Molecular Genetic Study of Autism and Intellectual

Disability genes on the X-Chromosome

by

Abdul Noor

A thesis submitted in conformity with the requirements

for the degree of Doctor of Philosophy
Institute of Medical Science
University of Toronto

Copyright by Abdul Noor 2012

 Molecular Genetic Study of Autism and Intellectual Disability
genes on the X-Chromosome

Abdul Noor

Doctor of Philosophy

Institute of Medical Science

University of Toronto

2012

Abstract

Autism is a neurodevelopmental disorder with an estimated prevalence of 1 in 150 children

which makes it more common than childhood cancer and juvenile diabetes. It is estimated that

there are more than 100,000 individuals affected by autism in Canada and tens of millions

worldwide. It is well established that genetic factors play important role in the pathophysiology

of autism; still, our current understanding of these genetic factors is limited and cause of autism

remains an important question. During the past decade, after completion of human genome,

several new high throughput genome scan technologies have been developed such as

microarrays. In the present study, we undertook the challenge of identifying X-chromosomal

genes involved in autism by performing genome-wide copy number variation analysis of more

than 400 probands with autism using Affymetrix 500K single nucleotide polymorphism (SNP)

microarrays. We identified copy number variants implicating several genes on the chromosome

X such as PTCHD1, IL1RAPL1, IL1RAPL2 and TSPAN7 as autism candidate genes. We also

demonstrated that autism and intellectual disability may share some of these genes as etiologic

factors. We performed a comprehensive analysis of PTCHD1 locus and showed that mutations at

this locus are associated with autism in ~1 % of the cases. This study also demonstrated that
ii
PTCHD1 mutations can cause intellectually disability with or without autism, and that the

PTCHD1 protein may act as a receptor in Hedgehog signaling pathway. We have also carried out

a detailed analysis of TSPAN7 and IL1RAPL1 to explore the contributions of these genes in

autism. We identified one family with intronic deletion of IL1RAPL1 and another case with a

missense mutation in this gene, thus implicating this known intellectual disability gene in autism.

Our findings highlight the importance of the X chromosome in the etiology of autism, and

demonstrate the power of copy number variation analysis coupled with other technologies in

identification of disease genes, in particular for complex genetic disorders such as autism.

iii
 Acknowledgments
First and foremost, I offer my sincerest gratitude to my supervisor Dr. John Vincent for his
support, guidance and encouragement which allowed me to complete this journey of completion
of my PhD thesis. Without his excellent mentorship, I would not have achieved this task.

I would like to thank my supervisory committee members, Dr Stephen Scherer and Dr. Lucy
Osborne for providing guidance over the years. The valuable directions from my advisory
committee allowed me to successfully execute my project and polished my scientific skills.

I would like to thank all the past and present members of Dr. Vincents Lab. I would especially
like to thank Chris Harvey, Beata Stachowiak and Anna Mikhailov for their help, support and for
sharing their knowledge and skills with me. I would also like to thank Muhammad Arshad, Liana
Kaufman and Peter Gianakopoulos for their contributions in my project. Working with all of you
was a great learning and sharing experience for me.

Special thanks to members of Dr. Scherers Lab, in particular, to Dr. Christian Marshall and
Jennifer Howe. I must acknowledge that my entire thesis project branched out from data
generated by Dr. Marshall at Dr. Scherers lab.

I am also thankful to my family and friends for their continued support of my career goals,
especially; I thank my parents and my wife, Ayeshah for supporting me to achieve my career
goals. I also acknowledge my son, Bilal for brining lot of joy and happiness to our family which
provided my strength to focus towards my goals even when times were difficult. I am also very
excited to welcome the new member of our family, my daughter, Iman.

Last but not least, I am very thankful to the families and patients who participated in our study.
This endeavor was not possible without their commitment and support. I am also grateful to the
Canadian Institutes of Health Research (CIHR) for awarding me the Canada Graduate
Scholarship. I also acknowledge funding from Genome Canada and Autism Speaks which
enabled us to perform this study.

iv
 Table of Contents
Acknowledgments.......................................................................................................................... iv

Table of Contents ............................................................................................................................ v

List of Tables ................................................................................................................................. ix

List of Figures ................................................................................................................................. x

Abbreviations ............................................................................................................................... xiii

Chapter 1. Background ............................................................................................................. 1

1.1 Autism ................................................................................................................................. 2

1.1.1 Endophenotypes ...................................................................................................... 5

1.1.2 Autism in other single gene disorders ..................................................................... 7

1.1.3 Causes of Autism .................................................................................................... 9

1.1.4 Identification of Causative Genetic Factors .......................................................... 14

1.2 Intellectual Disability (ID) ................................................................................................ 25

1.3 The X-Chromosome.......................................................................................................... 30

1.3.1 Evolution of the X-Chromosome .......................................................................... 30

1.3.2 Autism and X-chromosomal genes: ...................................................................... 34

1.3.3 Autism and Non-syndromic XLID genes: ............................................................ 36

1.3.4 Evidence of X-chromosomal involvement in autism from measures of skewed

X-inactivation ....................................................................................................... 37

1.4 Thesis Objectives .............................................................................................................. 37

1.4.1 Chapter 2 ............................................................................................................... 37

1.4.2 Chapter 3 ............................................................................................................... 38

1.4.3 Chapter 4 ............................................................................................................... 38

Chapter 2. Chromosome X CNVs in Autism ......................................................................... 39

2.1 Introduction ....................................................................................................................... 40

2.2 Methods: ........................................................................................................................... 41

v
 2.2.1 DNA Samples ....................................................................................................... 41

2.2.2 Microarray and karyotyping experiments ............................................................. 42

2.2.3 CNV Analysis ....................................................................................................... 44

2.2.4 Validation of CNVs .............................................................................................. 44

2.2.5 Identification of Candidate Loci ........................................................................... 44

2.3 Results ............................................................................................................................... 46

2.3.1 Chromosome X CNVs in ASD cases.................................................................... 46

2.3.2 Validation of Interesting Loci and Identification of autism candidate genes ....... 52

2.4 Discussion ......................................................................................................................... 62

Chapter 3. Analysis of X-Linked Autism Candidate Genes TSPAN7 & IL1RAPL1 .............. 65

3.1 Introduction ....................................................................................................................... 66

3.2 Methods............................................................................................................................. 68

3.2.1 Samples ................................................................................................................. 68

3.2.2 PCR and Sequencing............................................................................................. 68

3.2.3 Expression studies ................................................................................................. 68

3.3 Results ............................................................................................................................... 72

3.3.1 TSPAN7 ................................................................................................................. 72

3.3.2 IL1RAPL1 ............................................................................................................. 74

3.4 Discussion ......................................................................................................................... 77

Chapter 4. Disruption at the PTCHD1 locus on Xp22.11 in autism spectrum disorder and
intellectual disability ................................................................................................................ 80

4.1 Abstract ............................................................................................................................. 84

4.2 Introduction ....................................................................................................................... 84

4.3 Results ............................................................................................................................... 85

4.3.1 CNV Analysis of PTCHD1 ................................................................................... 85

4.3.2 Mutation Screening of PTCHD1 .......................................................................... 86

vi
 4.3.3 CNVs upstream of PTCHD1 (PTCHD1AS1/PTCHD1AS2 locus) ....................... 87

4.3.4 Expression and Functional Studies of PTCHD1 ................................................... 88

4.4 Discussion ......................................................................................................................... 89

4.5 Methods............................................................................................................................. 92

4.5.1 Source of Subjects................................................................................................. 92

4.5.2 Copy Number Variation Analysis ......................................................................... 93

4.5.3 DNA Sequencing and Mutation Screening ........................................................... 94

4.5.4 X-Inactivation Studies .......................................................................................... 95

4.5.5 Expression Analysis and Protein Localization ..................................................... 95

4.5.6 Luciferase Assays ................................................................................................. 96

4.6 Supplementary Information ............................................................................................ 103

4.6.1 Cytogenetic and CNV analysis of proband from Family 9................................. 103

4.6.2 RT-PCR failed to find evidence for a shortened 3 PTCHD1 transcript from
individual with PTCHD1 exon 1 deletion .......................................................... 103

4.6.3 Consensus Sequence for PTCHD1AS1: .............................................................. 104

4.6.4 Consensus Sequence for PTCHD1AS2: .............................................................. 104

4.6.5 RT-PCR and 5 RACE (Rapid Amplification of cDNA Ends) analysis of the
ncRNAs, PTCHD1AS1 and PTCHD1AS2 and the PTCHD1 gene..................... 105

4.6.6 Alternative 5 exons for PTCHD1AS1, identified by 5RACE: ......................... 107

4.6.7 Putative promoter and enhancer sequences in intergenic region between

DDX53 and PTCHD1 ......................................................................................... 108

4.6.8 eQTL at PTCHD1 locus...................................................................................... 109

Chapter 5. Future Directions ................................................................................................ 140

5.1 Screening of additional autism families for CNVs using improved microarray
platforms ......................................................................................................................... 140

5.2 Analysis of splice variation and isoforms at the PTCHD1 locus.................................... 140

5.3 Induced pluripotent stem (iPS) studies ........................................................................... 141

5.4 Zebrafish knockdown experiments ................................................................................. 141

vii
 5.5 Mouse models ................................................................................................................. 142

5.6 Next Generation Sequencing of the entire chromosome X ............................................ 142

5.7 Development of Potential Therapies ............................................................................... 142

Chapter 6. References ........................................................................................................... 144

List of Appendices ...................................................................................................................... 176

viii
 List of Tables
Table 1-1 Categories of intellectual disability by IQ and ability to function in society as defined
by the DSM-IV-TR. ...................................................................................................................... 25

Table 2-1 Chromosome X CNVs identified in 427 ASD cases. ................................................... 47

Table 2-2 Autism Specific CNVs are listed. All genomic coordinates are based on hg17: Build
35................................................................................................................................................... 48

Table 2-3 Autism Specific Stringent CNVs.................................................................................. 51

Table 2-4 CNV regions validated with qPCR............................................................................... 55

Table 3-1 Primers used to amplify the coding regions and splice sites of TSPAN7. .................... 69

Table 3-2 Primers used to amplify the coding regions and splice sites of IL1RAPL1.................. 70

Table 3-3 Primer sequences used for qPCR validation and cDNA amplification of TSPAN7
duplication..................................................................................................................................... 71

Table 3-4 Primer sequences used for amplification of IL1RAPL1 cDNA. ................................... 72

Table 4-1 Primers used to amplify all three exons of PTCHD1 ................................................... 94

Table S 1 Clinical description of cases with disruptions at the PTCHD1 locus on Xp22.11 ..... 110

Table S 2 Breakpoint of deletions at the PTCHD1 locus: .......................................................... 117

Table S 3 Additional CNVs in 9 subjects with upstream deletions ............................................ 119

Table S 4 Gene co-expressed with PTCHD1 .............................................................................. 123

Table S 5 Summary of Samples Analyzed in the Study: ............................................................ 127

ix
 List of Figures
Figure 2-1 Major steps involved in processing of Affymetrix 500K microarrays ....................... 43

Figure 2-2 Workflow for mapping autism susceptibility genes using CNVs on the X
chromosome is outlined. ............................................................................................................... 45

Figure 2-3 Genomic region showing a 167 Kb deletion (blue line) at Xp22.11 which involves
Exon 1 of the PTCHD1 gene. ....................................................................................................... 56

Figure 2-4 Pedigree showing the segregation of deletion at the PTCHD1 locus ......................... 56

Figure 2-5 Genomic region showing an 82 Kb deletion (blue line) at Xp21.3 in intron 5 of
IL1RAPL1 gene. ............................................................................................................................ 57

Figure 2-6 Genomic region showing a 485 Kb duplication (red line) at Xq22.3 which involves
the IL1RAPL2 gene. ...................................................................................................................... 58

Figure 2-7 Genomic region showing a 172 Kb duplication (red line) at Xq23 which involves the
IL13RA2 and LRCH2 genes. ......................................................................................................... 58

Figure 2-8 Genomic region showing a 121 Kb duplication (red line) at Xp11.4 which involves
the TSPAN7 gene. ......................................................................................................................... 59

Figure 2-9 Genomic region showing a 505 Kb duplication (red line) at IDS locus (Xq28) ......... 60

Figure 2-10 Genomic region showing a 5.8 Mb deletion (blue line) at X22.33-p22.31 which
involves the NLGN4 gene. ............................................................................................................ 60

Figure 2-11 Genomic region showing a 4.6 Mb duplication (red line) at Xp11.23-p11.22 which
involves more than 50 RefSeq genes. ........................................................................................... 61

Figure 3-1 Agarose gel shows the amplification of TSPAN7 cDNA (bands) using lymphoblast
RNA of patient with intragenic duplication of TSPAN7. (A) 732 bp PCR product shows the
amplification of TSPAN7 cDNA containing Exons 1-7. (B) 381 bp PCR product shows the
amplification of Exons 1-3 of TSPAN7 cDNA ............................................................................. 73

x
Figure 3-2 PCR amplification using primers in the deleted region. ............................................. 75

Figure 3-3 Chromatogram shows a C to T substitution at cDNA nucleotide position 349.

Pedigree shows the maternal inheritance of the variant to the male proband. .............................. 75

Figure 3-4 Conservation of Alanine residue at position 113 in the IL1RAPL1 protein. .............. 76

Figure 4-1 Genomic organization of the PTCHD1 locus. ............................................................ 97

Figure 4-2 Pedigrees of families showing segregation of PTCHD1 mutations. ........................... 99

Figure 4-3 Expression analysis ................................................................................................... 101

Figure 4-4 Expression and functional studies of PTCHD1 ........................................................ 102

Figure S 4-1 PTCHD1 missense variants. Electropherograms indicate the nucleotide substitutions
within PTCHD1 in six unrelated ASD families and two ID families. ........................................ 133

Figure S 4-2 PTCHD1 domain structure .................................................................................... 134

Figure S 4-3 Quantitative RT-PCR for PTCHD1 in human brain regions. PTCHD1 expression in
24 regions of human adult brain is shown. Relatively higher expression was observed in the
cerebellum. .................................................................................................................................. 136

Figure S 4-4 PTCHD1 functional analysis. 10T1/2 cells were transiently transfected with -
galactosidase to normalize for transfection efficiency, and Gli2, PTCH1, PTCH2 or PTCHD1.
PTCHD1 exerted a statistically significant inhibitory effect on Gli-dependent transcription,
similar to PTCH1 and PTCH2 (** PTCHD1: p = 0.0061; PTCH1: p = 0.0024; PTCH2: p =
0.0010). Statistical significance (p below 0.05) was calculated using the Students t-test.
Standard error bars are shown..................................................................................................... 137

Figure S 4-5 Comparative and phylogenetic analysis of human Patched-related proteins.

Phylogram of Patched-related homologues: (Homo sapiens), created using CLUSTALW 2.0.12
(www.ebi.ac.uk), with N-J treetype. The phylogram is assumed to be an estimate of a

xi
phylogeny, where branch lengths are proportional to the amount of inferred evolutionary change.
..................................................................................................................................................... 138

Figure S 4-6 SNP coverage at the PTCHD1 locus across different genotyping platforms. The
SNP\CNV probes on Affymetrix 500K, Affymetrix 6.0 and Illumina 1M arrays are shown. ... 139

xii
 Abbreviations
ASD Autism Spectrum Disorder

PDD-NOS Pervasive developmental disorder not otherwise specified

BAP Broad autism phenotype

ADOS Autism Diagnostic Observation Schedule

ADI-R Autism Diagnostic Interview-Revised

M-CHAT Checklist for Autism in Toddlers-modified

ID Intellectual Disability

IQ Intelligent quotient

CNS Central Nervous System

ADM Autism Dysmorphology Measure

FXS Fragile X syndrome

RNA Ribonucleic acid

DNA Deoxyribonucleic acid

TSC Tuberous Sclerosis Complex

MIM Mendelian Inheritance in Man

JSRD Joubert Syndrome Related Disorder

PKU Phenylketonuria

MZ Monozygotic

DZ Dizygotic

xiii
LOD logarithm of odds

NPL Non-parametric LOD

AGPC Autism Genome Project Consortium

SNP Nucleotide polymorphism (SNP)

QTL Quantitative trait loci

UTR Untranslated region

AGP Autism Genome Project

aCGH Array-based comparative genomic hybridization

MR Mental Retardation

S-ID Syndromic intellectual disability

NS-ID Non-syndromic intellectual disability

XLID X-linked intellectual disability

XCI X-chromosome inactivation

PCR Polymerase chain reaction

HMM Hidden Markov Model

DGV Database of Genomic Variants

MRI Magnetic resonance imaging

AA Amino acid

BP Base pair

ncRNA Non-coding RNA

xiv
 1

Chapter 1. Background
The review of literature presented in this chapter is partly published in;

1. Book chapter

Common Genetic Etiologies and Biological Pathways Shared Between Autism Spectrum
Disorders and Intellectual Disabilities.

Liana Kaufman, Abdul Noor, Muhammad Ayub and John B. Vincent

Autism Spectrum Disorders: The Role of Genetics in Diagnosis and Treatment,

ISBN 978-953-307-495-5, publishing date: August 2011

2. Review

The genetic basis of non-syndromic intellectual disability: a review.

Kaufman L, Ayub M, Vincent JB.

J Neurodev Disord. 2010 Dec;2(4):182-209. Epub 2010 Jul 29.

1
 2

1.1 Autism

Autism (MIM 209850) is a severe, neurodevelopmental disorder characterized by impairments in

communication, socialization, and repetitive behavior. It was first outlined by Leo Kanner in
1943 as a disorder of innate inability of formation of the usual, biologically provided, affective
contact with people. The Autism Spectrum Disorder (ASD) includes autistic disorder, Asperger
syndrome, pervasive developmental disorder not otherwise specified (PDD-NOS) and Rett
syndrome (DSM-IV, 1994; ICD-10, 1992). These disorders differ from each other with regard to
severity of symptoms and early development of language, cognitive and social behavior.
Individuals with autism show deficits in all three domains and an abnormal development before
age 3 years. Individuals with Broad autism phenotype (BAP) have some symptoms of autism,
but do not meet the full criteria for autism or ASD (Hurley, Losh, Parlier, Reznick, & Piven,
2007). Asperger syndrome is characterized by qualitative impairment in social interaction and
restricted repetitive and stereotyped patterns of behavior, interests and activities, however, the
language and cognitive development is relatively unaffected (McConachie & Diggle, 2007).
Individuals with PDD-NOS meet autism criteria and these individuals may also show severe and
pervasive impairment in one or two of the three core areas with or without cognitive or language
delay. Rett syndrome almost exclusively occurs in females and it is characterized by
developmental arrest between 6 and 18 months of age, followed by loss of speech, stereotypical
movements, microcephaly, seizures, and intellectual disability (Hagberg, Aicardi, Dias, &
Ramos, 1983).

The symptoms of autism spectrum disorders (ASDs) are usually present by age of three years
and may persist throughout the life. According to DSM-IV, a child meets the diagnostic criteria
for autism if at least six of the 12 behaviors, at least two from (1), and one each from (2) and (3)
described in the three domains are being documented;

2
 3

1. Qualitative impairment in social interaction, as manifested by at least two of the

following:
a. marked impairment in the use of multiple nonverbal behaviors such as eye-to-eye gaze, facial
expression, body postures, and gestures to regulate social interaction.
b. failure to develop peer relationships appropriate to developmental level.
c. a lack of spontaneous seeking to share enjoyment, interests or achievements with other people
(e.g., by a lack of showing, bringing or pointing out objects of interest.
d. lack of social or emotional reciprocity.
2. Qualitative impairments in communication as manifested by at least one of the following:
a. delay in, or total lack of, the development of spoken language (not accompanied by an attempt
to compensate through alternative modes of communication such as gesture or mime).
b. in individuals with adequate speech, marked impairment in the ability to initiate or sustain a
conversation with others.
c. stereotyped and repetitive use of language or idiosyncratic language.
d. lack of varied, spontaneous, make-believe play or social imitative play appropriate to
developmental level.
3. Restricted, repetitive and stereotyped patterns of behavior, interests and activities, as
manifested by at least one of the following:
a. encompassing preoccupation with one or more stereotyped and restricted patterns of interest
that is abnormal either in intensity or focus.
b. apparently inflexible adherence to specific nonfunctional routines or rituals.
c. stereotyped and repetitive motor mannerisms (e.g., hand or finger flapping or twisting, or
complex whole-body movements).
d. persistent preoccupation with parts of objects.

The Autism Diagnostic Observation Schedule (ADOS) and Autism Diagnostic Interview-
Revised (ADI-R) are two widely accepted instruments used for diagnosis of ASD in both clinical
and research settings. ADI-R, a revised version of Autism Diagnostic Interview (ADI), is a semi-
structured, investigator-based interview for the caregivers of children with autism and adults for
whom autism or ASD is a possible diagnosis (Lord, Rutter, & Le, 1994). The ADOS is a semi-

3
 4

structured, standardized assessment of social interactions, communication, play, and imaginative

use of objects for children suspected of having ASD (Lord et al., 2000). It is an observational
assessment of the childs behavior, often performed by a psychologist or another trained
professional. There are some disadvantages of ADI-R and ADOS, for instance, these are lengthy,
require elaborate training and are suitable for use in more specialized settings. However, in
recent years, ADI-R and ADOS have been adapted to make them more appropriate for use in
clinical settings, as well as for diagnosis of toddlers and patients with intellectual disabilities. In
particular, the shorter version of ADOS is becoming increasingly popular in clinics.

Checklist tools such as The Checklist for Autism in Toddlers-modified (M-CHAT) are also
widely used in clinical practice because of their ease and efficiency. M-CHAT includes a
checklist of 23 items to be filled out by parents and it can be administered at a much earlier stage
to identify toddlers who are at the risk of autism. A recent study has confirmed the validity of
this instrument in detecting possible ASD at 16-30 months of age (Kleinman et al., 2008).
However, the high sensitivity of this checklist means that some children without autism will fail
the screening. It has been suggested that children who fail and do not have autism are at
increased risk for other developmental disorders or delays and should be monitored accordingly
(Kleinman et al., 2008).

In published literature, a wide range in the incidence of autism has been reported, with a
worldwide trend consistently showing a steady increase in prevalence. During 1980s, ASDs were
thought to be rare, with a prevalence of less than 5 per 10,000 persons (Gillberg, Steffenburg, &
Schaumann, 1991) and were not categorized as major public health problem. During 1990s, the
prevalence of autism was estimated to be 21 to 31 per 10,000 in preschool children (Fombonne,
1999). Afterward, an epidemiologic study conducted in United Kingdom report a prevalence rate
of 16.8 per 10,000 for autism and 63 per 10,000 for all ASDs in children under the age of five
years (Chakrabarti & Fombonne, 2001). A recent study in United States reported the incidence of
ASD in ~1 % of children age three to seventeen years, furthermore, it was estimated that 643,000
children in United States have ASD (Kogan et al., 2009). It is noteworthy that this study was
based on parents reporting of ASD, and it could be argued that these estimates might be falsely
high. However, at least two other recently published studies also report the prevalence of ASD to

4
 5

be more than 1 % (Baird et al., 2006; Baron-Cohen et al., 2009). On the other hand, it has been
argued that the increasing incidence of autism might be due to increased awareness of public and
professionals coupled with the broadening of the diagnostic criteria (Fombonne, Zakarian,
Bennett, Meng, & McLean-Heywood, 2006). Today, the prevalence of ASDs is believed to be
very high and this condition is now thought to be second only to Intellectual Disability (ID)
among the most common developmental disabilities in the United States (Yeargin-Allsopp et al.,
2003).

1.1.1 Endophenotypes

ASDs are clinically and etiologically complex neurodevelopmental disorders. It is has been
emphasized that delineation of the clinical heterogeneity of ASD may help in identification of
etiological factors and predict the outcome and treatment choices. ASD can be sub-grouped on
the basis of presence or absence of certain clinical features, also termed as endophenotypes,
such as intelligent quotient (IQ), seizures, brain malformations, dysmorphology and head
circumference (Viding & Blakemore, 2007). Historically, based on non-verbal IQ testing, up to
70% of autistic children have reported to have some form of ID (Fombonne, 2003) and DSM-IV
estimates that ~75% of children with autism have some degree of intellectual disability, usually
within the moderate range (IQ 35-50). However, this is likely an over-estimate and more recent
estimates propose a more modest level of ~60% (Chakrabarti & Fombonne, 2005).(Chakrabarti
& Fombonne, 2001; Bertrand et al., 2001; Baird et al., 2001) Furthermore, in a study performed
on an ID population, 28% met the criteria for an autism diagnosis on the ADI-R scale and only
half of these had been previously diagnosed (Bryson, Bradley, Thompson, & Wainwright, 2008).
These findings have been replicated repeatedly in the past, showing that within ID populations,
the prevalence of autism is 8-20%, with more individuals with severe ID meeting criteria for
ASD (Bryson et al., 2008; de et al., 2005; Stromme & Diseth, 2000; Nordin & Gillberg, 1996).
ID and autism have several overlapping phenotypic domains. The three major phenotypes that
are present in autism; language abnormalities, social deficits and stereotypies can all be present
to varying degrees in some ID individuals. Individuals with ID often display stereotypies, which
have a tendency to become more obvious, and often self-injurious, as IQ decreases. Studies have
shown that 30-60% of individuals with ID exhibit some form of stereotypy (Bodfish, Powell,

5
 6

Golden, & Lewis, 1995; Bodfish, Symons, Parker, & Lewis, 2000; Goldman et al., 2009) and
language abnormalities are often particularly severe in individuals with severe-profound ID.
Previously published longitudinal studies report that IQ scores can strongly predict the long-term
outcomes and are directly associated with the psychopathology of autism, even in young children
(Howlin, Goode, Hutton, & Rutter, 2004). Also, preschool cognitive functioning has been found
to be a strong predictor of School-age functioning and high IQ has been shown to be necessary
but not sufficient for optimal outcome in the presence of severe language impairment (Stevens et
al., 2000).

Another, Central Nervous System (CNS) dysfunction associated with autism is the high risk of
epilepsy (Spence & Schneider, 2009). The prevalence of seizures in autism is estimated to be up
to 46% (Hughes & Melyn, 2005) and it has been estimated that as many as 32% of epilepsy
patients may meet the diagnostic criteria for ASD (Clarke et al., 2005). Notably, the prevalence
of seizures is higher among individuals with moderate to severe ID and those with motor
abnormalities (Tuchman & Rapin, 2002). Furthermore, the individuals with autism plus epilepsy
have, on average, lower IQs, and presence of epilepsy is a negative factors on cognitive,
adaptive and behavioral/emotional outcomes for autistic individuals (Hara, 2007).
Structural brain malformations, including accentuated VirchowRobin space, acrocallosal
syndrome and polymicrogyria have been reported be associated with autism (Steiner, Guerreiro,
& Marques-de-Faria, 2004; Schifter et al., 1994; Zeegers et al., 2006), however, until recently,
MRI has been judged to be of insufficient value and it is not included in the standard clinical
evaluation of autism. A recent study has revealed an unexpectedly high prevalence of brain
abnormalities (48%) in autism patients, among these, the white-matter signal abnormalities,
severely dilated Vicrchow-Robin spaces and temporal lobe structural abnormalities were the
most common (Boddaert et al., 2009).

Generalized dysmorphology, an insult to early development has been reported in 15 to 20 % of

individuals with autism (Miles & Hillman, 2000) and it has been suggested to be a predictor of a
poor response to early intensive behavioral therapy. According to the Autism Dysmorphology
Measure (ADM) guidelines, the 12 body areas assessed for dysmorphology are: height, hair
growth pattern, structure and size of ear, nose size and shape, face size and structure, philtrum,

6
 7

mouth and lips, teeth, hand size, fingers and thumbs, nails and feet. Besides generalized
dysmorphology, the head size abnormalities (microcephaly and macrocephaly) have also been
found in autistic individuals. Microcephaly, head circumference <2nd centile, occurs in 5 to 15%
of children with autism and is a predictor of poor outcome (Miles, Hadden, Takahashi, &
Hillman, 2000; Miles et al., 2005). On the other hand, macrocephaly, head circumference >97th
centile has been observed in ~30% of children with autism (Miles et al., 2000). Generalized
dysmorphology and head circumference are proposed as good predictors of the clinical outcome
and may be used to classify the autism phenotype into subgroups, namely the complex autism
and essential autism. Complex autism consists of autistic individuals with the evidence of some
abnormality of early morphogenesis, manifested by either significant dysmorphology or
abnormal head size. The remainders, without dysmorphic features or head size abnormalities are
classified as essential autism (Miles et al., 2005), it is estimated that 70 to 80% of children with
autism have essential autism. Another study compared the facial morphology of 72 boys with
ASD and their 128 first-degree relatives to that of 254 unrelated controls and found that
asymmetry of the supraorbital and periorbital regions anterior to the frontal cerebral pole has
been shown to be associated with autism in male patients (Hammond et al., 2008).

1.1.2 Autism in other single gene disorders

In many single gene disorders, clinical features of autism are also observed. For example, more
than 30% of children with fragile X syndrome (FXS) have some autistic features (Macedoni-
Luksic et al., 2009) and 1 to 3% of children ascertained on the basis of diagnosis of autism have
FXS (Harris et al., 2008). FXS (MIM #300624) is the most common cause of hereditary ID and
it results from an expansion of CGG trinucleotide repeats in the FMR1 (Fragile X Intellectual
disability-1) gene at Xq27-3. The degree of ID is usually mild to severe in males with FXS while
females usually demonstrate a mild degree of learning disability, although this can be more
severe in a small percentage (~25%) of females (Cornish, Turk, & Hagerman, 2008). Molecular
studies indicate that the disruption of FMR1 gene may cause autism phenotype by RNA toxicity
to neurons and by silencing of genes involved in neuronal connectivity (Hagerman, 2006).
Tuberous Sclerosis Complex (TSC) is another genetic disorder which has an overlaps with
autism. It is an autosomal dominant disorder which involves multiple systems and it is

7
 8

characterized by hamartomas in the brain, skin, heart, kidneys, lung and other organs. CNS
symptoms may include epilepsy, learning difficulties, behavioral issues, and autism. Mutations
in TSC1 and TSC2 cause this disease. Interestingly, individuals with TSC along with ID are
more likely to have autism. By ADOS evaluation of TSC children, a recent study shows that
66% of infants meet criteria for autism or ASD at the age of 18 months, 54% at the age of 24
months, 46% at the age of 36 months and 50% at the age of 60 months (Jeste, Sahin, Bolton,
Ploubidis, & Humphrey, 2008).

Autistic patients have a significantly higher (100- to 190-fold) risk of Neurofibromatosis type I
(NF1) compared to the general population which suggests that the two diseases may share some
common etiological factors (Marui et al., 2004). NF1 (MIM #162200) is caused by mutation in
the neurofibromin gene (NF1) on chromosome 17q11.2. Clinical features of NF1 include the
cafe-au-lait spots, Lisch nodules in the eye, and skin fibromatous, also, the individuals with NF1
have higher susceptibility to the development of benign and malignant tumors. It is unclear
whether these relatively common childhood disorders have a true association or they co-occur by
chance (Plank et al., 2001).

Sotos syndrome is characterized by congenital macrocephaly, a prominent forehead with an

apparently receding hairline, overgrowth and mild to severe learning disability. Autosomal
dominant mutations in the NSD1 gene on chromosome 5 are responsible for 80 to 90% of cases
of Sotos syndrome (Buxbaum et al., 2007). The prevalence of disorder is estimated to be
between 1/10,000 and 1/50,000 and its prevalence in autism was recently reported to be 0.5%
(Zafeiriou, Ververi, & Vargiami, 2007). Although cases of autism and Sotos syndrome
comorbidity have been reported, the genetic bases of this overlap are not clear.

Joubert Syndrome (JS) is an autosomal recessive disorder characterized by partial or complete

agenesis of the cerebellar vermis which appears as the molar tooth sign on MRI, breathing
difficulties, abnormal eye movement, ID, and behavioral problems. Mutations in nine genes
(NPHP1, AHI1, CEP290, RPGRIP1L, TMEM67, ARL13B, CC2D2A, INPP5E and TMEM216)
have been associated with JS. In our own study, we have identified a splice mutation in CC2D2A
gene in a family with Joubert Syndrome Related Disorder (JSRD) (Noor et al., 2008).
Subsequently, several mutations in this gene have been reported in JS, COACH syndrome and

8
 9

Meckel syndrome (Tallila, Jakkula, Peltonen, Salonen, & Kestila, 2008; Doherty et al., 2010). In
a previous study, 11 children with JS were assessed for diagnosis of autism and three out of 11
children with JS met diagnostic criteria for autism and one out of 11 for PDD-NOS (Ozonoff,
Williams, Gale, & Miller, 1999). In another study, three sisters affected with JS were reported.
Among these two sisters were monozygotic twins and the twin with the more severe cerebellar
abnormality had autism (Raynes, Shanske, Goldberg, Burde, & Rapin, 1999). Both these studies
were done on a very small population, therefore, the overlap between JS and autism remains
inconclusive.

Autistic features have also been reported in several metabolic disorders including
phenylketonuria (PKU), adenylosuccinate lyase deficiency and creatine deficiency syndromes.
Co-morbidity of autism and untreated PKU has been described; however, due to severe ID in
these children, it is difficult to assess these patients for autistic features. A systematic study
investigated 243 PKU patients and showed that none of 62 early diagnosed and treated PKU
patients met diagnostic criteria for autism, whereas two of 35 (5.7%) late diagnosed patients
fulfilled the diagnostic criteria for ASD. These finding indicated that the classical PKU is one of
the causes of autism with very low prevalence (Baieli, Pavone, Meli, Fiumara, & Coleman,
2003). Adenylosuccinate lyase deficiency is a rare autosomal disorder of purine synthesis which
results in the increase of succinylpurines in body fluids. The clinical picture is heterogeneous;
clinical manifestations include developmental delay, seizures, and autistic symptoms including
failure to make eye contact, repetitive behavior, agitation, temper tantrums, and aggression.
Approximately 50% of patients with adenylosuccinate lyase deficiency show an autistic-like
phenotype (Stone et al., 1992).

As reviewed above, there are several genetic disorders which have co-morbidity with ASD.
These clinical findings suggest that some disorders may have the potential to cause the autism
phenotype by affecting the so far unknown autism regions or circuits of the brain.

1.1.3 Causes of Autism

1.1.3.1 Genetic
Epidemiological evidence suggests that genetic factors contribute significantly to the etiology of
autism. The evidence of involvement of genetic factors in etiology of autism comes primarily

9
 10

from the family and twin studies and this is further supported by the cytogenetic and molecular
studies. A study in 1985, assessed the biological siblings of 29 autistic probands with severe ID
and found a significant clustering of autism and nonspecific ID in the siblings of autistic
individuals with severe ID (Baird & August, 1985). Another study evaluated the developmental,
social, and psychiatric histories of the 67 adult siblings of 37 autistic probands and found that
two out of 67 siblings (3.0%) were autistic, three out of 67 siblings (4.4%) had severe social
problems, 10 out of 67 (15%) had cognitive disorders, and 10 out 67 (15%) had affective
disorder (Piven et al., 1990). This report was the first to investigate the frequency of
neuropsychiatric disorder in the adult siblings of autistic patients, and it demonstrated the
enrichment of a variety of neuropsychiatric conditions among the siblings of autistic individuals.
Bolton et al reviewed the family histories of 99 autistic patients and 36 probands with Down's
syndrome and confirmed an increased familial aggregation of both autism and broader ASD in
the siblings, and a similar trend was not observed among Down's syndrome families who were
studied as a comparison group (Bolton et al., 1994). A recent study examined the cognitive,
adaptive, social, imitation, play, and language abilities of 42 non-autistic siblings and 20 toddlers
with no family history of autism. The siblings were below average in expressive language
abilities and IQ; also, they had lower mean receptive language, adaptive behavior, and social
communication skills. They used fewer words, distal gestures, and social smiles than children
with no history of autism (Toth, Dawson, Meltzoff, Greenson, & Fein, 2007).

Collectively, the family studies show ~3% occurrence of autism among siblings of autistic
probands. However, a recent study has estimated a significantly higher recurrence rate of 18.7%
(Ozonoff et al., 2011). The occurrence rate supports familiality because the frequency is more
than 100 times the occurrence in the general population, and this estimated relative risk is higher
than for any other major psychiatric disease. On the other hand, the familiality of autism does not
mean that genetic factors are exclusively responsible for the disease, and the role of the
environmental factors which are also shared by family members who live together cannot be
excluded as having a role in this observed familiality.

The twin studies provide an alternate approach to investigate the relative magnitude of genetic
and/or environmental factors on the autism phenotype and penetrance. The higher the
monozygotic (MZ) concordance rate, the more important the genetic contribution while

10
 11

phenotypic differences between dizygotic (DZ) twins are due to non-genetic factors, including
environmental factors. Several twin studies provide major evidence of genetic etiology of autism.

