DOI: http://dx.doi.org/10.1590/1678-4499.

562
F.P. Madabula et al.

Plant Breeding - Article

Rice genotypes for drought tolerance:

morphological and transcriptional evaluation
of auxin-related genes
Frederico Pedro Madabula1, Railson Schreinert dos Santos1, Nata Machado1, Camila Pegoraro1, Mariana
Madruga Kruger1, Luciano Carlos da Maia1, Rogerio Oliveira de Sousa2, Antonio Costa de Oliveira1*
1. Universidade Federal de Pelotas - Faculdade de Agronomia Eliseu Maciel - Centro de Genômica e Fitomelhoramento -
Pelotas (RS), Brazil.
2. Universidade Federal de Pelotas - Faculdade de Agronomia Eliseu Maciel - Departamento de Solos - Pelotas (RS), Brazil.

Abstract: Drought stress affects crop quality and productivity. microarray data and then through real-time quantitative polymerase
The challenge of increasing food availability for a growing worldwide chain reaction (RT-qPCR), in the 6 phenotypically evaluated Brazilian
demand relies on the development of tolerant cultivars that will genotypes under standard conditions (absence of stress). Our results
need to be adapted to arid and semi-arid areas. In order to help the show that all genotypes lengthened its roots in response to drought,
understanding of rice response to stress, the phenotypic response of specially the 2 hybrids. The expression of these genes is modified
6 Brazilian rice cultivars and 2 different crosses between them were in response to stress, and OsRAA1 has a very special behavior,
characterized under drought conditions. Since gene regulation is an constituting a target for future studies. Further steps include the
important part of root morphological responses to stressful conditions, study of polymorphisms in these genotypes in order to understand if
4 genes related to auxin response and root modifications (OsGNOM1/ differences in these genes or in regulatory regions can be associated
CRL4, OsIAA1, OsCAND1 and OsRAA1) were evaluated. The expression with differences in root system architecture and/or stress tolerance.
of these genes was analyzed in stressed rice using public available Key words: Oryza sativa, RT-qPCR, root, abiotic stress.

*Corresponding author: [email protected]

