Ion Torrent TorrentSuite Guide Version 3.4.1

USER DOCUMENTATION
Torrent Suite 3.4.1
Revision Date December 2012
Version 3.4.1
Torrent Suite User Documentation

Welcome to the Torrent Suite User Documentation Home Page. Contents Quickstart Torrent Browser User Interface Guide Torrent Browser Analysis Report Guide Use Cases Technical Notes and Whitepapers
- Page 2 Copyright 2012 Life Technologies Corporation For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.
Version 3.4.1
Quickstart
Quickstart
What's Covered Here?
This guide gives you an overview of concepts and methods involved in working with Ion Torrent analysis data. The Introduction covers the Torrent Browser tabs and how you use templates and planned runs to control your sequencing runs. A high-level view of the run data flow, On Dataflow, should give you a point of reference for understanding the different stages of an analysis run. Learn how to start and monitor a run by reading Start a Run. Learn the basics of how to access and interpret the reports generated by a run, in View Runs and Reports. Finally, in What Next, you can find suggestions for additional reading that gives you more in-depth information about the concepts you have just learned.
Prerequisites
These instructions assume that you have already set up your Torrent Server and can access Torrent Browser. Detailed information about setting up your server is found in the Torrent Server Administration Guide. To manually run an analysis, you must also have a run defined in the run list with experiment data uploaded from the PGM or Proton sequencer to the Torrent Server.
Installed documentation
You can access the installed documentation from the Help menu Local Documentation option:
Quickstart Introduction On Dataflow
Version 3.4.1
Start a Run View Runs and Reports What Next
Introduction
Quickstart
Introduction
Torrent Suite provides an integrated environment to manage your sequencing instrument runs and the resulting sequencing data. The Torrent Browser is organized according to the three main phases of the sequencing lifecycle:
Plan Choose the experimental design for a template that can be reused many times for sequencing runs. Template details include application, reference, BED files, project, plugins, and the export destinations for results files. The Plan tab contains both templates (reusable experiment designs) and planned runs (executable instructions for individual sequencing runs). Monitor View the status of your system and running jobs, including thumbnail quality graphs for current runs. The quality graphs provide near real-time information on your runs, so that you know early on about any instrument issues. Data View summaries of completed runs, detailed run reports, plugin results. Also download output files, download the run report, review the planned run settings, and group result sets into projects for data management such as archival or pruning of result files. The Plan tab The Plan tab contains your experiment templates. These include pre-installed product templates (for instance for products such as the Ion AmpliSeq Comprehensive Cancer Panel) and as well as templates that you create, and areas for recently-used templates and ones you mark as favorites. Product templates contain the appropriate defaults for a product, including the default kits, BED files, and reference. Typically you copy a product template and customize the new template with your choices for project organization and data export handling. Then you reuse your new template to create many run plans, as needed. Each run plan has the correct settings (from the original template). Or you can edit your template when experimental or data handling changes are required. Templates are organized by sequencing application (and by product for some applications): AmpliSeq For Ion AmpliSeq DNA and RNA applications, including the Ion AmpliSeq Cancer Panel and Custom Ion AmpliSeq panels. TargetSeq For TargetSeq applications, with parameters optimized for hybridization-based target enrichment. Whole-Genome Seq For whole genome sequencing applications, which do not assume enrichment and do
Version 3.4.1
not require a target regions file. RNA Seq For RNA sequencing applications. Generic Sequencing For your own applications that do not fit in the other categories. Here you provide all the choices for the experiment. Your choices are not restricted based on a common application workflow. The pre-installed product templates use the correct default references and BED files for the application or product. These templates cannot be edited or deleted, but you can copy them to create and customize your own templates. The Plan tab contains two areas, Templates and Planned Runs:
Plan > Templates
The Templates page includes the pre-installed product templates, templates that you create, a list of recently-used templates, and the list of your favorites. Here is an example of one applications templates:
Plan > Planned Runs
The Planned Runs page contains runs which are ready to execute on the sequencing instrument. You create each planned run from a template (either from a product template or from your own template). A wizard walks you through each aspect of your new planned run. The example below shows the defaults in the reference selections page. The eight chevrons across the top show the different pages of the wizard. The wizards default selections guide you based on the application workflow.
Version 3.4.1
Each Planned Run contains complete instructions for its sample, from sequencing on instrument to export of the results files to other analysis systems, such as to Ion Reporter Software. Here is an example planned runs listing:
A planned run is ready to execute on the sequencing instrument and is executed by entering its 5-digit run code on the instrument. From the run code, all the plan runs settings are available to the instrument and to the Torrent Suite software. All of your selections, from the original template and the planned run that you save, are known to the Torrent system and software. The system carries out your instructions, from sequencing through to data export. The Monitor tab In the Monitor tab you can inspect your in-progress runs, including preliminary run metrics such as bead loading percentage, Ion Sphere Partical (ISP) percentages, key signal, and usable sequence percentage. With the
Version 3.4.1
thumbnail quality indicators, you can quickly tell if your runs are doing well. You do not have to wait until the end of your run to have a good idea of the run quality.
The example above is the Monitor tab list view, which displays 24 runs per page. The Monitor tab also supports a table view of run per row. In the following example of the Monitor tab table view, the run metrics are in the 5 right-hand columns:
The Data tab

In the Data tab, you manage your run results. You can inspect your results, group, export, and prune results, and combine output files. The Data tab contains these two areas: Completed Runs & Results A table of completed runs. Here you view run summary metrics, access detailed run reports and plugin output, manually run or rerun a plugin on your analysis results, redo an analysis with the same or changed plan, and download results files. A run report also contains information on the plan which created the run, test fragments, software versions, and analysis details such as flows, cycles, instrument name, chip type, barcode set, etc. Projects Projects are groups of results. You can create and use projects in a way that makes sense for your research. Data > Completed Runs & Results You can view results in a table view (that is one run per row) or a list view (about two runs per page). You can search for specific results by several attributes, and sort the list of results. For a specific run, you can click through to the detailed run report. You can also redo the analysis, either with the
Version 3.4.1
same run instructions or with changed run instructions. (Run instructions include reference, barcode, sample name, run type, library key, notes, etc.) Data > Projects Projects are simply groups of runs. You create and use these groups in a way that makes sense for your research. Projects are useful to hold runs, for instance, for the same laboratory project or runs that you will later handle in the same way (for data export or archival). But you can use projects as you wish. Projects are intended to be a convenience, so that related runs are grouped together. You do not have to repeatedly search through the completed runs table to find related runs. The Data > Projects area supports mass actions on the runs and run results in a project. First, you select one or more runs in the project, then the action is applied to those selections. For example, in a project, you can merge results files into a combined BAM file, with the Combine Selected... menu:
A project can only contain completed runs (including their run reports and results files).
Quickstart Introduction On Dataflow Start a Run View Runs and Reports What Next
On Dataflow
Quickstart
On Dataflow
The Ion Torrent dataflow involves the transfer of raw sequencing data from the PGM or Proton sequencer to
Version 3.4.1
the Torrent Server for analysis and reporting.
The following table shows a high-level view of the dataflow, including approximate file sizes for the Ion 314 chip, Ion 316 chip, and Ion 318 chip:
Step Flows Loading Library Reads Classification Raw Image Acquisition Image Processing Signal Processing and Base Calling
Resulting File Type ---bfmask.bin DAT
Ion 318 Chip 520 81% 4994815 25 MB 232 GB
Ion 316 Chip 520 70% 2167130 14 MB 126 GB
Ion 314 Chip 520 71% 660938 2.9 MB 41 GB
WELLS BAM
16 GB 3.9 GB
7.4 GB 1.8 GB
1.7 GB 0.5 GB
File sizes will vary depending on the number of flows, the number of wells generating signal, and the number of library reads available. Your file sizes may be different. An unmapped BAM file format is used in pipeline steps before alignment.
The Ion sequencers output raw sequencing data in the form of DAT files. The raw measurements are the conversion of the raw pH value in a well to a digital representation of the voltage. These raw data are transferred to the Torrent Server for analysis pipeline processing. The analysis pipeline converts the raw signal measurements into incorporation measures and, ultimately, into basecalls for each read. Output files
Version 3.4.1
at different pipeline stages include WELLS and other file formats. See Technical Note - Analysis Pipeline for a detailed description of analysis pipeline processing. See Technical Note - Transition from SFF to BAM format for more information on file formats. The Torrent Browser provides a web interface for viewing processing results, showing metrics and graphs. From Ion Torrent Sequencer to Analysis Files This section describes the data flow steps from a PGM sequencing instrument to the analysis results files. The steps for Proton sequencing data are similar. During a PGM sequencer run one acquisition (acq_<flowNumber>.dat) file is generated for each nucleotide flow. The acquisition file contains the raw signals measured in the chip wells. One data acquisition file is created for each nucleotide flow. Acquisition files are temporarily stored on the PGM sequencer hard drive(s).
Dataflow Steps
1. Data are generated on the PGM sequencer as acq_<flowNumber>.dat files with one file per flow. 2. The acq_<flowNumber>.dat files are transferred to the Torrent Server using a standard computer network cable. On the server, data transfer is controlled by the Crawler service. 3. After the data associated with the initial flows of the PGM sequencer are available on the Torrent Server, analysis pipeline processing of the data begins. The first processing step compiles data from the many acq_ <flowNumber>.dat files into one 1.wells file, for a given run. 4. Basecalling is performed on the 1.wells file data, producing an unmapped BAM file. Transfer Data to the Torrent Server Data are automatically transferred from the PGM or Proton sequencer to the Torrent Server. You may monitor the transfer progress with the Monitor tab of the Torrent Browser user interface. The display shows the status of each sequencing instrument run, in either a list view or a table view. This is an example from the Monitor tab list view:
Version 3.4.1
The total number of flows and the number transferred are shown. The progress bar also shows the transfer status. Preliminary run metrics that fall below your thresholds appear in red in the thumbnail graphs
Ideally, the PGM sequencer and Torrent Server are directly connected using a Category 6 cable, to handle the large data transfer. A direct connection provides the easiest setup and fastest data transfer options, and transfer performance varies greatly because of network infrastructure differences. Please consult the PGM sequencer site preparation guide for more detailed instructions on connecting the PGM sequencer to the Torrent Server.
Quickstart TOC
Start a Run
Quickstart
Start a Run
Torrent Browser provides a User Interface for planning and managing runs, viewing reports, and data management of your result sets. Access the run management interface 1. When you access your Torrent Server, Torrent Browser displays the start page shown in the following figure:
1.
Version 3.4.1
2. Enter your username and password, and click Login. 3. The interface is arranged by tabs corresponding to the life cycle of your sequencing experiments:
4. Click the Plan tab to begin. Here you create template protocols for your research. See The Plan Tab in the To rrent Browser User Interface Guide.
Run names and report names Beginning with the 3.0 release, you specify your run name in the planned run. This process is explained in the Torre nt Browser User Interface Guide, under The Plan Tab. Run analysis automatically initiates report generation. Monitor an Analysis Run analysis can take several hours, depending on many factors. You can monitor analysis progress, using the Monitor tab, with either a list view or a table view. The list view is more visual and allows you to scan the quality of in-progress runs at a glance. The list view has thumbnails graphs of quality metrics:
Version 3.4.1
These metrics are described in the following table: Metric Loading Description The percentage of wells (out of all potentially addressable wells on the chip) loaded with an Ion Sphere Particle (ISP). The percentage of wells (out of total wells) that contain an ISP with a signal of sufficient strength and composition to be associated with the library or Test Fragment key. The percentage of Live ISPs (out of all Live ISPs) that have a key signal identical to the library key signal. Strength of the signal associated with the key sequence.
Live ISPs
Library ISPs
Key Signal
Usable Sequence
In your templates, you can adjust the thresholds for loading, key signal, and usable sequence. If a run falls below your threshold for a metric, the thumbnail is shown in red instead of blue:
The list view also has a loading density image for each run. In these images, red indicates good loading. Yellow is passable, and green and blue show very poor loading.
Run plugins
Version 3.4.1
Your Torrent Suite includes the following pre-installed plugins: Plugin Alignment Description Performs a new alignment to the reference you specify. Note: The realignment results are added to the current results set and run report. The preferred method to realign the run with a new reference is to reanalyze the run. This method generates a new result set and a new run report. See Manually restart a run and Work with Completed Runs. Coverage Analysis Provides statistics and graphs describing the level of sequence coverage produced for targeted genomic regions. Helps with the analysis of ERCC RNA Spike-in Controls. It enables you to quickly determine whether or not the ERCC results indicate a problem with RNA-Seq library preparation or the PGM run. Transfers result sets from your Torrent Server to the Ion Reporter Software. The IonReporterUploader is specified in the Export (not Plugin) page of the wizard during template or planned run configuration. Considers candidate runs for inclusion in Ion Community leaderboards. Within each chip type (Ion 314 chip, Ion 316 chip, and Ion 318 chip), top runs are ranked according the number of AQ20 bases mapped. Calls SNP and InDel variants across a reference or within a targeted subset of that reference. In the somatic workflow, under some conditions can call variants down to a 5% level of variant frequency. Can optionally show which variants coincide with predefined HotSpot positions on the reference sequence.
ERCC Analysis
IonReporterUploader
Run RecognitION
Torrent Variant Caller
Plugins can be set to run automatically on every analysis, and also can be run manually on a completed analysis. See the following pages for instructions on running plugins: The Plan Tab, Templates Plugin Summary Run the Installed Plugins Torrent Variant Caller Plugin Features offered by the Torrent Variant Caller include the following: Increased accuracy of variant calls due to new algorithms (with optimized variant calling parameters)
Version 3.4.1
Ability to analyze standard and custom panels by uploading a BED file BED files for standard panels are available, and you can upload custom BED files which are provided with our custom-designed products. A single, efficient standard UI for multiple analysis types Streamline your workflow by running multiple analysis types from a single plugin. Manually restart an analysis Flagging a planned run on the PGM or Proton sequencer automatically starts analysis. You can also restart a run, manually, from Torrent Browser Data > Completed Runs & Reports tab: 1. Go to the Data > Completed Runs & Reports tab and find your run name.
2. In the table view, click the Reanalyze option in the gear menu on the right of the run entry:
In the list view, click the Reanalyze button on the right of the run entry:
Version 3.4.1
The Start Analysis dialog opens:
3. To redo the analysis with the same settings, enter a report name (of your choice) and click Start Analysis. To change analysis settings, click Advanced. See Work with Completed Runs for a description of these arguments. With Advanced settings, you can restart from signal processing, basecalling, or alignment.
View Runs and Reports

