55

［Japanese Journal of Water Treatment Biology Vol.48  No.2  55－61  2012］

Electricity Generation and Microbial Community

in Microbial Fuel Cells with Different Membranes
GUANGYU ZHOU1, NAOKI YOKOYAMA2, YUICHIRO YOSHINO1, TAKAHIRO YAMASHITA1,
TAKAHIRO SATO1, and YASUNORI KAWAGOSHI1＊

Graduate school of science and technology, Kumamoto university

1

/ 2－39－1, Kurokami, Kumamoto, 860－8555, Japan

2
Yuasa Membrane Systems Co., Ltd. / 4－8－1, Ohmori-kita, Ohta-ku, Tokyo 143－0016, Japan

Abstract
Microbial fuel cell (MFC) is a quite interesting technology in the field of wastewater
treatment because that direct recovery of electrical energy is possible along with treatment.
The one of issues on MFC reactor is the characteristics and performance of ion-exchange
membrane between anode and cathode. In this study, MFC performance and bacterial
community were investigated using three types of ion-exchange membranes by sequential
batch experiments. Maximum voltages were obtained at the same level in all the MFC
reactors using two proton-exchange membranes (PEMs) and a conventional cation-
exchange membrane (CEM). Coulombic efficiency was also comparable between them
although it was slightly higher in the reactor with CEM than PEMs. A little difference was
observed in bacterial community of the biomass on anodic electrode between each MFC
reactor and contribution of Lactococcus species to MFC performance was suggested in this
study.

Key words: m
 icrobial fuel cell, electricity, membrane, microbial community,
wastewater treatment

INTRODUCTION by electron acceptors such as O2. The

exoelectrogens have so far been found in
Microbial Fuel Cell (MFC) is becoming
various water environments5, 6). The studies
more attractive to researchers in the study
on MFC have been conducted using two
field of wastewater treatment because it can
types of reactors: single chamber type and
recover electrical energy directly from a
double chamber type. The former ones have
variety of wastewaters along with the
only anode chamber (no cathode chamber)
treatment1). Application of MFC to wastewater
but instead equip “air-cathode”, and
treatment may alter wastewater treatment
commonly can produce higher energy than
plants from an energy consumer to an energy
the second ones because that the electrons
producer2). In addition, future applications of
are directly contacted with O2 at the air-
MFC could include bioelectricity generation
cathode exposed to the atmosphere. On the
for devices in remote locations and a variety
other hand, the advantage of double chamber
of biosensors3).
reactors is that their contents are well
In MFC technique, particular kinds of
separated into each chamber. For instance,
bacteria, which called exoelectrogens4),
in microbial electrolysis cells (MECs),
mineralize substrates (commonly carbo­
relatively-pure hydrogen gas could be
hydrates) and transfer electrons from
obtained in double chamber-type reactors.
substrate to anode at the same time. The
The one of concerns in the study on two-
electrons are moved to cathode and received
chamber MFC is ion-exchange membrane
*Corresponding author
56 Japanese J. Wat. Treat. Biol. Vol.48 No.2

which is equipped between the anode- and conventional membrane widely used for
cathode- chambers. The proton exchange electrodialysis and so on. The anode and
membrane Nafion 117 (DuPont Co. Ltd., cathode chambers were connected by a
USA) have been commonly used for MFC conductive line with 1000Ω resistance.
studies so far due to its good proton-transport Medium and MFC operation    A synthetic
property7, 8). Liu and Logan operated a MFC medium for the anode chamber was prepared
with the Nafion 117 and obtained 494mW/m as follows; 0.82 g/l CH3COONa, 0.5 g/l yeast
power density 2, 8). On the other hand, there extract, 1 g/l (NH4)・2 SO4, 0.2 g/l MgCl・ 2 6H2O,

have been only a few studies on alternative 0.2 g/l NaCl, 0.045 g/l CaCl・ 2 2H2O, 5.6 g/l