Received: Nov. 18, 2015 – Accepted: Feb. 17, 2016

428 Bragantia, Campinas, v. 75, n. 4, p.428-434, 2016

 Drought tolerance in rice

INTRODUCTION MATERIAL AND Methods

Phenotypic analysis of 6 cultivars
Rice (Oryza sativa L.) is the second most cultivated cereal and 2 hybrids under polyethylene glycol
in the world and a primary source of food for about two-thirds 6,000 stress
of the world’s population (Pirdashti et al. 2009). The cultivation
of rice faces many different challenges, according to region, Six genotypes, with contrasting phenotypes according
climate and cultivation system, i.e. upland or lowland. In to the results previously obtained at our laboratory
order to be successful, plants have multiple mechanisms to (Mistura et al. unpublished data), were selected:
respond and adapt to adverse environmental conditions. 3 with well-developed root systems (“Arroz de Sequeiro”,
Drought stress is a problem in approximately 45% Ligeirinho, BRS Colosso) and 3 with poorly developed
of agricultural areas and the largest global constraint to root systems (SCS BRS 112, BRS Vencedora, Farroupilha).
productivity, becoming a major issue in scientific reports In addition, 2 hybrids (H.5×2 and H.6×5) had their
(Ahmadi et al. 2012; Ambavaram et al. 2014; Heinemann morphological response to drought assessed. H.5×2
et al. 2015; Todaka et al. 2015). In rainfed conditions, water was obtained from the cross Farroupilha × “Arroz de
deficit can become a primary limiting factor for productivity Sequeiro”, while H.6×5 was obtained from the cross BRS
and its importance is increasing due to climate changes (Datta Colosso x Farroupilha.
et al. 2012). In Asia, rice cultivation areas go through dry Rice seedlings (14 days of age) were stressed in nutrient
periods of varying intensity affecting different stages of the solution (Camargo and Oliveira 1981) containing 10%
crop cycle (Dixit et al. 2012). polyethylene glycol (PEG) 6,000 (−1.48 MPa of osmotic
In this difficult scenario in which climate is currently pressure). A control was used, consisting of seedlings kept in
changing, world’s demand for rice continues to grow, standard plant nutrient solution for a period of 2 weeks. After
and the use of dry areas in arid and semi-arid tropical that, plants proceeded to the evaluation of morphological
regions is both an opportunity and a problem (Sheshshayee traits: shoot length (SL), root length (RL), root dry weight
et al. 2011). Drought tolerance is a complex quantitatively (RDW) and shoot dry weight (SDW).
inherited character that refers to the plant ability to live, The analysis of variance (ANOVA) was performed in
grow and reproduce satisfactorily with limited water supply, a completely randomized design and the Tukey’s honest
being able to endure periods of water deficiency (Fleury significant difference (HSD) test was used for multiple
et al. 2010). comparisons between pairs at a 95% confidence interval
Efforts to improve plant tolerance to drought over time (p < 0.05). These analyses were made using the R package
across different regions have resulted in a range of variability “Agricolae” (R Core Team 2013), and the biological material
for drought tolerance (Degenkolbe et al. 2009). However, to was composed by 3 replicates of 4 plants.
obtain high yields, conventional breeding programs have
had limitations in generating new drought tolerant cultivars Transcriptional analysis using
(Ramya et al. 2010; Serraj et al. 2011). public database
Current studies have tried to identify factors that
influence the level of tolerance of a given species or cultivar The transcriptional analysis of genes related to auxin
through the evaluation of the transcriptional expression of response, which has been preselected in literature (Table 1),
different genes. Thus, assessments on the genetic basis was first performed using Genevestigator (Zimmermann et al.
of stress tolerance in plants have been performed (Lasanthi- 2008) with data from rice seedlings of a drought-sensitive
Kudahettige et al. 2007; Santos et al. 2013). cultivar (IR64) subjected to drought, salt and cold conditions
This study aimed to select and assess the transcriptional (Jain et al. 2007). Euclidean distance was used to measure
expression of 4 genes related to auxin and root development the distance for hierarchical clustering analysis, and optimal
in different stresses. Morphological responses of 8 genotypes leaf-ordering was applied to keep similar vectors positioned
to drought were also evaluated. Both informations are crossed close to each other. The differential expression under drought
in order to detect possible differential stress responses, which conditions considered filtered results with p-values under
can assist the breeding of more resilient crop varieties. 0.05 and 0.001.

Bragantia, Campinas, v. 75, n. 4, p.428-434, 2016 429

F.P. Madabula et al.

Table 1. Four genes related to auxin response and root modifications evaluated in this study.

Probe name in Forward Reverse

Generic
ID References genevestigator primer for primer for
name
analysis RT-qPCR analysis RT-qPCR analysis

Kitomi et al. (2008);

OsGNOM1/CRL4 Os03g0666100 Os.19756.1.S1_at TGCTCGCCATGAAACTAGTCG GCCACGGACCTTGATCTTGAT
Liu et al. (2009)
Song et al. (2009);
OsIAA1 Os01g0178500 Os.9069.1.S1_at ACCATATACGCAAAAAAACCGATG CTGACGACACGCGAGCC
Thakur et al. (2001)
OsCAND1 Os02g0712000 Wang et al. (2011) Os.5788.1.S1_at ACTTGGTTTTTTGCCCGAAG TCCACTATCCACTGCAGAGCAT

Ge et al. (2004);
OsRAA1 Os01g0257300 Os.487.1.S1_at CTCTTCCAGTTCCACAAGCGT AAGGAGTCGCGGTTCTTGA
Han et al. (2005)

