care, 31: 12 – 54.
19. DL, Hauser SL, Braunwald E, Fauci AS, Kasper, Longo DL, Jameson Li. (2001).
Harrison’s principles of internal medicine. New York: Mc Graw – Hills. 15, 2109 – 37.
20. Bertin E, Arner P, Bolinder J, Toft EH. (2001). Action of glucagon and glucagon – like
petide -1- (7 - 36) amide on lipolysis in human subcutaneous adipose tissue and skeletal
muscles in vivo. The Journal of Clinical Endocrinology and Metabolism. 86 (3),
1229 – 34.
21. Dumonteil E, Magnan C, Ritz’1 Laser B, Meda P, Dussoix P, Gilbert M, Ktorza A,
Phillipe J. (1998). Insulin but not glucose lowering corrects the hyperglucagonemia and
increased proglucagon messenger ribonucleic acid levels observed in insulinopenic
diabetes. Endocrinology. 139 (11), 4540 – 6.
22. Unger RH. (1976). Diabetes and the alpha cell. Diabetes. 25, 136 – 51.
23. Tsuruzoe, K., Araki, E., et al. (April 1998). Creation and Characterization of a
Mitochondrial DNA-Depleted Pancreatic -Cell Line, Impaired Insulin Secretion
Induced by Glucose, Leucine, and Sulfonylureas. Diabetes. 47, 621.
24. Mark I McCarthy. (2004). Progress in defining the molecular basis of type 2 diabetes
mellitus through susceptibility–gene identification. Human Molecular Genetics. 13,
33– 41.
94
25. Tzen CY, Thajeb P, Wu TY, Chen SC. (2003). MELAS with point mutations involving
tRNALeu (A3243G) and tRNAGlu (A14693G). Muscle Nerve. 28, 575 – 81.
26. Houshmand, M. (2003). Mitochondrial DNA mutations, pathogenicity and inheritance.
Iranian Journal of Biotechnology. 1, 1.
27. Nass S, Nass MMK. (1963). Intramitochondrial fibers with DNA characteristics. J Cell
Bio. l. 19, 613 – 629.
28. Anderson S, Bankier AT, Barrell BG, et al. (1981). Sequence and organization of the
human mitochondrial genome. Nature. 290, 457 – 465
29. Shay JW, Pierce DJ, Werbin H. (1990). Mitochondrial DNA copy number is
proportional to total cell DNA under a variety of growth conditions. J. Biol Chem. 265:
14802 – 14807.
30. Park SY, Choi GH, Choi HI, Ryo J, Jung CY, Lee W. (2005). Depletion of
mitochondrial DNA causes impaired glucose utilization and insulin resistance in L6
GLUT4myc Myocytes. J. Biol. Chem. 280, 9855 – 9864.
31. Wallace DC: (1992). Diseases of the mitochondrial DNA. Annu Rev Biochem. 61,
1175 –1212.
32. Moore JM. (1999). REPORT: Mitochondrial DNA Analysis at the FBI Laboratory.
DNA Analysis Unit II Federal Bureau of Investigation Washington, DC Alice R.
Isenberg Forensic Examiner/Biologist. 1 (2).
33. Wallace DC. (1982). Structure and evolution of organelle genomes. Microbiol Rev. 46,
208 – 240.
95
34. Giles RE, Blanc H, Cann HM, Wallace DC. (1980). Maternal inheritance of human
mitochondrial DNA. Proc Natl Acad Sci USA. 77, 6715 – 6719
35. Rose, M.R. (1998). Mitochondrial Myopathies – Genetic Mechanism, ARCH NEOROL.
55, 17 – 24.
36. Margulis L. (1970). Origin of eukaryotic cells. Ysle University press, New Haven.
37. Attardi G, Schatz G. (1988). Biogenesis of mitochondria. Annu Rev Cell Biol. 4,
289 – 333.
38. Clayton DA. (1992). Structure and function of the mitochondrial genome. J Inherit
Metab Dis. 15, 439 – 447.
39. Rotig, A., Munnich, A. (2003). Genetic features of mitochondrial respiratory chain
disorders. J Am Soc Nephro. 14, 2995 – 3007.
40. Murray RK, Grarmer DK, Mayes PA, Rodwell VW. (2000). Harper’s Biochemistry.
New York: McGraw Hill. 25, 610 – 26.
41. Maechler P. and Wolheim C.R. (2001). Mitochondrial function in normal and diabetic
β-cells. Nature. 414: 807 – 812.
42. Lemire, B. (September 14, 2005). Mitochondrial genetics, WormBook, ed.
43. Kadowaki T, Kadowaki H, Mori Y, et al. (1994). A subtype of diabetes mellitus
associated with a mutation of mitochondrial DNA. N Eng J Med. 20, 962 – 968.
44. Brown MD, Wallace DC. (1994). Molecular basis of mitochondrial DNA disease.
J Bioenerg Biomembr. 26, 273 – 289.
45. Idem. (2001). The inheritance of genes in mitochondria and chloroplast: laws,
mechanisms and models. Annu Rev Genet. 35, 125 – 48.
96
46. Leonard JV, Schapira AHV. (2000). Mitochondrial respiratory chain disorders I:
mitochondrial DNA defects. Lancet. 355, 299 – 304.
47. Mohan V, Deepa M, Deepa R, Shanthirani CS, Farooq S, Ganesan A, Datta M (2006)
Secular trends in the prevalence of diabetes and impaired glucose tolerance in urban
South India: the Chennai Urban Rural Epidemiology Study (CURES-17). Diabetologia
49: 1175 – 1178.
48. Owen KR, Stride A, Ellard S, Hattersley AT. (2003). Etiological investigation of
diabetes in young adults presenting with apparent type 2 diabetes. Diabetes Care 26:
2088 – 2093.
49. Lowell BB, Spiegelman BM. (2000). Towards a molecular understanding of adaptive
thermogenesis. Nature. 404, 652 – 660.
50. Shoffner JM. (2001). Oxidative phosphorylation disease. In: Scriver CV, Beaudet AL,
Sly WS. et al. The metabolic and molecular bases of inherited disease. New York.
McGraw – Hill. 2, 2367 – 2424.
51. Clayton DA. (1992). Transcription and replication of animal mitochondrial DNAs.
Int Rev Cytol. 141, 217 – 232.
52. Zeviani M, Carelli V. (2003). Mitochondrial disorders. Curr Opin Neurol. 16, 585 – 94.
53. Clayton DA. (1998) Nuclear-mitochondrial intergenomic communication. Bio Factors.
7, 203-205.
54. Zeviani M, Di Donato S. (2004). Mitochondrial disorders. Brain. 127, 2153 – 72.
55. Bindoff LA. (2004). Disorders caused by mitochondrial DNA instability. Eur J Neurol.
11 (2), 5.
97
56. Zeviani M, Tiranti V, D’Adamo P, et al. (2004). Nuclear genes in mitochondrial
disorders. Eur J Neurol. 11 (2), 5.
57. Wallace DC. (1994). Mitochondrial DNA sequence variation in human evolution and
disease. Proc. Acad. Sci. USA. 91, 8739 – 8746.
58. Johns, D.R. (1995). Mitochondrial DNA and Disease. NEJM. 333, 638 – 644.
59. Luft r, Ikkos D, Palmieri G, Ernster L, Afzelius B. (1962). A case of severe
hypermetabolism of non thyroid origin with a defect in the maintenance of
mitochondrial respiratory control: A correlated clinical, biochemical, and
morphological study. J Clin Invest. 41, 1776 – 1804.
60. Rotig A. (2003). Renal disease and mitochondrial genetics. J Nephrol. 16, 286 – 92.
61. Nardin RA, Johns DR. (2001). Mitochondrial dysfunction and neuromuscular disease.
Muscle Nerve. 24, 170 – 91.
62. Wolf NI, Smeitink JAM. (2002). Mitochondrial disorders. Neurolog. 59, 1402 – 5.
63. Goto Y. Nonaka I. Horai S. (1990). A mutation in tRNALeu(UUR) gene associated with
MELAS subgroup of mitochondrial encephalomyopathies. Nature. 348, 651 – 3.
64. Maassen, J.A., Janssen, G. M. C. and Hart, L.M. (2005). Molecular mechanism of
mitochondrial diabetes (MIDD). Annals of Medicine. 37(3), 213 – 221.
65. Bernier FP, Boneh A, Dennett X, et al. (2002). Diagnostic criteria for respiratory chain
disorders in adults and children. Neurology. 59, 1406 – 11.
66. Gillis L, Kaye E. (2002). Diagnosis and management of mitochondrial diseases. Pediatr
Clin N Am. 49, 203 – 19.
98
67. Gillis L, Kaye E. (2002). Diagnosis and management of mitochondrial diseases. Pediatr
Clin N Am. 49, 203 – 19.
68. Chinnery PF, Turnbull DM. (1997). Clinical features, investigation, and management of
patients with defects of mitochondrial DNA. J Neurol Neurosurg Psychiatry. 63,
559 – 63.
69. Arbustini, E., Diegoli, M. (1998). Mitochondrial DNA Mutations and Mitochondrial
Abnormalities in Dilated Cardiomyopathy. American Journal of Pathology. 153,
1501 – 1510.
70. Lostanlen DP, T RW, Camaret BM (2002). Molecular and functional effects of the
T14709C point mutation in the mitochondrial DNA of a patient with maternally
inherited diabetes and deafness. Biochemica et biophysica Acta (BBA) – Molecular
basis of disease. 1588 (3), 210 – 16.
71. McFarland R, Taylor RW, Turnbull DM. (2002). The neurology of mitochondrial DNA
disease. Lancet Neurology. 1, 343 – 51.
72. Finsterer J, Jarius C, Eichberger H, et al. (2001). Phenotype variability in 130 adult
patients with respiratory chain disorder. J Inher Metab Dis. 24, 560 – 76.
73. Hasegawa H, Matsuoka T, Goto Y, et al. (1991). Strongly succinate dehydrogenase
reactive blood vessels in muscle from patients with mitochondrial myopathy,
encephalomyopathy, lactic acidosis and stroke-like episodes. Ann Neurol. 29, 601 – 5.
74. Hirano M, Nishigaki Y, Marti R. (2004). Mitochondrial neuro gastrointestinal
encephalomyopathy (MNGIE): a disease of two genomes. Neurologist. 10, 8 – 17.
99
75. Walker UA. (2002). Inherited and acquired disorders of mitochondrial DNA. Schweiz
Rundsch Med Prax. 91, 2129 – 38.
76. Van den Ouweland JM, Lemkes HH, Gerbitz KD, et al. (1995). Maternally inherited
diabetes and deafness (MIDD): a distinct subtype of diabetes associated with a
mitochondrial tRNA(Leu)(UUR) gene point mutation. Muscle Nerve. 3, 124 – 30.
77. Maassen JA, Janssen GMC, Lemkes HHJP. (2002). Mitochondrial diabetes mellitus.
J Endocrinol Invest. 25, 477 – 484.
78. Chen YN, Liou CW, Huang CC, et al. (2004). Maternally inherited diabetes and
deafness (MIDD) syndrome: a clinical and molecular genetic study of a Taiwanese