membranes for MFC, although versatility NaH2PO・ 4 2H2O, 2.4 g/l NaH・ 2 PO4, 1 ml/l
and cost of membranes could be an important vitamin solution (mg/l; biotin 0.05, pyridoxine
concern from a practical perspectives, i.e., hydrochloride 0.3, thiamine hydrochloride
low internal resistance, high performance 0.5, nicotinic acid 0.5, cyanocobalamin 0.05,
and low cost membranes are expected in p-aminobenzoic acid 0.3), 1 ml/l mineral
MFC 9－13). In this study, effects of membrane solution (mg/l; EDTA－2Na 2.0, MnCl2 4H2O
types on the MFC performance and bacterial 0.1, FeSO・ 4 7H2O 2.0, CoCl・ 2 6H2O 0.1,
community were investigated by using two NiCl・2 6H2O 0.02, ZnCl2 0.1, CuCl・ 2 2H2O 0.01,

kinds of proton-exchange membranes (PEMs) AlK(SO4)2 0.1, H3BO3 0.1, Na2MoO・ 4 2H2O

and a conventional cation-exchange 0.02, Na2SeO4 0.001, KI 0.2, pH: 7.0). The
membrane (CEM). medium was autoclaved at 120 ℃ for 15
minutes. The cathode chamber was filled
MATERIALS AND METHODS
with phosphate buffer (5.6 g/l NaH2PO・ 4 2H2O,

Reactor configuration    MFC reactors 2.4 g/l NaH2PO4, pH: 7.0). The anode chamber
were made with acrylic resin, which consist was inoculated with 0.5 g (dry weight)
of two cuboids (volume: 144 ml, 40 mm digestion sludge of sewage water treatment
(L)×40 mm (W)×90 mm (H)) for anode- and plant (in Fukuoka prefecture, Japan) and
cathode- chambers were used in this study. A sparged by nitrogen gas for 10 min to keep
hole (diameter: 32mm) was made between an anaerobic condition. The cathode chamber
the chambers in order to install the was continuously aerated by a small pump at
membrane. Carbon cloth (30 mm×30 mm×4 400 ml/min. The reactors were placed in
mm) was boiled in 10% nitric acid solution incubators and maintained at 28 ℃. At the
for 1 hour and used as an anode electrode beginning of every batch experiment, a
and a piece of platinum sheet (20 mm×20 voltage of 500 mV was supplied between the
mm×0.1 mm) was used as a cathode electrode. electrodes for 48 hours in order to accelerate
The three kinds of membranes were used as the growth of exoelectrogens in the anode
follows: 1) Nafion 117 (Naf－117), 2) Selemion chamber14). Each experiment was conducted
HSF (Sel－HSF, Asahi Glass Co. Ltd., Japan), in batch mode and electric voltage was
3) Yumigraftor BA28DGZ (Yumi－28, Yuasa continuously monitored by a data logger. The
Membrane Systems Co. Ltd., Japan). The medium and buffer in the chambers were
properties of these membranes were shown replaced with fresh ones when the voltage
in Table 1. The Naf－117 is PEM and has value became bellow 50 mV. The reactor was
been used in many MFC studies. The Sel－ exposed to air for more than 10 minutes in
HSF was also PEM but there is no report an aseptic cabinet in order to restrain
about MFC study using it. The Yumi－28 is a methanogenic activity before every batch15).

Table 1  List of membranes used in this study and their properties

Nafion 117 Selemion HSF Yumigraftor BA28DGZ
Material Perfluorosulfonic acid organic polymer Sulfonic acid organic polymer Hydrocarbon polymer
Characteristic H+ selective H+ selective Cation selective
Thickness (μm) 178 150 30
2
Resistance (Ω.cm ) 0.44 0.3 0.12
 Microbial Fuel Cell with Different Membranes 57

