NGS

Next-Generation Sequencing
Data Analysis
Xinkun Wang
Data Analysis
Data Analysis
Xinkun Wang
Northwestern University
Chicago, Illinois, USA
CRC Press
Taylor & Francis Group
6000 Broken Sound Parkway NW, Suite 300
Boca Raton, FL 33487-2742
© 2016 by Taylor & Francis Group, LLC
CRC Press is an imprint of Taylor & Francis Group, an Informa business
No claim to original U.S. Government works

Version Date: 20160127
International Standard Book Number-13: 978-1-4822-1789-6 (eBook - PDF)
This book contains information obtained from authentic and highly regarded sources. Reasonable
efforts have been made to publish reliable data and information, but the author and publisher cannot
assume responsibility for the validity of all materials or the consequences of their use. The authors and
publishers have attempted to trace the copyright holders of all material reproduced in this publication
and apologize to copyright holders if permission to publish in this form has not been obtained. If any
copyright material has not been acknowledged please write and let us know so we may rectify in any
future reprint.
Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced,
transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or
hereafter invented, including photocopying, microfilming, and recording, or in any information stor-
age or retrieval system, without written permission from the publishers.
For permission to photocopy or use material electronically from this work, please access www.copy-
right.com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222
Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that pro-
vides licenses and registration for a variety of users. For organizations that have been granted a photo-
copy license by the CCC, a separate system of payment has been arranged.
Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are
used only for identification and explanation without intent to infringe.
Visit the Taylor & Francis Web site at
http://www.taylorandfrancis.com
and the CRC Press Web site at
http://www.crcpress.com
Contents
Section I Introduction to Cellular and Molecular Biology
1. The Cellular System and the Code of Life.................................................3

1.1 The Cellular Challenge......................................................................... 3
1.2 How Cells Meet the Challenge............................................................ 4
1.3 Molecules in Cells..................................................................................4
1.4 Intracellular Structures or Spaces........................................................5
1.4.1 Nucleus....................................................................................... 5
1.4.2 Cell Membrane.......................................................................... 6
1.4.3 Cytoplasm..................................................................................7
1.4.4 Endosome, Lysosome, and Peroxisome.................................8
1.4.5 Ribosome....................................................................................9
1.4.6 Endoplasmic Reticulum (ER)..................................................9
1.4.7 Golgi Apparatus...................................................................... 10
1.4.8 Cytoskeleton............................................................................ 10
1.4.9 Mitochondrion......................................................................... 10
1.4.10 Chloroplast............................................................................... 12
1.5 The Cell as a System............................................................................ 13
1.5.1 The Cellular System................................................................ 13
1.5.2 Systems Biology of the Cell................................................... 13
1.5.3 How to Study the Cellular System....................................... 14
2. DNA Sequence: The Genome Base............................................................ 17

2.1 The DNA Double Helix and Base Sequence.................................... 17
2.2 How DNA Molecules Replicate and Maintain Fidelity.................. 18
2.3 How the Genetic Information Stored in DNA Is Transferred
to Protein............................................................................................... 20
2.4 The Genomic Landscape..................................................................... 21
2.4.1 The Minimal Genome............................................................ 21
2.4.2 Genome Sizes.......................................................................... 21
2.4.3 Protein-Coding Regions of the Genome.............................22
2.4.4 Noncoding Genomic Elements............................................. 23
2.5 DNA Packaging, Sequence Access, and DNA–Protein
Interactions........................................................................................... 25
2.5.1 DNA Packaging....................................................................... 25
2.5.2 Sequence Access...................................................................... 25
2.5.3 DNA–Protein Interactions..................................................... 26
2.6 DNA Sequence Mutation and Polymorphism................................. 27
v
vi Contents
2.7 Genome Evolution................................................................................ 28

2.8 Epigenome and DNA Methylation.................................................... 29
2.9 Genome Sequencing and Disease Risk.............................................30
2.9.1 Mendelian (Single-Gene) Diseases....................................... 31
2.9.2 Complex Diseases That Involve Multiple Genes................ 31
2.9.3 Diseases Caused by Genome Instability............................. 32
2.9.4 Epigenomic/Epigenetic Diseases......................................... 32
3. RNA: The Transcribed Sequence............................................................... 35

3.1 RNA as the Messenger........................................................................ 35
3.2 The Molecular Structure of RNA...................................................... 35
3.3 Generation, Processing, and Turnover of RNA as a Messenger.... 36
3.3.1 DNA Template......................................................................... 37
3.3.2 Transcription of Prokaryotic Genes..................................... 37
3.3.3 Initial Transcription of Pre-mRNA from Eukaryotic
Genes........................................................................................ 38
3.3.4 Maturation of mRNA from Pre-mRNA............................... 40
3.3.5 Transport and Localization...................................................42
3.3.6 Stability and Decay.................................................................42
3.3.7 Major Steps of mRNA Transcript Level Regulation..........43
3.4 RNA Is More Than a Messenger........................................................44
3.4.1 Ribozyme................................................................................. 45
3.4.2 snRNA and snoRNA.............................................................. 46
3.4.3 RNA for Telomere Replication.............................................. 46
3.4.4 RNAi and Small Noncoding RNAs..................................... 46
3.4.4.1 miRNA...................................................................... 47
3.4.4.2 siRNA........................................................................ 49
3.4.4.3 piRNA....................................................................... 49
3.4.5 Long Noncoding RNAs......................................................... 50
3.4.6 Other Noncoding RNAs........................................................ 50
3.5 The Cellular Transcriptional Landscape.......................................... 51
Section II Introduction to Next-Generation

Sequencing (NGS) and NGS Data Analysis
4. Next-Generation Sequencing (NGS) Technologies: Ins and Outs...... 55

4.1 How to Sequence DNA: From First Generation to the Next.......... 55
4.2 A Typical NGS Experimental Workflow........................................... 58
4.3 Ins and Outs of Different NGS Platforms........................................ 60
4.3.1 Illumina Reversible Dye-Terminator Sequencing.............. 61
4.3.1.1 Sequencing Principle.............................................. 61
4.3.1.2 Implementation....................................................... 61
4.3.1.3 Error Rate, Read Length, Data Output,
and Run Time..........................................................64
Contents vii
4.3.2 Ion Torrent Semiconductor Sequencing..............................65

4.3.2.1 Sequencing Principle..............................................65
4.3.2.2 Implementation.......................................................65
4.3.2.3 Error Rate, Read Length, Date Output,
and Run Time.......................................................... 66
4.3.3 Pacific Biosciences Single Molecule Real-Time
(SMRT) Sequencing................................................................ 66
4.3.3.1 Sequencing Principle.............................................. 66
4.3.3.2 Implementation....................................................... 67
4.3.3.3 Error Rate, Read Length, Data Output,
and Run Time.......................................................... 67
4.4 Biases and Other Adverse Factors That May Affect NGS
Data Accuracy...................................................................................... 69
4.4.1 Biases in Library Construction............................................. 69
4.4.2 Biases and Other Factors in Sequencing............................. 70
4.5 Major Applications of NGS................................................................. 71
4.5.1 Transcriptomic Profiling and Splicing Variant
Detection (RNA-Seq).............................................................. 71
4.5.2 Genetic Mutation and Variation Discovery........................ 71
4.5.3 De novo Genome Assembly................................................... 71
4.5.4 Protein-DNA Interaction Analysis (ChIP-Seq)................... 71
4.5.5 Epigenomics and DNA Methylation Study (Methyl-Seq).... 72
4.5.6 Metagenomics.......................................................................... 72
5. Early-Stage Next-Generation Sequencing (NGS) Data Analysis:

Common Steps............................................................................................... 73
5.1 Base Calling, FASTQ File Format, and Base Quality Score........... 73
5.2 NGS Data Quality Control and Preprocessing................................ 76
5.3 Reads Mapping..................................................................................... 78
5.3.1 Mapping Approaches and Algorithms................................ 78
5.3.2 Selection of Mapping Algorithms and Reference
Genome Sequences.................................................................80
5.3.3 SAM/BAM as the Standard Mapping File Format............ 81
5.3.4 Mapping File Examination and Operation.........................83
5.4 Tertiary Analysis.................................................................................. 86
6. Computing Needs for Next-Generation Sequencing (NGS) Data

Management and Analysis.......................................................................... 87
6.1 NGS Data Storage, Transfer, and Sharing......................................... 87
6.2 Computing Power Required for NGS Data Analysis..................... 89
6.3 Software Needs for NGS Data Analysis...........................................90
6.4 Bioinformatics Skills Required for NGS Data Analysis................. 92
viii Contents
Section III Application-Specific NGS Data Analysis
7. Transcriptomics by RNA-Seq..................................................................... 97
7.1 Principle of RNA-Seq........................................................................... 97
7.2 Experimental Design........................................................................... 98
7.2.1 Factorial Design...................................................................... 98
7.2.2 Replication and Randomization........................................... 98
7.2.3 Sample Preparation................................................................ 99
7.2.4 Sequencing Strategy............................................................. 100
7.3 RNA-Seq Data Analysis.................................................................... 101
7.3.1 Data Quality Control and Reads Mapping....................... 101
7.3.2 RNA-Seq Data Normalization............................................ 103
7.3.3 Identification of Differentially Expressed Genes............. 105
7.3.4 Differential Splicing Analysis............................................. 107
7.3.5 Visualization of RNA-Seq Data.......................................... 108
7.3.6 Functional Analysis of Identified Genes........................... 108
7.4 RNA-Seq as a Discovery Tool........................................................... 109
8. Small RNA Sequencing............................................................................. 111

8.1 Small RNA Next-Generation Sequencing (NGS) Data
Generation and Upstream Processing............................................ 112
8.1.1 Data Generation.................................................................... 112
8.1.2 Preprocessing........................................................................ 113
8.1.3 Mapping................................................................................. 114
8.1.4 Identification of Known and Putative Small RNA
Species.................................................................................... 115
8.1.5 Normalization....................................................................... 115
8.2 Identification of Differentially Expressed Small RNAs............... 116
8.3 Functional Analysis of Identified Small RNAs............................. 116
9. Genotyping and Genomic Variation Discovery by Whole

Genome Resequencing............................................................................... 119
9.1 Data Preprocessing, Mapping, Realignment, and Recalibration... 120
9.2 Single Nucleotide Variant (SNV) and Indel Calling..................... 121
9.2.1 SNV Calling........................................................................... 121
9.2.2 Identification of de novo Mutations..................................... 123
9.2.3 Indel Calling.......................................................................... 124
9.2.4 Variant Calling from RNA-Seq Data................................. 124
9.2.5 Variant Call Format (VCF) File........................................... 125
9.2.6 Evaluating VCF Results........................................................ 126
9.3 Structural Variant (SV) Calling........................................................ 126
9.3.1 Read-Pair-Based SV Calling................................................ 126
9.3.2 Breakpoint Determination................................................... 128
9.3.3 De novo Assembly-Based SV Detection............................. 128
Contents ix
9.3.4 CNV Detection...................................................................... 128

9.3.5 Integrated SV Analysis........................................................ 129
9.4 Annotation of Called Variants......................................................... 129
9.5 Testing of Variant Association with Diseases or Traits................ 130
10. De novo Genome Assembly from Next-Generation Sequencing

(NGS) Reads.................................................................................................. 131
10.1 Genomic Factors and Sequencing Strategies for de novo
Assembly............................................................................................. 132
10.1.1 Genomic Factors That Affect de novo Assembly............... 132
10.1.2 Sequencing Strategies for de novo Assembly..................... 132
10.2 Assembly of Contigs.......................................................................... 134
10.2.1 Sequence Data Preprocessing, Error Correction,
and Assessment of Genome Characteristics..................... 134
10.2.2 Contig Assembly Algorithms............................................. 136
10.3 Scaffolding.......................................................................................... 138
10.4 Assembly Quality Evaluation.......................................................... 139
10.5 Gap Closure........................................................................................ 140
10.6 Limitations and Future Development............................................. 140
11. Mapping Protein–DNA Interactions with ChIP-Seq........................... 143

11.1 Principle of ChIP-Seq......................................................................... 143
11.2 Experimental Design......................................................................... 145
11.2.1 Experimental Control........................................................... 145
11.2.2 Sequencing Depth................................................................. 145
11.2.3 Replication............................................................................. 146
11.3 Read Mapping, Peak Calling, and Peak Visualization................. 146
11.3.1 Data Quality Control and Read Mapping......................... 146
11.3.2 Peak Calling........................................................................... 149
11.3.3 Peak Visualization................................................................ 156
11.4 Differential Binding Analysis.......................................................... 156
11.5 Functional Analysis........................................................................... 159
11.6 Motif Analysis.................................................................................... 159
11.7 Integrated ChIP-Seq Data Analysis................................................. 160
12. Epigenomics and DNA Methylation Analysis

by Next‑Generation Sequencing (NGS).................................................. 163
12.1 DNA Methylation Sequencing Strategies....................................... 163
12.1.1 Whole-Genome Bisulfite Sequencing (WGBS)................. 164
12.1.2 Reduced Representation Bisulfite Sequencing (RRBS).... 165
12.1.3 Methylation Sequencing Based on Methylated DNA
Enrichment............................................................................ 165
12.1.4 Differentiation of Cytosine Methylation from
Demethylation Products in Bisulfite Sequencing............ 166
12.2 DNA Methylation Sequencing Data Analysis............................... 166
x Contents
12.2.1 Quality Control and Preprocessing................................... 166

12.2.2 Read Mapping....................................................................... 167
12.2.3 Quantification of DNA Methylation.................................. 169
12.2.4 Visualization of DNA Methylation Data........................... 170
12.3 Detection of Differentially Methylated Cytosines or Regions.... 172
12.4 Data Verification, Validation, and Interpretation.......................... 173
13. Metagenome Analysis by Next-Generation Sequencing (NGS)....... 175

13.1 Experimental Design and Sample Preparation............................. 176
13.1.1 Metagenome Sample Collection......................................... 177
13.1.2 Metagenome Sample Processing........................................ 177
13.2 Sequencing Approaches.................................................................... 178
13.3 Overview of Whole-Genome Shotgun (WGS) Metagenome
Sequencing Data Analysis................................................................ 179
13.4 Sequencing Data Quality Control and Preprocessing.................. 181
13.5 Taxonomic Characterization of a Microbial Community............ 181
13.5.1 Metagenome Assembly........................................................ 181
13.5.2 Sequence Binning................................................................. 182
13.5.3 Calling of Open Reading Frames (ORFs) and Other
Genomic Elements from Metagenomic Sequences.......... 184
13.5.4 Phylogenetic Gene Marker Analysis.................................. 184
13.6 Functional Characterization of a Microbial Community............ 185
13.6.1 Gene Function Annotation.................................................. 185
13.6.2 Metabolic Pathway Reconstruction.................................... 185
13.7 Comparative Metagenomic Analysis.............................................. 186
13.7.1 Metagenome Sequencing Data Normalization................ 186
13.7.2 Identification of Differentially Abundant Species
or Operational Taxonomic Units (OTUs)........................... 187
13.8 Integrated Metagenomics Data Analysis Pipelines...................... 187
13.9 Metagenomics Data Repositories..................................................... 188
Section IV The Changing Landscape

of Next-Generation Sequencing
Technologies and Data Analysis
14. What Is Next for Next-Generation Sequencing (NGS)?...................... 191

14.1 The Changing Landscape of Next-Generation Sequencing
(NGS).................................................................................................... 191
14.2 Rapid Evolution and Growth of Bioinformatics Tools
for High-Throughput Sequencing Data Analysis......................... 193
14.3 Standardization and Streamlining of NGS Analytic Pipelines... 195
14.4 Parallel Computing............................................................................ 195
14.5 Cloud Computing.............................................................................. 196
Contents xi
Appendix A: Common File Types Used in Next-Generation

Sequencing (NGS) Data Analysis................................................................... 199
Appendix B: Glossary........................................................................................ 203
References............................................................................................................ 213
Section I
Introduction to Cellular
and Molecular Biology
1
The Cellular System and the Code of Life
1.1 The Cellular Challenge

A cell, although minuscule with a diameter of less than 50 μm, works wonders
if you compare it to any human-made system. Moreover, it perpetuates itself
using the information coded in its DNA. In case you ever had the thought
of designing an artificial system that shows this type of sophistication, you
would know the many insurmountable challenges such a system needs to
overcome. A cell has a complicated internal system, containing many types
of molecules and parts. To sustain the system, a cell needs to perform a wide
variety of tasks—the most fundamental of which are to maintain its inter-
nal order, prevent its system from malfunctioning or breaking down, and
reproduce or even improve the system—in an environment that is constantly
changing.
Energy is needed to maintain the internal order of the cellular system.
Without constant energy input, the entropy of the system will gradually
increase, as dictated by the second law of thermodynamics, and ultimately
lead to the destruction of the system. Besides energy, raw “building” mate-
rial is also constantly needed to renew its internal parts or build new ones, as
the internal structure of a cell is dynamic and responds to constant changes
in environmental conditions. Therefore, to maintain the equilibrium inside
and with the environment, it requires a constant influx of energy and raw
material, and excretion of its waste. Guiding the capture of the requisite
energy and raw material for its survival and the perpetuation of the system
is the information encoded in its DNA sequence.
Because of evolution, a great number of organisms no longer function as a
single cell. The human body, for example, contains trillions of cells. In a mul-
ticellular system, each cell becomes specialized to perform a specific func-
tion, for example, β-cells in our pancreas synthesize and release insulin, and
cortical neurons in the brain perform neurobiological functions that underlie
learning and memory. Despite this division of labor, the challenges a single-
cell organism faces still hold true for each one of these cells. Instead of deal-
ing with the external environment directly, they interact with and respond
to changes in their microenvironment.
3
4 Next-Generation Sequencing Data Analysis
1.2 How Cells Meet the Challenge

Many cells, like algae and plant cells, directly capture energy from the sun or
other energy sources. Other cells (or organisms) obtain energy from the envi-
ronment as heterotrophs. For raw material, cells can either fix carbon dioxide
in the air using the energy captured into simple organic compounds, which
are then converted to other requisite molecules, or directly obtain organic
molecules from the environment and convert them to requisite materials.
In the meantime, existing cellular components can also be broken down
when not needed for the reuse of their building material. This process of
energy capture and utilization, and synthesis, interconversion, and breaking
down for reuse of molecular material, constitutes the cellular metabolism.
Metabolism, the most fundamental characteristic of a cell, involves numer-
ous biochemical reactions.
Reception and transduction of various signals in the environment are
crucial for cellular survival. Reception of signals relies on specific recep-
tors situated on the cell surface, and for some signals, those inside the cell.
Transduction of incoming signals usually involves cascades of events in the
cell, through which the original signals are amplified and modulated. In
response, the cellular metabolic profile is altered. The cellular signal recep-
tion and transduction network is composed of circuits that are organized
into various pathways. Malfunctioning of these pathways can have a det-
rimental effect on the cell’s response to the environment and eventually its
survival.
Perpetuation and evolution of the cellular system rely on DNA replication
and cell division. The replication of DNA (to be detailed in Chapter 2) is a
high-fidelity, but not error-free, process. While maintaining the stability of
the system, this process also provides the mechanism for the diversification
and evolution of the cellular system. The cell division process is also tightly
regulated, for the most part to ensure equal transfer of the replicated DNA
into daughter cells. For the majority of multicellular organisms that repro-
duce sexually, during the process of germ cell formation the DNA is repli-
cated once but cell division occurs twice, leading to the reduction of DNA
material by half in the gametes. The recombination of DNA from female and
male gametes leads to further diversification in the offspring.
1.3 Molecules in Cells
Different types of molecules are needed to carry out the various cellular pro-
cesses. In a typical cell, water is the most abundant, representing 70% of the
total cell weight. Besides water, there is a large variety of small and large
The Cellular System and the Code of Life 5
molecules. The major categories of small molecules include inorganic ions

(e.g., Na+, K+, Ca2+, Cl–, and Mg2+), monosaccharides, fatty acids, amino acids,
and nucleotides. Major varieties of large molecules are polysaccharides, lip-
ids, proteins, and nucleic acids (DNA and RNA). Among these components,
the inorganic ions are important for signaling (e.g., waves of Ca2+ repre-
sent important intracellular signal), cell energy storage (e.g., in the form of
Na+/K+ cross-membrane gradient), or protein structure/function (e.g., Mg2+
is an essential cofactor for many metalloproteins). Carbohydrates (includ-
ing monosaccharides and polysaccharides), fatty acids, and lipids are major
energy-providing molecules in the cell. Lipids are also the major component
of cell membrane. Proteins, which are assembled from 20 types of amino
acids in different order and length, underlie almost all cellular activities,
including metabolism, signal transduction, DNA replication, and cell divi-
sion. They are also the building blocks of many intracellular structures, such
as cytoskeleton (see Section 1.4). Nucleic acids carry the code of life in their
nearly endless nucleotide permutations, which not only provide instructions
on the assembly of all proteins in cells but also exert control on how such
assembly is carried out based on environmental conditions.
1.4 Intracellular Structures or Spaces

Cells maintain a well-organized internal structure (Figure 1.1). Based on
the complexity of their internal structure, cells are divided into two major
categories: prokaryotic and eukaryotic cells. The fundamental difference
between them is whether a nucleus is present. Prokaryotic cells, being the
more primordial of the two, do not have a nucleus, and as a result their
DNA is located in a nucleus-like but nonenclosed area. Prokaryotic cells
also lack organelles, which are specialized and compartmentalized intra-
cellular structures that carry out different cellular functions (detailed next).
Eukaryotic cells, on the other hand, contain a distinct nucleus dedicated for
DNA storage, maintenance, and expression. Furthermore, they contain vari-
ous organelles including the endoplasmic reticulum (ER), Golgi apparatus,
cytoskeleton, mitochondrion, and chloroplast (plant cells). Following is an
introduction to the various intracellular structures and spaces, including the
nucleus, the organelles, and other subcellular structures and spaces such as
the cell membrane and cytoplasm.
1.4.1 Nucleus
Since DNA stores the code of life, it must be protected and properly main-
tained to avoid possible damage, and ensure accuracy and stability. As
proper execution of the genetic information embedded in the DNA is critical
Nucleus
Nuclear envelope
(with nuclear pores)
Chromatin Cell membrane
Peroxisome
Nucleolus Ribosome
Microtubule
Lysosome
Mitochondrion
Golgi apparatus
Rough ER
Smooth ER
Intermediate
filament
Centrosome
Cytoplasm Endosome
Microfilament
FIGURE 1.1
The general structure of a typical eukaryotic cell. Shown here is an animal cell.
to the normal functioning of a cell, gene expression must also be tightly reg-
ulated under all conditions. The nucleus, located in the center of most cells
in eukaryotes, offers a well-protected environment for DNA storage, main-
tenance, and gene expression. The nuclear space is enclosed by a nuclear
envelope consisting of two concentric membranes. To allow movement of
proteins and RNAs across the nuclear envelope, which is essential for gene
expression, there are pores on the nuclear envelope that span the inner and
outer membrane. The mechanical support of the nucleus is provided by the
nucleoskeleton, a network of structural proteins called lamins. Inside the
nucleus, long strings of DNA molecules, through binding to certain proteins
called histones, are heavily packed to fit into the limited nuclear space. In
prokaryotic cells, a nucleus-like irregularly shaped region that does not have
a membrane enclosure called the nucleoid, provides a similar but not as well-
protected space for DNA.
1.4.2 Cell Membrane
The cell membrane serves as a barrier to protect the internal structure of a
cell from the outside environment. Biochemically, the cell membrane, as well
as all other intracellular membranes such as the nuclear envelope, assumes a
lipid bilayer structure. While offering protection to their internal structure,

the cell membrane is also where cells exchange materials, and concurrently
energy, with the outside environment. Since the membrane is made of lipids,
most water-soluble substances, including ions, carbohydrates, amino acids,
and nucleotides, cannot directly cross it. To overcome this barrier, there are
channels, transporters, and pumps, all of which are specialized proteins, on
the cell membrane. Channels and transporters facilitate passive movement,
that is, in the direction from high to low concentration, without consumption
of cellular energy. Pumps, on the other hand, provide active transportation
of the molecules, since they transport the molecules against the concentra-
tion gradient and therefore consume energy.
The cell membrane is also where a cell receives most incoming signals
from the environment. After signal molecules bind to their specific receptors
on the cell membrane, the signal is relayed to the inside, usually eliciting a
series of intracellular reactions. The ultimate cellular response that the sig-
nal induces is dependent on the nature of the signal, as well as the type and
condition of the cell. For example, upon detecting insulin in the blood via the
insulin receptor in their membrane, cells in the liver respond by taking up
glucose from the blood for storage.
1.4.3 Cytoplasm
Inside the cell membrane, cytoplasm is the thick solution that contains the
majority of cellular substances, including all organelles in eukaryotic cells
but excluding the nucleus in eukaryotic cells and the DNA in prokaryotic
cells. The general fluid component of the cytoplasm that excludes the organ-
elles is called the cytosol. The cytosol makes up more than half of the cel-
lular volume and is where many cellular activities take place, including a
large number of metabolic steps such as glycolysis and interconversion of
molecules and most signal transduction steps. In prokaryotic cells, due to
the lack of a nucleus and other specialized organelles, the cytosol is almost
the entire intracellular space and where most cellular activities take place.
Besides water, the cytosol contains large amounts of small and large
molecules. Small molecules, such as inorganic ions, provide an overall bio-
chemical environment for cellular activities. In addition, ions such as Na+,
K+, and Ca2+ also have substantial concentration differences between the
cytosol and the extracellular space. Cells spend a lot of energy maintaining
these concentration differences, and use them for signaling and metabolic
purposes. For example, the concentration of Ca2+ in the cytosol is normally
kept very low at ~10 –7 M, whereas in the extracellular space it is ~10 –3 M.
The rushing in of Ca2+ under certain conditions through ligand- or voltage-
gated channels serves as an important messenger, inducing responses in a
number of signaling pathways, some of which lead to altered gene expres-
sion. Besides small molecules, the cytosol also contains large numbers of
macromolecules. Far from being simply randomly diffusing in the cytosol,
these large molecules form molecular machines that collectively function

as a “bustling metropolitan city” [1]. These supramacromolecular machines
are usually assembled out of multiple proteins, or proteins and RNA. Their
emergence and disappearance are dynamic and regulated by external and
internal conditions.
1.4.4 Endosome, Lysosome, and Peroxisome

Endocytosis is when cells bring in macromolecules, or other particulate
substances such as bacteria or cell debris, into the cytoplasm from the sur-
roundings. Endosome and lysosome are two organelles that are involved in
this process. To initiate endocytosis, part of the cell membrane forms a pit,
engulfs the external substances, and then an endocytotic vesicle pinches off
from the cell membrane into the cytosol. Endosome, normally in the size
range of 300 to 400 nm in diameter, forms from the fusion of these endocy-
totic vesicles. The internalized materials contained in the endosome are sent
to other organelles such as lysosome for further digestion.
The lysosome is the principal site for intracellular digestion of internalized
materials as well as obsolete components inside the cell. Like the condition
in our stomach, the inside of the lysosome is acidic (pH at 4.5–5.0), providing
an ideal condition for the many digestive enzymes within. These enzymes
can break down proteins, DNA, RNA, lipids, and carbohydrates. Normally
the lysosome membrane keeps these digestive enzymes from leaking into
the cytosol. Even in the event of these enzymes leaking out of the lysosome,
they can do little harm to the cell, since their digestive activities are heavily
dependent on the acidic environment inside the lysosome, whereas the pH
of the cytosol is slightly alkaline (around 7.2).
Peroxisome is morphologically similar to the lysosome, however it con-
tains a different set of proteins, mostly oxidative enzymes that use molecular
oxygen to extract hydrogen from organic compounds to form hydrogen per-
oxide. The hydrogen peroxide can then be used to oxidize other substrates,
such as phenols or alcohols, via peroxidation reaction. As an example, liver
and kidney cells use these reactions to detoxify various toxic substances that
enter the body. Another function of the peroxisome is to break down long-
chain fatty acids into smaller molecules by oxidation. Despite its important
functions, the origin of peroxisome is still under debate. One theory pro-
poses that this organelle has an endosymbiotic origin [2]. If this theory holds
true, all genes in the genome of the original endosymbiotic organism must
have been transferred to the nuclear genome. Another theory proposes that
the peroxisome is a remnant of an ancient organelle that served to lower
intracellular oxygen levels when the oxygen that we depend on today was
still highly toxic to most cells, while exploiting the chemical reactivity of
oxygen to carry out useful oxidative reactions for the host cell. Also based on
this theory, the mitochondrion (see later) that emerged later releases energy
from many of the same oxidative reactions that had previously taken place
in the peroxisome but without generating any energy, thereby rendering the
peroxisome largely irrelevant except for carrying out the remnant oxidative
functions.
1.4.5 Ribosome
Ribosome is the protein assembly factory in cells, translating genetic infor-
mation carried in messenger RNAs (mRNAs) into proteins. There are vast
numbers of ribosomes, usually from thousands to millions, in a typical cell.
Whereas both prokaryotic and eukaryotic ribosomes are composed of two
components (or subunits), eukaryotic ribosomes are larger than their pro-
karyotic counterparts. In eukaryotic cells, the two ribosomal subunits are
first assembled inside the nucleus in a region called the nucleolus and then
shipped out to the cytoplasm. In the cytoplasm, ribosomes can be either
free or get attached to another organelle (the ER). Biochemically, ribosomes
contain more than 50 proteins and several ribosomal RNA (rRNA) species.
Because ribosomes are highly abundant in cells, rRNAs are the most abun-
dant in total RNA extracts, accounting for 85% to 90% of all RNA species.
For profiling cellular RNA populations using next-generation sequencing
(NGS), rRNAs are usually not of interest despite their abundance and there-
fore need to be depleted to avoid generation of overwhelming amounts of
sequencing reads from them.
1.4.6 Endoplasmic Reticulum (ER)

As indicated by the name, the endoplasmic reticulum (ER) is a network of
membrane-enclosed spaces throughout the cytosol. These spaces intercon-
nect and form a single internal environment called the ER lumen. There are
two types of ERs in cells: rough ER and smooth ER. The rough ER is where
all cell membrane proteins, such as ion channels, transporters, pumps, and
signal molecule receptors, as well as secretory proteins, such as insulin, are
produced and sorted. The characteristic surface roughness of this type of ER
comes from the ribosomes that bind to them on the outside. Proteins des-
tined for cell membrane or secretion, once emerging from these ribosomes,
are threaded into the ER lumen. This ER-targeting process is mediated by a
signal sequence, or “address tag,” located at the beginning part of these pro-
teins. This signal sequence is subsequently cleaved off inside the ER before
the protein synthesis process is complete. Functionally different from the
rough ER, the smooth ER plays an important role in lipid synthesis for the
replenishment of cellular membranes. Besides membrane and secretory pro-
tein preparation and lipid synthesis, one other important function of the ER
is to sequester Ca2+ from the cytosol. In Ca2+-mediated cell signaling, shortly
after entry of the calcium wave into the cytosol, most of the incoming Ca2+
needs to be pumped out of the cell and/or sequestered into specific organ-
elles such as the ER and mitochondria.
1.4.7 Golgi Apparatus
Besides the ER, the Golgi apparatus also plays an indispensable role in sort-
ing as well as dispatching proteins to the cell membrane, extracellular space,
or other subcellular destinations. Many proteins synthesized in the ER are
sent to the Golgi apparatus via small vesicles for further processing before
being sent to their final destinations. Therefore, the Golgi apparatus is some-
times metaphorically described as the “post office” of the cell. The process-
ing carried out in this organelle includes chemical modification of some of
the proteins, such as adding oligosaccharide side chains, which serve as
“address labels.” Other important functions of the Golgi apparatus include
synthesizing carbohydrates and extracellular matrix materials, such as the
polysaccharide for the building of the plant cell wall.
1.4.8 Cytoskeleton
Cellular processes like the trafficking of proteins in vesicles from the ER to
the Golgi apparatus or the movement of a mitochondrion from one intracellu-
lar location to another are not simply based on diffusion. Rather, they follow
a certain protein-made skeletal structure inside the cytosol, that is, the cyto-
skeleton, as tracks. Besides providing tracks for intracellular transport, the
cytoskeleton, like the skeleton in the human body, plays an equally impor-
tant role in maintaining cell shape and protecting the cell framework from
physical stresses, as the lipid bilayer cell membrane is fragile and vulnerable
to such stresses. In eukaryotic cells, there are three major types of cytoskel-
etal structures: microfilament, microtubule, and intermediate filament. Each
type is made of distinct proteins and has its own unique characteristics and
functions. For example, microfilament and microtubule are assembled from
actins and tubulins, respectively, and have different thicknesses (the diam-
eter is about 6 nm for microfilament and 23 nm for microtubule). Although
biochemically and structurally different, both the microfilament and the
microtubule have been known to provide tracks for mRNA transport in the
form of large ribonucleoprotein complexes to specific intracellular sites, such
as the distal end of a neuronal dendrite, for targeted protein translation [3,4].
Besides its role in intracellular transportation, the microtubule also plays a
key role in cell division through attaching to the duplicated chromosomes
and moving them equally into two daughter cells. In this process, all micro-
tubules involved are organized around a small organelle called centrosome.
Previously thought to be only present in eukaryotic cells, cytoskeletal struc-
tures have also been discovered in prokaryotic cells [5].
1.4.9 Mitochondrion
The mitochondrion is the “powerhouse” in eukaryotic cells. While some
energy is produced from the glycolytic pathway in the cytosol, most energy
is generated from the Krebs cycle and the oxidative phosphorylation process
that take place in the many mitochondria contained in a cell. The number of
mitochondria in a cell is ultimately dependent on its energy demand. The
more energy a cell needs, the more mitochondria it has. Structurally, the mito-
chondrion is an organelle enclosed by two membranes. The outer membrane
is highly permeable to most cytosolic molecules, and as a result the inter-
membrane space between the outer and inner membranes is similar to the
cytosol. Most of the energy-releasing process occurs in the inner membrane
and in the matrix, that is, the space enclosed by the inner membrane. For
the energy release, high-energy electron carriers generated from the Krebs
cycle in the matrix are fed into an electron transport chain embedded in the
inner membrane. The energy released from the transfer of high-energy elec-
trons through the chain to molecular oxygen (O2), the final electron acceptor,
creates a proton gradient across the inner membrane. This proton gradient
serves as the energy source for the synthesis of ATP, the universal energy
currency in cells. In prokaryotic cells, since they do not have this organelle,
ATP synthesis takes place on their cytoplasmic membrane instead.
The origin of the mitochondrion, based on the widely accepted endosym-
biotic theory, is an ancient α-proteobacteria. So not surprisingly, the mito-
chondrion carries its own DNA, but the genetic information contained in
mitochondrial DNA (mtDNA) is extremely limited compared to nuclear
DNA. Human mitochondrial DNA, for example, is 16,569 bp in size coding
for 37 genes, including 22 for transfer RNAs (tRNAs), 2 for rRNAs, and 13 for
mitochondrial proteins. Although it is much smaller compared to the nuclear
genome, there are multiple copies of mtDNA molecules in each mitochon-
drion. Since cells usually contain hundreds to thousands of mitochondria,
there are a large number of mtDNA molecules in each cell. In comparison,
most cells only contain two copies of the nuclear DNA. As a result, when
sequencing cellular DNA samples, sequences derived from mitochondrial
DNA usually comprise a notable, sometimes substantial, percentage of total
generated reads. Although small, the mitochondrial genomic system is fully
functional and has the entire set of protein factors for mtDNA transcription,
translation, and replication. As a result of its activity, when cellular RNA
molecules are sequenced, those transcribed from the mitochondrial genome
also generate significant amounts of reads in the sequence output.
The many copies of mtDNA molecules in a cell may not all have the same
sequence due to mutations in individual molecules. Heteroplasmy occurs
when cells contain a heterogeneous set of mtDNA molecules. In general, mito-
chondrial DNA has a higher mutation rate than its nuclear counterpart. This
is because the transfer of high-energy electrons along the electron transport
chain can produce reactive oxygen species as byproducts, which can oxidize
and cause mutations in mtDNA. To make this situation even worse, the DNA
repair capability in mitochondria is rather limited. Increased heteroplasmy
has been associated with a higher risk of developing aging-related diseases,
including Alzheimer disease, heart disease, and Parkinson’s disease [6–8].
Furthermore, certain mitochondrial DNA mutations and deletions have

been known to underlie a number of diseases that mostly affect the nervous
system and muscle due to their high energy demand [9]. Characteristically,
these diseases are maternally inherited, as mitochondrial DNA is passed on
from mother to offspring.
1.4.10 Chloroplast
In animal cells, the mitochondrion is the only organelle that contains an
extranuclear genome. Plant and algae cells have another extranuclear
genome besides the mitochondrion, the plastid genome. Plastid is an organ-
elle that can differentiate into various forms, the most prominent of which
is the chloroplast. The chloroplast carries out photosynthesis by capturing
the energy in sunlight and fixing it into carbohydrates using carbon dioxide
as substrate, and releasing oxygen in the same process. For energy captur-
ing, the green pigment called chlorophyll first absorbs energy from sunlight,
which is then transferred through an electron transport chain to build up
a proton gradient to drive the synthesis of ATP. Despite the energy source,
the buildup of proton gradient for ATP synthesis in the chloroplast is very
similar to that for ATP synthesis in the mitochondrion. The chloroplast ATP
derived from the captured light energy is then spent on CO2 fixation. Similar
to the mitochondrion, the chloroplast also has two membranes, a highly per-
meable outer membrane and a much less permeable inner membrane. The
photosynthetic electron transport chain, however, is not located in the inner
membrane but in the membrane of a series of saclike structures called thy-
lakoids located in the chloroplast stroma (analogous to the mitochondrial
matrix).
Plastid is believed to have evolved from an endosymbiotic cyanobaterium,
which has gradually lost the majority of its genes in its genome over millions
of years. The current size of most plastid genomes is 100 to 200 kb, coding for
rRNAs, tRNAs, and proteins. In higher plants there are about 85 genes cod-
ing for various proteins of the photosynthetic system [10]. The transmission
of plastid DNA (ptDNA) from parent to offspring is more complicated than
the maternal transmission of mtDNA usually observed in animals. Based
on the transmission pattern, it can be classified into three types: (1) mater-
nal, inheritance only through the female parent; (2) paternal, inheritance
only through the male parent; or (3) bioparental, inheritance through both
parents [11]. Similar to the situation in mitochondrion, there exist multiple
copies of ptDNA in each plastid, and as a result there are large numbers
of ptDNA molecules in each cell with potential heteroplasmy. Transcription
from these ptDNA also generates copious amounts of RNAs in the organelle.
Therefore, sequence reads from ptDNA or RNA comprise part of the data
when sequencing plant and algae DNA or RNA samples, along with those
from mtDNA or RNA.
1.5 The Cell as a System

1.5.1 The Cellular System
From the aforementioned description of a typical cell, it is obvious that the
cell is a self-organizing system, containing many different molecules and
structures that work together coherently. Unlike other nonbiological sys-
tems, including natural and artificial systems such as a car or a computer,
the cell system is unique as it continuously renews and perpetuates itself
without violating the laws of the physical world. It achieves this by obtaining
energy from and exchanging materials with its environment. The cellular
system is also characterized by its autonomy, that is, all of its activities are
self-regulated. This autonomy is conferred by the genetic instructions coded
in the cell’s DNA. Besides the above characteristics, the cell system is highly
robust, as its homeostasis is not easily disturbed by changes in its surround-
ings. This robustness is a result of billions of years of evolution, which has
led to the building of tremendous complexity into the system. To study this
complexity, biologists have been mostly taking a reductionist approach to
study the different cellular molecules and structures piece by piece. This
approach has been highly successful and much knowledge has been gath-
ered on most parts of the system. For a cell to function as a single entity,
however, these different parts do not work alone. To study how it operates as
a whole, the different parts need to be studied in the context of the entire sys-
tem and therefore a holistic approach is also needed. It has become clearer to
researchers in the life science community that the interactions between the
different cellular parts are equally, if not more, important as any part alone.
1.5.2 Systems Biology of the Cell

Systems biology is an emerging field that studies the complicated inter
actions among the different parts of biological systems. It is an application of
the systems theory to the biological field. Introduced by the biologist Ludwig
von Bertalanffy in the 1940s, this theory aims to investigate the principles
common to all complex systems and to describe these principles using
mathematical models. This theory is applicable to many disciplines includ-
ing physics, sociology, and biology, and one goal of this theory is to unify
the principles of systems as uncovered from the different disciplines. It is
expected, therefore, that principles uncovered from other systems may be
applicable to biological systems and provide guidance to better understand-
ing of their working.
In the traditional reductionist approach, a single gene or protein is the basic
functioning unit. In systems biology, however, the basic unit is a genetic cir-
cuit. A genetic circuit can be defined as a group of genes (or the proteins they
code) that work together to perform a certain task. There are a multitude of
tasks in a cell that need to be carried out by genetic circuits, from the trans-
duction of extracellular signal to the inside, to the step-by-step breakdown
of energy molecules (such as glucose) to release energy, to the replication
of DNA prior to cell division. It is these genetic circuits that underlie cellu-
lar behavior and physiology. If the information or material flux in a genetic
circuit is blocked or goes awry, the whole system will be influenced, which
might lead to the malfunctioning of the system and likely a diseased state.
Based on the hierarchical organization principle of systems, gene circuits
interact with each other and form a complicated genetic network. Mapping
out a genetic network is a higher goal of systems biology. A genetic network
has been shown to share some common characteristics with nonbiological
networks such as the human society or the Internet [12]. One such charac-
teristic is modularity, for instance, when genes (or proteins) that often work
together to achieve a common goal form a module and the module is used
as a single functional unit when needed. Another common characteristic is
the existence of hub or anchor nodes in the network; for example, a small
number of highly connected genes (or proteins) in a genetic network serve
as hubs or anchors through which other genes (or proteins) are connected to
each other.
1.5.3 How to Study the Cellular System

Research into the systems biology of the cell is largely enabled by techno-
logical advancements in genomics, proteomics, and metabolomics. High-
throughput genomics technologies, for example, allow simultaneous analysis
of tens of thousands of genes in an organism’s genome. Genome refers to the
whole set of genetic material in an organism’s DNA, including both protein-
coding and noncoding sequences. Similarly, proteome and metabolome are
defined as the complement of proteins and metabolites (small molecules),
respectively, in a cell or population of cells. Proteomics, through simultaneous
separation and identification of proteins in a proteome, provides answers to
the questions of how many proteins are present in the target cell(s) and at
what abundance levels. Metabolomics, on the other hand, through analyzing
a large number of metabolites simultaneously, monitors the metabolic status
of target cells.
The development of modern genomics technologies was mostly initiated
when the human genome was sequenced by the Human Genome Project.
The completion of the sequencing of this genome and the genomes of other
organisms, and the concurrent development of genomics technologies, have
for the first time offered an opportunity to study the systems properties of
the cell. The first big wave of genomics technologies was mostly centered
on microarray, which enables analysis of the transcriptome and subsequent
study of genome-wide sequence polymorphism in a population. By study-
ing all RNAs transcribed in a cell or population of cells, transcriptomic
analysis investigates what genes are active and how active. Determination
of genome-wide sequence variations among individuals in a population

enables examination of the relationship between certain genomic poly-
morphisms and cellular dysfunctions, phenotypic traits, or diseases. More
recently, the development of NGS technologies provides more power, cover-
age, and resolution to the study of the genome (for details on the develop-
ment of NGS technologies, see Chapter 4). These NGS technologies, along
with recent technological developments in proteomics and metabolomics,
further empower the study of the cellular system.
2
DNA Sequence: The Genome Base
2.1 The DNA Double Helix and Base Sequence

Among the different types of molecules in cells, DNA has a structure that
makes it ideal to code the blueprint of life. The building blocks of DNA are
nucleotides, which are made up of three chemical groups: a five-carbon
sugar (deoxyribose), phosphate, and one of four nucleobases. The spatial
structure of DNA is a double helix comprising two strands. The backbone of
each strand is made of the sugar moiety and phosphate, which are invariably
connected in an alternating fashion and therefore do not carry genetic infor-
mation. The “rungs” that connect the two strands are composed of nucleo-
bases, which are where the information is stored. Since the discovery of this
structure in 1953 by Watson and Crick, the elegance and simplicity of this
structure has fascinated generations of biologists, chemists, and scientists
from other fields.
There are four different types of nucleobases (or simply bases) in DNA:
two purines (adenine, usually abbreviated as A; and guanine, G) and two
pyrimidines (cytosine, C; and thymine, T). Nucleobases in the two DNA
strands that form the rung structure interact via hydrogen bonding in a fixed
manner: A always pairing with T, and C with G. This complementary base-
pairing pattern enables the DNA molecule to assume the most thermody-
namically favorable structure. The fixed pairing pattern between the bases
makes it easy to provide coding for life and to replicate for perpetuation.
The almost endless arrangements of the base pairs in DNA provide the
basis for DNA’s role as the genetic information carrier. The information
embedded in the DNA base sequence dictates what, when, and how many
proteins are made in a cell at a certain point of time. At a deeper level, the
information codes for the entire operating logic of the cellular system. It con-
tains all instructions needed to form a new life and for it to grow, develop,
and reproduce. From the medical point of view, alterations or polymor-
phisms in the DNA base sequence can predispose us to certain diseases as
well as underlie our responses to medications.
17
2.2 How DNA Molecules Replicate and Maintain Fidelity

The DNA’s double helix structure and complementary base-pairing make it
robust to copy the bioinformation it carries through its replication. To rep-
licate, the two strands of the parent DNA molecule are first unwound by
an enzyme called helicase. The two unwound strands then serve as tem-
plates for the synthesis of new complementary strands, giving rise to two
offspring DNA molecules. The enzyme that carries out the new strand syn-
thesis is called DNA polymerase, which assembles nucleotides into a new
strand by adding one nucleotide at a time to a preexisting primer sequence
based on complementary base-pairing with the template strand (Figure 2.1).
Biochemically, the enzyme catalyzes the formation of a covalent phosphodi-
ester bond between the 5′-phosphate group of the incoming complementary
nucleotide and the 3′-hydroxyl group on the elongating strand end. Besides
elongating the new DNA strand, most DNA polymerases also have proof-
reading capability. If a nucleotide that is not complementary to the template
is accidentally attached to the end of the elongating strand (i.e., mispair-
ing), the enzyme will turn around and cleave the wrong nucleotide off. This
proofreading activity is important to maintain the high fidelity of the DNA
replication process. Mutations, or sudden changes of nucleotide sequence in
DNA, would occur much more frequently without this activity.
Many sequencing technologies are based on the process of DNA replica-
tion. These technologies, often referred to as sequencing-by-synthesis, use
this process to read the nucleotide sequence off one strand of the sequenc-
ing DNA target. Corresponding to the components required in the DNA
replication process, these sequencing systems require the following basic
components: (1) a sequencing DNA target, which provides the template;
(2) nucleotides; (3) a primer; and (4) a DNA polymerase. Since the DNA poly-
merase extends the new strand by attaching one nucleotide at a time, detect-
ing the attached nucleotide after each extension cycle generates a readout of
the nucleotide sequence on the template DNA strand. To facilitate the detec-
tion, the nucleotides used in sequencing reactions are usually chemically
modified, including labeling with fluorescent tags. Chapter 4 focuses on the
evolution of sequencing technologies.
Besides the high fidelity of DNA polymerases, an efficient DNA repair
system is also crucial to maintain genome stability and keep the mutation
rate low. Even under normal conditions, a DNA nucleotide sequence can be
accidentally altered by many physical and chemical factors in the environ-
ment, including intracellularly generated reactive oxygen and nitrogen spe-
cies, radiation in the environment (such as UV, x-ray, or γ-ray), and other
chemical mutagens. If left uncorrected, these changes will accumulate and
cause disturbances to normal cell function or even cause cell death, leading
to diseases. To maintain the fidelity of DNA molecules, cells invest heavily
on DNA repair enzymes. These enzymes constantly scan genomic DNA and
DNA Sequence 19
DNA polymerase T P P P dNTP

Primer
5′ A P C P G P A 3′
3′ T P G P C P T P A P G P C P C 5′
Template
Extension
P P + H+ P P P
C
5′ A P C P G P A P T 3′
Extension T P P P
P P + H+
5′ A P C P G P A P T P C 3′
+ H+ Misincorporation
P P
5′ A P C P G P A P T P C P T 3′
Error correction
P T G P P P
5′ A P C P G P A P T P C 3′
Extension
P P + H+
5′ A P C P G P A P T P C P G 3′
FIGURE 2.1
The DNA replication process. To initiate the process, a primer, which is a short DNA sequence
complementary to the start region of the DNA template strand, is needed for DNA polymerase
to attach nucleotides and extend the new strand. The attachment of nucleotides is based on
complementary base-pairing with the template. If an error occurs due to mispairing, the DNA
polymerase removes the mispaired nucleotide using its proofreading function. Due to the bio-
chemical structure of the DNA molecule, the direction of the new strand elongation is from
its 5′ end to the 3′ end (the template strand is in the opposite direction; the naming of the two
ends of each DNA strand as 5′ and 3′ is from the numbering of carbon atoms in the nucleotide
sugar ring).
make repairs if damage is detected. The serious consequences of a weakened

DNA repair system can be exemplified by mutations in BRCA2, a gene cod-
ing for a DNA repair enzyme, which lead to breast and ovarian cancers.
2.3 How the Genetic Information Stored in DNA

Is Transferred to Protein
While the logic of the cellular system is written in the nucleotide sequence
of its genomic DNA, almost all cellular activities are executed by the wide
array of proteins in the cell’s proteome. The bioinformation flow from DNA
to protein, known as the central dogma (Figure 2.2), provides a fundamental
framework for modern molecular biology and genetic engineering. Based on
this framework, a gene’s DNA sequence is first transcribed to make mRNA,
and then the nucleotide sequence in mRNA is used to guide the assem-
bly of amino acids into a protein. The translation of the mRNA nucleotide
sequence to the protein amino acid sequence is based on the triplet genetic
code. A continuous segment of DNA that contains the full set of triplet codon
for protein translation, from start to stop, is often called an open reading
frame (or ORF). The synthesis of one type of biopolymer molecule based on
information stored in another biopolymer is one of the greatest “inventions”
of nature.
Since its initial introduction, the central dogma has been gradually modi-
fied with increased sophistication. In its original form, one gene is translated
into one protein via one mRNA. This one gene–one protein paradigm was
later found to be too simplistic, as one gene can generate multiple forms of
Promoter 3′-UTR
DNA (gene)
RNA
(primary transcript)
mRNA
Exon
Protein
Intron
FIGURE 2.2
The central dogma.
DNA Sequence 21
proteins through alternative splicing (see Chapter 3). In addition, the informa-
tion flow between DNA and RNA is not simply one-way from DNA to RNA,
but RNA can also be reverse transcribed to DNA in some organisms. On the
additional role of RNAs in this information flow, some non-protein-coding
RNAs can silence gene expression through mechanisms such as inhibiting
gene transcription or translation, or protect genomes through mechanisms
like preventing the movement of transposable elements (or transposons,
mobile DNA elements that copy themselves to different genomic loci) (also
see Chapter 3). Furthermore, chemical modifications of DNA and some DNA-
interacting proteins constitute the epigenome, which also regulates the flow
of genetic information.
2.4 The Genomic Landscape

2.4.1 The Minimal Genome
After understanding the flow of bioinformation from DNA to protein,
the next question is what is the minimum amount of genetic information
needed to make the cellular system tick, that is, what constitutes the mini-
mal genome. Attempts to define the minimal genome started in the late
1950s, shortly after the discovery of the double helix structure of DNA. The
answer to this important question is not straightforward, however, as the
amount of genetic information needed for a minimal life form is depen-
dent on the specific environment it lives in. Considering the basic functions
that a cell has to perform, the minimal genome needs to contain genes at
least for DNA replication, RNA synthesis and processing, protein transla-
tion, energy, and molecular metabolism. The current estimate is that 150 to
300 genes are required at a minimum for any genome. A small bacterium,
Mycoplasma genitalium, containing a genome of 580,076 bp, has often been
used as a model of a naturally existing minimal genome for a free-living
organism because of its minimal metabolism and little genomic redun-
dancy [13]. Among the ~480 protein-coding genes contained in its genome,
382 are shown to be essential [14].
2.4.2 Genome Sizes
For the least sophisticated organisms, such as Mycoplasma genitalium, a mini-
mal genome is sufficient. For increased organismal complexity, more genetic
information and, therefore, a larger genome is needed. As a result, there
is a positive correlation between organismal complexity and genome size,
especially in prokaryotes. In eukaryotes, however, this correlation becomes
much weaker, largely due to the existence of noncoding DNA elements in
TABLE 2.1
Genome Sizes and Total Gene Numbers in Major Model Organisms (Ordered
by Genome Size)
Organism Genome Size (bp)a Number of Coding Genes
Mycoplasma genitalium (bacterium) 580,076 476
Haemophilus influenzae (strain 86-028NP) 1,914,490 1792
(bacterium)
Escherichia coli (strain K-12) (bacterium) 4,646,332 4227
Saccharomyces cerevisiae (yeast) 12,157,105 6692
Caenorhabditis elegans (nematode) 103,022,290 20,447
Arabidopsis thaliana (thale cress) 135,670,229 27,416
Drosophila melanogaster (fruit fly) 168,736,537 13,937
Medicago truncatula (legume) 309,576,036 44,115
Oryza sativa (japonica subspecies) (rice) 374,424,240 35,679
Danio rerio (zebrafish) 1,505,581,940 26,459
Rattus norvegicus (rat) 2,573,362,844 22,777
Zea mays (maize) 3,233,616,351 39,469
Homo sapiens (human) 3,381,944,086 20,364
Mus musculus (mouse) 3,482,005,469 22,606
a Data based on Ensembl genome databases as of February 2015.
varying amounts in different eukaryotic genomes (for details on noncoding

DNA elements, see Section 2.4.4). In terms of total gene number, the currently
documented range is 182 in the genome of Candidatus Carsonella ruddii (a
parasitic/endosymbiotic bacterium) [15] to 30,907 genes in the genome of
Daphnia pulex (a water flea) [16]. Table 2.1 shows the total number of genes in
some of the most studied organisms.
2.4.3 Protein-Coding Regions of the Genome

The protein-coding regions are the part of the genome that we foremost
study and know most about. The content of these regions directly affects
protein synthesis and protein diversity in cells. In prokaryotic cells, func-
tionally related protein-coding genes are often arranged next to each other
and regulated as a single unit known as an operon. The gene structure in
eukaryotic cells is more complicated. The coding sequences (CDSs) of almost
all eukaryotic genes are not continuous and interspersed among noncoding
sequences. The noncoding intervening sequences are called introns (int for
intervening), whereas the coding regions are called exons (ex for expressed)
(see Figure 2.2). During gene transcription, both exons and introns are tran-
scribed. In the subsequent mRNA maturation process, introns are spliced
out and exons are joined together for protein translation.
In the human genome, the average number of exons per gene is 8.8.
The titin gene, coding for a large abundant protein in striated muscle, has
DNA Sequence 23
363 exons, the most in any single gene, and also has the longest single exon
(17,106 bp) among all currently known exons. The total number of currently
known exons in the human genome is around 180,000. With a combined
size of 30 Mb, they constitute 1% of the human genome. This collection of
all exons in the human genome, or in other eukaryotic genomes, is termed
as the exome. Different from the transcriptome, which is composed of all
actively transcribed mRNAs in a particular sample, the exome includes all
exons contained in a genome. Although it only covers a very small percent-
age of the genome, the exome represents the most important and the best
annotated part of the genome. Sequencing of the exome has been used as
a popular alternative to whole genome sequencing. While it lacks on cov-
erage, exome sequencing is more cost effective, faster, and easier for data
interpretation.
2.4.4 Noncoding Genomic Elements

Although protein-coding genes are the most studied genomic element, they
may not necessarily be the most abundant part of the genome. Prokaryotic
genomes are usually rich in protein-coding gene sequences, for example, they
account for approximately 90% of the E. coli genome. In complex eukaryotic
genomes, however, their percentage is lower. For example, only about 1.5% of
the human genome codes for proteins (Figure 2.3). Among the non-protein-
coding sequences in eukaryotic genomes are introns, regulatory sequences,
and other unique noncoding DNA elements. The regulatory sequences are
genomic elements that are known to regulate gene expression, including
promoters, terminators, enhancers, repressors, and silencers. In comparison,
our current understanding of the other unique noncoding DNA elements is
the most rudimentary. We know nearly nothing about these elements, with
the exception of noncoding RNA genes, which include ribosomal RNAs
(rRNAs), transfer RNAs (tRNAs), and other functionally important RNA
species that will be detailed in Chapter 3. As mentioned in Chapter 1, rRNAs
are key structural components of the ribosome and directly involved in pro-
tein translation, whereas tRNAs transport proper amino acids to the ribo-
some for protein translation based on the genetic code.
Repetitive sequences occupy more than half of the human genome and
are even more pervasive in some other eukaryotic genomes. For example, in
some plants and amphibians, 80% of the genome is composed of repetitive
sequences. The percentage of repetitive sequences in prokaryotic genomes
is relatively lower but still significant. With respect to their internal struc-
tures, some repetitive sequences are tandem repeats, with the basic repeat-
ing units connected head to tail. In this type of sequence repeats, the length
of the repeating units is highly variable, from <10 bp to thousands of base
pairs. The other major type of sequence repeats is interspersed repeats, pres-
ent as a single copy in many genomic loci. These are either transposons or
retrotransposons that copy themselves via RNA intermediates. Discovered
Exons
(1.5%)
Repetitive
sequences not
related to
transposons
(14%) Introns
(20%)
Regulatory
sequences
(5%)
Repetitive
sequences Other unique
related to noncoding DNA
transposons sequences
(44.5%) (15%)
FIGURE 2.3
The composition of the human genome.
by geneticist Barbara McClintock, transposons (also called transposable ele-

ments, or “jumping genes”) are DNA sequences that move from one genomic
location to another. Repeat sequence units of this type are usually 100 bp to
over 10 kb in length, and may appear in over 1 million loci dispersed across
the genome.
Many highly repetitive DNA sequences exist in inert parts of chromo-
somes, such as the centromere and telomere. The centromere, the region
where two sister chromatids are linked together before cell division, con-
tains tandem repeat sequences. The telomere, existing at the ends of chromo-
somes, is also composed of highly repetitive DNA sequences. The telomeric
structure protects chromosomal integrity and thereby maintains genomic
stability. Besides being essential in maintaining the chromosomal structure,
repeat sequences have other functions in the genome, for example, they
play an architectonic role in higher-order physical genome structuring [17].
Despite their abundance and function, because sequences associated with
repeat regions are not unique, they create a major hurdle for assembling a
genome de novo from sequencing reads or mapping reads originated from
these regions to a preassembled genome.
DNA Sequence 25
2.5 DNA Packaging, Sequence Access,

and DNA–Protein Interactions
2.5.1 DNA Packaging
In the nucleoid of prokaryotic cells, multiple proteins fold and condense
genomic DNA into a supercoiled structure to make it fit into the rather lim-
ited space. While being generally condensed, parts of the DNA need to be
exposed to allow sequence access for transcription by related protein factors.
Although these processes have been studied in prokaryotic cells, DNA pack-
aging and sequence accessing are better studied and understood in eukary-
otic cells. In these cells, because of their much larger genome size, genomic
DNA is condensed in the nucleus to a much higher degree. For instance, the
total length of human genomic DNA is about 2 m when fully stretched out,
but the diameter of the human cell nucleus is only 6 μm. Bound to specific
proteins called histones, eukaryotic DNA is packaged in the form of chroma-
tin, in which the positively charged histones bind to the negatively charged
DNA molecules through electrostatic interactions. This packaging process
involves compacting DNA at different levels. At the first level, DNA wraps
around a protein complex composed of eight histone subunits to form the
basic structure of nucleosome. Each nucleosome contains about 200 nucleo-
tide pairs and has a diameter of 11 nm. At the second level, the nucleosome
structure is compacted into a fiber structure. This fiber, with a diameter of
30 nm, is the form most chromatin takes in the interphase between two cell
divisions. Prior to cell division, this chromatin fiber is further condensed by
two additional levels into chromosome, the extremely condensed form that
we can observe under a light microscope.
2.5.2 Sequence Access
Since different DNA sequences in the genome are constantly being tran-
scribed, instead of being permanently locked into the compacted form, DNA
sequences at specific loci need to be dynamically exposed to allow tran-
scriptional access to protein factors such as transcription factors and coacti-
vators. Furthermore, DNA replication and repair also require chromatin
unpackaging. This unpackaging of the chromatin structure is carried out
through two principal mechanisms. One is through histone modification,
such as acetylation of lysine residues on histones by histone acetyltransfer-
ases, which reduces the positive charge on histones and therefore decreases
the electrostatic interactions between histones and DNA. Deacetylation by
histone deacetylases, on the other hand, restricts DNA access and represses
transcription. The other unpackaging mechanism is through the actions of
chromatin remodeling complexes. These large protein complexes consume
ATP and use the released energy to expose DNA sequences for transcrip-
tion through nucleosomal repositioning, nucleosomal eviction, or local
unwrapping.
2.5.3 DNA–Protein Interactions
While DNA is the carrier of the code of life, the DNA code cannot be exe-
cuted without DNA-interacting proteins. Nearly all of the processes men-
tioned earlier, including DNA packaging/unpackaging, transcription,
repair, and replication, rely on such proteins. Besides histones, examples of
these proteins include transcription factors, RNA polymerases, DNA poly-
merases, and nucleases (for DNA degradation). Many of these proteins, such
as histones and DNA/RNA polymerases, interact with DNA regardless of
their sequence or structure. Some DNA-interacting proteins bind to DNA
of special structure/conformation, for example, high-mobility group (HMG)
proteins that have high affinity for bent or distorted DNA. Some other DNA-
interacting proteins bind only to regions of the genome that have certain
characteristics such as having damage, the examples of which are DNA
repair enzymes such as BRCA1, BRCA2, RAD51, RAD52, and TDG.
The most widely studied DNA-interacting proteins are transcription
factors, which bind to specific DNA sequences. Through binding to their
specific recognition sequences in the genome, transcription factors regu-
late transcription of gene targets that contain such sequences in their pro-
moter region. Since they bind to more than one gene location in the genome,
transcription factors regulate the transcription of a multitude of genes in
a coordinated fashion, usually as a response to certain internal or external
environmental changes. For instance, NRF2 is a transcription factor that is
activated in response to oxidative stress. Upon activation, it binds to a short
segment of a specific DNA sequence called the antioxidant response ele-
ment (ARE), located in the promoter region of those genes that are respon-
sive to oxidative stress. Through binding to this sequence element in many
regions of the genome, NRF2 regulates the transcription of its target genes
and thereby elicits coordinated responses to counteract the damaging effects
of oxidative stress.
Study of DNA–protein interactions provides insights into how the genome
responds to various conditions. For example, determination of transcrip-
tion factor binding sites, such as those of NRF2, across the genome can
unravel what genes might be responsive to the conditions that activate the
transcription factors. Although such sites can be predicted computationally,
only a wet-lab experiment can determine where a transcription factor actu-
ally binds in the genome under a certain condition. ChIP-Seq, or chromatin
immunoprecipitation coupled with sequencing, is one application of next-
generation sequencing (NGS) that is developed to study genomic binding of
transcription factors and other DNA-interacting proteins. Chapter 11 focuses
on ChIP-Seq data analysis.
DNA Sequence 27
2.6 DNA Sequence Mutation and Polymorphism

