Argulus Te Ecology of The Fish Pest

Argulus
THE ECOLOGY OF A FISH PEST

Argulus

Een wetenschappelijke proeve op het gebied van de
Natuurwetenschappen, Wiskunde en Informatica

PROEFSCHRIFT

ter verkrijging van de graad van doctor
aan de Radboud Universiteit Nijmegen
op gezag van de rector magnificus prof. mr. S.C.J .J . Kortmann,
volgens besluit van het College van Decanen
in het openbaar te verdedigen op vrijdag 4 juli 2008
om 13.30 uur precies

door

Peter David Walker

geboren op 2 januari 1979
te Blackpool, Engeland

Promotor: Prof. dr. S.E. Wendelaar Bonga

Copromotor: Dr. G. van der Velde (Vrije Universteit, Brussel)

Manuscriptcommissie:
Prof. dr. E.W. Roubos (voorzitter)
Prof. dr. D. Hoole (Keele University, Keele, United Kingdom)
Prof. dr. G. Wiegertjes (Wageningen Universiteit en Researchcentrum)

Paranimfen: Wout Abbink
Ivor Tellings

Cover design: Peter Walker & Lidwien van der Horst
Printers: PrintPartners Ipskamp, Nijmegen
ISBN: 978-90-9023175-4

Argulus

A academic essay in Science

Doctoral Thesis

to obtain the degree of doctor
from the Radboud University Nijmegen
on the authority of the Rector Magnificus, prof. dr. S.C.J .J . Kortmann
according to the decision of the Council of Deans
to be defended in public on Friday, 4
th
J uly 2008
at precisely 13:30 hours

by

Peter David Walker

Born on 2nd J anuary 1979
in Blackpool, England

Supervisor: Prof. dr. S.E. Wendelaar Bonga

Co-supervisor: Dr. G. van der Velde (Vrije Universiteit, Brussels)

Manuscript committee:
Prof. Dr. E.W. Roubos (Chair)
Prof. dr. D. Hoole (Keele University, Keele, United Kingdom)
Prof. dr. G. Wiegertjes (Wageningen University, Wageningen, The Netherlands)

For my grandparents, Jenny and Eric Walker,
absent from this world but never from my heart

"The Argulus foliaceus is an exceedingly pretty and graceful
little animal; and as it can leave the fish on which it feeds, and
swim freely in the water, there are many opportunities for
watching its gambols through its native element"

W. Baird (1850)

Baird, W. (1850). The Natural History of the British Entomostraca. Ray Society, London,
364pp.

Table of Contents

Chapter 1 General Introduction
11
Chapter 2 The biology of parasites from the genus Argulus and a review of the
interactions with their host
21
Chapter 3 Differential host utilisation by different life history stages of the fish
ectoparasite Argulus foliaceus (L., 1758) (Crustacea: Branchiura)
53
Chapter 4 Effect of host weight on the distribution of Argulus foliaceus (L., 1758)
(Crustacea: Branchiura) within a fish community
75
Chapter 5 Size matters: stickleback size and infection with Argulus foliaceus (L.,
1758) (Branchiura, Arguloida)
93
Chapter 6 The off-host survival and viability of Argulus (Crustacea: Branchiura)
101
Chapter 7 Feeding in Argulus japonicus (Crustacea: Branchiura), an ectoparasite
on fish
123
Chapter 8 Transcriptional analysis of the common carp (Cyprinus carpio L.)
immune response to the fish louse Argulus japonicus Thiele (Crustacea:
Branchiura)
139
Chapter 9 General Discussion
159
Summaries in English and Dutch (Samenvatting)
171
Acknowledgements
179
Curriculum vitae
185
List of publications
187

Chapter 1

General Introduction

Chapter 1
12

So, naturalists observe a flea
Hath smaller fleas that on him prey,
And these have smaller fleas to bite em.
And so proceed ad infinitum.

J . Swift (referenced in Roberts and J anovy, 1996)
13
The fact that parasitism has evolved in nearly every known phylum emphasises the success of
this mode of existence. The vertebrates are the only phylum where there are few examples of
species exhibiting a parasitic mode of existence and yet even here there are examples of
parasitic behaviour such as the parasitic males of some angler fish species and lamprey eels,
which are widely considered to be parasites.
According to Roberts and J anovy (1996), parasitism is essentially a very specific form
of symbiosis. The term symbiosis was originally coined by DeBary in 1876 and was used to
describe two species that live together. This covered a range of intimate interactions between
organisms, including mutualism, commensalism and parasitism. Mutualism (sometimes also
referred to as symbiosis) is used to describe an association between organisms in which both
organisms mutually benefit from the association, for example, the symbiosis of the hermit
crab Dardanus fucosus and the anemone Calliactis tricolor, where the hermit crab receives
benefit from camouflage and protection from predators and the anemone benefits by having
easy access to scraps from the hermit crabs meals and also receives protection from certain
predators (Lpez-Victoria et al., 2004). Commensalism is the term applied when one member
of an association benefits without significantly harming or helping the other member of the
association.
In the case of parasitism only one partner benefits from the association, the parasite,
and this is by definition at the expense of the other partner, the host. Typically, this gain is in
the form of nutrition, but often parasites will benefit in other ways such as shelter from the
external environment and protection against predators. Parasites often have deleterious effects
on their host's physiology, sometimes even killing the host. However, a good parasite should
avoid inducing the mortality of its host to minimise the difficulties associated with having to
locate a new host (except in some cases where host mortality facilitates parasite transmission).
To avoid confusion we will adopt the same definition as Kearn (2004). The term parasite
throughout this thesis refers only to unicellular or multicellular eukaryotic animals that derive
benefit from a symbiotic relationship at the expense of their host.
According to definitions by Roberts and J anovy (1996), a parasite living on the
surface of its host is referred to as an ectoparasite but if it lives inside its host it is termed an
endoparasite. Some authors also refer to a third group of parasites, mesoparasites, which live
in the external openings of an animal's body e.g., the buccal cavity or the cloaca.
Parasites are, in the main, obligate parasites, meaning that they cannot complete their
lifecycle without spending at least some part of it in a parasitic relationship with another
organism. Some animals can also become parasitic accidentally when they enter the body of
Chapter 1
14
another organism via a wound or other opening e.g. the mouth if they are eaten. Parasites can
be permanent, temporary or intermittent, depending on whether they spend all, part or
repeated short periods in contact with their host.
Intermittent parasites are sometimes termed micropredators. In the case of many
ectoparasitic arthropods the term micropredator is perhaps more appropriate than intermittent
parasite. Zelmer (1998) provided an evolutionary definition of parasitism which states that the
parasite requires the host as both a source of nutrition and a habitat. Ectoparasitic arthropods
usually attach themselves to the integument of their hosts in order to feed. However, many of
these species can in fact survive quite effectively as independently free-living animals and
depend upon a host purely for nutritional reasons. Branchiuran fish lice, the subjects of this
thesis, can survive for as long as two weeks without a host animal (see Chapter 6 of this
thesis). Due to this lack of dependence upon the host for anything other than nutrition and
because many of these intermittent parasites feed on multiple host species, the term
micropredator is probably the most accurate. This equating of ectoparasites with predators
was also discussed by Ewald (1995).
An advantage of this micropredator lifestyle as opposed to a more permanent parasitic
mode of existence could be that the micropredator avoids the consequences of the host's
immune response. This can be achieved either by relocating to a site distant from the first
feeding site on the same host or, if the immune response is severe enough to be spread
systemically throughout the host, by relocating to a new host.
Based on the evidence that endoparasites reach their internal infestation sites by
penetrating the host's skin or gills or via ingestion with the host's food, Kearn (2004) suggests
that some endoparasites may well be descended from parasites living on the skin or gills of
the host animal. He therefore states that a thorough knowledge of the biology of external
parasites of fishes is important if we are to understand how parasites evolve and progress. It
is also plausible that many parasite species are in fact descendents of micropredators that have
simply evolved to maintain contact with their prey instead of constantly facing the problems
associated with foraging.
Parasites are studied for several reasons but one of the main driving forces behind
parasitology studies is the effects they have on humans. This can be either directly in the case
of parasites infecting humans or indirectly by infecting livestock in both terrestrial and aquatic
farming operations.
With the ever increasing diversification and intensification of aquaculture practices
parasitic diseases of fish and shellfish have inherently received an increase in attention due to
15
the deleterious effects these pathogens can have on farm stocks. Whilst viral and bacterial
pathogens have in general received more interest from researchers than other parasitic
organisms, the often dramatic effects of salmon lice (Lepeophtheirus salmonis) on salmon
cage farm stocks have resulted in ectoparasitic lice (particularly copepods) receiving more
concentrated research focus. Recent research has also suggested that lice originating from
farmed salmon may cause localised extinction of wild pink salmon stocks (Krkoek et al.,
2007; Rosenberg, 2008).
Much of the research focus has, in the past, centred around the effects parasites have
on their hosts and on the development of methods to treat or immunise fish against infection.
As such, for many common parasites of fish, there is a general paucity of information
regarding the ecology of parasites in their natural environments, particularly when
considering the factors which may affect their success as organisms in their own right.
Within European freshwater bodies, Argulus spp. are perhaps the parasite species most
likely to be encountered by the naturalist, angler or aquarist working in freshwater
environments. Despite this there are still huge gaps in our knowledge about these common
animals. In 1982, Fryer stated that the alien invader Argulus japonicus was already
widespread across continental Europe and was likely to be found in the British Isles in the
future. His predictions turned out be correct and A. japonicus was recorded in Britain for the
first time in 1992 (Rushton-Mellor, 1992). Originating in the Far East, this species probably
spread with the trade in cyprinids such as carp (Cyprinus carpio L.) and goldfish (Carrassius
auratus (L.)). It is likely that with the onset of global warming this species distribution will
continue to expand (Chapter 6 of this thesis).
This thesis aims to expand the current knowledge on branchiuran fish lice with a
particular emphasis on the native European species Argulus foliaceus (L.) and its invasive
relative A. japonicus Thiele, by examining key aspects of their life history as shown in Figure
1.
Chapter 2 begins by providing an overview of the literature currently available
regarding this group of parasites covering topics from life history traits, morphology, host
location and host choice to the effects the parasites have on their hosts in terms of behavioural
changes and activation of the stress and immune response.
Chapter 3 details a study which focussed on the occurrence of the different life history
stages (i.e. larval, juvenile and adult) of a native European argulid, A. foliaceus, on different
host species found in a commercial coarse fishery. This chapter aimed to answer two main
questions:
Chapter 1
16
1) Are some fish species more likely to be infested with A. foliaceus?
2) Are larval, juvenile and adult lice distributed similarly within the host community?

Environmental Factors
Biotic factors
e.g. Fish assemblages
Abiotic factors
e.g. Temperature
Survival
2,6,7
Host location
2,3,4,5
Feeding
2,6,7,8
Host response
2,7,8
Egg
Adults Larvae
Attachment
2,6,7,8
H
A
T
C
H
I
N
G
DEVELOPMENT
R
E
P
R
O
D
U
C
T
I
O
N
Host preference
2,3,4,5
Argulus
Survival
2,6,7
Host location
2,3,4,5
Feeding
2,6,7,8
Host response
2,7,8
Egg
Adults Larvae
Attachment
2,6,7,8
H
A
T
C
H
I
N
G
DEVELOPMENT
R
E
P
R
O
D
U
C
T
I
O
N
Host preference
2,3,4,5
Argulus
Environmental Factors
Biotic factors
e.g. Fish assemblages
Abiotic factors
e.g. Temperature
Survival
2,6,7
Host location
2,3,4,5
Feeding
2,6,7,8
Host response
2,7,8
Egg
Adults Larvae
Attachment
2,6,7,8
H
A
T
C
H
I
N
G
DEVELOPMENT
R
E
P
R
O
D
U
C
T
I
O
N
Host preference
2,3,4,5
Argulus
Survival
2,6,7
Host location
2,3,4,5
Feeding
2,6,7,8
Host response
2,7,8
Egg
Adults Larvae
Attachment
2,6,7,8
H
A
T
C
H
I
N
G
DEVELOPMENT
R
E
P
R
O
D
U
C
T
I
O
N
Host preference
2,3,4,5
Argulus

Figur e 1. Schematic representation of the way the environment (both abiotic and biotic) influences the
distribution of a generalised argulid via effects on its behaviour, ecology and physiology. Key aspects
of the life history between larval hatching and adult maturation/reproduction and how these aspects are
interrelated are shown. Numbers given in text boxes correspond with chapters in this thesis, where
each of these aspects is addressed to some extent.

17
Chapters 4 and 5 further explore the infection dynamics of A. foliaceus amongst a wild
fish community by looking at the effect of host size on parasite infection intensity and
prevalence. The third question of this thesis, which is addressed in these two chapters, is:
3) Are larger fish more heavily infested with A. foliaceus than smaller fish?
The mechanisms and circumstances that result in epizootics of many parasite species
has been a topic of great interest to parasitologists, but for the vast majority of parasite groups
our understanding is still limited. With the continuing onset of global warming it is certain
that we will observe changes in the parasite fauna, especially in aquatic environments. As
such it is vital that we increase our understanding of the way temperature affects parasitic
organisms. Chapter 6 examines the effect of temperature on the off-host survival of three life
history stages of the exotic A. japonicus and native European A. foliaceus. This chapter also
examines the effect of starvation and temperature on the viability of A. japonicus. Here we
attempt to answer the following questions:
4) Does temperature affect the off-host survival time of A. foliaceus and A.
japonicus?
5) What are the maximum off-host survival times of these two species?
6) Does temperature affect the attachment success of A. japonicus?
7) What are the effects of starvation on the attachment success of A. japonicus?
Once argulid parasites have successfully located a host and have attached to it they
can begin to feed. Chapter 7 reviews the mechanisms by which these animals feed using A.
japonicus as a model. The main question we aim to answer in this chapter is:
8) What is A. japonicus's diet?
Advances in the field of fish immunology have been significant in recent years. Our
understanding of the way in which fish respond to infection from pathogenic organisms is
increasing all the time due mainly to the advancement of the techniques used to study immune
responses. In chapter 8 we use standard histological techniques to illustrate the damage
caused by the feeding activities of A. japonicus. In addition we use PCR techniques to
demonstrate the immune response of common carp to infection by A. japonicus at the
molecular level. The question addressed in this chapter is:
9) Does A. japonicus elicit an immune response in common carp?
In Chapter 9 the main findings in this thesis research are discussed in relation to the
questions introduced in this introductory chapter.

Chapter 1
18

Refer ences

DeBary, A. (1876). Researches into the nature of the potato-fungus-Phytophthora infestans.
Journal of the Royal Agricultural Society of England. 12, 239-268.
Ewald, P. W. (1995). The evolution of virulence: a unifying link between Parasitology and
ecology. Journal of Parasitology 81, 659-669.
Fryer, G. (1982). The parasitic Copepoda and Branchiura of British Freshwater Fishes. A
Handbook and Key. Freshwater Biological Association, Scientific Publication no. 46,
Ambleside, England, 87pp.
Kearn G. C. (2004). Leeches, Lice and Lampreys: A Natural History of Skin and Gill
Parasites of Fishes. Springer, Dordrecht, The Netherlands, 432pp.
Krkoek, M., Ford, J . S., Morton, A., Lele, S., Myers, R. A. and Lewis, M. A. (2007).
Declining wild salmon populations in relation to parasites from farm salmon. Science
318, 1772-1775.
Lpez-Victoria, M., Barrios, L. M., Kraus, H. and Osorio, L. (2004). New aspects on the
symbiotic relationships between Dardanus fucosus (Crustacea: Paguridae), Calliactus
tricolor (Cnidaria: Hormathidae) and Porcellana sayana (Crustacea: Porcellanidae).
Boletn de Investigaciones Marinas y Costeras 33, 261-264.
Roberts, L. S. and J anovy, J . (1996). Foundations of Parasitology (5
th
ed.). Wm. C. Brown
Publishers, Dubuque, IA.
Rosenberg, A. A. (2008). The price of lice. Nature 451, 23-24. doi:10.1038/451023a
Rushton-Mellor S. K. (1992). Discovery of the fish louse, Argulus japonicus Thiele
(Crustacea: Branchiura), in Britain. Aquaculture and Fisheries Management 23, 269-
271.
Zelmer, D. A. (1998). An evolutionary definition of parasitism. International Journal for
Parasitology 28, 531-533.

19

Chapter 2

The biology of parasites from the genus Argulus and
a review of the interactions with their host

Peter D. Walker, Gert Flik and Sjoerd E. Wendelaar Bonga

Symposia of the Society for Experimental Biology 55, 107-29 (2004).
Chapter 2
22
1. Intr oduction
During the 20
th
century crustacean ectoparasites of fish did not receive the same research
focus that other piscine pathogens experienced. This has resulted in a delay in our
understanding of these economically important organisms. However, it is now recognized by
fin fish producers and researchers alike that parasitic lice can indeed play a significant role in
the economic success of aquaculture organizations. Around the globe there are continuous
reports on the deleterious effects of these pathogens on fish farm stock (e.g. Bauer, 1959;
Costello, 1993; Menezes et al., 1990; Revie et al., 2002; Saksida et al., 2007) and on wild fish
populations (e.g. Poulin and Fitzgerald, 1987, 1988; J ohnson et al., 1996; Whelan and Poole,
1996; Todd et al., 2000; Krkoek et al., 2006). A recent report even showed that lice may be
causing localised extinctions of some fish populations (Krkoek et al., 2007). Even parasitic
infections in recreational fisheries are under current investigation to evaluate the effects of
such infections on fishery economics (Taylor et al., 2006). These reports have led to an
increase in the number of researchers concentrating on the study of ectoparasitic crustaceans
found on fish but there is still a considerable lack of knowledge in some areas. This chapter
aims to give a review on the current ecological knowledge available for the Branchiuran
genus Argulus including a focus upon the general biology and parasite-host interactions.
All argulids are described as obligate ectoparasites of fish but they are also frequently
encountered swimming freely in the water column as they seek out new hosts, mates or when
females detach from their hosts to deposit eggs (Bower-Shore 1940; Mikheev et al., 1998;
Bandilla et al., 2007a). Morphologically they bear a close resemblance to several parasitic
copepod species and this similarity has led to some conflict over their classification during the
20
th
century (Martin, 1932; Kearn, 2004). To date the majority of researchers are in agreement
that similarities exist as a result of convergent evolution rather than the sharing of a common
ancestor (Kearn, 2004). Table 1 details the taxonomic classification of the genus Argulus
according to descriptions by Bowman and Abele in 1982.
When factors such as parasite distribution and relative lack of host specificity are
considered, the genus Argulus can be regarded as one of the most widespread and
economically important groups of crustacean ectoparasites affecting freshwater fish around
the globe (Bower-Shore, 1940; Menezes et al., 1990; Shafir and Oldewage, 1992; Taylor et
al., 2006). Whilst morbidity is not always linked to infections of Argulus spp., the direct and
indirect results of louse infections can still be significantly costly to aquaculture and sport
fishing operations (Menezes et al., 1990; Northcott et al., 1997; Taylor et al., 2006).

Argulus: a review of the current knowledge

23
Table 1. Taxonomic classification of the genus Argulus (After Bowman and Abele, 1982)
Taxonomic Level Taxa
Phylum Arthropoda
Subphylum Crustacea Pennant, 1777
Class Maxillopoda Dahl, 1956
Subclass Branchiura Thorell, 1864
Order Arguloida Rafinesque, 1815
Family Argulidae Leach, 1819
Genus Argulus O. F. Mller, 1785

In addition to the deleterious impacts resulting from parasitic feeding and attachment,
secondary infections from bacteria and fungi (Stammer, 1959; Shimura et al., 1983; Singhal
et al., 1990) are very common and argulids have also been shown to act as vectors for other
pathogens including nematodes (Moravec, 1994; Molnr and Szkely, 1998) and viruses
(Dombrowski, 1952; Ahne, 1985; Cusack and Cone, 1986).
There are several reviews available for argulids concentrating on factors such as
distribution (Gurney, 1948; Rushton-Mellor, 1992; Poly, 1997, 1998), development (Rushton-
Mellor and Boxshall, 1994) and morphology (Martin, 1932; Benz and Otting, 1996). This
chapter aims to provide an overview of the currently published knowledge regarding, in
particular, those species of Argulus found in European freshwaters.

2. Life cycle, gr owth and development
The life cycle of argulids has been described by several authors (e.g. Bower-Shore, 1940;
Kollatsch, 1959; Mclaughlin, 1980; Kearn, 2004) and evidence shows that the cycle is very
similar for all members of the Argulus genus. The only differences appear to be in the number
of developmental stages between hatching and maturity. Figure 1 illustrates the key stages
involved in the life cycle of a generalised argulid.
Eggs are deposited on a suitable surface (e.g. plant stems, stones or glass sides of
aquaria) in clumps or more typically parallel rows (Fig. 1), a process reported to be unusual
for aquatic ectoparasites (Williams, 1997). In parasitic copepods (e.g. Caligus elongatus,
Lepeophtheirus salmonis, Tracheliastes maculatus) the females generally possess egg sacs in
which eggs are maintained until hatching (Walker et al., 2006). The number of eggs deposited
by any female argulid varies considerably between individuals (from less than 10 up to
several hundred) and to date there is no conclusive evidence regarding the factors affecting
Chapter 2
24
clutch size. Even between different species from this genus there are no obvious differences
between clutch sizes. We speculate that gravidity is dependent upon such factors as meal
quality (i.e. health status of host fish), parasite size (or age) and parasite species. Development
time of egg stages is heavily dependent upon the temperature of the surrounding water with
development being more rapid at higher temperatures. Argulus foliaceus eggs for example
hatch after just 8 days at 26
o
C (Fryer, 1982) or after several months for eggs deposited at
temperatures below 10
o
C (e.g. Lester and Roubal, 1995; Mikheev et al., 2001). This could be
a strategy that evolved to enable parasites in temperate regions to survive harsh winter
conditions as an egg stage and to take maximum advantage of favourable summer conditions
to increase and/or maintain population sizes (Fenton et al., 2006). Certainly overwintering
egg stages have been reported for several species of this genus (e.g. Bower-Shore 1940;
Mikheev et al., 2001).

Figur e 1. Generalised life cycle for the genus Argulus. Copulation occurs on the host after which the
female detaches to deposit eggs in rows or clumps on a suitable substrate (e.g. a rock, plant stem or
even glass sides of aquaria). The tiny larvae are immediately parasitic and upon locating a suitable
host they undertake several moults until the adult stage is achieved. Adult lice may continue to moult
throughout their life.

25
Upon hatching, the late nauplius larva (Fig. 1) resembles the larger adult form.
Although the general body forms of the different life history stages are similar, there are
distinctive morphological features that enable differentiation of the various developmental
stages (Rushton-Mellor and Boxshall, 1994). The copepodid-like metanauplius larvae are
immediately parasitic (Lester and Roubal, 1995) and perish within a few days of hatching if a
suitable host is not located (Kollatsch, 1959; Chapter 6). After just a few days of feeding these
hatchlings moult into a second stage which possesses most of the features of an adult and can
therefore be referred to as juveniles (Rushton-Mellor and Boxshall, 1994). A key
morphological difference between juvenile and adult lice is a lack of the prominent maxillary
suckers, which only begin to appear in later developmental stages. A succession of moults
takes place approximately every 5 days depending on the individual species and the ambient
temperature (Fryer, 1982). The total number of developmental stages involved is species-
dependent but examples include 7 stages for A. japonicus (Tokioka, 1936), 9 stages for A.
coregoni (Shimura, 1980) and 10 stages for A. foliaceus (Rushton-Mellor and Boxshall,
1994). After approximately 4 to 6 weeks a mature adult louse is recognisable. This
development time is generalised here for ease of explanation but the reader should be aware
that this period can be significantly shorter or longer depending upon temperatures and
individual Argulus species examined (see Hindle, 1949; Shimura, 1980; Fryer, 1982).
Although all argulid species are dioecious, i.e. have separate sexes (Benz and Otting,
1996; Pasternak et al., 2004), the sexes do not differ enormously in terms of their
morphology. Separate sexes are distinguishable by examination of the abdominal lobes
located at the posterior end of the parasite's body. Females possess small spermathecae
whereas males possess large testes, which are clearly visible in live specimens due to the
transparent properties of these animals exoskeletons. In addition, white eggs can often be
seen within the pigmented ovaries located along the midline in adult, female lice. Copulation
typically occurs on the host although our observations have revealed that lice will also
copulate whilst detached from their host fish i.e. whilst swimming freely in the water column.
Copulation involves the transfer of sperm from the male directly to the female. Sperm cells
are then stored in the females spermathecae until she fertilises her eggs during the deposition
process (Kollatsch, 1959). Eggs are typically protected by a mucous-like coating that
presumably protects them from some smaller predators or opportunistic bacteria and fungi or
possibly plays a role in maintaining the hydro-mineral balance of the fertilised eggs.

Chapter 2
26
3. Mor phology
Argulid morphology has been the topic of attention for several authors (e.g. Martin, 1932;
Bauer, 1959; Kabata, 1985; Wadeh et al., 2007) and in light of this only a superficial
summary of those structures considered important to the parasites life style and ecology are
described here along with some discussion of their possible function. Similarly, a detailed
description of the morphology of larval and intermediate juvenile stages is also omitted here.
Figure 2 shows the key morphological features of a typical argulid. Much of an argulid's
morphological design can be linked to its ectoparasitic life style. The dorso-ventrally flattened
body covered by a large, rounded carapace presents a streamlined surface offering little
resistance to water currents that may otherwise dislodge a parasite when a host fish moves
through the water column. This general form can also be witnessed in other ectoparasitic
organisms of host animals such as fish and birds that need to maintain a streamlined form, e.g.
Lepeophtheirus salmonis (salmon louse), Caligus elongatus (sea louse) and Crataerina
melbae (swift louse/flat fly). Such a large number of parasites demonstrate this ectoparasitic
mode of existence and exhibit this flattened, streamlined form, that we must consider it to be
an evolutionary successful trait.
The cuticle of all argulids, like most crustaceans, is chitinous and forms a rigid
exoskeleton that provides the support needed for the animal to maintain its form in a similar
way to the internal skeleton of vertebrates. The body can be divided into three distinct
regions; i) cephalothorax, ii) thorax and iii) abdomen (Fig. 2). When live specimens are
observed one can often see numerous pigment cells (chromatophores) which are typically
associated with the gut and ovaries. Respiratory areas can be viewed as those areas of the
carapace lacking in the small spines and scales that adorn the ventral surface of the carapace.
These areas possess a much thinner cuticle and are located adjacent to a large blood sinus
which facilitates the diffusion of oxygen into the blood stream of the animal. The shape and
position of these areas is also useful for taxonomic purposes (Benz and Otting, 1996).

3.1 Attachment
Streamlined bodies, however, do not provide all the necessary tools to keep an ectoparasite
attached to its host and argulids typically show an array of structures that assist in keeping the
parasite connected to its food source (Fig. 2). Not surprisingly the attachment structures are
all located on the ventral surface of the animal which is the surface that is in contact with the
animal's host organism. The most conspicuous of these structures are the large maxillary
suckers. These suckers are actually modified first maxillae (commonly referred to as

27
maxillules). Their chitinous support structures (formed by rods composed of sclerites
stacked on top of each other (Benz and Otting, 1996) and associated musculature provide a
powerful suctorial action that keeps these animals stuck to their hosts. These suction cups
are positioned upon a moveable stalk allowing the parasite to move the suckers independently
across the hosts surface, and this means that the louse can travel over the body of its host
with relative ease and surprising speed. In addition to these highly specialised structures
argulids also possess modified first antennae that appear as hooks. Numerous small setae,
spines and bristles are also believed to play a role in attachment and may also have a defence
purpose. These various spines and scales can be observed on the majority of the ventral
surface (Fig. 2).

Figure 2 Scanning electron
micrograph of the ventral
surface of an adult male
Argulus japonicus (actual size
= 6mm). The key
morphological features are
labelled here and discussed in
section 7.3. Abdominal lobe,
al; Antennae, A; Carapace, C;
Feeding proboscis, F;
Maxillary suckers, M; Second
maxilla, X; Sheath containing
pre-oral stylet, S; Testes, T;
Thoracopods (legs), L. Note
also numerous small spines
and hook-like projections
probably used to assist
attachment.

Chapter 2
28
3.2 Locomotion
Section 2 discussed the life cycle of these parasites and drew attention to the fact that these
animals can and frequently do leave their hosts for a variety of reasons (e.g. accidental
dislodging, mate location, egg deposition and new host location). During these off-host
periods argulids must propel themselves through the water column with a great deal of
efficiency, especially if they are aiming to successfully locate a new host. Indeed, argulids are
quite proficient swimmers (Bandilla et al., 2007a, b). Propulsion is provided in the main by
the four pairs of thoracopods located on the posterior portion of the animals ventral surface.
These appendages exhibit the primitive crustacean form (Martin, 1932) in that they are
cirriform and biramous with two segmented sympods and rami, each with lateral rows of
pinnate setae (Benz and Otting, 1996). The long setae on these swimming appendages form a
paddle-like surface as they beat backwards, propelling the animal forwards. These limbs are
also frequently moved backwards and forwards whilst the louse is attached to its host,
presumably to provide a continuous flow of fresh water across the respiratory areas. In
addition argulids can also catapult themselves very quickly over a short distance using a
method similar to that employed by lobsters and shrimps. The lice rapidly flick their
abdominal lobes ventrally and towards the anterior of their bodies at the same time as flexing
the whole carapace. This action is typically used in predator avoidance although it is possible
that lice will also use the same technique to jump onto a passing fish.

3.3 Feeding
The mechanisms employed by argulids to access a meal from their hosts has been described
by many authors in the past and yet still remains a topic of debate. This topic will be
addressed in Chapter 7 in more detail. In the simplest description the feeding apparatus of an
argulid is composed of a retractable pre-oral stylet (also referred to as a sting or stiletto)
contained within a sheath and a feeding proboscis or mouth tube (Fig. 2).
The pre-oral stylet is located on the midline of the lice just anterior to the feeding
proboscis and in specimens prepared for scanning electron microscopy the stylet may be
completely or partially extended or may even be retracted completely inside its associated
sheath. According to Martin (1932) the relative size of this stylet varies considerably between
species and although often considered as part of the argulid's mouthparts it bears no direct
relation to the other mouthparts associated with the proboscis. The proboscis itself also lies
along the midline of the animal, just posterior to the aforementioned stylet. When an argulid

29
is not feeding this proboscis rests in a medial groove but during feeding activities it is
extended away from the parasites body so that it meets the hosts integument at right angles.

3.4 Sensory organs
The structures/organs utilized by an organism to sense its environment are typically diverse
and can take the form of light-sensitive organs (including eyes), mechanoreceptors that detect
pressure waves (e.g. the lateral line in fishes) and chemosensory/olfactory organs (including
antennae and nostrils).
Argulids certainly possess well-developed compound eyes and several authors (e.g.
Madsen, 1964 and Mikheev et al., 1998), believe that these function as the main organs
utilised by argulids to locate their hosts. A median, naupliar eye is also present but this
relatively primitive structure can probably detect nothing more than simple changes in light
intensity, which would provide information for the parasite regarding its orientation. In
addition, antennae, setae and sensillae can be observed on various parts of the animal's surface
and these structures may have a sensory function. Several authors have speculated on the role
of mechanosensation and chemosensation in locating hosts and possibly mates (e.g.
Galarowicz and Cochran; 1991) and recently Bandilla et al. (2007b) demonstrated a positive
directional response to chemical cues (fish and mate odours).

4. Distr ibution and seasonality
One of the factors that make Argulus spp. so successful as a parasite and so threatening as a
pathogen is its apparent lack of specificity (See Kennedy, 1974; Holland and Kennedy, 1997;
Chapter 3) . Argulids are often described as being able to infect any freshwater fish and
several species have even been recorded from amphibians, especially tadpoles (Wolfe et al.,
2001; Poly, 2003). This lack of specificity appears to be one of the key factors that have
resulted in the cosmopolitan distribution of many Argulus species. In addition some species of
Argulus can tolerate temperature ranges from as low as 3
o
C up to 28
o
C (Chapter 6 and
references therein). However, the disease argulosis (the causative agent being Argulus spp) is
often referred to as being a seasonal disease, particularly in temperate regions. Certainly A.
foliaceus, A. japonicus and A. Coregoni reach their maximum abundance in Europe during the
late summer/early autumn months. Relatively few lice are found during the winter and for
many years researchers believed that lice populations only survived a winter due to
overwintering egg stages deposited in the autumn. Over the last few decades, however, there
have been many reports of adult argulids being found on fish sampled during winter months
Chapter 2
30
(Bower-Shore, 1940; Kimura, 1970; Shafir and Van As, 1986). This could be an unnatural
phenomenon facilitated by global warming.

5. Par asite-host inter actions
In general, parasites are significantly smaller than their host organisms (think of a single flea
on a dog). Despite their relatively small size many parasites have the potential to exert strong
effects on their hosts biology, the consequences of which are often detrimental to the
individual host organism. Many parasites are even capable of causing mortality of their hosts
although this does not make evolutionary sense because many of them are in fact obligate
parasites meaning they depend on their host organisms for nutrition and survival. Still, this
harm-causing ability is one of the criteria proposed by Begon et al. (1990) as being a
defining characteristic of a parasite.
The relationships between host animals and the organisms that parasitize them are
very intimate and have typically been subject to generations of co-evolution, which has
resulted in the characteristics of infection that we observe. In this section we will discuss
several key aspects of the host-parasite relationship between argulids and their fish hosts. We
will begin with some of the more ecological aspects of this relationship, e.g. host choice, and
then expand to introduce topics such as the immune response to argulids and the stress
response of fish to ectoparasites. Due to the embryonic research status of this topic we will
also give examples from other host-parasite relationships to illustrate key topics where
appropriate.
Whilst argulids are typically described as obligate ectoparasites of fish this description
carries some flaws. Argulids are indeed ectoparasitic organisms because they attach to
external surfaces of their hosts and feed from this attachment site. It is also fair to state that
they are obligate parasites because they must locate a host to feed. However, they are not
necessarily obligate parasites of fish. Several species of the genus Argulus have been
documented from amphibian hosts and we have witnessed Argulus foliaceus successfully
attaching to Xenopus laevis toads under laboratory conditions (unpublished data). It is
important to note here that argulids can and frequently do detach from their hosts for periods
of time making them temporary or intermittent parasites compared to permanent parasites that
spend their entire adult lives within or on their hosts (Roberts and J anovy, 1996). For this
reason argulids can even be assigned the term micropredators, which is a term also used to
describe some other temporary ectoparasites such as mosquitos and ticks (Chapters 1 and 2).


31
5.1 Host choice and specificity
Many species of lice from the genus Argulus are described as being non-host-specific. Poulin
(1998) defines parasite specificity as the extent to which a parasite taxon is restricted in the
number of host species used at any given stage in the life cycle and we will adopt this
definition here. In Western Europe there are three known freshwater species from this genus:
A. foliaceus, A. coregoni, and the introduced A. japonicus. When examining lists of fish
species that these louse species have been found on, then the genus quickly appears to show
very low specificity. However, studies have shown that under certain conditions these
parasites may show some preference for certain fish over others (Mikheev et al., 1998; Kearn
t al., 2004 and referenes therein). For the purpose of this discussion we will concentrate on
the common European species because host preference studies are most common for these
lice species and they are also some of the more common species known from around the
globe.
The A. foliaceus population of a small mixed coarse fishery in South-West England
underwent an intensive 5 month study to examine population dynamics and infection
characteristics (Chapters 3, 4 and 5). A total of 8 fish species were recorded and all of them
yielded individual fish harbouring lice at some point during the study. However, the
prevalence (proportion of infected fish) and infection intensity (number of lice per fish)
differed markedly between individual fish and species, and the infection characteristics varied
over the sampling period. During the warm summer months the infection levels (both
prevalence and intensity) increased significantly on adult carp (Cyprinus carpio). These fish
spend a large portion of their time basking in the warmer shallow regions of the lake and as a
result may prove to be easier hosts for the lice to locate. Adult bream (Abramis brama)
showed similar infection characteristics.
A comparative study of argulosis from two sites in South West England revealed
differences in preferred host species for A. foliaceus (Walker, 2002). The two sites differed
somewhat in their fish community structure and species present with one being a densely
populated commercial coarse fishery and the other a sparsely populated natural lake with a
much greater volume and depth. The results of this study suggested that host choice by
argulids cannot be characterised definitively. Host choice instead depends on the combination
of several factors such as host species present, population densities and prevailing
environmental conditions both in terms of the physical and chemical parameters (e.g. depth,
temperature, dissolved oxygen).
Chapter 2
32
Other biological factors may also play a significant role in host selection by argulids.
Poulin and Fitzgerald (1988) noted that during daylight hours A. canadensis would inhabit the
lower half of the water column. Certain fish species (e.g. rudd, Scardinius erythropthalmus)
spend much of their time in the upper few centimetres of the water column feeding on small
zooplankton and other invertebrates that may drop onto the water surface. This would reduce
the likelihood of these fish encountering lice at least during daylight hours. In contrast, eels
spend much of their time hidden amongst submerged objects or half buried in the bottom silt
and again this would reduce their chances of encountering lice. In fact this behaviour may
account for the fact that very few eels have ever been found harbouring lice (Evans and
Mathews, 2000).
Mikheev et al. (1998) noted that light intensity significantly affected the host choice of
A. foliaceus. In darkened conditions perch (Perca fluviatilis) were favoured over roach
(Rutilus rutilus) and when light intensity was increased roach became increasingly more
preferable to the lice. Reduced activity and vertical positioning of the fish probably accounts
for some of this variation in host choice, but, the host location strategies employed by the lice
suggests something more interesting. During light periods the free-swimming lice spent most
of their time hovering almost stationary in the water column whilst during dark periods they
appeared to undertake a much more active searching strategy (Mikheev et al., 1998). The sit
and wait strategy probably serves to conserve energy stores whilst host fish are more active
during daylight hours. The active searching strategy would then be more successful during
darker periods when many fish lie dormant. This also suggests that argulids can either see
extremely well in dark conditions or that they have some kind of chemosensory capability
(Bandilla et al., 2007). If these lice do indeed have chemosensory capabilities then it is
plausible that certain fish species will have a more appealing set of chemical discharges that
argulids could home in on. In the case of the experiments conducted by Mikheev et al. (1998),
perch would have emitted the more appealing smell. Galarowicz and Cochran (1991)
showed that A. japonicus would indeed respond to host chemical cues, and Y-maze style
investigations undertaken by Bandilla et al. (2007) substantiate this theory.

