QPCR A&E

Content IV: A&E Class
•  Introduction
–  Mnemonics once again
–  Mathematics of qPCR
•  Data Analysis and Evaluation
–  Quantification Strategies in qPCR
•  Absolute Quantification
•  Relative Quantification
–  Fidelity in qPCR
•  Specificity, Sensitivity, Accuracy, Reproducibility
•  Experimental Variations, Replicates,
•  Standard Deviation Calculations
•  Optimizing qPCR Experiments
–  Primer and probe optimization
–  Multiplex assay optimization
•  Questions & Answers
–  I got mail ...
Rainer B. Lanz, M.S., Ph.D. 2

Essentials - One More Time
•  Target Reporter Fluorescence…
–  is determined from the fractional cycle at which a
threshold amount of amplicon DNA is reached:
•  RCT = R0·(1+ET)CT
–  Amplification Efficiency (@ threshold T): ET = 10(-1/s) -1
•  slope (s) of linear regression of CT values vs. log[cDNA]
–  Fluorescence increase I is proportional to the amount
of target DNA: I = k·RCT
R CT ∆Rn

Mathematics of qPCR
•  Basic Equations:
–  Rearrangement: RCT = R0 (1+Eexp)CT ⇒ R0 = RCT/(1+E)CT
–  Taking logarithms and rearrangements yields:
y = CT
y •  log(R0) = log(RCT) - log[(1+E)CT] = log(RCT) - log(1+E) · CT,
•  or: log(R0) - log(RCT) = - log(1+E) · CT
ss = -1/log(1+E)
•  Solving for CT: CT = -1/log(1+E) log(Ro) + log(RCT)/log(1+E)
bb =
log(RCT)/log(1+E) •  Comparison with y = sx + b indicates that plotting CT vs log(R0)
x produces a line with the slope s, therefore:
x= log(R0)
s = -1/log(1+E), or: log(1+E) = -1/s
–  Solving logarithm yields the amplification efficiency E:
•  1+E = 10-1/s, E = 10(-1/s) -1
•  [for E=1: 2 = 10-1/s, or log2 = -1/s, or: s = -1/log2 = -3.32]
–  Because we aim at obtaining the initial numbers of target

molecules, it is appropriate to now substitute reporter
fluorescence R with numbers N:
•  N0 = NCT/(1+E)CT (I) and I = k·NCT , k = const

Quantification Strategies in qPCR
•  Absolute Quantification
–  Absolute Standard Curve Method > requires standards
of known quantities
•  STND1/2/…/6, UNKN, NTC
•  Relative Quantification
A comparative method: requires a reference, which is
also a target (2nd amplicon), = active reference.
–  Relative Standard Curve Method: relative target
quantity in relation to standard curves of standard
and reference
•  STND1, 2, …, 6, REF1, 2, …, 6, UNKN, NTC
–  Comparative CT Method (∆∆CT): relative target
quantity in relation to a endogenous control only (no
standards)
•  REF, UNKN, NTC

Absolute Quantification: AQ
•  A Calibration Curve Method
–  Known amounts of external targets are amplified in a
parallel group of reactions run under identical
conditions to that of the unknown samples.
–  Standards: recRNA, recDNA, gDNA (see class 1)
–  The absolute quantities of the standards must first
be determined by some other independent means.
–  SDS determines N0 for each Unknown based on linear
regression calculations of the standards.

AQ … continued
•  No Data Munching
Quantities exported
•  to Excel
•  to text only
calculated on the basis
of a calibration curve
(standard curve).
•  Easy, but …
–  Standards
•  appropriate?
•  same/different RT?
–  Expensive
–  Least accurate method
•  quantitative accuracy = f(standards, standard curve)
Relative Quantification: RQ
•  An Active Reference
–  …is used to determine changes in the amount of a
given sample relative to another - internal - sample.
•  a different amplicon in the same PCR reaction as the
amplification of the amplicon for the GOI
–  Does not require standards with known concentrations
•  Calculation Methods for Relative Quantitations
–  Standard Curve method (∆CT)
•  Two ‘standard’ curves (relative control & GOI)
•  May include a 2nd normalization with an arbitrarily
chosen calibrator sample
–  Comparative CT method (∆∆CT)
•  no standards, but with amplification of a reference
•  contingent upon similar amplification efficiencies of the
amplicons for GOI and reference
•  Always relative to a calibrator sample