Although DNA replication is a high-fidelity process and the nucleus main-
tains an army of DNA repair enzymes, sequence mutation does happen,
though at a very low frequency. In general, the rate of mutation in prokary-
otic and eukaryotic cells is at the scale of 10 –9 per base per cell division. In
multicellular eukaryotic organisms, germline cells have a lower mutation
rate than somatic cells. In these organisms, because most cells, including
germline cells, undergo multiple divisions in the organisms’ lifetime, the
per-generation mutation rate is significantly higher. For example, whole
genome sequencing data collected from human blood cell DNA estimates a
mutation rate of 1.1 × 10 –8 per base per generation, corresponding to about 70
new mutations in each human diploid genome [18]. Depending on the nature
of the change, mutations may have deleterious, neutral, or, rarely, beneficial
effects on the organism. Mutations lead to sequence variation and are ulti-
mately the basis of genome evolution and diversification for those carried
through the germline. Although mutations in somatic cells are not passed on
to the next generation, they can lead to diseases, including cancer, and affect
the survival of the individual.
There are various forms of DNA mutations, from single nucleotide sub-
stitutions, to small insertions/deletions (or indels), to structural variations
(SVs) that involve larger genomic regions. Among these different types of
mutations, single nucleotide substitutions, also called point mutations, are
the most common. These substitutions can be either transitions or trans-
versions. Transitions involve the substitution of a purine for the other
purine (i.e., A↔G) or a pyrimidine for the other pyrimidine (i.e., C↔T).
Transversions, on the other hand, involve the substitution of a purine for
a pyrimidine or vice versa. Theoretically, there are more combinations of
transversions than transitions, but due to the nature of the underlying bio-
chemical processes, transitions actually occur more frequently than trans-
versions. If a single nucleotide substitution takes place in a protein-coding
region, it might lead to a change in amino acid coding. If it causes the sub-
stitution of one amino acid for another, it is a missense mutation, which
may lead to a change of protein function. If it introduces a stop codon and
as a result leads to the generation of a truncated protein, it is a nonsense
mutation. Both the missense and nonsense mutations are nonsynonymous
mutations. If it does not change the coded amino acid due to the redun-
dancy in the genetic code, it is a synonymous mutation and has no effect
on protein function. Because of its common occurrence, single nucleotide
variation (SNV) is the most frequently observed sequence variation. If an
SNV is commonly observed in a population, it is called a single nucleotide
polymorphism (SNP). More than 100 million SNPs in the human genome
have been cataloged. Because of their high density in the genome, SNPs
are often used as flagging markers to cover the entire genome in high
resolution when scanning for genomic region(s) that are associated with a
phenotype or disease of interest.
Besides single nucleotide substitutions, indels are another common type
of mutation. Most indels involve small numbers of nucleotides. In protein-
coding regions, small indels lead to the shift of ORF (unless the number of
nucleotides involved is a multiple of three), resulting in the formation of a
vastly different protein product. Indels that involve large regions (>1 kb in
size) lead to alterations of genomic structure and are usually considered as
a form of SV. Besides large indels, SVs also include inversions, transloca-
tions, or duplications that involve alterations of larger DNA regions (typi-
cally >1 kb). Copy number variation (CNV) is a subcategory of SV, usually
caused by large indel or segmental duplication. Although they affect larger
genomic region(s) and some lead to observable phenotypic changes or
diseases, many CNVs, or SVs in general, have no detectable effects. The
frequency of SVs in the genome was previously underestimated due to
technological limitations. The emergence of NGS has greatly enabled SV
detection, which has led to the realization of its wide existence [19].
2.7 Genome Evolution
The spontaneous mutations that lead to sequence variation and polymor-
phism in a population are also the fundamental force behind the evolution
of genomes and eventually the Darwinian evolution of the host organisms.
Gradual sequence change and diversification of early genomes, over billions
of years, have evolved into the extremely large number of genomes that
had existed or are functioning in varying complexity today. In this process,
existing DNA sequences are constantly modified, duplicated, and reshuffled.
Most mutations in protein-coding or regulatory sequences disrupt the pro-
tein’s normal function or alter its amount in cells, causing cellular dysfunc-
tion and affecting organismal survival. Under rare conditions, however, a
mutation can improve existing protein function or lead to the emergence of
new functions. If such a mutation offers its host a competitive advantage, it is
more likely to be selected and passed on to future generations.
Gene duplication provides another major mechanism for genome evolu-
tion. If a genomic region containing one or multiple gene(s) is duplicated
resulting in the formation of an SV, the duplicated region is not under selec-
tion pressure and therefore becomes substrate for sequence divergence and
new gene formation. Although there are other ways of adding new genetic
information to a genome such as interspecies gene transfer, DNA duplica-
tion is believed to be a major source of new genetic information generation.
Gene duplication often leads to the formation of gene families. Genes in the
same family are homologous, but each member has its specific function and
DNA Sequence 29
expression pattern. As an example, in the human genome there are 339 genes
in the olfactory receptor gene family. Odor perception starts with the bind-
ing of odorant molecules to olfactory receptors located on olfactory neurons
inside the nose epithelium. To detect different odorants, a combination of dif-
ferent olfactory receptors that are coded by genes in this family is required.
Based on their sequence homology, members of this large family can be even
further grouped into different subfamilies [20]. The existence of pseudo-
genes in the genome is another result of gene duplication. After duplication,
some genes may lose their function and become inactive from additional
mutation. Pseudogenes may also be formed in the absence of duplication
by the disabling of a functional gene from mutation. A pseudogene called
GULO mapped to the human chromosome 8p21 provides such an example.
The functional GULO gene in other organisms codes for an enzyme that
catalyzes the last step of ascorbic acid (vitamin C) biosynthesis. This gene is
knocked out in primates, including humans, and becomes a pseudogene. As
a result, we have to get this essential vitamin from food. The inactivation of
this gene is possibly due to the insertion to the gene’s coding sequence of a
retrotransposon-type repetitive sequence called Alu element [21].
DNA recombination, or reshuffling of DNA sequences, also plays an
important role in genome evolution. Although it does not create new genetic
information, by breaking existing DNA sequences and rejoining them, DNA
recombination changes the linkage relationships between different genes
and other important regulatory sequences. Without recombination, once
a harmful mutation is formed in a gene, the mutated gene will be perma-
nently linked to other nearby functional genes, and it becomes impossible to
regroup all the functional genes into the same DNA molecule. Through this
regrouping, DNA recombination makes it possible to avoid gradual accumu-
lation of harmful gene mutations. Most DNA recombination events happen
during meiosis in the formation of gametes (sperm or eggs) as part of sexual
reproduction.
2.8 Epigenome and DNA Methylation

Besides the regulatory DNA sequences introduced earlier, chemical modi-
fications of specific nucleotides in the genome, like the acetylation and
deacetylation of histones, offer another layer of regulation on genetic activi-
ties. Since they provide additional genetic activity regulation, these chemical
modifications on DNA and histones constitute the epigenome. Methylation
of the fifth carbon on cytosine (5-methylcytosine, or 5mC) is currently the
most studied epigenomic modification in many organisms. Enzymatically
this methylation is carried out and maintained by DNA methyltransfer-
ases (three identified in mammals: DNMT1, DNMT3A, and DNMT3B). The
cytosines that undergo methylation can occur in three different sequence

contexts—CpG, CHG, and CHH (H can be A, G, or T)—each involving dif-
ferent pathways [22]. Most methylated cytosines exist in the CpG context,
where the methylation reduces gene expression through recruiting gene
silencing proteins or preventing transcription factors from binding to the
DNA. The methylation of cytosines in this context also affects nucleosome
positioning and chromatin remodeling, as methyl-CpG binding domain
(MBD) proteins that specifically bind to 5mC at CpG sites can recruit histone-
modifying proteins and those in the chromatin remodeling complex [23].
The effects of cytosine methylation in the CHG and CHH contexts are less
clear, but available data seems to suggest that they may play a regulatory role
in repetitive regions [24].
Just like deacetylation counteracts the effects of acetylation in histones,
demethylation of cytosines should be similarly important to reverse the
effects of 5mC when the methylation is no longer needed. It is until recently
that the steps involved in the cytosine demethylation process begin to be
understood. In this process, the 5mC is first oxidized to 5-hydroxymethyl-
cytosine (5hmC), and then to 5-formylcytosine (5fC) and 5-carboxylcytosine
(5caC) in mammals. These oxidative conversions are catalyzed by enzyme
systems such as the TET family proteins. The subsequent base excision repair
of 5fC/5caC by an enzyme called TDG, or 5mC directly by the glycosylase
enzyme in plants, completes the DNA demethylation process [25]. Compared
to 5mC, the levels of these demethylation intermediate products are detected
to be much lower in most cells (except that 5hmC has been found to be rela-
tively abundant in embryonic stem cells and in the brain).
Different from the genome, which is static, the epigenome is dynamic
and changes with environmental conditions. These dynamically changing
epigenomic modifications regulate gene expression and thereby play impor-
tant roles in embryonic development, cell differentiation, stem cell pluripo-
tency, genomic imprinting, and genome stability. In accordance with their
regulatory functions, these modifications are highly site specific. To study
where cytosine methylations take place in the genome, multiple NGS-based
approaches, which will be detailed in Chapter 12, have been developed and
widely applied to epigenomics studies. Methodological development for the
study of cytosine demethylation is currently still at an early stage.
2.9 Genome Sequencing and Disease Risk

The wide accessibility of DNA sequences, largely fueled by the rapid devel-
opment of new sequencing technologies, has uncovered extensive sequence
variation in individual genomes within a population. The extensiveness in
sequence variation was not envisioned in early days of genetics, not even
DNA Sequence 31
when the Human Genome Project was completed in 2003. This has gradu-
ally led to a paradigm shift in disease diagnosis and prevention. As a result,
the public becomes more aware of the role of individual genomic makeup in
disease development and predisposition. In addition, the easier accessibility
to our DNA sequence has further prompted us to look into our genome and
use that information for preemptive disease prevention. The declining cost
of genome sequencing has also enabled the biomedical community to dig
deeper into the genomic underpinnings of diseases, by unraveling the link-
age between sequence polymorphism in the genome and disease incidence.
Following is a brief overview of the major categories of human diseases that
have an intimate connection with DNA mutation, polymorphism, genome
structure, and epigenomic abnormality.
2.9.1 Mendelian (Single-Gene) Diseases

The simplest form of hereditary diseases is caused by mutation(s) in a single
gene, and therefore called monogenic or Mendelian diseases. For example,
sickle cell anemia is caused by a mutation in the HBB gene located on the
human chromosome 11. This gene codes for the β subunit of hemoglobin,
an important oxygen-carrying protein in the blood. A mutation of this gene
leads to the replacement of the sixth amino acid, glutamic acid, with another
amino acid valine in the coded protein. This change of a single amino acid
causes conformational change of the protein, leading to the generation of
sickle-shaped blood cells that die prematurely. This disease is recessive,
meaning that it only appears when both copies (or alleles) of the gene carry
the mutation. In dominant diseases, however, one mutant allele is enough
to cause sickness. Huntington’s disease, a neurodegenerative disease that
leads to gradual loss of mental faculties and physical control, is such a domi-
nant single-gene disease. It is caused by mutation in a gene called HTT
on the human chromosome 4, coding for a protein called huntingtin. The
involved mutation is an expanded and unstable trinucleotide (CAG) repeat.
Individuals carrying one copy of the mutant HTT gene usually develop the
disease later in life.
2.9.2 Complex Diseases That Involve Multiple Genes

Most common diseases, including heart disease, diabetes, hypertension,
obesity, and Alzheimer’s disease (AD), are caused by multiple genes. In the
case of AD, while its familial or early-onset form can be attributed to one
of three genes (APP, PSEN1, and PSEN2), the most common form, sporadic
AD, involves a large number of genes [26]. In this type of complex diseases,
the contribution of each gene is modest, and it is the combined effects of
mutations in these genes that predispose an individual to these diseases.
Besides genetic factors, lifestyle and environmental factors often also play a
role in these complex diseases. For example, a history of head trauma, lack
of mentally stimulating activities, and high cholesterol levels are all risk fac-
tors for developing AD. Because of the number of genes involved and their
interactions with nongenetic factors, complex multigene diseases are more
challenging to study than single-gene diseases.
2.9.3 Diseases Caused by Genome Instability

Aside from the gene-centered disease models introduced earlier, diseases
can also occur as consequences of large-scale genomic changes such as rear-
rangement of large genomic regions, alterations of chromosome number, and
general genome instability. For example, when a genome becomes unstable
in an organism, it can cause congenital developmental defects, tumorigen-
esis, premature aging, and so forth. Dysfunction in genome maintenance,
such as DNA repair and chromosome segregation, can lead to genome insta-
bility. Fanconi anemia, a disease caused by genome instability, is character-
ized by growth retardation, congenital malformation, bone marrow failure,
high cancer risk, and premature aging. The genome instability in this dis-
ease is caused by mutations in a cluster of DNA repair genes, and manifested
by increased mutation rates, cell cycle disturbance, chromosomal breakage,
and extreme sensitivity to reactive oxygen species and other DNA damaging
agents.
Cancer, to a large degree, is also caused by genome instability. This can
be hinted by the fact that two well-known high-risk cancer genes, BRCA1
and BRCA2, are both DNA damage repair genes. Mutations in the two genes
greatly increase the susceptibility to tumorigenesis, such as breast and ovar-
ian cancers. In general, many cancers are characterized by chromosomal
aberrations and genome structural changes, involving deletion, duplication,
and rearrangement of large genomic regions. The fact that genome instabil-
ity is intimately related to major aspects of cancer cells, such as cell cycle reg-
ulation and DNA damage repair, also points to the important role of genome
instability in cancer development.
2.9.4 Epigenomic/Epigenetic Diseases
Besides gene mutations and genome instability, abnormal epigenomic/
epigenetic patterns can also lead to diseases. Examples of diseases in
this category include fragile X syndrome, ICF syndrome, Rett syndrome,
and Rubinstein-Taybi syndrome. In ICF syndrome, for example, the gene
DNMT3B is mutated leading to the deficiency of DNA methyltransferase 3B.
Patients afflicted with this disease invariably have DNA hypomethylation,
and have symptoms such as facial anomaly, immunodeficiency, and chro-
mosome instability. Cancer, as a genome disease that is caused by more than
one genetic/genomic factor, is also characterized by abnormal DNA meth-
ylation, including both hypermethylation and hypomethylation. The hyper-
methylation is commonly observed in the promoter CpG islands of tumor
DNA Sequence 33
suppressor genes [27], which leads to their suppressed transcription. The

hypomethylation is mostly located in highly repetitive sequences, including
tandem repeats in the centromere and interspersed repeats. This lowered
DNA methylation has been suggested to play a role in promoting chromo-
somal rearrangements and genome instability [28].
3
RNA: The Transcribed Sequence
3.1 RNA as the Messenger

The blueprint of life is written in DNA, but almost all life processes are
executed by proteins. To convert the information coded in the DNA into the
wide array of proteins in each cell, segments of DNA sequence in the genome
must be copied into messenger RNAs (mRNAs) first. The transcribed nucle-
otide sequences in the mRNAs are then translated into proteins through
an information decoding process carried out by ribosomes. Because of the
intermediary role played by mRNAs between DNA and proteins, the com-
position of mRNAs in a cell or population of cells—the transcriptome—is
often used to study cellular processes and functions. Unlike the genome,
which is mostly static and the same for every cell in an organism, the tran-
scriptome is dynamically regulated and therefore can be used as a proxy of
cellular functional status.
3.2 The Molecular Structure of RNA

Structurally, RNA is closely related to DNA and also made of nucleotides.
The nucleotides that make up the RNA molecule are slightly different from
those of DNA. Instead of deoxyribose, its five-carbon sugar moiety is a
ribose. Among the four nucleobases, uracil (U) is used in place of thymine
(T), but the remaining three (A, C, and G) are the same. Unlike the double-
stranded structure of DNA, RNA molecules are single stranded, which
gives them great flexibility. If intramolecular sequence complementarity
exists between two regions of a single RNA molecule, this structural flex-
ibility allows the regions to bend back on each other and form intramolecu-
lar interactions.
As a result of its structural flexibility and internal sequence complementar-
ity, an RNA molecule can assume secondary structures, such as hairpins and
stem-loops, and tertiary structures depending on its specific sequence. These
35
structures can sometimes afford them special chemical properties in cells.

For example, some nonmessenger RNAs can catalyze chemical reactions like
protein enzymes and are therefore called RNA enzymes (or ribozymes; more
details in Section 3.4.1). Some RNA molecules may assume tertiary struc-
tures that enable them to bind to other small molecules such as ligands or
large molecules such as RNA-binding proteins. For mRNAs, their structures
may also be important for various steps of their life cycle (see next section
for details). One example of this is riboswitch, a region in some mRNAs that
binds to small molecule ligands such as metabolites or ions, and thereby
regulates their transcription, translation, or splicing via changes in RNA
structure upon ligand binding [29]. Binding of proteins to mRNA elements
like those located in the 3′ untranslated region (UTR) can also induce struc-
tural changes of these elements and affect mRNA translation [30]. Transport
of mRNAs to specific cellular locations, such as distal dendritic regions of
a neuron, also requires the mRNAs to assume specific structures for RNA-
binding proteins to bind as a prerequisite of the transport process. To study
structures of individual RNAs, computational prediction and experimental
approaches, such as RNA fingerprinting that uses a variety of chemical and
enzymatic probes, have been the classic methods. With the advent of RNA
sequencing based on next-generation sequencing (NGS), that is, RNA-Seq,
transcriptome-wide RNA structural mapping is enabled when integrated
with these classic approaches [31].
3.3 Generation, Processing, and Turnover of RNA

as a Messenger
When a protein is needed in a cell, its coding gene is first transcribed to
mRNA, which is then used as the template to translate to the requisite pro-
tein. In a prokaryotic cell, mRNA transcription is immediately followed by
protein translation. In a eukaryotic cell, the information flow from DNA to
protein through mRNA is more complex, because the two steps of transcrip-
tion and translation are physically separated and eukaryotic genes contain
introns that need to be removed before translation. In the eukaryotic system,
initial transcript (also called primary transcript) is first synthesized from
the DNA template and then processed, including intron removal, to pro-
duce mature mRNA in the nucleus. Then the mRNA is transported from the
nucleus to the cytoplasm for translation. When they are no longer needed,
the mRNAs are degraded and recycled by the cell. It should also be noted
that the transcription process generates a number of mRNA copies from a
gene, and the copy number varies from condition to condition and from gene
to gene depending on cellular functional status.
RNA 37
3.3.1 DNA Template
To initiate transcription, a gene’s DNA sequence is first exposed through
altering its packing state. In order to transcribe the DNA sequence, the two
DNA strands in the region are first unwound, and only one strand is used as
the template strand for transcription. Since it is complementary to the RNA
transcript in base pairing (A, C, G, and T in the DNA template are tran-
scribed to U, G, C, and A, respectively, in the RNA transcript), this DNA
template strand is also called the antisense or negative (–) strand (Figure 3.1).
The other DNA strand has the same sequence as the mRNA (except with T’s
in DNA being replaced with U’s in RNA) and is called the coding, sense, or
positive (+) strand. It should be noted that either strand of the genomic DNA
can be potentially used as the template, and which strand is used as the
template for a gene depends on the orientation of the gene along the DNA. It
should also be noted that the triplet nucleotide genetic code that determines
how amino acids are assembled in proteins refers to the triplet sequence in
the mRNA sequence.
3.3.2 Transcription of Prokaryotic Genes

RNA polymerase catalyzes the transcription of RNA from its DNA template.
In prokaryotic cells, there is only one type of RNA polymerase. The prokary-
otic RNA polymerase holoenzyme contains a core enzyme of five subunits
that catalyzes RNA transcription from a DNA template, and another subunit
called the sigma factor that is required for initiation of transcription. The
sigma factor initiates the process by enabling binding of the core enzyme
to the promoter region and guiding it to the transcription start site (TSS).
Promoter is the region upstream of the protein-coding sequence of a gene
or an operon. Prokaryotic promoters share some core sequence elements,
such as the motif centered at 10 nucleotides upstream of the TSS with the
DNA
5´... A T G A G A A C G T T A G G C ...3´ Sense strand
3´... T A C T C T T G C A A T C C G ...5´ Antisense strand
Transcription
mRNA
5´... A U G A G A A C G U U A G G C ...3´
Translation
Peptide
Met - Arg - Thr - Leu - Gly - ...
FIGURE 3.1
How the two strands of DNA template match the transcribed mRNA in sequence, and the
genetic code in mRNA sequence corresponds to the peptide amino acid sequence.
consensus sequence TATAAT. Once reaching the TSS, the sigma factor dis-
associates from the core enzyme. The core RNA polymerase, unlike DNA
polymerase, does not need a primer, but otherwise the enzyme catalyzes the
attachment of nucleotides to the nascent RNA molecule one at a time in the
5′→3′ direction. At a speed of approximately 30 nucleotides/second, the RNA
polymerase slides through the DNA template carrying the elongating RNA
molecule.
Although the attachment of new nucleotides to the elongating RNA is
based on base pairing with the DNA template, the new elongating RNA does
not remain associated with the template DNA via hydrogen bonding. On the
same template, multiple copies of RNA transcripts can be simultaneously
synthesized by multiple RNA polymerases one after another. During tran-
script elongation, these polymerases hold on tightly to the template and do
not disassociate from the template until the stop signal is transcribed. The
stop signal is provided by a segment of palindromic sequence located at the
end of the transcribed sequence. Right after transcription, the inherent self-
complementarity in the palindromic sequence leads to the spontaneous for-
mation of a hairpin structure. An additional stop signal is also provided by
a string of four or more uracil residues after the hairpin structure, which
forms weak associations with the complementary A’s on the DNA template.
The hairpin structure pauses further elongation of the transcript, and the
weak associations between the U’s on the RNA and the A’s on the DNA dis-
sociate the enzyme and the transcript from the template.
Regulation of prokaryotic transcription is conferred by promoters and pro-
tein factors such as repressors and activators. Promoter strength, that is, the
number of transcription initiation events per unit time, varies widely in dif-
ferent operons. For example, in E. coli, genes in operons with weak promoters
can be transcribed once in 10 minutes, while those with strong promoters
can be transcribed 300 times in the same amount of time. The strength of an
operon’s promoter is based on the host cell’s demand for its protein products
and dictated by its sequence. Specific protein factors may also regulate gene
transcription. Repressors, the best known among these factors, prevent RNA
polymerase from initiating transcription through binding to an intervening
sequence between the promoter and TSS called an operator. Activators exert
an opposite effect and induce higher levels of transcription. The sigma fac-
tor, being the initiation factor of the prokaryotic RNA polymerase, provides
another mechanism for regulation. There are different forms of this factor
in prokaryotic cells, each of which mediates sequence-specific transcription.
Differential use of these sigma factors, therefore, provides another level of
transcriptional regulation in prokaryotic cells.
3.3.3 Initial Transcription of Pre-mRNA from Eukaryotic Genes

In eukaryotic cells there are three types of RNA polymerases, among
which RNA polymerase II transcribes protein-coding genes, while RNA
RNA 39
polymerases I and III transcribe ribosomal RNA (rRNA), transfer RNA

(tRNA), and various types of small RNAs. Transcription in eukaryotic cells
is in general much more sophisticated, because of the highly compressed
packaging of chromosomal DNA, the complex structure of eukaryotic genes,
and intricate regulation by multiple factors. Prior to transcription, the highly
compressed DNA in the chromatin needs to be uncompressed and the gene
sequence exposed for access by RNA polymerase.
To perform the transcription of protein-coding genes, besides RNA poly-
merase II, a variety of other proteins in the nucleus are also required, includ-
ing transcription factors and coactivators. Transcription factors include
general and specific transcription factors. General transcription factors,
such as TFIIA, TFIIB, and TFIID, are required in all transcription initiation.
Their function is to position the RNA polymerase at the promoter region
and unwind the template DNA strands for transcription. Specific transcrip-
tion factors, which are detailed next, provide key regulatory function to the
transcription initiation process. Coactivators bring together all requisite
transcription factors to form the transcription initiation complex. Once tran-
scription is initiated, most of the protein factors in the complex are released
and the RNA elongation process is carried out by RNA polymerase II in a
manner similar to what occurs in prokaryotic cells. The termination of the
elongation process in eukaryotic cells is provided by the signal sequence
AAUAAA, which also serves as the signal for cleavage of the transcribed
RNA to generate the 3′ end and for polyadenylation (see Section 3.3.4). After
completion of the transcription process, the transcript contains both exons
and introns, and is called the primary transcript or pre-mRNA.
During RNA transcript elongation in both the eukaryotic and prokaryotic
systems, like in DNA replication by the DNA polymerase, there is a certain
probability of introducing mismatched nucleotides and therefore errors. For
proofreading, the prokaryotic and eukaryotic RNA polymerases have 3′→5′
exonuclease activity. If a wrong nucleotide is added to the elongating RNA
chain, the RNA polymerase will backtrack and correct the error. Because
of this activity, the overall error rate of the transcriptional process in both
systems is estimated to be 10 –4 to 10 –5 per base [32]. Although this is higher
than the DNA mutation rate, the transcriptional errors are seldom harm-
ful, because there are multiple copies for each transcript, and transcripts
carrying premature stop codons are quickly removed by a process called
nonsense-mediated decay.
Besides the step of gene sequence exposure through histone modifications
and chromatin remodeling, the eukaryotic gene transcription process is
mostly regulated at the initiation step through the use of specific transcrip-
tion factors. As a large group of DNA-interacting proteins (Chapter 2), these
transcription factors bind to specific sequence elements in the promoter
region of genes, through which they help assemble general transcription fac-
tors and the RNA polymerase into the transcription initiation complex. In
addition, specific transcription factors may also bind to specific regulatory
sequences at distant locations that are called enhancers or cis-regulatory

modules. Different from transcription factor binding sites in the promoter
regions, enhancers function independent of sequence orientation and from
a distance as far as megabases away from the regulated gene, and are some-
times embedded in intergenic regions that otherwise have no known func-
tion. Having a significant effect on gene transcription, enhancers exert their
regulatory function by DNA looping, which brings enhancer and promoter
sequences together affecting formation of the transcription initiation com-
plex. The binding of specific transcription factors to enhancers can have a
stimulatory, or inhibitory (through the recruitment of repressors), effect on
gene transcription. In general, the transcription of a gene is often regulated
by multiple specific transcription factors, and the combined signal input from
these transcription factors determines whether the gene will be transcribed,
and if yes, at what level. A particular transcription factor can also bind to
multiple genomic sites, coordinating the transcription of functionally related
genes. NGS-based approaches, such as ChIP-Seq (Chapter 11), are often used
to locate the binding sites of specific transcription factors across the genome.
3.3.4 Maturation of mRNA from Pre-mRNA

In prokaryotic cells, there is no posttranscription RNA processing, and tran-
scripts are immediately ready for protein translation after transcription. In
fact, while mRNAs are still being transcribed, ribosomes are already binding
to the transcribed portions of the elongating mRNAs synthesizing peptides.
In eukaryotic cells, however, primary transcripts undergo several steps of
processing in the nucleus to become mature mRNAs. These steps are (1) cap-
ping at the 5′ end, (2) splicing of exons and introns, and (3) addition of a poly-
A tail at the 3′ end.
The first step, adding a methylated guanosine triphosphate cap to the 5′
end of nascent pre-mRNAs, takes place shortly after the initiation of tran-
scription when the RNA chains are still less than 30 nucleotides long. This
step is carried out by adding a guanine group to the 5′ end of the transcripts,
followed by methylation of the group. This cap structure marks the tran-
scripts for subsequent transport to the cytoplasm, protects them from degra-
dation, and promotes efficient initiation of protein translation. Once formed,
the cap is bound by a protein complex called cap-binding complex.
The second step, splicing of exons and introns, is the most complicated
of the three steps. As introns are noncoding intervening sequences, they
need to be spliced out while exons are retained to generate mature mRNAs.
The molecular machinery that carries out the splicing, called the spliceo-
some, is assembled from as many as 300 proteins and 5 small nuclear RNAs
(snRNAs). The spliceosome identifies and removes introns from primary
transcripts, using three positions within each intron: the 5′ end (starts with
the consensus sequence 5′-GU, serving as the splice donor), the 3′ end (ends
with the consensus sequence AG-3′, as the splice acceptor), and the branch
RNA 41
point, which starts around 30 nucleotides upstream of the splicing acceptor

and contains an AU-rich region. The actual excision of each intron and the
concomitant joining of the two neighboring exons are a three-step process:
(1) cleavage at the 5′ end splice donor site; (2) attachment of the cleaved splice
donor site to the branch point to form a lariat or loop structure; and (3) cleav-
age at the 3′ end splicing acceptor site to release the intron and join the two
exons.
Beyond simply removing introns from primary transcripts, the splicing
process also employs differential use of exons, and sometimes even includes
some introns, to create multiple mature mRNA forms from the same pri-
mary transcript. This differential splicing, also called alternative splicing
(Figure 3.2), provides an additional regulatory step in the production of
mRNA populations. When it was first reported in 1980, alternative splicing
was considered to be an exception rather than the norm. Currently avail-
able data has shown that primary transcripts from essentially all multiexon
genes are alternatively spliced [33,34]. The biological significance of alter-
native splicing is obvious: by enabling production of multiple mRNAs and
thereby proteins from the same gene, it greatly augments protein and, con-
sequently, functional diversity in an organism without significantly increas-
ing the number of genes in the genome, and offers explanation to why more
evolved organisms do not contain many more genes in their genomes (see
Chapter 2, Table 2.1).
Exon skipping
Use of mutually exclusive exons
Intron retention
Use of alternative promoters
Use of alternative polyadenylation signals
FIGURE 3.2
Varying forms of RNA transcript splicing.
In the third step, once the new primary transcript passes the termination
signal sequence, it is bound by several termination-related proteins. One of
the proteins cleaves the RNA at a short distance downstream of the termina-
tion signal to generate the 3′ end. This is followed by a polyadenylation step
that adds 50 to 200 A’s to the 3′ end by an enzyme called poly-A polymerase.
This poly-A tail, like the 5′ end cap, increases the stability of the resulting
mRNA. This tail is bound and protected by a poly(A)-binding protein, which
also promotes its transport to the cytoplasm.
Besides these three major constitutive processing steps, some transcripts
may undergo additional processing steps. RNA editing, although considered
to be rare, is among the best known of these steps. RNA editing refers to the
change in RNA nucleotide sequence after it is transcribed. The most com-
mon types of RNA editing are conversions from A to I (inosine, read as G
during translation), which are catalyzed by enzymes such as ADARs (ade-
nosine deaminases that act on RNA), or from C to U, catalyzed by cytidine
deaminases. As a result of these conversions, an edited RNA transcript no
longer fully matches the sequence on the template DNA. RNA editing has
the potential to change genetic codons, introduce new or remove existing
stop codons, or alter splicing sites [35]. Evidence shows that RNA editing and
other RNA processing events such as splicing can be coordinated [36].
3.3.5 Transport and Localization

After maturation, mRNAs need to be exported out of the nucleus to the cyto-
plasm for protein translation. While allowing mature mRNAs to be trans-
ported out, the nucleus keeps unprocessed or partially processed transcripts,
as well as processed side products like removed introns, inside the nucleus.
To move across the nucleus envelope through the nuclear pore complexes,
mature mRNAs are packaged into large ribonucleoprotein (RNP) complexes.
Once in the cytoplasm, many mRNA species can be used to start synthesiz-
ing proteins right away. As the cytoplasm is a crowded place, they may ran-
domly drift in the cytoplasm while translating. Some translations, however,
take place at highly localized sites. For example, in neurons some mRNAs are
required to be transported to distal dendritic regions for translation. Local
protein translation at such target sites has been known to underlie impor-
tant biological functions, such as synaptic plasticity that underlies learning
and memory [37]. In order to transfer mRNAs to these special locations, the
mRNAs bind to special proteins to form mRNA-protein complexes, which
are then attached to protein motors to move along cytoskeletal tracks.
3.3.6 Stability and Decay

Steady-state mRNA concentrations, which are the detection target of tran-
scriptomic analyses such as RNA-Seq, are determined by not only rates of
mRNA production but also their decay. In general, prokaryotic mRNAs are
RNA 43
unstable and quickly degraded by endoribonucleases and exoribonucleases

after transcription. As a result, most of them are short lived and the average
prokaryotic mRNA half-life, that is, the amount of time to have half of the
mRNAs degraded, is under 10 minutes [38]. This high turnover rate allows
prokaryotic cells to quickly respond to environmental changes by altering
transcription. In comparison, eukaryotic mRNAs are in general more stable
and have a longer average half-life of 7 to 10 hours [39,40]. As a general rule,
mRNAs for regulatory or inducible proteins, such as transcription factors
or stress response proteins, tend to have shorter half-lives (e.g., less than
30 minutes), while those for housekeeping proteins, such as those of metabo-
lism and cellular structure, have long half-lives (e.g., days). The stability and
half-lives of mRNAs are also regulatable based on developmental stage or
environmental factors. For example, the stability and half-lives of mRNAs of
muscle-specific transcription factors, such as myogenin and myoD, are the
highest during muscle differentiation but quickly decline once the differen-
tiation is completed [41].
The regulation of eukaryotic mRNA degradation is not well understood
but has been known to involve interactions between some sequence elements
on mRNAs and protein as well as small RNA factors. One example of the
mRNA stability regulatory sequences is the AU-rich element, a region on the
3′ untranslated region of many short-lived mRNAs that, as the name suggests,
are rich in adenines and uridines. Many protein factors interact with this ele-
ment to modulate mRNA turnover, such as the AU-rich binding factor 1 (or
AUF1). Small RNAs, including microRNA (miRNA), small interfering RNA
(siRNA), and Piwi-interacting RNA (piRNA), are also important regulators of
mRNA stability and degradation (see Section 3.4.4 for details). P-bodies (pro-
cessing bodies), a granular structure in eukaryotic cells, are the focal point of
mRNA turnover mediated by protein and small RNA factors [42].
Most eukaryotic mRNA decay starts with deadenylation at the 3′ end, that
is, removal of the poly-A tail by deadenylase. The deadenylation then leads
to mRNA degradation through two alternative mechanisms. One mecha-
nism is through decapping of mRNA at the 5′ end, which leaves the mRNA
vulnerable to degradation by 5′→3′ exoribonuclease. The other mechanism
is direct 3′→5′ decay from the tail end, which is carried out by a multipro-
tein complex called exosome. Besides these major deadenylation-dependent
mRNA decay pathways, there are also other pathways that do not rely on
deadenylation [43].
3.3.7 Major Steps of mRNA Transcript Level Regulation

As indicated earlier, the regulation of both prokaryotic and eukaryotic tran-
scription is mostly applied at the initiation step, and this regulation is heavily
dependent on specific protein–DNA interactions. In the prokaryotic system,
besides promoter strength, the regulation of transcriptional initiation is pro-
vided by protein factors including repressors and activators, both of which
DNA
1 – Transcriptional control
Pre-mRNA
2 – RNA processing control
mRNA
Nucleus
Cytoplasm 3 – mRNA transport and localization control
mRNA
4 – Translational control
Protein
5 – mRNA stability and degradation control
Inactive mRNA/
degraded mRNA
FIGURE 3.3
The regulation of eukaryotic gene expression at multiple levels.
bind to specific promoters sequences. In the eukaryotic system, specific tran-

scription factors that bind to specific sequences in promoters and/or enhancers
offer most of the regulation. In addition, prior to the engagement of transcrip-
tion initiation complex, gene sequence access is regulated through histone
modification and chromatin remodeling. Since the generation of mRNA in
the eukaryotic system is a multistep process, regulatory mechanisms are also
applied at subsequent steps (Figure 3.3). During mRNA maturation, regula-
tion of exon and intron splicing leads to generation of alternative splicing
variants. Trafficking of mRNAs to localized cellular domains provides addi-
tional regulatory mechanism for some genes [44]. Equally important in deter-
mining steady-state mRNA levels, mRNA decay is another important but less
studied step upon which regulation is also exerted.
3.4 RNA Is More Than a Messenger

Despite their apparent indispensability, mRNAs constitute only about 5%
of total cellular RNA. Besides rRNAs and tRNAs, there is a rapidly growing
RNA 45
number of non-protein-coding RNAs that play important roles in regulating

protein-coding genes or carry out essential cellular functions. These non-
coding RNAs include miRNAs, piRNAs, siRNAs, snRNAs, small nucleolar
RNAs (snoRNAs), long-noncoding RNAs (lncRNAs), and RNAs that function
as catalysts (ribozymes). Some of these noncoding RNAs have been exten-
sively studied, such as the ribozymes, the discovery of which won the 1989
Nobel Prize in Chemistry and has led to the “RNA world” hypothesis. Based
on this hypothesis, early life forms were solely based on RNA, and DNA and
protein evolved later. The rRNAs, tRNAs, and ribozymes are thought by this
hypothesis as evolutionary remnants of the original RNA world [45]. The
functional importance and diversity of other noncoding RNAs, such as the
many forms of small RNAs and lncRNAs, are still in the process of being
fully appreciated, because they were discovered more recently. However,
because of their wide presence and importance, the 2006 Nobel Prize in
Physiology or Medicine was awarded to the discovery of RNA interference
(RNAi) by small RNAs. Due to the diverse and important roles that noncod-
ing RNAs play in cells, RNA is not treated as simply a messenger any more.
3.4.1 Ribozyme
Similar to proteins, RNAs can form complicated three-dimensional struc-
tures, and some RNA molecules carry out catalytic functions. These catalytic
RNAs are called ribozymes. A classic example of a ribozyme is one type
of intron called group I intron, which splices itself out of the pre-mRNA
that contains it. This self-splicing process, involving two transesterification
steps, is not catalyzed by any protein. A group I intron is about 400 nucleo-
tides in length and mostly found in organelles, bacteria, and the nucleus of
lower eukaryotes. When a precursor RNA that contains a group I intron is
incubated in a test tube, the intron splices itself out of the precursor RNA
autonomously. Despite variations in their internal sequences, all group I
introns share a characteristic spatial structure, which provides active sites
for catalyzing the two steps. Another example of ribozyme is the 23S rRNA
contained in the large subunit of the prokaryotic ribosome. This rRNA cat-
alyzes the peptide bond formation between an incoming amino acid and
the existing peptide chain. Although the large subunit contains more than
30 proteins, rRNA is the catalytic component, while the proteins only pro-
vide structural support and stabilization [46].
Also similar to protein catalysts, the dynamics of the reactions catalyzed
by ribozymes follows the same characteristics as those of protein enzyme-
catalyzed reactions, which are usually described by the Michaelis-Menten
equation. Further similarities of ribozymes to protein enzymes include that
ribozyme activity can also be regulated by ligands, usually small molecules,
the binding of which leads to structural change in the ribozyme. For instance,
a ribozyme may contain a riboswitch, which as part of the ribozyme can
bind to a ligand to turn on or off the ribozyme activity.
3.4.2 snRNA and snoRNA

Although a group I intron can self-splice, most pre-mRNA introns are not of
this type and need the spliceosome for splicing. The spliceosome, even larger
than the ribosome in size, contains five snRNAs (U1, U2, U4, U5, and U6),
and a large number of proteins. The splicing process heavily depends on the
interactions between these snRNAs and pre-mRNAs. For example, to initiate
splicing, U1 interacts with the 5′ splice donor site and U2 with the branch site
via base pairing. Later in the process, U6 binds to the 5′ splice site prior to its
cleavage. Although the spliceosome contains a large number of proteins, the
roles played by these snRNAs are indispensable.
Similarly, snoRNAs are indispensable for pre-rRNA processing. The
eukaryotic ribosome contains four rRNAs—28S, 18S, 5.8S, and 5S—with the
first three initially transcribed into a single large rRNA precursor. To gener-
ate the three rRNAs, the precursor rRNA needs to be first chemically modi-
fied and then cleaved. The chemical modification includes methylation at
over 100 nucleotides and isomerization of uridine at another 100 sites. The
snoRNAs are required in this process to identify the specific sites for modifi-
cation. There are many different types of snoRNAs, each of which can form
a complementary region with the precursor rRNA via base pairing. These
duplex regions are then recognized as targets for modification.
3.4.3 RNA for Telomere Replication

Located at the tips of a chromosome, telomeres seal the ends of chromosomal
DNA. Without telomeres, the integrity of chromosomes would be compro-
mised since DNA repair enzymes would recognize the DNA termini as break
points. Inside each telomeric region is a long string of highly repetitive DNA
sequences. Normally, shortening of telomere length occurs with each chro-
mosome replication, since chromosomal DNA duplication enzymes cannot
reach to the very ends of the DNA (the end replication problem). To prevent
this problem in germ cells and stem cells, an enzyme called telomerase is
responsible for replenishing the telomeric region. The telomerase is a large
complex comprising an RNA component, which serves as a template for the
repeat sequence, and a catalytic protein component (reverse transcriptase),
which uses the RNA template to synthesize the repetitive telomeric DNA
sequence. The telomerase activity is usually turned off or at very low levels
in most somatic cells. Therefore, these cells can only divide a certain number
of times before reaching senescence due to the gradual shortening of the
telomere.
3.4.4 RNAi and Small Noncoding RNAs

RNAi, as a cellular mechanism that uses small RNAs to silence gene expres-
sion, offers an excellent illustration of the significance of noncoding RNAs
RNA 47
in the regulation of protein-coding genes. RNAi achieves gene silencing

by suppressing mRNA translation, degrading mRNAs, or inhibiting gene
transcription [47]. As a native gene regulation mechanism in a wide range
of organisms, RNAi plays an essential role in organismal development and
various cellular processes. As viral RNA can activate the RNAi pathway in
host cells leading to degradation of the viral RNA, RNAi is also used by
plants and some animals to fight viral infections. Furthermore, RNAi can
also silence mobile elements in the genome, such as transposons, to maintain
genome stability. Currently, large amounts of data have established the per-
vasiveness of small RNA mediated RNAi in many organisms. For example,
in the human genome, over 60% of genes are regulated by small noncod-
ing RNAs [48]. Since its discovery, RNAi has been applied as a powerful
research tool to silence virtually any gene in the genome in order to decipher
their functions. Clinically, small RNAs have been tested as a strategy for
gene therapy through turning off faulty genes that underlie many genetic
diseases.
RNAi is mediated by three principal groups of small noncoding RNAs:
miRNA, siRNA, and piRNA. All these small RNAs induce RNAi through
the same basic pathway that involves a ribonucleoprotein complex called the
RNA-induced silencing complex (RISC). Following is a more detailed intro-
duction to these three groups of small RNAs and their differences.
3.4.4.1 miRNA
Mature miRNA, in the size range of 19 to 24 bases, induces gene silencing
through mRNA translational repression or decay. The precursor of miRNA
is usually transcribed from non-protein-coding genes in the genome
(Figure 3.4). The primary transcript, called pri-miRNA, contains an inter-
nal hairpin structure and is much longer than mature miRNA. For initial
processing, the pri-miRNA is first trimmed in the nucleus by a ribonuclease
called Drosha that exists as part of a protein complex called the microproces-
sor, to an intermediate molecule called pre-miRNA, about 70 nucleotides in
size. Alternatively, some miRNA precursors originate from introns spliced
out from protein-coding transcripts. These precursors, to be processed
for the generation of mirtrons (miRNAs derived from introns), bypass the
microprocessor complex in the nucleus. For further processing, the pre-
miRNA and the mirtron precursor are exported out of the nucleus into the
cytoplasm, where they are cleaved by the endoribonuclease Dicer to form
double-stranded miRNA. The double-stranded miRNA is subsequently
loaded into RISC. Argonaute, the core protein component of RISC, unwinds
the two miRNA strands and discard one of them [49]. The remaining strand
is used by Argonaute as the guide sequence to identify related mRNA targets
through imperfect base pairing with a seed sequence usually located in the
3′-UTR of mRNAs. Through this miRNA–mRNA interaction, RISC induces
silencing of target genes through repressing translation of the mRNAs and/ or
miRNA
gene
Pri-miRNA
Drosha
Pre-miRNA
Exportin 5
Nucleus
Cytoplasm dsRNA
Dicer
miRNA: siRNA
miRNA* duplex
duplex Unwind
Asymmetric RISC Some

assembly miRNA
RISC RISC
Ribosome
Target
mRNA
ORF RISC RISC RISC
Translational repression mRNA cleavage
FIGURE 3.4
The generation and functioning of miRNA and siRNA in suppressing target mRNA activity.
Genomic regions that code for miRNAs are first transcribed into pri-miRNAs, which are pro-
cessed into smaller pre-miRNAs in the nucleus by Drosha. The pre-miRNAs are then trans-
ported by exportin 5 into the cytoplasm, where they are further reduced to miRNA:miRNA*
duplex by Dicer. While both strands of the duplex can be functional, only one strand is assem-
bled into the RNA-induced silencing complex (RISC), which induces translational repression
or cleavage of target mRNAs. Long double-stranded RNA can also be processed by Dicer to
generate siRNA duplex, which also uses RISC to break down target mRNA molecules. (From
L He and GJ Hannon, MicroRNAs: Small RNAs with a big role in gene regulation, Nature
Reviews Genetics 2004, 5:522–531. With permission.)
RNA 49
their deadenylation and degradation. Because the base pairing is imper-

fect, one miRNA can target multiple target genes’ mRNAs. Conversely, one
mRNA may be targeted by multiple miRNAs.
3.4.4.2 siRNA
While being similar in size and using basically the same system for gene
silencing, siRNA differs from miRNA in a number of aspects. On origin,
siRNA is usually exogenously introduced, such as from viral invasion or
artificial injection. But they can also be generated endogenously, for example,
from repeat-sequence-generated transcripts (such as those from telomeres or
transposons), or RNAs synthesized from convergent transcription (in which
both strands of a DNA sequence are transcribed from the two opposite orien-
tations with corresponding promoters), or other naturally occurring sense–
antisense transcript pairs [50]. To generate mature siRNA, exogenously
introduced double-stranded RNA, or endogenously transcribed precursor
that is transported from the nucleus to the cytoplasm, is cleaved by Dicer.
The mature siRNA is then loaded into RISC for silencing target mRNAs by
Argonaute. On target mRNA identification, siRNA differs from miRNA in
that it has perfect or nearly perfect sequence complementarity with their tar-
get. On the mechanism of gene silencing, siRNA usually leads to endonu-
cleolytic cleavage, also called slicing, of the mRNAs.
3.4.4.3 piRNA
piRNA is a relatively newer class of small noncoding RNAs between 24 and
31 nucleotides in length and have functions in animal germline tissues. While
using a similar basic RNAi mechanism, piRNA is different from miRNA and
siRNA in two major aspects. One is that its biogenesis does not involve Dicer,
and the other is that, for gene silencing, it specifically interacts with Piwi, a
different clade of Argonaute proteins. The biogenesis of piRNA starts from
transcription of long RNAs from specific loci of the genome called piRNA
clusters. With regard to these clusters, it has been found that while their
locations in the genome do not show much change in related species, their
sequences are not conserved even in closely related species. After transcrip-
tion, the RNAs are transported out of the nucleus, and then subjected to
a parsing process by endonuclease(s) that is currently not clearly known.
To induce gene silencing, mature piRNA is loaded into RISC that contains
Piwi, which uses the piRNA sequence as a guide to silence target mRNAs
by slicing. In addition, piRNA-loaded mature RISC can also be transported
into the nucleus, where it finds and silences target mRNAs that are still
in the process of being transcribed. This transcriptional gene silencing is
achieved through interactions with other protein factors in the nucleus, and
histone modification that alters chromatin structure and gene access. The
currently best-known function of piRNAs, through post-transcriptional and
transcriptional gene silencing, is to repress transposon activity and thereby

maintain genome stability in germline cells. Nontransposon gene targets of
Piwi-interacting RNAs have also been reported such as those related to early
development.
3.4.5 Long Noncoding RNAs

Some noncoding RNAs, unlike the small RNAs, are rather long with an
average length of over 200 nucleotides in their mature form. These RNAs,
called long noncoding RNAs, have been discovered more recently and are
therefore less studied. The biogenesis of lncRNAs is somewhat similar to
that of mRNAs, as many of them are transcribed by RNA polymerase II and
subject to splicing, capping at the 5′ end, and polyadenylation at the 3′ end.
Unlike mRNAs, however, they are usually shorter with a median length of
~600 nucleotides, have fewer exons, and are generally expressed at levels
lower than those of mRNAs. Furthermore, their expression displays higher
tissue and developmental stage specificity than mRNAs, and are mostly
localized in the nucleus rather than transported to the cytoplasm.
Although they are relatively new, evidence on their importance in regu-
lating fundamental cellular functions is rapidly accumulating [51,52]. They
have been known to control many steps of gene activity, including chromatin
remodeling, transcriptional regulation, mRNA processing, stability, localiza-
tion, and translation [53,54]. For example, some lncRNAs, such as Xist and
HOTAIR, repress gene transcription at target genomic sites by interacting
with chromatin remodeling protein complexes [55,56]. A class of lncRNAs
that was recently discovered by NGS is transcribed from enhancer regions of
protein-coding genes. These transcripts, called eRNAs (or enhancer RNAs),
have been shown to affect transcription of protein-coding genes that are reg-
ulated by the enhancers [57]. In general, lncRNAs regulate gene activity via
binding to transcription factors, repressing promoter activity, and interacting
with mRNA-binding proteins and splicing factors. In addition, lncRNAs can
directly interact with mRNAs and thereby influence their stability and trans-
lation [58,59]. Because of their functional importance, it is not surprising that
abnormal lncRNA expression can lead to diseases such as cancer [60].
3.4.6 Other Noncoding RNAs

Deep sequencing of the cellular transcriptome has led to the discovery of
other noncoding RNAs. For example, circular RNAs (circRNAs) exist in
many species and cell types. Unlike linear RNAs, which include all the
RNA species introduced so far, circRNAs have their 5′ and 3′ ends joined
forming a loop structure. This structure makes them less vulnerable to
attacks from RNases and expectedly more stable. Because their widespread
existence was not unveiled until 2012 with the use of RNA-Seq, the func-
tion of most circRNAs is still largely unknown. Some reports suggest that
RNA 51
they have regulatory potency, including acting as miRNA sponges [61,62].

Besides the major noncoding RNAs introduced in this chapter, there are
also other classes of noncoding RNA species in cells that perform a remark-
able array of functions [63]. It is highly possible that new classes of noncod-
ing RNAs will continue to be discovered through RNA sequencing.
3.5 The Cellular Transcriptional Landscape

Traditionally, protein-coding mRNA transcripts used to be the major tar-
gets of transcriptional studies and as a result were often regarded as the
major component of a transcriptome. However, with the evolution of tran-
scriptomics technologies and as a result of the discovery of the wide vari-
ety of noncoding RNAs, it has been gradually realized that protein-coding
transcripts only constitute a minor fraction of a cell’s transcribed sequences.
Large-scale studies on the landscape of cellular transcription, as carried
out by consortia including the FANTOM (Functional Annotation Of the
Mammalian genome) and ENCODE (Encyclopedia of DNA Elements), have
revealed that the majority of the genome is transcribed, and a large propor-
tion of the transcriptome is noncoding RNAs [64,65]. For example, after
studying the transcriptional landscape of 15 human cell lines, encompass-
ing RNA populations isolated from different cellular sub-compartments
including the cytosol and the nucleus, the ENCODE consortium found that
the transcription of the genome is pervasive and 75% of genomic sequences,
including those located in gene-poor regions, are present in transcripts.
Many of the transcripts come from intronic and intergenic regions that
are not currently characterized and therefore novel. The complex cellular
RNA landscape adds further evidence that RNA is not simply a messenger
between DNA and protein.
Section II
Introduction to Next-
Generation Sequencing
(NGS) and NGS
Data Analysis
4
Next-Generation Sequencing (NGS)
Technologies: Ins and Outs
4.1 How to Sequence DNA: From First Generation to the Next

The sequence of nucleotides in a DNA molecule can be determined in
multiple ways. Early in the 1970s, biochemists (Drs. Walter Gilbert and
Frederick Sanger) devised different methods to sequence DNA. Gilbert’s
method is based on chemical procedures that break down DNA spe-
cifically at each of the four bases. Sanger’s method, on the other hand,
takes advantage of the DNA synthesis process. In this process, a new
DNA chain is synthesized base by base using sequence information on
the template (Chapter 2). The use of chemically modified nucleotides, that
is dideoxynucleotides, as irreversible DNA chain terminators in Sanger’s
method randomly stops the synthesis process at each base position, so
a series of new DNA chains of various lengths that differ by one base
are produced (Figure 4.1). Determining the lengths in single base resolu-
tion of specifically broken DNA molecules in Gilbert’s method, or new
DNA chains that are randomly terminated at each of the four nucleo-
tides in Sanger’s method, enabled sequencing of the template DNA. Over
the years the Sanger method was further developed. The integration of
automation into the process reduced human involvement and improved
efficiency. The use of fluorescently labeled terminators, instead of the
radioactively labeled terminators that were initially used, made it safer
to operate and sequence detection more robust. The improved separation
of DNA chains with the use of capillary electrophoresis, instead of slab
gels, enabled high-confidence base calls. All these developments led to
the Sanger method being widely adopted and the method of choice for
the Human Genome Project. Even today this method is still widely used
for single or low-throughput DNA sequencing. With the coming of next-
generation sequencing (NGS), this method has become the synonym of
first-generation sequencing.
Although it is robust in sequencing individual DNA fragments, the
Sanger method cannot easily achieve high throughput, which is the key to
55
T G C A G G C A T C A G
Denatured G T C Labeled
template primer
A C G T C C G T A G T C
Add dNTPs and

polymerase
ddG ddA ddT ddC Template/product
T G C A G G C A T C A G
ddC G T A G T C
ddC C G T A G T C
ddC G T C C G T A G T C
(a)
Denaturing gel
Labeled strands
G A T C
ddA C G T C C G T A G T C
A
ddC
C
ddG
G
ddT
T
ddC
C
ddC
C
ddG
G
ddT
T
ddA
A
(b)
FIGURE 4.1
The Sanger sequencing method as originally proposed. This method involves a step for new
DNA strand synthesis using the sequencing target DNA as the template (panel a), followed by
sequence deduction through resolution of the newly synthesized DNA strands (panel b). In the
first step, the new strand synthesis reaction contains denatured DNA template, radioactively
labeled primer, DNA polymerase, and dNTPs. For the dNTPs, the Sanger method is character-
ized by the use of dideoxynucleotides (ddG, ddA, ddT, and ddC, as shown in the figure) along
with regular unmodified nucleotides. The DNA polymerase in the reaction incorporates dide-
oxynucleotides into the elongating DNA strand like regular nucleotides, but once a dideoxy-
nucleotide is incorporated, the strand elongation terminates. In this sequencing scheme, each
of the four dideoxynucleotides is run in a separate reaction, and the ratio of these dideoxynu-
cleotides to their regular counterparts in each reaction is controlled so that the polymerization
can randomly terminate at each base position. The end product of each reaction is a popula-
tion of DNA fragments with different lengths, with the length of each fragment dependent on
where the dideoxynucleotide is incorporated. Panel b illustrates the separation of these frag-
ments in a denaturing gel by electrophoresis, in which smaller fragments migrate faster than
larger ones and appear toward the bottom of the gel. The radioactive labeling on the primer
enables visualization of the fragments as bands on the gel. Shown on the right are DNA frag-
ments that correspond to each of the bands, respectively. From the arrangement of DNA bands
the complementary sequence of the original DNA template can be deduced (shown on the left
of the sequencing gel, read from bottom upward). (From P Moran, Overview of commonly
used DNA techniques, in LK Park, P Moran, and RS Waples, eds., Application of DNA Technology
to the Management of Pacific Salmon, 1994, 15–26, Department of Commerce, NOAA Technical
Memorandum NMFS-NWFSC-17. © Paul Moran, NOAA’s Northwest Fisheries Science Center.
With permission.)
Next-Generation Sequencing (NGS) Technologies 57
lowering sequencing cost, largely due to the segregation of its DNA synthe-
sis process and the subsequent DNA chain separation/detection process.
Its principle of sequencing-by-synthesis, however, becomes the basis of sev-
eral NGS technologies, all of which are characterized by extremely high
throughput. These technologies generally use nucleotides with reversible
terminator or other cleavable chemical modifications, or regular unmodi-
fied nucleotides, so the new DNA strand synthesis is not permanently
terminated and therefore can be monitored as or after each base is incorpo-
rated. This development, along with advancements in other relevant fields,
makes it possible to conduct sequencing of millions of DNA fragments
simultaneously.
One of the early NGS technologies, 454 (later acquired by Roche), achieved
high-throughput sequencing by further developing a method called pyro-
sequencing. This method is based on the detection of the pyrophosphate
released after each nucleotide incorporation in the new DNA strand synthe-
sis [66]. In this technology, each of the four different nucleotides is added
into the sequencing reaction in a fixed order one at a time. If complemen-
tary, the corresponding nucleotide (or more than one, if there is a homopol-
ymer on the template) is ligated to the new strand, and as part of the ligation
reaction a pyrophosphate is released as a side product. An enzyme called
ATP sulfurylase converts this pyrophosphate to ATP, which in turn is used
to convert luciferin to oxyluciferin by luciferase. The generated oxyluciferin
emits light, and the amount of light emitted is generally proportional to
the number of nucleotides incorporated. By detecting light emission after
each cycle of nucleotide addition, the sequence on each DNA template is
deduced. High throughput is achieved when massive numbers of DNA
templates are sequenced in this fashion simultaneously. Using the 454/
Roche technology, sequence reads of 400 to 500 bp in length are generated.
A number of widely used NGS technologies, including Illumina reversible
dye-terminator sequencing, Ion Torrent semiconductor sequencing, and
Pacific Biosciences single-molecule real-time sequencing, are all based on
the sequencing-by-synthesis principle. The specifics of these methods will
be detailed in Section 4.3.
Not all NGS technologies are based on the principle of sequencing-by-
synthesis. For example, the SOLiD (Sequencing by Oligonucleotide Ligation
and Detection) system from Life Technologies uses a sequencing-by-ligation
process. Nanopore sequencing, as commercialized by companies such as
Oxford Nanopore Technologies, deduces the DNA sequence through detect-
ing differential electric field disturbances caused by different nucleotides
when a strand of DNA is threaded through a nanopore structure. Despite the
differences in how different NGS technologies work in principle, the overall
workflow of an NGS experiment is more or less similar. Next is an overview
of a typical NGS experimental workflow as conducted in a wet lab, along
with early-phase data analysis.
4.2 A Typical NGS Experimental Workflow

Sequencing genomic DNA, or RNA transcripts, with NGS technologies
involves multiple steps (Figure 4.2). The early steps in this process are to
construct sequencing libraries from DNA or RNA molecules extracted from
biological samples of interest. As they are usually too large to be directly
handled by most NGS technologies, especially those that produce short
reads, the extracted DNA or RNA molecules need to be broken into smaller
fragments first. This fragmentation can be achieved with different tech-
niques, including sonication, nebulization, acoustic shearing, or enzymatic
treatment. The fragmentation step is usually followed by a size selection step
to collect fragments in a certain target range.
A key step in the sequencing library construction process is the ligation of
adapters to the two ends of DNA fragments. For RNA fragments, they are
usually converted to complementary DNA (cDNA) first before adding the
adapters. The adapters are artificial sequences that contain multiple compo-
nents that serve several purposes in the sequencing process. These sequence
components include (1) universal sequencing primer sequence(s) that initi-
ate sequencing reactions on each fragment; (2) polymerase chain reaction
(PCR) amplification primer sequences for sequencing template enrichment;
(3) anchoring sequences that enable presequencing attachment of the DNA
fragments to a solid support, such as glass slide or bead, where sequencing
reactions take place; and (4) indexing (or “barcode”) sequences to differenti-
ate multiple samples when they are sequenced together. While they gener-
ally serve similar functions in different NGS platforms, the actual standard
adapter sequences are specific to each platform. It is also possible to design
custom adapters to meet special needs as long as key adapter sequence ele-
ments essential for a platform are in place. Prior to adapter ligation, the
two ends of the DNA (or cDNA) fragments need to be prepared in an end
repair step (not shown in Figure 4.2). After adapter ligation, the sequencing
DNA templates in the resultant library usually need to be enriched through
a PCR amplification step using the primer sequence built in the adapters.
Alternatively, the constructed library may be sequenced PCR-free without
enrichment on some platforms.
To sequence the constructed DNA libraries, different platforms use differ-
ent approaches and collect sequencing signals that are of different nature.
For example, as to be detailed next, optical or physicochemical signals are
often captured and processed to generate sequence readout of the DNA
fragments. The optical signal is usually based on either direct light emis-
sion (as in the 454/Roche platform) or fluorescence generated from the use
of chemically modified nucleotides that carry fluorescent labels (as in the
Illumina and Pacific Biosciences systems). The physicochemical signal is
measured from physical or chemical activity associated with the sequenc-
ing process, such as the release of H+ and the concomitant pH change (as
Sequencing target
(DNA or RNA)
Fragmentation
Size selection
Adapter ligation
Immobilization to
a solid support
Sequencing using
NGS technologies
G A T C A A T
A T A T C A A
A T C T A G A Sequencing reads
A G G T A T C
A T A T C A A
C A A T G T C
A G G T A T C
A T C T A G A
A T A T C A A
A T A T C A A Alignment (or assembly)
G A T C A A T of sequencing reads
C A A T G T C
A G G T A T C T A G A T C A A T G T C
FIGURE 4.2
The general workflow of an NGS experiment.
in the Ion Torrent system), or electric field disturbance (as in Nanopore

sequencing). Processing of such optical or physicochemical signals leads
to sequence deduction of the DNA fragments. For data output and stor-
ing, the raw, unprocessed signals are usually stored in a platform-specific
format, whereas the processed sequence reads are usually reported in a file
format that is more universal (for details, see Chapter 5).
Although a DNA sequence can be read from only one end of a DNA tem-
plate (i.e., single-read sequencing), it can also be read from both ends of the
DNA fragment (called paired-end sequencing). Besides doubling the total
number of sequence reads, paired-end sequencing also has the advantage
of facilitating subsequent alignment to a reference genome (Chapter 5) or
genome assembly (Chapter 10). Because DNA fragments are usually size
selected and therefore their approximate length known, the resultant paired
reads and the distance between them provide additional information on how
to align the reads to a reference genome or assemble them into a new genome.
Most current NGS platforms can accommodate paired-end sequencing.
From the aforementioned general NGS experimental workflow, it is clear
that besides the ingenuity in the development of new sequencing chemistries
or schemes, the success of NGS technologies in achieving extremely high
throughput with the simultaneous detection of millions of DNA molecules
is also due to modern engineering and computing feats. Advancements in
microfluidics and microfabrication make signal detection from microvolume
of sequencing reaction possible. Developments in modern optics, micros-
copy, and imaging technology enable tracking of sequencing reactions in
high resolution, high fidelity, and high speed. Some NGS platforms also rely
on the decades of progress in the semiconductor industry or more recent
but rapid development in nanopore technology (such as the Ion Torrent and
Nanopore platforms, respectively). High-performance computing makes it
possible to process and deconvolve the torrent of signals recorded from mil-
lions of these processes.
4.3 Ins and Outs of Different NGS Platforms