Real-time quantitative polymerase chain of each gene (Iskandar et al. 2004; Lasanthi-Kudahettige
reaction for auxin-related genes in different et al. 2007). Gene expression data was displayed as a heat
genotypes map graphic, through Multi Experiment Viewer (MeV),
EASE Expression Analysis Systematic Explorer version 4.6
Seedlings (21 days of age) of rice genotypes SCS BRS (Saeed et al. 2003), where the cultivar SCS BRS 112 was
112, “Arroz de Sequeiro”, BRS Ligeirinho, BRS Vencedora, used as calibrator.
Farroupilha and BRS Colosso grown in nutrient solution
(Camargo and Oliveira 1981) were used in this experiment.
As the production of hybrid seeds was enough to cover RESULTS AND DISCUSSION
only the morphological analyses, these genotypes were not Effect of stress on morphology PEG 6000
included in transcriptional analysis.
Total RNA was extracted from 0.1 g of root tissue from Significant differences (p < 0.05) between genotypes were
rice seedlings following the protocol described by PureLinkTM observed for SL and RL, as well as for SDW and RDW, under
reagent (InvitrogenTM). Samples were treated with DNAse I control and stressful conditions (Figure 1).
(InvitrogenTM). The quantity of RNA was assessed, and For RL (Figure 1b), both hybrids presented very high
each sample was reverse-transcribed into cDNA using the values when subjected to stress. This response becomes
commercial kit SuperScript® III First-Strand System for real- especially important when it is observed that the values
time quantitative polymerase chain reaction (RT-qPCR) found for this variable are quite low when the plants are
(InvitrogenTM). Samples consisted of cDNA produced from in control conditions, indicating that indeed the hybrids
mRNA obtained from 3 different biological replicates. These provided an intense response.
replicates were composed by bulks of 4 plants each. The genotypes characterized as having well-developed root
Primers for 4 genes related to auxin response and root systems did not show the highest values for RL as a response to
development were designed according to Applied Biosystems® stress. However, when analyzing RDW (Figure 1d), genotypes
recommendations (Table 1) and evaluated for amplification with well-developed root systems showed the highest values
efficiency above 90%. Also, the dissociation curves of each under stress, along with BRS Ligeirinho.
pair of primers contained a single peak, and the agarose Since small changes in the root system can have significant
gels revealed single bands corresponding to the predicted effects on productivity, the importance of root growth to
amplicon length. maintain crop productivity is being increasingly recognized
The RT-qPCR was performed in a 7500 Real-Time by plant breeders (Meng et al. 2010; Bengough et al. 2011).
PCR System (Applied Biosystems®) using SYBR® Green The transfer of carbohydrates from leaves to roots and
(InvitrogenTM) dye. Relative quantification of each single the consequent increase in root growth is a response that
gene expression was performed using the comparative favors its uptake capacity (Davatgar et al. 2009). In this
threshold cycle method (Livak and Schmittgen 2001), and study, plants subjected to water deficit condition increased
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was root development, something that can be seen through the
used as a reference gene to quantify transcript abundance increase in RL and RDW.

430 Bragantia, Campinas, v. 75, n. 4, p.428-434, 2016

 Drought tolerance in rice

Shoot lenght
The indirect effect of drought, simulated by PEG 6,000,
40.00 b a
30.00
d
*
c
*D
*
B f C eA can be observed through the reduction of SDW for all
* g h *
(a) 20.00
* E *
G F
*
*
genotypes (Figure 1c). However, genotypes characterized
H *
10.00
* 0% as having less developed root system presented longer
10%
0.00 shoots in stress conditions, except for “Arroz de Sequeiro”.
Farroupilha

BRS Vencedora

“Arroz de Sequeiro”

SCS BRS 112

BRS Colosso

BRS Ligeirinho

H. 6x5

H. 5x2
As expected, this response was similar to what happened to
SL (Figure 1a), where the main differences were in hybrids,
which had SL less affected than SDW.

