See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/257840411

Isolation and Cloning of cDNA of Gene Encoding for Metallothionein Type 2

from Soybean [Glycine max (L.) (Merrill)] cv. Slamet

Article · July 2014

CITATIONS READS

2 64

3 authors:

Sony Suharsono Yassier Anwar

Bogor Agricultural University Verdant Bioscience
76 PUBLICATIONS 843 CITATIONS 2 PUBLICATIONS 2 CITATIONS

SEE PROFILE SEE PROFILE

Utut Widyastuti
Bogor Agricultural University
41 PUBLICATIONS 393 CITATIONS

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

coral reef in transition facing environmental change (global and local) View project

Seaweed Production View project

All content following this page was uploaded by Sony Suharsono on 30 May 2014.

The user has requested enhancement of the downloaded file.

BIODIVERSITAS ISSN: 1412-033X (printed edition)
Volume 10, Number 3, July 2014 ISSN: 2085-4722 (electronic)
Pages: 109-114

Isolation and Cloning of cDNA of Gene Encoding for Metallothionein

Type 2 from Soybean [Glycine max (L.) (Merrill)] cv. Slamet

SUHARSONO1,2,, YASSIER ANWAR1, UTUT WIDYASTUTI1,2

1
Research Center for Biological Resources and Biotechnology, Bogor Agricultural University (IPB), Bogor 16680.
2
Biologi Department, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University (IPB), Bogor 16680.

Received: 10th January 2009. Accepted: 26th May 2014.

ABSTRACT

Metallothionein has an important role in the detoxification of metal ions. It has a low molecular weight and contains cysteine-
rich residue. The objective of this research is to isolate and clone the cDNA of gene encoding for metallothionein from
soybean [Glycine max (L.) (Merrill)] cv Slamet (GmMt2). We had successfully isolated total RNA by reverse transcription
and synthesized total cDNA from total RNA as template. cDNA of GmMt2 had been isolated from total cDNA by PCR. It was
successfully inserted into pGEM-T Easy plasmid, and the recombinant plasmids were introduced into Escherichia coli strain
DH5α. Sequence analysis by using T7 and SP6 primers showed that the length of PCR-isolated fragment was 257 bp
containing 246 bp completed sequence of Mt2 cDNA encoding for 81 amino acids. Enzyme restriction analysis showed
that GmMt2 did not contain any restriction sites found in the multi cloning sites of pGEM-T easy. Nucleotide and amino acid
alignment analysis using BLAST program showed that GmMt2 was similar with completed cDNA of AtMt2A from
Arabidopsis thaliana (L.) Heynh. Amino acid sequence analysis showed that the motifs of Cys sequence of GmMT2 are
Cys-Cys, Cys-X-Cys, and Cys-X-X-Cys.
© 2014 Biodiversitas, Journal of Biological Diversity

Key words: soybean, metallothionein, cDNA, isolation, cloning, cysteine.

INTRODUCTION 2004; Wong et al., 2004), and the infection and cell
death (Vasak and Hasler, 2000). In addition, the
Metallothionein (MT) is low molecular weight presence of MTs in the nuclear can protect the DNA
proteins (4-8 kDa), containing rich of cysteine, and from the damage induced by oxidative stress
capable to bind heavy metal ions. Based on the (Chubatsu and Meneghini, 1993; Cai et al., 1995). The
pattern of cysteine residues distribution along the MT synthesis of MTs is induced by several metals, growth
sequence, MT proteins of several species of plants signals and hormones (Templeton et al., 1985;
are divided into two types, i.e. type 1 and type 2. Type Andrews et al., 1987; Nartey et al., 1987). In wheat,
1 has a motif Cys-X-Cys, whereas type 2 has Cys- aluminum stress caused the increase of expression of
Cys, Cys-X-Cys, and Cys-X-X-Cys motifs where X is gene encoding for MT (Snowden and Gardner, 1993).
an amino acid other than Cys. MTs are present in a Pilon-Smith and Pilon (2002) showed that the
vast range of organisms including plants, mammals, detoxification of Al was due to the binding of Al by
fungi and procaryotic organisms (Valle, 1991; Cobbet cysteine-rich containing proteins as MTs, glutathione
and Goldsbrough, 2002; Coyle et al., 2002). (GSH) dan phytochelatin. MT type 2 (MT2) is one of
In the animals and the plants, MTs not only have MT family protein.
an important role in the homeostatic mechanism and Soybean [Glycine max (L.) (Merrill)] cv Slamet is a
detoxification heavy metal ions (Cobbet and local cultivar tolerant to acid soil and Al stress. Al can
Goldsbrough, 2002; Hall, 2002), but they also involve cause oxidative stress by creating radical oxygene
in the process of physiology, regulation of cell growth, species (ROS) (Panda et al., 2003). Since MTs
proliferation, the activities of metalloenzymes, involve in the detoxification of ROS, we suppose that
transcription factor (Haq et al., 2003; Akashi et al., MTs involve also in the detoxification of Al. Therefore
the isolation and cloning of cDNA of gene encoding of
MT2 from soybean is important. This research has an
objective to isolate and clone cDNA of gene encoding
for MT2 of soybean cv Slamet.
 Corresponding address:
Gd. PAU, Jl. Kamper, Kampus IPB Darmaga, Bogor 16680
Tel. +62-251-8621257; Fax.: +62-.251-8621724
email: [email protected]; [email protected]
110 BIODIVERSITAS Vol. 10, No. 3, July 2014, pp. 109-114