The NGS technologies mentioned earlier have generated the vast majority of
NGS data in existence today. Several of these platforms will continue to pro-
duce more NGS data for life science research, but some of these systems have
been discontinued. For example, the Roche/454 pyrosequencing platform
was discontinued in 2013, and the NGS company Helicos Biosciences filed for
bankruptcy in 2012. Although sequencing data is still being generated from
existing 454 and Helicos systems, this section focuses on the platforms that
are currently most active and widely used. As NGS technologies continue to
evolve, new platforms will appear while some current technologies become
obsolete. Although an overview of NGS platforms usually becomes outdated

fairly soon, the guiding principles on the analysis of NGS data introduced in
this book will remain.
4.3.1 Illumina Reversible Dye-Terminator Sequencing

4.3.1.1 Sequencing Principle
The Illumina NGS platform is by far the most popular and has generated the
largest amounts of NGS data. At the core of the Illumina sequencing technol-
ogy is the employment of fluorescently labeled nucleotides with reversible
terminator [67]. As previously mentioned, this method is based on the same
basic principle of sequencing-by-synthesis as the Sanger method; but unlike
the Sanger method, after the incorporation of each of these specially modi-
fied nucleotides, the terminator moiety they carry only temporarily prevents
the new DNA strand from extending. After optical detection of the incorpo-
rated nucleotide based on its specific fluorescent label, the terminator moiety
is cleaved, and thereby the new strand synthesis resumes for the next cycle of
nucleotide incorporation. For simultaneous detection of nucleotide incorpo-
ration in millions of sequencing reactions, dATP, dCTP, dGTP, and dTTP are
labeled with different fluorescent labels so each nucleotide can be detected
by the different fluorescence signal they emit. The fluorescent labels and the
reversible terminator moiety are attached to the nucleotides via the same
chemical bond, so both of them can be cleaved off in a single reaction after
each nucleotide incorporation and detection cycle to prepare for incorpora-
tion of the next nucleotide.
4.3.1.2 Implementation
The sequencing reaction in an Illumina NGS system takes place in a flow cell
(Figure 4.3). The microfluidic channels in the flow cell, often called lanes, are
where sequencing reactions take place and sequencing signals are collected
through scanning. The top and bottom surface of each lane is covered with
a lawn of oligonucleotide sequences that are complementary to the anchor
sequences in the ligated adapters. When sequencing libraries are loaded into
each of the lanes, DNA templates in the libraries bind to these oligonucle-
otide sequences and become immobilized onto the lane surface (Figure 4.4).
After immobilization, each template molecule is clonally amplified through
a process called “bridge amplification,” through which up to 1000 identical
copies of the template are generated in close proximity (<1 micron in diam-
eter) forming a cluster. During sequencing, these clusters are basic detection
units, which generate enough signal intensity for base calling.
Under ideal conditions the simultaneous incorporation of nucleotides
to the many identical copies of sequencing templates in a single cluster is
expected to be in synchronization from step to step and therefore remain in
FIGURE 4.3
An Illumina sequencing flow cell. It is a special glass slide that contains fluidic channels inside
(called lanes). Sequencing libraries are loaded into the lanes for massively parallel sequencing
after template immobilization and cluster generation. In each step of the sequencing process,
a DNA synthesis mixture, including DNA polymerases and modified dNTPs, is pumped into
and out of each of the lanes through their inlet and outlet ports located at the two ends.
(a)
(b)
(c)
B B
B
B
B
(d)
FIGURE 4.4
Illumina sequencing sample preparation and sequencing approaches. (a) Ligation of adapters
in a forked configuration to fragmented and size-selected DNA. Each ligation product is then
amplified using primers complementary to sequences in the adapters to generate blunt-end
amplicons. (b) Clonal amplification by isothermal bridge amplification. To achieve this, DNA
strands are first separated by denaturing, and each strand is attached to the flow cell surface
with complementary sequences. After a new strand (dotted line) is synthesized on the flow cell
surface, the original DNA strand is removed. The “free” end of the new strand then attaches to
the other anchoring oligonucleotide sequence on the flow cell surface with sequence comple-
mentarity, which leads to the formation of a bridge configuration for synthesis of a new com-
plementary strand. Repetition of this process generates many copies of the original sequence
template in a cluster. (c) Sequencing from one end or both ends of the DNA templates. Prior to
sequencing, one strand is cleaved within one adapter sequence (marked with an asterisk) and
then removed after denaturing. The remaining strand is used as the template for sequencing
from one end. For sequencing from the other end (i.e., paired sequencing), the sequencing tem-
plate is rebuilt. The template rebuilding process includes removal of the first read’s new strand
after denaturing, generation of a complementary template (dotted line) with the bridge synthe-
sis, and cleavage and removal of the original template. The new template is used to generate
read 2 from the opposite end. (d) Mate-pair sequencing. This strategy enables sequencing of
the two ends of long DNA fragments (e.g., >1 kb). In this strategy, the long DNA fragments are
first circularized and then fragmented. Those fragments that contain the end junction are then
sequenced using the paired-end process illustrated in b. (From DR Bentley, S Balasubramanian,
HP Swerdlow, GP Smith, J Milton, CG Brown, KP Hall et al., Accurate whole human genome
sequencing using reversible terminator chemistry, Nature 2008, 456:53–59. With permission.)
phase. In reality, a small percentage of templates lose sync with the major-
ity of molecules in the same cluster, leading to either falling behind (called
phasing), due to incomplete removal of the terminator as well as missing a
cycle, or being one or several bases ahead (prephasing), due to incorporation
of nucleotides with no terminators. The existence of phasing and prephas-
ing in a cluster leads to increased background noise and decreased base call
quality. When more and more sequencing cycles are conducted, this problem
becomes worse. This is why platforms that are based on clonal amplification
(which also include the Ion Torrent platform to be detailed next) have declin-
ing base call quality scores toward the end. Eventually the decrease in base
call quality reaches a threshold beyond which the quality scores become
simply unacceptable. The gradual loss of synchronicity is a major determi-
nant of read length for these platforms.
4.3.1.3 Error Rate, Read Length, Data Output, and Run Time

The overall error rate of the Illumina sequencing method is below 1%, which
makes it one of the most accurate NGS platforms currently available. The
most common type of errors is single nucleotide substitution. On read length,
the high-throughput HiSeq system can generate reads of up to 125 bases in
length using the high-output run mode and 250 bases using the rapid run
mode. The relatively low-throughput MiSeq system produces reads up to
300 bases long. With regard to data output, the HiSeq system can generate
up to 8 billion paired-end reads on two 8-lane flow cells, with a total data
yield of 1 Tb (terabase) using the high-output run mode. Using the rapid run
mode, it can produce up to 1.2 billion pair-end reads on two 2-lane flow cells,
with a total yield of 300 Gb (gigabase). The MiSeq system, on the low side,
can generate up to 50 million paired-end reads, with a total data output of
15 Gb. With single-end sequencing, the total number of reads and data yield
is half of the aforementioned numbers. Among the three major platforms
presented here, the Illumina systems offer the shortest reads. However, at the
read length of up to 250 bases, it can meet the needs of most NGS applica-
tions. It should be noted that the technical numbers listed here are as of early
2015 and will change with future system updates.
Concerning run time, a MiSeq run takes 5 to 55 hours, while a HiSeq 2500
run takes from 7 hours to up to 11 days depending on run modes (rapid
vs. high output) and chemistry. The enzymatic step for the incorporation of
nucleotides actually takes little time. The majority of time is spent imaging
the clusters on the flow cell surface. For the imaging, the fluorescent labels
on the nucleotides are illuminated with a red and a green laser and scanned
through four different filters. After each cycle, four images are generated on
each tile and the current high output flow cell contains 768 tiles. The imag-
ing step can be sped up by decreasing the total scanning surface area (the
2-lane rapid run flow cell has only 128 tiles), but this comes with the tradeoff
of decreased data volume and cost-efficiency.
There are three steps in the Illumina sequence data generation process.
First, raw images captured after each cycle are analyzed to locate clusters
and report signal intensity, coordinates, and noise level for each cluster. This
step is conducted by the instrument control software. The output from this
step is fed into the next step of base calling by the instrument Real Time
Analysis (RTA) software, which uses cluster signal intensity and noise level
to make base calls and quality score calculation. This step also filters out low-
quality reads. In the third step, the base call files, or bcl files, are converted to
compressed FASTQ files by the Illumina’s proprietary software CASAVA. If
samples are indexed and sequenced in a multiplex fashion, demultiplexing
of the sequence data is also performed in the third step. The compressed and
demultiplexed FASTQ files are what an end user receives from an NGS core
facility after the completion of a run.
4.3.2 Ion Torrent Semiconductor Sequencing

The Ion Torrent semiconductor sequencing system is the first NGS platform
that does not rely on chemically modified nucleotides, fluorescence label-
ing, and the time-consuming step of image scanning, thereby achieving
much faster speed, lower cost, and smaller equipment footprint. The Ion
Torrent platform sequences DNA through detecting the H+ ion released
after each nucleotide incorporation in the sequencing-by-synthesis pro-
cess. When a nucleotide is incorporated into a new DNA strand, the chemi-
cal reaction catalyzed by DNA polymerase releases a pyrophosphate group
and a H+ (proton). The release of H+ leads to pH change in the vicinity of
the reaction, which can be detected and used to determine the nucleotide
incorporated in the last cycle. As the change in pH value is not nucleotide-
specific, to determine DNA sequence, each of the substrate nucleotides
(dATP, dGTP, dCTP, and dTTP) is added to the reaction in order at different
times. A detected pH change after the introduction of a nucleotide sug-
gests that the template strand contains its complementary base at the last
position.
The library construction process in this technology is similar to other NGS
technologies, involving ligation of platform-specific primers to DNA shot-
gun fragments. The library fragments are then clonally amplified by emul-
sion PCR onto the surface of 3-micron diameter beads. The microbeads
coated with the amplified sequence templates are then deposited into an Ion
chip. Each Ion chip has a liquid flow chamber that allows influx and efflux
of native nucleotides (introduced one at a time), along with DNA polymerase
and buffer that are needed in the sequencing-by-synthesis process. For
measuring possible pH change associated with each introduction of nucleo-

tide, there are millions of pH microsensors that are manufactured on the
chip bottom by the employment of standard processes used in the semicon-
ductor industry.
4.3.2.3 Error Rate, Read Length, Date Output, and Run Time

The overall error rate of the Ion Torrent platform is higher than the Illumina
platform but lower than the Pacific Biosciences system (see Section 4.3.3.3).
The major type of errors is indels caused by homopolymers. When the DNA
template contains a homopolymeric region, which is a stretch of identical
nucleotides (such as TTTTT), the signal in pH change is stronger and pro-
portional to the number of nucleotides contained in the homopolymer. For
example, if the template contains two T’s, the influx of dATPs will generate a
pH change signal that is about twice as strong as that generated for a single T.
Accordingly the signal for 3 T’s will be 1.5-fold that of 2 T’s, and the signal
for 6 T’s will be reduced to 1.2-fold that of 5 T’s. Therefore, with the increase
in the total number of the repeat base, there is a gradual decrease in signal
strength ratio, which reduces the reliability of calling the total number of the
base correctly. It is estimated that the current error rate for calling a 5-base
homopolymer is 3.5%.
The current (as of early 2015) Ion PGM system using an Ion 318 chip
(v2) takes 4 to 7 hours to generate 4 million to 5.5 million reads that are
35 to 400 bases in length (~600 Mb to 2 Gb data). The higher through-
put Ion Proton system using the Ion PI chip generates in 2 to 4 hours
10 Gb data with 60 million to 80 million reads that are up to 200 bases
long, enough to sequence two human exomes. Use of the PII chip on the
Proton system can generate 32 Gb data in 4 hours, enabling sequenc-
ing of the human genome 10 times. The data volume generated from
this technology is expected to increase with continuous development
of new chips by increasing total chip surface area and microwell/pH-
microsensor density.
4.3.3 Pacific Biosciences Single Molecule Real‑Time (SMRT) Sequencing

The Pacific Biosciences’ single molecule real-time (SMRT) sequencing
platform is usually regarded as third-generation sequencing technology,
as it is sensitive enough to sequence single DNA molecules and therefore
bypasses any form of amplification [68]. In addition, this platform gener-
ates much longer reads than most other NGS platforms, with the current
median length in the range of 8 to 10 kb. While it is also based on the prin-
ciple of sequencing-by-synthesis, different from the Illumina method,
SMRT sequencing uses nucleotides that carry fluorescent labels linked to
their end phosphate group but no terminator group. When a nucleotide

is incorporated into an elongating DNA strand, with the cleavage of the
end phosphate group (actually a pyrophosphate group as mentioned ear-
lier), the fluorescent label is simultaneously released, which enables real-
time signal detection. As this process does not involve a separate step of
fluorescent label releasing and detection, the sequence-detecting signal is
continuously recorded as a 75-frames-per-second movie instead of using
scanner images.
The single-molecule sensitivity of this technology is achieved by the use
of zero-mode waveguide (or ZMW), a hole tens of nanometers in diam-
eter microfabricated in a metal film of 100 nm thickness, which is in turn
deposited onto a glass substrate. To conduct sequencing in a ZMW, a single
DNA polymerase and a single DNA strand (sequencing target) are immo-
bilized to its bottom. Because the diameter of a ZMW is smaller than the
wavelength of visible light, and due to the natural behavior of visible light
passing through such a small opening from the glass bottom, only the bot-
tom 30 nm of the ZMW is illuminated. Having a detection volume of only
20 zeptoliters (10 –21 L), this detection scheme greatly reduces background
noise and enables detection of nucleotide incorporation into a single DNA
molecule.
While the SMRT platform performs single molecule sequencing, it still
requires a lot of DNA samples at the starting point (1 μg currently). The
library prep process for SMRT is similar to other NGS platforms, includ-
ing shotgun fragmentation of DNA into required size, which is multi-
kilobases for this technology. This is followed by DNA fragment end
repair and adapter ligation. The resultant sequencing templates are then
annealed to sequencing primers, onto which DNA polymerases are sub-
sequently bound. Prior to sequencing, the template–primer–polymerase
complex is immobilized to the 150,000 ZMWs at the bottom of a SMRT
cell. Due to technical restraints, currently only about one third (~50,000 to
60,000) of these ZMWs generate quality reads that pass filter.
4.3.3.3 Error Rate, Read Length, Data Output, and Run Time

One major disadvantage of this platform is its high error rate and run cost
compared to the other platforms (Table 4.1). The error rates, at 10% to 15%,
are higher than the other two platforms, with the most common error types
being indels. On actual read length and data output, with the current movie
length of 3 hours, the longest read that can be sequenced exceeds 30 kb
(8.5 kb on average). The current total data output of a SMRT cell is 375 Mb on
the current model (RSII).
68
TABLE 4.1
Comparison of Current NGS Platforms
Read Data Output Cost Common Error Error Paired-End Required DNA
Platform Principle Detection Length per Run per Gbc Type Ratea Sequencing Sample Amount
HiSeq Reversible Fluorescence 125–250 1000 Gb $ Single nucleotide 10–3 Yes 50–1000 ng
2500 Terminator basesb substitution
MiSeq Reversible Fluorescence 300 15 Gb $$ Single nucleotide 10–3 Yes 50–1000 ng
Terminator bases substitution
Ion Proton pH change 400 Up to 2 Gb $$$ Indels (mostly at 10–2 Yes 100–1000 ng
Torrent release and bases homopolymers)
PGM pH change
Ion Proton pH change 200 10 Gb $$$$ Indels (mostly at 10–2 Yes 100–1000 ng
Proton release and bases (PI Chip) homopolymers)
pH change
PacBio ZMW and Fluorescence 8.5 kb 375 Mb $$$$$ Indels 10–1 No 1000 ng
RSII single average
molecule
sequencing
a Source: CW Fuller, LR Middendorf, SA Benner, GM Church, T Harris, X Huang, SB Jovanovich et al., The challenges of sequencing by synthesis, Nature
Biotechnology 2009, 27:1013–1023. With some modifications.
b 125 bases: high-output mode; 250 bases: rapid mode.
c Relative sequencing cost: $, least expensive; $$$$$, most expensive.
Next-Generation Sequencing Data Analysis
4.4 Biases and Other Adverse Factors

That May Affect NGS Data Accuracy
Just as a certain level of erroneous base calls is inherent to an NGS platform,
the multiple steps that lead to the generation of sequence calls are not immune
to biases. Different from errors, biases affect accurate representation of the
original DNA or RNA population leading to higher (or lower) representation
of some sequences than expected. The major source of biases in NGS are
the molecular steps involved in the library construction and the sequencing
process itself. Besides biases, there are also other potential factors that may
lead to the generation of inaccurate sequencing signals. Detailed next are the
various potential biases and other adverse factors during sequencing library
construction and sequencing that may affect NGS data accuracy. It should
be noted that while it is impossible to avoid them altogether, being aware of
their existence is the first step toward minimizing their influence through
careful experimental design and data analysis, and developing more robust
analytic algorithms.
4.4.1 Biases in Library Construction

Biases in DNA fragmentation and fragment size selection. The initial step of
library construction, that is, DNA fragmentation, is usually assumed to be
a random process and not dependent on sequence context. This has been
shown not to be the case [69]. For example, sonication and nebulization cause
DNA strand breaks after a C residue more often than expected. After DNA
fragmentation, the size selection process may also introduce bias. For exam-
ple, if gel extraction is employed for this process, the use of a high gel melting
temperature favors recovery of fragments with high GC content.
Ligation biases. After fragmentation and size selection, double-stranded
DNA fragments are usually adenylated, after end repair, at the two 3′-ends
generating 3′-dA tails that facilitate subsequent ligation of adapters that
carry 5′-dT overhangs and thereby avoid self-ligation of DNA fragments or
adapters. This AT-overhang-based adapter ligation process, however, tends
to be biased against DNA fragments that start with a T [70]. The sequenc-
ing of large RNA species, such as mRNAs or long noncoding RNAs, is also
affected by this bias, as cDNA molecules reverse transcribed from these
species are also subjected to the same adapter ligation process. Small RNA
sequencing is not affected by this bias, as the ligation of adapters in small
RNA sequencing library preparation is carried out prior to the reverse tran-
scription step. The small RNA adapter ligation step, however, introduces a
different type of bias, which affects some small RNAs in a sequence-specific
manner. Sequence specificity underlies small RNA secondary and tertiary
structure, which is also affected by temperature, concentration of cations,
and destabilizing organic agents (such as dimethyl sulfoxide [DMSO]) in the
ligation reaction mixture. The efficiency of small RNA adapter ligation is

influenced by their secondary and tertiary structure [71].
PCR biases. After adapter ligation, the DNA library is usually enriched by
PCR for sequencing on most of the current NGS platforms. PCR, based on the
use of DNA polymerases, is known to be biased against DNA fragments that
are extremely GC- or AT-rich [72]. This can lead to variation in the coverage
of different genomic regions and underrepresentation of those regions that
are GC- or AT-rich. Although optimization of PCR conditions can ameliorate
this bias to some degree, especially for high-GC regions, this bias can only
be eliminated via adoption of a PCR-free workflow. To achieve this, Illumina
has introduced a PCR-free workflow. Similar workflow has also been estab-
lished for the Ion Torrent platform.
4.4.2 Biases and Other Factors in Sequencing

Like PCR, the sequencing-by-synthesis process carried out by most current
NGS systems is also based on the use of DNA polymerases, which introduces
similar coverage bias against genomic regions of extreme GC or AT content.
As the use of DNA polymerases is at the core of these technologies, it is
difficult to completely eradicate this bias. This bias should be kept in mind
though when sequencing genomes or genomic regions of extremely high
GC or AT content (>90%). Besides this enzymatic procedure, other aspects
of the sequencing process, including equipment operation and adjustment,
image analysis, and base calling, may also introduce biases as well as arti-
facts. For example, air bubbles, crystals, dust, and lint in the buffers could
obscure existing clusters (or beads) and lead to the generation of artificial
signals. Misalignment of the scanning stage, or even unintended light reflec-
tions, can cause significant imaging inaccuracies. Unlike some of the inher-
ent biases mentioned earlier, these artifacts can be minimized or avoided by
experienced personnel.
The sequencing signal processing and base calling steps may also intro-
duce bias. For example, on the Illumina platform, the four images generated
from each tile after each cycle need to be overlaid (registered), and signal
intensities extracted for each cluster and cycle. This procedure is compli-
cated by two factors: (1) signals from the four detection channels are not
independent, as there is crosstalk between A and C and between G and T
channels, due to the overlapping in the emission spectra of their fluorescent
labels; (2) signals from a particular cycle are also dependent on signals from
the cycles before and after, due to phasing and prephasing. Although the
Illumina’s proprietary software is efficient at dealing with these factors for
base calling, there are other commercial and open-source tools that employ
different algorithms at these tasks and generate varying results. The algo-
rithms these methods use (including the Illumina method) make different
assumptions on signal distribution, which may not strictly represent the col-
lected data, and therefore introduce method-specific bias to base calling.
4.5 Major Applications of NGS

4.5.1 Transcriptomic Profiling and Splicing Variant Detection (RNA-Seq)
NGS has gradually replaced microarray as the major means of detecting tran-
scriptomic profiles and changes. The transcriptomic profile of a biological
sample (such as a cell, tissue, or organ) is determined by and reflects on its devel-
opmental stage, and internal and external functional conditions. By sequencing
all RNA species in the transcriptome, NGS provides answers to key questions
such as what genes are active and at what activity levels. Transcriptomic studies
are almost always comparative studies, contrasting one tissue/stage/condition
with another. Besides gene-level analysis, RNA-Seq can also be used to study
different transcripts derived from the same gene through alternative splicing.
As an integral part of the transcriptome, small RNAs can be similarly studied
by NGS. Compared to most DNA-based analyses, RNA-Seq data analysis has
its own uniqueness. Analysis of NGS data generated from large and small RNA
species is covered in Chapters 7 and 8, respectively.
4.5.2 Genetic Mutation and Variation Discovery

Detecting and cataloging genetic mutation or variation among individuals in
a population is a major application of NGS. Existing NGS studies have already
shown that severe diseases such as cancer and autism are associated with novel
somatic mutations. Projects such as the 1000 Genomes Project have revealed the
great amount of genetic variation in a population that accounts for individual dif-
ferences in physical traits, disease predisposition, and drug response. Chapter 9
focuses on data analysis techniques and how to identify mutations and various
types of variations, and test their associations with traits or diseases.
D e novo Genome Assembly

4.5.3
Sanger sequencing used to be regarded as the golden standard for de novo
genome assembly, but more and more genomes, including large com-
plex genomes, have been assembled with NGS reads alone. Technological
advancements in the NGS arena, including the stable increases of read length
in short-read technologies and the development of new NGS technologies
that produce very long sequence reads, has contributed to this trend. The
development of new algorithms for NGS-based genome assembly is another
force behind this progress. Chapter 10 focuses on how to use these algo-
rithms to assemble a new genome from NGS reads.
4.5.4 Protein-DNA Interaction Analysis (ChIP-Seq)

The normal functioning of a genome depends on its interaction with a mul-
titude of proteins. Transcription factors, for example, are among some of the
best-known DNA-interacting proteins. Many of these proteins interact with

DNA in a sequence- or region-specific manner. To determine which regions
of the genome these proteins bind to, the bound regions can be first cap-
tured by a process called chromatin immunoprecipitation (or ChIP) and then
sequenced by NGS. ChIP-Seq can be applied to study how certain conditions,
such as a developmental stage or disease, affect the binding of protein factors
to their affinity regions. ChIP-Seq data analysis is covered in Chapter 11.
4.5.5 Epigenomics and DNA Methylation Study (Methyl-Seq)

Chemical modifications of certain nucleotides and histones provide an
additional layer of genome modulation beyond the regulatory mechanism
embedded in the primary nucleotide sequence of the genome. These modi-
fications and the modulatory information they provide constitute the epi
genome. NGS-based epigenomics studies have revealed how monozygotic
twins display differences in certain phenotypes and how changes in the
epigenomic profile can lead to diseases such as cancer. Cytosine methylation
is a major form of epigenomic change. Chapter 12 covers analysis of DNA
methylation sequencing data.
4.5.6 Metagenomics
To study a community of microorganisms like the microbiome in the gut
or those in a bucket of seawater, where extremely large but unknown num-
bers of species are present, a brutal force approach that involves the study of
all genomes contained in such a community is metagenomics. Recently, the
field of metagenomics has been greatly fueled by the development of NGS
technologies. By quickly sequencing everything in a metagenome, research-
ers can get a comprehensive profile of the makeup and functional state of
a microbial community. Compared to NGS data generated from a single
genome, the metagenomics data is much more complicated. Chapter 13
focuses on metagenomics NGS data analysis.
5
Early-Stage Next-Generation Sequencing
(NGS) Data Analysis: Common Steps
In general, next-generation sequencing (NGS) data analysis is divided into

three stages. In the primary analysis stage, bases are called based on decon-
volution of the optical or physicochemical signals generated in the sequenc-
ing process. Regardless of sequencing platforms or applications, the base
call results are usually stored in the standard FASTQ format. Each FASTQ
file contains a massive number of reads, which are the sequence readouts of
DNA fragments sampled from a sequencing library. In the secondary analy-
sis stage, reads in the FASTQ files are quality checked, preprocessed, and
then mapped to a reference genome. The data quality check or control (QC)
step involves examining a number of sequence reads quality metrics. Based
on data QC results, the NGS sequencing files are preprocessed to filter out
low-quality reads, trim off portions of reads that have low-quality base calls,
and remove adapter sequences or other artificial sequences (such as poly-
merase chain reaction [PCR] primers) if they exist. Subsequent mapping (or
aligning) of the preprocessed reads to a reference genome aims to determine
where in the genome the reads come from, the critical information required
for most tertiary analysis (except de novo genome assembly). The stage of
tertiary analysis is highly application-specific and detailed in the chapters
of Section III. This chapter focuses on steps in the primary and secondary
stages, especially on reads QC, preprocessing, and mapping, which are com-
mon and shared among most applications (Figure 5.1).
5.1 Base Calling, FASTQ File Format, and Base Quality Score

The process of base calling in the primary stage from fluorescence images,
movies, or physicochemical measurements is carried out with platform-
specific, proprietary algorithms. For example, Illumina uses its propri-
etary algorithm called Bustard for base calling. The implementation of
these base callers may involve multiple steps, which eventually generate
for each sequencing cycle a base call and an accompanying confidence
score for the call. Most end users do not usually intervene in the base
calling process but rather focus on analysis of the base calling results.
73
Base calling
Data QC and
preprocessing
Reads mapping De novo

to a reference genome genome assembly
Transcriptomic analysis Protein−DNA interaction

Metagenomics analysis
(RNA-Seq) analysis (ChIP-Seq)
Epigenomics and DNA Mutation and variation

methylation analysis discovery (whole
(methyl-Seq) genome resequencing)
FIGURE 5.1
General overview of NGS data analysis. The steps in the dashed box are common steps con-
ducted in primary and secondary analysis.
Regardless of the sequencing platform, base calling results are usually

reported in the universally accepted FASTQ format. While there are other
NGS file formats such as FASTA, CFASTA, SFF, and QUAL, FASTQ has
become the de facto standard for reporting NGS reads data, and all the
other formats can be converted to FASTQ using conversion tools (such
as NGS QC Toolkit). In file size, a typical compressed FASTQ file is usu-
ally in the multigigabyte range and may contain 200 million or more
reads. In a nutshell, the FASTQ format is a text-based format, containing
the sequence of each read along with the confidence score of each base.
Figure 5.2 shows an example of one such read sequence reported in the
FASTQ format.
The confidence (or quality) score, as a measure of the probability of mak-
ing an erroneous base call, is an essential component of the FASTQ format.
The NGS base call quality score (Q-score) is similar to the Phred score used
in Sanger sequencing and is calculated as
Q = –10 × log10 PErr
where PErr is the probability of making a base call error. Based on this equa-
tion, a 1% chance of incorrectly calling a base is equivalent to a Q-score of
20, and Q30 means a 1/1000 chance of making a wrong call. Usually for a
base call to be reliable, it has to have a Q-score of at least 20. High-quality
calls have Q-scores above 30, usually up to 40. For better visualization of
@HISEQ:131:C5NWFACXX:1:1101:3848:2428 1:N:0:CGAGGCTGCTCTCTAT
CTTTTATCAGACATATTTCTTAGGTTTGAGGGGGAATGCTGGAGATTGTAATGGGTATGGAGACATATCATATAAGTAATGCTAGG
GTGAGTGGTAGGAAG
+
BB7FFFFB<F<FBFBBFBFBFFFIFFFFIIIFF<FBFFFBFIFFBFFFIFFFBFB07<BFFF7BBFFFBFFFFFF<BFBFBBBBBB
B'77B<770<BBBBB
FIGURE 5.2
The FASTQ sequence read report format. Shown here is one read generated from an NGS experiment. A FASTQ file usually contains millions of such
reads, with each containing several lines as shown here. Line 1, starting with the symbol “@,” contains sequence ID and descriptor. Line 2 is the read
sequence. Line 3 (optional) starts with the “+” symbol, which may be followed by the sequence ID and description. Line 4 lists confidence (or quality)
scores for each corresponding base in the read sequence (Line 2). For Illumina-generated FASTQ files, the sequence ID in line 1 in its current version
basically identifies where the sequence was generated. This information include the equipment (“HISEQ” in the example), sequence run ID (“131”),
flow cell ID (“C5NWFACXX”), flow cell lane (“1”), tile number within the lane (“1101”), x-y coordinates of the sequence cluster within the tile (“3848”
and “2848”, respectively). The ensuing descriptor contains information about the read number (“1” is for the single read here; for the paired-end
read it can be 1 or 2), whether the read is filtered (“N” here means it is not filtered), control number (“0”), and index (or sample barcode) sequence
(“CGAGGCTGCTCTCTAT”).
Early-Stage Next-Generation Sequencing (NGS) Data Analysis
75
ASCII Character: ! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 :

Quality Score: 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
; < = > ? @ A B C D E F G H I J
26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41
FIGURE 5.3
Encoding of base call quality scores with ASCII characters. ASCII stands for American
Standard Code for Information Interchange, and an ASCII code is the numerical representa-
tion of a character in computers (e.g., the ASCII code of the letter B is 66). In this encoding
scheme, the ASCII character codes are equal to Q-scores plus 33. Current major NGS platforms,
including Illumina (after version 1.8), use this encoding scheme for Q-score representation.
Q-scores associated with their corresponding base calls, they are usually
encoded with ASCII characters. Although there have been different encod-
ing scheme versions (e.g., Illumina 1.0, 1.3, and 1.5), the NGS field has mostly
settled on the use of the same encoding scheme used by Sanger sequencing
(Figure 5.3). In the FASTQ example shown in Figure 5.2, the first base, C, has
an encoded Q-score of B (i.e., 33).
To come up with the PErr, a control lane or spike control is usually used
to generate a base call score calibration table in Illumina sequencing for
lookup. A precomputed calibration table can also be used in the absence
of a control lane and spike control. Because each platform calibrates its
Q-scores differently, if they are to be compared with each other or ana-
lyzed in an integrated fashion, their Q-scores need to be recalibrated. To
carry out the recalibration, a subset of reads is used that map to regions
of the reference genome that contain no SNPs, and any mismatch between
the reads and the reference sequence is considered a sequencing error.
Based on the rate of mismatch at each base position of the reads, a new
calibration table is constructed, which is then used for recalibration. Even
without cross-platform NGS data comparison and integration, NGS data
generated on the same platform can still be recalibrated postmapping
(see Section 5.3) using the same approach, which often leads to improved
base call quality scores.
5.2 NGS Data Quality Control and Preprocessing

After NGS data generation, the first step should be a data quality check.
Although this step does not directly generate biological insights, it is none-
theless essential and should be carried out carefully. Doing so will avoid
production of nonsensical or even erroneous results in later steps and unnec-
essary consumption of computational resources and time. In this process,
the following metrics of data quality need to be examined:
Early-Stage Next-Generation Sequencing (NGS) Data Analysis 77
Q-scores—Q-scores can be examined in different ways. On a per-base

basis, this process can be conducted by examining quality scores
across all base positions of all reads, from the first sequenced base
to the last. As a general trend, for platforms based on sequencing-
by-synthesis, base positions covered at early phases of a sequencing
procedure tend to have higher Q-values than those sequenced later
in the procedure. The Q-scores for even the late-phase base posi-
tions, however, should still have a median value of at least 20. If there
is a significant Q-score drop in the late phase, the affected base posi-
tions need to be closely examined and low-quality bases should be
trimmed from affected reads. In addition, increased percentage of
N calls also helps determine loss of base call quality (an N is called
when the base-calling algorithm cannot call any of the four bases
with confidence). Another way of inspecting Q-scores is by plotting
the average Q-score of each read and examining their distribution
pattern. For a successful run, the majority of reads should have aver-
age Q-score of over 30, and only a very small percentage of reads
have an average Q-score below 20.
Percentage of each base across base positions—If reads are obtained
from a sequencing library constructed from randomly generated
DNA fragments, the chance of observing each of the four bases at
each base position should be constant. Therefore, when plotting
the percentages of each base across all base positions, the plots
for A, C, G, and T should be roughly parallel to each other, and
the overall percentage shown in each plot should reflect the over-
all frequency of each base in the target library. If the plots deviate
significantly from being parallel, this indicates problem(s) in the
library construction process, such as existence of overrepresented
sequences in the library (such as rRNA in an RNA-Seq library), or
nonrandom fragmentation.
Read length distribution—For platforms that produce reads of vary-
ing length (such as the Pacific Biosciences platform), the distribution
of read length should also be examined. In combination with the
distribution of Q-scores, this determines the total amount of useful
data a run generates. In addition, with data quality and total volume
being equal, a run that produces longer reads is more advantageous
in terms of sequence alignment or assembly than one with more
relatively short reads.
Besides examining reads quality and length distribution, other QC

metrics should also be examined, such as existence of artificial sequences
including adapters and PCR primers, or duplicated sequences based on
sequence identity (sequence duplication can also be checked based on ref-
erence genome mapping results). After inspecting sequence data quality,
filtering should be performed to remove low-quality reads. Furthermore,

low-quality base calls (e.g., bases at the 3′ end that have Q-scores below
20), as well as artificial sequence contaminants, should also be trimmed
off if they exist. While some platforms (e.g., Illumina) perform sequence
filtering by default prior to FASTQ file generation, if the distribution
of sequence Q-scores is found to be unsatisfactory after examination,
additional filtering/trimming may need to be performed. Execution of
these preprocessing tasks is a requirement for high-quality downstream
analysis.
The most often used NGS data QC software include FastQC [73], FASTX-
Toolkit [74], and NGS QC Toolkit [75]. These toolkits have functional mod-
ules to examine per-read and per-base Q-scores, base frequency distribution,
read length distribution, and existence of duplicated sequences and artificial
sequences. FastQC is written in Java and has a user-friendly interface on
most operating systems including Windows. Preprocessing tasks such as fil-
tering and trimming can be carried out by tools like ngsShoRT [76], sickle
[77], Trimmomatic [78], and those contained in FASTX-Toolkit and NGS QC
Toolkit.
5.3 Reads Mapping
After the data is cleaned up, the next step is to map, or align, the reads to a
reference genome if it is available, or conduct de novo assembly. As shown
in Figure 5.1, most NGS applications require reads mapping to a reference
genome prior to conducting further analysis. The purpose of this map-
ping process is to locate origins of the reads in the genome. Compared to
searching for the location(s) of a single or a small number of sequences in a
genome by tools such as BLAST, simultaneous mapping of millions of NGS
reads, sometimes very short, to a genome is not trivial. A further challenge
comes from the fact that any particular genome from which NGS reads are
derived deviates from the reference genome at many sites because of poly-
morphism and mutation. As a result any algorithm built for this task needs
to accommodate such sequence deviations. To further complicate the situ-
ation, sequencing errors are often indistinguishable from true sequence
deviations.
5.3.1 Mapping Approaches and Algorithms

The mapping of NGS reads to a reference genome is not a new task in
itself. As indicated earlier, before the advent of NGS, a number of sequence
alignment algorithms already existed, the best known of which is BLAST.
These aligners use hash tables and seed-and-extend methods to perform the
computationally intensive process of aligning an individual query sequence

against a sequence database (such as GenBank). To use these methods to
align the millions of NGS reads to a reference genome, however, creates a
scalability problem, as they simply cannot scale up to the data volume, and
scale down to the short length of many NGS reads (as a short read carries less
information). As a result, a new generation of algorithms has been devised
for the mapping of NGS reads, either through optimizing the previous meth-
ods or introducing new approaches.
Aligners based on the optimization of the previous hash table and seed-
and-extend methods include SOAP (Short Oligonucleotide Alignment Program)
[79], MAQ (Mapping and Assembly with Qualities) [80], ELAND (Efficient
Large-scale Alignment of Nucleotide Databases, Illumina’s proprietary
aligner), and Novoalign (Commercial). To boost searching speed, index-
ing of either reference genome sequence or read sequences in the computer
memory is used. Among these aligners, SOAP and Novoalign are based on
reference genome indexing, whereas MAQ and ELAND perform indexing
on NGS reads.
In the seed-and-extend approach used by BLAST, if a match is found
between short stretches of nucleotides (called words) in the query sequence
and the reference sequence, the matched area is used as a seed to extend
the alignment to nearby regions. The seed used by BLAST is a consecutive
sequence, which is designed to locate near-exact matches but is not sensitive
to sequence variations especially indels. To increase alignment sensitivity,
NGS reads aligners have migrated from the use of consecutive exact-match
seeds to nonconsecutive (or spaced) seeds (Figure 5.4a). By allowing space
between seeds, the chance of finding a match is increased. In SOAP and
Novoalign, to perform alignment using spaced seeds, the reference genome
sequence is first cut into equal-sized small fragments and saved in a big
hash table in memory. The NGS reads are then cut in a similar fashion into
subsequences, which are searched against the reference genome. In MAQ
and ELAND, the hash table is created from NGS reads, and subsequences
extracted from the reference genome are used to look up matches in the
reads. Computationally these aligners are memory and processor intensive
and therefore not very fast.
To further increase speed and reduce demands on computational resources,
a novel approach is developed on the basis of Burrows-Wheeler transform
(or BWT) [81] and suffix trees (or arrays) (Figure 5.4b). BWT achieves better
reference genome sequence compression to enable more efficient indexing
and faster searching. For example, the human genome indexed with BWT
only takes 2 to 3 GB of computer memory, whereas the spaced-seed indexing
approach can take over 50 GB memory. This newer approach is employed by
algorithms such as BWA (Burrows-Wheeler Alignment) [82], Bowtie/Bowtie
2 [83], and SOAP2 [84]. Through the use of BWT and suffix trees (or arrays),
the run time needed for aligning million of reads to a large and complex
genome, like the human genome, is cut from hours to minutes.
(a) Spaced seeds (b) Burrows-Wheeler

Reference genome Short read Reference genome Short read
(>3 gigabases) (>3 gigabases)
Chr1 ACTCCCGTACTCTAAT Chr1 ACTCCCGTACTCTAAT
Chr2 Chr2
Chr3 Chr3
Chr4 Chr4
Concatenate into
Extract seeds single string
Position N
Burrows-Wheeler
Position 2 transform and indexing
CTGC CGTAAACTAATG
Bowtie index
Position 1
(~2 gigabytes)
ACTG CCGTAAACTAAT ACTC CCGT ACTC TAAT ACTCCCGTACTCTAAT
ACTG * * * * AAAC * * * * 1 T
* * * * CCGT * * * * TAAT Six seed 2 Look up AT
ACTG * * * * * * * * TAAT pairs per 3 “suffixes” AAT
* * * * * * * * AAAC TAAT read/ 4 of read
ACTG CCGT * * * * * * * * fragment 5
* * * * CCGTAAAC * * * * 6
ACTCCCGTACTCTAAT
Index seed pairs Hits identify
positions in
Seed index genome where
(tens of gigabytes) Look up each pair read is found
of seeds in index
ACTG * * * * AAAC * * * *
Hits identify positions
in genome where
spaced seed pair
is found
* * * * CCGT * * * * TAAT
ACTG * * * * * * * * TAAT Confirm hits Convert each
* * * * CCGTAAAC * * * * by checking hit back to
“****” positions genome location
Report alignment to user
FIGURE 5.4
Two NGS reads mapping approaches. (a) The approach based on spaced seed indexing. In this
illustration, spaced seeds extracted from the reference genome sequence are indexed. Some
mapping algorithms like MAQ and ELAN index reads (usually in batches) instead. (b) A newer
approach developed on the basis of the Burrows-Wheeler transform. In this example, the algo-
rithm Bowtie performs mapping by looking up reads base by base, from right to left, against
the transformed and indexed genome. (Modified from C Trapnell, SL Salzberg, How to map
billions of short reads onto genomes, Nature Biotechnology 2009, 27:455–457. With permission.)
5.3.2 Selection of Mapping Algorithms

and Reference Genome Sequences
When selecting aligners, factors including speed and sensitivity need to be
considered. As these factors are usually conflicting, some aligners put more
emphasis on speed while others stress sensitivity. If speed is a more impor-
tant factor, Bowtie or SOAP2 is recommended. BWA strikes a balance between
speed and sensitivity. If higher sensitivity is preferred, hash-table-based tools
such as Novoalign, Stampy [85], and SHRiMP2 [86] are often used. Most of
these aligners were initially developed to map very short reads, such as those
of 35 nucleotides from early Illumina sequencers. With the gradual increase in
read length, these aligners have been adapted accordingly; for instance, BWA-
MEM is a recent adaptation of the original BWA algorithm for aligning longer
reads [87].
For aligning much longer reads such as those from the Pacific Biosciences
SMRT platform, aligners designed to handle long sequences, such as BLASR
[88], LAST [89], LASTZ [90], or BWA-MEM, should be used. Among these
long reads aligners, LAST, which uses adaptive seeds instead of fixed-
length seeds and suffix array indexing to achieve speed and sensitivity, and
LASTZ, which uses the more traditional seed-and-extend approach like
BLAST, are whole genome alignment tools originally designed for genome-
scale comparisons and therefore can conduct pairwise alignment on very
long sequences. BLASR is designed for aligning long reads generated from a
single DNA molecule like those from the SMRT system. It conducts mapping
of such reads through combining short read mapping data structures and
alignment methods used by whole genome alignment tools.
Besides mapping algorithms, selection of reference genome sequences,
when multiple reference genome sequences are available, also affects map-
ping result. By the design of most current mappers, reads that are more
similar to the selected reference sequence align better than those that devi-
ate more from the reference. If the deviation is sufficiently large, it might be
discarded as a mismatch. As a result, the use of different reference genome
sequences can introduce a “reference bias.” The use of any one particular ref-
erence genome invariably introduces this bias, as a single reference genome
simply cannot accommodate sequence variations and polymorphisms that
are naturally present in a population or species. This bias should be kept in
mind though, especially when the genetic background of the source organ-
ism is different from the reference genome. In this situation, comparison of
mapping results from the use of different references can help select a ref-
erence that is more appropriate. Alternatively, some more recent mapping
algorithms, such as GenomeMapper [91], have the capability of using mul-
tiple genome references simultaneously as a reference.
5.3.3 SAM/BAM as the Standard Mapping File Format

Mapping results generated from the various algorithms are usually stored
in the SAM or BAM file format. SAM, standing for Sequence Alignment/
Map, has a tab-delimited text format. It is human readable and easy to exam-
ine but relatively slow to parse. BAM, being the compressed binary ver-
sion of SAM, is smaller in size and faster to parse. Due to their widespread
use, SAM/BAM have become the de facto standard for storing reads mapping
results. The basic structure of a SAM/BAM file is straightforward, contain-
ing a header section (optional) and an alignment section. The header section,
TABLE 5.1
Mandatory Fields in the SAM/BAM Alignment Section
Col Field Type Description
1 QNAME String Query sequence read (or template) NAME
2 FLAG Integer Bitwise FLAG
3 RNAME String Reference sequence NAME
4 POS Integer Leftmost mapping POSition on the reference sequence
5 MAPQ Integer MAPping Quality
6 CIGAR String CIGAR string
7 RNEXT String Reference name of the NEXT read (For paired-end reads)
8 PNEXT Integer Position of the NEXT read (For paired-end reads)
9 TLEN Integer Observed Template LENgth
10 SEQ String Segment SEQuence
11 QUAL String ASCII of Phred-scaled base QUALity+33
if it exists, provides generic information about the SAM/BAM file and is
placed above the alignment section. Each line in the header section starts
with the symbol “@.” For the alignment section there are 11 mandatory fields
(listed in Table 5.1). An example of the SAM/BAM format is presented in
Figure 5.5.
In the example shown in Figure 5.5, the header section contains two
lines. The first line has the two-letter record type code HD, signifying it
as the header line, which is always the first line if present. This record
has two tags: VN, for format version, and SO, for sorting order (in this
case the alignments are sorted by coordinate). The second line is for SQ,
which is the reference sequence dictionary. It also has two tags SN and
LN, for reference sequence name and reference sequence length, respec-
tively. For the alignment section, while most of the fields listed on Table
5.1 are self-explanatory, some fields may not be so clear at first glance. The
FLAG field uses a simple decimal number to track the status of 11 flags
used in the mapping process, such as whether there are multiple segments
in the sequencing (like r001 in the example) or if the SEQ is reverse comple-
mented. To check on the status and meaning of these flags, the decimal
number needs to be converted to its binary counterpart. For the POS field,
SAM uses a 1-based coordinate system, that is, the first base of the refer-
ence sequence is counted as 1 (instead of 0). The MAPQ is the mapping
quality score, which is calculated similarly to the Q-score introduced ear-
lier (MAPQ = –10 × log10(PMapErr)). The CIGAR field describes in detail how
the SEQ maps to the reference sequence, with the marking of additional
bases in the SEQ that are not present in the reference, or missing reference
bases in the SEQ. In the earlier example, the CIGAR field for r001/1 shows a
value of “8M2I4M1D3M,” which means the first 8 bases matching the refer-
ence, the next 2 bases being insertions, the next 4 matching the reference,
Coor 12345678901234 5678901234567890123456789012345

Ref TACGATCGAAGGTA**ATGACATGCTGGCATGACCGATACCGCGACA
+r001/1 CGAAGGTACTATGA*ATG
+r002 cggAAGGTA*TATGA
+r003 TGACAT..............TACCG
-r001/2 ACCGCGACA
(a)
@HD VN:1.5 SO:coordinate

@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 CGAAGGTACTATGAATG *
r002 0 ref 9 30 3S6M1P1I4M * 0 0 CGGAAGGTATATGA *
r003 0 ref 16 30 6M14N5M * 0 0 TGACATTACCG *
r001 147 ref 37 30 9M = 7 -39 ACCGCGACA * NM:i:1
(b)
FIGURE 5.5
The SAM/BAM format for storing NGS reads alignment results. The alignment shown in
panel (a) is captured by the SAM format shown in panel (b). In panel (a), the reference sequence
is shown on the top with the corresponding coordinates. Among the sequences derived from
it, r001/1 and r001/2 are paired reads. The bases in lowercase in r002 do not match the refer-
ence and as a result are clipped in the alignment process. The read r003 represents a spliced
alignment. In panel b, the SAM format contains 11 mandatory fields that are explained in more
detail in Table 5.1.
the next 1 being a deletion, and the last 3 again being matches. For more
details (such as those on the different FLAG status) and full specification of
the SAM/BAM format, please refer to the documentation from the SAM/
BAM Format Specification Working Group.
5.3.4 Mapping File Examination and Operation

After carrying out the mapping process, the mapping results reported
in SAM/BAM files should be closely examined. First, summary statis-
tics, such as the percentage of aligned reads, especially uniquely mapped
reads, should be generated. Currently, the mapping rates are still far from
100%. Even under ideal conditions, most aligners find unique genomic
position matches for 70%–75% of sequence reads. This inability to locate
the genomic origin of a significant number of reads can be attributed to
multiple factors, including the existence of repetitive sequences in most
genomes, the relatively short length and therefore limited position-
ing information of most NGS reads, algorithmic limitation, sequencing
error, and DNA sequence variation and polymorphism in a population.
The mapping performance is expected to improve with increasing read
length from newer NGS technologies and better-designed algorithms
from active developments in this area.
Second, reads that map to multiple genomic locations, often called multi
reads, usually do not contribute to subsequent analysis and therefore are
filtered out. The ambiguity in the mapping of multireads is due to the
aforementioned sequence deviation caused by polymorphism and muta-
tion, sequencing error, and the existence of highly similar sequences in
the genome such as those from duplicated genes. Inclusion of these reads
in downstream analysis may lead to biased or erroneous results. For most
experiments, these reads should be excluded from further analysis. As fil-
tering of multireads usually removes a significant number of reads, which
may lead to potential loss of information, there are some algorithms (such
as BM-Map [92]) that are designed to reuse multireads by probabilistically
allocating them to competing genomic loci.
Third, besides multireads, duplicate reads should also be identified and
filtered out for many experiments. In a diverse nonenriched sequenc-
ing library, because of the randomness of the fragmentation process, the
chance of getting identical fragments is extremely low. Even with a PCR
step to enrich DNA fragments, the chance of generating duplicate reads is
still very low (usually <5%), as the number of cycles in the PCR process is
limited and the subsequent sequencing process is a random sampling of
the DNA library (to varying depth). The existence of excessive numbers of
duplicate reads, therefore, suggests PCR overamplification. Duplicate reads
can be detected based on sequence identity, but due to sequencing errors
this tend to underestimate the amount of duplicate reads. It is more appro-
priate, therefore, to detect duplicate reads after the mapping step (Figure
5.6). Because technical duplicates caused by PCR overamplification and
true biological duplicates are indistinguishable, researchers should exert
caution when making decisions on whether to remove duplicate reads from
further analysis. Although removing duplicate reads can lead to increased
performance in subsequent analysis in many cases (such as variant dis-
covery), in circumstances that involve less complex or mostly enriched
sequencing targets, including those from an extremely small genome or
those used in RNA-Seq or ChIP-Seq, removing them can lead to loss of true
biological information.
Furthermore, a variety of other steps can also be conducted to operate SAM/
BAM files. These steps are usually provided by SAMtools and Picard, two
widely used packages for operating SAM/BAM files. These operations include
• SAM and BAM interconversion; SAMtools can also convert other

alignment file formats to SAM/BAM
• Merging of multiple BAM files into a single BAM file
• Indexing of SAM/BAM files for fast random access
• Sorting reads alignment using various criteria, for example, genomic
coordinates, lanes, libraries, or samples
FIGURE 5.6
Detection of duplicate reads after the mapping process. Depth of coverage of the reference
genomic region is shown on the top. Mapped reads, along with a set of duplicate reads that map
to the same area, are shown underneath. The light and dark gray colors denote the two DNA
strands. (Generated with CLC Genomics Workbench and used with permission from CLC bio.)
• Additional reads alignment filtering, such as removing paired reads

that only one of the pair can map to the reference genome
• Generation of a pileup format file (Figure 5.7) to show matching (or
mismatching) bases from different reads at each genomic coordinate
(SAMtools)
• Simple visualization using a text-based viewer for close examination
of read alignment in a small genomic region (SAMtools)
SAMtools and Picard are very versatile in handling and analyzing SAM/
BAM files. In fact, the steps mentioned earlier, that is, generation of align-
ment summary statistics and removal of multireads and duplicate reads,
can be directly conducted with these tools. For example, both SAMtools and
Picard have utilities to detect and remove duplicate reads called rmdup and
markduplicates, respectively. These utilities mark reads that are mapped to
the same starting genomic locations as duplicates.
Last, in terms of examining mapping results, nothing can replace direct
visualization of the mapped reads in the context of the reference genome.
While a text-based alignment viewer, such as that provided by SAMtools,
offers a simple way to examine a small genomic region, direct graphical
ref 181 A 24 ,.$.....,,.,.,...,,,.,..^+. <<<+;<<<<<<<<<<<=<;<;7<&

ref 182 C 23 ,.....,,.,.,...,,,.,..A <<<;<<<<<<<<<3<=<<<;<<+
ref 183 A 23 ,.$....,,.,.,...,,,.,... 7<7;<;<<<<<<<<<=<;<;<<6
ref 184 G 23 ,$....,,.,.,...,,,.,...^l. <+;9*<<<<<<<<<=<<:;<<<<
ref 185 G 22 ...T,,.,.,...,,,.,.... 33;+<<7=7<<7<&<<1;<<6<
ref 186 C 22 ....,,.,.,.A.,,,.,..G. +7<;<<<<<<<&<=<<:;<<&<
ref 187 G 23 ....,,.,.,...,,,.,....^k. %38*<<;<7<<7<=<<<;<<<<<
ref 188 A 23 C..T,,.,.,...,,,.,..... ;75&<<<<<<<<<=<<<9<<:<<
FIGURE 5.7
The pileup file format as generated from SAMtools. A pileup file shows how sequenced bases
in mapped reads align with the reference sequence at each genomic coordinate. The columns
are (from left to right) chromosome (or reference name), genomic coordinate (1-based), refer-
ence base, total number of reads mapped to the base position, read bases, and their call quali-
ties. In the read bases column, a dot signifies a match to the reference base, a comma to the
complementary strand, and “AGCT” are mismatches. Additionally, the “$” symbol marks the
end of a read, while “^” marks the start of a read, and the character after the “^” represents
mapping quality.
visualization of mapping results by overlaying mapped read sequences against

the reference genome provides a more intuitive way of examining the data
and looking for patterns. This visualization process serves multiple purposes,
including additional data QC, experimental procedure validation, and map-
ping pattern recognition. Commonly used visualization tools include the
Integrative Genomics Viewer (IGV) [93], EagleView [94], and Tablet [95]. The
UCSC and Ensembl genome browsers also provide visualization options by
adding customized BAM tracks.
5.4 Tertiary Analysis
After the sequence reads mapping step, subsequent analyses vary greatly
with application. For example, the workflow for RNA-Seq data analysis is
different from that for mutation and variant discovery. Therefore, it is not
possible to provide a “typical” workflow for all NGS data analyses in this
chapter beyond the common steps of data QC, preprocessing, and reads
mapping. Chapters in Section III provide details on application-specific ter-
tiary analytic steps and commonly used tools.
6
Computing Needs for Next-Generation
Sequencing (NGS) Data Management
and Analysis
The gap between our ability to pump out next-generation sequencing (NGS)
data and our capability to extract knowledge from these data is getting
broader. To manage and process the torrent of NGS data for deep understand-
ing of biological systems, significant investment in computational infrastruc-
ture and analytical power is needed. How to gauge computing needs and
build a system to meet the needs, however, poses serious challenges to small
research groups and even large research organizations. To meet this unprec-
edented challenge, the NGS field can borrow solutions from other “big data”
fields such as high-energy particle physics, climatology, and social media. For
biologists without much training in bioinformatics, while getting expert help
is needed, having a good understanding of the various aspects of NGS data
management and analysis will be beneficial for years to come.
6.1 NGS Data Storage, Transfer, and Sharing

NGS has itself become a major producer of big data in scientific research.
With the continuous drop in sequencing cost, the speed at which NGS data is
pumped out will only pick up. This translates into a concomitant increase in
the demand for more data storage, access, and processing power. Compared
to files generated from other biological assays, such as gel pictures or even
microarray data files, NGS files are much larger. For an individual lab, a sin-
gle typical run generates data at the level of tens or hundreds of gigabytes
(GB) in compressed FASTQ format. After aligning to a reference genome,
the processed files increase in size appreciably. Further analysis leads to the
generation of more and more files and propagation in data volume. On aver-
age, analysis of the FASTQ files generates working data files at the level of
500 GB each month by current estimation. To accommodate raw and pro-
cessed files from multiple runs, tens of terabytes (TB) of storage space is
required. Storing and archiving these files are no trivial task. To make the
situation even worse, the raw sequencing signal intensity files in formats
87
such as scanned images or movies are in the scale of terabytes from a single
run (this amount is not counted in the data volume mentioned earlier). As
these raw signal files accumulate, they can easily overwhelm most data stor-
age systems. While these raw images files can be retained long term, newer
sequencing systems process them on-the-fly and delete them by default once
they have been analyzed to alleviate the burden of storing them. Oftentimes
it is easier and more economical to rerun the samples in case of data loss
rather than archiving these huge raw signal files.
Due to the huge size of most NGS files, transferring them from one place
to another is nontrivial. For a small-sized project to transfer sequencing
files from a production server to a local storage space, download via FTP
or HTTP might be adequate if a fast network connection is available. As for
network speed, a 1 Gbps network is essential, while a 10 Gbps network offers
improved performance for high-traffic conditions. When the network speed
is slow or the amount of data to be transferred is too large, the use of an
external hard drive might be the only option. When the data reaches the lab,
for fast local file reading, writing, and processing, they need to be stored in a
hard drive array inside a dedicated workstation or server.
For a production environment, such as an NGS core facility or a large
genome center, that generates NGS data for a large number of projects,
enterprise- level data storage system, such as Directly Attached Storage
(DAS), Storage Area Network (SAN), or Network Attached Storage (NAS), is
required to provide centralized data repositories with high reliability, access
speed, and security. To avoid accidental data loss, these data storage sys-
tems are usually backed up, mirrored, or synced to data servers distributed
at separate locations. For large-scale collaborative projects that involve mul-
tiple sites and petabytes to exabytes of data, the processes of data transfer
and sharing pose more challenges, which prompt the development of high-
capacity and high-performance platforms such as Globus.
Data sharing among collaborating groups creates additional technical issues
beyond those dealt with by individual labs. A centralized data repository
might be preferred over simple data replication at multiple sites to foster
effective collaboration and timely discussion. Associated with data shar-
ing also comes the issues of data access control, and privacy for data gen-
erated from patient-oriented studies. In a broader sense, NGS data sharing
with the entire life science community also increases the value of a research
project. For this reason, many journals enforce a data sharing policy that
requires deposition before publication of sequence read data and pro-
cessed data into a publicly accessible database (such as the National Center
for Biotechnology Information’s [NCBI] Sequence Read Archive [SRA] or
the European Nucleotide Archive [ENA]). To facilitate data interpretation
and potential meta-analysis, relevant information about such an experi-
ment must also be deposited with the data. Some organizations, such as
the Functional Genomics Data Society, have developed guidelines on what
information should be deposited with the data. For example, the Minimum
Computing Needs for NGS Data Management and Analysis 89
Information about a high-throughput Nucleotide SEQuencing Experiment

(MINSEQE) guidelines specify the following information be provided with
sequence read data and processed data: (1) description of the biological sys-
tem, samples, and experimental variables; (2) experimental summary and
sample-data relationships; and (3) essential experimental and data pro-
cessing protocols. Archiving NGS data and associated information for the
community is a huge undertaking and requires sizeable investment in main-
taining and growing the requisite infrastructure and expert support. The
NCBI SRA repository was shut down in 2011 due to high costs and govern-
ment budgetary constraints. However, because its vital importance to the
community, the National Institutes of Health (NIH) resumed its support to
SRA later that year.
6.2 Computing Power Required for NGS Data Analysis

Processing the large volume of NGS data requires a lot of computing power.
The question of how much computing power is needed is dependent on the
type of analysis to be performed. For example, de novo assembly of a large
genome requires much more computing power than resequencing for variant
discovery, or transcriptomic analysis for the identification of differentially
expressed genes. Therefore, to determine the computing power needed for
a project, a lab, or an organization, the type(s) of NGS work to be performed
need to be analyzed first. If the work will require intensive computation,
or involve development and optimization of new algorithms and software
tools, a high-performance cluster may be needed. On the other hand, if the
work will use established workflow that does not require highly intensive
computation, a powerful workstation may suffice. It is also advisable that the
computer system to be built be scalable to accommodate increases in future
computing needs due to unforeseeable change of future research projects or
further development of high-throughput genomics technologies.
For a small-sized project, the most basic system needed for NGS data anal-
ysis can be simply a 64-bit computer with 8 GB of RAM and two 2 GHz
quad-core processors. With such a computer, basic mapping to a reference
genome can be performed on obtained sequence reads. This basic setup
allows handling of one data set at a time. For simultaneous processing of
multiple data sets or projects, high-performance computing (HPC) systems
with more memory and CPU cores are needed. The number of cores that an
HPC system needs is based on the number of simultaneous tasks to be run
at one time. For each task, the number of cores that is needed depends on the
nature of the task and the algorithm that carries it out.
Besides the number of CPU cores, the amount of memory a system has
also heavily affects its performance. Again memory needs depend on the
number and complexity of jobs to be processed, for example, reads map-

ping to a small genome may need only a few gigabytes of memory, whereas
de novo assembly of a large genome may require hundreds of gigabytes or even
terabyte-level memory. The current estimation is that for each CPU core the
amount of memory needed should not be less than 3 GB. In an earlier imple-
mentation of de novo assembly of the human genome using the SOAPdenovo
pipeline (to be detailed in Chapter 10), a standard supercomputer with
32 cores (eight AMD quad-core 2.3 GHz CPUs) and 512 GB memory was
used [96]. As a more recent example of the computing power needed for de
novo genome assembly, a server with 64 cores (eight Intel Xeon X6550 8-core
2.00 GHz CPUs) and 2 TB RAM is used by a Swedish team [97]. For de novo
assembly of small genomes such as those of microbes, a machine that con-
tains at least 8 CPU cores, 256 GB of RAM, and a fast data storage system can
get a job completed in a reasonable time frame. By current estimation, an
8-core workstation with 32 GB RAM and 10 TB storage can work for many
projects that do not conduct de novo genome assembly.
The amount of time needed to complete a job varies greatly with the com-
plexity of the job and accessible computing power. As a more concrete exam-
ple, on a computer with 32 cores and 128 GB RAM, it took <2 hours to map
an RNA-Seq data set of 80 million 75 bp reads to the human genome using
Bowtie, and less time in subsequent steps including normalization and dif-
ferential expression statistical tests [98]. In a small RNA NGS study, with a
32-core and 132 GB memory workstation, processing 20 multiplex barcoded
samples with a total of 160 million reads took a little over 2 hours for sample
demultiplexing, and about the same amount of time for read mapping to the
host genome and small RNA annotation databases [99].
6.3 Software Needs for NGS Data Analysis