5.2 The effects of argulids on fish
The effects of Argulus parasites on their fish hosts are quite diverse and range from physical
damage caused by attachment and feeding activities of the lice to behavioural changes
associated with stress. The following sections will highlight the current knowledge on the
effects of the parasites on fish with a particular emphasis on stress and behaviour. Other

33
topics such as physical damage and immune responses related to infection will also be
introduced.

5.2i Effects on host behaviour
Many parasites are known to affect their hosts behaviour during the course of an infection.
There are numerous parasite species that are known to have taken advantage of these host
behavioural changes. For example studies involving the cestode Schistocephalus solidus and
its intermediate host the three-spined stickleback (Gasterosteus aculeatus) have shown that
this parasite alters its hosts behaviour in a way that facilitates transmission of the tapeworm
to its definitive host, piscivorous birds. Behavioural changes included increased time spent
foraging away from cover, reduced swimming performance and suppression of the hosts anti-
predator response (Barber et al., 2004).
Argulid parasite species are also known to cause behavioural changes in their fish
hosts. Some of these appear to facilitate parasite transmission whereas others are clearly
behaviours that have evolved as mechanisms employed by the host fish to try and dislodge
lice from their external surfaces. Here we will discuss some of those changes documented by
other researchers along with lice-induced behaviours witnessed by the authors here.
One of the first behavioural changes one can observe in fish harbouring an Argulus
infection is the so-called flashing or scratching behaviour. Fish will repeatedly flash their
flanks against submerged objects such as plants, stones or even gravel. This behaviour is very
common in fish infected with a wide range of ectoparasites and is believed to be an attempt at
dislodging the culprits (e.g. Gyrodactylus spp., Ichthyoptheirus multifilis (white-spot),
Lernaea spp.). Similarly, some fish leap clear of the water and certainly argulids will often
detach from their hosts when exposed to the air. Communication between the authors and a
commercial trout fishery in The Netherlands revealed that trout leaping clear of the water
increases in frequency as water temperature increases and this coincides with an increase in
the abundance of A. foliaceus within the lake (P. Walker unpublished observations).
Sticklebacks have even been witnessed leaping onto the concrete surrounding of a garden
pond in an attempt to rid themselves of a heavy lice infection. Sadly the efforts of these
particular fish were thwarted by some resident frogs that viewed the floundering sticklebacks
as an easy meal (Van der Velde pers com.). The determined effort by some fish to rid
themselves of attached lice shows that lice are in fact extremely irritating to a fishs skin.
Other general behavioural changes associated with argulid infections include loss of
appetite, denser shoaling behaviour, lethargy and changes in vertical positioning within a
Chapter 2
34
water column. Our broodstock carp (Cyprinus carpio) harbouring A. japonicus were also
observed to spend significant amounts of time crowding over air stones in their aquaria. This
behaviour probably offers some relief to the irritation caused by lice living on the fishes
bodies or it is even possible that the continuous bombardment by air bubbles eventually
persuades the lice to dislodge from their hosts.
Research undertaken in Canada on the argulid species Argulus canadensis has
revealed some interesting behaviour changes associated with Argulus infections. Dugatkin et
al. (1994) showed that under experimental conditions juvenile sticklebacks will avoid schools
of parasitized conspecifics even though the parasite itself did not elicit an avoidance response.
Poulin (1999) showed that juvenile trout respond to the release of alarm substances emitted by
conspecifics infected by Diplostomum parasites and it is possible that a similar event was
occurring in the sticklebacks of Dugatkin's 1994 experiments.
Poulin and colleagues have shown some other behavioural changes associated with
fish infected with argulids (e.g. Poulin and Fitzgerald, 1988). These researchers demonstrated
that parasitic infections can have significant consequences on the community and population
structures of fish. They revealed that in the presence of parasites fish will form larger, denser
shoals. This strategy will decrease the chance that an individual will be targeted by parasites
seeking a new host. However, the strategy also benefits the parasite by giving it an easy
access to a wide range of potentially suitable hosts. Similar changes in shoaling behaviour
were observed by Northcott et al. (1997) during an Argulus epizootic in a Scottish, Stillwater
trout fishery. Sticklebacks were also noted to adjust their vertical positioning in the water
column when infected with lice. Heavily infected fish would often just lie motionless for long
periods on the bottom of ponds or experimental tanks.

5.2ii Damage to the host integument
Argulus spp. cause direct damage to their hosts integument through their attachment and
feeding mechanisms (Chapters 7 and 8). This damage can result from either mechanical
actions (i.e. from the sharp mouth parts) or from chemical secretions.
As mentioned earlier, the main attachment organs in adult lice are the maxillary
suckers. In addition, various appendages are modified to form hooks or spines and
microscopical examination of these structures clearly reveals how they may be damaging to
the hosts integument. Whilst attached to their host argulids continuously beat their
thoracopods back and forth to maintain a flow of fresh water over their bodies for respiratory

35
purposes. This results in pressure atrophy and small bruised areas can often be observed
when lice are removed.
The majority of the damage caused to the fishes skin results from the feeding activities
of these parasites. The pre-oral stylet and labial spines have all been suggested as capable of
secreting various toxins or digestive enzymes that facilitate the parasites feeding (Kearn, 2004
and references therein). These reported substances probably degenerate cells, making the
mechanical feeding processes less strenuous for the lice.
The feeding action of argulids creates significant damage to the host integument. In
chapter 8 we demonstrate that small craters can be formed in the host skin as a result of the
feeding activities of these lice. Epidermal hyperplasia at the wound margins is also visible.
Typically these craters are not much deeper than the epidermis but some examples of wounds
reaching as deep as the stratum compactum have been recorded (Lester and Roubal, 1995).
Mucous cells are generally absent within the craters themselves but a proliferation of these
cells is frequently evident at wound margins (Lester and Roubal, 1995).

5.2iii Immune response
The immune response in mammals has been a topic addressed by many researchers
throughout the 20
th
century. A strong focus has been on those pathogens that may ultimately
have a significant implication for humans. This impact can take the form of disease symptoms
in human populations directly or in the form of infections affecting livestock or domestic
animals. With the increasing importance of fish for supplying protein to human populations
researchers have begun to investigate those factors that may impact upon fish production i.e.
pathogens. In order to combat these pathogens it is vital that we gain an understanding of the
natural defence mechanisms employed by fish. This knowledge requirement has led to a new
wave of research focusing upon the piscine immune system. In this section we will discuss
some of those immune responses exhibited by fish that harbour parasites from the genus
Argulus.
The immune system in fish can be described as having two parts, viz. i) the
innate/non-specific immune response, and ii) the acquired/specific immune response.
Recently there has been a renewed interest in the innate immune response of fish to pathogens
because this consists of the first defensive barriers that any foreign invader will encounter
(e.g. epithelial barriers, acidic conditions in the gut, etc). These mechanisms are typically not
pathogen-specific and similar infection types will illicit similar responses (i.e. localised
inflammation, increase in mucous cell numbers, macrophage activation etc). The adaptive or
Chapter 2
36
acquired immune response is so called due to its memory properties. It normally takes
several hours or even days for the animal to mount a response against a first infection from a
pathogen but subsequent infections from the same pathogen will be met with an increasingly
faster response. Typically, this involves the production of antibodies specific to certain
antigen binding sites.
The immune response of fish to ectoparasitic organisms and particularly crustacean
ectoparasites has only begun to receive special attention in the last decade and even then the
research is rather unfocussed. It is, however, recognised now that this knowledge is of
paramount importance if we ever hope to develop commercially viable and environmentally
sound methods of treatment and control e.g. vaccines.
The most notable immune response to argulid infestations is observed as localised
inflammation, which appears as small red spots on the fishs skin. The causative factor is
often reported to be secretions from the pre-oral stylet of Argulus individuals but attachment
of the parasite is also likely to have an impact on this response and certainly pressure atrophy
has been documented previously (Lester and Roubal, 1995). The latter authors have suggested
that secretions of the parasite have low antigenicity due to inflammation at feeding sites not
being a major component of the histological changes. Ruane et al. (1995) demonstrated a
humoral antibody response in rainbow trout (Oncorhynchus mykiss) after they had been
immunised with an antigen extract from A. foliaceus. A similar type of response was seen in
rainbow trout and Atlantic salmon (Salmo salar) after immunisation with sea lice antigens
(Grayson et al., 1991; Reilly and Mulcahy, 1993). These data provide information that may
prove invaluable for the development of vaccines against ectoparasitic crustaceans.
Inflammation is commonly associated with argulid infections and indeed large red
spots can frequently be observed even within just a few hours post-infection (Chapters 7 and
8). The mechanisms involved in the inflammatory response have been well documented for
mammals but considerably less information is available for fish. In a preliminary
investigation of the early inflammatory immune response of carp to A. japonicus C. Haond
and G. Wiegertjes (pers. comm.) measured the blood leukocyte redistribution over a period of
40 days post-infection. The relative percentage of granulocytes and monocytes, identified on
the basis of typical forward/sideward scatter profiles in a flow cytometer, increased
dramatically over time. The relative percentage of these phagocytic cell types was highest 30
days post-infection, when numbers of parasites on the skin also peaked, and declined
thereafter with declining numbers of parasites. Skin samples from these infected fish were
analysed for early (1 h post-infection) gene expression with RT-PCR, indicating increased

37
expression of the pro-inflammatory cytokines interleukin-1 and tumour necrosis factor alpha.
These preliminary data support the existence of an inflammatory immune response to
Argulus. Furthermore, Huising et al. (2003) analysing the same samples, demonstrated
increased expression of particular CXC chemokines at the inflammation site, which could
possibly explain the increase in granulocytes in the blood. Future work on the inflammatory
response and other innate immune responses of fish is likely to show several comparisons
with the mammalian systems, and as a result we may come to combine knowledge to develop
successful control methods.

5.2iv Stress response
Cannon (1935) was one of the first researchers to introduce the concept of stress. He claimed
that when the normal homeostasis of an organism was threatened by one or more stimuli that
the organism could be considered as stressed. In 1992, Chrousos and Gold provided a more
comprehensive definition of stress: stress is a condition in which the dynamic equilibrium of
animal organisms, called homeostasis, is threatened or disturbed as a result of the actions of
intrinsic or extrinsic stimuli, commonly defined as stressors. In this section we will focus
upon the stress response of fish.
The physiological mechanisms of the teleost integrated stress response have been
shown to share many similarities with that of terrestrial vertebrates (Wendelaar Bonga, 1997).
The responses exhibited by a fish subjected to a stressor involve physiological and
behavioural responses that are induced as mechanisms to try and protect homeostasis or
maintain the dynamic equilibrium of the stressed organism (Wendelaar Bonga, 1997). These
responses can be categorised as primary, secondary and tertiary responses (Wendelaar Bonga,
1997 and references therein).
The primary response involves dramatic increases in the blood levels of
catecholamines and glucocorticoids. These hormones are the dominant hormones involved in
the stress response and are the primary messengers of the two main routes through which the
brain co-ordinates the stress response. These two routes include the hypothalamic-autonomic
nervous system and the hypothalamic-pituitary-interrenal axis (Wendelaar Bonga, 1997). The
secondary response comprises metabolic changes (i.e. plasma glucose and lactate levels),
hydromineral disturbance (fluctuations in plasma chloride and sodium levels), haematological
changes (e.g. in hematocrit and haemoglobin content) and changes in the hosts immune
system (i.e. immunosuppression). Finally, the tertiary response consists of changes in the
organism as a whole including reduced growth, impaired swimming performance, lower
Chapter 2
38
reproductive success and reduced disease resistance, all of which can impact negatively upon
the survival of the organism.
When examining the effects of a stressor, researchers typically use one or a
combination of several parameters. Cortisol is the most widely used hormone involved in the
stress response and because it is usually obtained from a fishs blood many researchers will
also examine blood glucose levels in conjunction with cortisol and to a lesser extent serum
sodium and chloride levels may be measured.
Other factors that can be indicative of stress include changes in the skin and gill
epithelia. For example, skin from stressed fish exhibits abnormally high levels of apoptosis
and necrosis which, if not fully compensated by cell proliferation, may result in epithelial
disruption. In addition mucous cell discharge is stimulated and infiltration of the epithelia by
leukocytes can be observed and indicates of the immune response is activated. Several effects
of cortisol on the skin of rainbow trout (Oncorhynchus mykiss) in vivo have also been
documented by Iger et al. (1995). Gill lamellae of stressed fish can appear irregular and
swollen due to increased blood flow and blood pressure.

2.5.2v Parasites as stressors
Several studies have explored the hypothesis that sea lice infections elicit a stress
response in fish (e.g. Nolan et al., 1999; Poole et al., 2000; Ruane et al., 2000). In contrast,
very few studies have investigated the physiological effects of freshwater lice (Argulus spp.)
on their hosts including whether they induce or affect the stress response of their hosts. For
this reason we will include here the effects of sea lice as stressor.
Several authors have challenged fish to examine their stress response upon infection with
ectoparasites. These studies have included a range of different host species and sizes but in
general they have not been conducted using standard methods. What is clearly evident from
many of these studies is that the level of stress caused by the infection is influenced by the
intensity of the infection, host size, host condition and, possibly, host species of host (van
Ham, 2003).
To enable some comparison between studies we have reported intensity of infection as
the number of L. salmonis per gram of host body weight. In a study of sea lice, we examined
the effects of ectoparasites in post-smolt Atlantic salmon, Salmo salar (Nolan et al., 1999).
The direct effects of the parasite were the damage caused by parasite attachment and feeding
on the body surface. The indirect stress effects included the effects on the overall integrity of
the skin and gill epithelia such as increased apoptosis and necrosis of the superficially located

39
epithelial cells and decreased numbers of mucous cells in the skin. Reduced mucous cell
numbers as a result of ectoparasitic infestations have also been reported in brown trout (Salmo
trutta) epidermis (Pottinger et al., 1984). In the gills, where no lice were found, uplifting of
the epithelium, intercellular swelling and infiltration by leukocytes is commonly observed in
filaments and lamellae. High cell turnover of chloride cells was associated with significantly
elevated gill Na
+
/K
+
-ATPase activities. These indirect stress effects are predominantly
hormone mediated as a consequence of the parasite being perceived by the host, causing a
stress response in the fish, and likely resulting in increased levels of blood cortisol and
catecholamines.
Some of the differences between the stress response of terrestrial vertebrates and the
stress response of teleosts can be attributed to the aquatic life style of fishes. The most
important of these differences is the disturbance of the hydromineral balance in fishes,
expressed by the changes in plasma sodium and chloride levels. Fish are directly exposed to
the water over a large area via the epithelia covering the skin and gills. These epithelia are a
complex assembly of many types of living cells (Whitear, 1986) and maintenance of epithelial
integrity, particularly that of the gills, is essential for maintaining hydromineral balance,
protection against waterborne pathogens, and thus ultimately the fishs health. High levels of
catecholamines can influence the integrity of the branchial epithelium, probably by increasing
the blood flow (and blood pressure) through the gills, and the permeability of the epithelium
to water and ions (Wendelaar Bonga, 1997).
Nolan et al. (2000) examined the effects of low numbers of Argulus foliaceus on the
epidermis of the rainbow trout. No effects were noticed on the number of mucocytes, but
electron microscopic analysis of the upper cell layers revealed stimulated mucous cell
discharge, and increased production of the small secretory vesicles of the pavement cells.
These have been attributed antimicrobial activity, and the presence of peroxidase activity in
these vesicles has been demonstrated. In addition to these signs of increased cellular activity,
increased rates of apoptosis and necrosis were noticed. The intracellular spaces in the skin
epithelium of the parasitized fish were enlarged and contained many leukocytes, most likely
cells that had permeated the epithelium after leaving the blood system, since the number of
circulating leucocytes was reduced 48 h post-infection.
In an attempt to distinguish between the direct effects of the parasites on the skin and the
indirect effects mediated by hormonal messengers connected with the stress response, the
effects of administration of cortisol (via the diet, to prevent the stress associated with
injections) were studied (van der Salm et al., 2000). This showed that cortisol stimulates
Chapter 2
40
mucous discharge, secretion of small vesicles by the pavement cells, apoptosis (but not
necrosis) of epidermal cells, and leukocyte infiltration. Nolan et al. (2000) also noticed that
low numbers of A. foliaceus (6 lice per fish) did not significantly elevate plasma cortisol
levels 48 hrs post-infection. They attributed this to the fact that ectoparasites have co-evolved
with their host organisms and therefore the host fish have evolved a tolerance to low numbers
of lice (Nolan et al., 2000). Ruane et al. (1998) did, however, demonstrate elevated plasma
cortisol levels in rainbow trout infected with Argulus 48 hrs after a 4 h confinement stress.
This suggested that whilst the effect of lice may not be seen immediately after infection the
effects become apparent when the response to a second stressor is examined (Nolan et al.,
2000).
Infection with low numbers of the salmon louse L. salmonis generally does not result in
significant increases in plasma cortisol levels of the host (J ohnson and Albright, 1992b; Bjorn
and Finstad, 1997; Ross et al., 2000). However, heavy infections may cause substantial
elevation, far beyond those which cause immunosuppression (J ohnson and Albright 1992b;
Mustafa et al., 2000). Exposure of O. mykiss to juvenile stages of L. salmonis increased blood
cortisol levels after 4 h net confinement to levels that were significantly higher than those in
confined, but unparasitised fish (Ruane et al., 2000). Similar results were obtained with O.
mykiss confined after 21 days of infestation with adult A. foliaceus (Ruane et al., 1999a).
The conclusions we can draw from these few studies include the fact that ectoparasitic
lice can induce similar responses in fish skin to those stress responses observed for toxic
stressors (Nolan et al., 2000). In addition, it was observed that certain fish species can tolerate
low numbers of lice providing additional stressors are not encountered. This stress effect has
implications for other host systems including the immune response and it is known that fish
harbouring lice are frequently subjected to secondary infections possibly due to
immunosuppression influenced by stress related responses (Bandilla et al., 2006). The next
section highlights some of the more common secondary infections that fish infected with
argulids may encounter.

5.2vi Secondary infections
In addition to the damage and stress caused by Argulus itself, one of the main concerns for fin
fish producers is the associated secondary infections that can result from infections with
parasites. Several studies have examined the role of parasites as vectors for other diseases
(e.g. Nigrelli, 1950; J ones and Hine, 1983; Cusack and Cone, 1985; Cusack and Cone, 1986)
and Argulus spp. have been the topic of some of these reviews (e.g. Dombrowski, 1952;

41
Ahne, 1985). The wounds created by this parasites feeding action are an obvious site for
infection and bacterial e.g. Aeromonas salmonicida, Shimura et al. (1983) and fungal e.g.
Saprolegnia spp. (Bower-Shore, 1940; Stammer, 1959) infections are often concurrent with
Argulus spp. infections (Lester and Roubal, 1995). Some nematodes (e.g. Anguillicolidae and
Skrjabillanidae) also use argulids as intermediate hosts (Moravec, 1978). The most worrying
of these transmitted pathogens, however, is spring viraemia of carp (also known as infectious
dropsy). This acute viral disease of carp kills hundreds of wild and captive carp every year.
Argulids have long been suspected as vectors for this virus (Dombrowski, 1952) but it was
only in the 1980s that this was proved satisfactorily through controlled laboratory
experiments (Ahne, 1985).

6. Contr ol and pr evention
There are numerous options available for the control, prevention and treatment of Argulus
infections. Much of the literature recognises that Argulosis, like many other diseases, is best
defended against by good fish husbandry and stock management. Quarantining fish is vital for
the aquarist but not always feasible for large-scale fish production (e.g. trout farming).
Individual fish can then be examined for the presence of parasites and any encountered can be
carefully removed using forceps (Benz et al., 2001). Care must be taken to examine buccal
and gill cavities also because on occasion Argulus individuals have been found there. Large
scale fish production requires other control methods suitable for treating large numbers of
fish.
There are numerous options available for the control, prevention and treatment of
Argulus infections. Many traditional treatment methods rely on the use of toxic chemicals
such as malachite green or other insecticide type chemicals. The damaging effects of many of
these chemicals on wildlife are now widely recognized and as a result many countries now
prohibit their use. There is also an increasing demand from consumers for food fish that have
not been subjected to chemical treatments. The wide range of chemical treatments available
for infections of Argulus spp. are well documented. Due to the extensive literature available
on this topic no effort is made here to discuss them in detail. The author therefore refers the
reader to selected texts, e.g. Kabata (1970, 1985), Williams (1997), Van Duijn J nr (1973) and
Lester and Roubal (1995).
In addition to the chemical treatments available, scientists are intensively examining
new methods that may prove cost-effective and, more importantly today, environmentally
Chapter 2
42
friendly. The use of invertebrate developmental inhibitors (IDIs) is now under review for the
treatment of fish ectoparasites. For example, Williams (1997) recently examined the
effectiveness of a chitin inhibiting treatment (diflubenzuron) for the treatment of Argulus
infestations and particularly the success from oral administration of these chemicals. Whilst
the results showed some effect against the parasite the study was not conclusive. Combining
the drug with the fish feed in a way that proved palatable for the fish and viable as a treatment
proved to be the main difficulty.
During the last couple of decades researchers seeking cost-effective, environmentally
friendly methods to control crustacean ectoparasites have come up with some interesting
biological control methods. In wild situations many fish utilize cleaner fish (commonly
various species of wrasse) to help rid themselves of parasites. In Norway, fish farmers have
employed wrasse in salmon cages to help control ectoparasitic copepod numbers (Bjordal,
1991). This method has shown some promise but has not been universally successful. In
2002, Gualt et al., published a paper detailing the use of novel egg-laying boards to control
argulid numbers in a commercial, stillwater trout fishery. Boards were positioned in the water
column with the idea that lice would use them as sites for egg deposition. The results were
very promising therefore further investigations are being undertaken by this research group.

7. Conclusions
Argulus spp. rarely have significant impacts upon natural fish populations. Epizootics are
observed when the natural equilibrium is perturbed by one or more factors and in many cases
anthropogenic actions have been implicated. For example, increased population densities in
fish farms and even commercial sport fisheries facilitates parasite transmission and stress
resulting from crowding, capture, handling and confinement can have a deleterious effect
upon the fishs immune response. Menezes et al. (1990) provided evidence that stocking
water bodies with non-native fish species can also provide easy targets for lice and, as we
have seen with A. japonicus, anthropogenic transfer of fish can also facilitate parasite
dispersal (Rushton-Mellor, 1992).
Much of the research with argulids in the past has focused on morphological and
ecological aspects of these organisms. Whilst this information is useful in understanding
certain aspects of the parasites life cycle and mode of existence the more recent research
focusing on the host-parasite interactions shows considerable promise in helping to develop
economically viable and environmentally sound methods of controlling these parasites. If the

43
fish and lice have co-evolved over many generations it seems logical that we should consider
both organisms together when trying to solve the problems we face.
With continuing advances in the field of fish immunology future research is likely to
increase our knowledge of the intimate relationship between argulids and their fish hosts.
Many of the advances in sea lice research may also contribute to our understanding of the
relationship between freshwater lice and their hosts. In addition to increasing our knowledge
of fish defense mechanisms and the host parasite interactions, we must also consider the
parasite itself. Much of the basic knowledge regarding these organisms biology is still not
fully understood and in many cases may prove vital to our insight into the complex
relationships between pathogens and their hosts.

Acknowledgements

This work was supported in part by the European Community's Improving Human Potential
Programme under contract [HPRN-CT-2001-00214], [PARITY]. In addition the authors
would like to thank Raymond Duijf for the donation of his scanning electron microscope
image to this chapter and Geert Wiegertjes for useful comments on early versions of the
manuscript.

Refer ences

Ahne, W. (1985). Argulus foliaceus L. and Piscicola geometra L. as mechanical vectors of
spring viraemia of carp virus (SVCV). Journal of Fish Diseases. 8, 241242.
Bandilla, M., Hakalahti, T. and Valtonen, E. T. (2007a). Patterns of host switching in the fish
ectoparasite Argulus coregoni. Behavioural Ecology and Sociobiology. 62, 975-982.
Bandilla, M., Hakalahti, T. and Valtonen, E. T. (2007b). Experimental evidence for a
hierarchy of mate- and host-induced cues in a fish ectoparasite, Argulus coregoni
(Crustacea: Branchiura). International Journal for Parasitology. 12, 1343-1349.
Bandilla, M., Valtonn, E. T., Suomalainen, L. R., Aphalo, P. J . and Hakalahti, T. (2006). A
link between ectoparasitic infectionand susceptibility to bacterial disease in rainbow
trout. International Journal for Parasitology. 36, 987-991.
Barber, I., Walker, P. and Svensson, P. A. (2004). Behavioural responses to simulated avian
Chapter 2
44
predation in three-spined sticklebacks: the effect of experimental Schistocephalus
infections. Behaviour. 141, 1425-1440.
Bauer, O. N., Musselius, V. A. and Strelkov, Y. A. (1973). Diseases of Pond Fishes. Israel
Program For Scientific Translations. Keter Press, J erusalem. Translated from Russian.
Begon M., Harper J . L. and Townsend C. R. (1990). Ecology: Individuals, Populations and
Communities. Blackwell Scientific Publications, London, UK. 1068pp.
Benz, G. W., Bullard, S. A. and Dove A. D. M. (2001). Metazoan parasites of fishes: synoptic
information and portal to the literature for aquarists. pp 115. In Regional Conference
Proceedings 2001, Anonymous (ed). American Zoo and Aquarium Association, Silver
Spring, MO. 160pp.
Benz, G. W. and Otting, R. L. (1996). Morphology of the Fish Louse (Argulus: Branchiura).
Drum and Croaker. 27, 1522.
Bjordal, A. (1991). Wrasse as cleaner-fish for farmed salmon. Progress in Underwater
Science. 16, 1729.
Bjorn, P. A. and Finstad, B. (1997). The physiological effects of salmon lice infection on sea
troutsmolts. Nordic Journal of Freshwater Research. 73, 6072.
Bower-Shore, C. (1940). An investigation of the common Fish Louse, Argulus foliaceus
(Linn.). Parasitology. 32, 361371.
Bowman, T. E. and Abele, L. G. (1982). Classification of the Recent Crustacea. Pages 1-27
In: Abele, L. G. (ed.) The Biology of Crustacea, v. 1. Systematics, The Fossil Record,
and Biogeography, pp. 127. Academic Press, New York.
Cannon W.B. (1935). Stresses and strains of homeostasis. The American Journal of the
Medical Sciences. 189, 114.
Chrousos, G. P. and Gold, P. W. (1992). The concepts of stress and stress system disorders.
Overview of physical and behavioral homeostasis. The Journal of the American
Medical Association. 267, 12441252.
Costello, M. J . (1993). Review of methods to control sea lice (Caligidae: Crustacea)
infestations on salmon (Salmo salar) farms. In: Boxshall, G.A. and DeFaye, D. (eds)
Pathogens of Wild and Farmed Fish: Sea Lice, pp. 219252. Ellis Horwood, London.
Cusack, R. and Cone, D. K. (1985). A report on the presence of bacterial microcolonies on the
surface of Gyrodactylus (Monogenea). Journal of Fish Diseases. 8, 125127.
Cusack, R. and Cone, D. K. (1986). A review of parasites as vectors of viral and bacterial
diseases of fish. Journal of Fish Diseases. 9, 169171.
Dombrowski, H. (1952). Die Karpfenlaus, Argulus foliaceus. Fishbauer. 2, 145147.

45
Dugatkin, L. A., FitzGerald, G. J . and Lavoie, J . (1994). J uvenile three-spined sticklebacks
avoid parasitized conspecifics. Environmental Biology of Fishes. 39, 215218.
Evans, D. W. and Matthews, M. A. (2000). First record of Argulus foliaceus on the European
eel in the British Isles. Journal of Fish Biology. 57, 529530.
Fenton, A., Hakalahti, T., Bandilla, M. and Valtonen, E. T. (2006). The impact of variable
hatching rates on parasite control: a model of an aquatic ectoparasite in a Finnish fish
farm. Journal of Applied Ecology. 43, 660-668.
Fryer, G. (1982). The parasitic Copepoda and Branchiura of British freshwater fishes: A
handbook and key. F.B.A. Scientific Publications of the Freshwater Biological
Association, Ambleside. 46, 1-87.
Galarowicz, T. and Cochran, P. A. (1991). Response by the parasitic crustacean Argulus
japonicus to host chemical cues. Journal of Freshwater Ecology. 6, 455456.
Gault, N. F. S., Kilpatrick, D. J ., and Stewart, M. T. (2002). Biological control of the fish
louse in a rainbow trout fishery. Journal of Fish Biology. 60, 226237.
Grayson, T. H., J enkins, P. G., Wrathmell, A. B. and Harris, J . E. (1991). Serum responses to
the salmon louse, Lepeophtheirus salmonis (Kroyer, 1838) in naturally infected
salmonids and immunised rainbow trout Oncorhynchus mykiss (Walbaum) and
rabbits. Fish and Shellfish Immunology. 1, 141156.
Gurney, R. (1948). British species of the fish louse of the genus Argulus. Proceedings of the
Zoological Society of London. 118, 553558.
Hindle, E. (1949). Notes on the treatment of fish infected with Argulus. Proceedings of the
Zoological Society of London. 119, 7981.
Holland, C. V., Kennedy, C. R. (1997). A checklist of parasitic helminth and crustacean
species recorded in freshwater fish from Ireland. Proceedings of the Royal Irish
Academy. 3, 225-243.
Huising, M. O., Stolte, E., Flik, G., Savelkoul, H. F., and Verburg-van Kemenade, B. M.
(2003). CXC chemokines and leukocyte chemotaxis in common carp (Cyprinus carpio
L.). Developmental and Comparative Immunology. 27, 875888.
Iger, Y., Balm, P. H. M., J enner, H. A. and Wendelaar Bonga, S. E. (1995). Cortisol induces
stress related changes in the skin of rainbow trout (Oncorhynchus mykiss). General
and Comparative Endocrinology. 97, 188198.
J ohnson, S. S. and Albright, L. J . (1992). Comparative susceptibility and histopathology of
the response of naive Atlantic, chinook and coho salmon to experimental infection
Chapter 2
46
with Lepeophtheirus salmonis (Copepoda: Caligidae). Diseases of Aquatic Organisms.
14, 179193.
J ohnson, S., Blaylock, R. B., Elphick, J . and Hyatt, K. D. (1996). Disease caused by the sea
louse (Lepeophtheirus salmonis) (Copepoda: Caligidae) in wild sockeye salmon
(Oncorhynchus nerka) stocks of Alberni inlet, British Columbia. Canadian Journal of
Fisheries and Aquatic Sciences. 53, 28882897.
J ones, J . B. and Hine, P. M. (1983). Ergasilus rotundicorpus n. sp. (Copepoda: Ergasilidae)
from Siganus guttatus (Bloch) in the Philipines. Systematic Parasitology. 5, 241244.
Kabata, Z. (1985). Parasites and Diseases of Fish Cultured in the Tropics. Taylor and
Francis, London. 318pp.
Kearn, G. C. (2004). Leeches, Lice and Lampreys: A natural history of skin and gill parasites
of fishes. Springer, Dordrecht, The Netherlands, 432pp.
Kennedy, C. R. (1974) A checklist of British and Irish freshwater fish parasites with notes on
their distribution. Journal of Fish Biology. 6, 613-644.
Kimura, S. (1970). Notes on the reproduction of water lice (Argulus japonicus Thiele).
Bulletin of the Freshwater Fisheries Research Laboratory Tokyo. 20, 109126.
Kollatsch, D. (1959). Untersuchungen ber die Biologie und kologie der Karpenluse
(Argulus foliaceus L.). Zoologisch Beitrge. 5, 136.
Krkoek, M., Lewis, M. A., Morton, A., Frazer, L. N. and Volpe, J . P. (2006). Epizootics of
wild fish induced by farm fish. Proceedings of the National Academy of Sciences of
the United States of America. 103, 15506-15510.
Lester, R. J . G. and Roubal, F. (1995). Phylum Arthropoda, 475598. In: Woo, P. (ed.) Fish
Diseases And Disorders: Volume 1: Protozoan and Metazoan Infections, pp. 475598.
CAB International, Wallingford, UK.
Madsen, N. (1964). The anatomy of Argulus foliaceus Linn. Lunds Universitets Arsskrift. 59,
1-31.
Martin, F. M. (1932). On the morphology and classification of Argulus (Crustacea).
Proceedings of the Zoological Society of London. 103, 771806.
Mclaughlin P. A. (1980). Comparative Morphology of Recent Crustacea. W.H. Freeman and
Co. San Francisco, USA.
Menezes, J ., Ramos, M. A., Pereira, T. G. and Moreira da Silva, A. (1990). Rainbow trout
culture failure in a small lake as a result of massive parasitosis related to careless
introductions. Aquaculture. 89, 123126.

47
Mikheev, V. N., Valtonen, E. T. and Bintamki-Kinnunen, P. (1998). Host searching in
Argulus foliaceus L. (Crustacea: Branchiura): the role of vision and selectivity.
Parasitology. 116, 425430.
Mikheev, V. N. Mikheev, A. V., Pasternak, A. F. and Valtonen, E. T. (2000). Light-mediated
host searching strategies in a fish ectoparasite, Argulus foliaceus L. (Crustacea:
Branchiura). Parasitology. 120, 409416.
Mikheev, V. N., Pasternak, A. F., Valtonen, E. T. and Lankinen, Y. (2001). Spatial
distribution and hatching of overwintered eggs of a fish ectoparasite, Argulus coregoni
(Crustacea: Branchiura). Diseases of Aquatic Organisms. 46, 123128.
Molnr, K. and Szkely, C. (1998). Occurrence of skrjabillanid nematodes in fishes of
Hungary and in the intermediate host, Argulus foliaceus L. Acta Veterinaria
Hungarica. 46, 451-463.
Moravec, F. (1978). Redescription of the nematode Philometra obturans (Prenant, 1886) with
a key to the philometrid nematodes parasitic in European freshwater fishes. Folia
Parasitologica. 25, 115124.
Moravec, F. (1994). Parasitic Nematodes of Freshwater Fishes of Europe. Academia, Prague.
473pp.
Mustafa, A., MacWilliams, C., Fernandez, N., Matchett, K., Conboy, G. A. and Burka, J . F.
(2000). Effects of sea lice, Lepeophtheirus salmonis infestation on non-specific
defence mechanisms in Atlantic salmon, Salmo salar. Fish and Shellfish Immunology.
10, 4759.
Nigrelli, R. F. (1950). Lymphocystis disease and ergasilid parasites in fishes. Journal of
Parasitology. 36, 36.
Nolan, D. T., Reilly, P. and Wendelaar Bonga, S. E. (1999). Infection with low numbers of
the sea louse Lepeophtheirus salmonis (Kryer) induces stress-related effects in the
Atlantic salmon (Salmo salar L.). Canadian Journal of Fisheries and Aquatic
Sciences. 56, 947959.
Nolan, D. T., van der Salm, A. L. and Wendalaar Bonga, S. E. (2000). The hostparasite
relationship between the rainbow trout (Oncorhynchus mykiss) and the ectoparasite
Argulus foliaceus(Crustacea: Branchiura): epithelial mucous cell response, cortisol
and factors which may influence parasite establishment. Contributions to Zoology. 69,
5763.
Northcott, S. J . (1997). An outbreak of freshwater fish lice, Argulus foliaceus L., seriously
affecting a Scottish stillwater fishery. Fisheries Management and Ecology. 4, 7375.
Chapter 2
48
Pasternak, A. F., Mikheev, V. N. And Valtonen, E. T. (2004). Adaptive significance of the
sexual size dimorphism in the fish ectoparasite Argulus coregoni (Crustacea:
Branchiura). Translated from Doklady Akademii Nauk, 399, pp. 282285
Poly, W. J . (1997). Host and locality records of the fish ectoparasite, Argulus (Branchiura),
from Ohio (U.S.A.). Crustaceana. 70, 867874.
Poly, W. J . (1998). New state, host, and distribution records of the fish ectoparasite, Argulus
(Branchiura), from Illinois (U.S.A.). Crustaceana. 71, 18.
Poly, W. J . (2003). Argulus ambystoma, a new species parasitic on the salamander
Ambystoma dumerili from Mexico (Crustacea: Branchiura: Argulidae). The Ohio
Journal of Science. 103, 52-61.
Poole, W. R., Nolan, D. T. and Tully, O. (2000). Modelling the effects of capture and sea lice
(Lepeophtheirus salmonis (Kryer) infestation on the cortisol stress response in trout.
Aquaculture Research. 31, 835841.
Pottinger T. G., Pickering A. D. and Blackstock N. (1984). Ectoparasite induced changes in
epidermal mucification of the brown trout, Salmo trutta L. Journal of Fish Biology.
25, 123128.
Poulin, R. (1998). Evolutionary Ecology of Parasites. Chapman and Hall, New York.
Poulin, R. and FitzGerald, G. J . (1987). The potential of parasitism in the structuring of a salt
marsh stickleback community. Canadian Journal of Zoology. 65, 27932798.
Poulin, R. and FitzGerald, G. J . (1988). Water temperature, vertical distribution, and risk of
ectoparasitism in juvenile sticklebacks. Canadian Journal of Zoology. 66, 20022005.
Poulin R., Marcogliese, D. J . and McLaughlin, P. A. (1999). Skin-penetrating parasites and
the release of alarm substances in juvenile rainbow trout. Journal of Fish Biology. 55,
4753.
Reilly, P. and Mulcahy, M. F. (1993). Humoral antibody response in Atlantic salmon (Salmo
salar L.) immunised with extracts derived from the ectoparasitic caligid copepods,
Caligus elongates (Nordmann, 1832) and Lepeophtheirus salmonis (Kroyer, 1838).
Fish and Shellfish Immunology. 3, 5970.
Revie, C. W., Gettinby, G., Treasurer, J . W., Rae, G. H. and Clark, N. (2002). Temporal,
environmental and management factors influencing the epidemiological patterns of sea
lice (Lepeophtheirus salmonis) infestations on farmed Atlantic salmon (Salmo salar)
in Scotland. Pest Management Science. 58, 576-574.
Roberts, L. S. and J anovy, J . (1996). Foundations of Parasitology, 5th edn. WCB Publishers
New York, USA. 659 pp.

