ASOE Chem - 2012 0 - 1 - 1

ASI School ID:
2012 AUSTRALIAN SCIENCE OLYMPIAD EXAM

CHEMISTRY – SECTIONS A & B
TO BE COMPLETED BY THE STUDENT. USE CAPITAL LETTERS
Student Name: ………………...…..…………………………………………………….

Home Address: ..………………………………….……………………………………..
……………………………………........................................ Post Code: …………...
Telephone: (……….) ……………………………… Mobile: ………………………….
E-Mail: …..……………………………………………... Date of Birth: .…../….../...….
 Male  Female Year 10  Year 11  Other: …….
Name of School: ………………………………………….………………..State: ……...
To be eligible for selection for the Australian Science Olympiad Summer School,
students must be able to hold an Australian passport by the time of team selection
(March 2013).
The Australian Olympiad teams in Biology, Chemistry and Physics will be selected
from students participating in the Science Summer School.
Signature: ……………………………………………… Date: …………………………
Information is collected solely for the purpose of Science Summer School offers. To view the ASI
privacy policy:
www.asi.edu.au
Examiners’ Use Only:
Page 1 of 30
2012 Australian Science Olympiad Exam - Chemistry
©Australian Science Innovations ABN 81731558309
CHEMISTRY
2012 Australian Science Olympiad Exam
Time Allowed:
Reading Time: 10 minutes
Examination Time: 120 minutes
INSTRUCTIONS
• Attempt ALL questions in ALL sections of this paper.
• Permitted materials: Non-programmable non-graphical calculator, pens, pencils, erasers and a ruler.
• Answer SECTION A on the Multiple Choice Answer Sheet provided. Use a pencil.
• Answer SECTION B in the spaces provided in this paper. Write in pen and use a pencil only for graphs.
• Ensure that your diagrams are clear and labelled.
• All numerical answers must have correct units.
• Marks will not be deducted for incorrect answers.
• Rough working must be done only on pages 28 to 29 of this booklet.
• Relevant data that may be required for a question will be found on page 3.
• Do not staple the multiple choice answer sheet to this booklet.
MARKS
SECTION A 15 multiple choice questions 30 marks
SECTION B 3 short answer questions 90 marks
Total marks for the paper 120 marks
Page 2 of 30
DATA
–1 –1
Avogadro constant (N) 6.02 × 1023 mol Velocity of light (c) 2.998 × 108 m s
–3
1 faraday 96,486 coulombs Density of water at 25°C 0.9971 g cm
1 coulomb 1 A s–1 Acceleration due to gravity 9.81 m s
–2
Universal gas constant (R) 1 newton (N) 1 kg m s–2 1k