After a workstation or server is put together from requisite hardware, the
operating system and software need to be installed. While some NGS analy-
sis software (such as CLC Genomics Workbench) can operate in the Windows
environment, most tools only operate in the Unix (or Linux) environment.
Therefore, Unix or Linux is usually the operating system installed on such
a machine. Installing software in Unix or Linux is not as straightforward as
in Windows, as uncompiled software source code downloaded from a devel-
oper site needs to be compiled first before being installed to a particular dis-
tribution of the operating system. If the reader is not familiar with the Unix/
Linux environment and the command line interface it uses, an introductory
book or web-based tutorial is suggested.
One approach to reducing the barrier of using tools developed for the Unix/
Linux environment is to access them through a “bridging” system, such as
Galaxy [100], that provides a more user-friendly interface to the command

line tools. Developed by the Nekrutenko lab at Penn State and the Taylor
lab at Johns Hopkins University, the Galaxy system provides a mechanism
to deploy these tools via the familiar web browser interface, making them
accessible to users regardless of the operating systems they use. The Galaxy
system is highly extensible, with the latest tools being constantly wrapped
for execution through the web interface. Besides providing a user-friendly
interface, such a system also allows creation of data analysis workflow from
different tools, which enables fast deployment of multiple tools in tandem,
achievement of consistency and reproducibility, and sharing of analytical
procedures with other researchers. Galaxy can be accessed through a pub-
licly available server (e.g., usegalaxy.org), installed on a local instance or in
the cloud. With a public server, the user does not need to maintain a local
server, but the usable storage space assigned to each account is usually lim-
ited and the computing resource is shared with many other users. Creating
a local Galaxy instance in Unix/Linux or Mac OS takes some effort and the
user does need to provide maintenance, but the user has more control on
storage space, computing power, and selection and installation of tools from
the entire collection of genomics tools that are made available through the
Galaxy Tool Shed. The Galaxy team has made it very easy to install a local
instance by offering detailed and easy-to-follow instructions. An instance of
Galaxy on the cloud, instantiated via CloudMan [101] on the Amazon Elastic
Compute Cloud (EC2), behaves like a local setup but with the flexibility of
configuring on a needed basis (see more on cloud computing in Chapter 14).
There are also other community projects that provide alternative plat-
forms to facilitate user access to various NGS and other genomics analysis
tools. Bioconductor, an open-source and open-development software project,
is among the best known of these projects. This large-scale project is based
on R, a programming language and software environment designed for
statistical computing and graphics. With the goal of providing tools for the
analysis and comprehension of high-throughput genomics data, the recent
release (version 3.1) of the Bioconductor software library contains more than
one thousand software packages, many of which are designed or can be
used to process NGS data. The R environment and the Bioconductor library
can be installed in all major operating systems including Windows. The
Bioconductor project web portal (www.bioconductor.org) and the R project
site (www.r-project.org) provide detailed information and tutorials for the
installation and use of these packages. Each tool is well documented with
actual use examples provided.
Identifying, installing, and maintaining suitable NGS analysis software
from an ever-growing number of tools for a local Unix/Linux workstation, a
local Galaxy instance, or a local Bioconductor R library are not trivial. New
software tools are constantly being developed and introduced, while many
existing ones are updated from time to time. To evaluate candidate packages
and identify appropriate tools for installation, it is better to use multiple test
datasets, not just using those from computer simulation but also those from
real-world biological samples. In addition, almost all tools have adjustable
parameters, which should be set equivalently to facilitate performance com-
parison. Also in terms of performance, earlier NGS software usually does
not take advantage of high-performance parallel computing (more details on
parallel computer Chapter 14). To increase performance and take full advan-
tage of the multiple cores or nodes in an HPC system, more recent algorithms
tend to use threading or a message passing interface (MPI) to spread the
work across multiple processes. Therefore, when evaluating NGS tools, it
also helps to examine if these types of parallel processing are employed to
take advantage of the power of multicore computing architecture.
6.4 Bioinformatics Skills Required for NGS Data Analysis

For biologists and students in life sciences, acquiring basic bioinformatics
skills is greatly advantageous, as biology has become more data rich and
data driven. Understanding the basics of bioinformatics also facilitates com-
munication with bioinformaticians on the conduct of more advanced tasks.
In general, these skills include use of common computing environments,
bioinformatic algorithms, and software packages. Following is a short list of
bioinformatics skills required of biologists for NGS data handling.
• Familiarity with Unix/Linux, and the most commonly used com-

mands in the Unix/Linux computing environment. This is essential
to operate a local Unix/Linux-based machine or log into a remote
server to initiate and monitor jobs, as most genomics servers are
Unix/Linux based.
• Basic knowledge of programming languages that are commonly
used for NGS data analysis. These languages include R and Perl,
both of which are open source, easy to learn, and have a large user
base for help and support. While programming is not required of
biologists, understanding how an algorithm is executed step-by-step
can be helpful, especially when a preexisting tool does not work ide-
ally for a special case and needs modification.
• Knowledge of key concepts in computational biology and biostatis-
tics. Some computational methodologies developed in the field of
computer science, especially machine learning and data mining,
have been widely applied to high-throughput biological data pro-
cessing. Artificial neural networks (ANNs), hidden Markov mod-
els (HMMs), and support vector machines (SVMs) serve as good
examples in this domain. Statistical approaches such as linear and
nonlinear regression are integrated into many genomics data analy-

sis tools and should also be integrated into our knowledge base.
• Basic understanding of a relational database. Most of the informa-
tion currently available for the annotation and interpretation of
NGS data is captured in various databases. Knowledge of database
design and structure is the basis to extract, manipulate, and pro-
cess the information stored in these databases for generation of new
biological knowledge. Knowing how to interact with the databases
via Standard Query Language (SQL) or Application Programmer
Interfaces (APIs) is also beneficial. This knowledge on relational
databases and their operation also determines our ability to curate,
organize, and disseminate the tremendous amount of information
generated from NGS projects.
• Basic understanding and handling of computer hardware such
as CPU, RAM, and storage. Although strictly speaking computer
hardware is not in the realm of bioinformatics, it is nevertheless
advantageous and economical to know how to put together a data
server and have it up and running. It is also beneficial to understand
how an HPC cluster, or a heterogeneous computing system, works
through parallel processing, as NGS tools that are designed to take
advantage of these computing systems usually function better and
this knowledge can help evaluate and select those that maximize
performance built in a server system.
For bioinformaticians who deal with NGS data, on the other hand, the fol-
lowing skills and knowledge are expected:
• Proficiency with Unix-based operating systems

• Familiarity with a programming language such as Python, Perl,
Java, or Ruby
• Familiarity with statistical software such as R, MATLAB, or
Mathematica
• Understanding of supercomputing, HPC (including parallel com-
puting), and network-based storage
• Knowledge of database management languages such as MySQL or
Oracle
• Familiarity with web authoring and web-based user interface imple-
mentation technologies
• Understanding of molecular biology, cell biology, and biochemistry
Section III
Application-Specific
NGS Data Analysis
7
Transcriptomics by RNA-Seq
7.1 Principle of RNA-Seq
Transcriptomic analysis deals with the questions of which parts of the
genome are transcribed and how actively they are transcribed. In the past,
these questions were mostly answered with microarray, which is based on
hybridization of RNA samples to DNA probes that are specific to individual
gene-coding regions. With this hybridization-based approach, the repertoire
of hybridization probes, which are designed based on the current annotation
of the genome, determines what genes in the genome or which parts of the
genome are analyzed, and genomic regions that have no probe coverage are
invisible. A next-generation sequencing (NGS)-based approach, on the other
hand, does not depend on the current annotation of the genome. Because
it relies on sequencing of the entire RNA population, hence the term RNA-
Seq, this approach makes no assumption as to which parts of the genome
are transcribed. After sequencing, the generated reads are mapped to the
reference genome in order to search for their origin in the genome. The total
number of reads mapped to a particular genomic region represents the level
of transcriptional activity at the region. The more transcriptionally active a
genomic region is, the more copies of RNA transcripts it produces, and the
more reads it will generate. RNA-Seq data analysis is essentially based on
counting reads generated from different regions of the genome.
By counting the number of reads from transcripts and therefore being
digital in nature, RNA-Seq does not suffer from the problem of signal satu-
ration that is observed with microarrays at very high values. RNA-Seq also
offers a native capability to differentiate alternative splicing variants, which
is basically achieved by detecting reads that fall on different splice junctions.
Whereas some specially designed microarrays, like the Affymetrix Exon
Arrays, can be used to analyze alternative splicing events, standard micro
arrays usually cannot make distinctions between different splicing isoforms.
Also different from microarray signals, which are continuous, raw RNA-Seq
signals (i.e., read counts) are discrete. Because of this difference, distribution
model and methods of differential expression analysis designed for micro
array data cannot be directly applied to RNA-Seq data without modification.
97
7.2 Experimental Design
7.2.1 Factorial Design
Before carrying out an RNA-Seq experiment, the biological question to be
answered must be clear and well defined. This will guide experimental
design and subsequent experimental workflow from sample preparation
to data analysis. For experimental design, factorial design is usually used.
Many experiments compare the transcriptomic profile of two conditions,
for example, cancer versus normal cells. This is a straightforward design,
involving only one biological factor (i.e., cell type). Experiments involving a
single factor may also have more than two conditions, for example, compari-
son of samples collected from multiple tissues in the body in order to detect
tissue-specific gene expression.
If a second biological factor (e.g., treatment of a drug) is added to the exam-
ple of cancer versus normal cell comparison, the experiment will have a total
of four (2 × 2) groups of samples (Table 7.1). In this two-factor design, besides
detecting the effects of each individual factor—cell type and drug treatment—
the interacting effects between the two factors are also detected, for example,
drug treatment may have a larger effect on cancer cells than normal cells. If
the factors contain more conditions, there will be a total of m × n groups of
samples, with m and n representing the total number of conditions for each
factor. Experiments involving more than two factors, such as adding a time
factor to the aforementioned example to detect time-dependent drug effects
on the two cell types, are inherently more complex and therefore more chal-
lenging to interpret, because in this circumstance it is not easy to attribute
a particular gene expression change to a certain factor, or especially, to the
interaction of these factors due to the existence of multiple interactions (three
factors involve four different types of interactions).
7.2.2 Replication and Randomization

As with any experiment that requires proper statistical analysis, replication
and randomization is an essential component of RNA-Seq experimental
design. Randomization refers to the random assignment of experimental
subjects or targets into each group. This is to avoid introducing unwanted
biases to the sample collection process. To generalize the gene expression
TABLE 7.1
Experimental Design Involving Two Biological Factors
Cancer Cells Normal Cells
Drug treated Cancer + Drug Normal + Drug
Vehicle treated Cancer + Vehicle Normal + Vehicle
Transcriptomics by RNA-Seq 99
differences observed from groups of samples to the respective populations,

within-group variability in the expression of each gene has to be estimated,
which requires replication. To meet this requirement at least three replicates
need to be included within each group. The more replicates each group has,
the more accuracy there is in within-group biological variability estima-
tion, and therefore more certainty to call a gene differentially expressed.
While differential gene expression can be detected from unreplicated data,
the results are limited to the tested samples and not easily generalizable.
Due to the lack of knowledge on biological variation within each group, it
is unrealistic to draw conclusions on the population from an unreplicated
experiment.
7.2.3 Sample Preparation
Since gene expression is highly plastic and varies greatly with internal (such
as tissue and cell type, developmental stage, circadian rhythm, etc.) and exter-
nal (such as environmental stress) conditions, samples should be collected in
a way that minimizes the effects of irrelevant factors. If the influence of such
factors cannot be totally avoided, they should be balanced across groups. As
many biological samples contain different cell types, this heterogeneity in
cell composition is another factor that may confound data interpretation. The
use of homogeneous target cells is preferred whenever possible, as this will
greatly improve data quality and experimental reproducibility.
To prepare samples for RNA-Seq, total RNA (or messenger RNA [mRNA])
is first extracted from samples of contrasting conditions. As ribosomal RNAs
(rRNAs) are usually the predominant but uninformative component in total
RNA extractions, rRNA species are usually depleted prior to sequencing.
Approaches for rRNA depletion include enrichment of eukaryotic mRNAs
that have poly(A) tails with poly(T) primer-based capturing; the Ribo-Zero
method based on hybridization and then removal of rRNAs with rRNA-
specific RNA probes; degradation by duplex-specific nuclease (DSN), which
relies on denaturation-reassociation kinetics to remove extremely abundant
RNA species including rRNAs [102]; and RNase H selective depletion based
on binding rRNAs to rRNA-specific DNA probes and then using RNase H to
digest bound rRNAs. Without rRNA depletion using one of these approaches,
signals from low-abundance mRNA transcripts might be masked.
Besides rRNA depletion, degradation of RNA molecules in an extracted
sample may also lead to artifactual results. To detect the intactness of RNA
molecules in samples, some quality metrics, such as the RNA integrity num-
ber (or RIN), are often used. It is recommended to use high-quality RNA
samples with no or low levels of degradation, as indicated by high RIN
scores, whenever possible. One prerequisite to extracting high-quality RNA
is to snap-freeze tissue samples whenever possible to avoid potential RNA
degradation. Under circumstances where this is not possible (e.g., sample col-
lection in the field), RNA stabilizing reagent (such as RNAlater) can be used.
For RNA samples prepared under certain circumstances such as those from
historical samples or formalin-fixed paraffin-embedded (FFPE) clinical tis-
sues, RNA degradation can be unavoidable. But even from highly degraded
RNA samples such as these, useful data may still be generated [103].
Other experimental factors may also have impacts on RNA-Seq data
generation and subsequent analysis. Contamination of RNA samples with
genomic DNA is one such factor. To remove DNA contaminants, DNase treat-
ment of extracted RNA samples is recommended. In addition, many RNA
extraction protocols do not retain small RNA species including microRNAs
(miRNAs). If these species are also of interest (more on small RNA sequenc-
ing in Chapter 8), alternative protocols (such as the TRIzol method) need
to be used. After RNA extraction, an RNA sequencing library needs to be
constructed, which basically involves reverse transcription to cDNA and
sequencing adapters ligation. This sequencing library construction process
may also introduce bias to the subsequent sequencing and data generation.
For example, using poly(T) oligonucleotides to enrich for mRNA or prime
reverse transcription during this process introduces 3′ end bias, as these pro-
cedures are based on the poly-A tail located at the 3′ end of the vast majority
of eukaryotic mRNAs. This bias precludes analysis of those mRNAs and
other noncoding RNAs that do not have this tail structure [104]. If these RNA
species are of interest, the use of alternative rRNA depletion methods and
random primers in the reverse transcription step can be employed.
7.2.4 Sequencing Strategy
To facilitate subsequent read alignment to identify their origins in the
genome, although single-end long reads will definitely help, use of paired-
end but shorter reads works equally well. Besides read length, how to arrange
samples on a sequencer in terms of lane assignment can also affect the out-
come of an RNA-Seq experiment. On sequencer lane assignment, a balanced
block design [105] should be used to minimize technical variation due to
lane-to-lane or flow cell-to-flow cell difference. In such a design, samples
from different conditions are multiplexed on the same lanes, instead of run-
ning different samples or conditions on separate lanes.
An often-asked question on the conduct of RNA-Seq is how many reads
should be obtained for an RNA-Seq experiment. The answer on this issue of
coverage depth is based on a number of factors, such as the size of the organ-
ism’s genome, the purpose of the study (quantification of low-abundance
genes and alternative splicing variants vs. quick survey of majorly expressed
genes), and ultimately statistical rigor (effect size and statistical power).
Some RNA-Seq power analysis tools, such as Scotty [106], can be used to
help decide on sequencing depth as well as sample size. To start on a spe-
cies or cell type that has not yet been studied, it might be useful to try out
a small number of samples first to get a general idea on the composition of
the target transcriptome and the variability between biological replicates.
In general, for human studies, 100 million reads (after filtering, see Section
7.3.1) are needed to detect ~80% of expressed genes; significantly more reads
(300 million) are needed, however, to find 80% of differentially expressed genes
between conditions. Studying alternative splicing requires more reads due
to the increased resolution. It is estimated that 150 million reads are needed
to detect 80% of splicing events and 400 million reads for finding 80% of
differential splicing events between conditions [107–109]. It should also be
mentioned that the detection power of an RNA-Seq study is not only affected
by sequencing depth but also the number of sample replicates. Sequencing
depth and sample replication provide estimation on gene expression varia-
tion at two different levels, with the former sampling RNA fragments in the
sequencing library (not every RNA fragment is sequenced) and the latter
sampling biological subjects. For projects on budget, it has been reported
that increasing the number of biological replicates is more effective in boost-
ing detection power than increasing sequencing depth [110].
7.3 RNA-Seq Data Analysis

7.3.1 Data Quality Control and Reads Mapping
The first step after an RNA sequencing run is to examine the run summary
with regard to the total number of reads generated, quality score distribu-
tion, GC content, and other indices of the sequencing run, as detailed in
Chapter 5. Besides the standard NGS quality control (QC) packages men-
tioned in Chapter 5, RNA-Seq data QC can also be conducted with those
specially designed for RNA-Seq data, including RNA-SeQC [111] and RSeQC
[112]. Based on QC results generated from these packages, reads filtering and
base trimming can be conducted to remove low-quality reads or base calls.
Some other data quality metrics, including percentage of total aligned reads,
percentage of rRNA reads, rates of duplicate reads, and genomic coverage,
should be examined after reads mapping.
Mapping RNA-Seq reads to a reference genome is more complex than the
general reads mapping procedure described in Chapter 5. Because mRNAs are
generated from the splicing out of introns and joining of exons, many RNA-
Seq reads may not map continuously to the reference genomic sequence.
Mapping of these reads, therefore, creates a challenge to the mapping algo-
rithms that are designed to map reads to a reference genome continuously.
Two approaches have been developed to meet this challenge. One is to use
the current gene exonic annotation in the reference genome to build a data-
base of reference transcript sequences that join currently annotated exons.
RNA-Seq reads are then searched against this reference transcripts database
using standard nongapped read aligners such as BWA or Bowtie. Examples
of annotation-guided mappers include PASTA [113], RNASEQR [114], RUM

[115], SAMMate [116], and SpliceSeq [117]. These mappers may produce bet-
ter outcome when high accuracy and reliability are emphasized.
The other approach conducts ab initio splice junction detection, and there-
fore does not depend on genome annotation. Depending on their meth-
odology, ab initio spliced mappers can be classified into two categories:
methods using “exon-first” and those using “seed-and-extend.” The exon-
first methods include TopHat/TopHat2 [118,119], MapSplice [120], SpliceMap
[121], HMMSplicer [122], and GEM [123]. They first align reads to a refer-
ence genome to identify unspliced continuous reads (i.e., exonic reads first),
and then predict splice junctions out of the initially unmapped reads based
on the initial mapping results. Taking TopHat/TopHat2 as an example, they
first use Bowtie/Bowtie2 to align reads to the reference genome. Reads that
map to the reference continuously without interruption are then clustered
based on their mapping position. The clusters, supposedly representing
exonic regions, are used to search for splicing junctions from the remaining
reads. The seed-and-extend methods, on the other hand, use part of reads as
substrings (or k-mers) to initiate the mapping process, followed by extension
of candidate hits to locate splicing sites. Examples of methods in this cat-
egory include GSNAP [124], MapNext [125], SplitSeek [126], and STAR [127].
A hybrid strategy combining the two is also used sometimes, with the exon-
first approach employed for mapping unspliced reads and the seed-and-
extend approach for spliced reads. As they do not rely on current genomic
annotations, these ab initio methods are suitable to identify new splicing
events and variants.
The percentage of reads that are mapped to the genome is an important QC
parameter. Although it is variable depending on a number of factors such as
aligning method and species, this number usually falls within the range of
70% to 90%. The percentage of reads that map to rRNA regions is depen-
dent on and a measure of the efficiency of the rRNA depletion step. Due to
technical and biological reasons, it is usually impossible to remove all rRNA
molecules. The percentage of rRNA reads can vary greatly, from 1%–2% to
35% or more. For downstream analysis, rRNA reads are filtered out so they
do not usually affect subsequent normalization. Duplicate reads, a common
occurrence in an RNA-Seq experiment, can be caused by biological factors,
such as overpresentation of a small number of highly expressed genes, and/
or technical reasons, such as PCR overamplification. It is possible to have a
high percentage of duplicate reads (e.g., 40% to 60%) in a run. While it is still
debatable as to how to treat duplicate reads, because of the biological factors
involved in their formation they should not be simply removed. Some exper-
imental approaches, such as removing some of the highly expressed genes
prior to library construction, or using paired-end reads, can help reduce the
amount of duplicate reads. With regard to genomic coverage, RNA-Seq QC
tools often report on the percentage of reads that are intragenic, that is, those
that map within genes (including exons or introns), or intergenic, for those
that map to genomic space between genes.
If the species under study does not have a sequenced reference genome
against which to map RNA-Seq reads, two approaches exist. One is to map
the reads to a related species that has a reference genome, while the alterna-
tive is to assemble the target transcriptome de novo. The de novo assembly
approach is more computationally intensive, but it does not rely on reference
genomic sequence. Currently available de novo transcriptome assemblers
include Oases [128], SOAPdenovo-Trans [129], Trans-ABySS [130], and Trinity
[131]. These de novo assemblers are suited when no related species or only
very distantly related species with a reference genome exists, or the target
genome, despite the available reference sequence, is heavily fragmented or
altered (such as in tumor cells). It should also be noted that if a related refer-
ence genome exists with 85% or higher sequence similarity with the species
under study, mapping to the related genome may work equally well, or even
better, compared to the de novo assembly approach. This is especially true
when studying alternative splicing variants.
7.3.2 RNA-Seq Data Normalization

As previously mentioned, the basic principle of determining gene expression
levels through RNA-Seq is that the more active a gene is transcribed, the
more reads we should be able to observe from it. To apply this basic principle
to gene expression quantification and cross-condition comparison, at least
two factors must be taken into consideration. The first is sequencing depth.
If a sample is split into two halves, and one half is sequenced to a depth that
is twice of that of the other, for the same gene the former will generate twice
as many reads as the latter although both are from the same sample. The
other factor is the length of gene transcript. If one gene transcript is twice
the length of another gene transcript, the longer transcript will also pro-
duce twice as many reads as the shorter one. Because of these confounding
factors, prior to comparing abundance of reads from different genes across
samples in different conditions, the number of reads for each gene needs to
be normalized against both factors using the following formula to ensure
different samples and genes can be directly compared:
gi, j × SF
ei, j =
ai × l j

where ei,j is the normalized expression level of gene j in sample i, gi,j is the
number of reads mapped to the gene in the same sample, ai is the total num-
ber of mapped reads (depth) in sample i, and lj is the length of gene j. SF is
a scaling factor and equals to 109 when ei,j is presented as RPKM or FPKM
(reads, or fragments [for paired-end reads], per kilobase of transcript per

million mapped reads).
The calculation of RPKM or FPKM is the simplest form of RNA-Seq data
normalization. In a nutshell, normalization deals with unintended factors
and/or technical bias, such as those that lead to unwanted variation in total
read counts in different samples. By correcting for the unwanted effects of
these factors or bias, the normalization process puts the focus on the biologi-
cal difference of interest and makes samples comparable. Since the introduc-
tion of RKPM or FKPM as an early normalization approach for RNA-Seq data,
other methods of normalization have also been developed. Some of these
methods employ a similar strategy to adjust for sequencing depth. This group
of methods normalize RNA-Seq data through dividing gene read counts by
either (1) the total number of mapped reads (i.e., the total count approach),
(2) the total read count in the upper quantile (the upper quantile approach)
[132], or (3) the median read count (the median approach). These methods do
not normalize against gene length, as it is not needed if the goal is to detect
relative expression changes of the same genes between groups rather than
compare relative abundance levels of different genes in the same samples.
Further normalization approaches are based on the assumption that the
majority of genes are not differentially expressed, and for those that show
differential expression, the proportion of up- and downregulation is about
equal. These include the normalization approaches employed in two com-
monly used RNA-Seq analysis tools: DESeq and edgeR. In DESeq, normal-
ization is carried out by dividing the read count of each gene in each sample
by a scaling factor. To compute the scaling factor for each sample, the ratio of
each gene’s read count over its geometric mean across all samples is first cal-
culated. After calculating this ratio for all genes in the sample, the median of
this ratio is used as the scaling factor. The edgeR package employs a different
approach called TMM (trimmed means of M values). In this approach, one
sample is used as the reference and others as test samples. TMM is computed
as the weighted mean of gene count log ratios between a test sample and the
reference, excluding genes of highest expression and those with the highest
expression log ratios. Based on the assumption of no differential expression
in the majority of genes, the TMMs should be 1 (or very close to 1). If not,
a scaling factor should be applied to each sample to adjust their TMMs to
the target value of 1. Multiplying the scaling factor with the total number of
mapped reads generates effective library size. The normalization is then car-
ried out by dividing the raw reads count by the effective library size, that is,
Normalized read count = Raw read count/(Scaling factor × Total number

of mapped reads)
The quantile normalization method, originally developed for microarray

data, has also been adopted for RNA-Seq data. This method sorts gene read
count levels and adjusts quantile means to be equal across all samples, thus
ensuring that all samples have the same empirical distribution. This method
is used by the package limma, originally designed for microarray data anal-
ysis and now revised for RNA-Seq data [133]. Among other normalization
methods are those that use a list of housekeeping genes or spike-in controls
as the normalization standard. The use of housekeeping genes or spike-
in controls is for conditions in which the assumption that the majority of
genes are not differentially expressed might be violated. In this approach,
a set of constitutively expressed housekeeping genes that are known to stay
unchanged in expression under the study conditions, or a panel of artificial
spike-in controls that mimic natural mRNA and are added to biological sam-
ples at known concentrations, is used as the basis against which other genes
are normalized. Additional methods include those that adjust for putative
bias associated with sample-specific GC content [134].
7.3.3 Identification of Differentially Expressed Genes

To compare normalized RNA-Seq gene expression data in different groups
and identify differentially expressed genes, the distribution model of the data
has to be established first in order to decide on the appropriate statistical tests
to be used. While microarray data can be treated as normally distributed vari-
ables after log transformation, the RNA-Seq read count values, being discrete
in nature, cannot be approximated by continuous distributions even after
transformation. In general, count data, including the RNA-Seq data, follows
the Poisson distribution, which is characterized by the mean of the distribu-
tion being equal to the variance. While this distribution can be and has been
used to model RNA-Seq data [132,135], it has also been observed that in RNA-
Seq data genes with larger mean counts tend to have greater variance, causing
the over-dispersion problem [136] (see Figure 7.1). To deal with this problem,
an overdispersed Poisson process, or as an approximation the negative bino-
mial distribution, is often applied. Other distribution models that have been
used in RNA-Seq data analysis tools, including the Poisson log-linear model
used by PoissonSeq [137] and the normal linear model used by limma [133],
have also been found to perform well under many circumstances.
On the identification of differentially expressed genes based on these
models, there is a growing list of methods to choose from, among which
the commonly used ones are baySeq [138], Cuffdiff/Cuffdiff 2 [139,140],
DEGSeq [141], DESeq/DESeq2 [136,142], and edgeR [143]. While DEGSeq has
been developed based on the Poisson distribution, baySeq, Cuffdiff/Cuffdiff
2, DESeq/DESeq2, and edgeR have been designed on the negative bino-
mial distribution. To detect differentially expressed transcripts, these pack-
ages use different approaches. For example, baySeq employs an empirical
Bayesian-based approach, in which two alternative models are proposed for
each gene, with one assuming differential expression and another assuming
null. Given the observed read counts, the posterior likelihood for the dif-
ferential expression model is used to identify differentially expressed genes.
108 3
2
106
1
104
Variance 102
100
10−2
10−4
100 101 102 103 104 105
Mean
FIGURE 7.1
The overdispersion problem in RNA-Seq data. Poisson distribution is often used to model
RNA-Seq data, but instead of the variance/dispersion being approximately equal to the mean
as assumed by the distribution, the variance in RNA-Seq data is often dependent on the
mean. Line 1 represents the relationship between variance and mean based on the Poisson
distribution, and lines 2 and 3 (dashed) represent local regressions used by DESeq and edgeR,
respectively, based on negative binomial distribution. (Modified from S Anders, W Huber,
Differential expression analysis for sequence count data, Genome Biology 2010, 11:R106.)
Cuffdiff/Cuffdiff 2 uses the T statistic, which equals the ratio of mean(log[y])

over variance(log[y]), with y representing the expression ratio of a gene
between two groups. Since this statistic approximately follows a normal dis-
tribution, a t-test is used to identify differentially expressed genes. DEGSeq
employs several methods to identify differentially expressed genes, includ-
ing methods based on the MA-plot, Fisher’s exact test, likelihood ratio test,
and samrWrapper (a wrapper of functions in SAM, which was originally
designed for identifying differential gene expression from microarray data).
DESeq identifies differentially expressed genes using a method that is simi-
lar to Fisher’s exact test for single-factor experiments and a generalized lin-
ear model (GLM) based test for multifactor experiments (DESeq2 uses the
GLM model for both single- and multifactor experiments). Similarly, edgeR
also tests for differential gene expression using an exact test that is highly
parallel to Fisher’s for experiments with one factor, and the GLM likelihood
ratio test for multifactorial experiments.
Packages that are not based on the Poisson distribution or negative bino-
mial distribution are also used for differential expression analysis. For
example, limma uses a moderated t-statistic to find differentially expressed
genes. PoissonSeq conducts differential expression analysis based on tests of
a correlation term between gene and experimental conditions, which follows
a chi-squared distribution model. The adaptation of SAM for RNA-Seq data
analysis has led to the development of SAMseq, which, different from the
original SAM, is based on a nonparametric approach [144].
Most of the currently available methods are designed to handle samples

with biological replicates. For RNA-Seq without replicates, the method devel-
oped by Audic and Claverie, which is also based on the Poisson distribu-
tion, is particularly sensitive and suitable [145]. Although it was originally
implemented for analyzing relatively small data sets (<10 K reads), the A-C
statistic is equally applicable to the much larger NGS data sets that contain
millions of reads.
7.3.4 Differential Splicing Analysis

Besides overall expression level changes, eukaryotic genes also undergo
alternative splicing to produce different forms of transcripts (see Chapter 3).
As differential splicing may exist even in the absence of overall gene expres-
sion level changes, analysis of differential splicing adds another dimension
to transcriptomic profiling. This analysis involves a number of steps, includ-
ing reads mapping, inference of splicing events/variants, detection of splic-
ing pattern changes between groups, and identification of differentially
expressed splicing variants.
At the reads mapping step, many of the mappers introduced earlier in
this chapter, especially the ab initio spliced mappers, can be used to map
the reads. Inference of individual splicing events, such as skipped exons,
alternative 3′/5′ splicing sites, or retained introns, can be performed on
the mapped reads using methods such as MISO [146], SpliceTrap [147],
and RUM [115]. As an example of how these methods work, RUM gen-
erates read counts and RPKM of exons and splicing junctions as well
as the entire gene. Assembly and quantification of individual splicing
variants are less straightforward because of the uncertainty associated
with assigning shared reads to individual variants. There are a number of
methods that attempt to achieve this task. ERANGE, for example, assigns
reads mapped to known splice junctions to different variants based on
gene structure coverage and reports the expression level of each variant
as RPKM. Other methods, such as RABT [148], SLIDE [149], and DRUT
[150], do not rely on gene annotations, but instead predict and quantify
novel splicing variants.
To detect splicing pattern change, methods such as SpliceSeq quantify and
compare reads covering exons and splicing junctions to determine splicing
pattern changes. Most of these methods carry out gene splicing analysis at
the level of splicing events rather than full-length splicing variants, again
due to the uncertainty in assigning reads to splicing variants. There are,
however, an increasing number of methods, including MISO, ALEXA-Seq
[151], FDM [152], rDiff [153], and rSeqDiff [154], that attempt to deal with this
uncertainty. These methods assign reads, especially those shared by vari-
ants, to different variants by using probabilistic models. For differential
analysis of the identified splicing variants, available methods include BASIS
[155], BitSeq [156], Cuffdiff2 [140], and EBSeq [157].
For species without a sequenced reference genome, or in cases where

RNA transcripts are expected to contain much variation from the reference
genome (such as those produced under cancerous conditions), splicing vari-
ants can be analyzed using genome-independent methods. Some of these
methods are based on mapping to a transcriptome preassembled from RNA-
Seq reads. Examples of this transcriptome-based approach include RSEM
[158], IsoEM [159], and BitSeq [156]. Additionally, most recently developed
de novo transcriptome assemblers, including SOAPdenovo-Trans, Oases, Trinity,
Trans-ABySS, Rnnotator [160], and KisSplice [161], can also assemble and dif-
ferentiate splicing variants. These assemblers gather reads into the transcrip-
tion unit, that is, the set of RNA sequences transcribed from the same gene
locus that contain different splicing variants. While these genome-independent
methods do not depend on a sequenced reference genome, one major chal-
lenge is in distinguishing splicing variants from transcripts derived from
closely related genes. For this reason, mapping assembled transcripts to
a related reference genome or transcriptome, even from a not-so-closely-
related species, often improves accuracy [108].
7.3.5 Visualization of RNA-Seq Data

RNA-Seq data visualization is often needed to appreciate the complexity in
gene transcription, including alternative splicing. A growing list of visual-
ization tools has been used to meet this need. Among the most used are
the Integrative Genomics Viewer (IGV) and the Integrated Genome Browser
(IGB). In addition, RNA-Seq data can be exported as custom tracks for display
in a genome browser such as the UCSC Genome Browser. For visualization
of alternative splicing, tools like Alexa-Seq, SpliceGrapher, SpliceSeq, and
SplicingViewer have their own built-in visualization capabilities. DiffSplice
generates GFF-style files that can be visualized in the genomic browser
GBrowse.
7.3.6 Functional Analysis of Identified Genes

Once a list of differentially expressed genes is identified, data interpreta-
tion is necessary to connect the genes, usually in large numbers, to the bio-
logical question under study. Functional analysis of the identified genes is
at the core of this process. This analysis can be conducted at multiple levels,
including Gene Ontology (GO), biological pathway, and gene network. There
are many tools available for analyses at these levels. DAVID [162] is among
the best known, which detects enrichment of biological terms in the identi-
fied genes, including GO terms and biological pathways. The statistical sig-
nificance of this enrichment is usually calculated using the hypergeometric
distribution, or one-tailed Fisher’s exact test. An alternative approach is the
Gene Set Enrichment Analysis (GSEA), which instead of using a filtered list
of genes, uses the entire gene set for functional analysis [163]. Not relying on
a somewhat arbitrary cutoff for gene selection, the GSEA approach increases
sensitivity of the analysis and can pick up weaker signals that might be oth-
erwise missed. For gene network analysis, tools like Cytoscape or Ingenuity
Pathway Analysis (IPA, commercial) are often used. Gene network can be
reconstructed on the basis of currently available experimental evidence, or
coexpression patterns.
7.4 RNA-Seq as a Discovery Tool

Besides interrogating currently cataloged genes, RNA-Seq, being an unbiased
approach, is a powerful technology for discovering novel transcripts, splic-
ing events, and other transcription-related phenomena. RNA-Seq studies of
the transcriptional landscape of the genome have found that besides protein-
coding regions, the majority of the genome produces RNA transcripts. The
finding that 75% of the human genome is transcribed (see Chapter 3), made
with extensive use of RNA-Seq, shows the power of this technology in dis-
covering currently unknown transcripts. The aforementioned de novo alter-
native splicing variant analysis has also shown its potential in uncovering
currently unknown splicing variants. For example, the discovery of circular
RNAs (also see Chapter 3), which are formed as a result of noncanonical
RNA splicing, is also due to the application of RNA-Seq [164]. RNA-Seq has
also been applied to uncover other transcription-related phenomena, such
as gene fusion. Gene fusion is caused by genomic rearrangement and is a
common occurrence under certain conditions such as cancer. Because RNA-
Seq has the capability to locate transcripts generated from a fused gene,
detection of gene fusion events has been greatly facilitated by this powerful
technology [165].
8
Small RNA Sequencing
Small RNAs play an important role in regulating gene expression in both

the cytoplasm and the nucleus through inducing both posttranscriptional
and transcriptional gene silencing mechanisms. In additional to RNA inter-
ference (RNAi), some studies also show that some small RNAs can increase
gene expression via a mechanism called RNA activation (RNAa) [166].
Through these regulatory activities, small RNAs are involved in many cel-
lular processes, affect growth and development, and if their own expression
goes awry, lead to diseases such as cancer and Alzheimer’s disease.
As introduced in Chapter 3, the major categories of small RNAs in cells
include microRNAs (miRNAs), small interfering RNA (siRNAs), and Piwi-
interacting RNAs (piRNAs). Among these three types of small RNAs,
miRNAs are so far the most studied. A total of 24,521 miRNA loci have been
cataloged in 206 species in a recent release of miRBase (version 20), the gold-
standard database for miRNAs. It has been estimated that a typical mam-
malian cell contains hundreds of miRNA species, each of which regulates
transcripts from multiple genes. The expression of these miRNAs is cell- and
tissue-specific, and dynamically regulated based on cellular state. Mutations
or methylations in miRNA genes often lead to dysregulation in their expres-
sion. Studying the expression of miRNAs and other small RNAs is an
important aspect of studying their roles in biological processes and diseases.
Compared to other small RNA expression analysis methods, such as micro-
array and qPCR, next-generation sequencing (NGS) has a broader dynamic
range for measuring small RNAs even at extremely high or low levels, a
single-base resolution to differentiate closely related small RNA molecules,
the ability to study organisms without a currently available genome assem-
bly, and the capability to discover novel small RNA species.
Concerning new small RNA discovery, although from human and other
model organisms the community has cataloged thousands of miRNAs and
other small RNA species, more remain to be found. For less studied spe-
cies, the number of known small RNAs is still low. Many in silico miRNA
prediction algorithms have been developed, but their predictions have to
be validated with experimental evidence. Small-RNA sequencing, through
interrogating the entire pool of small RNAs, provides an excellent tool for
novel miRNA discovery and experimental validation of computational pre-
dictions. Furthermore, small RNA sequencing offers an assumption-free,
comprehensive analysis of the small RNA transcriptome in biological tar-
gets, including differential expression between conditions. In general, small
111
RNA sequencing data analysis shares much commonality with the analysis
of RNA-Seq data (Chapter 7). In the meantime, some aspects of small RNA
sequencing data analysis are unique and mostly focused on in this chapter.
8.1 Small RNA Next-Generation Sequencing (NGS)

Data Generation and Upstream Processing
8.1.1 Data Generation
Because sequencing analysis of small RNAs in the transcriptome is simi-
lar to messenger RNA (mRNA) analysis, the experimental aspects detailed
in Chapter 7 on factorial design, replication and randomization, and sam-
ple collection apply equally here and are therefore not repeated. Mature
small RNA species, generated as a result of Dicer and Argonaute process-
ing (Figure 8.1, also see Chapter 3, Section 3.4.4.1), have a size range of 18 to
31 nucleotides. Small RNA molecules can be purified from cells or tissues,
while total RNA extracts that retain small RNA species works equally well
and are often recommended. A size selection step in the sequencing library
construction process removes larger RNA molecules in total RNA extracts.
Furthermore, the small RNA sequencing library construction process takes
advantage of the particular end structure on small RNAs, which are absent
on mRNAs. Canonical mature small RNAs have a monophosphate group
at the 5′ end and a hydroxyl group at the 3′ end, which is derived from the
action of small RNA processing enzymes such as Dicer.
Sequence
reads
miRNA-miRNA*
Pre-miRNA Loop duplex
Dicer *
Argonaute *
cleavage processing
and deep
sequencing
FIGURE 8.1
Deep sequencing of mature small RNAs after Dicer and Argonaute processing. Dicer cleaves a
short stem-loop structure out of pre-miRNA to form the miRNA:miRNA* duplex. Upon load-
ing into RISC, Argonaute unwinds the duplex and uses one strand as a guide for gene silencing
and discards the other strand (the star strand). Although the short stem-loop and star strand
sequences are usually degraded, they may still generate sequencing signals, because of unde-
graded residues or the fact that they may exist to perform other functions (e.g., the star strand
is sometimes functional).
Small RNA Sequencing 113
The small RNA sequencing library construction process starts with ligation
of adapter sequences to their 3′ and 5′ ends. The universal adapter sequences
provide anchoring for subsequent reverse transcription, and then PCR amplifi-
cation. In the polymerase chain reaction (PCR) step, the number of cycles should
be limited to less than 15 (even when the amount of starting material is limited),
otherwise library complexity may be reduced leading to a biased result. For
multiplexed sequencing, indexing sequences should also be incorporated dur-
ing the PCR step as part of the PCR primers. Alternatively incorporating index-
ing sequences during adapter ligation as part of adapter sequence has been
found to lead to serious ligation bias [167,168]. After the PCR step, size selection
is conducted to purify constructs that carry only small RNAs. Although the
library construction process may vary with different sequencing platforms in
technical detail such as the use of different adapters and PCR primers, this
general workflow is usually followed. It should also be noted that some biases,
sometimes unavoidable like in other NGS applications, can be introduced in the
library preparation process, for example, some miRNA sequences may be pref-
erentially captured over others, leading to sequence-specific biases [168–170].
Because of their short length, constructed small RNA sequencing libraries
do not need to be sequenced for very long. The actual read length depends on
the configuration of library constructs and whether the index sequences are
read in the same pass or as a separate reading step. In the current version of the
Illumina small RNA sequencing protocol that reads index sequences in a sec-
ond pass, 50 cycles of sequencing can be enough. Sequencing depth is another
key factor in the data generation process that determines the power of differ-
ential expression analysis and novel small RNA discovery. While this depends
on the sample source, as small RNA amount and composition vary greatly
with cell type and species, in general 4 million to 5 million raw unmapped
reads should offer enough confidence for most studies. A study has shown
that coverage higher than 5 million reads contributes little to the detection of
new small RNA species [171].
8.1.2 Preprocessing
After obtaining sequencing reads and demultiplexing (if the samples are
multiplexed), the reads generated from each sample need to be checked for
base call quality using the quality control (QC) tools introduced in Chapter 5
such as FastQC and FASTX-Toolkit. Because small RNA libraries are usually
sequenced longer than the actual lengths of the small RNA inserts, the 3′
adapter sequence is often part of the generated sequence reads and therefore
should also be trimmed off. The trimming can be carried out with standalone
tools such as Cutadapt and Trimmomatic, or utilities in the FASTX-Toolkit
and NGS QC Toolkit. Adapter trimming can also be conducted contempo-
raneously with mapping, as some mappers provide such an option, or using
data preprocessing modules within some small RNA data analysis tools (to
be covered next).
8.1.3 Mapping
For mapping small RNA sequencing reads to a reference genome, short read
aligners introduced in Chapter 5, such as Bowtie/Bowtie2, BWA, Novoalign,
or SOAP/SOAP2, can be used. Among these aligners, Novoalign offers the
option of stripping off adapter sequences in the mapping command. As for
the reference genome, the most recent assembly should always be used.
Because of the short target read length, the number of allowed mismatches
should be set as 1. To speed up the mapping process, a multithreading
parameter, which enables the use of multiple CPU cores, can be used if the
aligner supports it. After mapping, reads that are aligned to unique regions
are then searched against small RNA databases to establish their identities
(see Section 8.1.4), while those that are mapped to a large number (e.g., >5000)
of genomic locations should be removed from further analysis.
Besides the aforementioned general tools for small RNA reads preprocess-
ing and mapping, tools have also been developed specially for small RNA
analysis, including DSAP [172], miRanalyzer [173], miRDeep/ miRDeep2
[174], miRExpress [175], miRNAKey [176], and mirTools [177]. Among these
tools, miRanalyzer was among the first developed and is currently one of
the most widely used methods. It provides functions for data preprocess-
ing, including 3′ adapter sequence removal, and uses Bowtie for mapping.
Both miRDeep2 and mirTools also have modules for data preprocessing, and
mapping with the use of Bowtie and SOAP, respectively. DSAP, miRNAKey,
and miRExpress all have preprocessing functionalities, but instead of map-
ping to a reference genome, they map the reads to noncoding RNA (ncRNA)
databases including miRBase and Rfam [178]. Rfam is an annotated database
for ncRNA families with each family containing a series of RNA sequences
that share a common ancestor.
While the mapping of small RNA reads to a reference genome is similar
to the mapping in RNA-Seq, as covered in Chapter 7, some characteristics
of small RNAs, mostly their short length and posttranscriptional editing,
present different challenges from the small RNA reads mapping process.
Because of their short length, sizeable numbers of small RNA reads are usu-
ally mapped to more than one genomic region. In comparison, this issue is
minimal for RNA-Seq data, as longer and sometimes paired-end reads greatly
increase specificity. The easiest way to deal with multimapped small RNA
reads is to simply ignore them, but this leads to the loss of great amounts of
data. A more commonly used approach is to randomly assign them to one of
the mapped positions, while an alternative approach is to report them to all
possible positions. More sophisticated algorithms have also been developed
in an effort to avoid the precision or sensitivity pitfalls of these approaches.
For example, one package called Butter (Bowtie UTilizing iTerative placE-
ment of Repetitive small RNAs) [179] makes assignment to one of the pos-
sible positions based on the relative local densities of other more confidently
assigned reads.
Posttranscriptional editing, on the other hand, leads to the generation of

isomiRs [180], which are isoforms of canonical miRNAs that resemble but
nevertheless vary from the reference miRNA annotated in miRBase. The
isomiRs have various forms of variations from the canonical sequence,
including alternative 3′ (more often) and 5′ termini, and nucleotide substitu-
tions in the body sequence. Since their discovery, which itself is attributed
to small RNA sequencing, isomiRs have been shown to have physiological
significance [181,182]. Because the discovery of isomiRs is very recent, most
small RNA mappers still only count miRNAs with exact matches or small
variations to the miRBase-cataloged reference of mature miRNA sequences.
More recently developed tools, such as miRSeq [183] and SeqBuster [184],
have begun to cover isomiRs.
8.1.4 Identification of Known and Putative Small RNA Species

To identify currently known small RNA species, the mapped reads need to be
searched against the most recent version of the miRBase or other small RNA
databases (such as piRNABank). Reads with no matches in these databases
can then be searched against other databases (Rfam, repeat, and mRNA) to
determine if they are degradation products of ncRNAs, genomic repeats,
and mRNAs. The previously mentioned tools, that is, DSAP, miRanalyzer,
miRDeep/miRDeep2, miRExpress, miRNAKey, and mirTools, all provide
these database search capabilities.
To discover potentially novel miRNA species, mapped reads that do not
match known miRNAs and sequences in the other databases are submit-
ted to algorithms such as miRanalyzer and miRDeep2, which are designed
to search for putative miRNAs. A machine learning approach based on the
random forest classifier is used by miRanalyzer to classify the reads and
make predictions. The approach used by miRDeep2 takes into consider-
ation the biogenic process of miRNAs. It first identifies potential miRNA
precursor coding regions out of the genomic regions that are clustered with
the mapped reads. RNA secondary structures are then predicted on these
identified regions using RNA folding software, and examined to see if they
resemble a typical miRNA hairpin structure seen in pri-miRNA molecules
and if they are thermodynamically stable. Putative miRNA species are called
if the reads fall into stable hairpins in an expected manner, along with other
evidence such as reads from the star strand.
8.1.5 Normalization
Before identifying differentially expressed small RNAs, read counts for each
small RNA species in the samples need to be normalized. The goal of normal-
ization is to make the samples directly comparable by removing unwanted
sample-specific variations, which are usually due to differences in library
size and therefore sequencing depth. The normalization approaches used in
RNA-Seq as detailed in Chapter 7 can be similarly applied here. The general

assumption for most of the normalization approaches, that the majority of
small RNAs stay constant between conditions, seems to hold. For the total
read-count-based normalization, since all small RNAs are similarly short in
size, the RPKM (reads per kilobase of transcript per million mapped reads)
normalization can be simplified as RPM (reads per million). This popular
method, however, has been found to be inadequate in some benchmark stud-
ies [185,186]. Other normalization approaches, including the DESeq, quan-
tile, or LOWESS methods, were found to have better performance in these
studies.
8.2 Identification of Differentially Expressed Small RNAs

The packages and tests introduced for RNA-Seq differential expression
analysis in Chapter 7 can also be directly used for small RNA analysis. For
experiments without replicates, the Audic-Claverie methods can be used.
For those with replicates, DESeq and edgeR, along with the other tools intro-
duced earlier, work well on the identification of differentially expressed
small RNAs. Because of their good performance, these tools are also often
used by packages particularly designed for miRNA-Seq data analysis. For
example, miRanalyzer applies DESeq for its differential expression analysis,
and mirTools uses the Audic-Claverie method.
8.3 Functional Analysis of Identified Small RNAs

To perform functional analysis of differentially expressed small RNAs, their
gene targets need to be predicted first. A number of tools are available for
this task, including miRanda [187], mirSVR [188], PicTar [189], PITA [190],
RNA22 [191], RNAhybrid [192], TargetScan [193], and the DNA intelligent
analysis (DIANA) application microT-CDS [194] or microT [195]. These tools
predict target genes based on base-pairing pattern, thermodynamic stability,
and sequence conservation. For example, miRanda makes predictions based
on the miRNA–mRNA complementarity pattern, location of the binding site
in the mRNA, binding energy, and miRNA evolutionary conservation. On
miRNA target gene prediction, it should also be noted that the predictions
generated from the aforementioned tools have certain levels of false positives,
as well as false negatives, as miRNA target gene prediction is no easy task
because of the small size of the miRNA-mRNA binding area, often imperfect
complementarity of the binding, and sometimes lack of conservation [196].
Once a list of potential target genes are generated, functional analysis, such
as Gene Ontology (GO) and pathway analysis, can be conducted using the
approaches detailed in Chapter 7. In addition, for pathway analysis, a list of
miRNAs can also be uploaded directly to the DIANA miRPath web server
to a generate a list of biological pathways that are significantly enriched with
the miRNAs’ target genes, which are predicted with DIANA-microT-CDS or
documented with existing experimental evidence [197].
9
Genotyping and Genomic Variation
Discovery by Whole Genome Resequencing
Detection of genomic variation among individuals of a population is

among the most frequent applications of next-generation sequencing (NGS).
Genome sequence heterogeneity is prevalent in a naturally occurring popu-
lation, which cannot be captured by the current use of a single reference
genome for a species. Genomic variant cataloging projects, such as the 1000
Genomes Project and the 100,000 Genomes Project, underscore the impor-
tance of genomic variation discovery. Locating genomic sequence variations
that correlate with disease predisposition or drug response, and establishing
a genotypic basis of various phenotypes have become common focuses of
many NGS studies in biomedical and life science research. Besides variations
carried through the germline for generations, NGS has also been applied
to identify de novo germline and somatic mutations, which occur more fre-
quently than previously expected and underlie numerous human diseases
including various types of cancer [198,199].
Detecting the various forms of genomic variations/mutations from NGS
data, as detailed in Chapter 2, including single nucleotide variations (SNVs),
indels, and structural variations (SVs), is not an easy task. The primary chal-
lenge is to differentiate true sequence variations/mutations from false posi-
tives caused by sequencing errors and artifacts generated in base calling
and sequence alignment. It is, therefore, important to generate high-quality
sequencing data before performing data analysis. Equally important, sen-
sitive and yet specific variant/mutant calling algorithms are required to
achieve high accuracy in genomic variation and mutation discovery. This
chapter first provides details on data preprocessing, alignment, realignment,
and recalibration. It then focuses on methods for the detection of SNVs/
indels and SVs, followed by variant annotation, and finally testing of variant
association with diseases or phenotypic traits. Figure 9.1 shows an overview
of the data analysis pipeline.
119
Data preprocessing and

quality control
Read mapping
Local realignment
Base quality recalibration
Variant calling
(SNVs, mutations, indels, and SVs)
Variant annotation
Association test
(between variants and diseases/phenotypes)
FIGURE 9.1
General workflow for genotyping and variation discovery from resequencing data.
9.1 Data Preprocessing, Mapping,

Realignment, and Recalibration
Besides the general data preprocessing and quality control steps introduced
in Chapter 5, such as examining sequencing data quality, removing low-
quality and duplicate reads, additional steps are needed for variant calling.
The reads mapping step requires the use of a highly sensitive alignment
algorithm, such as BWA, Novoalign, Stampy, MOSAIK, or BFAST (particu-
larly good for aligning SOLiD-generated color space sequence reads). After
examining mapping quality, reads with low-quality mapping scores need
to be filtered out. For paired-end reads, they should map to the reference
genome as pairs at the expected interval and those that do not show the
expected pattern should be filtered out as well.
After the initial alignment, realignment around indels usually leads to
improvement in mapping results. This is usually due to the fact that short
indels, especially those at the ends of reads, often cause problems in the ini-
tial alignment process. To realign around the indel regions, the original BAM
Genotyping and Genomic Variation Discovery 121
file is first processed to identify where realignment is needed using tools

such as the GATK RealignerTargetCreator. In this process, using a known set
of indels (such as those in dbSNP, or those cataloged by the 1000 Genomes
Project) can speed the process and improve accuracy. After the target regions
for realignment are identified, programs such as the GATK IndelRealigner
can be employed to conduct the realignment. At the end of this process, a
new BAM file is generated containing realigned reads.
Prior to variant calling, the original base-call quality scores should also
be recalibrated to further improve data quality. This base quality score reca-
libration can be conducted with tools such as the GATK BaseRecalibrator,
which recalibrates raw quality values using a covariate-aware base quality
recalibration algorithm. This algorithm adjusts for covariates, such as the
machine sequencing cycle and local sequence context, that are known to
affect sequencing signal and base-call quality. To carry out the recalibration,
the covariation pattern is first analyzed, which is examined and then applied
to recalibrate the data. Variant calling based on the recalibrated data has
higher accuracy and cuts down on the number of false positives.
9.2 Single Nucleotide Variant (SNV) and Indel Calling

9.2.1 SNV Calling
In general, variant calls are made based on a number of factors (Figure 9.2).
These factors include (1) base call quality, (2) mapping quality, (3) single versus
paired-end sequencing, (4) read length, (5) depth of coverage, and (6) sequence
context. Because of errors or uncertainties that occur in the steps of sequenc-
ing, base calling, and mapping, there are almost always certain levels of
uncertainty associated with each variant call. To minimize this uncertainty,
C
T
T
C
T
C
C
FIGURE 9.2
The variant calling process is usually affected by various factors. In this illustration, a number
of reads are aligned against a reference sequence (bottom). At the illustrated site, the reference
sequence has a C, while the reads have C and T. Depending on the factors mentioned in the
text and prior information, this site can be called heterozygous (C/T), or no variation (C/C)
if the T’s are treated as errors. It is also possible to be called a homozygous T/T, if the C’s are
regarded as errors.
base-calling algorithms use statistical models or heuristics. By modeling the

errors and biases, and sometimes incorporating other related prior informa-
tion, variant callers that use statistical models significantly reduce the prob-
ability of miscalling variants. For methods that are based on the heuristic
approach, on the other hand, the call variants are based on a number of heu-
ristic factors, such as minimum read depth, base quality, and allele frequency.
Algorithms based on statistical models are currently more widely used than
those based on heuristics. It should be noted, however, that statistical models
are usually based on certain assumptions. Under circumstances when the
assumptions are violated, the heuristic methods can be more robust.
Among the tools that are based on statistical models, GATK [200] and
Samtools [201] are currently among the most widely used. In its cur-
rent version, GATK offers two variant callers, UnifiedGenotyper and
HaplotypeCaller. UnifiedGenotyper uses a Bayesian genotype likelihood
model to call variants (SNPs and indels separately) and genotypes (i.e., as
A/A, A/B, or B/B). This caller is fast and considers each locus independently.
HaplotypeCaller, as the name suggests, considers the linkage between
nearby variants, and calls SNPs and indels simultaneously. It performs local
de novo assembly of haplotypes and is therefore more computationally inten-
sive and slower. Samtools uses the same genotype likelihood model for vari-
ant calling, which is achieved in two steps, namely, mpileup and Bcftools.
In the mpileup step, it collects summary information from input BAM files
and computes the likelihoods of possible genotypes, which are stored in BCF
files. The subsequent Bcftools step uses the likelihood information in the
BCF files to conduct variant calling.
Besides GATK and Samtools, other model-based variant callers include
SOAPsnp [202], a component of the SOAP tool package, and Atlas 2 for
variant analysis of exome sequencing data [203]. SOAPsnp takes a similar
Bayesian modeling approach to identify SNPs. Atlas 2 is based on logistic
regression models that are validated with whole exome sequencing data. A
commonly used heuristics-based variant caller is VarScan/VarScan2 [204],
which works more robust on data confounded by factors such as extreme
read depth, pooled samples, and contaminated or impure samples. Since
these different types of tools use different approaches for variant calling,
the variants they identify are usually only partially overlapping. It is advis-
able, therefore, to closely examine the specifics of an experiment to decide on
more appropriate variant caller(s). If more than one method can be used, it
is advisable to compare their outputs and analyze how they intersect. Use of
convergent variants is an effective way to reduce rates of miscalled variants.
Some of these tools, such as GATK, work for both single- and multiple-
sample data. Multiple-sample analysis usually has more detection power
than single-sample analysis. This is because with multiple samples it is more
likely to call a variant when more than one sample shows the same variation.
Therefore, to improve variant call quality it is usually better to conduct the
calling on multiple samples.
9.2.2 Identification of de novo Mutations

Most of the currently available variant-calling methods are designed to
identify variations that are passed from generation to generation. Although
these variants are a major target of genomic variation studies, de novo muta-
tions in somatic and germline cells (Figure 9.3) also play important roles in
many diseases and altered phenotypes. To identify these de novo mutations,
though some of the variant callers mentioned earlier such as VarScan can be
used, there exist some specifically designed algorithms, including MuTect
[205], SomaticSniper [206], Strelka [207], and JointSNVmix [208], on the com-
parison of parent–offspring or normal–diseased samples. Mechanistically,
while some of these algorithms (such as MuTect and VarScan) carry out
mutation calling on each of the contrasting samples separately against a ref-
erence genome, others (such as JointSNVmix, Strelka, and SomaticSniper)
directly compare the contrasting samples. In the former approach, sequence
reads generated from contrasting samples (e.g., normal versus cancer tissues
Reference
ACTCCCGTCGGAACGAATGCCACG
genome
ACTCCCGTCGGAACCAATGCC - - -
- CTCCCGTCGGAACCAATGCCACC
- - - CCCGTCGGAACCAATGCCACG
- - - - - CGTCGGAACCAATGCCACG
- - - - - CATCGGAACCAATGCCACC
Normal - - - - - - GTCGGAACCAATGCCACG
- - - - - - - - - - - - - - CAATGCCACC
- - - - - - - - - - - - - - - - - - - - CACC
Allelic counts
aN 122335566666660777778773
dN 122335666666667777778777
ACTCCCGTCGGAACCAATGCCACC
- - TCCCGTCGGAACCAATGCCACC
- - - CCCGTCGGAACCAATGCCACC
- - - - - - GTCGGCACCAATGCCACG
- - - - - - - - CGGCACCAATGCCACG
Tumor - - - - - - - - - - GCACCAATGCCACG
- - - - - - - - - - - - - - - AATGCCACG
- - - - - - - - - - - - - - - - - - - CCACG
aT 112333445563660777788883
Allelic counts
dT 112333445566666777788888
Germline
Somatic (AA,AB) (AB,BB) (AB,AB)
FIGURE 9.3
De novo somatic mutations versus inherited germline variations. In this example, sequence
reads from normal and tumor tissues are aligned to the reference genome (shown at the top).
The allelic counts, that is, the number of matches (aN and aT) and depth of reads (dN and dT), at
each base position are shown. The light gray sites indicate germline variants, while the dark
gray indicates a de novo somatic variant acquired in some tumor cells. Also shown at the bot-
tom are the predicted genotypes for the normal and tumor tissues. (Modified from A Roth,
J Ding, R Morin, A Crisan, G Ha, R Giuliany, M Hirst et al., JointSNVMix: A probabilistic
model for accurate detection of somatic mutations in normal/tumour paired next-generation
sequencing data, Bioinformatics 2012, 28 (7):907–913. With permission.)
carrying somatic mutations from the same patient) are independently aligned
to and variants called against a reference genome. The called variants in the
contrasting samples are then compared to each other to locate somatic muta-
tions in the cancer tissue. In the latter approach, the samples are directly
compared to each other using statistical tests on the basis of joint probability.
9.2.3 Indel Calling
Calling small indels (large indels are covered in Section 9.3 on SV calling),
which occur at a frequency of about 1 in 8000 bp in the genome, is more chal-
lenging than calling SNVs. This is because the existence of indels in a read
could interfere with the read’s accurate mapping. The mapping for small indel
calling, therefore, should allow insertions or deletions that involve a few bases.
After mapping, a simple approach to indel calling is to extract insertion and
deletion information from the sorted BAM file using Samtools (varFilter). This
approach, while simple, often shows high false-positive and false-negative
rates. More complex approaches, such as Dindel [209] or GATK, can be used for
improved performance. The basic workflow of these approaches is (1) scan the
input BAM file for insertions and deletions; (2) for each indel site, build a new
haplotype based on the indel event; (3) realign all sequence reads to the newly
created alternative haplotype; (4) count the number of reads that support the
indel in the alternative haplotype; and, finally, (5) make indel calls.
Another approach that addresses the challenge of calling indels is based
on local de novo assembly. SOAPindel [210] is an example of this approach.
With the use of paired-end reads, this approach first identifies mapped reads
that have unmapped mates, and then positions the unmapped reads at their
expected genomic locations. A local de novo assembly is subsequently built
with high density of such unmapped reads and aligned to the reference to
identify indels. This approach is computationally more intensive, especially
when the reference genome is large.
9.2.4 Variant Calling from RNA-Seq Data