Analyses and MFC performance evaluation   GM－5F with GC－clamp (5’－CGCCCGCCGC

The current-voltage characteristics were GCGCGGCGGGCGGGGCGGGGGCACGGG
investigated by applying constant voltage GGGCCTACGGGAGGCAGCAG－3’), reverse
between the electrodes using a potentiostat primer: DS907R (5’－CCCCGTCAATTCCTTT
(HAB－151A, Hokuto Denko Corp., Japan). GAGTTT－3’). The PCR－DGGE was performed
Total organic carbon (TOC) and acetate according to the previously reported method17).
concentration were measured by a TOC DNA sequencing was performed using DTCS
meter (TOC－V, Shimadzu Corp., Japan) and Quick Start Kit and CEQ8000 (Beckman
a high performance liquid chromatograph Coulter, USA) in accordance with manu­
(HPLC) system (Shimadzu Corp., Japan). facturer’s protocol. Homology search of the
The condition of HPLC is as follows; mobile sequence of DNA bands detected on the
phase: 4mM HClO4; flow rate: 1ml/min; DGGE gel was carried out by using BLAST
temperature: 40 ℃; infusion pressure: 6 database. The sequence alignment and
MPa. phylogenic analysis were performed using
In order to evaluate the MFC performance, the MEGA software (version 5)18). Phylogenetic
power density (PD) and coulombic efficiency tree was constructed by the neighbor-joining
(CE) were calculated as follows16): method with bootstrap values based on 1000
replications.
PD = I × U / A  (1)
RESULTS AND DISCUSSION
CE = (CM / CT) × 100  (2)
Effects of the Membrane on MFC

∫ Idt 
t Performance    Electrical voltage was auto­
CM = (3)
t=0 matically collected every 10 min. Figures 1
and 2 show the maximum voltage and TOC
CT = (F × n × S × V) / M  (4)
removal rate at every batch, respectively.
Where, PD: power density (mW/m ), I: 2
The substrates (acetate) consumption and
electric current (A), U: electric voltage (mV), voltage output were observed during 48
A: electrode area (m2 ), CE: coulombic hours in all experiments, and the maximum
efficiency (%), CM: measured coulomb value voltage values little changed between every
(C), CT: theoretical coulomb value (C), F: batch in each experiment. The maximum
Faraday constant (96485 C/mol), n: number voltage values were 203 mV in the reactor
of moles of electrons produced per mole of with Naf－117, 213 mV with Yumi－28, and
substrate (n = 8 for acetate in this study), S: 188 mV with Sel－HSF. The maximum voltage
substrate concentration (g/l), V: substrate with Naf－117 was 5% lower than Yumi－28
volume (l ), M : molecular weight of substrate and 13% higher than Sel－HSF, indicating
(g/mol). that the ability of voltage generation was not
Bacterial community analysis    The much different among the three types of
polymerase chain reaction and denaturing membranes. The TOC removal rates were
gradient gel electrophoresis (PCR－DGGE) more than 90% as shown in Fig. 2 and
analysis was carried out to investigate the acetate was consumed completely (data not
bacterial community of the biomass in the shown) in all experiments.
anode chamber at the end of each series of The current-voltage characteristics were
experiment (more than 20 batches). The DNA investigated in the reactor with each
was extracted from the biomass attached to membrane after the voltage value became
the carbon cloth surface (anode electrode) stable. Figure 3 shows the relationship
and purified using Ultra Clean Soil DNA between an applied current and PD. The
Isolation Kit (MO BIO Lab., Inc., USA) maximum PD was 16.4 mW/m2 in the reactor
according to the manufacturer’s instructions. with Naf－117, 16.2 mW/m2 with Yumi－28
The partial DNA fragments including V.3 and 16.5 mW/m2 with Sel－HSF. The difference
－V.4 regions of 16S rRNA were amplified of the maximum PD between three membranes
with bacterial universal primers for DGGE. was within 1% although the maximum
The primers were as follows; forward primer: electricity was observed in high current
58 Japanese J. Wat. Treat. Biol. Vol.48 No.2

200

Max. electric voltage (mV)

150
100

50
0
1 2 3 4 5 6 7 8 9 10
Batch number (times)
Naf-117 Sel-HSF Yumi-28

Fig. 1  Maximum electric voltage at every batch in the MFC with each type of membrane