–1 –1
8.314 J K mol
–2 –1 –1
8.206 × 10 L atm K mol
–34
Planck’s constant (h) 6.626 × 10 J s 1 pascal (Pa) 1 N m–2 1N
Standard temperature and pressure (STP) pH = −log10[H+]
273 K and 100 kPa pH + pOH = 14.00 at 25°C
0°C and 100 kPa Ka = {[H+] [A–]} / [HA]
0°C and 1 bar pH = pKa + log10{[A–] / [HA]}
0°C and 750 mm Hg PV = nRT
E = hν
Molar volume of ideal gas at STP 22.7 L c = νλ
1 bar = 100 kPa Surface area of sphere A = 4πr2
Page 3 of 30
SECTION A: MULTIPLE CHOICE
USE THE ANSWER SHEET PROVIDED
1. Which one of the following compounds is the most acidic oxide?
a. Na2O
b. MgO
c. A2O3
d. SiO2
e. SO2
2. Which one of the following elements has the highest electronegativity value?
a. C
b. S
c. P
d. Si
e. A
3. A working galvanic cell is constructed using an iron electrode in an iron(II) nitrate solution and a
silver electrode in a silver(I) nitrate solution. When the cell runs down, it can be charged up again.
Which of the following scenarios will occur during the charging process?
[Eº(Ag+(aq)/Ag(s) = +0.80 V and Eº(Fe2+(aq)/Fe(s) = –0.41 V]
a. A minimum of 1.21 volts is applied to the cell and electrons move from the silver electrode to
the iron electrode.
b. A minimum of 1.21 volts is applied to the cell and electrons move from the iron electrode to the
silver electrode.
c. A minimum of 0.39 volts is applied to the cell and electrons move from the silver electrode to
the iron electrode.
d. A minimum of 0.39 volts is applied to the cell and electrons move from the iron electrode to the
silver electrode.
e. A minimum of 2.01 volts is applied to the cell and electrons move from the silver electrode to
the iron electrode.
4. DNA consists of two strands that run in opposite directions to each other with one end being labelled
5' and the other 3'. Just like words on a page, DNA is read in one direction, from the 5' to the 3' end.
A restriction enzyme, used to cut DNA, reads the DNA and recognises the sequence GAATTC and
cuts the strands between G and A. If applied to the following helix of DNA how many pieces would
result after denaturing the strand?
5` A GTACGATATAACGAATTCTGACGTAGCGTTAGACTGAATTCATAG 3`
3` T CATCCTATATTGCTTAAGACTGCATCGCAAGCTGACTTAAGTATC 5`
a. 2
b. 4
c. 6
d. 8
e. 10
Page 4 of 30
5. Chlorine occurs naturally as a gas at room temperature, yet iodine is a solid. What is the best
explanation for this behaviour?
a. The iodine molecule is heavier and hence has a lower vapour pressure.
b. The iodine molecule has more electrons and a larger nuclear charge, so it forms stronger bonds
with its neighbours in solid form.
c. The chlorine molecule has a higher electronegativity and hence interacts more strongly with
polar molecules in the atmosphere.
d. The iodine molecule has more electrons over a greater volume, so there are more dispersion
forces due to induced dipoles.
e. The chlorine molecule is polar, and so is more easily displaced from solid or liquid phase by the
molecules in air.
6. What is the pH of a 0.010 mol L–1 solution of a weak monoprotic acid that is 4.0% ionised?
a. 2.00
b. 2.40
c. 2.80
d. 3.40
e. 7.00
7. The salt Na2HAsO4.nH2O is an ionic salt containing n waters of crystallization. In warm air, this
compound readily effloresces and loses these water molecules to its surroundings. If the mass lost
during this process is 40.42% of the original, how many waters of crystallization were there
originally?
a. 1
b. 3
c. 5
d. 6
e. 7
8. Which one of the following elements would be expected to form the largest ion with a noble gas
electron configuration?
a. A
b. C
c. P
d. K
e. S
9. A certain buffer solution contains equal concentration of weak acid (HX) and its conjugate base (X–).
Ka for HX is 2.9 × 10–5. What is the pH of the buffer?
a. 4.53
b. 5.53
c. 7.00
d. 8.47
e. 9.47
Page 5 of 30
10. Which one of the following compounds is both an amine and a ketone?
a. O
H NH2
b. O
NH2
c. O
NH2
d. NH2
e. HO O
NH2
11. The molecules listed below are of the general formula XYn with n≥2. In which is the Y–X–Y bond
angle the greatest?
a. BF3
b. CH4
c. H 2O
d. NH3
e. PC3
Page 6 of 30
12. The enthalpy change of formation (ΔfH0) for a species at 298 K is defined as the enthalpy change
that accompanies the formation of one mole of a substance from its constituent elements in their
standard states. Which of the following species has ΔfH0 = 0 kJ mol–1?
a. H2O(l)
b. Na(g)
c. Na(s)
d. CO2(g)
e. O3(g)
13. Doctor Who has a secret laboratory on Venus where atmospheric pressure is 92 times that of Earth
and room temperature is 735 Kelvin. There, Doctor Who mixes 4.00 g of CaCO3 with 40.00 mL of
1.00 mol L–1 HC. What volume of carbon dioxide gas at VSTP (Venusian Standard
Temperature and Pressure) is produced?
a. 1.81 mL
b. 13.1 mL
c. 26.2 mL
d. 52.4 mL
e. 111 mL
14. Use the standard reduction potential given below to calculate Eº for the following reaction:
Cr2O72–(aq) + 14 H+(aq) + 6 Fe2+(aq) → 2 Cr2+(aq) + 7 H2O() + 6 Fe3+(aq).
[Eº(Cr2O72–(aq)/Cr3+(aq) = +1.33 V and Eº(Fe3+(aq)/Fe2+(aq) = +0.77 V]
a. 0.56 V
b. 0.98 V
c. 1.00 V
d. 2.10 V
e. 3.29 V
15. One way to measure the concentration of a substance is through molality. A 1 molal solution is
defined as 1 mol of substance per 1 kg of the solvent used to make up the solution. What is the
molality of a solution made by dissolving 100 g of bromothymol blue (C27H28Br2O5S) in 1.00 L of
ethanol on a winter’s day at 10ºC? The density of ethanol at this temperature is 0.7979 kg L-1.
a. 0.100 mol kg–1