family. Chang Gung Med J. 27, 66 – 73.
79. Majamaa K, Moilanen JS, Uimonen S, Remes AM, Salmela PI, Karppa M, Majamaa-
Voltti KA, Rusanen H, Sorri M, Peuhkurinen KJ, Hassinen IE. (1998). Epidemiology
of A3243G, the mutation for mitochondrial encephalomyopathy, lactic acidosis, and
strokelike episodes: prevalence of the mutation in an adult population. Am J Hum
Genet. 63(2): 447 – 54.
80. Finsterer J. (2004). Mitochondriopathies. Eur J Neurol. 11, 163 - 86.
81. Leonard JV, Schapira AHV. (2000). Mitochondrial respiratory chain disorders II:
neurodegenerative disorders and nuclear gene defects. Lancet. 355, 389 – 94.
82. Dubeau F, De Stefano N, Zifkin BG, Arnold DL, Shoubridge EA. (2000). Oxidative
phosphorylation defect in the brains of carriers of the tRNALeu(UUR) A3243G mutation
in a MELAS pedigree. Ann Neurol. 47, 179 – 185.
83. Brunmair B, Lest A, Staniek K, et al. (2004). Fenofibrate impairs rat mitochondrial
function by inhibition of respiratory complex I. J Pharmacol Exp Ther. 311, 109 – 14.
100
84. Sztark F, Payen JF, Piriou V, et al. (1999). Cellular energy metabolism: physiologic
and pathologic aspects. Ann Fr Anesth Reanim. 18, 261 – 9.
85. Fischel-Ghodsian, Nathan. (2003). Mitochondrial Deafness. Ear & Hearing. 24(4):
303 – 313.
86. Riess ML, Eells JT, Kevin LG, Camara AK, Henry MM, Stowe DF. (2004).
Attenuation of mitochondrial respiration by sevoflurane in isolated cardiac
mitochondria is mediated in part by reactive oxygen species. Anesthesiology. 100,
498 – 5.
87. L MA, Hua W, W Jin, et al. (2000). Mitochondrial gene variation in type 2 diabetes
mellitus. Detection of a novel mutation associated with maternally inherited diabetes in
a Chinese family. Chinese medical journal. 113(2), 111 – 116.
88. J.V. Leonard, A.H. Schapira. (2000). Mitochondrial respiratory chain disorders I:
mitochondrial DNA defects, Lancet. 355, 299 – 304.
89. Chomyn A., Enriquez J.A., Micol V., Fernandez-Silva P., Attardi G. (2000) The
mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episode
syndrome-associated human mitochondrial tRNALeu(UUR) mutation causes
aminoacylation deficiency and concomitant reduced association of mRNA with
ribosomes. J. Biol. Chem. 275: 19198 – 19209.
90. Kadowaki T, Kadowaki H, Mori Y, Tobe K, et al. (1994). A subtype of diabetes
mellitus associated with a mutation of mitochondrial DNA. N Engl J Med. 330,
962 – 968.
91. George M.C. Janssen, Paul J. Hensbergen, Frans J. van Bussel, Crina I.A. Balog, J.
Antonie Maassen, André M. Deelder, Anton K. Raap. (2007). The A3243G
101
tRNALeu(UUR) mutation induces mitochondrial dysfunction and variable disease
expression without dominant negative acting translational defects in complex IV
subunits at UUR codons. Human Molecular Genetics. 16 (20), 2472 – 2481.
92. Jacobs H. (2003). Disorders of mitochondrial protein synthesis. Hum. Mol. Genet. 12:
293 – 301.
93. Jacobs H.T., Holt I.J. (2000). The np 3243 MELAS mutation: damned if you
aminoacylate, damned if you don't. Hum. Mol. Genet. 9: 463 – 465.
94. Guillausseau, P.J. Massin, P. et al. (2001). Maternally inherited diabetes and deafness:
A multicenter study. : Pakistan ANNALS. 134, 721 – 728.
95. Fischel-Ghodsian, Nathan. (2003). Mitochondrial Deafness. Ear & Hearing. 24(4):
303 – 313.
96. Yasukawa T., Suzuki T., Ueda T., Ohta S., Watanabe K. (2002). Modification defect at
anticodon wobble nucleotide of mitochondrial tRNAsLeu(UUR) with pathogenic
mutations of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like
episodes. J. Biol. Chem. 275: 4251 – 4257.
97. Kirino Y., Yasukawa T., Ohta S., Akira S., Ishihara K., Watanabe K., Suzuki T. (2004).
Codon-specific translational defect caused by a wobble modification deficiency in
mutant tRNA from a human mitochondrial disease. Proc. Natl. Acad. Sci. USA. 101:
15070 – 15075.
98. Yu P, Yu DM, Liu DM, et al. (2004 Jul). Relationship between mutations of
mitochondrial DNA ND1 gene and type 2 diabetes. Chin Med J (Engl). 117 (7),
985 – 9.
102
99. Hsieh RH, Yuan Li ABJ, Pang CY, et al. (2001). A Novel Mutation in the
Mitochondrial 16SrRNA Gene in a Patient with MELAS Syndrome, Diabetes Mellitus,
Hyperthyroidism and Cardiomyopathy. J Biomed Sci. 8, 328 – 335.
100. Choo-Kang AT, Lynn S, Taylor GA, et al. (2002). Defining the importance of
mitochondrial gene defects in maternally inherited diabetes by sequencing the entire
mitochondrial genome. Diabetes. 51, 2317 – 20.
101. Ohkubo K, Yamano A, Nagashima M, Mory Y, Anzai K, Akehi Y, et al. (2001).
Mitochondrial gene mutations in the tRNA(Leu(UUR)) region and diabetes: prevalence
and clinical phenotypes in Japan. Clin Chem. 47, 1641 – 8.
102. Willems PJ. (2000). Genetic Causes of Hearing Loss. NEJM. 342(15), 1101 – 1109.
103. Urata M. Wakiyama M. Iwase M. et al. (1998). New sensitive method for the detection
of the A3243G mutation of human mitochondrial deoxyribonucleic acid in diabetes
mellitus patients by ligation-mediated polymerase chain reaction. Clinical Chemistry.
44(10), 2088 – 2093.
104. Ohkubo K. Yamano A. Nagashima M. et al. (2001). Mitochondrial gene mutations in
the tRNALeu(UUR) region and diabetes: Prevalence and clinical phenotypes in Japan.
Clinical chemistry (Molecular Diagnostics and Genetics). 47(9), 1641 – 1648.
105. Dods RF. In: Kaplan LA, Pesco AJ, Kazmierczak SC. (1996). Clinical chemistry. New
York: Maplevail press. 31, 634 – 5.
106. Tinder P, Ann. (1969). Clin Biochem. 6, 24.
107. Morris CJOR, Morris P. (1976). Separation methods in biochemistry. London: The
Pitman Press. 2, 93 – 148.
103
108. First MR. Kaplan LA, Pesco AJ, Kazmierczak SC. (1994). Clinical chemistry. JB
lippincott company, Philadelphia. 2, 269—80.
109. Tamaoku K. Murao Y. and Alkiura. (1982). Analytica chimica. Acta. 136, 121.
110. Young DS. (1995). Effects of drugs on clinical laboratory tests. AACC press; 4.
111. Shepherd MDS. Whiting MJ. (1990). Falsely low estimation of triglycerides in lipemic
plasma by the enzymatic triglyceride method with modified Tinder’s chromogen. Clin
Chem. 36 (2), 325 – 329.
112. Koditschek LK, Umbreit WWJ. (1969). Bacteriol. 68, 1063 – 1068.
113. Stein EA, Myers GL. (1995). National cholesterol education program recommendations
for triglyceride measurement: Executive Summary. Clin Chem. 41, 1421 – 1426.
114. Schumann GB, Schweitzer SC. In: (1996). Kaplan LA, Pesco AJ, Kazmierczak SC.
Clinical chemistry. New York: Maplevail press. 3, 1122.
115. Finnilä, S., Autere, J., Lehtovirta, M., Hartikainen, P., Mannermaa, A., Soininen, H.,
Majamaa, K. (2001). Increased risk of sensorineural hearing loss and migraine in
patients with a rare mitochondrial DNA variant 4336A>G in tRNAGln. J. Med. Genet.
38, 400 – 405.
116. Guardino CA. (2008) Identification and Placement for Deaf Students With Multiple
Disabilities: Choosing the Path Less Followed. American Annals of the Deaf. 153(1),
55 – 64.
117. Maassen JA,’t Hart LM, van Essen E, Heine RJ, Nijpels G, Jahangir Tafrechi RS, et al.
(2004). Mitochondrial diabetes: molecular mechanisms and clinical presentation.
Diabetes. 53(1), 103 – 9.
104
118. King H, Aubert RE, Herman WH. (1998). Global burden of diabetes, 1995–2025:
prevalence, numerical estimates, and projections. Diabetes Care 21:1414 – 1431.
119. Guillausseau P-J, Massin P, Dubois-LaForgue D, Timsit J, Virally M, et al. (2001).
Maternally inherited diabetes and deafness: a multicenter study. Ann Intern Med. 134,
721 –728.
120. Chinnery PF, Johnson MA, Wardell TM, et al. (2000). The epidemiology of pathogenic
mitochondrial DNA mutations. Ann Neurol. 48, 188 – 193.
121. Durham S.E., Samuels D.C., Cree L.M., Chinnery P.F. (2007). Normal levels of wild-
type mitochondrial DNA maintains cytochrome c oxidase activity for two pathogenic
mitochondrial DNA mutations but not for m.3243AG. Am. J. Hum. Genet. 81, 189 – 195.
122. Olsson C, Johnsen E, Nilsson M, Wilander E, Syvänen A-C, Lagerström-Fermér M.
(2001). The level of the mitochondrial mutation A3243G decreases upon aging in
epithelial cells from individuals with diabetes and deafness. Eur J Hum Genet. 9,
917 –921.
123. Wallace DC, Lott MT. (2005). MITTOMAP: A Human mitochondrial genome database.
Available at: http://www.mitomap.org.
124. Malecki M. Klupa T, Wanic K et al. (2001). Search for mitochondrial A3243G tRNALeu
mutation in Polish patients with type 2 diabetes mellitus. Med Sci Monit. 7(2), 246 – 50.
125. Zambelli A, Rioja LV. (1999). Lack of association between mitochondrial DNA mutation
np3243 and Maternally Inherited Diabetes Mellitus. Clinical Biochemistry, 32(1), 81– 82.
126. Shaag A, Saada A, Steinberg A, Navon P, Elpeleg O. (1997). Mitochondrial
encephalomyopathy associated with a novel mutation in the mitochondrial tRNA
105
(Leu)(UUR) gene (A3243T). Biochem Biophys Res Commun. 233, 637 – 639.
127. A Noda M, Yamashita S, Takahashi N, Eto K, Shen LM, Izumi K, Daniel S, Tsubamoto
Y, Nemoto T, Iino M, Kasai H, Sharp GW, Kadowaki T. (2002). Switch to anaerobic