In 1977, a landmark study by Folstein and Rutter showed a significant difference between
monozygotic (N = 11) and dizygotic (N = 10) twins in their concordance for autism. Based on
presence of presence of autism and ID, they observed a concordance rate of 82 % and 10 % for
MZ twins and DZ twins, respectively (Folstein & Rutter, 1977). The concordance difference
between MZ and DZ suggested a major role for genes in the etiology of autism and it was
confirmed by subsequent studies (Ritvo et al., 1985; Steffenburg et al., 1989). Ritvo et al studied
40 pairs of affected twins and show a concordance rate of 95.7% in the monozygotic twins (22 of
23) and 23.5% in the dizygotic twins (Ritvo, Freeman, Mason-Brothers, Mo, & Ritvo, 1985).
Another study of 21 twins under the age of 25 years and matched for gender reported a
concordance rate of 91% in the monozygotic and 0% in the dizygotic twin pairs (Steffenburg et
al., 1989).

Recently, a large scale study of 277 twin pairs (210 DZ) and 67 MZ) reported 88% concordance
MZ twins and 31% concordance for DZ twins. In MZ twins, the authors also observed a higher
prevalence of bipolar disorder and Asperger syndrome with a higher concordance of the latter
(Rosenberg et al., 2009).

In conclusion, for autism, the twin studies show a higher concordance rate (60-90%) in MZ
compared to concordance rate 0-30% in DZ and the heritability is estimated to be ~90%. These
findings provide strong but indirect evidence of the role of genetic factors in the etiology of
autism. Also, the twin and family studies have significantly contributed to our understanding of
the causes of autism and triggered the search for causative genetic factors. Nevertheless, a
recently published study have shown that the environmental factors may account for 55% of the
liability to autism, which suggest a much lower contribution of genetics factors compared to
previously published twin studies (Hallmayer et al., 2011).

1.1.3.2 Epigenetic
It is widely accepted that genetic factors play a major role in etiology of ASD; however, the
involvement of epigenetic factors cannot be excluded. Epigenetic modifications include cytosine

11
 12

methylation and post-translational modification of histones may act as a mechanism for control
of gene expression (Samaco, Hogart, & LaSalle, 2005). The epigenetic modulation of gene
expression can be influenced by exposure to the environmental factors and it can show the parent
of origin effects. Notably, epigenetic factors play a central role in pathogenesis of two single
gene disorders, Rett syndrome and fragile X syndrome (FXS) that are commonly associated with
autism (Gillberg, 1986; Brown et al., 1982). Rett syndrome, a progressive neurodevelopmental
disorder is classified among ASDs and it is caused by mutation in the MeCP2 gene that encodes
the methyl-CpG-binding protein 2 which is involved in epigenetic regulation of gene expression
(Amir et al., 1999). FXS is caused by expansion of a CGG repeats in the 5 untranslated region
of the FMR1 gene. This expansion results in epigenetic silencing of the region, causing the loss
of expression of the gene, thus, FXS is caused by a genetic mutation resulting in epigenetic
dysregulation (Hagerman, Ono, & Hagerman, 2005). RELN gene is another interesting example
of possible contributions of epigenetic factors in ASD. RELN gene encodes a large extracellular
matrix protein that organizes neuronal positioning during corticogenesis, one of the most notable
effects of disruption of RELN is the abnormal formation of the cerebral cortex and inversion of
cells in the horizontal laminations in mice (Caviness, Jr., 1976). Several independent studies
have shown an association between RELN and ASD (Skaar et al., 2005; Ashley-Koch et al.,
2007; Holt et al., 2010). Interestingly, reduced levels of reelin and its isoforms have been
previously shown in autistic twins and their first degree relatives (Fatemi et al., 2005). RELN is
not an imprinted gene, however, studies have shown a potential regulation of RELN expression
by DNA methyltransferase 1 in mouse primary cortical cultures (Noh et al., 2005). In conclusion,
the RELN gene has been shown to be associated with ASD, and its expression is possibly
regulated by epigenetic mechanisms which further highlight the importance of epigenetic factors
in pathophysiology of ASD. Genomic imprinting is another mode of regulation of gene
expression by epigenetic modifications and it results in the parent of origin-specific gene
expression. Interestingly, genomic duplications of an imprinted region on the proximal long arm
of chromosome 15 (15q11-q13) are associated 0.5-3.0% of autism (Hogart, Wu, LaSalle, &
Schanen, 2010). Therefore, genomic importing may also play a role in etiology of autism.

12
 13

1.1.3.3 Other Factors

Support for the possibility of environmental contribution to causation of autism comes from the
incomplete concordance in monozygotic twins, which cannot be accounted for by standard
genetic mechanisms. Furthermore, there is evidence that in-utero exposure to valproic acid or
thalidomide may increase the risk of ASD (Arndt, Stodgell, & Rodier, 2005). Recently, a long-
term study of 632 children exposed to antiepileptic drugs during gestation found that 6.3% of the
children in-utero exposed to valproic acid had ASD or some features of ASD. This incidence is
seven times higher than the control group (0.9%) (Bromley, Mawer, Clayton-Smith, & Baker,
2008). Similarly, a higher incidence of autism has been reported among children prenatally
exposed to thalidomide. In a population of 100 Swedish thalidomide embryopathy cases, at least
four met full diagnostic criteria for autism (Stromland, Nordin, Miller, Akerstrom, & Gillberg,
1994; Rodier, 2002). Animal models have also demonstrated that in-utero exposure to
thalidomide or valproic acid can carry an increased risk for the development of ASD. It has been
shown that early serotonergic neural development is disrupted in rats exposed to thalidomide or
valproic acid on the ninth day of gestation (Narita et al., 2010).

Mercury (Hg), because of its known neurotoxicity has drawn particular attention in relation to
deficits in neurodevelopment of autism patients and a number of studies have compared the level
of Hg in blood, hair, or urine in children with autism versus without autism. However, none of
these studies has shown any substantial evidence of involvement of Hg in autism. Recently, a
study conducted on 452 autism patients failed to demonstrate any difference in blood Hg level of
autism patients compared to controls (Hertz-Picciotto et al., 2010).

Childhood immunization is an environmental factor that has been popularized in the media as a
potential cause of autism. The use of mercury in vaccines has been one of the prime sources of
concern surrounding vaccines and their role in autism (Baker, 2008). However, there is no
consistent evidence in support of the theory that vaccines are related to the etiology of autism. In
the late 1990s, a link between vaccines and autism was reported by clinical observation of onset
of autism soon after vaccination of children (Wakefield & Montgomery, 1999). These
observations triggered a series of studies in the US, UK, Europe and Japan, however, none of
these studies found any compelling evidence for a link between vaccines and autism.

13
 14

Although the majority of research to date has focused on genetic factors involved in the etiology
of autism, non-genetic factors are also likely to contribute. Our knowledge of these factors is
currently very limited. It has been suggested that distinct genetic features/pathways may cause
distinct domains of autistic behavior, but this has yet to be tested at the molecular level (Happe &
Ronald, 2008). It does, however, resonate with the idea that autism is a genetically
heterogeneous spectrum, and that multiple genetic aberrations may be necessary to reach the
autism phenotype threshold (Cook, Jr. & Scherer, 2008). The threshold theory postulates that the
cumulative effect of several genetic aberrations, for instance a copy number variant together with
one or more single nucleotide variants, and possibly in combination with environmental factors,
in a single individual, may result in an autism phenotype. These genetic aberrations may include
chromosomal, single nucleotide or epigenetic abnormalities. It has also been noted that some
genetic aberrations are more penetrant than others and may be more likely to result in a
phenotype. In contrast with ID genetics, which are relatively straightforward, autism presents us
with a convoluted, likely multigenic/multifactorial disorder for which it may be more difficult to
delineate causes.

1.1.4 Identification of Causative Genetic Factors

1.1.4.1 Linkage and Association Studies

Analysis of pedigrees with multiple incidences of autism would suggest that the mode of
inheritance is neither clearly dominant nor recessive or X-linked, and is frequently described as
non-Mendelian or complex. A high degree of genetic heterogeneity is anticipated. Genetic
linkage analysis may be used to identify the regions of the genome that are shared between
affected members in a family, and may be performed by using gene or locus specific markers or
a set of markers covering the entire genome. The two commonly used models for linkage
analysis are parametric and non-parametric. The results of Linkage analysis are reported as a
logarithm of odds (LOD) score. For complex genetic disorders such as autism, in general, a LOD
score greater than 3.6 is considered to be significant at the genome-wide level, while a score
greater than 2.2 is considered as suggestive of linkage (Lander & Kruglyak, 1995). Because of
the complex mode of inheritance in ASD, non-parametric linkage may be considered a more
appropriate model for analysis. Relatively few parametric linkage studies have been reported.
For example, Laumonnier et al used parametric linkage to study a large pedigree with 13 males

14
 15

with autism and a statistically significant linkage was achieved at Xp22.33. By sequencing the
NLGN4 gene in this region a 2 base pair (bp) deletion was indentified in all affected patients
(Laumonnier et al., 2004). Parametric linkage analysis has also successfully led to the
identification of additional ASD loci, including the MECP2 gene, which is implicated in Rett
syndrome (Amir et al., 1999), also the CNTNAP2 gene, which is involved in epilepsy,
intellectual disability, and autism (Strauss et al., 2006).

A number of studies have used nonparametric or model-free linkage analysis to search for
ASD genes. These studies have reported suggestive to significant evidence of linkage on almost
every chromosome, however, only a few of these loci have been replicated (Abrahams &
Geschwind, 2008). Among these replicated loci, 2q24-2q31, 7q, and 17q11-17q21 have been
shown by at least two studies to have genomewide significant LOD scores (Abrahams &
Geschwind, 2008). In a study from the Vincent and Gurling labs using markers on the X-
chromosome, a maximum parametric LOD score of 1.7 was reported for the narrowest
diagnostic category of the typical autism/severe autism spectrum, and nonparametric analysis
produced a maximum non-parametric LOD (NPL) score of 2.1 for markers on Xq27-q28,
encompassing the FMR1 (FXS) and MECP2 (Rett) genes, thus provided evidence of modest
linkage to this region (Vincent et al., 2005). By using 10,000 single nucleotide polymorphism
(SNP) markers, members of the Autism Genome Project Consortium (AGPC) performed a
genome scan of about 1160 multiplex families with autism and reported suggestive evidence of
linkage at 11p12-p13 (Szatmari et al., 2007). Recently, a linkage and association study was
performed by using ~500,000 SNP markers in set of 1,031 multiplex families with autism, and
suggestive linkage at 6q27 and a significant linkage at 20p13 was reported (Weiss, Arking, Daly,
& Chakravarti, 2009). The linkage analysis studies have demonstrated that many loci may
underlie the risk of autism; these findings are consistent with the well-accepted supposition that
many genes may be associated with autism. This genetic heterogeneity may result in weak
linkage signals and along with variation in clinical ascertainment and other diagnostic issues,
may contribute to failure of replication of linkage signals. Several studies have attempted to
overcome this issue by increasing the sample homogeneity, or by focusing on selected sub-
phenotypes of autism (endophenotypes) such as large head circumference, language,
developmental milestones and stereotyped patterns of behavior and interests. This approach

15
 16

facilitates the identification of quantitative trait loci (QTL) for a trait that contributes to the
overall phenotype. For example, in the study by Alarcon et al, a QTL for language delay was
mapped at 7q34-7q36 (Alarcon, Cantor, Liu, Gilliam, & Geschwind, 2002).
Linkage analysis is a powerful method for identifying high-risk disease alleles, however, in the
case of complex genetic diseases such as ASD in which it is anticipated that contributions of
several loci result in the expression of phenotype, association studies may be more suitable to
search for disease genes\loci. Family-based association studies compare the frequency of
transmitted versus non-transmitted parental alleles of polymorphic markers in the affected
individuals, whereas case-control association studies compare the frequencies of alleles in
affected individuals with unaffected controls in order to detect alleles that differ significantly in
frequency between the two groups (Carlson, Eberle, Kruglyak, & Nickerson, 2004). One
advantage of the family-based association studies over the case-control association studies is that
the former avoids the possible effects of population stratification, thus the possibility of false
positive results are reduced. Frequently, association studies are performed using genetic markers
selected from small chromosomal regions or from single genes. In most such studies, the
selection of candidate region/gene for autism is based on its location within a significant autism
linkage region, a known cytogenetic abnormality, or is based on its role in a biological pathway
hypothesized to be involved in ASDs or its known function in brain and Central Nervous System
(CNS) development (Alarcon et al., 2002).

In previously published association studies, over 100 ASD candidate genes\regions have been
tested. Notably, most of these studies were inconclusive and failed to find significant and
replicable genetic association with ASD. On the other hand, this approach has also resulted in the
identification of some interesting candidate genes that may be involved in a sub-set of ASD
patients. Among these, SLC25A12, RELN and CNTNAP2 are of interest.

At least two studies have mapped an ASD susceptibility locus at chromosome 2q (AUTS5). The
first study analyzed 95 affected-relative-pair families and found a maximum multipoint
heterogeneity LOD score of 1.96 and a maximum multipoint nonparametric linkage (NPL) score
of 2.39 (Buxbaum et al., 2001). The second study was performed by the genome-wide linkage
analysis of 152 autistic sib pairs and showed further support for this locus at 2q (IMGSAC,

16
 17

2001). One of the interesting candidate genes in this region is SLC25A12, which encodes a
calcium-binding mitochondrial carrier protein. The protein localizes to the mitochondria and is
potentially involved in the exchange of aspartate for glutamate across the inner mitochondrial
membrane (Palmieri et al., 1997). By genotyping two SNPs (rs2056202, rs2292813) within
SLC25A12 gene in 411 autistic families, an association between autistic disorder and these two
SNPs was reported (Ramoz et al., 2004). This association was investigated by another
independent study - 158 Irish affected child-parent trios were genotyped for the rs2056202 and
rs2292813 SNPs. The Transmission Disequilibrium Test was applied to examine these markers
for association with autism. Interestingly, in agreement with the previous study, the authors
found significant association and provided the replication of the association between autism and
SLC25A12 (Segurado et al., 2005). These studies strongly associated this region with ASD,
following which several other groups started further exploration of this region. Contrarily, at
least three independent studies failed to find any association for this gene. Blasi et al used a
collection of families from the International Molecular Genetic Study of Autism Consortium
(IMGSAC) and failed to find any significant association for the SNPs tested at SLC25A12 locus,
suggesting that the variants at this locus are unlikely to play a major role in genetic susceptibility
to autism in their samples (Blasi et al., 2006a). In another study, Rabionet et al attempted to test
for association in SLC25A12 in an independent data set of 327 families with autistic offspring
(Rabionet et al., 2006). Again, this study was also unable to find an association between
SLC25A12 and autism, which suggests that SLC25A12 is not a major contributor to autism risk in
these families. A recent study of Han Chinese samples from Taiwan using a population-based
case-control approach was also unable to find any evidence of association of the SLC25A12 gene
with autism (Chien et al., 2010). The discrepant results of these studies may be due to the clinical
heterogeneity of cases analyzed in these studies and the genetic heterogeneity of autism.
Several independent studies have mapped an autism susceptibility locus at chromosome 7q
(Philippe et al., 1999; Barrett et al., 1999; IMGSAC, 2001). The Reelin gene, RELN, maps to 7q
and plays an important role in the migration of several neuronal cell types and in the
development of neural connections (Del Rio et al., 1997; Ogawa et al., 1995). The physical
position and function of this gene make it a good candidate and several studies have attempted to
explore possible contribution of this gene in autism phenotype. Persico et al tested the
association and linkage to this gene in 95 Italian patients in comparison with 186 ethnically-

17
 18

matched controls, and using the transmission/disequilibrium test and haplotype-based haplotype
relative risk was assessed in 172 complete trios from 165 families collected in Italy and in the
USA. Both case-control and family-based analyses found a significant association between
autistic disorder and a polymorphic GGC repeat located immediately 5' of the RELN gene
(Persico et al., 2001). A study by Skaar et al replicated the findings of association of 5'-UTR
repeat of RELN with autism (Skaar et al., 2005). These two studies show the potential of RELN
as an important contributor to genetic risk in autism. The RELN gene includes a polymorphic
GGC repeat region in the 5UTR. In a more recent study, authors transfected mammalian cells
with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of a
luciferase reporter gene and demonstrated decreasing luciferase activity with increasing GGC
repeat number, which further highlights the potential importance of the RELN GGC repeats in
autism (Persico, Levitt, & Pimenta, 2006). An interesting study by Fatemi et al tested the
expression levels of Reelin protein and mRNA, as well as mRNA levels for the Reelin receptor
gene, VLDLR, and downstream markers of the Reelin pathway, Dab-1 and GSK3, in brain
regions from autistic versus control individuals. Interestingly, reduced levels of the Reelin
protein and mRNA and Dab 1 mRNA were observed, these findings emphasize the impairments
in the Reelin signaling system in autism and may account for some of the brain structural and
cognitive deficits observed in this disorder (Fatemi et al., 2005). Contrary to these findings,
several other reports have not found any association between autism and RELN trinucleotide
repeats (Li et al., 2004; Bonora et al., 2003; Krebs et al., 2002).

In a recent genome-wide association study from our AGP collaborative group, by testing ~1
million SNP markers for association with ASD, a strong association of rs4141463 in MACROD2
with autism was identified (P < 5 x 108). Strong association signals were also observed for
several other genes such as KIAA0564, PLD5, POU6F2, ST8SIA2 and TAF1C (Anney et al.,
2010).

1.1.4.2 Cytogenetic Analysis

The identification of the candidate genes for autism by linkage and association studies has
proven to be a complex endeavor, and the analysis of cytogenetic abnormalities associated with
autism has been proven to be a relatively successful alternative. It is estimated that

18
 19

cytogenetically identified abrasions are present in 6-7% of ASD cases and this proportion is even
higher in patients with intellectual disability and dysmorphic features (Marshall et al., 2008).
These chromosomal abnormalities are widely distributed across the genome and none of these
aberrations account for major fraction of individuals with ASDs, with the exception of a
duplication on 15q11-q13, which is the most frequently (0.5 to 3.0 %) and consistently found
chromosomal abnormality in ASD patients (Hogart et al., 2010). This region is of particular
interest because of its relationship with other neurodevelopmental and behavioral syndromes.
Deletion of the maternal copy of this interval, as well as mutations in the UBE3A gene within
this interval, lead to Angelman syndrome (MIM# 105830), a disorder that has some overlap with
severe autism phenotypes. Conversely, deletion of the paternal copy leads to Prader-Willi
syndrome (MIM# 176270) characterized by prominent behavioral features including
perseveration, obsessive-compulsive phenomena, and impulsive behavior (Vorstman et al.,
2006). Duplications of this 15q1113 region, mostly though not exclusively involving the
maternal copy, have been reported in patients with ASD (Miller et al., 2009). This gene rich
region encompasses several candidate genes such as GABRB3 (GABA A receptor beta-3) and
UBE3A (ubiquitin protein ligase E3A)- both highly expressed in CNS. However, no mutations
have been identified in these genes in cytogenetically normal patients with ASDs, and no
association of common alleles has been conclusively demonstrated. Chromosomal abnormalities
have also been reported on many chromosomes, including chromosomes for which positive
linkage or association has been established such as chromosome 2 and 7.

Characterization of cytogenetic aberrations has resulted in the identification of several ASD

candidate genes including RAY1/ST7 (suppression of tumorigenicity 7), AUTS2 (autism
susceptibility gene 2), MMP16 (matrix metalloproteinase 16), NBEA (neurobeachin), GRPR
(gastrin-releasing peptide receptor), GABRG1 (GABA-A receptor gamma-1), DSC1
(Desmocollin 1) and DSC2 (Desmocollin 2). RAY1\ST7 was identified by characterizing a
translocation (t(7;13)(q31.3;q21)) disrupting this gene in an ASD patient (Vincent et al., 2000).
AUTS2 was implicated by characterization of the translocation t(7;20) (q11.2; p11.2) in a
monozygotic twin pair concordant for autism (Sultana et al., 2002). To date, there are at least
seven reports of translocations disrupting the AUTS2 gene in autistic kids (Huang, Zou, Maher,
Newton, & Milunsky, 2010). The MMP16 gene was identified by breakpoint mapping of a de

19
 20

novo, apparently balanced t(2;8)(q35;q21.2) translocation in a boy with developmental delay and
autism. The 8q21.2 breakpoint was mapped within MMP16, which encodes the matrix
metalloproteinase 16 protein (Borg et al., 2002). In another patient with idiopathic autism and no
family history of autism, the NBEA gene was disrupted by a de novo translocation
t(5;13)(q12.1;q13.2) (Castermans et al., 2003). In two brothers diagnosed with autism, Vincent et
al reported a paracentric inversion of the short arm of chromosome 4 (46,XY, inv(4)(p12-
p15.3)), the proximal breakpoint (4p12) mapped within a cluster of gamma-aminobutyric acid A
(GABA(A)) receptor genes and directly disrupted the GABRG1 gene (Vincent et al., 2006). In a
recent study from our group, we have reported a de novo balanced translocation
t(5;18)(q33.1;q12.1) in a boy with autism. Further molecular characterization revealed that the 5
breakpoint lies at the 3' end of the SH3TC2 gene and distal to beta-adrenergic receptor gene
ADRB2 and serotonin receptor gene HTR4, while the 18q breakpoint lies between desmocollin
genes DSC1 and DSC2. We attempted to check the possibility of mono-allelic expression of
these genes due to a position effect of the translocation interfering with gene expression;
interestingly, the DSC1 and DSC2 were only transcribed from the normal chromosome 18 in
lymphocytes from the proband. DSC1 and DSC2 play important role in cell adhesion and
desmosome formation, disruption of these genes may contribute to etiology of autism (Vincent et
al., 2009).

1.1.4.3 Copy Number Variation

For many years, the single nucleotide polymorphism (SNP), small insertion-deletions, variable
numbers of repetitive sequences, microsatellite and minisatellite were the known forms of
genetic variations. However, with the completion of human genome project and availability of
human reference sequence coupled with advances in the microarray technology, a new form of
genomic structural variation, the submicroscopic copy number variants (CNVs) were revealed in
2004 (Iafrate et al., 2004; Sebat et al., 2004). The term CNV was introduced in 2006 and a CNV
was defined as a segment of DNA that is 1 kb or larger and is present at a variable copy number
in comparison with a reference genome (Feuk, Carson, & Scherer, 2006). These genomic
structural variants can be genomic copy number gains, insertions, or losses relative to a
designated reference genome sequence. In a landmark study, Iafrate and colleagues used array-
based comparative genomic hybridization (array CGH) to analyze the genomes of 55 unrelated

20
 21

individuals. Using this approach, they identified 255 loci across the human genome that had
genomic imbalances among unrelated individuals. Among these, 24 variants were identified in >
10% of the examined individuals. Interestingly, 50% these variants encompassed annotated
genes and many coincided with segmental duplications or gaps in the human genome assembly
(Iafrate et al., 2004). Another report published at the same time identified 221 copy number
differences among 20 unrelated individuals analyzed on oligonucleotide microarrays. Out of
these 221 structural variants, 76 were unique and on average 11 variants per genome were
identified with an average length of a 465 kb (Sebat et al., 2004). Similar to Iafrate et al, this
study also found that many of these variants encompassed known genes, including genes
involved in neurological function, regulation of cell growth, regulation of metabolism, and
disease associated genes (Sebat et al., 2004). Both these reports uncovered the dynamic nature of
the human genome and suggested the possible involvement of these variants in normal human
variation and in genetic defects. Since then, microarrays and other tools for discovery of CNVs
have been substantially improved and this approach has been very successful in the identification
of genomic regions\genes involved in different genetic disorders, and in particular, complex
genetic disorders such as autism.

The first comprehensive CNV study of autism was published in 2007, through a genome scan of
715 families (1,109 samples) using 10K SNP arrays, in which 2,788 putative CNVs were
identified (Szatmari et al., 2007). Further quality controls measures resulted in the identification
of 624 stringent CNVs from 350 different families. This study reported several autism
susceptibility genes\loci including NRXN1, 1q21 and 22q11.2 (Szatmari et al., 2007).

Using comparative genomic hybridization (CGH) on the genomic DNA of 264 families, Sebat et
al tested the hypothesis that de novo CNVs are associated with autism. Interestingly, prevalence
of de novo CNVs was significantly higher in cases (10%) compared to controls (1%) which
confirmed the strong association of de novo CNVs with autism (P = 0.0005) (Sebat et al., 2007).

In a study involving our collaborative group, using Affymetrix 500K microarray, a genome scan
was performed on 427 ASD families, and 277 unbalanced CNVs in 44% of ASD families were
identified. These CNVs were not present in ~1600 controls (Marshall et al., 2008). Amongst the
patients, 11% had de novo CNVs, which is comparable to Sebat et al (10%). Our data further

21
 22

implicated some of the previously known ASD susceptibility genes such as SHANK3, NLGN4
and NRXN1. Furthermore, we identified several novel ASD candidate loci\genes such as DPP6,
DPP10, PCDH9, ANKRD11, DPYD, PTCHD1, and 15q24. Most importantly, we showed that
CNVs at 16p11.2 are associated with autism in ~1% of the cases (p = 0.002). Subsequently, the
association of the recurrent 16p11.2 CNVs (micro-deletions and reciprocal micro-duplications)
with 1% ASD cases was further confirmed by several independent studies (Weiss et al., 2008).
We also highlighted several CNV events spanning previously known ID genes, indicating
possible etiological overlap between autism and ID (Marshall et al., 2008). The detailed
characterization of chromosome-X CNVs identified in this study is the primary focus of this
dissertation and will be elaborated on in detail in the data chapters.

Another CNV study of 859 ASD cases and 1,409 healthy children identified several new CNV
regions potentially involved in etiology of autism. The authors validated their positive findings in
an independent cohort of 1,336 ASD cases and 1,110 controls (Glessner et al., 2009). This data
supported the involvement of some of the previously reported ASD candidate genes, such as
NRXN1 and CNTN4 and identified many new ASD susceptibility genes such as NLGN1, ASTN2,
UBE3A, PARK2, RFWD2, FBXO40 and AK123120. It was noticed that several of the genes
disrupted by CNVs were involved in neuronal cell-adhesion or ubiquitin degradation, which
suggested that genes involved in these biological processes may play a key role in the
susceptibility to ASD (Glessner et al., 2009). CNVs at 15q11-q13 (including UBE3A) and other
previously know loci were also confirmed in another study of exonic CNVs in autism patients
(Bucan et al., 2009).

Our collaborative group recently reported a comprehensive map of CNVs in 996 ASD
individuals of European ancestry and ~5000 ethnically matched controls (Pinto et al., 2010). Our
finding confirmed a higher global burden of rare, genic CNVs (1.19 fold, P = 0.012) in ASD
cases, especially, for the previously implicated loci. Furthermore, similar to our finding in
Marshall et al, we found significant enrichment of CNVs at known ID loci (1.69 fold, P = 3.4 x
10-4). We identified numerous de novo and inherited events which resulted in identification of
new ASD susceptibility loci such as SHANK2, SYNGAP1, DLGAP2 and the X-linked DDX53-
PTCHD1 locus. We have also grouped genes disrupted by these CNVs on the basis of their

22
 23

function, which indicated that they are mainly involved in cellular proliferation, projection and
motility, and GTPase/Ras signaling (Pinto et al., 2010).

CNV analysis coupled with direct sequencing has proved to be a powerful approach to uncover
disease causing mutations in several genes. For example, in case of SHANK2 (synaptic
scaffolding gene) gene, Berkel et al initially found de novo CNVs in this gene in two unrelated
individuals with ASD and ID. Subsequent sequencing of coding regions of SHANK2 in 396 ASD
cases and 184 ID cases identified a de novo nonsense mutation and seven rare inherited changes.
SHANK2 is another example, where mutations in a gene can cause ID or Autism or both (Berkel
et al., 2010). Using similar strategy, we identified PTCHD1 mutations in ASD and\or ID cases,
discussed in detail in chapter 4.

The study of CNVs in ASD has proven to be a successful approach in delineating a portion of the
etiology of autism. These studies have accelerated the pace of discovery of causative genetic
factors for autism and resulted in increasing our understanding of this complex disorder. Several
CNV studies have highlighted some critical biological pathways, and further investigation of
these pathways may yield novel targets for therapeutic interventions.

1.1.4.4 Candidate Gene Sequencing

Direct sequencing of candidate genes is another rapid approach for identification of disease
genes. The candidate genes can be prioritized on the basis of protein function, expression in
brain regions or physical position of gene such as genes in previously linked susceptibility
regions.

Using this approach, causative mutations have been previously reported in NLGN3 and NLGN4
genes (Jamain et al., 2003). These genes map within previously linked regions of chromosome X
(Auranen et al., 2002) and these are involved in cell-adhesion with important function in
synaptogenesis during brain development and in connection of pre and postsynaptic membranes.
A frameshift mutation (1186insT) in NLGN4 has been reported in a family with two affected
brothers, one with typical autism and the other with ASD and a missense mutation (R451C) in
NLGN3 in another family (Jamain et al., 2003). In another large family, a two base pair deletion

23
 24

within NLGN4 was reported, the mutation segregated with phenotype, X-linked intellectual
disability and three males with ASD (Laumonnier et al., 2004). Another study that involved
performing extensive mutation screening of NLGN3 and NLGN4 revealed four new missense
mutations (Yan et al., 2005). Recently, a de novo 1 base pair (335G>A) substitution located in
the promoter region of NLGN4 has been reported in a patient with autism and nonsyndromic
profound ID (Daoud et al., 2009). However, several other studies failed to identify any causative
variants in NLGN3\NLGN4, and therefore the mutations in these genes are proven to be very rare
(Vincent et al., 2004; Wermter, Kamp-Becker, Strauch, Schulte-Korne, & Remschmidt, 2008).
By chromosomal analysis and DNA sequencing several mutations in SHANK3 (also known as
ProSAP2) has been recently reported. In one the families, a heterozygous, 1bp insertion has been
reported in two brothers with autism, both brothers had severely impaired speech and severe ID
(Durand et al., 2007). A follow up study performed the sequencing of 400 cases and identified a
de novo mutation. Additionally, by CNV analysis two gene deletions were also discovered.
Combining the sequence and CNV mutations, the frequency of SHANK3 mutation was estimated
to be 0.75% in the study cohort (Moessner et al., 2007).

By systematic sequencing of X chromosomal synaptic genes, IL1RAPL1 (Interleukin-1 Receptor

Accessory Protein-Like 1) has been recently implicated in autism (Piton et al., 2008). All coding
exons of IL1RAPL1 were sequenced in a cohort of 142 subjects (20 females and 122 males) and a
seven base pair deletion was identified in a French-Canadian girl diagnosed with ASD without
language delay. It is noteworthy that this gene was initially implicated in non-syndromic ID
(Bhat et al., 2008a), however, the girl reported here did not have ID.
In our own attempt to sequence candidate genes, we have identified several disease associated
mutations in PTCHD1 and IL1RAPL1 genes, which will be elaborated in detail later in this
dissertation.

In conclusion, numerous studies have attempted to find causative mutation by sequencing

candidate genes but with a limited success, possibly, due to the high degree of genetic
heterogeneity of this disorder. Nevertheless, this approach has found many causative variants in
different genes, as reviewed above. The study of these genes will help in the diagnosis of more

24
 25

cases in the future, and will help us understand the function these gene and the biological
pathways in which they play a role.

1.2 Intellectual Disability (ID)

Intellectual disability (ID) or Mental Retardation (MR) is characterized by an intelligence
quotient (IQ) of 70 or below coupled with deficits in at least two adaptive behaviors, which
include skills related to everyday life (American Psychiatric Association 2000). On the basis of
IQ, ID is divided into five subtypes: Mild, moderate, severe, profound and unable to classify
(DSM IV) and the prevalence of ID is estimated to be up to 3% in general population (Leonard
& Wen, 2002a).

Severity IQ Proportion of ID Functional Level

Borderline 70-84 N/A Normal

Mild 50-69 85% Can often live independently with social support

Acquire some communication and self-help skills,

Moderate 35-49 10% require moderate supervision

Acquire only basic self-help and communication

Severe 20-34 3-4% skills, require supervision

Profound/ Require highly structured and supervised living

Unspecified <20 1-2% conditions

Table 1-1 Categories of intellectual disability by IQ and ability to function in society as

defined by the DSM-IV-TR.

While the prevalence of severe ID is relatively stable, the prevalence of mild ID is variable and
often depends heavily on external environmental factors such as level of maternal education,

25
 26

access to education/opportunity and access to healthcare (Leonard & Wen, 2002b; Drews,
Yeargin-Allsopp, Decoufle, & Murphy, 1995; Roeleveld, Zielhuis, & Gabreels, 1997). Study
design, age of subjects, and the catchment population for various epidemiological studies may
also contribute to the variability seen across mild ID prevalence studies (Leonard & Wen, 2002b;
Roeleveld et al., 1997).

The new DSM-V will be changing the severity criteria to encompass behavioral deficits and the
level of impact that these have in the lives of affected individuals (DSM5.org). The manual will
also be changing the wording of the ID diagnostic criteria to encourage cultural sensitivity and
relevance, and to ensure that culturally validated psychometric tests are used to evaluate IQ and
level of functioning.

In addition to categorization by severity/IQ level, ID can also be grouped into syndromic

intellectual disability (S-ID) and non-syndromic intellectual disability (NS-ID). In S-ID,
individuals present with one or multiple clinical features or co-morbidities in addition to ID.
While S-ID has a clear definition, there is debate over the classification of NS-ID. Traditionally,
NS-ID has been defined by the presence of intellectual disability as the sole clinical feature.
However, it has been a challenge to rule out the presence of more subtle physical signs,
neurological anomalies and psychiatric disorders in these individuals, as they may be less
apparent, or difficult to diagnose due to the cognitive impairment. Additionally, the symptoms of
some syndromes may be so subtle that they are extremely difficult to diagnose unless the
features are looked for specifically in the context of a known genetic defect previously associated
with these features (Ropers, 2006a). Thus the distinction between S-ID and NS-ID is often
blurred.

Despite its universal occurrence, there tends to be higher prevalence of ID in areas of lower
socioeconomic status and developing countries, particularly for mild cases (Drews et al., 1995;
Roeleveld et al., 1997; Durkin, Hasan, & Hasan, 1998; Emerson, 2007). As previously
mentioned, variability of prevalence is more pronounced for mild ID. It has been suggested that
this discrepancy is likely due to environmental factors (Drews et al., 1995; Roeleveld et al.,
1997; Durkin et al., 1998; Emerson, 2007).

26
 27

Approximately 30% more males are diagnosed with ID than females (American Psychiatric
Association, 2000; McLaren & Bryson, 1987). However, despite a higher ratio of males to
females among milder cases of ID, the ratio decreases as IQ decreases (American Psychiatric
Association, 2000; McLaren & Bryson, 1987). Some studies suggest that severe ID may be more
prevalent among females (Katusic et al., 1996; Bradley, Thompson, & Bryson, 2002), however
these studies were performed in quite specific communities, and may not necessarily be
generalizable to other regions. Some of this gender bias can be accounted for by mutations on the
X-chromosome. In most cases of X linked ID (ie. X-linked intellectual disability; XLID) or X-
linked autism, more males are affected due to hemizygosity. However, in some disorders, such as
Rett syndrome, this ratio is reversed because mutations in the Rett syndrome gene, MeCP2, are
generally lethal in haploid genomes, or in female-restricted epilepsy and intellectual disability
(EFID), in which heterozygous mutations in the gene PCDH19 cause the disease in females and
in which there is reprieve in males with hemizygous PCDH19 mutations (Dibbens et al., 2008;
Hynes et al., 2009).

It is believed that genetic factors play important role in etiology of ID, however, the
contributions of environment and other factors cannot be excluded. ID is a clinically and
genetically heterogeneous disorder, to date, at least, 215 X- linked ID (XLID) conditions have
been reported and more than 85 genes have been linked to this disorder. Based on the mode of
inheritance, ID is classified into autosomal recessive, autosomal dominant, and X-linked. During
the past decade, many genes\loci causing ID have been identified, however, the cause of ID in up
to 60% of the cases still remains unknown (Rauch et al., 2006). Chromosomal aberrations are
identified in ~15% of all ID cases (Leonard & Wen, 2002a). Approximately, 30% more males
are diagnosed with ID than females. To date, more than 80 X-linked genes are known to cause
ID, however, mutations in these genes are thought to be responsible for only 10% of the ID
found in males, which suggests that there must be many other unknown genes or other
contributing factors which result in this gender bias (McLaren & Bryson, 1987; Ropers, 2006b).

The discovery of XLID genes began in the early 1980s, when mutations in the HPRT, PGK1 and
PLP genes were identified, since then, the list of XLID genes has grown rapidly, and, to date,
more than 85 genes have been linked to XLID (Ropers, 2008). During 2006-2008, in just two
years, 16 new genes were implicated in XLID. A regularly updated table of all ID genes is

27
 28

available at http://www.ggc.org/XLID.htm. Among known XLID genes, mutations in the FMR1

gene which result in the Fragile X syndrome (MIM#300624) are the most frequent cause of
XLID which may account for 25% of all families with XLID (Fishburn, Turner, Daniel, &
Brookwell, 1983). Second to FMR1 is ARX mutations in which may cause syndromic or non-
syndromic XLID in >5% of the families (Gecz, Cloosterman, & Partington, 2006). Other
frequently implicated genes include CUL4B, JARID1C and SLC6A8, mutations in each of these
genes account for 23% of the families, whereas mutations in the rest of the known XLID genes
are rare (< 1%) (Ropers, 2008).