While variant calling is mostly carried out from DNA sequencing data, RNA-
Seq can also be used to call variants from transcriptionally active regions of
the genome. RNA-Seq-based variant calling is more challenging due to the
inherent heterogeneity in the abundance of reads transcribed from different
regions and the splicing of exons. Variant calling from RNA-Seq data offers
certain advantages, however, as it does not incur additional cost beyond col-
lecting the original transcriptomic data, and it directly interrogates tran-
scriptionally active regions of the genome. In addition, RNA-Seq-based
variant discovery can be used to validate variants called from whole-genome
or whole-exome sequencing. Methods for RNA-Seq-based variant calling are
still limited. Currently available tools, including eSNV-Detect [211], SNPiR
[212], and SNVMix [213], employ different models for variant calling. For
example, SNVMix employs a probabilistic binomial mixture model to call

variants from premapped RNA-Seq reads.
9.2.5 Variant Call Format (VCF) File

Variant call format (VCF) is a standard file format for storing major types
of sequence variation, including SNVs, indels, and SVs [214]. This format is
designed to be scalable to encompass millions of sites from thousands of
samples. Originally developed for the 1000 Genomes Project, it is designed
for fast data retrieval. Besides reporting variants and their genomic posi-
tions, it allows fields to store additional information such as variant-call
quality score and allows users to add their own custom tags to describe new
sequence variations thereby offering flexibility.
Figure 9.4 provides an example of the VCF. It contains metainformation lines
at the front, a header line, and data lines, each of which describes a variant posi-
tion. The metainfo lines start with “##” and describe related analysis informa-
tion, such as species, file date, and assembly version. In addition, abbreviations
used in the user definable data columns are also defined in the metainfo lines.
The subsequent header line lists the names of the eight mandatory columns
(Table 9.1). In the QUAL column, a Phred-like quality score for the alternative
allele (ALT) call is given (e.g., a QUAL value of 30 means the probability of the
ALT call being wrong is 0.001). In the FILTER column, “PASS” means this posi-
tion has passed all filters, while a value of “q10” as shown in Figure 9.4 indicates
that the variant-call quality at this site is below 10. The data lines, containing
variant calls for a list of genomic positions, make the body of a VCF file.
VCF files can be parsed and manipulated using tools such VCFtools [214]
or vcflib [215]. VCFtools, for example, is a tool kit containing various utilities
for VCF file parsing, analysis, and manipulation. It consists of two modules: a
general Perl API and a C++ binary executable. The Perl module can be used for
FIGURE 9.4
The VCF format (version 4.2). (From http://samtools.github.io/hts-specs/; the format is cur-
rently managed by the Global Alliance Data Working Group File Formats Task Team.)
TABLE 9.1
Mandatory Fields in a VCF File
Col Field Type Description
1 #CHROM String Chromosome number
2 POS Integer Start position of the variation
3 ID String Database identifier
4 REF String Reference allele
5 ALT String Alternate allele(s)
6 QUAL Numeric Quality score (Phred-style)
7 FILTER String Filter status
8 INFO String User extensible information
routine tasks such as VCF file validation, merging, intersecting, complements,

and so forth. The binary executable provides tools for generating various QC
metrics, filtering out specific variants, summarizing the variants, estimating
allele frequencies, calculating levels of linkage disequilibrium, and so on.
9.2.6 Evaluating VCF Results

SNVs and indels reported in VCF files need to be evaluated in order to iden-
tify false positives. Visualization of called variants and supporting reads in
a genome browser, such as IGV or Savant, provides an initial examination of
the variant call result. Further evaluation should be based on criteria such as
deviation from Hardy–Weinberg equilibrium, systematic call quality differ-
ence between major and minor alleles, extreme depth of coverage, or strand
bias. The ratio of transitions and transversions (Ti/Tv) is an additional indi-
cator of variant call specificity and quality. The theoretical ratio of Ti/Tv is
0.5, because purely from the point of statistical probability the chance of pro-
ducing transitions is half that of transversions. However, due to biochemi-
cal mechanisms involved in these nucleotide substitution processes, the
frequency of having transitions is higher than that of transversions. Based
on existing NGS data from multiple species, the expected values of Ti/Tv for
whole genome and exome data sets are usually in the ranges of 2.0 to 2.1 and
3.0 to 3.5, respectively [216].
9.3 Structural Variant (SV) Calling

9.3.1 Read-Pair-Based SV Calling
Earlier experimental methods on the detection of SVs were mostly based on
comparative genome hybridization and SNP whole genome arrays. The advent
Paired reads
Insert
Reference
sequence
Insertion Deletion
P1 P1 P2 P2
P1 P2 P1 P2
Translocation Inversion
FIGURE 9.5
Common SVs and the basic approach to detect them using paired reads.
of NGS, especially the use of paired-end reads, has greatly pushed SV detec-
tion forward. As illustrated in Figure 9.5, the basic approach to locate large
indels, inversions, and translocations is based on changes in orientation or dis-
tance between paired reads. SV detection algorithms that employ this general
approach include BreakDancer [217], GASV [218], HYDRA [219], PEMer (Paired-
End Mapper) [220], and SVDetect [221]. Figure 9.6 shows the general algorithmic
procedure for calling SVs using this approach. The first step is to separate read
pairs into concordant and discordant groups, defined by the distance between a
read pair matching or deviating from the expected distance based on the refer-
ence genome. The discordant read pairs are then assembled into different clus-
ters based on the genomic region they cover to generate candidate SV calling
regions. In the last step, the candidate SV clusters are filtered based on statisti-
cal assessment so that only clusters that are covered by multiple read pairs are
reported as SVs. The bounds on possible breakpoints in the region are also iden-
tified in this step (indicated by the shaded area in Figure 9.6d).
(a) (b)
(c) (d)
FIGURE 9.6
General steps of calling SVs using paired-end reads. (a) Paired reads are mapped to the reference
genome. (b) Discordant read pairs are identified. (c) Discordant read pairs are assembled into
clusters. (d) Candidate clusters of discordant read pairs are filtered to identify SVs, and bounds
on possible breakpoints identified. (From C Whelan, Detecting and analyzing genomic struc-
tural variation using distributed computing, 2014, Scholar Archive, Paper 3482. With permission.)
9.3.2 Breakpoint Determination
Although the aforementioned read-pair based approach can be used to locate
most SV events (except multiple copy number duplications), they cannot be
used to locate exactly where the breakpoints are in the genome. This is due
to the fact that the distance between paired reads is dependent on the size of
the fragment of their origin, which is not exact even under the best experi-
mental conditions. To locate the breakpoints in these events, a split-read
based approach may be used, which locates breakpoints by splitting some
reads into subsequences that map to different genomic regions. Algorithms
that use this approach include CREST [222], Pindel [223], SplazerS [224], and
SRiC [225]. Pindel, for example, first searches for read pairs in which one
read aligns to the reference genome but the other does not. Based on the
assumption that the second read contains a breakpoint, it uses the aligned
read as anchor to scan the surrounding regions for split mapping of the sec-
ond read. Although it can locate breakpoints at single base resolution, this
approach is computationally expensive because of the challenge associated
with aligning read subsequences to different genomic regions with gaps in
between.
9.3.3 D e novo Assembly-Based SV Detection

Both the read-pair mapping and the split-read analyses are based on align-
ment to a reference genome. A different approach to SV detection is to use de
novo assembly. This approach tries to assemble much of the genome directly
from the reads, and then the assembled genome is compared to the refer-
ence genome searching for SVs. Cortex [226] is an SV detection algorithm
that employs this de novo approach. While this approach has the advantage
of being unbiased, it is computationally more intensive and demanding on
computer hardware than the read-pair mapping approach. Because of the
computational complexity involved in the process, it is less used compared
to the other approaches.
9.3.4 CNV Detection
Detection of variation in segmental copy numbers is usually conducted with
algorithms that detect abnormal changes in regional read frequency. These
algorithms are based on the assumption that the number of reads obtained
from a region is proportional to its copy number in the genome. If a genomic
segment is repeated multiple times, a significantly higher number of reads
will be observed from the segment compared to other nonrepeated regions.
If a segment is deleted, on the other hand, there will be no read coverage
for it. Examples of these algorithms include CNAseg [227], CNV-Seq [228],
CNVnator [229], Event-Wise Testing (EWT) [230], JointSLM [231], mrFAST,
and SegSeq [232]. As other factors, such as GC content, may also affect local
read density, a normalization step is often conducted in these methods to

account for the compounding factors. In studies that involve comparison of
samples from the same genetic background, for example a diseased versus
a healthy tissue from the same patient, these compounding factors are often
canceled out.
9.3.5 Integrated SV Analysis
The different software tools introduced earlier are usually tailored for detect-
ing particular types (or aspects) of SVs. In order to make calls for the full
range of SVs, there have been efforts to take an integrated approach toward
comprehensive SV calling using the different but often complementary tools.
SVMerge, being one of these efforts, integrates SV calling results from dif-
ferent callers [233]. It first feeds BAM files into a number of SV callers such
as those introduced earlier to generate BED files, and then the SV calls in the
BED files are merged. A comprehensive list of SVs is generated after com-
putational validation with breakpoints refined by local de novo alignment.
Other efforts that take a similarly integrated approach include GASVPro
[234], SVSeq [235], and CNVer [236].
9.4 Annotation of Called Variants

To gain biological insights from identified SNVs, indels, or SVs, annota-
tion of the variants is needed. For example, if an SNV is annotated to be
nonsynonymous in a gene, it may impair protein function if the affected
amino acid is located within the active site of the protein. Through exami-
nation of their annotations, called variants can be filtered and prioritized
for more in-depth analysis. Because of the large number of variants usually
called from an experiment, an automatic pipeline is usually preferred. To
meet this demand, a number of variant annotation tools have been devel-
oped. ANNOVAR [237] is one such tool among the most widely used. It takes
SNVs, indels, and CNVs as input, and as output, it reports their functional
impacts and provides significance scores to help with filtering and prioriti-
zation. Its TABLE_ANNOVAR script can quickly turn a variant list into an
Excel-compatible file containing many annotation fields that can help the
researcher evaluate the function importance of the variants. ANNOVAR
offers flexibility and extensibility; for example, it can identify variants located
in conserved genomic regions, or find variants that overlap with those from
the 1000 Genomes Project or dbSNP. Other variant annotation tools include
SeattleSeq [238], SnpEff [239], and VEP (Variant Effect Predictor) [240]. For
easy access, SeattleSeq and VEP provide a web interface. For local deploy-
ment, ANNOVAR, SnpEff, and VEP provide scripts for download.
9.5 Testing of Variant Association with Diseases or Traits

To identify polymorphic variants significantly associated with a disease
or trait of interest, an association test needs to be carried out. For common
polymorphic variants with frequency of occurrence >5%, the test is usually
conducted at the level of single variants, which examine each variant indi-
vidually for association with the disease or trait. Commonly used statistical
methods include the chi-squared test, Fisher’s exact test, Cochran-Armitage
test for trend, or logistic regression for disease incidence and qualitative
traits. For quantitative traits, such as blood pressure or body mass index, lin-
ear regression is often used. Because of the large number of individual tests
involved in such an analysis, the significance level of each variant needs to
be adjusted for multiple testing (such as false discovery rate [FDR]). Many of
the aforementioned statistical methods are implemented in software tools
such as PSEQ [241].
For the detection of rare polymorphic variants, that is, those with fre-
quency of occurrence <5%, the single-variant level association test is often
underpowered. To improve detection power, multiple variants, such as those
located in a gene or a sliding window of predefined size, can be grouped
together for association testing. In this approach, the different variants in the
group are often tested individually first and then the individual test results
combined to represent the group. To further improve detection power for
rare variants, all variants across a genomic region can be aggregated and col-
lapsed into a single unit for subsequent test. For such a test, multiple logistic
or linear regression models can be used to combine the effects of these vari-
ants. For the collapsing method, statistical tests such as CAST (cohort allelic
sums test) [242] or CMC (combined multivariate and collapsing) [243] can be
used to determine if the aggregated burden of rare variants is significantly
different between two conditions.
10
De novo Genome Assembly from Next-
Generation Sequencing (NGS) Reads
Sanger sequencing was considered the golden standard for de novo genome
assembly. However, it is prohibitively expensive and time-consuming
to assemble a genome using this first-generation technology, as it took
$3 billion and 13 years to generate the human genome draft assembly. The
demand for low-cost and fast genome sequencing provides the very impe-
tus for the development of next-generation sequencing (NGS) technolo-
gies. The dramatically reduced cost of NGS makes whole-genome shotgun
sequencing much more affordable and accessible to individual labs. De novo
genome assembly from the relatively short and enormous number of reads
generated from most NGS platforms, however, poses serious challenges to
assembling algorithms that were designed for Sanger sequences. The short
length of NGS reads means that they carry less information and as a result
lead to more uncertainties in the assembling process. To remedy this situa-
tion, higher coverage is required, which significantly increases the number
of reads required and therefore the computational complexity. For example,
using Sanger sequences with lengths up to 800 bp, assembling the human
genome used approximately 8× coverage; for NGS reads of 35 to 100 bp, the
same task needs 50× to 100× coverage [244].
Since Sanger sequence assemblers cannot deal effectively with these chal-
lenges, new de novo genome assemblers have been developed for NGS data.
The development of Velvet [245] and ABySS [246] in 2008 and 2009 showed
that de novo high-quality genome assembly can be achieved, even for large
genomes, using massive numbers of ultrashort (as short as 30 bp) reads. The
first de novo assembly of a human genome with the use of only short NGS
reads was accomplished in 2010 with the development of SOAPdenovo [96].
With the recent rapid algorithmic developments in this direction, along with
the gradual increase in read length, de novo genome assembly from NGS
sequences has been becoming more and more robust.
131
10.1 Genomic Factors and Sequencing Strategies

for de novo Assembly
10.1.1 Genomic Factors That Affect de novo Assembly
The size of a target genome to a large degree determines the difficulty of
assembling it. All NGS de novo assemblers (see Section 10.2) can handle
small genomes (<10 Mb), such as those of bacteria, without difficulty. For
genomes of medium size (10 Mb–1 Gb), such as those of lower plants and
insects, most of the assemblers should still work without much problem. For
large genomes (>1 Gb), while some assemblers, such as the aforementioned
SOAPdenovo, have been shown to have the capability to assemble the human
or other mammalian genome, in general it is still not an easy task to put
them together with only short reads (e.g., those from Illumina sequencers).
In addition, assembling a large genome de novo is the most computationally
demanding among all NGS applications.
The amount of repetitive sequences in a genome is another major factor that
affects de novo genome assembly. Some genomes are inherently more diffi-
cult to assemble than others because they contain more repetitive sequences.
Because they produce reads that are not unique due to their repetitive nature,
repetitive regions create serious challenges in the genome assembly process.
The challenges come from the inability to assemble reads from these regions
into contiguous segments (contigs) or scaffolds, and the inability to deter-
mine the locations of these reads in relation to contigs or scaffolds assembled
from reads from nonrepetitive regions. As a result, these regions become
gaps in a draft assembly. Besides repetitive elements, genomic heterozygos-
ity is another factor that may affect de novo assembly. Genomic heterozygos-
ity is a measure of allelic differences in a genome, and allelic differences in
a diploid or polyploid genome lead to uncertainty in assembling their reads
together. In addition, other genome features, such as local GC content, may
also affect de novo genome assembly.
10.1.2 Sequencing Strategies for de novo Assembly

Filling the gaps caused by repetitive regions is important for most de novo
genome assembly projects, and how to fill them should be a major consider-
ation when devising an appropriate sequencing strategy. The basic approach
to connect contigs or scaffolds across the gaps is to use read pairs that span
a distance longer than the gaps. These read pairs have to be generated from
paired-end or mate-pair sequencing, and the known distances between the
read pairs provide guidance to align the contigs or scaffolds over the gaps.
Mate-pair sequencing differs from paired-end sequencing (see Chapter 4)
in that the mate-pair approach is designed to “jump” sequence two ends of
a larger DNA fragment. To conduct mate-pair sequencing, a DNA fragment
De Novo Genome Assembly from NGS Reads 133
is first circularized to have the two ends joined. This circular DNA is then
fragmented, and the segment that contains the junction of the two ends is
selected and sequenced with paired-end sequencing. To span repetitive
regions in different sizes, sequencing reads generated from mate-pair librar-
ies of varying insert sizes (e.g., from 2 to 40 Kb), as well as regular paired-end
reads, are often used [247,248].
The combined use of paired-end and mate-pair libraries of different
insert sizes is a key strategy in assembling a genome from NGS reads. The
paired-end sequencing generates reads at the shorter size range (e.g., 180 bp)
for assembling of nonrepeat sequences as well as resolving short repeat
sequences, whereas the mate-pair jump sequencing produces reads at the
larger size range for resolving intermediate and long-range repeat regions
and fill the corresponding gaps. Gaps of substantial sizes that are beyond the
covering range of mate-pair libraries cannot be filled.
Besides the use of paired-end and mate-pair sequencing, read length is
also a key parameter for de novo genome assembly. Although mammalian
genomes have been assembled from reads shorter than 75 bp [96,248], lon-
ger reads are always better. To obtain long reads, some sequencing plat-
forms, such as that from Pacific Biosciences, can be used. To balance read
length with cost and error rate, NGS systems that usually do not read long
sequences, such as the Illumina system, can also be used ingeniously to pro-
duce longer reads. For example, the current Illumina system can sequence
250 nucleotides from one end using the rapid run mode. If using this mode
to conduct paired-end sequencing on libraries that contain DNA inserts of
450 bp, each generated read pair will overlap, and with software they can be
merged to form a single long read covering the entire length of 450 bp. This
strategy, combined with the use of mate-pair libraries of different sizes, or
different sequencing technologies, can to a large degree overcome the limita-
tion imposed by a short read length. Read length will become a lesser issue
with the emergence of long-read NGS technologies.
Sequencing depth is another important factor to consider for a de novo
assembly project. While it varies by project and is dependent on the other
factors (including the amount of repeats and level of heterozygosity in the
genome as well as read length and error rate), a coverage that is too low
will undoubtedly result in a highly fragmented assembly. As a rough guide,
in the combined use of paired-end and mate-pair libraries of various insert
sizes, 45× to 50× coverage is needed for the short-insert-size paired-end
and intermediate-size (3 to 10 Kb) mate-pair libraries, and 1× to 5× cover-
age for the long-insert (10 to 40 Kb) mate-pair libraries [249,250]. It should
also be noted that while higher coverage may lead to improvement in the
final assembly quality, additional increase in coverage also means increased
data volume, computational complexity, and processing time. There are also
studies showing that beyond a certain level of coverage, further increase in
sequencing depth does not necessarily lead to an increase in assembly qual-
ity in terms of the size of assembled contigs [96].
10.2 Assembly of Contigs
10.2.1 Sequence Data Preprocessing, Error Correction,
and Assessment of Genome Characteristics
The de novo assembly of a genome from NGS reads is a multistep process
(Figure 10.1). As the first step, sequence data quality needs to be inspected.
The data quality control (QC) steps described in Chapter 5 can be performed
here to examine per-base error rate, quality score distribution, read size dis-
tribution, contamination of adaptor sequences, and so on. Low-quality reads
need to be filtered out, and portions of reads that contain low-quality base
calls (usually the 3′ end), ambiguities (reported as N’s), or adaptor sequences
should be trimmed off. As part of data preprocessing, paired-end reads with
part of their sequences overlapped need to be merged to generate longer reads.
The read merging can also correct errors if discrepancy at some base positions
are observed, in which case the higher quality base call is used. The merging
process can be handled by tools such as FLASH [251] or PANDAseq [252].
Sequencing error correction is an important step for de novo read assem-
bly, more so than for most other NGS applications due to the fact that the
Sequencing paired-end and

mate-pair libraries
(of varying insert sizes)
Data quality control and

preprocessing
(including error correction and
genome size and coverage estimation)
Contig assembly
(greedy, OLC, and de Bruijn approaches)
Scaffold construction
Genome assembly
quality evaluation
Gap closure
FIGURE 10.1
General workflow for de novo genome assembly.
assembly process is much more sensitive to these errors. The data QC mea-
sures mentioned earlier cannot totally remove sequencing errors, as high
base-call quality scores alone cannot guarantee a read is free of sequenc-
ing errors. If left uncorrected, the errors will lead to prolonged computa-
tional time, erroneous contigs, and low-quality genome assembly. While
it can be time consuming, an additional error correction step can improve
final assembly quality. There are multiple options to carry out this step. For
example, the Quake error corrector [253] can be used as a standalone tool,
while some assemblers (see Section 10.2.2) have their own error correction
modules, such as ALLPATHS-LG [254]. Most error correction algorithms are
based on k-mer filtering [255]. K-mer refers to all the possible subsequences
of length k in a read, and breaking reads to k-mers makes the complicated
task of genome assembly more tractable. When all reads are converted to
k-mers, most k-mers in the pool are represented multiple times. Having a
k-mer that appears only once or twice is an indication of sequencing error
(Figure 10.2). The general error correction approach is to find the smallest
number of base changes to make all k-mers contained in a read “strong,”
that is, with the frequency of these k-mers from all reads above a thresh-
old level. To determine the appropriate threshold level for error correction,
the distribution of the frequency of k-mers can be plotted using data from
a k-mer counting software such as Jellyfish [256]. From the distribution pat-
tern, the size of the to-be-assembled genome, as well as coverage, can also
be estimated. For example, tools such as Kmergenie [257], SGA [258], and
VelvetOptimiser [259] provide reports on genome size and coverage from
the k-mer distribution pattern. Some of these tools, like SGA, also report on
other characteristics of the genome, such as repeat content and the level of
heterozygosity.
0.015
Error k-mers
0.010
True k-mers
Density
0.005
0.000
0 20 40 60 80 100
Coverage
FIGURE 10.2
The coverage profile of true k-mers and those with sequencing errors. (From DR Kelley, MS
Schatz, SL Salzberg, Quake: Quality-aware detection and correction of sequencing errors,
Genome Biology 2010, 11:R116. Used under the terms of the Creative Commons Attribution
License, http://creativecommons.org/licenses/by/2.0, © 2010 Kelley et al.)
10.2.2 Contig Assembly Algorithms

Fundamentally different from the reference-based alignment process, which
is used by most of the other NGS applications in this book, de novo genome
assembly attempts to construct a superstring (or superstrings) of DNA letters
based on the overlapping of sequence reads. This assembly process was pre-
viously modeled by Lander and Waterman with the use of ideal (error- and
repeat-free) sequence data [260]. In this model, if two reads overlap and the
overlap is above a cutoff level, the two reads are merged into a contig and this
process reiterates until the contig cannot be further extended. Although this
guiding model is straightforward, finding all possible overlaps between mil-
lions of short reads and assembling them into contigs are computationally
intensive and challenging. Added to this challenge are other complicating
factors such as sequencing errors, heterozygosity, and repetitive sequences.
To deal with these challenges, a number of assemblers that employ different
methodologies have been developed.
The currently available de novo genome assemblers can be classified into
three major categories: those using (1) the Greedy approach, (2) the overlap–
layout–census (OLC) approach, and (3) the de Bruijn graph. Although all
of them are based on graphs, the Greedy approach is the one that is based
on the maximization of local sequence similarity. It was used by Sanger
sequence assemblers, such as phrap and the TIGR assembler, and early NGS
reads assemblers, such as SSAKE [261], SHARCGS [262], and VCAKE [263].
Since it is a local approach, the Greedy approach does not consider the global
relationship between reads. Therefore, more recent NGS-based assemblers
no longer use this approach, as it cannot take advantage of the global rela-
tionship offered by paired-end and mate-pair reads.
The OLC and the de Bruijn graph approaches are global by design, and
both assemble reads into contigs using reads overlapping information based
on the Lander-Waterman model. They approach the task, however, in dif-
ferent ways (Figure 10.3). The OLC approach, as the name suggests, involves
three steps: (1) detecting potential overlaps between all reads; (2) laying out
all reads with their overlaps in a graph; and (3) constructing a consensus
sequence superstring. The first step is computationally intensive and the run
time increases quadratically with the increase in the total number of reads.
The graph created in the second step consists of vertices (or nodes) represent-
ing reads, and edges between them representing their overlaps. The con-
struction of a consensus sequence superstring equals to finding a path in the
graph that visits each node exactly once, which is known as a Hamiltonian
path in graph theory. Currently available OLC-based short read assemblers
include CABOG [264], Edena [265], Fermi [266], Forge [267], and Newbler [66].
The OLC approach is widely used to assemble longer reads generated from
454 and Sanger sequencers, but relatively less used to assemble short reads
(such as those from Illumina sequencers) due to the demand for signifi-
cantly higher depth and consequently quadratic increase in computational
R1 R2 R3 R4 R5 R6 K1 K2 K3 K14 K15 K16
(a) (b)
FIGURE 10.3
Comparison of the (a) OLC and the (b) de Bruijn graph approaches for global de novo genome
assembly. In the OLC example, six sequence reads (R1–R6) are shown for the illustrated
genomic region, with each read being 10 bp in length and the overlap between them set at
≥5 bp. The reads are laid out in order based on how they overlap. The OLC graph is shown at
the bottom, with many nodes having more than one incoming or outgoing connection. In the
de Bruijn graph example, the reads are cut into a series of k-mers (k = 5). In total there are 16
such k-mers, many of which occur in more than one read. The k-mers are arranged sequen-
tially based on how they overlap, and the de Bruijn graph built from this approach is shown
at the bottom. Different from those in the OLC graph, the majority of the nodes in this graph
have only one incoming and one outgoing connection. (From Z Li, Y Chen, D Mu, J Yuan, Y Shi,
H Zhang, J Gan, et al., Comparison of the two major classes of assembly algorithms: Overlap–
layout–consensus and de-Bruijn-graph, Briefings in Functional Genomics 2012, 11(1):25–37. With
permission.)
complexity. To reduce the high computing demand imposed by this

approach, a simplified version of the OLC graph called the String graph has
been employed to merge and reduce redundant vertices and edges, along
with identification and removal of false vertices and edges [268]. The imple-
mentation of a string indexing data structure called FM-index has improved
the performance of assemblers such as SGA and ReadJoiner [269].
Compared to the OLC approach, the de Bruijn graph-based approach takes
an alternative, computationally more tractable route. This approach does not
involve a step to find all possible overlaps between reads. Instead, the reads
are first cut into k-mers. For instance, the sequence read ATTACGTCGA can
be cut into a series of k-mers, for example, ATT, TTA, TAC, ACG, CGT, GTC,
TCG, and CGA, when k = 3. These k-mers are then used as vertices in the de
Bruijn graph. An edge that connects two nodes represents a convergence of
the two nodes, for example, the edge that connects ATT and TTA is ATTA.
Using the de Bruijn graph, the assembly process is equivalent to finding
a shortest path that visits each node at least once, which is known as the
Chinese postman problem in graph theory. An Eulerian path, if it exists, rep-
resents the solution to this problem. Computationally, finding an Eulerian
path is much easier than finding a Hamiltonian path for the OLC approach.
The major drawback of this approach, however, is that it is highly sensitive to
sequencing errors. Therefore, to use assemblers in this category, error correc-

tion is mandatory. Assemblers that use this approach include ABySS [246],
ALLPATHS-LG [254,270,271], Euler-SR [255], IDBA-UD [272], SOAPdenovo
[96,273], SparseAssembler [274], and Velvet [245]. Some assemblers, such as
MaSuRCA [275], combine the de Bruijn graph and OLC approaches in an
attempt to increase efficiency.
10.3 Scaffolding
After assembly of contigs, the next step is to organize the contigs into a “scaf-
fold” structure to improve continuity rather than leave them disjointed. This
scaffolding process orders and orients the contigs, and estimates the lengths
of the gaps between them (Figure 10.4). To establish positional relationship
between contigs, scaffolding algorithms use mate-pair reads that span dif-
ferent contigs.
For input, scaffolding algorithms take preassembled contigs, mate-pair
reads, and sometimes long reads generated from other sequencing technolo-
gies (such as 454 or PacBio). The first and also an important step in the scaf-
folding process is to map the input read pairs or long reads to the contigs. To
improve mapping results, sequencing errors in the reads should be corrected
prior to mapping. To assemble the contigs into scaffolds using the guiding
information in the mate-pair or long reads, scaffolders usually take a graph-
based approach similar to the contig assembly process, but here with contigs
as nodes and connecting read pairs (or long reads) as edges. The quality
Scaffold
Contig 1 Contig 2
DNA fragments
Paired-end read
Approximate length, but no known sequence
FIGURE 10.4
Assembling contigs into a scaffold.
of the assembled scaffolds is dependent on the quality of input contigs, the

complexity of the genome, and the quality of mate-pair or long-read libraries.
The sizes of the scaffolds are limited by the insert size of mate-pair libraries
or the length of long reads, as the scaffolds cannot span repetitive regions
larger than the insert size or read length.
Currently available standalone scaffolders include Bambus2 [276,277],
Opera [278], SOPRA [279], and SSPACE [280]. Many contig assemblers, includ-
ing ABySS, SGA, and SOAPdenovo2, also have built-in scaffolding modules.
The performance of different scaffolders varies with data sets and analysis
parameters. Therefore, before deciding on an appropriate scaffolder for a
project, it is helpful to first try different scaffolders using different param-
eters and then evaluate the results (see Section 10.4). As of this writing, SGA,
SOAPdenovo2, SOPRA, and SSPACE seem to perform well based on bench-
mark tests [281].
10.4 Assembly Quality Evaluation

Contiguity, completeness, and accuracy are key indices of the quality of an
assembly. Contiguity is reflected by the total number of assembled contigs
or scaffolds and their size distribution, that is, whether the assembly is com-
posed of a small number of large fragments or a large number of small frag-
ments. It can be measured by statistics such as mean or median length, but
the most commonly used statistic is N50, which is the weighted mean of
assembled contigs (or scaffolds). To calculate the N50, all contigs (or scaf-
folds) are first ranked based on length from the largest to the smallest. Their
lengths are then summed up from the largest contig (or scaffold) downward.
N50 refers to the size of the contig (or scaffold) at which the summed length
becomes greater or equal to 50% of the total assembly size.
The total assembly size, however, does not measure the completeness
of the assembly. To determine completeness, the original DNA reads are
aligned to the assembly and the percentage of reads aligned is calculated.
Other sequence data from the same species, such as RNA-Seq data, may also
be used for the alignment and rough estimation of completeness. On the
measurement of accuracy, the assembly can be compared to a high-quality
reference genome of the species, if such a reference is available. This com-
parison can be carried out on two aspects of the assembly: base accuracy
and alignment accuracy. Base accuracy determines if the right base is called
in the assembly at a given position, while alignment accuracy examines the
probability of placing a sequence at the right position and orientation. In
many cases, however, a reference map is not available and instead is the very
goal of the assembling process. For these cases, a measurement on internal
consistency, through aligning original reads to the assembly and checking
for evenness and congruence in coverage across the assembly, provides an

indicator of the assembly quality. Comparison of the assembly with inde-
pendently acquired sequences from the same species, such as gene or cDNA
sequences, can also be used to estimate assembly accuracy. With regard to
software implementation on evaluating assembly quality, only a limited
number of tools are currently available, such as QUAST [282], to help per-
form the aforementioned measurements and compare different contig and
scaffold assembly algorithms and settings.
10.5 Gap Closure
The final stage of finishing a de novo genome assembly is to close the gaps
between contigs. A standard approach to achieving this is to employ PCR,
first to amplify the gapped regions using primers specific to the ends of the
two contigs bordering the gaps, followed by sequencing of the amplicons.
If the number of gaps is high, however, this approach can be laborious and
expensive. Alternatively, gap filling software, such as IMAGE [283], GapFiller
[284], or gap filling modules in some assemblers (such as SOAPdenovo) can
be used to close the gaps using paired reads generated from the gapped
regions. For example, IMAGE uses a targeted reassembly process in the gap
region to create new contigs to gradually fill the entire gap (Figure 10.5). It
first collects read pairs that align to contig ends and uses them to create new
contigs that extend into the gap region. After incorporating the new contigs
into the scaffold, this process is reiterated until the entire gap is filled.
10.6 Limitations and Future Development

The short read length of most current NGS systems poses a limit on de novo
genome assembly. This, combined with other factors including sequencing
errors, repetitive elements, and uneven regional coverage, leads to ambi-
guities, false positive and branched paths in the assembly graph, and early
terminations in contig extension, limiting the completeness of assembled
sequences. As a result, the assembled sequences are usually fragmented and
exist in the suboptimal form of large numbers of contigs. Among the contigs,
there are also certain (sometimes high) levels of falsely assembled contigs,
due to chimeric joining. In addition, the gapped regions between the assem-
bled contigs may not be completely filled. To overcome some of these limi-
tations and increase assembly quality, the use of a reference genome, even
from a remotely related species, can be very helpful. This reference-assisted
Contig A Gap Contig B
1. Align the paired end

reads onto draft
sequence
2. Local assembly of the

aligned reads; new
contigs are produced New contigs
3. Gaps are now shortened;

repeat the whole procedure
in a few iterations
New reads can be
aligned with the presence
of extended reference
Merged contig
4. The gap is now closed
FIGURE 10.5
Gap closing with the IMAGE process. (From IJ Tsai, TD Otto, M Berriman, Improving draft
assemblies by iterative mapping and assembly of short reads to eliminate gaps, Genome Biology
2010, 11:R41. Used under the terms of the Creative Commons Attribution License, http://
creativecommons.org/licenses/by/2.0, © 2010 Tsai et al.)
assembly approach works especially well when scaffolding information

from paired reads is not available or exhausted. With the quickly increas-
ing number of sequenced genomes, improving assembly quality with this
reference-assisted approach becomes more feasible. Some tools have recently
been developed to provide this functionality, either as dedicated packages
such as AlignGraph [285] and RACA [286], or components of existing assem-
blers including ALLPATHS-LG, IDBA-Hybrid, and Velvet.
With the development of third-generation sequencing technologies that
generate increasingly long reads, the landscape of de novo genome assembly
will be bound to change. In the meantime, to further overcome the limita-
tions caused by short reads, the community has devised innovative work-
around approaches. For example, a hierarchical sequencing approach has
been used to increase the assembly quality of large complex genomes. In this
approach, a genome is first divided into a small number of large overlapping
fragments, each of which is made into a sequencing library. After indepen-
dent sequencing of the libraries, the reads from each library are assembled
into contigs. Subsequently, all contigs assembled from the different libraries
are merged to supercontigs, which are then connected with scaffolders. This
hierarchical approach leads to a significant decrease in sequence complex-
ity within each library and an increase in final assembly quality. Ingenious
workaround approaches like this overcome the challenges resulting from
the current short-read-based shotgun approach.
11
Mapping Protein–DNA
Interactions with ChIP-Seq
11.1 Principle of ChIP-Seq
Without the involvement of DNA-interacting proteins, the information coded
in DNA could not be accessed, transcribed, and maintained. Besides a large
number of transcription factors and coactivators, key DNA-interacting pro-
teins include histones, DNA and RNA polymerases, and enzymes for DNA
repair and modification (e.g., methylation). Through their DNA-interacting
domains, such as helix-turn-helix, zinc finger, and leucine zipper domains,
these proteins interact with their DNA targets by hydrogen bonding, hydro-
phobic interactions, or base stacking. Because the intimate relationship
between DNA and these proteins plays an important role in the function-
ing of the genome, studying how proteins and DNA interact and where
DNA-interacting proteins bind across the genome provides key insights into
the many roles these proteins play in various aspects of genomic function,
including information exposure, transcription, and maintenance.
ChIP-Seq is a next-generation sequencing (NGS)-based technology to
locate binding sites of a DNA-interacting protein in the genome. An exem-
plary scenario for using ChIP-Seq is to study transcription factor binding
profiles in the genome under different conditions, such as development
stages or pathological conditions. To achieve this, the protein of interest is
first cross-linked covalently to DNA in cells with a chemical agent, usually
formaldehyde (Figure 11.1). Then the cells are disrupted, and subsequently
sonicated or enzymatically digested to shear chromatin into fragments that
contain 100 to 300 bp DNA, followed by enrichment of the target protein with
its bound DNA by immunoprecipitation using an antibody specific for the
protein. Subsequently, the enriched protein-DNA complex is dissociated by
reversing the cross-links previously formed between them, and the released
DNA fragments are subjected to NGS. One key experimental factor in the
ChIP-Seq process is the quality of the antibody used in the enrichment step,
as the use of a poor-quality antibody can lead to high experimental noise due
to nonspecific precipitation of DNA fragments.
143
Cross-link
and
shear DNA-protein
complexes
DNA with
interacting proteins
1 2
G Immuno-
G precipitate
A
C
G
T
T
C
DNA Purify
sequencing
4
3
Map reads to
reference genome
G G A C G
A C G TT C G T
G G A C G T T C Tag distribution
G A C G T
5
FIGURE 11.1
The basic steps of ChIP-Seq. (From AM Szalkowski, CD Schmid, Rapid innovation in ChIP-seq
peak-calling algorithms is outdistancing benchmarking efforts, Briefings in Bioinformatics 2011,
12(6):626–633. With permission.)
Mapping Protein–DNA Interactions with ChIP-Seq 145
Based on the size of the region(s) that they bind, DNA-interacting proteins
can be divided into three groups:
1. Punctate binding—These proteins, usually transcription factors,

bind to a genomic region that is a few hundred base pairs or less in
size.
2. Broad binding—Chemically modified histones, or other proteins
associated with chromatin domains, bind to a much larger area of
the genome up to several hundred thousand base pairs.
3. Mixed or intermediate binding—These include proteins such as
RNA polymerase II, which bind to regions of the genome that are a
few thousand base pairs in size.
11.2 Experimental Design
11.2.1 Experimental Control
Appropriate control for a ChIP-Seq experiment is the key to account for arti-
facts or biases that might be introduced into the experimental process. These
artifacts and biases may include potential antibody cross-reactivity with
nonspecific protein factors, higher signal from open chromatin regions (since
they are easier to fragment than closed regions [287]), and uneven sequenc-
ing of captured genomic regions due to variations in base composition. Two
major types of controls are usually set up for ChIP-Seq signal adjustment.
One is input control, that is, chromatins extracted from cells or tissues,
which are subjected to the same cross-linking and fragmentation procedure
but without the immunoprecipitation process. The other is “mock” control,
which is processed by the same procedure including immunoprecipitation;
the immunoprecipitation, however, is carried out using an irrelevant anti-
body (e.g., IgG). While it may seem to serve as the better control between
the two, the mock control often produces much less DNA for sequencing
than real experimental ChIP samples. Although sequencing can be carried
out on amplified DNA in this circumstance, the amplification process adds
additional artifacts and bias to the sequencing data, which justifies the use of
input DNA as the experimental control in many cases.
11.2.2 Sequencing Depth
How many reads to obtain for a ChIP-Seq experiment depends on the size
of the genome and how many binding sites the protein of interest has in the
genome. A good indication of having reached sufficient sequence depth is
when the number of protein binding sites reaches plateau with the increasing
number of reads. As a practical guide, for analyzing a transcription factor

that has thousands of binding sites in the mammalian genome, 20 million
reads may be sufficient. Fewer reads may suffice for a smaller genome, while
more reads are required for proteins that bind to the genome at a higher fre-
quency or with larger “footprint.” To locate binding regions of these proteins,
including histone marks, 60 million reads might be needed for a genome at
the scale of the human genome [287]. Higher sequencing depth is required
for control samples in order to obtain background signals from most regions
of the genome.
11.2.3 Replication
To examine the reproducibility of a ChIP-Seq experiment and to reduce the
false discovery rate (FDR), replicate samples should be used. If a protein of
interest binds to regions of the genome with high affinity, the bound regions
should be identified in replicate samples. Regions that are not identified in
replicates are most possibly due to experimental noise. The Pearson correla-
tion coefficient (PCC) between biological replicates serves as a measurement
of experimental reproducibility, and the irreproducible discovery rate (IDR)
is another such metric. The calculation and usage of the PCC and IDR will be
detailed later in this chapter.
11.3 Read Mapping, Peak Calling, and Peak Visualization

11.3.1 Data Quality Control and Read Mapping
The first step in ChIP-Seq data analysis (Figure 11.2) is to evaluate reads
quality. The quality control (QC) metrics detailed in Chapter 5 need to be
examined. If necessary, low-quality reads should be filtered out and low
quality bases trimmed off. Other aspects of determining ChIP-Seq data qual-
ity include assessing library complexity and experimental reproducibility
between replicates. Assessment of library complexity is important, as low-
complexity libraries, caused by limited starting material, over-crosslinking,
low antibody quality, or polymerase chain reaction (PCR) overamplification,
can lead to skewed reads distribution. Library complexity can be examined
with tools such as Preseq [288], or using the PCR bottleneck coefficient (PBC),
which is defined as the ratio of N1/Nd, with N1 being the number of non
redundant, uniquely mapped reads, and Nd the number of uniquely mapped
reads. PBC is calculated by a component of ENCODE Software Tools (http://
www.encodeproject.org/software/) called phantompeakqualtools, which,
besides PBC, also calculates other quality metrics, such as normalized strand
cross-correlation (NSC) and relative strand cross-correlation coefficients (RSC),
Experimental design
(controls, sequencing depth, replication)
Data quality control
Read mapping
Peak calling
Peak visualization
Differential binding analysis
Functional analysis
(peaks assigned to nearby genes)
DNA-binding motif analysis
FIGURE 11.2
Basic ChIP-Seq data analysis workflow.
as measures of sequence enrichment (NSC and RSC will be discussed more

in Section 11.3.2). The assessment of experimental reproducibility is usually
performed by analyzing IDR, which can be calculated using another compo-
nent of ENCODE Software Tools called Irreproducible Discovery Rate (IDR)
(http://www.encodeproject.org/software/idr/).
The assessment of library complexity and experimental reproducibility by
the ENCODE Software Tools, or the use of other ChIP-Seq QC tools such
as CHANCE [289], requires mapping the filtered/trimmed reads to a ref-
erence genome. For this mapping, the mappers introduced in Chapter 5,
including Bowtie, BWA, or SOAP, can be used. One mapping parameter that
directly affects subsequent binding site detection sensitivity and specificity
is whether to use multireads, which are reads that map to multiple genomic
regions. Multireads may represent background noise and, if this is the case,
should be excluded from further analysis, but they may also represent true
signals located in repeats or duplicated regions. Including them increases
sensitivity but at the expense of higher FDR, while excluding them improves
specificity but at the risk of losing true signals. The choice for their inclusion
or not, therefore, is dependent on whether sensitivity or specificity is a prior-
ity. Independent of whether multireads are used, the percentage of uniquely
mapped reads reported from the mappers is indicative of data quality. If this
value is below 50%, it may indicate a potential problem with the experimen-
tal procedure and caution should be used in the interpretation of the data.
ChIP-Seq involving proteins that bind to repetitive regions of the genome
may also generate a low percentage of uniquely mapped reads.
For ChIP-Seq reads mapping, it is also worth mentioning that ChIP is an
enrichment, not purification, of protein-bound DNA sequences. As a result,
more reads are usually generated from background noise than from bound
regions. The background noise can be determined empirically with the use
of control samples. The distribution of observed background noise is not ran-
dom as many would expect (Figure 11.3). Instead, it is affected by the den-
sity of mappable reads in different genomic regions and the local chromatin
structure (e.g., as previously mentioned, an open chromatin structure gener-
ates more background reads). True binding signals in ChIP-Seq samples are
100
80
60
* * *
40
20
Pol II ChIP-Seq
0
100
80
60
40
20
Input DNA
0
100
80
60
40 Interferon-γ–stimulated STAT1 ChIP-Seq
20
0
100
80
60
40
20
Interferon-γ–stimulated input DNA
0
1
0.8
0.6
0.4
0.2
0
Mappable bases (1 Kb)
XPNPEP3 RBX1 EP300
0.000 39,500.000 39,520.000 39,540.000 39,560.000 39,580.000 39,600.000 39,620.000 39,640.000 39,660.000 39,680.000 39,700.000 39,720.000 39,740.000 39,760.000 39,780.000 39,800.000 39,820.000 39,840.000 39,860.000 39,880.000
SLC25A17 ST13
FIGURE 11.3
Background noise and signal profiles in a ChIP-Seq experiment. Shown here is the density
of mapped reads in one region of the human chromosome 22 for RNA polymerase II and the
transcription factor STAT1 (tracks 1 and 3, count from the top), respectively. Genes coded by
the two DNA strands in this region are displayed at the bottom. Tracks 2 and 4 show the dis-
tribution of mapped reads for the respective input DNA controls for the two proteins. It should
be noted that some of the peaks in the protein tracks are also present in their input controls.
Track 5 displays the fraction of uniquely mappable bases. (From J Rozowsky, G Euskirchen,
RK Auerbach, ZD Zhang, T Gibson, R Bjornson, N Carriero et al., PeakSeq enables systematic
scoring of ChIP-seq experiments relative to controls, Nature Biotechnology 2009, 27:66–75. With
permission.)
usually superimposed on the background noise. In the absence of control

samples, although the background noise could be estimated from modeling
of the ChIP-Seq data itself, the estimation cannot fully capture the inher-
ent complexity of the background noise and therefore experimental con-
trols should always be run. To further complicate the situation, the degree
of protein-binding sequence enrichment may also vary from location to
location, with some having strong signals and others more modest signals.
The degree of enrichment at each location is not necessarily a reflection of
their biological importance, as those with more modest enrichment may be
equally important as those at the top of the enrichment list.
After mapping, reproducibility between replicate samples and overall sim-
ilarity between different samples can be examined with the PCC. The PCC
can be calculated with tools such as GMD [290] using sample read counts
at each genomic location. In this calculation, regions that have no signals in
both samples should be excluded, as they lead to overestimation of the PCC.
For replicate samples in experiments of high reproducibility, the level of PCC
is expected to be >0.9. For unrelated samples, it is typically in the range of
0.3 to 0.4. For a successful run, the PCCs between replicate samples should
be much higher than those between ChIP and their control samples. Besides
PCC and the other aforementioned QC measures such as PBC, additional
QC analyses can also be performed. For example, visualization of the distri-
bution of mapped reads in the genome, using the visualization tools intro-
duced in Chapter 5, can offer further clues on data quality. This is especially
true when some specific binding regions have already been known for the
protein of interest. In comparison to those from control samples, sequence
reads from ChIP samples should show strong clustering in these regions.
11.3.2 Peak Calling
Peak calling, the process of finding regions of the genome to which the pro-
tein of interest binds, is a key step in ChIP-Seq data analysis. It is basically
achieved through locating regions where reads are mapped at levels signifi-
cantly above the background. The simplest way of peak calling is to count
the total number of reads mapped along the genome and call each location
with the number of mapped reads over a threshold as a peak. Due to the
inherent complexity in ChIP-Seq signal generation, including uneven back-
ground noise and other confounding experimental factors, this approach is
overly simplistic. Among the experimental factors, the way the immunopre-
cipitated DNA fragments are sequenced on most platforms has a direct influ-
ence on how peaks are called. Since the reads are usually short, only one end
or both ends of a fragment, instead of the entire fragment, are sequenced.
To locate a target protein’s binding regions, which are represented by the
immunoprecipitated DNA fragments and not just the generated reads, peak
calling algorithms need to either extend or shift the reads to cover the actual
binding areas. For example, PeakSeq extends each mapped read in the 3′
direction to reach the average length of DNA fragments [292]. Alternatively,

Kharchenko et al. [300] used a strategy to shift reads mapped to the two
opposite strands relative to each other (Figure 11.4).
The reads shift approach and the strand cross-correlation profile shown in
Figure 11.4 can also be used to evaluate ChIP-Seq data quality. When using
short reads (usually less than 100 bases) to analyze large target genomes,
which usually results in a significant number of reads being mapped to mul-
tiple genomic locations, a “phantom” peak also exists at a shift that equals to
the read length [301] (Figure 11.5). If a run is successful, the fragment-length
ChIP peak should be significantly higher than the read-length “phantom”
peak, as well as the background signal. The aforementioned ENCODE soft-
ware phantompeakqualtools provides two indices for the examination of
strand cross-correlation: (1) NSC, the ratio of the cross-correlation coefficient
at the fragment-length peak over that of the background; and (2) RSC, the
ratio of background-adjusted cross-correlation coefficient at the fragment-
length peak over that at the phantom peak.
Shifting reads mapped to the positive and negative strands toward the cen-
ter, or extending reads to reach the average fragment length, in order to count
the number of aggregated reads at each base-pair position is the first substep
to peak calling. As illustrated in Figure 11.6, peak calling involves multiple
substeps. First, a signal profile is created through smoothing of aggregated
read count across each chromosome. Subsequently, background noise needs
to be defined and the signals along the genome need be adjusted for the
background. One simple approach is to subtract read counts in the control
sample, if available, from the signal across the genome, or use the signal-to-
noise ratio. In the absence of a control sample, the background noise can be
modeled using Poisson or negative binomial distributions. Some peak callers
also use modeling to simulate background in their initial pass even when
control data is available. For example, PeakSeq uses background modeling in
its first pass to identify potential binding regions. In the second pass, to more
accurately adjust for the background using control data, the fraction of reads
located in the initially identified potential binding regions are excluded and
the reads in the remainder of the genome in the ChIP-Seq sample is normal-
ized to the control data by linear regression [292]. Some other peak calling
packages, such as MACS [293] and CisGenome [294], use similar approaches
for background adjustment using control data.
To call peaks from the background-adjusted ChIP-Seq signal, often-used
approaches include using absolute signal strength, signal enrichment in rela-
tion to background noise (shown in Figure 11.6), or a combination of both.
To facilitate determination of the signal enrichment, the statistical signifi-
cance is often computed using Poisson or negative binomial distributions.
Empirical estimation of the FDR can be carried out by first calling peaks
using control data (i.e., false positives), and subsequently calculating the
ratio of peaks called from the control to those called from the ChIP sample.
60 0.14
Protein 10
40 0.12
+
− 5 0.10
20
0.08
0 0
Tag counts
0.06
Tag density
−20 0.04
−5
Crosslink 0.02
−40
Fragmentation
Strand cross-correlation coefficient

Positive-strand tag −10
0.00
Negative-strand tag −100 −50 0 50 100 150 200 250 300
110,500,100 110,500,200 110,500,300
Position on chromosome 1 Relative strand shift
(a) (b) (c)
FIGURE 11.4
The distribution of ChIP-Seq reads around the actual binding region and their positional shift on the two DNA strands. (a) How ChIP-Seq reads are
Mapping Protein–DNA Interactions with ChIP-Seq
produced from cross-linked and fragmented DNA. The cross-linking between the protein and the bound DNA can occur at different sites, as does
the fragmentation of the DNA. Each fragment is read at its 5′ end (indicated by the squares). These reads, serving as sequence tags of each fragment,
are clustered around the actual binding region from the two sides depending on which strand they come from. The dashed line depicts a fragment
from a long cross-link. (b) The distribution of sequence tag signal around the binding region. Vertical lines represent counts of sequence tags whose
5′ end maps to each nucleotide position on the positive and negative strands (displayed as positive and negative values, respectively). The solid curves
represent smoothed tag density along each strand. Since the two curves approach the binding site from the two sides, there is a gap between their
peaks. (c) Strand cross-correlation associated with shifting the strands across the gap. Before shifting the strands, the Pearson correlation coefficient is
calculated between the tag density of the two strands. When sequence tags mapped to the two strands are shifted relative to each other (shown on the
x-axis), the Pearson correlation coefficient gradually changes (y-axis). The dashed line at x = 0 corresponds to the strand cross-correlation before the shift,
while the one at the peak corresponds to the highest cross-correlation coefficient at the strand shift that equals to the average length of the DNA frag-
ments. (From PV Kharchenko, MY Tolstorukov, PJ Park, Design and analysis of ChIP-seq experiments for DNA-binding proteins, Nature Biotechnology
2008, 26:1351–1359. With permission.)
151
“Phantom” peak ChIP peak
0.0400.045
Cross-correlation
0.035 0.030
0 100 200 300 400

Strand shift
Successful Marginal Failed
0.035 0.040 0.045 0.050 0.055 0.060 0.065 0.070
0.010 0.012 0.014 0.016 0.018

cc(fragment_length)
0.04 0.06 0.08 0.10 0.12 0.14
Cross-correlation
Cross-correlation
Cross-correlation
cc(read_length)
min(cc)
0 100 200 300 400 0 100 200 300 400 0 100 200 300 400
Strand shift Strand shift Strand shift
cc(fragment length) cc(fragment length)−min(cc)
NSC = RSC =
min(cc) cc(read length)−min(cc)
FIGURE 11.5
The “phantom” peak and its use in determining ChIP-Seq data quality. The phantom peak
corresponds to the cross-correlation at the strand shift that equals to the read length, while
the ChIP peak corresponds to the cross-correlation at the shift of the average DNA fragment
length. A successful run is characterized by the existence of a predominant ChIP peak and a
much weaker phantom peak. In marginally passed or failed runs, the former diminishes while
the latter relatively becomes much stronger. (Adapted from SG Landt, GK Marinov, A Kundaje,
P Kheradpour, F Pauli, S Batzoglou, BE Bernstein et al., ChIP-seq guidelines and practices of the
ENCODE and modENCODE consortia, Genome Research 2012, 22(9):1813–1831. With permis-
sion. ©2012 Cold Spring Harbor Laboratory Press.)
After peak calling, artifactual peaks need to be filtered out, including those
that contain only one or a few reads that are most possibly due to PCR arti-
facts, or those that involve significantly imbalanced numbers of reads on the
two strands (see Figure 11.6).
For implementation of this peak calling process, different peak callers use
different methods, which can lead to differences in final outcomes. Table 11.1
shows some of the currently available peak callers. PeakSeq, MACS/MACS2,
HOMER (findPeaks module) [302], and SPP [300] are among some of the pop-
ular ones. As previously mentioned, the peak calling employed in PeakSeq
is a two-pass process. In the second pass, peaks are called by scoring reads-
enriched target regions based on calculation of the fold enrichment in the
Generate signal profile Define background

along each chromosome (model or data)
ChIP Tag shift Control

data data
Tag count
Tag count
Position (bp) Position (bp)
Identify Peak region

peaks in
ChIP
Tag count
signal
Enrichment relative
to background
Position (bp)
Assess significance
Filter artifacts
P(s)
sthresh Tags
S Position (bp)
FIGURE 11.6
Basic substeps of calling peaks from ChIP-Seq data. The P(s) at bottom left signifies the prob-
ability of observing a location covered by S mapped reads, and the sthresh marks the thresh-
old for calling a peak significant. Bottom right shows two types of possible artifactual peaks:
single strand peaks and those based on mostly duplicate reads. (From S Pepke, B Wold, A
Mortazavi, Computation for ChIP-seq and RNA-seq studies, Nature Methods 6, 2009:S22–S32.
With permission.)
TABLE 11.1
ChIP-Seq Peak Calling Algorithms
Name Description Reference
CCAT Designed to identify weak ChIP signals 303
CisGenome Features multifaceted interactive analysis and 294
customized batch-mode computation
E-RANGE A Python package for both ChIP-Seq and RNA-Seq data 304
analysis
F-Seq Generates continuous genomic sequence density data 305
for easier visualization and interpretation
GLITR Uses classification to identify regions that have peak 306
height and fold-change not resembling those in control
HOMER Identifies peaks based on the principle that more 302
(findPeaks sequencing reads are found in these regions than
module) expected by chance
MACS/MACS2 Empirically models ChIP-Seq read length to improve 293
peak prediction, uses a dynamic Poisson distribution
PeakSeq Based on a two-pass strategy to compensate for open 292
chromatin signal
PeakRanger Uses a staged algorithm to discover enriched regions 307
and the summits within them
QuEST A statistical framework based on kernel density 308
estimation
RSEG Especially developed for locating genomic regions 309
associated with histone marks
SICER Uses a clustering approach to identify enriched 310
domains from histone modification ChIP-Seq data
SiSSRs Uses the direction and density of reads and the average 311
DNA fragment length to identify binding sites
SPP Includes binding profile normalization, peak detection, 300
and estimation of read depth to achieve peak saturation
USeq Empirical algorithms to reduce false positives and 312
estimate confidence in ChIP-Seq peaks
ZINBA Models and accounts for factors covarying with 313
background or true signals
ChIP-Seq sample versus the control, and the statistical significance associ-
ated with each enriched target region is calculated from binomial distribu-
tion. The MACS/MACS2 method was one of the earliest developed methods
and a good overall peak caller. It reduces analysis bias through the use of
control data and local statistics and generates an empirical FDR. The find-
Peaks module in HOMER identifies peaks based on the principle that more
sequencing reads are found in these regions than expected by chance. SPP
is an R package designed for analyzing Illumina-generated ChIP-Seq data. It
calculates a smoothed read enrichment profile along the genome and identi-
fies significantly enriched sites compared to input control.
To ensure the robustness of analysis results, it is recommended to use more

than one method for peak calling. Although IDR is usually used to mea-
sure the rate of irreproducible discoveries, which are peaks that are called in
one replicate sample but not in another, it can also be used to compare peak
calling results generated from different methods. The original use of IDR
in assessing replicate reproducibility is based on the rationale that peaks of
high significance are more consistently ranked across replicates and there-
fore have better reproducibility than those of low significance. As shown in
Figure 11.7, to compare a pair of ranked lists of peaks identified in two repli-
cates, IDR are plotted against the total numbers of ranked peaks. Since IDR
computation relies on the use of both high significance (more reproducible)
and low significance (less reproducible) peaks, peak calling stringency needs
to be relaxed to allow generation of both high and low confidence calls. The
transition in this plot from reliable signal gradually to noise is an index of
overall experimental reproducibility. Because IDR is independent of any par-
ticular peak-calling method, it can be applied to compare the performance
of different peak calling methods on a particular data set and therefore help
pick the most appropriate method(s) (Figure 11.8). IDR can also be used to
evaluate reproducibility across experiments and labs.
For proteins that bind to specific genomic sites, the fraction of reads in
peaks (or FRiP) is an index of immunoenrichment and ChIP-Seq data qual-
ity. Usually only a small percentage of reads map to peak regions, and the
majority of reads only represent background. As a general guideline, the
ENCODE consortium sets 1% as the minimum for an acceptable FRiP with
0.6
150
0.5
Score of replicate 1
Irreproducible
signals
0.4
100
IDR
0.3
0.2
50
Reproducible
0.1
signals
0.0
0
0 20 40 60 80 100 120 140 0 5000 10,000 20,000 30,000

Score of replicate 2 Number of significant peaks
(a) (b)
FIGURE 11.7
Use of irreproducible discovery rate (IDR) in assessing replicate reproducibility. (a) The distri-
bution of the significance scores of the peaks identified in two replicate experiments. The IDR
method computes the probability of being irreproducible for each peak, and classifies them as
being reproducible (black) or irreproducible (gray). (b) The IDR at different rank thresholds
when the peaks are sorted by the original significance score. (From T Bailey, P Krajewski,
I Ladunga, C Lefebvre, Q Li, T Liu, P Madrigal, C Taslim, J Zhang, Practical guidelines for the
comprehensive analysis of chip-seq data, PLoS Computational Biology 9, 2013:e1003326. Used
under the terms of the Creative Commons Attribution License, http://creativecommons.org
/licenses/by/3.0/, ©2013 Bailey et al.)
0.5
0.4
0.3
IDR
0.2
0.1
0
0
00
0
00
00
00
50
25
10
15
20
Number of peaks
FIGURE 11.8
Evaluation of the performance of six peak callers using IDR. (Original study from Y Chen, N
Negre, Q Li, JO Mieczkowska, M Slattery, T Liu, Y Zhang et al., Systematic evaluation of factors
influencing ChIP-seq fidelity, Nature Methods 9, 2012:609–614. With permission.)
MACS as the peak caller using default parameters. As they can vary with the
use of different peak callers and parameters, FRiP values must be derived
from the same algorithm using same parameters in order for them to be
comparable across samples or experiments.
11.3.3 Peak Visualization
Visualizing peaks in their genomic context allows identification of overlap-
ping or nearby functional elements, and thereby facilitates peak annotation
and data interpretation. Many peak callers generate BED files containing
peak chromosomal locations, along with WIG and bedGraph track files,
all of which can be uploaded to a genome browser for peak visualization.
Examination of peak regions in a genome browser and comparison with other
data/annotation tracks allow identification of associated genomic features,
such as promoters, enhancers, and other regulatory regions. BEDTools can
also be applied to explore relationships between peaks and other genomic
landmarks such as nearby protein-coding or noncoding genes.
11.4 Differential Binding Analysis