glucose metabolism with NADH accumulation in the beta-cell model of mitochondrial
diabetes: characteristics of betaHC9 cells deficient in mitochondrial DNA transcription. J
Biol Chem. 277, 41817 – 41826.
128. Maassen JA, Biberoglu S, ’t Hart LM, Bakker E, de Knijff P. (2002). A case of a de novo
A3243G mutation in mitochondrial DNA in a patient with diabetes and deafness.
Arch Physiol Biochem. 110, 186 – 188.
129. Janssen GMC. Maassen JA. Van den Ouweland JM. (1999). the diabetes associated 3243
mutation in the mitochondrial in tRNALeu(UUR) gene causes severe mitochondrial
dysfunction without a strong decrease in protein synthesis rate. The journal of Biological
Chemistry. 274 (42), 29744 – 48.
130. Van den Ouweland JM, Maechler P. Wollheim CB. Attardi G. Maassen JA. (1999).
Functional and morphological abnormalities of mitochondria harbouring the
tRNALeu(UUR) mutation in mitochondria derived from patients with maternally inherited
diabetes and deafness (MIDD) and progressive kidney disease. Diabetologia. 42,
485 – 92.
131. Chinnery PF. Turnbull DM. (2000). Mitochondrial DNA mutations in the pathogenesis of
human disease. Molecular Medicine Today. 6, 425 – 432.
132. McCarthy MI. Froguel P. (2002). Genetic approaches to the molecular understanding of
type2 diabetes. Am J Physiol. 283, 2012 – 2018.
106
133. McCarthy MI. (2004). Progress in defining the molecular basis of type 2 diabetes
mellitus through susceptibility-gene identification. Hum Mol Genet. 13, 33 – 41.
134. Suzuki S. (2004). Diabetes mellitus with mitochondrial gene mutation in Japan.
Annals NYAS online. 1011, 185 – 192.
135. Wang JJ, Qiao Q, Miettinen ME, Lappalainen J, Hu G, Tuomilehto J. (2004). The
Metabolic syndrome defined by factor analysis and incident type 2 diabetes in a Chinese
population with high post-prandial glucose. Diabetes Care. 27, 2429 – 2437.
136. Wang JJ, Hu G, Lappalainen J, Miettinen ME, Qiao Q, Tuomilehto J. (2005). Changes in
features of the metabolic syndrome and incident impaired glucose regulation or type 2
diabetes in a Chinese population. Diabetes Care. 28, 448 – 450.
137. Jacobs H.T., Holt I.J. (2000). The np 3243 MELAS mutation: damned if you
aminoacylate, damned if you don't. Hum. Mol. Genet. 9, 463 – 465.
138. Shuldiner AR. McLenithan JC. (2004). Genes and pathophysiology of type 2 diabetes
mellitus: more than just the randle cycle all over again. J Clin. Invest. 114, 1414 – 1417.
139. Nomiyama T. Tanaka Y. Piao L. et al. (2004). Accumulation of somatic mutation in
mitochondrial DNA and atherosclerosis in diabetic patients. Annals NYAS online. 1011,
193 – 204.
140. Rotig A, Bonnefont JP, Munnich A. (1996). Mitochondrial diabetes mellitus. Diabetes
Metab. 22, 291 – 8.
141. Alan T.W. Choo-Kang, Lynn S, et al. (2002). Defining the importance of mitochondrial
gene defects in maternally inherited diabetes by sequencing the entire mitochondrial
genome. Diabetes; 51, 2317 – 2320.
107
142. G.M. Janssen, J.A. Maassen, J.M.Van Den Ouweland. (1999). The diabetes-associated
3243 mutation in the mitochondrial tRNA (LEU(UUR)) gene causes severe
mitochondrial dysfunction without a strong decrease in protein synthesis rate.
J. Biol. Chem. 274, 29744 – 48.
143. Majamaa K, Moilanen JS, Uimonen S et al. (1998). Epidemiology of A3243G, the
mutation for mitochondrial encephalomyopathy, lactic acidosis, and stroke like episodes:
prevalence of the mutation in an adult population American Journal of Human Genetics.
63, 447 – 454.
144. Lindgren CM, Widén E, Tuomi T, Li H, Almgren P, Kanninen T, Melander O, Weng J,
Lehto M, Groop LC. (2002). Contribution of known and unknown susceptibility genes to
early-onset diabetes in Scandinavia: evidence for heterogeneity. Diabetes 51, 1609–1617.
145. Barrett TG. (2001) Mitochondrial diabetes, DIDMOAD and other inherited diabetes
syndromes. Best Pract Res Clin Endocrinol Metab. 15, 325 – 343.
146. Fajans SS, Bell GI, Polonsky KS. (2001). Molecular mechanism and clinical
pathophysiology of maturity-onset diabetes of the young. N Engl J Med. 345, 971 – 980.
147. Ramachandran A, Snehalatha C, Latha E, Vijay V, Viswanathan M. (1997). Rising
prevalence of NIDDM in urban population in India. Diabetologia. 40: 232 – 237.
148. Ramachandran A, Snehalatha C, Kapur A, Vijay V, Mohan V, Das AK, Rao PV, Yajnik
CS, Prasanna KS, Nair JD. (2001). High prevalence of diabetes and impaired glucose
tolerance in India-National Urban Diabetes Survey (NUDS). Diabetologia. 44,
1094 – 1101.
108
149. Sahu RP, Aggarwal A, Zaidi G, Shah A, Modi K, Kongara S, Aggarwal S, Talwar S, et
al. (2007). Etiology of Early-Onset Type 2 Diabetes in Indians: Islet Autoimmunity and
Mutations in Hepatocyte Nuclear Factor 1 and Mitochondrial Gene. J. Clin. End. &
Metab. 92(7), 2462 – 2467.
150. Lepretre F, Vionett N, Budhan S, Dina C, Powell KL, Genin E, Das AK, Nallam V, Passa
P, Froguel P. (1998). Genetic studies of polymorphisms in ten non-insulin-dependent
diabetes mellitus candidate genes in Tamil Indians from Pondichery. Diabet Metab 24,
244 – 250.
151. McCarthy M, Cassell P, Tran T, Mathias L, ’t Hart LM, Maassen JA, Snehalatha C,
Ramachandran A, Viswanathan M, Hitman GA. (1996). Evaluation of the importance of
maternal history of diabetes and of mitochondrial variation in the development of
NIDDM. Diabet Med, 13: 420 – 428.
152. UK Prospective Diabetes Study Group: (1994). UK Prospective Diabetes Study XII:
differences between Asian, Afro-Caribbean and white Caucasian type 2 diabetic patients
at diagnosis of diabetes. Diab Medicine. 11, 670 – 677.
153. American Diabetes Association: (2000). Type 2 Diabetes in children and adolescents.
Pediatrics. 105, 671 – 680.
154. Matthews DR, Wallace TM. (2002). Children with type 2 diabetes: the risks of
complications. Horm Res. 57, 34 – 39.
155. Fagot-Campagna A, Pettitt DJ, Engelgau MM, Burrows NR, Geiss LS, Valdez R,
Beckles R, Saaddine J, Gregg EW, Williamson DF, Narayan KM. (2002). Type 2
diabetes among North American children and adolescents: an epidemiologic review and a
public health perspective. J Pediatr. 136, 664 – 672.
109
156. Petit C. (1996). Genes responsible for human hereditary deafness: symphony of a
thousand. Nat Genet. 14, 385 – 391.
157. Howes T, Madden C, Dasgupta S, Saeed S, Das V. (2008). Role of mitochondrial
variation in maternally inherited diabetes and deafness syndrome. J Laryngol Otol, 122,
1249 – 52.
158. Guan MX, Ghodsian FN, Attardi G. (2001). Nuclear background determines biochemical
phenotype in the deafness-associated mitochondrial 12S rRNA mutation. Hum. Mol.
Genet. 10(6), 573 – 580.
159. M. Frydman, S. Vreugde, B. I. Nageris, S. Weiss, O. Vahava, and K. B. Avraham.
(2000). Clinical Characterization of Genetic Hearing Loss Caused by a Mutation in the
POU4F3 Transcription Factor. Arch Otolaryngol Head Neck Surg. 126(5), 633 – 637.
160. Guillausseau PJ, Dubois-LaForgue D, Massin P, Laloi- Michelin M, Bellanne-Chantelot
C, Gin H, et al. (2004). Heterogeneity of diabetes phenotype in patients with 3243 bp
mutation of mitochondrial DNA (Maternally Inherited Diabetes and Deafness or MIDD).
Diabetes Metab. 30, 181 – 6.
161. Guan MX, Enriquez JA, Fischel-Ghodsian N, et al. (1998). The deafness-associated
mitochondrial DNA mutation at position 7445, which affects tRNASer(UCN) precursor
processing, has long-range effects on NADH dehydrogenase subunit ND6 gene
expression. Mol Cell Bio. 18, 5868 – 79.
162. Steel KP, Kros CJ. (2001). A genetic approach to understanding auditory function. Nat
Genet. 27, 143 – 9.
110
163. Sue CM, Tanji K, Hadjigeorgiou G, et al. (1999). Maternally inherited hearing loss in a
large kindred with a novel T7511C mutation in the mitochondrial DNA
tRNA(Ser(UCN)) gene. Neurology. 52, 1905 – 1908.
164. Skvorak AB, Weng Z, Yee AJ, Robertson NG, Morton CC. (1999). Human cochlear
expressed sequence tags provide insight into cochlear gene expression and identify
candidate genes for deafness. Hum Mol Genet. 8: 439 – 452.
165. Casano RA, Johnson DF, Bykhovskaya Y, Torricelli F, Bigozzi M, Fischel-Ghodsian N.
(1999). Inherited susceptibility to aminoglycoside ototoxicity: genetic heterogeneity and
clinical implications. Am J Otolaryngol. 20, 151 – 156.
166. Chinnery PF, Elliott C, Green GR, et al. (2000). The spectrum of hearing loss due to
mitochondrial DNA defects. Brain. 123, 82 – 92.
167. Kohrt WM, Kirwan JP, Staten MA, Bourey RE, King DS, Holloszy JO. (1993). Insulin
resistance in aging is related to abdominal obesity. Diabetes. 42, 273 – 281.
168. Ravussin E., Klimes I., Sebokova E., Howard B.V. (2002). Lipid and Insulin Resistance:
What We’ve Learned at the Fourth International Smolenice Symposium. Ann.N.Y. Acad.
Sci. 967, 576 – 580.
169. Kraegen EW, Cooney GJ, Ye JM, Thompson AL, Furler SM. (2001). The role of lipids in
the pathogenesis of muscle insulin resistance and beta cell failure in type II diabetes and
obesity. Exp Clin Endocrinol Diabetes. 109(2), 189 – 201.