100
TOC removal rate (%)

80
60
40
20
0
1 2 3 4 5 6 7 8 9 10
Batch number (times)
Naf-117 Sel-HSF Yumi-28

Fig. 2  Total organic carbon (TOC) removal rate at every batch in the MFC with each type of membrane

18 Naf-117 10
Max. coulombic efficiency (%)

16 Sel-HSF
Power density (mW/m2)

Yumi-28 8
14
12 6
10
8 4
6
2
4
2 0
0 Naf-117 Sel-HSF Yumi-28
0 0.1 0.2 Membrane type (-)
Current density (mA/m2)
Fig. 4 Maximum coulombic efficiency in the MFC with
Fig. 3 Relationship between current density and power each type of membrane
density in the MFC with each type of membrane

range for the reactor with Sel－HSF. Figure 4 These results demonstrate that the
shows the maximum CE. In every batch the membranes used in this study have almost
maximum CE was stable. The maximum CE same ability in MFC performance and
was 9.1% in the reactor with Yumi－28, which removal of organic carbon. In previous
was slightly higher than the values in the studies, CEMs had the similar internal
other reactors (8.9% with Sel－HSF and 8.1% resistances with PEMs, but their performances
with Naf－117). The CEs obtained in this were about 6% lower than PEMs12, 13). We
study were comparable to the value so far therefore presumed that the different results
reported on two-chamber MFC using mixed could be obtained between the reactors with
bacterial culture19). CEM (Yumi－28) and PEMs (Naf－117 and
 Microbial Fuel Cell with Different Membranes 59

Sel－HSF) before this study. However, there Among 5 DNA bands on DGGE gel, DNA
was no significant difference between them, sequence of mf1112c (AB683770) showed the
instead the MFC performance with Yumi－28 highest homology with Lactococcus garvieae
was even a little higher than Naf－117. In (HM573320), which have been well known as
addition, CEMs such as Yumi－28 are
conventional membrane widely used for a
number of usages, and have a good Inoculum Naf-117 Yumi-28 Sel-HSF
mechanical strength even with low thickness.
The low thickness can reduce the internal
resistance of MFCs reactor and increase the
energy output13), thus the availability of other mf1112a
common CEMs to MFC could be expected.
Bacterial community of the biomass attached mf1112b
to anode electrode    Figure 5 shows DGGE mf1112c
profiles of the inoculum and biomass samples mf1112d
attached to the anode electrode (carbon
cloth). More than 10 DNA bands were
visually confirmed on the DGGE gel. As a
result of DNA-sequence homology search, five
mf1112e
DNA bands (mf1112a－mf1112e in Fig. 5)
showed more than 95% similarity to the
bacteria recorded on the BLAST database.
Figure 6 shows a phylogenic tree for the 5 Fig. 5 Denaturing gradient gel electrophoresis (DGGE)
DNA bands based on the neighbor-joining profile using the bacterial universal primer
targeting 16S rRNA.
method.

mf1112c (AB683770)
Lactobacillales bacterium LA48 (DQ822778)
98 Lactococcus lactis (EU520326)
Lactococcus garvieae (HM573320)

95 mf1112a (AB683768)
Clostridiaceae bacterium FH042 (AB298771)
75
Clostridium metallolevans (DQ133569)

90 mf1112e (AB683772)
Sphaerobacter thermophilus (AJ871227)
99
60
Bacillales bacterium P371 (AM749774)

91 mf1112b (AB683769)
Owenweeksia hongkongensis (AB125062)
81
Bacteroidetes bacterium 4F6B (AB623230)

68 mf1112d (AB683771)
Azonexus fungiphilus (DQ029204)
100
Azonexus caeni (DQ029203)
Brachyspira hyodysenteriae (FW591778)
(as out-group)