RQ: Intuitively
–  ∆CT = const because Eexp = const
–  Same amplicon:
•  EA = EB ⇒ NA/NB = 2-∆CT
For example: if ∆CT between A and B is 5 cycles, then there
is 2-5 = 1/32 as much A than B.
–  Different amplicons:
For example: GOI (x) and endogenous control (c):
•  EX ≠ EC ⇒ Nx/Nc = K (1+Ec)CTc / (1+Ex)CTx
RQ: Mathematically
–  NCT = N0 (1+E)CT and I = k NCT
–  The relative Intensities of samples A and B is:
•  IA = kA· NCTA = kA· N0A (1+EA)CTA and
•  IB = kB· NCTB = kB· N0B (1+EB)CTB
–  at threshold: IA = IB thus: kA· NCTA = kB· NCTB
–  Solving for constants yields: K = kB/kA = NCTA/ NCTB ,
•  inserting NCTA= N0A (1+EA)CTA and NCTB = N0B (1+EB)CTB and
rearranging we get:
–  N0A/N0B = K· (1+EB)CTB / (1+EA)CTA (II)
•  The fractions of A and B expressed as percentages are:
A = 100·[K·(1+EB)CTB/(1+EA)CTA] /1+K·[(1+EB)CTB/(1+EA)CTA]
B = 100·[1] /1+K·[(1+EB)CTB/(1+EA)CTA]
–  Relative Standards:
•  For example: the ratio of treatment (t) vs. control (c):
(NA/ NB)t (1 + EBt)CTBt/(1 + EAt)CTAt

=K
(NA/ NB)c (1 + EBc)CTBc/(1 + EAc)CTAc
Relative Standard Method, Example A
–  Two serial dilutions: one for GOI (c-myc), another one

for the endogenous control (GAPDH)
–  Expression profiling in brain, kidney, liver, lung
Applied Biosystems User

Bulletin #2 (PN 4303859)

RQ: Data Handling in Excel
–  Average replicates, then divide the average c-myc (GOI)
value by the average GAPDH control value of the
corresponding samples.
–  For example:
Applied Biosystems User

Bulletin #2 (PN 4303859)
〈GOI〉
〈Ref〉
2nd normalization:
Calibrator = Brain
see slide 33 for

error handling

… continued
–  Relative Quantification with Absolute Values: involves
the division by a calibrator value:
•  normalize using an endogenous control, then
•  divide the normalized values by an arbitrarily chosen
calibrator value (e.g. kidney samples in this example)
GOI 18S Normalized Relative

raw raw GOI/18S Value
kidney 82 3592 0.023 1.0
liver 18351 8996 2.05 90
ovary 44 1669 0.03 1.3
spleen 1 8 0.13 5.6
–  Quality of quantification using the relative standard

curve method:
•  quantitative accuracy = f (standards, standard curve)
•  Still, more accurate than the absolute standard method
(normalization of biological variance)
Relative Standard Method, Example B
•  e.g. c-myc Expression Analysis in Liver, Kidney Tissues

•  GOI is c-myc, endogenous control is GAPDH,
•  reference sample is RNA isolated from lung tissue
•  2 ‘Standard’ curves: serial dilutions of a cDNA sample
generated from lung tissue RNA - one series is analyzed for c-
myc, the other for GAPDH.
Liverc-myc
LiverGAPDH
Kidneyc-myc
KidneyGAPDH
From: Applied Biosystems Documentation PN 4376785 Rev D

SDSv2 Does the Analysis For You

Relative Standard Method, Example C
–  Relative to endogenous control AND treatment(s)

–  For example: +/- TNFa induced TNFAIP3 and GAPDH
(NA/ NB)t
=
(NA/ NB)c
(1 + EBt)CTBt /(1 + EAt)CTAt