170. Hayden MR. (2002). Islet amyloid, metabolic syndrome, and the natural progressive
history of type 2 diabetes mellitus. JOP. 3 (5), 126 – 38.
111
171. Pan DA, Lillioja S, Kriketos AD, Milner MR, Baur LA, Bogardus C, Jenkins AB,
Storlein LH. (1997). Skeletal muscle triglyceride levels are inversely related to insulin
action. Diabetes. 46, 983 – 988.
172. Kraegen EW, Cooney GJ, Ye JM, Thompson AL, Furler SM. (2001). The role of lipids in
the pathogenesis of muscle insulin resistance and beta cell failure in type II diabetes and
obesity. Exp Clin Endocrinol Diabetes. 109(Supp l2), 189 – 201.
173. Vasudevan DM, Sreekumari S. (2005). Textbook of Biochemistry. Jaypee brothers
medical publishers (P) Ltd, India. 371 – 8.
174. Satyanarayana U. (2000). Biochemistry. Jaypee brothers medical publishers (P) Ltd,
India. 587 – 602.
175. Parker E,1 Phillips DIW,2 Cockington RA,3 Cull C,4 Jo. (2005) A common mitchondrial
DNA variant is associated with thinness in mothers and their 20-yr-old offspring. Am J
Physiol Endocrinol Metab. 289, 1110 – 1114.
176. Poulton, Tessa A, Giannotti A, Tieri L, Vilarinho L, Marotta G, Santorelli FM. (2001).
Maternally inherited deafness associated with a T1095C mutation in the mDNA. Eur J
Hum Genet. 9(2), 147 – 9.
177. ’t’ Hart LM. Jensen JJ. Lemkes HH. De Knijff P. Maassen JA. (1996). heteroplasmy
LEVELS of mitochondrial gene mutation associated with diabetes mellitus decreases in
leucocyte DNA upon aging. Hum Mutat. 7, 193 – 197.
178. Bonilla E, Sciacco M, Tanji K, Sparaco M, Petruzzella V, Moraes CT. (1992). New
morphological approaches to the study of mitochondrial encephalomyopathies. Brain
Pathol. 2,113 – 119.
112
179. Croom KF, Plosker GL. (2005). Atorvastatin: a review of its use in the primary
prevention of cardiovascular events in patients with type 2 diabetes mellitus. Drugs.
65(1), 137 – 52.
180. Rutishauser J. (2006). The role of statins in clinical medicine--LDL--cholesterol lowering
and beyond. Swiss Med Wkly. 136(3-4), 41 – 9.
181. Amarenco P, Bogousslavsky J, Callahan A, Goldstein LB, Hennerici M, Rudolph AE, et
al. (2006). Stroke Prevention by Aggressive Reduction in Cholesterol Levels (SPARCL)
Investigators. High-dose atorvastatin after stroke or transient ischemic attack. N Engl J
Med. 355, 549 – 559.
182. Park SY. Choi GH. Choi HI, et al. (2005). Depletion of mitochondrial DNA causes
impaired glucose utilization and insulin resistance in L6 GLUT4mycmyacytes. J. Biol.
Chem. 280, 9855 – 9864.
183. Lee HK. (2004). Overview. Annals NYAS online; 1011: 1 – 6.
184. Wang JJ, Hu G, Miettinen ME, Tuomilehto J. (2004). The metabolic syndrome and
incident diabetes: Assessment of four suggested definitions of the metabolic syndrome in
a Chinese population with high post-prandial glucose. Horm Metab Res. 36, 708 – 715.
185. Wang JJ, Yuan SY, Zhu LX, Fu HJ, Li HB, Hu G, Tuomilehto J. (2004). Effects of
impaired fasting glucose and impaired glucose tolerance on predicting incident type 2
diabetes in a Chinese population with high post-prandial glucose. Diabetes Res Clin
Pract. 66, 183 – 191.
186. Jagla A, Schrezenmeir J. (2001). Postprandial triglycerides and endothelial function. Exp
Clin Endocrinol Diabetes. 109, 533 – 47.
113
187. (2001). Executive Summary of the Third Report of the National Cholesterol Education
Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood
Cholesterol in Adults (Adult Treatment Panel III). JAMA. 285, 2486 – 2497.
188. Gu D, Reynolds K, Duan X, Xin X, Chen J, Wu X, Mo J, Whelton PK, He J. (2003).
Prevalence of diabetes and impaired fasting glucose in the Chinese adult population:
International Collaborative Study of Cardiovascular Disease in Asia (InterASIA).
Diabetologia. 46, 1190 - 1198.
189. The MRFIT Research Group. (1982). Multiple Risk Factor Intervention Trial. Risk factor
changes and mortality results. JAMA. 248, 1465 – 77.
190. De Backer G, Ambrosioni E, Borch-Johnsen K, et al. (2003). European guidelines on
cardiovascular disease prevention in clinical practice: Third joint task force of European
and other societies on cardiovascular disease prevention in clinical practice. Eur J
Cardiovasc Prev Rehabil. 10, 1 – 10.
191. Khalil A, Rehman S, Jamil S, Najamuddin, Ashfaqullah, Riaz M. (2005). Prevalence of
diabetic dyslipidaemia in 120 patients of type 2 diabetes mellitus. J Med Sci. 13,
128 – 31.
192. Aminul Haq, Jamilur Rehman, Mahmood R, Safi A, Ahmed Z, Arif S. (2006). Pattern of
lipid profile in type 2 diabetes mellitus patients. J Postgrad Med Inst. 20, 366 – 9.
193. Naheed T, Khan A, Masood G, Yunus B, Chaudhry MA. (2003). Dyslipidaemias in type
2 diabetes mellitus patients in a teaching hospital of Lahore. Pak J Med Sci. 19, 283 – 6.
194. Mehta JL, Bursac Z, Hauer-Jensen M, Fort C, Fink LM. (2006 Oct 1). Comparison of
mortality rates in statin users versus nonstatin users in a United States veteran
population.Am J Cardiol. 98(7), 923 – 8.
114
195. Khan SR, Ayub N, Nawab S, Shamsi TS. (2008). Triglyceride Profile in Dyslipidaemia
of Type 2 Diabetes Mellitus. JCPSP. 18 (5), 270 – 273.
196. Abbasi MA, Hafeezullah, Shah NA, Abro AD, Sammo JA. (2007). Non high density
lipoprotein cholesterol in type 2 diabetes mellitus. Pak J Physiol. 3(2), 40 – 43.
197. Ahmad J, Hameed B, Das G, Siddiqui MA, Ahmad I. (2005). Postprandial
hypertriglyceridemia and carotid intima – media thickness in north Indian type 2 diabetic
subjects. Diabetes Res Clin Pract; 69, 142 – 50.
198. Nakhjavani M, Esteghamati AR, Esfahanian F, Heshmat AR. (2006). Dyslipidaemia in
type 2 diabetes mellitus: more atherogenic lipid profile in women. Acta Med Iran; 44,
111 – 8.
199. Virga G, Gaspari F, Thomaseth K, Cara M, Mastrosimone S, Rossi V. (2007). A new
equation for estimating renal function using age, body weight and serum creatinine.
Nephron Clin Pract. 105(2), 43 – 53.
200. Remuzzi G, Schiepati A, Ruggenenti P. (2002). Nephropathy in patients with type 2
diabetes. N Engl J Med. 346, 1145 – 1151.
201. Wahid M, Naveed AK, Hussain I. (2006). Insulin & Glucagon ratio in the
pathophysiology of diabetic ketoacidosis & hyperosmolar hyperglycemic non-ketotic
diabetes. JCPSP. 16(1), 11 – 14.
202. Wahid M, Naveed AK, Mahmood S. (2007). Hyperglucagonemia – a potent threat which
can worsen diabetes mellitus. Annals of KEMU. 13 (4), 247 – 251.
203. Tentolouris N, Stylianou A, Lourida E. (2007). High postprandial triglyceridemia in
patients with type 2 diabetes and microalbuminuria. J Lipid Res. 48(1), 218 – 225.
115
204. Williams G, Pickup JC. (1999). Handbook of Diabetes. WC1N 2BL. 2, 1 – 206.
205. Rehman G, Khan SA, Hamayun M. (2005). Studies on diabetic nephropathy and
secondary diseases in type 2 diabetes. INT. J. DIAB. DEV. COUNTRIES. 25, 25 – 29.
206. American Diabetic Association. (1996). Consensus development conference on the
diagnosis and management of nephropathy in patients with diabetes mellitus (Editorial).
Diabetes Digest. 9(2), 5 – 11.
207. Lovell HG. (2000). Angiotensin converting enzyme inhibitors in normotensive diabetic
patients with microalbuinuria. Cochrane Review In; The Cochrane Library. 2, 1 – 13.
208. Adler AI, Stevens RJ, Manley SE, Bilous RW, Cull CA, Holman RR. (2003).
Development and progression of nephropathy in type 2 diabetes: the United Kingdom
Prospective Diabetes Study (UKPDS 64). Kidney Int. 63, 225 – 232.
209. Molnar M, Wittmann I, Nagy J. (2000). Prevalence, course and risk factors of diabetic
nephropathy in type 2 diabetes mellitus: Med Sci Monit. 6(5), 929 – 936.
116
Chapter 6 Appendices
APPENDIX TABLE – 6.1
Sex, age, age of onset of diabetes mellitus and plasma glucose levels of the patients with
T2DM, group A (n = 50).
Age Of Onset
Case Age Plasma glucose
Sex Of
No. (years) (mmol/L)
Diabetes
1
M 30 35 20.0
2
M 32 55 5.0
3
M 35 65 21.0
4
M 38 60 4.5
5
M 40 57 22.0
6
F 29 55 22.0
7
F 37 54 5.0
8
M 38 67 5.0
9
M 32 55 13.9
10
M 33 60 21.0
11
F 29 58 19.0
12
F 28 55 21.0
13
F 31 60 18.0
117
APPENDIX TABLE - 6.1 (Continued)
Age Of Onset
Sex Of
DIABETES
14
F 30 58 11.0
15
F 39 40 20.0
16
F 40 55 11.5
17
F 41 54 17.0
18
M 37 41 11.1
19
M 35 55 16.9
20
M 39 60 18.9
21
M 30 45 19.0
22
M 32 61 13.0
23
F 35 50 22.0
24
M 38 50 5.0
25
M 31 35 10.0
118
Age Of Onset
Sex Of
DIABETES
26
M 29 58 11.9
27
M 37 59 4.5
28
F 38 50 12.7
29
F 32 54 13.7
30
M 33 45 5.0
31
M 29 42 14.3
32
F 28 45 21.0
33
M 31 56 22.0
34
M 30 54 12.0
35
M 39 60 11.0
36
F 40 45 6.0
37
F 41 56 22.0
38
M 37 53 5.0
119
Age Of Onset
Sex Of
DIABETES
39
M 35 58 12.4
40
M 39 45 7.0
41
M 29 45 16.0
42
F 43 56 5.0
43
M 41 65 8.0
44
M 43 50 21.0
45
M 43 50 22.0
46
M 39 54 5.3
47
M 40 54 5.0
48
M 45 54 5.0
49
F 44 51 4.9
50
F 43 50 22.5
Mean
Female=36% 35.86 53.06 13.36
s.e.m 5.23 7.17
Males= 64% 0.94
(SD) (SD)
120
Plasma Glycosylated hemoglobin level, plasma urea, plasma cholesterol and plasma triglyceride
level of the patients with T2DM, group A (n = 50).
Glycosylated Plasma Plasma