Binding of DNA-interacting proteins to their target genomic regions is
a quantitative process, that is, they occupy these regions at different rates
under different conditions. This is due to regional accessibility, presence/
absence of other protein partners, and/or other factors that regulate their
binding. Differential binding analysis answers the question of how a target
protein changes its DNA-binding pattern under different conditions. There

are two different approaches for this analysis, with one qualitative and the
other quantitative. The qualitative approach compares peaks called in dif-
ferent conditions, and divides them into “shared” and “unique” [316]. This
approach is simple but it does not use the quantitative information gener-
ated in the peak calling process, so it is best used to produce a rough ini-
tial estimation of differential binding. The quantitative approach, based on
analysis of read counts or read densities in peak regions, generates statisti-
cal assessment of the degree of differential binding between conditions. As
this is similar to the RNA-Seq-based differential expression analysis, data
normalization is required to adjust for systematic biases that are unrelated
to biological factors. For the comparison of two or more ChIP-Seq samples,
such biases include immunoprecipitation efficiency and sequencing depth.
Similar to normalizing RNA-Seq data, adjusting for sequencing depth is
the simplest approach. In this approach, the total numbers of reads in differ-
ent samples are adjusted by multiplying a scaling factor to each sample to the
same target level, for example, the median or lowest total read count among
the samples. The basic assumption for this approach is that the overall num-
ber of binding sites for a target protein does not change across different
experimental conditions. Although this approach is simple and straightfor-
ward, it does not take into consideration the differences in the signal-to-noise
ratios that are often observed in different samples. If one sample library is
noisier and contains more background reads, these reads, while not repre-
senting true signals, are still counted in the total read number. This situation
will therefore lead to bias in the normalized data.
There are several currently available normalization approaches that
consider this issue of signal-to-noise ratio variation among samples. For
example, the normalization procedure used in diffReps first identifies and
removes regions with low read count (mostly background noise) [295]. The
subsequent normalization is then based on the remaining regions, using a
linear procedure similar to that used by DESeq. Another similar approach
uses only reads mapped to peaks. In this modified sequencing depth-based
normalization approach, the total number of reads mapped to the peak
regions are used as the basis for calculating scaling factor for each sample
[296]. Using this approach, the normalized peak signal is computed as the
original peak sequence read count being scaled by the sum of read counts of
all peaks, that is,
Xi, j
Zi, j =
∑
N
Xi, j
j=1

where Zi,j and Xi,j are the normalized and original peak signal for sample i
and peak j, and N is the total number of called peaks.
Normalization methods that were previously developed for microarray

data have also been adapted for ChIP-Seq data. MAnorm uses a nonlinear
normalization process [297] that is similar to the MA plot approach used for
microarray data. ChIPnorm uses a modified version of quantile normaliza-
tion [298]. A locally weighted regression (LOESS) normalization approach
for ChIP-Seq data [299] is similar to the LOESS procedure applied to cDNA
microarray data normalization. All these approaches assume that the overall
binding profile of the target protein does not vary across different conditions.
Besides all the normalization approaches introduced earlier, good experi-
mental design and consistent experimental procedure can minimize data
variability in different samples and groups, thereby alleviating the burden
on posterior normalization. For example, processing all samples side by side
using the same experimental procedure and parameters, such as the same
antibody, by the sample operator, will minimize sample-to-sample variabil-
ity. When conducting an experiment in this way, the simpler normalization
approach based on total library read count can be sufficient.
Since the ChIP-Seq-based quantitative analysis of differential binding is
similar to the RNA-Seq-based differential expression analysis, packages
such as edgeR and DESeq can be applied here. Table 11.2 lists some of the
packages that are designed for ChIP-Seq differential binding analysis. Like
those devised for RNA-Seq-based differential expression analysis, these
TABLE 11.2
Packages Developed for ChIP-Seq Differential Binding Analysis
Name Description Reference
ChIPComp Differential binding analysis taking into consideration controls, 317
signal-to-noise ratios, replicates, and multifactor experimental
design
ChIPDIff Differential histone mark analysis based on Hidden Markov model 318
ChIPnorm Carries out quantile normalization for differential binding sites 298
identification
ChromaSig Performs unsupervised learning to determine significant patterns 319
of chromatin modifications across multiple experiments
DBChIP Identifies differentially bound punctate binding sites in multiple 320
conditions using RNA-Seq differential expression approaches
and accommodates controls
DiffBind Uses statistical tests used in RNA-Seq packages edgeR and DESeq 321
to process peak sets and identify differentially bound regions
diffReps Detects and annotates differential chromatin modification hotspots 295
DIME Differential binding analysis using a finite exponential-normal 322
mixture model
MAnorm Conducts an MA-plot-based normalization prior to quantitative 297
comparison
MMDiff Takes a multivariate nonparametric approach to testing differential 323
binding
packages are designed on certain assumptions and therefore the user needs
to be aware of these assumptions and ensure they are fulfilled prior to using
them. For example, DIME is based on the assumption that a large proportion
of peaks are common across the conditions under comparison.
11.5 Functional Analysis
Often the data gathered from a ChIP-Seq study is used to understand gene
expression regulation and associated biological functions. To conduct func-
tional analysis, peaks are first assigned to nearby genes. While it is debatable
on what genes a peak should be assigned to, a straightforward approach
is to assign it to the closest gene. Once peaks are assigned to target genes,
an integrated analysis of ChIP-Seq and gene expression data (more on this
later) can be carried out. Furthermore, Gene Ontology (GO), biological path-
way, gene network, or gene set enrichment analyses can be conducted using
similar approaches as described in Chapter 7. Prior to carrying out these
gene functional analyses, one should also bear in mind that the peak-to-gene
assignment process is biased by gene size, as the presence of peak(s) has a
positive correlation with the length of a gene. In addition, the distribution
of gene size in different functional annotations such as GO categories is not
uniform, with some categories having an excess number of long genes and
others having more short genes. To solve the problems caused by different
gene size, methods that adjust for the effects of gene size should be used,
such as ChIP-Enrich [324].
11.6 Motif Analysis
One of the goals of ChIP-Seq data analysis is to identify DNA-binding motifs
for the protein of interest. A DNA-binding motif is usually represented by
a consensus sequence, or more accurately, a position-specific frequency
matrix. Figure 11.9a shows an example of such a DNA-binding motif, the one
bound by a previously introduced transcription factor NRF2 (see Chapter 2).
To identify motifs from ChIP-Seq data, all peak sequences need to be assem-
bled and fed into multiple motif discovery tools. Some of the commonly
used motif discovery tools are Cistrome [325], Gibbs motif sampler (part of
CisGenome), HOMER (findMotifs module), MEME-ChIP [326], QuEST [308],
RSAT peak-motifs [327], and ChIPMunk [328]. The motif discovery phase
usually ends up with one or more motifs, with one being the binding site
of the target protein and others being that of its partners. The discovered
Consensus
2.0
Bits
1.0
0.0
(a)
De novo motif
2.0
Bits
1.0
0.0
(b)
FIGURE 11.9
The consensus DNA binding motif of the transcription factor NRF2. (a) The currently known
NRF2-binding motif. (b) The result of a de novo motif analysis using NRF2 ChIP-Seq data.
(From BN Chorley, MR Campbell, X Wang, M Karaca, D Sambandan, F Bangura, P Xue, J Pi,
SR Kleeberger, DA Bell, Identification of novel NRF2-regulated genes by ChIP-Seq: Influence
on retinoid X receptor alpha, Nucleic Acids Research 2012, 40(15):7416–7429. With permission.)
motif(s) can be compared with currently known motifs to detect similarities,

find relationships with other motifs, or locate other proteins that might bind
at or near the peak region as part of a protein complex. Tools for motif com-
parison include STAMP [329] and Tomtom [330]. Motif enrichment analysis
can also be carried out to find out if other known motifs are enriched in
the peak regions using tools such as CentriMo [331]. Finally motif scanning
and mapping by tools like FIMO [332] allows visualization of the discovered
motif(s) in the ChIP-Seq peak areas. Some of these tools have been integrated
into motif analysis pipelines, such as the MEME Suite (http://meme-suite
.org), which includes MEME-Chip, Tomtom, CentriMo, and FIMO.
11.7 Integrated ChIP-Seq Data Analysis

Because genomic functions are to a large degree controlled by concerted
binding of a wide array of DNA-interacting proteins, integrated analysis of
ChIP-Seq data sets generated for a multitude of these proteins affords new
opportunities to gain a comprehensive overview of the functional states of
a genome and the host cell. As a good example, such an integrated analysis
has led to the discovery of a large number of chromatin states, each of which
display distinct sequence motifs and functional characteristics [333]. The dis-
covery of these chromatin states was achieved with the use of a multivariate
hidden Markov model on a large collection of ChIP-Seq data, generated for
38 different histone methylation and acetylation marks, H2AZ (a variant of
histone H2A), RNA polymerase II, and CTCF (a transcriptional repressor).
Besides meta-analysis of multiple ChIP-Seq data sets, integrated analysis of
ChIP-Seq with other genomics data, such as RNA-Seq data, offers further
information on genome function and regulation. The majority of protein fac-
tors used in various ChIP-Seq studies are transcription factors and histones
that carry a large array of modified marks, all of which are key regulators of
genome transcription. Coupled analysis of matched ChIP-Seq and RNA-Seq
data augments the utility of both data types, and provides new insights that
cannot be obtained from analyzing either data type alone. To carry out inte-
grative analysis of ChIP-Seq and RNA-Seq data, Bayesian mixed models [334]
can be applied. In addition, tools such as CEAS [314] and ChIPpeakAnno
[315] can also be used to help investigate the correlation between the DNA
binding profile and regulation of nearby gene transcription.
12
Epigenomics and DNA Methylation Analysis
by Next-Generation Sequencing (NGS)
The genomic information embedded in the primary nucleotide sequence of

DNA is modulated by epigenomic code generated from chemical modifica-
tions of DNA bases and key DNA-interacting proteins such as the histones.
The methylation of cytosines leading to the formation of 5-methylcytosines
(5mCs), for example, provides a major means for the modification of the pri-
mary DNA code. As detailed in Chapter 2, DNA methylation plays important
roles in many biological functions such as embryonic development, cell dif-
ferentiation, and stem cell pluripotency, by regulating gene expression and
chromatin remodeling. Abnormal patterns of DNA methylation, on the other
hand, lead to diseases such as cancer. DNA methylome analysis, as a key
component of epigenomics, has for many years been conducted with the use
of microarrays (such as the Illumina Infinium 450K BeadChips). Although
microarrays are low-cost and easy to use, their inherent constraints, such as
limited genomic coverage from the use of preselected probes and being avail-
able for only a few model organisms, have limited their use. In comparison,
next-generation sequencing (NGS) offers a more unbiased, comprehensive,
and quantitative approach for the study of DNA methylation status in a wide
array of species. This chapter is focused on DNA methylation sequencing
data generation and analysis. For epigenomic studies that involve interroga-
tion of histone modifications, ChIP-Seq (covered in Chapter 11) can be used.
12.1 DNA Methylation Sequencing Strategies

Because the DNA polymerases used in the regular NGS sequencing library
construction process cannot distinguish methylated from unmethylated
cytosines, the DNA methylation pattern is usually not retained in the pro-
cess. In order to study DNA methylation status with NGS, two strategies are
usually used, with one based on bisulfite conversion and the other on meth-
ylated DNA enrichment. The first strategy employs a chemical conversion
process, which uses sodium bisulfite to deaminate unmethylated cytosines.
After the conversion, unmethylated cytosines in a DNA molecule are con-
verted to uracils, while 5mCs in the same molecule are retained since they
are nonreactive. The subsequent sequencing of the converted DNA, therefore,
163
reads unmethylated cytosines as thymines, and methylated cytosines still

as cytosines. The efficiency and specificity of this process can be monitored
and optimized through the use of certain methylated and unmethylated
DNAs as controls. Based on genomic coverage, bisulfite conversion-based
DNA methylation sequencing, or simply bisulfite sequencing, can be further
divided into different subcategories.
12.1.1 Whole-Genome Bisulfite Sequencing (WGBS)

As the name suggests, whole-genome bisulfite sequencing (WGBS) analyzes
cytosine methylation in the entire genome, that is, the methylome. In pre-
paring WGBS libraries from total genomic DNA, regular DNA library con-
struction protocols need to be modified. For example, if adapters are added
prior to the bisulfite conversion step, they must not contain unmethylated
cytosines, that is, all cytosines in the adapter sequence must be methyl-
ated. In the polymerase chain reaction (PCR) step, a polymerase that can
tolerate uracil residues needs to be used. As a result of the conversion and
subsequent PCR amplification, the two DNA strands that were originally
complementary are no longer complementary. Instead, four strands that are
distinct from the original complementary strands are generated (Figure 12.1).
Furthermore, the conversion leads to reduced sequence complexity due to
Watson >>ACmGTTCGCTTGAG>> Cm Methylated

Crick <<TGCmAAGCGAACTC<< C Unmethylated
(1) Denaturation
Watson >>ACmGTTCGCTTGAG>> Crick <<TGCmAAGCGAACTC<<
(2) Bisulfite treatment
BSW >>ACmGTTUGUTTGAG>> BSC <<TGCmAAGUGAAUTU<<
(3) PCR amplification
BSW >>ACmGTTTGTTTGAG>> BSC <<TGCmAAGTGAATTT<<

BSWR <<TG CAAACAAACTC<< BSCR >>ACG TTCACTTAAA>>
FIGURE 12.1
Major steps of bisulfite sequencing. Prior to bisulfite treatment, the two strands of DNA are
first separated by denaturation. The bisulfite treatment then converts unmethylated, but not
methylated, cytosines to uracils. The two strands from the treatment, BSW and BSC, are then
subjected to PCR amplification. This leads to the generation of four strands (BSW, BSWR, BSC,
and BSCR), all of which are distinct from the original Watson and Crick strands. (From Y Xi,
W Li, BSMAP: Whole genome bisulfite sequence MAPping program, BMC Bioinformatics 2009,
10:232. Used under the terms of the Creative Commons Attribution License, http://creative
commons.org/licenses/by/2.0, ©2009 Xi and Li.)
Epigenomics and DNA Methylation Analysis by NGS 165
underrepresentation of cytosines in the generated reads. Without the use of

an external sequencing library to create a calibration table for the base caller,
the reduced sequence complexity will lead to a high base call error rate.
Therefore, use of such a calibration library, such as the phiX174 control library
for Illumina sequencing, is needed for bisulfite sequencing data generation.
The power to detect DNA methylation levels, and differentially methyl-
ated sites or regions between different experimental conditions (e.g., dis-
ease versus normal), is dependent on the sequencing depth and the number
of biological replicates. The National Institutes of Health (NIH) Roadmap
Epigenomics Project recommends at least two replicates per condition with
a combined depth of at least 30× [335]. While this can be used as a general
guideline for many projects, key statistical issues, that is, within-condition
biological variation and between-condition difference, determine the actual
detection power. Consistent with the aforementioned recommendations,
currently available data suggests a per-sample coverage of 5× to 15× [336].
Sequencing above this range may not be as cost-effective as adding more
biological replicates in reaching higher detection power.
12.1.2 Reduced Representation Bisulfite Sequencing (RRBS)

Although WGBS enables detection of methylation in the entire genome, the cost
associated with such analyses was high at the earlier days of NGS. To reduce
the cost, strategies such as reduced representation bisulfite sequencing (RRBS)
[337] were devised. To perform RRBS, genomic DNA is first digested with a
methylation-insensitive restriction enzyme (such as MspI) that recognizes
CpG-containing restriction sites. The digested DNA products are then sepa-
rated and size selected to pick fragments in a certain size range for bisulfite
conversion and then sequencing. While it only interrogates a few percent of the
genome, RRBS provides a rough survey of DNA methylation in the genome. If
particular region(s) of the genome are found to be of special interest, they can be
captured for subsequent sequencing using approaches such as ligation capture
[338,339], bisulfite padlock probes [340], or liquid hybridization capture [341].
12.1.3 Methylation Sequencing Based on Methylated DNA Enrichment

Different from the aforementioned bisulfite conversion-based methods, the
methylated DNA enrichment strategy captures methylated DNA for tar-
geted sequencing. The target DNA capturing is achieved with the use of
5mC antibodies or proteins that bind to methylated cytosines. One of the
methods based on this strategy is MeDIP-Seq, or methylated DNA immuno-
precipitation coupled with NGS. In this method, antibodies against 5mC are
used to precipitate methylated single-stranded DNA fragments for sequenc-
ing. Another commonly used method is MBD-Seq, or methyl-CpG-binding
domain capture (MBDCap) followed by NGS. MBD-Seq utilizes proteins
such as MBD2 or MECP2 that contain the methyl-CpG binding domain
to enrich for methylated double-stranded DNA fragments. In one type of

MBDCap method called MIRA (Methylated-CpG Island Recovery Assay), a
protein complex of MBD2 and MBD3L1 (methyl-CpG-binding domain pro-
tein 3-like-1) is used to achieve enhanced affinity to methylated CpG regions.
While MeDIP-Seq and MBD-Seq usually generate highly concordant results,
there are some differences between these two approaches. MeDIP-Seq can
detect both CpG and non-CpG methylation, while MBD-Seq is focused on
methylated CpG sites because of the binding affinity of MBD. At methylated
CpG sites, MeDIP tends to enrich at regions that have low CpG density, while
MBD-Seq favors regions of relatively higher CpG content [342,343].
In principle, these enrichment-based methods are very similar to ChIP-
Seq (Chapter 11), based on the same process of specific protein-based DNA
capture, protein-DNA complex affinity binding, and target DNA elution.
Likewise, their sequencing data generation and subsequent analysis are also
similar to those in ChIP-Seq. Therefore, the data analysis methods covered
in Chapter 11 equally apply to the analysis of sequencing data generated
by MeDIP-Seq, MBD-Seq, or other methylated DNA enrichment-based NGS
methods. This chapter is, therefore, mostly focused on the analysis of bisul-
fite sequencing data.
12.1.4 Differentiation of Cytosine Methylation from Demethylation

Products in Bisulfite Sequencing
Among the three 5mC demethylation intermediate products—5hmC, 5fC,
and 5caC (see Chapter 2)—5hmC is not reactive to the sodium bisulfite,
whereas 5fC and 5caC are reactive and converted to uracils. During the sub-
sequent sequencing, as a consequence, 5hmC cannot be differentiated from
5mC, while 5fC/5caC cannot be differentiated from unmethylated cytosines.
However, since these demethylation products are usually at levels that are
much lower than 5mC or unmethylated cytosines in cells, their interference is
minimal. For samples prepared from the brain or embryonic stem cells where
5hmC is relatively high, strategies such as oxBS-Seq [344] are available to dif-
ferentiate 5mC from 5hmC. Some third-generation single-molecule sequenc-
ing technologies, such as the Pacific Biosciences’s SMRT sequencing and
nanopore sequencing, have been shown to be capable of differentially detect-
ing these modifications without relying on bisulfite conversion [345–347].
12.2 DNA Methylation Sequencing Data Analysis

12.2.1 Quality Control and Preprocessing
After raw data generation, the quality control (QC) step removes low-quality
reads or base calls as they directly affect subsequent alignment to the reference
genome and DNA methylation site identification. The general data QC steps
detailed in Chapter 5 should be performed for their removal. Other QC steps
include adapter trimming, as some sequencing reactions may run through
DNA inserts into adapters. In addition, for MspI-digested RRBS libraries, the
DNA fragment end repair step during the library construction artificially
introduces two bases (an unmethylated cytosine and a guanine) to both
ends, both of which should be trimmed off as well. Tools such as Trim Galore
(a wrapper tool using Cutadapt and FastQC) [348] can be used for these
trimming steps, especially removing the two artificially introduced bases
in RRBS reads derived from MspI digestion. Besides these general-purpose
QC tools, some packages designed for bisulfite sequencing reads processing,
including BSmooth [349] and WBSA [350], also contain QC modules.
12.2.2 Read Mapping
In order to identify methylated DNA sites, sequencing reads derived from
bisulfite conversion or methylated DNA enrichment need to be first mapped
to the reference genome. Mapping of reads generated from the enrichment-
based methods is rather straightforward, and like mapping ChIP-Seq reads,
is usually conducted with general aligners, such as Bowtie, BWA, or SOAP.
Mapping of bisulfite sequencing reads, however, is less straightforward. This
is because through the bisulfite conversion and the subsequent sequencing
process, a converted unmethylated cytosine is read as a thymine (T), or an
adenine (A) on the complementary strand, whereas a methylated cytosine
remains as a cytosine (C), or a guanine (G) on the complementary strand (see
Figure 12.1). The conversion therefore has several implications for the read
mapping process:
• Fuzziness in mapping—A T in the reads could be mapped to a C or T

in the reference sequence, thus complicating the searching process.
• Increase in search space—This is partly caused by the non one-to-one
mapping, and more seriously, by the generation of the four bisulfite-
converted strands that are distinct from the reference strands (also
as illustrated in Figure 12.1), leading to a significant increase in
search space.
• Reduction in sequence complexity—The amount of C’s in the bisul-
fite reads is significantly reduced, and this reduction in sequence
complexity leads to higher levels of mapping ambiguity. Conse
quently, aligning bisulfite sequencing reads to the reference genome
is not as straightforward as that for ChIP-Seq or other DNA deep
sequencing data.
There are two general strategies for mapping bisulfite sequencing reads:
(1) replacing all C’s in the reference genome with the wild-card letter Y to
match both C’s and T’s in the reads; and (2) converting all C’s in the refer-
ence sequence and reads to T’s, and then aligning with a seed-and-extend
approach. Aligners that use the wild-card approach include BSMAP [351],
Pash [352], and RRBSMAP (a version of BSMAP specifically tailored for RRBS
reads) [353]. In the example of BSMAP, it uses SOAP for carrying out read
alignment, and deploys genome hashing and bitwise masking for speed and
accuracy. BSMAP indexes the reference genome using a hash table contain-
ing original reference seed sequences and all their possible bisulfite conver-
sion variants through the replacement of C’s with T’s. After determining the
potential genomic position of each read by looking up the hash table, for the
T’s in each bisulfite read that are mapped to reference genome position(s)
where the original reference bases are C’s, BSMAP masks as C’s. The masked
bisulfite reads are then mapped again to the reference genome.
Aligners such as BatMeth [354], Bismark [355], BRAT-BW [356], BS-Seeker/
BS-Seeker2 [357,358], and MethylCoder [359] use the other three-letter
approach. Among these aligners, Bismark is commonly used. To carry out
its alignment (illustrated in Figure 12.2), Bismark first converts C’s in the
reads into T’s, and G’s into A’s (equivalent of the C-to-T conversion on the
Genomic fragment
Sequence after bisulfite
treatment
Read conversion
(1) (2)
Align to bisulfite
converted genomes
(3) (4)
Forward strand C-to-T converted genome Forward strand G-to-A converted genome
(1) (2) (3) (4) Read all four alignment

outputs simultaneously
to determine if the
sequence can be
mapped uniquely
Determine unique best alignment
FIGURE 12.2
The “three-letter” bisulfite sequencing read alignment approach used by Bismark. (Adapted
from F Krueger, SR Andrews, Bismark: A flexible aligner and methylation caller for Bisulfite-
Seq applications, Bioinformatics 2011, 27:1571–1572. With permission.)
complementary strand). This conversion process is also performed on the

reference genome. The converted reads are then aligned, using Bowtie or
Bowtie2, to the converted reference genome in four parallel processes (also
refer to Figure 12.1), out of which a unique best alignment is determined
(alignment 1 in Figure 12.2). Some benchmark studies [360] found that in
comparison with other aligners, Bismark offers a good combination of speed,
accuracy, and genomic region coverage.
After mapping, distribution of the mapped reads in the genome should
be examined. This provides an initial survey of the results, and at the same
time it also serves as an additional QC step. For example, duplicate reads
that map exactly to the same position are most likely PCR artifacts and
should be removed from further analysis. Other abnormalities in distribu-
tion, such as significantly unbalanced numbers of reads mapped to the two
DNA strands in a genomic region, should be checked with caution, and
the reads may need to be filtered out. Some tools, such as BSeQC [361], also
carry out postalignment QC processing using the SAM/BAM alignment
files as input.
12.2.3 Quantification of DNA Methylation

After bisulfite read mapping, uniquely mapped reads need to be aggregated
to quantify the methylation level (also called β-value) at individual cytosine
sites in the reference genome, based on the frequency of C’s (methylated
cytosines) and T’s (unmethylated cytosines) in reads mapped to each of these
sites. This quantitative step can be performed by dividing the total number
of C’s by the total combined number of C’s and T’s that are mapped to each
site. All of the bisulfite sequence mappers introduced in the previous section
generate this information. Postmapping tools such as GBSA [362] and methyl-
kit [363] can also be used for methylation quantification. For this quantifica-
tion step, it should be noted that the involved calculations usually require
a minimum depth (e.g., at least three reads) at the individual sites to avoid
deriving unreliable methylation levels from too few reads.
Besides quantifying methylation levels at individual cytosine sites, DNA
methylation quantification is also often calculated on a regional basis, usu-
ally performed to facilitate comparisons between multiple samples. Different
approaches can be used for regional DNA methylation quantification. One of
the approaches is to divide the genome into a number of bins, and the mean
of methylation levels at individual cytosine sites within each bin is used to
represent the binned area. Alternatively, each bin’s methylation level can be
calculated as the overall proportion of methylated cytosines among all cyto-
sines within the bin. Other approaches also use sliding windows, instead of
individual bins, for regional methylation quantification.
These calculations, however, do not take into consideration the possible
existence of SNPs that involve the change from C to T. Some algorithms,
such as Bis-SNP, remove this potential confounding factor by distinguishing
bisulfite conversion from genetic variants. The use of sequence reads from
the complementary strand makes this possible, because a T produced from
bisulfite conversion will have a G on the opposite strand, whereas a C → T
SNP will have an A on the other strand.
Different from the bisulfite-conversion-based sequencing methods, the
methylated DNA enrichment sequencing approaches such as MeDIP-Seq
and MBD-Seq cannot quantify methylation at the single-nucleotide resolu-
tion. In addition, the absolute levels of DNA methylation cannot be obtained
from the enrichment-based methods, as the sequence read counts from
these methods are a function of both absolute DNA methylation levels and
regional CpG content. Since these approaches are based on affinity immuno-
precipitation and more similar to ChIP-Seq, analytical methods developed
for ChIP-Seq data analysis, including background determination, normal-
ization, and peak detection, can be applied for quantification of DNA meth-
ylation by these approaches. As an output, the degree of DNA methylation
can be summarized as coverage over a predefined region, such as per gene,
promoter, or certain-sized bin.
12.2.4 Visualization of DNA Methylation Data

Visualizing DNA methylation data serves at least two purposes. First, the
distribution pattern of DNA methylation may be discerned through visu-
alization. Second, visual examination of known DNA methylation regions
and other randomly selected regions also offers data validation and a quick
estimate of data quality. One method to visualize bisulfite sequencing data
and associated information, such as depth of coverage, is through the use
of bedGraph files. This standard format (Figure 12.3), compatible with most
genome browsers and tools including the Washington University EpiGenome
Browser [364], can be directly generated from many of the methylation quan-
tification tools such as Bismark, GBSA, and methylkit. Figure 12.4 shows
an example of displaying methylation level along with read depth in the
genome.
Alternatively, DNA methylation quantification results can be saved in tab-
delimited files and then converted to bigBed or bigWig formats [365]. Both
formats are compatible with and enable visualization of the methylation
track type=bedGraph
chr19 45408804 45408805 1.0
chr19 45408806 45408807 0.75
chr19 45408854 45408855 0.3
chr19 45408855 45408856 0.5
FIGURE 12.3
An example of the bedGraph file format. It includes a track definition line (the first line), fol-
lowed by track data lines in a four-column format (i.e., chromosome, chromosome start posi-
tion, chromosome end position, and data value).
1 60
0 0
1 60
Forward 1
H1 ESC
methylC-Seq 0
Max read depth: 30
Reverse 1
HOXA1 HOXA3 HOXA4 HOXA5 HOXA7 HOXA10 HOXA13
HOXA2 HOXA6 HOXA9 HOXA11
chr7 p21.3 p21.1 p15.3 p14.1 p13 q11.22q11.23 q21.11 q21.3 q22.1 q31.1 q33 q34 q35 q36.1
Epigenomics and DNA Methylation Analysis by NGS
FIGURE 12.4
Visualization of DNA methylation data in a genome browser. Shown here is the methylC track in the Washington University EpiGenome Browser
for a region of the human chromosome 7 where the HOXA gene cluster is located. The original WGBS data was collected from H1 human embryonic
stem cells. Both DNA methylation levels (represented by vertical bars) and read depth (the smoothed curve) are displayed in a strand-specific fashion.
A close-up view of the boxed region is shown on the top, with the left axis marking the DNA methylation level and the right marking read depth.
(Modified from X Zhou, D Li, RF Lowdon, JF Costello, T Wang, methylC Track: Visual integration of single-base resolution DNA methylation data on
the WashU EpiGenome Browser, Bioinformatics 2014, 30:2206–2207. With permission.)
171
results in web-based genome browsers such as the UCSC Genome Browser,

or desktop-based ones such as IGV and IGB. An additional option is to export
DNA methylation data to the VCF format using tools such as GobyWeb [366],
and then visualize with genome browsers such as IGV and Savant.
12.3 Detection of Differentially Methylated

Cytosines or Regions
One frequent goal of DNA methylation analysis is to compare and iden-
tify specific cytosines or genomic regions that show differential methyla-
tion between conditions. To identify differentially methylated cytosines or
regions (DMCs or DMRs), different statistical approaches have been used.
These include parametric tests such as t-test or ANOVA, and nonparametric
tests such as Fisher’s exact test, Wilcoxon test, chi-squared test, or Kruskal-
Wallis test. The parametric tests assume normal distribution, which is likely
to be violated for DNA methylation data as it tends to follow bimodal dis-
tribution. As a result, most currently available tools use nonparametric
tests, for example, WBSA employs the Wilcoxon test. The package methyl-
Kit identifies DMCs/DMRs with the use of Fisher’s exact test for compari-
son of groups without replicates, and logistic regression for comparison
involving multiple samples per group. BSmooth uses a modified t-test with
local data smoothing to increase detection power. Another package called
Methy-Pipe [367] detects DMRs using the Mann-Whitney U test with a slid-
ing window approach. More sophisticated approaches include the use of a
beta-binomial hierarchical model in MOABS [368] and Shannon entropy
in QDMR [369]. Besides these different statistical tests or models, another
notable difference among these packages is in how biological replicates
are handled. Earlier methods tend to pool replicate data for DMC/DMR
detection, leading to the loss of information on sample-to-sample variation.
Newer methods, such as BSmooth and MOABS, are more replicate-aware
and provide estimation on biological variation, thereby increasing detection
power. On multiple testing correction, FDR is mostly used, while other meth-
ods are also reported, such as a sliding linear model (SLIM) method used by
methylKit.
Data obtained from approaches based on methylated DNA enrichment
follows the negative binomial distribution, like the ChIP-Seq and RNA-Seq
data. Therefore, they can be analyzed to identify DMRs using algorithms
developed for RNA-Seq-based differential expression. For example, tools
such as EdgeR and DESeq can be directly used. In some DNA methylation
analysis tools, such as Repitools [370], EdgeR is directly called.
12.4 Data Verification, Validation, and Interpretation

The DMCs/DMRs identified in the previous step need to be verified and
further validated. Verification is usually conducted on the same set of sam-
ples as those used for DNA methylation sequencing data generation. Further
validation, on the other hand, is carried out on a new set of samples. For
DNA methylation sequencing data verification and validation, the following
techniques are often used: methylation-specific PCR (such as MethyLight),
or methylation-independent PCR coupled with pyrosequencing, mass spec-
trometry, or combined bisulfite restriction analysis (COBRA).
Data interpretation is a key step in translating a list of DMCs/DMRs into
a mechanistic understanding of the biological process under study. Most
potential effects of the DMCs/DMRs can only be revealed through examin-
ing them in their genomic context. Tools such as EpiExplorer [371], GBSA,
methylKit, or WBSA can be very helpful in this regard via placing them in
the context of other genomic features such as CpG islands, transcription
start sites, histone modification marks, or repetitive regions. DMCs/DMRs
can also be mapped to nearby genes, which can then be subjected to gene
set enrichment, biological pathway, and gene networking analyses. In this
regard, the web-based Genomic Regions Enrichment of Annotations Tool
(or GREAT) [372] can be used to map DMCs/DMRs to nearby genes, while
controlling for gene size difference and distance, for functional annotation
and interpretation.
13
Metagenome Analysis by Next-Generation
Sequencing (NGS)
A small amount of environmental sample, such as a handful of soil, is rich

in microbial life, but the number of microbial species in such a sample is
unknown. The microbiome on or within our body contains tens of thou-
sands, if not more, species of bacteria, fungi, and archaea. Besides their
tremendous species diversity, the composition, as well as function, of such
microbial communities is not static but constantly changing according to the
status of their environment. Our current understanding of these diverse and
dynamic microbial communities is still significantly lacking, as most of our
knowledge comes from culturable species. For those that still cannot be cul-
tured in the lab, which comprise the majority of microorganisms on earth,
we know very little. Metagenomics offers an important approach to study
microbial diversity in these environmental communities without relying on
artificial culturing. Also referred to as environmental or community genom-
ics, metagenomics examines all genomes existing in a microbial commu-
nity as a whole without the need to capture or amplify individual genomes.
Through simultaneous analysis of all DNA molecules present in a microbial
community, metagenomics provides a profile of taxonomic composition and
functional status of the community and its environment.
Before the advent of next-generation sequencing (NGS), metagenomics
studies were usually conducted with DNA cloning combined with Sanger
sequencing. In this approach, DNA extracted from a microbial community
is first fragmented, and then the DNA fragments are cloned into plasmid
vectors for amplification in order to produce enough materials for Sanger
sequencing. With the continuous development and significant cost drop in
NGS technologies, massively parallel metagenomic sequencing has quickly
replaced this traditional low-throughput approach and become a major
approach for studying various microbial communities. The high sensitivity
offered by the NGS approach provides direct access to unculturable species
that were previously “invisible” to analysis [373]. The Human Microbiome
Project exemplifies the use of NGS in interrogating complex metagenomes,
such as those at different sites of the human body including the gastrointes-
tinal tract. The application of NGS in metagenomic analysis of a large variety
of other microbial communities, such as those in soil, the phyllosphere, the
ocean, and those associated with bioremediation and biofuel generation, has
led to an exponential increase in the number of metagenomes studied.
175
Compared to the NGS data generated from a single species (most chap-
ters in this book deal with individual species), the metagenomics data from
microbial community sequencing is much more complicated. Each metage-
nome contains DNA sequences from a large but unknown number of spe-
cies, including viruses, bacteria, archaea, fungi, and microscopic eukaryotes.
To further complicate the situation, the relative abundance of these species
varies widely. In comparison to sequencing reads collected from a single
species, metagenomic sequencing reads contain much higher heterogeneity
because of the tremendous genome diversity in each microbial community.
Also because of the tremendous DNA sequence complexity contained in the
metagenome, most metagenomic sequencing efforts can only sample part of
the DNA pool. As a result of this limited sampling in a highly diverse DNA
space, metagenomic NGS data is highly fragmented and has low redundancy.
Due to the lack of redundant (i.e., partially overlapping, not duplicate) reads,
metagenomic NGS data has an inherently higher error rate when compare to
single-genome sequencing. All these differences between metagenomic and
monogenomic NGS data require an entirely different set of tools for NGS-
based metagenome data analysis for microbial community structural and
functional profiling.
13.1 Experimental Design and Sample Preparation

Metagenomics studies aim to determine identities and relative abundance
of different members, or taxa, in a microbial community, and how environ-
mental factors affect the composition and function of these communities.
To achieve this by sequencing, there are two general approaches: whole-
genome shotgun (WGS) metagenomic sequencing and targeted metagenomic
sequencing. The WGS approach provides random sampling of all genomes
contained in an environmental or host-associated microbial sample. To carry
out WGS, total DNA extracted from such a sample is first broken into small
fragments, which are then sequenced.
In the targeted approach, genomic component(s) that are shared among dif-
ferent species are first amplified with polymerase chain reaction (PCR) and
the amplicons are then sequenced. The most commonly used target in this
approach is the 16S rRNA gene, while other genes that code for specific pro-
tein functions (such as resistance to specific antibiotics) or noncoding genes
are also used. The 16S rRNA gene, being considered as the universal clock
of life [374], is usually used as a surrogate marker for measuring the relative
abundance of different operational taxonomic units (OTUs, a metagenomics
term to describe a species or a group of species when only DNA sequence
information is available). By focusing on the 16S rRNA gene or other specific
genomic target(s), this approach greatly reduces complexity in the generated
Metagenome Analysis by Next-Generation Sequencing (NGS) 177
data, thereby achieving deeper coverage and accommodating more samples.

It should be noted that the 16S-rRNA-based approach only produces approxi-
mate estimation of relative taxonomic abundance, due to 16S rRNA copy
number variation in some species and the fact that the standard 16S rRNA
PCR primers may not bind to their supposed target sites in all cases because
of random mutation. In comparison, the WGS approach, while relatively lack-
ing on depth and affordability, takes an unbiased path to offer a comprehen-
sive assessment of genome content in the community, and thereby provides
in-depth information on community composition and function. This chapter
is focused on WGS metagenome sequencing data analysis.
13.1.1 Metagenome Sample Collection

The success of a metagenomics project is to a degree dependent on factors
that are not related to genomics. One such factor is how much is known
about the habitat where study samples will be collected. The more physi-
cally, chemically, and ecologically characterized the habitat is, the more
knowledge will be gathered from the metagenomic NGS data. In-depth
characterization and detailed description of the sampling environment is
one foundation of a successful metagenomics experiment. Keeping detailed
metadata on the habitat and the sampling process (such as characteristics of
the general environment, geographical location, and specific features of the
sampling locales and the sampling method) is of great importance to down-
stream data interpretation.
As the composition and complexity of a metagenome sample are deter-
mined by the habitat and the sampling site, the unique characteristics of a
sampling environment, along with the question to be answered or specific
hypothesis to be tested, eventually determine how many reads are required.
It should also be emphasized that since where the samples are collected
directly shapes the outcome, the sampling sites must be representative of
the habitat under study. In order to collect representative samples, informa-
tion on spatial and temporal variation in the habitat must be known prior to
sample collection. If this information is not available, a small-scale trial shot-
gun sequencing run might prove helpful with a small number of samples
sequenced. Alternatively, a targeted 16S rRNA amplicon sequencing can also
be used to survey the diversity of the microbial community.
13.1.2 Metagenome Sample Processing

DNA extraction is the first and also a key step in metagenome sequencing
sample preparation. The DNA extracted from this step should represent
all, or at least most, members of the sampling community and their rela-
tive abundance, be of high purity and free of contaminants that might inter-
fere with the subsequent sequencing library construction. While this step
might be routine in conventional genome sequencing for a single organism,
extracting high-quality DNA from microbial community samples collected

from various habitats poses challenges. For example, humic acids, polysac-
charides, tannins, and other compounds are major contaminants in environ-
mental samples such as those from the soil, which if not removed can lead to
inhibition of enzymes used in library construction. In host-associated habi-
tats such as the human gut, host DNA is the major potential contaminant.
Besides purity, extracting DNA in equal efficiency from different com-
munity members is another challenge, as the optimal condition of cell lysis
for DNA release from one group of microbes may not be ideal for another.
For example, mechanical disruption is often used for breaking up cells in
metagenomics studies, but by using this method DNA released from eas-
ily lysed cells may be sheared to fragments when tougher cells are eventu-
ally disrupted. While these challenging issues should be acknowledged and
addressed, they are not insurmountable and robust extraction protocols are
available for various habitats [375].
Advancements in sequencing library preparation protocols have reduced
the amounts of DNA required considerably to lower nanogram levels
(e.g., the Nextera XT protocol needs only 1 ng DNA to start). This should
accommodate DNA extracted from most habitats. In situations where only
a very limited amount of DNA is available, amplification of the DNA might
be needed to generate enough material for creating sequencing libraries. To
maintain the relative abundance level between community members, strate-
gies such as multiple displacement amplification can be used. Such ampli-
fication can generate more than enough DNA for library construction from
femtograms of starting DNA.
13.2 Sequencing Approaches
There are several key factors that need to be considered before the sequenc-
ing process starts. These include sequencing depth, read length, and sequenc-
ing platforms. The depth of sequencing is dependent on the goal to be
pursued. Studies that attempt to locate rare members of microbial commu-
nities require deeper sequencing than those that are only focused on more
abundant members. With regard to read length, longer reads are always bet-
ter than shorter reads in metagenomics for sorting out the inherent sequence
complexity. The read length from the commonly used Illumina HiSeq sys-
tem can currently read 125 bp from one end using the high-output mode,
and can generate ~450 bp reads if using partially overlapped paired-end
sequencing during the rapid run mode (see Chapter 10). As overviewed in
Chapter 4, other technologies, such as Pacific Biosciences’s SMRT (single
molecule real-time) and the 454 pyrosequencing, generate longer (but fewer)
reads. A hybrid approach is often used to take advantage of the different
strength of these technologies, with the use of shorter reads to generate an

in-depth survey of the community and longer reads to provide scaffolding
for assembling contigs (see Section 13.5.1). Future advancements in sequenc-
ing technologies will undoubtedly lead to continuous increase in read length
and drop in cost making the goals of metagenomics more achievable.
13.3 Overview of Whole-Genome Shotgun (WGS)

Metagenome Sequencing Data Analysis
For microbial community profiling, whole-metagenome shotgun sequenc-
ing has the benefit of being able to detect microbial genes without having to
assemble entire genomes contained in the community first. When the micro-
bial community is complex and most species have low coverage, sequence
reads can be directly searched against currently known gene sequences to
identify gene tags and analyzed for taxonomic composition and functional
status. For less complex communities, reads can be assembled into contigs
before conducting further analysis, and an increase in sequence length gen-
erally produces better results in subsequent taxonomic and functional analy-
ses including pathway reconstruction, although the assembly process is not
without challenges.
Figure 13.1 shows an overview of WGS metagenome data analysis,
including the use of short reads directly for gene mapping and the alter-
native metagenome-assembly-based approach. For both approaches, sub-
sequent sequence homology and other feature searches against currently
cataloged genes in various public databases are the key steps. Although the
results from these key steps are limited to the currently known sequences,
the rapid increase in the number of sequenced microbial genomes will
gradually alleviate this limitation. Besides taxonomic identification and
functional profiling in one condition or habitat, comparative metagenomics
analysis between conditions or habitats is usually performed to achieve the
final goal of studying the effects of environmental factors on a microbial
community. The following sections cover these various aspects of metage-
nomics data analysis. Because of the great diversity in sampling habitats/
conditions and the specific questions asked in each study, there is no fixed
workflow for metagenomics data analysis. Many of the steps outlined
in Figure 13.1 and covered next are not necessarily arranged in the most
appropriate order for a particular project, and they can be used in different
combinations or with some step(s) omitted. Compared to other NGS appli-
cations, there is still a relative lack of tools for metagenome analysis. Some
of the currently available tools, such as those required for contig assembly
and sequence search against multiple databases, require considerable com-
puting resources and power.
Metagenome sample collection

and metadata recording
Sample processing
and sequencing
Data quality control

and preprocessing
Reads binning
Metagenome assembly
Reads mapping to currently
known gene sequences
Contig binning
Calling of ORFs
and genomic elements
Phylogenetic analysis
Gene function annotation
Metabolic pathway
reconstruction
Comparative metagenomic
analysis
FIGURE 13.1
Major steps of metagenome analysis.
13.4 Sequencing Data Quality Control and Preprocessing

To ensure data quality and avoid erroneous results, metagenomic shotgun
sequencing reads should be examined and preprocessed prior to conducting
downstream analysis. Using the tools introduced in Chapter 5, reads of low
quality should be filtered out, and low-quality bases and adapter sequences
trimmed off. In addition, for samples from host-associated habitats, contami-
nating host sequences need to be marked and excluded from further analy-
sis. Currently available tools for marking and removing DNA contamination
sequences include BMTagger [376] and DeconSeq [377]. Additional data pre-
processing also includes removal of duplicated reads. This can be conducted
with tools such as the Picard module called EstimateLibraryComplexity,
which identifies and removes duplicate reads without the need to align reads
to a reference genome.
13.5 Taxonomic Characterization of a Microbial Community

13.5.1 Metagenome Assembly
Though the ultimate goal of metagenomics is to assemble each genome in a
microbial community, this is currently still far from achievable for several
reasons. The number of organisms in a metagenome is unknown, and there
are wide variations in their relative abundance and therefore sequencing
depth among the organisms. This is especially the case for samples collected
from highly complex microbial communities. The large number of species
in these samples and the concomitant low-sequencing depth for most spe-
cies make metagenome assembly extremely challenging. Sequence similar-
ity between closely related species poses further challenges to assemblers,
often leading to chimeric assemblies that contain reads from different OTUs.
Despite the challenges, metagenome reads assembly is an important step,
especially for low-complexity samples. It enables discovery of novel genomes
(e.g., the discovery of three novel viral genomes in Yellowstone lake [378]),
discovery of novel genes (e.g., the first bacterial rhodopsin was discovered
by metagenomics [379]), and characterization of long complex genomic ele-
ments (such as clustered regularly interspaced short palindromic repeats, or
CRISPRs [380]).
For de novo metagenome assembly, the assemblers introduced in Chapter 10
for single-genome de novo assembly, such as SOAPdenovo and Velvet, were
initially applied but with limited success. As a result, assemblers tailored for
metagenome reads have been developed. For assembling longer reads such as
those generated from Sanger or 454 technologies, assemblers like MAP [381],
Genovo [382], and Xgenovo [383] can be used. For the relatively short Illumina
reads, more assemblers are currently available, including MetaVelvet/
MetaVelvet-SL [384,385], meta-IDBA/IDBA-UD [386,387], GeneStitch [388],
Ray Meta [389], and Omega [390]. Similar to single-genome assemblers, many
of these short-read metagenome assemblers are based on the de Bruijn graph
approach (see Chapter 10). The difference from the single-genome assem-
blers, though, is that they attempt to identify subgraphs within a mixed de
Bruijn graph, each of which is expected to represent an individual genome.
For example, MetaVelvet first builds a large mixed de Bruijn graph from meta
genomic reads, which is then decomposed into individual subgraphs.
After the assembling process, a metagenome usually comprises mostly
small contigs. To evaluate the assembly quality, traditional evaluation met-
rics, such as N50, are not as informative and representative as in evaluat-
ing single-genome assemblies. Instead, aggregate statistics such as the total
number of contigs, and the maximum, median, and average length of the
contigs are often used. Further inspection of the assembly quality includes
looking for chimeric assemblies. While there are currently no tools available
to detect chimeric assembly, the assemblies should nevertheless be checked
by looking for signs of chimeric assembly, such as sudden changes in cover-
age, G/C content, and codon usage (different species have different codon
usage patterns). The use of paired-end reads and a higher sequence match
threshold helps reduce the rate of chimeric assemblies.
After contig assembly, if paired reads are available, metagenome scaffolds
can be built from the contigs. Many of the metagenome assemblers have a
module to carry out scaffolding. Besides these modules, dedicated metage-
nome scaffolding tools like Bambus 2 [277] may be used to determine if
additional scaffolding is needed. Bambus 2 accepts contigs constructed with
most assemblers using reads from all sequencing platforms. In the process
of building scaffolds from contigs, ambiguous and inconsistent contigs may
also be identified.
13.5.2 Sequence Binning
Metagenomic sequence binning refers to the process of grouping sequence
fragments in the mixture and placing them into different “bins” correspond-
ing to their taxonomic origins. This process can be conducted on both assem-
bled and unassembled reads. With longer reads or contigs, high-resolution
binning can be achieved at the levels of family or genus. Short sequences may
be binned only to the level of phylum due to the limited information carried
in the sequences. Since it reduces the complexity inherent in the metagenom-
ics data, each set of binned sequences can also be subjected to independent
analysis in other steps. For example, assembly can be performed postbinning
on each binned sequence set to improve performance.
Three binning approaches are usually used: those based on sequence com-
position, homology, and fragment recruitment. Composition-based binning
assigns sequences into different taxonomic groups based on characteristics

such as G/C content, oligonucleotide sequence frequency, and codon usage.
This binning approach is based on the assumption that sequences from
closely related species are more similar to each other in these characteris-
tics than to distantly or nonrelated species. Binning methods that use this
approach include PhyloPythia [391] and its successor PhyloPythiaS [392],
TETRA [393], TACOA [394], Phymm [395], S-GSOM [396], and PCAHIER
[397]. Unlike the other two approaches, these methods do not compare reads
to a database of reference sequences, although some use reference sequences
from different taxonomic groups to train their algorithms. For example,
PhyloPythia uses the frequency of oligonucleotide sequence of variable
length to assign metagenomic sequences to different clades, based on the
support vector machine (SVM) model trained with taxonomically anno-
tated reference sequences. Composition-based binning is more reliable for
long and assembled reads, because short sequences carry less information
due to their limited length. While the composition-based binning approach
has the advantage of being fast, as it does not rely on aligning metagenomic
sequences to references, variation in the distribution of composition char-
acteristics can lead to inaccuracies. For those methods that use reference
sequences to train their binning models, the selection of training sequences
can also affect the results.
Homology-based binning is based on sequence similarity and the assump-
tion that sequences from closely related species are more similar to each other
than to unrelated species. This approach assigns metagenomic sequences to
their taxonomic sources of origin by searching against a database of micro-
bial sequences that are taxonomically annotated. Currently available meth-
ods based on this approach include MEGAN4/5 [398,399], CARMA and
WebCARMA [400,401], SOrt-ITEMS [402], and MetaPhyler [403]. MEGAN, for
example, conducts a BLAST search on metagenomic sequences using a data-
base of NCBI (National Center for Biotechnology Information) sequences that
have known taxonomic origins. Because of the tremendous amount of BLAST
search involved, this process is computationally intensive and demanding
on computing resources. As it is based on the current annotation of cata-
loged sequences, this approach is not suitable to find currently unknown
species or taxa. Some methods, such as MetaCluster [404], PhymmBL [395],
and SPHINX [405], take a hybrid strategy combining both the composition
and the homology approaches.
The third approach, based on fragment recruitment, maps metagenomic
reads to available microbial genomes in order to identify their sources of ori-
gin. This approach was first used by the Global Ocean Sampling Expedition
to study the marine planktonic microbiota [406]. Although the mapping can
be conducted with general-purpose mappers such as Bowtie or BWA, there
are few algorithms, except Genometa [407] and FR-HIT [408], that are spe-
cifically designed for this approach. Since it is limited to assigning metage-
nomic sequences to species that have a reference genome, this approach
is not very well suited to study microbial communities that contain many
unknown species.
13.5.3 Calling of Open Reading Frames (ORFs) and Other

Genomic Elements from Metagenomic Sequences
To answer the questions of what taxonomic groups are in a microbial com-
munity and what they are doing, identification of genes and other genomic
elements (such as noncoding RNA) from assembled contigs or unassem-
bled reads is an essential step. For gene coding region identification, since
metagenomic sequences containing open reading frames (ORFs) may not
carry full-length ORFs, metagenome ORF calling algorithms do not penalize
for their incompleteness. Many metagenome ORF callers employ machine-
learning strategies such as hidden Markov models (HMMs) or artificial neu-
ral networks (ANNs). Examples of these callers include FragGeneScan (FGS)
[409], MetaGeneMark and other programs in the GeneMark family such as
GeneMark.hmm [410], MetaGeneAnnotator (MGA) [411], and Orphelia [412].
Identification of other genomic elements, such as ncRNAs and CRISPRs, may
require long reads or contigs as well as more computational resources. A
limited number of tools such as tRNA-SE [413] and CRISPRFinder [414] are
currently available to identify these elements. Besides providing answers to
the composition and function of a microbial community, calling of ORFs and
other genomic elements also helps identify misassembled reads or locate
adjoining contigs that are not yet placed into the same scaffold.
13.5.4 Phylogenetic Gene Marker Analysis

Phylogenetic gene markers are ubiquitous genes that are phylogenetically
diverse and therefore can be used to determine the structure and compo-
sition of a microbial community. Examples of these marker genes are the
rRNA genes (e.g., 16S), recA (DNA recombinase A), rpoB (RNA polymerase
beta subunit), fusA (protein chain elongation factor), and gyrB (DNA gyrase
subunit B). There are two general approaches to apply these gene markers to
the determination of taxonomic groups in a community. The first is based
on a sequence similarity search. Methods that use this approach include
MetaPhlAn [415] and MetaPhyler. MetaPhlAn, for example, conducts a
metagenomic sequence similarity search against an extensive list of clade-
specific gene markers to determine taxonomic composition. The other approach
uses the phylogenetic information embedded in gene marker sequences
to infer phylogenetic trees from metagenomic reads via multiple sequence
alignment. AMPHORA (also AMPHORA2 and AmphoraNet) [416–418],
PhylOTU [419], and PhyloSift [420] are some examples of this approach. In
the case of AMPHORA, HMMs are used to align metagenomic reads to
multiple marker sequences. A phylogenetic tree is then inferred from the
multiple-alignment results.
13.6 Functional Characterization of a Microbial Community

13.6.1 Gene Function Annotation
ORF calling from metagenomic sequences provides substrate for functional
analysis of the underlying community, that is, answering the question of
what they are doing. Functional annotation of called ORFs can reveal the
full repertoire of genes (or their protein products) in a habitat, which usu-
ally perform a wide range of functions such as metabolism, signal transduc-
tion, stress tolerance, and virulence. Uncommon functions may suggest an
unusual lifestyle and activity in a community. The relative abundance of
different types of genes also reveals specificity about a community and how
organisms in the community deal with environmental factors in the habitat.
To conduct functional annotation, predicted protein sequences from
called ORFs are searched against a database of reference protein sequences,
or HMMs that describe protein families. Protein sequence databases (such
as COG/KOG, eggNOG, FIGfams, and UniRef) and HMM databases (such
as Pfam and TIGRFAMs) are among the most commonly used databases.
This task of database searching to identify all possible peptides coded by
the metagenome is a computationally intensive process. If local computing
resources permit, locally installed standalone tools such as RAAMCAP [421],
SmashCommunity [422], and MetAMOS [423] can be used. Alternatively, the
task can also be submitted to a web-based system such as the MG-RAST
SEED system [424] or IMG/M.
This process of database searching at the ORF or gene level provides a func-
tional snapshot of the community in terms of what functions are most pos-
sibly active. Although this functional annotation is based on metagenomic
DNA instead of metatranscriptomic RNA analysis, comparison of metage-
nomic and metatranscriptomic data has found that the relative abundance
levels of genes and their transcripts are usually well correlated in the same
communities [425]. Therefore, the functional snapshot revealed by metage-
nomics data serves as an approximation of gene activity in the community.
13.6.2 Metabolic Pathway Reconstruction

To perform functional analysis at the metabolic pathway level, which offers
a different layer of understanding of community activities, the same meta
genomically predicted peptide sequences can be searched against KEGG
Orthology and MetaCyc. Both databases allow mapping of the peptide
sequences to different biological pathways. One of the currently available
tools for metabolic pathway analysis is HUMAnN [426]. It employs MBLASTX
to search metagenomic reads against the KEGG Orthology to determine the
abundances of individual orthologous protein families. HUMAnN recon-
structs pathways using MinPath [427], which is a maximum parsimony
approach to explain the observed families and their abundances with a

minimal set of pathways. After further noise reduction and smoothing, the
output from HUMAnN displays pathway coverage (i.e., whether each path-
way is present or absent) and the relative abundance of each pathway in the
metagenomic samples. MetaPath [428], another currently available tool, iden-
tifies differentially abundant metabolic subnetworks between metagenomic
samples.
13.7 Comparative Metagenomic Analysis

Comparative metagenomic analysis between habitats or conditions can lead
to insights about the underlying microbial communities and their dynamics.
However, statistical comparison between metagenomes is not as straightfor-
ward as other NGS-based comparative analyses (such as RNA-Seq). This is
mostly due to the tremendous amount of variability involved in comparative
metagenomic analysis. One source of this variability is biological, as micro-
bial composition can vary greatly between different samples. Another source
is technical, due to insufficient sequencing depth and therefore undersam-
pling of low-abundance species. These species generate fewer reads and are
more affected by stochastic factors in the sequence sampling process, as in
general the number of reads from a species is dependent on a number of fac-
tors, including relative abundance of the species, genome size, genome copy
number, within-species heterogeneity, and DNA extraction efficiency. Due to
these biological and technical factors, many species or OTUs detected in one
sample or condition are often absent in another sample or condition. If rare
species need to be studied in a metagenome study, it is more cost-effective
to artificially increase their abundance using cell enrichment technologies
such as flow cell sorting rather than increasing sequencing depth. In a typi-
cal metagenomics project that does not artificially increase the abundance
of rare species, their undersampling can lead to significant biases in subse-
quent data normalization and detection of significant differences between
samples. Compared to other steps in the metagenomic data analysis pipeline,
there has been relatively less method development in comparative metage-
nomic analysis.
13.7.1 Metagenome Sequencing Data Normalization

Similar to RNA-Seq data, metagenomic abundance data needs be normal-
ized prior to comparative analysis. Currently there is still no consensus as
to how metagenomics data should be normalized. Among the normaliza-
tion approaches that have been reported, total-sum scaling (TSS), equiva-
lent to the total count approach in RNA-Seq (Chapter 7), is performed by
dividing the raw count of reads assigned to a certain species or OTU by the
total number of reads in the same sample. Another approach is cumulative-
sum scaling (CSS), which, similar to the upper quartile approach in RNA-
Seq, is calculated by dividing the raw count of reads assigned to a species
or OTU by the cumulative sum of counts up to a certain percentile. In a cur-
rently available study [429], CSS performed better than other normalization
approaches including TSS.
13.7.2 Identification of Differentially Abundant Species

or Operational Taxonomic Units (OTUs)
To identify species or OTUs that are differentially abundant between habi-
tats or conditions, currently available tools include metagenomeSeq [429],
LEfSe [430], METASTATS [431], STAMP [432], Xipe [433], MEGAN4/5, and
MG-RAST. These tools use different methods and statistics to detect dif-
ferential abundance between metagenomes. For example, metagenomeSeq
implements the CSS normalization and a distribution mixture statistical
model to deal with the biases caused by the undersampling issue that con-
founds comparative metagenomic analyses. LEfSe uses the Kruskal-Wallis
rank-sum test to detect features that display significant differential abun-
dance between conditions. Besides comparative abundance analysis, some
of these tools, such as MEGAN4/5 and MG-RAST, can also be used to com-
pare functional profiles between contrasting conditions in terms of Gene
Ontology (GO) and KEGG pathways. Tools dedicated to the comparison of
functional profiles between habitats or conditions are also available, such as
ShotgunFunctionalizeR [425].
13.8 Integrated Metagenomics Data Analysis Pipelines

Besides the tools developed for each of the aforementioned individual steps,
pipelines designed for integrated comprehensive analysis of metagenom-
ics data are also available. These pipelines, including IMG/M, MEGAN4/5,
MetAMOS, and MG-RAST, contain a large collection of tools that encompass
the many aspects of metagenomics data mining including preprocessing,
binning, feature identification, functional annotation, and cross-condition
comparison. For example, MG-RAST directly takes sequencing and metadata
files as input, conducts reads quality checks and preprocessing, gene calling,
protein identification, annotation mapping, abundance profiling, comparative
analysis, and metabolic reconstruction. Currently these pipelines require dif-
ferent input files. IMG/M prefers preassembled contigs, MEGAN4/5 requires
reads BLAST search results against a database of reference sequences, and
MetAMOS can take both sequence reads and preassembled contigs.
13.9 Metagenomics Data Repositories

In the United States, like for other NGS data, the NCBI SRA database provides
the official repository for all metagenomic data collected by NGS technolo-
gies. In Europe, the EBI Metagenomics service offers archiving and analysis
of metagenomics data. The data archived by the EBI Metagenomics service
is also accessible through ENA-SRA. Besides these official metagenomics
data repositories, MG-RAST and IMG/M are two de facto metagenomic data
repositories that also enable data sharing in a collaborative environment
and with the entire research community. The value of these repositories
will become more apparent when more metagenomics data becomes avail-
able. For example, they can accelerate the discovery of new genes and spe-
cies by providing opportunities to compare currently unknown sequences
that exist in multiple metagenomes. In a typical WGS metagenomics study,
many sequences are previously unknown and may represent novel genes or
sequences from currently uncataloged species. To discover novel genes and
new species, meta-analysis of data (including metadata) is needed, which is
only enabled by these repositories.
Section IV
The Changing Landscape

of Next-Generation
Sequencing Technologies
and Data Analysis
14
What Is Next for Next-Generation
Sequencing (NGS)?
14.1 The Changing Landscape of Next-Generation

Sequencing (NGS)
Massively parallel sequencing is a highly dynamic area of genomics. While
the current technologies are still evolving to further improve performance,
new technologies are constantly being developed. With more researchers
adopting the next-generation sequencing (NGS) approach for transcrip-
tomics, genotyping, de novo genome assembly, protein–DNA interaction
analysis, epigenomics, and metagenomics, the drive for cheaper, faster, more
accurate, and more sensitive sequencing technologies that generate longer
reads will only become greater. With the power of NGS being proven in
research labs, it has been gradually accepted in clinical settings to improve
diagnosis, prognosis, and treatment of patients. On November 19, 2013, the
U.S. Food and Drug Administration (FDA) for the first time approved the use
of an NGS platform (the Illumina MiSeqDx system) for clinical use. The
broadened use of NGS technologies in research and clinical settings has fur-
ther accelerated the development of third- and future-generation sequencing
technologies, including those based on the detection of electrical signals dif-
ferentially induced by individual nucleotides.
The Oxford bio-nanopore technology, for instance, reads nucleotide
sequences off a single-stranded DNA (or RNA) while it is threaded across
a biological nanopore. The speed at which the DNA (or RNA) strand passes
through the pore is critical for signal measurement and controlled by a
processive enzyme located at the pore orifice. The raw sequencing signal
from each pore is a trace of ionic current changes emitted from five-nucleotide
DNA (or RNA) k-mers (not individual nucleotides) [434]. Deducing bases from
the electrical signal trace is performed by the company’s cloud-based soft-
ware called Metrichor, which is based on hidden Markov models (HMMs).
Another platform that is also based on the detection of electrical signals has
been developed by the Japanese company Quantum Biosystems. Different
from the Oxford technology, this platform conducts random DNA (or RNA)
191
FIGURE 14.1
Third-generation single DNA/RNA molecule sequencing by measuring tunneling currents
generated from the passing of a DNA/RNA molecule through a pair of nanoelectrodes with
a subnanometer gap. (From T Ohshiro, K Matsubara, M Tsutsui, M Furuhashi, M Taniguchi,
T Kawai, Single-molecule electrical random resequencing of DNA and RNA, Scientific Reports
2012, 2:501. With permission.)
single-base sequencing via measuring tunneling currents (Figure 14.1). These

currents are produced when DNA (or RNA) molecules pass between pairs
of nanoelectrodes that are separated by a gap of subnanometer scale [435].
Similar to the Oxford technology, the key to this technology generating a
high-quality electrical signal for base calling is to control the speed of DNA
(or RNA) molecule translocation through the gap, while at the same time
confining the molecule’s configuration during translocation. Specific statisti-
cal methods and algorithms are required for base calling from the generated
tunneling currents.
While emerging sequencing technologies as exemplified by the Oxford
and Quantum systems have to overcome technical including computational
hurdles before becoming widely adopted, some characteristics of upcoming
DNA (or RNA) sequencing technologies seem to be clear. Such characteris-
tics include
• Single DNA (or RNA) molecule sequencing, that is, the ability to
directly read individual target DNA molecules without relying on
polymerase chain reaction (PCR) amplification or conversion to
cDNA in the case of RNA
• Much improved read length
What Is Next for Next-Generation Sequencing (NGS)? 193
• Smaller equipment footprint and increased portability; for example,

the Oxford MinION sequencing system is a miniaturized device
that directly works through a computer’s USB port
• Further drop in sequencing costs
The increased sensitivity that leads to the achievement of single DNA (or
RNA) molecule sequencing makes it possible to directly sequence the genome
or transcriptome of a single cell without any amplification. The reduced
equipment size and increased affordability makes high-throughput sequenc-
ing more accessible to individual research and clinical labs, instead of being
mostly limited to large genome centers or core facilities. The change in read
length, and other aspects of sequence read output such as error model, also
drives further evolution of bioinformatic tools.
14.2 Rapid Evolution and Growth of Bioinformatics Tools

for High-Throughput Sequencing Data Analysis
The increased read length will undoubtedly improve the efficiency of
bioinformatic tools for sequence mapping and assembly. With gradually
improving chemistry since the introduction of NGS, we have already seen
progressively increasing read lengths from the currently available plat-
forms. Significantly longer reads associated with third- or future-generation
sequencing technologies, as well as new techniques developed on the basis
of currently available technologies (e.g., the Moleculo long-read technology
acquired by Illumina), will not only improve de novo genome assembly
but also all the other applications that depend on mapping to a reference
genome. For example, increased read length in RNA-Seq can lead to recog-
nition of different transcripts that are produced from the same gene, and
therefore facilitate studies of alternative splicing. As higher read length
increases sequence information content and uniqueness, which in turn leads
to increased “assemblability” or “mappability,” newer alignment algorithms
or updated versions of existing ones are surely to be developed to harness
the power afforded by this increase in read length. For example, long-read
de novo genome assemblers, such as HGAP [436] and FALCON [437], have
been developed more recently to assemble long reads generated from plat-
forms such as the Pacific Biosciences system. BWA-MEM has also been added
recently to the widely used BWA alignment package to accommodate longer
reads, and it generates better performance on these reads than previous ver-
sions designed for shorter reads.
The adaptation of algorithms to the increase in read length is only one exam-
ple of the impact of sequencing technology advancements on the evolution
of bioinformatic tools. Besides assembly and alignment, algorithms and

tools for other steps or applications, including base calling, variant calling,
transcriptomic analysis, ChIP-Seq peak calling, DNA methylation sequenc-
ing, and metagenome characterization, are also under constant develop-
ment. While new ones are continuously being introduced, many existing
algorithms and tools are also under constant revision. As base calling is
highly platform-dependent, base callers are usually developed as part of the
sequencing platform development process. Although there are also third-
party base callers being developed in an attempt to further improve per-
formance, efforts on algorithmic and software tool development are mostly
focused on more downstream analyses.
As an illustration of the dynamic nature of these efforts, RNA-Seq analysis
algorithmic development and utilization have seen continuous growth since
2010. Figure 14.2 shows the total number of reports related to RNA-Seq data
analysis algorithms published each year between 2010 and 2014. While these
numbers do not directly measure the total number of new or updated RNA-
Seq algorithms, they do to a large degree reflect the amount of algorithmic
development efforts as well as the demand in this direction. Algorithmic
development and application in other steps/applications show the same
trend. Because of the constant introduction and improvement of bioinfor-
matic tools, researchers might find it necessary at times to rerun previously
performed analyses using newer tools.
12,000
10,000
Number of publications
8000
6000
4000
2000
0
2010 2011 2012 2013 2014