MATERIALS AND METHODS Synthesis of total cDNA

Total cDNA was synthesized from total RNA by
using Superscript III Reverse Transcriptase enzyme
Materials
(Invitrogen). The composition of the synthesis of total
Soybean cv Slamet was used as plant material.
cDNA was 5 μg total RNA, 4 μL RT buffer (5x), 20
The primers of ActF (ATGGCAGATGCCGAGGATAT)
pmol oligo(dT), 4 mM dNTP mix, 10 mM DTT, 1 U
and ActR (CAGTTGTGCGACCACTTGCA) designed
SuperScript TMIII RTase (Invitrogen), and ajusted to
based on cDNA of -actin of soybean (Shah et al., 20 μL by the additon of H2O-DEPC. The synthesis of
1982) were used to amplify exon1-exon2 of cDNA of total cDNA was carried out at 45°C for 50 minutes.
β-actin as a control for the purity of total cDNA. The successful of synthesis of total cDNA and the
Primers of MF (TCGAGAAAAATGTCTTGCTGTG) purity of total cDNA from genomic DNA contaminant
and M7R (CTTGCACCTGCAAGTGAAGG) designed were determined by PCR using specific actF and
based on cDNA of MT2 of Arabidopsis thaliana (L.) actR primers for exon1-exon2 of β-actin. The
Heynh (Acc: NM_1117733) were used to isolate the composition to amplify cDNA of β-actin was 1 μL total
cDNA of MT2 of soybean (GmMt2). pGEM-T Easy cDNA, 1 µL Taq buffer (10x), 40 mM MgCl2, 4 mM
plasmid (Promega) was used as a cloning vector. dNTP mix, 10 pmol ActF primer, 10 pmol ActR primer,
Escherichia coli strain DH5α was used as a host of 4% DMSO, 0.5 U Taq DNA polymerase (Fermentas)
recombinant plasmids. and H2O in the final volume of 10 μL. The condition of
PCR was pre-PCR at 95°C, 5 minutes,
Isolation of total RNA denaturation at 94°C, 30 seconds, primer annealing
The isolation of total RNA was carried out by using at 55°C, 30 seconds, and extension at 72°C, 1.5
Trizol Kit (Invitrogen) as described by Mashuda minutes, with 35 cycles, and post-PCR at 72°C, 5
(2006). For this purpose, 1 g of root tips was ground minutes followed by 15°C, 5 minutes.
in the mortar in the presence of liquid nitrogen to
become the fine powder. These powder were mixed Isolation of cDNA of GmMt2
into suspension with 800 μL Trizol in the 1.5 mL micro The cDNA of GmMt2 was isolated from total cDNA
tubes. This suspension was then incubated in the by PCR. The composition of PCR was 2 μL total
room temperature for 5 minutes, and after that added cDNA, 2 μL Taq buffer (10x), 4 mM dNTP mix, 20
with 200 μL chloroform and vortexed thoroughly. After pmol MF primer, 20 pmol M7R primer, 4% DMSO, 1
incubation for 3 minutes in the room temperature, the U Taq DNA polymerase (RBC) and completed to 20
suspension was centrifuged at 10,000 rpm (Jouan μL by H2O. The condition of PCR was pre-PCR at
BR4i) at 4°C for 15 minutes. The supernatant was 95°C, 5 minutes, denaturation at 94°C 30 seconds,
collected and added by 500 μL isopropyl alcohol, then primer annealing at 58°C, 30 seconds and extension
incubated at the room temperature for 10 minutes. at 72°C, 1.5 minutes, with 35 cycles, post-PCR at
After the centrifugation at 10,000 rpm, at 4°C for 10 72°C, 5 minutes followed by 15°C, 5 minutes.
minutes, the liquid was discarded and the pellet was
added by 500 μL ethanol 75%, then the tubes were Cloning of cDNA of GmMt2
centrifuged at the same condition as previous step. The cDNA of GmMt2 resulted from PCR was
The liquid was discarded, and the pellet was vacuum- ligated to pGEM–T Easy (Promega) by mixing 3 μL of
dried. The pellet was suspended in 30 μL H2O-DEPC. PCR product, 1 μL (10 ng) pGEM-T Easy, 0.5 U T4
The quantity and quality of total RNA were DNA ligase (Promega), 1 μL rapid ligation buffer (10x)
determined by spectrophotometer UV-VIS (Cecil CE and adjusted to 10 μL by H2O. This reaction mixture
2020). was incubated at 4°C for overnight. The ligation
The integrity of total RNAs was determined by product was introduced into E. coli DH5α as
electrophoresis in the 1% agarose gel (FMC, USA) in described by Suharsono (2002).
the MOPS buffer (4.2 g L-1 MOPS, 0.41 g L-1 Na-
acetate, 0.37 g L-1 Na2-EDTA). For electrophoresis, 1 Selection of E. coli containing recombinant plasmid
μL total RNA was mixed with 12 μL premix solution E. coli DH5α containing recombinant plasmid was
(MOPS, 50% (v/v) formamide, 17.5% (v/v) selected by using ampicillin and blue-white selection
formaldehyde and 27.5% (v/v) H2O-DEPC). This in the solid LB media (10 g L-1 bacto-trypton, 5 g L-1
suspension was heated at 65°C, 10 minutes, and yeast extract, 10 g L-1 NaCl, pH7.5, 1.5% bacto agar)
immediately cooled in the ice for 5 minutes, and containing 100 mg L-1 ampicillin, 10 mM IPTG
added by 1/6 volume loading dye (0.25% blue (isopropyl-β-D-thiogalactopyranoside) and 50 mg L-1
bromophenol, 0.25% xylene cyanol FF, 30% X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyrano-
glycerol). This suspension containing total RNAs was side). White colony grown in the selection media was
electrophoresed at 100 volt 30 minutes. After used as source of template for PCR to detect the
submerging in the EtBr solution (0.5 μg mL-1) for 30 presence of GmMt2 in the transformed bacteria. For
minutes, and washing by H2O, the total RNAs in the this purpose, one white colony was picked up by
gel were visualized on the UV GelDoc transilluminator using toothpick, then suspended in 6.5 μL dH2O and
(Labquip) and recorded by digital camera. heated at 95°C in the waterbath for 10 minutes and
 SUHARSONO et al. – Gene encoding for metallothionein from Glycine max 111