Quickstart
View Runs and Reports

The Torrent Server hosts an embedded Web service, called Torrent Browser, which provides a GUI interface to control and view analysis runs, reports and various configuration parameters. You can access Torrent Browser from another computer connected to your network or from any computer connected to the Internet. You do not need to connect a monitor and keyboard directly to Torrent Server. Consult with your Torrent Server Administrator for details on how to access the Torrent Server hosting your data.
When you access Torrent Browser by entering the Torrent Server URL in your browser address bar, the initial page prompts you to start a browser session:
Version 3.4.1
Enter your username and password credentials, and click Login to access Torrent Browser features. (To request a new user account, click Register and see The Login Page.) The Torrent Browser header tabs correspond to the life cycle of your sequencing runs:
In this guide, we are introduce only the Data > Competed Runs & Reports tab. A run is one chip run on the PGM or Proton sequencer. A report is the analysis report generated on the Torrent Server. One run can have multiple reports. General UI features First, it is helpful to understand some common Competed Runs & Reports UI features. The run listings support two types of views, search, filtering, and other controls.
Views
You can view results in a table view that is one run per row or a list view with about three runs per page. Here is an example of the list view:
Version 3.4.1
Here is an example of the table view:
Version 3.4.1
Filter displayed runs
Competed Runs & Reports has a filter panel at the top of the page for selecting the runs and reports to display. The filter menus and fields are the same for both the table view and the list view:
The following methods are provided to filter the displayed run list: Filter by run name or partial run name (with the search field) Filter by run parameter (with the filter menus) Filter by date Filter by star
Filter by run name or partial run name
Use the Search names field to search by run name or partial run name. Click the Go button to active the search.
The Completed Runs & Report listing is then restricted to runs which match your search entry. Click the Clear butto
Version 3.4.1
n to cancel the search and restore all results. The Clear button also cancels the effect of the filter menus.
Filter menus
These images demonstrate how to use the display filter menus. We use the All Results Status menu and Completed status as an example. This setting restricts the run table display to only runs with a Completed status. Set the All Result Status to Completed:
The menu changes to the following:
The display changes to only run with Completed status. You do not need to click the Go button for the menu setting to take effect. To turn off run status filtering, click the red X in the run status menu field:
You can also click the Clear button. The Clear button resets all menus and search fields.
The date filter
The search date field opens a menu with preset choices or a date range picker:
The selection you make in the Date field takes effect immediately (depending on server load). You do not need to click the search Go button.
Version 3.4.1
The Today selection enters the current date in the Date field and limits the run table display only to jobs with a run date from the current date:
The This week selection uses a date range from Monday to the current day:
The Date Range selection opens two calendar pickers, one for the range start date and one for the range end date. Dates that you select are shown in white. The current date is shown in pale yellow.
You can optionally edit the date range directly in the Date field.
Version 3.4.1
The starred runs filter
Click the checkbox next to the search area blue star
to restrict display only to runs that you (or others) have . The start turns blue when clicked.
starred. You star a run by clicking the star next to its run name:
Sort
In the run table (table view only), click any header in bold to sort the table by that column. Click a second time to reverse the sort.
Other UI controls
This section describes other UI controls on the Completed Runs & Reports page: Auto Update Auto Update refreshes your page display whenever a new run is available to display. With Auto Update off, the page is a static display of information at the time you opened the page:
When Auto Update is on, the button changes to Stop Updates:
The gear menu In the run table (table view only), click the gear menu to reanalyze a run or edit the planned run settings:
The list view has separate buttons to reanalyze or edit a run. Open in new window The icon next to a report name opens the run report in a new browser tab or a
Version 3.4.1
new window. Other UI controls are available, such as for archival. See Completed Runs and Reports Tab for a complete description of the page. View all reports for a run Follow these steps to list all reports for a run: 1. Go to the Data > Completed Runs & Reports page and select List View. 2. Find the run, and click the Show all reports link (your link will have a different number):
View an analysis report To view a run report, go to the Data > Completed Runs & Reports page and click on a Report Name. In the table view, you can open only the representative report name. In the list view, you can open one of the report in the Report Name column, or click Show all reports to find a different report:
See Completed Runs and Reports Tab for a description of a representative run report.
Version 3.4.1
See Torrent Browser Analysis Report Guide for a description of a run report's contents. View test fragment data Toward the end of a run report, near the Plugin Summary area, is the test fragment information:
This area summarizes the performance of individual test fragments, with total number of reads, a quality percentage, and a thumbnail histrogram. Compare data across multiple runs The Torrent Browser UI does not include a feature for comparing data across multiple runs. But a CSV file can be downloaded to use with external applications, such as Excel, for data analysis. Click the Download CSV button to download analysis data (this link is at the bottom of the Data > Completed Runs & Reports tab page, in the list view):
What Next
Quickstart
What Next?
Check out the Plan > Templates tab in the Torrent Browser. See which applications and pre-install product
Version 3.4.1
templates might be helpful to your work. Click the Review link for templates to see what kits and references they use. Try out the template wizard (click Add New Template to start with a generic application template or Copy to start from an existing template). Walk through the wizard to become familiar with its organization, menus, and options. You can cancel at the end or save your work. Documentation Use these suggested references to learn more about Torrent Server. These documents describe the Torrent Server functionality in detail.
Administrator Documentation
Torrent Server Administration Guide Administrator documentation describes how to set up and maintain your Torrent Server. It also includes information on working directly with the database, which involves working with user configuration and run parameters.
User Documentation
In addition to this quickstart guide, user documentation includes the following kinds of documents: Torrent Browser User Interface Guide The user interface guide describes the Torrent Browser interface features, including how to use them and how they relate to the function you want to perform. Torrent Browser Analysis Report Guide The analysis report guide gives a detailed description of the default analysis report. This guide also contains information about the Torrent plugins, including the Torrent Variant Caller: Run the Installed Plugins Torrent Variant Caller Plugin Use Cases This set of documents describes how to perform common operations in your day-to-day work with Ion Torrent. Technical Notes and Whitepapers These documents elaborate on particular topics, providing a significant, in-depth presentation of each topic. The Ion Community The Ion Community has many user resources. Visit the following pages: Explore Torrent Suite Software 3.0 The Torrent Suite space (http://ioncommunity.lifetechnologies.com/community/products/torrent_suite) Especially recommended are the overview and documents in the Best Practices area. (These pages are currently for the previous release, 2.2, and do not cover templates, but this area will be updated for 3.x.) http://ioncommunity.lifetechnologies.com/community/products/torrent_suite/best_practices Torrent Browser functionality Explore each of the Torrent Browser interface tabs as a hands-on way to learn more about the system: Plan Enter your PGM or Proton run information in advance, reducing hands-on instrument time and
Version 3.4.1
allowing an opportunity to print and review your run information. Under Plan are two tabs, Templates and Planned Runs: Templates Reusable experiment designs. Design details include the application, laboratory kits, reference, BED files, project, and the export destinations for results files. Your templates serve as a digital version of your protocol from these you create planned runs as necessary. Planned Runs Executable instructions for individual sequencing runs. You create a planned run from one of your templates (or from a pre-installed template). Monitor View the progress of your instrument runs in real time. Data Search and review all of your instrument runs or drill down to see your run reports. Completed Runs & Reports Access a run report, download a result set, launch a plugin on a completed run. Projects Group your result sets into projects for convenient access and data management. Export result sets to other systems for further analysis. Archive or prune results sets.
Version 3.4.1
Torrent Browser User Interface Guide