49
Ross, N. W., Firth, K. J ., Wang, A., Burka, J . F. and J ohnson, S. C. (2000). Changes in
hydrolytic enzyme activities of naive Atlantic salmon (Salmo salar) skin mucus due to
infection with the salmon louse (Lepeophtheirus salmonis) and cortisol implantation.
Diseases of Aquatic Organisms. 41, 4351.
Ruane, N., McCarthy, T. K. and Reilly, P. (1995). Antibody response to crustacean
ectoparasites immunized with Argulus foliaceus L. antigen extract. Journal of Fish
Diseases. 18, 529537.
Ruane, N. M., Nolan, D. T., Rotllant, J ., Tort, L., Balm, P. H. M. and Wendelaar Bonga, S. E.
(1998). Modulation of the response of rainbow trout (Oncorhynchus mykiss Walbaum)
to confinement, by an ectoparasitic (Argulus foliaceus L.) infestation and cortisol
feeding. Fish Physiology and Biochemisry. 20, 4351.
Ruane, N. M., Nolan, D. T., Rotllant, J . and Wendelaar Bonga, S. E. (2000). Experimental
exposure of rainbow trout Oncorhynchus mykiss (Walbaum) to the juvenile stages of
the sea louse Lepeophtheirus salmonis (Kryer) modifies the response to a second
stressor. Fish and Shellfish Immunology. 10, 451463.
Rushton-Mellor, S. K. (1992). Discovery of the fish louse, Argulus japonicus Theile
(Crustacea: Branchiura), in Britain. Aquaculture and Fisheries Management. 23, 269
271.
Rushton-Mellor, S. K. and Boxshall, G. A. (1994). The developmental sequence of Argulus
foliaceus. Journal of Natural History. 28, 763785.
Saksida, S., Karreman G. A., Constantine, J . and Donald, A. (2007). Differences in
Lepeophtheirus salmonis abundance levels on Atlantic salmon farms in the Broughton
Archipelago, British Columbia, Canada. Journal of Fish Diseases. 30, 357-366.
Shafir, A. and Oldewage, W. H. (1992). Dynamics of a fish ectoparasite population:
opportunistic parasitism in Argulus japonicus (Branchiura). Crustaceana. 62, 5064.
Shafir, A. and van As, J . E. (1986). The opportunistic nature of Argulus japonicus in
maintaining host-parasite relationships. South African Journal of Science. 81, 635.
Shimura, S. (1980). The larval development of Argulus coregoni Thorell (Crustacea,
Branchiura). Journal of Natural History. 15, 331348.
Shimura, S. (1983). SEM observation on the mouth tube and preoral sting of Argulus
coregoni Thorell and Argulus japonicus Thiele (Crustacea: Branchiura). The Japanese
Society of Fish Pathology. 18, 151156.
Shimura, S. and Inoue, K. (1984). Toxic effects of extract from the mouth-parts of Argulus
Chapter 2
50
coregoni Thorell (Crustacea: Branchiura). Bulletin of the Japanese Society for Science
and Fisheries. 50, 729.
Singhal, R. N., J eet, S. and Davies, R. W. (1990). The effect of argulosis-saprolegniasis on
the growth and production of Cyprinus carpio. Hydrobiologia. 202, 2732.
Stammer, H. J . (1959). Beitrge zur Morphologie, Biologie und Bekampfung der
Karpfenluse. Zeitschrift Fr Parasitenkunde. 19, 135208.
Taylor, N. G. H., Sommerville, C., Wooten, R. (2006). The epidemiology of Argulus spp.
(Crustacea: Branchiura) infections in Stillwater trout fisheries. Journal of Fish
Diseases. 29, 193-200.
Todd, C. D., Walker, A. M., Hoyle, E. J ., Northcott, S. J . Walker, A. F. and Ritchie, M. G.
(2000). Infestations of wild adult Atlantic salmon (Salmo salar L.) by the ectoparasitic
copepod sea louse Lepeophtheirus salmonis Kryer: prevalence, intensity and the
spatial distribution of males and females on the host fish. Hydrobiologia. 429, 181-
196.
Tokioka, T. (1936). Preliminary report on Argulidae in J apan. Annotationes Zoologicae
Japonenses. 15, 334343.
van Ham E. H. (2003). The physiology of juvenile turbot (Scophthalmus maximus
Rafinesque) and Atlantic halibut (Hippoglossus hippoglossus, L.) under different
stress conditions. Katholieke Universiteit Nijmegen PhD Thesis.
van der Salm, A. L., Nolan, D. T., Spanings, F. A. T. and Wendelaar Bonga, S. E. (2000).
Effects of infection with the ectoparasite Argulus japonicus (Thiele) and
administration of cortisol on cellular proliferation and apoptosis in the epidermis of
common carp, Cyprinus carpio L., skin. Journal of Fish Diseases. 23, 173184.
Wadeh, H., Yang, J . W. and Li, G. Q. (2007). Ultrastructure of Argulus japonicus Thiele,
1900 (Crustacea: Branchiura) collecte from Guangdong, China. Parasitology
Research. 102, 765-770.
Walker, P. D. (2002). An investigation into the population structure, distribution, host
selection and effects of abiotic factors on the off-host longevity of, the crustacean
ectoparasite of fish, Argulus foliaceus L. (Crustacea: Branchiura). MRes thesis
University of Plymouth.
Walker, P. D., Abbink, W. Van der Velde, G. and Wendelaar Bonga, S. E. (2006). A new
record of Tracheliastes maculatus Kollar, 1835 (Copepoda, Siphonostomatoida,
Lernaeopodidae) on common bream (Abramis brama (L., 1758)) in The Netherlands.
Crustaceana. 79, 1015-1019.

51
Wendelaar Bonga, S. E. (1997). The stress response in fish. Physiological Reviews. 77, 591
625.
Whelan, K. F. and Poole, W. R. (1996). The sea trout stock collapse, 19891992. In: The
Conservation of Aquatic Systems, Reynolds, J .D. (ed.) Dublin, Royal Irish Academy.
Whitear, M. (1986). The skin of fishes including cyclostomes Epidermis. In: Bereiter-Hahn,
J ., Matoltsy, A.G. and Richards, K.S. (eds) Biology of the Integument, Vol 2., pp. 8
38. Springer-Verlag, Berlin.
Williams, C. (1997). Investigation of Diflubenzuron in the control of Argulus foliaceus L. in
carp, Cyprinus carpio L. in relation to management strategies. MSc thesis, University
of Plymouth.
Wolfe, B. A., Harms, C. A., Groves, J . D. and Loomis, M. R. (2001). Treatment of Argulus
sp. infestation of river frogs. Contemporary Topics in Laboratory Animal Science. 40,
35-36.
Woo, P. (1995). Fish Diseases And Disorders: Volume 1: Protozoan and Metazoan
Infections. CAB International, Wallingford.
Van Duijn J nr, C. (1973). Diseases of Fishes. Cox and Wyman Ltd, London. 372pp.

Chapter 3

Differential host utilisation by different life history
stages of the fish ectoparasite Argulus foliaceus
(L., 1758) (Crustacea: Branchiura)

Peter D. Walker, J ack E. Harris, Gerard van der Velde and Sjoerd E. Wendelaar Bonga

Folia Parasitologica (in press)
Chapter 3
54
Abstr act

In this study we examine differences in the occurrence of life history stages of the destructive
fish ectoparasite Argulus foliaceus (L., 1758) on eight fish species (stickleback, rudd, roach,
gudgeon, bream, tench, crucian carp and common carp) sampled from a mixed-species
recreational fishing lake on nine occasions during late spring and summer. Total numbers of
A. foliaceus, as well as the number of larval, juvenile and adult parasite stages, from each fish
were recorded along with the fish species. Lice generally exhibited an aggregated distribution
approximating a negative binomial distribution. Significant differences in the prevalence,
intensity and intensity frequency distribution were observed between life history stages and
between host species. In general, all life history stages of A. foliaceus exhibited an over-
dispersed disribution. However, larval lice did show some degree of aggregation, particularly
within the stickleback samples. Infection data for parasite larval stages suggested that
sticklebacks are more likely to be infected than other host species. For adult lice, however,
carp appeared to be the main host. We propose that A. foliaceus infection characteristics are
predominantly determined by the level of host exposure to the parasite and its life history
stages (larval, juvenile and adult), rather than by an innate difference in susceptibility related
to individual host factors such as immune responses. We conclude that host exposure is
determined by the parasite-host behavioural interplay related to species specific ecology and
behavioural traits such as microhabitat preference and normal swimming speed.

Host choice by Argulus foliaceus
55
Intr oduction
The ecology of freshwater macrophytes, planktonic organisms and macro-invertebrates is well
described but many common parasites are still poorly studied. There is a plethora of published
material relating to fish parasites (e.g. Kabata, 1985; Barber et al., 2000; Nolan et al., 2000;
Benz et al., 2001). Many of these papers have focussed upon cultured, and laboratory-reared
host-parasite models and, in some cases, data regarding the natural ecology and infection
dynamics of are considerably lacking by comparison.
Host-specificity has always been an area of interest for parasitologists as many
parasite species show high levels of specificity, typically being restricted to just one species or
genus (Roberts and J anovy, 1996). Intermittent parasites appear to be an exception to this
trend with several groups exhibiting relatively low specificity, e.g., many lice, fleas, leeches,
mosquitos and midges. The fish louse Argulus foliaceus (L., 1758) seems to share this non-
host-specific trait with other intermittent parasites as occurs on a wide range of freshwater
fish species (Gurney, 1948, Kollatsch, 1959, Stammer, 1959, Kennedy, 1974, Lester and
Roubal, 1995, Holland and Kennedy, 1997, Kearn, 2004, Walker et al., 2004).
Many authors have commented on the lack of specificity of argulid parasites, sharing
the opinion that individual species from this group (e.g., A. foliaceus and A. japonicus Thiele,
1900) can infect a wide range of host species (Kearn, 2004 and references therein; Walker et
al., 2004 and references therein). However, some apparent host preferences have been
demonstrated (e.g., Valtonen et al., 1997, Mikheev et al., 1998, 2000, Pasternak et al., 2000).
Most publications regarding host preferences of branchiurans concentrate on infection
dynamics within just one or two host species (e.g., LaMarre and Cochran, 1992, Mikheev et
al., 1998, Pasternak et al., 2000), often in non-natural situations such as laboratory aquaria or
fish farms (e.g., Hakalahti and Valtonen, 2003, Mikheev et al., 2004). There is a noticeable
lack of published information regarding the distribution and epidemiology of A. foliaceus in
mixed species fish communities.
It is probable that, for behavioural and ecological reasons, some fish species are more
likely to be infected by non-host-specific parasites than others. Bandilla et al., (2005)
suggested that host-behaviour leading to increased exposure to lice was the most likely
mechanism leading to observed infection characteristics of Argulus coregoni Thorell on
rainbow trout, Oncorhynchus mykiss (Walbaum), from a Finnish fish farm.
On this basis we hypothesise that certain fish species are more likely to be infected
with different life history stages of the non-host-specific ectoparasite, A. foliaceus, due to the
increased likelihood of encounters related to species specific ecological and behavioural traits.
Chapter 3
56
This study aims to use field observations of infection characteristics of A. foliaceus on several
host fish species to highlight the importance of considering parasite ontogeny when looking at
parasite distributions amongst hosts and also the importance of considering all members of a
fish community when studying such an apparently non-host-specific parasite.

Mater ials and methods

Fish sampling
Sampling took place in one lake of a mixed species, freshwater, commercial fishery in South
West England (OS grid reference: SX456751). The lake has a surface area of approximately 2
acres and an average depth of approximately 90cm. This man-made fishing lake was
completed and opened to the angling public in 1995. Fish were sampled on nine occasions
during the late spring and summer season, a period when A. foliaceus is known to be most
abundant and when all life history stages are present (Walker et al., 2004). Fish were mostly
sampled with angling techniques; samples of small fish inhabiting the dense weed beds of the
shallow littoral zone were obtained with a standard pond net. During each sampling trip
several different areas were fished and within each area anglers were fishing at several depths
and locations during the course of the day. Standard angling methods were used for several
reasons: i) the fishery owner wished it; ii) the authors felt this method of fish capture causes
the least disturbance to the environment; iii) it did not cause excessive damage to the fins,
scales, mucous layer and epidermis of the fish; iv) it reduced the risk of parasites being
'rubbed' off during capture; v) several regions of the fishery and several species of fish were
targeted simultaneously by using several anglers. Upon capture all fish were placed on a pre-
wetted, white mat (to aid spotting of dislodged parasites) and handled with wet hands to
minimise damage to the epithelium and the protective mucous layer. The eyes of larger fish
were covered with a damp cloth to calm the fish during parasite collection.

Parasite collection
The external surfaces and buccal and gill cavities of all fish were examined thoroughly for
Argulus individuals which were subsequently removed carefully using a set of blunt forceps.
The total number of parasites (referred to as all lice from here on) and the number from
each life history stage (larval, juvenile and adult) collected from the fish was recorded along
with the fish species they were taken from. Parasite developmental stage was classified as
larval, juvenile or adult according to descriptions by Rushton-Mellor and Boxshall (1994).
57
Data analysis
Parasite numbers from all nine sampling occasions were pooled to give an overview of the
infection characteristics during the sampling period. Statistics were calculated using methods
described by Rzsa et al. (2000) with Quantitative Parasitology 3.0 (QP 3.0; Reiczigel and
Rzsa, 2005). Descriptive statistics include prevalence (proportion of infected hosts amongst
all hosts examined) with better exact confidence limits and mean intensity (average number of
parasites found on the infected hosts zeros of uninfected hosts were excluded) with
bootstrap confidence limits (BCa) as recommended by Rzsa et al. (2000). As measures of
aggregation we calculated the Index of Discrepancy (D) as described by Poulin (1993) and
tested the infection intensity frequency distribution to see how closely it fits a negative
binomial distribution (K). All confidence intervals are given at the 95% level unless otherwise
stated.
Differences between host species numbers were analysed with ANOVA and Dunns
post-hoc test using INSTAT. Chi-square test was used to test differences between prevalences
as recommended by Rzsa et al. (2000). Bootstrap 2-sample t-test was applied to test for
differences between mean intensities. This test is considered more appropriate for parasites
due to the skewness of their distribution (Rzsa et al., 2000). A Brunner-Munzel test of
stochastic equality was applied to test differences between parasite intensity distributions
(Reiczigel et al., 2005)

Results

Fish species
Eight species of fishes were encountered during the sample period: three-spined stickleback
Gasterosteus aculeatus aculeatus L.; rudd Scardinius erythropthalmus (L.); roach Rutilus
rutilus (L.); gudgeon Gobio gobio gobio (L.); common bream Abramis brama (L.); tench
Tinca tinca (L.); crucian carp Carassius carassius (L.); common carp Cyprinus carpio carpio
L.. Not all species were equally represented in samples (Table 1) indicating that there are
probably greater numbers of some species than others within the resident fish community.
Rudd (24%), carp (22%), gudgeon (18%) and roach (13%) were the most abundant species in
samples (Table 1).

Chapter 3
58
Table 1. The proportion of the sampled fish community made up by each species and the
distribution of all lice (larval +juvenile +adult stages), larval lice, juvenile lice and adult lice
on different host species.
Pr opor tion (%)
Fish species Total fish
com.
All lice Lar val lice Juvenile lice Adult lice
Stickleback 8 32 83 26 9
Rudd 24 4 0 9 2
Roach 13 <1 0 1 0
Gudgeon 18 18 10 19 22
Br eam 6 6 0 5 11
Tench 4 2 0 2 4
Cr ucian car p 5 1 1 3 <1
Common car p 22 37 6 35 52

Infection data
Fish lice (Argulus foliaceus) were found on all sampling days (identified with characteristics
described by Fryer (1982)). Of the 650 fish sampled, 241 were infected with A. foliaceus.
Infection summary statistics for all, larval, juvenile and adult lice are summarized in Table 2.
All the louse populations show infection intensity frequencies that exhibit an over-dispersed
pattern with many fish harbouring low numbers and nly a few fish with high numbers of lice.
These data fit a negative binomial distribution in all cases (Fig. 1).
Water temperature during the sampling period ranged from a minimum of 15.5
o
C at
the start of the sampling period to a maximum of 22.5
o
C at the end of the sampling period.
The abundance of all lice and the different life history stages on the different fish species
varied during the course of the sampling period (Fig. 2A-D). However, a general trend is
apparent with larval and juvenile stages typically being more abundant on sticklebacks than
other species throughout the sampling period (Fig. 2B, C). Adult lice, however, were
consistently more abundant on carp and gudgeon with sticklebacks sometimes appearing as an
important host species (Fig. 2D). From the beginning of J une until the end of the sampling
period, larval lice exhibit a much greater abundance than adult lice and this pattern was
similar for juvenile stages although their numbers did not increase until mid to late J une. The
abundance of all lice increased during the first half of the sampling period and then appears to
level off and even decrease towards the end of the sampling period. The abundance of larval
and juvenile stages match this pattern quite closely, however, the abundance of adult lice
appears to remain relatively stable throughout the sampling period.
59
Prevalence is highest for adult lice followed by juvenile and then larval lice. The
prevalences of the different life history stages differ significantly (Chi-square =112.75, 2df; P
<0.0001). Lower average infection intensity typically coincided with higher prevalence. Mean
infection intensity in larval lice was significantly higher than in adult (t =-4.22, 2-sided P-
value <0.01) and juvenile stages (t =-3.85, 2-sided P-value <0.01). Infection intensity for
juvenile lice was also significantly higher than for adult lice (t =-2.18, 2-sided P-value
<0.05). Infection intensity distributions of adult and larval stages and juvenile and larval
stages also differed significantly (2-tailed P-values <0.00001 and 0.0001, respectively) but not
between adult and juvenile stages (2-tailed P-value =0.177).

Table 2. Mean and maximum intensity (I), prevalence and Index of Discrepancy (D) (after Poulin
1993), for all lice , larval, juvenile and adult lice are shown for the whole fish community and the
stickleback, rudd, gudgeon and carp populations. Data for roach are not given due to the very low
louse prevalence on this species. The 95% confidence limits for each value are shown in
parentheses.
Par asite
gr oup
Par ameter All fish
(n = 650)
Stickleback
(n = 53)
Rudd
(n = 153)
Gudgeon
(n = 119)
Car p
(n = 140)
Pr evalence 37.1 (33-41) 56.6 (42-70) 8.5 (5-14) 57.1 (48-66) 65.7 (58-73)
Mean I 2.8 (2.5-3.3) 7.3 (5.4-9.6) 2 (1.5-2.5) 1.8 (1.5-2.2) 2.7 (2.3-3.1)
Max I 23 23 4 8 9
All lice
D 0.796 0.667 0.932 0.601 0.587
Pr evalence 3.8 (2.6-5.7) 28.3 (18-42) N/A 3.4 (1-8) 2.9 (1-7)
Mean I 6.4 (4.6-8.4) 8.9 (6.6-12.1) N/A 4.0 (1.3-6.3) 2.0 (1.0-3.3)
Max I 22 22 N/A 7 4
Lar val
D 0.977 0.796 N/A 0.970 0.973
Pr evalence 17.4 (14.6-20.5) 24.5 (15-38) 7.2 (4-13) 24.4 (17-33) 28.6 (22-37)
Mean I 2.1 (1.9-2.4) 4.8 (3.6-5.5) 1.9 (1.3-2.6) 1.6 (1.3-2.0) 2.2 (1.7-2.7)
Max I 7 7 4 5 7
Juvenile
D 0.888 0.789 0.944 0.81 0.810
Pr evalence 24.8 (21.5-28.2) 30.2 (19-44) 2.6 (1-6) 39.5 (31-48) 50 (42-58)
Mean I 1.8 (1.6-1.9) 1.5 (1.2-1.9) 1.3 (1.0-1.5) 1.3 (1.2-1.4) 2.1 (1.8-2.5)
Max I 7 3 2 2 7
Adult
D 0.825 0.735 0.971 0.663 0.662

Chapter 3
60

Fig 1. Intensity frequency histograms for all lice (A), larval (B), juvenile (C) and adult
stages (D) infecting different fish groups.

1 6 11 16 21
All fish
A
B
C
D
1 6 11 16 21
Sticklebacks
A
B
C
D
1 6 11 16 21
Rudd
A
C
D
1 6 11 16 21
A
B
C
D
Gudgeon
1 6 11 16 21
A
B
C
D
Carp
61

Fig. 2. Stacked bar charts showing the abundance (number of lice/number of
fish sampled) of all lice (A), larval (B), juvenile (C) and adult stages (D) on
five different fish species sampled on nine occasions.
0
2
4
6
8
10
12
14
16
18
8
t
h

M
a
y
2
1
s
t

M
a
y
5
t
h

J
u
n
e
1
4
t
h
J
u
n
e
2
5
t
h
J
u
n
e
4
t
h

J
u
l
y
1
0
t
h

J
u
l
y
2
5
t
h

J
u
l
y
7
t
h
A
u
g
u
s
t
A
b
u
n
d
a
n
c
e
Carp
Gudgeon
Roach
Rudd
Sticklebacks
0
1
2
3
4
5
6
7
8
8
t
h

M
a
y
2
1
s
t
M
a
y
5
t
h

J
u
n
e
1
4
t
h
J
u
n
e
2
5
t
h
J
u
n
e
4
t
h

J
u
l
y
1
0
t
h
J
u
l
y
2
5
t
h
J
u
l
y
7
t
h
A
u
g
u
s
t
A
b
u
n
d
a
n
c
e
0
1
2
3
4
5
6
7
8
8
t
h

M
a
y
2
1
s
t

M
a
y
5
t
h

J
u
n
e
1
4
t
h
J
u
n
e
2
5
t
h
J
u
n
e
4
t
h

J
u
l
y
1
0
t
h

J
u
l
y
2
5
t
h

J
u
l
y
7
t
h
A
u
g
u
s
t
A
b
u
n
d
a
n
c
e
0
0.5
1
1.5
2
2.5
8
t
h

M
a
y
2
1
s
t

M
a
y
5
t
h

J
u
n
e
1
4
t
h

J
u
n
e
2
5
t
h

J
u
n
e
4
t
h

J
u
l
y
1
0
t
h

J
u
l
y
2
5
t
h

J
u
l
y
7
t
h

A
u
g
u
s
t
A
b
u
n
d
a
n
c
e
Chapter 3
62
Lice were not distributed evenly between the fish species and the distribution of larval,
juvenile and adult stages showed differences in terms of their occurrence on different host
species (Table 1). The majority of the lice sampled were found on carp and sticklebacks with
a large proportion also being found on gudgeon (Table 1). Relatively few lice were observed
on the other fish species caught. Larval lice were found predominantly on sticklebacks.
J uvenile louse distribution approximates closely that of all lice together, with carp and
sticklebacks harbouring the majority of juvenile lice followed by gudgeon and again relatively
few lice being found on the other host species (Table 1). Adult lice, however, were found
predominantly on carp followed by gudgeon and then bream. Tench, crucian carp and bream
samples were not subjected to further statistical analyses due to the low number of individuals
sampled.

Infection data for the stickleback population
Of the 53 sticklebacks examined, 58% were infected with A. foliaceus (Table 2). The whole
louse population and the larval lice portion, fit the negative binomial distribution (Fig. 1). The
juvenile and adult lice portions do not fit the negative binomial distribution. Lice infecting the
stickleback population appear to be more aggregated in their distribution than the pattern for
the whole fish community.
Prevalence ranged from the highest for adult lice to the lowest for juvenile lice.
However, prevalences were not significantly different (Chi-square =0.44, 2df; P =0.803).
The mean infection intensity of larval lice was significantly higher than the mean infection
intensity of juvenile and adult lice (t =-2.723, 2-sided P-value <0.05 and t =-5.113, 2-sided
P-value <0.001, respectively). The mean intensity of juvenile lice was significantly higher
than that of adult lice (t =-6.053, 2-sided P-value <0.0001).
Aggregation was highest in larval lice followed by juvenile and then adult stages
(Table 2). Infection intensity distributions of the three life history stages differed significantly
in all cases (2-tailed P-values: adults versus larvae, P <0.001; adults versus juveniles, P
<0.001; juveniles versus larvae, P <0.05).

Infection data for the roach population
Prevalence was very low (3.5%, 0.001 <95% cl <0.1) with only three out of 85 fish
harbouring lice. Two fish harboured one juvenile louse each and the third fish harboured one
adult louse. Due to the extremely low numbers of lice statistical analyses were not possible.

63
Infection data for the rudd population
Of the 153 rudd examined, only 8.5% were infected with A. foliaceus (Table 2). The whole
louse population and the juvenile portion fit a negative binomial distribution (Fig. 1). No
larval lice were found on rudd and there were insufficient adult lice to test the intensity
frequency distribution. Infection intensities were considered low in all cases (maximum of 4
lice per fish).
Prevalence of the different life history stages differed significantly (Chi-square =
12.819, 2df; P <0.005) with juveniles exhibiting the highest prevalence. However, the
prevalences were considered low (<8%) in all cases. J uvenile louse mean infection intensity
was higher than that of adults (Table 2) but the difference was not significant (P >0.05).

Infection data for the gudgeon population
More than half of the gudgeon sampled were infected with A. foliaceus (Table 2). In the case
of all lice, larval and juvenile stages, the infection intensity frequency data fit a negative
binomial distribution (Fig. 1).
Adult prevalence was highest followed by juvenile and then larval lice (Table 2).
Prevalence of the different life history stages differed very significantly (Chi-square =45.067,
2df; P <0.0001). Larval lice exhibited the highest mean infection intensity followed by
juvenile and then adult lice. However, mean intensities of the different life history stages did
not differ significantly in all cases. Larval lice also exhibited the highest degree of
aggregation, again followed by juvenile and adult stages (Table 2) but intensity distributions
did not differ significantly.

Infection data for the carp population
Of the 140 carp sampled, 66% were infected with lice (Table 2). The intensity frequency
distribution of the louse population as a whole fit a negative binomial distribution as did the
juvenile louse portion (Fig. 1). Adult louse intensity frequency distribution did not fit a
negative binomial distribution, however, and there were not enough categories of larval lice to
test the fit.
Adult lice exhibited the highest prevalence followed by juvenile and then larval lice
(Table 2). Prevalence of the different life history stages differed significantly (Chi-square =
78.885, 2df; P <0.0001). Mean infection intensities of the three life history stages were all
very similar (Table 2) and did not differ significantly. Larval lice exhibited the highest degree
Chapter 3
64
of aggregation followed by juveniles and then adults (Table 2). However, the infection
intensity distributions did not differ significantly.

Between species comparisons
The prevalence of all lice and of larval, juvenile and adult life history stages differed
significantly between species in all cases (Chi-square =172.242, 4df; P <0.0001). The
infection intensity of all lice on sticklebacks was significantly higher than all other species (2-
sided P-values <0.01 in all cases). Mean infection intensity on roach was significantly lower
than those of all other species (2-sided P-values <0.03 in all cases). Mean infection intensity
on rudd was significantly higher than roach (2-sided P-value <0.03) but not significantly
different from gudgeon (2-sided P-value >0.1). The mean infection intensity of carp was
higher than that of rudd although the difference was only marginally significant (2-sided P-
value = 0.085). Mean infection intensity on gudgeon was significantly lower than on
sticklebacks and carp (2-sided P-values <0.03) but not significantly different from rudd (2-
sided P-values >0.05).
Only sticklebacks, gudgeon and carp harboured larval lice. Mean infection intensity of
larval lice on sticklebacks was significantly higher than on gudgeon or carp (2-sided P-values
<0.05 respectively). Mean infection intensity of larval lice on gudgeon was higher than that of
carp (Table 2) but the difference was not significant (2-sided P-value >0.05).
All five species were infected with juvenile lice. However, only two roach harboured
juvenile lice, therefore this species was not included in the statistical analysis. J uvenile louse
infection intensity was significantly higher on sticklebacks than on all other host species (2-
sided P-values <0.05 respectively). J uvenile louse infection intensity on rudd was slightly
higher than on gudgeon and slightly lower than on carp but the differences were not
significant (2-sided P-values >0.05 respectively). Infection intensity of juvenile lice on carp
was slightly higher than on gudgeon and the difference was considered marginally significant
(2-sided P-value =0.06).
For adult louse infection intensity, roach were again excluded from statistical analysis
as there was only one fish harbouring adult lice. Adult louse mean infection intensity on carp
was significantly higher than on sticklebacks, rudd and gudgeon (2-sided P-values <0.05
respectively). Mean infection intensity of adult lice on sticklebacks was slightly higher than
on rudd or gudgeon but the differences were not significant (2-sided P-values >0.05).
Infection intensities of adult lice on rudd and gudgeon also did not differ (2-sided P-value
>0.05).
65
We also tested the intensity distributions of lice, and of the different life history stages,
between the different species. Roach were excluded from all analyses, except that of all lice,
due to the low number of infected fish for this species. In addition, rudd were excluded from
analyses of larval lice because no rudd were found with this parasite life history stage.
Intensity distributions of all lice were significantly different between all species (2-sided P-
values <0.05) except between rudd and gudgeon, and rudd and carp (2-sided P-values >0.05).
The difference between larval lice intensity distribution on sticklebacks and carp was
significant (2-sided P-value <0.05), between gudgeon and sticklebacks the difference was
marginally significant (2-sided P-value =0.06) and the difference between carp and gudgeon
was not significant (2-sided P-value >0.05).
J uvenile lice intensity distributions on sticklebacks differed significantly from rudd,
gudgeon and carp (2-sided P-values <0.01 in all cases). Intensity distributions on rudd did not
differ significantly from gudgeon or carp (2-sided P-values >0.05) and intensity distributions
did not differ between carp and gudgeon either. Finally, intensity distributions of adult lice
differed significantly between carp and gudgeon (2-sided P-value <0.01) but not between any
of the other species.

Discussion
A range of different regions and depths around the lake were sampled at several different
times during the day and on each sampling trip several angling methods were employed to try
and ensure that any bias in fish species caught could not be attributed to sampling locality or
sampling technique. Very heavily infected fish are likely to be lethargic and spend less time
feeding than lightly infected or uninfected individuals (Wendelaar Bonga, 1997, Walker et al.,
2004), which would reduce the likelihood of these individuals being caught. No moribund or
dead fish were observed during the whole of the sampling period and the fishery owner had
not reported such occurrences. Infection levels were generally not high enough to cause
serious effects, e.g., morbidity and lethargy, associated with epizootics. Lice could be
dislodged during capture of the fish, but Bower-Shore (1940) observed that a fast flowing
stream of water in the laboratory did not dislodge adult parasites. Therefore, the chosen
sampling methodology probably did not result in significant losses of lice during fish capture.
No data is available to determine if the attachment strength differs between life history stages.
An alternative sampling technique that would exclude all of the above possible biases or
provided more reliable data is currently unavailable.
Chapter 3
66
The abundance data hint towards a trend of certain fish species being favoured as
hosts by different life history stages of Argulus foliaceus. The relative abundance of larvae
and juveniles on the different host species does not appear to vary greatly throughout the
sampling period although their numbers do vary considerably. However, the abundance of
adults on sticklebacks does vary noticeably throughout the sampling period. Adult lice appear
to be more abundant on sticklebacks approximately 4 weeks prior to the first big peak in
larval lice numbers and approximately 3 weeks prior to the second big peak in larval lice
numbers. Our own laboratory observations have shown that A. foliaceus eggs can hatch in
only 18 days at 20
o
C and 28 days at 15
o
C (unpublished data). Therefore, it appears that adult
lice may utilize sticklebacks as a temporary host whilst they move into shallow water to
deposit their eggs which subsequently hatch after 2-6 weeks (depending on temperature)
resulting in the observed peaks in larval lice abundance that we observed.
If A. foliaceus and the various host fish species were evenly distributed with the water
body, parasite distribution should be related to the number of available hosts from each
species. However, in terms of total numbers of lice, parasite distribution amongst the host
community does not appear to be related to the number of available hosts from each fish
species in our study.
All fish species sampled are known to be potential hosts for A. foliaceus (Kennedy,
1974). The infection data for the fish community as a whole showed that adult louse
prevalence (i.e., proportion of the community harbouring adult lice) was significantly higher
than both juvenile and larval louse prevalence. In contrast larval lice show the highest mean
intensity and adult lice the lowest mean intensity. This indicates a trend of larval lice having a
more aggregated distribution than other life history stages but becoming more dispersed as
they mature. Eggs of A. foliaceus are deposited in clumps or, more commonly, parallel rows
with as many as several hundred eggs in a clutch (Mikheev et al., 2003; Kearn, 2004; Walker
et al., 2004). A firm substrate such as a plant stem or surface of a stone, is required for egg
deposition (Kearn, 2004), and therefore certain areas where a large surface area of suitable
substrate is available may become 'hot-spots' for infection of fish with larval lice leading to an
aggregated distribution on hosts that occur in these regions. The intensity frequency data
support this (Fig. 1), showing that several individuals were infected with relatively high
numbers of larval lice (up to a maximum of 22 lice) and very few fish with more than 4 adult
lice.
As a generalist parasite, A. foliaceus probably does not actively discriminate between
fish species. However, if certain regions are indeed hot-spots for infection with larval lice
67
then fish that frequent these regions are more likely to become infected with larval lice than
fish that generally occur in other regions of the water body. Mikheev et al., (2003) suggested
that most freshwater fishes concentrate close to the shore in late spring and early summer for
spawning and foraging thereby increasing the risk of exposure at least to larval and adult
female parasites. Urho (1996) showed that A. foliaceus occurs almost exclusively in the
littoral zone of a lake during the summer although no distinction was made as to what life
history stage was encountered. We found that adult A. foliaceus was more common in open
water habitats (data not shown) but it should be noted that our study was conducted in a very
small, shallow (mean depth <1m) pond the whole of which is probably representative of a
larger lake's littoral zone.
Prevalence of the three parasite development stages on sticklebacks did not differ
significantly. However, mean infection intensities did, with larval lice showing much higher
intensities than adult and juvenile stages, and adults showing the lowest. Sticklebacks inhabit
the shallower, more sheltered regions of stillwaters (Davies et al., 2004), particularly during
the spring and summer periods for reproduction purposes and because of higher food
abundance (Mikheev et al., 2003, Davies et al., 2004). These sheltered, littoral regions (e.g.,
reed beds and pier supports) are also the areas generally chosen for egg deposition by adult
female A. foliaceus (Walker et al., 2004). This would place sticklebacks at high risk of
infection by larval lice and the present data and those of Walker et al., (2007) support this.
In aquaria A. foliaceus showed a preference for juvenile roach over perch under light
conditions, with the reverse being found under dark conditions (Mikheev et al., 1998). In the
field, perch exhibited higher infection levels than roach (Valtonen et al., 1997). In our study
we only encountered three roach harbouring lice, only one of which was an adult louse.
Mikheev et al. (2000) later demonstrated that A. foliaceus also changes its hunting strategies
depending on whether conditions are light or dark. The small lake sampled for our study was
very turbid and light intensities were probably quite low only several cm below the surface.
This is typical of lakes containing many carp due to their feeding habits (Davies et al., 2004).
Herter (1927) suggested that A. foliaceus avoids the surface zones with too much light and
this could be to avoid the 'sensory overload' mentioned by Mikheev et al. (2003). This
hypothesis was deduced from lice in glass aquaria. However, rippling on the water surface
may cause light reflections resulting in similar confusing effects for the lice. This effect may
cause behavioural changes in the lice resulting in avoidance of this zone. If this behavioural
change does occur then lice will be subjected to lower light intensities resulting from high
turbidity and this could influence A. foliaceus to adopt the 'dark-hunting-strategy', which may
Chapter 3
68
not favour the location of roach as suggested by Mikheev et al., (1998). In addition, roach
tend to show a fairly ubiquitous distribution within stillwaters with no obvious microhabitat
preference (Davies et al., 2004). Larval lice especially are more likely to occur in regions with
vegetation, or around other structures more common in shallow littoral zones, due to the egg
deposition habits of adult female lice. J uvenile and adult stages may be more dispersed if
lower light intensities do encourage a shift towards the 'dark-hunting-strategy'. Then fish that
are swimming in close proximity to the lake bottom and which are not highly active in their
behavioural habits (e.g., gudgeon, carp and stickleback) are more likely to become infected
than those showing more pelagic or surface-dwelling habit (e.g., roach and rudd).
Whilst the prevalence of A. foliaceus on rudd is more than double of that on roach, at
8.5% it is still a very small portion of the population that is infected. Rudd tend to swim close
to the surface in proximity to, but not necessarily within, vegetation stands (Davies et al.,
2004). As we stated earlier, larval lice are more likely to be found within vegetation stands
rather than outside of them and all lice are likely to be more common near the bottom (Herter,
1927) in a different vertical zone to that typically inhabited by the rudd. Rudd are relatively
active, fast swimmers when compared with species such as gudgeon and sticklebacks. The
relatively slow swimming speed of A. foliaceus (especially the larval stage) may mean that
rudd provide a difficult target for lice to locate and successfully attach to.
More than half of the gudgeon population was infected with lice. Gudgeon are benthic
feeders (Davies et al., 2004), so are more likely to encounter lice showing the 'dark-hunting-
strategy' and swimming closer to the bottom away from the bright, reflective, surface zones.
Gudgeon are a slow swimming, shoaling species often occurring in large shoals which would
facilitate parasite transmission by dispersing them amongst the population. Thus, we would
expect a high prevalence but not necessarily a high intensity, and this is indeed what we
observed. The higher intensity of larval lice is concurrent with a low prevalence suggesting
that a small number of fish had encountered a hot-spot where larval lice had emerged and the
parasites become more dispersed within the host population as they mature.
A. foliaceus is also called the 'carp louse' and it is not surprising therefore that the
highest prevalence of lice was observed on carp. As with other host species, adult louse
prevalence was higher than that of larval and juvenile life stages and this, combined with a
relatively low average intensity, shows adult lice to be rather over-dispersed amongst the host
population. Interestingly larval lice exhibited a very low prevalence and intensity. Carp are
known to be fairly ubiquitous in their distribution within this lake and are probably relatively
69
more active than sticklebacks and gudgeon. This higher level of activity would make it more
difficult for larval lice to locate and successfully attach to carp.
The differences between species were significant for several infection variables. The
prevalence of the three life stages differed significantly between species in all cases.
Significant differences were also found for mean infection intensities (although the
differences were only marginally significant for larvae), suggesting average infection
intensities are dependent upon host species. Intensity distributions also support the
hypothesis, formulated from the prevalence and average infection intensity data, that A.
foliaceus exhibits a stage-specific distribution within the host community. Mean intensities of
all lice, and the larval and juvenile stages, on sticklebacks were significantly higher than on
all other host species. This indicates that this species exhibits habits that increase its exposure
to young A. foliaceus (Walker et al., 2007).
The physical and immune response characteristics of the host fish probably play a role
in determining infection characteristics. Ecological and behavioural characteristics of the host
species may create different opportunities for different life history stages of A. foliaceus to
infest them and this is the more likely driving force behind the infection characteristics
observed in natural systems. Mikheev et al., (2003) similarly suggested that it is the interplay
between host and parasite behaviour that determines host-searching success of the parasite
and subsequent observed parasite infection patterns. The range of species found harbouring A.
foliaceus supports the view that this is a generalist parasite species and patterns of parasite
distribution within mixed host species communities are likely to be determined by host-
parasite encounter frequencies. Whilst the mechanisms employed for host location (e.g.
olfaction, vision, mechanoperception) have been investigated previously (Mikheev et al.,
1998, 2000, 2003, 2004) information is still lacking on how these sensory mechanisms may
influence host selection by this parasite and by each of its life history stages.
The observed differences in abundance between the life history stages is probably
attributable to the fact that larval, juvenile and adult lice are known to spend different
amounts of time free-swimming (Stammer, 1959)., Pasternak et al., 2000, Mikheev et al.,
2003) Adult male lice must leave their hosts to locate mates, and females must do so in order
to deposit eggs (Walker et al., 2004). Further studies examining these off-host periods for
lice, in particular for the adult stage, are required to determine the degree to which these off-
host periods influence louse distributions in the wild.
Differences in parasite prevalence and/or intensity on one host species at one time do
not necessarily demonstrate a preference for this species (Lester, 1984), but may in fact reflect
Chapter 3
70
differences in the level of exposure of this species to the parasite due to other factors such as
the relative abundance or distribution of that host species. In conclusion, A. foliaceus
distributions within a community differ between host species and parasite life history stages,
and ecological/behavioural traits of both host and parasite play a significant role in
determining these distributions.