Most of the known XLID genes have been identified by candidate gene sequencing and\or
characterization of chromosomal aberrations. For instance, characterization of a deletion resulted
in identification of IL1RAPL1 as an XLID gene. Subsequently, several other studies further
confirmed the role of this gene in XLID (Carrie et al., 1999a; Piton et al., 2008; Nawara et al.,
2008). Disruption of this has also been shown to cause autism with or without ID (Bhat et al.,
2008b; Marshall et al., 2008; Piton et al., 2008).

Recently, in the largest study of chromosome X gene sequencing to date, most of the annotated
X-chromosomal genes (~900) were sequenced in 208 families with ID. This study discovered
nine new XLID genes including SYP, ZNF711 and CASK (Tarpey et al., 2009a). Hundreds of
novel variants were also identified, however, the contributions of many of these variants to XLID
remains unclear. Another interesting finding was the observation of loss of function mutations in
~1% of X-chromosomal genes without any apparent associated phenotype (Tarpey et al., 2009a).

Also, in recent candidate gene sequencing studies, a nonsense and a splice site mutation in
RAB39B have been recently shown to cause ID with autism, epilepsy, and macrocephaly in
unrelated families (Giannandrea et al., 2010). Another study has reported the disruption of
IQSEC2 gene in first family published as NS-XLID (MRX1) in 1988. In addition to this family,
disease causing mutations were also identified in three other XLID families (Shoubridge et al.,
2010).

Because of the haploid status of most X chromosome genes in males, mutations are much more
severe in males, at least in genes that do not escape X-inactivation, leading to a distinct gender
bias in X-linked disorders. Hence, mutations in X-linked genes account for the observation of

28
 29

more males affected with intellectual disability than females. Interestingly, a similar direction of
gender bias has been observed in autism; the ratio of affected males to females is estimated to be
4:1 (Volkmar, Szatmari, & Sparrow, 1993). As reviewed above, the majority of ID genes
identified to date map to the chromosome-X, and many forms of XLID, both syndromic and non-
syndromic, have very broad spectra of phenotype and severity, and often include features that
overlap significantly with autism. DSM-IV ascribes ~5% of intellectual disability individuals to
known genetic conditions such as Tay-Sachs, tuberous sclerosis or fragile X syndrome, and
~30% to recognized predisposing factors affecting early embryonic development such as trisomy
21 or maternal alcohol consumption, and ~15-20% to environmental influences and other mental
disorders such as autistic disorder. DSM-IV also estimates that ~75% of children with autistic
disorder have ID, usually within the moderate range (IQ 35-50). This is likely to be an over-
estimate, and more recent estimates suggest a more modest level of 50-60% (Chakrabarti &
Fombonne, 2001; Bertrand et al., 2001; Baird et al., 2000). Therefore, these factors suggest a
possible overlap between ID and autism and these disorders may share some genetic etiologies.
In our own study of CNVs in autism, we have identified CNVs disrupting a number of ID
genes- the first time such observations have been reported for autism (Marshall et al., 2008).
Details of these findings are illustrated in chapter 2 of this dissertation.

29
 30

1.3 The X-Chromosome

The X chromosome is one of two sex-determining chromosomes in humans and many other
mammals. The first finished sequence of the human X chromosome was published in 2005 by an
international team of more than 250 genomic researchers led by the Wellcome Trust Sanger
Institute. The X chromosome was reported to be ~155 Mb in length having 1098 genes, of which
at least 800 genes are protein coding. Sequence annotation revealed that the X chromosome is a
relatively gene poor chromosome, and has a lower GC content (39 %) compared to the genome
average (41 %) (Ross et al., 2005).

The human X chromosome has many interesting features that are unique in the human genome,
for example, females inherit one X chromosome from each parent while males inherit a single,
maternal X chromosome. At most of the X chromosomal loci the gene dosage in females is
equaled to males by the process of X-chromosome inactivation (XCI) during early development,
and one chromosome remains inactive in somatic tissues thereafter. In the female germ line, the
inactive chromosome is reactivated and undergoes meiotic recombination with the second X
chromosome. Furthermore, male X chromosomes do not recombine along its entire length during
meiosis but recombination is restricted to short regions at the tips of the X chromosome arms that
recombine with equivalent segments on the Y chromosome. Genes inside these regions are
shared between the X and Y chromosomes, and they are described as pseudoautosomal genes.
Genes outside the pseudoautosomal regions of the X chromosome are strictly X-linked, and the
vast majority is hemizygous in the male genome. Interestingly, the X chromosome acquired
these unique features as consequence of its evolutionary process.

1.3.1 Evolution of the X-Chromosome

In 1967, Ohno proposed that the mammalian sex chromosomes evolved from a pair of autosomes
following their selection into a chromosomal system for sex determination, within the last 300
million years. Ohnos law states that the establishment of a dosage compensation mechanism
had a stabilizing effect on mammalian X chromosomal genes, and the mammalian X
chromosome length and gene content is extraordinarily conserved (Graves, 1996). During the
process of evolution, a barrier to recombination developed between these proto sex
chromosomes, isolating the sex-determining regions and eventually spreading throughout the

30
 31

two homologues. As a result of absence of recombination and accumulation of mutation events

the Y chromosome was subsequently degenerated. Ancestral chromosome blocks that fused to
form the X-Y pair can be identified by comparing the gene content of the X and Y in humans
and distantly related mammals like marsupials and monotremes, which diverged 180 and 210
million years ago respectively, and the gene contents of orthologous regions in other vertebrates.
Richardson et al reported that the human sex-linked enzyme loci such as are also sex-linked in
marsupials (Richardson, Czuppon, & Sharman, 1971). A more recent study by Johnston et al also
supported these finding (Johnston & Robinson, 1986).

Spencer et al studied ten human genes located on the long arm of the X chromosome (Xq) and by
somatic cell analysis and in situ hybridization, they found that these genes were located on the X
chromosome in marsupial species. The results of this study indicated that the long arm of the
human X chromosome represents a highly conserved region that formed part of the X
chromosome in a therian ancestor 120-150 million years ago, before the mammalian infraclasses
diverged (Spencer, Watson, & Graves, 1991). However, many genes located on the short arm
(Xp) of the human X chromosome were shown to be absent from the X chromosome in
marsupials, in which they appear to be autosomal (Sinclair, Wrigley, & Marshall Graves, 1987);
Watson, Spencer, Riggs, & Graves, 1991). The fusion point for this appears to be around
Xp11.23 (homo sapiens)- from here to the centromere, genes are X chromosomal in eutherian
and non-eutherian mammals (Wilcox et al, 1996).

Watson et al proposed two alternative hypotheses to explain the finding of human Xp genes on
marsupial autosomes. First, the human Xp region was part of the X chromosome in the common
therian ancestor of the eutherians and marsupials and was translocated to an autosome in the
marsupial lineage. Second, the human Xp region was originally autosomal and was translocated
to the X chromosome in the eutherian lineage (Watson, Spencer, Riggs, & Graves, 1991).
Experimental testing of these hypotheses using comparative chromosome painting techniques
revealed that the human Xp region was originally autosomal and was translocated to the X
chromosome in the eutherian lineage (Glas, Marshall Graves, Toder, Ferguson-Smith, &
O'Brien, 1999). Another study proposed four evolutionary strata on the human X chromosome
and suggested that the human sex chromosome evolution was punctuated by at least four events
in which X-Y recombination was suppressed in one stratum and the gene order was conserved.

31
 32

Furthermore, it was proposed that the first event, which marked the beginnings of X-Y
differentiation, occurred about 240 to 320 million years ago, shortly after divergence of the
mammalian and avian lineages (Lahn & Page, 1999). The placental mammalian X is
extraordinarily conserved in size, gene content and even gene-order. However, only part of the
human X (Xqter-p11.2) is shared with the marsupial and monotreme X chromosomes, and the
rest is autosomal. This defines an ancient X-conserved region (XCR) and an X-added region
(XAR), which was added to the placental X after the marsupialplacental divergence but before
the placental radiation (Graves, 1995).

Although, conventional mapping techniques provided insight in to human X chromosome

evolution, with the availability of whole genome sequence of human and other species, a
comprehensive reconstruction of evolutionary events became possible by comparing genomes
from species that diverged from mammals early in the history of vertebrates. Mammals diverged
from birds and reptiles ~310 million years ago (Hedges & Kumar, 2004) and from fish ~450
million years ago (Vandepoele, De Vos, Taylor, Meyer, & Van de Peer, 2004). Interestingly, the
sex chromosome system of birds evolved independently during the last 300 million years and is
not homologous to those of mammals. The evolution of sex chromosomes of birds gave rise to
homogametic (ZZ) male birds and heterogametic (ZW) female birds, in contrast to the
mammalian system of XY males and XX females. The alignment of the human X chromosome
and chicken whole genome sequences supports the autosomal origin of mammalian sex
chromosomes. Orthologues of some human X chromosome genes were previously mapped to
different chicken chromosomal loci including 1q13-q21 and 4p11-p14 (Schmid et al., 2000). The
comparison of draft human genome sequence and chicken sequence confirmed and extended the
previous model of human X chromosome evolution. However, the fourth stratum on human
Xp22.3 described earlier by Lahn and Page, which resulted from a recent inversion of the Y
chromosome between prosimians and simians, cannot be reconstructed by this approach.
Additionally, the genome sequence comparison confirmed that X chromosome is strikingly
conserved during evolution with exception of few genes in Xp11.2 and Xq28 (Kohn, Kehrer-
Sawatzki, Vogel, Graves, & Hameister, 2004).

With availability of finished human chromosome X sequence, using genomic sequence

alignment, Ross et al identified ~30 regions of homology that together cover most of human Xq

32
 33

and are confined to a single section of approximately 20Mb at the end of chicken chromosome
4p. In contrast, most of the short arm of X chromosome including the pseudoautosomal region
PAR1, aligned to a single block of chicken chromosome 1q, while the emergence of the rest of
the short arm remained unclear. This analysis supported the previously described X-conserved
region (XCR) and an X-added region (XAR). However, in contrast to earlier hypotheses, it was
proposed that much of the proximal short arm (Xcenp11.3) should no longer be considered part
of an XCR. Furthermore, this study investigated the precise order of genes in XAR and proposed
new model that the XAR was acquired by recombination between the X chromosome and a ring
chromosome in which the ancestral PLCXD1, RGN and RGN2 sequences were neighbors. The
recent patterns of evolution were examined by comparison of the human X chromosome with
other mammalian sequences. Nine major blocks of sequence homology between human and
mouse X chromosomes, and eleven between human and rat were identified. The homology
blocks occupy most of the X chromosome, confirming the remarkable degree of conserved
synteny of this chromosome within the eutherian mammalian lineage (Ross et al., 2005).

Another interesting aspect of the X chromosomal evolution is the special selection process that
forced some X-linked genes to develop an extended functional spectrum. One such example is
genes involved in development of cognitive abilities. It is well established that an excess of
genes responsible for cognitive abilities are mapped on X chromosome and this phenomenon is
also described as the large X-chromosome effect (Turelli & Orr, 1995). However, Zechner et
al, proposed a large X-chromosome effect for general cognitive abilities in humans and defined
the evolution of enhanced cognitive abilities as a specifically human trait. A large X-
chromosome effect influencing the development of a specific character like fertility or cognitive
ability implies that this character is selected in the species (Zechner et al., 2001).

In conclusion, the origin and evolution of the X chromosome is very interesting for several
reasons, including its unique dosage compensation mechanism by XCI, its role in evolution of
chromosome Y and its large chromosome effect for development of cognitive capabilities in
humans. It is also notable that the X chromosome is the most conserved chromosome in the
human genome. Particularly, the Xq is strikingly conserved during evolutionary processes
spanning millions of years, and even much of the gene order is conserved across diverse species.

33
 34

Further investigation of X chromosome evolution will increase our understanding of how genes
acquired extended functions during human evolution.

1.3.2 Autism and X-chromosomal genes:

The striking observation that males are nearly four times as likely to be affected by autism as
females (Volkmar et al., 1993) may implicate the sex chromosomes having some direct or
indirect etiological effect. In order to test the hypotheses that loci on the X chromosome may
increase susceptibility to autism, various studies have used X-chromosome-specific approaches
or genome-wide approaches to look for X-linkage to autism. Linkage analysis performed by Dr.
Vincents research group using 23 multiplex families with autism from the UK found that
linkage to autism for markers in the Xq27-Xqter region could not be excluded, for a variety of
phenotypic definitions of affected status. For the most inclusive phenotypic definition, a non-
parametric LOD score of 2.1 was computed (Vincent et al., 2005). Our continuing follow-up of
this finding using the CANAGEN study families has also identified suggestive linkage around
Xq27 (unpublished data).

A genome-wide screen by Liu et al (2001), using the AGRE multiplex families with autism, also
demonstrated suggestive linkage to the region encompassing Xq25-qter, with a MLS of 2.67 at
DXS1047 (Liu et al., 2001). Both studies used relatively low density of markers on the X
chromosome (1 marker per 12.6cM (AGRE), and 5.6cM (UK)), and hence only a small
proportion of the meiotic information has been extracted from the families genotyped. A recent
study of French-Canadian males with autism also showed association for markers and haplotypes
within this region, with p values as low as p=0.00001 for marker DXS8043 at Xq27.3 (Gauthier
et al., 2006). These results show that further investigation, either by genetic linkage analysis or
by the direct detection of mutations in coding and regulatory regions of DNA is required if this
region is to be excluded as a candidate locus. Another study used the linkage and association
data pointing to the distal Xq region to search for potential candidate genes for autism, and
appear to have identified mutations within the ribosomal protein encoding gene (RPL10) on
Xq28 (Klauck et al., 2006). Although the importance of this gene in autism needs to be
confirmed, this study highlights the interest in X chromosome genes in autism.

34
 35

In a study by Thomas et al, de novo deletions at Xp22.3 locus were reported in three autistic
females (Thomas et al., 1999). These finding prompted a comprehensive analysis of this region
which lead to the identification of NLGN4 gene, a member of Neuroligin family (Jamain et al.,
2003). Neuroligins constitute a family of proteins thought to mediate cell-to-cell interactions
between neurons (see HNL1; MIM 600568). Neuroligins function as ligands for the neurexin
family of cell surface receptors (see NRXN1; MIM 600565), and are thought to act as a trans-
neuronal signal that triggers synapse formation (Scheiffele, Fan, Choih, Fetter, & Serafini, 2000).
Several stop mutations have been identified and segregate with disease in three families with
autism in the X-chromosomal orthologs NLGN3 and 4 (Jamain et al., 2003). A number of studies
including our own (Vincent et al., 2004) have screened autism populations for mutations in
NLGN3 and 4, but have failed to find any evidence of mutations in their autism patients
(Ylisaukko-oja et al., 2005; Gauthier et al., 2005; Blasi et al., 2006b). One study reported four
putative missense changes in NLGN4 in four families with autism (Yan et al., 2005). Another
study describes a large family where a frameshift mutation in NLGN4 is present in 10 members
with non-specific x-linked intellectual disability, two with autism and one with pervasive
developmental disorder (Laumonnier et al., 2004). More recently, the gene encoding ribosomal
protein 10 (RPL10) on Xq28 was screened in autism patients, and missense mutations identified
in 2 families (Klauck et al., 2006). Mutations in the intellectual disability genes FMR1, MECP2,
the X-linked creatine transporter SLC6A8, and ARX have all been linked to occasional cases of
autism, as outlined in the following paragraphs. In addition, the first study to identify a gene
disrupted by a translocation in a patient with autism (Ishikawa-Brush et al., 1997) identified the
gastrin releasing peptide receptor (GRPR) on Xp22.2. Although there are no further reports
linking this gene to autism, GRPR blockade in rats resulted in impaired social behavior, and thus
it should not be excluded from a possible etiologic role. Another X-linked gene that may play a
role in autism is EFHC2- a recent study has identified this gene as a quantitative trait locus for
fear-recognition in Turners syndrome. This is relevant to autism, because impaired recognition
of emotion is present in autism, and a large proportion of Turners syndrome patients (~30%)
have autism (Weiss et al., 2007).

35
 36

1.3.3 Autism and Non-syndromic XLID genes:

There are at least 34 genes which that have been implicated in non-syndromic (NS) XLID,
including ACSL4, AFF2/FMR2, AGTR2, AP1S2, ARHGEF6, ARX, ATRX, BRWD3, CASK,
DLG3, FGD1, FTSJ1, GDI1, HUWE1, IL1RAPL1, JARID1C (KDM5C), MAGT1, MECP2,
NLGN4, OPHN1, PAK3, PQBP1, PTCHD1, RPS6KA3, SHROOM4, UPF3B, ZNF41, ZNF674,
ZNF711, ZNF81, SLC6A8, SYP and TSPAN7 (Kaufman, Ayub, & Vincent, 2010). NS-XLID
disorders appear to have an extremely broad phenotypic range. Furthermore, given the potential
mutation spectrum along with wide scope for protein regulation of these NS-XLID genes, it is
anticipated that some mutations within some of these genes will lead to symptoms within the
autistic spectrum.

The identification of genes for either syndromic or non-syndromic forms of XLID has indicated
some surprising pathways which, when disrupted, can lead to impaired cognitive development.
For instance, the fatty acid-coA ligase 4 gene, FACL4, has recently been identified as the
causative factor in both syndromic (Alport syndrome) and non-syndromic XLID (Meloni et al.,
2002). OPHN1, PAK3, ARHGEF6 and FGD1 genes are involved in the RhoGTPase cycle, which
mediates cytoskeletal organization and cell motility, and is involved in outgrowth of axons and
dendrites (Ramakers, 2002). Similarly, other XLID genes have shown that proteins involved in
ERK/MAPK pathway, cell cycle regulation, transcriptional regulation, chromatin remodeling,
cell adhesion are important for normal cognitive development (Kaufman et al., 2010).

Interestingly, it is also apparent that the X-chromosomal neuroligin genes, NLGN3 and NLGN4,
which were recently identified as carrying mutations in families with autism (Jamain et al.,
2003), may also be involved in NS-XLID. Mutations in NLGN4 were identified among members
of a large pedigree with NS-XLID either with or without autism or pervasive developmental
disorders (Laumonnier et al., 2004). Similarly, mutations in IL1RAPL1 and PTCHD1 may cause
autism, ID or both.

36
 37

1.3.4 Evidence of X-chromosomal involvement in autism from measures

of skewed X-inactivation

In females, who carry two X-chromosomes, gene dosage for most X-chromosome genes is
suppressed to equal that of the male by the inactivation of one of the two X chromosomes. Genes
that escape X-inactivation are believed to be responsible for gender-specific traits (sexual
dimorphism). X-inactivation randomly inactivates either the paternally-derived or maternally-
derived X-chromosome in somatic cells. Skewed X-inactivation is a common feature among
XLID disorders (Plenge, Stevenson, Lubs, Schwartz, & Willard, 2002) as well as recurrent
pregnancy loss. Skewed X-inactivation would be able to explain differences in severity in
affected families for X-linked intellectual disability (XLID) and autism, and can explain lack of
phenotype in mothers transmitting disease alleles to offspring. In a recent study 33% of 35
autistic females tested showed clearly skewed X-inactivation, compared with 11% of unaffected
females (N=42), further implicating the X chromosomes involvement in autism (Talebizadeh,
Bittel, Veatch, Kibiryeva, & Butler, 2005).

To summarize, a number of converging lines of evidence have already linked X-chromosomal

genes to a proportion of cases of autism, where the gene mutation is the major contribution to the
disease, and there is very good reason to believe that there will be more such genes on the X
chromosome. Linkage and association studies suggest that there may also be X-chromosomal
loci that are relatively common risk factors for autism. Use of high resolution SNP data to
characterize CNVs may help the identification of new genes for autism on the X chromosome.

1.4 Thesis Objectives

1.4.1 Chapter 2
a) Although it is well established that genetic factors play an important role in the etiology

of autism, conventional methods such as linkage analysis and association studies have

shown a limited success in identification of autism genes. Our objective was to identify

autism candidate genes by mapping the CNV data.

37
 38

1.4.2 Chapter 3
a) While the CNV analysis highlighted several genes which may contribute to autism, still,
the biological consequences, if any, were not clear for many loci. The objective was to
study additional autism cases using sequence analysis and to perform qPCR assays to
establish the clinical significance of candidate genes.

1.4.3 Chapter 4
a) By characterizing CNVs, we identified several autism candidate genes including the
PTCHD1. The objective was to execute a comprehensive genomic and functional study
of PTCHD1 gene, in order to explore the involvement of this gene in autism and to
understand the biological function of protein encoded by this gene.

38
 39

Chapter 2. Chromosome X CNVs in Autism

The data presented in this chapter is included in Structural variation of chromosomes in

autism spectrum disorder originally published in The American Journal of Human
Genetics (Appendix 1).

Marshall CR, Noor A, Vincent JB, Lionel AC, Feuk L, Skaug J, Shago M, Moessner R, Pinto D,
Ren Y, Thiruvahindrapduram B, Fiebig A, Schreiber S, Friedman J, Ketelaars CE, Vos YJ,
Ficicioglu C, Kirkpatrick S, Nicolson R, Sloman L, Summers A, Gibbons CA, Teebi A, Chitayat
D, Weksberg R, Thompson A, Vardy C, Crosbie V, Luscombe S, Baatjes R, Zwaigenbaum L,
Roberts W, Fernandez B, Szatmari P, Scherer SW.
Structural variation of chromosomes in autism spectrum disorder (2008).
Am J Hum Genet. Feb;82(2):477-88.

Contributions: I analyzed all chromosome X CNV calls and filtered out the CNVs present in
controls. Further, I identified all CNVs mapped at previously known ID loci and prioritized the
potentially interesting loci. I designed and performed all experiments for the validation of
selected CNVs and mapped the breakpoints of deletions. I also performed the segregation
analysis of the CNVs. I helped in presentation of this data in the manuscript and edited the
manuscript.

39
 40

2.1 Introduction
The contribution of genetic factors to autism is well established, but the mode of genetic
transmission is unclear. However, it is apparent that autism is a complex non-Mendelian
disorder, and it is anticipated that genetic heterogeneity and oligo/polygenic inheritance are
involved.

There are several lines of evidence such as gender bias, positive linkage findings, role of X-
chromosomal genes in cognition and skewed inactivation which suggest the possible
involvement of X-chromosomal loci in the etiology of autism. Although the X chromosome is
generally a gene poor chromosome, majority of the known ID genes map to the X chromosome.
To date, more than 80 X-linked have been implicated in various forms of ID (Ropers, 2008).
Because of the haploid status of most sex chromosomal genes in males, mutations of
chromosome X or Y are much more severe in male, which may explain in part the gender bias in
autism and ID.

Cytogenetically-detectable chromosome abnormalities may be identified in up to 7.4% of ASD

cases (Marshall et al., 2008). The occurrence of genomic imbalances is higher in syndromic
forms of ASD (Vorstman et al., 2006). Balanced translocations and inversions account for 17%
of the genomic rearrangements and the most frequent chromosomal anomaly observed is
maternally-derived duplication of chromosome 15q11-q13 in 1-3% of cases (Veenstra-
Vanderweele, Christian, & Cook, Jr., 2004). By using chromosomal abnormalities to identity
ASD candidate genes, mutations have been identified in SHANK3 on chromosome 22q13
(Moessner et al., 2007; Durand et al., 2007), NLGN3 and NLGN4 genes on the X-chromosome
(Jamain et al., 2003), and the neurexin 1 gene (NRXN1) on chromosome 2p16 (Szatmari et al.,
2007). It has been recently shown that the sub-microscopic CNVs may contribute to etiology of
autism and de novo CNVs seem to be an even more significant risk factor in sporadic compared
with familial forms of ASD (Sebat et al., 2007).

Epidemiological studies have shown a gender bias in autism as well as in ID, where the number
of males affected with autism is 3-4 times greater than females, and for ID the ratio is ~1.3:1,
although this is believed to decrease with decreasing IQ (American Psychiatric Association
2000; McLaren and Bryson 1987) and some studies suggest that severe ID may be more

40
 41

prevalent among females (Katusic et al. 1996; Bradley et al. 2002),. Also, some form of ID has
been reported in up to 70% of autistic children (Fombonne, 2003). This overlap between autism
and ID warrants the search for common etiological factors and the sex ratios in these disorders
make the X chromosome an excellent candidate. Thus, the present study hypothesized that a
number of autism candidate genes are present on chromosome X, and some of these can be
identified by the analysis of X chromosome CNVs and through the direct sequencing of
candidate genes among probands with autism.

In the present study we took advantage of the technological advances in the field of DNA
microarrays. The genome scan of over 400 hundred probands with autism was performed using
the Affymetrix 500k SNP array. We attempted to identify autism candidate genes by mapping
the CNVs on the X chromosome, coupled with the sequencing of relevant candidate genes that
map to these CNVs, in order to identify additional patients with sequence mutations.

2.2 Methods:
2.2.1 DNA Samples
The study included 427 families with ASD. Among these 228 families were recruited at The
Hospital for Sick Children, 99 families at Memorial University, 86 families at McMaster
University and another 14 families were recruited at other sites. ADOS and ADI-R tools were
used for assessments and all probands met the DSM-IV diagnostic criteria for autism. Within this
cohort, 32 patients carried a cytogenetic chromosome rearrangement and 18 of these 32
chromosomal rearrangements had been detected by previous karyotyping. Siblings of the
proband were also assessed for ASD. 236 families had one ASD child (simplex) and 189 families
had more than one ASD child (multiplex). This high ratio of simplex to multiplex is likely due to
bias in the ascertainment of the families. Approximately 75% of cases were screened for FRX
mutations, and families with FRX mutations were excluded from the study. Most experiments
were performed on genomic DNA extracted from lymphocytes (80%), and for the remainder the
DNA was extracted from lymphoblastoid cell lines. Using multi-locus SNP genotype data, the
population ancestry was inferred by STRUCTURE (Falush, Stephens, & Pritchard, 2003).
Analysis by STRUCTURE software revealed that ~90% (386/427) of probands were of
European origin, 4.5% (19/427) were of European-mixed origin, 4.5% (19/427) were of Asian

41
 42

origin and 0.07% (3/427) were of African origin. Probands were clustered without considering
their original geographical origin using 780 unlinked SNPs, assuming three ancestral
populations. In the same clustering, 209 unrelated HapMap individuals (African, European and
Asian) were used as reference.

CNVs were also assessed in 500 European control individuals from Northern Germany, who
were ascertained through the PopGen project (Krawczak et al., 2006). Additionally, 1152 non-
disease control individuals of European origin who were recruited from the province of Ontario
were also included in the study. Details of these control individuals are published elsewhere
(Zogopoulos et al., 2007).

2.2.2 Microarray and karyotyping experiments

For each sample, approximately 500,000 SNPs were genotyped using the Affymetrix GeneChip
Human Mapping 500K Array. The 500K Human Mapping microarrays are comprised of two-
chips, the Affymetrix NspI array and StyI array. Also, some of the samples were analyzed on
Human Mapping 500K Early Access Arrays. All arrays were processed at the microarray facility
at The Centre for Applied Genomics (TCAG) according to the manufacturers instructions. The
basic steps in processing of these arrays are outlined in Figure 2-1.

42
 43

Figure 2-1 Major steps involved in processing of Affymetrix 500K microarrays

Adapted from www.affymetrix.com. The basic steps involved in the processing of Affymetrix
500K microarray are outlined. Briefly, 250 ng genomic DNA is digested by NspI or StyI
restriction enzymes. Standard adapters are ligated to the fragments of DNA followed by a PCR
amplification and End-labeling. These labeled fragments are then hybridized to chips and
unligated fragments are subsequently washed. The chips are then scanned and fluorescent colors
and intensities are used to infer the genotyping and CNVs.

43
 44

2.2.3 CNV Analysis

CNVs, i.e. either gain or loss of genomic material, were initially inferred by comparative
analysis of hybridization intensities using dChip analyzer (Li & Wong, 2001). After
normalization, we used Hidden Markov Model (HMM) to infer the DNA copy number from the
raw signal data. Additionally, the data was also analyzed using the CNAG software which is an
improved algorithm for copy number analysis of the human genome (Nannya et al., 2005). The
advantages of this algorithm are the improvement of signal-to-noise (S/N) ratios and the use of
an optimized reference. To maximize the CNV discovery and for cross validation the microarray
data was also analyzed with another software called GEMCA (Komura et al., 2006). The
analysis of NspI and StyI chips data was performed separately and also by combining both chips
together in the analysis.

2.2.4 Validation of CNVs

Validation of CNV calls was performed using the SYBR-Green I based real-time quantitative
PCR (qPCR), using the FOXP2 locus as a control amplicon, as CNVs of this region are not seen
in general population. At least two independent assays were used for CNV confirmations. For
hemizygous deletions of chromosome X loci in males, standard PCR reactions were performed
using the primers within the deletion region and products were analyzed on agarose gel.

2.2.5 Identification of Candidate Loci

In order to identify candidate autism susceptibility genes\loci, 500K SNP microarray data were
used to infer CNVs on the X chromosome in 427 autism patients. To exclude copy number
polymorphisms (CNPs), the presence of these CNVs was checked in 1652 controls and the
Database of Genomic Variants (DGV). The CNVs present in controls or in the DGV were
discarded. The rest of the CNVs were classified as autism specific events, and were marked for
validation using SYBR Green-I quantitative PCR (qPCR), in the probands and their family
members. CNVs that were either de novo or transmitted from unaffected mothers to affected
sons were further followed up. Any deletions in male patients for which there was known
overlap with genomic variants in controls, were also considered, under the hypothesis that the
CNV at a X-linked recessive gene may be present (and harmless) in control females yet
etiologically relevant in hemizygous males. Within the autism specific CNV regions the

44
 45

candidate genes were selected based on the function, expression profile or physical position of a
gene. An overview of the workflow in outlined in Figure 2-2.

Figure 2-2 Workflow for mapping autism susceptibility genes using CNVs on the X
chromosome is outlined.

45
 46

2.3 Results
2.3.1 Chromosome X CNVs in ASD cases
We used the Affymetrix GeneChip Human Mapping 500K SNP array (NspI and StyI Chips) to
scan the genomes of 427 ASD cases to assess genomic imbalances that may be associated with
the disease. The entire data set is published in Marshall et al, 2008. This thesis will only focus on
X chromosomal CNVs. Using high-density SNP microarray ~10,000 SNP markers across
chromosome X, with average marker density of ~15 kb, were genotyped which enabled us to call
CNVs and map the boundaries of these CNVs with relatively high precision. For selection of
appropriate controls, we used the SNP genotypes to categorize the ancestry of the samples, and
showed that over 90 % of samples had European ancestry.

A total of N=116 genomic X chromosomal CNVs were detected among the 427 ASD samples
(Table 2-1). Among these, 97 CNVs were gain (duplications) and 19 were loss (deletions). These
CNVs were further analyzed for overlap with polymorphic CNVs in 500 PopGen controls, 1152
Ontario controls and CNVs annotated in the DGV. It was observed that among these variants,
N=54 CNVs were specific to autism cases, as they were not identified in any of the controls
(Table 2-2). The autism specific CNVs were further classified as stringent autism specific if a
CNV was picked by more than one of the three algorithms (dCHIP, CNAG or GEMCA), or on
both NspI and StyI arrays. With this criteria, N=15 stringent autism specific CNVs were
indentified (Table 2-3).

The CNVs identified range from a few kilobases (Kb) to several megabases (Mb) in size, and
some of them encompass functionally important candidate genes such as IL1RAPL1, TSPAN7,
NLGN4 and FMR1, or genes of unknown function yet of interest due to homology with genes of
known function, e.g. PTCHD1 and IL1RAPL2. Two autism specific CNVs, a 104 Kb deletion at
Xq21.31 and a 121 Kb deletion at Xq27.3 do not involve any known RefSeq genes. However, it
is possible that these regions may contain some novel and uncharacterized genes or regulatory
regions that may play a role in autism susceptibly.

Other interesting regions include the Xq28, Xq25 and Xp22.31, which have CNVs in unrelated
cases. Duplications within Xq28 were found in N=4 autism probands -- one of these gains
encompasses the FMR1 and FMR1NB genes. This region has been previously reported to have

46
 47

modest linkage to autism, and expansion/hypermethylation of the FMR1 gene is a known cause
of intellectual disability and occasionally autism. Therefore, our CNV findings at this locus
further reinforce the importance of detailed analysis of this CNV.

Table 2-1 Chromosome X CNVs identified in 427 ASD cases.

Type of CNVs Analysis Results

Total CNVs Gain Loss

All Chromosome X 116 97 19
CNVs (M=89) (M=15)
(F=8) (F=4)
Autism Specific 54 47 7
(M=44) (M=3)
(F=3) (F=4)
Autism Specific 15 10 5
Stringent (M=8) (M=3)
(F=2) (F=2)

47
 48

Table 2-2 Autism Specific CNVs are listed. All genomic coordinates are based on hg17:
Build 35.

Gender Start Stop Length Call Method_Chip Cytoband

M 34,419 108,567 74,148 gain CNAG_Sty Xp22.33
M 34,419 159,978 125,559 gain CNAG_Sty Xp22.33
M 34,419 375,007 340,588 gain CNAG_Nsp Xp22.33
M 34,419 1,016,559 982,140 gain dChip_Sty Xp22.33
F 34,419 5,859,730 5,825,311 loss CNAG_Sty, Xp22.33,
dChip_Sty, Xp22.32,
CNAG_Nsp, Xp22.31
dChip_Nsp
M 11,496,818 13,241,465 1,744,647 gain CNAG_Sty Xp22.2
M 12,512,339 12,848,932 336,593 gain CNAG_Nsp Xp22.2
M 16,784,446 16,973,300 188,854 gain CNAG_Sty Xp22.2
M 19,943,694 21,501,963 1,558,269 gain CNAG_Nsp Xp22.12
M 20,399,305 20,579,609 180,304 gain CNAG_Nsp Xp22.12
M 22,793,958 24,734,469 1,940,511 gain CNAG_Nsp Xp22.11,
Xp21.3
M 22,962,800 23,119,000 156,200 loss dChip_Nsp_E Xp22.11
A,
dChip_Sty_EA
M 23,397,818 23,847,382 449,564 gain CNAG_Sty Xp22.11
M 25,516,263 25,620,400 104,137 loss CNAG_Nsp, Xp21.3
dChip_Nsp
,CNAG_Sty,
dChip_Sty
M 32,917,766 33,917,680 999,914 gain CNAG_Nsp Xp21.1
M 36,222,896 36,319,718 96,822 gain CNAG_Sty Xp21.1
M 38,250,331 38,371,333 121,002 gain dChip_Nsp, Xp11.4
CNAG_Nsp
M 38,490,148 41,130,651 2,640,503 gain CNAG_Nsp Xp11.4
M 39,837,594 40,393,087 555,493 gain CNAG_Sty Xp11.4
M 42,060,666 42,634,113 573,447 gain CNAG_Sty Xp11.4,
Xp11.3
M 44,395,900 45,060,800 664,900 gain dChip_Sty,CN Xp11.3
AG_Nsp,CNA
G_Sty,dChip_
Nsp
M 44,779,891 51,230,762 6,450,871
48 gain CNAG_Nsp Xp11.3,
Xp11.23,
Xp11.22
 49

F 48,073,600 52,716,966 4,643,366 gain dChip_Sty,CN Xp11.23,

AG_Sty,GEMC Xp11.22
A_Nsp+Sty,CN
AG_Nsp,dChi
p_Nsp
M 51,459,178 53,166,194 1,707,016 gain CNAG_Sty Xp11.22
F 65,488,795 65,801,228 312,433 loss CNAG_Nsp Xq12
M 65,591,616 65,696,889 105,273 gain CNAG_Nsp Xq12
M 78,334,183 79,401,607 1,067,424 gain CNAG_Nsp Xq21.1
M 79,200,454 83,135,188 3,934,734 gain CNAG_Sty Xq21.1
M 80,371,599 80,887,402 515,803 gain CNAG_Sty Xq21.1
M 81,444,763 82,211,554 766,791 gain CNAG_Nsp Xq21.1
F 83,866,300 92,175,100 8,308,800 loss dChip_Nsp_E Xq21.1,
A,dChip_Sty_ Xq21.2,
EA Xq21.31,
Xq21.32
M 85,144,362 86,633,742 1,489,380 gain CNAG_Nsp Xq21.2,
Xq21.31
M 87,452,050 87,595,200 143,150 gain CNAG_Sty,CN Xq21.31
AG_Nsp,dChi
p_Nsp
M 87,941,538 87,986,051 44,513 gain CNAG_Nsp Xq21.31
M 90,370,143 92,382,892 2,012,749 gain CNAG_Sty Xq21.31,
Xq21.32
M 90,965,080 91,396,910 431,830 gain CNAG_Nsp Xq21.31
M 95,626,658 97,930,570 2,303,912 gain CNAG_Sty Xq21.33
M 104,153,000 104,638,000 485,000 gain dChip_Nsp_E Xq22.3
A,dChip_Sty_
EA
M 109,904,707 109,994,757 90,050 gain CNAG_Nsp Xq23
M 112,066,070 112,473,368 407,298 gain CNAG_Nsp Xq23
F 112,325,000 113,213,000 888,000 loss dChip_Sty_EA Xq23
M 114,042,922 114,215,435 172,513 gain dChip_Nsp,CN Xq23
AG_Sty,CNAG
_Nsp,dChip_S
ty
M 125,043,881 125,731,339 687,458 gain CNAG_Nsp Xq25
M 130,406,000 130,695,499 289,499 gain dChip_Nsp,CN Xq26.2
AG_Nsp,CNA
G_Sty
M 130,637,670 133,185,428 2,547,758 gain CNAG_Sty Xq26.2
F 140,600,370 140,907,495 307,125 gain GEMCA_Nsp+ Xq27.2
Sty,CNAG_Ns

49
 50

p
M 142,561,000 142,682,000 121,000 loss CNAG_Sty,dC Xq27.3
hip_Nsp,CNA
G_Nsp
M 143,059,574 143,399,300 339,726 gain dChip_Nsp,CN Xq27.3
AG_Nsp
M 145,322,000 145,431,000 109,000 gain dChip_Sty Xq27.3
M 146,494,249 147,235,753 741,504 gain CNAG_Nsp Xq27.3,
Xq28
F 147,697,891 147,754,812 56,921 gain CNAG_Nsp Xq28
M 147,974,000 148,479,449 505,449 gain CNAG_Sty,dC Xq28
hip_Nsp,dChi
p_Sty
M 148,391,695 148,440,293 48,598 gain CNAG_Sty Xq28
M 152,846,293 154,411,193 1,564,900 gain CNAG_Nsp Xq28

50
 51

Table 2-3 Autism Specific Stringent CNVs.