immediately cooled in the ice for 5 minutes. This Electrophoresis of total RNA in denaturated
suspension was used as the template to amplify the agarose gel containing formaldehyde resulted two
insert GmMt2 with the same composition and dominant bands. These two bands were 18S and 28S
condition of PCR as described for isolation of cDNA ribosomal RNA (rRNA) (Figure 1). This result
of GmMt2. indicated that isolated total RNA was in a very good
quality. Therefore mRNA contained in the total RNA
Isolation and analysis of recombinant plasmid was also in a very good quality for the integrity. The
containing GmMt2 integrity of mRNA is very important in the synthesis of
The isolation of recombinant pGEM-T Easy cDNA.
plasmid DNA contained in E. coli DH5α was carried
out as described by Suharsono (2002). To excised Synthesis of total cDNA.
the insert GmMt2 cDNA, recombinant plasmid DNA Total cDNA had been successfully synthesized
was cut by EcoR1 (Fermentas) by mixing 200 ng from total RNA as template by reverse transcription
plasmid DNA, 10 U EcoR1, 1x restriction buffer and method. By using oligo(dT) primer, only mRNA can
dH2O in 20 μL solution. The solution was incubated at be used as template for cDNA synthesis because it
37°C for 2 hours. contains poly-A tail. This poly-A tail can form a
complementary pair with oligo(dT) primer. rRNA and
Sequencing and sequence analysis of GmMt2 tRNA do not have poly-A tail, so they can not be used
Sequencing of GmMt2 cDNA was performed by as template for cDNA synthesis. PCR by using total
using DNA sequencer ABI Model 3100/3130 cDNA as template and spesific primers for cDNA of
MERCIAN. Local allignment analysis of GmMt2 was exon1-exon2 of β-actin gene resulted one band DNA
carried out by using BLAST (Basic Local Alignment at 450 bp in size (Figure 2).
Search Tools) (http://www.ncbi.nlm.nih.gov/BLAST/) 1 2
program. Amino acid sequence was deduced by
using translation program of EXPASY
(http://www.expasy.ch/tools/dna.htm). The analysis of
open reading frame (ORF) was carried out by using
BESTORF program (http://www.softberry/bestorf/htm).
1000 pb
Analysis of restriction sites in the GmMt2 cDNA was
performed by using NEBCutter program
(http://www.firstmarket.com/cutter/cut2.html).
500 pb