Acknowledgements

The authors wish to thank the members of the EU Training network, PARITY, for advice and
comments during informal presentations of these data. Thanks are also extended to Ben
Holbrook, Anthony Oxley, Iain Russon and Stewart Walker for assistance with fish sampling
and parasite counting. In addition, the authors wish to thank the owners and anglers at Mile
Mead fishery, Tavistock, UK for their assistance and tolerance. This is Centre for Wetland
Ecology publication number 486.

Refer ences

Bandilla, M., Hakalahti, T., Hudson, P. J ., Valtonen, E. T. (2005). Aggregation of Argulus
coregoni (Crustacea: Branchiura) on rainbow trout (Onchorhynchus mykiss): a
consequence of host susceptibility or exposure? Parasitology. 130, 169-176.
Barber, I., Hoare D., Krause, J . (2000). Effects of parasites on fish behaviour: a review and
evolutionary perspective. Reviews in Fish Biology and Fisheries. 10, 131-165.
Benz, G. W., Bullard, S. A., Dove, A. D. (2001). Metazoan parasites of fishes: synoptic
information and portal to the literature for aquarists. Regional Conference
Proceedings of the American Zoo and Aquarium Association 2001. AZA, Silver
Spring, MD, pp 1-15.
Bower-Shore, C. (1940). An investigation of the common fish louse, Argulus foliaceus
(Linn.). Parasitology. 32, 361-371.
Davies, C., Shelly, J ., Harding, P., Mclean, I., Gardiner, R., Peirson, G. (2004). British
Freshwater Fishes the Species and their Distribution. Harley Books, Essex, 184 pp.
71
Gurney, R. (1948). British species of the fish louse of the genus Argulus. Proceedings of the
Zoological Society of London 118, 553558.
Hakalahti, T., Valtonen, E. T. (2003). Population structure and recruitment of the ectoparasite
Argulus coregoni Thorell (Crustacea: Branchiura) on a fish farm. Parasitology. 127,
79-85.
Herter, K. (1927). Reizphysiologische Untersuchungen an der Karpfenlaus (Argulus foliaceus
L.). Zeitschrift fr vergleichende Physologie. 5, 283-370.
Holland, C. V., Kennedy, C. R. (1997). A checklist of parasitic helminth and crustacean
species recorded in freshwater fish from Ireland. Proceedings of the Royal Irish
Academy. 3, 225-243.
Kabata, Z. (1985). Parasites and Diseases of Fish Cultured in the Tropics. Taylor and
Francis, London. 318pp.
Kennedy, C. R. (1974) A checklist of British and Irish freshwater fish parasites with notes on
LaMarre, E., Cochran, P. A. (1992). Lack of host species selection by the exotic parasitic
crustacean, Argulus japonicus. Journal of Freshwater Ecolology. 7, 77-80.
Lester, R. J . G. (1984). A review of methods for estimating mortality due to parasites in wild
fish populations. Helgolnder Meeresunterschungen 37, 53-64.
Lester, R. J . G. and Roubal, F. (1995). Phylum Arthropoda, 475598. In: Woo, P. (ed.) Fish
Diseases And Disorders: Volume 1: Protozoan and Metazoan Infections, pp. 475598.
CAB International, Wallingford, UK.
Mikheev, V. N. Mikheev, A. V., Pasternak, A. F. and Valtonen, E. T. (2000). Light-mediated
Branchiura). Parasitology. 120, 409416.
Mikheev, V. N., Pasternak, A. F., Valtonen, E. T. (2003). How do fish ectoparasites Argulus
spp. (Crustacea: Branchiura) match with their hosts at the behavioural and ecological
scales? Zhurnal Obshchei Biologii. 64, 238-247.
Chapter 3
72
Mikheev, V. N., Pasternak, A. F., Valtonen, E. T. (2004). Tuning host specificity during the
ontogeny of a fish ectoparasite: behavioural responses to host induced cues.
Parasitology Research. 92, 220-224.
Mikheev, V. N., Pasternak, A. F., Valtonen, E. T., Lankinen, Y. (2001). Spatial distribution
and hatching of overwintered eggs of a fish ectoparasite, Argulus coregoni (Crustacea:
Branchiura). Diseases of Aquatic Organisms. 46, 123-128.
Mikheev, V. N., Valtonen, E. T., Rintamki-Kinnunen, P. (1998). Host searching in Argulus
foliaceus L. (Crustacea: Branchiura): the role of vision and selectivity. Parasitology.
116, 425-430.
Nolan, D. T., van der Salm, A. L., Wendelaar Bonga, S. E. (2000). The host parasite
relationship between the rainbow trout (Oncorhynchus mykiss) and the ectoparasite
Argulus foliaceus (Crustacea: Branchiura): epithelial mucous cell response, cortisol
and factors which may influence parasite establishment. Contributions to Zoology. 69,
57-63.
ines, O., Simonson, J . H., Knutsen, J . A., Heuch, P. A. (2006). Host preference of adult
Caligus elongatus Nordmann in the laboratory and its implications for Atlantic cod
aquaculture. Journal of Fish Diseases. 29, 167-174.
Pasternak, A. F., Mikheev, V. N., Valtonen, E. T. (2000). Life history characteristics of
Argulus foliaceus L. (Crustacea: Branchiura) populations in Central Finland. Annales
Zoologici Fennici. 37, 25-35.
Poulin, R. (1993). The disparity between observed and uniform distributions: a new look at
parasite aggregation. International Journal for Parasitology. 23, 937-944.
Poulin, R., FitzGerald, G. J . (1987). The potential of parasitism in the structuring of a salt
marsh stickleback community. Canadian Journal of Zoology. 65, 2793-2798.
Poulin, R., FitzGerald, G. J . (1988). Water temperature, vertical distribution, and risk of
ectoparasitism in juvenile sticklebacks. Canadian Journal of Zoology. 66, 2002-2005.
Reiczigel, J . (2003). Confidence intervals for the binomial parameter: some new
considerations. Statistics in Medicine. 22, 611-621.
Reiczigel, J ., Rzsa, L. (2005). Quantitative Parasitology 3.0. Budapest. Distributed by the
authors.
Reiczigel, J ., Zakarias, I., Rzsa, L. (2005). A bootstrap test of stochastic equality of two
populations. American Statistician. 59, 156-161.
Roberts, L. S., J anovy, J . (1996). Foundations of Parasitology, 5
th
Ed. WCB Publishers, New
York, USA, 659 pp.
73
Rzsa, L., Reiczigel, J ., Majoros, G. (2000). Quantifying parasites in samples of hosts.
Journal of Parasitology. 86, 228-232.
Karpfenluse. Zeitschrift Fr Parasitenkunde 19, 135208.
Urho, L. (1996). Habitat shifts of perch larvae as survival strategy. Annales Zoologici Fennici.
33, 329-340.
Valtonen, E. T., Holmes, J . C., Koskivaara, M. (1997). Eutrophication, pollution and
fragmentation: effects on parasite communities in roach (Rutilus rutilus) and perch
(Perca fluviatilis) in four lakes in central Finland. Canadian Journal of Fisheries and
Aquatic Sciences. 54, 572-585.
Walker, P. D., Abbink, W., van der Velde, G., Wendelaar Bonga, S. E. (2007). Size matters:
stickleback size and infection with Argulus foliaceus (L., 1758) (Branchiura,
Arguloida). Crustaceana. 80, 1397-1401.
Walker, P. D., Flik, G., Wendelaar Bonga, S. E. (2004). The biology of parasites from the
genus Argulus and a review of the interactions with its host. Symposia of the Society
for Experimental Biology. 55, 107-129.
Wendelaar Bonga, S. E. (1997). The stress response in fish. Physiological Reviews. 77, 591
625.

Chapter 4

Effect of host weight on the distribution of Argulus
foliaceus (L., 1758) (Crustacea: Branchiura) within a fish
community


Acta Parasitologica (in press)
Chapter 4

76
Abstr act

Spatial heterogeneity is a feature common to many ecosystems. Aquatic organisms exhibit
this heterogeneous distribution but to date little is known about the distribution of many
common parasite species within water bodies. In this study the distribution of Argulus
foliaceus (L.), an ectoparasitic crustacean, on different sized hosts within a mixed species fish
community was determined.
Different fish species exhibited differences in their louse burdens (prevalence and
intensity). The highest prevalence of A. foliaceus was observed on fish species dominated by
larger individuals (i.e. Cyprinus carpio, Abramis brama and Tinca tinca). C. carpio and A.
brama also exhibited the highest mean louse intensities.
Infested fish were generally heavier than uninfested conspecifics. Differences in the
weight of uninfested and infested fish were significant (P <0.05) for the whole fish
community samples and the Scardinius erythrophthalmus, A. brama and C. carpio samples.
There was also a general pattern of increasing infestation intensity with an increase in host
body weight, with significant correlations for the whole fish community for S.
erythrophthalmus, A. brama and C. carpio samples. In addition there were significant
differences in parasite prevalence and intensity between different host weight groups and
larger (heavier) fish appeared to be more frequently infested by, and harboured higher
numbers of, A. foliaceus.

Size choice by Argulus foliaceus
77
Intr oduction
Identifying the characteristics that result in observed abundance and distribution patterns of
organisms is one of the central goals of ecology (Poulin, 1999b). Within infested host
populations, parasite species often show a heterogeneous, highly-dispersed pattern with many
individual hosts harbouring very few parasites and very few hosts harbouring large numbers
(Poulin, 1993 and references therein). One of the main questions associated with this
observation is: why do certain individuals exhibit higher levels of infestation than others?
Factors determining observed infestation characteristics are typically complex and may be
based on a variety of factors including morphological, physiological, behavioural,
immunological, genetic or nutritional characteristics (Mustafa et al., 2005).
Bandilla et al. (2005) suggested that for the fish louse Argulus coregoni Thorell
(Crustacea: Branchiura) on rainbow trout, Oncorhynchus mykiss (Walbaum), infestation
characteristics were determined, at least in part, by ecological and/or behavioural
characteristics of the parasite as well as the host. They demonstrated that these characteristics
led to an increased exposure risk to infective stages of the parasite for some individuals and
suggested that differences in susceptibility linked, for example, to immune competence, were
less important in determining observed infestation levels.
The size of individual hosts also influences parasite distribution within a host
population. Grutter (1994) found a positive correlation between host fish length and gnathiid
parasite loads. Rzsa (1997) showed that wing-feather mite abundance correlates with the
body mass of their bird hosts. Poulin (1999b) demonstrated that for copepod ectoparasites of
fish both parasite prevalence and intensity correlate positively with host body size. However,
Poulin (2000) showed that the nature of the relationship between intensity of infection and
host size depends on the individual host and parasite species involved.
From a parasites perspective, individual hosts are unequivocally islands (Kuris et al.,
1980). Using the MacArthur and Wilson (1967) island biogeography theory we would predict
that larger hosts are likely to harbour more parasite species and higher numbers of individual
parasites than smaller hosts (Kuris et al., 1980 and references therein). This is due to the
probability that a larger host has the potential for a higher availability of resources. In
addition, larger hosts are frequently older (Kuris et al., 1980) with a longer period of exposure
to parasites. However, this parasite accumulation theory is probably not valid for parasites
that frequently change their host, as is the case for intermittent parasites, or micropredators
such as ectoparasitic fish lice.
LaMarre and Cochran (1992) suggest that parasites may be size-selective and, as a
Chapter 4

78
result, host species preferences may be confounded with the effects of host size. Even if active
selectivity is not apparent, then the fact that they attach to the hosts surface may mean that
just by chance, larger hosts, providing a larger surface area, are attacked relatively more often
than smaller hosts (Cochran, 1985). Adult fishes frequently exhibit different habitat
preferences to their juvenile counterparts. LaMarre and Cochran (1992) state that because of
these possible effects on host-selectivity, any study on host species preferences should
control, or account for, host size.
Argulus foliaceus (L.) has been found on a wide range of freshwater fish species and is
therefore frequently described in the literature as being a generalist parasite, non-selective in
its choice of hosts (Kearn, 2004). However, this could simply be the result of host availability.
In situations where equal numbers of equal sized hosts are present at the same time, host
species preferences of A. foliaceus may become more apparent. Mikheev et al. (1998) studied
this situation on roach, Rutilus rutilus (L.), and perch, Perca fluviatilis (L.), and found that
perch were generally favoured over roach. There are only a few studies investigating host
preferences by A. foliaceus and this could be due in part to its universal acceptance as a
generalist. In this study on the distribution of A. foliaceus in a multi-species fish community,
we address the question: are larger (heavier) fish more likely to be infested by Argulus
foliaceus than their smaller counterparts?


Fish sampling
Sampling took place in a lake of a mixed commercial coarse fishery in SW England (OS grid
reference: SX456751) during the late spring and summer months of the year 2002, the
seasons when A. foliaceus is most abundant (Walker et al., 2004). Angling methods were used
for sampling fish for the following reasons: i) the fishery owner wished it; ii) the authors felt
this method of fish capture caused the least disturbance to the environment; iii) it did not
cause excessive damage to the fins, scales, mucous layer and epidermis of the fish; iv) it
reduced the risk of parasites being 'rubbed' off during capture; v) several regions of the fishery
and several species of fish could be targeted simultaneously by using several anglers. During
each sampling trip several different areas were fished and within each area anglers would fish
at several depths and positions during the course of the day. Upon capture all fish were placed
on a pre-wetted, white mat to aid spotting of dislodged parasites, and handled with wet hands
to minimise damage to the epithelium and protective mucous layer. The eyes of larger fish
79
were covered with a damp cloth to help calm the fish during parasite collection.

Parasite collection
The external surfaces including buccal and gill cavities of all fish were examined thoroughly
for Argulus individuals which were gently removed from their host using a set of blunt
forceps. The total number of parasites collected from each fish was recorded along with the
fish species and weight.

Data analysis
Differences between the average weight of infested and uninfested hosts were analysed with
Student t-tests calculated in INSTAT. Where multiple pair-wise comparisons were conducted
a Bonferroni-Holme correction was applied. A Spearman rank correlation test was used to
examine the relationship between host weight and parasite intensity. This test is non-
parametric and is more applicable when data do not fit a Gaussian distribution as was the case
here. Spearman rank correlation tests were also calculated in INSTAT.
Parasite prevalence (=the proportion of the host sample that was infested) with better
exact confidence limits and mean intensity (=the average number of lice per infested fish,
excluding the zero values for uninfested fish) with bootstrap confidence limits as
recommended by Rzsa et al. (2000), were calculated using Quantitative Parasitology 3.0 (QP
3.0: Reiczigel and Rzsa, 2005). Chi-square test (prevalence all fish) or Fishers exact test
(prevalence individual species) were used to test for differences between the parasite
prevalence of different groups and differences were deemed significant if the 2-sided P-value
<0.05. Bootstrap 2-sample t-tests were used to test for differences between the mean
infestation intensity of different groups. In each case 10,000 bootstrap replications were used
and differences were deemed significant when the 2-sided bootstrap P-value <0.05. Bootstrap
t-tests and Fisher's exact test were carried out using QP 3.0 (Reiczigel and Rzsa, 2005).

Results
Rudd Scardinius erythrophthalmus (L.), common bream Abramis brama (L.), tench Tinca
tinca (L.), crucian carp Carassius carassius (L.) and common carp Cyprinus carpio carpio L.
were caught during sampling. Table 1 shows the number of individuals of each fish species
caught on each sampling date. The total number of individuals of each species caught and
their mean weight are given in Table 2. Rudd (38.9 %) and common carp (35.6%) were far
more numerous than the other species, accounting for approximately 75% of the total portion
Chapter 4

80
of the samples.

Table 1. The number of individuals of each species caught on each sampling date.
Date Rudd Bream Tench
Crucian
carp
Common carp
08/05/2002 8 0 0 0 7
21/05/2002 17 6 0 1 10
05/06/2002 21 8 2 5 12
14/06/2002 12 6 1 0 13
25/06/2002 8 0 8 8 7
04/07/2002 29 8 0 7 24
10/07/2002 20 9 7 10 29
25/07/2002 20 0 0 0 27
07/08/2002 18 5 6 3 11

The fish size class distribution varied considerably within the community and between
species (Fig. 1). The fish samples appeared to be dominated by fish of <200g although the
very large fish (>500g) also made up a significant portion. The rudd population was
dominated by very small fish (50g) with no fish >300g being caught. The bream population
was dominated by fish in the 101-200g category which was similar for crucian carp. Bream
50g were not caught. There were relatively few small fish (100g) in the tench samples.
The carp catches appeared to be dominated by two size groups, 101-200g and >500g. No carp
50g were caught.
All fish species harboured individuals infested with A. foliaceus. Prevalence of A.
foliaceus differed significantly (P <0.001) between species (Table 2). Intensities differed
significantly between bream and crucian carp (P =0.002), carp and crucian carp (P <0.0001)
and carp and tench (P <0.0001) (Table 2). After Bonferonni-Holme correction the differences
between rudd and crucian carp (P = 0.03), and bream and tench (P <0.019) were not
significant although there was an obvious trend towards a higher infection intensity in rudd
than in crucian carp and a higher infection intensity in bream than in tench.
The mean weight of infested fish was consistently higher than that of uninfested fish
in all cases (Fig. 2). The differences between infested and uninfested groups were statistically
significant (P <0.05) for all fish together, and rudd, bream and carp, respectively, but not
significant for tench and crucian carp (P >0.05). Figures 3A-F show the relationship between

81
Table 2. Number of individuals for each host group, mean weight for each host group (1 s.d.),
Argulus foliaceus louse prevalence and mean intensity (95% confidence intervals are given in
parentheses).
Host Group N Mean weight (g)
Louse prevalence
(%)
Mean louse intensity
All fish 393 266.2 347.3 35.6
(31-41)
2.41
(2.15-2.71)
Rudd 153 58.8 52.9 8.5
(5-14)
2
(1.46-2.54)
Bream 42 239.6 176.2 40.5
(26-56)
2.47
(1.82-3.06)
Crucian carp 34 212.2 101.2 23.5
(11-41)
1.13
(1.0-1.25)
Tench 24 435.0 272.7 41.7
(23-63)
1.5
(1.1-1.7)
Common carp 140 485.1 460.2 65.7
(58-73)
2.66
(2.3-3.11)

0
20
40
60
80
100
120
50 51-100 101-200 201-300 301-400 401-500 >500
Host size class (g)
N
o
.

I
n
d
i
v
i
d
u
a
l
s
Common Carp
Tench
Crucian carp
Bream
Rudd

fish weight and infestation intensity on individual fish from each of the host groups.
Significant correlations for host size and number of lice were found for all fish and for rudd,
bream and carp sub-groups (Table 3). Correlation scores reflected a strong relationship
between host size and number of lice for all fish and carp and bream sub-groups (Table 3).
The relationship was less strong for rudd (Table 3). Correlations were not significant for
crucian carp or tench as was reflected in their low r values (Table 3).
Figure 1. The number of
collected individuals of
each host species from
each size group.
Chapter 4

82
0
200
400
600
800
1000
1200
All fish Rudd Bream Crucian Tench Carp
Host group
W
e
i
g
h
t

(
g
)

Figure 2. Mean weight in grams of uninfested fish (black bars) and fish infested by Argulus foliaceus
(grey bars). Error bars =1 s.d.

Figures 3A-F. The relationship between host weight and infection intensity by Argulus foliaceus for
individual fish from the whole community (3A), rudd (3B), bream (3C), crucian carp (3D), tench (3E)
and carp (3F) samples.
0
2
4
6
8
10
0 500 1000 1500 2000
Weight (g)
N
o
.

l
i
c
e
0
1
2
3
4
5
0 50 100 150 200 250
Weight (g)
N
o
.

l
i
c
e
0
1
2
3
4
5
6
0 100 200 300 400 500 600 700
Weight (g)
N
o
.

l
i
c
e
0
0.5
1
1.5
2
2.5
0 100 200 300 400 500
Weight (g)
N
o
.

l
i
c
e
0
0.5
1
1.5
2
2.5
0 200 400 600 800 1000 1200
Weight (g)
N
o
.

l
i
c
e
0
2
4
6
8
10
0 500 1000 1500 2000
Weight (g)
N
o
.

l
i
c
e
A
F
E
D
C
B
83
Table 3. Spearmans rank correlation coefficient scores, 95% confidence intervals and 2-tailed P-values
for the relationship between host weight and infection intensity by Argulus foliaceus.
All Fish Rudd Bream Crucian
carp
Tench Common
carp
r-value
(corrected for ties)
0.4629 0.3908 0.8109 0.3113 0.2793 0.5271
95% confidence
intervals
0.3172 -
0.5872
0.2430 -
0.5209
0.6676 -
0.8963
-0.04052 -
0.5944
-0.1524
0.6214
0.3916
0.6403
2-tailed P-value <0.0001 <0.0001 <0.0001 >0.05 >0.05 <0.0001

Louse prevalence and intensity increased with increasing weight of the hosts (Figs. 4 and 5).
Louse prevalence in the whole fish community differed significantly between host size classes
(Chi-square statistic =63.211, 5df, P <0.0001). Mean intensities however only differed
significantly between 51-100g and >500g (P <0.0001), 101-200 and >500g (P <0.0001), 201-
300g and >500g (P =0.0003) and 301-400g and >500g groups (P =0.0002).
All three size groups in the rudd samples were infested with lice (Table 4). Prevalence
increased with increasing weight and the difference in parasite prevalence between groups
was statistically significant (P <0.001). Mean intensity also increased with increasing host
weight. Intensity data was only suitable for comparison for the 51-100g and 101-200g groups
and here the differences were not statistically significant (P >0.05).
For bream differences between louse prevalence of the different size groups were
statistically significant (P <0.001). Infestation intensity showed a trend towards higher
intensities on larger fish although the intensity for the >500g size group was less than half that
of the 401-500g size group. No significant differences were found between the infestation
intensities of the different size groups although this could be due to small sample sizes.
For crucian carp no significant difference was found between the prevalence (P >0.05)
or intensities (P >0.05 in all cases tested) of the different weight classes. Sample sizes for
tench did not allow for meaningful statistical comparisons (Table 4).
All weight classes of carp were infested with lice (Table 4). Prevalence of lice on the
different weight classes differed significantly (P <0.05). Infestation intensities showed a
general trend of increasing with increasing host weight. Differences in infestation intensity
between weight classes were however only significant between 51-100g and >500g (P
<0.0001), 101-200g and >500g (P <0.0001), 201-300g and >500g (P =0.002) and 301-400
and >500g (P =0.002) groups.

Chapter 4

84
0
10
20
30
40
50
60
70
80
90
50 51-100 101-200 201-300 301-400 401-500 >500
Weight (g)
L
o
u
s
e

p
r
e
v
a
l
e
n
c
e

(
%
)

0
0.5
1
1.5
2
2.5
3
3.5
4
50 51-100 101-200 201-300 301-400 401-500 >500
Weight (g)
M
e
a
n

i
n
t
e
n
s
i
t
y

Parasite burden (number of lice/g) showed a trend of decreasing as host weight
increased (Fig. 6). The data fit an exponential power curve. A Spearman rank (r
s
) correlation
test demonstrates a very significant (P <0.0001) negative correlation (r
s
=-0.76, corrected for
ties; 95% confidence intervals =-0.82 to -0.68).

y = 0.2788x
-0.6677
R
2
= 0.5537
0
0.005
0.01
0.015
0.02
0.025
0.03
0.035
0.04
0 500 1000 1500 2000
Wei ght (g)
L
o
u
s
e

a
b
u
n
d
a
n
c
e

Figure 4. Argulus
foliaceus louse
prevalence on
different size
classes of hosts
within the whole
fish community.

Figure 5. Mean
Argulus foliaceus
louse intensity on
different host size
classes within the
whole fish
community.

Figure 6. Parasite density (number of Argulus
foliaceus lice per gram of body weight) in relation
to host weight (g). R
2
value represents the
proportion of variance in the observed data
explained by the theoretical power curve.
85
Table 4. Summary infection statistics for rudd, bream, crucian carp, tench and carp sample groups.

Discussion
The species encountered and size ranges were consistent with those that the fishery owner
claimed to be stocked. Size ranges did not match those expected from a wild fish population
(Bone et al., 1995) and this is due to the fact that this is a man-made, artificially stocked lake.
Carp exhibited the highest mean weight. This species is deliberately favoured by coarse
fisheries around the UK due to its ability to grow to large sizes relatively quickly.
The differences in louse prevalence and intensity between species suggest a preference
of A. foliaceus for some host species. Carp appear to be the preferred host which is in
agreement with Kollatsch (1959) and supports the use of the common name for A. foliaceus,
the carp louse. Host availability may be a factor influencing the distribution of A. foliaceus.
However, rudd was the most frequently encountered fish species from the lake (followed
closely by carp) and this species exhibited the lowest prevalence of A. foliaceus. Additionally,
tench were encountered the least often, but, exhibited the second highest prevalence of A.
foliaceus. The high prevalence on tench is also in agreement with observations made by
Host species
Size
categor y
(weight g)
N
Pr evalence
(%)
95% confidence
limits
pr evalence
Mean
intensity
95%
confidence
limits
intensity
Rudd 50 98 1.0 0.06 - 5.4 1.0 -
51-100 26 15.4 5.4 34.4 1.5 1.00 1.75
101-200 28 28.6 14.2 48.2 2.38 1.63 3.13
Br eam 51-100 6 0 - - -
101-200 20 5.0 0.26 24.4 1.0 -
301-400 6 100 58.9 100 2.33 1.5 3.0
401-500 6 100 58.9 100 3.5 1.83 4.17
>500 4 100 47.3 100 1.5 1.0 2.0
Cr ucian car p 50 3 0 - - -
101-200 17 17.6 4.99 41.7 1.0 -
201-300 8 25 4.6 63.5 1.5 -
301-400 6 60 18.9 92.4 1.0 -
401-500 1 0 - - -
Tench 51-100 1 0 - - -
101-200 3 0 - - -
201-300 4 75 24.9 98.7 1.67 -
301-400 6 16.7 0.86 58.86 2.0 -
401-500 5 60 18.93 92.4 1.33 1.0 1.67
>500 5 60 18.93 92.4 1.33 1.0 1.67
Car p 51-100 18 44.4 23.7 67 1.25 1.0 1.5
101-200 52 50 36.5 63.6 1.62 1.35 2.04
201-300 11 81.8 50.0 96.7 2.0 1.33 2.67
301-400 3 100 36.9 100 1.67 -
401-500 2 100 22.4 100 2.0 -
>500 54 81.5 68.7 90.1 3.77 3.14 4.39
Chapter 4

86
Kollatsch (1959). This suggests that factors other than the number of available hosts within a
water body are responsible for louse distributions within the fish community.
The higher mean weight of infested fish compared to uninfested fish indicates an
increased risk of infestation with A. foliaceus for larger hosts. Differences were not significant
for tench or crucian carp but it should be noted that these species were found in relatively low
numbers (Table 1) and it may be that samples were biased due to this. This is supported by
the relationship between host weight and infestation intensity as illustrated by the scatter plots
(Fig 3A-F).
Prevalence of lice on different size classes generally showed significant differences,
typically with larger host size classes exhibiting a higher prevalence. The low number of
individuals from each size class for crucian carp and tench makes these analyses less reliable.
However, for the other three species and the host community as a whole the pattern is
relatively consistent, with larger fish typically exhibiting a higher prevalence and infestation
intensity of A. foliaceus.
Throughout the literature various measures of host size are reported, e.g. length,
weight and surface area. When estimating infection intensities, number of lice per unit of
surface area is the most desirable method. However, accurately measuring this parameter for
large numbers of fish under field conditions is usually not practical and therefore other
measures of size are frequently used instead. We chose weight as this parameter correlates
with surface area to a higher degree than standard length for fish according to Tucker et al.
(2002) and O'Shea et al. (2006).
Ectoparasitic infestations generally show an increase in infestation intensity with an
increase in host size (Tucker et al., 2002). This is probably related to the greater surface area
available for attachment (Dogiel et al., 1958). However, Todd et al. (2000) reported that there
is no significant relationship between host size and infestation levels for wild adult Atlantic
salmon (Salmo salar L.) and the ectoparasitc copepod Lepeophtheirus salmonis Kryer.
Tucker et al. (2002) showed that under experimental conditions larger fish acquired more lice
but the relative density (number of lice per cm
-2
) of lice was higher on smaller fish. Poulin et
al. (1991) also demonstrated that host size, rather than host behavioural traits, determined the
intensity of ectoparasitic infestations of Salminicola edwardsii (Olsson, 1869) on Salvelinus
fontinalis (Mitchill, 1814). We also found that relative lice density (number of lice per gram
body weight) was higher on smaller fish than on their larger counterparts. The debate in the
literature over whether to use length or weight to estimate parasite burdens remains
unresolved but the general consensus is that surface area is the best measure, at least for
87
external parasites such as lice, and weight correlates more closely with this variable than
length in the majority of cases (O'Shea et al., 2006).
Poulin and FitzGerald (1987) concluded that A. funduli Kryer (incorrectly identified
as A. canadensis Wilson; see Poulin, 1999a) were not size-selective in their attachment to
sticklebacks. However, Gasterosteus wheatlandi Putnam infested with the copepod Thersitina
gasterostei Pagenstecher were significantly longer and heavier than uninfested individuals.
LaMarre and Cochran (1992) suggest that the fact that A. japonicus Thiele readily attached to
very small fish (34-62mm long) only days after having been attached to carp of 1-2 kg
suggests that neither host size nor host species is of overriding importance in host selection.
Our data provide evidence that in general A. foliaceus show a higher prevalence and
intensity on larger fish. To our knowledge this is the first paper to report on host size
preferences by this species of Argulus. Poulin and FitzGerald (1987) suggest that it may be
adaptive for A. funduli to parasitize smaller hosts because larger hosts capture and eat more
free swimming parasites and the lice require more time and energy to penetrate the thicker
skin layer of larger hosts. Mikheev et al. (2000) came to the conclusion that juvenile roach
and perch usually avoid free swimming A. foliaceus. It is not known if adult fish exhibit the
same behaviour. In addition, smaller fish generally occur in larger schools which may result
in a dilution effect as shown by Poulin and FitzGerald (1989).
We propose that a combination of factors including physical characteristics (e.g.
increased surface area for attachment and for visual location by parasites) and behavioural
traits related to parasite detection and avoidance are responsible for observed parasite
distributions amongst their hosts rather than a process of active size selection by A. foliaceus.
However, our study does not enable us to conclude whether A. foliaceus is actively size-
selective or not.
From this investigation we conclude that larger fish are more likely to be infested with
A. foliaceus. We hypothesise that this is due to the fact that larger fish are easier for A.
foliaceus to locate and attach to, due to their greater surface area. However, parasite burdens
generally seem to be higher on smaller fish. Therefore, whilst larger fish may demonstrate an
increased risk of infestation due to their size, the consequences of infestation may be more
significant for smaller fish. In addition, we propose that behavioural differences related to
parasite detection and avoidance may also be responsible, at least in part, for the observed
parasite distributions.

Chapter 4

88
Acknowledgements

The authors wish to thank the members of the EU Training network, PARITY, for advice and
comments during informal presentations of these data. Thanks are also extended to Ben
Holbrook, Anthony Oxley, Iain Russon and Stewart Walker for assistance with fish sampling
and parasite counting. In addition the authors wish to thank the owners and anglers at Mile
Mead fishery for their assistance and tolerance. This is CWE publication 484.