Introduction
Torrent Browser, the main Torrent Suite software user interface, provides access to the following tasks: Design your research protocols in the form of experiment templates. Plan future runs to be executed on your Ion sequencing instruments. Monitor the progress and preliminary quality of your current instrument runs. View a Detailed Report for a specific run. View summary statistics from several analyses. Find a specific run or report, using filter or search criteria. Restart an analysis from a completed run. Run or rerun a plugin on the analysis results from a completed run. Group your analyses into projects for more convenient data management. Configure various Torrent Suite software parameters to control archiving, reporting, and other administrative functions. You can also access support and licensing information at the bottom of the main page: The Torrent Browser interface is organized according to three main phases of the sequencing lifecycle:
Plan Choose the experimental design for a template, which can be reused many times to create planned runs, or create a new planned run from an existing template. Design details include the application, reference, BED files, project, and the export destinations for results files. The Plan tab contains both templates (reusable experiment designs) and planned runs (executable instructions for individual sequencing runs). Use pre-installed product-specific templates, such as the templates for the Ion AmpliSeq Inherited Disease Panel, the Ion TargetSeq Ion Exome Panel, or Whole Transcriptome RNA Seq, or create your own templates customized to your research requirements. Monitor View the status of your system and running jobs, including thumbnail quality graphs for current runs, server status, and reagent levels. The quality graphs provide near real-time information on your runs, so that you know early on about any instrument issues. Data View summaries of completed runs, detailed run reports, and plugin results; download output files and the run report; review the run plan settings; combine output from multiple runs into a single result set; export results to other systems; and create projects to manage your results. If you are new to Torrent Suite Software or new to 3.x releases, the first thing to do is to read the Quickstart Guide. Then the easiest way to learn more about Torrent Browser functionality is to review topics presented in each user interface tab:
Version 3.4.1
The Plan Tab The Monitor Tab The Data Tab
Contents Torrent Browser User Interface Guide The Login Page The Plan Tab Templates Planned Runs Template and Planned Run Wizard Create Multiple Run Plans Create a Template from AmpliSeq Designer The Monitor Tab The Data Tab Completed Runs and Reports Tab Work with Completed Runs The Projects Tab The Projects Listing Page Project Result Sets Page CSV Metric File Format The Admin Menu
Login Page
The Torrent Browser Login Page
The login page shows the main phases of your use of the Torrent Browser: Plan Create new run templates and plan sequencing instrument runs. You can use Ion torrent templates or create new uses that match your own protocols. Monitor View the progress of the sequencing instrument in real time and assess the run metrics as they are gathered. Data Search and review across all of your runs and drill down to see your data in the run report. View your run results grouped into projects.
Version 3.4.1
Export Automatically package and group data and export it to other applications.
Login To access the Torrent Browser, enter your user name and password, and click Login. Register for a new account Each new account requires administrator approval and it not active until approval is granted. Follow these steps to register for a new user account: 1. On the login page, click the Register link: 2. Fill out the new user form and click Submit:
Version 3.4.1
3. You see the following message that your account is pending admin approval: Thanks for Registering Your account has been created and is pending approval by an admin user. Please contact your local admin and ask them to visit the Account Configuration page to activate your new account.
Version 3.4.1
Plan Tab
Plan Tab
The Plan tab gives you control over your sequencing experiments. You use a plan template, in the Plan > Template tab, to create a digital protocol with specifications for almost your entire experiment, from sample preparation through sequencing, data analysis, and data export to other systems for additional analysis. From the template, you create one or more planned runs, which execute directly on your Ion PGM or Ion Proton sequencing instrument. These steps describe how templates and planned runs fit into your Ion PGM or Ion Proton sequencing workflow: 1. Your decide on your sequencing application and sequencing product (such as an Ion AmpliSeq panel). 2. You select a pre-installed template with defaults for your application and sequencing product, or you create your own template from scratch. You customize your template. 3. You copy the template to a new planned run, adding the name of the tissue sample to be sequenced. 4. The Torrent Browser assigns your new planned a run code. 5. You enter the run code directly on the Ion sequencing instrument to initiate the sequencing. 6. The planned run automates the process from sequencing through data analysis and data handling.
Version 3.4.1
In the Plan > Templates tab, you create and organize your templates, and also create planned runs. The Plan > Planned Runs tab lists existing planned runs. In this tab, you can review planned run settings and edit or delete planned runs. See Templates and Planned Runs.
You can also download a CSV file to create multiple planned runs from one of your templates. Recommended for users who are familiar with templates and run plans. See Create Multiple Run Plans.
Version 3.4.1
Templates
Templates
The following describe a template: A canned set of instructions for both your sequencing run and your post-sequencing data analysis. A digital protocol with specifications for almost your entire experiment, from sample preparation through sequencing, data analysis, and data export to other systems for additional analysis. (A plan template is missing only the sample name, from your experiment information.) A sample planned run that you can copy to quickly create actual planned runs with known defaults and settings. A reusable set of laboratory, sequencing, data analysis, and data management instructions. These steps describe how a plan template fits into your Ion PGM or Ion Proton sequencing workflow: 1. Your decide on your sequencing application and sequencing product (such as an Ion AmpliSeq panel). 2. You select a pre-installed template with defaults for your application and sequencing product, or you create your own template from scratch. You customize your template. 3. You copy the template to a new planned run, adding the name of the tissue sample to be sequenced. 4. The Torrent Browser assigns your new plan a run code. 5. You enter the run code directly on the Ion sequencing instrument to initiate the sequencing. 6. The planned run automates the process from sequencing through data analysis and data handling. You use a template to create multiple repeatable planned runs on demand. With the planned run wizard, you can create a new planned run with only a few clicks and the entry of the sample name. With the Plan Multiple feature, you download a CSV and customize it to create multiple planned runs without using the planned run wizard. (See Pl an Multiple.) Plan templates play an important role in enabling rapid throughput across your sequencing instrument. Templates also help reduce the chance of error, by listing the reagent kits used on the instrument. The Plan tab > Templates page contains your experiment templates. These include pre-installed product templates (for instance for products such as the Ion AmpliSeq Cancer Panel) and as well as templates that you create, and areas for recently-used templates and ones you mark as favorites. Product templates contain the appropriate defaults for a product, including the default kits, BED files, and reference. Overview Typical use Plan > Template page organization Wizard Overrides Examples Example template Example application group Template wizard power Application type and run type Kits
Version 3.4.1
Monitoring metrics References and regions files Plugins Projects Export Sample name and run name The template wizard Create your own template Plan Multiple How do I execute on the sequencing instrument? What is the point? Where are we? Overview
Typical use
Typically you copy a product template and customize the new template with your choices for project organization and data export handling. Then you reuse your new template to create many planned runs, as needed. Each run plan has the correct settings (from the original template). Or you can edit your template when experimental or data handling changes are required. A planned run both executes on your Ion sequencing instrument and also automates your decisions for post-sequencing data analysis and data management.
Plan > Template page organization
Templates are organized by sequencing application (and by product for some applications): AmpliSeq DNA and RNA Ion AmpliSeq applications, including the Ion AmpliSeq Comprehensive Cancer Panel and Custom Ion AmpliSeq panels. TargetSeq Ion TargetSeq products and other targeted resequencing applications, with parameters optimized for hybridization-based target enrichment. Whole-Genome Seq Whole genome sequencing applications, which do not assume enrichment and do not require a target regions file. RNA Seq RNA sequencing applications. Generic Sequencing Your own applications that do not fit in the other categories. With a generic sequenci ng template, you provide the settings for the experiment. Your choices are not restricted based on the logic of an application workflow, and it is theoretically possible to create a flawed template. The template page also has groups for recently-used templates and for templates that you mark as your favorites. You can also create a template from your AmpliSeq Designer run. See Create a Template from AmpliSeq Designer.
Wizard
When you create a new template or a planned run (from a template), the template wizard walks you through each aspect of your new template or planned run, using pre-populated defaults based on the application template or product template you choose. The example below shows the defaults in the reference selections page. The eight chevrons across the top show the different pages of the wizard.
Version 3.4.1
Overrides
Run information that is specified in a template can be changed when you create a planned run. And run information in a planned run can be changed on your sequencing instrument, after you load the planned run onto the instrument. You can optionally leave some information out of a template, in order to add different settings in different planned runs. Examples These sections show an example of the information that a template contains, an example of a group of application templates, and a description of different template types.
Example template
An example of a template's contents is shown below. A template typically contains all (or almost all) of the information required for a sequencing run, except for the sequencing run name and sample name. Only a planned run has the run name and sample name. This example is in the format used with the review template links.
Version 3.4.1
Example application group
A group of application templates is shown below, using the Ion AmpliSeq application as an example. These templates all relate to Ion AmpliSeq products or the Ion AmpliSeq application.
Version 3.4.1
This example shows the following template types and planned run option: Product templates Pre-installed templates with the recommended defaults for specific sequencing products. With a product template, you can review the template settings, create a planned run, and create a new customized template of your own. You cannot edit or delete a product template, as those links are not supported. A product template supports these actions: User templates The first template in this example is user-created and also supports the edit and delete actions: Generic application template The link next to the application name contains defaults for the application type but not for a specific product. Generic planned run The link next to the application name creates a planned run based on the generic application template. Multiple plans The link helps you create multiple run plans from a template. The link downloads a CSV file with template information. You edit the CSV file and upload it with the Upload Plans button in the Favorites template group. This mechanism bypasses the planned run wizard and is convenient for multiple similar run plans. The buttons are shown below:
Template wizard power Templates give you control over your sequencing experiments and subsequent data analysis. You can use pre-installed product templates that already have the recommended defaults known to be compatible with the sequencing product and sequencing application. Or you can create your own template from scratch or from supplied templates with defaults for a common sequencing applications. With relationship between template and executable planned run, you can customize your templates so that with only a few clicks to add the specific sequencing sample, you can easily create multiple planned runs with known and automated data analysis and data management options. A template potentially defines the aspects of your experiment and data analysis described in the sections below. These sections describe what you can do with a template and how the template information relates to the Torrent Browser pages and to the create template wizard. These sections are organized by the corresponding page of the create template wizard.
Application type and run type
Choose from common sequencing applications, such as Ion AmpliSeq DNA sequencing, Ion AmpliSeq RNA se quencing, Ion TargetSeq resequencing, whole genome sequencing, and RNA sequencing, or create your own. Pre-installed templates are available for these common sequencing products: Ion AmpliSeq Cancer Hotspot Panel v1.0 or v2.0 Ion AmpliSeq Comprehensive Cancer Panel Ion AmpliSeq Cancer Panel Ion AmpliSeq Inherited Disease Panel Ion AmpliSeq Cancer Panel Template v1.0 Library Chemistry
Kits
Version 3.4.1
A template can contain the following information about laboratory kits and other sequencing parameters: (Optional) Sample preparation kit Library kit type, including also the forward library key and the forward 3' adapter Templating kit type Sequence kit Number of flows (Optional) Barcode set (Optional) Control sequence (Optional) Chip type Note: The value entered for number of flows represents the maximum possible for a run using a planned run based on this template. Instrument conditions such as the availability of consumables might cause fewer flows to be completed.
Monitoring metrics
The Torrent Browser displays run quality metrics when you monitor your current sequencing jobs (in the Torrent Browser Monitor tab > Run in Progress page). In a template, you specify thresholds for these metrics. A metric that falls below your specified threshold shows in red on the Runs in Progress page:
You can specify thresholds for bead loading, key signal, and usable sequence metrics.
References and regions files
A template can specify the genome reference, target regions BED file, and Hotspot regions BED file. (All of these settings are optional.)
Plugins
A template can specify the plugins you want to use (for planned runs that are made from this template). This image shows a example plugin selection checkboxes in the template wizard:
Notes: The plugins available to you depend on what is installed and configured in your Torrent Server. All active plugins (those installed, configured, and enabled on your Torrent Server) are available in this menu. When you select the variantCaller plugin, the Variant Caller configuration page opens in the wizard. See Torr ent Variant Caller Plugin for options and configuration information. The IonReporterUploader plugin does not appear on this page, but on the Export wizard page.
Version 3.4.1
Projects
Projects are groups that you create to organize your results sets. Projects are for your convenience, to organize as you wish. You might organize some projects according to users, lab projects, data analysis methods, data export handling, or however else makes sense for your lab and your research. Projects provide you with easier access to related results sets, so that you avoid repeatedly searching through the complete runs table. In your templates, you optionally specify one or more projects to receive the results sets. You create projects on the Torrent Browser Projects page, and use the Add Project... button to add new projects to this list.
Export
A template's export options allow you to automate the data handling of your results set directly to other systems such as the Ion Reporter Software. For example, if you choose to export a result set to the Ion Reporter Software, you later specify the Ion Reporter workflow name and sample relationships (in the Plan chevron). Notes: This release supports the IonReporterUploader as the pre-installed export option. Other providers may supply other export options. To appear in the wizard, export uploaders must be installed and correctly configured on your Torrent Server.
Sample name and run name
A template does not contain either the name of the sample to be sequenced or the sequencing run name. Both of these settings are contained only in the executable planned runs. You can specify both of these settings when you copy a template to a planned run and when you use the Plan Multiple button to prepare a CSV file of plans. The template wizard The template wizard guides you through 8 pages where you can approve or change each pre-populated default. The 8 wizard pages cover these areas shown by the wizard's chevron labels:
The wizard pages and chevron names correspond to the areas of information seen when you review a template or plan (see Example template). The first three chevrons, in a darker gray, cover physical aspects of lab work and the sequencing instrument run. The 4th through 8th chevrons, in a lighter shade of gray, cover data analysis, data management, data export options, and naming options. For detailed descriptions of the template wizard pages, see Template and Planned Run Wizard.
Version 3.4.1
Note: The wizard pages for a planned run are the same except for the last page:
The last page is titled Plan and includes fields for the planned run name and the sample name. Templates and the template wizard do not have these two fields. Create your own template You create your own template in order to have specific customizations that are not available in the pre-installed templates. Examples of customizations include the following: Custom plugin usage Use of custom BED file for regions of interest or hotspot locations. Automatic inclusion of result sets into one or more projects, for convenient data management step later on. Automatic export of results sets to other analysis systems, such as to the Ion Reporter Software system. In general, you start with the product template or application template that most closely matches your research requirements, copy that template, make your custom changes in the template wizard, and save your new template under a new name. Your new template appears in the same application group as the original template. You optionally can also mark the new template to appear in your Favorites template group. To create your own template, follow the instructions in Template and Planned Run Wizard. To create a template from your completed AmpliSeq Designer run, follow the instructions in Create a Template from AmpliSeq Designer. Plan Multiple When you have an established template, you can download a CSV file to clone a number of planned runs from your template. You edit the CSV file to add plan names and sample name and optionally to make other customization to the run plans, then upload it in the templates page. This mechanism bypasses the planned run wizard. See Create Multiple Run Plans. How do I execute on the sequencing instrument? Every run on your Ion sequencing instrument can be automated through the use of planned runs, which in turn are each derived from one of your plan templates. Your templates cannot be executed on a sequencing instrument the planned runs can. A planned run contains all of the digital protocol defined in your template, plus also the planned run name and the name of the physical sample to be sequenced. To use your plan template on a sequencing run, first you create a planned run from your plan template. For instructions on how to create a planned run from a template, see Planned Runs. (The wizard to create a planned run is the same as the template wizard, except that the planned run wizard includes the planned run name and the sample name.) What is the point?
Version 3.4.1
The main points of the Plan > Templates page: A template is a reusable digital protocol for your sequencing experiments. You use a template to create a planned run that both executes on your sequencing instrument and automates your decisions for post-instrument data analysis and data management. The Torrent Suite Software provides pre-installed plan templates with the correct defaults for Ion sequencing products and also for sequencing applications. You can use the pre-installed product templates or customize your own templates. A planned run contains the template's protocol, plus the experiment run name and sample name (that you add in the planned run). To create planned runs, you use the Plan Run link to open planned run wizard for a single run plan, or use the Plan Multiple link to bypass the wizard.
Where are we?
The Plan > Templates page is used during the phase in bold: Application, product > template > planned run > instrument run > monitor > results > run report > other data analysis and data management
Version 3.4.1
Planned Runs
Torrent Browser User Interface Guide Planned Runs
The Plan tab > Planned Runs page contains planned runs which are ready to execute on your sequencing instrument. A planned run is an electronic protocol of everything required for a sequencing run, from reagent kits to sample name to genome reference, data analysis, and data management. You create each planned run from an application template (either from a product template or from your own template). Templates and planned runs provide alternate methods (and timing) of entering the same data that is otherwise entered on the Ion sequencing instrument, for example on the PGM Run Info screen. With templates and planned runs, you can enter the information in advance, and have an opportunity to print and review your entries. Use of tem plates and planned runs reduces your hands-on time on the instrument. If you do not create planned runs here in the Plan tab, you must enter the run information directly on the Ion sequencing instrument. When you create a planned run, the run plan wizard walks you through each aspect of your new planned run, using pre-populated defaults based on the application template or product template you choose. The example below shows the defaults in the reference selections page. The eight chevrons across the top show the different pages of the wizard. To execute a planned run, you select it directly on the sequencing instrument, for instance on the PGM Run Info screen.
Where are we?
Version 3.4.1
This page describes steps involved with the highlighted phase of your sequencing workflow: Application or product > template > planned run > instrument run > monitor > results > run report > export, data analysis, data management
Run planning workflow Create a run plan Execute a run plan on your sequencer
Example Planned Runs page
The following is an example of a Planned Runs page with several planned runs.
The following table describes the Planned Runs page contents. Column heading Run Code Description A short code identifying the planned run.
Version 3.4.1
Run Plan Name Barcodes Application
Name of the planned run. Name of the DNA barcode set, if any. An icon identifying the sequencing application (such as whole genome, RNA Seq, etc.) Name of the project to contain the output result sets. Note: You can automate result sets going to more than one project. Only one project is shown here.
Project
Sample Library Last modified
Name of the sample to be sequenced. Name of the reference library used. Time stamp of the last time the planned run was created or changed. The gear menu on the right side of of a planned run allows you to review, edit, copy, or delete the planned run:
Gear menu
Example run plan information
The following is an example of the information contained in a planned run. This is output of the Review option from a planned run gear menu.
Version 3.4.1
Run planning workflow
These steps describe how plan templates and planned runs fit into your Ion PGM or Ion Proton sequencing workflow: 1. Your decide on your sequencing application and sequencing product (such as an Ion AmpliSeq panel). 2. You select a pre-installed template with defaults for your application and sequencing product, or you create your own template from scratch. You customize your template. 3. You create new planned runs from your templates, adding the names of the tissue samples to be sequenced. 4. The Torrent Browser assigns your new plan a run code. 5. You enter the run code directly on the Ion sequencing instrument to initiate the sequencing. 6. The planned run automates the process from sequencing through data analysis and data handling.
Version 3.4.1
Plan templates and planned runs allow you to enter run information via the Torrent Browser rather than directly on the Ion sequencer. The use of templates and planned runs reduces the chance of error and wasted runs, reduces setup time on the sequencing instrument, and increases instrument throughput. On the Ion Torrent sequencer, information for a planned run is applied to the current Run Info screen by entering the planned run's short code or by selecting the planned run from a menu of planned runs. You can optionally overwrite (change) planned run information directly on the Ion sequencer.
Create a run plan
To create a planned run, first you create a plan template, which can be reused over and over to create planned runs with known, optimized settings (see Templates). this section describes using a wizard which walks you through the steps to create a planned run from your plan template. To instead bypass the wizard and create multiple run plans with a CSV file, see Create Multiple Run Plans. Plan templates are organized by sequencing application (such as Ion AmpliSeq DNA or RNA sequencing, Ion TargetSeq sequencing, etc.). Within each application, there are pre-installed product templates optimized for specific sequencing products, a generic application template (which does not have product-specific defaults), and templates that you create and customize for your own research. This image shows example Plan > Templates page links to create a new planned run. The Plan Run links on the individual template rows create a planned run that either is optimized for a specific sequencing product or is from a template that you have customized for your own research requirements. The Plan New Run link on the application line creates a planned run from the generic application template the generic template is tuned for the application but not for any specific sequencing product within that application.
After you have a plan template, follow these instructions to create a planned run: 1. On the Plan > Templates page, find the template for your planned run. 2. For a product template or one of your own templates, click the Plan Run link next to the template name. For a generic application template, click the Plan New Run link next to the application name. 3. The plan wizard opens to the Save page. You can do either of the following: a. Enter the sample name and the run name and the click the Plan button to save the planned run and finish the wizard. b. Review the information on the other wizard pages and optionally change any of the settings. Any change you make affect only your new planned run, not the original plan template. Then enter the sample name and the run name and the click the Plan button to save the planned run and finish the wizard. 4. The Torrent Browser assigns the new planned run a run code, which you use to load the planned run onto the Ion sequencer. 5. The new plan appears as a planned run in the Plan > Planned Runs page, and is ready to execute on the Ion sequencer. (See Execute a run plan on your sequencer.) An example of the planned run wizard is shown below. The wizard opens in the last page, so that you only have to
Version 3.4.1
add the sequencing sample names and click the Plan Run button to save and create your new planned run. You can optionally review the run plan from this page or click the chevrons on the top of the page to visit the other wizard pages.
See Template and Planned Run Wizard for a detailed explanation of the plan wizard.
Execute a run plan on your sequencer
A planned run created on the Torrent Server is executed on the Ion Torrent sequencer by selecting it from the sequencer's Run Info screen. With the browse button you can select a planned run from a list of pending runs previously created on the Torrent Server. The change button allows you to select a planned run via its run code. The pending run information is populated into the Run Info screen. You can optionally change run information on the Run Info screen. When ready, click Next --> to start your Ion Torrent sequencing run. Your planned run is
Version 3.4.1
removed from the Plan > Planned Runs table when you approve the run confirmation.
The planned run short code can be entered by entering it manually from the touch screen. You can also type the planned run short code (for example, ITHWQ) into the Pending Run: text field on the Run Info screen:
Version 3.4.1
Template and Planned Run Wizard