b. 0.128 mol kg–1
c. 0.160 mol kg–1
d. 0.201 mol kg–1
e. 0.252 mol kg–1
Page 7 of 30
SECTION B: 3 SHORT ANSWER QUESTIONS
ANSWER IN THE SPACES PROVIDED
Question 16
The final step in the industrial production of copper is electrolytic refinement. This process involves
submerging two electrodes in a solution of copper(II) sulfate. One electrode is composed of unrefined
(crude) copper and the second electrode is composed of refined copper. The electrodes are connected and a
current is induced such that copper atoms of the crude electrode lose electrons to form Cu2+ ions that pass
into solution. Simultaneously at the other electrode, copper ions in solution gain electrons and form solid
(refined) copper.
(a) (i) Write the half-equation for the process occurring at the crude copper electrode.
(ii) Is the process occurring at the crude copper electrode oxidation or reduction?
The purpose of electrolytic refinement is to remove impurities present in the crude copper electrode. These
impurities include Fe, Pb, Ni, Co, Ag, Au, Pt, Pd, Ru and Ir.
During electrolytic refinement some of these metals also form ions and pass into solution. Such metals
include Fe, Ni and Co. Other metals do not react at all and form a solid mixture below the anode called the
‘anode mud’. Such metals include Ag, Au, Pt, Pd, Ru and Ir.
(b) Based on the information above, which one of the following would lead to a chemical reaction? Place
your answer of A, B, C or D in the box.
A. Ag(s) is added to a copper(II) sulfate solution.