Refer ences

Bandilla, M., Hakalahti, T., Hudson, P. J . and Valtonen, E. T. (2005). Aggregation of Argulus
consequence of host susceptibility or exposure? Parasitology. 130, 169-176.
Bone, Q., Marshall, N. B. and Baxter, J . H. S. (1995). Biology of fishes, 2
nd
edn. Chapman
and Hall, London.
Cochran, P. A. (1985). Size selective attack by parasitic lampreys: consideration of alternative
null hypotheses. Oecologia. 67, 137-141.
Dogiel, V. A., Petrushevski, G. K. and Yu, I. (1958). Parasitology of fishes. Leningrad
University Press, Leningrad (translated by Kabata, Z. Oliver and Boyd, London).
Grutter, A. S. (1994). Spatial and temporal variations of the ectoparasites of seven reef fish
species from Lizard Island and Heron Island, Australia. Marine Ecology Progress
Series. 115, 21-30.
Kollatsch, D. (1959). Untersuchungen ber die Biologie und kologie der Karpfenluse
(Argulus foliaceus L.). Zoologische Beitrge. 5, 1-36.
Kuris, A. M., Blaustein, A. R. and Alio, J . J . (1980). Hosts as islands. The American
Naturalist. 116, 570-586.
LaMarre, E. and Cochran, P. A. (1992). Lack of host species selection by the exotic parasitic
crustacean, Argulus japonicus. Journal of Freshwater Ecology. 7, 77-80.
MacArthur, R. H. and Wilson, E. O. (1967). The Theory of Island Biogeography. Princeton
University Press, Princeton, N.J . 203pp.
Mikheev, V. N., Valtonen, E. T. and Rintamki-Kinnunen, P. (1998). Host searching in
89
Parasitology. 116, 425-430.
Mikheev, V. N., Mikheev, A. V., Pasternak, A. F. and Valtonen, E. T. (2000). Light-mediated
Branchiura). Parasitology. 120, 409-416.
Mustafa, A., Mackinnon, B. M. and Piasecki, W. (2005). Interspecific differences between
Atlantic salmon and arctic charr in susceptibility to infestation with larval and adult
Caligus elongatus: effect of skin mucous protein profiles and epidermal histological
differences. Acta Ichthyologica et Piscatoria. 35, 7-13.
O'Shea, B., Mordue-Luntz, A. J ., Fryer, R. J ., Pert, C. C. and Bricknell, I. R. (2006).
Determination of the surface area of a fish. Journal of Fish Diseases. 29, 437-440.
Poulin, R. (1993). The disparity between observed and uniform distributions: A new look at
Poulin, R. (1999a). Parasitism and shoal size in juvenile sticklebacks: conflicting selection
pressures from different ectoparasites? Ethology. 105, 959-968.
Poulin R. (1999b). Body size vs abundance among parasite species: positive relationships?
Ecography. 22, 246-250.
Poulin, R. (2000). Variation in the intraspecific relationship between fish length and intensity
of parasitic infection: biological and statistical causes. Journal of Fish Biology. 56,
123-137.
Poulin, R., Curtis, M. A. and Rau, M. E. (1991). Size, behaviour, and acquisition of
ectoparasitic copepods by brook trout, Salvelinus fontinalis. Oikos. 61, 169-174.
Poulin, R. and FitzGerald, G. J . (1987). The potential of parasitism in the structuring of a salt
marsh stickleback community. Canadian Journal of Zoology. 65, 2793-2798.
Poulin, R. and FitzGerald, G. J . (1989). Shoaling as an anti-ectoparasite mechanism in
juvenile sticklebacks (Gasterosteus spp.). Behavioural Ecology and Sociobiology. 24,
251-255.
Reiczigel, J . and Rzsa, L. (2005). Quantitative Parasitology 3.0. Budapest. Distributed by the
authors.
Rzsa, L. (1997). Wing-feather mite (Acari: Protophyllodidae) abundance correlates with
body mass of passerine hosts: a comparative study. Canadian Journal of Zoology. 75,
1535-1539.
Rzsa, L., Reiczigel, J . and Marjoros, G. (2000). Quantifying parasites in samples of hosts.
Journal of Parasitology. 86, 228-232.
Chapter 4

90
Todd, C. D., Walker, A. M., Hoyle, E. J ., Northcott, S. J . Walker, A. F. and Ritchie, M. G.
(2000). Infestations of wild adult Atlantic salmon (Salmo salar L.) by the ectoparasitic
copepod sea louse Lepeophtheirus salmonis Kryer: prevalence, intensity and the
spatial distribution of males and females on the host fish. Hydrobiologia. 429, 181-
196.
Tucker, C. S., Sommerville, C. and Wooten, R. (2002). Does size really matter? Effects of
fish surface area on the settlement and initial survival of Lepeophtheirus salmonis, an
ectoparasite of Atlantic salmon Salmo salar. Diseases of Aquatic Organisms. 49, 145-
152.

91

Chapter 5

Size Matters: stickleback size and infection with
Argulus foliaceus (L., 1758) (Branchiura, Arguloida)


Crustaceana 80, 1397-1405 (2007)
Chapter 5
94
Shor t Communication

Parasite loads on fish have been shown to be influenced by the size of the host (Kabata, 1981;
Grutter, 1994). The general trend is that a larger host will harbour higher numbers of
ectoparasites (Tucker et al., 2002). The reasons for this may be partly related to the hosts age
(larger hosts are generally older) with older hosts having had longer to accumulate parasites,
and partly related to the surface area of the host as a larger host has a larger surface area
making it easier for parasites to locate and attach to them (Kuris et al., 1980 and references
therein).
Crustacean ectoparasites on fish provide an excellent model for studying parasite
distributions within a host population due to the relative ease in identifying and counting
them. Parasites from the genus Argulus are regarded as the most widespread and problematic
parasites in freshwater fish culture (Kearn, 2004; Walker et al., 2004). This species has been
responsible for significant economic losses in aquaculture (Menezes et al., 1990) and
recreational fishery operations (Taylor et al., 2006). Despite this there are still huge gaps in
our understanding of the way in which these parasites interact with their hosts.
Argulus foliaceus L. is regarded as non-host-specific and has been recorded from
practically every freshwater fish species within its natural range (Stammer, 1959; Kennedy,
1974). Despite the opportunistic nature of this parasite some hosts still appear to be more
susceptible than others (Bandilla et al., 2005). However, the factors influencing the
distribution of A. foliaceus within a host population however are still poorly studied. In this
investigation we analysed a stickleback population from a mixed species recreational fishing
lake in the south-west of England.
Three-spined sticklebacks Gasterosteus aculeatus are common in many aquatic
habitats in temperate zones of the northern hemisphere (Wooton, 1976). Because of their role
in the food web as both predators and prey they are consequently hosts in many parasite life
cycles (Kalbe et al., 2002). As a result they may also serve as reservoirs for some parasite
species, transmitting parasites to other fish residing in the same habitats. Sticklebacks breed in
the warm shallow regions of ponds and lakes (Davies et al., 2004), which are the same
regions preferred for egg deposition by A. foliaceus. This will expose sticklebacks to this
parasite throughout the breeding season and as such one would expect high infection
prevalences and intensities on this species. However, juvenile sticklebacks appear to show
behavioural changes including an increase in shoaling behaviour in the presence of argulid
Stickleback size preference by Argulus
95
lice (Poulin 1999). These changes in behaviour probably reduce the risk of individuals being
parasitised.
Three-spined sticklebacks were caught from the littoral regions of the lake using a
standard pond net. Upon capture the standard length of each fish was recorded and the
number of attached parasites noted. Statistical analyses were carried out using Quantitative
Parasitology 3.0 (QP 3.0: Reiczigel and Rzsa, 2005) and INSTAT.
53 sticklebacks were caught varying in length from 13 to 44 mm. 30 of the fish were
infected with A. foliaceus giving a parasite prevalence of 56% (95% confidence limits : 42 to
70%). The mean infection intensity was 7.33 (95% confidence limits: 5.43 to 9.57; n =30)
and the maximum number of lice recorded on an individual fish was 23. The average length
of infected sticklebacks was significantly greater (Mann-Whitney U-test, 2-tailed P-value <
0.0001) than that of the uninfected sticklebacks (Fig. 1). In addition, all infected fish were
found to be greater than 30mm in length (Fig. 2).
0
5
10
15
20
25
30
35
40
45
uninfected infected
Infecti on status
L
e
n
g
t
h

(
m
m
)

Figure 1. Mean standard length of infected (n = 30) and uninfected three-spined
sticklebacks (n =23). Error bars =1 s.d.

J uvenile sticklebacks can and do exhibit parasite avoidance behaviour (Poulin and
Fitzgerald, 1988; Dugatkin et al., 1994). A similar behavioural trait was observed in juvenile
roach Rutilus rutilus (Mikheev et al., 2003). It is plausible that the lack of parasites on small
sticklebacks in this study is a result of parasite avoidance behaviour. In addition it may be that
Argulus infections are lethal to fish below a certain size and as a result any small fish that
were infected perished so quickly that they were not accounted for in this study. Argulus can
be lethal to juvenile carp Cyprinus carpio (Rhaman, 1996) and larval eels Anguilla anguilla
(Hoffman, 1977). Argulus may also be size-selective in its choice of host, preferring to infect
Chapter 5
96
larger individuals that are more likely to cope better with infestations than their smaller
counterparts. It is also plausible that below a certain size threshold Argulus simply does not
regard fish as a host. Poulin and Fitzgerald (1988) proposed that it may be adaptive for

0
5
10
15
20
25
10 15 20 25 30 35 40 45
Fi sh l ength (mm)
N
o
.

l
i
c
e

Figure 2. Scatter plot showing the relation between three-spined stickleback standard
length and infection intensity.

Argulus canadensis to parasitise smaller hosts as larger fish capture and eat more parasites.
However, our data for A. foliaceus and three-spined sticklebacks do not appear to support this
hypothesis.
In conclusion, our study demonstrates a possible size-based difference in susceptibility
amongst three-spined sticklebacks. Future studies involving the interactions between A.
foliaceus and three-spined sticklebacks are required to elucidate the reasons for our
observations.

97
Acknowledgements
Thanks are extended to the owners of Mile Mead fisheries for allowing the authors to conduct
this investigation on their premises. This is CWE publication number 489.

Refer ences

Bandilla, M., Hakalahti, T., Hudson, P. J . and Valtonen, E. T. (2005). Aggregation of Argulus
consequence of host susceptibility or exposure? Parasitology 130, 169-176.
Davies, C., Shelly, J ., Harding, P., Mclean, I., Gardiner, R. and Peirson, G. (2004). British
Freshwater Fishes the species and their distribution. Harley Books, Essex.
Dugatkin, L. A., FitzGerald, G. J . and Lavoie, J . (1994). J uvenile three-spined sticklebacks
avoid parasitized conspecifics. Environmental Biology of Fishes 39, 215-218.
Grutter, A. S. (1994). Spatial and temporal variations of the ectoparasites of seven reef fish
species from Lizard Island and Heron Island, Australia. Marine Ecology Progress
Series 115, 21-30.
Hoffman, G. L. (1977). Argulus, a Branchiuran parasite of freshwater fishes. U.S. Fish and
Wildlife Service. Fish diseases leaflet 49, 9.
Kalbe, M., Wegner, K. M. and Reusch, T. B. H. (2002). Dispersion patterns of parasites in 0+
year three-spined sticklebacks: a cross population comparison. Journal of Fish
Biology 60, 1529-1542.
Kabata, Z. (1981). Copepoda (Crustacea) parasitic on fishes: problems and perspectives.
Advances in Parasitology 19, 1-71.
Kearn, G. C. (2004). Leeches, Lice and Lampreys: A Natural History of Skin and Gill
Parasites of Fishes. Springer, Dordrecht The Netherlands. 432pp.
Kennedy, C. R. (1974). A checklist of British and Irish freshwater fish parasites with notes on
their distribution. Journal of Fish Biology 6, 613-644.
Kuris, A. M., Blaustein, A. R. and Alio, J . J . (1980). Hosts as islands. The American
Naturalist 116, 570-586.
introductions. Aquaculture 89, 123-126.
Chapter 5
98
scales? Zhurnal Obshchei Biologii 64, 238-247.
Poulin, R. (1999). Parasitism and Shoal Size in J uvenile Sticklebacks: Conflicting Selection
Pressures from Different Ectoparasites? Ethology 105, 959-968.
ectoparasitism in juvenile sticklebacks. Canadian Journal of Zoology 66, 2002-2005.
Reiczigel, J . and Rzsa, L. (2005). Quantitative Parasitology 3.0. Budapest. Distributed by the
authors.
Rhaman, M. (1996). Effects of a freshwater fish parasite, Argulus foliaceus Linn. infection on
common carp, Cyprinus carpio Linn. Bangladesh Journal of Zoology 24, 57-63.
Stammer, H. J . (1959). Beitrge zur Morphologie, Biologie und Bekmpfung der
Karpfenluse. Zeitschrift fr Parasitenkunde 19, 135-208.
Taylor, N. G. H., Sommerville, C. and Wooten, R. (2006). The epidemiology of Argulus spp.
Diseases 29, 193-200.
ectoparasite of Atlantic salmon Salmo salar. Diseases of Aquatic Organisms 49, 145-
152.
for Experimental Biology 55, 107-129.
Wootton, R. J . (1976). The Biology of the Sticklebacks. London: Academic Press. 387pp.

99

Chapter 6

The off-host survival and viability of Argulus
(Crustacea: Branchiura)

Peter D. Walker, Iain J . Russon, Raymond Duijf, Gerard van der Velde
and Sjoerd E. Wendelaar Bonga

Submitted to Folia Parasitologica
Chapter 6
102
Abstr act

During off-host periods, intermittent parasites must cope with varying abiotic conditions
without access to food. We investigated the effect of temperature (5 to 28
o
C) on the off-host
survival time of Argulus japonicus Thiele, 1900, a crustacean ectoparasite of fish which is
apparently expanding its distribution range, and compared this with its native European
relative A. foliaceus (L., 1758). Results demonstrated a clear effect of temperature on the off-
host survival time of larvae, juveniles and adults of both species. Larval and juvenile A.
japonicus survived longest at 22
o
C (up to 9 days) and adults at 15
o
C (up to 13 days). Larval A.
foliaceus survived longest at 15
o
C (up to 5 days), adults at 9
o
C (up to 14 days) and juveniles
at 9 and 15
o
C (up to 7 days). Thus, A. japonicus is more resistant to starvation at higher
temperatures under off-host conditions and A. foliaceus is more resistant to starvation at lower
temperatures. Infectivity of A. japonicus decreased linearly with time spent off-host after 2
days for larvae and 4 days for adults. Temperature only had a significant effect on the
infectivity of both developmental stages after 24 hours off-host between 13 and 23
o
C for
larvae and 13 and 18
o
C for adults. We conclude that temperature significantly affects off-host
survival times and infectivity of argulids. Infectivity of A. japonicus is also influenced by time
spent off-host.

Argulus survival and viability
103
Intr oduction
Parasites from the genus Argulus Mller, 1785, are the causative agents of the disease
argulosis, which has been associated with fish spoilage and mortality of fishes world-wide.
Damage typically occurs in the form of small craters formed by the feeding activities of the
lice and epidermal hyperplasia at the wound margins (Walker et al., 2004). Wounds typically
do not penetrate deeper than the epidermis although there are instances of wounds penetrating
as deep as the stratum compactum (Lester and Roubal, 1995).
In addition to their destructive nature, Argulus species are known to act as vectors for
other pathogens including viruses (Ahne, 1985), bacteria (Shimura, 1983), fungi (Bower-
Shore, 1940, Stammer, 1959), and nematodes (Moravec, 1994). Bandilla et al., (2006)
showed that argulids can also increase the susceptibility of their host to secondary infections.
Reports detailing the damage and economic loss caused by argulids are widespread and
involve several fish species which highlights the opportunistic nature of these parasites.
Argulus foliaceus (L., 1758), is probably the most common and widespread argulid in
Western Europe and to date is the most documented. This species has been reported as a
threat to the culture of tilapia (Oreochromis niloticus) (Roberts and Sommerville, 1982,
Paperna, 1991), rainbow trout (Oncorhynchus mykiss) (Menezes et al., 1990, Ruane et al.,
1995) and common carp (Cyprinus carpio) (J afri and Ahmed, 1994). Recently, Taylor et al.,
(2006) demonstrated that parasitic lice from the genus Argulus are also perceived as a
potential economic threat to commercial recreational trout fisheries due to the damage they
cause to fish and the resulting loss of revenue associated with a decrease in the number of
anglers.
Argulus japonicus Thiele, 1900, is believed to have originated in J apan and probably
owes its current wide-spread distribution to the trade in ornamental fish such as goldfish
(Carassius auratus) and koi carp (Cyprinus carpio) (Rushton-Mellor, 1992). A. japonicus was
not recorded from Britain until 1992, and was only known from a few isolated locations in the
south. Nowadays, it is now probably widespread in the UK as well as in other parts of
Western Europe (Rushton-Mellor, 1992). This species has also been reported from several
locations in Africa despite the fact that it is also not endemic to that continent (Rushton-
Mellor, 1994). This, and the lack of records of A. foliaceus from Africa, suggests a greater
tolerance of A. japonicus for higher temperatures.
The life cycle of argulids was recently reviewed in Walker et al., (2004) and Kearn
(2004). Larval lice hatch as free-swimming metanauplii from eggs that have been deposited
on various substrates (e.g. plant stems and stones). Wilson (1902) observed yolk in the
Chapter 6
104
digestive system of larval argulids but there is no data available on how long this yolk can
sustain these lice. Reports vary with respect to the off-host survival times of newly hatched
argulids but typically, state between 2 and 4 days (Mikheev et al., 2003).
Argulid fish lice when present on their host do not remain in contact with their hosts
for the rest of their life. They may become dislodged by the fish or detach themselves for the
purpose of mate location, egg deposition or to locate a more preferable host (Walker et al.,
2004). The length of time spent apart from a host will ultimately depend upon the host
location abilities of the parasites and the availability of suitable hosts. Reports regarding the
survival time of adult lice during these off-host periods are fragmentary and sometimes
conflicting. Factors such as timing of the parasites last meal, level of activity and temperature
all probably determine this time period.
Despite the knowledge that species such as A. foliaceus and A. japonicus have a
relatively ubiquitous occurrence and appear to be expanding their range (as is the case for A.
japonicus) little is known about the effects of abiotic factors, including temperature, on these
parasites, particularly with regard to their survival. This information could be vital in
predicting the future spread of these potentially destructive lice, especially with the onset of
global warming. In addition, in order to efficiently devise efficient, environmentally friendly
control methods we need a thorough understanding of the biology of argulids and to identify
environmental and biological factors which may naturally influence the success of such
pathogens.
In this paper we investigate the effect of temperature and stage of development on the
off-host survival of argulids by comparing two species, A. japonicus and A. foliaceus, with
overlapping natural ranges, habitats and host species. In addition we discuss the effects of
these off-host periods and temperature on the host location capabilities of A. japonicus.


Parasite culture
Populations of A. japonicus and A. foliaceus were maintained on common carp Cyprinus
carpio L. (approximately 1kg weight) in recirculation systems at 23
o
C (1
o
C) and with a
12:12 light:dark photoperiod. Nijmegen tap water (non-chlorinated) was used in all systems.
Infestation intensities typically varied from 10 to 30 lice per fish. Eggs of Argulus were
deposited on the glass sides and bottoms of the aquaria. Host fish were monitored regularly
and parasite eggs were removed to control parasite numbers when infestation intensities
105
appeared to be too heavy as indicated by host condition and host-behavioural changes e.g.
lethargy and loss of appetite. All parasite populations had been established under these
conditions for several generations (exact number unknown) prior to these experiments.

Off-host survival of A. japonicus and A. foliaceus: effect of temperature
Adult A. japonicus and A. foliaceus (males >3mm, females >4mm to ensure maturity) were
collected from stock carp that had been anaesthetised in a 2-phenoxyethanol (Sigma-Aldrich,
St Louis, MO, USA) solution (dilution is 1:1000). Fish were considered anaesthetised once
they displayed loss of equilibrium (i.e. turned 'belly-up') which took approximately 2 minutes.
Parasites were subsequently removed from all fish using a set of blunt forceps and then held
in beakers containing Nijmegen tap water (non-chlorinated) at 23
o
C for 24 hours prior to use
in experiments. During this time any eggs deposited by lice were collected and incubated in
Nijmegen tap water at 23
o
C with daily refreshment of the water. Upon hatching (the
difference between hatching rates was less than 10 hours), larval lice (metanauplii) were
either held for approximately 24 hours under the same conditions as adult lice or were
allowed to attach to a group of juvenile common carp (maintained as for stock carp) to
develop for 12 days before being collected and treated in the same way as for adult lice. At
23
o
C A. japonicus and A. foliaceus take approximately 25 days to reach maturity (personal
observations). Twelve day old lice are therefore considered as juveniles following the
descriptions by Rushton-Mellor and Boxshall (1994). All lice used were taken from multiple
egg strings and pooled prior to selection for subsequent experiments.
Lice from each of the developmental stages (larval, juvenile and adult; n =30-50 lice
per development stage, per trial depending on the number of lice available from cultures)
were then placed into small clear plastic bags with 300 ml of Nijmegen tap water (23 1
o
C)
and acclimated to experimental temperatures for 30 minutes before being added to
experimental aquaria. Experiments were conducted in 3 replicate small glass aquaria (10
litres) containing Nijmegen tap water and maintained at 5, 9, 15, 23 or 28
o
C (1
o
C) with a
12:12 light:dark photoperiod and without access to a host upon which they could feed.
Aquaria were individually aerated and 10% of the water was refreshed daily after being
acclimated to the appropriate temperatures. Parasites were examined daily and the number of
dead specimens recorded. Death was assumed when no limb movements could be observed
from the parasites, checked by gently touching lice with a small metal seeker and finally
confirmed by examination under a binocular microscope.

Chapter 6
106
Attachment success of A. japonicus effect of starvation
Adult (24 days old) and larval lice (metanauplii 1 day post-hatch) were acquired using
methods described above. Fifty adult and fifty larval lice were held in beakers containing
Nijmegen tap water (23 1
o
C) for varying periods of time (1, 2, 3, 4 or 5 days for larval lice
and 1, 2, 3, 4, 5, 6 or 7 days for adult lice) without access to a host upon which they could
feed. Parasites were then added to small (10 litre), individually aerated aquaria containing five
juvenile common carp and left for one hour to locate and attach to the host. After one hour all
carp were removed and anaesthetised and the number of attached lice recorded. The number
of lice remaining in the aquaria (i.e. the ones that did not successfully attach to a host) was
also noted to check if host predation on the parasites had occurred. Experiments were
performed in triplicate (i.e. 3 x 50 lice for both larval and adult stages) for each period of time
off-host.

Attachment success of A. japonicus effect of temperature
Adult (24 days old) and larval lice (metanauplii 1 day post-hatch) were acquired using
methods described above. Sixty juvenile common carp were equally distributed between 12
small (10 litre), individually aerated aquaria and acclimated to 13, 18, 23 or 29
o
C (with 3
replications of each temperature), for a period of 2 weeks prior to use in experiments. Fifty
lice were then placed into small transparent plastic bags containing 300 ml Nijmegen tap
water and allowed to acclimate to experimental temperatures for a period of 30 min before
being released into the aquaria to search for a host. All fish were sampled after 1 hour and
thoroughly examined for any attached lice. The number of attached lice for each aquarium
was then recorded and attachment success calculated as the % of lice successfully attaching to
a host.

Data analysis
Differences between the off-host survival times of each of the developmental stages (larval,
juvenile and adult) of the two parasite species (A. japonicus and A. foliaceus) were initially
evaluated using 3-way ANOVA, with temperature, developmental stage and parasite species
as factors. Data was then divided by species (A. foliaceus and A. japonicus) and evaluated
using 2-way ANOVA with temperature and developmental stage as factors. Data was further
subdivided by developmental stage (larval, juvenile and adult) and evaluated with 1-way
ANOVAs. When these tests indicated significant differences in the data set Tukey's post hoc
tests were used to determine where off-host survival times differed. Between species
107
comparisons were evaluated using 2-sample T-tests. Bonferroni-Holme corrections were
applied to P-values where multiple pairwise comparisons were conducted within the same
dataset.
Differences between the attachment success of larval and adult A. japonicus were
evaluated with 1-way ANOVAs. When these tests indicated significant differences in the
dataset Tukey's post hoc tests were used to determine where differences occurred. Differences
in the attachment success of larval and adult A. japonicus at different temperatures were
similarly evaluated using 1-way ANOVAs followed by Tukey's post hoc tests.
All data sets were tested for normality (Kolmogorov-Smirnov) and homogeneity of
variances (Levenes) to ensure that data met the assumptions of statistical tests (ANOVA,
Tukey's, T-test) prior to performing statistical tests.

Results

Off-host survival
The number of individual lice per treatment and developmental stage is shown in Table 1.
Survivorship curves for A. japonicus and A. foliaceus larvae, juveniles and adults are shown
in Figure 1. The majority of the curves exhibit a pattern somewhere between a type 1 and type
2 survivorship curve (Deevey, 1947). However, the data for juvenile and adult A. japonicus at
28
o
C more closely resemble a type 3 survivorship curve (Deevey, 1947).
Considerable variation is exhibited between parasite developmental stages and
temperatures. Maximum off-host survival times varied from 3 to 9 days for larval A.
japonicus and 3 to 5 days for larval A. foliaceus. J uvenile lice showed a similar variation in
maximum off-host survival times ranging from 5 to 12 days for A. japonicus and 5 to 7 days
for A. foliaceus. Adult louse maximum off-host survival times ranged from 5 to 13 days for A.
japonicus and 8 to 14 days for A. foliaceus.
The longest off-host survival times for larval lice were at 22
o
C for A. japonicus and
15
o
C for A. foliaceus. J uvenile lice survived off-host for the longest time at 22
o
C for A.
japonicus, and 9 and 15
o
C for A. foliaceus. In the case of adult lice, A. japonicus survived off-
host for the longest time at 15
o
C and A. foliaceus at 9
o
C. The mean off-host survival times of
A. japonicus and A. foliaceus larvae, juveniles and adults at five different temperatures
showed differences between developmental stages and at different temperatures (Fig. 2A and
B).

Chapter 6
108

Fig. 1. Survivorship curves for three developmental stages of A. japonicus (larvae, A; juveniles, B;
and adults, C) and A. foliaceus (larvae, D; juveniles, E; and adults, F) at five different temperatures.
=5
o
C; =9
o
C; =15
o
C; =22
o
C; =28
o
C. Larvae =1 day post-hatch (metanauplii);
juveniles =12 days old; adults =24 days old.

0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5 6 7 8 9
No. days
S
u
r
v
i
v
o
r
s
h
i
p

(
%
)
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5 6 7 8 9 10 11 12
No. days
S
u
r
v
i
v
o
r
s
h
i
p

(
%
)
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5 6 7 8 9 10 11 12 13
No. days
S
u
r
v
i
v
o
r
s
h
i
p

(
%
)
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5
No. days
S
u
r
v
i
v
o
r
s
h
i
p

(
%
)
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5 6 7
No. days
S
u
r
v
i
v
o
r
s
h
i
p

(
%
)
0
10
20
30
40
50
60
70
80
90
100
0 1 2 3 4 5 6 7 8 9 10 11 12 13 14
No. days
S
u
r
v
i
v
o
r
s
h
i
p

(
%
)
A
B
C
D
E
F
109

Fig. 2. Mean off-host survival time (in days), of A =A. japonicus and B =A. foliaceus,
larvae (1 day-post-hatch), juveniles (12 days old) and adults (>24 days old) at five
different temperatures. Means were calculated from 3 replicate sets of up to 50 parasites.
Standard deviations for A. japonicus ranged from 0 to 0.023 (larvae), 0.01 to 0.03
(juveniles) and 0.02 to 0.07 (adults). Standard deviations for A. foliaceus ranged from 0.01
to 0.04 (larvae), 0.03 to 0.09 (juveniles) and 0.05 to 0.1 (adults). Larvae =1 day post-hatch
(metanauplii); juveniles =12 days old; adults =24 days old.

Results of the 3-way ANOVA showed that the interaction variable Temperature x
Developmental Stage x Species was significant (F=216.719, P<0.001, 8d.f.). Therefore data
were divided by parasites species and further evaluated by 2-way ANOVAs. The interaction
variable T x DS was significant for both the A. japonicus and A. foliaceus 2-way ANOVAs
(A. japonicus F=2763.23, P<0.001, 8d.f.; A. foliaceus F=305.35, P<0.001, 8d.f.). Therefore
data were subdivided by developmental stage and further analysed by 1-way ANOVAs.

0
2
4
6
8
10
12
5 9 15 22 28
Temp (
o
C)
N
o
.

d
a
y
sLarvae
Juveniles
Adults
0
2
4
6
8
10
5 9 15 22 28
Temp (
o
C)
N
o
.

d
a
y
s
Larvae
Juveniles
Adults
A
B
Chapter 6
110
Table 1. The number of Argulus lice per developmental stage used for trials examining the effect of
temperature on off-host survival times (pooled from three replicates). Larvae =1 day post-hatch
(metanauplii); juveniles =12 days post-hatch; adults =24 days post-hatch.
Temp (
o
C) 5 9 15 22 28
A. japonicus 150 150 150 150 150
Lar vae
A. foliaceus 150 150 150 150 150
A.. japonicus 150 150 150 150 150
Juveniles
A. foliaceus 150 130 140 120 110
A. japonicus 110 110 110 110 110
Adults
A. foliaceus 110 110 110 110 110

ANOVA showed significant differences between temperatures for the off-host
survival times of larval A. japonicus (F=22588.75, P<0.001, 4d.f.). Tukey's pairwise
comparisons revealed that these differences were significant between all temperatures except
for between 9 and 28
o
C and 15 and 22
o
C (Table 2). ANOVA also showed that off-host
survival times of juvenile A. japonicus were significantly different between temperatures
(F=20644.05, P<0.001, 4d.f.). Tukey's test confirmed that differences in off-host survival
times were significant between all temperatures for juvenile A. japonicus (Table 2). A similar
result was obtained for adult lice with ANOVA showing significant differences between the
off-host survival times of adult A. foliaceus at different temperatures (F=10738.32, P<0.001)
and Tukey's test confirming that these differences were significant between all temperatures
(Table 2).
For A. foliaceus, ANOVA showed significant differences between off-host survival
times of larval lice at different temperatures (F=1109.45, P<0.001). Tukey's test showed these
differences were significant in all cases for larval A. foliaceus apart from between 9 and 22
o
C
(Table 3). ANOVA also showed significant differences between off-host survival times of
juvenile A. foliaceus at different temperatures (F=329.21, P<0.001) and between off-host
survival times of adult A. foliaceus at different temperatures (F=329.21, P<0.001). Tukey's
tests confirmed differences were significant between all temperatures for both juvenile and
adult A. foliaceus (Table 3).

111
Table 2. Results of pairwise comparisons (Tukeys tests) to evaluated differences in off-host survival
times between temperatures for the 3 developmental stages A. japonicus.
Lar vae Juveniles Adults Temper atur es
(
o
C) T P-value T P-value T P-value
5 v 9 -48.00 <0.0001 7.4 0.0002 11.57 <0.0001
5 v 15 160.50 <0.0001 114.2 <0.0001 101.14 <0.0001
5 v 22 158.50 <0.0001 156.6 <0.0001 49.71 <0.0001
5 v 28 -46.00 <0.0001 -100.1 <0.0001 -97.41 <0.0001
9 v 15 208.50 <0.0001 106.8 <0.0001 89.6 <0.0001
9 v 22 206.50 <0.0001 149.2 <0.0001 38.1 <0.0001
9 v 28 2.00 0.3316 -107.5 <0.0001 -109.0 <0.0001
15 v 22 -2.00 0.3316 42.4 <0.0001 -51.4 <0.0001
15 v 28 -206.50 <0.0001 -214.3 <0.0001 -198.5 <0.0001
22 v 28 -204.50 <0.0001 -256.7 <0.0001 -147.1 <0.0001

Table 3. Results of pairwise comparisons (Tukeys tests) to evaluate differences in off-host survival
times between temperatures for the 3 developmental stages A. foliaceus.
Lar vae Juveniles Adults Temper atur es
(
o
C) T P-value T P-value T P-value
5 v 9 48.99 <0.0001 20.41 <0.0001 23.47 <0.0001
5 v 15 60.04 <0.0001 8.92 <0.0001 8.62 0.0001
5 v 22 47.27 <0.0001 -4.00 0.0167 -11.27 <0.0001
5 v 28 28.64 <0.0001 -13.25 <0.0001 -24.07 <0.0001
9 v 15 11.04 <0.0001 -11.49 <0.0001 -14.85 <0.0001
9 v 22 -1.73 0.4619 -24.41 <0.0001 -34.74 <0.0001
9 v 28 -20.36 <0.0001 -33.66 <0.0001 -47.54 <0.0001
15 v 22 -12.77 <0.0001 -12.92 <0.0001 -19.89 <0.0001
15 v 28 -31.40 <0.0001 -22.16 <0.0001 -32.69 <0.0001
22 v 28 -18.63 <0.0001 -9.245 <0.0001 -12.79 <0.0001

For both A. japonicus and A. foliaceus adult lice typically survive off-host for the longest
periods and larvae for the shortest irrespective of temperature. Larval and juvenile A.
japonicus generally survive longer off-host than their A. foliaceus counterparts. For adult
stages however the trend is reversed with A. foliaceus surviving longer off-host at 5, 9 and
22
o
C. A. japonicus adults survived longer than A. foliaceus adults at 15 and 22
o
C however.
Chapter 6
112
Off-host survival times were significantly different between A. japonicus and A. foliaceus for
all developmental stages at all temperatures (Table 4).

Table 4. T-test results for analysis of differences in off-host survival times of the three
developmental stages (larvae, juveniles and adults) of A. japonicus and A. foliaceus at 5 different
temperatures. T-statistics (T), degrees of freedom (D.F.) and p-values are all shown.
5
o
C 9
o
C 15
o
C 22
o
C 28
o
C
T 34.2 -68.59 128.80 184.22 -17.0
D.F. 3 4 2 4 3 Lar vae
P <0.001 <0.001 <0.001 <0.001 <0.001
T 14.07 -5.63 62.81 211.40 -11.09
D.F. 2 2 3 3 2 Juveniles
P 0.005 0.030 <0.001 <0.001 0.008
T -44.64 -111.64 13.01 4.04 -68.64
D.F. 2 2 2 3 3 Adults
P 0.001 <0.001 0.006 0.027 <0.001

Attachment success of A. japonicus effect of starvation
The two developmental stages differed in the relative numbers of lice successfully locating
and attaching to a host within the one hour time frame of this experiment (Fig. 3). A
maximum of 98% of all adult lice successfully located, and attached to, a host within one hour
whereas for larvae the maximum value was substantially smaller at 74%. ANOVA showed
significant differences in the attachment success rates of adult A. japonicus after different
starvation periods (F=2080.81, P<0.001). Tukey's tests revealed that attachment success of
adult A. japonicus started to significantly decline daily after approximately four days of
starvation (Table 5). For larval A. japonicus ANOVA showed significant differences in the
attachment success after different starvation periods (F=946.50, P<0.001). Tukey's tests show
that attachment success of larval A. japonicus started to significantly decline daily after
approximately 2 days of starvation (Table 5).