Gender Start Stop Length Call Method_Chip
Cytoband
F 34,419 5,859,730 5,825,311 loss CNAG_Sty,dChip_Sty,CN
AG_Nsp,dChip_Nsp Xp22.33,
Xp22.32,
Xp22.31
M 22,962,800 23,119,000 156,200 loss dChip_Nsp_EA,dChip_Sty
_EA Xp22.11
M 25,516,263 25,620,400 104,137 loss CNAG_Nsp,dChip_Nsp,C
NAG_Sty,dChip_Sty Xp21.3
M 38,250,331 38,371,333 121,002 gain dChip_Nsp,CNAG_Nsp
Xp11.4
M 44,395,900 45,060,800 664,900 gain dChip_Sty,CNAG_Nsp,CN
AG_Sty,dChip_Nsp Xp11.3
F 48,073,600 52,716,966 4,643,366 gain dChip_Sty,CNAG_Sty,GE
MCA_Nsp+Sty,CNAG_Ns Xp11.23,
p,dChip_Nsp Xp11.22
F 83,866,300 92,175,100 8,308,800 loss dChip_Nsp_EA,dChip_Sty
_EA Xq21.1,
Xq21.2,
Xq21.31,
Xq21.32
M 87,452,050 87,595,200 143,150 gain CNAG_Sty,CNAG_Nsp,dC
hip_Nsp Xq21.31
M 104,153,000 104,638,000 485,000 gain dChip_Nsp_EA,dChip_Sty
_EA Xq22.3

M 114,042,922 114,215,435 172,513 gain dChip_Nsp,CNAG_Sty,CN Xq23

AG_Nsp,dChip_Sty

M 130,406,000 130,695,499 289,499 gain dChip_Nsp,CNAG_Nsp,C Xq26.2

NAG_Sty

F 140,600,370 140,907,495 307,125 gain GEMCA_Nsp+Sty,CNAG_ Xq27.2

Nsp

M 142,561,000 142,682,000 121,000 loss CNAG_Sty,dChip_Nsp,CN Xq27.3

AG_Nsp

M 143,059,574 143,399,300 339,726 gain dChip_Nsp,CNAG_Nsp Xq27.3

M 147,974,000 148,479,449 505,449 gain CNAG_Sty,dChip_Nsp,dC Xq28

hip_Sty

51
 52

2.3.2 Validation of Interesting Loci and Identification of autism candidate

genes
N=11 CNV regions of interest spanning positional and\or functional candidate genes were
selected for follow up (Table 2-4). Among these, six CNVs were gains and five CNVs were
losses. We attempted to validate these CNVs by qPCR, SNP calls and standard PCR (for
deletions in male probands). 10 out 11 CNVs were successfully confirmed; however, a 741kb
gain at Xp27.3-q28 (at FMR1) was not validated by qPCR. This CNV was possibly a false call.
We discovered a 167 Kb (chrX:23,114,179-23,281,723; NCBI Build 36) deletion spanning the
exon 1 and upstream region of patched domain containing 1 gene (PTCHD1, NM_ 173495.2) at
Xp22.11 (Figure 2-3). The deletion also spans a previously uncharacterized small non-coding
RNAs (nc-RNA), DA355362 (PTCHD1AS2). Initially, the deletion was validated by PCR
amplification of primers spanning the exon 1 sequence. PCR reaction failed to amplify in the
proband as well as in the affected dizygotic twin brother. To check the presence of this deletion
in other family members, qPCR assays were performed. Segregation analysis revealed that the
CNV was inherited from a carrier mother, leading to null PTCHD1 in the proband and his
dizygotic twin affected brother, an unaffected sister was a carrier (Figure 2-4). In silico analysis
suggests that PTCHD1 is an 888 amino acid long transmembrane protein containing a patched-
related domain with twelve transmembrane helices, highly related to the Hedgehog (Hh)
receptors PATCHED1 (PTCH1) and PTCH2 as well as to Niemann-Pick Type C1 protein
(NPC1). Hh is one of the key signaling pathways involved in the formation of the neural tube
and brain, specifically the differentiation of motor neurons ventrally and commissural
interneurons dorsally (11, 12). Mutations in Sonic Hedgehog, SHH (MIM 600725), have been
reported in patients with developmental abnormalities, delay in speech acquisition and learning
disabilities (13). Niemann-Pick disease type C1 is a disorder of cholesterol transport and
esterification, and involves neurological and intellectual deficits (MIM 257220). This led us to
investigate a possible role for PTCHD1 as a candidate gene for ASD and ID.

We therefore decided to explore a possible role for the PTCHD1 gene in the etiology of ASD
and ID; these studies and results are reported in Chapter 4 of this thesis.

In another autism patient, we identified an 82 Kb deletion within intron 5 of the IL1RAPL1 gene
which encodes the IL1RAPL1 protein, a member of the interleukin 1 receptor family (Figure 2-

52
 53

5), and known XLID gene (MIM #300143). The PCR primers from the deletion region failed to
amplify in the proband and an unaffected male sibling. The qPCR results showed that the
deletion was maternally inherited to male proband and an affected female sibling, as well as the
unaffected male sibling. The IL1RAPL1 gene has been previously implicated in NS-ID (Bahi et
al., 2003; Tabolacci et al., 2006). As reviewed above, there is a significant overlap between ID
and autism which makes it a good candidate gene for autism. Therefore, we explored this gene in
our autism cases, and the data is presented in Chapter 3 of this dissertation.

We also identified CNVs spanning two other members of the interleukin 1 receptor family,
namely the IL1RAPL2 and IL13RA2. A 485 Kb gain (chrX:104,153,000-104,638,000; NCBI
Build 34) spanned the exons 3-6 of IL1RAPL2 (Figure 2-6). We confirmed this CNV by qPCR
and the segregation analysis revealed that it was maternally inherited to the proband. We also
validated a 172 Kb duplication (chrX:114,042,922-114,215,435; NCBI Build 35) spanning the
entire IL13RA2 gene and at least 7 exons of LRCH2 (Figure 2-7). The segregation analysis
confirmed the maternal inheritance of this CNV.

Another interesting CNV, a 121 Kb duplication spanned the exons 2-7 of tetraspanin 7
(TSPAN7; also known as TM4SF2) gene (chrX:38,250,331-38,371,333; NCBI Build 35). The
distal breakpoint of this duplication mapped between the exon 1 and 2. We confirmed this CNV
by qPCR assays and segregation was found to be maternal. In addition to these CNV findings,
mutations in this gene have been previously reported to cause NS-ID (MRX58; MIM #300096)
(Abidi et al., 2002) which makes it a good candidate gene for ASD. We studied the possible
effect of this CNV on gene expression and performed the mutation screening of this gene in ASD
cases. The data is presented in the Chapter 3 of this dissertation.

We also detected a 505 Kb (chrX:147,974,000-148,479,449; NCBI Build 35) gain at Xq28

spanning the entire iduronate 2-sulfatase (IDS) gene and several other genes (Figure 2-9). The
qPCR assays confirmed this CNV and it was found to be maternally transmitted to the male
proband. The mutations in IDS cause mucopolysaccharidosis type 2 (MPS2) (MIM#309900) also
known as Hunter syndrome. Patients with Hunter syndrome present with skeletal defects, cardiac
abnormalities, hyperactivity, developmental delay and ID.

53
 54

Interestingly, we also discovered two large genomic imbalances, more than 4 Mb in size. A 5.8
Mb (chrX:34,419-5,859,730: NCBI Build 35) deletion mapped to Xp22.31-p22.33 (Figure 2-10).
This deletion spanned the NLGN4 and several other genes. The qPCR assay confirmed this CNV
and familial segregation revealed that it was a de novo loss in a female proband. The proximal
break point of this deletion mapped between the exon 2 and 3 of NLGN4. Mutations in NLGN4
gene have been reported to cause ID and\or ASD (Jamain et al., 2003), also Laumonnier et al,
2004).

A second large CNV, a 4.6 Mb (chrX:48,073,600-52,716,966; NCBI Build 35) gain mapped to
Xp11.22-p11.23 (Figure 2-11). The CNV was validated by qPCR and was found to be a de novo
imbalance in a female proband. The deleted region spanned more than 50 annotated genes.

We also analyzed two autism specific CNVs which do not encompass any known gene. The first
CNV, a 104 Kb deletion, mapped to Xp21.3 No annotated gene was directly disrupted by this
CNV. The PCR amplification of sequence within this CNV region failed in the male proband.
Subsequent, qPCR assays showed that deletion was inherited from mother to the affected son.
The second CNV was a 121 Kb loss at Xq27.3. This deletion was also maternally inherited to a
male proband and did not directly disrupt any known gene. Both these CNVs were not seen in
more than 1600 controls included in this study.

In conclusion, the present study has identified several candidate genes for autism. Our findings
underscore the importance of Chromosome X genes in the etiology of autism. More importantly,
we have demonstrated for the first time that several ID genes may also cause autism with or
without ID. These finding also confirm that in some cases autism and ID may share common
etiologies.

54
 55

Table 2-44 CNV regio

ons validatedd with qPCR
R

55
 56

Figure 2-3 Genomic region showing a 167 Kb deletion (blue line) at Xp22.11 which involves
Exon 1 of the PTCHD1 gene.

Figure 2-4 Pedigree showing the segregation of deletion at the PTCHD1 locus

56
 57

Figure 2-5 Genomic region showing an 82 Kb deletion (blue line) at Xp21.3 in intron 5 of
IL1RAPL1 gene.

57
 58

Figure 2-6 Genomic region showing a 485 Kb duplication (red line) at Xq22.3 which
involves the IL1RAPL2 gene.

Figure 2-7 Genomic region showing a 172 Kb duplication (red line) at Xq23 which involves
the IL13RA2 and LRCH2 genes.

58
 59

Figure 2-8 Genomic region showing a 121 Kb duplication (red line) at Xp11.4 which
involves the TSPAN7 gene.

59
 60

Figure 2-9 Genomic region showing a 505 Kb duplication (red line) at IDS locus (Xq28)

Figure 2-10 Genomic region showing a 5.8 Mb deletion (blue line) at X22.33-p22.31 which
involves the NLGN4 gene.

60
 61

Figure 2-11 Genomic region showing a 4.6 Mb duplication (red line) at Xp11.23-p11.22
which involves more than 50 RefSeq genes.

61
 62

2.4 Discussion
In present study, we characterized the CNVs on the X chromosome to identify autism
susceptibility genes. The X chromosome is of particular interest for mapping genes involved in
the etiology of autism and ID. Using high density SNP arrays, we identified 116 chromosome X
CNVs in 427 unrelated probands with autism. In contrast to genome-wide CNVs, where the
number of deletions and duplications were almost equal, on the chromosome X, number of
deletions was significantly lower than that of duplications (97 duplications and 19 deletions).
This may be due to the fact that males are hemizygous for chromosome X and deletions might
not be tolerated. After filtering out the CNVs present in controls, N=54 CNV were found to be
specific to autism. Among autism specific CNVs, N=15 were inferred by more than algorithm.

We attempted to identify autism candidate genes by characterizing the disease associated CNV
regions. One of our compelling findings was the identification of several CNVs directly
involving previously known syndromic or non-syndromic ID loci. For example, we identified an
85 kb intergenic deletion of IL1RAPL1, a member of interleukin 1 receptor family, previously
implicated in non-syndromic ID (Tabolacci et al., 2006). We also identified 485 kb duplication
in a closely related gene, IL1RAPL2. Another, 175 kb duplication was identified in IL13RA2,
another member of interleukin family. Based on these findings, we proposed the possible
involvement of these genes in autism (Marshall et al., 2008). Later studies further supported our
findings by reporting IL1RAPL1 mutations in autism. A study by Bhat et al reported a
pericentromeric inversion resulting in disruption of IL1RAPL1 gene in a patient with Autism and
ID (Bhat et al., 2008b). Piton et al sequenced the coding regions of IL1RAPL1 and IL1RAPL2 in
autism patients and identified a frameshift mutation in IL1RAPL1 in an autism patient. However,
they failed to identify any coding mutations in IL1RAPL2 (Piton et al., 2008).

We also identified a 121 Kb duplication spanning 5 exons of TSPAN7 gene. The protein encoded
by this gene is a cell surface glycoprotein which may control neurite outgrowth. This gene has
been previously implicated in non-syndromic XLID. First, Abidi et al reported a 2 bp deletion in
this gene in an ID patient (Abidi et al., 2002). Secondly, mutations in this gene was reported in 4
male patients with non-specific XLID (De, Frints, Borghgraef, & Fryns, 2002). Thus, TSPAN7 is
another gene originally implicated in XLID, and in our study we found a disease associated CNV

62
 63

also involving this gene. Based our findings, we proposed TSPAN7 as an autism candidate gene
(Marshall et al., 2008). Recently, a large scale sequencing study by Piton et al identified a
missense mutation in two autism patients in this gene, further supporting our findings (Piton et
al., 2010). The authors also sequenced 190 ethnically matched controls and could not identify
this variant in any of the controls. Interestingly, an identical missense variant has also been
reported by another group (Maranduba et al., 2004). In our study, we also sought to further
explore the contribution of this gene in etiology of autism. The details of experiments and results
are discussed in Chapter 3 of this thesis.

Another interesting CNV spanned exons 1 and 2 of the NLGN4 gene. This CNV was 5.8 Mb in
size and the proximal breakpoint of the CNV mapped between the exon 2 and 3 of NLGN4. The
CNV spanned more than 50 annotated genes. Although, NLGN4 is an obvious candidate, the loss
of other genes within this region may also contribute to the phenotype. Neuroligins are cell
adhesion molecules and play a crucial role in the synaptogenesis. NLGN4 was initially
indentified by characterizing a deletion breakpoint and further analysis discovered causative
mutations in this gene in ASD cases (Jamain et al., 2003). A later study identified a 2 bp deletion
in NLGN4 segregating with phenotype in a large French family. Interestingly, the mutation was
reported to cause ASD or ID or both in the affected individuals (Laumonnier et al., 2004). In our
own study, we were unable to identify any coding mutations among 196 probands with autism
(Vincent et al., 2004). Another, follow up study failed to find any NLGN4 mutation in French-
Canadian male autism patients (Gauthier et al., 2005). These findings may suggest that NLGN4
mutations are very rare, and may account for only a minor fraction of autism cases.

In addition to CNVs involving non-syndromic ID, we also uncovered genomic structural variants
spanning genes involved in syndromic forms of ID. For example, we detected a 505 kb
duplication spanning entire IDS gene. The IDS mutations are known to cause Hunter syndrome
(MIM#309900), also known MPS2. The Hunter syndrome involves multiple systems and
patients present with skeletal abnormalities, cardiac problems, hyperactivity, developmental
delay and ID (Beck, 2011).

Importantly, using our CNV data we also identified novel autism candidate genes such as
PTCHD1. We identified a 167 Kb deletion spanning the exon 1 and upstream regulatory regions

63
 64

of PTCHD1 gene. Additional analysis confirmed the maternal inheritance of this deletion to two
dizygotic twin brothers (Marshall et al., 2008). This was the first CNV mutation of this gene. We
also found the disruption of this can cause ID as well as ASD phenotype (Noor et al., 2010). The
details of our analysis of PTCHD1 are included in the Chapter 4 of this dissertation. Recently, a
study by Filges et al has identified a submicroscopic deletion of entire PTCHD1 gene in two
boys with ID (Filges et al., 2011). These findings further strengthen our claim that disruption of
PTCHD1 may cause autism or ID or both. Thus, PTCHD1 has emerged as another gene which
may cause autism and\or ID.

We have demonstrated here that a number of XLID genes may also play a role in etiology of
autism. Although, the overlap between autism and ID is very well established, it is unclear to
what degree they share common genetic etiologies.

64
 65

Chapter 3. Analysis of X-Linked Autism Candidate

Genes TSPAN7 & IL1RAPL1
Results of TSPAN7 CNV analysis and mutation screening are originally published in
Psychiatric Genetic (Appendix 2)

Noor A, Gianakopoulos PJ, Fernandez B, Marshall CR, Szatmari P, Roberts W, Scherer SW,
Vincent JB.

Copy number variation analysis and sequencing of the X-linked mental retardation gene
TSPAN7/TM4SF2 in patients with autism spectrum disorder.

Psychiatr Genet. 2009 Jun;19(3):154-5.

Contributions: For this manuscript, I performed the CNV validations, expression analysis and
mutation screening. I also prepared the initial draft of manuscript and performed subsequent
revisions. Gianakopoulos PJ helped with sequencing and preparation of manuscript.

65
 66

3.1 Introduction
CNV data analysis has allowed us to identify several autism candidate genes on the X
chromosome (discussed in Chapter 2). A substantial number of CNVs present in the human
genome are likely to affect gene expression if a gene(s) and/or regulatory region(s) is duplicated,
deleted or interrupted. This in turn, could contribute to human phenotypic differences, and may
cause disease or even embryonic lethality. However, many CNVs may result in loss of intronic
regions or duplication of a gene but have little or no effect on human phenotypic variation or
disease. Furthermore, CNV studies cannot determine if an intronic deletion or partial gene
duplication results in loss of normal expression of a gene. Therefore, we undertook further
characterization of some of the candidate loci to determine the effect of CNVs on gene
expression as well as attempting to sequence coding regions of these candidate genes to identify
additional cases with sequence mutations of these genes.

In this study, by performing a genome-wide scan of 427 unrelated probands with autism using
the 500K SNP microarray (Affymetrix), we reported several autism candidate genes, including
TSPAN7 and IL1RAPL1(Marshall et al., 2008). We selected these two genes to further explore
the possible contribution of these genes in the etiology of autism.

TSPAN7 maps to Xp11.4 and spans 127.4 Kb genomic region. It has eight exons and encodes a
249 AA protein which is a member of the transmembrane 4 superfamily, also known as the
tetraspanin family. Members of this protein family are cell-surface proteins that are characterized
by the presence of four hydrophobic domains. The TSPAN7 protein is a cell surface glycoprotein
that may have a role in the control of neurite outgrowth, and is also known to complex with
integrins (Berditchevski, 2001).

Previously, by characterizing the X chromosome breakpoint of an X;2 balanced translocation,

TSPAN7 (also known as TM4SF2) was found to be disrupted in a female patient with ID and
some autistic features (Zemni et al., 2000). Zemni et al also sequenced the coding regions of
TSPAN7 gene in additional families with ID and identified mutations in two families. A G218X
mutation was identified in one family which resulted in premature truncation of protein, thus
removing the fourth transmembrane segment and the carboxy-terminal domain. The second
mutation, P172H, resulted in substitution of a non-conserved amino acid. Additional studies have

66
 67

also reported several mutations in TSPAN7 in NS-XLID patients. For example, 2 bp deletion
(564delGT) in TSPAN7 was reported to segregate with ID in a family with NS-XLID (Abidi et
al., 2002).

Based on these observations and the identification of 121 Kb duplication involving exonic
sequences of this gene in our own study, we hypothesized that mutations in TSPAN7 might also
be present in a number of autistic patients. To test our hypothesis we sequenced the entire coding
region and splice sites of this gene in 250 unrelated probands with autism. We also attempted to
check the effect of this duplication on the expression of TSPAN7 mRNA.

The second autism candidate gene we have tested here is IL1RAPL1, which spans 1,368 Kb of
genomic DNA, contains 10 coding exons and encodes a protein of 696 AA. The IL1RAPL1 gene
has been previously implicated in XLID (Carrie et al., 1999a; Tabolacci et al., 2006). In an
extended pedigree with NS-XLID a W487X mutation was reported to cause premature truncation
which resulted in loss 210 amino acids of the cytoplasmic domain (Tabolacci et al., 2006). In
another patient with ID and autism, a pericentromeric inversion of the chromosome X was
reported to potentially disrupt the expression of IL1RAPL1 gene (Bhat et al., 2008a). This study
reported some autistic features associated with disruption of IL1RAPL1. At roughly the same
time, we also reported an intronic deletion in IL1RAPL1 in a patient and affected sibling with
autism (Marshall et al., 2008). To further investigate the involvement of IL1RAPL1 gene in
autism, we undertook the sequencing of all coding exons of this gene in 250 unrelated probands
with autism. We also attempted to test if the intronic deletion which we identified in the proband
with autism results in loss of expression of this gene.

67
 68

3.2 Methods
3.2.1 Samples
250 unrelated probands diagnosed with autism were checked for the coding mutations of
TSPAN7 and IL1RAPL1. These samples were from the same cohort used in the CNV study.
These families were recruited at three sites, namely, The Hospital for Sick Children, Memorial
University and McMaster University. ADOS and ADI-R Assessments were performed and all
probands met diagnostic criteria for ASD. Details of these samples are included in Chapter 2 of
this thesis.

3.2.2 PCR and Sequencing

PCR primers were designed using Primer3 software (http://frodo.wi.mit.edu/primer3/). Primer
sequences are provided in Table 3-1 for TSPAN7 and Table 3-2 for IL1RAPL1. These primers
were designed to amplify all coding exons and exon-intron boundaries, extending >50 bp into
intronic sequences both 5' and 3' to each exon.

PCR amplifications were performed using Qiagen Hot StarTaq Master Mix Kit (Cat. # 203446)
in a final volume of 12 l. PCR cycling conditions consisted of an initial denaturation step at
95C for 15 min, followed by 30 cycles of 95C for 45 sec, annealing at 57C for 45 sec and
elongation at 72C for 45 sec followed by final extension for 10 min at 72C.

DNA sequencing was performed in a 10 L final volume using Big Dye Terminator Ready
Reaction mix (Applied Biosystems), and data was generated using the ABI 3730 Genetic
Analyzer. Sequence chromatograms were checked for any sequence changes using the
DNASTAR SeqMan software (http://www.dnastar.com/).

3.2.3 Expression studies

To check the effect of CNVs in expression of TSPAN7 and IL1RAPL1, RNA was extracted from
the lymphoblastoid cells of the appropriate patients, and first-strand cDNA was synthesized by
standard methods. cDNA primers were designed to amplify exonic sequences. We first tested
these cDNA primers using human brain cDNA to ensure the PCR conditions were optimum for
the successful amplification. Next, we tested the expression of TSPAN7 and IL1RAPL1 genes in

68
 69

lymphoblast cDNA. Primer sequences for TSPAN7 are listed in Table 3-3 and those for
IL1RAPL1 are listed in Table 3-4.

Table 3-1 Primers used to amplify the coding regions and splice sites of TSPAN7.

EXON1-F CCCGGCTTTTTCAGTAGGAG

EXON1-R GAGGGGTCCCAGATTTGATT

EXON2-F TTTCTCGTTGCTCAGGGAAT

EXON2-R GCTGTGTTTGGGGTTGTTTT

EXON3-F CCAGATTTCTCCAGGTGAGC

EXON3-R CCCAAACACCCCTTAACTGA

EXON4-F CCCCTCCAGTAGGTCATTCA

EXON4-R CCAACCTACAGGCAGTCCAT

EXON5-F TTGACTCACCAAAGCTGCAC

EXON5-R AAAGCCAACACTCGCTGTCT

EXON6-F TAGGGGAAGGGTCATGTGTC

EXON6-R TATGCCAGCACGTTCTTCAG

EXON7-F AGTGCCCTTTCCCCATTTAC

EXON7-R CCTTCCCAGAACCACAGAA

69
 70

Table 3-2 Primers used to amplify the coding regions and splice sites of IL1RAPL1.

EXON1 NON-CODING, NOT SEQUENCED

EXON2-F ATTGCACCGATCATGTTTGA

EXON2-R CCACTAATGGCACATGTGTAGA

EXON3-F TGACCCAATATGGATGCTCA

EXON3-R AGACAACGGCTTTAGGCAAA

EXON4-F CCCTGTGGAATAAGTCAAGATACC

EXON4-R TGTCCCAGAATATAAGGCACAA

EXON5-F TGCAATTTTAGAAGCTTTTGTTTT

EXON5-R TCACCTATAGGAATCCACTTAGCA

EXON6-F TGAAAGTGAAAAATATTTGGGAAA

EXON6-R CAAATGGATTTAGCTGCGAGT

EXON7-F TGTTACCTGTCAGTTTGCCTAAAA

EXON7-R AACAGTGTTTTGCTTCTTTATCATT

EXON8-F CATCAGATTCGGATTCATCTACA

EXON8-R TCGGTGGCTCTAATGCAAAT

70
 71

EXON9-F ACCCGTTAACCCACATCTGA

EXON9-R TATACGAGCTGCTGCCATTG

EXON10-F AAATGGGACATTTGGAGACG

EXON10-R TTCATGTGAACACACAAAGACG

EXON11A-F AGGAGAAGCAAGTCCCAAACT

EXON11A-R GTGGCTAGAGCTGTGGAGGT

EXON11B-F GAACTCCAAGTTCTGGAAACG

EXON11B-R ACAGCAGCAGTCGAGGATTT

Table 3-3 Primer sequences used for qPCR validation and cDNA amplification of TSPAN7
duplication.

TSPAN7-QPCR1-F TGGGCAGTCAGTCTCTGTTG

TSPAN7- QPCR1-R GCATCAGCCTCCTGTATGGT

TSPAN7- QPCR2-F AAAGCCCAGTGGCATCATAC

TSPAN7- QPCR2-R CTGGGAGCAGGTCTCAAGTC

TSPAN7- CDNA1-F CGAGGAGAATGGAGACCAAA

CATACTGATTGGCCGTGATG
TSPAN7- CDNA1-R

TSPAN7- CDNA2-F CGAGGAGAATGGAGACCAAA

TGACGAAACACAAACCCTGA
TSPAN7- CDNA2-R

71
 72

Table 3-4 Primer sequences used for amplification of IL1RAPL1 cDNA.

IL1RAPL1-CNV1-F TGGGTGAAAATGACACTGGA
TCCGCTGTACCCAAAGAAAG
IL1RAPL1-CNV1-R

IL1RAPL1-CNV2-F GCTCCGATTCCACACTTGAT
AGGAGCTTGATGGTGTGCTT
IL1RAPL1-CNV2-R

IL1RAPL1-CNV3-F GAAGCCACCATTTCTTTTGG
TGACCACCAGCAGTACAAGG
IL1RAPL1-CNV3-R

3.3 Results
3.3.1 TSPAN7
We identified a ~121 Kb duplication (ChrX 38,250,331 to 38,371,333 (UCSC 2004) flanked by
SNPs rs5917211 and rs5917628. The duplication included 12 SNPs on the NspI and StyI
Affymetrix microarray, spanned exons 2-8 of TSPAN7 and was not present in a control cohort of
1652 samples. This CNV call was validated by performing SYBR Green-I based quantitative
Real-Time PCR and it was observed that this CNV gain was inherited in the affected male
proband from his unaffected mother. To ascertain a possible effect of this CNV on gene
expression of TSPAN7, we first checked the expression of TSPAN7 mRNA in lymphoblast
cDNA from normal individuals and found a moderate expression. Next, we amplified and
sequenced TSPAN7 mRNA procured from Epstein Barr virus-transformed lymphoblasts from the
proband. RT-PCR revealed a normal size transcript was expressed in the patient, and no change
in mRNA sequence was observed (Figure 3-1). These results indicated that this CNV gain does
not disrupt the expression or coding sequence of the TSPAN7 gene. To further investigate the

72
 73

potential involvement of TSPAN7 in the etiology of autism, we sequenced the entire coding
region and exon-intron boundaries of TSPAN7 in a cohort of 250 (210 male and 40 female)
unrelated autistic probands. Analysis of sequencing data revealed no coding mutations in any of
the 250 subjects.

Figure 3-1 Agarose gel shows the amplification of TSPAN7 cDNA (bands) using
lymphoblast RNA of patient with intragenic duplication of TSPAN7. (A) 732 bp PCR
product shows the amplification of TSPAN7 cDNA containing Exons 1-7. (B) 381 bp PCR
product shows the amplification of Exons 1-3 of TSPAN7 cDNA

A B

73
 74

3.3.2 IL1RAPL1
In another male autism patient, we identified an intronic 82 Kb deletion in the IL1RAPL1 gene.
Deletion was initially validated by performing PCR using primers within the deleted region and
it failed to amplify in the proband and unaffected male sibling (Figure 3-2). To investigate the
segregation of this CNV, qPCR was performed. qPCR results confirmed that the deletion was
maternally inherited to the male proband, female affected sibling and a male unaffected sibling.
We attempted to investigate if this intronic deletion resulted in the loss of normal expression of
this gene, however, the expression of this gene was not detected in the lymphoblast. Therefore,
we were unable to check the effect of IL1RAPL1 deletion in this family.

Mutation screening of all coding regions of IL1RAPL1 was performed using DNA from 250
unrelated probands with autism. The mutation analysis unveiled three rare variants, one coding
non-synonymous variant, one coding synonymous variant and an intronic variant.

The non-synonymous variant c.G349T resulted in the substitution of Alanine to Serine at amino
acid position 113. Segregation analysis revealed that the mutation was maternally inherited to
male proband and was not transmitted to unaffected male sibling (Figure 3-3). The Alanine
residue at position 113 is highly conserved (Figure 3-4) and this variant was not seen in 48
unrelated controls sequenced in the ExoSeq project (http://www.sanger.ac.uk/cgi-
bin/humgen/exoseq/exoseqview). Furthermore, this variant was not identified in additional 276
control chromosomes (Piton et al., 2008).

A synonymous C to T variant was also identified in the proband with autism. Additionally, a G
to A change in intron 5 was also observed in two unrelated probands. This variant was 30 bp
upstream of exon 6 and is not predicted to have any effect on splicing.

74
 75

Figure 3-2
3 PCR amplification using
u primeers in the deeleted region
n.

Figure 3-3 ws a C to T substitution at cDNA nucleotide position

3 Chromattogram show p 3499.
Pedigreee shows the maternal in
nheritance of
o the varian
nt to the maale proband
d.

75
 76

Figure 33-4 Conserva

ation of Alaanine residu
ue at position 113 in thee IL1RAPL1 protein.

76
 77

3.4 Discussion
In this chapter, we studied two autism candidate genes TSPAN7 and IL1RAPL1 by employing
two different approaches, namely the investigation of effect of a CNV at the mRNA level, and
screening for point mutations by direct DNA sequencing to identify additional cases with
mutation within these genes.

Disruption of the TSPAN7 by a balanced translocation and sequence mutations of this gene
implicated it in the etiology of XLID (Zemni et al., 2000). Another study reported a two bp
deletion in this gene in patients with XLID, thus, further supporting the role of this gene ID
(Abidi et al., 2002). In our own study, we identified a 121 Kb gain partially spanning the
TSPAN7 (Marshall et al., 2008). In a recent study, duplication of similar region was reported in
two patients, one with syndromic and the other with non-syndromic intellectual disability
(Froyen et al., 2007). We hypothesized that TSPAN7 may play a role in the etiology of autism
and the partial gene duplication identified in proband with autism may result in disruption of this
gene. To test this hypothesis, expression analysis of TSPAN7 was performed on lymphoblast
cDNA of the proband with partial gene duplication of this gene. However, our PCR and
sequencing results confirmed the expression of the normal transcript. Thus, the CNV does not
directly disrupt the expression of this gene in our proband and may represent a rare benign CNV.
A possible reason could be that the duplicated region may not necessarily be directly in tandem
with the normal genomic region. Recently, duplication of this region has also been reported in
male and female healthy individuals, thus supporting our findings that this CNV is likely a rare,
benign variant which is not associated with a phenotype (Cai et al., 2008). Nonetheless, the null
result of the TSPAN7 CNV further emphasizes the importance of validating possible CNV
effects at the mRNA level to establish a contribution to disease.

Furthermore, by direct DNA sequencing, we were unable to identify any sequence mutations in
250 unrelated probands with autism. Our results indicate that coding mutations in TSPAN7 are
not associated with our cohort of autism patients. However, the involvement of TSPAN7
mutations in a very small fraction of autism patients cannot be excluded and further studies are
required to investigate if genetic variants in non-coding regions of this gene are involved in the
increased risk or etiology of autism. Altogether, our findings exclude the involvement of
TSPAN7 sequence variants in most cases of autism.

77
 78

In this study, we also investigated the role of IL1RAPL1 in the pathogenesis of autism by
studying the effect of an intronic deletion in this gene, as well as by sequencing the coding
regions of this gene in 250 unrelated probands with autism. Large deletions resulting in
contiguous deletion syndromes initially suggested that deletion of the IL1RAPL1 gene might be
responsible for the ID phenotype in those patients (Jin, Gardner, Viswesvaraiah, Muntoni, &
Roberts, 2000). In 2006, a truncating mutation in IL1RAPL1 gene was reported in four affected
males, thus, confirming the role of this gene in etiology of XL-NSID (Tabolacci et al., 2006).
These studies established that mutations in this gene are associated with XL-NSID. We
discovered a 82 Kb deletion in intron 5 of IL1RAPL1 and proposed that this gene may also play a
role in etiology of autism (Marshall et al., 2008). At the same time, another study reported a
pericentromeric inversion of the X chromosome in a patient with intellectual disability and
autism which resulted in disruption of IL1RAPL1 (Bhat et al., 2008a).

Here, we explored further the association of this gene with autism. We first attempted to observe
the effect of the intronic deletion in our patient on the expression of IL1RAPL1, however we
were unable to amplify IL1RAPL1 mRNA from the lymphoblast cDNA due to the extremely low
level of expression of the gene in this tissue. Segregation analysis showed the CNV was
maternally transmitted to the male proband and an affected female proband. However, deletion
was also seen in unaffected male sibling, therefore, did not segregate with the phenotype,
consequently, it is likely to represent a benign rare variant. On the other hand, the presence of
IL1RAPL1 deletion in the male sibling without a phenotype could also be explained by
incomplete penetrance. Alternately, it can also be explained by the Threshold Model of relative
contribution for neuropsychiatric disorders (Cook, Jr. & Scherer, 2008), where, this CNV alone
may not have substantial effect to express phenotype and may require additional genetic
mutations at other loci to cross the threshold to demonstrate phenotype.

Mutation screening of IL1RAPL1 discovered three new variants among 250 autism patients. One
synonymous variant is likely a rare benign variant as it does not alter the amino acid. The
intronic variant identified in another proband is 30 bp upstream of exon 5, and hence, does not
directly involve the splice site. The best way to check the effect of this variant, if any, on the
splicing of IL1RAPL1 mRNA would the expression analysis but our ability to perform such
experiments was limited by the lack of expression of this gene in lymphoblasts.

78
 79

The third variant resulted in substitution of a conserved Alanine residue at position 113 to Serine.
The mutation was maternally inherited to male proband but was not inherited to an unaffected
male sibling, therefore segregated with the phenotype. Moreover, this mutation is within the
extracellular domain of protein and was not observed in more than 300 control chromosome
which further strengthened the causal role of this variant. However, further functional studies are
required to determine if this variant is pathogenic. Interestingly, in this proband, in addition to
the IL1RAPL1 sequence mutation, we also identified a de novo duplication partially spanning the
DLGAP2 (Marshall et al., 2008). DLGAP2 protein is predicted to be involved in the
organization of synapses and in neuronal cell signaling, and this gene has recently been reported
as an autism candidate (Pinto et al., 2010). These finding can be explained by the model of
relative contribution to the susceptibility to autism where more than one genetic variant may be
required to express the phenotype (Cook, Jr. & Scherer, 2008).