B. Ir(s) is added to a dilute sulfuric acid solution.
C. Co(s) is added to a ruthenium(III) chloride solution.
D. None of the above
Lead forms Pb2+ ions during electrolysis. Most lead impurity, however, is found in the anode mud and not in
solution.
(c) Why is lead found in the anode mud?
Anode mud provides a raw material from which highly valuable metals may be extracted. After the removal
of lead from the anode mud, the first step in the purification of such metals is treatment of the anode mud
with aqua regia – a mixture of concentrated nitric and hydrochloric acids. In this first step Au(s), Pt(s) and
Pd(s) pass into solution as HAuC4, H2PtC6, and H2PdC4 respectively, whereas Ru and Ir remain as solids
and silver precipitates as AgC(s).
Page 8 of 30
(d) What is the oxidation state of the indicated metal in each of the following compounds?
(i) Au in HAuC4
(ii) Pt in (NH4)2PtC6
(iii) Pd in H2PdC4
(iv) Ru in Sr2RuO4
Next, iron(II) sulfate solution is added to the solution containing HAuC4, H2PtC6, and H2PdC4 in order to
precipitate gold metal, Au. In this process the AuC4– ion is converted into Au(s) and C– ions. Fe3+ ions are
also formed.
(e) Write two balanced half-equations and the overall redox equation for the reaction that occurs when
iron(II) sulfate solution is added.
Oxidation Half-Equation:
Reduction Half-Equation:
Redox Equation:
Anode mud is at most 2.50% gold by mass.
(f) (i) Calculate the maximum mass of gold that can be attained from 75.0 kg of anode mud.
Page 9 of 30
(ii) Calculate the minimum volume of a saturated (1.70 mol L–1) FeSO4 solution that is required to ensure
complete precipitation of gold from 75.0 kg of anode mud.
During electrolytic refinement the concentrations of the soluble impurities – Fe, Ni and Co – build up in the
copper(II) sulfate solution and must be removed before they reach levels that interfere with the refinement
process.
In order to determine the amount of these impurities, the copper(II) sulfate solution obtained after the
refinement of 100.0 kg of crude copper was analysed. The concentration of the copper(II) sulfate solution
remained constant at 1.000 mol L–1 throughout electrolysis.
A 25.00 mL sample of the solution was diluted to 250.0 mL. 20.00 mL aliquots were titrated with a
0.1000 mol L–1 solution of EDTA with an average titre at endpoint of 21.37 mL. EDTA binds strongly to
Cu2+, Fe2+, Co2+and Ni2+ in the following way:
M2+ + EDTA → M(EDTA)2+.
(g) Calculate the total concentration of M2+ ions in solution following refinement.
Page 10 of 30
Triethanolamine was added to 50.00 mL samples of the undiluted solution. Triethanolamine binds to Fe2+,
Co2+ and Cu2+ but not to Ni2+. Triethanolamine-bound metal ions are unable to react with EDTA. Titration
of these aliquots with the 0.1000 mol L–1 EDTA solution gave an average titre of 8.79 mL.
(h) Calculate the concentration of Ni2+ ions in solution following refinement.
Excess ammonium sulfide solution – (NH4)2S – is added to a 100.0 mL sample of the undiluted solution.
Cu2+, Fe2+, Co2+ and Ni2+ ions all form insoluble sulfide salts of the formula MS(s). Filtration, drying and
weighing of the resulting precipitate yielded 10.180 g.
(i) Given that Cu, Fe, Co and Ni are only present in the M2+ form, calculate the concentration of Fe2+ and
Co2+. [Remember the copper(II) sulfate concentration is constant at 1.000 mol L–1.]
More working space can be found on the next page.
Page 11 of 30
[Fe2+]: [Co2+]:
Page 12 of 30
Question 17
Analysis of compounds is essential in Chemistry in order to determine chemical structure. One valuable
method of analysis is mass spectrometry which allows for the mass of a compound to be determined. Mass
spectrometry can be so sensitive that compounds with different isotopes can be differentiated. Therefore,
when determining mass, the exact mass of atoms must be used and not the average mass of naturally
occurring isotopes. The exact masses of some common atoms, expressed in atomic mass units (amu, where 1
amu is 1/12 the mass of a 12C atom), are:
1
H = 1.0078
12
C = 12.0000
14
N = 14.0031
16
O = 15.9949
When drawing organic compounds a simplified method of representing the structure is used to reduce
complexity. Carbon atoms and the implicit hydrogen atoms on carbon atoms are not drawn, so that
H2
C OH
H3C C OH
H2 is identical to
(a) Using exact masses, determine the mass in amu of each of the following compounds when they are
composed of the isotopes listed above.
(i) CH2O
(ii)
NH2
(iii)
O
Page 13 of 30
An example of a mass spectrum of C2H5Br is shown below.
C2H579Br
C2H581Br
The peak corresponding to the mass of the compound is termed the molecular peak (indicated with an arrow
on the above diagram). Some elements exist in nature as a mixture of more than one isotope of high natural
abundance. For example, bromine appears as two abundant isotopes: 79Br (49.3% abundance) and 81Br
(50.7% abundance). Molecules of a compound containing one bromine atom will give rise to two molecular
peaks. One peak will result from molecules that contain 79Br, and the other will result from molecules that
contain 81Br. The two peaks differ by two mass units. The relative intensities of these two peaks correspond
to the natural abundance of the isotopes (49.3 : 50.7).
(b) Consider the following isotopic ratios for different elements.
Isotope Exact mass Natural