Case Plasma TG
hemoglobin Urea cholesterol
No. (mmol / L)
(%) (mmol / L) (mmol / L)
1
9.3 8.0 5.8 2.0
2
6.9 5.0 5.7 1.5
3
11.0 7.0 12.0 2.1
4
7.0 6.0 9.9 1.7
5
10.0 6.5 5.6 1.8
6
11.0 9.0 5.8 1.6
7
7.0 5.0 9.0 2.0
8
5.0 13.0 5.1 1.9
9
11.5 6.5 5.0 1.7
10
12.0 14.0 4.9 1.1
11
11.3 7.7 5.9 1.0
12
12.1 18.0 7.0 1.3
13
13.0 21.0 5.5 1.6
121
Plasma Plasma
Case Glycosylated Plasma TG
Urea cholesterol
No. hemoglobin (%) (mmol / L)
(mmol / L) (mmol / L)
14
10.5 6.5 5.4 1.4
15
13.5 7.0 6.0 1.3
16
9.8 6.0 5.8 1.5
17
10.8 21.5 5.7 1.6
18
9.5 6.0 5.6 1.8
19
11.6 22.0 5.3 1.7
20
12.8 6.0 9.0 2.1
21
9.8 10.0 5.8 1.9
22
10.6 9.9 5.0 1.5
23
13.8 18.0 5.1 1.8
24
9.0 12.9 5.0 2.0
25
9.0 4.7 4.9 2.1
122
Plasma Plasma
Case Glycosylated Plasma TG
Urea cholesterol
No. hemoglobin (%) (mmol / L)
(mmol / L) (mmol / L)
26
9.7 9.0 5.9 1.9
27
5.0 8.6 7.0 1.8
28
9.8 17.0 5.5 1.6
29
11.4 13.0 5.4 1.4
30
5.0 7.0 6.0 1.9
31
9.9 6.0 5.3 1.3
32
13.5 8.0 5.1 2.3
33
12.3 9.0 5.1 2.2
34
10.5 8.0 5.3 1.9
35
12.0 7.0 5.0 1.7
36
5.0 7.9 4.9 2.0
37
12.0 4.9 5.9 2.0
38
4.5 4.8 7.0 2.1
123
Glycosylated Plasma Plasma