K
(1 + EBc)CTBc /(1 +
EAc)CTAc
SuperArray Bioscience
Corporation Newsletter 1

The Comparative CT Method
•  Derivation of the ∆∆CT Method
–  Targets at threshold cycle CT: ⇒ NCT = N0·(1+E)CT
•  For XT: number of target GOI molecules at threshold
•  and RT: number of reference molecules at threshold
•  XT/RT = X0·(1+Ex)CTX / R0·(1+ER)CTR = Kx/KR = K
–  If EX ≈ ER =: E ⇒ K = X0/R0·(1+E)CTX-CTR = XN·(1+E)∆CT
Whereby ∆CT = CTX-CTR, and XN = X0/R0
Rearranged: XN = K/(1+E)∆CT, or XN = K·(1+E)-∆CT (III)
–  Another normalization of each normalized sample XN
by the XN of a calibrator (cb) yields:
XN,/XN,cb = K (1+E)-∆CT / K (1+E)-∆CT,cb = (1+E)-∆∆CT
–  E = const., and with N =XN/XN,cb: N = 2-∆∆CT (IV)
–  Quality of quantification:
•  quantitative accuracy = f(amplification efficiency)
•  Accurate and most efficient qPCR data analysis method.
•  (∆∆CT method provides large SD if CV > 4%, see later)
∆∆CT Method continued
–  SDS v2 does it for you! Otherwise, use Excel:
–  Normalize GOI signals to signals of an endogenous
reference (e.g. 18S): CTGOI - CT18S ⇒ ∆CTr
–  Normalize each ∆CTr value to a particular ∆CTcb value
of an assay calibrator (cb): ∆CTr - $∆CTcb$ ⇒ ∆∆CTr
•  The ∆∆CTr of the calibrator then is 0
•  Calibrator cb may be a control treatment, or the sample
with the highest ∆CTr value
–  The relative target number N then is 2-∆∆CT
•  N for the calibrator is 20 = 1.
GOI
CT
18S
CT
Norm. I
∆CTr
Norm. II
∆∆CTr
N
E 24 14 10 -1 2
P 20 11 9 -2 4
E+P 21 11 10 -1 2
∆CTcb DMSO 27 16 11 0 1

Comparative CT Method (∆∆CT) Example B
•  e.g. p53 Expression in Liver, Kidney, Brain Tissues
•  GOI is TP53, endogenous control is GAPDH
•  Assumption: similar amplification efficiencies (ETP53 = EGAPDH)
(∆∆CT validation experiment, see later)
24 wells!
Relative standard
method: 48 wells!
From: Applied Biosystems Documentation PN 4376785 Rev D

SDSv2 Does the Analysis For You

∆∆CT Method, Example C
•  siRNA Transfection
–  Measuring the % Knock-down and remaining gene
expression:

Validation Experiment
•  ∆∆CT Method is contingent upon EGOI ≈ ERef
–  The absolute value (|s|) of the slope s of log input
amount (or dilutions) vs. ∆CT should be less than 0.1
EX vs. ER
Efficiencies:
|s| < 0.1
Livak and Schmittgen, 2001,
E max. Methods 25, 402-408
amplification
efficiency: –  Comparing important linear regression plots for qPCR :
s = -3.32 Ampl. Efficiency ∆∆CT Validation
CT ∆CT
Log [] Log []
What If EGOI ≠ Eref ?
•  Use Efficiency Correction
–  Note: Rainer does NOT recommend efficiency corrections
for qPCR data analyses (if you follow the recommendations,
you most likely won’t have this problem)
(Ex)∆CT x(control-sample)
Relative N =
(ER)∆CT R(control-sample)
(ER)CT sample (ER)CT calibrator

= ÷
(EX)CTsample (EX)CTcalibrator
•  Use REST Software

–  REST© (Relative Expression Software Tool)
•  Pfaffl et al.
2002. Nucl. Acids Res; 30(9): E36
•  http://www.gene-quantification.info/ then go to ‘Data Analysis’, ‘qPCR
software applications’, ‘REST versions’, then scroll down to ‘New REST
software application are available:’
How to Attain High Fidelity in qPCR
  Specificity
–  Assay design and project integration: a prerequisite
–  Determining the amplification efficiency: a prerequisite
–  Melting curve analysis: maybe
  Sensitivity
Effective –  TaqMan® or SYBR® protocol? comparable dynamic range
qPCR   Efficiency
in a –  Eexp = 10(-1/s) -1 over a wide range of input material
Nutshell, –  Pearson correlation coefficient r ≥ 0.95
indeed •  Accuracy and Precision
–  Replicates (n ≥ 3) for intra-assay (technical) precision
–  Strategy: RT = main source of variability ⇒ single cDNA
pool (no OneStep), RT assay optimization (see class 1)
–  Repetitions for inter-assay precision (Reproducibility)
•  not necessary (>< peer reviewer’s thinking)
•  Use a calibrator for inter-plate-normalizations
–  Optimizing sub-optimal experiments: always E, RT
Experimental Variations
•  Biological Variations
–  = f{population being studied},
–  Large CVs (CV = SD/〈X〉) likely
•  Process Variations
–  Random variations: common-cause errors, not affecting
all samples, = f{accuracy, standard operating
procedure}
•  e.g. pipetting errors
–  Systemic (technical) variations: biasing all samples, =
f{calibration, standard operating procedure}
•  e.g. software settings in sequence detection systems
•  System Variations
–  System constant, affecting all samples equally, =
f{instrument accuracy}
•  Fluorescence increase I is proportional to the amount of
target DNA: I = k·RCT
Accuracy versus Precision
•  Accuracy
–  How close a measurement is to the true or actual value
•  Precision
–  How close the measured values are to each other,
–  = f{variability of the data}
•  Example: 4 Populations AppliedBiosystems TechNotes 14-4
–  A, B: small system and population variability, large fold difference