(amu) Abundance
35
C 34.9689 75.8
37
C 36.9659 24.2
Molecules that differ from each other only in their isotopic composition are called isotopologues. Determine
the exact mass of each chlorine isotopologue of the following compound and state the relative intensities of
their corresponding peaks in the compound's mass spectrum.
Cl
Page 14 of 30
Electron impact mass spectrometry involves a stream of electrons fired at a molecule dislodging an electron
and creating a radical or lone unpaired electron. These radical compounds are unstable and fragment or
decompose into multiple smaller more stable fragments. The height of the peaks is a representation of the
stability of each fragment with each peak having the isotope ratio discussed above. These fragmentation
patterns are diagnostic for individual compounds but have similarities for compounds with the same
functional groups.
(c)
(i) Examine the following four mass spectra and determine the molecular mass for either isotopologue of
each of the compounds being analysed.
(A) Atoms present C, H and Br.
(B) Atoms present C, H and C.
Page 15 of 30
(C) Atoms present C, H and C.
(D) Atoms present C, H and Br .
(ii) On the basis of fragmentation, determine which pairs of spectra have related functionality and give an
explanation as to how you reached this conclusion.
Page 16 of 30
Before proper analysis can take place a sample must first be purified. One method of purification is known
as gas chromatography. Gas chromatography involves a gas mobile phase that passes through a stationary
phase, which is packed into a column. The phases are chosen such that components of the sample for
purification have different affinities for each phase. A component which is strongly attracted to the stationary
phase will take longer to travel through than a component which is not as strongly attracted to the stationary
phase, especially if the latter has a strong affinity for the mobile phase. As a result of these differences,
sample components will become separated from each other as they travel through the stationary phase. The
time it takes for a compound to leave the stationary phase is called the retention time. At the end of the
stationary phase compounds are detected giving rise to a chromatogram. A chromatogram has a flat line
when no compounds are coming off the column and once a compound is detected this gives rise to a peak.
Different types of compounds are likely to have different retention times measured at the maximum height of
the peak.
(d) Examine each of the following gas chromatograms and give a single retention time for each of the peaks.
(i)
Retention time for peak 1 (min): Retention time for peak 2 (min):
(ii)
Retention time for peak 1 (min): Retention time for peak 2 (min):
Page 17 of 30
Compounds are generally separated on the basis of polarity. Normal stationary phase columns are polar
which means more polar compounds adhere better to the stationary phase and have greater retention times.
(e) Arrange each of the following compounds (using A, B, C, D) in order from lowest retention time to
highest retention time for a normal stationary phase.
O OH
HO
A B C D
Lowest retention time Highest retention time
A reverse stationary phase column is non-polar which means more polar compounds do not adhere as well to
the stationary phase and have lower retention times.
(f) If a mixture of the following two compounds is purified with gas chromatography, one with a normal
stationary phase and another with a reverse stationary phase the following two chromatograms are obtained.
O O
HO HO
E F
Chromatogram 1:
Page 18 of 30
Chromatogram 2:
(i) Identify which chromatogram is obtained when using the normal stationary phase and which is obtained
when using the reverse stationary phase.
normal stationary phase reverse phase stationary phase
(ii) Label the peaks on both spectra identifying which peak corresponds to which compound E or F.
Gas chromatography and mass spectrometry can be combined into one technique known as gas
chromatography mass spectrum (GCMS). This enables a mass spectrum to be obtained for each individual
peak from the gas chromatograph.
(g) A mixture of the following compounds is subjected to GCMS, one with a normal stationary phase and
another with a reverse stationary phase. Label each of the peaks (G, H, I) on both chromatograms.
OH O NH2
G H I
Normal Phase Chromatogram
Page 19 of 30
Spectrum 1: Retention time = 3.22 min
Page 20 of 30
Reverse Phase Chromatogram
Page 21 of 30
Mass spectra obtained from SDBSWeb : http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of