Case Plasma TG
hemoglobin Urea cholesterol
No. (mmol / L)
(%) (mmol / L) (mmol / L)
39
8.0 15.0 5.5 1.9
40
5.0 7.0 5.4 1.8
41
12.0 6.0 6.0 1.7
42
4.3 6.0 5.3 1.9
43
5.0 4.4 5.1 2.2
44
13.0 8.1 5.1 2.0
45
12.0 6.0 5.3 2.0
46
5.0 9.0 7.0 1.5
47
4.9 7.0 4.9 2.1
48
4.5 8.0 5.9 1.9
49
5.0 6.0 5.0 1.8
50
12.6 6.0 13.0 1.7
Mean
9.39 9.12 6.054 1.8
s.e.m
0.43 0.65 0.24 0.04
124
BMI, deafness, age of onset of deafness, glycosuria and type of therapy of the patients with
Age at onset
Case
BMI DEAFNESS of deafness Glycosuria Type of therapy
No.
(years)
1
19 yes 31 yes Insulin
2
17 yes 45 no Insulin
3
4
5
6
7
Oral
8
18 no - yes Hypoglycemic
drugs
9
10
11
12
13
19 no - yes Insulin
125
Age at onset
Case
BMI DEAFNESS of deafness Glycosuria Type of therapy
No.
(years)
14
15
16
Oral
17
22 yes 44 yes Hypoglycemic
drugs
Oral
18
drugs
19
20
Oral
21
drugs
22
23
24
25
126
Age at onset
Case Type of
BMI DEAFNESS of deafness Glycosuria
No. therapy
(years)
26
Oral
27
20 no - no Hypoglycemic
drugs
Oral
28
drugs
29
30
31
20 no - yes Insulin
32
20 no - yes Insulin
33
Oral
34
drugs
35
36
20 no - yes Insulin
Oral
37
drugs
38
127
Age at onset
Case Type of
BMI DEAFNESS of deafness Glycosuria
No. therapy
(years)
Oral
39
drugs
40
41
42
22 no - no Insulin
Oral
43
drugs
Oral
44
drugs
45
21 no - yes Insulin
46
47
48
49
Oral
50
drugs
Analysis 20.26 + 0.32 Deafness= 47.05+ 6.32 Glycosuria Insulin
(mean + s.e.m) 78% (mean + SD) present= 80% therapy= 76%
128
Sex, age, plasma glucose levels and Glycosylated hemoglobin level of the first-degree relatives
of the patients with T2DM, group B (n = 50).
Plasma Glycosylated
Case Age
Sex glucose hemoglobin
No. (years)
(mmol/L) (%)
51
M 30 5.0 5.5
52
M 34 3.5 4.5
53
M 38 4.0 6.6
54
M 18 5.0 6.0
55
F 23 5.0 6.1
56
F 36 4.9 5.5
57
F 24 5.1 6.0
58
F 30 5.3 5.0
59
M 37 5.5 4.5
60
M 27 6.0 6.0
61
M 35 5.0 5.0
62
M 31 5.7 6.1
63
M 35 5.6 5.0
129
Plasma Glycosylated
Case Age
No. (years)
(mmol/L) (%)
64
M 18 5.4 5.1
65
M 27 4.0 4.5
66
M 20 5.0 5.0
67
M 45 4.9 4.3
68
F 23 5.0 6.0
69
F 34 4.0 5.0
70
F 22 5.2 4.5
71
M 23 6.0 5.0
72
F 15 5.9 6.0
73
M 18 5.0 6.5
74
M 22 3.5 6.0
75
F 23 4.7 5.0
130
Plasma Glycosylated
Case Age
No. (years)
(mmol/L) (%)
76
F 32 4.9 5.5
77
M 34 5.0 5.2
78
M 22 5.0 4.8
79
F 29 5.3 4.5
80
F 32 6.0 5.0
81
M 35 4.9 5.0
82
M 23 5.0 6.6
83
M 31 5.0 6.0
84
M 25 4.7 5.7
85
M 34 5.4 5.2
86
M 23 6.0 5.0
87
F 45 4.6 4.5
88
M 32 4.8 4.0
131
Plasma Glycosylated
Case Age
No. (years)
(mmol/L) (%)
89
F 40 5.0 5.0
90
M 18 3.4 5.0
91
F 29 5.0 5.7
92
M 33 5.1 6.0
93
M 34 5.2 4.9
94
F 23 5.2 6.0
95
F 34 6.0 5.8
96
F 41 5.0 5.7
97
F 34 5.0 6.0
98
M 20 5.0 5.5
99
M 32 4.5 4.5
100
F 23 5.5 5.0
Mean
28.92 5.01 5.34
Female= 40%
s.e.m Males=60% 7.34
0.09 0.09
(SD)
132
Plasma urea, Plasma cholesterol, plasma triglyceride (TG) and Body mass index (BMI) of the
first-degree relatives of the patients with T2DM, group B (n = 50).
Plasma Plasma Plasma