In summary, our data indicate that the TSPAN7 duplication and sequence mutations are not
associated with cases of autism; however, contribution of this gene in a small fraction of cases
cannot be excluded due to limitation of sample size of this study. We also provide further
evidence for involvement of IL1RAPL1 in the pathogenicity of autism. Our data highlights the
genetic overlap between autism and ID, therefore, studies of other ID genes in autism may imply
some of these genes in autism phenotype.

79
 80

Chapter 4. Disruption at the PTCHD1 locus on Xp22.11

in autism spectrum disorder and intellectual disability

Origionally published in Science Translational Medicine (Appendix 3)

Noor A, Whibley A, Marshall CR, Gianakopoulos PJ, Piton A, Carson AR, Orlic-Milacic M,
Lionel AC, Sato D, Pinto D, Drmic I, Noakes C, Senman L, Zhang X, Mo R, Gauthier J, Crosbie
J, Pagnamenta AT, Munson J, Estes AM, Fiebig A, Franke A, Schreiber S, Stewart AF, Roberts
R, McPherson R, Guter SJ, Cook EH Jr, Dawson G, Schellenberg GD, Battaglia A, Maestrini E;
Autism Genome Project Consortium, Jeng L, Hutchison T, Rajcan-Separovic E, Chudley AE,
Lewis SM, Liu X, Holden JJ, Fernandez B, Zwaigenbaum L, Bryson SE, Roberts W, Szatmari P,
Gallagher L, Stratton MR, Gecz J, Brady AF, Schwartz CE, Schachar RJ, Monaco AP, Rouleau
GA, Hui CC, Lucy Raymond F, Scherer SW, Vincent JB.

Disruption at the PTCHD1 Locus on Xp22.11 in Autism spectrum disorder and intellectual
disability.

Sci Transl Med. 2010 Sep 15;2(49):49ra68.

Contributions: For this manuscript, I performed the CNV validations, segregation analysis,
sequencing, multiple tissue expression analysis and cloning experiments. I also prepared the
initial draft of manuscript and performed subsequent revisions. Microarray analysis, sequencing
of additional cohorts, phenotypic analysis and functional studies of Hedgehog Signaling pathway
were performed by our collaborators.

80
 81

Running title: PTCHD1, mutations in autism and intellectual disability.

Abdul Noor1, Annabel Whibley2, Christian R. Marshall3, Peter J. Gianakopoulos1, Amelie

Piton4, Andrew R. Carson3, Marija Orlic-Milacic1, Anath Lionel3, Daisuke Sato3, Dalila Pinto3,
Irene Drmic5, Carolyn Noakes5, Lili Senman5, Xiaoyun Zhang6, Rong Mo6, Julie Gauthier4,
Jennifer Crosbie7, Alistair T. Pagnamenta8, Jeffrey Munson9, Annette M. Estes10, Andreas
Fiebig11, Andre Franke11, Stefan Schreiber11,12, Alexandre F.R. Stewart13, Robert Roberts13, Ruth
McPherson13, Stephen J. Guter14, Edwin H. Cook Jr14, Geraldine Dawson15, Gerard D.
Schellenberg16, Agatino Battaglia17, Elena Maestrini18, Autism Genome Project Consortium,
Linda Jeng19, Terry Hutchison20, Evica Rajcan-Separovic21, Albert E. Chudley22, Suzanne M.E.
Lewis23, Xudong Liu24, Jeanette Holden24, Bridget Fernandez25, Lonnie Zwaigenbaum26, Susan
E. Bryson27, Wendy Roberts5, Peter Szatmari28, Louise Gallagher29, Michael R. Stratton30, Jozef
Gecz31, Angela F. Brady32, Charles E. Schwartz33, Russell J. Schachar7, Anthony P. Monaco8,
Guy A. Rouleau4, Chi-chung Hui6,34, F. Lucy Raymond2, Stephen W. Scherer3,34, John B.
Vincent1,35

1
Neurogenetics Section, Centre for Addiction and Mental Health, Toronto, Ontario, Canada;

2
Cambridge Institute of Medical Research, University of Cambridge, Cambridge, UK;

3
Program in Genetics and Genome Biology and The Centre for Applied Genomics, The Hospital
for Sick Children, Toronto, Ontario, Canada;

4
Center of Excellence in Neuromics, Centre Hospitalier de l'Universit de Montral, and
Department of Medicine, University of Montreal, Montreal, Quebec, Canada;

5
Autism Research Unit, The Hospital for Sick Children, Toronto, Ontario, Canada;

6
Program in Developmental & Stem Cell Biology, The Hospital for Sick Children, Toronto,
Ontario, Canada;

7
Department of Psychiatry, Neurosciences and Mental Health, The Hospital for Sick Children,
Toronto, Ontario, Canada;

8
Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, UK;

81
 82

9
Department of Psychiatry and Behavioral Sciences, University of Washington, Seattle,
Washington, USA;

10
Department of Speech and Hearing Sciences, University of Washington, Seattle, Washington,
USA;

11
Institute for Clinical Molecular Biology, Christian-Albrechts-University and Biobank popgen,
Kiel, Germany;

12
Dept. of Internal Medicine, University of Kiel, Kiel, Germany;

13
University of Ottawa Heart Institute, Ottawa, Ontario, Canada;

14
Laboratory of Developmental Neuroscience, University of Illinois at Chicago, Chicago,
Illinois, USA;

15
Autism Speaks, New York, NY, and Department of Psychiatry, University of North Carolina,
Chapel Hill, North Carolina, USA;

16
Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania,
USA;

17
Stella Maris Institute for Child and Adolescent Neuropsychiatry, Calambrone, Pisa, Italy

18
Department of Biology, University of Bologna, Bologna, Italy;

19
Department of Laboratory Medicine, University of California, San Francisco, San Francisco,
California, USA;

20
Department of Neurology, University of California San Francisco, San Francisco, California,
USA

21
Department of Pathology (Cytogenetics), Children's and Women's Health Centre of BC,
Vancouver, British Columbia, Canada;

22
Program in Genetics and Metabolism, Children's Hospital, Winnipeg, Manitoba, Canada;

82
 83

23
Department of Medical Genetics, UBC, Vancouver, BC, Canada

24
Depts. Psychiatry and Physiology, Queen's University, Ontario, Canada;

25
Disciplines of Genetics and Medicine, Memorial University of Newfoundland, St Johns,
Newfoundland, Canada;

26
Department of Psychiatry, University of Alberta, Edmonton, Alberta, Canada;

27
Departments of Pediatrics and Psychology, Dalhousie University, Halifax, Nova Scotia,
Canada;

28
Department of Psychiatry and Behavioural Neurosciences, McMaster University, Hamilton,
Ontario, Canada;

29
Neuropsychiatric Genetics Research Group, Trinity Centre for Health Sciences, Trinity College
Dublin, Dublin, Ireland;

30
Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus Hinxton, Cambridge, UK;

31
SA Pathology, Womens and Childrens Hospital, North Adelaide and The University of
Adelaide, Australia;

32
North West Thames Regional Genetic Centre, Northwick Park Hospital, Harrow, UK;

33
JC Self Research Institute, Greenwood Genetic Center, Greenwood, South Carolina, USA;

34
Department of Molecular Genetics, University of Toronto, Toronto, Ontario, Canada;

35
Department of Psychiatry, University of Toronto, Toronto, Ontario, Canada;

See supplementary text for full list of names and affiliations;

Correspondence should be addressed to: J.B.V. ([email protected]); or to S.W.S.

([email protected]).

83
 84

4.1 Abstract
Autism is a common neurodevelopmental disorder with a complex mode of inheritance. It is one
of the most highly heritable of the complex disorders, however, the underlying genetic factors
remain largely unknown. Here, we report mutations in the X-chromosome PTCHD1 (patched-
related) gene, in seven families with autism spectrum disorder (ASD) and in three families with
intellectual disability (ID). A 167 Kb microdeletion spanning exon 1 was found in two brothers,
one with ASD the other with learning disability and ASD features, and a 90 Kb microdeletion
spanning the entire gene was found in three males with ID in a second family. In 900 ASD and
208 ID male probands we identified seven different missense changes in eight probands, all male
and inherited from unaffected mothers, and not found in controls. Two of the ASD individuals
with missense changes also carried a de novo deletion at another ASD-susceptibility locus
(DPYD and DPP6), suggesting complex genetic contributions. In additional males with ASD, we
identified deletions in the 5 flanking region of PTCHD1 disrupting a complex non-coding RNA
and potential regulatory elements; equivalent changes were not found in male control individuals
(p=1.2 x10-5). Systematic screening at PTCHD1 and 5-flanking regions, suggests involvement
of this locus in ~1% of ASD and ID individuals.

4.2 Introduction
Autism (MIM 209850) is a severe, lifelong neurodevelopmental disorder characterized by
impairments in communication and socialization, and by repetitive behavior. Recent studies of
sub-microscopic genomic copy number variation (CNV) have identified several loci associated
with Autism Spectrum Disorder (ASD; MIM 209850) (Szatmari et al., 2007; Sebat et al., 2007).
De novo CNVs associated with ASD have been reported in ~7% of simplex families and ~2% of
multiplex families (Sebat et al., 2007; Marshall et al., 2008). CNV studies have also led to the
identification of autism candidate genes such as SHANK3 (MIM 606230) and NRXN1 (MIM
600565) (Szatmari et al., 2007; Durand et al., 2007; Moessner et al., 2007). Intellectual disability
(ID) is frequently associated with autism (in up to ~30% of cases for ASD, and ~67% for autism)
(Chakrabarti & Fombonne, 2005). Moreover, mutations in several X-linked ID (XLID) genes
(e.g. NLGN4 and IL1RAPL1) have been shown to result in an autistic phenotype, which suggests
that autism and ID may often share a common genetic etiology (Marshall et al., 2008; Jamain et

84
 85

al., 2003; Laumonnier et al., 2004; Bhat et al., 2008a; Piton et al., 2008). We previously reported
a 167 Kb microdeletion of exon 1 of PTCHD1 (NM_ 173495.2) on chromosome Xp22.11
(Marshall et al., 2008). PTCHD1 has three exons spanning ~62 Kb and it is predicted to encode a
protein of 888 amino acids. In silico analysis suggests that PTCHD1 is a transmembrane protein
containing a patched-related domain with twelve transmembrane helices, highly related to the
Hedgehog (Hh) receptors PATCHED1 (PTCH1) and PTCH2 as well as to Niemann-Pick Type
C1 protein (NPC1). Hh is one of the key signaling pathways involved in the formation of the
neural tube and brain, specifically the differentiation of motor neurons ventrally and
commissural interneurons dorsally (Jessell, 2000; Jacob & Briscoe, 2003). Mutations in Sonic
Hedgehog, SHH (MIM 600725), have been reported in patients with developmental
abnormalities, delay in speech acquisition and learning disabilities (Hehr et al., 2004). Niemann-
Pick disease type C1 also involves neurological and intellectual deficits (MIM 257220). This led
us to investigate a possible role for PTCHD1 as a candidate gene for ASD and ID.

Further to the initial CNV-screening ASD cohort (Marshall et al, 2008), we have now analyzed
CNV screening data for a cohort of ID subjects, as well as cohorts of unaffected subjects, and,
where CNVs have been identified at the PTCHD1 locus, we have validated and characterized the
CNVs and their inheritance in the families. This screening identified a second deletion at
PTCHD1, segregating among males in a family with ID. This finding also prompted screening of
additional ASD cohorts for CNVs at the PTCHD1 locus. We also screened a proportion of the
cases and controls for coding mutations within PTCHD1 (see table S5 for details on cohorts
studied). Preliminary functional evidence for the PTCHD1 protein is consistent with a role in Hh
signaling.

4.3 Results
4.3.1 CNV Analysis of PTCHD1
We characterized the precise breakpoints of the 167 Kb deletion at PTCHD1 identified in
the male proband from Family 1. This CNV also disrupts long, spliced non-coding RNAs
(ncRNAs) on the opposite strand, but no other coding genes were interrupted (Figure 4-1). The
deletion was validated in the family using both PCR and SYBR-Green I-based real-time
quantitative PCR (qPCR) and was found to be transmitted from a heterozygous unaffected

85
 86

mother to two affected dizygotic twin sons, also to an unaffected daughter (Figure 4-2). X-
chromosome inactivation (XCI) analysis of the mother, carrier of the PTCHD1 deletion, revealed
a highly skewed allelic ratio of 94:6.

To assess the possible involvement of CNVs disrupting X-chromosomal genes in the etiology of
ID, we initially screened 246 males with intellectual disability and probable X-linked inheritance
using a custom-designed NimbleGen 385K array with probes targeting the X chromosome. A 90
Kb deletion encompassing the entire PTCHD1 gene and 5 exons of the ncRNAs (but no other
known coding genes) was found in a male ID patient (Family 2). The deletion was validated
using qPCR revealing that the deletion was maternally inherited in two affected brothers and
their affected uncle (Figure 4-2). XCI analysis revealed allele ratios of 51:49 and 75:25 from
lymphocytes of 2 obligate female carriers.

Subsequent to the ascertainment of these cohorts, an additional case of ID with dysmorphic

features was referred to us through cytogenetic services at the University of California, San
Francisco, California, USA. CNV analysis with a custom designed 105K microarray identified a
146 kb deletion in this patient which spans PTCHD1 exon 1 and upstream regions
(chrX:23,146,927-23,293,273, hg18).

4.3.2 Mutation Screening of PTCHD1

In order to identify additional cases with PTCHD1 mutations, we sequenced the coding regions
in 900 (M=723; F=177) unrelated ASD cases and 225 unrelated male ID cases. Seven missense
changes were identified in six unrelated probands with ASD and two ID probands (Figure 4-2;
Figure S 4-1 & Figure S 4-2; table S1). All of these variants, which resulted in the substitution of
highly conserved amino acids, were inherited from unaffected carrier mothers (Figure S 4-1). In
six of the eight families the missense variants appear to segregate with the phenotype, however
in Family 6 L73F did not segregate, and in Family 7 the A470D did not segregate in different
loops (not shown) of the extended pedigree (see Figure 4-2 and table S1 for details).

We sequenced the entire coding region of PTCHD1 in 700 control individuals (M=531 F=169),
and none of the missense changes identified from among the ASD and ID patient cohorts has
been detected. Only two missense changes have been identified: P252L from amongst our

86
 87

controls, and N497K reported in the SNP database (rs35880456, in 1 out of 39 screened; NCBI)
(2010b), both in females who were heterozygotes. Altogether, absence of PTCHD1 missense
variants indicates that these variants are significantly enriched in the males with ASD (6/723
male ASD versus 0/531 male control: Fishers exact test: p =0.042) and may contribute to the
phenotype.

Additional controls were sequenced for the exons in which missense mutations were identified.
We tested control chromosomes for the sequence underlying the I173V and V195I mutations
(N=1101 chromosomes), the ML336_337II mutation (N=1193), and the L73F, E479G, A470D
and H359R mutations (N=869) and detected none of these variants.

4.3.3 CNVs upstream of PTCHD1 (PTCHD1AS1/PTCHD1AS2 locus)

Additionally, from a study of 996 ASD families examined with the Illumina 1M BeadChip
(Pinto et al., 2010), we identified eight deletions in probands or affected siblings, and a ninth in a
father with a diagnosis of Broad Autism Phenotype (BAP) (Hurley et al., 2007; Constantino &
Todd, 2005), all occurring 5' of PTCHD1, and overlapping with an anti-sense non-coding RNA,
PTCHD1AS1/PTCHD1AS2 (Figure 4-1). A tenth deletion at this upstream locus was identified in
a patient from a CNV study of 167 unrelated attention deficit-hyperactivity disorder (ADHD)
patients. The ADHD proband with the deletion also has a BAP diagnosis. These deletions were
validated with qPCR and exact breakpoints were mapped (table S2). Additional CNV data for
these 10 individuals are included in table S3.

We analyzed SNP microarray data from 10,246 control individuals (4,829 male; 5,417 female),
for CNVs at PTCHD1 and the upstream region. In a 1.4-Mb region spanning from PTCHD1 to
adjacent genes PRDX4 (proximal) and ZNF645 (proximal), we identified 15 CNVs (7
duplications and 8 deletions); however, it is notable that only 1 male control with a deletion was
identified, which was 20.6 Kb in length and did not disrupt any known exons of any genes or
non-coding RNAs, or any of the identified conserved or putative regulatory sequences. The
remaining 7 deletions were all identified among female controls, consistent with the X-linked
recessive inheritance observed for the PTCHD1 mutations. Thus, PTCHD1 and upstream

87
 88

deletions were not observed in 4,829 male controls, or in the Database of Genomic Variants
(Iafrate et al., 2004), which suggests that the CNV directly disrupting PTCHD1 and the 6 CNVs
located just upstream in unrelated ASD probands are associated with autism (male ASD cases
N=7, out of 1,185; male controls N=0 out of 4,829; Fishers exact test: p =1.2x10-5).

Subsequently, an additional case with ID and with a number of other clinical features was
referred to us from Dr. A.E. Chudley, Childrens Hospital, Winnipeg and Dr. Evica Rajcan-
Separovic at Children's and Women's Health Centre of BC, Vancouver, BC. This family has a
maternally inherited 112 kb deletion upstream of PTCHD1, including DDX53 and at least one
exon of PTCHD1AS1 (chrX:22,819,116-22,931,588, hg18).

4.3.4 Expression and Functional Studies of PTCHD1

Expression analysis for the PTCHD1 and the ncRNA transcripts suggests that they are
transcribed in brain regions, notably the cerebellum, as well as in other tissues (Figure 4-3 and
Figure S 4-3). RNA in situ hybridization of Ptchd1 in mouse showed widespread expression in
the developing brain from E9.5/10.5 to P1 (Figure 4-4a), as well as broad expression in the adult
mouse brain (6 months), with highest density in the cerebellum (see Allen brain atlas online
(2010a)).

To investigate its function, we studied the sub-cellular localization of PTCHD1 and found that a
PTCHD1-GFP fusion protein predominantly localizes to the cell membrane (Figure 4-4b). We
further hypothesized that PTCHD1 may function in the Hh-signaling pathway and have similar
functional attributes as PTCH1 and PTCH2. We performed a Gli-dependent transcription assay
in Hh-responsive 10T1/2 cells to test whether PTCHD1 could interfere with Hh signaling. In
10T1/2 cells, overexpression of PTCH1 or PTCH2 inhibits transcription from a Gli-luciferase
reporter containing multiple copies of the Gli protein-binding site in the presence of Smoothened
agonist purmorphamine (Sinha & Chen, 2006) (Figure 4-4c) or Gli2 (Figure S 4-4). Similar to
PTCH proteins, PTCHD1 also exerted a statistically significant inhibitory effect in these assays
suggesting that PTCHD1 functions in the Hedgehog signalling pathway.

88
 89

4.4 Discussion
We have identified microdeletions that directly disrupt the PTCHD1 gene in males in three
families affected with either ASD, ID or learning disability. These deletions are maternally
inherited and were not observed in more than 10,000 controls, indicating that these alterations
are associated with ASD and ID. We also report seven maternally inherited missense mutations
in eight male probands. These variants were not seen in more than 500 controls, further
supporting a possible role of this gene in autism and ID.

In addition, we have found another 11 deletions that map to regions upstream of PTCHD1. The
region 5 and distal to PTCHD1 is relatively gene poor. Within this upstream region, a coding
gene, DDX53, encoding DEAD Box 53, lies ~335 Kb 5 to PTCHD1. Five of the 11 upstream
deletions span DDX53. However, based on the function of the DDX53 protein and the expression
pattern of this gene (which is restricted mainly to testis and tumor cells (Cho et al., 2002)), it is
unlikely to contribute to the ASD or ID phenotype. Additionally, within the gene-poor region
between PTCHD1 and DDX53, there is a putative pseudogene of FAM3C, FAM3C2, which is
disrupted by five of the 10 upstream deletions. FAM3C, a cytokine-like gene on 7q31.31,
consists of 10 exons (Zhu et al., 2002) whereas FAM3C2, although 99% identical, has no
intron/exon structure and is interrupted by a short interspersed nuclear element (SINE). It
appears to have inserted on Xp22 after human/chimp evolutionary divergence. Since no mRNA
or EST matches exactly to FAM3C2, it is most likely an untranscribed processed pseudogene.

We examined the region just distal to PTCHD1 in detail and identified a number of putative
enhancer and promoter sequences, as well as conserved (and putative regulatory) elements
(Figure 4-1). We also identified several overlapping spliced long (>200nt) non-coding (nc)
RNAs (PTCHD1AS1 (from cDNA clone IMAGE:1560626; BX115199) and PTCHD1AS2 (from
cDNA clone BRSTN2000219; DA355362)), which map to the opposite strand and distal to
PTCHD1 (see Figure 4-1). 5RACE (Rapid Amplification of cDNA Ends) shows that a number
of splice variants of these transcripts originate at the CpG island just upstream of PTCHD1,
encompassing its putative promoter. Similar antisense transcripts are present at syntenic loci in
other mammalian species, at least two exons of which appear to be conserved between rat,
mouse and humans (Figure 4-1).

89
 90

Although these ncRNAs do not appear to encode protein, they may serve as regulators for other
coding genes, particularly for PTCHD1, since the 5 exons are adjacent on opposite strands.
Such ncRNAs may regulate expression of a coding transcript on the opposite strand through a
number of mechanisms, including modification of chromatin, transcriptional regulation and post-
transcriptional modification (Mercer, Dinger, & Mattick, 2009; Kleinjan & van, V, 2005).

All 11 of the upstream deletions as well as the three PTCHD1 deletions (Families 1 and 2)
disrupt conserved (and putative regulatory) sequences and/or exons of these ncRNAs (see Figure
4-1). These deletions were not inherited by a subset of the affected family members; also, the
missense variants do not segregate with disease in two families (Families 6 & 7) (Figure 4-2).
These findings are similar to other previously reported major affect ASD loci such as 16p11.2
(Weiss et al., 2008) and are also consistent with the complex, non-Mendelian inheritance
believed to control the etiology of autism. As discussed in a recently proposed threshold model
of relative contribution in ASD (Cook, Jr. & Scherer, 2008), it is anticipated that multiple
common and rare variants may act in concert to generate the phenotype. For instance, under this
model, some de novo CNVs may be solely sufficient to cause ASD. Conversely, other de novo
CNVs may have weaker effects, requiring contributions from additional loci (for example
additional risk haplotypes, or other CNVs), or environmental risk factors, for the burden of
contributory factors to cross a risk threshold and result in an ASD phenotype. In three of the
eight families (6 ASD and 2 ID) that carry putative PTCHD1 missense mutations (Families 8, 9
and 10), we have identified other CNVs involving genes that may also contribute to the
phenotype. In Family 9, in addition to the I173V substitution, we found a de novo ~1.1 Mb loss
at 1p21.3 resulting in deletion of the entire DPYD gene (MIM 274270), encoding
dihydropyrimidine dehydrogenase (DPD) (Marshall et al., 2008). Complete DPD deficiency
results in highly variable clinical outcomes, with convulsive disorders, motor retardation, and
intellectual disability being the most frequent manifestations, and autistic features occasionally
reported (van Kuilenburg et al., 1999). In this family, a balanced translocation, t(19;21)(p13.2;
q22.12) is also present in the proband, but is inherited from the unaffected mother and shared
with an unaffected sister (see Supplementary Materials). In Family 10, which shows the V195I
substitution in PTCHD1, we have previously reported a 66 Kb de novo loss at 7q36.2 that results
in deletion of the third exon of DPP6 (MIM 126141) previously reported as a positional and
functional candidate gene for autism (Marshall et al., 2008). In ID Family 8, we have identified a

90
 91

H359R substitution in PTCHD1 and a 2 Kb deletion spanning the last exon of SLC16A2, both
variants are maternally inherited. The phenotype in this family was severe ID compatible with
Allan-Herndon-Dudley syndrome (MIM 300523) (Friesema et al., 2004; Schwartz et al., 2005),
for which mutations in SLC16A2 have previously been reported.

Thus, in two ASD individuals we have evidence for the possible involvement of more than one
locus in the disease, and these findings may support the threshold model of relative contribution
in ASD described above (Cook, Jr. & Scherer, 2008) and polygenic inheritance in autism. As
such, some de novo CNVs may be highly penetrant in causing ASD susceptibility (e.g.
disruption of PTCHD1 in Family 1). Conversely, other de novo CNVs (e.g. DPP6 and DPYD
deletions) may have more subtle effects, requiring contributions of additional loci (e.g. PTCHD1
missense mutations in the case of Families 9 & 10) for ASD to be phenotypically evident. This
scenario may also apply to the ID families with PTCHD1 mutations, although for Family 8 the
PTCHD1 missense variant contribution is likely overwhelmed by the phenotypic effect of a
whole exon deletion of SLC16A2.

PTCHD1 gene expression showed high correlation with expression of other cerebellar genes
such as ZIC1, CADPS2, EN2, CBLN1, and with synaptic genes such as PCLO, NRXN3, SNAP25,
SYT2, DPP6 and DPP10 (see table S4). Cerebellar abnormalities have frequently been linked to
autism, including recent magnetic resonance imaging (MRI) studies showing significant decrease
in cerebellar grey matter (Courchesne et al., 2001; Toal et al., 2009), and decreased cerebellar
connectivity and activity (Mostofsky et al., 2009).

PTCHD1 encodes a Patched-related protein with 12 transmembrane domains and a sterol-

sensing domain, structurally similar to the Hh receptors PTCH1 and PTCH2, as well as the
Niemann-Pick Type C1 protein (NPC1) and several others (Figure S 4-5). Many Patched-related
genes have been found in various organisms, from nematodes to humans, and they appear to play
diverse biological functions, including cytokinesis, growth and pattern formation (Zugasti,
Rajan, & Kuwabara, 2005). For instance, there are just seven patched-related genes in humans
(PTCH1, PTCH2, PTCHD1, PTCHD2, PTCHD3, NPC1 and c6orf138 (see Figure S 4-5),
whereas in C. elegans there are at least 26 patched-related genes, with diverse roles in
development in addition to Hh signaling, including cytokinesis, growth and pattern formation

91
 92

(33). In 10T1/2 cells, we have demonstrated an inhibitory effect of PTCHD1 on Gli-dependent

transcription. Although these results suggest that PTCHD1 exhibits biochemical activity in Hh-
dependent processes similar to that of PTCH1 and 2, other functions or roles for PTCHD1 cannot
be excluded at this point.

In summary, our data indicate that mutations at the PTCHD1 locus are highly penetrant and
strongly associated with ASD (including BAP) and ID in ~1.1% and ~1.3% of the individuals
analyzed, respectively (based on probands for whom comprehensive mutation screening, for both
CNVs and sequence variants, has been performed (4 out of 353 ASD, and 3 out of 225 ID).
Overall, our finding are reminiscent of genetic findings for several other X chromosome genes,
including NLGN4 (Jamain et al., 2003; Laumonnier et al., 2004) and IL1RAPL1 (Bhat et al.,
2008a; Piton et al., 2008; Carrie et al., 1999b), in that mutations can apparently cause either ASD
or ID (or both), and thus PTCHD1 may be a gene for both. IL1RAPL1, for example, was initially
reported as a gene for non-syndromic X-linked ID (34), and then subsequently was also found to
harbor mutations in ASD pedigrees (9, 10). We have also identified two families in whom at
least two loci may be contributing to the pathogenesis of ASD, and another seven families
bearing upstream microdeletions that disrupt a complex non-coding RNA, providing possible
genetic explanations for the clinical heterogeneity of these disorders. Finally, our results raise the
possibility that Hh signaling may be perturbed in these conditions. This discovery may help
provide possible targets for therapeutics in individuals with mutations at this locus.

4.5 Methods
4.5.1 Source of Subjects
CNVs at the PTCHD1 locus were initially assessed in 427 ASD patients, as described (Marshall
et al., 2008). DNA samples from 900 individuals diagnosed with ASD were sequenced for
PTCHD1 mutations. Among these, 400 samples were collected at three sites, namely The
Hospital for Sick Children (HSC) in Toronto and child diagnostic centers in Hamilton, Ontario
and St, Johns, Newfoundland. Details of these samples are published elsewhere (Moessner et
al., 2007). 420 ASD cases were recruited at Montreal, details of these samples are published
elsewhere (Gauthier et al., 2006). Another 80 ASD probands from the Autism Genetic Resource
Exchange (AGRE) were also included. The second cohort of 996 autism probands was recruited

92
 93

at different sites as a part of the Autism Genome Project (AGP); ascertainment is described
elsewhere (Pinto et al., 2010). 246 male patients with intellectual disability were recruited from
the UK, United States, Australia, Europe and South Africa as the IGOLD study. A subset of 225
from this cohort were also used for sequence analysis of PTCHD1. Details of these samples are
published elsewhere (Tarpey et al., 2009b). 167 unrelated patients diagnosed with ADHD were
recruited through the Department of Psychiatry at the Hospital for Sick Children, Toronto.
Microarray data from controls included 1,123 (M=623, F=500) controls recruited from northern
Germany as a part of the PopGen project, 1,234 (M=586, F=648) healthy controls of European
origin recruited from the province of Ontario, Canada, 1,287 (M=383, F=904) controls from the
Study of Addiction: Genetics and Environment (SAGE), 1,320 (M=589, F=1320) controls from
Childrens Hospital of Philadelphia (CHOP), 4783 (M=2460, F=2323) controls were recruited by
the Wellcome Trust Case Control Consortium, 440 (M=158, F=282) controls were recruited by
The Centre of Addiction and Mental Health (CAMH) and GlaxoSmithKline (GSK), and 59
(M=30, F=29) from the Centre dEtude Polymorphisme Humaine (CEPH) HapMap controls
(total N=5,023). We sequenced more than 650 Ontario controls obtained from The Centre for
Applied Genomics (TCAG) and The Centre for Addiction and Mental Health (CAMH). Details
of all samples included in the study are summarized in table S5. Institutional ethical review
board approval (CAMH, HSC, CHOP and all other collaborating institutions) was obtained for
the study, and informed written consent was obtained for each family. Details of the clinical
findings in families with PTCHD1 mutations or CNVs are summarized in table S1.

4.5.2 Copy Number Variation Analysis

We used Affymetrix 500K SNP arrays to assess CNVs in a cohort of 427 ASD cases. Details on
the methods of copy number analysis and complete results are published elsewhere (Marshall et
al., 2008). Only the CNV result at PTCHD1 is described here. Another cohort of 996 autism
probands was analyzed on 1M BeadChips (Illumina) (Pinto et al., 2010). 246 male patients with
ID were analyzed on a custom designed NimbleGen 385K array. Genomic DNA samples were
sent to NimbleGen for the hybridizations to be performed. Each patient sample (Cy5-labelled)
was co-hybridised with DNA from the reference sample NA10851 (Cy3-labelled; obtained from
Coriell Cell Repository). After data normalisation, the ADM-1 algorithm (CGH Analytics 3.4,
Agilent) was used for CNV discovery. The ADHD cohort was analyzed on Affymetrix 6.0

93
 94

arrays. Three algorithms (Birdsuite, iPattern and Affymetrix Genotyping console (GTC)) were
used to infer CNVs. The CEPH, PopGen and Ontario controls were analyzed on Affymetrix 6.0
arrays, SAGE controls were analyzed 1M BeadChips (Illumina) and Illumina 550K arrays were
used for the CHOP and CAMH\GSK controls. Similar methods were used to infer CNVs in
controls. The probe density of different microarray platforms at the PTCHD1 locus is shown in
Figure S 4-6. Fishers Exact Test was used to calculate the two-tailed p value.

4.5.3 DNA Sequencing and Mutation Screening

PCR primers were designed with Primer 3 (v. 0.3.0) to amplify all three exons and intron-exon
boundaries (Table 4-1). PCR were performed under standard conditions, and products were
purified and sequenced directly with the BigDye Terminator v3.1 Cycle Sequencing Ready
Reaction Kit (Applied Biosystems).

Table 4-1 Primers used to amplify all three exons of PTCHD1

Primer Sequence

Exon 1F AGA GCT CAG GGT CTC GCC

Exon 1R CTA GGA GAG GTG GCG CTC T

Exon 2F GAA TGT CCA CCC TCT CCA AA

Exon 2R AAG GCT ACT CCT GGC CTT TT

Exon 3aF CTT TGA CCC AGT AGT CCC TCA

Exon 3aR GCA CAA ACC CCT TGG TGT A

Exon 3bF TGT GAT TGG GTT TTA CAT ATA TGA GTC

Exon 3bR AGG TCA GAT TTG AAG GCA CAG

Exon 3cF AAA AAT GCC CTG GAA GTG C

Exon 3cR TGT GTG AAT TCT CAT AAC AAC TCC T

94
 95

4.5.4 X-Inactivation Studies

The X Chromosome Inactivation assay was performed on genomic DNA extracted from
peripheral blood as described (Allen, Zoghbi, Moseley, Rosenblatt, & Belmont, 1992). Briefly,
X Chromosome Inactivation was measured by the analysis of the (CAG)n repeat in the androgen
receptor gene at Xq11-q12 before and after digestion with methylation sensitive restriction
enzymes HhaI and HpaII. Quantitative PCR amplification of androgen receptor gene repeat
alleles was compared, with and without restriction digestion, to determine the ratio of X-
active/inactive alleles.

4.5.5 Expression Analysis and Protein Localization

Expression analysis and tissue distribution for PTCHD1, PTCHD1AS1 and PTCHD1AS2 was
performed by RT-PCR, with a multiple tissue panel of first strand cDNA. The housekeeping
gene G3PDH was used as a control. Origene human adult brain tissue panel was used to check
the expression of PTCHD mRNA in different regions of the brain. qRT-PCR was performed
with TaqMan Gene Expression assay Hs00288486, and samples were pre-normalized to GAPDH
expression. Northern blot analysis was performed with a six tissue mRNA blot (BioChain). The
BioChain FastHyb solution was used to hybridize the probe according to manufacturers
instructions. RNA in situ hybridization was performed on paraffin sections and whole-mounted
fetal mouse and adult mouse brain using a 411 bp (chrX:152,008,934-152,009,344, UCSC
Mouse July, 2007 (2010c)) digoxigenin-labeled mouse antisense probe (and sense probe as
negative control), using standard methods. To examine cellular localization of PTCHD1 protein,
full-length human fetal brain PTCHD1 cDNA was PCR amplified and cloned into the
pcDNA3.1/CT-GFP-TOPO expression vector (Invitrogen). After confirming the correct
sequence and orientation of the insert, we transiently transfected COS-7 and SK-N-SH cells with
2 g of purified construct DNA with SuperFect (Qiagen). 24 hours after transfection, we
visualized the PTCHD1-GFP fusion protein in transfected cells using a Zeiss Axioplan 2
imaging microscope, equipped with the LSM510 array confocal laser scanning system, and the
Zeiss LSM510 version 3.2 SP2 software package.

95
 96

4.5.6 Luciferase Assays

A luciferase assay was performed to compare the effect of PTCH1, PTCH2 and PTCHD1 on Gli-
dependent transcription with a previously described method (Nieuwenhuis et al., 2006). Briefly,
the 10T1/2 cells were transiently transfected with mixtures containing 0.1 g -galactosidase to
normalize for transfection efficiency, 1 g reporter plasmid (8xGlipro) encoding multimerized
Gli binding sites fused to the luciferase gene and up to 1 g of Gli2, PTCH1 or PTCH2 or
PTCHD1. Gli-dependent transcription was measured and normalized by -galactosidase. Data
were replicated in independent experiments performed in triplicates. In another assay, 10T1/2
cells were transiently transfected with mixtures containing 0.1 g -galactosidase, 1 g
8xGlipro reporter plasmid and purmorphamine, PTCH1 or PTCH2 or PTCHD1. The effect of
PTCH1, PTCH2 and PTCHD1 on the endogenous Gli-dependent transcription was measured.
Statistical significance was calculated as p below 0.05, using the Students t-test.

96
 97

Figure 4-1 Genomic organization of the PTCHD1 locus.

Detailed genomic organization of the PTCHD1 locus. The known genes, predicted CpG islands
(>300 bp), predicted promoters (ElDorado Suite from Genomatix) and conserved sequences
(>75% identity with chicken, >90% identity with opossum or 100% identity with dog or horse)
are shown. Putative non-coding RNA transcripts PTCHD1AS1 (from cDNA clone
IMAGE:1560626; BX115199) and PTCHD1AS2 (cDNA clone BRSTN2000219; DA355362)
from human, mouse and rat genomes are also shown, with the transcripts assembled from RT-
PCR and 5 RACE (PTCHD1AS3) (see Supplementary Material). The dotted line between the
two exons in transcript PTCHD1AS1 indicates that this is a putative exon, identified through
clone sequencing. This exon is putative because, although this location represents its best
genomic hit, it only partially matches the 5 end of the clone sequence. Black boxes within the
spliced transcripts indicate homologous exons between the sequences. White bars with black
borders indicate CNV losses within this locus that have been identified in patients with ASD and
controls. Cross-hatched or grey bars indicate CNV losses identified in patients with ADHD and
ID, respectively. Colored lines within these bars indicate overlap with exons of known
transcripts (blue) or ncRNA (red). The breakpoints of the deletions for all families that are
reported here were mapped by sequencing the junction (see table S2 for coordinates).
Breakpoints for all CNVs in controls were mapped by using the physical positions of microarray
probe fragments.