Year
FIGURE 14.2
The increase in the number of publications from 2010 to 2014 related to the development and
application of RNA-Seq algorithms. (From Google Scholar.)
14.3 Standardization and Streamlining

of NGS Analytic Pipelines
While the active development of algorithms and the wide array of bio
informatic tools becoming available may seem to make it more difficult
to test and choose the right tools, there are also more efforts focusing on
standardizing and streamlining bioinformatic workflows for the different
NGS applications. Commercial packages, such as CLC Genomics Workbench
and GeneSpring NGS, tend to incorporate different modules into one suite
to cover most commonly used NGS applications. Whereas packages devel-
oped out of academic settings tend to be more specialized and as a result a
bit fragmented, there have also been efforts on the unification of different
components into frameworks, such as the GATK for variant calling [438].
The clinical use of NGS on diagnosis, genetic risk assessment, and patient
management further demands the standardization and streamlining of NGS
data analytic workflow, which has led to the deployment of pipelines such as
Mercury [439] and Rainbow [440]. To handle the vast volumes of NGS data
effectively, many of these pipelines take advantage of high-performance par-
allel computing, and increasingly with the use of cloud technologies.
14.4 Parallel Computing
Parallelization, a computation term that describes splitting of a task into a
number of independent subtasks, can significantly increase the processing
speed of highly parallelizable tasks, which include many NGS data analysis
steps. For example, although millions of reads are generated from a sequenc-
ing run, mapping of these reads to a reference genome is a process that is
“embarrassingly parallel,” as each read is mapped independently to the
reference. As parallel computing can be efficiently carried out by graphics
processing units (GPUs) since rendering of each pixel on a computer screen
is also a highly parallel process, the integration of GPUs with CPUs in het-
erogeneous computing systems can increase throughput ten- to hundred-
fold, and turn individual computers into mini-supercomputers. While these
systems can be applied to various aspects of NGS data analysis, many NGS
analytical tools have yet to take full advantage of the power of parallel com-
puting in such systems.
Parallelization is also an important factor in determining how an increase
in the number of CPU (or GPU) cores might affect actual NGS data pro-
cessing performance. If a step is highly parallelizable, and the algorithm
designed for it employs parallelization, then an increase in core number will
most likely lead to improved performance. On the contrary, if the step is not
readily parallelizable, or even if the task is parallelizable but the algorithm

deployed does not use parallelization, simply having more cores may not
lead to improvement in performance.
14.5 Cloud Computing
Because the rates at which NGS technologies advance and sequencing costs
drop are faster than those of development in the computer hardware indus-
try and the resultant increase in computing power (i.e., Moore’s law), the gap
between NGS data generation and their computational analysis will only
widen. To narrow this gap and speed up NGS data processing, the NGS com-
munity has begun to embrace a trend that has been taking place in comput-
ing resource distribution from the long-existing model of local computing to
cloud computing. Companies such as Amazon, Microsoft, and Google have
been building megascale cloud computing clusters and data storage systems
for end users to use over the Internet. Compared to local computing, cloud
computing enables access to supercomputing and mass data storage capa-
bilities without the need to build and maintain a local workstation, server, or
high-performance computing cluster.
At the core of cloud computing is virtualization technology, which allows
an end user to create a virtual computer system on demand with the flex-
ibility of specifying the number of CPU cores, memory size, disk space, and
operating system that are required for a job. With this technology, multiple
virtual computer systems can be run simultaneously on the same physical
cloud server. The adoption of cloud computing for NGS data processing has
demonstrated the advantages of this “supercomputing-on-demand” model,
which include flexibility, scalability, and oftentimes cost-savings. The flexibil-
ity and scalability offered by cloud computing allow a researcher to conduct
NGS data analysis using supercomputing capabilities that previously only
existed in large genome centers. Cost savings are achieved as the user only
needs to pay for the time used by the user-configured computing instance.
Another advantage of using the cloud is with data sharing among research-
ers and projects. By providing single, centralized data storage, the cloud
enables different groups located in different geographical locations to have
access to the same data sets and share analytical results. Furthermore, with
cloud computing, the task of bringing software tools to the “big” NGS data
can be more readily realized. In contrast to the large sizes of NGS data
files, the software and scripts designed to process them are much smaller.
Therefore, it is much easier and more efficient to download and install them
to wherever the data is stored, rather than moving or replicating the high
volumes of NGS data to where the tools are installed. By directly storing
production data in the cloud, the burden of data transfer is greatly reduced;
by coupling data and tools in the same place, optimal performance can be
achieved.
While cloud computing enables users to offload the hassle and cost of run-
ning and maintaining a local computing system, it does have downsides that
need to be considered. One of the practical barriers of moving to the cloud
is the speed of data transfer into and out of the cloud. It may take a week to
upload 100 GB of data to the cloud using low-speed Internet connections.
The question of whether to run analysis in the cloud is heavily dependent
on the amount of data to be transferred and the computational complexity
of the analytical steps. As a general rule, it is only worthwhile to upload
data to the cloud for processing when the analytical task requires more than
105 CPU cycles per byte of data [441]. So for projects that deal with large
amounts of data but do not involve a lot of highly intensive computational
steps, more time may be spent on data transfer to the cloud rather than data
processing. Other potential factors include data security, cost ineffectiveness
under some circumstances, availability of analytical tools in the cloud envi-
ronment, and network downtime. Although users can access their data from
anywhere on the Internet, the convenience also means the possibility of data
security being breached or compromised. Some heavy users may find cloud
computing not as cost-effective as running a local server. While more tools
are becoming available in the cloud, users still need to use due diligence
to make sure that the tools they need are available. For users at places that
suffer frequent network outages, cloud computing can be problematic as all
cloud-based operations are dependent on Internet traffic.
Despite the potential downsides, cloud computing has been proven to
be a viable approach for NGS data analysis. Table 14.1 is a list of some of
the current cloud-computing providers that can be used for NGS applica-
tions. To illustrate how cloud computing can be deployed for analyzing NGS
data, following is an example on the conduct of reads alignment using the
Amazon Elastic Compute Cloud (Amazon EC2). As the first step, input data
files (FASTQ files and a reference genome file) are uploaded from a local
computer to a “bucket” in the Amazon S3 cloud storage. This bucket, which
is also used to hold program scripts and output files, can be created with the
TABLE 14.1
Providers of Cloud Computing That Can Be Used for NGS Data Analysis
Provider URL
Amazon Elastic Compute Cloud http://aws.amazon.com/ec2/
Rackspace http://www.rackspace.com
Bionimbus http://bionimbus.opensciencedatacloud.org
Open Cloud Consortium (not-for-profit) http://opencloudconsortium.org
Microsoft Azure http://azure.microsoft.com/
Google Cloud https://cloud.google.com
AWS (Amazon Web Services) Management Console, a unified interface to

access all Amazon cloud resources. To initiate alignment, a workflow must
be defined first using the Console’s “create workflow” function. To define the
workflow, the input sequence read files, the aligner script, and the saving
location for alignment output files are specified. In the meantime, the num-
ber of Amazon EC2 instances required for the job, which determines mem-
ory and processor allocation, is also configured. After the configuration, the
job is submitted through the Management Console. When the instances are
finished, alignment output files are deposited into the prespecified file loca-
tion in the S3 cloud storage.
Appendix A:
Common File Types Used in
(NGS) Data Analysis
BAM: A file format for storing reads alignment data. It is the binary version
of the SAM format (see SAM). Compared to its equivalent SAM file,
a BAM file is considerably smaller in size and much faster to load.
Unlike SAM files, however, the BAM format is not human-readable.
BAM files have a file extension of .bam. Some tools require BAM
files to be indexed. Besides the .bam file, an indexed BAM file also
has a companion index file of the same name but with a different file
extension (.bai).
BCF: Binary VCF (see VCF). While it is equivalent to VCF, BCF is much
smaller in file size due to compression, and therefore achieves high
efficiency in file transfer and parsing.
BCL: Binary base call files generated from Illumina’s proprietary base call-
ing process.
BED: Browser Extensible Display format used to describe genes or other
genomic features in a genome browser. It is a tab-delimited text for-
mat that defines how genes or genomic features are displayed as an
annotation track in a genome browser such as the UCSC Genome
Browser. Each entry line contains three mandatory fields (chrom,
chromStart, and chromEnd, specifying for each genomic feature the
particular chromosome it is located on and the start and end coor-
dinates) and nine optional fields. Binary PED files (see PED) are also
referred to as BED files, but this is a totally different file format.
bedGraph: Similar to the BED format, bedGraph provides descriptions of
genomic features for their display in a genome browser. Distinctively
the bedGraph format allows display of continuous values, such as
probability scores or coverage depth, in a genome.
bigBed: A format similar to BED, but bigBed files are binary, compressed,
and indexed. Display of bigBed files in a genome browser is sig-
nificantly faster due to the compression and indexing, which allow
transmittal of only the part of the file that is needed for the current
view instead of the entire file.
bigWig: A format for visualization of dense, continuous data, such as GC
content, in a genome browser. A newer format than the WIG format
199
200 Appendix A
(see WIG), bigWig is a compressed and indexed binary file format

and loads significantly faster.
FASTA: A text-based format for storing sequences. A sequence stored in the
FASTA format contains only two elements: a single-line description
(or defline) and the sequence text. The defline starts with the “>”
symbol, followed by a sequence identifier, and then a short descrip-
tion. The sequence text is usually divided into multiple lines with
each less than 80 characters in length. This format has its origin in
the FASTA program package developed in the late 1980s. Multiple
sequences can be stored in a FASTA file. FASTA files often have file
extensions of .fa, .fasta, or .fsa.
FASTQ: The current de facto standard for storing sequencing data generated
from various NGS systems. It is a compact text-based format con-
taining nucleotide base sequences and their call quality scores. Each
read sequence in a FASTQ file is represented by four lines of infor-
mation. The first line starts with the symbol “@,” followed by the
sequence ID and descriptor. The second line is the read sequence.
Line 3 starts with the “+” symbol, which may be followed by the
sequence ID and description (optional). Line 4 lists base-call quality
scores for each base in the read sequence. This format was originally
developed by the Sanger Institute. FASTQ files have file extensions
of .fq or .fastq. Compressed FASTQ files also have the suffix .gz or
.gzip from the compression utility used to create them.
GFF: General (or Generic) Feature Format. GFF is a tab-delimited text file
format that describes how genes or other genomic features are dis-
played in a genome browser. There are different versions of this for-
mat, and GFF2 and GFF3 are currently the two major versions in use.
The GFF format can be converted to the BED format (see BED).
GTF: Gene Transfer Format. A refined GFF format. Identical to GFF2.
PED: A file format used by PLINK (a toolset for genome-wide association
analysis) that contains pedigree/phenotype data.
SAM: Standing for Sequence Alignment/Map, SAM is a standard NGS
reads alignment file format that describes how reads are mapped
to a reference genome. It is a tab-delimited text format and human-
readable. SAM files can be converted into a compressed binary ver-
sion (BAM) for faster parsing and file size reduction. SAM files have
a file extension of .sam. An indexed SAM file also has an accompa-
nying index file that has the file extension of .sai.
SFF (Standard Flowgram Format): A type of binary sequencing file gener-
ated by 454 sequencers. Can be converted to the FASTQ format using
utilities such as sff2fastq.
VCF: Stands for Variant Call Format. A commonly used file format for stor-
ing variant calls. It is a tab-delimited, human-readable text format
that contains metainformation lines, a header line, and data lines
that describe each variant.
Appendix A 201
WIG: Wiggle Track Format. It is used for displaying continuous data tracks,
such as GC content, in a genome viewer such as the UCSC Genome
Browser. The WIG format is similar to the bedGraph format (see bed-
Graph), but a major difference between the two is that data exported
from a WIG track is not as well preserved as that from a bedGraph
track. The WIG format can be converted to bigWig (see bigWig) for
improved performance.
Appendix B:
Glossary
5-methylcytosine (5-mC): The most frequently observed form of epigenetic

DNA modification. Produced by the addition of a methyl group to
the fifth carbon of cytosine. Cytosine methylation reduces gene tran-
scription and regulates chromatin remodeling.
algorithm: A well-defined procedure that comprises a set of instructions for
solving a recurring problem.
alignment: Similarity-based arrangement of sequences. In next-generation
sequencing data analysis, sequence reads are usually aligned against
a reference genome to locate their genomic origins.
allele: One particular variant form of a gene that has a number of alternative
sequence variants.
annotation: The process of providing biologically relevant information to a
piece of DNA or RNA sequence. Also refers to the biological infor-
mation itself that is attached to a sequence.
ASCII: Standing for American Standard Code for Information Interchange,
ASCII provides a standard for encoding characters. Since a computer
only deals with numbers, each human-readable character has to be
encoded with a unique number in a computer. An ASCII code is the
numerical representation of a character in a computer. For example,
in the ASCII table, the character “A” is represented by the number 65.
assembly: A computational process to reconstruct a longer sequence from
short sequences.
barcode: Unique short artificial sequence(s) attached to DNA molecules in
a sequencing sample. The use of barcode sequences enables iden-
tification of different samples when they are sequenced together in
a mixture (i.e., multiplex sequencing). Also see multiplex sequencing
and demultiplexing.
base-call quality score: A score assigned to each base call in a sequence read
to quantify the confidence level of making the call. In next-generation
sequencing, it is defined in the same way as the Phred quality score
originally developed for Sanger sequencing. Also see Phred quality score.
bisulfite conversion: A chemical process that leads to the differentiation of
methylated cytosines from unmethylated cytosines. The treatment
by bisulfite converts unmethylated cytosines in DNA to uracil, while
methylated cytosines are not affected by this process. Bisulfite con-
version coupled with next-generation sequencing is a major means
to study genome-wide DNA methylation. Also see whole-genome
bisulfite sequencing.
203
204 Appendix B
Burrows-Wheeler transform (BWT): A method of permuting the characters

of one string into another string. In next-generation sequencing data
analysis, BWT enables fast reference genome searching by providing
efficient compression and indexing.
cDNA: Complementary DNA. Refers to DNA that is reversely transcribed
from and therefore complementary to an mRNA species.
CDS (coding DNA sequence): The region of DNA that is translated into
protein.
ChIP-Seq: Chromatin immunoprecipitation coupled with sequencing.
A major application of next-generation sequencing for studying
genome binding of DNA-interacting proteins such as transcription
factors.
codon: A trinucleotide sequence of DNA or RNA that codes for a specific
amino acid or the signal for protein synthesis termination. There are
a total of 64 codons, with 61 specifying amino acids and 3 as termi-
nation signals.
contig: A contiguous segment of RNA or DNA sequence resulting from
assembly of a set of overlapping sequence reads.
copy number variation (CNV): One type of genomic variation caused by
changes in copy number of a DNA segment, usually as a result of
deletion or duplication. CNV is a subcategory of structural variation
and involves DNA segments that are usually larger than 1 Kb. Also
see structural variation.
coverage: The average number of times that nucleotides in different genomic
positions appear in a sequencing data set. Also known as sequenc-
ing depth or simply depth.
demultiplexing: The identification and separation of sequencing reads that
are generated from different samples, based on the unique barcode
sequence(s) they carry, after a multiplex sequencing run. Also see
barcode and multiplex sequencing.
depth: See coverage.
DNA polymerase: A class of enzyme that catalyzes the synthesis of a new
DNA strand from free nucleotides, using an existing DNA strand as
template. Many molecular techniques, including polymerase chain
reaction and sequencing-by-synthesis, are based on the use of DNA
polymerases.
DNase: An enzyme that catalyzes the hydrolysis of DNA into oligonucle-
otides or nucleotides.
epigenome: Refers to chemical modifications to DNA and histones, which
provides additional regulation to genomic activity.
exome: The complete set of exons in an organism’s genome.
exon: A stretch of nucleotide sequence that is part of a gene providing cod-
ing information for protein synthesis. Exons are transcribed to and
usually retained in mRNA.
Appendix B 205
false discovery rate (FDR): A measure of statistical significance after cor-

recting for multiple testing. It estimates the proportion of false dis-
coveries in the final list of findings. Among the various approaches
for multiple testing correction, FDR estimation offers a balance
between statistical stringency and rate of type II errors and therefore
is widely used for high-throughput genomics data analysis. Also see
multiple testing correction.
GC content: The percentage of guanines plus cytosines in a DNA/RNA
sequence or genome.
gene expression: The process by which the information encoded in a gene’s
nucleotide sequence is used to direct the synthesis of a functional
gene product. The level of gene expression in a cell or population of
cells is represented by the abundance of its product. The composi-
tion of the large number of gene products and their expression levels
in a cell or population of cells constitute the gene expression profile
of the host cell(s).
Gene Ontology (GO): An initiative to provide consistent description of
gene products using standardized vocabulary. Each gene product
is described by three structured ontologies that encompass their
associated biological processes, cellular components, and molecular
functions.
genome: The complete set of DNA sequence in a cell or an organism.
Contains the complement of information needed to form and main-
tain the cell or organism. Including both protein-coding and non-
coding sequences.
genotype posterior probability: The probability of a genotype given an
observed data set, calculated from next-generation sequencing reads
and often with the use of prior genotype information.
hidden Markov model (HMM): Name after the Russian mathematician
Andrei Markov (1856–1922), HMM is a commonly used machine
learning and data mining approach for signal processing and pat-
tern recognition. A Markov model is a statistical model that deals
with observed sequences and state transitions. In bioinformatics,
HMM is often used for base calling, sequence alignment, and gene
prediction.
high-performance computing (HPC): A computer system that has the capa-
bility to perform over one teraflop (1012) floating-point operations per
second by the use of parallel processing.
indel: A generic term for either the insertion or deletion of nucleotide(s) in
a DNA sequence. Such insertion/deletion events lead to DNA muta-
tion and sequence length change.
indexing: The process of creating a data structure for fast search. Techniques
of indexing for sequence alignment include hashing (storing infor-
mation on where a particular subsequence can be found in a refer-
ence genome or a large collection of reads), suffix array (that consists
206 Appendix B
of lexicographically sorted genomic DNA sequence suffixes), and

Burrows-Wheeler transform (permutation of a genome based on suf-
fix array).
irreproducible discovery rate (IDR): A measure of experimental reproduc-
ibility. Developed to evaluate the reproducibility between replicates
of a ChIP-Seq experiment, it calculates the rate of irreproducible
discoveries, that is, peaks that are called in one replicate but not in
another.
k-mer: In genome assembly or sequence alignment, k-mer refers to all the
possible subsequences of length k in a sequence read.
library: Collection of many different DNA (or RNA) fragments that are sys-
tematically modified for target DNA screening or high-throughput
analysis (including next-generation sequencing). Specifically, a
sequencing library is a pool of DNA (or RNA) fragments with
universal adapters attached to their ends. To construct a sequenc-
ing library, DNA (or RNA) molecules extracted from a population
of cells are usually randomly fragmented, followed by addition of
universal adapters to the two ends of the fragments. Sequences in
the adapters enable subsequent enrichment and high-throughput
sequencing of the fragments.
long noncoding RNA (lncRNA): Non-protein-coding RNA species that are
over 200 nucleotides in length; compare to small RNAs.
machine learning: A branch of computer science that focuses on developing
software algorithms that provide computers the capability to learn
and make predictions on new data. Machine learning is built on
computational model construction from existing input data, which
is then applied to new data for generating predictions or decisions.
mapping: The process of searching the sequence of a read against a refer-
ence genome sequence to locate its origin in the genome. Also see
alignment.
mapping quality: An estimation of the probability of misaligning a read to a
reference genome. It is reported as a Phred-scale quality score. Also
see Phred quality score.
mate-pair reads: Reads generated from two ends of a long DNA fragment.
To achieve sequencing of the two ends, the long DNA fragment is
first circularized and then fragmented. Paired-end sequencing of
the fragment that contains the junction of the two ends generates
mate-pair reads.
MeDIP: Methylated DNA immunoprecipitation with anti-5-methylcytosine
antibody.
metagenome: The collection of all the genomes contained in a microbial
community that consists of many individual organisms.
metagenomics: Studies of all the genomes existing in a microbial commu-
nity as a whole without the need to capture or amplify individual
genomes. Also referred to as environmental or community genomics.
Appendix B 207
microarray: A high-throughput genomics technology based on the use of

predesigned detection probes that are printed or synthesized on a
solid surface, such as glass or a silicon chip, in a high-density array
format.
minor allele frequency (MAF): Frequency of the least abundant allelic vari-
ant in a population.
miRNA: MicroRNA. See small RNA.
mRNA: Messenger RNA that carries protein-coding information from DNA
for protein translation. It acts as the intermediate between DNA and
protein. An important component of a transcriptome.
multiple testing correction: Adjustment of statistical confidence based on
the number of tests performed. Multiple testing without such an
adjustment leads to high levels of false positives. For example, at
a p-value of 0.05, performing 100 comparisons simultaneously will
generate 5 positive outcomes simply by chance if a correction is not
applied. Commonly applied multiple testing correction approaches
include the Bonferroni adjustment (conservative) and false discov-
ery rate estimation. Also see false discovery rate.
multiplex sequencing: Simultaneous sequencing of multiple samples
together. The use of artificial barcode sequence(s) enables sample
identification. Also see barcode and demultiplexing.
multireads: Reads that map to multiple genomic locations.
N50: The weighted mean contig size of a genome assembly. To calculate N50,
all contigs are first ranked based on their lengths, which is then fol-
lowed by adding the ranked lengths from the top downward. N50
refers to the length of the contig that makes the total added length
equal to or greater than 50% of the assembly size. An often-used
metric of de novo genome assembly quality.
NAS: Network attached storage. Specialized computer data storage server
providing data access to a variety of clients through network.
noncoding RNA: RNA species that carry out functions other than coding
for proteins. Examples include small RNAs and lncRNAs. Also see
small RNA and long noncoding RNA.
normalization: A mathematical procedure to correct for unwanted effects
of unintended factors and/or technical bias (such as differences in
sequencing depth between samples in RNA-Seq). This procedure
puts focus on the biological difference of interest and makes samples
in different conditions comparable.
normalized strand correlation (NSC): A measure of signal-to-noise ratio in
ChIP-Seq. It is calculated as the normalized ratio between the maxi-
mum strand cross-correlation (at the fragment-length peak) and
the background cross-correlation. Also see relative strand correlation
(RSC).
208 Appendix B
open reading frame (ORF): A continuous segment of DNA containing

nucleotide triplet codons that starts with the start codon (ATG) and
ends with one of the stop codons (TAA, TAG, or TGA).
operational taxonomic unit (OTU): A common microbial diversity unit
used in metagenomics that may represent a species or a group of
species. OTUs are clustered together based on DNA sequence infor-
mation alone.
paired-end reads: Reads obtained from the two ends of a DNA frag-
ment. Since the length of the DNA fragment, that is, the distance
between the reads, is known, use of paired-end reads provides addi-
tional positional information in mapping or assembly of the reads.
Compare to single-end reads.
pathway: A succession of molecular events that leads to a cellular response
or product. Each event is usually carried out by a gene product.
Many biological pathways are involved in metabolism, signal trans-
duction, and gene expression regulation.
PCR bottleneck coefficient (PBC): An index of sequencing library complex-
ity. It is calculated after the read mapping step as the ratio between
the number of genome locations to which only one unique sequence
read maps and the total number of genome locations to which one
or more unique reads maps. PBC measures the distribution of read
counts toward one read per location.
Phred quality score (Q score): An integer value that is used to estimate the
probability of making an error, that is, calling a base incorrectly. It
is calculated as Q = –10 × log(10)P(Err). For example, a Q score of 20
(Q20) means a 1/100 chance of making a wrong call. Q30 represents
a 1/1000 chance of making a wrong call, which is considered to be a
high-confidence score. Q scores are often represented as ASCII char-
acters for brevity.
Picard: A set of tools written in Java for handling next-generation sequenc-
ing data and file formats.
Pileup: A file format created with SAMtools showing how each genomic
coordinate is covered by reference sequence-matching or -unmatch-
ing bases from all aligned reads.
piRNA: Piwi-interacting RNA. See small RNA.
polymerase chain reaction (PCR): A molecular biology technique that
amplifies the amount of a DNA or RNA fragment, with the use of
specific oligonucleotide primers that flank the two ends of the target
fragment.
promoter: DNA sequence upstream of the open reading frame of a gene. The
promoter region is recognized by RNA polymerase during initiation
of transcription. Contains highly conserved sequence motifs.
proteome: The complete set of proteins in a cell, tissue, or organ at a certain
point of time. Proteomics analyzes a proteome via identifying indi-
vidual component proteins in the repertoire and their abundance.
Appendix B 209
quality score: See base-call quality score.

read: Sequence readout of a DNA (or RNA) fragment.
reduced representation of bisulfite sequencing (RRBS): An experimen-
tal approach based on next-generation sequencing that determines
the DNA methylation pattern in a reduced genome (usually to save
costs). The reduced representation of the genome is usually achieved
by the use of restriction enzymes.
relative strand correlation (RSC): A metric of signal-to-noise ratio in ChIP-
Seq. RSC is the ratio between background-adjusted cross-correlation
coefficient at the fragment-length peak and that at the read-length
peak. Also see normalized strand correlation (NSC).
RNA-Seq: Stands for RNA sequencing. Also referred to as whole tran-
scriptome shotgun sequencing. RNA-Seq is a major technology for
transcriptome analysis and a major application of next-generation
sequencing.
RNAi: RNA interference, that is, inhibition of gene expression. RNAi is usu-
ally mediated by small RNAs, which lead to degradation of specific
mRNA targets.
RNase: An enzyme that catalyzes the degradation of RNA molecules.
rRNA: Ribosomal RNA, that is, RNA species that are essential components
of the ribosome. They play key roles in protein synthesis. By quan-
tity, they are the most abundant RNA species in a cell.
SAN: Storage area network. A type of local area network (LAN) designed to
handle large data transfers.
Sanger sequencing: The first widely adopted DNA sequencing technology.
Devised by Dr. Fred Sanger, it is based on the principle of sequencing-
by-synthesis with the use of dideoxynucleotides that irreversibly
terminate new DNA strand synthesis once incorporated. With the
advent of next-generation sequencing technologies, this sequencing
method has become the synonym of first-generation sequencing.
scaffold: Ordered arrangement of de novo assembled contigs. The relative
positional relationships between contigs are inferred by mate-pair or
paired-end reads. In a scaffold, while the order of contigs is known,
sequence gaps still exist between contigs.
sequencing depth: See coverage.
sequencing library: See library.
single-end read: Sequence read generated from one end of a DNA fragment.
This is in comparison with paired reads generated from both ends of
a DNA fragment. Also see paired-end reads.
single nucleotide polymorphism (SNP): DNA sequence polymorphism due
to variation at a single nucleotide position. Different from the term
single nucleotide variation (SNV), SNP only refers to SNV that is
relatively common in a population with frequency reaching a cer-
tain threshold (usually 1%). Also see single nucleotide variation.
210 Appendix B
single nucleotide variation (SNV): DNA sequence variation that involves

change at a single nucleotide position, for example, the sequence
change from ATTGCA to ATCGCA.
siRNA: Small interfering RNA. See small RNA.
small RNA: Also called small noncoding RNA. The major categories of small
RNA are miRNA, siRNA, and piRNA. In comparison to mRNA mol-
ecules, these RNA molecules are much smaller in size. Small RNA
play important regulatory roles in cells through mediating RNAi.
Also see RNAi.
splicing: The process of removing introns from primary RNA transcripts
and joining of exons to form mature mRNAs. Splicing can be con-
ducted in more than one way for many genes, and this alternative
splicing can lead to the production of different mRNA species from
the same gene through retaining different combinations of exons (or
even introns sometimes).
SRA: Sequence Read Archive (also called Short Read Archive) maintained
by the National Center for Biotechnology Information (NCBI). SRA
is one of the major archives of next-generation sequencing data gen-
erated worldwide. Other publicly available next-generation sequenc-
ing data archives include the European Nucleotide Archive (ENA)
maintained by the European Bioinformatics Institute (EBI).
strand cross-correlation: In ChIP-Seq, there is a shift in base position
between reads generated from the forward and reverse strands of
DNA. Strand cross-correlation is a measure of this shift, and calcu-
lated as the Pearson correlation coefficient between the forward and
reverse read counts at each base position when the reads on the two
strands are shifted toward and away from each other at different
base shifts. Also see normalized strand correlation and relative strand
correlation.
structural variation (SV): Large-scale genomic change that include large
indel, inversion, translocation, or copy number variation. Different
from SNPs or small indels, SVs involve DNA segments that are usu-
ally larger than 1 Kb. Also see copy number variation.
transcript: An RNA molecule transcribed from a segment of DNA.
transcription start site (TSS): The nucleotide site in a segment of DNA from
which RNA transcription is initiated.
transcriptome: The complete set of RNA transcripts in a cell, tissue, or organ
at a certain point of time.
transcriptomics: Studies of the composition of a transcriptome. Encompasses
identification of the large number of RNA species in a transcriptome
and determination of their abundance levels. Major transcriptomics
technologies include microarray and RNA-Seq.
translation: The process of protein synthesis from mRNA. Carried out by
ribosomes.
Appendix B 211
tRNA: Transfer RNA. The function of tRNAs is to transfer amino acids to

ribosomes for protein synthesis according to the triplet genetic code.
UTR: Untranslated region of an mRNA molecule. Can be located on either
the 5′ end or the 3′ end of the mRNA molecule.
variant calling: Identification of sequence difference at specific positions
of an individual genome (or transcriptome) in comparison with a
reference genome. Each called variant usually has a corresponding
Phred-scale quality score.
whole-genome bisulfite sequencing (WGBS): An application of next-
generation sequencing that determines DNA methylation pattern
across the entire genome using bisulfite conversion. Also see bisulfite
conversion.
References
1. Vale RD. The molecular motor toolbox for intracellular transport. Cell 2003,
112:467–480.
2. Cavalier-Smith T. The simultaneous symbiotic origin of mitochondria, chloro-
plasts, and microbodies. Ann NY Acad Sci 1987, 503:55–71.
3. Lopez de Heredia M, Jansen RP. mRNA localization and the cytoskeleton. Curr
Opin Cell Biol 2004, 16:80–85.
4. Hirokawa N. mRNA transport in dendrites: RNA granules, motors, and tracks.
J Neurosci 2006, 26:7139–7142.
5. Mayer F. Cytoskeletons in prokaryotes. Cell Biol Int 2003, 27:429–438.
6. Bender A, Krishnan KJ, Morris CM, Taylor GA, Reeve AK, Perry RH, Jaros E
et al. High levels of mitochondrial DNA deletions in substantia nigra neurons
in aging and Parkinson disease. Nat Genet 2006, 38:515–517.
7. Corral-Debrinski M, Shoffner JM, Lott MT, Wallace DC. Association of mito-
chondrial DNA damage with aging and coronary atherosclerotic heart disease.
Mutat Res 1992, 275:169–180.
8. Santos RX, Correia SC, Zhu X, Smith MA, Moreira PI, Castellani RJ, Nunomura
A, Perry G. Mitochondrial DNA oxidative damage and repair in aging and
Alzheimer’s disease. Antioxid Redox Signal 2013, 18:2444–2457.
9. Greaves LC, Reeve AK, Taylor RW, Turnbull DM. Mitochondrial DNA and dis-
ease. J Pathol 2012, 226:274–286.
10. Green BR. Chloroplast genomes of photosynthetic eukaryotes. Plant J 2011,
66:34–44.
11. Harris SA, Ingram R. Chloroplast DNA and biosystematics: The effects of intra-
specific diversity and plastid transmission. Taxon 1991:393–412.
12. Roy U, Grewal RK, Roy S. Complex networks and systems biology. In Systems
and Synthetic Biology. Springer; 2015:129–150.
13. Fraser CM, Gocayne JD, White O, Adams MD, Clayton RA, Fleischmann RD,
Bult CJ et al. The minimal gene complement of Mycoplasma genitalium. Science
1995, 270:397–403.
14. Glass JI, Assad-Garcia N, Alperovich N, Yooseph S, Lewis MR, Maruf M,
Hutchison CA, 3rd, Smith HO, Venter JC. Essential genes of a minimal bacte-
rium. Proc Natl Acad Sci USA 2006, 103:425–430.
15. Nakabachi A, Yamashita A, Toh H, Ishikawa H, Dunbar HE, Moran NA, Hattori
M. The 160-kilobase genome of the bacterial endosymbiont Carsonella. Science
2006, 314:267.
16. Colbourne JK, Pfrender ME, Gilbert D, Thomas WK, Tucker A, Oakley TH,
Tokishita S et al. The ecoresponsive genome of Daphnia pulex. Science 2011,
331:555–561.
17. Shapiro JA, von Sternberg R. Why repetitive DNA is essential to genome func-
tion. Biol Rev Camb Philos Soc 2005, 80:227–250.
18. Roach JC, Glusman G, Smit AF, Huff CD, Hubley R, Shannon PT, Rowen L et al.
Analysis of genetic inheritance in a family quartet by whole-genome sequenc-
ing. Science 2010, 328:636–639.
213
214 References
19. Alkan C, Coe BP, Eichler EE. Genome structural variation discovery and geno-
typing. Nat Rev Genet 2011, 12:363–376.
20. Malnic B, Godfrey PA, Buck LB. The human olfactory receptor gene family. Proc
Natl Acad Sci USA 2004, 101:2584–2589.
21. Inai Y, Ohta Y, Nishikimi M. The whole structure of the human nonfunctional
L-gulono-gamma-lactone oxidase gene—the gene responsible for scurvy—and
the evolution of repetitive sequences thereon. J Nutr Sci Vitaminol (Tokyo) 2003,
49:315–319.
22. Law JA, Jacobsen SE. Establishing, maintaining and modifying DNA methyla-
tion patterns in plants and animals. Nat Rev Genet 2010, 11:204–220.
23. Cedar H, Bergman Y. Linking DNA methylation and histone modification:
Patterns and paradigms. Nat Rev Genet 2009, 10:295–304.
24. Guo W, Chung WY, Qian M, Pellegrini M, Zhang MQ. Characterizing the
strand-specific distribution of non-CpG methylation in human pluripotent
cells. Nucleic Acids Res 2014, 42:3009–3016.
25. Wu H, Zhang Y. Reversing DNA methylation: Mechanisms, genomics, and bio-
logical functions. Cell 2014, 156:45–68.
26. Bertram L, McQueen MB, Mullin K, Blacker D, Tanzi RE. Systematic meta-
analyses of Alzheimer disease genetic association studies: The AlzGene data-
base. Nat Genet 2007, 39:17–23.
27. Baylin SB, Jones PA. A decade of exploring the cancer epigenome—Biological
and translational implications. Nat Rev Cancer 2011, 11:726–734.
28. Ehrlich M. DNA hypomethylation in cancer cells. Epigenomics 2009, 1:239–259.
29. Serganov A, Nudler E. A decade of riboswitches. Cell 2013, 152:17–24.
30. Ray PS, Jia J, Yao P, Majumder M, Hatzoglou M, Fox PL. A stress-responsive
RNA switch regulates VEGFA expression. Nature 2009, 457:915–919.
31. Wan Y, Kertesz M, Spitale RC, Segal E, Chang HY. Understanding the tran-
scriptome through RNA structure. Nat Rev Genet 2011, 12:641–655.
32. Imashimizu M, Oshima T, Lubkowska L, Kashlev M. Direct assessment of tran-
scription fidelity by high-resolution RNA sequencing. Nucleic Acids Res 2013,
41:9090–9104.
33. Wang ET, Sandberg R, Luo S, Khrebtukova I, Zhang L, Mayr C, Kingsmore SF,
Schroth GP, Burge CB. Alternative isoform regulation in human tissue tran-
scriptomes. Nature 2008, 456:470–476.
34. Pan Q, Shai O, Lee LJ, Frey BJ, Blencowe BJ. Deep surveying of alternative splic-
ing complexity in the human transcriptome by high-throughput sequencing.
Nat Genet 2008, 40:1413–1415.
35. Keegan LP, Gallo A, O’Connell MA. The many roles of an RNA editor. Nat Rev
Genet 2001, 2:869–878.
36. Bratt E, Ohman M. Coordination of editing and splicing of glutamate receptor
pre-mRNA. RNA 2003, 9:309–318.
37. Pfeiffer BE, Huber KM. Current advances in local protein synthesis and synap-
tic plasticity. J Neurosci 2006, 26:7147–7150.
38. Rustad TR, Minch KJ, Brabant W, Winkler JK, Reiss DJ, Baliga NS, Sherman
DR. Global analysis of mRNA stability in Mycobacterium tuberculosis. Nucleic
Acids Res 2013, 41:509–517.
39. Sharova LV, Sharov AA, Nedorezov T, Piao Y, Shaik N, Ko MS. Database for
mRNA half-life of 19 977 genes obtained by DNA microarray analysis of pluri
potent and differentiating mouse embryonic stem cells. DNA Res 2009, 16:45–58.
References 215
40. Yang E, van Nimwegen E, Zavolan M, Rajewsky N, Schroeder M, Magnasco

M, Darnell JE, Jr. Decay rates of human mRNAs: Correlation with functional
characteristics and sequence attributes. Genome Res 2003, 13:1863–1872.
41. Figueroa A, Cuadrado A, Fan J, Atasoy U, Muscat GE, Munoz-Canoves P,
Gorospe M, Munoz A. Role of HuR in skeletal myogenesis through coordinate
regulation of muscle differentiation genes. Mol Cell Biol 2003, 23:4991–5004.
42. Kulkarni M, Ozgur S, Stoecklin G. On track with P-bodies. Biochem Soc Trans
2010, 38:242–251.
43. Garneau NL, Wilusz J, Wilusz CJ. The highways and byways of mRNA decay.
Nat Rev Mol Cell Biol 2007, 8:113–126.
44. Willis DE, Twiss JL. Regulation of protein levels in subcellular domains through
mRNA transport and localized translation. Mol Cell Proteomics 2010, 9:952–962.
45. Jeffares DC, Poole AM, Penny D. Relics from the RNA world. J Mol Evol 1998,
46:18–36.
46. Cech TR. Structural biology. The ribosome is a ribozyme. Science 2000,
289:878–879.
47. Wilson RC, Doudna JA. Molecular mechanisms of RNA interference. Annu Rev
Biophys 2013, 42:217–239.
48. Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are
conserved targets of microRNAs. Genome Res 2009, 19:92–105.
49. Kawamata T, Tomari Y. Making RISC. Trends Biochem Sci 2010, 35:368–376.
50. Carthew RW, Sontheimer EJ. Origins and Mechanisms of miRNAs and siR-
NAs. Cell 2009, 136:642–655.
51. Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte M et al.
Chromatin signature reveals over a thousand highly conserved large non-
coding RNAs in mammals. Nature 2009, 458:223–227.
52. Ponjavic J, Ponting CP, Lunter G. Functionality or transcriptional noise?
Evidence for selection within long noncoding RNAs. Genome Res 2007,
17:556–565.
53. Liu X, Hao L, Li D, Zhu L, Hu S. Long non-coding RNAs and their biological
roles in plants. Genomics Proteomics Bioinformatics 2015, 13:137–147.
54. Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, Guernec G
et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of
their gene structure, evolution, and expression. Genome Res 2012, 22:1775–1789.
55. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC et al.
Long non-coding RNA HOTAIR reprograms chromatin state to promote can-
cer metastasis. Nature 2010, 464:1071–1076.
56. Zhao J, Sun BK, Erwin JA, Song JJ, Lee JT. Polycomb proteins targeted by a short
repeat RNA to the mouse X chromosome. Science 2008, 322:750–756.
57. Li W, Notani D, Ma Q, Tanasa B, Nunez E, Chen AY, Merkurjev D et al.
Functional roles of enhancer RNAs for oestrogen-dependent transcriptional
activation. Nature 2013, 498:516–520.
58. Yoon JH, Abdelmohsen K, Srikantan S, Yang X, Martindale JL, De S, Huarte
M, Zhan M, Becker KG, Gorospe M. LincRNA-p21 suppresses target mRNA
translation. Mol Cell 2012, 47:648–655.
59. Gong C, Maquat LE. lncRNAs transactivate STAU1-mediated mRNA decay by
duplexing with 3’ UTRs via Alu elements. Nature 2011, 470:284–288.
60. Yarmishyn AA, Kurochkin IV. Long noncoding RNAs: A potential novel class
of cancer biomarkers. Front Genet 2015, 6:145.
216 References
61. Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L et al.

Circular RNAs are a large class of animal RNAs with regulatory potency.
Nature 2013, 495:333–338.
62. Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, Kjems
J. Natural RNA circles function as efficient microRNA sponges. Nature 2013,
495:384–388.
63. Cech TR, Steitz JA. The noncoding RNA revolution-trashing old rules to forge
new ones. Cell 2014, 157:77–94.
64. Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, Oyama R
et al. The transcriptional landscape of the mammalian genome. Science 2005,
309:1559–1563.
65. Djebali S, Davis CA, Merkel A, Dobin A, Lassmann T, Mortazavi A, Tanzer A
et al. Landscape of transcription in human cells. Nature 2012, 489:101–108.
66. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J
et al. Genome sequencing in microfabricated high-density picolitre reactors.
Nature 2005, 437:376–380.
67. Bentley DR, Balasubramanian S, Swerdlow HP, Smith GP, Milton J, Brown CG,
Hall KP et al. Accurate whole human genome sequencing using reversible ter-
minator chemistry. Nature 2008, 456:53–59.
68. Eid J, Fehr A, Gray J, Luong K, Lyle J, Otto G, Peluso P et al. Real-time DNA
sequencing from single polymerase molecules. Science 2009, 323:133–138.
69. Poptsova MS, Il’icheva IA, Nechipurenko DY, Panchenko LA, Khodikov MV,
Oparina NY, Polozov RV, Nechipurenko YD, Grokhovsky SL. Non-random
DNA fragmentation in next-generation sequencing. Sci Rep 2014, 4:4532.
70. Seguin-Orlando A, Schubert M, Clary J, Stagegaard J, Alberdi MT, Prado JL,
Prieto A, Willerslev E, Orlando L. Ligation bias in illumina next-generation DNA
libraries: Implications for sequencing ancient genomes. PLoS One 2013, 8:e78575.
71. Hafner M, Renwick N, Brown M, Mihailovic A, Holoch D, Lin C, Pena JT et al.
RNA-ligase-dependent biases in miRNA representation in deep-sequenced
small RNA cDNA libraries. RNA 2011, 17:1697–1712.
72. Aird D, Ross MG, Chen WS, Danielsson M, Fennell T, Russ C, Jaffe DB, Nusbaum
C, Gnirke A. Analyzing and minimizing PCR amplification bias in Illumina
sequencing libraries. Genome Biol 2011, 12:R18.
73. FastQC, http://www.bioinformatics.babraham.ac.uk/projects/fastqc/.
74. FASTX-Toolkit, http://hannonlab.cshl.edu/fastx_toolkit/.
75. Patel RK, Jain M. NGS QC Toolkit: A toolkit for quality control of next genera-
tion sequencing data. PLoS One 2012, 7:e30619.
76. Chen C, Khaleel SS, Huang H, Wu CH. Software for pre-processing Illumina
next-generation sequencing short read sequences. Source Code Biol Med 2014, 9:8.
77. Sickle: A sliding-window, adaptive, quality-based trimming tool for FastQ files
(version 1.33) [software], https://github.com/najoshi/sickle.
78. Bolger AM, Lohse M, Usadel B. Trimmomatic: A flexible trimmer for Illumina
sequence data. Bioinformatics 2014, 30:2114–2120.
79. Li R, Li Y, Kristiansen K, Wang J. SOAP: Short oligonucleotide alignment pro-
gram. Bioinformatics 2008, 24:713–714.
80. Li H, Ruan J, Durbin R. Mapping short DNA sequencing reads and calling vari-
ants using mapping quality scores. Genome Res 2008, 18:1851–1858.
81. Burrows M, Wheeler DJ. A block-sorting lossless data compression algorithm. Digital
Systems Research Center: Palo Alto, CA, Research Report 124, 1994.
References 217
82. Li H, Durbin R. Fast and accurate long-read alignment with Burrows-Wheeler

transform. Bioinformatics 2010, 26:589–595.
83. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat
Methods 2012, 9:357–359.
84. Li R, Yu C, Li Y, Lam TW, Yiu SM, Kristiansen K, Wang J. SOAP2: An improved
ultrafast tool for short read alignment. Bioinformatics 2009, 25:1966–1967.
85. Lunter G, Goodson M. Stampy: A statistical algorithm for sensitive and fast
mapping of Illumina sequence reads. Genome Res 2011, 21:936–939.
86. David M, Dzamba M, Lister D, Ilie L, Brudno M. SHRiMP2: Sensitive yet practi-
cal Short Read Mapping. Bioinformatics 2011, 27:1011–1012.
87. Li H. Aligning sequence reads, clone sequences and assembly contigs with
BWA-MEM. arXiv preprint arXiv:13033997 2013.
88. Chaisson MJ, Tesler G. Mapping single molecule sequencing reads using basic
local alignment with successive refinement (BLASR): Application and theory.
BMC Bioinformatics 2012, 13:238.
89. Kielbasa SM, Wan R, Sato K, Horton P, Frith MC. Adaptive seeds tame genomic
sequence comparison. Genome Res 2011, 21:487–493.
90. Harris RS. Improved pairwise alignment of genomic DNA. PhD dissertation,
Pennslyvania State University, 2007. ProQuest.
91. Schneeberger K, Hagmann J, Ossowski S, Warthmann N, Gesing S, Kohlbacher
O, Weigel D. Simultaneous alignment of short reads against multiple genomes.
Genome Biol 2009, 10:R98.
92. Yuan Y, Norris C, Xu Y, Tsui KW, Ji Y, Liang H. BM-Map: An efficient software
package for accurately allocating multireads of RNA-sequencing data. BMC
Genomics 2012, 13 Suppl 8:S9.
93. Thorvaldsdottir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer
(IGV): High-performance genomics data visualization and exploration. Brief
Bioinform 2013, 14:178–192.
94. Huang W, Marth G. EagleView: A genome assembly viewer for next-generation
sequencing technologies. Genome Res 2008, 18:1538–1543.
95. Milne I, Bayer M, Cardle L, Shaw P, Stephen G, Wright F, Marshall D. Tablet—
Next generation sequence assembly visualization. Bioinformatics 2010, 26:
401–402.
96. Li R, Zhu H, Ruan J, Qian W, Fang X, Shi Z, Li Y, Li S, Shan G, Kristiansen K
et al. De novo assembly of human genomes with massively parallel short read
sequencing. Genome Res 2010, 20:265–272.
97. Lampa S, Dahlo M, Olason PI, Hagberg J, Spjuth O. Lessons learned from
implementing a national infrastructure in Sweden for storage and analysis of
next-generation sequencing data. Gigascience 2013, 2:9.
98. Rasche A, Lienhard M, Yaspo ML, Lehrach H, Herwig R. ARH-seq: Identification
of differential splicing in RNA-seq data. Nucleic Acids Res 2014. doi: 10.1093/nar
/gku495.
99. Farazi TA, Brown M, Morozov P, Ten Hoeve JJ, Ben-Dov IZ, Hovestadt V, Hafner
M et al. Bioinformatic analysis of barcoded cDNA libraries for small RNA pro-
filing by next-generation sequencing. Methods 2012, 58:171–187.
100. Galaxy, https://usegalaxy.org.
101. Afgan E, Baker D, Coraor N, Chapman B, Nekrutenko A, Taylor J. Galaxy
CloudMan: Delivering cloud compute clusters. BMC Bioinformatics 2010, 11
Suppl 12:S4.
218 References
102. Zhulidov PA, Bogdanova EA, Shcheglov AS, Vagner LL, Khaspekov GL,
Kozhemyako VB, Matz MV et al. Simple cDNA normalization using kamchatka
crab duplex-specific nuclease. Nucleic Acids Res 2004, 32:e37.
103. Gallego Romero I, Pai AA, Tung J, Gilad Y. RNA-seq: Impact of RNA degrada-
tion on transcript quantification. BMC Biol 2014, 12:42.
104. Yang L, Duff MO, Graveley BR, Carmichael GG, Chen LL. Genomewide charac-
terization of non-polyadenylated RNAs. Genome Biol 2011, 12:R16.
105. Auer PL, Doerge RW. Statistical design and analysis of RNA sequencing data.
Genetics 2010, 185:405–416.
106. Busby MA, Stewart C, Miller CA, Grzeda KR, Marth GT. Scotty: A web tool
for designing RNA-Seq experiments to measure differential gene expression.
Bioinformatics 2013, 29:656–657.
107. Wang Y, Ghaffari N, Johnson CD, Braga-Neto UM, Wang H, Chen R, Zhou H.
Evaluation of the coverage and depth of transcriptome by RNA-Seq in chick-
ens. BMC Bioinformatics 2011, 12 Suppl 10:S5.
108. Vijay N, Poelstra JW, Kunstner A, Wolf JB. Challenges and strategies in tran-
scriptome assembly and differential gene expression quantification. A compre-
hensive in silico assessment of RNA-seq experiments. Mol Ecol 2013, 22:620–634.
109. Liu Y, Ferguson JF, Xue C, Silverman IM, Gregory B, Reilly MP, Li M. Evaluating
the impact of sequencing depth on transcriptome profiling in human adipose.
PLoS One 2013, 8:e66883.
110. Ching T, Huang S, Garmire LX. Power analysis and sample size estimation for
RNA-Seq differential expression. RNA 2014, 20:1684–1696.
111. DeLuca DS, Levin JZ, Sivachenko A, Fennell T, Nazaire MD, Williams C, Reich
M, Winckler W, Getz G. RNA-SeQC: RNA-seq metrics for quality control and
process optimization. Bioinformatics 2012, 28:1530–1532.
112. Wang L, Wang S, Li W. RSeQC: Quality control of RNA-seq experiments.
113. Tang S, Riva A. PASTA: Splice junction identification from RNA-sequencing
data. BMC Bioinformatics 2013, 14:116.
114. Chen LY, Wei KC, Huang AC, Wang K, Huang CY, Yi D, Tang CY, Galas DJ,
Hood LE. RNASEQR—A streamlined and accurate RNA-seq sequence analysis
program. Nucleic Acids Res 2012, 40:e42.
115. Grant GR, Farkas MH, Pizarro AD, Lahens NF, Schug J, Brunk BP, Stoeckert
CJ, Hogenesch JB, Pierce EA. Comparative analysis of RNA-Seq alignment
algorithms and the RNA-Seq unified mapper (RUM). Bioinformatics 2011,
27:2518–2528.
116. Xu G, Deng N, Zhao Z, Judeh T, Flemington E, Zhu D. SAMMate: A GUI tool for
processing short read alignments in SAM/BAM format. Source Code Biol Med
2011, 6:2.
117. Ryan MC, Cleland J, Kim R, Wong WC, Weinstein JN. SpliceSeq: A resource
for analysis and visualization of RNA-Seq data on alternative splicing and its
functional impacts. Bioinformatics 2012, 28:2385–2387.
118. Trapnell C, Pachter L, Salzberg SL. TopHat: Discovering splice junctions with
RNA-Seq. Bioinformatics 2009, 25:1105–1111.
119. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2:
Accurate alignment of transcriptomes in the presence of insertions, deletions
and gene fusions. Genome Biol 2013, 14:R36.
References 219
120. Wang K, Singh D, Zeng Z, Coleman SJ, Huang Y, Savich GL, He X et al.
MapSplice: Accurate mapping of RNA-seq reads for splice junction discovery.
Nucleic Acids Res 2010, 38:e178.
121. Au KF, Jiang H, Lin L, Xing Y, Wong WH. Detection of splice junctions from
paired-end RNA-seq data by SpliceMap. Nucleic Acids Res 2010, 38:4570–4578.
122. Dimon MT, Sorber K, DeRisi JL. HMMSplicer: A tool for efficient and sensitive
discovery of known and novel splice junctions in RNA-Seq data. PLoS One 2010,
5:e13875.
123. Marco-Sola S, Sammeth M, Guigo R, Ribeca P. The GEM mapper: Fast, accurate
and versatile alignment by filtration. Nat Methods 2012, 9:1185–1188.
124. Wu TD, Nacu S. Fast and SNP-tolerant detection of complex variants and splic-
ing in short reads. Bioinformatics 2010, 26:873–881.
125. Bao H, Xiong Y, Guo H, Zhou R, Lu X, Yang Z, Zhong Y, Shi S. MapNext: A
software tool for spliced and unspliced alignments and SNP detection of short
sequence reads. BMC Genomics 2009, 10 Suppl 3:S13.
126. Ameur A, Wetterbom A, Feuk L, Gyllensten U. Global and unbiased detection
of splice junctions from RNA-seq data. Genome Biol 2010, 11:R34.
127. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson
M, Gingeras TR. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics
2013, 29:15–21.
128. Schulz MH, Zerbino DR, Vingron M, Birney E. Oases: Robust de novo RNA-seq
assembly across the dynamic range of expression levels. Bioinformatics 2012,
28:1086–1092.
129. Xie Y, Wu G, Tang J, Luo R, Patterson J, Liu S, Huang W et al. SOAPdenovo-Trans:
De novo transcriptome assembly with short RNA-Seq reads. Bioinformatics
2014, 30:1660–1666.
130. Robertson G, Schein J, Chiu R, Corbett R, Field M, Jackman SD, Mungall K et al.
De novo assembly and analysis of RNA-seq data. Nat Methods 2010, 7:909–912.
131. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X
et al. Full-length transcriptome assembly from RNA-Seq data without a refer-
ence genome. Nat Biotechnol 2011, 29:644–652.
132. Bullard JH, Purdom E, Hansen KD, Dudoit S. Evaluation of statistical methods
for normalization and differential expression in mRNA-Seq experiments. BMC
Bioinformatics 2010, 11:94.
133. Law CW, Chen Y, Shi W, Smyth GK. Voom: Precision weights unlock linear
model analysis tools for RNA-seq read counts. Genome Biol 2014, 15:R29.
134. Risso D, Schwartz K, Sherlock G, Dudoit S. GC-content normalization for RNA-
Seq data. BMC Bioinformatics 2011, 12:480.
135. Marioni JC, Mason CE, Mane SM, Stephens M, Gilad Y. RNA-seq: An assess-
ment of technical reproducibility and comparison with gene expression arrays.
Genome Res 2008, 18:1509–1517.
136. Anders S, Huber W. Differential expression analysis for sequence count data.
137. Li J, Witten DM, Johnstone IM, Tibshirani R. Normalization, testing, and
false discovery rate estimation for RNA-sequencing data. Biostatistics 2012,
13:523–538.
138. Hardcastle TJ, Kelly KA. baySeq: Empirical Bayesian methods for identifying
differential expression in sequence count data. BMC Bioinformatics 2010, 11:422.
220 References
139. Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ,
Salzberg SL, Wold BJ, Pachter L. Transcript assembly and quantification by
RNA-Seq reveals unannotated transcripts and isoform switching during cell
differentiation. Nat Biotechnol 2010, 28:511–515.
140. Trapnell C, Hendrickson DG, Sauvageau M, Goff L, Rinn JL, Pachter L.
Differential analysis of gene regulation at transcript resolution with RNA-seq.
Nat Biotechnol 2013, 31:46–53.
141. Wang L, Feng Z, Wang X, Wang X, Zhang X. DEGseq: An R package for iden-
tifying differentially expressed genes from RNA-seq data. Bioinformatics 2010,
26:136–138.
142. Love MI, Huber W, Anders S. Moderated estimation of fold change and disper-
sion for RNA-Seq data with DESeq2. bioRxiv 2014.
143. Robinson MD, McCarthy DJ, Smyth GK. edgeR: A Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics
2010, 26:139–140.
144. Li J, Tibshirani R. Finding consistent patterns: A nonparametric approach for
identifying differential expression in RNA-Seq data. Stat Methods Med Res 2013,
22:519–536.
145. Audic S, Claverie JM. The significance of digital gene expression profiles.
Genome Res 1997, 7:986–995.
146. Katz Y, Wang ET, Airoldi EM, Burge CB. Analysis and design of RNA sequencing
experiments for identifying isoform regulation. Nat Methods 2010, 7:1009–1015.
147. Wu J, Akerman M, Sun S, McCombie WR, Krainer AR, Zhang MQ. SpliceTrap:
A method to quantify alternative splicing under single cellular conditions.
148. Roberts A, Pimentel H, Trapnell C, Pachter L. Identification of novel transcripts
in annotated genomes using RNA-Seq. Bioinformatics 2011, 27:2325–2329.
149. Li JJ, Jiang CR, Brown JB, Huang H, Bickel PJ. Sparse linear modeling of next-
generation mRNA sequencing (RNA-Seq) data for isoform discovery and
abundance estimation. Proc Natl Acad Sci USA 2011, 108:19867–19872.
150. Mangul S, Caciula A, Glebova O, Mandoiu I, Zelikovsky A. Improved tran-
scriptome quantification and reconstruction from RNA-Seq reads using partial
annotations. In Silico Biol 2011, 11:251–261.
151. Griffith M, Griffith OL, Mwenifumbo J, Goya R, Morrissy AS, Morin RD, Corbett
R et al.: Alternative expression analysis by RNA sequencing. Nat Methods 2010,
7:843–847.
152. Singh D, Orellana CF, Hu Y, Jones CD, Liu Y, Chiang DY, Liu J, Prins JF. FDM: A
graph-based statistical method to detect differential transcription using RNA-
seq data. Bioinformatics 2011, 27:2633–2640.
153. Drewe P, Stegle O, Hartmann L, Kahles A, Bohnert R, Wachter A, Borgwardt K,
Ratsch G. Accurate detection of differential RNA processing. Nucleic Acids Res
2013, 41:5189–5198.
154. Shi Y, Jiang H. rSeqDiff: Detecting differential isoform expression from RNA-
Seq data using hierarchical likelihood ratio test. PLoS One 2013, 8:e79448.
155. Zheng S, Chen L. A hierarchical Bayesian model for comparing transcriptomes
at the individual transcript isoform level. Nucleic Acids Res 2009, 37:e75.
156. Glaus P, Honkela A, Rattray M. Identifying differentially expressed tran-
scripts from RNA-seq data with biological variation. Bioinformatics 2012, 28:
1721–1728.
References 221
157. Leng N, Dawson JA, Thomson JA, Ruotti V, Rissman AI, Smits BM, Haag JD,
Gould MN, Stewart RM, Kendziorski C. EBSeq: An empirical Bayes hierarchical
model for inference in RNA-seq experiments. Bioinformatics 2013, 29:1035–1043.
158. Li B, Dewey CN. RSEM: Accurate transcript quantification from RNA-Seq data
with or without a reference genome. BMC Bioinformatics 2011, 12:323.
159. Nicolae M, Mangul S, Mandoiu, II, Zelikovsky A. Estimation of alternative
splicing isoform frequencies from RNA-Seq data. Algorithms Mol Biol 2011, 6:9.
160. Martin J, Bruno VM, Fang Z, Meng X, Blow M, Zhang T, Sherlock G, Snyder M,
Wang Z. Rnnotator: An automated de novo transcriptome assembly pipeline
from stranded RNA-Seq reads. BMC Genomics 2010, 11:663.
161. Sacomoto GA, Kielbassa J, Chikhi R, Uricaru R, Antoniou P, Sagot MF,
Peterlongo P, Lacroix V. KISSPLICE: De-novo calling alternative splicing events
from RNA-seq data. BMC Bioinformatics 2012, 13 Suppl 6:S5.
162. Huang da W, Sherman BT, Lempicki RA. Systematic and integrative analysis of
large gene lists using DAVID bioinformatics resources. Nat Protoc 2009, 4:44–57.
163. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA,
Paulovich A et al. Gene set enrichment analysis: A knowledge-based approach
for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA 2005,
102:15545–15550.
164. Salzman J, Gawad C, Wang PL, Lacayo N, Brown PO. Circular RNAs are the
predominant transcript isoform from hundreds of human genes in diverse cell
types. PLoS One 2012, 7:e30733.
165. Davare MA, Tognon CE. Detecting and targeting oncogenic fusion proteins in
the genomic era. Biol Cell 2015, 107(5):111–129.
166. Huang V, Qin Y, Wang J, Wang X, Place RF, Lin G, Lue TF, Li LC. RNAa is con-
served in mammalian cells. PLoS One 2010, 5:e8848.
167. Alon S, Vigneault F, Eminaga S, Christodoulou DC, Seidman JG, Church GM,
Eisenberg E. Barcoding bias in high-throughput multiplex sequencing of
miRNA. Genome Res 2011, 21:1506–1511.
168. Hafner M, Renwick N, Brown M, Mihailovic A, Holoch D, Lin C, Pena JT et al.
RNA-ligase-dependent biases in miRNA representation in deep-sequenced
small RNA cDNA libraries. RNA 2011, 17:1697–1712.
169. Linsen SE, de Wit E, Janssens G, Heater S, Chapman L, Parkin RK, Fritz B et al.
Limitations and possibilities of small RNA digital gene expression profiling.
Nat Methods 2009, 6:474–476.
170. Tian G, Yin X, Luo H, Xu X, Bolund L, Zhang X, Gan SQ, Li N. Sequencing bias:
Comparison of different protocols of microRNA library construction. BMC
Biotechnol 2010, 10:64.
171. Metpally RP, Nasser S, Malenica I, Courtright A, Carlson E, Ghaffari L, Villa S,
Tembe W, Van Keuren-Jensen K. Comparison of analysis tools for miRNA high
throughput sequencing using nerve crush as a model. Front Genet 2013, 4:20.
172. Huang PJ, Liu YC, Lee CC, Lin WC, Gan RR, Lyu PC, Tang P. DSAP: Deep-
sequencing small RNA analysis pipeline. Nucleic Acids Res 2010, 38:W385–391.
173. Hackenberg M, Sturm M, Langenberger D, Falcon-Perez JM, Aransay AM.
miRanalyzer: A microRNA detection and analysis tool for next-generation
sequencing experiments. Nucleic Acids Res 2009, 37:W68–76.
174. Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N. miRDeep2 accu-
rately identifies known and hundreds of novel microRNA genes in seven ani-
mal clades. Nucleic Acids Res 2012, 40:37–52.
222 References
175. Wang WC, Lin FM, Chang WC, Lin KY, Huang HD, Lin NS. miRExpress:
Analyzing high-throughput sequencing data for profiling microRNA expres-
sion. BMC Bioinformatics 2009, 10:328.
176. Ronen R, Gan I, Modai S, Sukacheov A, Dror G, Halperin E, Shomron N.
miRNAkey: A software for microRNA deep sequencing analysis. Bioinformatics
2010, 26:2615–2616.
177. Zhu E, Zhao F, Xu G, Hou H, Zhou L, Li X, Sun Z, Wu J. mirTools: microRNA
profiling and discovery based on high-throughput sequencing. Nucleic Acids
Res 2010, 38:W392–397.
178. Burge SW, Daub J, Eberhardt R, Tate J, Barquist L, Nawrocki EP, Eddy SR,
Gardner PP, Bateman A. Rfam 11.0: 10 years of RNA families. Nucleic Acids Res
2013, 41:D226–232.
179. Axtell MJ. Butter: High-precision genomic alignment of small RNA-seq data.
bioRxiv 2014:007427.
180. Morin RD, O’Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL,
Zhao Y et al. Application of massively parallel sequencing to microRNA profil-
ing and discovery in human embryonic stem cells. Genome Res 2008, 18:610–621.
181. Fernandez-Valverde SL, Taft RJ, Mattick JS. Dynamic isomiR regulation in
Drosophila development. RNA 2010, 16:1881–1888.
182. Li SC, Tsai KW, Pan HW, Jeng YM, Ho MR, Li WH. MicroRNA 3’ end nucleotide
modification patterns and arm selection preference in liver tissues. BMC Syst
Biol 2012, 6 Suppl 2:S14.
183. Pan CT, Tsai KW, Hung TM, Lin WC, Pan CY, Yu HR, Li SC. miRSeq: A user-
friendly standalone toolkit for sequencing quality evaluation and miRNA pro-
filing. Biomed Res Int 2014, 2014:462135.
184. Pantano L, Estivill X, Marti E. SeqBuster, a bioinformatic tool for the processing
and analysis of small RNAs datasets, reveals ubiquitous miRNA modifications
in human embryonic cells. Nucleic Acids Res 2010, 38:e34.
185. Garmire LX, Subramaniam S. Evaluation of normalization methods in mam-
malian microRNA-Seq data. RNA 2012, 18:1279–1288.
186. Dillies MA, Rau A, Aubert J, Hennequet-Antier C, Jeanmougin M, Servant
N, Keime C et al. A comprehensive evaluation of normalization methods for
Illumina high-throughput RNA sequencing data analysis. Brief Bioinform 2013,
14:671–683.
187. Enright AJ, John B, Gaul U, Tuschl T, Sander C, Marks DS. MicroRNA targets in
Drosophila. Genome Biol 2003, 5:R1.
188. Betel D, Koppal A, Agius P, Sander C, Leslie C. Comprehensive modeling of
microRNA targets predicts functional non-conserved and non-canonical sites.
189. Krek A, Grun D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P
et al. Combinatorial microRNA target predictions. Nat Genet 2005, 37:495–500.
190. Kertesz M, Iovino N, Unnerstall U, Gaul U, Segal E. The role of site accessibility
in microRNA target recognition. Nat Genet 2007, 39:1278–1284.
191. Miranda KC, Huynh T, Tay Y, Ang YS, Tam WL, Thomson AM, Lim B, Rigoutsos
I. A pattern-based method for the identification of MicroRNA binding sites and
their corresponding heteroduplexes. Cell 2006, 126:1203–1217.
192. Rehmsmeier M, Steffen P, Hochsmann M, Giegerich R. Fast and effective pre-
diction of microRNA/target duplexes. RNA 2004, 10:1507–1517.
References 223
193. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by aden-
osines, indicates that thousands of human genes are microRNA targets. Cell
2005, 120:15–20.
194. Reczko M, Maragkakis M, Alexiou P, Grosse I, Hatzigeorgiou AG. Functional
microRNA targets in protein coding sequences. Bioinformatics 2012, 28:771–776.
195. Maragkakis M, Alexiou P, Papadopoulos GL, Reczko M, Dalamagas T,
Giannopoulos G, Goumas G et al. Accurate microRNA target prediction cor-
relates with protein repression levels. BMC Bioinformatics 2009, 10:295.
196. Ritchie W, Flamant S, Rasko JE. Predicting microRNA targets and functions:
Traps for the unwary. Nat Methods 2009, 6:397–398.
197. Vlachos IS, Kostoulas N, Vergoulis T, Georgakilas G, Reczko M, Maragkakis M,
Paraskevopoulou MD, Prionidis K, Dalamagas T, Hatzigeorgiou AG. DIANA
miRPath v.2.0: Investigating the combinatorial effect of microRNAs in path-
ways. Nucleic Acids Res 2012, 40:W498–504.
198. Veltman JA, Brunner HG. De novo mutations in human genetic disease. Nat
Rev Genet 2012, 13(8):565–575.
199. Meyerson M, Gabriel S, Getz G. Advances in understanding cancer genomes
through second-generation sequencing. Nat Rev Genet 2010, 11(10):685–696.
200. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky
A, Garimella K et al. The Genome Analysis Toolkit: A MapReduce frame-
work for analyzing next-generation DNA sequencing data. Genome Res 2010,
20(9):1297–1303.
201. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis
G, Durbin R, Genome Project Data Processing Subgroup. The Sequence
Alignment/Map format and SAMtools. Bioinformatics 2009, 25(16):2078–2079.
202. Li R, Li Y, Fang X, Yang H, Wang J, Kristiansen K, Wang J. SNP detection for mas-
sively parallel whole-genome resequencing. Genome Res 2009, 19(6):1124–1132.
203. Challis D, Yu J, Evani US, Jackson AR, Paithankar S, Coarfa C, Milosavljevic
A, Gibbs RA, Yu F. An integrative variant analysis suite for whole exome next-
generation sequencing data. BMC Bioinformatics 2012, 13:8.
204. Koboldt DC, Zhang Q, Larson DE, Shen D, McLellan MD, Lin L, Miller CA,
Mardis ER, Ding L, Wilson RK. VarScan 2: Somatic mutation and copy num-
ber alteration discovery in cancer by exome sequencing. Genome Res 2012,
22(3):568–576.
205. Cibulskis K, Lawrence MS, Carter SL, Sivachenko A, Jaffe D, Sougnez C,
Gabriel S, Meyerson M, Lander ES, Getz G. Sensitive detection of somatic point
mutations in impure and heterogeneous cancer samples. Nat Biotechnol 2013,
31(3):213–219.
206. Larson DE, Harris CC, Chen K, Koboldt DC, Abbott TE, Dooling DJ, Ley TJ,
Mardis ER, Wilson RK, Ding L. SomaticSniper: Identification of somatic point
mutations in whole genome sequencing data. Bioinformatics 2012, 28(3):311–317.
207. Saunders CT, Wong WS, Swamy S, Becq J, Murray LJ, Cheetham RK. Strelka:
Accurate somatic small-variant calling from sequenced tumor-normal sample
pairs. Bioinformatics 2012, 28(14):1811–1817.
208. Roth A, Ding J, Morin R, Crisan A, Ha G, Giuliany R, Bashashati A et al.
JointSNVMix: A probabilistic model for accurate detection of somatic muta-
tions in normal/tumour paired next-generation sequencing data. Bioinformatics
2012, 28(7):907–913.
224 References
209. Albers CA, Lunter G, MacArthur DG, McVean G, Ouwehand WH, Durbin R.
Dindel: Accurate indel calls from short-read data. Genome Res 2011, 21(6):961–973.
210. Li S, Li R, Li H, Lu J, Li Y, Bolund L, Schierup MH, Wang J. SOAPindel: Efficient
identification of indels from short paired reads. Genome Res 2013, 23(1):195–200.
211. Tang X, Baheti S, Shameer K, Thompson KJ, Wills Q, Niu N, Holcomb IN et al.
The eSNV-detect: A computational system to identify expressed single nucle-
otide variants from transcriptome sequencing data. Nucleic Acids Res 2014,
42(22):e172.
212. Piskol R, Ramaswami G, Li JB. Reliable identification of genomic variants from
RNA-seq data. Am J Hum Genet 2013, 93(4):641–651.
213. Goya R, Sun MG, Morin RD, Leung G, Ha G, Wiegand KC, Senz J et al.
SNVMix: Predicting single nucleotide variants from next-generation sequenc-
ing of tumors. Bioinformatics 2010, 26(6):730–736.
214. Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo MA,
Handsaker RE et al. The variant call format and VCFtools. Bioinformatics 2011,
27(15):2156–2158.
215. vcflib, https://github.com/ekg/vcflib.
216. Freudenberg-Hua Y, Freudenberg J, Kluck N, Cichon S, Propping P, Nothen
MM. Single nucleotide variation analysis in 65 candidate genes for CNS disor-
ders in a representative sample of the European population. Genome Res 2003,
13(10):2271–2276.
217. Chen K, Wallis JW, McLellan MD, Larson DE, Kalicki JM, Pohl CS, McGrath
SD et al. BreakDancer: An algorithm for high-resolution mapping of genomic
structural variation. Nat Methods 2009, 6(9):677–681.
218. Sindi S, Helman E, Bashir A, Raphael BJ. A geometric approach for classifica-
tion and comparison of structural variants. Bioinformatics 2009, 25(12):i222–i230.
219. Quinlan AR, Clark RA, Sokolova S, Leibowitz ML, Zhang Y, Hurles ME, Mell
JC, Hall IM. Genome-wide mapping and assembly of structural variant break-
points in the mouse genome. Genome Res 2010, 20(5):623–635.
220. Korbel JO, Abyzov A, Mu XJ, Carriero N, Cayting P, Zhang Z, Snyder M, Gerstein
MB. PEMer: A computational framework with simulation-based error models
for inferring genomic structural variants from massive paired-end sequencing
data. Genome Biol 2009, 10(2):R23.
221. Zeitouni B, Boeva V, Janoueix-Lerosey I, Loeillet S, Legoix-ne P, Nicolas A,
Delattre O, Barillot E. SVDetect: A tool to identify genomic structural varia-
tions from paired-end and mate-pair sequencing data. Bioinformatics 2010,
26(15):1895–1896.
222. Wang J, Mullighan CG, Easton J, Roberts S, Heatley SL, Ma J, Rusch MC et al.
CREST maps somatic structural variation in cancer genomes with base-pair
resolution. Nat Methods 2011, 8(8):652–654.
223. Ye K, Schulz MH, Long Q, Apweiler R, Ning Z. Pindel: A pattern growth
approach to detect break points of large deletions and medium sized insertions
from paired-end short reads. Bioinformatics 2009, 25(21):2865–2871.
224. Emde AK, Schulz MH, Weese D, Sun R, Vingron M, Kalscheuer VM, Haas
SA, Reinert K. Detecting genomic indel variants with exact breakpoints in
single- and paired-end sequencing data using SplazerS. Bioinformatics 2012,
28(5):619–627.
References 225
225. Zhang ZD, Du J, Lam H, Abyzov A, Urban AE, Snyder M, Gerstein M.

