Stem Questions

Examine carefully and answer the following question/s.
•1.How many servings are in this container?

•2.Would you agree that this is the reasonable amount of food you would consume per
serving?
*3.How many total food calories (C) are in this container?
•4.How much fat is present in one serving? 5.What kind of fat? 6.What is the importance of
consuming fats in our diet?
•7.How much carbohydrates are present in one serving? 8.What kind of carbohydrates?
9. What is the importance of consuming carbohydrates in our diet?
•10.Decide on whether this food sample can be eaten often or sparingly and justify.
A glycosidic bond or glycosidic linkage is a type of covalent bond that joins a carbohydrate (sugar)
molecule to another group, which may or may not be another carbohydrate
Dehydration synthesis reaction between two molecules of glucose, forming a molecule of maltose with
the release of a water molecule. In the dehydration synthesis reaction above, two molecules of the
sugar glucose (monomers) combine to form a single molecule of the sugar maltose.
Two monosaccharides, such as glucose and fructose, can be joined together (to form sucrose) using
dehydration synthesis. ... The process of hydrolysis is the reverse reaction, meaning that the water is
recombined with the two hydroxyl groups and the disaccharide reverts to being monosaccharides.
There are four major biological macromolecules: carbohydrates, lipids, proteins, and nucleic
acids.
1.Which of the following makes carbohydrates unique from the other biological macromolecules?
(Choice A) Long-term energy storage is provided by carbohydrates. Carbohydrates do provide energy,

but they act as short-term energy reserves. Long-term energy is provided by lipids.
(Choice B) Carbohydrates contain a 1:2:1 ratio of carbon to hydrogen to oxygen. The chemical formula
of carbohydrates is (\text{CH}_{2}\text{O})_{n}(CH 2 O) n left parenthesis, C, H, start subscript, 2, end
subscript, O, right parenthesis, start subscript, n, end subscript, meaning each carbohydrate molecule
contains a 1 carbon:2 hydrogen:1 oxygen ratio.
(Choice C )Carbohydrates are polymers that always form a ring structure.

Carbohydrates do not always form rings. Sometimes they remain as straight, long chains.
(Choice D) The monomers in carbohydrates are held together by peptide bonds.

The monomers in carbohydrates are held together by glycosidic bonds rather than peptide bonds, which
are found in proteins instead.
2. Which of the following statements is true of the carbohydrate glucose?
(Choice A) Glucose is a structural isomer of galactose.
(Choice B) Glucose contains carbon, hydrogen, and oxygen atoms.
(Choice C) Glucose is a pentose sugar.
(Choice D) Glucose is a polysaccharide.
3. Which of the following correctly describes hydrolysis?
(Choice A) Long carbohydrates are broken into monomers through the addition of water molecules
between the subunits.
(Choice B) Hydrogen atoms are removed from the end of a carbohydrate.
(Choice C) Monomers are linked together by the removal of one or more water molecules.
(Choice D) Hydrogen atoms are added to each end of the carbohydrate to protect it from degradation.
4. Which of the following makes carbohydrates unique from the other biological macromolecules?
(Choice A) Long-term energy storage is provided by carbohydrates. Carbohydrates do provide energy,

but they act as short-term energy reserves. Long-term energy is provided by lipids.
(Choice B) Carbohydrates are polymers that always form a ring structure. Carbohydrates do not always
form rings. Sometimes they remain as straight, long chains.
(Choice C) Carbohydrates contain a 1:2:1 ratio of carbon to hydrogen to oxygen.
The chemical formula of carbohydrates is (\text{CH}_{2}\text{O})_{n}(CH2 O) n left parenthesis, C, H,

start subscript, 2, end subscript, O, right parenthesis, start subscript, n, end subscript, meaning each
carbohydrate molecule contains a 1 carbon:2 hydrogen:1 oxygen ratio.
5. Glucose and fructose are both monosaccharides
How does the structure of fructose compare to the structure of glucose?
(Choice A) Glucose is a monosaccharide and fructose is a disaccharide.
(Choice B) Glucose and fructose are structural isomers.
(Choice C) Glucose and fructose are stereoisomers of one another.
(Choice D) Glucose has a chemical formula of \text{C}_{6}\text{H}_{12}\text{O}_{6}CH1O6 C, start