Root lenght
25.00 A
Transcriptional expression
B *
C D
20.00 E * * F *
* *
(b) 15.00
a b
G
*
H
* A small transcriptional change in genes OsGNOM1/CRL4,
10.00 * c d e
g * * f
* h
5.00 * * *
*
0%
OsCAND1 and OsIAA1, which are all repressed under the 3
0.00 10%
different analysed stresses, was seen in the Genevestigator
Farroupilha

BRS Vencedora

“Arroz de Sequeiro”

SCS BRS 112

BRS Colosso

BRS Ligeirinho

H. 6x5

H. 5x2

platform (Figure 2a). For OsRAA1, however, an increase

in expression was observed (Jain et al. 2007). It is known
that drought, high salinity, and low temperature induce
the expression of a large number of genes (Todaka et al.
Shoot dry weight
a
2015). These stresses are very complex stimuli that possess
0.18 *
0.14 c A b
many different yet related attributes (Xiong et al. 2002).
* * * d
(c) 0.10 g
C B * D e It is interesting to point out that this gene had a very distinct
* * gE * f * F
0.06 *
G
*
F * 0% position in the clustering analysis.
0.02 10%
Farroupilha

BRS Vencedora

“Arroz de Sequeiro”

SCS BRS 112

BRS Colosso

BRS Ligeirinho

H. 6x5

H. 5x2

Drought
Cold
Salt

OsRAA1
(a)
OsGNOM1/CRL4
OSCAND1
Root dry weight OsIAA1
0.05 A Log(2)-ratio
C * B B
0.04 * E D * *
* * F –2.5 –2.0 –1.5 –1.0 –0.5 0.0 0.5 1.0 1.5 2.0 2.5
(d) 0.03 a a
* G
c c * b *
* c * c
0.02 * * * c * 0% Down-regulated Up-regulated
*
0.01 10%
Farroupilha

BRS Vencedora

“Arroz de Sequeiro”

SCS BRS 112

BRS Colosso

BRS Ligeirinho

H. 6x5

H. 5x2

Drought stress
(b) 4
OsRAA1**
3
Fold change

2
* There are significant differences (p < 0.05) within each
genotype between plants grown in nutrient solution only 1
(light blue bar) and subjected to stress by polyethylene
glycol 6,000 (darker bar) 0

(a, …, h) There are differences between genotypes that were not –1

subjected to stress OsGNOM1/CRL4*
–2
OsIAA1** OSCAND1**
(A, …, H) There are also differences between genotypes subjected
to stress (Tukey’s test). Error bars represent the standard
deviation of the mean. Figure 2. Expression of genes related to auxin response and root
development. (a) Hierarchical clustering grouping genes that have
Figure 1. Comparison of (a) Shoot length; (b) Root length; (c) Shoot similar profiles under cold, salt and drought stresses; (b) Differential
dry weight; (d) Root dry weight. expression under drought conditions (*p < 0.05; **p < 0.001).

Bragantia, Campinas, v. 75, n. 4, p.428-434, 2016 431

F.P. Madabula et al.

The transcriptional change of these genes under drought apical dominance and root initiation (Du et al. 2011), and
stress can be seen in Figure 2b. Interestingly, OsRAA1 shows is also important in root development and architecture
a positive 3.13-fold change (p < 0.001) in IR64, but different (Wang et al. 2011). Differences in cycle length between
results were found when analyzing the other cultivars with these cultivars possibly have harmed the comparison of
PEG 6,000. Since overexpression of OsRAA1 results in reduced transcriptional activity of the studied genes, since the
growth of primary roots (Han et al. 2005), this may suggest metabolism of these plants operates on quite different
that, in the experiment with the genotype IR64 (sensitive), the rates and may vary even with very small differences in
upregulation of this gene can be one of the reasons that make developmental stages.
this cultivar more susceptible to drought. This is supported In general, plants subjected to drought stress had reduced
by opposite results we found for the cultivars analyzed under shoot growth and number of roots. An increase in root lenght
stress by PEG 6,000 in the experiment described here. This and, consequently, an increase in its dry weight were also
gene, that is transcriptionally responsive to stresses and has observed. The ratio of dry weight of roots and shoots also
a proven impact on root morphology, is still poorly studied, registered a significant increase due to stress.
and greater efforts to better understand its role in rice under
stressful conditions are needed (Ge et al. 2004; Han et al.
2005; Wu and Cheng 2014). CONCLUSION
The transcriptional expression of these genes in each
of the 6 rice genotypes can be seen in Figure 3. Low From the results presented here, it was possible to
expression was observed for all studied genes in BRS confirm that these genotypes respond differently
Ligeirinho and BRS Vencedora. Auxin plays a crucial to drought stress. However, even though these genes
role in regulation of various plant responses, such as cell are transcriptionally responsive to different stresses, their
elongation, cell division, photoperiodism, gravitropism, transcriptional levels do not explain root morphological
differences between the tested genotypes in the absence
of stress. Of the different assessed phenotypic parameters,
0.0 1.0 1.6 the one that showed best results was RDW, which was
“Arroz de Sequeiro”

more responsive to drought stress in genotypes with well-

BRS Vencedora
BRS Ligeirinho

BRS Colosso
SCS BRS 112

developed root systems.