The Template and Planned Run Wizard When you create a new template or a new planned run, a wizard guides you through the process. You can begin by copying one of the pre-installed product templates, and then the wizard is populated with defaults that are compatible with that product. The same wizard supports both new templates and new planned runs. The template wizard guides you through 8 pages where you can approve or change each pre-populated default. The 8 wizard pages cover these areas shown by the wizard's chevrons:
The wizard pages and chevron names correspond to the areas of information seen when you review a template or plan (see Example template and planned run information).
Version 3.4.1
The first three chevrons, in a darker gray, cover physical aspects of lab work and the sequencing instrument run. The 4th through 8th chevrons, in a lighter shade of gray, cover data analysis, data management, data export options, and naming options. You can navigate to a wizard page by clicking on its chevron. Example template and planned run information Differences between templates and planned runs Start the wizard Wizard pages Application Kits Monitor Reference Plugins Project Export Template Save page and the planned run Plan page Example template and planned run information The following shows the type of information contained in both a template and a planned run. This format is used by the wizard Review Run Plan and Review Template buttons and the Plan > Planned Run page review option. Sequencing sample names and run names are not shown in these reviews, but are present in planned runs. Sample names and run names are not contained in template information.
Differences between templates and planned runs Templates and planned runs have much the same information. Templates come first. Planned runs are created from templates. Templates do not have sample names and run names. Planned runs do contain these names.
Version 3.4.1
Planned runs are executable on the sequencing instrument, because they contain sample names and run names. A template is a sample planned run. From a template, you can create many planned runs. Each resulting planned run is already customized for your research and can quickly be created from your template you add only the sample name and the run name. The planned run wizard opens in the last page, so that if you accept all the template settings, all you need do is supply are the run name and sample names and save the new planned run. The last page of the wizard is different for templates and planned runs. The planned run last page requires th e run name and sample names. (Templates do not contain this information.) The wizard pages for a template and a planned run are the same except for the last page. The planned run last page requires the run name and sample names. Template wizard:
Planned run wizard:
Start the wizard For both templates and planned runs, you start the wizard from the Plan > Templates page. The steps to start the wizard depend on whether you want to create a planned run from generic application template or an existing template, or create a template from generic application template or an existing template. How you start the wizard is important, especially if your sequencing workflow uses common sequencing products. Pr e-installed templates are available for these common sequencing products: Ion AmpliSeq Cancer Hotspot Panel v2.0 Ion AmpliSeq Comprehensive Cancer Panel Ion AmpliSeq Cancer Panel Ion AmpliSeq Inherited Disease Panel Ion AmpliSeq Cancer Panel If you start with a pre-install product template, your new template or planned run has the correct settings for the product.
Templates
To create a new template from a generic application template, click the Add New Template link next to the application name. To create a new template from an existing template, click the Copy link in that template's row.
Version 3.4.1
Planned runs
To create a new planned run from a generic application template, click the Plan New Run link next to the application name. To create a new planned run from an existing template, click the Plan Run link in that template's row.
Wizard pages These sections describe how to use the wizard to create either a new template or a new planned run. Each section corresponds to one page of the wizard. The Ion AmpliSeq Inherited Disease Panel template is used in these examples.
Application
In this page you define the basic options of a sequencing run, with the application type and run type. Typically you already selected the application type by the link you used to start the wizard. If you use the Generic Sequencing application template, then you must select your application type. This release supports the run type Forward.
Version 3.4.1
Kits
On the Kits wizard page, enter the following information about laboratory kits and other sequencing parameters: (Optional) Sample preparation kit Library kit type, including the forward library key and the forward 3' adapter Templating kit type Sequence kit Number of flows Barcode set Required for barcoded runs Control sequence Required for RNA runs (Optional) Chip type Note: The value entered for number of flows represents the maximum possible for a run using a planned run based on this template. Instrument conditions such as the availability of consumables might cause fewer flows to be completed.
Version 3.4.1
Monitor
The Torrent Browser displays run quality metrics when you monitor your current sequencing jobs (in the Torrent Browser Monitor tab > Run in Progress page). In a template, you specify thresholds for these metrics. A metric that falls below your specified threshold shows in red on the Runs in Progress page:
You can specify thresholds for bead loading, key signal, and usable sequence metrics. The default for each is 30%.
Version 3.4.1
Reference
In the Reference page, you specify the genome reference, target regions BED file, and Hotspot regions BED file. (All of these settings are optional.)
Plugins
Version 3.4.1
You specify the plugins you want to use either in this new planned run or in planned runs that are made from this new template.
Notes: The plugins available to you depend on what is installed and configured in your Torrent Server. All active plugins (those installed, configured, and enabled on your Torrent Server) are available in this menu. The IonReporterUploader plugin does not appear on this page, but on the Export wizard page. For information on configuring the variantCaller plugin, see Torrent Variant Caller Plugin. For information on the other plugins that ship with the Torrent Suite, see Run the Installed Plugins.
Projects
Projects are groups that you create to organize your results sets. Projects are for your convenience, to organize as you wish. You might organize some projects according to users, lab projects, data analysis methods, data export handling, or however else makes sense for your lab and your research. Projects provide you with easier access to related results sets, so that you avoid repeatedly searching through the complete runs table. In your templates and planned runs, you optionally specify one or more projects to receive the results sets. You create projects on the Torrent Browser Projects page, and use the wizard Add Project... button to add new projects to the wizard list.
Version 3.4.1
Export
The export options allow you to automate the data handling of your results set directly to other systems such as the Ion Reporter Software. For example, in a planned run if you choose to export a result set to the Ion Reporter Software, in the planned run wizard Plan page you specify the Ion Reporter workflow name and sample relationships.
Notes:
Version 3.4.1
This release supports the IonReporterUploader as the pre-installed export option. Other providers may supply other export options. Export options require uploaders that are installed and correctly configured on your Torrent Server.
Template Save page and the planned run Plan page
The last page of the wizard is different for templates and planned runs. The template wizard last page is titled "Save". The planned run wizard last page is titled "Plan" and includes run names and sample names. Save page In the template wizard Save page, you enter the name for your new template. You can also optionally set the new template to appear in the Favorites section. And you can review the template settings with the Review Template but ton (see Example template and planned run information).
Note: A template does not contain either the name of the sample to be sequenced or the sequencing run name. After you click the Copy Template button, your new template appears in its application group on the Torrent Browser Plan > Templates page and optionally also in the Favorites group. And the new template is ready for you to create a planned run from it. Plan page In the planned run wizard Plan page, you enter the name for your new planned run and the name for each the sample to be sequenced. You can optionally enter a note, which will appear in the Data > Completed Runs & Reports entry for this run. And you can review the planned run settings with the Review Run Plan button (see Exam ple template and planned run information). This example Plan page shows how the page appears when you do not have any data uploaders selected on the wizard Export page:
Version 3.4.1
When you select a data export option in the wizard Export page, then in the wizard Plan page you specify data analysis settings for your export option. For example, when you select IonReporterUploader as an export option, then in the wizard plan page for each sample name you also specify the Ion Reporter Software workflow and sample relationship:
After you click the Plan Run button, your new planned run appears in the Torrent Browser Plan > Planned Runs page with its system-assigned run code. When you want to execute your planned run on the sequencing instrument, you use the run code to load the planned run onto the sequencing instrument.
Version 3.4.1
Create Multiple Run Plans