RESULTS AND DISCUSSIONS

Isolation of total RNA Figure 2. cDNA of exon1-exon2 of β-actin resulted from

Total RNA of root tips of soybean cv Slamet has PCR by using total cDNA as template. 1= 1 kb ladder DNA,
been successfully isolated. Quantification of total 2= exon1-exon2 of β-actin cDNA.
RNA by using spectrophotometer showed that the
efficacy of total RNA isolation was 187 µg of total This result showed that the amplified region was
RNA per g root tips. This result was enough for the cDNA of exon1-exon2 and was not genomic DNA of
synthesis of total cDNA. The OD260/OD280 ratio of total β-actin. Amplication of exon1-exon2 region of
RNA was 1.88 indicating that isolated total RNA had a genomic DNA resulted about 550 bp DNA fragment
very good purity from the protein contaminant (Farrel, containing intron1. This intron1 was spliced during the
1993). synthesis of mRNA. The size of intron1 of actin of
soybean is around 90 bp (Shah et al., 1982). The
absence of 550 bp DNA band in the agarose gel
(Figure 2) showed that the synthesized total cDNA
was pure and free from genomic DNA contaminant.
Beside showing the purity of cDNA from genomic
DNA contaminant, this result showed also that the
28S
isolated total RNA had a very good quality.
18S
Isolation and cloning of GmMt2 cDNA
The isolation of GmMt2 cDNA by PCR by using
total cDNA as a template and specific primers for Mt2
resulted cDNA fragment of about 250 bp (Figure 3).
This fragment was then called GmMt2 (Glycine max
Mt2) fragment. It has the same size as Mt2 cDNA of
Figure 1. Total RNA isolated from root tips.
A. thaliana (AtMt2A).
112 BIODIVERSITAS Vol. 10, No. 3, July 2014, pp. 109-114

1 2 1 2

1000 pb
1000 pb

250 pb
250 pb

Figure 3. GmMt2 fragment resulted from PCR using total Figure 4. The result of PCR using white colony as the
cDNA as template. 1= GmMt2, 2= 1 kb marker DNA. source of template. 1= 1 kb DNA marker, 2= GmMt2.