Farroupilha

Further research using plants adapted to drought

(xerophytes), assisted by bioinformatics and molecular biology,
OsRAA1 can provide us information about relevant differences found
OsLAA1
OsGNOM1 in these genes when compared to crops. The identification of
OSCAND1
polymorphisms and the pattern of regulation of homologs
of these genes in these species may be valuable, but the
Figure 3. Heat map graphic of the relative expression of the 4 genes
involved in root development in rice, where the genotype SCS BRS
conservation of its function will have to be tested in different
112 was used as control. The data are presented as means. crops, including rice.

REFERENCES

Ahmadi, G., Akbarabadi, A., Kahriri, D., Rezaizad, A. and Gheytouli, to environmental stress. Nature Communications, 5, 5302. http://
M. (2012). Study of drought tolerance of bread wheat (Triticum dx.doi.org/10.1038/ncomms6302.
aestivum L.) genotypes in seedling stage. Bihrean Biologist, 6, 77-80.
Bengough, A., McKenzie, B., Hallett, P. and Valentine, T. (2011). Root
Ambavaram, M. M., Basu, S., Krishnan, A., Ramegowda, V., Batlang, elongation, water stress, and mechanical impedance, a review of
U., Rahman, L., Baisakh, N. and Pereira, A. (2014). Coordinated limiting stresses and beneficial root tip traits. Journal of Experimental
regulation of photosynthesis in rice increases yield and tolerance Botany, 62, 59-68. http://dx.doi.org/10.1093/jxb/erq350.

432 Bragantia, Campinas, v. 75, n. 4, p.428-434, 2016

 Drought tolerance in rice

Camargo, C. E. O. and Oliveira, O. F. (1981). Tolerância de Heinemann, A. B., Barrios-Perez, C., Ramirez-Villegas, J., Arango-
cultivares de trigo a diferentes níveis de alumínio em solução Londoño, D., Bonilla-Findji, O., Medeiros, J. C. and Jarvis, A. (2015).
nutritiva e no solo. Bragantia, 40, 21-31. http://dx.doi.org/10.1590/ Variation and impact of drought-stress patterns across upland rice
S0006-87051981000100003. target population of environments in Brazil. Journal of Experimental
Botany, 66, 3625-3638. http://dx.doi.org/10.1093/jxb/erv126.
Datta, K., Baisakh, N., Ganguly, M., Krishnan, S., Yamaguchi, K. and
Datta, S. (2012). Overexpression of Arabidopsis and rice stress Iskandar, H. M., Simpson, R. S., Casu, R. E., Bonnett, G. D., Maclean,
genes’ inducible transcription factor confers drought and salinity D. J. and Manners J. M. (2004). Comparison of reference genes for
tolerance to rice. Plant Biotechnology Journal, 10, 579-586. http:// quantitative real-time polymerase chain reaction analysis of gene
dx.doi.org/10.1111/j.1467-7652.2012.00688.x. expression in sugarcane. Plant Molecular Biology Reporter, 22,
325-337. http://dx.doi.org/10.1007/BF02772676.
Davatgar, N., Neishabouri, M., Sepaskhah, A. and Soltani, A. (2009).
Physiological and morphological responses of rice (Oryza sativa Jain, M., Nijhawan, A., Arora, R., Agarwal, P., Ray, S., Sharma, P.,
L.) to varying water stress management strategies. International Kapoor, S., Tyagi, A. K. and Khurana, J. P. (2007). F-box proteins in
Journal of Plant Production, 3, 19-32. rice. Genome-wide analysis, classification, temporal and spatial
gene expression during panicle and seed development, and
Degenkolbe, T., Do, P. T., Zuther, E., Repsilber, D., Walther, D., Hincha,
regulation by light and abiotic stress. Plant Physiology, 143, 1467-
K. and Köhl, K. (2009). Expression profiling of rice cultivars differing
1483. http://dx.doi.org/10.1104/pp.106.091900.
in their tolerance to long-term drought stress. Plant Molecular
Biology, 69, 133-153. http://dx.doi.org/10.1007/s11103-008-9412-7. Kitomi, Y., Ogawa, A., Kitano, H. and Inukai, Y. (2008). CRL4 regulates
crown root formation through auxin transport in rice. Plant Root,
Dixit, S., Swamy, B., Vikram, P., Ahmed, H., Sta Cruz, M., Amante, 2, 19-28. http://dx.doi.org/10.3117/plantroot.2.19.
M., Atri, D., Leung, H. and Kumar, A. (2012). Fine mapping of QTLs
for rice grain yield under drought reveals sub-QTLs conferring a Lasanthi-Kudahettige, R., Magneschi, L., Loreti, E., Gonzali, S.,