Create Multiple Run Plans The Plan Multiple button for a template creates a CSV file with information for multiple run plans. Each data line in the CSV file is a separate run plan. Follow these steps to use the Plan Multiple feature: 1. Select the template to create run plans from. Click the Plan Multiple button for that template: 2. In the popup, specify how many run plans you want created from the template and click the button Download CSV for batch planning. The CSV file is downloaded to your local machine. An example file name is batch Planning_2013_01_15_12_53_42.csv. The naming pattern is batchPlanning_timestamp.csv. 3. You edit the CSV file (on your local machine). For each plan, fill in the Run Name and Sample Name columns :
3.
Version 3.4.1
4. If necessary, you can optionally customize individual run plans, such as for plugins to run or number of flows to execute. (However, these changes are usually done in the template.) 5. When your run plans are complete, save the CSV file. 6. Back in the Templates page, in the Favorites group, click the Upload Plans button:
7. In the Upload Plan Runs popup, click the Choose File button, browse to your CSV file, and click Open. The file name appears on the right of the Choose File button. 8. Click the Upload CSV for batch planning button. Any errors found in the CSV file, such as missing run names or sample names, are shown in the Upload Plan Runs popup. 9. The Torrent Browser create run pans from your CSV file and assigns your new plans a run code. The Torrent Browser opens the Planned Runs tab.
Notes about the Plan Multiple feature: In this release, the defaults are used for plugins that are specified in multiple runs plans. To configure options, such as for the variantCaller plugin, on the Planned Runs page edit each plan to configure the plugin options. After you click the Upload CSV for batch planning button, if any errors such as missing run names or sample names are found in the CSV file, the errors are shown in the Upload Plan Runs popup. See also Templates and Planned Runs.
Version 3.4.1
Create a Template from AmpliSeq Designer

Create a Template from AmpliSeq Designer This page describes how to download results from a completed AmpliSeq Designer run and import your results into the Torrent Browser to use as a template. On your Results Ready page in the AmpliSeq Designer, you click the download results button. Then in the Torrent Browser, import the zipped results file to the hg19 reference. The Torrent Browser creates a new template in the AmpliSeq DNA template group, using your results file from the AmpliSeq Designer. Download your AmpliSeq Designer results Import the AmpliSeq Designer results file in the Torrent Browser References tab Use the new template in the AmpliSeq DNA template group
Download your AmpliSeq Designer results
Version 3.4.1
The first step is to download you AmpliSeq Designer results to your local machine: 1. In the AmpliSeq Designer, open the Results Ready page for your design and click the Download results butt on:
2. In the Download Results popup, click the Download Now button. The results zip file, which is named for your design ID, is downloaded to your local machine. The Download Results popup also describes the contents of the zip file.
Import the AmpliSeq Designer results file in the Torrent Browser References tab
This step imports your AmpliSeq Designer results into the Torrent Browser. 1. In your Torrent Browser, select the gear menu References option to go to the References tab:
2. In the Reference Sequences table, click the entry for hg19:
Version 3.4.1
The hg19 reference details page opens. 3. In the Available BED Files section, click Upload BED files. 4. Click Select a new BED File. Browse to your AmpliSeq Designer results file and select it:
5. Verify that your results file is successfully added:
Version 3.4.1
The Torrent Browser does the rest.

Use the new template in the AmpliSeq DNA template group
The Torrent Browser creates your new template in the AmpliSeq DNA template group. The new template has the same name as your AmpliSeq Designer design:
Next you use your new template to create a run plan, which executes on your sequencer. See Planned Runs and Te mplates.
Version 3.4.1
Monitor Tab
Monitor Tab
The Monitor tab provides you with information, optionally in thumbnail graphs as well as numerical format, to help you confirm that your current runs are working. This tab provides data for you to know whether an in-progress run is working or not, through the following metrics: Beads loading Key signal Usable sequence In the Monitor tab, you can also review the planned run settings for a run that is currently in progress on the sequencing instrument. Example monitoring metrics
Version 3.4.1
Views Auto Update Review the planned run settings
Example monitoring metrics

An example entry in the Monitor > Runs in Progress is shown below:
With the Monitor tab List View you can see at a glance if any run quality metrics fall below the thresholds that you define in your template (see Templates). Any metrics below threshold are shown in red in the thumbnail graphs. Other information shown in Run in Progress entries are: The Sequencing run name Run information: started date, chip type, run type, and run notes A link to the run report Run status: In progress, completed, or terminated A link to the run plan for this sequencing run The number of flows transferred A flow transfer progress bar
Views
The Monitor > Runs in Progress page supports a list view and a table view. An example list view entry is shown in E xample. The list view display 3 or 4 runs per page. The table view, shown below, displays 1 run per row.
When you use the table view, you can sort the table by any of the columns in bold type. Click a column header to sort the table, and click the header a second time to reverse the sort.
Auto Update
Version 3.4.1
Auto Update refreshes your page display whenever a new run is available to display. With Auto Update off, the page is a static display of information at the time you opened the page:
When Auto Update is on, the button changes to Stop Updates:
Review the planned run settings

In the Monitor tab you can review the planned run settings for a run that is in progress. In the table view, open the planned run review from the gear menu on the right of a table entry. The gear menu is only available on this page while the run is still in progress.
In the list view, click the Review Run Plan link. This link is only available while the run is still in progress.
The following is an example of the display when you review planned run settings:
Version 3.4.1
Version 3.4.1
Data Tab
Data Tab
With the Data tab, you inspect run results and also control your data analysis and data management tasks. In the Data > Completed Runs & Results tab, you review completed runs and run reports. Use this tab to search, filter, and sort the Ion PGM and Ion Proton sequencer runs to display. You can also resubmit a run with the same or changed run parameters. For an overview, including UI controls, see Completed Runs and Reports Tab. For run report details, see Torrent Browser Analysis Report Guide. Normally you use a template to specify data management tasks to be automatically completed. (In this release, a template supports automation of your export and project selections.) In the Data > Projects tab, you can manually perform the following data management tasks. See Projects Tab.
Version 3.4.1
Combine multiple result sets into one (useful to later analyze as a single run). Archive result sets Prune results sets (remove some data from a result set) Export result sets to another system for additional analysis Group result sets into projects for convenient tracking and bulk data management
The Data tab contains subtabs for Completed Runs & Results and Projects:
Note: To monitor (and possibly terminate) sequencer instrument runs that are in progress, see the Monitor Tab.
Version 3.4.1
Completed Runs and Reports Tab