1 2
GmMt2 fragment had been inserted in the middle
of lacZ of pGEM-T Easy plasmid and this ligation had
been successfully introduced into E. coli strain DH5α.
The successful of insertion of GmMt2 into pGEM-T
Easy plasmid and introduction of recombinant pGEM- 3000 pb
T Easy plasmid into E. coli was demonstrated by the
presence of white colony grown in the selection LB
media containing ampicillin, IPTG and X-gal. Only E.
coli strain DH5α containing plasmid can survive in this 1000 pb
selection media, and only the colony containing
recombinant plasmid had a white color. The blue
colonies survived in this selection media contained 250 pb
non-recombinant plasmid. The development of blue
color is due to the conversion of uncolored X-gal
substrate into blue color by β–galactosidase encoded
by lacZ gene. The cloning sites (CS) are located in Figure 5. Digestion of recombinant plasmid by EcoR1. 1=
the middle of lacZ gene. The expression of lacZ is recombinant plasmid cut by EcoR1, 2= 1 kb DNA marker.
induced by IPTG. The blue color of colonies is
developed when in the middle of lacZ does not have Analysis of GmMt2 fragment
an insertion of DNA. If GmMt2 fragment inserts in the DNA sequencing of insert GmMt2 fragment
lacZ gene, β-galactosidase is not synthesized and the resulted 257 nucleotides containing 246 bp ORF
E. coli colonies develop in white color. (open reading frame). This ORF encodes 81 amino
The presence of GmMt2 inserted in the acids with 14 cysteine residues. Local alignment
recombinant plasmid contained in the white colonies analysis with BLASTn showed that GmMt2 had
of E. coli was confirmed by colony-PCR. Colony-PCR similarity 100% with AtMt2A of A. thaliana.
using white colony as source of template resulted 250 Since the nucleotide sequence is the same, so the
bp DNA fragment showing that this white colony deduced amino acid sequence of GmMt2 is also the
contained GmMt2 fragment (Figure 4). same as AtMt2A. Therefore, GmMT2 apparently has
To reconfirm that GmMt2 had been inserted in the a similar role as AtMT2A in the binding and
pGEM-T Easy, recombinant plasmid DNA had been detoxifying metal ions and avoiding oxidative damage
isolated from white colony, and cut with EcoR1 to (Zhou and Goldsbrough, 1995). Nucleotide analysis
excise insert GmMt2. Digestion of recombinant showed that GmMt2 contains start (ATG) and stop
plasmid DNA by EcoR1 resulted two DNA fragments, (TGA) codons, therefore this isolated GmMt2 is a full
one was 3,000 bp fragment DNA corresponding to lenght of cDNA of Mt2 (Figure 6).
pGEM-T Easy vector, and the other was 250 bp DNA Based on restriction site analysis, GmMt2
fragment being similar in size with GmMt2 fragment fragment does not contain restriction sites located in
(Figure 5). This result showed that the GmMt2 the CS of pGEM-T Easy, therefore all restriction sites
fragment had been inserted into pGEM-T Easy in the CS can be used to excise the insert GmMt2
plasmid. from pGEM-T Easy. GmMt2 fragment contains BbvI,
 SUHARSONO et al. – Gene encoding for metallothionein from Glycine max 113

nuk aa
atg tct tgc tgt gga gga aac tgc gga tgt gga tct ggc tgc aag tgc 48
M S C C G G N C G C G S G C K C 16
ggc aac ggt tgt gga ggt tgc aaa atg tac cct gac ttg gga ttc tcc 96
G N G C G G C K M Y P D L G F S 32
ggc gag aca acc aca act gag act ttt gtc ttg ggc gtt gca ccg gcg 144
G E T T T T E T F V L G V A P A 48
atg aag aat cag tac gag gct tca ggg gag agt aac aac gct gag aac 192
M K N Q Y E A S G E S N N A E N 64
gat gct tgc aag tgt gga tct gac tgc aag tgt gat cct tgc acc tgc 240
D A C K C G S D C K C D P C T C 80
aag tga 246
K - 81

Figure 6. Nucleotide and deduced amino acid sequences of GmMt2.

recombinant

Figure 7. Orientation of GmMt2 in the CS of pGEM–T Easy.

BsaBI, BtsCI, TseI, FokI, ApeKI, CspCI, HpyCH4III, the lacZ gene (Figure 7). The orientation of gene is
PshAI, BsrFI, SgrAI, AcuI, BtgZI, MboII, SfaNI, Cac8I very important for the gene expression.
dan Hpy188I sites, so these sites can not be used to The analysis of amino acid sequence deduced
clone this gene because they will cut it into two from nucleotide sequence showed that the motifs of
fragments or more. The restriction site analysis of the Cys amino acid sequence of GmMT2 are Cys-Cys
DNA fragment is very important for the genetic (3rd – 4th residues), Cys-X-Cys (8-10, 14-16, 67-69,
engineering. 73-75, 78-80) and Cys-X-X-Cys (20-23). These motifs
The analysis of GmMt2 orientation in the CS of Cys sequence of GmMT2 are specific for MT
based on nucleotide sequence showed that GmMt2 protein type 2 of plant (Robinson et al., 1993; Cobbett
fragment was located in the downstream of T7 primer and Goldsbrough, 2002).
inserted in the lacZ and in the opposite orientation of
114 BIODIVERSITAS Vol. 10, No. 3, July 2014, pp. 109-114