response to variable drought severities. Theoretical and Applied Licausi, F., Novi, G., Beretta, O., Vitulli, F., Alpi, A. and Perata, P.

Genetics, 125, 155-169. http://dx.doi.org/10.1007/s00122-012-1823-9. (2007). Transcript profiling of the anoxic rice coleoptile. Plant
Physiology, 144, 218-231. http://dx.doi.org/10.1104/pp.106.093997.
Du, C., Xu Y., Wang, Y. and Chong, K. (2011). Adenosine diphosphate
ribosylation factor-GTPase-activating protein stimulates the transport Liu, S., Wang, J., Wang, L., Wang, X., Xue, Y., Wu, P. and Shou, H.

of AUX1 endosome, which relies on actin cytoskeletal organization (2009). Adventitious root formation in rice requires OsGNOM1
and is mediated by the OsPINs Family. Cell Research, 19, 1110-
in rice root development. Journal of Integrative Plant Biology, 53,
1119. http://dx.doi.org/10.1038/cr.2009.70.
698-709. http://dx.doi.org/10.1111/j.1744-7909.2011.01059.x.
Livak, K. J. and Schmittgen, T. D. (2001). Analysis of relative
Fleury, D., Jefferies, S., Kuchel, H. and Langridge, P. (2010). Genetic
gene expression data using real-time quantitative PCR and the
and genomic tools to improve drought tolerance in wheat. Journal
2−ΔΔCT method. Methods, 25, 402-408. http://dx.doi.org/10.1006/
of Experimental Botany, 61, 3211-3222. http://dx.doi.org/10.1093/
meth.2001.1262.
jxb/erq152.
Meng, Y., Xiaoxia, X., Chen, D., Wu, P. and Chen, M. (2010). Micro
Ge, L., Chen, H., Jiang, J. F., Zhao, Y., Xu, M. L., Xu, Y. Y., Tan, K.
RNA-mediated signaling involved in plant root development.
H., Xu, Z. H. and Chong, K. (2004). Overexpression of OsRAA1
Biochemical and Biophysical Research Communications, 393,
causes pleiotropic phenotypes in transgenic rice plants, including
345-349. http://dx.doi.org/10.1016/j.bbrc.2010.01.129.
altered leaf, flower, and root development and root response to
gravity. Plant Physiology, 135, 1502-1513. http://dx.doi.org/10.1104/ Pirdashti, H., Sarvestani, Z. and Bahmanyar, M. (2009). Comparison
pp.104.041996. of physiological responses among four contrast rice cultivars under
drought stress conditions. World Academy of Science, Engineering
Han, Y., Wang, X., Jiang, J., Xu, Y., Xu, Z. and Chong, K. (2005).
and Technology, 49, 52-53.
Biochemical character of the purified OsRAA1, a novel rice protein
with GTP-binding activity, and its expression pattern in Oryza R Core Team (2013). R: a language and environment for statistical
sativa. Journal of Plant Physiology, 162, 1057-1063. http://dx.doi. computing. Vienna: R Foundation for Statistical Computing;
org/10.1016/j.jplph.2004.12.001. [accessed 2016 Jul 19]. http://www.R-project.org/

Bragantia, Campinas, v. 75, n. 4, p.428-434, 2016 433

F.P. Madabula et al.