Torrent Browser User Interface Guide Completed Runs and Reports Tab
Use this tab to to search, filter, and sort your sequencing instrument runs to be displayed. You can also edit a run plan, reanalyze a run, and manually run a plugin. You can view the run information in a table view that contains one run per row or a list view that displays about three runs per page. You access a detailed run report by clicking on the report name. Or click on the Open in a new window icon ne xt to a report name to open the run report in a new browser tab or a new browser window. (See the Torrent Browser Analysis Report Guide for a description of run reports). The Completed Runs & Reports page is divided into three areas: The top panel provides menus and fields to filter the run display. The middle panel displays a list of runs that matched the run filtering specification. Two view styles are available: table and list. The bottom panel displays the current page number, with links to navigate between the previous and next pages (if present) and a link to download a CSV file of the run information to your local machine. Views Search for a run Filter the displayed data Filter menus The date filter The starred runs filter Sort Report Data Management Export Archive Prune Toggle Exemption View Log Other UI controls Representative run report CSV metrics file What is the point? Where are we? Views You can view results in a table view that is one run per row or a list view with about three runs per page. Here is an example of the list view:
Version 3.4.1
Here is an example of the table view:
Version 3.4.1
Notes entered on the sequencing instrument are listed in the run entry to aid in finding and identifying the run of interest.
Search for a run Use the Search names field to search by run name or partial run name. Click the Go button to active the search.
The Completed Runs & Report listing is then restricted to runs which match your search entry. Click the Clear butto n to cancel the search and restore all results. The Clear button also cancels the effect of the filter menus. Filter the displayed data The filter menus and fields are the same for both the table view and the list view:
Filter menus
Version 3.4.1
These images demonstrate how to use the display filter menus. We use the All Results Status menu and Completed status as an example. This setting restricts the run table display to only runs with a Completed status. Set the All Result Status to Completed:
The menu changes to the following:
The display changes to only run with Completed status. You do not need to click the Go button for the menu setting to take effect. To turn off run status filtering, click the red X in the run status menu field:
You can also click the Clear button. The Clear button resets all menus and search fields.
The date filter
The search date field opens a menu with preset choices or a date range picker:
The selection you make in the Date field takes effect immediately (depending on server load). You do not need to click the search Go button. The Today selection enters the current date in the Date field and limits the run table display only to jobs with a run date from the current date:
Version 3.4.1
The This week selection uses a date range from Monday to the current day:
The Date Range selection opens two calendar pickers, one for the range start date and one for the range end date. Dates that you select are shown in white. The current date is shown in pale yellow.
You can optionally edit the date range directly in the Date field.
Version 3.4.1
The starred runs filter
Click the checkbox next to the search area blue star
to restrict display only to runs that you (or others) have . The start turns blue when clicked.
starred. You star a run by clicking the star next to its run name: Sort
In the run table (table view only), click any header in bold to sort the table by that column. Click a second time to reverse the sort. Report Data Management The Report Data Management menu is available in the Data > Completed Runs & Reports page in the list view only, from the gear box menu for each completed run report:
These options allow you to manage the results files and disk space implications of the run report.
Export
The Export option copies the selected run reports (and their result sets) to the exportedReports directory in the Report Data Management backup location. For more information ask your Torrent Server administrator or see Repor t Data Management.
Version 3.4.1
This Export option is not related to the automatic export that is configured in a template. The template export option sends your result set to another software system, while the Report Data Management Export option copies the result set and complete run report to a locally mounted file system.
Archive
The Process Selected... button Archive option eventually moves the selected run reports (and their result sets) to the archivedReports directory in the Report Data Management backup location. The Archive option first does the following: Creates a customer support archive. Creates a PDF of the run report. The Archive option leaves the customer support archive and the run report PDF in the run report directory. Other report files and result files are deleted from the run reports directory after the copy to the archivedReports directory.
Run reports and results files that are archived can be accessed and viewed on the archive file system, but there is no support for accessing, viewing, or managing archived run reports and result files through the Torrent Browser. For example, once a report is archived with the Report Data Management option, the Torrent Browser cannot access that report to use with Combine Alignment or other actions.
The gold Archive button specifies an ionArchive service setting and is not related to the Report Data Management Archive option. The ionArchive service is activated when free disk space thresholds are reached.
Prune
The Prune option removes files from the selected result set. Your Torrent Server administrator configures which files are deleted by the Prune option. Recovery of files deleted by the Prune option is not supported.
Toggle Exemption
Your Torrent Server administrator can configure an automatic prune or archival action. Setting the exemption toggle to trues mean the automatic action cannot act on this run report or its results files.
View Log
Version 3.4.1
The View Log option opens a history log of Report Data Management action taken on this run report:
New entries appear in the bottom of the log. The View Log icon shows the current or last Report Data Management action taken on the run report: Indicates no Report Data Management action has been taken on the run report
Pruning in progress
Pruning completed
Export in progress
Export completed
Archival in progress
Archival completed
Failure of an Report Data Management option
Other UI controls This section describes other UI controls on the Completed Runs & Reports page: Auto Update Auto Update refreshes your page display whenever a new run is available to display. With Au to Update off, the page is a static display of information at the time you opened the page. The Auto Update button shows whether the feature is on or off. Click the button to change the setting:
Version 3.4.1
The gear menu In the run table (table view only), click the gear menu to reanalyze a run or edit the planned run settings:
The list view has separate buttons to reanalyze or edit a run.
After you upgrade to the Torrent Suite 3.4 release, to reanalyze runs of an earlier release, reanalyze from the wells file.
Archive menu With the list view Archive menu, you specify the ionArchive service settings for a run report:
Version 3.4.1
When disk space thresholds are reached, the ionArchive service deletes or archives reports and result sets based on these settings. Open in new window The icon next to new window. Representative run report When you have multiple sequencing runs for a sample, you can designate one or more of the run reports as the representative report or reports for the group. The representative report appears at the top of Completed Runs & Reports listings and is accessible with a single click. Other reports may require you to use a See All Reports button to access them. Follow these instructions to set a run report as representative. The report must be for an already-completed run. 1. Go to the Data > Completed Runs & Reports page and select List View. 2. Find the run, and click the Show all reports link (your link will have a different number): a report name opens the run report in a new browser tab or a
3. In the list of all reports, click the thumbs-up icon
for the report you want to mark as representative.
4. That report moves to the top of the list of all reports. Click the Hide link. Now the representative report is shown at the top of the list of report for that run:
Version 3.4.1
CSV metrics file
At the bottom of the list view page, the Download CSV link downloads a comma-separated value file of report metrics:
For the format of the CSV file, see CSV Metrics File Format. What is the point? The main point of the Data > Completed Runs & Reports page is to find and use your run reports and result sets. You can also do these things in this page: Search for runs by run name, date, run status, sequencing instrument name, project name, or other search and filtering criteria. Reanalyze a run: Rerun either with the same plan settings or edited settings. Restart from signal processing, base calling, or alignment. Restrict output to only runs you have starred. Open a run report. From a run report, you can download results files and manually launch a plugin. Specify archive settings for a run report. Manually export, archive, or prune the run report and result set for a completed run.
Where are we?
The Data > Completed Runs & Reports page is used during the phases in bold: Application, product > template > planned run > instrument run > monitor > results > run report > other data analysis and data management
Version 3.4.1
Work with Completed Runs

Torrent Browser User Interface Guide Work with Completed Runs
Reanalyze a run Add run to a project Terminate an analysis run Change the analysis reference Change run metadata To begin a sequencing run, see Templates and Planned Runs.
Reanalyze a run
After you upgrade to the Torrent Suite 3.4 release, to reanalyze runs of an earlier release, select Signal Processing with Start reanalysis from option. 1. Go to the Data > Completed Runs & Reports tab and find your run name.
Version 3.4.1
1.
In the table view, click the Reanalyze option in the gear menu on the right of the run entry:
The main run analysis dialog opens:
To rerun the analysis with the same settings, fill in the report name and click Start Analysis. To rerun the analysis with changed settings, click the Advanced button to display the additional run parameter options:
Version 3.4.1
The analysis fields are described below: Parameter....... Report name Description Text string of the report name (up to 128 characters). Required.
Version 3.4.1
Start reanalysis from
The Analysis Pipeline proceeds through three stages: Signal Processing, Base Calling, and Alignment. Normally report generation proceeds through all three steps, but if you have already generated a report, it is possible to reanalyze the experiment and skip the earlier stages of the pipeline. For example, you may wish to change the genome that is used for Alignment. After changing the genome for the experiment on the Runs page using the Edit field, you need to reanalyze data to produce a new report using the new genome. But since there is no need to repeat the time consuming Signal Processing and Basecalling steps, you can use the output from an existing report as a starting point for Alignment, and the report will be completed much more quickly. You can restart the analysis from these points: Signal Processing (Default) Does not use the Use data from previous report field. Reprocesses from the .dat files. You can optionally use both the Analysis args and Basec aller args fields. Base Calling Uses the Use data from previous report field and optionally the Basecall er args field. Reprocesses from the .wells file. Does not use the Analysis args field.
Use data from previous report
This option applies only when starting reanalysis from Base Calling or Alignment. In these cases, the results from a previous report are used as input for reanalysis. Beadfind module command line arguments. Should not be modified unless instructed by Ion Torrent Technical Support. Analysis command line arguments. Should not be modified unless instructed by Ion Torrent Technical Support. Basecaller command line arguments. Should not be modified unless instructed by Ion Torrent Technical Support. Recalculates signal measurements for homopolymers. Sequence used to identify library reads. Example: "TCAG".
Beadfind args
Analysis args
Basecaller args
Enable Base Recalibration Library Key
Version 3.4.1
TF key TF config
Sequence used to identify test fragment reads. Example: "ATCG". Name of an external file that specifies Test Fragment information. If a file is not specified, the default Test Fragment file is used. Use this menu to change the reference used for alignment in the new analysis. Custom arguments for the TMAP aligner. Leave blank to use the default TMAP parameters. Filter out PCR duplicates. Useful when reanalyzing combined BAM files. When enabled, this option uses Picard MarkDuplicates and sets a flag in the BAM file. See http://picard.sourceforge.net/comman d-line-overview.shtml#MarkDuplicates for more information. Enter one or more (comma-separated) project names if you want the result set to automatically be a member of a project or projects. Projects are created if they do not already exist. (Check your spelling of project names. A typo creates a new project and the report is not sent to the correct project.)
Alignment Reference TMAP args
Mark PCR duplicates
Project name(s)
2. Enter the parameter values or accept the previous settings. Click Start Analysis to start the run, which checks the analysis status before displaying the run confirmation message:
3. View run progress by clicking Report or by selecting the run name in the Monitor tab. 4. Click Log to view run progress details in text form. Click your browser refresh button to update the log.
Add run to a project
In the Data tab Completed Runs & Reports page table view, you can add a completed run to a project. (You optionally create projects to group your runs. For more information, see Projects Tab.)
Version 3.4.1
The following list describes advantages of grouping your results sets into projects. Combine multiple result sets into one (useful to later analyze as a single run) Archive result sets Prune results sets (remove some data from a result set) Export result sets to another system for additional analysis Group result sets into projects for convenient tracking and bulk data management Follow these steps to add a completed run to a project: 1. Go to the Data > Completed Runs & Reports page and click Table View. 2. Find the run report you want to add to a project. For that run, click the gear menu on the right and select Add Report To Project:
3. The Pick Projects page opens:
4. Enable the checkbox for the project (or projects) you want the run report added to. Click the Add projects button. The run report is added to the selected project or projects.
Version 3.4.1
Terminate an analysis run
To terminate a run that has not yet completed, go to the Services option in the Admin menu and click Terminate to the right of the run name. (See also: Terminate an Analysis Run, under Use Cases)
Change the analysis reference
Use the following procedure to change the reference for an analysis: 1. Follow the instructions in Reanalyze a run to open the run analysis dialog advanced options. 2. Use the Alignment Reference menu to select the new reference:
3. Follow the instructions in Reanalyze a run to save your selection and to redo the analysis.
Change run metadata
The Completed Runs & Reports edit option allows you to change the metadata for a run, for example, to add a note or to correct the following run metadata: Sample name Application type (run type) Reference name DNA barcode set (index) Library kit Sequencing kit Chip identifying barcode Library key 3' adapter
You must restart or re-analyze your run for these changes to take effect.
When you change the metadata, you change the information in the run database. Because the analysis pipeline is initialized with the run database information at the time that an analysis starts, changing metadata does not affect an analysis that is in progress. For a running analysis, you must terminate the run and start analysis manually. For a completed analysis, you must re-analyze the run.
Points to know about changing metadata: The run report (in the Completed Runs & Reports tab) always shows the metadata in effect for the run. If your
Version 3.4.1
changes are not shown in the run report, the changes were not in place at the time the report was generated. If you add or change an entry in the Notes field, that note does not appear in the run report unless you restart or re-analyze the run (even though the note does not affect the analysis results).
The Edit Run page
The Edit options open the Edit Run page:
Version 3.4.1
Version 3.4.1
Location of the Edit option or button
In the table view, the Edit option is found in the gear menu on the right of a run entry:
In the list view, use the Edit button on the right of the run entry:
Edit run metadata
Follow these steps to change metadata for a run: 1. In the table view, click the Edit option in the run entry's gear menu. In the list view, click the edit button in the run entry. 2. In the Edit Run page, make your corrections to the metadata. 3. When you are done, click Save. 4. Restart the run: a. If the run is in progress, terminate the run and restart it. b. If the run is completed, re-analyze the run.
Your changes in the Edit Run page do not affect a run that is in progress.
Notes: The Reverse Run checkbox is not supported in this release.