CONCLUSIONS Farrel, R.E. 1993. RNA Methodologies. A Laboratory Guide for

Isolation and Characterization. San Diego: Academic Press Inc.
Hall, J.L. 2002. Cellular mechanism for heavy metal detoxification
Full length of cDNA encoding for metallothionein of and tolerance. Journal of Experimental Botany 53 (366): 1-11.
soybean cv Slamet (GmMt2) had been isolated and Haq, F, M. Mahoney, and J. Koropatnick. 2003. Signaling events
cloned into pGEM-T Easy plasmid. This cDNA has for metallothionein induction. Mutation Research 533: 211-226.
Mashuda. 2006. Ekspresi Gen Gα dan GST pada Kedelai Kultivar
246 nucleotides encoding for 81 amino acids. GmMt2 Slamet yang Mendapat Cekaman Aluminium. [Tesis]. Bogor:
has the same sequence as AtMt2 of A. thaliana. The Sekolah Pascasarjana IPB.
motifs of Cys amino acid sequence of GmMT2 were Nartey, N.O., D. Banerjee, and M.G. Cherian. 1987.
Cys-Cys, Cys-X-Cys, dan Cys-X-X-Cys. Immunohistochemical localization of metallothionein in cell
nucleus and cytoplasm of fetal human liver and kidney and its
changes during development. Pathology 19: 233-238.
Panda, S.K., L.B. Singha, and M.H. Khan. 2003. Does aluminum
AKNOWLEDGMENT phytotoxicity induce oxidative stress in greengram (Vigna
radiata). Bulgarian Journal of Plant Physiology 29: 77-86.
Pilon-Smiths, E., and M. Pilon. 2002. Phytoremediation of metals
This research was financially supported by using transgenic plants. Critical Review of Plant Science 21:
Competence Research Grant (Hibah Kompetensi), 439-456.
Directorate Research and Community Services, Robinson, N.J., A.M. Tommey, C. Kuske, and P.J. Jackson. 1993.
Directorate General of Higher Education, Ministry of Plant metallothionein. The Journal of Biochemistry 295: 1-10.
Shah D.M., R.C. Hightower, and R.B. Meagher. 1982. Complete
National Education, Republic of Indonesia, by nucleotide sequence of a soybean actin gene. Proceeding of
Contract SPK 008/HIKOM/DP2M/2008. the National Academic of Science of the USA 79 (4): 1022-
1026.
Snowden, K.C., and R.C. Gardner. 1993. Five genes induced by
aluminum in wheat (Triticum aestivum L.) roots. Plant
REFERENCES Physiology 103: 855-861.
Suharsono. 2002. Konstruksi pustaka genom kedelai kultivar
Akashi, K, N. Nishimura, Y. Ishida, and A. Yokota. 2004. Potent Slamet. Hayati 9 (3): 67-70.
hydroxyl radical-scavenging activity of drough-induced type-2 Templeton, D.M., D. Banerjee, and M.G. Cherian. 1985.
metallothionein in wild watermelon. Biochemical and Metallothionein synthesis and localization in relation to metal
Biophysical Research Communications 323: 72-78. storage in rat liver during gestation. Biochemistry and Cell
Andrews, G.K., K.R. Gallant, and M.G. Cherian. 1987. Regulation Biology 63: 16-22.
of the ontogeny of rat liver metallothionein mRNA by zinc. Valle, B.L. 1991. Introduction of metallothionein. Methods in
European Journal of Biochemistry 166: 527-531. Enzymology 205: 3-7.
Cai, L., J. Koropatnick, and M.G. Cherian. 1995. Metallothionein Vasak, M., and D.W. Hasler. 2000. Metallothioneins: new functional
protects DNA from copper-induced but not iron-induced and structural insight. Current Opinion in Chemical Biology 4:
cleavage in vitro. Chemistry and Biology 96: 143-155. 177-183.
Chubatsu, L.S., and R. Meneghini. 1993. Metallothionein protects Wong, H.L., T. Sakamoto, T. Kawasaki, K. Umemura, and K.
DNA from oxidative damage. The Journal of Biochemistry 291: Shimamoto. 2004. Down-regulation of metallothionein, a
193-198. reactive oxygen scavenger, by the small GTPase OsRac I in
Cobbett, C., and P. Goldsbrough. 2002. Phytochelatins and rice. Plant Physiology 135: 1447-1456.
metallothioneins: roles in heavy metal detoxification and Zhou, J., and P.B. Goldsbrough. 1995. Structure, organization and
homeostasis. Annual Review of Plant Biology 53: 159-182. expression of the metallothionein gene family in Arabidopsis.
Coyle, P., J.C. Philcox, L.C. Carey, and A.M. Rofe. 2002. Molecular and General Genetics 248: 318-328.
Metallothionein: the multipurpose protein. Cellular and
Molecular Life Sciences 59: 627-647.

View publication stats