Ramya, M., Raveendran, M., Sathiyamoorthy, S. and Ramalingam, Plant Molecular Biology, 70, 297-309. http://dx.doi.org/10.1007/
J. (2010). In silico analysis of drought tolerant genes in rice. s11103-009-9474-1.
International Journal of Biological and Medical Research, 1, 36-40.
Thakur, J. K., Tyagi, A. K. and Khurana, J. P. (2001). OsIAA1, an Aux/
Saeed, A., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., IAA cDNA from rice, and changes in its expression as influenced
Braisted, J., Klapa M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, by auxin and light. DNA Research, 8, 193-203. http://dx.doi.
M., Rezantsev, A., Popov, D., Ryltsov, A., Kostukovich, E., Borisovsky, org/10.1093/dnares/8.5.193.
I., Liu, Z., Vinsavich, A., Trush, V. and Quackenbush, J. (2003). TM4:
Todaka, D., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2015).
a free, open-source system for microarray data management and
Recent advances in the dissection of drought-stress regulatory
analysis. Biotechniques, 34, 374-378.
networks and strategies for development of drought-tolerant
Santos, R. S., Krüger, M. M., Pegoraro, C., Madabula, F., Maia, L. C., transgenic rice plants. Frontiers in Plant Science, 6, 84. http://
Rombaldi, C. V. and Oliveira, A. C. (2013). Transcriptional regulation dx.doi.org/10.3389/fpls.2015.00084.

of seven ERFs in rice under oxygen depletion and iron overload Wang, X. F., He, F. F., Ma, X. X., Mao, C. Z., Hodgman, C., Lu, C. G.
stress. Tropical Plant Biology, 6, 16-25. http://dx.doi.org/10.1007/ and Wu, P. (2011). OsCAND1 is required for crown root emergence
s12042-013-9117-1. in rice. Molecular Plant, 4, 289-299. http://dx.doi.org/10.1093/mp/

Serraj, R., McNally, K., Loedin, I., Kohli, A., Haefele, S., Atlin, G. ssq068.

and Kumar, A. (2011). Drought resistance improvement in rice: Wu, W. and Cheng, S. (2014). Root genetic research, an opportunity
an integrated genetic and resource management strategy. Plant and challenge to rice improvement. Field Crops Research, 165,
Production Science, 14, 1-14. http://dx.doi.org/10.1626/pps.14.1. 111-124. http://dx.doi.org/ 10.1016/j.fcr.2014.04.013.

Sheshshayee, M. E., Abou-Kheir, S., Rohini, N., Srivastava, B., Xiong, L., Schumaker, K. S. and Zhu, J-K. (2002). Cell signaling
Mohanraju, K., Nataraja, T. G., Prasad, T. G. and Udayakumar, M. during cold, drought, and salt stress. Plant Cell, 14, s165-s183. http://
(2011). Phenotyping for root traits and their improvement through dx.doi.org/10.1105/tpc.000596.
biotechnological approaches for sustaining crop productivity. Root
Zimmermann, P., Laule, O., Schmitz, J., Hruz, T., Bleuler, S. and
Genomics, 205-223. http://dx.doi.org/10.1007/978-3-540-85546-0_9.
Gruissem, W. (2008). Genevestigator transcriptome meta-analysis
Song, Y., You, J. and Xiong, L. (2009). Characterization of OsIAA1 and biomarker search using rice and barley gene expression
gene, a member of rice Aux/IAA family involved in auxin and databases. Molecular Plant, 1, 851-857. http://dx.doi.org/10.1093/
brassinosteroid hormone responses and plant morphogenesis. mp/ssn048.

434 Bragantia, Campinas, v. 75, n. 4, p.428-434, 2016