Version 3.4.1
The ChipBarCode field contains a chip identifier. The chip barcode should not be confused with chemical barcodes and barcode sets (which are described here: Manage DNA Barcodes and DNA Barcode Sets).
Projects Tab
Torrent Browser User Interface Guide The Projects Tab
With the Data > Projects tab, you control your data analysis and data management tasks. Projects are simply groups of runs. You create and use these groups in a way that makes sense for your research. Projects are useful to hold runs for instance for the same laboratory project or runs that you will later handle in the same way (for data export or archival). Projects are intended to be a convenience: You do not have to repeatedly search through the completed runs table to find related runs. You can perform data management tasks on many members of a project at a time.
Version 3.4.1
In the Projects tab, you can access the main projects listing page and also the detail page for a single project (called called the project result sets page). In the main projects listing page, under Data > Projects, you can do the following (see Projects Listing): Search the listing by project name or partial name Filter the listing by date (date range, current month, current week, current day, or specific date) Rename a project Delete a project View a history log for a project Open the result sets page for a project In a project result sets page, under Data > Projects > projectname, you can manually perform the following data management tasks. In one action, you can do these to a single result set (a single run), or to some or all of the result sets in the project.(See Project Result Sets Page.) Combine multiple result sets into one (useful to later analyze as a single run) Archive result sets Prune results sets (remove some data from a result set) Export result sets to another system for additional analysis Group result sets into projects for convenient tracking and bulk data management Copy result sets to other projects Remove result sets from the current project Search the result sets for by name or partial name Filter the project display by date (date range, current month, current week, current day, or specific date) Download a CSV file of metrics for one or more analyses in the project These menus show the actions you can take on members of a project, from the project result sets page, under Data > Projects > projectname:
You can think of these options as acting on either the run report or the run's result set (or both). Example Projects listing page Example project result sets page Add a report to a project Example Projects listing page
Version 3.4.1
The Data > Projects page lists all projects that exist on your Torrent Server:
Example project result sets page An example project result sets page, under Data > Projects > projectname is shown below. You get to this page by clicking on the project name in the Data > Projects listing.
Version 3.4.1
Add a report to a project You can add a completed run report to a project from the Data > Completed Runs & Reports page or from an existing project. Follow these steps to add a report to a project from the Data > Completed Runs & Reports page: 1. In the list view, click the gear menu for the report and select Add Report to Project:
Version 3.4.1
Or, in the table view, click the gear menu for the report and select Add Report to Project:
2. The Pick Project popup opens:
Version 3.4.1
3. Enable the checkbox for the project or projects and click the Add projects button. The report becomes a member of the project or projects that you select.
From an existing project, click the Process Selected... button and select Add to Project.Then follow the Pick Project popup step described above.
Version 3.4.1
See also
For the main projects page, Data > Projects, see Projects Listing. For a project detail page, Data > Projects > projectname, see Project Result Sets Page.
Version 3.4.1
Projects Listing
The Projects Listing Page
The Data > Projects page lists all projects that exist on your Torrent Server. On the project listing page, you can do the following: Open the result sets page for a project (click on the project name)
Version 3.4.1
Create a new empty project Rename a project Delete a project View a history log for a project Search the listing by a project name or partial name Filter the listing by date (date range, current month, current week, current day, or specific date) Sort the projects listing by Name or Last Modified See also Project Result Sets page for a description of a single project. Example Projects listing page Open project details Rename a project Delete a project View project history Sort Search Filter by date Example project result sets page
Example Projects listing page
The Data > Projects page lists all projects that exist on your Torrent Server:
Version 3.4.1
Open project details
To open the result sets page for a project, click on the project name, under the Name column.
Rename a project
You rename a project on the Data > Projects page, with the edit button under the Action column:
Version 3.4.1
A dialog opens for you to enter the new name:
You cannot use the name of a project that already exists. However, case differences matter: you can have both a project named "ExampleProject" and one named "exampleProject".
Delete a project
You delete a project from the either the project's details page or the Data > Projects page. On the Data > Projects page, use the delete button under the Action column:
On a project's details page, use the Delete Project button:
Version 3.4.1
A confirmation dialog appears:
Be sure before you press the Yes, Delete button. There is no undo. Deleting a project does not delete the run reports that were members of the project.
View project history
On the Data > Projects page, use the Log button under the Action column to open the history log for that project.
Sort
Sort the projects listing by the Name or Last Modified columns. Click a column heading in bold type to sort the
Version 3.4.1
listing. Click the column heading again to reverse the sort.

Search
In the Data > Projects page, you can search for project names and in a project details page you can search for run report names. The search field behavior is the same in both cases. After you press Go, the displayed information is limited to only names which match or contain the search string.
The search field takes a complete or partial name. For example, the following project names match the search string "mpli": amplicon, amplicon33, AmpliSeq, Samplier. The search is not case-sensitive. Wildcards are not supported in the search string. Click the Clear button to cancel the search and display unfiltered results.
Filter by date
The date filter controls are the same on both the Data > Projects tab and in a project details page. The date field opens a menu with preset choices or a date range picker:
The selection you make in the Date field takes effect immediately (depending on server load). You do not need to click the search Go button.
Version 3.4.1
The Today selection enters the current date in the Date field and limits the run table display only to jobs with a run date from the current date. The This week selection uses a date range from Monday to the current day. The Last 7 days selection uses a date range from 6 days ago to the current day. The This month selection uses a date range from the first of the current month to the current day. The Date Range selection opens two calendar pickers, one for the range start date and one for the range end date. The current date is shown in pale yellow. Dates that you select are shown in white, as are the dates of the current date range (if any). Click the Done button after using the Date Range picker. You can optionally edit the date range directly in the Date field: Use the Clear button to remove the filter and return to the full results listing.
Example project result sets page
An example project result sets page is shown below. You get to this page by clicking on the project name in the Data > Projects listing. (See Project Result Sets page for a description of this single project page.)
Version 3.4.1
Project Result Sets Page
Version 3.4.1

A Project Result Sets Page
The project details page lists the result sets for a single project. You reach this page by clicking on the project name in the Data > Projects tab. Projects are simply groups of runs that you create and use in a way that makes sense for your lab environment and your research. In a project's detail page, you can manually perform these data management tasks: Combine multiple result sets into one (useful to later analyze as a single run). Archive result sets Prune results sets (remove some data from a result set) Export result sets to another system for additional analysis Group result sets into projects for convenient tracking and bulk data management Download a CSV file of metrics for one or more analyses in the project
Example project result sets page Download a CSV file of metrics Project menus and actions Actions on members of a project Combine Alignments Add to Project Remove from Project Export Archive Prune Search Filter by date Sort Delete a project For instead a description of run report contents, see the Torrent Browser Analysis Report Guide.
Example project result sets page
An example project result sets page is shown below. You reach this page by clicking on the project name in the Data > Projects listing.
Version 3.4.1
Download a CSV file of metrics
In a project's Results Sets listing, you can generate a CSV file of analysis metrics and compare results across analyses. To generate the CSV file, first select the checkboxes for the analyses, then click the Download Selected CSV butto n. The button is inactive until at least one analysis checkbox is enabled. See CSV Metric File Format for a description of the metrics that are included in the CSV file.
Project menus and actions
These menus show the actions you can take on members of a project:
Version 3.4.1
You can think of these selections as acting on either the run report or the run's result set (or both). In each case, you first select the reports' checkboxes, then select the menu action: Combine Alignments Combines reads aligned from multiple run reports. The resulting data set can be treated the same results from a single analysis run, for instance to export or to use as input to a plugin. Intended for use when multiple runs analyze the same tissue sample, for example when a tissue sample is run on more than one chip. All reports must be aligned to the same reference. Add to Project Adds the selected result sets to other projects. Remove from Project Removes the selected result sets from the current project. (Does not delete the run report.) Export Copies the selected run reports to the Report Data Management export backup location. (Does not delete the run reports or their project membership.) Archive For each selected run report, creates a PDF of the run report, creates a customer support archive, copies the run report to the Report Data Management archive backup location, and then deletes the run report and result set, except for the run report PDF and the new customer support archive. (Does not delete their project membership.) Prune Delete a class of files from selected result sets.
Actions on members of a project
The Combine Selected... and Process Selected... menus show the actions you can take on members of a project:
Version 3.4.1
You first select the reports' checkboxes, then select the menu action. You can think of these selections as acting on either the run report or the run's result set (or both).
Combine Alignments
Use the Combine Selected... > Combine Alignments option to combine reads aligned from multiple run reports. This option is intended for use when multiple runs analyze the same tissue sample, for example when a tissue sample is run on more than one chip. The resulting data set can be treated the same results from a single analysis run, for instance to export or to use as input to a plugin. All reports must be aligned to the same reference and must be member of the same project. 1. 2. 3. 4. Have the run reports that are to be combined in the same project. In that project, select the checkboxes for the run reports that are to be combined. Open the Combine Selected... menu and select the Combine Alignments option. In the Combine Results popup, enter your choice of name for the new combined run report, and click Save.
5. The new combined run report also becomes a member of your project.
Add to Project
Use the Process Selected... > Add to Project option to copy the selected result sets to one or more other projects. In the next screen, the project selection screen, enable the checkbox for each project that the selected result sets are to be copied to. Use the page 1 navigation at the bottom right to scroll through the list of project names. The Add to Project option adds the selected result sets to the other project (or projects). The result sets are not removed from the current project.
Version 3.4.1
Remove from Project
Use the Process Selected... > Remove from Project option to removes the selected result sets from the current project. Be careful when using this option it does not give you a confirmation screen before removing the projects. This option does not delete the selected run reports and their result sets it only removes them from the current project.
Export
The Export option copies the selected run reports (and their result sets) to the exportedReports directory in the Report Data Management backup location. For more information ask your Torrent Server administrator or see Repor t Data Management. This Export option is not related to the automatic export that is configured in a template. The template export option sends your result set to another software system, while the Report Data Management Export option copies the result set and complete run report to a locally mounted file system.
Archive
The Process Selected... button Archive option eventually moves the selected run reports (and their result sets) to the archivedReports directory in the Report Data Management backup location. The Archive option first does the following: Creates a customer support archive. Creates a PDF of the run report. The Archive option leaves the customer support archive and the run report PDF in the run report directory. Other report files and result files are deleted from the run reports directory after the copy to the archivedReports directory.
The gold Archive button specifies an ionArchive service setting and is not related to the Report Data Management Archive option. The ionArchive service is activated when free disk space thresholds are reached.
Prune
The Prune option removes files from the selected result sets. Your Torrent Server administrator configures which files are deleted by the Prune option. Recovery of files deleted by the Prune option is not supported.
For more information ask your Torrent Server administrator or see Report Data Management.
Search
In the Data > Projects page, you can search for project names and in a project details page you can search for run report names. The search field behavior is the same in both cases. After you press Go, the displayed information is limited to only names which match or contain the search string.
Version 3.4.1
The search field takes a complete or partial name. For example, the following project names match the search string "mpli": amplicon, amplicon33, AmpliSeq, Samplier. The search is not case-sensitive. Wildcards are not supported in the search string. Click the Clear button to cancel the search and display unfiltered results.
Filter by date
The date filter controls are the same on both the Data > Projects tab and in a project details page. The date field opens a menu with preset choices or a date range picker:
The selection you make in the Date field takes effect immediately (depending on server load). You do not need to click the search Go button. The Today selection enters the current date in the Date field and limits the run table display only to jobs with a run date from the current date. The This week selection uses a date range from Monday to the current day. The Date Range selection opens two calendar pickers, one for the range start date and one for the range end date. The current date is shown in pale yellow. Dates that you select are shown in white, as are the dates of
Version 3.4.1
the current date range (if any). You can optionally edit the date range directly in the Date field. Use the Clear Selection button to cancel filtering and return to the full results listing.
Sort
You can sort the project's run reports by clicking on any of the column heading that are in bold type. Click the heading a second time to reverse the sort.
Delete a project
On a project's details page, use the Delete Project button:
A confirmation dialog appears:
Be sure before you press the Yes, Delete button. There is no undo. Deleting a project does not delete the run reports that were members of the project.
Version 3.4.1
CSV Metric File Format