97
 98

98
 99

Figure 4-2 Pedigrees of families showing segregation of PTCHD1 mutations.

Pedigrees of families. (A) Pedigrees showing PTCHD1 mutations. (B) Pedigrees showing
deletions at the PTCHD1/PTCHD1AS1-3 locus. The third male in Family 18 was assessed at age
4 and had speech and language problems, but was not available for further assessment. The
father in Family 19 has a broader autism phenotype (BAP). The proband in Family 20 (hatched)
has ADHD plus BAP. A diamond symbol represents siblings who were not tested as part of the
study, and with gender not indicated.

99
 100

100
 101

Figure 4-3 Expression analysis

Transcription analysis. (A) RT-PCR expression analysis of PTCHD1 transcript in 30 different
adult tissues. The housekeeping gene G3PDH was used as a control. (B) Northern hybridization
analysis of PTCHD1 showing a ~4.1Kb band in all lanes..Current RefSeq annotation of
PTCHD1 describes a ~5.3Kb transcript; however, the only polyadenylation site predicted for the
mRNA sequence (NM_173495) by POLYAH is at 4.379 bp. RT-PCR expression analysis of (C)
PTCHD1AS1 and (D) PTCHD1AS2 expression in seven human tissues, also with G3PDH as a
control. Northern analysis of the ncRNAs did not give sufficient signal for detection.

101
 102

Figure 4-4 Expression and functional studies of PTCHD1

Expression and functional studies. (A) Whole-mount RNA in situ hybridization showing
expression of PTCHD1 in mouse embryo E9 and E14. (B) Localization of PTCHD1 protein in
COS7, SK-N-SH and control cells shows that the PTCHD1-GFP protein is predominantly
localized in the cell membrane. (C) PTCHD1 exerted a statistically significant inhibitory effect
on endogenous Gli-dependent transcription, similar to PTCH1 and PTCH2, when transfected in
Hedgehog-responsive 10T1/2 cells (PTCHD1: p= 0.0101; PTCH1: p= 0.0096; PTCH2: p=
0.0159). Statistical significance was calculated using the Students t-test. Absolute expression of
reporter gene normalized to -gal expression is shown. Standard error bars are shown.

102
 103

4.6 Supplementary Information

4.6.1 Cytogenetic and CNV analysis of proband from Family 9
Localization of translocation breakpoints was performed by fluorescence in situ hybridization
(FISH; performed in accordance with standard procedures) initially using bacterial artificial
chromosome (BAC) clones across the suspected breakpoint regions, and then narrowing the
search using fosmid clones. BAC clones were obtained from the RP11 human genomic library,
and fosmid clones from the Whitehead fosmid library WIBR2. For the chromosome 19 locus, the
clone G248P85500F11 was translocated, and thus distal to the breakpoint, while clone
G248P85559B4 was not translocated, and thus proximal to the breakpoint. The breakpoint
therefore lies within a 32 Kb region between these two clones (UCSC March 2006: Chr19:
7,843,511-7,874,724. This region encompasses just two genes: FLJ22184, LRRC8E. At the
chromosome 21 translocation site, fosmid clone G248P87249E2 was translocated, and
G248P89542E9 was not translocated, and the breakpoint thus lies within a ~14.5 Kb region
between these two clones, within an intron of the RUNX1 gene.

Whole-genome SNP analysis was performed using the Affymetrix 260K NspI SNP microarray.
Analysis using the dCHIP and CNAG programs indicated a loss of heterozygosity from SNPs
rs10875047 at Chr1:97,367,581 and rs822559 at Chr1:98,424,675 (inclusive; UCSC March
2006). This apparent deletion spans from intron 20 of the gene DPYD to include the first 20
DPYD exons, as well as two proximal putative genes, AK094607 and AX747691.

4.6.2 RT-PCR failed to find evidence for a shortened 3 PTCHD1

transcript from individual with PTCHD1 exon 1 deletion
We speculated that the difference in phenotype between the two PTCHD1 deletion families (#1
and #2), could be explained by residual PTCHD1 protein function in relevant brain regions in
Family 1 due to downstream transcription and translation of a shorter isoform, possibly driven by
a secondary promoter just upstream of exon 2, resulting in the milder ASD symptoms, rather
than the severer ID with the full deletion. However, RT-PCR did not detect any evidence of
shorter downstream transcripts. Alternatively, genetic factors elsewhere may modify the effect of
the deletion.

103
 104

4.6.3 Consensus Sequence for PTCHD1AS1:

TCTACACAAA CCAGATGAAC CTTCCAATCT CCTGCCTCGA GTATTGAAGC

CTGGCTACTG TGACTGTGGG GAAGGGATTA ATGGTCTCAG CATTCAGCCA

ACAACAATAC CTGCTCACTA TAAGCATTCA GAAAACAGAA AAGTTTCAAG

AAGCAGGAAG AAAAGACTCA CCTATGATCC CAACACCCAG AGATAAGAGT

CCTGAAGCTC AGATGACACA GCTGATAACA GGGAAGCCAG GACAGAATCT

CATTGTTTTG AACACCAAAA CCCGTTCCCT TGACAACTTG GCTATACTAC

ACTATTCGAA TGTTGCAGAT ACTGTGGTCA CATTTCAAAG GCCAGATCTT

TCCCAGGGCT TAAGCTGTTC CTTGGATACT TTTGGTAAGT CATTTATCCA

CTAATCATTT AGTAATCGTC TCTGACATGC CAAACACCCT GCTCAGGGCT

GGAAATGCAG AACCTGGGAA GCCACTGGCC TTGTCCTCAA GATCTCTCTC

TGGCTCCCTT TGAATTTGCT AATTCAGACT TTCACATTTC CCCCAGGAAA

AATCATAAGG ACCAAATCAT ATCCGTTTTC TCAAATGGCT TCAAAGACCC

ATGTCATCGT TTGGCATCAT GTAATTCTTT ACTGATGTAC TTTAAGAGTC

ACGTTTTATT CTCTTTATGC AGCTGTCAAG GACAGACACA AAGAGGGGGG

GGGNGGCCTT CCTCACTAAA TACTTTTCCC ACAACA

4.6.4 Consensus Sequence for PTCHD1AS2:

ACAACTGCAG CGAGAGAAGA GGCTGGCAGC ATGGGTGGCA GGAGGCTTGG

CAGCCTCACA GGATGCCTGC AAATACCTTT CACTTATGCA GTTTGGCAGT

GCAGTGGTGC ATGGAGACAG CGTCTTGGGC CTGGCACCCA CAGtCACTTA

104
 105

GGAAGTTGGA GTCCTGGAGA GGAGAACACA GAACGTGGAC AACTAGCTGT

CAAATTGCAG TAAAAGTTGG TTCAGGAAAA GTGGAAGCTA CCCAGATGTC

TACCAATTGA GATGAACCAT CCAATCTCCT GCCTCGAGTA TTGAAGCCTG

GCTACTGTGA CTGTGGGGAA GGGATTAATG GTCTCAGCAT TCAAAGCTTC

TATTCTGGAA TAGAACAGCT AGCATACTAC CAAGACTTTT CAAGGAGCAA

GAATGGAGCT CCCTGGAGAA CTGACTGAAC ATGGCTTCAG AGGCAGTATC

CATGTCACAT TTCAAAGGCC AGATCTTTCC CAGGGCTTAA GCTGTTCCTT

GGATACTTTT GCTGATGGTT TACACATCTT CTTCCCACAT TATATTGTAA

CTTTCTT

4.6.5 RT-PCR and 5 RACE (Rapid Amplification of cDNA Ends)

analysis of the ncRNAs, PTCHD1AS1 and PTCHD1AS2 and the
PTCHD1 gene

By RT-PCR, the annotated exons of PTCHD1AS1 and PTCHD1AS2 were amplified from human
cerebellum cDNA. Sequencing of RT-PCR product confirmed the current annotation of the
ncRNAs. Additionally, we verified the annotation of PTCHD1AS1 by re-sequencing of the
IMAGE clone 1560626.

We attempted to identify additional 5 sequence of the ncRNAs and PTCHD1 by 5 RACE

analysis using the Clontech Marathon-ReadyTM fetal brain cDNA (Cat. No. 639300). According
to the manufacturer instructions the gene specific primers were designed for PTCHD1AS1,
PTCHD1AS2 and PTCHD1 and RT-PCR was performed. The PCR products were cloned into
the Promega pGEM-T Easy Vector and the clones were sequenced using standard methods.
We were unable to find any additional upstream sequence for PTCHD1, However, for the
PTCHD1AS1 we found at least two additional exons. One of these exons completely overlaps

105
 106

with the PTCHD1AS2 exon 2 (chrX:23,198,089-23,198,215), while the second exon mapped
further upstream at chrX:23,261,313-23,261,767 (UCSC 2006). RT-PCR also identified another

splice variant with an initial exon at ChrX:23,262,967-23,262,009, which skips to exon 2 in the
current annotation of PTCHD1AS1. It is possible that the extremely GC-rich nature of the 5
region of PTCHD1 prevented us finding additional upstream sequence.

NCRNA Exon Size (bp) Coordinates Comments

PTCHD1AS1 1I 126 chrX:23,198,089- This exon is alternatively

23,198,214 spliced and completely overlaps
with the exon 2 of the
NCRNA355362.

PTCHD1AS1 1II 455 chrX:23,261,313- Starts 1.1Kb upstream of

23,261,767 PTCHD1 and overlaps with the
exon 1 of mouse transcript
AK028243 and the PTCHD1
CpG island.

PTCHD1AS1 1III 43 chrX:23,261,967- Starts ~900 bp upstream of

23,262,009 PTCHD1 and overlaps with the
PTCHD1 CpG island. The
transcript starting from this exon
skips the Exon 1II, 1I and exon 1.

106
 107

4.6.6 Alternative 5 exons for PTCHD1AS1, identified by 5RACE:

4.6.6.1
Sequence of exon 1I

CAATTGGTAGACATCTGGGTAGCTTCCACTTTTCCTGAACCAACTTTTAC

TGCAATTTGACAGCTAGTTGTCCACGTTCTGTGTTCTCCTCTCCAGGACT

CCAACTTCCTAAGTGGCTGTGGGTGC

4.6.6.2
Sequence of exon 1II

ACCTGTGCGTGGCCGTTCCCGCCGCCGCCGCAGGTCTATCCCGGGGCCGA

AGCCGGCGCCCGCCTTCTCGGGGAATTCTCCGGAGGGGGAGTGCGAGGGG

AACCACGGTGACTGCCTGCTAGCTCACGGCTGGCGCGCACACGCACACGC

CCAACTTTGCCAAGCCGTCGGCGCCCCGCGGGCTCCCCCGCGCCCCCTGC

GGCTCAACACGCTCGGAGACCTGTATCTCTCCTGCTCTGAGATAAGGTTC

CCTCCACTCTCACACCTTCGCATGTAGGGGAGGAGAGGGCGGAGTGAGGC

AGAGAAGGGGGTTAATGCTACTGACTCCCTGGCCAGCCTTTCTCAAACAC

TCTACGCCCGCAGGGGCGCCCGCGCCAGCCACGCCGCACCAGGTCCCCCA

GACCTGCTGGTGACGACAGAGAGAGGAGGAGGAAGAGAAGGCAGGGCGAA

GAACC

107
 108

4.6.6.3
Sequence of exon 1III
CTTTTGAGTGGACGTGCTCCAGACACACACCCGGACCCCGTGG

4.6.7 Putative promoter and enhancer sequences in intergenic region

between DDX53 and PTCHD1
The identification of predicted promoter sequences may indicate the presence of an alternative
upstream transcription start site for PTCHD1 (or possibly another unknown gene), that may be
disrupted by the CNVs identified upstream of PTCHD1 in ASD families (see Figure 4-1). We
have used the Genomatix ElDorado suite to predict promoter sequences. In addition to promoter
sequences at the 5 ends of DDX53 and PTCHD1, on the plus strand we identified a putative
promoter sequence in the intergenic region, from ChrX:22,927,508-22,928,108. This putative
promoter lies ahead of ENSEMBL predicted non-coding transcript ENST00000407873. On the
minus strand we identified a putative promoter sequence in the intergenic region, from ChrX:
chrX:23,022,123-23,022,723, which lies just ahead of ENSEMBL predicted non-coding
transcript ENST00000356867 and an EST clone (AU118198). We also used the ElDorado Suite
from Genomatix, as well as the FPROM algorithm from the Softberry suite, which predicted
promoter/enhancer sequences just upstream of the FAM3C2 predicted pseudogene.

Comparative sequence analysis indicates a number of regions located in the gene desert upstream
of PTCHD1 and between DDX53 where nucleotide sequence conservation is relatively high
through vertebrate evolution or through mammalian evolution. Such conserved regions may
represent functional regions, possibly cis-regulatory sequences for PTCHD1. Regions were
selected through the Vertebrate Multiz Alignment & PhastCons Conservation (28 Species) track
on the UCSC (March 2006 build) browser. Results are shown in Supplementary Table S 1, and
indicate which conserved elements overlap with CNV losses upstream of PTCHD1.

108
 109

4.6.8 eQTL at PTCHD1 locus

The SNP rs7878766, located within PTCHD1 intron 1, has been reported as a quantitative trait
locus for expression of mRNA levels of MAP8KIP2 in control brain cortex
(http//eqtl.uchicago.edu), with a QTL score of 5.3. RefSeq Summary reports this to encode a
scaffold protein involved in the c-Jun N-terminal kinase signaling pathway, and is thus thought
to act as a regulator of signal transduction. Using mRNA by SNP Browser 1.0.1 (Dixon et al.,
2007), other SNPs at the PTCHD1 locus that show as suggestive QTLs for mRNAs include
rs5925800 (ACSM2A; LOD= 5.039, p=1.5 x10-6; GALNT4, LOD=5.095, p=1.3 X 10-6;
PIK3C2G, LOD= 5.27, p=8.4 x 10-7), rs868659 (DLEU2, LOD= 5.427, p=5.8 x 10-7), and
rs6526278 (SGCG, LOD= 5.248, p=8.8 x 10-7).

109
 110

Table S 1 Clinical description of cases with disruptions at the PTCHD1 locus on Xp22.11

Family ID Genes; #Chromosomes Clinical Details in Proband Family Segregation Comments

Mutation Tested in Controls

Family 1 PTCHD1, 15,663 Proband (deletion) = Autism (based on ADI & ADOS- Simplex family.
Module 1) & ADHD.
(1-0186) PTCHD1AS2/3 (M=4,829 Probands brother DZ twin (deletion) = ASD
F=10,834) Leiter-R brief IQ: 97 (42%); PLS-3: 86 (18%); VABS: features and Learning Disability. WASI: Non-
167 Kb del
COM=88 (21%); DLS=79 (8%), SOC=80 (9%), MOT=75 Verbal IQ=67 (1%), Verbal IQ=86 (18%);
(5%), ABC=74 (4%). VABS: COM=84 (14%), DLS=95(37%),
SOC=104 (61%), ABC=92 (30%)

Probands sister (heterozygous deletion) = non-

ASD

Family 2 PTCHD1, 15,663 Proband (deletion) = non-ASD, moderate to severe ID. Multiplex family.
PTCHD1AS2/3
(GOLD540) (M=4,829 Probands brother (deletion) = moderate to
90Kb del F=10,834) severe ID.

Probands maternal uncle (deletion) = moderate

to severe ID

Family 3 PTCHD1 1101 Proband (mutation) = Autism (based on ADI & ADOS- Simplex family. No other siblings.
Module 1).

110
 111

(S01407) I173V (M=613 F=488) Non-Verbal IQ=95, Verbal IQ=85.

Family 4 PTCHD1 1193* Proband (mutation) = Autism (based on ADI & ADOS- Simplex family. No other siblings.
Module 1).
(S01433) ML336-7II (M=643 F=550)
Some traits were observed that might be related to
schizophrenia.

Family 5 PTCHD1 869 Proband (mutation) = High Functioning Autism Simplex family.

(S01355) E479G (M=531 F=338) Probands brother (no genotype data) = non-
ASD

Family 6 PTCHD1 869 Proband (mutation) = Autism Multiplex family.

(AU0501) L73F (M=531 F=338) Probands brother #1 (no mutation) = ASD

Probands brother #2 (mutation) = phenotype is

currently unclear.

Family 7 PTCHD1 869 Proband=non-ASD; mild ID Clinodactyly, 3rd fringer; camptodactyly.

(GOLD243) A470D (M=531 F=338) Probands siblings (no genotype data) = no ID.

111
 112

Family 8 PTCHD1 869 Proband (mutation) = non-ASD, severe ID, seizures. Multiplex family.

(GOLD398) H359R and (M=531 F=338) Probands brother (no genotype data) = ID

2 Kb deletion
spanning last exon of
SLC16A2

Family 9 PTCHD1 I173V and 1101 Proband (mutation) = Autism (based on ADI & ADOS- Simplex family.
Module 1), intellectual disability, hyperactive, poor motor
(1-0215) de novo ~1.1 Mb loss (M=613 F=488) Probands sister (mutation) = non-ASD
coordination.
at DPYD
Leiter-R Brief IQ = 38. OWLS = 40 (<1%). VABS: COM=36
(<1%); DLS=<20 (<1%), SOC=31 (<1%), ABC=26 (<1%).

Family 10 PTCHD1 1101 Proband (mutation) = Autism (based on ADI & ADOS- Simplex family. No other siblings
Module 1). Severe expressive/receptive language delay. CT
(3-0002) V195I and 66 Kb de (M=613 F=488)
head=Normal.
novo loss at DPP6

Family 11 PTCHD1AS1-3, 15,663 Proband (deletion) = Autism (based on ADI-R & ADOS- Simplex family.
Module1), ID, speech delay, apraxia. Uses single words.
(5298) DDX53 (M=4,829 Probands sister (heterozygous deletion) = non-
F=10,834) Leiter Brief IQ: 42 (<1%). PPVT-4: 20 (<1%). VABS: ASD.
125 Kb del
112
 113
COM=<20 (<1%); DLS=47 (<1%), SOC=44 (<1%), ABC=34
(<1%).

Family 12 PTCHD1AS1 15,663 Proband (deletion) = Autism (based on ADI-R & ADOS- Mulitplex family. Paternal family history of
Module 4). Verbally fluent. ASD.
(5065) 65 Kb del (M=4,829
F=10,834) Leiter IQ: 71 (3%). VABS: COM=68 (2%), DLS=45 (<1%), Probands brother (no deletion) = Autism (based
SOC=58 (<1%), ABC=52 (<1%). on ADI & ADOS-Module 4). Verbally Fluent.
VABS: COM=71 (3%), DLS=38 (<1%),
SOC=51 (<1%), ABC=49 (<1%).

Family 13 104 Kb del 15,663 Proband (deletion) = Autism (based on ADI & ADOS). Simplex family.

(3424) (M=4,829 WISC-R: Non-Verbal IQ=58, Verbal IQ=50, Total IQ=50 Probands brother (no deletion) =non-ASD
F=10,834)

Family 14 PTCHD1AS1 15,663 Proband (deletion) = Autism (based on ADI-R & ADOS- Mulitplex family. Paternal family history of
Module1). Uses single words. MRI = normal. ASD & ADHD.
(5111) 59 Kb del (M=4,829
F=10,834) Leiter IQ: 46 (<1%). VABS: COM=37 (<1%), DLS=31 Probands brother (no deletion) = Autism (based
(<1%), SOC=52 (<1%), ABC=37 (<1%). on ADI & ADOS-Module 3). Verbally fluent.
Leiter IQ: 105 (63%). VABS: COM=108 (70%),
DLS=62 (1%), SOC=92 (30%), ABC=83 (13%).

Probands sister (heterozygous deletion) = non-

ASD, Bassen-Kornzweig syndrome.

113
 114

Probands father (no deletion) = non-ASD,

OCD.

Family 15 PTCHD1AS1 15,663 Proband (deletion) = Autism (based on ADI & ADOS) Multiplex family.

(3253) 54 Kb del (M=4,829 Non-Verbal IQ=75, Verbal IQ=56 Probands brother (no deletion) = ASD
F=10,834)
Probands sister (no deletion) = non-ASD.

Family 16 PTCHD1AS1-3, 15,663 Proband (deletion) = Autism (based on ADI & ADOS). No Multiplex family.
epilepsy, history of language delay followed by a rapid
(13047) DDX53 (M=4,829 Probands brother #1 (no deletion) = Autism
language learning progression.
F=10,834) (based on ADI & ADOS), IQ=average to above
389 Kb del
Average to above average Non-Verbal and Verbal IQ. average

Probands brother #2 (no deletion) = ASD

Probands sister (no CNV data) = non-ASD,

semantic-pragmatic language disorder.

Family 17 101 Kb del 15,663 Proband (no deletion) = ASD Multiplex family.

(8273) (M=4,829 WISC III IQ: Non-verbal=120, Verbal=130 Probands brother (deletion) = ASD
F=10,834)
Probands sister #1 (deletion) = ASD

114
 115

Probands sister #2 (deletion) = ASD

Family 18 PTCHD1AS1 15,663 Proband (no deletion) = Autism (based on ADI & ADOS- Multiplex family.
Module 3).
(8013) 65 Kb del (M=4,829 Probands brother #1(deletion) = Autism (based
F=10,834) WISC-III: Non-Verbal IQ=139 (>99%), Verbal IQ=89 (23%). on ADI & ADOS-Module 3). WISC III: Total
VABS: SOC=76 (5%). IQ=44 (1%).

Probands brother #2 (deletion) = non-ASD.

WPPSI-R: Verbal IQ=89 (23%), non-verbal=100
(50%).

Family 19 PTCHD1AS1-3, 15,663 Proband (no deletion) = ASD Multiplex family.

(3387) DDX53 (M=4,829 Probands father (deletion) = Broad Autism

F=10,834) Phenotype
213 Kb del
Probands brother (no deletion) = ASD

Probands sister (deletion) = non-ASD.

Family 20 PTCHD1AS1-3, 15,663 Proband (deletion) = ADHD, NVLD Simplex family.

DDX53
1-27075 (M=4,829 Verbal IQ =131, Performance IQ =113. Probands sister#1 (genotype unknown) = non-
388 Kb del F=10,834) ASD
Proband has some ASD spectrum features (disinterest in

115
 116
social relationships, preference for being alone, difficulty with
Probands sister#2 (genotype unknown) = non-
change and over-adherence to structure and rules, difficulty
ASD
with reading nonverbal cues resulting in social difficulties)
but no evidence of restricted, repetitive, or stereotyped
behaviour.

All probands are male and are of European ancestry except for those in family 9 (Mixed European), family 4 (East Asian), and families 6 and 7 (Not
available). The referring diagnosis for all probands is Autism Spectrum Disorder (ASD) except for Families 2, 7, 8 (intellectual disability; ID) and
Family 20 (ADHD)

Abbreviations used: ADHD: Attention-Deficit Hyperactivity Disorder; BAP: Broad Autism Phenotype; NVLD: Non-verbal Learning Disability;
ADOS: Autism Diagnostic Observation Schedule; ADI(-R): Autism Diagnostic Interview(-Revised); Leiter-R: Leiter International Performance
Scale-Revised (non-verbal); WISC-(R or III): Wechsler Intelligence Scale for Children (Revised or 3rd Edition); WPPSI-R: Wechsler Preschool and
Primary Scale of Intelligence Revised; VABS: Vineland Adaptive Behaviour Scale consists of the following domains: COM-Communication,
DLS-Daily Living Scales, SOC-Socialization, MOT-Motor Skills, ABC-Adaptive Behaviour Composite; PLS-3: Preschool Language Scale-3;
OWLS: Oral and Written Language Scale; PPVT-4: Peabody Picture Vocabulary Test (4th Edition).

Standard Score 100 +15 (percentile)

*Controls included N=92 of Asian ancestry

116
 117
Table S 2 Breakpoint of deletions at the PTCHD1 locus:

Family Breakpoints Deletion size (bp) Method used to map the breakpoints

Family 1(5240) chrX:23,114,179-23,281,723 167,543 Sequencing of junction fragment.

Family 2 (GOLD540) chrX:23,239,008-23,329,210 90,203 Sequencing of junction fragment.

Family 11 (5298) chrX:22,890,415-23,015,667 125,253 Sequencing of junction fragment.

Family 12 (5065) chrX:22,859,294-22,924,136 64,843 Sequencing of junction fragment.

Family 13 (3424) chrX:23,011,719-23,116,212 104,494 Sequencing of junction fragment.

Family 14 (5111) chrX:22,841,534-22,900,490 58,957 Sequencing of junction fragment.

Family 15 (3253) chrX:22,853,977-22,908,345 54,367 Sequencing of junction fragment.

Family 16 (13047) chrX:22,826,477-23,215,032 388,556 Sequencing of junction fragment.

Family 17 (8273) chrX: 22,989,332-23,091,080 101,749 Sequencing of junction fragment.

Family 18 (8013) chrX:22,859,294-22,924,136 64,843 Sequencing of junction fragment.

Family 19 (3387) chrX:22,824,496-23,037,508 213,013 Sequencing of junction fragment.

117
 118

Family 20 (1-27075) chrX: 22,678,81423,066,819 388,006 Sequencing of junction fragment.

118
 119

Table S 3 Additional CNVs in 9 subjects with upstream deletions

Family Gender Inheritanc Physical Position Size CNV Cytoban Genes

e (bp) d

Family 1 M Maternal 2:236932539_236990050 57,512 3 2q37.2 IQCA1

(5240)

Family 11 M Paternal 14:43889940_44003766 113,827 3 14q21.3 No gene.

(5298)

M Maternal 16:16225138_16726778 501,641 3 16p12.3, ABCC6,NOMO3

16p13.1
1

M 16:18153166_18699648 546,483 3 16p12.3 ABCC6P1,NOMO2,

LOC339047,RPS15A

Family 12 M Maternal 1:17079505_17140083 60,579 1 1p36.13 CROCC

(5065)

119
 120

M paternal 3:1719782_1786952 67,171 3 3p26.3 No gene.

M Maternal 3:17494057_17542224 48,168 1 3p24.3 TBC1D5

M Maternal 3:197219312_197527449 308,138 3 3q29 PCYT1A,TCTEX1D

2,TFRC,ZDHHC19,
OSTalpha

M Maternal 4:22488002_22620537 132,536 3 4p15.31 No gene.

M Maternal 10:68138586_68227559 88,974 1 10q21.3 CTNNA3

M paternal 11:61516315_61632187 115,873 3 11q12.3 No gene.

M Maternal 16:21506626_21647775 141,150 3 16p12.2 METTL9,IGSF6,OT

OA

Family 13 M paternal 5:98798044_98836932 38,889 1 5q21.1 No gene.

(3424)

M Maternal 7:149089061_149159195 70,135 3 7q36.1 SSPO,ZNF467

120
 121

Family 14 M Maternal 18:66315754_66382003 66,250 1 18q22.2 No gene.

(5111)

Family 15 M NA 5:20975886_21105120 129,235 1 5p14.3 No gene.

(3253)

M NA 7:109552072_109593909 41,838 1 7q31.1 No gene.

M NA 9:11936421_12032535 96,115 1 9p23 No gene.

Family 16 M Maternal 1:244036261_245191978 1,160,00 1 1q44 AHCTF1,TFB2M,LO

(13047) 0 C149134,SCCPDH,S
MYD3,C1orf71

M Maternal 9:24652558_24705098 52,541 1 9p21.3 No gene.

M Maternal 18:67894269_67931021 36,753 1 18q22.3 No gene.

Family 17 NA
(8273)

Family 18 NA

121
 122

(8013)

Family 19 NA
(3387)

Family 20 NA

(1-27075)

122
 123

Table S 4 Gene co-expressed with PTCHD1

Genes co-expressed with PTCHD1, from gene Affymetrix gene expression microarray analysis from A. BioGPS (Gene Atlas U133A,
gcrma; http://biogps.gnf.org); B. UCLA Gene Expression Tool (UGET: http://genome.ucla.edu/~jdong/GeneCorr.html; using human
HG-U133_Plus_2 microarrays (Day, Carlson, Dong, O'Connor, & Nelson, 2007), and C. correlation with mouse PTCHD1 using
UGET and Mouse430_2 microarrays. These algorithms correlate expression based on banked Affymetrix gene microarray data, and is
not tissue specific. Ranking counts multiple probes as single hits, and excludes hypothetical proteins.

A. BioGPS co-expression data for PTCHD1 from Gene Atlas, U133A

Gene Name Correlation Rank# OMIM Comments

#

PTCHD1 1 1

ZIC1 0.7564 2 600470 Zinc finger protein in cerebellum; homologue of Gli

GABRD 0.7064 12 137163 Receptor subunit (delta) for GABA neurotransmitter

MAB21L1 0.6916 17 601280 Autism susceptibility locus, AUTS3, candidate gene

123
 124

CBLN1 0.6832 21 600432 Precerebellin 1

CADPS2 0.6827 22 609978 Cerebellar gene; involved in vesicular trafficking; autism candidate gene

CACNA1A 0.6801 23 601011 Gene for spinocerebellar ataxia 6

CALN1 0.6675 26 607176 Calneurin 1; cerebellar homologue of calmodulin

NRXN3 0.6041 42 600567 Neurexin 3; synaptic adhesion and presynaptic voltage-gated Ca2+ signalling

EN2 0.5799 50 131310 Engrailed 2; candidate gene at autism locus, AUTS10

SYT2 0.5782 51 600104 Synaptotagmin 2; synaptic vesicle associated protein, CA2+ sensor

GRM1 0.5747 52 604473 Metabotropic glutamate neurotransmitter receptor

GABRA6 0.5171 77 137143 Receptor subunit (alpha-6) for GABA neurotransmitter

SNAP25 0.5034 87 600322 Synaptosomal-associated protein

UGET co-expression data for PTCHD1 from HG-U133_Plus_2 platform

PTCHD1 0.85455 1

124
 125

SNAP25 0.5389 7 600322 Synaptosomal-associated protein

CACNA1A 0.52815 10 601011 Gene for spinocerebellar ataxia 6

NRXN3 0.514 13 600567 Neurexin 3; synaptic adhesion and presynaptic voltage-gated Ca2+ signalling

GABRA6 0.50935 15 137143 Receptor subunit (alpha-6) for GABA neurotransmitter

GRM1 0.50555 19 604473 Metabotropic glutamate neurotransmitter receptor

GABRD 0.4958 24 137163 Receptor subunit (delta) for GABA neurotransmitter

KCNC1 0.4935 25 176258 Voltage-gated K+ channel, Shaw-related, Kv3.1

SYT4 0.4934 26 600103 Synaptotagmin 4; synaptic vesicle associated protein, CA2+ sensor

CBLN3 0.4867 32 612978 Precerebellin 3

DPP6 0.4771 45 126141 Dipeptidyl peptidase 6: forms complex with Kv4.2 channels at synapse

CADPS2 0.4699 54 609978 Cerebellar gene; involved in vesicular trafficking; autism candidate gene

UGET co-expression data for mouse PTCHD1 from Mouse430_2 platform

125
 126

PTCHD1 0.7053 1

Olfm3 0.4714 2 607567 Olfactomedin 3

Gria4 0.4397 3 138246 Glutamate receptor (AMPA); L-glutamate-gated ion channel

Pclo 0.4235 5 604918 Piccolo; presynaptic cytoskeletal matrix component

Dpp10 0.4165 9 608209 Dipeptidyl peptidase 10; forms complex with Kv4.2 channels at synapse

Cadps2 0.39 19 609978 Cerebellar gene; involved in vesicular trafficking; autism candidate gene

Nrxn3 0.3879 21 600567 Neurexin 3; synaptic adhesion and presynaptic voltage-gated Ca2+ signalling

En2 0.3816 30 131310 Engrailed 2; candidate gene at autism locus, AUTS10

126
Table S 5 Summary of Samples Analyzed in the Study:

Samples Gender Ancestry Platform used Analysis Major Findings

427 ASD cases M = 346 >90% Affymetrix CNV analysis PTCHD1 exonic
have 500K SNP and deletion and 3
F = 81
European arrays sequencing missense
ancestry mutations

420 ASD cases M = 364 Europeans Sequencing 3 missense

recruited at (French mutations
F = 56 Not applicable
Montreal Canadian)

996 autism M = 839 996 have Illumina 1M CNV analysis Upstream

probands from European BeadChips PTCHD1
F = 157
Autism ancestry deletions
Genome
Project (AGP)

246 patients M = 246 Not NimbleGen CNV analysis PTCHD1 exonic

with ID F=0 available 385K array and deletion and 2
sequencing of misssense
200 cases mutations

167 patients M = 114 88 % have Affymetrix 6.0 CNV Upstream

diagnosed with European arrays Analysis PTCHD1 deletion
F = 53
ADHD ancestry

1,123 PopGen M = 623 European Affymetrix 6.0 CNV Not applicable

controls arrays Analysis
F = 500

127
1,234 Ontario M = 586 European Affymetrix 6.0 CNV Not applicable
controls arrays Analysis
F = 648

59 CEPH M = 30 European Affymetrix 6.0 CNV Not applicable

controls arrays Analysis
F = 29

1,320 CHOP M = 589 European Illumina 550K CNV Not applicable

arrays Analysis
F = 731

440 M = 158 European Illumina 550K CNV Not applicable

CAMH\GSK arrays Analysis
F = 282
controls

1,287 SAGE M = 383 73% have Illumina 1M CNV Not applicable

European BeadChips Analysis
F = 904
ancestry

4,783 Welcome M = 2460 European Affymetrix 6.0 CNV Not applicable

Trust controls arrays Analysis
F = 2323

650 M = 650 >95% Not applicable Sequencing Not applicable

128
Ontario\CAMH have
F=0
Controls European
ancestry

Names and Affiliations of Autism Genome Project (AGP) Consortium Authors:

Lambertus Klei1, Richard Anney2, Daniele Merico3, Regina Regan4, Judith Conroy4, Tiago
Magalhaes5, Catarina Correia5, Brett S. Abrahams6, Joana Almeida7, Elena Bacchelli8, Gary D.
Bader3, Anthony J. Bailey9*, Gillian Baird10, Tom Berney11, Nadia Bolshakova2, Sven Blte12,
Patrick F. Bolton13, Thomas Bourgeron14, Sean Brennan2, Jessica Brian15, Guillermo Casallo16,
Jillian Casey4, Lynne Cochrane2, Christina Corsello17, Emily L. Crawford18, Andrew Crossett19,
Maretha de Jonge20, Richard Delorme21, Eftichia Duketis12, Frederico Duque7, Penny Farrar22,
Tiziana Filippi11, Eric Fombonne23, Christine M. Freitag12*, John Gilbert24, Christopher
Gillberg25, Joseph T. Glessner26, Jeremy Goldberg27, Andrew Green4, Jonathan Green28, Hakon
Hakonarson26,29*, Elizabeth A. Heron2, Matthew Hill2, Richard Holt2, Jennifer L. Howe16, Gillian
Hughes2, Vanessa Hus17, Roberta Igliozzi10, Cecilia Kim26, Sabine M. Klauck30*, Alexander
Kolevzon31, Olena Korvatska32, Vlad Kustanovich33, Clara M. Lajonchere33, Janine A. Lamb34,
Magdalena Laskawiec9, Marion Leboyer35, Ann Le Couteur11, Bennett L. Leventhal29, Xiao-
Qing Liu16, Catherine Lord27, Linda Lotspeich36, Sabata C. Lund18, William Mahoney37, Carine
Mantoulan38, Helen McConachie11, Christopher J. McDougle39, Jane McGrath2, William M.
McMahon40*, Alison Merikangas2, Ohsuke Migita16, Nancy J. Minshew41, Ghazala K. Mirza22,
Jeff Munson20, Stanley F. Nelson42*, Gudrun Nygren25 , Guiomar Oliveira7*, Katerina
Papanikolaou43, Jeremy R. Parr9, Barbara Parrini11, Tara Paton16, Andrew Pickles44, Marion
Pilorge45, Joseph Piven46*, Chris P. Ponting47, David J Posey39, Annemarie Poustka30X, Fritz
Poustka12, Aparna Prasad16, Jiannis Ragoussis22, Katy Renshaw9, Jessica Rickaby16, Kathryn
Roeder19, Bernadette Roge38, Michael L. Rutter48, Laura J. Bierut49, John P. Rice49, SAGE
Consortium, Jeff Salt29, Katherine Sansom16, Ricardo Segurado2, Naisha Shah4, Val C.
Sheffield50, Latha Soorya31, Ins Sousa22, Olaf Stein51, Vera Stoppioni52, Christina
Strawbridge27, Raffaella Tancredi11, Katherine Tansey2, Bhooma Thiruvahindrapduram16, Ann P.