Identification of genomic indels and structural variations using split reads.
BMC Genomics 2011, 12:375.
226. Iqbal Z, Caccamo M, Turner I, Flicek P, McVean G. De novo assembly and geno-
typing of variants using colored de Bruijn graphs. Nat Genet 2012, 44(2):226–232.
227. Ivakhno S, Royce T, Cox AJ, Evers DJ, Cheetham RK, Tavare S. CNAseg—A
novel framework for identification of copy number changes in cancer from
second-generation sequencing data. Bioinformatics 2010, 26(24):3051–3058.
228. Xie C, Tammi MT. CNV-seq, a new method to detect copy number variation
using high-throughput sequencing. BMC bioinformatics 2009, 10:80.
229. Abyzov A, Urban AE, Snyder M, Gerstein M. CNVnator: An approach to dis-
cover, genotype, and characterize typical and atypical CNVs from family and
population genome sequencing. Genome Res 2011, 21(6):974–984.
230. Yoon S, Xuan Z, Makarov V, Ye K, Sebat J. Sensitive and accurate detection
of copy number variants using read depth of coverage. Genome Res 2009,
19(9):1586–1592.
231. Magi A, Benelli M, Yoon S, Roviello F, Torricelli F. Detecting common copy
number variants in high-throughput sequencing data by using JointSLM algo-
rithm. Nucleic Acids Res 2011, 39(10):e65.
232. Chiang DY, Getz G, Jaffe DB, O’Kelly MJ, Zhao X, Carter SL, Russ C, Nusbaum
C, Meyerson M, Lander ES. High-resolution mapping of copy-number altera-
tions with massively parallel sequencing. Nat Methods 2009, 6(1):99–103.
233. Wong K, Keane TM, Stalker J, Adams DJ. Enhanced structural variant and
breakpoint detection using SVMerge by integration of multiple detection meth-
ods and local assembly. Genome Biol 2010, 11(12):R128.
234. Sindi SS, Onal S, Peng LC, Wu HT, Raphael BJ. An integrative probabilistic
model for identification of structural variation in sequencing data. Genome Biol
2012, 13(3):R22.
235. Zhang J, Wu Y. SVseq: An approach for detecting exact breakpoints of deletions
with low-coverage sequence data. Bioinformatics 2011, 27(23):3228–3234.
236. Medvedev P, Fiume M, Dzamba M, Smith T, Brudno M. Detecting copy number
variation with mated short reads. Genome Res 2010, 20(11):1613–1622.
237. Wang K, Li M, Hakonarson H. ANNOVAR: Functional annotation of genetic
variants from high-throughput sequencing data. Nucleic Acids Res 2010,
38(16):e164.
238. SeattleSeq, http://snp.gs.washington.edu/SeattleSeqAnnotation138/.
239. Cingolani P, Platts A, Wang le L, Coon M, Nguyen T, Wang L, Land SJ, Lu X,
Ruden DM. A program for annotating and predicting the effects of single
nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melano-
gaster strain w1118; iso-2; iso-3. Fly 2012, 6(2):80–92.
240. McLaren W, Pritchard B, Rios D, Chen Y, Flicek P, Cunningham F. Deriving
the consequences of genomic variants with the Ensembl API and SNP Effect
Predictor. Bioinformatics 2010, 26(16):2069–2070.
241. PSEQ, http://atgu.mgh.harvard.edu/plinkseq/pseq.shtml.
242. Morgenthaler S, Thilly WG. A strategy to discover genes that carry multi-allelic
or mono-allelic risk for common diseases: A cohort allelic sums test (CAST).
Mutation Res 2007, 615(1–2):28–56.
226 References
243. Li B, Leal SM. Methods for detecting associations with rare variants for com-
mon diseases: Application to analysis of sequence data. Am J Hum Genet 2008,
83(3):311–321.
244. Schatz MC, Delcher AL, Salzberg SL. Assembly of large genomes using second-
generation sequencing. Genome Res 2010, 20:1165–1173.
245. Zerbino DR, Birney E. Velvet: Algorithms for de novo short read assembly
using de Bruijn graphs. Genome Res 2008, 18:821–829.
246. Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ, Birol I. ABySS: A parallel
assembler for short read sequence data. Genome Res 2009, 19:1117–1123.
247. van Heesch S, Kloosterman WP, Lansu N, Ruzius FP, Levandowsky E, Lee CC,
Zhou S et al. Improving mammalian genome scaffolding using large insert
mate-pair next-generation sequencing. BMC Genomics 2013, 14:257.
248. Li R, Fan W, Tian G, Zhu H, He L, Cai J, Huang Q et al. The sequence and de
novo assembly of the giant panda genome. Nature 2010, 463:311–317.
249. Nagarajan N, Pop M. Sequence assembly demystified. Nat Rev Genet 2013, 14:157–167.
250. Desai A, Marwah VS, Yadav A, Jha V, Dhaygude K, Bangar U, Kulkarni V, Jere
A. Identification of optimum sequencing depth especially for de novo genome
assembly of small genomes using next generation sequencing data. PLoS One
2013, 8:e60204.
251. Magoc T, Salzberg SL. FLASH: Fast length adjustment of short reads to improve
genome assemblies. Bioinformatics 2011, 27:2957–2963.
252. Masella AP, Bartram AK, Truszkowski JM, Brown DG, Neufeld JD. PANDAseq:
Paired-end assembler for illumina sequences. BMC Bioinformatics 2012, 13:31.
253. Kelley DR, Schatz MC, Salzberg SL. Quake: Quality-aware detection and cor-
rection of sequencing errors. Genome Biol 2010, 11:R116.
254. Gnerre S, Maccallum I, Przybylski D, Ribeiro FJ, Burton JN, Walker BJ, Sharpe
T et al. High-quality draft assemblies of mammalian genomes from massively
parallel sequence data. Proc Natl Acad Sci USA 2011, 108:1513–1518.
255. Pevzner PA, Tang H, Waterman MS. An Eulerian path approach to DNA frag-
ment assembly. Proc Natl Acad Sci USA 2001, 98:9748–9753.
256. Marcais G, Kingsford C. A fast, lock-free approach for efficient parallel count-
ing of occurrences of k-mers. Bioinformatics 2011, 27:764–770.
257. Chikhi R, Medvedev P. Informed and automated k-mer size selection for
genome assembly. Bioinformatics 2014, 30:31–37.
258. Simpson JT. Exploring genome characteristics and sequence quality without a
reference. Bioinformatics 2014, 30:1228–1235.
259. VelvetOptimiser, https://github.com/Victorian-Bioinformatics-Consortium
/VelvetOptimiser.
260. Lander ES, Waterman MS. Genomic mapping by fingerprinting random clones:
A mathematical analysis. Genomics 1988, 2:231–239.
261. Warren RL, Sutton GG, Jones SJ, Holt RA. Assembling millions of short DNA
sequences using SSAKE. Bioinformatics 2007, 23:500–501.
262. Dohm JC, Lottaz C, Borodina T, Himmelbauer H. SHARCGS, a fast and highly
accurate short-read assembly algorithm for de novo genomic sequencing.
Genome Res 2007, 17:1697–1706.
263. Jeck WR, Reinhardt JA, Baltrus DA, Hickenbotham MT, Magrini V, Mardis ER,
Dangl JL, Jones CD. Extending assembly of short DNA sequences to handle
error. Bioinformatics 2007, 23:2942–2944.
References 227
264. Miller JR, Delcher AL, Koren S, Venter E, Walenz BP, Brownley A, Johnson
J, Li K, Mobarry C, Sutton G. Aggressive assembly of pyrosequencing reads
with mates. Bioinformatics 2008, 24:2818–2824.
265. Hernandez D, Francois P, Farinelli L, Osteras M, Schrenzel J. De novo bacterial
genome sequencing: Millions of very short reads assembled on a desktop com-
puter. Genome Res 2008, 18:802–809.
266. Li H. Exploring single-sample SNP and INDEL calling with whole-genome de
novo assembly. Bioinformatics 2012, 28:1838–1844.
267. Diguistini S, Liao NY, Platt D, Robertson G, Seidel M, Chan SK, Docking TR
et al. De novo genome sequence assembly of a filamentous fungus using
Sanger, 454 and Illumina sequence data. Genome Biol 2009, 10:R94.
268. Myers EW. Toward simplifying and accurately formulating fragment assembly.
J Comput Biol 1995, 2:275–290.
269. Gonnella G, Kurtz S. Readjoiner: A fast and memory efficient string graph-
based sequence assembler. BMC Bioinformatics 2012, 13:82.
270. Butler J, MacCallum I, Kleber M, Shlyakhter IA, Belmonte MK, Lander ES,
Nusbaum C, Jaffe DB. ALLPATHS: De novo assembly of whole-genome shot-
gun microreads. Genome Res 2008, 18:810–820.
271. Maccallum I, Przybylski D, Gnerre S, Burton J, Shlyakhter I, Gnirke A, Malek J
et al. ALLPATHS 2: Small genomes assembled accurately and with high conti-
nuity from short paired reads. Genome Biol 2009, 10:R103.
272. Peng Y, Leung HC, Yiu S-M, Chin FY. IDBA—A practical iterative de Bruijn
graph de novo assembler. In Research in Computational Molecular Biology,
Springer; 2010: 426–440.
273. Luo R, Liu B, Xie Y, Li Z, Huang W, Yuan J, He G et al. SOAPdenovo2: An empir-
ically improved memory-efficient short-read de novo assembler. Gigascience
2012, 1:18.
274. Ye C, Ma ZS, Cannon CH, Pop M, Yu DW. Exploiting sparseness in de novo
genome assembly. BMC Bioinformatics 2012, 13 Suppl 6:S1.
275. Zimin AV, Marcais G, Puiu D, Roberts M, Salzberg SL, Yorke JA. The MaSuRCA
genome assembler. Bioinformatics 2013, 29:2669–2677.
276. Pop M, Kosack DS, Salzberg SL. Hierarchical scaffolding with Bambus. Genome
Res 2004, 14:149–159.
277. Koren S, Treangen TJ, Pop M. Bambus 2: Scaffolding metagenomes. Bioinformatics
2011, 27:2964–2971.
278. Gao S, Sung WK, Nagarajan N. Opera: Reconstructing optimal genomic
scaffolds with high-throughput paired-end sequences. J Comput Biol 2011,
18:1681–1691.
279. Dayarian A, Michael TP, Sengupta AM. SOPRA: Scaffolding algorithm for
paired reads via statistical optimization. BMC Bioinformatics 2010, 11:345.
280. Boetzer M, Henkel CV, Jansen HJ, Butler D, Pirovano W. Scaffolding pre-
assembled contigs using SSPACE. Bioinformatics 2011, 27:578–579.
281. Hunt M, Newbold C, Berriman M, Otto TD. A comprehensive evaluation of
assembly scaffolding tools. Genome Biol 2014, 15:R42.
282. Gurevich A, Saveliev V, Vyahhi N, Tesler G. QUAST: Quality assessment tool
for genome assemblies. Bioinformatics 2013, 29:1072–1075.
283. Tsai IJ, Otto TD, Berriman M. Improving draft assemblies by iterative mapping
and assembly of short reads to eliminate gaps. Genome Biol 2010, 11:R41.
228 References
284. Boetzer M, Pirovano W. Toward almost closed genomes with GapFiller. Genome
Biol 2012, 13:R56.
285. Bao E, Jiang T, Girke T. AlignGraph: Algorithm for secondary de novo genome
assembly guided by closely related references. Bioinformatics 2014, 30:i319–i328.
286. Kim J, Larkin DM, Cai Q, Asan, Zhang Y, Ge RL, Auvil L et al. Reference-
assisted chromosome assembly. Proc Natl Acad Sci USA 2013, 110:1785–1790.
287. Chen Y, Negre N, Li Q, Mieczkowska JO, Slattery M, Liu T, Zhang Y et al.
Systematic evaluation of factors influencing ChIP-seq fidelity. Nat Methods 2012,
9:609–614.
288. Daley T, Smith AD. Predicting the molecular complexity of sequencing librar-
ies. Nat Methods 2013, 10:325–327.
289. Diaz A, Nellore A, Song JS. CHANCE: Comprehensive software for quality
control and validation of ChIP-seq data. Genome Biol 2012, 13:R98.
290. Zhao X, Sandelin A. GMD: Measuring the distance between histograms
with applications on high-throughput sequencing reads. Bioinformatics 2012,
28:1164–1165.
291. Diaz A, Park K, Lim DA, Song JS. Normalization, bias correction, and peak call-
ing for ChIP-seq. Stat Appl Genet Mol Biol 2012, 11:Article 9.
292. Rozowsky J, Euskirchen G, Auerbach RK, Zhang ZD, Gibson T, Bjornson R,
Carriero N, Snyder M, Gerstein MB. PeakSeq enables systematic scoring of
ChIP-seq experiments relative to controls. Nat Biotechnol 2009, 27:66–75.
293. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, Nusbaum C
et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol 2008, 9:R137.
294. Ji H, Jiang H, Ma W, Johnson DS, Myers RM, Wong WH. An integrated soft-
ware system for analyzing ChIP-chip and ChIP-seq data. Nat Biotechnol 2008,
26:1293–1300.
295. Shen L, Shao NY, Liu X, Maze I, Feng J, Nestler EJ. diffReps: Detecting differen-
tial chromatin modification sites from ChIP-seq data with biological replicates.
PLoS One 2013, 8:e65598.
296. Manser P, Reimers M. A simple scaling normalization for comparing ChIP-Seq
samples. PeerJ PrePrints 2014, 1.
297. Shao Z, Zhang Y, Yuan GC, Orkin SH, Waxman DJ. MAnorm: A robust model
for quantitative comparison of ChIP-Seq data sets. Genome Biol 2012, 13:R16.
298. Nair NU, Sahu AD, Bucher P, Moret BM. ChIPnorm: A statistical method for
normalizing and identifying differential regions in histone modification ChIP-
seq libraries. PLoS One 2012, 7:e39573.
299. Taslim C, Wu J, Yan P, Singer G, Parvin J, Huang T, Lin S, Huang K. Comparative
study on ChIP-seq data: Normalization and binding pattern characterization.
300. Kharchenko PV, Tolstorukov MY, Park PJ. Design and analysis of ChIP-seq
experiments for DNA-binding proteins. Nat Biotechnol 2008, 26:1351–1359.
301. Landt SG, Marinov GK, Kundaje A, Kheradpour P, Pauli F, Batzoglou S,
Bernstein BE et al. ChIP-seq guidelines and practices of the ENCODE and
modENCODE consortia. Genome Res 2012, 22:1813–1831.
302. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, Cheng JX, Murre C,
Singh H, Glass CK. Simple combinations of lineage-determining transcription
factors prime cis-regulatory elements required for macrophage and B cell iden-
tities. Mol Cell 2010, 38:576–589.
References 229
303. Xu H, Handoko L, Wei X, Ye C, Sheng J, Wei CL, Lin F, Sung WK. A signal-noise
model for significance analysis of ChIP-seq with negative control. Bioinformatics
2010, 26:1199–1204.
304. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping and quan-
tifying mammalian transcriptomes by RNA-Seq. Nat Methods 2008, 5:621–628.
305. Boyle AP, Guinney J, Crawford GE, Furey TS. F-Seq: A feature density estima-
tor for high-throughput sequence tags. Bioinformatics 2008, 24:2537–2538.
306. Tuteja G, White P, Schug J, Kaestner KH. Extracting transcription factor targets
from ChIP-Seq data. Nucleic Acids Res 2009, 37:e113.
307. Feng X, Grossman R, Stein L. PeakRanger: A cloud-enabled peak caller for
ChIP-seq data. BMC Bioinformatics 2011, 12:139.
308. Valouev A, Johnson DS, Sundquist A, Medina C, Anton E, Batzoglou S, Myers
RM, Sidow A. Genome-wide analysis of transcription factor binding sites based
on ChIP-Seq data. Nat Methods 2008, 5:829–834.
309. Song Q, Smith AD. Identifying dispersed epigenomic domains from ChIP-Seq
data. Bioinformatics 2011, 27:870–871.
310. Zang C, Schones DE, Zeng C, Cui K, Zhao K, Peng W. A clustering approach for
identification of enriched domains from histone modification ChIP-Seq data.
311. Jothi R, Cuddapah S, Barski A, Cui K, Zhao K. Genome-wide identification of
in vivo protein-DNA binding sites from ChIP-Seq data. Nucleic Acids Res 2008,
36:5221–5231.
312. Nix DA, Courdy SJ, Boucher KM. Empirical methods for controlling false posi-
tives and estimating confidence in ChIP-Seq peaks. BMC Bioinformatics 2008,
9:523.
313. Rashid NU, Giresi PG, Ibrahim JG, Sun W, Lieb JD. ZINBA integrates local
covariates with DNA-seq data to identify broad and narrow regions of enrich-
ment, even within amplified genomic regions. Genome Biol 2011, 12:R67.
314. Shin H, Liu T, Manrai AK, Liu XS. CEAS: cis-Regulatory element annotation
system. Bioinformatics 2009, 25:2605–2606.
315. Zhu LJ, Gazin C, Lawson ND, Pages H, Lin SM, Lapointe DS, Green MR.
ChIPpeakAnno: A Bioconductor package to annotate ChIP-seq and ChIP-chip
data. BMC Bioinformatics 2010, 11:237.
316. Chen X, Xu H, Yuan P, Fang F, Huss M, Vega VB, Wong E et al. Integration of
external signaling pathways with the core transcriptional network in embry-
onic stem cells. Cell 2008, 133:1106–1117.
317. Chen L, Wang C, Qin ZS, Wu H. A novel statistical method for quantitative
comparison of multiple ChIP-seq datasets. Bioinformatics 2015, 31:1889–1896.
318. Xu H, Wei CL, Lin F, Sung WK. An HMM approach to genome-wide identifica-
tion of differential histone modification sites from ChIP-seq data. Bioinformatics
2008, 24:2344–2349.
319. Hon G, Ren B, Wang W. ChromaSig: A probabilistic approach to finding com-
mon chromatin signatures in the human genome. PLoS Comput Biol 2008,
4:e1000201.
320. Liang K, Keles S. Detecting differential binding of transcription factors with
ChIP-seq. Bioinformatics 2012, 28:121–122.
321. Stark R, Brown G. DiffBind: Differential binding analysis of ChIP-Seq peak
data. In R package version 2011, 100.
230 References
322. Taslim C, Huang T, Lin S. DIME: R-package for identifying differential ChIP-
seq based on an ensemble of mixture models. Bioinformatics 2011, 27:1569–1570.
323. Schweikert G, Cseke B, Clouaire T, Bird A, Sanguinetti G. MMDiff: Quantitative
testing for shape changes in ChIP-Seq data sets. BMC Genomics 2013, 14:826.
324. Welch RP, Lee C, Imbriano PM, Patil S, Weymouth TE, Smith RA, Scott LJ, Sartor
MA. ChIP-Enrich: Gene set enrichment testing for ChIP-seq data. Nucleic Acids
Res 2014. doi: 10.1093/nar/gku463.
325. Liu T, Ortiz JA, Taing L, Meyer CA, Lee B, Zhang Y, Shin H et al. Cistrome: An
integrative platform for transcriptional regulation studies. Genome Biol 2011, 12:R83.
326. Machanick P, Bailey TL. MEME-ChIP: Motif analysis of large DNA datasets.
327. Thomas-Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden
J. RSAT peak-motifs: Motif analysis in full-size ChIP-seq datasets. Nucleic Acids
Res 2012, 40:e31.
328. Kulakovskiy IV, Boeva VA, Favorov AV, Makeev VJ. Deep and wide digging for
binding motifs in ChIP-Seq data. Bioinformatics 2010, 26:2622–2623.
329. Mahony S, Benos PV. STAMP: A web tool for exploring DNA-binding motif
similarities. Nucleic Acids Res 2007, 35:W253–258.
330. Gupta S, Stamatoyannopoulos JA, Bailey TL, Noble WS. Quantifying similarity
between motifs. Genome Biol 2007, 8:R24.
331. Bailey TL, Machanick P. Inferring direct DNA binding from ChIP-seq. Nucleic
Acids Res 2012, 40:e128.
332. Grant CE, Bailey TL, Noble WS. FIMO: Scanning for occurrences of a given
motif. Bioinformatics 2011, 27:1017–1018.
333. Ernst J, Kellis M. Discovery and characterization of chromatin states for sys-
tematic annotation of the human genome. Nat Biotechnol 2010, 28:817–825.
334. Klein HU, Schafer M, Porse BT, Hasemann MS, Ickstadt K, Dugas M. Integrative
analysis of histone ChIP-seq and transcription data using Bayesian mixture
models. Bioinformatics 2014 (Epub ahead of print).
335. Standards and Guidelines for Whole Genome Shotgun Bisulfite Sequencing,
http://www.roadmapepigenomics.org/protocols.
336. Ziller MJ, Hansen KD, Meissner A, Aryee MJ. Coverage recommendations
for methylation analysis by whole-genome bisulfite sequencing. Nat Methods
2015, 12(3):230–232.
337. Meissner A, Gnirke A, Bell GW, Ramsahoye B, Lander ES, Jaenisch R. Reduced
representation bisulfite sequencing for comparative high-resolution DNA
methylation analysis. Nucleic Acids Res 2005, 33:5868–5877.
338. Nautiyal S, Carlton VE, Lu Y, Ireland JS, Flaucher D, Moorhead M, Gray JW
et al. High-throughput method for analyzing methylation of CpGs in targeted
genomic regions. Proc Natl Acad Sci USA 2010, 107:12587–12592.
339. Varley KE, Mitra RD. Bisulfite Patch PCR enables multiplexed sequencing of
promoter methylation across cancer samples. Genome Res 2010, 20:1279–1287.
340. Deng J, Shoemaker R, Xie B, Gore A, LeProust EM, Antosiewicz-Bourget J, Egli
D et al. Targeted bisulfite sequencing reveals changes in DNA methylation
associated with nuclear reprogramming. Nat Biotechnol 2009, 27:353–360.
341. Ivanov M, Kals M, Kacevska M, Metspalu A, Ingelman-Sundberg M, Milani
L. In-solution hybrid capture of bisulfite-converted DNA for targeted bisulfite
sequencing of 174 ADME genes. Nucleic Acids Res 2013, 41:e72.
References 231
342. Harris RA, Wang T, Coarfa C, Nagarajan RP, Hong C, Downey SL, Johnson BE
et al. Comparison of sequencing-based methods to profile DNA methylation
and identification of monoallelic epigenetic modifications. Nat Biotechnol 2010,
28:1097–1105.
343. Nair SS, Coolen MW, Stirzaker C, Song JZ, Statham AL, Strbenac D, Robinson
MD, Clark SJ. Comparison of methyl-DNA immunoprecipitation (MeDIP) and
methyl-CpG binding domain (MBD) protein capture for genome-wide DNA
methylation analysis reveal CpG sequence coverage bias. Epigenetics 2011,
6:34–44.
344. Booth MJ, Branco MR, Ficz G, Oxley D, Krueger F, Reik W, Balasubramanian S.
Quantitative sequencing of 5-methylcytosine and 5-hydroxymethylcytosine at
single-base resolution. Science 2012, 336:934–937.
345. Flusberg BA, Webster DR, Lee JH, Travers KJ, Olivares EC, Clark TA, Korlach J,
Turner SW. Direct detection of DNA methylation during single-molecule, real-
time sequencing. Nat Methods 2010, 7:461–465.
346. Laszlo AH, Derrington IM, Brinkerhoff H, Langford KW, Nova IC, Samson
JM, Bartlett JJ, Pavlenok M, Gundlach JH. Detection and mapping of
5-methylcytosine and 5-hydroxymethylcytosine with nanopore MspA. Proc
Natl Acad Sci USA 2013, 110:18904–18909.
347. Schreiber J, Wescoe ZL, Abu-Shumays R, Vivian JT, Baatar B, Karplus K, Akeson
M. Error rates for nanopore discrimination among cytosine, methylcytosine,
and hydroxymethylcytosine along individual DNA strands. Proc Natl Acad Sci
USA 2013, 110:18910–18915.
348. Trim Galore!, http://www.bioinformatics.babraham.ac.uk/projects/trim
_galore/.
349. Hansen KD, Langmead B, Irizarry RA. BSmooth: From whole genome bisulfite
sequencing reads to differentially methylated regions. Genome Biol 2012, 13:R83.
350. Liang F, Tang B, Wang Y, Wang J, Yu C, Chen X, Zhu J, Yan J, Zhao W, Li R.
WBSA: Web service for bisulfite sequencing data analysis. PLoS One 2014,
9:e86707.
351. Xi Y, Li W. BSMAP: Whole genome bisulfite sequence MAPping program. BMC
352. Coarfa C, Yu F, Miller CA, Chen Z, Harris RA, Milosavljevic A. Pash 3.0: A ver-
satile software package for read mapping and integrative analysis of genomic
and epigenomic variation using massively parallel DNA sequencing. BMC
353. Xi Y, Bock C, Muller F, Sun D, Meissner A, Li W. RRBSMAP: A fast, accurate and
user-friendly alignment tool for reduced representation bisulfite sequencing.
354. Lim JQ, Tennakoon C, Li G, Wong E, Ruan Y, Wei CL, Sung WK. BatMeth:
Improved mapper for bisulfite sequencing reads on DNA methylation. Genome
Biol 2012, 13:R82.
355. Krueger F, Andrews SR. Bismark: A flexible aligner and methylation caller for
Bisulfite-Seq applications. Bioinformatics 2011, 27:1571–1572.
356. Harris EY, Ponts N, Le Roch KG, Lonardi S. BRAT-BW: Efficient and accurate
mapping of bisulfite-treated reads. Bioinformatics 2012, 28:1795–1796.
357. Chen PY, Cokus SJ, Pellegrini M. BS Seeker: Precise mapping for bisulfite
sequencing. BMC Bioinformatics 2010, 11:203.
232 References
358. Guo W, Fiziev P, Yan W, Cokus S, Sun X, Zhang MQ, Chen PY, Pellegrini M.
BS-Seeker2: A versatile aligning pipeline for bisulfite sequencing data. BMC
Genomics 2013, 14:774.
359. Pedersen B, Hsieh TF, Ibarra C, Fischer RL. MethylCoder: Software pipeline for
bisulfite-treated sequences. Bioinformatics 2011, 27:2435–2436.
360. Kunde-Ramamoorthy G, Coarfa C, Laritsky E, Kessler NJ, Harris RA, Xu M,
Chen R, Shen L, Milosavljevic A, Waterland RA. Comparison and quantitative
verification of mapping algorithms for whole-genome bisulfite sequencing.
361. Lin X, Sun D, Rodriguez B, Zhao Q, Sun H, Zhang Y, Li W. BSeQC: Quality
control of bisulfite sequencing experiments. Bioinformatics 2013, 29:3227–3229.
362. Benoukraf T, Wongphayak S, Hadi LH, Wu M, Soong R. GBSA: A comprehen-
sive software for analysing whole genome bisulfite sequencing data. Nucleic
Acids Res 2013, 41:e55.
363. Akalin A, Kormaksson M, Li S, Garrett-Bakelman FE, Figueroa ME, Melnick A,
Mason CE. methylKit: A comprehensive R package for the analysis of genome-
wide DNA methylation profiles. Genome Biol 2012, 13:R87.
364. Washington University EpiGenome Browser, http://epigenomegateway.wustl
.edu/browser/.
365. Kent WJ, Zweig AS, Barber G, Hinrichs AS, Karolchik D. BigWig and
BigBed: Enabling browsing of large distributed datasets. Bioinformatics 2010,
26:2204–2207.
366. Dorff KC, Chambwe N, Zeno Z, Simi M, Shaknovich R, Campagne F. GobyWeb:
Simplified management and analysis of gene expression and DNA methylation
sequencing data. PLoS One 2013, 8:e69666.
367. Jiang P, Sun K, Lun FM, Guo AM, Wang H, Chan KC, Chiu RW, Lo YM, Sun H.
Methy-Pipe: An integrated bioinformatics pipeline for whole genome bisulfite
sequencing data analysis. PLoS One 2014, 9:e100360.
368. Sun D, Xi Y, Rodriguez B, Park HJ, Tong P, Meong M, Goodell MA, Li W. MOABS:
Model based analysis of bisulfite sequencing data. Genome Biol 2014, 15:R38.
369. Zhang Y, Liu H, Lv J, Xiao X, Zhu J, Liu X, Su J et al. QDMR: A quantitative
method for identification of differentially methylated regions by entropy.
370. Statham AL, Strbenac D, Coolen MW, Stirzaker C, Clark SJ, Robinson MD.
Repitools: An R package for the analysis of enrichment-based epigenomic data.
371. Halachev K, Bast H, Albrecht F, Lengauer T, Bock C. EpiExplorer: Live explora-
tion and global analysis of large epigenomic datasets. Genome Biol 2012, 13:R96.
372. McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, Wenger AM,
Bejerano G. GREAT improves functional interpretation of cis-regulatory
regions. Nat Biotechnol 2010, 28:495–501.
373. Schloss PD, Handelsman J. Metagenomics for studying unculturable micro
organisms: Cutting the Gordian knot. Genome Biol 2005, 6:229.
374. Yarza P, Ludwig W, Euzeby J, Amann R, Schleifer KH, Glockner FO, Rossello-
Mora R. Update of the All-Species Living Tree Project based on 16S and 23S
rRNA sequence analyses. Syst Appl Microbiol 2010, 33:291–299.
375. Delmont TO, Robe P, Clark I, Simonet P, Vogel TM. Metagenomic comparison
of direct and indirect soil DNA extraction approaches. J Microbiol Methods 2011,
86:397–400.
References 233
376. BMTagger, http://biowulf.nih.gov/apps/bmtagger.html.

377. Schmieder R, Edwards R. Fast identification and removal of sequence contami-
nation from genomic and metagenomic datasets. PLoS One 2011, 6:e17288.
378. Zhou J, Sun D, Childers A, McDermott TR, Wang Y, Liles MR. Three novel viro-
phage genomes discovered from yellowstone lake metagenomes. J Virol 2015,
89:1278–1285.
379. Beja O, Aravind L, Koonin EV, Suzuki MT, Hadd A, Nguyen LP, Jovanovich SB
et al. Bacterial rhodopsin: Evidence for a new type of phototrophy in the sea.
Science 2000, 289:1902–1906.
380. Rho M, Wu YW, Tang H, Doak TG, Ye Y. Diverse CRISPRs evolving in human
microbiomes. PLoS Genet 2012, 8:e1002441.
381. Lai B, Ding R, Li Y, Duan L, Zhu H. A de novo metagenomic assembly program
for shotgun DNA reads. Bioinformatics 2012, 28:1455–1462.
382. Laserson J, Jojic V, Koller D. Genovo: De novo assembly for metagenomes.
J Comput Biol 2011, 18:429–443.
383. Afiahayati, Sato K, Sakakibara Y. An extended genovo metagenomic assembler
by incorporating paired-end information. PeerJ 2013, 1:e196.
384. Namiki T, Hachiya T, Tanaka H, Sakakibara Y. MetaVelvet: An extension of
Velvet assembler to de novo metagenome assembly from short sequence reads.
385. Afiahayati, Sato K, Sakakibara Y. MetaVelvet-SL: An extension of the Velvet
assembler to a de novo metagenomic assembler utilizing supervised learning.
DNA Res 2014. doi: 10.1093/dnares/dsu041.
386. Peng Y, Leung HC, Yiu SM, Chin FY. Meta-IDBA: A de Novo assembler for
metagenomic data. Bioinformatics 2011, 27:i94–101.
387. Peng Y, Leung HC, Yiu SM, Chin FY. IDBA-UD: A de novo assembler for single-
cell and metagenomic sequencing data with highly uneven depth. Bioinformatics
2012, 28:1420–1428.
388. Wu YW, Rho M, Doak TG, Ye Y. Stitching gene fragments with a network
matching algorithm improves gene assembly for metagenomics. Bioinformatics
2012, 28:i363–i369.
389. Boisvert S, Raymond F, Godzaridis E, Laviolette F, Corbeil J. Ray Meta: Scalable
de novo metagenome assembly and profiling. Genome Biol 2012, 13:R122.
390. Haider B, Ahn TH, Bushnell B, Chai J, Copeland A, Pan C. Omega: An overlap-
graph de novo assembler for metagenomics. Bioinformatics 2014, 30:2717–2722.
391. McHardy AC, Martin HG, Tsirigos A, Hugenholtz P, Rigoutsos I. Accurate phy-
logenetic classification of variable-length DNA fragments. Nat Methods 2007,
4:63–72.
392. Patil KR, Roune L, McHardy AC. The PhyloPythiaS web server for taxonomic
assignment of metagenome sequences. PLoS One 2012, 7:e38581.
393. Teeling H, Waldmann J, Lombardot T, Bauer M, Glockner FO. TETRA: A
web-service and a stand-alone program for the analysis and comparison of
tetranucleotide usage patterns in DNA sequences. BMC Bioinformatics 2004,
5:163.
394. Diaz NN, Krause L, Goesmann A, Niehaus K, Nattkemper TW. TACOA:
Taxonomic classification of environmental genomic fragments using a kernel-
ized nearest neighbor approach. BMC Bioinformatics 2009, 10:56.
395. Brady A, Salzberg SL. Phymm and PhymmBL: Metagenomic phylogenetic clas-
sification with interpolated Markov models. Nat Methods 2009, 6:673–676.
234 References
396. Chan CK, Hsu AL, Halgamuge SK, Tang SL. Binning sequences using very
sparse labels within a metagenome. BMC Bioinformatics 2008, 9:215.
397. Zheng H, Wu H. Short prokaryotic DNA fragment binning using a hierarchi-
cal classifier based on linear discriminant analysis and principal component
analysis. J Bioinform Comput Biol 2010, 8:995–1011.
398. Huson DH, Mitra S, Ruscheweyh HJ, Weber N, Schuster SC. Integrative analy-
sis of environmental sequences using MEGAN4. Genome Res 2011, 21:1552–1560.
399. Huson DH, Auch AF, Qi J, Schuster SC. MEGAN analysis of metagenomic data.
Genome Res 2007, 17:377–386.
400. Gerlach W, Junemann S, Tille F, Goesmann A, Stoye J. WebCARMA: A web
application for the functional and taxonomic classification of unassembled
metagenomic reads. BMC Bioinformatics 2009, 10:430.
401. Gerlach W, Stoye J. Taxonomic classification of metagenomic shotgun sequences
with CARMA3. Nucleic Acids Res 2011, 39:e91.
402. Monzoorul Haque M, Ghosh TS, Komanduri D, Mande SS. SOrt-ITEMS:
Sequence orthology based approach for improved taxonomic estimation of
metagenomic sequences. Bioinformatics 2009, 25:1722–1730.
403. Liu B, Gibbons T, Ghodsi M, Treangen T, Pop M. Accurate and fast estimation of
taxonomic profiles from metagenomic shotgun sequences. BMC Genomics 2011,
12 Suppl 2:S4.
404. Leung HC, Yiu SM, Yang B, Peng Y, Wang Y, Liu Z, Chen J, Qin J, Li R, Chin
FY. A robust and accurate binning algorithm for metagenomic sequences with
arbitrary species abundance ratio. Bioinformatics 2011, 27:1489–1495.
405. Mohammed MH, Ghosh TS, Singh NK, Mande SS. SPHINX—An algorithm for
taxonomic binning of metagenomic sequences. Bioinformatics 2011, 27:22–30.
406. Rusch DB, Halpern AL, Sutton G, Heidelberg KB, Williamson S, Yooseph S, Wu
D et al. The Sorcerer II Global Ocean Sampling expedition: Northwest Atlantic
through eastern tropical Pacific. PLoS Biol 2007, 5:e77.
407. Davenport CF, Neugebauer J, Beckmann N, Friedrich B, Kameri B, Kokott S,
Paetow M et al. Genometa—A fast and accurate classifier for short metage-
nomic shotgun reads. PLoS One 2012, 7:e41224.
408. Niu B, Zhu Z, Fu L, Wu S, Li W. FR-HIT, a very fast program to recruit metage-
nomic reads to homologous reference genomes. Bioinformatics 2011, 27:1704–1705.
409. Rho M, Tang H, Ye Y. FragGeneScan: Predicting genes in short and error-prone
reads. Nucleic Acids Res 2010, 38:e191.
410. Zhu W, Lomsadze A, Borodovsky M. Ab initio gene identification in metage-
nomic sequences. Nucleic Acids Res 2010, 38:e132.
411. Noguchi H, Taniguchi T, Itoh T. MetaGeneAnnotator: Detecting species-
specific patterns of ribosomal binding site for precise gene prediction in anony-
mous prokaryotic and phage genomes. DNA Res 2008, 15:387–396.
412. Hoff KJ, Lingner T, Meinicke P, Tech M. Orphelia: Predicting genes in metage-
nomic sequencing reads. Nucleic Acids Res 2009, 37:W101–105.
413. Lowe TM, Eddy SR. tRNAscan-SE: A program for improved detection of trans-
fer RNA genes in genomic sequence. Nucleic Acids Res 1997, 25:955–964.
414. Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: A web tool to identify clustered
regularly interspaced short palindromic repeats. Nucleic Acids Res 2007, 35:W52–57.
415. Segata N, Waldron L, Ballarini A, Narasimhan V, Jousson O, Huttenhower
C. Metagenomic microbial community profiling using unique clade-specific
marker genes. Nat Methods 2012, 9:811–814.
References 235
416. Wu M, Eisen JA. A simple, fast, and accurate method of phylogenomic infer-
ence. Genome Biol 2008, 9:R151.
417. Kerepesi C, Banky D, Grolmusz V. AmphoraNet: The webserver implementa-
tion of the AMPHORA2 metagenomic workflow suite. Gene 2014, 533:538–540.
418. Wu M, Scott AJ. Phylogenomic analysis of bacterial and archaeal sequences
with AMPHORA2. Bioinformatics 2012, 28:1033–1034.
419. Sharpton TJ, Riesenfeld SJ, Kembel SW, Ladau J, O’Dwyer JP, Green JL, Eisen
JA, Pollard KS. PhylOTU: A high-throughput procedure quantifies microbial
community diversity and resolves novel taxa from metagenomic data. PLoS
Comput Biol 2011, 7:e1001061.
420. Darling AE, Jospin G, Lowe E, Matsen FA, Bik HM, Eisen JA. PhyloSift:
Phylogenetic analysis of genomes and metagenomes. PeerJ 2014, 2:e243.
421. Li W. Analysis and comparison of very large metagenomes with fast clustering
and functional annotation. BMC Bioinformatics 2009, 10:359.
422. Arumugam M, Harrington ED, Foerstner KU, Raes J, Bork P. SmashCommunity:
A metagenomic annotation and analysis tool. Bioinformatics 2010, 26:2977–2978.
423. Treangen TJ, Koren S, Sommer DD, Liu B, Astrovskaya I, Ondov B, Darling AE,
Phillippy AM, Pop M. MetAMOS: A modular and open source metagenomic
assembly and analysis pipeline. Genome Biol 2013, 14:R2.
424. Overbeek R, Begley T, Butler RM, Choudhuri JV, Chuang HY, Cohoon M, de
Crecy-Lagard V et al. The subsystems approach to genome annotation and its
use in the project to annotate 1000 genomes. Nucleic Acids Res 2005, 33:5691–5702.
425. Franzosa EA, Morgan XC, Segata N, Waldron L, Reyes J, Earl AM, Giannoukos
G et al. Relating the metatranscriptome and metagenome of the human gut.
Proc Natl Acad Sci USA 2014, 111:E2329–2338.
426. Abubucker S, Segata N, Goll J, Schubert AM, Izard J, Cantarel BL, Rodriguez-
Mueller B et al. Metabolic reconstruction for metagenomic data and its applica-
tion to the human microbiome. PLoS Comput Biol 2012, 8:e1002358.
427. Ye Y, Doak TG. A parsimony approach to biological pathway reconstruction/
inference for genomes and metagenomes. PLoS Comput Biol 2009, 5:e1000465.
428. Liu B, Pop M. MetaPath: Identifying differentially abundant metabolic path-
ways in metagenomic datasets. BMC Proc 2011, 5 Suppl 2:S9.
429. Paulson JN, Stine OC, Bravo HC, Pop M. Differential abundance analysis for
microbial marker-gene surveys. Nat Methods 2013, 10:1200–1202.
430. Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, Huttenhower
C. Metagenomic biomarker discovery and explanation. Genome Biol 2011,
12:R60.
431. White JR, Nagarajan N, Pop M. Statistical methods for detecting differentially
abundant features in clinical metagenomic samples. PLoS Comput Biol 2009,
5:e1000352.
432. Parks DH, Tyson GW, Hugenholtz P, Beiko RG. STAMP: Statistical analysis of
taxonomic and functional profiles. Bioinformatics 2014, 30:3123–3124.
433. Rodriguez-Brito B, Rohwer F, Edwards RA. An application of statistics to com-
parative metagenomics. BMC Bioinformatics 2006, 7:162.
434. Jain M, Fiddes IT, Miga KH, Olsen HE, Paten B, Akeson M. Improved data
analysis for the MinION nanopore sequencer. Nat Methods 2015, 12:351–356.
435. Ohshiro T, Matsubara K, Tsutsui M, Furuhashi M, Taniguchi M, Kawai T.
Single-molecule electrical random resequencing of DNA and RNA. Sci Rep
2012, 2:501.
236 References
436. Chin CS, Alexander DH, Marks P, Klammer AA, Drake J, Heiner C, Clum A
et al. Nonhybrid, finished microbial genome assemblies from long-read SMRT
sequencing data. Nat Methods 2013, 10:563–569.
437. FALCON, https://github.com/PacificBiosciences/falcon.
438. DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis
AA et al. A framework for variation discovery and genotyping using next-
generation DNA sequencing data. Nat Genet 2011, 43:491–498.
439. Reid JG, Carroll A, Veeraraghavan N, Dahdouli M, Sundquist A, English
A, Bainbridge M et al. Launching genomics into the cloud: Deployment of
Mercury, a next generation sequence analysis pipeline. BMC Bioinformatics
2014, 15:30.
440. Zhao S, Prenger K, Smith L, Messina T, Fan H, Jaeger E, Stephens S. Rainbow: A
tool for large-scale whole-genome sequencing data analysis using cloud com-
puting. BMC Genomics 2013, 14:425.
441. Schadt EE, Linderman MD, Sorenson J, Lee L, Nolan GP. Computational
solutions to large-scale data management and analysis. Nat Rev Genet 2010,
11:647–657.
Statistics
Next-Generation Sequencing Data Analysis walks readers through the

multiple stages of next-generation sequencing (NGS) data generation and
analysis in an easy-to-follow fashion. It covers every step in each stage, from
the planning stage of experimental design, sample processing, sequencing
strategy formulation, the early stage of base calling, reads quality check
and data preprocessing to the intermediate stage of mapping reads to a
reference genome and normalization to more advanced stages specific to
each application. All major applications of NGS are covered, including:
• RNA-seq: mRNA-seq and small RNA-seq

• Genotyping and variant discovery through genome re-sequencing
• De novo genome assembly
• ChIP-seq to study DNA–protein interaction
• Methylated DNA sequencing on epigenetic regulation
• Metagenome analysis through community genome shotgun
sequencing
Before detailing the analytic steps for each of these applications, the book
presents the ins and outs of the most widely used NGS platforms, with
side-by-side comparisons of key technical aspects. This helps practitioners
decide which platform to use for a particular project. The book also offers
a perspective on the development of DNA sequencing technologies, from
Sanger to future-generation sequencing technologies.
The book discusses concepts and principles that underlie each analytic
step, along with software tools for implementation. It highlights key features
of the tools while omitting tedious details to provide an easy-to-follow
guide for practitioners in life sciences, bioinformatics, and biostatistics. In
addition, references to detailed descriptions of the tools are given for further
reading if needed. The accompanying website for the book provides step-
by-step, real-world examples of how to apply the tools covered in the text to
research projects. All the tools are freely available to academic users.
K22126
w w w. c rc p r e s s . c o m

NGS

Uploaded by

Copyright:

Available Formats

NGS

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

NGS

Uploaded by

Copyright:

Available Formats

Next-Generation Sequencing

No claim to original U.S. Government works

International Standard Book Number-13: 978-1-4822-1789-6 (eBook - PDF)

Section I Introduction to Cellular and Molecular Biology

1. The Cellular System and the Code of Life.................................................3

2. DNA Sequence: The Genome Base............................................................ 17

2.7 Genome Evolution................................................................................ 28

3. RNA: The Transcribed Sequence............................................................... 35

Section II Introduction to Next-Generation

4. Next-Generation Sequencing (NGS) Technologies: Ins and Outs...... 55

4.3.2 Ion Torrent Semiconductor Sequencing..............................65

5. Early-Stage Next-Generation Sequencing (NGS) Data Analysis:

6. Computing Needs for Next-Generation Sequencing (NGS) Data

Section III Application-Specific NGS Data Analysis

8. Small RNA Sequencing............................................................................. 111

9. Genotyping and Genomic Variation Discovery by Whole

9.3.4 CNV Detection...................................................................... 128

10. De novo Genome Assembly from Next-Generation Sequencing

11. Mapping Protein–DNA Interactions with ChIP-Seq........................... 143

12. Epigenomics and DNA Methylation Analysis

12.2.1 Quality Control and Preprocessing................................... 166

13. Metagenome Analysis by Next-Generation Sequencing (NGS)....... 175

Section IV The Changing Landscape

14. What Is Next for Next-Generation Sequencing (NGS)?...................... 191

Appendix A: Common File Types Used in Next-Generation

1.1 The Cellular Challenge

1.2 How Cells Meet the Challenge

molecules. The major categories of small molecules include inorganic ions

1.4 Intracellular Structures or Spaces

lipid bilayer structure. While offering protection to their internal structure,

these large molecules form molecular machines that collectively function

1.4.4 Endosome, Lysosome, and Peroxisome

1.4.6 Endoplasmic Reticulum (ER)

Furthermore, certain mitochondrial DNA mutations and deletions have

1.5 The Cell as a System

1.5.2 Systems Biology of the Cell

1.5.3 How to Study the Cellular System

of genome-wide sequence variations among individuals in a population

2.1 The DNA Double Helix and Base Sequence

2.2 How DNA Molecules Replicate and Maintain Fidelity

DNA polymerase T P P P dNTP

make repairs if damage is detected. The serious consequences of a weakened

2.3 How the Genetic Information Stored in DNA

2.4 The Genomic Landscape

varying amounts in different eukaryotic genomes (for details on noncoding

2.4.3 Protein-Coding Regions of the Genome

2.4.4 Noncoding Genomic Elements

by geneticist Barbara McClintock, transposons (also called transposable ele-

2.5 DNA Packaging, Sequence Access,

2.6 DNA Sequence Mutation and Polymorphism

2.8 Epigenome and DNA Methylation

cytosines that undergo methylation can occur in three different sequence

2.9 Genome Sequencing and Disease Risk

2.9.1 Mendelian (Single-Gene) Diseases

2.9.2 Complex Diseases That Involve Multiple Genes

2.9.3 Diseases Caused by Genome Instability

suppressor genes [27], which leads to their suppressed transcription. The

3.1 RNA as the Messenger

3.2 The Molecular Structure of RNA

structures can sometimes afford them special chemical properties in cells.

Section II Introduction to Next-Generation

Section IV The Changing Landscape

1.1 The Cellular Challenge

1.2 How Cells Meet the Challenge

1.4 Intracellular Structures or Spaces

1.4.4 Endosome, Lysosome, and Peroxisome

1.4.6 Endoplasmic Reticulum (ER)

1.5 The Cell as a System

1.5.2 Systems Biology of the Cell

1.5.3 How to Study the Cellular System

2.1 The DNA Double Helix and Base Sequence

2.2 How DNA Molecules Replicate and Maintain Fidelity

2.3 How the Genetic Information Stored in DNA

2.4 The Genomic Landscape

2.4.3 Protein-Coding Regions of the Genome

2.4.4 Noncoding Genomic Elements

2.5 DNA Packaging, Sequence Access,

2.6 DNA Sequence Mutation and Polymorphism

2.8 Epigenome and DNA Methylation

2.9 Genome Sequencing and Disease Risk

2.9.1 Mendelian (Single-Gene) Diseases

2.9.2 Complex Diseases That Involve Multiple Genes

2.9.3 Diseases Caused by Genome Instability

3.1 RNA as the Messenger

3.2 The Molecular Structure of RNA

3.3 Generation, Processing, and Turnover of RNA

3.3.2 Transcription of Prokaryotic Genes

3.3.3 Initial Transcription of Pre-mRNA from Eukaryotic Genes

3.3.4 Maturation of mRNA from Pre-mRNA

3.3.5 Transport and Localization

3.3.6 Stability and Decay

3.3.7 Major Steps of mRNA Transcript Level Regulation

3.4 RNA Is More Than a Messenger

3.4.2 snRNA and snoRNA

3.4.3 RNA for Telomere Replication

3.4.4 RNAi and Small Noncoding RNAs

3.4.5 Long Noncoding RNAs

3.4.6 Other Noncoding RNAs

3.5 The Cellular Transcriptional Landscape

4.1 How to Sequence DNA: From First Generation to the Next

4.2 A Typical NGS Experimental Workflow

4.3 Ins and Outs of Different NGS Platforms

4.3.1 Illumina Reversible Dye-Terminator Sequencing

4.3.1.3 Error Rate, Read Length, Data Output, and Run Time

4.3.2 Ion Torrent Semiconductor Sequencing

4.3.2.3 Error Rate, Read Length, Date Output, and Run Time

4.3.3 Pacific Biosciences Single Molecule Real‑Time (SMRT) Sequencing

4.3.3.3 Error Rate, Read Length, Data Output, and Run Time

4.4 Biases and Other Adverse Factors

4.4.1 Biases in Library Construction

4.4.2 Biases and Other Factors in Sequencing

4.5 Major Applications of NGS

4.5.2 Genetic Mutation and Variation Discovery

4.5.4 Protein-DNA Interaction Analysis (ChIP-Seq)

4.5.5 Epigenomics and DNA Methylation Study (Methyl-Seq)

5.1 Base Calling, FASTQ File Format, and Base Quality Score

5.2 NGS Data Quality Control and Preprocessing

5.3.1 Mapping Approaches and Algorithms