Advanced Industrial Science and Technology)
Page 22 of 30
Question 18
Lewis structures provide a simple model of bonding and lone pairs of electrons and, to some extent,
molecular shape. For example, Lewis structures for water and ammonia are shown below.
O H N H
H H
H
(a) Draw a Lewis structure for each of the following species:
(i) C2O
(ii) PC3
(iii) CS2
The molecular geometry of simple molecules can be predicted by identifying the number of regions of
electron density around the central atom. The AXE method involves counting the number of bonding
regions, denoted ‘X’, (single and multiple bonds are treated identically) and the number of non-bonding
regions, denoted ‘E’, around a central atom, ‘A’.
Bonding (X) Non-bonding (E) AXE designation Molecular geometry

2 0 AX2 linear
2 1 AX2E bent
2 2 AX2E2 bent
3 0 AX3 trigonal planar
3 1 AX3E trigonal pyramidal
3 2 AX3E2 T-shaped
Page 23 of 30
(b) What molecular geometry does each of the following molecules have?
(i) (ii)
O H N H
H H
H
(iii)
F F
B
F
In any covalent bond between atoms of different electronegativity (a measure of the nucleus’ attraction for
electrons) there will be an asymmetric distribution of charge. Such bonds are said to have a bond dipole
moment.
Similarly, if there is an asymmetric distribution of charge over a molecule, it is said to have a net dipole
moment. The presence of individual bond dipole moments and the symmetry of the molecule determine
whether a molecule has a net dipole moment. A molecule will not possess a net dipole moment if the
symmetry of the molecule results in the individual bond dipole moments cancelling each other out.
Bonds or molecules with a net dipole moment are said to be polar.
(c) Circle any polar bonds in the molecules shown below.
(d) Tick the appropriate box to indicate whether or not the molecule is polar.
+
(i) S -
 polar  non-polar
O- O
(ii) O  polar  non-polar
S
O O
(iii)  polar  non-polar
O C O
Page 24 of 30
Vibrational modes are characteristic displacements of one or more atoms in a molecule. A linear molecule
with N atoms will have 3N-5 vibrational modes and a non-linear molecule with N atoms will have 3N-6
vibrational modes.
(e) How many vibrational modes will POC3 have?
For a vibrational mode to absorb infrared (IR) radiation, the displacement of atoms involved must give rise
to a change in the net dipole moment of the molecule. If this occurs, the vibrational mode is said to be “IR
active” and will give rise to an absorption in the IR spectrum.
(f) The table below shows the 3 vibrational modes of SO2 (arrows indicate displacement of the atoms
involved). Indicate which of these will be IR active by filling out the right-hand column.
Vibration type Equilibrium structure Displaced structure IR active?

(Y/N)
symmetric
stretch
asymmetric
stretch
deformation
(g) How many vibrational modes will water have, and how many of these will be IR-active?
Number of vibrational modes: IR-active modes:
Page 25 of 30
IR spectroscopy provides evidence for molecular shape. In the following example, we consider what the IR
spectrum of SO2 would look like if it were linear rather than bent.
(h) The table below shows the 4 vibrational modes of “linear SO2” (again, arrows indicate displacement of
the atoms involved; + and – symbols indicate displacement out of and into the plane of the page
respectively). Complete the table by adding the following features:
(i) Vibration 1: Displaced structure and IR activity.
(ii) Vibration 2: Displaced structure and IR activity.
(iii) Vibration 3: Direction arrows on equilibrium structure to show movement of atoms.
IR active?
Vibration Equilibrium structure Displaced structure
(Y/N)
3 Y
4 + + Y
We would expect “linear SO2” to have four vibrational modes, as shown above, however in practice two of
these vibrational modes are of equal energy. Such vibrational modes are called degenerate and give rise to a
single absorption in the IR spectrum.
(i) Which of the four “linear SO2” vibrational modes in the table above are degenerate (of equal energy)?
(j) How many absorptions in the IR spectrum would you expect for “linear
SO2”?
Page 26 of 30
(k) The table below shows 4 vibrational modes of SO3 (again, arrows indicate displacement of the atoms
involved; + and – symbols indicate displacement out of and into the plane of the page respectively). Indicate
which of these will be IR active by filling out the right-hand column.
Vibration type Equilibrium structure IR active?