Case
Urea Cholesterol TG BMI
No.
(mmol/L) (mmol/L) (mmol/L)
51
4.3 3.9 1.9 26
52
3.4 4.0 1.2 25
53
6.3 4.1 1.3 24
54
3.9 5.0 1.1 27
55
3.7 4.5 1.4 23
56
9.2 4.6 1.5 24
57
8.5 6.0 1.7 22
58
3.9 4.0 1.1 24
59
3.7 4.0 1.0 25
60
9.2 7.0 1.3 25
61
8.5 5.0 1.6 12
62
4.3 4.0 1.4 24
63
3.4 3.8 1.3 27
133

Case
No.
64
6.3 7.0 1.0 24
65
3.7 4.1 .9 27
66
6.3 4.4 1.2 21
67
5.1 3.9 1.2 30
68
4.5 5.0 1.3 24
69
4.7 4.1 1.1 28
70
4.9 4.3 1.4 21
71
4.8 4.5 1.5 22
72
4.5 5.0 1.7 19
73
4.7 4.0 1.1 18
74
5.0 4.0 1.0 21
75
5.1 5.0 1.3 23
134

Case
No.
76
4.6 6.0 1.6 28
77
4.2 7.7 1.4 30
78
4.2 3.8 1.3 22
79
4.1 3.7 1.0 28
80
6.0 4.1 .8 31
81
4.3 4.4 1.2 26
82
5.0 3.9 1.7 23
83
4.3 4.0 1.4 29
84
5.0 4.1 1.4 26
85
4.7 4.3 1.3 25
86
4.9 3.6 1.3 24
87
6.0 4.0 1.6 27
88
4.5 5.0 1.4 23
135