between the means (30-fold, ~3% CV)
–  C, D: larger dispersion around the means, small fold difference
between the means (1.3-fold, ~30% CV)
Replicates
•  Biological Replicates
–  Separate biological samples, same treatment, > variability of
the biology + variability of the quantitation process
•  e.g. different RNA extractions from multiple animals, …
•  Technical Replicates
–  Aliquots from the same source run through the quantitation
process independently, > variability of the process
•  e.g. triplicates for PCR from cDNA from one RT reaction
•  How Many Replicates?
–  The greater the fold changes between the means of
different populations, the fewer replicates are needed.
–  The more dispersed the population variability, the more
biological replicates are needed:

Parametric or Non-Parametric Tests?
•  Distributions of the CTs
–  Symmetric, bell-shaped curve: normal distribution
•  > parametric ⇒ Student’s t-test
–  Symmetric, not-normal distribution
–  Asymmetric distribution
•  > non-parametric ⇒ Mann-Whitney
U-test (Glover and Mitchel, 2008)
•  Rainer’s Suggestions
–  Re-evaluate, re-design assay when
abnormal distributions are observed
–  Don’t ‘solve’ short-comings by using
the magic power of statistics
Goni R. et al. Integromics White Paper, Sept. 2009

PCR Reproducibility
•  Standard Deviation and Coefficient of Variation
–  Expressed as the Standard Deviation (SD) in CT, as the
square root of the variance. The variance is
n
∑ (CTi - 〈CT〉)2 where 〈 CT 〉 is the mean
SD2 = i=1
of the measured CT
n-1
•  Use “=STDEV(number1, number2, number3, …)” in Excel

–  The relative uncertainty in the number of DNA
molecules is expressed by the CV, the Coefficient of
Variation, which is the ratio of the standard deviation
of a distribution to its arithmetic mean (〈X〉):
CV = SD/〈X〉, or for qPCR : CV = SD/〈CT〉 , or in %:
CV% = 100 SD where 〈(1+E)-CT 〉 is the

〈(1+E)-CT 〉 mean of (1+E)-CT

Coefficient of Variation: Example
CV% = 100 SD
〈(1+E)-CT 〉
0.039 / 14.561 x 100 = 0.267%

Calculating Standard Deviations
•  SD = f{qPCR Data Analysis Method}
•  For the Standard Curve Method:

–  The SDQ for the normalized (GOI/Ref) quotient Q is
calculated using: SDQ = CVQ·〈X〉 , with
CVQ = (CVGOI2 + CVRef2) 1/2
•  For the Comparative Method:

–  The SD∆ for the difference (of ∆CT values) is based
on the SD of the GOI AND SD of the reference
values: SD∆ = (SDGOI2 + SDRef2)1/2
–  The SD of the ∆∆CTr is the same as the SD∆.
OK, now let’s put everything together - Error Handling

for the relative quantification in practice:

a) Error Handling for the Standard
Curve Method
•  N = (NGOI/NRef) ± SDQ
–  The average values of the GOI replicates is divided by the
average values of the reference samples (NGOI/NRef =:Q).
The SDQ of the quotient is calculated using:
CVQ = SDQ/〈X〉 = (CVGOI2 + CVRef2) 1/2 (V)
i.e., calculate the SDs for the replicates of GOI and Ref
first, then their individual CVs. Use these CVs to calculate
the CV for the normalized (GOI/Ref) using (V). Obtain the
SDQ of the quotient using SDQ = CVQ·〈X〉
GOI GOI GOI Ref Ref Ref GOI/ CVQ SDQ
mean SD CV mean SD CV Ref
Brain& 0.039 0.004 0.004/ 0.54 0.034 0.034/ 0.039/ 0.12* 0.12 ·
0.039= 0.54= 0.54 = 0.072=
0.1026 0.063 0.072
0.009
Kidney& 0.41 0.016 0.016/ 1.02 0.052 0.052/ 0.41/ 0.06# 0.06 ·
0.41= 1.02= 1.02 = 0.402=
0.039 0.051 0.402 0.026
&: samples *: SQRT[0.10262 + 0.0632] = 0.12 SDQ= CVQ·〈X〉 = 0.12 x 0.072 = 0.0087
from Table 1, #
: SQRT[0.03902 + 0.0512] = 0.06 SDQ = CVQ·〈X〉 = 0.06 x 0.402 = 0.0258
slide 13
b) Error Handling for the Comparative
CT Method
•  A) SD-Method: N = 2-∆∆CT ± (2-∆∆CT-SDs - 2-∆∆CT+SDs )
–  Calculate mean, SD and CV for replicate CTvalues of GOI
and Ref, reject >4%CV.
–  Determine ∆CTr = 〈CTGOI〉 - 〈CT18S〉. The SD of the
difference (SD∆) is based on the SD of the GOI and the SD
of the reference values: SD∆ = (SDGOI2 + SDRef2)1/2
–  Normalize each ∆CTr value to a particular ∆CTc value of an
assay calibrator (cb): ∆∆CTr = ∆CTr - ∆CTcb. The SD of the
∆∆CTr is the same as the SD∆ (SD∆∆CTr = SD∆CTr).
–  The final relative values (fold induction) are 2-∆∆CT with
∆∆CTr- SD∆ and ∆∆CTr+ SD∆
a, b: SQRT[0.152 + 0.092] = 0.175, c: 20.0+0.175 = 1.1, 20.0-0.175 = 0.88