113
0
10
20
30
40
50
60
70
80
90
100
0 2 4 6 8
No. days
A
t
t
a
c
h
m
e
n
t

s
u
c
c
e
s
s

(
%
)

Attachment success of A. japonicus effect of temperature
Attachment success was similar for both adult and larval lice and at different temperatures
(Fig. 4). However, there were significant differences in the attachment success of larval A.
japonicus at different temperatures (F=16.53, P<0.001). However, Tukey's test showed that
this difference was only statistically significant between 13 and 23
o
C (T=6.948, P=0.0003).
For adult A. japonicus ANOVA again showed that there were significant differences in
attachment success at different temperatures (F=16.53, P<0.001). Tukey's tests, however,
confirmed that the difference was only significant between 13 and 18
o
C (F=5.964, P=0.008).
0
20
40
60
80
100
13 18 23 29
Temperature (
o
C)
A
t
t
a
c
h
m
e
n
t

s
u
c
c
e
s
s

(
%
)

Fig. 4. Mean attachment success (% 1 S.D.) of A. japonicus adults (white bars) and larvae
(black bars) at four different temperatures. Number of trials =3 (50 parasites used in each
trial therefore 150 adults and larvae/temperature). Larvae =1 day post-hatch (metanauplii);
juveniles =12 days old; adults =24 days old.
Fig. 3. Mean
attachment success
(% 1 S.D.) of
larval A. japonicus
() in relation to
days post-hatch and
the re-attachment
success of adult A.
japonicus () in
relation to days
spent off-host.
Larvae = 1 day
post-hatch
(metanauplii);
juveniles =12 days
old; adults = 24
days old.
Chapter 6
114
Table 5. Results of pairwise comparisons (Tukeys tests) to evaluate differences in attachment success
of adult and larval A. japonicus after x days of starvation.
Adults Lar vae
Starvation
periods (days)
T P-value
Starvation
periods (days)
T P-value
1 v 2 -0.62 0.9948 1 v 2 2.86 0.0971
1 v 3 -1.25 0.8641 1 v 3 -16.69 <0.0001
1 v 4 -5.61 0.0010 1 v 4 -35.75 <0.0001
1 v 5 -35.55 <0.0001 1 v 5 -46.72 <0.0001
1 v 6 -56.12 <0.0001 2 v 3 -19.55 <0.0001
1 v 7 -79.82 <0.0001 2 v 4 -38.62 <0.0001
2 v 3 -0.62 0.9948 2 v 5 -49.58 <0.0001
2 v 4 -4.99 0.0029 3 v 4 -19.07 <0.0001
2 v 5 -34.92 <0.0001 3 v 5 -30.03 <0.0001
2 v 6 -55.50 <0.0001 4 v 5 -10.96 <0.0001
2 v 7 -79.20 <0.0001
3 v 4 -4.37 0.0089
3 v 5 -34.30 <0.0001
3 v 6 -54.88 <0.0001
3 v 7 -78.57 <0.0001
4 v 5 -29.93 <0.0001
4 v 6 -50.51 <0.0001
4 v 7 -74.21 <0.0001
5 v 6 -20.58 <0.0001
5 v 7 -44.28 <0.0001
6 v 7 -23.70 <0.0001

Dicussion
A major ecological difference between parasites and free-living animals is that once contact
has been made with a suitable host, parasites no longer need to expend resources searching for
food. As a result nutrient shortages are not a problem experienced by many parasites
(Hakalahti et al., 2005). However, should a parasite lose contact with its host then nutrient
shortages and the risk of starvation become significant issues in terms of parasite survival.
115
The off-host survival time of larval argulids were typically reported as approximately
2 days with maximum reported off-host survival times of approximately 4 days (Mikheev et
al., 2003). Our data for A. foliaceus differ only marginally from those reported by Mikheev et
al., (2003). The average off-host survival times determined by these authors ranged from 2.10
to 3.26 days with a maximum off-host survival time of 5 days (at 15
o
C). Shafir and Oldewage
(1992) stated that A. japonicus perished after only 3 or 4 days off-host. They did not,
however, state the developmental stage of these lice. In our study, the mean off-host survival
time of larval A. japonicus ranged from 2.39 days to 5.17 days (depending upon ambient
temperature) which appears to be in rough agreement with the observations of Shafir and
Oldewage (1992). The larval A. japonicus in our study survived for a maximum period of 8 or
even 9 days off-host in a few cases. However, most of these animals appeared incapable of
locomotion and could have been easily mistaken as dead, which may account for the
differences between our data and those reported by Shafir and Oldewage (1992). Hakalahti et
al., (2005) reported off-host survival times for larval A. coregoni, another European argulid,
up to a maximum of 174 hours (approximately 7.5 days) with the majority of lice perishing
after 90 hours (approximately 3.75 days) which is in closer agreement to our data for both A.
foliaceus and A. japonicus than the data reported by Shafir and Oldewage (1992).
The differences observed between developmental stages and between temperatures for
the off-host survival time of both Argulus species in our study may shed some light on the
apparently conflicting reports found in the literature. Many of the reports regarding off-host
survival times of argulids were based on observations under unspecified conditions with
information regarding parasite developmental stage, time since parasite collection/hatching,
light regimes and temperature not being reported.
We showed that the mean off-host survival time of adult A. japonicus ranged from
2.46 to 9.43 days with a maximum off-host survival time of 13 days (at 15
o
C). Similar results
were obtained for A. foliaceus although here mean survival times were higher than those of A.
japonicus for 3 out of 5 of the temperatures and the maximum off-host survival time was 14
days (at 9
o
C).
In general, adult A. foliaceus survived longer at lower temperatures than A. japonicus.
Larval A. japonicus appear to be able to survive longer than larval A. foliaceus at temperatures
in the mid-range of those studied here. The differences in the apparent optimum temperatures
(in terms of off-host survival time) between the two species is interesting from an
evolutionary perspective. A. foliaceus is native to Europe whereas A. japonicus, although
widespread in Europe for many decades, is believed to have been introduced from the orient
Chapter 6
116
via the trade in ornamental fish varieties (Rushton-Mellor, 1992). It may be that these two
species have evolved in climates experiencing different temperature regimes and that as a
result this has determined their temperature tolerance. With the continuing onset of global
warming, this factor has implications for the future distribution of these two Argulus species.
Temperature has the greatest influence on off-host survival times at the two extremes
of the parasites tolerance range but is most striking at the highest temperatures. A. foliaceus
appears more adapted to survival at lower average temperatures typical of more northerly
climates than its relative from the orient, A. japonicus. A. japonicus is reported as widespread
across much of Southern and Western Europe (Walker et al., 2004). The latest British reports
state its distribution in the United Kingdom is probably restricted to southern England
currently (Rushton-Mellor, 1992) although by now it is likely this range has been extended. It
can be hypothesized that the further spread of A. japonicus will be restricted by this species
reduced ability to survive at lower temperatures although global warming may ultimately
extend this species range. Whilst there are several reports of A. foliaceus overwintering as
adults at temperatures lower than 5
o
C, such reports are not available for A. japonicus or A.
foliaceus larval and juvenile stages. Our experimental data demonstrate that all developmental
stages of A. foliaceus and A. japonicus are probably also able to over-winter although their
survival rates may be limited in comparison with adult A. foliaceus due to their shorter off-
host survival time at lower temperatures. For both species high temperatures seem to be
detrimental in terms of off-host survival times. This is again likely linked to the evolutionary
history of these species as they both originate and persist in regions where such high water
temperatures are not frequently experienced and thus they probably cannot tolerate prevailing
conditions such as reduced dissolved oxygen levels typical of water at such temperatures. The
effect of temperature on the metabolic process of these animals is not known but it is likely
that extremes of temperature will also have a negative effect on such processes.
The short acclimation period used for lice in this study may have some influence on
the results. In a natural situation temperature is unlikely to change as rapidly as experienced
by lice used in this study. Acclimation of lice to different temperatures and the effects of
acclimation periods on Argulus spp. off-host survival times is an area that ultimately requires
further investigation.
We observed that 1 or 2 days before they perished, both argulid species became very
inactive, sometimes even seeming to be dead until they were agitated with a metal seeker.
Hakalahti et al., (2005) reported similar observations for larval A. coregoni (metanauplii) and
attributed this to a possible state-dependent behavioural modification (Fenton and Rands,
117
2004). In our study, the attachment success of larval A. japonicus was optimal for
approximately 2 days post-hatching and for approximately 4 days off-host for adults. The
attachment success in relation to the time spent without access to a host upon which to feed,
confirmed that lice become very lethargic after a certain period of starvation. In fact, several
days before they die as a result of starvation, their ability to locate and infect a host is
significantly diminished and at a certain point, although still alive, they do not appear to
possess sufficient energy reserves to locate and attach to a host anymore and as a result can be
considered not viable/infective any longer. We estimate this time frame to be after 4 days for
larval A. japonicus and after 6 days for adult A. japonicus at 23
o
C. We do not disagree with
the state-dependent behavioural modification proposed by Hakalahti et al., (2005). However,
at a certain starvation point behavioural modifications are probably over-shadowed by the
lack of sufficient energy reserves to fuel any kind of host location behaviour. The difference
in maximum numbers of lice successfully locating and attaching to a host fish hints towards a
difference in the host location abilities of the different developmental stages. It appeared that
adults are much more successful at locating a host than larvae. From this study it is difficult to
conclude which mechanisms are responsible for this difference. We speculate that several
factors likely play a role including the level of development of the sensory organs, swimming
ability, morphological differences in attachment organs or perhaps even an ability of lice to
'learn' to recognise a host more quickly as they mature.
Kollatsch (1959) stated an optimal temperature for locomotion as being 18-23
o
C for A.
foliaceus. We expected to find that temperature therefore has a significant effect on host
location and attachment success of A. japonicus. From our data it appears that the optimum
temperature for host location and attachment success for A. japonicus is probably similar to
that of A. foliaceus according to the results of Kollatsch (1959). From an evolutionary
perspective it seems logical that a parasite would be minimally affected by temperature in
terms of its ability to successfully locate and attach to a new host. Dislodgement or death of
the host can occur during any season and therefore at any temperature, and any reduced
ability to locate a host could be lethal to this parasite. Intermittent parasites need to retain their
ability to mobilize themselves to locate and attach to a host under a range of environmental
conditions and because >50% of parasites successfully located and attached to a host at each
temperature, it appears that A. japonicus accomplishes this with respect to temperature.
Several authors have demonstrated that argulids modify their host-searching behaviour
in order to best-utilize their energy reserves in relation to the likelihood of host encounters,
i.e. they switch from sit-and-wait to active searching strategies connected with the changes
Chapter 6
118
from light to dark conditions (reviewed in Mikheev et al., 2003). Hakalahti et al., (2005)
propose a second type of host-searching behavioural modification that is state-dependent, i.e.
dependent upon the state of the parasite's energy reserves. We observed that at a certain point,
however, these mechanisms apparently fail and parasites lose the ability to successfully locate
a host resulting in mortality.
In conclusion, we have shown that under experimental conditions temperature and
developmental stage have a clear influence on the off-host survival time of A. japonicus as
well as A. foliaceus. The off-host survival time increases as the lice mature. There were
significant differences in the survival times of the two parasite species and each appears to
have its own optimum temperature range, which also differs between developmental stages.
We have also demonstrated that, like the native European A. foliaceus, A. japonicus can
probably overwinter as adult stages increasing the potential number of generations produced
in subsequent breeding seasons. In addition we have shown that off-host periods significantly
influence the infectivity of A. japonicus, with lice becoming less viable the longer they have
been without food. Finally, temperature does not appear to greatly influence the infectivity of
A. japonicus within the broad temperature range tested although there may be a small increase
in infectivity between the optimum temperatures of 18 and 23
o
C.
We suggest that future studies regarding the survival abilities of parasites should
always control or account for development stage and temperature. The information presented
in this chapter has implications for the future management and control of A. japonicus.
Control strategies must account for the fact that this parasite can probably survive as both egg
stages and adult stages during the winter months and this poses a much larger threat in terms
of the number of potentially infective lice appearing at the start of each breeding season if
water temperatures in Western Europerise rise significantly as a result of global warming.

Acknowledgements
The authors would like to acknowledge T. Spanings for his assistance with fish husbandry,
sampling and anaesthesia of fish. Thanks are extended to members of the PARITY EU
Training network for advice and comments during informal presentations of these data. P. D.
Walker and I. Russon acknowledge the financial support provided through the European
Communitys Improving Human Potential Programme under contract (HPRN-CT-2001-
00214), (PARITY). This is Centre for Wetland Ecology publication No. 485.

119
Refer ences

Ahne W. (1985). Argulus foliaceus L. and Piscicola geometra L. as mechanical vectors of
spring viraemia of carp virus (SVCV). Journal of Fish Diseases. 8, 241-242.
Bower-Shore C. (1940). An investigation of the common fish louse, Argulus foliaceus
(Linn.). Parasitology. 32, 361-371.
Bandilla, M., Valtonen, E. T., Suomalainen, L. R., Aphalo, P. J . and Hakalahti, T. (2006). A
link between ectoparasite infection and susceptibility to bacterial disease in rainbow
Deevey, E. S. (1947). Life tables for natural populations of animals. Quarterly Review of
Biology. 22, 283-314.
Fenton A. and Rands S. A. (2004). Optimal parasite infection strategies: a state dependent
approach. International Journal for Parasitology. 34, 813-821.
Hakalahti T., Bandilla M. and Valtonen E. T. (2005). Delayed transmission of a parasite is
compensated by accelerated growth. Parasitology. 131, 647-656.
J afri S. I. H., Ahmed S. S. (1994). Some observations on mortality in major carps due to fish
lice and their chemical control. Pakistan Journal of Zoology. 26, 274-276.
Lester R. J . G., Roubal F. (1995). Phylum Arthropoda. In: P. Woo (Eds.), Fish Diseases and
Disorders. Vol. 1. Protozoan and Metazoan Infections. CAB International,
Wallingford, UK, pp. 475-598.
Menezes J ., Ramos M. A., Pereira T. G., Moreira da Silva A. (1990). Rainbow trout culture
failure in a small lake as a result of massive parasitosis related to careless
introductions. Aquaculture. 89, 123-126.
Mikheev, V. N., Pasternak, A. F., Valtonen, E. T. and Lankinen, Y. (2001). Spatial
distribution and hatching of overwintered eggs of a fish ectoparasite, Argulus coregoni
(Crustacea: Branchiura). Diseases of Aquatic Organisms. 46, 123128.
scales? Zhurnal Obshchei Biologii. 64, 238-247.
Moravec, F. (1994). Parasitic Nematodes of Freshwater Fishes of Europe. Academia, Prague.
Chapter 6
120
Paperna I. (1991). Diseases caused by parasites in the aquaculture of warm water fish. Annual
Reviews in Fish Diseases. 1, 155-194.
Pasternak, A. F., Mikheev, V. N., Valtonen, E. T. (2000). Life history characteristics of
Roberts R. J ., Sommerville C. (1982). Diseases of tilapias. In: R.S.V. Pullin and R.H. Lowe-
McConnell (Eds.), The Biology and Culture of Tilapias. ICLARM Conference
Proceedings, 7, Manila, Philippines. pp. 247263.
Ruane, N., McCarthy, T. K. and Reilly, P. (1995). Antibody response to crustacean
ectoparasites immunized with Argulus foliaceus L. antigen extract. Journal of Fish
Diseases. 18, 529537.
Rushton-Mellor, S. K. (1992). Discovery of the fish louse, Argulus japonicus Theile
(Crustacea: Branchiura), in Britain. Aquaculture and Fisheries Management. 23, 269
271.
Rushton-Mellor S. K. (1994). The genus Argulus (Crustacea: Branchiura) in Africa:
identification keys. Systematic Parasitology. 28, 51-63.
opportunistic parasitism in Argulus japonicus (Branchiura). Crustaceana. 62, 5064.
Shimura, S. (1983). SEM observation on the mouth tube and preoral sting of Argulus
coregoni Thorell and Argulus japonicus Thiele (Crustacea: Branchiura). The Japanese
Society of Fish Pathology. 18, 151156.
Karpfenluse. Zeitschrift Fr Parasitenkunde. 19, 135208.
Taylor, N. G. H., Sommerville, C., Wooten, R. (2006). The epidemiology of Argulus spp.
Diseases. 29, 193-200.
Wilson C. B. (1902). North American parasitic copepods of the family Argulidae, with a
bibliography of the group and a systematic review of all known species. Proceedings
of the United States National Museum. 25, 635-742.
121

Chapter 7

Feeding in Argulus japonicus (Crustacea:
Branchiura), an ectoparasite on fish

P. D. Walker, I. J . Russon, C. Haond, G. van der Velde and S. E. Wendelaar-Bonga

Submitted to Journal of Fish Diseases
Chapter 7
124
Abstr act

The argulids are an economically important group of crustacean ectoparasites known to be
problematic in fish farming operations from both temperate and tropical regions. Argulus
japonicus was first described parasitising J apanese fishes but is now well established in many
parts of the world including Europe. To aid the development of effective chemotheraputants
and/or vaccines against these parasites it is essential to know exactly what these animals
ingest when feeding upon their fish hosts. From past morphological studies it has been shown
that these parasites use a proboscis-like mouth tube for feeding, but, until now there has been
much speculation regarding the diet of these animals. Live observations, histology, scanning
and transmission electron microscopy were used to examine the feeding apparatus and gut
contents of individual lice before and after feeding on juvenile common carp (Cyprinus
carpio). Red colouration of the parasites gut after feeding was obvious suggesting ingestion of
red blood cells by the lice. Sections of the lice used for histology and transmission electron
microscopy revealed red blood cells from the fish host within the parasites gut. Haemorrhagic
responses of the hosts skin was observed between 24 and 48 hrs post infection. All techniques
provided evidence that these parasites are indeed obligate blood feeders.

Feeding in Argulus japonicus
125
Intr oduction
Ectoparasitc lice from the genus Argulus have negative impacts on the stock of fish farms and
recreational fisheries (Menezes et al., 1990; Northcott, 1997; Taylor et al., 2006). Therefore
these parasites have received considerable attention from researchers during the last few
decades (Walker et al., 2004). In spite of this attention it is difficult to find clear statements
regarding the feeding mechanisms and diet of these parasites (Kearn, 2004).
The feeding apparatus of Argulus japonicus and other argulids species have been
relatively well described previously (Martin, 1932; Gresty et al., 1993; Kearn, 2004; Walker
et al., 2004; Tam and Avenant-Oldewage, 2006). The mouth tube is composed of a labium
and a labrum, which surround the buccal cavity. Contained within the buccal cavity are the
mandibles and labial spines. In addition to the mouth tube there is a pre-oral stylet which has
been the topic of some debate for several decades. To date the function of this unique organ is
still unclear but the general consensus is that is used to deliver a toxin that may help
breakdown the epithelial cells of the host or induce haemorrhaging. Similarly, the function of
the labial spines is unconfirmed.
There is much controversy in the literature over the diet of Argulus spp. Authors state
that Argulus spp. feed on fish mucous (LaMarre and Cochrane, 1992), skin (van der Salm et
al., 2000) externally digested cell contents (Lester and Roubal, 1995) and tissue fluids
(Frabioni, 1974). Others state that these animals are in fact obligate blood feeders (van Duijn,
1956; Ahne, 1985; Poulin and Fitzgerald 1988; Mikheev et al., 1998, 2000; Pasternak et al.,
2000) but even here some authors have argued that they only ingest blood serum and not
whole blood (Ivanfi, 1926: referenced in Gresty et al., 1993). This controversy is not
altogether surprising because there has been a distinct lack of detailed studies to show exactly
what these animals are feeding upon.
The aim of this study was to provide evidence on the diet of A. japonicus. Live
observations, histology, scanning and transmission electron microscopy were used to examine
the feeding apparatus and gut contents of A. japonicus after they had fed on juvenile common
carp (Cyprinus carpio). Results are discussed in relation to the importance of parasitic feeding
mechanisms and diet for the development of effective control methods.

Chapter 7
126

Feeding experiment
Adult A. japonicus were collected from Nijmegen laboratory brood stock carp using blunt
forceps. These lice were then held in a small beaker containing aquarium water for 48 hours at
20
o
C, without access to a host. The water was replaced once after 24 hours. Several lice were
then taken and allowed to feed on a juvenile carp (Cyprinus carpio) for 2 hours before once
again being removed with a set of blunt forceps. Several fish were left with lice attached and
examined at 24 and 48 hrs post infection for gross pathological signs associated with parasitic
infection. Live observations were then conducted by placing several fed and unfed parasites
on microscope slides in a drop of water. The slide was placed in a freezer (-20
o
C) for
approximately 1 minute to reduce the level of activity exhibited by the animals. Low power
micrographs were obtained using a stereo-microscope with a mounted digital camera.

Histology
Lice were collected after feeding on juvenile common carp for 2 hrs and immediately placed
in Bouins fixative for approximately 24 hrs. Samples were then processed for paraffin
histology using the standard procedure. Paraffin sections were stained with Masson trichrome
(Martoja and Martoja, 1967).
Skin samples were dissected from euthanised (overdose of 2-phenoxyethanol
anaesthetic followed by spinal transaction) juvenile common carp (Cyprinus carpio) and
immediately fixed in Bouin's fixative for a minimum of 24 hrs. Samples were subsequently
dehydrated through a graded ethanol series and embedded in paraffin. Five m sections were
mounted on gelatinised glass slides and dried overnight at 40
o
C. Slides were then stained with
hematoxylin and eosine, and examined microscopically.

Scanning electron microscopy (SEM)
Adult and larval lice were collected from Nijmegen brood stock carp and then immediately
fixed in 2% glutaraldehyde in 0.1 M cacodylate buffer and left overnight. Samples were then
post-fixed for 2 hrs in ice-cold 1% OsO
4
, 0.15 M sucrose in the same buffer before being
dehydrated through a graded ethanol series, critical point-dried and sputter-coated with a
microlayer of gold palladium. Specimens were observed with a J EOL SEM 6330.

127
Transmission electron microscopy (TEM)
For electron microscopy, lice were collected after feeding for 2 hrs on juvenile common carp.
The lice were then dissected in 2% glutaraldehyde in 0.1 M cacodylate buffer and kept for 4
hrs in ice-cold fixative. After washing in 0.2 M sucrose in 0.1 M cacodylate buffer, dissected
pieces of the dorsal shield (carapace) were post-fixed for 2 hrs in ice-cold 1% OsO
4
, 0.15 M
sucrose in the same buffer, washed in demineralised water, dehydrated in ethanol baths and
embedded in LR White resin. Ultra-thin sections were cut using a diamond knife (Diatom),
contrasted with uranyl acetate and lead citrate, and examined with a J EOL CXII transmission
electron microscope.

Results
Comparison of the feeding apparatus of larval and adult A. japonicus shows that the mouth
parts are essentially comprised of the same component parts, e.g. mandibles, labrum and
labium (Figs. 1A and B). The most notable difference between the feeding apparatus of adult
and larval lice is in the overall size of the mouth parts. In particular the aperture of the buccal
cavity is significantly larger in adult lice (approx 20m across) than in larval lice
(approximately 9m across) (Figs. 1A and B). The pre-oral stylet consists of a spine
possessing a rounded tip with two small openings located behind it (Fig. 1C). This stylet was
either completely retracted inside its associated sheath or partially exposed (Fig. 1C),
depending on the specimen.
The anterior and posterior midgut and enteral dirverticula are clearly visible in live A.
japonicus larvae (Fig. 2F). The gut of larval A. japonicus have many pigment cells associated
with it. Squash preparations of larval parasites after having been attached to juvenile carp for
2 hrs did not contain carp erythrocytes.
Examination of live adult parasites using the stereo microscope revealed that after 48
hrs without feeding the gut of these animals was completely empty (Fig. 2 A, B). The gut of
these animals consists of a foregut or crop, and a hind gut (Fig. 2). There are also many
diverticula running through the dorsal carapace which begin from one of two lateral
extensions of the crop, one on each side of the animal. Numerous chromatophores associated
with the gut diverticula were also apparent (Fig 2). J ust two hours after being allowed to
attach and feed on a small juvenile common carp, many of the parasites exhibited a
conspicuous red colouration within the various regions of the gut suggesting that
haematophagous activities had occurred and that the animal's gut was now full of blood.

Chapter 7
128

Fig. 1. Scanning electron
micrographs of the mouth
parts of an adult (A) and
larval (B) Argulus
japonicus showing the
mouth tube (mt), labium
(lab), labrum (lb), labial
spine (ls) and buccal cavity
(bc). The pre-oral stylet of
an adult (C) takes the form
of a hollow spine (St)
possessing two openings
near to its tip (white
arrows) and is contained
within a sheath (S) into
which it can be retracted
when not in use.

129

Fig. 2 A-F. Stereo micrographs of live Argulus japonicus; c, foregut or crop; eg, hind/end gut; o,
ovaries; t, testis; s, spemathecae; d, enteral diverticula; pc, pigment cells (chromatophores); am,
anterior midgut. (A, B) Female specimen observed 48hrs after removal from its host. The ovaries are
clearly visible as are the diverticula of the gut extending throughout the dorsal carapace. The empty
diverticula can be seen along with associated pigment cells or chromatophores (B). (C-E) Male and
female specimens removed from their host after feeding for two hours. The male can be identified by
the testis which are clearly visible within the abdominal lobes at the posterior end of the animal (C).
The female specimen is distinguished by the conspicuous ovaries and also by the spermathecae which
can be seen on the abdominal lobes (D). In both specimens blood can be seen in the foregut or crop,
the diverticula of the gut and in the end gut. (E) Magnified area of the male parasites dorsal carapace
showing in detail the diverticula filled with blood. (F) Larval louse 2hrs post hatch with the anterior
and posterior portions of the midgut (am and pm respectively) clearly visible as are the enteral
diverticula (d). Numerous pigment cells were associated with the gut of larval A. japonicus giving it a
red/brown colouration here.
Chapter 7
130

Fig. 3 A-E. Gut content of fed adult Argulus japonicus. (A) Longitudinal section through the
carapace. Diverticula of the gut (d) seen in transverse section contain clotted material (arrows).
(B) Transverse section through a gut diverticulum (d). Fish erythrocytes are clearly visible within
the gut (arrowhead). (C, D) Transverse sections of the crop (c). Ovaries (o) can be seen clearly
indicating the specimen was female. The crop contains a pellet (C) full of fish red blood cells (D).
(E) TEM micrographs of a transverse section through the gut diverticulum. Digestive cells (dc)
and microvilli (mv) surrounding the gut are clearly visible. Fish red blood cells (bc) are clearly
identifiable within the gut. Scale bars: A-100m, B-50m, C-500m, D-50m, E-5m.
131

A
B
d d
e e
40m
15mm
A
B
d d
e e
40m
15mm

Fig 4. J uvenile common carp (Cyprinus carpio) 48hrs after infection with adult Argulus
japonicus (A). Arrows indicate heamorrhagic lesions caused by feeding activities of the
parasites. A section through the flank skin of a juvenile common carp (Cyprinus carpio)
showing the crater-like wound inflicted by a feeding argulid (arrow) (B).

Sections through various regions of a fed parasites body in which gut diverticula are
present, show that the various gut parts contain substances assumed to be the parasites last
meal. TEM (Fig. 3E), clearly shows the presence of nucleated cells which were identified as
erythrocytes from a fish.
J uvenile carp that had been infected for up to 48 hrs exhibited prominent red lesions
on their skin (Fig. 4A). These lesions appeared haemorrhagic and were often associated with
attached parasites. Microscopical examination of these lesions revealed craters in the skin of
Chapter 7
132
the fish at the sites where parasites had been feeding (Fig. 4B). These craters penetrated as far
as the dermis (stratum compactum) and infiltration of leukocytes into tissues surrounding the
wounds was observed.

Discussion
Branchiuran lice have undergone major modifications of the mandibles and associated feeding
appendages. Mandibles typically occur as a pair of transversely toothed hooks between the
labium and labrum and this indeed is the case for specimens studied by us. These mandibles
are located just inside the entrance to the buccal cavity forming part of the specialised
proboscis (McLaughlin 1982). The mechanism of feeding in argulids has been described (e.g.
van Duijn 1956; Kabata 1985; Overstreet et al., 1993; Lester & Roubal 1995) but there is
some controversy concerning the facts. Much of this controversy relates to the function of the
pre-oral stylet, an organ unique to species of Argulus and Dipteropeltis. Some authors are of
the opinion that argulids use the pre-oral, retractable stylet to inject toxic substances into their
host creating a localised inflammatory response with sub-cutaneous haemorrhaging. Gresty et
al. (1993) also demonstrated that this organ was used to inject substances into the host rather
than to withdraw fluids as was believed by other authors, e.g. van Duijn (1956) and Kabata
(1970). The parasite then likely uses its serrated mandibles, which can be everted, to tear a
hole in the epidermal layers to gain access to the host's blood. Whole blood (including
erythrocytes) is then sucked up through a proboscis-like mouth tube, which, according to
Kearn (2004), superficially resembles the mouth tube of a siphonostomatoid copepod.
Several authors have suggested that Argulus is haematophagous (see Walker et al.,
2004 and Kearn, 2004 and referencs therein), but Kabata (1970) stated that red blood cells
have not been recorded in the gut of Argulus. Our observations revealed the presence of large
numbers of nucleated erythrocytes in the gut of adult A. japonicus just 2 hrs after feeding, and
strongly indicate that whole blood forms a significant part of the diet of these parasites. The
extensively branched nature of the gut in Argulus spp. is comparable to that of leeches, which
are also designed to take up masses of blood (Wesenberg-Lund 1939). Whilst the precise
function of the labial spines and pre-oral stylet has not been elucidated by this study we
anticipate that future studies will demonstrate the presence of an anticoagulant aiding the
hematophagous habits of A. japonicus. Certainly previous authors have described glands
associated with pre-oral stylet and mouthparts which may produce such substances (Wilson
1903; Wesenberg-Lund 1939; Gresty et al. 1993; Kearn 2004).
133
In the case of larval A. japonicus the ingestion of whole blood (including erythrocytes)
is unlikely. Erythrocytes from carp are typically around 12-13m in the longest diameter
(Imagawa, Hashioto, Kitagawa, Kon, Kudo & Sugimura 1989). Our observations regarding
the aperture size of the opening to the parasites buccal cavity demonstrate that it is not large
enough to allow the ingestion of intact red blood cells. In addition, no erythrocytes were
observed in squash preparations of larval parasites. According to Tam & Avenant-Oldewage
(2006) the sizes of the larval A. japonicus proboscis (approximately 50m in length) and
mandibular blades (approximately 15m in length), located inside the proboscis, are probably
insufficient to penetrate down to the blood vessels located in the dermis of a cyprinid host,
due to the thickness of its epidermis (thickness =approximately 100m). This probably
accounts for the absence of erythrocytes in larval A. japonicus. Tam & Avenant Oldewage
(2006) state that the food of larval A. japonicus appeared to consist of host mucous and
epithelial cells and as with our study host erythrocytes were not observed.
Shimura & Inoue (1984) injected an extract derived from Argulus coregoni into
rainbow trout (Oncorhynchus mykiss) and found that it induced a haemorrhagic response
which would facilitate haematophagy by A. coregoni. Forlenza, Walker, de Vries, Wendelaar
Bonga & Wiegertjes (2008) demonstrated an inflammatory response in carp skin following
infection with A. japonicus. A similar haemorrhagic response was observed in carp in this
study between 24 and 48 hrs post-infection suggesting that, like its relative A. coregoni, A.
japonicus utilizes chemical secretions to facilitate feeding.
Blood feeding parasites have long been a topic of interest in many biological sub-
disciplines, from the medical sciences to animal physiology and ecology. The reasons for
studying animals that show this feeding behaviour are diverse and range from improving our
understanding the importance of haematophagous animals as vectors for important diseases of
farmed animals and humans (e.g. SVCV Ahne, 1985; Malaria Prevot, 2003; Lyme disease
Randolph, 1998) to raising our insights into role of these animals within ecosystems e.g.
host population control. Kabata (1985) stated that aquaculturists should pay particular
attention to the control of blood sucking parasites due to their potential as vectors for other
serious pathogens (e.g. spring viraemia of carp virus, infectious pancreatic necrosis, bacterial
hemorrhagic septicaemia). A. japonicus can now be confirmed as being within this important
group of blood-suckers and we believe that other argulids will also be confirmed as blood
feeders in the future. However, Covich and Thorp (2001) suggest that blood feeding is likely
to be species-specific among branchiurans.

Chapter 7
134
Acknowledgements

The authors gratefully acknowledge T. Spanings for his assistance with fish husbandry and
maintenance of the parasite stocks. P.D. Walker and I. Russon acknowledge the financial
support provided through the European Community's Improving Human Potential Programme
under contract (HPRN-CT-2001_00214), (PARITY).

Refer ences

Covich, A. P. and Thorp, J . H. (2001). Introduction to the subphylum Crustacea. Chapter 19,
p. 777-809. In: J . H. Thorp and A. P. Covich 2001. Ecology and classification of
North American Freshwater Invertebrates. Second edition Academic Press, San Diego.
1056 pp.
Forlenza, M., Walker, P. D., de Vries, B. J ., Wendelaar Bonga S. E. and Wiegertjes G. F.
(2008). Transcriptional analysis of the common carp (Cyprinus carpio L.) immune
response to the fish louse Argulus japonicus Thiele (Crustacea: Branchiura). Fish and
Shellfish Immunology. (in press).
Fraboni, J . (1974). Argulus: The Carp Louse; Life history of the parasite Argulus; fish
symptoms; disease prevention and treatment. The American Currents. 2 (1).
Gresty, K., Boxshall, G. A. and Nagasawa, K. (1993). The fine structure and function of the
cephalic appendages of the branchiuran parasite, Argulus japonicus Thiele.
Philosophical Transactions of the Royal Society, London B. 339, 119-135.
Imagawa, T., Hashioto, Y., Kitagawa, H., Kon, Y., Kudo, N. and Sugimura, M. (1989).
Morphology of blood cells in carp (Cyprinus carpio L.). Japanese Journal of
Veterinary Science. 6, 1163-1172.
Ivanfi, E. (1926). A pontytetu (Argulus foliaceus L.) morphologiaja es biologiaja. Archivum
Balatonicum Budapest. 1, 145-163.
Kabata, Z. (1985). Parasites and diseases of fish cultured in the tropics. Taylor and Francis,
London. 318pp.
Kearn, G. C. (2004). Leeches, Lice and Lampreys: A Natural History of Skin and Gill
Parasites of Fishes. Springer, Dordrecht The Netherlands. 432pp.
135
LaMarre, E. and Cochrane, P. A. (1992). Lack of host species selection by the exotic
ectoparasitic crustacean, Argulus japonicus. Journal of Freshwater Ecology. 7, 77-80.
Lester, R. J . G. and Roubal, F. R (1995). In Woo, P. Fish Diseases And Disorders: Volume
1: Protozoan and Metazoan Infections. CAB International, Wallingford, 475-598pp.
Martin, F. M. (1932). On the Morphology and Classification of Argulus (Crustacea).
Proceedings of the Zoological Society of London. 103, 771-806.
Martoja, R. and Martoja, M. (1967). Initiation aux Techniques de lHistologie Animale. Paris:
Masson et Cie. 345pp.
McLaughlin, P. A. (1982). Comparitive morphology of crustacean appendages. In: L. G.
Abele (ed.). The biology of Crustacea Vol. 2. Academic Press, New Yrk, 197-256.
introductions. Aquaculture. 89, 123-126.
Mikheev, V. N., Valtonen, E. T. and Rintmaki-Kinnunen, P. (1998). Host searching in
Mikheev, V. N., Mikheev, A. V., Pasternak, A. F. and Valtonen, E. T. (2000). Light-
mediated host searching strategies in a fish ectoparasite, Argulus foliaceus L.
(Crustacea: Branchiura). Parasitology. 120, 409-416.
Northcott, S. J . (1997). An outbreak of freshwater fish lice, Argulus foliaceus L., seriously
affecting a Scottish stillwater fishery. Fisheries management and ecology. 4, 73-75.
Overstreet, R. M., Dykova, I. and Hawkins, E. (1993). Branchiura. Pp. 384-413. In, F. W.
Harrison and A. G. Humes (eds.), Microscopical Anatomy of the Invertebrates. Vol. 9.
Crustacea. Wiley Liss Inc, New York.
Pasternak, A. F., Mikheev, V. N. and Valtonen, E. T. (2000). Life history characteristics of
ectoparasitism in juvenile sticklebacks. Canadian Journal of Zoology. 66, 2002-2005.
Prvot, G. I., Laurent-Winter, C., Rodhain, F. and Bourgouin, C. (2003). Sex-specific and
blood meal-induced proteins of Anopheles gambiae midguts: analysis by two-
dimensional gel electrophoresis. Malaria Journal. 2, 1.
Randolph, S. E. (1998). Ticks are not insects: consequences of contrasting vector biology for
transmission potential. Parasitology Today. 14, 186-192.
Chapter 7
136
coregoni Thorell (Crustacea: Branchiura). Bulletin of the Japanese Society of
Scientific Fisheries. 50, 729.
Tam, Q. and Avenant-Oldewage, A. (2006). The digestive system of larval Argulus japonicus
(Branchiura). Journal of Crustacean Biology. 26, 447-454.
Taylor, N. G. H., Sommerville, C. and Wooten, R. (2006). The epidemiology of Argulus spp.
Diseases. 29, 193-200.
van der Salm, A. L., Nolan, D. T., Spannings, F. A. T. and Wendelaar Bonga, S. E. (2000).
common carp, Cyprinus carpio L., skin. Journal of Fish Diseases. 23, 173-184.
Van Duijn, C. (1956). Diseases of Fishes. Water Life, London. 174pp.
Walker P. D., Flik G. and Wendelaar Bonga S. E. (2004). The biology of parasites from the
genus Argulus and a review of the interactions with its host. Symposia for the Society
of Experimental Biology. 55, 107-29.
Wesenberg-Lund, C. (1982). Biologie der Ssswassertiere: wirbellose Tiere. Strauss and
Cramer, Hirschberg, Germany, 772pp.

137

Chapter 8

Transcriptional analysis of the common carp
(Cyprinus carpio L.) immune response to the fish
louse Argulus japonicus Thiele (Crustacea:
Branchiura)

Maria Forlenza*, Peter D. Walker*, Beitske J . De Vries, Sjoerd E. Wendelaar Bonga and
Geert F. Wiegertjes
*Both authors contributed equally to the ideas and preparation of this manuscript
Fish and Shellfish Immunology (in press)
Chapter 8
140
Abstr act

In the present study we investigated changes in transcription levels of a panel of selected
immune relevant genes in peripheral blood leukocytes (PBL) and skin samples collected from
carp exposed to larval Argulus japonicus. We show that in skin, the up-regulation of gene
transcription of the chemokine CXCa, and to a lesser extent that of the chemokine receptor
CXCR1 and the cytokine TNF, are good indicators of parasite-induced skin damage at 2
days post-parasite exposure. Up-regulation of gene transcription corresponded well with an
increase in leukocyte, probably neutrophilic granulocyte, numbers in skin samples collected at
the sites of infection. We show that time-point controls are essential when studying gene
expression, especially in peripheral blood leukocytes (PBL). In addition, we demonstrate that
non-infected control samples isolated from the skin of infected fish are suitable autologous
controls, at least until after larval A. japonicus have undergone their first moult and begun to
demonstrate increased mobility over their hosts integument. The observed results are
indicative of A. japonicus affecting the skin as a whole organ, particularly after the parasite's
first moult, a phenomenon which has a great impact on correct skin sampling for RNA
isolation.

Carp immune response to Argulus
141
Intr oduction
Parasite-induced damage and disease in fish is currently receiving a more intensive research
focus from the scientific community. Fish lice have been shown to be a threat to farmed fish
over countless decades and, more recently, to wild fish stocks. Sea lice, particularly those
from the genus Caligus and Lepeophtheirus, have undergone intensive study as organisms in
their own right (J ohnson and Albright, 1991; Boxshall and Defaye, 1993; Krkoek et al.,
2004) and over the last few decades the interactions between these animals and their hosts has
also been the subject of several scientific investigations (J ohnson and Albright, 1991; Nolan
et al., 2000; Krkoek et al., 2004; Wells et al., 2006). However, certain groups of parasites,
whilst economically important, have not been intensively studied with regard to the effects
they have on their fish hosts.
Argulus spp. are typically regarded as generalist parasites and have been recorded
from practically every species of fish occurring in the same habitat (Walker et al., 2004 and
references therein). Occupying a similar niche to sea lice, the generalist freshwater lice from
the genus Argulus have received a considerable amount of attention concerning their life
cycle, morphology and ecology. However, the effects they have on their hosts are still poorly
understood. Some of the most recent work has examined physiological and ultrastructural
changes associated with stress induced by this parasitic organism (Nolan et al., 2000; van der
Salm et al., 2000). However, despite the economic importance of this group of pathogens (in
terms of their deleterious effects on fish stocks (Walker et al., 2004)), few studies have
addressed the immune response of fish to an infestation with these parasites. To combat these
pathogens successfully it is vital to gain a comprehensive understanding of the natural defence
mechanisms employed by fish (Walker et al., 2004), for example by gene transcription studies
in tissue samples of infected fish.
Skin is an essential protective barrier for fish and functions as a first line of defense
against infectious microbes from the aqueous environment. The cell composition of the
epidermis is well known and in common carp (Cyprinus carpio L.) the epidermis consists
mainly of filament cells, mucous cells, club cells and an upper layer of pavement cells. The
dermis contains chromatophores and melanophores (Iger et al., 1994). In the epidermis and
dermis of healthy fish, small numbers of lymphocytes and macrophages can be found (Iger et
al., 1994). Nevertheless, limited information is available for this organ with regard to immune
response mechanisms and associated gene transcription. A few recent studies have shown
regulation of immune gene transcription in fish skin following infection with ectoparasites
(Lindenstrom et al., 2003; Lindenstrom et al., 2004; Sigh et al., 2004a,b; Gonzales et al.,
Chapter 8
142
2007). Further, the blood is essential for mounting a rapid immune response, for example by
transportation of the relevant leukocytes, often neutrophilc granulocytes, to the site of
inflammation.
In the present study we investigated changes in gene transcription in peripheral blood
leukocytes (PBL) and skin of common carp (C. carpio) infected with larval stages of the
ectoparasite Argulus japonicus. Larval stages were chosen over adult stages, not only due to
the fact that larger numbers were obtainable, resulting in a potentially higher number of
attached parasites per fish, but also because larval lice appear to migrate over the surface of
their host to a much lesser degree than their adult counterparts (unpublished observation).
This will increase the probability of a synchronized timing of the immune response resulting
in reduced variation measured between samples. We collected time-point control samples
from non-infected fish for the gene transcription studies and, in addition, for the studies on the
host skin we included autologous time-point control samples corresponding to non-infected
spots isolated from infected fish. We also performed a histological examination of sites of
infection to examine the putative contribution of migrating leukocytes to changes in gene
transcription.