(Y/N)
symmetric stretch
asymmetric stretch
+
asymmetric
deformation 1
(doubly degenerate) –
+ +
asymmetric
deformation 2
(doubly degenerate)
(l) Now consider SOC2. How many absorptions in the IR spectrum would you
expect for SOC2?
(m) CF3 has the following T-shaped structure. It has six vibrational modes, none of
which are degenerate. How many of these will be IR active?
Page 27 of 30
BLANK WORKING PAGE
Page 28 of 30
BLANK WORKING PAGE
Page 29 of 30
Integrity of Competition
If there is evidence of collusion or other academic dishonesty, students will be

disqualified. Markers’ decisions are final.
Page 30 of 30

ASOE Chem - 2012 0 - 1 - 1

Uploaded by

Copyright:

Available Formats

ASOE Chem - 2012 0 - 1 - 1

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

ASOE Chem - 2012 0 - 1 - 1

Uploaded by

Copyright:

Available Formats

ASI School ID:

2012 AUSTRALIAN SCIENCE OLYMPIAD EXAM

Student Name: ………………...…..…………………………………………………….

Name of School: ………………………………………….………………..State: ……...

Signature: ……………………………………………… Date: …………………………

Examiners’ Use Only:

Reading Time: 10 minutes

Examination Time: 120 minutes

• Attempt ALL questions in ALL sections of this paper.

• Ensure that your diagrams are clear and labelled.

• All numerical answers must have correct units.

• Marks will not be deducted for incorrect answers.

• Rough working must be done only on pages 28 to 29 of this booklet.

• Do not staple the multiple choice answer sheet to this booklet.

Universal gas constant (R) 1 newton (N) 1 kg m s–2 1k

1. Which one of the following compounds is the most acidic oxide?

[Eº(Cr2O72–(aq)/Cr3+(aq) = +1.33 V and Eº(Fe3+(aq)/Fe2+(aq) = +0.77 V]

a. 0.100 mol kg–1

A. Ag(s) is added to a copper(II) sulfate solution.

(c) Why is lead found in the anode mud?

Anode mud is at most 2.50% gold by mass.

M2+ + EDTA → M(EDTA)2+.

(h) Calculate the concentration of Ni2+ ions in solution following refinement.

More working space can be found on the next page.

(b) Consider the following isotopic ratios for different elements.

Isotope Exact mass Natural

(A) Atoms present C, H and Br.

(B) Atoms present C, H and C.

(D) Atoms present C, H and Br .

Lowest retention time Highest retention time

Normal Phase Chromatogram

Spectrum 2: Retention time = 12.10 min

Spectrum 3: Retention time = 13.21 min

Spectrum 1: Retention time = 1.70 min

Spectrum 2: Retention time = 2.83 min

Mass spectra obtained from SDBSWeb : http://riodb01.ibase.aist.go.jp/sdbs/ (National Institute of

Bonding (X) Non-bonding (E) AXE designation Molecular geometry

Bonds or molecules with a net dipole moment are said to be polar.

(c) Circle any polar bonds in the molecules shown below.

(ii) O  polar  non-polar

(iii)  polar  non-polar

(e) How many vibrational modes will POC3 have?

Vibration type Equilibrium structure Displaced structure IR active?

Number of vibrational modes: IR-active modes:

(i) Vibration 1: Displaced structure and IR activity.

(ii) Vibration 2: Displaced structure and IR activity.

(iii) Vibration 3: Direction arrows on equilibrium structure to show movement of atoms.

Vibration type Equilibrium structure IR active?

If there is evidence of collusion or other academic dishonesty, students will be

You might also like