a, b: SQRT[0.062 + 0.082] = 0.100, c: 22.5+0.100 = 6.06, 22.5-0.100 = 5.28
… the ∆∆ CT Method continued
•  B) SE-Method: N = 2-∆∆CT ± (2-∆∆CT-SE - 2-∆∆CT+SE )
–  SE ≠SD: Standard error (SE) of a sample of size N is the
sample standard deviation (SD) divided by N1/2: ⇒ SE < SD
–  Calculate SD, then SE for replicate CT values of GOI and
Ref: SEGOI = SDGOI/ N1/2, and SERef = SDRef/ N1/2
–  The SE of the difference (SE∆) is based on the SE of GOI
and the SE of reference values: SE∆ = (SEGOI2 + SERef2)1/2
–  Normalize each ∆CTr value to a particular ∆CTc value of an

assay calibrator (cb): ∆∆CTr = ∆CTr - ∆CTcb. The SE of the
∆∆CTr is the same as the SE∆ (SE∆∆CTr = SE∆CTr).
–  The final relative values (fold induction) are 2-∆∆CT with
∆∆CTr- SE∆ and ∆∆CTr+ SE∆

Remarks to Quantitative Precision
•  SE ≠SD
–  Smaller errors (SE < SD) do not imply better results
–  … but may indicate a lack of understanding.
CT < 36 •  Variability
–  In general, the intra-assay variation of 10-20% and a
Baseline mean inter-assay variation of 15-50% on molecule
Threshold basis is realistic over the wide dynamic range (of over
a billion fold range).
–  Variability is highest at >107 and <102 template copy
ranges
•  Cut-off value: cycle 35, i.e. disregard CT values for cycle
numbers 36 and higher.
–  For the threshold methods, the precision is
dependent on the proper setting of the threshold,
which itself is dependent on proper base line settings.
–  Evaluate only assays with a normal distribution of the
CTs
Integrated Genomics - The Future?
•  Real-Time StatMinerTM
–  http://www.integromics.com/StatMiner.php

Optimizing qPCR Experiments
•  Follow Guidelines ⇒ NO Optimization needed
–  Basic Knowledge
–  Assay design (follow the guidelines, class 3)
–  Reverse Transcription
•  Two-step
•  Hot start with unfolded RNA (heat-denaturation)
–  SDS operation (class 2)
•  Maximizing PCR
–  Optimizing primer concentrations :-|
•  ∆Rn > 2.5 logs (∆Rn = f{quencher})
–  Optimizing probe concentrations ;-(
–  Optimizing AD experiments ✓
–  Optimizing multiplex experiments
•  Almost always! ✓
Optimizing Primer Concentrations
•  Primer Optimization Matrix
–  Maximize ∆Rn :
Reverse Forward Primer [nM]

Primer
[nM] 50 300 900
50 50/50 300/50 900/50

300 50/300 300/300 900/300
900 50/900 300/900 900/900
–  Suggested conc.:
•  ≤900nM for TaqMan
•  ~50nM for SYBR Green
Applied Biosystems SDS Chemistry Guide (PN 4348358)

Optimizing Probe Concentrations
•  Secondary to Primer Optimization
–  Maximize ∆Rn :
Primer Probe
[nM] [nM]
100/900 50
100/900 125
100/900 250
100/900 500
–  Suggested conc.:
•  ~250nM

Optimizing Genotyping Experiments
•  Scattering of Data Points / Diffuse Clusters
–  Low DNA concentrations
–  Suggested: > 1 ng
(relatively high)