Animals
European common carp (Cyprinus carpio carpio L.) were bred in the central fish facility of
Wageningen University, The Netherlands, and raised in recirculating UV-treated water at
23
o
C (1
o
C) and with a 12:12 light:dark photoperiod in the central fish facility of Radboud
University Nijmegen and fed pelleted dry food (Trouvit, Nutreco) daily. R3R8, carp which
are the offspring of a cross between fish of Hungarian origin (R8 strain) and of Polish origin
(R3 strain), were used (Irnazarow, 1995). Fish were divided over 8 aquaria, each containing
10 fish. All studies were performed with the approval of the animal experimental committee
of Radboud University Nijmegen.

Parasites
A population of Argulus japonicus was maintained on stock carp (approximately 1000g
fish). Infestation intensities typically varied from 10-30 lice per fish. Eggs were deposited on
the glass sides and bottoms of the aquaria. Host fish were monitored regularly and parasite
eggs were removed to control parasite numbers when infestation intensities appeared to be too
143
heavy as indicated by host condition and host-behavioural changes e.g. lethargy and loss of
appetite.

Parasite collection
Adult A. japonicus were collected from stock carp that had been anaesthetised in a 2-
phenoxyethanol (Sigma-Aldrich, St Louis, MO, USA) solution (dilution =1:1000). Parasites
were subsequently removed from all fish using a set of blunt forceps and then held in beakers
containing tap water (non-chlorinated) at 23
o
C for 48 hrs. During this time any eggs deposited
by lice were collected and incubated in tap water at 23
o
C with daily refreshment of the water.
Upon hatching larval lice were held in groups of 150 individuals/beaker under identical
conditions as for the eggs/adult lice for 24 hrs prior to the start of the experiment. This
increased the likelihood that stored food reserves were fully diminished prior to the start of
the experiment (Tam and Avenant-Oldewage, 2006), increasing the likelihood that parasites
would immediately seek out and attach to a fish.

Infection of carp with Ar gulus japonicus
To infect the carp, the beakers of water containing larval lice were emptied into 5 (randomly
selected) of the 8 experimental aquaria. The same amounts of tap water was also poured into
each of the control, non-infected tanks. This marked the time zero (T0) time point. One fish
was then removed from each of the tanks at T0, 10 h, 24 h (1 day), 48 h (2 days), 72 h (3
days) and 6 days post-infection. Upon removal, fish were irreversibly anaesthetized in 2-
phenoxyethanol (dilution =1:500) and subsequently weighed, measured (standard length) and
the number of attached parasites recorded.

Peripheral blood leukocytes (PBL) and skin isolation
Blood was collected via puncture of the caudal vessel and diluted 1:1 with cRPMI (RPMI
1640; Cambrex, Verviers, Belgium; adjusted to 270 mOsmol kg
-1
) containing 50 IU/ml of
heparin (Leo Pharmaceutical products, Weesp, The Netherlands). After centrifugation at 600
g for 10 min, the buffy-coat containing leukocytes was collected and layered on 5 ml of
Ficoll-Paque Plus (Amersham Biosciences, Uppsala, Sweden). Following subsequent
centrifugation at 800 g for 25 min, the PBL at the interface were collected and washed three
times with cRPMI. Cell pellets were collected, immediately snap frozen in liquid nitrogen and
stored at -80C until used for RNA isolation.
Chapter 8
144
Several 5 x 5 mm samples of skin were carefully removed from the ventral region of
the flanks of uninfected (control) and infected fish. For infected fish, samples were taken from
sites of parasite attachment/feeding (infected spots) and also from sites distant to the sites of
infection (autologous controls). The number of infected spots differed between individual
fish. Skin samples were then immediately snap frozen in liquid nitrogen and stored at -80C
until use or immersed in Bouin's fixative for subsequent processing and histological analysis.

Histological analysis
Skin samples for histological analyses were fixed for a minimum of 24 h in Bouins fixative.
Samples were subsequently dehydrated through a graded series of ethanol and embedded in
paraffin. Five-m sections were mounted on gelatinized glass slides and dried overnight in an
oven at 40
o
C. Slides were then stained with hematoxylin and eosin and examined
microscopically for evidence of parasite-induced damage and host inflammatory responses
(i.e. infiltration of leukocytes).

RNA isolation and quantification
For Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) analysis total RNA was
isolated from PBL and skin using the RNAeasy Mini Kit (Qiagen, Leusden, The Netherlands)
according to the manufacturers instructions. On-column DNase treatment with the RNase-
free DNase set (Qiagen) was also included.
RNA was isolated, separately from 3 skin pieces from each of the three non-infected
controls or from 5 pieces (autologous controls) and 1-4 pieces (infected spots) from each of
the five infected fish. RNA isolated from more pieces from the same individual was never
pooled and each piece was handled and analyzed separately.
The concentration of RNA was measured spectrophotometrically (GeneQuant,
Pharmacia Biotech) at OD
260nm
and the purity determined as the OD
260nm
/OD
280nm
ratio with
expected values between 1.8 and 2.0. The integrity of RNA was determined by
electrophoresis on 1% agarose gel containing 0.5 g/ml ethidium bromide at 100 V. Total
RNA was stored at -80C until further use.

cDNA Synthesis
Prior to cDNA synthesis, a second DNase treatment was performed using DNase I,
Amplification Grade (Invitrogen, Breda, The Netherlands). Briefly, 1 g of RNA from each
sample was combined with 1 l 10x DNase reaction buffer and 1U DNase I up to a final
145
volume of 10 l, mixed and incubated at RT for 15 min, followed by inactivation of DNase I
by adding 1 l of 25 mM EDTA. Synthesis of cDNA was performed with Invitrogens
Superscript
TM
III First Strand Synthesis Systems for RT-PCR, according to the
manufacturers instructions. Briefly, DNase I-treated RNA samples (11 l) were mixed with
5x first strand buffer, 300 ng random primers, 10 mM dNTPs, 0.1 M DTT, 10 U RNase
inhibitor, and 200 U Superscript III Reverse Transcriptase (Invitrogen) up to a final volume of
20 l. The mixture was incubated at 37C for 60 min followed by an inactivation step at 70C
for 15 min. A non-reverse transcriptase control was included for each sample. Before use as
template in RT-qPCR experiments, the cDNA was further diluted 25 times in nuclease-free
water.

Real-Time quantitative Polymerase Chain Reaction (RT-qPCR)
RT-qPCR using SYBR Green I technology was performed using a Rotor-Gene 2000
(Corbett Research, Mortlake, Sydney, Australia) with the BrilliantSYBRGreen QPCR
(Stratagene, La J olla, CA, USA) as detection chemistry. The primers used for RT-qPCR are
listed in Table 1. PCR conditions were optimized by analyzing the melting curves of the
products and product specificity was assessed by analysis on a 1% agarose gel. Master-mix
for each PCR run was prepared as follows: 0.32 l of water, 0.84 l of each primer (5 M), 7
l Master SYBR Green I mix. Finally, 5 l of diluted cDNA was added to 9 l of master mix
and transferred to a 0.1 ml tube. The following amplification program was used: after 15 min
of denaturation at 95C, 40 cycles of RT-qPCR with three-step amplification were performed
- 15 s at 95C for denaturation, 30 s at 60C for annealing and 30 s at 72C for elongation
followed by a final holding step of 1 min at 60C. A melting step was then performed with
continuous fluorescence acquisition starting at 60C with a rate of 1C/5s up to 99C to
determine the amplification specificity. In all cases, the amplifications were specific and no
amplification was observed in negative controls (non-template control and non-reverse
transcriptase control). Fluorescence data from RT-qPCR experiments were analyzed using
Rotor-Gene version 6.0.21 software and exported to Microsoft Excel. The cycle threshold C
t

for each sample and the reaction efficiencies (E) for each primer set were obtained upon
Comparative Quantitation Analysis from the Rotor-Gene version 6.0.21 software. Briefly, the
E for each primer set was recorded per sample and an average E (E
A
) was then calculated for
each primer set. The relative expression ratio (R) of a target gene was calculated based on the
E
A
and the Ct deviation of sample versus control, and expressed in comparison to a reference
gene (Pfaffl, 2001; Tichopad et al., 2003). Gene expression analysis in skin tissue was
Chapter 8
146
performed for each sample separately, even for those isolated from the same individual. The
R in each treated sample (autologous control and infected spot) was calculated relative to a
total of nine non-infected pieces collected from three time-point controls. For analysis in PBL,
controls at time point zero (n=5) were used for relative expression analysis. Only at the end
mean R of each sample in each time point was calculated and used for statistical analysis. The
40S ribosomal protein S11 was used as an internal reference gene.

Table 1. Primers used in RT-qPCR gene expression analysis.
Pr imer Sequence 5 3 Pr oduct (bp) Acc no
qIL-1.FW ACGCCACCAAGAGCCTTTTA
qIL-1.RV GCAGCCCATATTTGGTCAGA 69 AJ 245635
qTNF.FW GCTGTCTGCTTCACGCTCAA
qTNF.RV CCTTGGAAGTGACATTTGCTTTT 106 AJ 311800
qCXCa.FW CTGGGATTCCTGACCATTGGT
qCXCa.RV GTTGGCTCTCTGTTTCAATGCA 88 AJ 421443
qCXCRI.FW GCAAATTGGTTAGCCTGGTGA
qCXCRI.RV AGGCGACTCCACTGCACAA 144 AB010468
qIL-10.FW CGCCAGCATAAAGAACTCGT
qIL-10.RV TGCCAAATACTGCTCGATGT 103 AB110780
q40S.FW CCGTGGGTGACATCGTTACA
q40S.RV TCAGGACATTGAACCTCACTGTCT 69 AB012087

Statistics
Relative expression ratios (R) were calculated as described above. Transformed values (ln(R))
were used for statistical analysis in SPSS Software (version 15.0). Homogeneity of variance
was analysed using the Levenes test. Significant differences (P<0.05) were determined by a
two-way ANOVA followed by a Sidak test. In case of unequal variances between groups, the
two-way ANOVA was followed by a Games-Howell test.

147
Results

General observations
Larval parasites were found attached to fish just 2 h post-infection. Infection was confirmed
for all carp exposed to the parasites. However, the number of attached lice/fish was low and
varied between individual fish (mean =3.8 3.1 S.D.) in all tanks. Infection intensities did
not exhibit a time related change in parasite numbers. No significant behavioral changes in the
host fish were observed at any time during the course of the experiment. The first gross
pathological signs of infection were visible as red spots/lesions on the surface of infected fish
and appeared between 24 and 48 h post-infection (p.i.). These lesions varied in size up to a
maximum of 6 mm across. Parasites were only observed as larval stages until approximately
day 5 post-infection, when the vast majority of observed parasites had undergone their first
moult, becoming juveniles.

Gene expression analysis in PBL
We investigated the kinetics of expression of several immune-relevant genes in PBL of non-
infected and fish infected with the ectoparasite A. japonicus. On day 1 to 2 p.i., a significant
(P<0.05) up-regulation of IL-1 (6-fold), TNF (3.2 fold) and of the chemokine receptor
CXCR1 (3.5-fold) but not CXCa was observed when compared to the control at time point
zero (T0, Fig. 1). However, no significant differences were observed when the gene
expression levels were compared with the respective time point controls. In fact, the same
genes were upregulated in PBL samples from individual time point controls, possibly owing
to unknown environmental stimuli. On day 6 p.i. both IL-1 and IL-10 transcript levels were
significantly up-regulated when compared to the control at time point zero (Fig. 1) but, again,
not when compared to the time point controls.

Gene expression analysis in skin
To investigate not only the local immune response at the site of infection but also a more
generalized response which might affect the skin as a whole, we analyzed the kinetics of
expression of several immune relevant genes in samples collected from both infected spots
and non-infected spots (autologous controls) of infected fish. Kinetics of expression were
compared to those observed in samples collected from non-infected fish at each individual
time point. For clarity, since infected spots were not visible until 24 h, the 10 h time point was
Chapter 8
148
excluded from the analysis. Two days post-infection CXCa showed a significant up-
regulation when

Figur e 1. Kinetics of gene expression in PBL after Argulus japonicus infection of common
carp (Cyprinus carpio L.). Fish were exposed to 150 larval parasites/tank by bath challenge.
PBL from non-infected and infected fish were collected at different time points post-
infection. Expression was determined by Real-Time quantitative PCR and expressed relative
to S11 protein of the 40S subunit. Data represent mean values of: n=5, 0h controls; n=5,
infected fish; n=3, time-point controls (SD). Symbol * represents a significant difference
as compared to non infected controls at time point zero. Symbol a indicates a significant
difference as compared to the non infected time-point control.

compared to the autologous controls and also when compared to the non-infected time-point
control (Fig. 2). TNF and CXCR1 transcription levels were also elevated at 2 days p.i. but
this difference was significant only when compared to the non-infected autologous control. At
day 6 p.i., TNF, CXCa and IL-10 transcription levels were significantly up-regulated in skin
samples collected from infected spots when compared to the non-infected time-point control.
At the same time point, only for TNF and CXCa, significantly elevated transcription levels
149
were observed in the autologous control samples when compared to the respective non-
infected time-point control.

Figur e 2. Kinetics of gene expression in skin after Argulus japonicus infection of common
carp (Cyprinus carpio L.). Fish were exposed to 150 larval parasites/tank by bath challenge.
Skin samples were collected at different time points post-infection from non-infected fish,
non-infected spots of infected fish (autologous control) and infected spots from infected fish.
Expression was determined by Real-Time quantitative PCR and expressed relative to S11
protein of the 40S subunit. Data represent mean values of n=5 infected fish and n=3 time-
point controls (SD). Symbol * represents a significant difference as compared to the non-
infected time-point control. Symbol a indicates a significant difference as compared to the
autologous control.

Histological analysis
To investigate whether chemokine (CXCa) up-regulation of gene transcription could be
related to increased transcription activity in leukocytes already present in the skin or to an
increased number of leukocytes in the skin following infection, we performed a histological
analysis of the skin samples. Figure 3B shows a massive infiltration by leukocytes at the site
of infection. A large amount of inflammatory infiltrate can be observed in both the mildly
Chapter 8
150
hyperplastic epidermal and dermal tissue and also throughout the whole subcutaneous fatty
layer. A very low number of leukocytes could be observed in control skin samples (Fig. 3A).

Figur e 3. Histological analysis of carp skin. A) Skin sample from a control, non-infected fish. Note
that there are only a few scattered leukocytes and no inflammation of the tissues (magnification =
1000x), L =leukocytes, m =melanophores and ac =club cells. B) Skin sample from A. japonicus
infected fish. Infected spot collected 2d p.i., at site of parasite feeding. A crater can be observed in the
epidermis and apical part of the dermis. A high degree of leukocyte infiltration can be observed in
both the mildly hyperplastic epidermal and dermal tissue (thick arrows) and a large number of
leukocytes can also be seen dispersed throughout the subcutaneous fatty layer (thin arrows). Note the
leukocytes dispersing from the blood vessel at the top right of the image (magnification =300x).
151
Discussion
We investigated the immune response of common carp to freshwater lice from the genus
Argulus. The most pronounced upregulation of gene transcription was observed for the
chemokine CXCa in the skin at 1-2 days post-infection with larval Argulus japonicus. At the
same time a massive infiltration by leukocytes, most likely neutrophilic granulocytes, at the
site of infection could be observed in histological sections of the skin. At day 6 post-infection
immune gene transcription was up-regulated not only in infected skin but also, although to a
lesser extent, in autologous skin sample controls collected from non-infected spots of infected
fish. This suggests that the response to A. japonicus larval stages is initially restricted to the
site of infection but is extended to a generalised response throughout the skin as a whole
organ at a later stage of the infection. In PBL, transcription levels of the investigated genes
varied greatly in control fish, emphasizing the importance of time-point control samples for
gene transcription studies.
During our experiment, the first visible red, inflamed spots were not observed until
approximately 2 days post-infection, despite the attachment of several larval lice to the skin of
exposed fish as early as 2h post-infection. In other experiments, the first notable response to
argulid infestations, observed as small red areas (up to several mm in diameter), has been
noted even within a few hours post-infection (Walker et al., 2004). Although we could
confirm infection for each individual fish, the infection pressure in our experiment was
relatively mild as shown by a mean infection intensity of 3.8 attached parasites per fish.
Further, we chose to investigate the immune response to larval rather than juvenile or adult
lice. Adult argulids are quite mobile being able to glide over the surface of their hosts with
relative ease using their maxillary suckers (Kearn, 2004). This can result in multiple sites of
infection on the same host being caused by one parasite at different times. However, larval
stages tend to be less mobile and remain relatively stationary, anchoring themselves to their
hosts integument via the use of their hook-like 2
nd
antennae (Walker et al., 2004). Argulus
spp. cause direct damage to the fish skin through their attachment and feeding mechanisms
although, typically, the craters do not penetrate much deeper than the epidermis (Lester and
Roubal, 1995). Skin damage is the result of mechanical actions of the maxillary suckers in
adult lice and hooks or spines in larval and juvenile stages and the sharp mandibles. In
addition, damage results from various toxins or digestive enzymes secreted via the pre-oral
stylet and labial spines (Shimura and Inoue, 1984).
Two days post-infection, levels of CXCa transcripts were up-regulated in skin samples
collected at the sites of infection (infected spots), and were significantly different from the
Chapter 8
152
levels measured in skin isolated not only from non-infected control fish, but, also from
autologous skin samples collected from non-infected spots of infected fish. At the same time
point, TNF and CXC receptor-1 (CXCR1) transcription were found to be up-regulated with
respect to the autologous control. In comparison to the response observed 1-2 days post-
infection, at 6 days post-infection a clear upregulation of CXCa, TNF and, to a lesser extent,
IL-10 transcripts was observed in skin samples collected from both infected and non-infected
spot of the infected fish. These results indicate that whilst the immune response to A.
japonicus larval stages (2 days post-infection) is restricted to the site of infection, the response
to juvenile stages (6 days post-infection) is extended throughout the skin as a whole. For A.
japonicus, in fact, a succession of moults takes place approximately every 5 days, depending
on the ambient temperature (Fryer, 1982). It is likely, also during our experiment, that after 5
days A. japonicus larval stages started to moult and migrate over the skin of the fish host. This
would explain why the change in gene expression profile was similar, although somewhat
smaller, between autologous skin sample controls and infected skin samples. The observed
results are suggestive of migrating A. japonicus affecting the skin as a whole organ.
In contrast to the results obtained after the analysis of the skin samples, changes in
gene expression in samples collected from PBL were found to be significantly different only
when compared to the controls at time zero, indicating the vital importance of time point
controls when employing RT-qPCR analyses of gene expression, at least in PBL. The same
PBL samples were used for a flow cytometric analysis (unpublished data) using antibodies
directed against carp macrophages (Weyts et al., 1997) and granulocytes (Nakayasu et al.,
1998). In this flow cytometer experiment we found a very high fish-to-fish variation not only
between infected but also between non-infected individuals, confirming the importance of
proper time-point controls, especially when analysing PBL.
In the present study we show an up-regulation of the chemokine CXCa in the skin of
common carp exposed to larval A. japonicus at 1-2 days post-infection. Although at the same
time-point transcription of the chemokine receptor CXCR1 and of the cytokines IL-1 and
TNF seemed to be upregulated, these changes were not significantly different from the non-
infected controls. Although not significant, probably due to the large individual variation,
these changes might reflect a biologically relevant phenomenon. The same immune genes
(CXCa, CXCR1, IL-1), in fact, were up-regulated in carp skin at 1.5-2 days after infection
with the ectoparasite Ichthyophthirius multifiliis (Gonzalez et al., 2007). The chemokine
CXCa and the chemokine receptor, CXCR1, have been implicated as factors stimulating the
migration of neutrophilic granulocytes towards sites of infection (Huising et al., 2003). We
153
noticed an increase in number of infiltrating leukocytes, most likely neutrophilic granulocytes,
at sites of skin damage in histological sections of carp skin infected by A. japonicus. This
would suggest a correlation between up-regulation of CXCa (CXR1) and the migration of
neutrophilic granulocytes. Recently, a study in carp skin on the changes in gene transcription
induced purely by mechanical injury reported an up-regulation of the same set of genes:
CXCa, CXCR1, IL-1 and to a lesser extent TNF 2-3 h after injury (Gonzalez et al., 2007).
In the latter study also migrating neutrophils were observed in histological sections of
damaged skin. In general, the results of tissue damage are recognized at the cell level via
receptor-mediated detection of intracellular proteins (alarmins) released by dead cells and,
indeed, endogenous alarmins but exogenous pathogen-associated molecular patterns (PAMPs)
also convey similar (immune) responses and can be considered subgroups of a larger set, the
damage-associated molecular patterns (DAMPs) (Bianchi, 2007). The CXCa, CXCR1 and IL-
1beta genes especially, seem to be part of a set of immune genes in fish that are commonly
induced by DAMPs.
We aimed to design an optimal animal experiment by using a mild pathogen load
mimicking a natural situation where both host and parasite are expected to co-exist and
survive. We used time-point controls for both skin and PBL samples. These latter controls
were shown to be essential since differences in transcription levels noted especially in the
PBL samples were significant only when compared to the controls at time-point zero. In
addition, we used autologous skin samples as controls for infected spots from the same fish,
an approach which proved highly informative, especially at later time points. In conclusion,
we demonstrate that in the skin of carp exposed to larval/juvenile A. japonicus up-regulation
of gene transcription for the chemokine CXCa and to a lesser extent the chemokine receptor
CXCR1 and the cytokines IL-1 and TNF are good indicators of parasite-induced skin
damage. Up-regulation of gene transcription corresponded well with an increase in leukocyte
numbers, possibly neutrophilic granulocytes, in skin samples collected at the sites of
infection.

Acknowledgements

This work was funded by the European Community's Improving Human Potential Programme
under contract HPRN-CT-2001-00214, PARITY, including a fellowship for MF and PDW.
The authors also wish to thank T. Spanings for fish husbandry and M. J oerink, J .J . Taverne-
Thiele, S. Gomez and W. Abbink for assistance with fish sampling.
Chapter 8
154
Refer ences

Bianchi, M. E. (2007). DAMPs, PAMPs and alarmins: all we need to know about danger.
Journal of Leukocyte Biology. 81, 1-5.
Boxshall, G. A., Defaye, D. (1993). Pathogens of Wild and farmed Fish Sea Lice.
Chichester, U.K. 378pp.
Gonzalez, S. F., Buchmann, K. and Nielsen, M. E. (2007). Real-time gene expression analysis
in carp (Cyprinus carpio L.) skin: inflammatory responses caused by the ectoparasite
Ichthyophthirius multifiliis. Fish and Shellfish Immunology. 22, 641-50.
Gonzalez, S. F., Huising, M. O., Stakauskas, R., Forlenza, M., Verburg-van Kemenade, B. M.
L. and Buchmann, K., Nielsen, M. E. And Wiegertjes, G. F. (2007). Real-time gene
expression analysis in carp (Cyprinus carpio L.) skin: inflammatory responses to
injury mimicking infection with ectoparasites. Developmental and Comparative
Immunology. 31, 244-54.
Huising, M. O., Stolte, E., Flik, G., Savelkoul, H. F. and Verburg-van Kemenade, B. M. L.
(2003). CXC chemokines and leukocyte chemotaxis in common carp (Cyprinus carpio
L.). Developmental and Comparative Immunology. 27, 875-88.
Iger, Y., Lock, R. A., van der Meij, J . C. and Wendelaar Bonga, S. E. (1994). Effects of
water-borne cadmium on the skin of the common carp (Cyprinus carpio). Archives of
Environmentl Contamination and Toxicology. 26, 342-50.
Irnazarow, I. (1995). Genetic variability of Polish and Hungarian carp lines. Aquaculture
Research. 129, 215-19.
J ohnson S. C., Albright L. J . (1991). The developmental stages of Lepeophtheirus salmonis
(Kryer, 1837) (Copepoda: Caligidae). Canadian Jounal of Zoology. 69, 929-50.
Krkoek, M., Lewis, M. A., Volpe J . P. (2004). Transmission dynamics of parasitic sea lice
from farm to wild salmon. Proceedings of the Royal Society of London. Series B,
Biological Sciences. 272, 689-96.
Lester, R. J . G. and Roubal, F. (1995). Phylum Arthropoda. In:Woo PTK, editor. Fish
Diseases and Disorders. Wallingford, UK: CAB International. pp. 475-498.
155
Lindenstrm, T., Buchmann, K. and Secombes, C. J . (2003). Gyrodactylus derjavini infection
elicits IL-1beta expression in rainbow trout skin. Fish and Shellfish Immunology. 15,
107-15.
Lindenstrm, T., Secombes, C. J . and Buchmann, K. (2004). Expression of immune response
genes in rainbow trout skin induced by Gyrodactylus derjavini infections. Veterinary
Immunology and Immunopathology. 97, 137-48.
Nakayasu, C., Omori, M., Hasegawa, S., Kurata, O. and Okamoto, N. (1998).Production of a
monoclonal antibody for carp (Cyprinus carpio L.) phagocytic cells and separation of
the cells. Fish and Shellfish Immunology. 8, 91-100.
Nolan D. T., van der Salm A. L. and Wendelaar Bonga, S. E. (2000). The host-parasite
relationship between the rainbow trout (Onchorhynchus mykiss Walbaum) and the
ectoparasite Argulus foliaceus L. (Crustacea: Branchiura): epithelial mucous cell
response, cortisol and factors which may influence parasite establishment.
Contributions to Zoology. 69, 57-63.
Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Research. 29, e45.
coregoni Thorell (Crustacea: Branchiura). Bulletin of the Japanese Society for Science
and Fisheries. 50, 729.
Sigh, J ., Lindenstrm, T. and Buchmann, K. (2004). The parasitic ciliate Ichthyophthirius
multifiliis induces expression of immune relevant genes in rainbow trout,
Oncorhynchus mykiss (Walbaum). Journal of Fish Diseases. 27, 409-17.
Sigh, J ., Lindenstrm, T., Buchmann, K. (2004). Expression of pro-inflammatory cytokines in
rainbow trout (Oncorhynchus mykiss) during an infection with Ichthyophthirius
multifiliis. Fish and Shellfish Immunology. 17, 75-86.
Tam, Q. and Avenant-Oldewage, A. (2006). The digestive system of larval Argulus japonicus
Tichopad, A., Dilger, M., Schwarz, G. and Pfaffl, M. W. (2003). Standardized determination
of real-time PCR efficiency from a single reaction set-up. Nucleic Acids Research. 31,
122.
van der Salm, A. L., Nolan, D. T., Spannings, F. A. T. and Wendelaar Bonga, S. E. (2000).
common carp Cyprinus carpio (L.) skin. Journal of Fish Diseases. 23, 173-84.
Chapter 8
156
for Experimental Biology. 55, 107-129
Wells, A., Grierson, C. E., MacKenzie, M., Russon, I. J ., Reinardy, H., and Middlemiss, C.,
Bjrn, P. A., Finstad, B., Wendelaar Bonga, S. E., Todd, C. D. and Hazon, N. (2006).
Physiological effects of simultaneous, abrupt seawater entry and sea lice
(Lepeophtheirus salmonis) infestation of wild, sea-run brown trout (Salmo trutta)
smolts. Canadian Journal of Fisheries and Aquatic Sciences. 63, 2809-21.
Weyts, F. A. A., Rombout, J . H. W. M, Flik, G. and Verburg-Van Kemenade, B. M. L.
(1997). A common carp (Cyprinus carpio L.) leucocyte cell line shares morphological
and functional characteristics with macrophages. Fish and Shellfish Immunology. 7,
123-33.

157

Chapter 9

General Discussion

Chapter 9
160
A detailed knowledge of fish parasites biology and ecology and the effects parasites have on
their hosts is of huge importance, even more so today than in the past due to the ever
increasing role of aquaculture and fisheries in supplying global protein demands. Parasites of
fish cause high commercial losses in both the aquaculture (Menezes et al., 1990) and fisheries
industries (Taylor et al., 2006; Krkoek et al., 2007) and can have serious socio-economic in
both developing and developed countries (Barber et al., 2000).
The intimate relationship between parasites and there hosts have typically co-evolved
over countless generations. Parasites are continually locked in an evolutionary arms race (Red
Queen Hypothesis; see Woolhouse and Webster, 2000) with their hosts, each species
constantly evolving new strategies to increase its fitness and gain an advantage over the other.
Ultimately however a parasite must aim to have a minimum negative impact upon its host so
that it does not directly, or indirectly, cause the death of the host, thus forcing the parasite to
locate a new host or perish with its current one. Parasitology, the study of parasites and their
habits, provides valuable information about how parasites live, reproduce, feed and interact
with their hosts.

Aims
The aim of this PhD research project was to identify key areas in which information regarding
the ecology, physiology and host-parasite interactions of A. foliaceus and A. japonicus was
lacking and subsequently try through field observations and experimental investigations to
bridge some of these gaps in our knowledge of these economically important parasites.
In order to realize precisely what was missing it was important to first gain a thorough
understanding of what information was currently available. This was achieved by the
compilation of an extensive literature review presented in Chapter 2, which reviews the
majority of the available published material on these animals. From this review it became
apparent that there were important topics where information was indeed lacking or
contradictory. Much of the contradictory statements in the literature appeared to be the result
of statements being made in the absence of sufficient scientific evidence to support the claims.
Chapter 2 concludes by stating that much of the basic knowledge regarding these organisms
biology is still not fully understood and in many cases may prove vital to our understanding of
the complex relationships between pathogens and their hosts. The following synthesis will
show how this thesis has contributed to the knowledge regarding Argulus spp. and their hosts.
Like all scientific investigations however, it has also resulted in the generation of new
General Discussion
161
questions, confirming that the more we discover about a topic, the more we realize we have
yet to discover.
Survival
2,6,7
Temperature, developmental
stage and species effects off-host
survival times.
Host location/Host
preference
2,3,4,5
Different development stages
use different host species.
Larvae occur more often on
sticklebacks, adults on carp
Larger hosts have more lice
Feeding
2,6,7,8
Adult A. japonicus eat whole
blood.
Larval A. japonicus do not eat
whole blood.
Host response
2,7,8
A. japonicus cause significant
damage to the epithelium of their
host.
Carp exhibit a typical
inflammatory response similar to
that exhibited during mechanical
skin damage.
Egg
Adults
Larvae
Attachment
2,6,7,8
Starvation, temperature and
development stage have a
significant effect on parasite
viability.
H
A
T
C
H
I
N
G
DEVELOPMENT
R
E
P
R
O
D
U
C
T
I
O
N
Argulus
Survival
2,6,7
Temperature, developmental
stage and species effects off-host
survival times.
Host location/Host
preference
2,3,4,5
Different development stages
use different host species.
Larvae occur more often on
sticklebacks, adults on carp
Larger hosts have more lice
Feeding
2,6,7,8
Adult A. japonicus eat whole
blood.
Larval A. japonicus do not eat
whole blood.
Host response
2,7,8
A. japonicus cause significant
damage to the epithelium of their
host.
Carp exhibit a typical
inflammatory response similar to
that exhibited during mechanical
skin damage.
Egg
Adults
Larvae
Adults
Larvae
Attachment
2,6,7,8
Starvation, temperature and
development stage have a
significant effect on parasite
viability.
H
A
T
C
H
I
N
G
DEVELOPMENT
R
E
P
R
O
D
U
C
T
I
O
N
Argulus

Figure 1. Schematic representation of the way the environment (both abiotic and biotic)
influences the distribution of a generalised argulid via effects on its behaviour, ecology and
physiology. Key aspects of the life history between larval hatching and adult
maturation/reproduction and how these aspects are interrelated are shown. Numbers given
in text boxes correspond with chapters in this thesis, where each of these aspects is
addressed to some extent.
Chapter 9
162
The diagram presented in the introductory chapter of this thesis (Chapter 1, Fig. 1)
illustrates key topics addressed in subsequent chapters. This diagram is presented here in an
amended form (Fig. 1) and the following discussion will aim to highlight how, through the
various chapters in this thesis, we have increased our knowledge on these aspects of Argulus
parasitology. The ways in which these aspects are inter-related will be discussed
simultaneously.

Life Cycle
As illustrated in Fig. 1, upon hatching, the larval argulid is a free-swimming animal with a
finite energy reserve. This parasite must survive (Survival) long enough to successfully locate
a suitable host (Host location; Host preference). Once a potential host has been identified the
larval parasite must attach to its host (Attachment) before it can begin feeding (Feeding). The
feeding activities of this parasite cause damage to its host and this elicits various responses
from the host including activation of stress and immune responses, and often includes
behavioural changes such as flashing behaviour and leaping clear of the water to try and shed
lice (Chapter 2; Wesenberg-Lund, 1982). As the larval parasite matures, it may switch hosts
several times. Reasons for host switching are not clear but may include accidental
dislodgement of the parasite, competition for a suitable attachment/feeding site or it may be
some aspect of host-preference exhibited by the lice. Once the parasite becomes sexually
mature it must locate a female in order to reproduce. Copulation typically occurs on a host
fish (Chapter 2). In order to locate a suitable mate, parasites may be forced to abandon their
hosts. Once a female has mated she must then also abandon her host to deposit her eggs on a
suitable substrate.
The life cycle of an argulid includes a constant switching between on-host and off-host
periods. Each time a parasite loses contact with its host it must therefore survive for an
indefinite period of time off-host (Chapter 6) until it can successfully locate a new host
(Chapters 2, 3, 4 and 5) upon which it can attach and feed (Chapters 2, 6, 7 and 8). Feeding
activities of these lice will ultimately illicit a response in their hosts (Chapters 2, 7 and 8)
which may result in unfavourable conditions for the parasite resulting in it changing location
on the host or once again abandoning its host in search of a more preferable one (Chapters 2,
3, 4, 5 and 7). And so each time the cycle continues with the parasite constantly facing
challenges relating to survival, host location, attachment, host preference, feeding and host
responses.

General Discussion
163
Host location/Host preference
Q1) Are some fish species more likely to be infested with A. foliaceus?
A1) Yes.
It has been frequently stated that parasites from this genus show little or no host
specificity (Chapter 2, 3, 4 and 5 and references therein). Studies by (among others) Kennedy
(1974), Lamarre and Cochran (1992), Mikhhev et al. (1998),Evans and Mathews (2000),
Pasternak et al. (2000) and Mikheev et al. (2004), suggest that whilst species such as A.
foliaceus, A. japonicus and A. coregoni may be capable of infecting practically any freshwater
fish they encounter, various factors may result in some fish being more prone to infestation
than others. Despite the countless records of A. foliaceus from a multitude of different host
species there appeared to be a lack of studies regarding the epidemiology of this parasite
within natural systems.
Individual species seem to have an important influence on infection levels (Chapter 3).
We concluded on the basis of evidence from our study and the studies of Mikheev et al.
(2003) and Bandilla et al. (2005), that within natural water bodies the chances of an individual
fish becoming infected with A. foliaceus are dependent mainly upon the risk of encountering
this parasite rather than upon factors such as species preferences.
Q2) Are larval, juvenile and adult lice distributed similarly within the host community?
A2). No.
Large, slow moving, bottom feeding fish seem most prone to infection by adult lice
whereas smaller slow moving fish that typically inhabit shallow littoral regions of a water
body seem more prone to infection from larval lice (Chapters 3 and 4). The 'en-masse'
hatching of larval lice from egg strands deposited in these littoral regions can lead to large
high infection intensities with some sticklebacks harbouring tens of larval lice and even as
many as 143 on one specimen (Chapter 5).
Q3) Are larger fish more heavily infested with A. foliaceus than smaller fish?
A3) Partly.
Chapters 3, 4 and 5 provide an overview of the distribution of A. foliaceus on various
fish species within a semi-natural water body. The results clearly indicate that within a mixed
fish community certain fish individuals are more likely to become infested than others. It
appears that size plays an important role in infection dynamics, as it does with many other
ectoparasitic species (Cochrane, 1985; Poulin, 1993; Poulin, 1999; Poulin, 2000; Poulin et al.,
1991; Rzsa, 1997; Tucker et al., 2000). The observed pattern is that larger fish are infested
with higher numbers of lice. Preliminary investigations with A. japonicus infecting common
Chapter 9
164
carp under controlled laboratory conditions suggest that this pattern of larger fish acquiring
greater numbers of lice also holds true in aquaria. However, this does not necessarily mean
that these larger fish are more heavily infested. At this stage we must consider the
implications of the size of the parasite in relation to the host.
Lower numbers of lice do not necessarily infer less negative consequences for the host
animal. J ust one or two adult Argulus on a 3cm stickleback, for example, may have
significantly higher, possibly even lethal, consequences. However, large carp can carry
significantly higher numbers of lice without significant deterioration in condition (Chapter 4).