0.2

Fig. 6 Phylogenetic tree showing affiliation of 16S rRNA gene sequences of DNA bands detected on the DGGE gel.
The tree was built based on neighbor-joining and confirmed by maximum parsimony analysis. The numbers
on nodes indicate bootstrap values higher than 50% and the bar indicates 20% sequence divergence.
60 Japanese J. Wat. Treat. Biol. Vol.48 No.2

facultative anaerobic acid producer. The L. In this study, other DNA bands were also
garvieae is the closely-related bacterium to L. observed on DGGE gel as shown in Fig. 5,
lactis (EU520320) which was reported to be however, no bacteria showing close sequence
exoelectroges in previous MFC studies5), thus similarity to these bands were found in
there is a high possibility that the mf1112c BLAST database. In addition, DNA-bands
contributed to electricity generation. In pattern (composition) on the DGGE gel
addition, this DNA band was clearly seen in showed a little difference between each
the sample from the MFC with Naf－117, but sample, and, no significant relationship
was quite feeble in that from the MFC with between the DNA-bands pattern and MFC
Sel－HSF as shown in Fig. 5. Therefore, it performance was confirmed.
was considered that relatively lower voltage
ACKNOWLEDGEMENTS
output in MFC reactor with Sel－HSF than
the others (shown in Fig. 1) could be due to We thank Lei Fu and Wenzhong Liu for
a difference of activity of mf1112c bacterium. their insightful advice and valuable
The band of mf1112a (AB683768) was suggestions, Kato Michelle and Yuanzhi Liu
found in all samples and showed the high for their helpful advice.
sequence identity to the bacteria belong to
Clostridiaceae family such as Clostridium
REFERENCES
metallolevans (DQ133569). The bacteria
belonging to Clostridiaceae family have been 　1　）Rodrigo, M. A., Canizares, P., Lobato, J., Paz,
normally found in anaerobic digestion sludge. R., Saez, C., and Linares, J. J.: Production of
Their presence was also confirmed in MFC electricity from the treatment of urban
studies using glucose as a substrate, but wastewater using a microbial fuel cell, J.
their role in MFC has not been known20). The Power Sources, 169, 198－204 (2007)
mf1112d (AB683771) was observed in all 　2　）Saito, T., Merrill, M. D., Watson, V. J., Logan,
samples and clearly seen in the samples from B. E., and Hickner, M. A.: Investigation of
the MFCs with Yumi－28 and Sel－HSF. The ionic polymer cathode binders for microbial
DNA sequence of this band showed the fuel cells, Electrochimica Acta., 55, 3398
highest sequence identity to Azonexus －3403 (2010)
fungiphilus (DQ029204). The growth of 　3　）Logan, B. E.: Microbial Fuel Cells, John
Azonexus species in MFC reactors could be Wiley & Sons, Inc., Hoboken, New Jersey
expected because that they can utilize short- (2008)
chain fatty acids as a carbon source. Actually 　4　）Logan, B. E., Call, D., Cheng, S., Hamelers,
they have been detected in MFC reactors H. V. M., Sleutels, T. H. J. A., Jeremiasse, A.
inoculated with anaerobic sludge in previous W., and Rozendal, R. A.: Microbial
studies6, 21). electrolysis cells for high yield hydrogen
The mf1112b (AB683769) was confirmed in gas production from organic matter,
the samples from the MFCs with Naf－117 Environ. Sci. Technol., 42, 8630－8640
and Sel－HSF. The DNA sequence of this (2008)
band showed high homology with 　5　）Freguia, S., Masuda, M., Tsujimura, S., and
Kano, K.: Lactococcus lactiscatalyses
Owenweeksia hongkongensis (AB125062).
electricity generation at microbial fuel cell
Finally, the mf1112e (AB683772) was
anodes via excretion of a soluble quinone,
confirmed in all the samples except for the
Bioelectrochemistry, 76, 14－18 (2009)
inoculum (anaerobic digestion sludge), and
　6　）Oha, S. T., Kim, J. R., Premier, G. C., Lee, T.
the DNA sequence of this band showed high
H., Kim, C., and Sloan, W. T.: Sustainable
homology with Sphaerobacter thermophilus
wastewater treatment: How might
(AJ871227). Both Owenweeksia and
microbial fuel cells contribute, Biotechnol.
Shpaerobacter species are normally seen in
Adv., 28, 871－881 (2010)
variety of water environments, but there has
　7　）Kim, B. H., Kim, H. J., Hyun, M. S., and
been no report describing their presence in Park, D. H.: Direct electrode reaction of
MFCs so far, thus their roles in MFC Fe(III)－reducing bacterium Shewanella
performance is not clear.
 Microbial Fuel Cell with Different Membranes 61