Multiplexing
•  Primer-Limited Assays
–  ABI Vic® reporter dyes are primer limited, allowing
multiplexing of TaqMan® endogenous controls with
GOI quantitation.
–  Extensive assay optimization

–  Normal probe levels: 250nM
–  Suggested primer conc.:
•  50nM or less
–  Determine plateau region:
•  CT values are constant

Revisiting the Goals
•  Questions a PI should ask when presented with qPCR
data:
–  How does this assay integrate with the project?
•  1 primer pair per question! (1pppq)
–  Did you use a ‘One-step’ kit?
•  If “Yes” -> deny the assay!
–  What assay was used? commercial or custom design?
–  What chemistry was used? Why?
•  If TaqMan: MGB or conventional probe?
–  What is the amplification efficiency (E) for this amplicon?
•  Show me the ‘Primer validation’ experiment!
–  How do the amplification plots look like?
•  How did you adjust the baseline, the threshold?
–  How many times did you measure this result? How many runs
were necessary to get to this result?
–  What method of data evaluation did you use?
•  If ∆∆CT: show me the validation experiment.
–  How many replicates were used for the measurements?
–  Are any CT values larger than 35?
–  What did you do for error handling?
Selected References
•  Bookout A. and Mangelsdorf D. (2003), Nuclear Receptor Signaling 1, e012,
•  Ditto, Supplementary File 1: qPCR Protocols and Worksheets (http://nursa.org/
ejournal/published/01012/nrs01012.sp1.pdf)
•  Applied Biosystems. (1997) Relative Quantitation Of Gene Expression: ABI PRISM

7700 Sequence Detection System: User Bulletin #2: Rev B. (AppliedBiosystems PN
4303859)
•  Collins M.L et al (1995), Preparation and characterization of RNA standards for use
in quantitative branched DNA hybridization assays. Anal. Biochem. 226: 120-129
•  Higuchi, R. et al. (1992). Simultaneous amplification and detection of specific DNA
sequences. Biotechnology 10:413-417.
•  Higuchi, R. et al. (1993). Kinetic PCR: Real time monitoring of DNA amplification
reactions. Biotechnology 11:1026-1030.
•  Kwok, S. and Higuchi, R. (1989) Avoiding false positive with PCR. Nature
339:237-238.
•  Livak, K.J. and Schmittgen, T.D. (2001) Analysis of Relative Gene Expression Data
Using Real-Time Quantitative PCR and the 2-∆∆CT Method. Melthods 25:402-408.
•  Livak, K.J. et al. (1995) Oligonucleotides with fluorescent dyes at opposite ends
provide a quenched probe system useful for detecting PCR product and nucleic acid
hybridization. PCR Methods Appl.4:357-62
•  Morrison, T.B. et al. (1998) Quantification of Low-Copy Transcripts by Continuous
SYBR Green I Monitoring During Amplification. Biotechniques 24(6):954-962.
•  Suzuki T. et al. (2000) Control Selection for RNA Quantification. Biotechniques
29(2):332-337.
•  Whittwer C.T. et al. (1997) Continuous Fluorescence Monitoring of Rapid Cycle DNA
Amplification. Biotechniques 22(1):130-138
•  Pfaffl et al.
(2002) Nucl. Acids Res; 30(9): E36
•  Glover, T. and Mitchell K. 2008. An Introduction in Biostatistics. 2nd ed. Waveland
Pr. Inc
I Got Mail !
I am attending your qPCR course. I lost my handouts for the first two
classes. I heard of a website that apparently has the handouts.
Could you please give me the name of that website? Thanks.
http://www.nursa.org/qpcr_tutorials/
… In your classes you said that we should ignore Ct values larger than
35. Why? I have seen plots that go up to 45 cycles, or higher.
CT 35 is close to the limit of detection for threshold-
based qPCR . By definition, a gene is not detectable
When the average CT > 35.
…I found a manuscript that mentions cleaning up the cDNA using Qiagen

columns before using the material for qPCR. I'm wondering, is this kind
of clean up necessary?
Not necessary. Rather, use spin columns PRIOR
reverse transcriptase reaction to super-clean
your RNA prep, or to remove the enzyme after
DNAse treatment.
Could you tell us how you define triplicates of a qPCR experiment - since it
seems everyone has their own definition. Thanks.
Three repeat pipetting events into three separate
wells of one plate with the same cDNA, same master mix
(to control for process variations).
To control for biological variations (e.g.differently
treated mice), repeat the triplicates for each mouse
sample RNA/cDNA.
…I found a manuscript that mentions cleaning up the cDNA using Qiagen

columns before using the material for qPCR. I'm wondering, is this kind
of clean up necessary?
Not necessary. Rather, use spin columns PRIOR
reverse transcriptase reaction to super-clean
your RNA prep, or to remove the enzyme after
DNAse treatment.