Case
No.
89
4.7 3.2 1.3 24
90
5.0 4.1 1.0 22
91
5.5 4.4 .8 24
92
4.6 3.9 1.2 25
93
4.2 4.0 1.7 25
94
5.6 4.1 1.4 12
95
4.1 4.3 1.4 24
96
6.0 3.6 1.3 27
97
6.5 4.1 1.3 24
98
5.0 4.4 1.6 24
99
5.0 3.9 1.4 27
100
4.7 4.0 1.3 24
Mean
5.09 4.44 1.31 24.20
s.e.m
0.19 0.13 0.03 0.52
136
Glycosuria and deafness in the first-degree relatives of the diabetic patients, group B (n = 50).
Case No. Glycosuria Deafness

51
no no
52
no no
53
no no
54
no no
55
no no
56
no no
57
no no
58
no no
59
no no
60
no no
61
no no
137
APPENDIX TABLE – 6.6 (Continued)
62
no no
63
no no
64
no no
65
no no
66
no no
67
no no
68
no no
69
no no
70
no no
71
no no
72
no no
138

73
no no
74
no no
75
no no
76
no no
77
no no
78
no no
79
no no
80
no no
81
no no
82
no no
83
no no
84
no no
85
no no
86
no no
87
no no
88
no no
139

89
no no
90
no no
91
no no
92
no no
93
no no
94
no no
95
no no
96
no no
97
no no
98
no no
99
no no
100
no no
Result
0% 0%
140
Sex, age, plasma glucose levels and Glycosylated hemoglobin level of non – diabetic subjects
with no family history of diabetes mellitus, group C (n = 50).
Glycosylated
Sex hemoglobin
(%)
101
M 24 4.0 4.7
102
F 25 5.0 4.9
103
F 45 6.0 4.5
104
F 4 5.4 6.0
105
F 32 5.0 5.4
106
F 31 5.0 6.1
107
F 23 4.9 6.7
108
F 54 6.0 5.2
109
M 43 5.3 5.5
110
M 34 5.5 4.5
111
M 23 5.0 6.6
112
M 13 5.0 6.1
113
M 33 5.7 6.1
141
Glycosylated
Age Plasma glucose
Case Sex hemoglobin
(years) (mmol/L)
No. (%)
114
F 46 5.6 7.2
115
M 57 4.5 4.6
116
M 45 5.0 5.5
117
M 42 5.0 6.1
118
M 25 6.0 5.5
119
F 25 5.0 6.0
120
F 32 3.5 5.5
121
M 35 5.2 4.5
122
M 31 6.0 5.0
123
F 26 5.9 4.7
124
M 37 4.5 5.5
125
M 45 4.8 7.2
142
Glycosylated
Sex hemoglobin
(%)
126
M 57 4.7 6.0
127
F 23 6.0 5.5
128
F 24 5.0 6.1
129
M 25 5.8 5.5
130
M 45 4.0 5.0
131
F 4 5.1 5.5
132
F 32 4.9 4.5
133
F 31 4.7 6.6
134
F 23 4.7 6.8
135
F 54 5.5 6.1
136
F 43 5.4 5.9
137
F 34 6.0 5.8
138
M 23 4.6 4.5
143
Glycosylated
Sex hemoglobin
(%)
139
M 13 4.8 4.0
140
M 33 5.0 4.7
141
M 46 5.0 5.6
142
M 57 5.0 5.7
143
F 45 6.0 5.9
144
M 42 5.2 4.9
145
M 25 5.2 6.0
146
M 25 5.7 5.8
147
M 32 5.0 5.7
148
F 35 5.0 5.8
149
F 31 4.9 5.5
150
M 26 4.5 4.5
Mean Females=46% 34.72 5.13 5.55
s.e.m. Males=54% 1.6

0.08 0.10
(SD)
144
Plasma urea, plasma cholesterol, plasma triglyceride level and BMI of non – diabetic subjects

Case
No.
101
3.9 4.1 1.0 27
102
3.7 4.3 .8 21
103
9.2 3.6 1.2 30
104
8.5 4.0 1.7 24
105
4.3 4.0 1.4 28
106
4.0 5.1 1.4 21
107
6.3 5.0 1.3 22
108
5.0 4.0 1.3 19
109
6.3 3.8 1.1 18
110
6.0 3.7 1.4 21
111
8.2 4.1 1.5 23
112
5.0 4.4 1.7 28
113
4.9 3.9 1.1 30
145

Case
No.
114
9.2 4.0 1.0 22
115
8.5 4.1 1.3 28
116
5.0 4.3 1.6 31
117
4.9 4.5 1.4 26
118
6.3 4.6 1.3 23
119
5.0 4.0 1.0 25
120
6.3 4.0 .9 29
121
5.1 4.0 1.2 28
122
8.2 5.1 1.2 27
123
3.9 5.0 1.3 25
124
6.0 4.0 1.1 19
125
9.2 4.8 1.4 32
146
Plasma Plasma
Case Plasma Urea
Cholesterol TG BMI
No. (mmol/L)
(mmol/L) (mmol/L)
126
8.5 3.7 1.5 26
127
4.3 4.1 1.7 25
128
4.4 4.4 1.1 24
129
6.3 4.4 1.0 27
130
5.0 7.6 1.3 23
131
5.0 7.0 1.6 24
132
5.1 5.0 1.3 22
133
4.6 5.1 1.1 24
134
4.2 4.6 1.4 25
135
4.2 8.0 1.9 25
136
4.1 6.0 1.7 12
137
6.0 6.1 1.1 24
138
4.3 4.6 1.0 27
147
Plasma Plasma
Case Plasma Urea
Cholesterol TG BMI
No. (mmol/L)
(mmol/L) (mmol/L)
139
5.0 4.7 1.3 24
140
4.3 5.8 1.6 24
141
5.0 5.3 1.4 27
142
4.7 5.1 1.3 24
143
4.9 5.0 1.5 27
144
6.0 7.0 1.6 21
145
4.5 3.8 1.2 30
146
4.7 4.0 1.2 24
147
9.2 4.4 1.3 28
148
8.5 4.7 1.1 21
149
4.3 7.0 1.8 22
150
3.4 5.4 1.5 19
Mean
5.67 4.78 1.32 24.52
s.e.m.
0.24 0.15 0.04 0.53
148

Islamic Verse

Uploaded by

Copyright:

Available Formats

Islamic Verse

Uploaded by

Document Information

Original Description:

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Islamic Verse

Uploaded by

Copyright:

Available Formats

In the name of Allah, the Most Gracious,

the Most Merciful

MITOCHONDRIAL DNA MUTATION IN TYPE 2

DIABETES MELLITUS IN PAKISTAN

Candidate: DR. MARYAM SHARIF

Supervisor: MAJ GEN ABDUL KHALIQ NAVEED

DR. MARYAM SHARIF

The Faculty of Biological Sciences

submitted by Dr Maryam Sharif in its present form, as satisfying the thesis

requirements for the degree of “Doctor of Philosophy (PhD) in Biochemistry”.

External Examiner: ________________________

External Examiner: ________________________

DR. MARYAM SHARIF

• Diagnosis of diabetes mellitus: 3

• Replication of Mitochondrial DNA 7

Chapter No.2 : Materials and Methods 29

• Polymerase Chain Reaction (PCR) 32

• Horizontal Gel Electrophoresis 33

• PCR – RFLP analysis 34

• Determination Of Glycosylated Hemoglobin 37

• Plasma Urea Estimation 39

• Plasma Cholesterol Estimation 41

• Plasma Triglyceride Estimation 42

¾ BODY MASS INDEX (BMI) 45

Chapter No.3 : Results

• Detection of A3243G mutation 47

¾ CLINICAL STUDIES: DEAFNESS 67

• A3243G mutation in the region of tRNALeu(UUR) gene in

• Age and sex 76

• Body mass index 83

• Plasma triglycerides and cholesterol profile 85

• Plasma urea level 86

Chapter No.6 : Appendices 117

No works can suffice to express my indebtedness to my supervisor, Dr. Abdul

I am thankful to my senior PhD Scholar Dr Muhammad Naeem and all my lab

My heartfelt gratitude is reserved for my kids, Maheen, Minahil and Haroon,

A Sample Absorbance of Sample

AStandard Absorbance of Standard

ADP Adenosine Diphosphate

ATP Adenosine Triphosphate

BMI Body Mass Index

CO2 Carbon Dioxide

CStandard Concentration of Standard

CVD Cardiovascular Disease

DNA Deoxy Ribonucleic Acid

EDTA Ethylene Diamine Tetra Acetic acid

FADH Reduced Flavin Adenine Dinucleotide

GAD Glutamic Acid Carboxylase

HbA1c Glycosylated Hemoglobin.

H – Strand Heavy Strand

L – Strand Light Strand

LPL Enzyme lipoprotein lipase

MDA Multiple Displacement Amplification

MIDD Maternally Inherited Diabetes and Deafness

mmo1/L Millimole per Liter

MELAS Mitochondrial myopathy, encephalopathy, lactic acidosis and

NADH Reduced Nicotinamide Adenine Dinucleotide

NCEP National Cholesterol Education Program

NIDDM Non-insulin dependent diabetes mellitus