putrifaciens, J. Microbiol Biotechnol., 9, microbial fuel cells at ambient and

127－31 (1999) mesophilic temperatures, Bioresour.
　8　）Liu, H., Logan, B. E.: Electricity generation Technol., 101, 469－475 (2010)
using an air-cathode single chamber­ 16）Rabaey, K., Lissens, G., Siciliano, S. D., and
microbial fuel cell in the presence and Verstraete, W.: A microbial fuel cell capable
absence of a proton exchange membrane, of converting glucose to electricity at high
Environ. Sci. Technol., 38, 4040－4046 rate and efficiency, Biotechnol. Lett., 25,
(2004) 1531－1535 (2003)
　9　）Hickner, M. A., Ghassemi, H., Kim, Y. S., 17）Kawagoshi, Y., Hino, N., Fujimoto, A., Nakao,
Einsla, B. R., and McGrath, J. E.: Alternative M., Fujita, Y., Sugimura, S., and Furukawa,
polymer systems for proton exchange K.: Effect of inoculum conditioning on
membranes (PEMs), Chem. Rev., 104, hydrogen fermentation and pH effect on
4587－4612 (2004) bacterial community relevant to hydrogen
10）Harrison, W. L., Hickner, M. A., Kim, Y. S., production, J. Biosci. Bioeng., 100, 524
and McGrath, J. E.: Poly (arylene ether －530 (2005)
sulfone) copolymers and related systems 18）Tamura, K., Peterson, D., Peterson, N.,
from disulfonated monomer building Stecher, G., Nei, M., and Kumar, S.: MEGA5:
blocks: synthesis, characterization, and molecular evolutionary genetics analysis
performance - a topical review, Fuel Cells, using maximum likelihood, evolutionary
5, 201－212 (2005) distance, and maximum parsimony
11）Min, B., Cheng, S., and Logan, B. E.: methods, Mol. Biol. Evol., 28, 2731－2739
Electricity generation using membrane (2011)
and salt bridge microbial fuel cells, Water 19）Jang, J. K., Pham, T. H., Chang, I. S., Kang,
Res., 39, 1675－1686 (2005) K. H., Moon, H.,Cho, K. S., and Kim, B. H.:
12）Kim, J. R., Cheng, S., Oh, S., and Logan, B. Construction and operation of a novel
E.: Power generation using different mediator-and membrane-less microbial
cation, anion, and ultrafiltration mem­ fuel cell, Process Biochem., 39, 1007－1012
ｎbranes in microbial fuel cells, Environ. (2004)
Sci. Technol., 41, 1004－1009 (2007) 20）Watson, V. J.: Shewanella oneidensis Mr－1
13）Hamid, R. Y., Carverb, S. M., Christya, A. D., compared to mixed cultures for electricity
and Tuovinenb, O. H.: Cathodic limitations production in four different microbial fuel
in microbial fuel cells: an overview, J. cell configurations, Doctoral thesis, The
Power Sources, 180, 683－694 (2008) Pennsylvania State University, (2009)
14）Shinogi, K., Ikeda, H., Ito, T., and Watanabe, 21）Chae, K. J., Choi, M. J., Lee, J. W., Kim, K.
T.: Effect of preparation for anodic biofilm Y., and Kim, I. S.: Effect of different
by electrolytic stimulation on performance substrates on the performance, bacterial
of microbial fuel cell, The 43th Annual diversity, and bacterial viability in
conference of Japan Society on Water microbial fuel cells, Bioresour. Technol.,
Environment, 165 (2009) (Abstract, in 100, 3518－3525 (2009)
Japanese) (Submitted 2012. 1. 25)
15）Ahn, Y. and Logan, B. E.: Effectiveness of (Accepted 2012. 4. 19)
domestic wastewater treatment using