Dear Dr. Lanz,
I am attending your qPCR tutorial, and I must say that it is very helpful. Thank
you for your time and effort. In yesterday’s class you mentioned you were
going to do a Q&A session. Here are some of my questions:
1) Will primer-dimers emerge in a melt/dissociation curve analysis if the

primers were chosen carefully? I mean, can we 100% avoid them, or there
will always be some formation happening?
“Show Primer Secondary Structure” under the Option
menu in PE will show potential problems. The melt analysis
will only show robust levels of primer-dimers (a broad
‘peak’ at lower Tms than the Tm of the PCR product).
2) If I show up to your office showing you a dissociation curve analysis
that shows two peaks (i.e. primer dimer formation) would you consider that
qPCR ‘not good’, no matter the size of the primer dimer curve?
Correct! I would want you to show me E, not a melt.
3) You mentioned in the first class about AmpErase UNG and ROX.
Which one would you (strongly) recommend that we include in our assay
design?
ROX
Hi Dr. Lanz,
These are a few questions I have:
1) If we want to use the 18s rRNA as our endogenous control, could we use
the fabricated arrays like the QuantumRNA™ Classic 18S from Applied
Biosystems? Or is there a particular one you would recommend?
Isn’t this a newer version of Ambion’s Internal Standards?
Do you need RNA standards or 18S for a endogenous
control? I’ve always used the original ABI primers for 18S
X00686: 5'accgcagctaggaataatgga3' 5'gcctcagttccgaaaacca3'
2) In the class today, do you think you could include an example about how to
the data analysis with standard curve, as well as how to normalize data
between plates and at the same time use an endogenous control as
GAPDH?
Done!
3) I run out of my plate-to-plate controls, so I had to make up a new set of
controls. I run a plate with old and new controls (measuring GOI and
endogenous). So, from then on I have used the new controls, but I’m
comparing to data where I was using the old controls. Can you do a new-
control/old-control ratio and then normalize all you data with that number? Is
kind of complicated!
Relative (intra-plate) quantities ⇒ always comparable!
I am taking your qPCR classes right now and have thought of a couple of
questions.
First, when running the delta delta Ct relative quantification you have said
that the Es must be similar. Would it still be possible to analyze data for Es
that are not similar as long as you know both E values? I would think (at
least theoretically) you could calculate the difference between the Es and
know how big of a change to discount in your analysis.
Yes, but in general I don’t recommend this approach.
Rather, I would re-think the assay.
Remember that 0.1 difference in the E values results in
a 5-fold difference in sample quantity at PCR cycle 30.
If the differences in E is due to a ‘not-so-good’ 18S
amplicon, I do have some suggestions (>discussion)
Second, does the primer design change much when designing them for
C. elegans? Since C. elegans have very small introns, I did not know how
this would affect my design
(trying to space across 2 exons).
Put a hybridization probe over the exon junction.

Dear Dr.Lanz, I have 2 questions.
First one is about RT: For RT, if you use 100ul as the reaction volume, do
you increase the reverse transcriptase amount 5 times, since my RTase
is for 10-20ul reaction, or you use high concentration RTase?
I don’t know, as I’ve never used kits. Use Superscript III,
and formulate your own reagent mix (molarity of dNTPs)
Use 200ul total volume.
Second question: is this amplicon good?
TaqMan probe for MCP-1, 5'-CCACTCACCTGCTGCTACTCATTCACCA-3';
PCR forward primer for MCP-1, 5'-TCAGCCAGATGCAGTTAACGC-3';
PCR reverse primer for MCP-1, 5'-TGATCCTCTTGTAGCTCTCCAGC-3';
NO! primer spans 2 exons ⇒ will amplify gDNA
ATGCAGGTCCCTGTCATGCTTCTGGGCCTGCTGTTCACAGTTGCCGGCTGGAGCA
TCCACGTGTTGGCTC 
AGCCAGATGCAGTTAACGCCCCACTCACCTGCTGCTACTC
ATTCACCAGCAAGATGATCCCAATGAGTAG 
GCTGGAGAGCTACAAGAGGATCACCA
GCAGCAGGTGTCCCAAAGAAGCTGTAGTTTTTGTCACCAAGCTC 
AAGAGAGAGGTC
TGTGCTGACCCCAAGAAGGAATGGGTCCAGACATACATTAAAAACCTGG

Is qPCR the most sensitive method for sequence detection and quantification?
No. QuantiGene assays (Panomics) using branched DNA are
a tiny bit more sensitive. They don’t have the dynamic range
of qPCR, but provide similar precision and accuracy

My PI said that my way of qPCR data analysis cannot be true. I thought
I followed your suggestions. Is there anything wrong with my calculations?
No, you did right, but send your PI to the classes!