129
Thompson27, Susanne Thomson18, Ana Tryfon31, John Tsiantis43, Herman Van Engeland20, Fred
Volkmar53, Simon Wallace9, Kai Wang26, Zhouzhi Wang16, Thomas H. Wassink54*, Caleb
Webber47, Kirsty Wing22, Kerstin Wittemeyer38, Shawn Wood1, Jing Wu19, Brian L. Yaspan18,
Danielle Zurawiecki31, Joseph D. Buxbaum31*, Rita M. Cantor42*, Hilary Coon40, Michael L.
Cuccaro24, Bernie Devlin1*, Sean Ennis4*, Daniel H. Geschwind6*, Michael Gill2*, Jonathan L.
Haines55*, Joachim Hallmayer36*, Judith Miller40, John I. Nurnberger Jr.39*, Andrew D.
Paterson16*, Margaret A. Pericak-Vance24*, Astrid M. Vicente5*, Veronica J. Vieland51*, Ellen M.
Wijsman56*, James S. Sutcliffe18*, Catalina Betancur45*

1
Department of Psychiatry, University of Pittsburgh School of Medicine, Pittsburgh 19104-6100,
Pennsylvania, USA. 2Autism Genetics Group, Department of Psychiatry, School of Medicine,
Trinity College Dublin 8, Ireland. 3Banting and Best Department of Medical Research, Terrence
Donnelly Centre for Cellular and Biomolecular Research, University of Toronto, Toronto.
4
School of Medicine and Medical Science University College, Dublin 4, Ireland. 5Instituto
Nacional de Saude Dr Ricardo Jorge and Instituto Gulbenkian de Cencia Lisbon, Portugal.
6
Department of Neurology, University of California - Los Angeles School of Medicine, Los
Angeles, California 90095, USA. 7Hospital Pediatrico de Coimbra, Coimbra, Portugal.
8
Department of Biology, University of Bologna, 40126 Bologna, Italy. 9Department of
Psychiatry, University of Oxford, Warneford Hospital, Headington, Oxford, OX3 7JX, UK.
10
Newcomen Centre, Guy's Hospital, London, SE1 9RT, UK. 11Child and Adolescent Mental
Health, University of Newcastle, Sir James Spence Institute, Newcastle upon Tyne, NE1 4LP,
UK. 12Department of Child and Adolescent Psychiatry, Psychosomatics and Psychotherapy, J.W.
Goethe University Frankfurt, 60528 Frankfurt, Germany. 13Department of Child and Adolescent
Psychiatry, Institute of Psychiatry, London, SE5 8AF, UK. 14Human Genetics and Cognitive
Functions, Institut Pasteur; University Paris Diderot-Paris 7, Fondation FondaMental, 75015
Paris, France. 15Autism Research Unit, The Hospital for Sick Children and Bloorview Kids
Rehabilitation, University of Toronto, Toronto, Ontario, M5G 1Z8, Canada. 16The Centre for
Applied Genomics and Program in Genetics and Genomic Biology, The Hospital for Sick
Children and Department of Molecular Genetics, University of Toronto, Ontario, M5G 1L7,
Canada. 17Autism and Communicative Disorders Centre, University of Michigan, Ann Arbor,
Michigan, USA. 18Department of Molecular Physiology and Biophysics, Vanderbilt Kennedy

130
Center, and Centers for Human Genetics Research and Molecular Neuroscience, Vanderbilt
University, Nashville, Tennessee 37232, USA. 19Department of Statistics, Carnegie Mellon
University, Pittsburgh, Pennsylvania, USA 20Department of Child Psychiatry, University
Medical Center, Utrecht, The Netherlands. 21APHP, Hpital Robert Debr, Child and Adolescent
Psychiatry, 75019 Paris, France. 22Wellcome Trust Centre for Human Genetics, University of
Oxford, OX3 7BN, UK. 23Division of Psychiatry, McGill University, Montreal, Quebec, Canada.
24
The John P. Hussman Institute for Human Genomics, University of Miami, Miami, Florida
25
33101, USA. Department of Child and Adolescent Psychiatry, Goteborg University, Goteborg,
S41345, Sweden. 26The Center for Applied Genomics, Division of Human Genetics, The
Childrens Hospital of Philadelphia, Philadelphia, Pennsylvania 19104, USA. 27Department of
Psychiatry and Behavioural Neurosciences, McMaster University, Hamilton, Ontario, L8N 3Z5,
Canada. 28Academic Department of Child Psychiatry, Booth Hall of Children's Hospital,
Blackley, Manchester, M9 7AA, UK. 29Department of Pediatrics, Children's Hospital of
Philadelphia, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104,
30
USA Division of Molecular Genome Analysis, German Cancer Research Center (DKFZ),
Heidelberg 69120, Germany. 31The Seaver Autism Center for Research and Treatment,
Department of Psychiatry, Mount Sinai School of Medicine, New York 10029, USA.
32
Department of Medicine, University of Washington, Seattle, Washington 98195, USA.
33
Autism Genetic Resource Exchange, Autism Speaks, Los Angeles, California 90036-4234,
USA. 34Centre for Integrated Genomic Medical Research, University of Manchester,
Manchester, M13 9PT, UK. 35INSERM U995, Department of Psychiatry, Groupe hospitalier
Henri Mondor-Albert Chenevier, AP-HP; University Paris 12, Fondation FondaMental, Crteil,
France. 36Department of Psychiatry, Division of Child and Adolescent Psychiatry and Child
Development, Stanford University School of Medicine, Stanford, California 94304, USA.
37
Department of Pediatrics, McMaster University, Hamilton, Ontario, L8N 3Z5, Canada.
38
Centre d'Eudes et de Recherches en Psychopathologie, University de Toulouse Le Mirail,
Toulouse 31200, France. 39Department of Psychiatry, Indiana University School of Medicine,
Indianapolis, Indiana 46202, USA. 40Psychiatry Department, University of Utah Medical School,
Salt Lake City, Utah 84108, USA. 41Departments of Psychiatry and Neurology, University of
Pittsburgh School of Medicine, 15213. 42Department of Human Genetics, University of
California - Los Angeles School of Medicine, Los Angeles, California 90095, USA. 43University
Department of Child Psychiatry, Athens University, Medical School, Agia Sophia Children's

131
Hospital, 115 27 Athens, Greece. 44Department of Medicine, School of Epidemiology and Health
Science, University of Manchester, Manchester, M13 9PT, UK. 45INSERM U952 and CNRS
UMR 7224 and UPMC Univ Paris 06, UMR-S 952, Paris 75005, France. 46Carolina Institute for
Developmental Disabilities, University of North Carolina at Chapel Hill, North Carolina 27599-
3366, USA. 47MRC Functional Genomics Unit, Department of Physiology, Anatomy and
Genetics, University of Oxford, Oxford, United Kingdom. 48Social, Genetic and Developmental
Psychiatry Centre, Institute Of Psychiatry, London, SE5 8AF, UK. 49Department of Psychiatry,
Washington University in St. Louis, School of Medicine, St. Louis, Missouri 63130, USA.
50
Department of Pediatrics and Howard Hughes Medical Institute Carver College of Medicine,
University of Iowa, Iowa City, Iowa 52242, USA. 51Battelle Center for Mathematical Medicine,
The Research Institute at Nationwide Children's Hospital and The Ohio State University,
Columbus, Ohio 43205, USA. 52Neuropsichiatria Infantile, Ospedale Santa Croce,61032 Fano,
Italy. 53Child Study Centre, Yale University, New Haven, Connecticut 06520, USA.
54
Department of Psychiatry, Carver College of Medicine, Iowa City, Iowa 52242, USA. 55Center
for Human Genetics Research, Vanderbilt University Medical Centre, Nashville, Tennessee
37232, USA. 56Departments of Biostatistics and Medicine, University of Washington, Seattle,
Washington 98195, USA.

* Lead AGP investigators who contributed equally to this project.

X Deceased

132
Figure S 4-1 PTCHD1 missense variants. Electropherograms indicate the nucleotide
substitutions within PTCHD1 in six unrelated ASD families and two ID families.

133
Figure S 4-2 PTCHD1 domain structure

PTCHD1 domain structure and protein sequence conservation. The protein structure of the
transmembrane protein PTCHD1 is illustrated. (A) Twelve transmembrane domains (blue
cylinders) and Patched-domain (red line) were identified using the SMART tool
(http://smart.embl-heidelberg.de/) with the PFAM domain option selected. In addition, the
locations of seven missense sequence variants discovered among ASD (black) and ID (blue)
probands are shown. (B) CLUSTAL 2.0 alignments for PTCHD1 showing position of missense
mutations among ASD and ID probands. Amino acid positions given are relative to the human
PTCHD1 sequence (NP_775766). Other sequences used include mouse (NP_001087219),
opossum (XP_001366520), platypus (XP_001512040), chicken (XP_425565), zebrafish
(XP_690754), sea urchin (XP_001199849) and nematode (C. elegans) (NP_499380). (C)
CLUSTAL 2.0 alignments for PTCH1, showing missense mutations reported for
holoprosencephaly (Ming et al, 2002; Ribeiro et al, 2006), and including sequences from human
PTCH1 (NP_000255), mouse (NP_032983), opossum (XP_001368370), chicken (NP_990291),
Xenopus laevis (NP_001082082), zebrafish (XP_001922161), fruitfly (NP_523661) and
nematode (C. elegans; NP_495662). In these organisms, the closest matching homologs were
used, although this does not infer proof that these are the true ancestral forms.

134
135
Figure S 4-3 Quantitative RT-PCR for PTCHD1 in human brain regions. PTCHD1
expression in 24 regions of human adult brain is shown. Relatively higher expression was
observed in the cerebellum.

136
Figure S 4-4 PTCHD1 functional analysis. 10T1/2 cells were transiently transfected with -
galactosidase to normalize for transfection efficiency, and Gli2, PTCH1, PTCH2 or PTCHD1.
PTCHD1 exerted a statistically significant inhibitory effect on Gli-dependent transcription,
similar to PTCH1 and PTCH2 (** PTCHD1: p = 0.0061; PTCH1: p = 0.0024; PTCH2: p =
0.0010). Statistical significance (p below 0.05) was calculated using the Students t-test.
Standard error bars are shown.

137
Figure S 4-5 Comparative and phylogenetic analysis of human Patched-related proteins.
Phylogram of Patched-related homologues: (Homo sapiens), created using CLUSTALW
2.0.12 (www.ebi.ac.uk), with N-J treetype. The phylogram is assumed to be an estimate of
a phylogeny, where branch lengths are proportional to the amount of inferred evolutionary
change.

138
Figure S 4-6 SNP coverage at the PTCHD1 locus across different genotyping platforms.
The SNP\CNV probes on Affymetrix 500K, Affymetrix 6.0 and Illumina 1M arrays are
shown.

139
Chapter 5. Future Directions

5.1 Screening of additional autism families for CNVs using

improved microarray platforms
Since the start of this study the microarray platforms and CNV calling algorithms have improved
immensely. The CNV data presented in this study was generated using the Affymetrix
GeneChip Human Mapping 500K Array set, which provides a coverage of ~500,000 SNP
probes across the genome and ~154 Mb genomic region of Chromosome X is being covered by
only ~10,000 probes. Therefore, the possibility of missing some important CNVs is very likely.
Although, at the time of start of this study, this microarray platform was the best available,
currently, the new microarrays offer substantially higher genomic coverage. For example, the
new Affymetrix Genome-Wide Human SNP Array 6.0 offers 1.8 million genetic markers which
include ~906,000 SNP markers, and ~ 946,000 probes for the detection of genome-wide CNVs.
Recently, Illumina has introduced HumanOmni 5 microarray which will enable analysis of ~5.0
million markers across the genome. Furthermore, the CNV calling algorithms have also been
improved over time, and several new commercial software packages are now available for the
detection of copy number variants. Thus, additional autism families should be screened using
improved microarrays and CNV calling software to uncover CNVs which may have been missed
previously. Moreover, at this time, the coverage of clinical microarray platforms for genes
identified in this study is very poor. For example, the mostly widely used microarray, Agilent
4x180K covers PTCHD1 locus with only four probes. Hence, any CNVs at this locus will be
missed in samples processed in clinical laboratories. Therefore, the future version of clinical
microarrays should have an improved coverage of this locus.

5.2 Analysis of splice variation and isoforms at the PTCHD1

locus
As a precursor to more detailed investigations into the function of PTCHD1, it is important to
know whether the currently studied, 888 amino acid protein is the sole isoform, and if not then
which isoform/isoforms are predominant in tissues relevant to autism and ID. The only
commercially available antibodies raised against PTCHD1 (raised against an epitope located in a
region encoded by exon 2) shows two bands upon western hybridization- one at ~100KDa,

140
corresponding closely to the anticipated size for the 888 amino acid protein, and another, much
stronger signal at ~50KDa. Recent preliminary investigations undertaken in the Vincent lab
suggest that in brain tissue a major splice variant exists in which exon 2 is spliced out. This
variant is predicted to result in an mRNA size that correlates better with that shown by northern
blot analysis. However, this isoform cannot explain the western data, but goes some way to
demonstrate the importance investigate alternative splicing thoroughly. Use of alternative
polyadenylation sites should also be investigated.

5.3 Induced pluripotent stem (iPS) studies

To better understand the biological role of candidate genes discovered in this study, iPS cells can
be generated from the fibroblasts of patients and the carrier mothers, if the CNV is maternally
inherited. These iPS cells can be reprogrammed to neurons and other cell lines to explore the
effect of a CNV at cellular level. If a neurophysiological, or neuroanatomical phenotype can be
determined in these iPS cells, we may be able to assay the efficiency of recovering the normal
phenotype after introducing constructs carrying either wild-type PTCHD1 or carrying missense
variants such as those identified as part of the studies reported in this thesis. In addition, these
cells may be used to help further delineate the function or functions of PTCHD1, and these
functions may also be amenable to assaying the effects of missense mutations in PTCHD1.

5.4 Zebrafish knockdown experiments

The generation of morpholino gene knockdowns in zebrafish has become a standard and rapid
way to test the effects of a gene in a mammalian system. In such a system, an antisense molecule
to the gene of interest is introduced into the developing fish embryos, which disrupts the gene
expression, thus allowing the effects of the gene on early development to be assessed. In addition
to the rapidity of such a system (in comparison to mouse knockouts, for instance), another
advantage is that constructs carrying the wild type or mutant gene can then be introduced to see
if they can recover the normal phenotype. Thus, this system could also be a powerful tool to
assess whether missense variants, such as those identified in PTCHD1 or IL1RAPL1 in this
study, are likely to be disease-related.

141
 5.5 Mouse models
Another possible avenue for future research is the development and characterization of mouse
models for autism candidate genes reported in this thesis. In particular, development of a murine
knock-out (KO) of PTCHD1 will be of great interest. This approach will help us understand the
pathogenic nature of these candidate genes and their role in neurodevelopment and
neurophysiology, also it will help us learn if other systems are also affected. A future study may
include performing detailed neurocognitive and behavioral testing of a PTCHD1 mouse model to
determine to what degree Ptchd1 disruption contributes to the autistic and cognitive impairment
seen in the human PTCHD1 ve individuals. In particular, it would be interesting to see if
PTCHD1 KO mice exhibit the deficits in social interactions and show behavioral and motor
disturbances. Also, immunohistochemical studies of neurons of KO mice will be help to
elucidate any morphological defects. Furthermore, neurophysiological and/or
electrophysiological studies of WT and KO mice will be helpful in identification of any
functional abnormalities of synapses.

5.6 Next Generation Sequencing of the entire chromosome X

The present study has further highlighted the importance of X-chromosomal genes in the ID and
Autism. In fact, to date more than 95 chromosome X genes have been shown to cause some
form of ID. Consequently, future studies may utilize the Next Generation Sequencing (NGS)
technologies to search the sequence variants associated with autism. In recent years, NGS
technologies have rapidly emerged. Deep sequencing of the entire X chromosome has great
potential to uncover new autism candidate genes, and discover new biological pathways,
important in the etiology of autism. In addition, NGS approaches will enable us to screen many
more patients for coding mutations in PTCHD1.

5.7 Development of Potential Therapies

Another most important research direction may be the development of potential therapies for the
candidate genes. Monogenic causes of autism are the most suitable targets for development of
therapies, as the rescue of only a single protein would be required. Importantly, in this study, we
have identified deletion mutations of PTCHD1 as a monogenic cause of autism and\or ID, albeit
in a very small proportion of cases. In a larger number of cases we see missense variants in

142
PTCHD1 and CNVs upstream of PTCHD1 contributing to an oligogenic form of ASD. Hence,
development of any potential therapies for this target only may have enormous medical
implications. Nevertheless, development of therapies for other autism genes is also warranted.
This goal can be achieved through several different approaches. For example, a mouse model can
be generated by disrupting the gene of interest and then phenotype can be rescued by restoring
the functional gene.

143
Chapter 6. References

Allen Institute mouse brain atlas in situ hybridization data for Ptchd1: http://mouse.brain-

map.org/brain/Ptchd1.html?ispopup=true.

SNP database at NCBI: http://www.ncbi.nlm.nih.gov/projects/SNP/.

UCSC Genome Browser: http://genome.ucsc.edu/.

Abidi, F. E., Holinski-Feder, E., Rittinger, O., Kooy, F., Lubs, H. A., Stevenson, R. E. et al.

(2002). A novel 2 bp deletion in the TM4SF2 gene is associated with MRX58. J.Med.Genet., 39,

430-433.

Abrahams, B. S. & Geschwind, D. H. (2008). Advances in autism genetics: on the threshold of a

new neurobiology. Nat.Rev.Genet., 9, 341-355.

Alarcon, M., Cantor, R. M., Liu, J., Gilliam, T. C., & Geschwind, D. H. (2002). Evidence for a

language quantitative trait locus on chromosome 7q in multiplex autism families. American

Journal of Human Genetics, 70, 60-71.

Allen, R. C., Zoghbi, H. Y., Moseley, A. B., Rosenblatt, H. M., & Belmont, J. W. (1992).

Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-

receptor gene correlates with X chromosome inactivation. American Journal of Human Genetics,

51, 1229-1239.

American Psychiatric Association (2000). Diagnostic and statistical manual of mental disorders,

Text Revision. 4.

144
Amir, R. E., Van den Veyver, I. B., Wan, M., Tran, C. Q., Francke, U., & Zoghbi, H. Y. (1999).

Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding

protein 2. Nat.Genet., 23, 185-188.

Anney, R., Klei, L., Pinto, D., Regan, R., Conroy, J., Magalhaes, T. R. et al. (2010). A genome-

wide scan for common alleles affecting risk for autism. Human molecular genetics.

Arndt, T. L., Stodgell, C. J., & Rodier, P. M. (2005). The teratology of autism.

Int.J.Dev.Neurosci., 23, 189-199.

Ashley-Koch, A. E., Jaworski, J., Ma, d. Q., Mei, H., Ritchie, M. D., Skaar, D. A. et al. (2007).

Investigation of potential gene-gene interactions between APOE and RELN contributing to

autism risk. Psychiatr.Genet., 17, 221-226.

Auranen, M., Vanhala, R., Varilo, T., Ayers, K., Kempas, E., Ylisaukko-oja, T. et al. (2002). A

genomewide screen for autism-spectrum disorders: evidence for a major susceptibility locus on

chromosome 3q25-27. American Journal of Human Genetics, 71, 777-790.

Bahi, N., Friocourt, G., Carrie, A., Graham, M. E., Weiss, J. L., Chafey, P. et al. (2003). IL1

receptor accessory protein like, a protein involved in X-linked intellectual disability, interacts

with Neuronal Calcium Sensor-1 and regulates exocytosis. Human molecular genetics, 12, 1415-

1425.

Baieli, S., Pavone, L., Meli, C., Fiumara, A., & Coleman, M. (2003). Autism and

phenylketonuria. J.Autism Dev.Disord., 33, 201-204.

145
Baird, G., Charman, T., Baron-Cohen, S., Cox, A., Swettenham, J., Wheelwright, S. et al.

(2000). A screening instrument for autism at 18 months of age: a 6-year follow-up study.

J.Am.Acad.Child Adolesc.Psychiatry, 39, 694-702.

Baird, G., Charman, T., Cox, A., Baron-Cohen, S., Swettenham, J., Wheelwright, S. et al.

(2001). Current topic: Screening and surveillance for autism and pervasive developmental

disorders. Arch.Dis.Child, 84, 468-475.

Baird, G., Simonoff, E., Pickles, A., Chandler, S., Loucas, T., Meldrum, D. et al. (2006).

Prevalence of disorders of the autism spectrum in a population cohort of children in South

Thames: the Special Needs and Autism Project (SNAP). Lancet, 368, 210-215.

Baird, T. D. & August, G. J. (1985). Familial heterogeneity in infantile autism. J.Autism

Dev.Disord., 15, 315-321.

Baker, J. P. (2008). Mercury, vaccines, and autism: one controversy, three histories. Am.J.Public

Health, 98, 244-253.

Baron-Cohen, S., Scott, F. J., Allison, C., Williams, J., Bolton, P., Matthews, F. E. et al. (2009).

Prevalence of autism-spectrum conditions: UK school-based population study. Br.J.Psychiatry,

194, 500-509.

Barrett, S., Beck, J. C., Bernier, R., Bisson, E., Braun, T. A., Casavant, T. L. et al. (1999). An

autosomal genomic screen for autism. Collaborative linkage study of autism. Am.J.Med.Genet.,

88, 609-615.

Beck, M. (2011). Mucopolysaccharidosis Type II (Hunter Syndrome): Clinical Picture and

Treatment. Curr.Pharm.Biotechnol..

146
Berditchevski, F. (2001). Complexes of tetraspanins with integrins: more than meets the eye.

J.Cell Sci., 114, 4143-4151.

Berkel, S., Marshall, C. R., Weiss, B., Howe, J., Roeth, R., Moog, U. et al. (2010). Mutations in

the SHANK2 synaptic scaffolding gene in autism spectrum disorder and mental retardation.

Nat.Genet., 42, 489-491.

Bertrand, J., Mars, A., Boyle, C., Bove, F., Yeargin-Allsopp, M., & Decoufle, P. (2001).

Prevalence of autism in a United States population: the Brick Township, New Jersey,

investigation. Pediatrics, 108, 1155-1161.

Bhat, S. S., Ladd, S., Grass, F., Spence, J. E., Brasington, C. K., Simensen, R. J. et al. (2008).

Disruption of the IL1RAPL1 gene associated with a pericentromeric inversion of the X

chromosome in a patient with mental retardation and autism. Clin.Genet., 73, 94-96.

Blasi, F., Bacchelli, E., Carone, S., Toma, C., Monaco, A. P., Bailey, A. J. et al. (2006).

SLC25A12 and CMYA3 gene variants are not associated with autism in the IMGSAC multiplex

family sample. Eur.J.Hum.Genet., 14, 123-126.

Blasi, F., Bacchelli, E., Pesaresi, G., Carone, S., Bailey, A. J., & Maestrini, E. (2006). Absence

of coding mutations in the X-linked genes neuroligin 3 and neuroligin 4 in individuals with

autism from the IMGSAC collection. Am.J.Med.Genet.B Neuropsychiatr.Genet., 141B, 220-221.

Boddaert, N., Zilbovicius, M., Philipe, A., Robel, L., Bourgeois, M., Barthelemy, C. et al.

(2009). MRI findings in 77 children with non-syndromic autistic disorder. PLoS.One., 4, e4415.

147
Bodfish, J. W., Powell, S. B., Golden, R. N., & Lewis, M. H. (1995). Blink rate as an index of

dopamine function in adults with mental retardation and repetitive behavior disorders.

Am.J.Ment.Retard., 99, 335-344.

Bodfish, J. W., Symons, F. J., Parker, D. E., & Lewis, M. H. (2000). Varieties of repetitive

behavior in autism: comparisons to mental retardation. J.Autism Dev.Disord., 30, 237-243.

Bolton, P., Macdonald, H., Pickles, A., Rios, P., Goode, S., Crowson, M. et al. (1994). A case-

control family history study of autism. J.Child Psychol.Psychiatry, 35, 877-900.

Bonora, E., Beyer, K. S., Lamb, J. A., Parr, J. R., Klauck, S. M., Benner, A. et al. (2003).

Analysis of reelin as a candidate gene for autism. Mol.Psychiatry, 8, 885-892.

Borg, I., Squire, M., Menzel, C., Stout, K., Morgan, D., Willatt, L. et al. (2002). A cryptic

deletion of 2q35 including part of the PAX3 gene detected by breakpoint mapping in a child with

autism and a de novo 2;8 translocation. J.Med.Genet., 39, 391-399.

Bradley, E. A., Thompson, A., & Bryson, S. E. (2002). Mental retardation in teenagers:

prevalence data from the Niagara region, Ontario. Can.J.Psychiatry, 47, 652-659.

Bromley, R. L., Mawer, G., Clayton-Smith, J., & Baker, G. A. (2008). Autism spectrum

disorders following in utero exposure to antiepileptic drugs. Neurology, 71, 1923-1924.

Brown, W. T., Friedman, E., Jenkins, E. C., Brooks, J., Wisniewski, K., Raguthu, S. et al.

(1982). Association of fragile X syndrome with autism. Lancet, 1, 100.

Bryson, S. E., Bradley, E. A., Thompson, A., & Wainwright, A. (2008). Prevalence of autism

among adolescents with intellectual disabilities. Can.J.Psychiatry, 53, 449-459.

148
Bucan, M., Abrahams, B. S., Wang, K., Glessner, J. T., Herman, E. I., Sonnenblick, L. I. et al.

(2009). Genome-wide analyses of exonic copy number variants in a family-based study point to

novel autism susceptibility genes. PLoS.Genet., 5, e1000536.

Buxbaum, J. D., Cai, G., Nygren, G., Chaste, P., Delorme, R., Goldsmith, J. et al. (2007).

Mutation analysis of the NSD1 gene in patients with autism spectrum disorders and

macrocephaly. BMC.Med.Genet., 8, 68.

Buxbaum, J. D., Silverman, J. M., Smith, C. J., Kilifarski, M., Reichert, J., Hollander, E. et al.

(2001). Evidence for a susceptibility gene for autism on chromosome 2 and for genetic

heterogeneity. American Journal of Human Genetics, 68, 1514-1520.

Cai, G., Edelmann, L., Goldsmith, J. E., Cohen, N., Nakamine, A., Reichert, J. G. et al. (2008).

Multiplex ligation-dependent probe amplification for genetic screening in autism spectrum

disorders: efficient identification of known microduplications and identification of a novel

microduplication in ASMT. BMC.Med.Genomics, 1, 50.

Carlson, C. S., Eberle, M. A., Kruglyak, L., & Nickerson, D. A. (2004). Mapping complex

disease loci in whole-genome association studies. Nature, 429, 446-452.

Carrie, A., Jun, L., Bienvenu, T., Vinet, M. C., McDonell, N., Couvert, P. et al. (1999a). A new

member of the IL-1 receptor family highly expressed in hippocampus and involved in X-linked

mental retardation. Nat.Genet., 23, 25-31.

Carrie, A., Jun, L., Bienvenu, T., Vinet, M. C., McDonell, N., Couvert, P. et al. (1999b). A new

member of the IL-1 receptor family highly expressed in hippocampus and involved in X-linked

mental retardation. Nat.Genet., 23, 25-31.

149
Castermans, D., Wilquet, V., Parthoens, E., Huysmans, C., Steyaert, J., Swinnen, L. et al. (2003).

The neurobeachin gene is disrupted by a translocation in a patient with idiopathic autism.

J.Med.Genet., 40, 352-356.

Caviness, V. S., Jr. (1976). Patterns of cell and fiber distribution in the neocortex of the reeler

mutant mouse. J.Comp Neurol., 170, 435-447.

Chakrabarti, S. & Fombonne, E. (2001). Pervasive developmental disorders in preschool

children. JAMA, 285, 3093-3099.

Chakrabarti, S. & Fombonne, E. (2005). Pervasive developmental disorders in preschool

children: confirmation of high prevalence. Am.J.Psychiatry, 162, 1133-1141.

Chien, W. H., Wu, Y. Y., Gau, S. S., Huang, Y. S., Soong, W. T., Chiu, Y. N. et al. (2010).

Association study of the SLC25A12 gene and autism in Han Chinese in Taiwan.

Prog.Neuropsychopharmacol.Biol.Psychiatry, 34, 189-192.

Cho, B., Lim, Y., Lee, D. Y., Park, S. Y., Lee, H., Kim, W. H. et al. (2002). Identification and

characterization of a novel cancer/testis antigen gene CAGE. Biochem.Biophys.Res.Commun.,

292, 715-726.

Clarke, D. F., Roberts, W., Daraksan, M., Dupuis, A., McCabe, J., Wood, H. et al. (2005). The

prevalence of autistic spectrum disorder in children surveyed in a tertiary care epilepsy clinic.

Epilepsia, 46, 1970-1977.

Constantino, J. N. & Todd, R. D. (2005). Intergenerational transmission of subthreshold autistic

traits in the general population. Biol.Psychiatry, 57, 655-660.

150
Cook, E. H., Jr. & Scherer, S. W. (2008). Copy-number variations associated with

neuropsychiatric conditions. Nature, 455, 919-923.

Cornish, K., Turk, J., & Hagerman, R. (2008). The fragile X continuum: new advances and

perspectives. J.Intellect.Disabil.Res., 52, 469-482.

Courchesne, E., Karns, C. M., Davis, H. R., Ziccardi, R., Carper, R. A., Tigue, Z. D. et al.

(2001). Unusual brain growth patterns in early life in patients with autistic disorder: an MRI

study. Neurology, 57, 245-254.

Daoud, H., Bonnet-Brilhault, F., Vedrine, S., Demattei, M. V., Vourc'h, P., Bayou, N. et al.

(2009). Autism and nonsyndromic mental retardation associated with a de novo mutation in the

NLGN4X gene promoter causing an increased expression level. Biol.Psychiatry, 66, 906-910.

Day, A., Carlson, M. R., Dong, J., O'Connor, B. D., & Nelson, S. F. (2007). Celsius: a

community resource for Affymetrix microarray data. Genome Biol., 8, R112.

de, B. A., Serra, M., Luteijn, E., Kraijer, D., Sytema, S., & Minderaa, R. (2005). Social skills in

children with intellectual disabilities with and without autism. J.Intellect.Disabil.Res., 49, 317-

328.

De, V. B., Frints, S., Borghgraef, M., & Fryns, J. P. (2002). Cognitive and behavioral

characteristics in 4 affected males of a family with non-specific X-linked mental retardation and

TM4 SF2-gene mutation. Genet.Couns., 13, 191-194.

Del Rio, J. A., Heimrich, B., Borrell, V., Forster, E., Drakew, A., Alcantara, S. et al. (1997). A

role for Cajal-Retzius cells and reelin in the development of hippocampal connections. Nature,

385, 70-74.

151
Dibbens, L. M., Tarpey, P. S., Hynes, K., Bayly, M. A., Scheffer, I. E., Smith, R. et al. (2008).

X-linked protocadherin 19 mutations cause female-limited epilepsy and cognitive impairment.

Nat.Genet., 40, 776-781.

Dixon, A. L., Liang, L., Moffatt, M. F., Chen, W., Heath, S., Wong, K. C. et al. (2007). A

genome-wide association study of global gene expression. Nat.Genet., 39, 1202-1207.

Doherty, D., Parisi, M. A., Finn, L. S., Gunay-Aygun, M., Al-Mateen, M., Bates, D. et al.

(2010). Mutations in 3 genes (MKS3, CC2D2A and RPGRIP1L) cause COACH syndrome

(Joubert syndrome with congenital hepatic fibrosis). J.Med.Genet., 47, 8-21.

Drews, C. D., Yeargin-Allsopp, M., Decoufle, P., & Murphy, C. C. (1995). Variation in the

influence of selected sociodemographic risk factors for mental retardation. Am.J.Public Health,

85, 329-334.

DSM-IV (1994). American Psychiatric Association. Diagnostic and Statistical Manual of Mental

Disorders. American Psychiatric Association: 4th Edition.

Durand, C. M., Betancur, C., Boeckers, T. M., Bockmann, J., Chaste, P., Fauchereau, F. et al.

(2007). Mutations in the gene encoding the synaptic scaffolding protein SHANK3 are associated

with autism spectrum disorders. Nat.Genet., 39, 25-27.

Durkin, M. S., Hasan, Z. M., & Hasan, K. Z. (1998). Prevalence and correlates of mental

retardation among children in Karachi, Pakistan. Am.J.Epidemiol., 147, 281-288.

Emerson, E. (2007). Poverty and people with intellectual disabilities.

Ment.Retard.Dev.Disabil.Res.Rev., 13, 107-113.

152
Falush, D., Stephens, M., & Pritchard, J. K. (2003). Inference of population structure using

multilocus genotype data: linked loci and correlated allele frequencies. Genetics, 164, 1567-

1587.

Fatemi, S. H., Snow, A. V., Stary, J. M., Araghi-Niknam, M., Reutiman, T. J., Lee, S. et al.

(2005). Reelin signaling is impaired in autism. Biol.Psychiatry, 57, 777-787.

Feuk, L., Carson, A. R., & Scherer, S. W. (2006). Structural variation in the human genome.

Nat.Rev.Genet., 7, 85-97.

Filges, I., Rothlisberger, B., Blattner, A., Boesch, N., Demougin, P., Wenzel, F. et al. (2011).

Deletion in Xp22.11: PTCHD1 is a candidate gene for X-linked intellectual disability with or

without autism. Clin.Genet., 79, 79-85.

Fishburn, J., Turner, G., Daniel, A., & Brookwell, R. (1983). The diagnosis and frequency of X-

linked conditions in a cohort of moderately retarded males with affected brothers.

Am.J.Med.Genet., 14, 713-724.

Folstein, S. & Rutter, M. (1977). Infantile autism: a genetic study of 21 twin pairs. J.Child

Psychol.Psychiatry, 18, 297-321.

Fombonne, E. (1999). The epidemiology of autism: a review. Psychol.Med., 29, 769-786.

Fombonne, E. (2003). Epidemiological surveys of autism and other pervasive developmental

disorders: an update. J.Autism Dev.Disord., 33, 365-382.

Fombonne, E., Zakarian, R., Bennett, A., Meng, L., & McLean-Heywood, D. (2006). Pervasive

developmental disorders in Montreal, Quebec, Canada: prevalence and links with

immunizations. Pediatrics, 118, e139-e150.

153
Friesema, E. C., Grueters, A., Biebermann, H., Krude, H., von, M. A., Reeser, M. et al. (2004).

Association between mutations in a thyroid hormone transporter and severe X-linked

psychomotor retardation. Lancet, 364, 1435-1437.

Froyen, G., Van, E. H., Bauters, M., Hollanders, K., Frints, S. G., Vermeesch, J. R. et al. (2007).

Detection of genomic copy number changes in patients with idiopathic mental retardation by

high-resolution X-array-CGH: important role for increased gene dosage of XLMR genes.

Hum.Mutat., 28, 1034-1042.

Gauthier, J., Bonnel, A., St-Onge, J., Karemera, L., Laurent, S., Mottron, L. et al. (2005).

NLGN3/NLGN4 gene mutations are not responsible for autism in the Quebec population.

Am.J.Med.Genet.B Neuropsychiatr.Genet., 132B, 74-75.

Gauthier, J., Joober, R., Dube, M. P., St-Onge, J., Bonnel, A., Gariepy, D. et al. (2006). Autism

spectrum disorders associated with X chromosome markers in French-Canadian males.

Mol.Psychiatry, 11, 206-213.

Gecz, J., Cloosterman, D., & Partington, M. (2006). ARX: a gene for all seasons.

Curr.Opin.Genet.Dev., 16, 308-316.

Giannandrea, M., Bianchi, V., Mignogna, M. L., Sirri, A., Carrabino, S., D'Elia, E. et al. (2010).

Mutations in the small GTPase gene RAB39B are responsible for X-linked mental retardation

associated with autism, epilepsy, and macrocephaly. Am.J.Hum.Genet., 86, 185-195.

Gillberg, C. (1986). Autism and Rett syndrome: some notes on differential diagnosis.

Am.J.Med.Genet.Suppl, 1, 127-131.

154
Gillberg, C., Steffenburg, S., & Schaumann, H. (1991). Is autism more common now than ten

years ago? Br.J.Psychiatry, 158, 403-409.

Glas, R., Marshall Graves, J. A., Toder, R., Ferguson-Smith, M., & O'Brien, P. C. (1999). Cross-

species chromosome painting between human and marsupial directly demonstrates the ancient

region of the mammalian X. Mamm.Genome, 10, 1115-1116.

Glessner, J. T., Wang, K., Cai, G., Korvatska, O., Kim, C. E., Wood, S. et al. (2009). Autism

genome-wide copy number variation reveals ubiquitin and neuronal genes. Nature, 459, 569-

573.

Goldman, S., Wang, C., Salgado, M. W., Greene, P. E., Kim, M., & Rapin, I. (2009). Motor

stereotypies in children with autism and other developmental disorders. Dev.Med.Child Neurol.,

51, 30-38.

Graves, J. A. (1995). The origin and function of the mammalian Y chromosome and Y-borne

genes--an evolving understanding. BioEssays : news and reviews in molecular, cellular and

developmental biology, 17, 311-320.

Graves, J. A. (1996). Mammals that break the rules: genetics of marsupials and monotremes.

Annu.Rev.Genet., 30, 233-260.

Hagberg, B., Aicardi, J., Dias, K., & Ramos, O. (1983). A progressive syndrome of autism,

dementia, ataxia, and loss of purposeful hand use in girls: Rett's syndrome: report of 35 cases.

Ann.Neurol., 14, 471-479.