Survival
Q4) Does temperature affect the off-host survival time of A. foliaceus and A. japonicus?
A4) Yes.
During the search for a host, argulids survive as self-sufficient organisms either relying on
stored energy in the form of yolk (newly hatched larvae) or their last meal (Chapter 2 and 6).
The period of time these animals can survive without feeding on a host varies according to
various published data (e.g. Shafir and Oldewage, 1992; Mikheev et al., 2003; Hakalhati et
al., 2005). In Chapter 6 we investigated the effect of life history stage and temperature on the
off-host survival and viability of A. foliaceus and A. japonicus. This chapter showed that
temperature significantly affects the off-host survival of these two species. A. japonicus
apparently had a higher tolerance to warmer temperatures than its native European
counterpart A. foliaceus which appeared to survive better at slightly lower temperatures.

Q5) What are the maximum off-host survival times of these two species?
A5) A. japonicus =13 days; A. foliaceus =14 days.
The maximum survival times for these species were observed with adult lice. In Chapter 6 it
has been shown that the three developmental stages (larval, juvenile and adult) all differ in
terms of their off-host survival times with adults surviving longer than juveniles and juveniles
surviving longer than larvae.
The difference in off-host survival times between species, life history stages and at
different temperatures probably accounts for the varying reports within other published
literature. It is hoped that the information presented in Chapter 6 will serve as more definitive
reference guide for researchers working with these parasites in the future. Information of this
kind may also prove useful in developing management strategies (e.g. fallowing of ponds and
other fish rearing systems) to control these potentially devastating parasites. With the onset of
General Discussion
165
global warming A. japonicus may continue to extend its distribution northwards. More
information regarding the biology and pathogenicity of this species compared to native
Argulus spp. may prove vital in preventing serious economic damage to freshwater fish stocks
in the future.

Attachment
Q6) Does temperature affect the attachment success of A. japonicus?
A6) Yes.
In Chapter 6 evidence was presented that at certain temperatures A. japonicus is more
successful at locating and attaching to a host than at other temperatures. These "preferred"
temperatures were similar to those reported as optimal temperatures for locomotion in A.
foliaceus (Kollatsch, 1959). Such data are lacking for A. japonicus.

Q7) Does starvation affect the attachment success of A. japonicus?
A7) Yes
Data presented in Chapter 6 show that short periods of starvation do not significantly affect
the attachment success of A. japonicus. For larval lice this was up to 2 days and for adult lice
up to 3 days. After these short periods, however, there is a significant daily decrease in
attachment success of these lice. After 5 days for larvae and 7 days for adults the parasites
apparently do not have sufficient energy reserves for locomotion and consequently lose all
ability to successfully locate a host fish and attach to it.

Feeding
Q8) What does A. japonicus actually eat?
A8) Whole blood (including intact erythrocytes)
Until recently it was difficult to find any clear statement regarding what these parasites
actually eat (e.g. Kabata, 1970; Lamarre and Cochran, 1992; Gresty et al., 1993; Pasternak et
al., 2000; van der Salm et al., 2000; Kearn, 2004). In Chapter 7 we discuss feeding in A.
japonicus including recent reports by Tam and Avenant-Odewage (2006) regarding feeding in
newly hatched argulids. In addition, the first evidence that an argulid (A. japonicus) does in
fact consume whole blood, complete with whole erythrocytes, is presented. This has further
implications for the development of anti-parasite treatments and the role of argulids as vectors
for other pathogens that may be transmitted through fish blood (Ahne, 1985; Kearn, 2004 and
references therein; Chapter 2 and references therein). In addition it is proposed that future
Chapter 9
166
work should conduct similar investigations with other species of Argulus to evaluate how
widespread hematophagy is within this parasite genus and outside of this genus in other
branchiurans which lack the pre-oral stylet (e.g. Dolops spp.). If not, then it may provide
further evidence that the pre-oral stylet is intimately involved in Argulus feeding activities
perhaps by the introduction of a hemolytic substance and/or anti-coagulant from the glands
described by Wilson (1903) that are located at the base of the stylet.

Host response
Q9) Does A. japonicus elicit an immune response in common carp?
A9) Yes.
Despite argulids being widely reported as causing significant damage to their hosts there
is very little published material detailing the damage caused to the hosts by these animals
feeding activities. There is also little known about immune responses of fish to these lice.
Recent advances in the field of fish immunology have provided us with useful molecular tools
to investigate immune responses to parasites in fish. The skin of fish typically provides the
first line of defense against infectious agents. In spite of this fact there is very little
information available relating to immune response mechanisms and associated gene
transcription in the organ (Forlenza et al. 2008). In chapter 8 we provide an overview of
immune responses elicited in the skin of juvenile common carp (Cyprinus carpio) by damage
caused by the attachment and feeding activities of A. japonicus. Host fish for this study were
infected with larval parasites and the results illustrate the timing of the immune response
discussed in relation to the feeding habits of early life stages of this parasite species. An
investigation into the effects of adult lice on the host would be most welcome but sadly was
not possible within in the timeframe of this project mainly due to problems associated with
the parasite culture. It is perceived that, because adults feed on whole blood and juveniles do
not, host responses to adult lice feeding activities may be somewhat different to those
occurring in response to feeding activities of early life stages of A. japonicus. The response of
different host species to Argulus spp. has been reported to differ (Kaestner, 1967). Controlled
infection studies comparing the responses of different host species to infection with Argulus
are now required to evaluate such reports.

General Discussion
167
Refer ences

Bandilla, M., Valtonen, E. T., Suomalainen, L. R., Aphalo, P. J . and Hakalahti, T. (2006). A
link between ectoparasite infection and susceptibility to bacterial disease in rainbow
Barber, I., Hoare, D. and Krause, J . (2000). Effects of parasites on fish behaviour: a review
and evolutionary perspective. Reviews in Fish Biology and Fisheries. 10, 131-165.
Cochran, P. A. (1985). Size selective attack by parasitic lampreys: consideration of alternative
null hypotheses. Oecologia. 67, 137-141.
Evans, D. W. and Mathews, M. A. (2000). First record of Argulus foliaceus on the European
eel in the British Isles. Journal of Fish Biology. 57, 529-530.
Forlenza, M., Walker, P. D., de Vries, B. J ., Wendelaar Bonga, S. E. and Wiegertjes, G. F.
(2008). Transcriptional analysis of the common carp (Cyprinus carpio L.) immune
response to the fish louse Argulus japonicus Thiele (Crustacea: Branchiura). Fish and
Shellfish Immunology. (in press).
Gresty, K. A., Boxshall, G. A. and Nagasawa, K. (1993). The fine structure and function of
the cephalic appendages of the branchiuran parasite, Argulus japonicus Thiele.
Philosophical Transactions of the Royal Society. London B 339, 119-135.
Hakalahti T., Bandilla M. and Valtonen E. T. (2005). Delayed transmission of a parasite is
compensated by accelerated growth. Parasitology. 131, 647-656.
Kabata, Z. (1970). Crustacea as Enemies of Fishes. Book 1 of: Diseases of Fishes. Snieszko,
S. F. and Axelrod, H. R. (eds), T. F. H. Publications, J ersey City, USA. pp. 1-171.
Kaestner, A. (1967). Lehrbuch der Speziellen Zoologie; Band 1: Wirbellose, 2. Teil,
Crustacea. Gustav Fischer Verlag, Stuttgart, Germany, 849-1231.
Kearn G.C. (2004). Leeches, Lice and Lampreys: A Natural History of Skin and Gill Parasites
of Fishes. Springer, Dordrecht, The Netherlands, 432pp.
Kennedy, C. R. (1974). A checklist of British and Irish freshwater fish parasites with notes on
Kollatsch, D. (1959). Untersuchungen ber die Biologie und kologie der Karpfenluse
(Argulus foliaceus L.). Zoologische Beitrge. 5, 1-36.
Chapter 9
168
Krkoek, M., Ford, J . S., Morton, A., Lele, S., Myers, R. A. and Lewis, M. A. (2007).
Declining wild salmon populations in relation to parasites from farm salmon. Science.
318, 1772-1775.
LaMarre, E. and Cochran, P. A. (1992). Lack of host species selection by the exotic parasitic
crustacean, Argulus japonicus. Journal of Freshwater Ecology. 7, 77-80.
Menezes, J ., Ramos, M. A., Pereira, T.G.. and Moreira da Silva, A. (1990). Rainbow trout
introductions. Aquaculture. 89, 123-126
Mikheev, V. N., Valtonen, E. T. and Rintamki-Kinnunen, P. (1998). Host searching in
Mikheev V. N., Pasternak A. F. and Valtonen, E. T. (2003). How do fish ectoparasites
Argulus spp. (Crustacea: Branchiura) match with their hosts at the behavioural and
ecological scales? Zhurnal Obshchei Biologii. 64, 238-247.
Mikheev V. N., Pasternak A. F. and Valtonen E. T. (2004). Tuning host specificity during the
ontogeny of a fish ectoparasite: behavioural responses to host induced cues.
Parasitology Research. 92, 220-224.
Pasternak, A. F., Mikheev V. N. and Valtonen E. T. (2000). Life history characteristics of
Poulin, R. (1993). The disparity between observed and uniform distributions: A new look at
Poulin, R. (1999). Body size vs abundance among parasite species: positive relationships?
Ecography. 22, 246-250.
Poulin, R. (2000). Variation in the intraspecific relationship between fish length and intensity
of parasitic infection: biological and statistical causes. Journal of Fish Biology. 56,
123-137.
Poulin, R., Curtis, M. A. and Rau, M. E. (1991). Size, behaviour, and acquisition of
ectoparasitic copepods by brook trout, Salvelinus fontinalis. Oikos. 61, 169-174.
Rzsa, L. (1997). Wing-feather mite (Acari: Protophyllodidae) abundance correlates with
body mass of passerine hosts: a comparative study. Canadian Journal of Zoology. 75,
1535-1539.
opportunistic parasitism in Argulus japonicus (Branchiura). Crustaceana 62, 54-64.
General Discussion
169
Tam, Q. and Avenant-Odewage, A. (2006). The digestive system of larval Argulus japonicus
Taylor N. G. H., Sommerville C. and Wooten R. (2006). The epidemiology of Argulus spp.
Diseases 29. 193-200.
ectoparasite of Atlantic salmon Salmo salar. Diseases of Aquatic Organisms. 49, 145-
152.
van der Salm, A. L., Nolan, D. T., Spanings, F. A. T. and Wendelaar Bonga, S. E. (2000).
common carp, Cyprinus carpio L., skin. Journal of Fish Diseases. 23, 117-184.
Wesenberg-Lund, C. (1982). Biologie der Ssswassertiere: wirbellose Tiere. Strauss and
Cramer, Hirschberg, Germany, 772pp.
Wilson, C. B. (1903). North Amercan parasitic copepods of the family Argulidae, with a
bibliography of the group and a systematic review of all known species. Proceedings
of the United States National Museum. 25, 635-742.
Woolhouse, M. E. J . and Webster, J . P. (2000). In search of the Red Queen. Parasitology
Today 16, 506-508.

Summaries

English summary
172
English Summar y
Parasites of fish play a major role in the economic success of both fisheries and aquaculture
operations. With the continuing expansion and diversification of these industries these
parasites will continue impacting upon the economics of individual operations in a negative
way. This highlights the importance of understanding the biology, ecology and host-parasite
interaction of these animals so that we may ultimately develop management strategies that
reduce the impact of these pathogens whilst inflicting minimal environmental and economic
costs. In this thesis we have examined factors that influence the survival and distribution of an
economically important ectoparasite genus found on freshwater fishes.
Argulus is the parasite that an angler or amateur naturalist is most likely to encounter
in freshwater. This parasite has been reported in the past as exhibiting very low host
specificity and will infect practically any species of fish that it encounters. In the past, and
more recently, research has shown that Argulus is capable of decimating fish stocks and as
such can be considered as a serious pest species. Despite the impact this parasite can have,
there are still huge gaps in our understanding of its physiology, ecology and the effects it has
upon the fish it infects. In chapter 2 we reviewed the information currently available from
published papers, reports and book chapters. This allowed us to identify key areas where
details were lacking or conflicting.
In chapter s 3, 4 and 5 we explored the topic of host preference by examining the
occurrence of native European argulid, Argulus foliaceus, on fish from a mixed species
assemblage in a recreational angling lake. In chapter 3 we found that A. foliaceus does not
have an even distribution among host species within a single water body. Based on the
parasite loads we concluded that slower moving, bottom feeding fish species (e.g. carp,
Cyprinus carpio and bream, Abramis brama) were significantly more prone to infection than
faster, surface feeding species (e.g. rudd, Scardinius erythopthalmus). In addition, we showed
that three-spined sticklebacks (Gasterosteus aculeatus) were more prone to infection by larval
A. foliaceus than any other species. We attributed the differential host-species utilization of A.
foliaceus to the rate of host exposure to lice as determined by ecological and behavioural traits
of both the hosts and parasites.
In chapter s 4 and 5 we examined whether host size influences the infection intensity
of A. foliaceus. Larger hosts were significantly more likely to be infected by A. foliaceus and
typically harboured significantly higher numbers of lice than their smaller counterparts. In
chapter 5 we also observed that below a certain size (approximately 3 cm) sticklebacks were
Summaries
173
not found harbouring lice. The larger surface area of larger hosts is generally regarded as the
determining factor behind why larger hosts are more heavily infected than smaller hosts. We
hypothesised that behavioural differences between large and small fish might also account for
some of the observed differences in infection levels, especially in the case of sticklebacks. We
also pointed out that the consequences of infection for the host can be more severe for smaller
hosts than larger hosts.
In chapter 6 we observed how an abiotic factor, temperature, can significantly affect
the off-host survival and viability of Argulus spp. We compared the off-host survival times at
five different temperatures of larval, juvenile and adult lice from two Argulus species found in
European freshwaters, the native A. foliaceus and the exotic invader A. japonicus.
Temperature had a significant effect on the off-host survival times of both species. We also
observed that the three developmental stages and the two species differed significantly in their
off-host survival times at different temperatures. Starvation and temperature also had a
significant effect on the attachment success of A. japonicus. We concluded that temperature is
an important factor in determining the survival and viability of these two species and that
global warming is likely to have important consequences for the future distribution of A.
japonicus.
In chapter 7 we explored a topic that has been debated frequently in the literature:
what is the diet of Argulus spp.? We used a combination of morphological studies, live
observations, histology and transmission electron microscopy to investigate the feeding
mechanisms and diet of A. japonicus. We concluded that adult lice consume whole blood
from their hosts and are probably predominantly hematophagous (blood feeders). The
morphology of larval A. japonicus, and in particular the size of mouthparts, probably means
these stages cannot ingest whole blood and as such feed on epithelial cells, and tissue fluids.
We also showed that parasites can cause significant damage to the hosts epithelium, which
results in red lesions occurring at sites where the parasites have been feeding.
In chapter 8 we investigated the immune response of common carp (Cyprinus carpio)
to infection from A. japonicus. Here we showed that the response of the fish is similar to the
response caused by simple skin damage and therefore is probably not specific to the parasite.
At sites where the parasite had been feeding inflammation was evident from a significant
infiltration of leukocytes into the tissues surrounding the crater-like wound created by the
feeding parasite.
This thesis has highlighted the need to continue investigations into this fascinating and
economically important group of parasites. With the onset of global warming one is are likely
English summary
174
to see changes in the distribution of many parasite species including Argulus spp. As such it is
important to rapidly gain an understanding of the ways in which these animals can affect their
hosts. We must also continue to gather intelligence regarding these animals biology and how
environmental factors such as temperature can affect this. This intelligence will undoubtedly
prove vital in the future battle against these fish pests.

Summaries
175
Samenvatting (in het Neder lands)
Visparasieten spelen een belangrijke rol bij het economische succes van zowel visserij als
aquacultuur. In samenhang met de voortdurende uitbreiding en diversificatie van deze
bedrijfstakken zijn het de parasieten die voortdurend een negatieve invloed uitoefenen op de
opbrengst. Daarom is een beter begrip van de fysiologie, ecologie en gastheer-parasiet
interacties van deze dieren van groot belang. Met behulp van deze toegenomen kennis zouden
uiteindelijk strategien ontwikkeld kunnen worden om de invloed van deze ziekteverwekkers
te reduceren, tegen minimale milieu- en economische kosten. In dit proefschrift worden de
factoren onderzocht die de overleving en verspreiding van een economisch belangrijk geslacht
van ectoparasieten op vis (Argulus-soorten ofwel Karperluizen) bepalen.
Karperluizen zijn de parasieten die hengelaars of natuuronderzoekers vaak in zoet
water tegenkomen. Deze parasieten zijn in het verleden als zeer weinig gastheerspecifiek
beschouwd omdat ze praktisch elke soort vis die ze tegenkomen parasiteren. Uitvoerig
onderzoek heeft aangetoond dat deze parasieten in staat zijn om de visstand te decimeren, en
daarom kunnen ze worden beschouwd als zeer schadelijke soorten. Ondanks het feit dat de
schadelijke invloed van deze parasieten goed bekend is, zijn er nog steeds grote leemten in
onze kennis van hun fysiologie, ecologie, en van de effecten die deze dieren hebben op de vis
die ze infecteren. In hoofdstuk 2 is de informatie samengevat die bij het begin van dit project
beschikbaar was in de vorm van publicaties, rapporten en boekhoofdstukken. Hierdoor
konden kennisgebieden waar details ontbraken of waar gegevens elkaar tegenspraken, worden
opgespoord.
In de hoofdstukken 3, 4 en 5 wordt de gastheerpreferentie onderzocht van de inheemse
Europese Karperluis Argulus foliaceus op vissen van een vissengemeenschap met meerdere
soorten in een recreatieplas voor hengelaars. En van de conclusies in hoofdstuk 3 was dat A.
foliaceus geen gelijke verdeling over de gastheervissen vertoont binnen eenzelfde waterplas.
Op basis van de aantallen parasieten per vis is geconcludeerd dat langzamer zwemmende,
benthivore vissoorten zoals karper (Cyprinus carpio) en brasem (Abramis brama) door meer
parasieten geparasiteerd worden dan sneller zwemmende, zich meer aan het wateroppervlak
voedende soorten zoals de rietvoorn (Scardinius erythrophthalmus). Bovendien bleek dat
driedoornige stekelbaarzen (Gasterosteus aculeatus) meer genfecteerd worden door larvale
A. foliaceus dan de andere onderzochte vissoorten. De verschillen in gastheergebruik door A.
foliaceus kan worden geweten aan de frequentie van blootstelling aan de karperluizen,
Samenvatting (Dutch Summary)
176
hetgeen wordt bepaald door ecologische en gedragskenmerken van zowel gastheren als
parasieten.
De hoofdstukken 4 en 5 behandelen de vraag of de grootte van de gastheren de
infectie-intensiteit benvloedt. Grotere vissen waren significant meer genfecteerd door A.
foliaceus en droegen doorgaans meer karperluizen bij zich dan hun kleinere soortgenoten.
Onder een zekere grootte (ongeveer 3 cm) waren de driedoornige stekelbaarzen vrij van
karperluizen. Hun grotere oppervlak wordt in het algemeen beschouwd als de reden dat
grotere vissen meer genfecteerd worden dan kleine. Verschillen in gedrag tussen grote en
kleine vissen zou ook de oorzaak kunnen zijn van de verschillen in infectieniveaus, vooral in
het geval van driedoornige stekelbaarzen. Verder kunnen de consequenties van de infectie
ernstiger zijn voor kleinere gastheren dan voor grotere.
In hoofdstuk 6 wordt behandeld hoe een abiotische factor, watertemperatuur,
overleving en activiteit van Argulus-soorten zonder gastheer benvloedt. De overleving van
karperluizen zonder gastheer is onderzocht voor larven, juvenielen en volwassen exemplaren
van twee soorten karperluizen bij vijf verschillende temperaturen. De betreffen soorten zijn de
inheemse A. foliaceus en de exotische invader A. japonicus die in Europa en elders zijn
verspreidingsgebied uitbreidt. De watertemperatuur heeft een significant effect op de
overlevingstijd van beide soorten. Bovendien is waargenomen dat bij verschillende
temperaturen de drie ontwikkelingsstadia en de twee soorten zonder gastheer qua
overlevingsduur significant verschilden. Uithongering en temperatuur hadden ook een
duidelijk effect op het aanhechtingssucces van A. japonicus. De conclusie is dat de
watertemperatuur de overleving en levensvatbaarheid van deze twee soorten bepaalt en dat
daarom opwarming van de aarde waarschijnlijk belangrijk is voor de toekomstige
verspreiding van, vooral, A. japonicus.
In hoofdstuk 7 wordt een onderwerp gexploreerd dat vaak het onderwerp van debat in
de literatuur is, namelijk het dieet van karperluizen. Voor deze studie is een combinatie
gebruikt van observaties aan levende dieren, histologie en transmissie electronenmicroscopie,
teneinde de voedingsmechanismen en het dieet van A. japonicus vast te stellen. Volwassen
karperluizen van deze soort consumeren bloed inclusief de rode bloedcellen en zijn dus vooral
bloedzuigers. De morfologie van de larven van deze soorten, in het bijzonder de grootte van
de monddelen, maakt het hen onmogelijk om het bloed te benutten. Ze voeden zich
waarschijnlijk met epitheelcellen en weefselvloeistof. Ook is aangetoond dat de parasieten
veel schade kunnen aanrichten aan het huidepitheel, wat resulteert in rode laesies op plekken
waar de parasieten zich gevoed hebben.
Summaries
177
In hoofdstuk 8 is de immuunrespons van de gewone karper (Cyprinus carpio) op
infectie door A. japonicus bestudeerd. Deze respons lijkt sterk op de respons die veroorzaakt
wordt door een simpele huidbeschadiging, en is dus niet specifiek voor de parasiet. Op
plekken waar de parasiet zich had gevoed was inflammatie duidelijk zichtbaar als een
infiltratie van leucocyten in een kratervormige wond die veroorzaakt is door de zich voedende
parasiet.
Dit proefschrift maakt duidelijk dat onderzoek naar deze fascinerende en economisch
belangrijke groep van parasieten zou moeten worden voortgezet. De opwarming van de aarde
zal veranderingen veroorzaken in de verspreiding van vele soorten inclusief parasieten
waaronder Argulus-soorten. Daarom is het belangrijk om meer kennis te verzamelen over hoe
deze dieren hun gastheren kunnen aantasten. We moeten ook meer kennis vergaren omtrent
de biologie van deze dieren en hoe omgevingsfactoren zoals temperatuur op hen inwerken.
Zulke kennis zal ongetwijfeld van groot belang zijn bij de toekomstige bestrijding van
visplagen.

Acknowledgements

Acknowledgements
180
Acknowledgements (Dankwoor d)

The completion of the chapters in this thesis marks the completion of a chapter in my life.
During the last few years there have been many characters that have played various roles in
the final script. Some of those roles have been very significant and others less so, but without
each individual contribution, small or large, the experience wouldn't have been the same. The
challenge of undertaking a PhD in Nijmegen was not simply academic. Some of the greatest
challenges were of a more social nature. These challenges would have been infinitely more
difficult had I not been helped and encouraged by colleagues, friends and family. In this
section of my thesis I have the pleasure of thanking all of these people for making my time in
Nijmegen a truly memorable and enjoyable experience.
Sjoerd, the way in which you encouraged all of my ideas kept my own enthusiasm
alive even during the mysterious Argulus vanishing act! Without the freedom you gave me to
travel and collaborate I would not have built up the extensive research network I have now.
Gerard, you only officially joined the Argulus team at a late stage but your input has been
greatly appreciated! Whilst your humour sometimes baffled me it never failed to entertain me.
Declan, my very first contact in Nijmegen! I never imagined that a simple request for
information during my Masters project would lead to me defending a PhD in Nijmegen! Your
tips on surviving in the Dutch workplace and dealing with "The Boss" were a huge help!
Thank you Maia and Ciao for always making me feel welcome in your home. Christophe, the
microscopy skills you taught me have allowed me to show pictures of Argulus at its best.
Thank you to all my colleagues in Animal Ecology & Ecophysiology (Ivan (and your
laugh!), Marij, Iain, Fabio, Raju, J an, Monique, Marieke, Martijn, Chantal and Peter Pepels,
my old room mate and expert on Dunglish!). Of course I can't forget "The Hero of The
Department", Peter C, you made my life so much easier on many occasions and your coffee
helped keep me awake during the day. Aquatic ecologists and experimental plant ecologists
(J osef, Tamara, Coco, Corien, Martin, Eric, J elmer, Xin, J an K, J an v G, J ose & J ose, Heidi,
Hannie, Dries and the rest of you) thank you for your help with fieldwork, statistics and for
socialising around the department. Thanks also to my students Raymond and Maaike,
supervising the two of you was an education.
My colleagues and friends from upstairs, where do I start? The days out, borrels,
football, triathlons etc. all made working in Nijmegen a very social and fun experience. Gert,
from our first meal (with plenty of wine!) after my interview, you always made me feel
welcome and your door was always open to me, thank you. Peter Klaren, Rob, Daisy, Tony,
Dankwoord
181
Feico and Ron, thank you for adding positively to my social experience around the lab. Tom,
thanks for taking care of my fish and for your practical insight into experimental planning.
Frouwke (gliding was awesome!), Wim, Debbie, Peter Cruijsen you've all helped me with
practical matters at some point and it was always hugely appreciated. Angela, I always
enjoyed our lunchtime swims and jogging sessions. Batavierenrace people, in particular
Eduard and Folkert, thanks for organising things and J uriaan I hope you'll remember "eye of
the tiger" every time you run in the future! Thanks to my fellow triathletes for keeping the
competitive spirit alive, especially J uriaan, Geert, Peter Cruijsen and Bevelander. Paco, Ed,
Lock, Marnix, Geert, Martin, Mari, Aniko, Nicole, Adhanet, Tamas, and Eric, thank you for
tolerating my frequent social calls to your department and offices.
Martijn Frieling, thank you for helping me with my health insurance and uitkering
administration, you are a lifesaver! Hopefully we can finally have that beer together! Titti,
meeting you around the university was always a delight and I hope our paths cross sometime
in the future.
Thanks to all the members of PARITY. Geert, in many ways you were an additional
supervisor and always did your best to help me. I cannot thank you enough for your help
during my time in The Netherlands. Maria, I never managed to make you love Argulus like I
do, but, I did succeed in persuading you to conduct an experiment with it! Now we have
published a paper together that we can be proud of. Thanks to Beja for my "introduction to
PCR" and help with our samples. Michael, Dave Dieter and Ilgiz, together with the "young
researchers", Marian, Santiago, Eugene, Montse, Kris, Neli and Dalia, you've made me a
better scientist through your critical discussions of my work.
I made a lot of new friends in Nijmegen and I hope many of these will remain friends
for a long time. Ivor, the first friend I made in Nijmegen, it's quite appropriate that you are
now one of my paranimfs. I have great memories of Carnival in Roermond and I look forward
to your moms legendary erwten soup at next years Carnival! Iain Russon, having you as a
friend always made life more entertaining and I can't wait until our paths cross AGAIN as I'm
sure there will be a story to tell afterwards. Coco, I think we have worn a groove into the floor
with our coffee rounds. We've shared so many "deep conversations", late night minesweeper
games and ruled the dance floor (I remember the circle in Extase!). No matter where we end
up the freaky stones have sealed our fate as being friends forever.
Thank you to my Sint Annastraat housemates, Lodi, Faby and Mari. Lodi, thank you
for always taking the time to solve our internet problems. My "sister" Mari, thank you for
being a part of my family away from home. Our diving experience in Egypt will remain as
Acknowledgements
182
one of the most memorable experiences of my life and is something I would not have enjoyed
without you pushing me to do it. There will be a blanket and cookies for you wherever I live
in the future. Bevelander, it seems very fitting that you're with a girl that can cook such great
food having seen how much you enjoy eating! As with Mari, I considered you a part of my
family rather than a friend. You fit the role of "big brother" perfectly and I enjoyed having
someone around that loved a good fight as much as I did, whether it was on the screen or on
the mats. Thanks to my fellow Zanshin members, especially Gideon, Christian, Bas and Ralph
for the extra lunchtime training sessions, you all taught me so much.
My drinking friends, it's only right that I start here with my other paranimf. Wout, you
were the first person in Nijmegen to do some "serious" beer drinking with me. You started
slow but learned quickly and in the end we set a new standard for what counts as a legendary
session. Our mid-week missions will go down in history and whenever we meet in the future
two things are certain i) there will be tequila involved, ii) it will be very messy!! I should also
mention The Yank (Tyrell) here, because without him the "Night of the Wild Bulls" would
not have been invented and we may never have set such a ludicrous record of 18 bars in one
night! Zemog, you tried to be "one of the guys" and your efforts were brave (you could
certainly keep up with the drinking!) but I'm afraid that no guy would ever wear "those
shorts". Alan, thank you for introducing me to Henne, a debt I can never repay and will owe
you for forever, despite your ulterior motives! Iain, Edwin, Olga, Tom, J anine, Gideon, Aniko
(my favourite fish tank friend!), Bart, Kimmie, Raffa, Noemi, Floor (congratulations on
catching your first shark in Wales), South, Alex, Mark & J essica, Nathalie and all those other
people (sorry if I missed your name!) that made my nights out in Nijmegen so much fun.
Cheers to the whisky drinkers (Lock, Ed, Iain, Bart and co.). Thanks to all the staff and
regulars from O'Sheas (Austin, Kevin, Eddie, Andrew, Nadine, Webb, Mick, Harry, Hans,
Graham and many more). May we never forget the good times had in that bar, especially after
closing time! And Graham...what about the Chinese muddy loach?
Thanks to my fishing buddies. J uriaan, you're a great angler, but you know I'm better
right? I hope that you, Marieke and Timo are still enjoying my aquarium! Iain, Gideon and
Tom, you added a lot to the experience when you were there. Wout, we managed to combine
fishing, drinking and science, resulting in our paper in the "foremost journal in the world on
crustacean research". I'm not sure if that, or the 18 bars, was our finest achievement. No
thanks are extended to the Chinese mitten crabs for frequently causing biotic interference with
my bait.
Dankwoord
183
Thanks to my UK friends for visiting me in Nijmegen. Mike and Dave, I think you've
both visited me in every place I lived so far, a sign of real friendship. Let's hope you make it
to Wales soon! Sped, you took your time but made it in the end buddy. Mike and Erin, rats or
no rats, that timing is still suspicious, good luck with baby J ames. Smash, our visit to Poland
proved to be a real adventure and I hope we can undertake a new adventure together
sometime soon mate. Emmy-Lou, thanks for allowing two stinky boys to stay in your nice
girly flat in Poland and for coming to see me in Nijmegen.
To my colleagues in Wales. Ian, thank you for your patience with me and for not
complaining too much whenever you caught me writing up Nijmegen work! Andy, Nige and
Dan, thanks for your helpful discussions about stats. Andy, thanks for being there to help me
"relax" at the weekends. Thanks to all the other Fish Lab crew, Lewis, Alice, J ulian, Oscar,
Yosef, Rachel, and Tom for making me feel welcome in my new work place.
Alice, Arnold, Rutger, Esgo en natuurlijk oma J o, dank jullie wel voor het warme
welkom dat ik kreeg in jullie familie. Ik beloof dat ik altijd goed voor Henne zal zorgen, waar
we ook gaan in de wereld.
Mum and dad, with the completion of my PhD I hope I have made up for all of those
infuriating times during my high school years! You have supported all the career choices I've
made and encouraged me to always pursue my dreams. I hope I've made you proud. Louise
and Darran, thank you for all the times that you've picked me up from the airport over the last
few years. I must owe you so much petrol money by now! Mark, hearing my older brother say
he was proud of what I'd achieved was one of the best rewards for my efforts I've ever had,
even if we were both several beers into the night when you said it.
And finally Henne, thank you for your patience, understanding and support during all
the nights and weekends that I had to work on my thesis and leave you on your own,
especially after you moved countries for me! Thank you for introducing me to the real joy of
keeping rats, I never realised what fascinating animals they are and our ratjes, especially
Cappuccino, J ut and Madeliefje, will always be remembered for the entertainment they
provided. Most of all, thank you for giving me the comfort of knowing that whatever
challenges I have to face in the future, you'll be there facing them with me.

185
Cur r iculum vitae

Peter Walker was born on the 2
nd
of J anuary 1979 in Blackpool, the UK and grew up in
the small fishing town of Fleetwood. His parents, Kathy and Stewart Walker recognized
from an early age that Peter was likely to pursue a career working with animals having
seen the constant stream of invasive species entering their own ecosystem with some
anthropogenic assistance from Peter. Bugs (invertebrates) seemed to be the creatures that
fascinated Peter the most, that was until he developed a passion for angling. With a
passion for invertebrates and fish, a career in fish parasitology was not surprising because
this research field offered a perfect way to combine both groups of animals for research
purposes. Argulus featured in Peters academic career relatively early on. For his A-level
(College) biology project Peter studied host choice by this animal and whilst the
experiments conducted were of a relatively novice standard the ideas and results were
remarkably interesting. It was during these investigations at just 17years old that Peter
recognized a distinct gap in the knowledge surrounding these animals. This planted the
seed that there was an opportunity to be grasped here. Upon the completion of his A-
levels Peter embarked on his university career by studying Marine and Freshwater
Biology at The University of Wales Aberystwyth, UK. Upon the completion of his
bachelors degree Peter was awarded a Walter-Idris summer research internship at
Aberystwyth working under the supervision of Dr Iain Barber. Here he undertook
investigations examining the way in which parasitic tapeworms affect the behaviour of
the hosts. This resurrected his passion for parasites and when he began the Masters
course in Applied Fish Biology at Plymouth University, UK, there was no doubt
surrounding his choice of research project. It was here that the he became reacquainted
with Argulus and contacts formed during this research project resulted in him being
offered the position of J unior Researcher investigating Argulus at the Radboud University
Nijmegen, The Netherlands. Peter is currently working as a Research Officer at The
Bangor University in Wales (UK) and is an Advisory Editor of the scientific journal,
Crustaceana. From August 2008, he will be employed as an Aquatic Ecologist by APEM,
an aquatic consultancy organisation based in Oxford.

187
Publications

Peer-reviewed papers

Barber, I. Walker , P. & Svensson, P.A. (2004). Behavioural responses to simulated avian
predation in three-spined sticklebacks: the effect of experimental Schistocephalus
infections. Behaviour 141, 1425-1440.

Walker , P. D., Abbink, W., van der Velde, G. & Wendelaar Bonga, S. E. (2006). A new
record of Tracheliastes maculatus Kollar, 1835 (Copepoda, Siphonostomatoida,
Lernaeopodidae) on common bream (Abramis brama L., 1758) in The Netherlands.
Crustaceana 79(8), 1015-1019.

Walker , P.D., van der Velde, G., Harris, J .E. and Wendelaar Bonga, S.E. Size Matters:
stickleback size and infestation with Argulus foliaceus (Crustacea: Branchiura).
Crustaceana 80(11), 1397-1401.

Walker , P. D., Harris, J . van der Velde, G. And Wendelaar Bonga, S. E. Effect of host
size on fish louse distribution. Acta Parasitologica (in press).

Walker , P.D., Harris, J .E., van der Velde, G. & Wendelaar-Bonga, S.E. Differential host
utilization by different developmental stages of the ectoparasite Argulus foliaceus
(Crustacea: Branchiura). Folia Parasitologica (in press)

*Forlenza, M., *Walker , P. D., de Vries, B. J ., Wendelaar Bonga, S. E. & Wiegertjes, G.
F. Transcriptional analysis of the common carp (Cyprinus carpio L.) immune response to
the fish louse Argulus japonicus Thiele (Crustacea: Branchiura). Fish and Shellfish
Immunology (in press)

Walker , P. D., Russon, I. J ., Duijf, R., van der Velde, G. & Wendelaar Bonga, S. E.
Factors affecting the off-host survival and attachment success of the introduced Argulus
japonicus. Folia Parasitologica (submitted)

Walker , P.D., Russon, I.J ., Wendelaar-Bonga, S.E. & Haond, C. Feeding in adult
Argulus japonicus (Crustacea: Branchiura), an ectoparasite on fish. Journal of Fish
Diseases (submitted)

Book Chapter

Walker , P.D., Flik, G. and Wendelaar Bonga, S.E. (2004). The biology of parasites from
the genus Argulus and a review of the interactions with its host. In Host-Parasite
Interactions. Edited by G. Wiegertjes and G. Flik. Garland/BIOS Scientific Publishers,
Abingdon, U.K. pp. 107-129.

Argulus Te Ecology of The Fish Pest

Uploaded by

Copyright:

Available Formats

Argulus Te Ecology of The Fish Pest

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Argulus Te Ecology of The Fish Pest

Uploaded by

Copyright:

Available Formats

Argulus

THE ECOLOGY OF A FISH PEST

You might also like