QPCR A&E

Uploaded by

Copyright:

Available Formats

QPCR A&E

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

QPCR A&E

Uploaded by

Copyright:

Available Formats

Content IV: A&E Class

Rainer B. Lanz, M.S., Ph.D. 2

Rainer B. Lanz, M.S., Ph.D. 3

– Because we aim at obtaining the initial numbers of target

Rainer B. Lanz, M.S., Ph.D. 4

Rainer B. Lanz, M.S., Ph.D. 5

Rainer B. Lanz, M.S., Ph.D. 6

Rainer B. Lanz, M.S., Ph.D. 8

(NA/ NB)t (1 + EBt)CTBt/(1 + EAt)CTAt

– Two serial dilutions: one for GOI (c-myc), another one

Applied Biosystems User

Rainer B. Lanz, M.S., Ph.D. 11

Applied Biosystems User

see slide 33 for

Rainer B. Lanz, M.S., Ph.D. 12

GOI 18S Normalized Relative

– Quality of quantification using the relative standard

• e.g. c-myc Expression Analysis in Liver, Kidney Tissues

From: Applied Biosystems Documentation PN 4376785 Rev D

Rainer B. Lanz, M.S., Ph.D. 15

– Relative to endogenous control AND treatment(s)

(1 + EBt)CTBt /(1 + EAt)CTAt

Rainer B. Lanz, M.S., Ph.D. 16

Rainer B. Lanz, M.S., Ph.D. 18

From: Applied Biosystems Documentation PN 4376785 Rev D

Rainer B. Lanz, M.S., Ph.D. 20

Rainer B. Lanz, M.S., Ph.D. 21

(ER)CT sample (ER)CT calibrator

• Use REST Software

• Example: 4 Populations AppliedBiosystems TechNotes 14-4

– A, B: small system and population variability, large fold difference

Rainer B. Lanz, M.S., Ph.D. 27

Goni R. et al. Integromics White Paper, Sept. 2009

• Use “=STDEV(number1, number2, number3, …)” in Excel

CV% = 100 SD where 〈(1+E)-CT 〉 is the

Rainer B. Lanz, M.S., Ph.D. 29

Rainer B. Lanz, M.S., Ph.D. 30

• For the Standard Curve Method:

• For the Comparative Method:

OK, now let’s put everything together - Error Handling

Rainer B. Lanz, M.S., Ph.D. 31

a, b: SQRT[0.152 + 0.092] = 0.175, c: 20.0+0.175 = 1.1, 20.0-0.175 = 0.88

– Normalize each ∆CTr value to a particular ∆CTc value of an

Rainer B. Lanz, M.S., Ph.D. 34

Rainer B. Lanz, M.S., Ph.D. 36

Reverse Forward Primer [nM]

50 50/50 300/50 900/50

Applied Biosystems SDS Chemistry Guide (PN 4348358)

Rainer B. Lanz, M.S., Ph.D. 38

Applied Biosystems SDS Chemistry Guide (PN 4348358)

Rainer B. Lanz, M.S., Ph.D. 39

Applied Biosystems SDS Chemistry Guide (PN 4348358)

Rainer B. Lanz, M.S., Ph.D. 40

– Extensive assay optimization

Applied Biosystems SDS Chemistry Guide (PN 4348358)

Rainer B. Lanz, M.S., Ph.D. 41

• Applied Biosystems. (1997) Relative Quantitation Of Gene Expression: ABI PRISM

…I found a manuscript that mentions cleaning up the cDNA using Qiagen

…I found a manuscript that mentions cleaning up the cDNA using Qiagen

–  Because we aim at obtaining the initial numbers of target

–  Two serial dilutions: one for GOI (c-myc), another one

–  Quality of quantification using the relative standard

•  e.g. c-myc Expression Analysis in Liver, Kidney Tissues

–  Relative to endogenous control AND treatment(s)

•  Use REST Software

•  Example: 4 Populations AppliedBiosystems TechNotes 14-4

–  A, B: small system and population variability, large fold difference

•  Use “=STDEV(number1, number2, number3, …)” in Excel

•  For the Standard Curve Method:

•  For the Comparative Method:

–  Normalize each ∆CTr value to a particular ∆CTc value of an

–  Extensive assay optimization

•  Applied Biosystems. (1997) Relative Quantitation Of Gene Expression: ABI PRISM