Hagerman, R. J. (2006). Lessons from fragile X regarding neurobiology, autism, and

neurodegeneration. J.Dev.Behav.Pediatr., 27, 63-74.

155
Hagerman, R. J., Ono, M. Y., & Hagerman, P. J. (2005). Recent advances in fragile X: a model

for autism and neurodegeneration. Curr.Opin.Psychiatry, 18, 490-496.

Hallmayer, J., Cleveland, S., Torres, A., Phillips, J., Cohen, B., Torigoe, T. et al. (2011). Genetic

Heritability and Shared Environmental Factors Among Twin Pairs With Autism.

Arch.Gen.Psychiatry.

Hammond, P., Forster-Gibson, C., Chudley, A. E., Allanson, J. E., Hutton, T. J., Farrell, S. A. et

al. (2008). Face-brain asymmetry in autism spectrum disorders. Mol.Psychiatry, 13, 614-623.

Happe, F. & Ronald, A. (2008). The 'fractionable autism triad': a review of evidence from

behavioural, genetic, cognitive and neural research. Neuropsychol.Rev., 18, 287-304.

Hara, H. (2007). Autism and epilepsy: a retrospective follow-up study. Brain Dev., 29, 486-490.

Harris, S. W., Hessl, D., Goodlin-Jones, B., Ferranti, J., Bacalman, S., Barbato, I. et al. (2008).

Autism profiles of males with fragile X syndrome. Am.J.Ment.Retard., 113, 427-438.

Hedges, S. B. & Kumar, S. (2004). Precision of molecular time estimates. Trends in genetics :

TIG, 20, 242-247.

Hehr, U., Gross, C., Diebold, U., Wahl, D., Beudt, U., Heidemann, P. et al. (2004). Wide

phenotypic variability in families with holoprosencephaly and a sonic hedgehog mutation.

Eur.J.Pediatr., 163, 347-352.

Hertz-Picciotto, I., Green, P. G., Delwiche, L., Hansen, R., Walker, C., & Pessah, I. N. (2010).

Blood Mercury Concentrations in CHARGE Study Children with and without Autism.

Environ.Health Perspect., 118, 161-166.

156
Hogart, A., Wu, D., LaSalle, J. M., & Schanen, N. C. (2010). The comorbidity of autism with the

genomic disorders of chromosome 15q11.2-q13. Neurobiol.Dis., 38, 181-191.

Holt, R., Barnby, G., Maestrini, E., Bacchelli, E., Brocklebank, D., Sousa, I. et al. (2010).

Linkage and candidate gene studies of autism spectrum disorders in European populations.

Eur.J.Hum.Genet..

Howlin, P., Goode, S., Hutton, J., & Rutter, M. (2004). Adult outcome for children with autism.

J.Child Psychol.Psychiatry, 45, 212-229.

Huang, X. L., Zou, Y. S., Maher, T. A., Newton, S., & Milunsky, J. M. (2010). A de novo

balanced translocation breakpoint truncating the autism susceptibility candidate 2 (AUTS2) gene

in a patient with autism. Am.J.Med.Genet.A, 152A, 2112-2114.

Hughes, J. R. & Melyn, M. (2005). EEG and seizures in autistic children and adolescents: further

findings with therapeutic implications. Clin.EEG.Neurosci., 36, 15-20.

Hurley, R. S., Losh, M., Parlier, M., Reznick, J. S., & Piven, J. (2007). The broad autism

phenotype questionnaire. J.Autism Dev.Disord., 37, 1679-1690.

Hynes, K., Tarpey, P., Dibbens, L. M., Bayly, M. A., Berkovic, S. F., Smith, R. et al. (2009).

Epilepsy and mental retardation limited to females with PCDH19 mutations can present de novo

or in single generation families. J.Med.Genet..

Iafrate, A. J., Feuk, L., Rivera, M. N., Listewnik, M. L., Donahoe, P. K., Qi, Y. et al. (2004).

Detection of large-scale variation in the human genome. Nat.Genet., 36, 949-951.

157
ICD-10 (1992). World Health Organisation. The ICD-10 Classification of Mental and

Behavioural Disorders. Clinical Descriptions and Diagnostic Guidelines. World Health

Organisation.

IMGSAC (2001). A genomewide screen for autism: strong evidence for linkage to chromosomes

2q, 7q, and 16p. American Journal of Human Genetics, 69, 570-581.

Ishikawa-Brush, Y., Powell, J. F., Bolton, P., Miller, A. P., Francis, F., Willard, H. F. et al.

(1997). Autism and multiple exostoses associated with an X;8 translocation occurring within the

GRPR gene and 3' to the SDC2 gene. Human molecular genetics, 6, 1241-1250.

Jacob, J. & Briscoe, J. (2003). Gli proteins and the control of spinal-cord patterning. EMBO

Rep., 4, 761-765.

Jamain, S., Quach, H., Betancur, C., Rastam, M., Colineaux, C., Gillberg, I. C. et al. (2003).

Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with

autism. Nat.Genet., 34, 27-29.

Jessell, T. M. (2000). Neuronal specification in the spinal cord: inductive signals and

transcriptional codes. Nat.Rev.Genet., 1, 20-29.

Jeste, S. S., Sahin, M., Bolton, P., Ploubidis, G. B., & Humphrey, A. (2008). Characterization of

autism in young children with tuberous sclerosis complex. J.Child Neurol., 23, 520-525.

Jin, H., Gardner, R. J., Viswesvaraiah, R., Muntoni, F., & Roberts, R. G. (2000). Two novel

members of the interleukin-1 receptor gene family, one deleted in Xp22.1-Xp21.3 mental

retardation. Eur.J.Hum.Genet., 8, 87-94.

158
Johnston, P. G. & Robinson, E. S. (1986). Lack of correlation between Gpd expression and X

chromosome late replication in cultured fibroblasts of the kangaroo Macropus robustus.

Australian Journal of Biological Sciences, 39, 37-45.

Katusic, S. K., Colligan, R. C., Beard, C. M., O'Fallon, W. M., Bergstralh, E. J., Jacobsen, S. J.

et al. (1996). Mental retardation in a birth cohort, 1976-1980, Rochester, Minnesota.

Am.J.Ment.Retard., 100, 335-344.

Kaufman, L., Ayub, M., & Vincent, J. B. (2010). The genetic basis of non-syndromic intellectual

disability: a review. J.Neurodev.Disord., 2, 182-209.

Klauck, S. M., Felder, B., Kolb-Kokocinski, A., Schuster, C., Chiocchetti, A., Schupp, I. et al.

(2006). Mutations in the ribosomal protein gene RPL10 suggest a novel modulating disease

mechanism for autism. Mol.Psychiatry, 11, 1073-1084.

Kleinjan, D. A. & van, H., V (2005). Long-range control of gene expression: emerging

mechanisms and disruption in disease. American Journal of Human Genetics, 76, 8-32.

Kleinman, J. M., Robins, D. L., Ventola, P. E., Pandey, J., Boorstein, H. C., Esser, E. L. et al.

(2008). The modified checklist for autism in toddlers: a follow-up study investigating the early

detection of autism spectrum disorders. J.Autism Dev.Disord., 38, 827-839.

Kogan, M. D., Blumberg, S. J., Schieve, L. A., Boyle, C. A., Perrin, J. M., Ghandour, R. M. et al.

(2009). Prevalence of parent-reported diagnosis of autism spectrum disorder among children in

the US, 2007. Pediatrics, 124, 1395-1403.

159
Kohn, M., Kehrer-Sawatzki, H., Vogel, W., Graves, J. A., & Hameister, H. (2004). Wide

genome comparisons reveal the origins of the human X chromosome. Trends in genetics : TIG,

20, 598-603.

Komura, D., Shen, F., Ishikawa, S., Fitch, K. R., Chen, W., Zhang, J. et al. (2006). Genome-wide

detection of human copy number variations using high-density DNA oligonucleotide arrays.

Genome Res., 16, 1575-1584.

Krawczak, M., Nikolaus, S., von, E. H., Croucher, P. J., El Mokhtari, N. E., & Schreiber, S.

(2006). PopGen: population-based recruitment of patients and controls for the analysis of

complex genotype-phenotype relationships. Community Genet., 9, 55-61.

Krebs, M. O., Betancur, C., Leroy, S., Bourdel, M. C., Gillberg, C., & Leboyer, M. (2002).

Absence of association between a polymorphic GGC repeat in the 5' untranslated region of the

reelin gene and autism. Mol.Psychiatry, 7, 801-804.

Lahn, B. T. & Page, D. C. (1999). Four evolutionary strata on the human X chromosome.

Science (New York, N.Y.), 286, 964-967.

Lander, E. & Kruglyak, L. (1995). Genetic dissection of complex traits: guidelines for

interpreting and reporting linkage results. Nat.Genet., 11, 241-247.

Laumonnier, F., Bonnet-Brilhault, F., Gomot, M., Blanc, R., David, A., Moizard, M. P. et al.

(2004). X-linked mental retardation and autism are associated with a mutation in the NLGN4

gene, a member of the neuroligin family. American Journal of Human Genetics, 74, 552-557.

Leonard, H. & Wen, X. (2002). The epidemiology of mental retardation: challenges and

opportunities in the new millennium. Ment.Retard.Dev.Disabil.Res.Rev., 8, 117-134.

160
Li, C. & Wong, W. H. (2001). Model-based analysis of oligonucleotide arrays: expression index

computation and outlier detection. Proc.Natl.Acad.Sci.U.S.A, 98, 31-36.

Li, J., Nguyen, L., Gleason, C., Lotspeich, L., Spiker, D., Risch, N. et al. (2004). Lack of

evidence for an association between WNT2 and RELN polymorphisms and autism.

Am.J.Med.Genet.B Neuropsychiatr.Genet., 126B, 51-57.

Liu, J., Nyholt, D. R., Magnussen, P., Parano, E., Pavone, P., Geschwind, D. et al. (2001). A

genomewide screen for autism susceptibility loci. American Journal of Human Genetics, 69,

327-340.

Lord, C., Risi, S., Lambrecht, L., Cook, E. H., Jr., Leventhal, B. L., DiLavore, P. C. et al. (2000).

The autism diagnostic observation schedule-generic: a standard measure of social and

communication deficits associated with the spectrum of autism. J.Autism Dev.Disord., 30, 205-

223.

Lord, C., Rutter, M., & Le, C. A. (1994). Autism Diagnostic Interview-Revised: a revised

version of a diagnostic interview for caregivers of individuals with possible pervasive

developmental disorders. J.Autism Dev.Disord., 24, 659-685.

Macedoni-Luksic, M., Greiss-Hess, L., Rogers, S. J., Gosar, D., Lemons-Chitwood, K., &

Hagerman, R. (2009). Imitation in fragile X syndrome. Implications for autism. Autism, 13, 599-

611.

Maranduba, C. M., Sa, M. E., Muller, O. G., Pavanello, R. C., Vianna-Morgante, A. M., &

Passos-Bueno, M. R. (2004). Does the P172H mutation at the TM4SF2 gene cause X-linked

mental retardation? Am.J.Med.Genet.A, 124A, 413-415.

161
Marshall, C. R., Noor, A., Vincent, J. B., Lionel, A. C., Feuk, L., Skaug, J. et al. (2008).

Structural variation of chromosomes in autism spectrum disorder. American Journal of Human

Genetics, 82, 477-488.

Marui, T., Hashimoto, O., Nanba, E., Kato, C., Tochigi, M., Umekage, T. et al. (2004).

Association between the neurofibromatosis-1 (NF1) locus and autism in the Japanese population.

Am.J.Med.Genet.B Neuropsychiatr.Genet., 131B, 43-47.

McConachie, H. & Diggle, T. (2007). Parent implemented early intervention for young children

with autism spectrum disorder: a systematic review. J.Eval.Clin.Pract., 13, 120-129.

McLaren, J. & Bryson, S. E. (1987). Review of recent epidemiological studies of mental

retardation: prevalence, associated disorders, and etiology. Am.J.Ment.Retard., 92, 243-254.

Meloni, I., Muscettola, M., Raynaud, M., Longo, I., Bruttini, M., Moizard, M. P. et al. (2002).

FACL4, encoding fatty acid-CoA ligase 4, is mutated in nonspecific X-linked mental retardation.

Nat.Genet., 30, 436-440.

Mercer, T. R., Dinger, M. E., & Mattick, J. S. (2009). Long non-coding RNAs: insights into

functions. Nat.Rev.Genet., 10, 155-159.

Miles, J. H., Hadden, L. L., Takahashi, T. N., & Hillman, R. E. (2000). Head circumference is an

independent clinical finding associated with autism. Am.J.Med.Genet., 95, 339-350.

Miles, J. H. & Hillman, R. E. (2000). Value of a clinical morphology examination in autism.

Am.J.Med.Genet., 91, 245-253.

162
Miles, J. H., Takahashi, T. N., Bagby, S., Sahota, P. K., Vaslow, D. F., Wang, C. H. et al. (2005).

Essential versus complex autism: definition of fundamental prognostic subtypes.

Am.J.Med.Genet.A, 135, 171-180.

Miller, D. T., Shen, Y., Weiss, L. A., Korn, J., Anselm, I., Bridgemohan, C. et al. (2009).

Microdeletion/duplication at 15q13.2q13.3 among individuals with features of autism and other

neuropsychiatric disorders. J.Med.Genet., 46, 242-248.

Moessner, R., Marshall, C. R., Sutcliffe, J. S., Skaug, J., Pinto, D., Vincent, J. et al. (2007).

Contribution of SHANK3 mutations to autism spectrum disorder. American Journal of Human

Genetics, 81, 1289-1297.

Mostofsky, S. H., Powell, S. K., Simmonds, D. J., Goldberg, M. C., Caffo, B., & Pekar, J. J.

(2009). Decreased connectivity and cerebellar activity in autism during motor task performance.

Brain, 132, 2413-2425.

Nannya, Y., Sanada, M., Nakazaki, K., Hosoya, N., Wang, L., Hangaishi, A. et al. (2005). A

robust algorithm for copy number detection using high-density oligonucleotide single nucleotide

polymorphism genotyping arrays. Cancer Res., 65, 6071-6079.

Narita, M., Oyabu, A., Imura, Y., Kamada, N., Yokoyama, T., Tano, K. et al. (2010).

Nonexploratory movement and behavioral alterations in a thalidomide or valproic acid-induced

autism model rat. Neurosci.Res., 66, 2-6.

Nawara, M., Klapecki, J., Borg, K., Jurek, M., Moreno, S., Tryfon, J. et al. (2008). Novel

mutation of IL1RAPL1 gene in a nonspecific X-linked mental retardation (MRX) family.

Am.J.Med.Genet.A, 146A, 3167-3172.

163
Nieuwenhuis, E., Motoyama, J., Barnfield, P. C., Yoshikawa, Y., Zhang, X., Mo, R. et al.

(2006). Mice with a targeted mutation of patched2 are viable but develop alopecia and epidermal

hyperplasia. Mol.Cell Biol., 26, 6609-6622.

Noh, J. S., Sharma, R. P., Veldic, M., Salvacion, A. A., Jia, X., Chen, Y. et al. (2005). DNA

methyltransferase 1 regulates reelin mRNA expression in mouse primary cortical cultures.

Proc.Natl.Acad.Sci.U.S.A, 102, 1749-1754.

Noor, A., Whibley, A., Marshall, C. R., Gianakopoulos, P. J., Piton, A., Carson, A. R. et al.

(2010). Disruption at the PTCHD1 Locus on Xp22.11 in Autism spectrum disorder and

intellectual disability. Sci.Transl.Med., 2, 49ra68.

Noor, A., Windpassinger, C., Patel, M., Stachowiak, B., Mikhailov, A., Azam, M. et al. (2008).

CC2D2A, encoding a coiled-coil and C2 domain protein, causes autosomal-recessive mental

retardation with retinitis pigmentosa. American Journal of Human Genetics, 82, 1011-1018.

Nordin, V. & Gillberg, C. (1996). Autism spectrum disorders in children with physical or mental

disability or both. I: Clinical and epidemiological aspects. Dev.Med.Child Neurol., 38, 297-313.

Ogawa, M., Miyata, T., Nakajima, K., Yagyu, K., Seike, M., Ikenaka, K. et al. (1995). The reeler

gene-associated antigen on Cajal-Retzius neurons is a crucial molecule for laminar organization

of cortical neurons. Neuron, 14, 899-912.

Ozonoff, S., Williams, B. J., Gale, S., & Miller, J. N. (1999). Autism and autistic behavior in

Joubert syndrome. J.Child Neurol., 14, 636-641.

164
Ozonoff, S., Young, G. S., Carter, A., Messinger, D., Yirmiya, N., Zwaigenbaum, L. et al.

(2011). Recurrence Risk for Autism Spectrum Disorders: A Baby Siblings Research Consortium

Study. Pediatrics.

Palmieri, L., Lasorsa, F. M., De, P. A., Palmieri, F., Runswick, M. J., & Walker, J. E. (1997).

Identification of the yeast ACR1 gene product as a succinate-fumarate transporter essential for

growth on ethanol or acetate. FEBS Lett., 417, 114-118.

Persico, A. M., D'Agruma, L., Maiorano, N., Totaro, A., Militerni, R., Bravaccio, C. et al.

(2001). Reelin gene alleles and haplotypes as a factor predisposing to autistic disorder.

Mol.Psychiatry, 6, 150-159.

Persico, A. M., Levitt, P., & Pimenta, A. F. (2006). Polymorphic GGC repeat differentially

regulates human reelin gene expression levels. J.Neural Transm., 113, 1373-1382.

Philippe, A., Martinez, M., Guilloud-Bataille, M., Gillberg, C., Rastam, M., Sponheim, E. et al.

(1999). Genome-wide scan for autism susceptibility genes. Paris Autism Research International

Sibpair Study. Human molecular genetics, 8, 805-812.

Pinto, D., Pagnamenta, A. T., Klei, L., Anney, R., Merico, D., Regan, R. et al. (2010). Functional

impact of global rare copy number variation in autism spectrum disorders. Nature.

Piton, A., Gauthier, J., Hamdan, F. F., Lafreniere, R. G., Yang, Y., Henrion, E. et al. (2010).

Systematic resequencing of X-chromosome synaptic genes in autism spectrum disorder and

schizophrenia. Mol.Psychiatry.

165
Piton, A., Michaud, J. L., Peng, H., Aradhya, S., Gauthier, J., Mottron, L. et al. (2008).

Mutations in the calcium-related gene IL1RAPL1 are associated with autism. Human molecular

genetics, 17, 3965-3974.

Piven, J., Gayle, J., Chase, G. A., Fink, B., Landa, R., Wzorek, M. M. et al. (1990). A family

history study of neuropsychiatric disorders in the adult siblings of autistic individuals.

J.Am.Acad.Child Adolesc.Psychiatry, 29, 177-183.

Plank, S. M., Copeland-Yates, S. A., Sossey-Alaoui, K., Bell, J. M., Schroer, R. J., Skinner, C. et

al. (2001). Lack of association of the (AAAT)6 allele of the GXAlu tetranucleotide repeat in

intron 27b of the NF1 gene with autism. Am.J.Med.Genet., 105, 404-405.

Plenge, R. M., Stevenson, R. A., Lubs, H. A., Schwartz, C. E., & Willard, H. F. (2002). Skewed

X-chromosome inactivation is a common feature of X-linked mental retardation disorders.

American Journal of Human Genetics, 71, 168-173.

Rabionet, R., McCauley, J. L., Jaworski, J. M., Ashley-Koch, A. E., Martin, E. R., Sutcliffe, J. S.

et al. (2006). Lack of association between autism and SLC25A12. Am.J.Psychiatry, 163, 929-

931.

Ramakers, G. J. (2002). Rho proteins, mental retardation and the cellular basis of cognition.

Trends Neurosci., 25, 191-199.

Ramoz, N., Reichert, J. G., Smith, C. J., Silverman, J. M., Bespalova, I. N., Davis, K. L. et al.

(2004). Linkage and association of the mitochondrial aspartate/glutamate carrier SLC25A12

gene with autism. Am.J.Psychiatry, 161, 662-669.

166
Rauch, A., Hoyer, J., Guth, S., Zweier, C., Kraus, C., Becker, C. et al. (2006). Diagnostic yield

of various genetic approaches in patients with unexplained developmental delay or mental

retardation. Am.J.Med.Genet.A, 140, 2063-2074.

Raynes, H. R., Shanske, A., Goldberg, S., Burde, R., & Rapin, I. (1999). Joubert syndrome:

monozygotic twins with discordant phenotypes. J.Child Neurol., 14, 649-654.

Richardson, B. J., Czuppon, A. B., & Sharman, G. B. (1971). Inheritance of glucose-6-phosphate

dehydrogenase variation in kangaroos. Nature: New biology, 230, 154-155.

Ritvo, E. R., Freeman, B. J., Mason-Brothers, A., Mo, A., & Ritvo, A. M. (1985). Concordance

for the syndrome of autism in 40 pairs of afflicted twins. Am.J.Psychiatry, 142, 74-77.

Ritvo, E. R., Spence, M. A., Freeman, B. J., Mason-Brothers, A., Mo, A., & Marazita, M. L.

(1985). Evidence for autosomal recessive inheritance in 46 families with multiple incidences of

autism. Am.J.Psychiatry, 142, 187-192.

Rodier, P. M. (2002). Converging evidence for brain stem injury in autism. Dev.Psychopathol.,

14, 537-557.

Roeleveld, N., Zielhuis, G. A., & Gabreels, F. (1997). The prevalence of mental retardation: a

critical review of recent literature. Dev.Med.Child Neurol., 39, 125-132.

Ropers, H. H. (2006). X-linked mental retardation: many genes for a complex disorder.

Curr.Opin.Genet.Dev., 16, 260-269.

Ropers, H. H. (2008). Genetics of intellectual disability. Curr.Opin.Genet.Dev., 18, 241-250.

167
Rosenberg, R. E., Law, J. K., Yenokyan, G., McGready, J., Kaufmann, W. E., & Law, P. A.

(2009). Characteristics and concordance of autism spectrum disorders among 277 twin pairs.

Arch.Pediatr.Adolesc.Med., 163, 907-914.

Ross, M. T., Grafham, D. V., Coffey, A. J., Scherer, S., McLay, K., Muzny, D. et al. (2005). The

DNA sequence of the human X chromosome. Nature, 434, 325-337.

Samaco, R. C., Hogart, A., & LaSalle, J. M. (2005). Epigenetic overlap in autism-spectrum

neurodevelopmental disorders: MECP2 deficiency causes reduced expression of UBE3A and

GABRB3. Human molecular genetics, 14, 483-492.

Scheiffele, P., Fan, J., Choih, J., Fetter, R., & Serafini, T. (2000). Neuroligin expressed in

nonneuronal cells triggers presynaptic development in contacting axons. Cell, 101, 657-669.

Schifter, T., Hoffman, J. M., Hatten, H. P., Jr., Hanson, M. W., Coleman, R. E., & Delong, G. R.

(1994). Neuroimaging in infantile autism. J.Child Neurol., 9, 155-161.

Schmid, M., Nanda, I., Guttenbach, M., Steinlein, C., Hoehn, M., Schartl, M. et al. (2000). First

report on chicken genes and chromosomes 2000. Cytogenetics and cell genetics, 90, 169-218.

Schwartz, C. E., May, M. M., Carpenter, N. J., Rogers, R. C., Martin, J., Bialer, M. G. et al.

(2005). Allan-Herndon-Dudley syndrome and the monocarboxylate transporter 8 (MCT8) gene.

American Journal of Human Genetics, 77, 41-53.

Sebat, J., Lakshmi, B., Malhotra, D., Troge, J., Lese-Martin, C., Walsh, T. et al. (2007). Strong

association of de novo copy number mutations with autism. Science (New York, N.Y.), 316, 445-

449.

168
Sebat, J., Lakshmi, B., Troge, J., Alexander, J., Young, J., Lundin, P. et al. (2004). Large-scale

copy number polymorphism in the human genome. Science (New York, N.Y.), 305, 525-528.

Segurado, R., Conroy, J., Meally, E., Fitzgerald, M., Gill, M., & Gallagher, L. (2005).

Confirmation of association between autism and the mitochondrial aspartate/glutamate carrier

SLC25A12 gene on chromosome 2q31. Am.J.Psychiatry, 162, 2182-2184.

Shoubridge, C., Tarpey, P. S., Abidi, F., Ramsden, S. L., Rujirabanjerd, S., Murphy, J. A. et al.

(2010). Mutations in the guanine nucleotide exchange factor gene IQSEC2 cause nonsyndromic

intellectual disability. Nat.Genet., 42, 486-488.

Sinclair, A. H., Wrigley, J. M., & Marshall Graves, J. A. (1987). Autosomal assignment of OTC

in marsupials and monotremes: implications for the evolution of sex chromosomes. Genetical

research, 50, 131-136.

Sinha, S. & Chen, J. K. (2006). Purmorphamine activates the Hedgehog pathway by targeting

Smoothened. Nat.Chem.Biol., 2, 29-30.

Skaar, D. A., Shao, Y., Haines, J. L., Stenger, J. E., Jaworski, J., Martin, E. R. et al. (2005).

Analysis of the RELN gene as a genetic risk factor for autism. Mol.Psychiatry, 10, 563-571.

Spence, S. J. & Schneider, M. T. (2009). The role of epilepsy and epileptiform EEGs in autism

spectrum disorders. Pediatr.Res., 65, 599-606.

Spencer, J. A., Watson, J. M., & Graves, J. A. (1991). The X chromosome of marsupials shares a

highly conserved region with eutherians. Genomics, 9, 598-604.

169
Steffenburg, S., Gillberg, C., Hellgren, L., Andersson, L., Gillberg, I. C., Jakobsson, G. et al.

(1989). A twin study of autism in Denmark, Finland, Iceland, Norway and Sweden. J.Child

Psychol.Psychiatry, 30, 405-416.

Steiner, C. E., Guerreiro, M. M., & Marques-de-Faria, A. P. (2004). Brief report: acrocallosal

syndrome and autism. J.Autism Dev.Disord., 34, 723-726.

Stevens, M. C., Fein, D. A., Dunn, M., Allen, D., Waterhouse, L. H., Feinstein, C. et al. (2000).

Subgroups of children with autism by cluster analysis: a longitudinal examination.

J.Am.Acad.Child Adolesc.Psychiatry, 39, 346-352.

Stone, R. L., Aimi, J., Barshop, B. A., Jaeken, J., Van den Berghe, G., Zalkin, H. et al. (1992). A

mutation in adenylosuccinate lyase associated with mental retardation and autistic features.

Nat.Genet., 1, 59-63.

Strauss, K. A., Puffenberger, E. G., Huentelman, M. J., Gottlieb, S., Dobrin, S. E., Parod, J. M. et

al. (2006). Recessive symptomatic focal epilepsy and mutant contactin-associated protein-like 2.

N.Engl.J.Med., 354, 1370-1377.

Stromland, K., Nordin, V., Miller, M., Akerstrom, B., & Gillberg, C. (1994). Autism in

thalidomide embryopathy: a population study. Dev.Med.Child Neurol., 36, 351-356.

Stromme, P. & Diseth, T. H. (2000). Prevalence of psychiatric diagnoses in children with mental

retardation: data from a population-based study. Dev.Med.Child Neurol., 42, 266-270.

Sultana, R., Yu, C. E., Yu, J., Munson, J., Chen, D., Hua, W. et al. (2002). Identification of a

novel gene on chromosome 7q11.2 interrupted by a translocation breakpoint in a pair of autistic

twins. Genomics, 80, 129-134.

170
Szatmari, P., Paterson, A. D., Zwaigenbaum, L., Roberts, W., Brian, J., Liu, X. Q. et al. (2007).

Mapping autism risk loci using genetic linkage and chromosomal rearrangements. Nat.Genet.,

39, 319-328.

Tabolacci, E., Pomponi, M. G., Pietrobono, R., Terracciano, A., Chiurazzi, P., & Neri, G. (2006).

A truncating mutation in the IL1RAPL1 gene is responsible for X-linked mental retardation in

the MRX21 family. Am.J.Med.Genet.A, 140, 482-487.

Talebizadeh, Z., Bittel, D. C., Veatch, O. J., Kibiryeva, N., & Butler, M. G. (2005). Brief report:

non-random X chromosome inactivation in females with autism. J.Autism Dev.Disord., 35, 675-

681.

Tallila, J., Jakkula, E., Peltonen, L., Salonen, R., & Kestila, M. (2008). Identification of

CC2D2A as a Meckel syndrome gene adds an important piece to the ciliopathy puzzle.

Am.J.Hum.Genet., 82, 1361-1367.

Tarpey, P. S., Smith, R., Pleasance, E., Whibley, A., Edkins, S., Hardy, C. et al. (2009). A

systematic, large-scale resequencing screen of X-chromosome coding exons in mental

retardation. Nat.Genet., 41, 535-543.

Thomas, N. S., Sharp, A. J., Browne, C. E., Skuse, D., Hardie, C., & Dennis, N. R. (1999). Xp

deletions associated with autism in three females. Hum.Genet., 104, 43-48.

Toal, F., Bloemen, O. J., Deeley, Q., Tunstall, N., Daly, E. M., Page, L. et al. (2009). Psychosis

and autism: magnetic resonance imaging study of brain anatomy. Br.J.Psychiatry, 194, 418-425.

171
Toth, K., Dawson, G., Meltzoff, A. N., Greenson, J., & Fein, D. (2007). Early social, imitation,

play, and language abilities of young non-autistic siblings of children with autism. J.Autism

Dev.Disord., 37, 145-157.

Tuchman, R. & Rapin, I. (2002). Epilepsy in autism. Lancet Neurol., 1, 352-358.

Turelli, M. & Orr, H. A. (1995). The dominance theory of Haldane's rule. Genetics, 140, 389-

402.

van Kuilenburg, A. B., Vreken, P., Abeling, N. G., Bakker, H. D., Meinsma, R., Van, L. H. et al.

(1999). Genotype and phenotype in patients with dihydropyrimidine dehydrogenase deficiency.

Hum.Genet., 104, 1-9.

Vandepoele, K., De Vos, W., Taylor, J. S., Meyer, A., & Van de Peer, Y. (2004). Major events in

the genome evolution of vertebrates: paranome age and size differ considerably between ray-

finned fishes and land vertebrates. Proceedings of the National Academy of Sciences of the

United States of America, 101, 1638-1643.

Veenstra-Vanderweele, J., Christian, S. L., & Cook, E. H., Jr. (2004). Autism as a paradigmatic

complex genetic disorder. Annu.Rev.Genomics Hum.Genet., 5, 379-405.

Viding, E. & Blakemore, S. J. (2007). Endophenotype approach to developmental

psychopathology: implications for autism research. Behav.Genet., 37, 51-60.

Vincent, J. B., Herbrick, J. A., Gurling, H. M., Bolton, P. F., Roberts, W., & Scherer, S. W.

(2000). Identification of a novel gene on chromosome 7q31 that is interrupted by a translocation

breakpoint in an autistic individual. American Journal of Human Genetics, 67, 510-514.

172
Vincent, J. B., Horike, S. I., Choufani, S., Paterson, A. D., Roberts, W., Szatmari, P. et al.

(2006). An inversion inv(4)(p12-p15.3) in autistic siblings implicates the 4p GABA receptor

gene cluster. J.Med.Genet., 43, 429-434.

Vincent, J. B., Kolozsvari, D., Roberts, W. S., Bolton, P. F., Gurling, H. M., & Scherer, S. W.

(2004). Mutation screening of X-chromosomal neuroligin genes: no mutations in 196 autism

probands. Am.J.Med.Genet.B Neuropsychiatr.Genet., 129B, 82-84.

Vincent, J. B., Melmer, G., Bolton, P. F., Hodgkinson, S., Holmes, D., Curtis, D. et al. (2005).

Genetic linkage analysis of the X chromosome in autism, with emphasis on the fragile X region.

Psychiatr.Genet., 15, 83-90.

Vincent, J. B., Noor, A., Windpassinger, C., Gianakopoulos, P. J., Schwarzbraun, T., Alfred, S.

E. et al. (2009). Characterization of a de novo translocation t(5;18)(q33.1;q12.1) in an autistic

boy identifies a breakpoint close to SH3TC2, ADRB2, and HTR4 on 5q, and within the

desmocollin gene cluster on 18q. Am.J.Med.Genet.B Neuropsychiatr.Genet., 150B, 817-826.

Volkmar, F. R., Szatmari, P., & Sparrow, S. S. (1993). Sex differences in pervasive

developmental disorders. J.Autism Dev.Disord., 23, 579-591.

Vorstman, J. A., Staal, W. G., van, D. E., van, E. H., Hochstenbach, P. F., & Franke, L. (2006).

Identification of novel autism candidate regions through analysis of reported cytogenetic

abnormalities associated with autism. Mol.Psychiatry, 11, 1, 18-1, 28.

Wakefield, A. J. & Montgomery, S. M. (1999). Autism, viral infection and measles-mumps-

rubella vaccination. Isr.Med.Assoc.J., 1, 183-187.

173
Watson, J. M., Spencer, J. A., Riggs, A. D., & Graves, J. A. (1991). Sex chromosome evolution:

platypus gene mapping suggests that part of the human X chromosome was originally autosomal.

Proceedings of the National Academy of Sciences of the United States of America, 88, 11256-

11260.

Weiss, L. A., Arking, D. E., Daly, M. J., & Chakravarti, A. (2009). A genome-wide linkage and

association scan reveals novel loci for autism. Nature, 461, 802-808.

Weiss, L. A., Purcell, S., Waggoner, S., Lawrence, K., Spektor, D., Daly, M. J. et al. (2007).

Identification of EFHC2 as a quantitative trait locus for fear recognition in Turner syndrome.

Human molecular genetics, 16, 107-113.

Weiss, L. A., Shen, Y., Korn, J. M., Arking, D. E., Miller, D. T., Fossdal, R. et al. (2008).

Association between microdeletion and microduplication at 16p11.2 and autism. N.Engl.J.Med.,

358, 667-675.

Wermter, A. K., Kamp-Becker, I., Strauch, K., Schulte-Korne, G., & Remschmidt, H. (2008). No

evidence for involvement of genetic variants in the X-linked neuroligin genes NLGN3 and

NLGN4X in probands with autism spectrum disorder on high functioning level.

Am.J.Med.Genet.B Neuropsychiatr.Genet., 147B, 535-537.

Yan, J., Oliveira, G., Coutinho, A., Yang, C., Feng, J., Katz, C. et al. (2005). Analysis of the

neuroligin 3 and 4 genes in autism and other neuropsychiatric patients. Mol.Psychiatry, 10, 329-

332.

Yeargin-Allsopp, M., Rice, C., Karapurkar, T., Doernberg, N., Boyle, C., & Murphy, C. (2003).

Prevalence of autism in a US metropolitan area. JAMA, 289, 49-55.

174
Ylisaukko-oja, T., Rehnstrom, K., Auranen, M., Vanhala, R., Alen, R., Kempas, E. et al. (2005).

Analysis of four neuroligin genes as candidates for autism. Eur.J.Hum.Genet., 13, 1285-1292.

Zafeiriou, D. I., Ververi, A., & Vargiami, E. (2007). Childhood autism and associated

comorbidities. Brain Dev., 29, 257-272.

Zechner, U., Wilda, M., Kehrer-Sawatzki, H., Vogel, W., Fundele, R., & Hameister, H. (2001).

A high density of X-linked genes for general cognitive ability: a run-away process shaping

human evolution? Trends in genetics : TIG, 17, 697-701.

Zeegers, M., van der Grond, J., Durston, S., Nievelstein, R. J., Witkamp, T., van, D. E. et al.

(2006). Radiological findings in autistic and developmentally delayed children. Brain Dev., 28,

495-499.

Zemni, R., Bienvenu, T., Vinet, M. C., Sefiani, A., Carrie, A., Billuart, P. et al. (2000). A new

gene involved in X-linked mental retardation identified by analysis of an X;2 balanced

translocation. Nat.Genet., 24, 167-170.

Zhu, Y., Xu, G., Patel, A., McLaughlin, M. M., Silverman, C., Knecht, K. et al. (2002). Cloning,

expression, and initial characterization of a novel cytokine-like gene family. Genomics, 80, 144-

150.

Zogopoulos, G., Ha, K. C., Naqib, F., Moore, S., Kim, H., Montpetit, A. et al. (2007). Germ-line

DNA copy number variation frequencies in a large North American population. Hum.Genet.,

122, 345-353.

Zugasti, O., Rajan, J., & Kuwabara, P. E. (2005). The function and expansion of the Patched-

and Hedgehog-related homologs in C. elegans. Genome Res., 15, 1402-1410.

175
List of Appendices
Appendix 1: Manuscript entitled Structural variation of chromosomes in autism spectrum
disorder originally published in The American Journal of Human Genetics.

Appendix 2: Manuscript entitled "Copy number variation analysis and sequencing of the X-
linked mental retardation gene TSPAN7/TM4SF2 in patients with autism spectrum disorder"
published in Psychiatric Genetics.

Appendix 3: Manuscript entitled "Disruption at the PTCHD1 Locus on Xp22.11 in Autism

spectrum disorder and intellectual disability" published in Science:Translational Medicine.

176