subscript, 6, end subscript, H, start subscript, 12, end subscript, O, start subscript, 6, end subscript while
fructose has a chemical formula of \text{C}_{7}\text{H}_{14}\text{O}_{7}C7 H14 O7
The central dogma of molecular biology deals with the detailed residue-by-residue transfer of sequential
information. It states that such information cannot be transferred back from protein to either protein or
nucleic acid. ... There are 3 major classes of such biopolymers: DNA and RNA (both nucleic acids), and
protein.
Given the following coding sequence for DNA, provide the sequence of the complementary (template)
sequence.
Coding sequence: 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
Convert the given coding sequence into an mRNA transcript:
Complementary Non-coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
2. Translate the given mRNA transcript into a polypeptide sequence:
Coding sequence ~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
Given the following coding sequence for DNA, provide the sequence of the complementary (template)
sequence.
Coding sequence : 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
(Answer)
Complementary sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
Ask the learners to build models of DNA by using recyclable materials such as popsicle sticks or pieces of
colored papers to represent the complementary bases: G with C; A with T. The DNA backbone
(phosphate, sugar) should be included.
Teacher Tip: Be sure to note the antiparallel orientation of the coding and non-coding strands of DNA.
Explain the relative positions of the 5’ and 3’ ends.
1. Convert the given coding sequence into an mRNA transcript:
Complementary Non coding/ Templatesequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
(Answer)
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’

2. Translate the given mRNA transcript into a polypeptide sequence:
Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
(Answer)
Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
Teacher Tip: The mRNA transcript has almost the same sequence as the coding sequence (DNA), but the
thymines are replaced to Uracil. Show the learners how to read the codon Table Teach the learners the
single letter codes for the amino acids (e.g. ryptophan ! Trp ! W). Ask the learners to spell their names
using the amino acid codes (e.g. N-E-I-L ! Asn – Glu – Ile – Lue).

Stem Questions

Uploaded by

Copyright:

Available Formats

Stem Questions

Uploaded by

Document Information

Original Description:

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Stem Questions

Uploaded by

Copyright:

Available Formats

Examine carefully and answer the following question/s.

•1.How many servings are in this container?

(Choice A) Long-term energy storage is provided by carbohydrates. Carbohydrates do provide energy,

(Choice C )Carbohydrates are polymers that always form a ring structure.

(Choice D) The monomers in carbohydrates are held together by peptide bonds.

2. Which of the following statements is true of the carbohydrate glucose?

(Choice A) Glucose is a structural isomer of galactose.

(Choice B) Glucose contains carbon, hydrogen, and oxygen atoms.

(Choice C) Glucose is a pentose sugar.

(Choice D) Glucose is a polysaccharide.

3. Which of the following correctly describes hydrolysis?

(Choice B) Hydrogen atoms are removed from the end of a carbohydrate.

(Choice A) Long-term energy storage is provided by carbohydrates. Carbohydrates do provide energy,

(Choice C) Carbohydrates contain a 1:2:1 ratio of carbon to hydrogen to oxygen.

The chemical formula of carbohydrates is (\text{CH}_{2}\text{O})_{n}(CH2 O) n left parenthesis, C, H,

5. Glucose and fructose are both monosaccharides

How does the structure of fructose compare to the structure of glucose?

(Choice A) Glucose is a monosaccharide and fructose is a disaccharide.

(Choice B) Glucose and fructose are structural isomers.

(Choice C) Glucose and fructose are stereoisomers of one another.

(Choice D) Glucose has a chemical formula of \text{C}_{6}\text{H}_{12}\text{O}_{6}CH1O6 C, start

Coding sequence: 5’ ATGCATAGATTAGGATATCCCAGATAG 3’

Convert the given coding sequence into an mRNA transcript:

Complementary Non-coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’

2. Translate the given mRNA transcript into a polypeptide sequence:

Coding sequence ~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’

Coding sequence : 5’ ATGCATAGATTAGGATATCCCAGATAG 3’

Complementary sequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’

1. Convert the given coding sequence into an mRNA transcript:

Complementary Non coding/ Templatesequence 3’ TACGTATCTAATCCTATAGGGTCTATC 5’

Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’

Coding sequence ~ mRNA transcript 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’

Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C

You might also like