A Comma-Separated Value (CSV) file is a universal text file format for storing data. You can download an analysis metrics CSV file that contains analysis-level information for one or more Torrent Server analysis runs, in the Torrent Browser Projects > ProjectsName > Results Sets in ProjectName page. In the CSV file, each line represents a Torrent Server analysis run, and within each line information fields are separated by a comma. These files are easily opened using spreadsheet software, such as Microsoft Office Excel or Open Office Calc, where each comma-separated field is listed in a separate column. The Torrent Browser CSV file has many CSV fields per entry, as described in the following table:
Version 3.4.1
Field Report Status Flows TF Name* Q10 Mean* Q17 Mean* System SNR* 50Q10 Reads*
Description Name of the analysis run report Status of the analysis (e.g., Started, Complete) Number of flow cycles from the actual sequencing run Test Fragment Name Average Q10 read length. Average Q17 read length System Signal-to-Noise Ratio Number of TF Ion Sphere Particles (ISP) at 50+ bp at Q10 Number of TF Ion Sphere Particles (ISP) at 50+ bp at Q17 Number of reads that have test fragment keys Signal strength of the first three bases of the TF key Total number of reads Reads of length at least 50bp with 90% or greater accuracy Reads of length at least 100bp with 90% or greater accuracy Reads of length at least 200bp with 90% or greater accuracy Average length of reads with 90% or greater accuracy Average per base coverage considering reads with 90% or greater accuracy Longest read length amongst reads with 90% or greater accuracy Total bases from reads with 90% or greater accuracy
50Q17 Reads*
Keypass Reads* TF Key Peak Counts* Total_Num_Reads Library_50Q10_Reads
Library_100Q10_Reads
Library_Mean_Q10_Length Library_Q10_Coverage
Library_Q10_Longest_Alignment
Library_Q10_Mapped Bases
Version 3.4.1
Library_Q10_Alignments
Number of alignments from reads with 90% or greater accuracy Reads of length at least 50bp with 98% or greater accuracy Reads of length at least 100bp with 98% or greater accuracy Reads of length at least 200bp with 98% or greater accuracy Average length of reads with 98% or greater accuracy Average per base coverage considering reads with 98% or greater accuracy Longest read length amongst reads with 98% or greater accuracy Total bases from reads with 98% or greater accuracy Number of alignments from reads with 98% or greater accuracy Reads of length at least 50bp with 99% or greater accuracy Reads of length at least 100bp with 99% or greater accuracy Reads of length at least 200bp with 99% or greater accuracy Average length of reads with 99% or greater accuracy Average per base coverage considering reads with 99% or greater accuracy Longest read length amongst reads with 99% or greater accuracy Total bases from reads with 99% or greater accuracy Number of alignments from reads with 99% or greater accuracy Signal strength of the first three bases of the library key
Library_50Q17_Reads
Library_Q17_Mapped Bases Library_Q17_Alignments
Library_50Q20_Reads
Library_Q20_Mapped_Bases Library_Q20_Alignments
Library_Key_Peak_Counts
Version 3.4.1
Library_50Q47_Reads Library_100Q47_Reads Library_200Q47_Reads Library_Mean_Q47_Length Library_Q47_Coverage
Number of perfect reads of length at least 50bp Number of perfect reads of length at least 100bp Number of perfect reads of length at least 200bp Average length of perfect reads Average per base coverage considering only perfect reads Longest reads length amongst perfect reads Total bases from perfect reads Number of alignments from perfect reads CAFIE metric: Carry forward CAFIE metric: Incomplete extension CAFIE metric: Signal/polymerase loss (droop) System Signal-to-Noise Ratio Name of the sample Name of the reference genome Any additional user-provided notes Long name of the analysis run Name of the PGM or Proton instrument where the sample was sequenced Date the sample was sequenced Location of the raw DAT files on the Torrent Server NA NA NA NA
Library_Q47_Longest_Alignment Library_Q47_Mapped_Bases Library_Q47_Alignments Library_CF Library_IE Library_DR Library_SNR Sample Library Notes Run Name PGM Name
Run Date Run Directory Num_Washouts Num_Dud_Washouts Num_Washout_Ambigous Num_Washout_Live
Version 3.4.1
Num_Washout_Test_Fragment Num_Washout_Library Library_Pass_Basecalling Library_pass_Cafie Number_Ambiguous Number_Live Number_Dud Number_TF Number_Lib Number_Bead Library_Live Library_Keypass
NA NA NA NA NA Number of wells producing a signal Number of wells with ISPs but no signal Number of wells containing test fragment Number of wells containing library Number of wells containing beads Number of wells containing library ISP with signal Number of wells containing library ISP with signal and match key Number of wells containing test fragment ISP with signal Number of wells containing test fragment ISP with signal and match key Number of wells containing ISP with signal and match key JSON string of plugin data JSON string of plugin data
TF_Live
TF_Keypass
Keypass_All_Beads
P s
* Columns 4-11 contain test fragment metric. There is one row of metrics for each test fragment: A through D. The other columns contain library read metrics.
Admin Menu
The Admin Menu
The Torrent Browser Admin pages are accessed through the gear symbol menu near the top right of a Torrent
Version 3.4.1
Browser page:
See the Torrent Server Administration Guide for information on these pages.
Version 3.4.1
UI Table Of Contents
Version 3.4.1
Torrent Browser Analysis Report Guide

Introduction
A Torrent Browser run report contains statistics and quality metrics for your run. From a run report you can do the following: Review pre-alignment metrics such as bead loading, Ion Sphere Particle (ISP) density, total number of reads, filtering numbers, and mean read length Review alignment metrics such as total aligned bases, average coverage, and mean raw accuracy Download the result set Manually run a plugin on the run results Review the planned run settings Review the test fragments used with this run and test fragment quality metrics Review analysis information and Torrent Suite software versions Review the analysis log Generate a zip file for technical support See Old report analysis to handle runs generated with version of Torrent Suite earlier than 3.0. A run report is divided into the following main areas (see the example run report below): Report header Buttons to download the run report or summary as in PDF format, a button to review the planned run settings for the run, a menu to change to a different result set for the same sample, and a navigat ion bar, for instance to jump to the Output Files section. Barcode Summary For barcoded runs, a barcode summary table appears at the top of the run report. Unaligned Metrics taken before alignment, including bead loading, ISP density and other metrics, read and filtering metrics, and read length Aligned Metrics on the aligned reads Plugin Previews Summary output of completed plugins (when supported by the plugin) Output Files Download buttons for both pre-aligned reads and aligned reads files Plugin Summary Links to plugin reports and a button to select another plugin to run (on a completed analysis) Test Fragments A button which displays information about the performance of each test fragment included in the experiment Analysis Details A button which displays a set of information about the sequencing run environment (run date, sample name, chip type, instrument name, barcode set, etc.) Support A button which displays a link to the report log and a link to generate information for technical support Software Version A button which displays the version of Torrent Suite software and its modules
Version 3.4.1
Version 3.4.1
Report header
The run report header contains the following: A navigation bar to jump to other areas of the report, such as the Output Files section Summary PDF and Plugins PDF buttons to download the run report summary or the plugin results in PDF format A Classic Report button to view the run report in the Torrent Suite 2.x format A Result Set menu to view the run report of a different result set for the same sample A Review Run Plan button to view the planned run information for this run A Notes field which lists notes added to the run
Version 3.4.1
Old report analysis

The Torrent Browser cannot display run reports from earlier versions of the Torrent Suite software in the new run report format. To work with results generated with an earlier version of Torrent Suite software, you have these options: Re-analyze the run to generate a new report Opens the Data > Completed Runs & Reports > Reanalyze page. Typically you click Start Analysis button to re-analyze with the same settings. The Adv anced page is also available to change the analysis settings. After you re-analyze the run, you then have all 3.x features available in the new run report. View the pre-3.0 report Open the run report in the old pre-3.0 style. Many 3.x features are not available in the old style run report. View this report log Open the text log for this run.
Version 3.4.1
Contents Torrent Browser Analysis Report Guide Run Report Metrics Run Metrics Overview Run Report Metrics Before Alignment Run Report Metrics on Aligned Reads Barcode Reports Test Fragment Report Report Information Output Files Plugin Summary Run the Installed Plugins Alignment Plugin Coverage Analysis Plugin ERCC Analysis Plugin FastqCreator Plugin IonReporterUploader Plugin Run RecognitION Plugin sampleID Plugin SFFCreator Plugin Torrent Variant Caller Plugin Pre-3.0 Run Reports
Run Report Metrics

Run Report Metrics
This section provides background information on run metrics and detailed descriptions of a run report. See Run Metrics Overview for explanations of quality metrics, read length calculations, and alignment. Run Metrics Overview Run Report Metrics Before Alignment Run Report Metrics on Aligned Reads For analyses that are members of a project, you can download a CSV file of run metrics. See Project Result Sets Page and CSV Metric File Format.
Version 3.4.1
Run Metrics Overview

Run Metrics Overview This page provides background information on quality metrics, read lengths, and alignment. These concepts are required to understand your run report. The Torrent Browser Analysis Report gives performance metrics for reads whose initial bases match the library key. These reads are generated from the input library, not from the positive control Test Fragments.
Performance is measured based on either predicted quality or quality as measured following alignment. Q20 and AQ20 are explained as examples of predicted quality and quality following alignment.
Version 3.4.1
Predicted Quality (Q20) Quality Following Alignment (AQ20)

Predicted Quality (Q20)
The number of called bases with a predicted quality of Q20 is reported. The predicted quality values are reported on the Phred scale, defined as -10log10 (error probability). Q20, therefore, corresponds to a predicted error rate of one percent. Refer to http://en.wikipedia.org/wiki/Phred_quality_score for a more complete description of Phred values.
Quality Following Alignment (AQ20)
Alignment of reads can be a useful process to assess the quality of the sequencing reaction and the quality of the underlying library where an accurate reference is available. Reads are aligned to a reference genome. Any discrepancy in alignment to a reference (whether biological or technical, meaning a real variant or a sequencing error) is listed as a mismatch. Alignment performance metrics are reported depending on how many misaligned bases are permitted. Torrent Suite reports alignment performance at two quality levels: AQ20 Perfect
How Is Aligned Read Length Calculated?
The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read at which the accuracy in the bases up to and including the position meets the accuracy threshold. So for example the AQ20 length is the greatest length at which the error rate is 1% or less. The "perfect" length is simply the longest perfectly aligned segment. For all of these calculations the alignment is constrained to start from position 1 in the read - in other words, no 5' clipping is permitted. The underlying assumption is that the reference to which the read is aligned represents the true sequence that should have been seen. Suitable caution should be taken when interpreting AQ20 values in situations where the sample sequenced has substantial differences relative to the reference used, such as working with alignments to a rough draft genome or with samples that are expected to have high mutation rates relative to the reference used. In these situations the AQ20 lengths might be short even when sequencing quality is excellent. Specifically, the AQ20 length is computed as follows: 1. Every base in the read is classified as being correct or incorrect according to the alignment to the reference. 2. At every position in the read the total error rate is computed up to and including that position. 3. The greatest position at which the error rate is one percent or less is identified and that position defines the AQ20 length. For example, if a 100bp read consists of 80 perfect bases followed by 2 errors followed by 18 more perfect bases, the total error rate at position 80 is zero percent. At position 81 the total error rate is 1.2% (1/81), at position 82 the error rate is 2.4%, continuing up to position 100 where it is two percent (2/100). The greatest length at which the error rate is one percent or less is 80 and the greatest length at which the error rate is two percent or less is 100, so the AQ20 lengths are 80 and 100 bases, respectively.
How Is Alignment Performed?
Within Torrent Browser, the objective is to provide you with a view on alignment that helps determine run and library quality.
Version 3.4.1
There are many alignment algorithms available within the marketplace and you are encouraged to consult with a bioinformatician for the most appropriate alignment algorithm for your downstream analysis needs. Alignment algorithms are also embedded in many of the commercial software tools available within the Ion Torrent Web store. You are also encouraged to experiment with these tools. Alignment within Torrent Browser is performed using TMAP. TMAP is currently an unpublished alignment algorithm, created by the authors of the BFAST algorithm. Please, contact Ion Torrent Technical Support for more information about TMAP. Technical Note - Analysis Pipeline Technical Note - TMAP Alignment Although TMAP is unpublished and a reference is not currently available, the precursor to TMAP, BFAST, is based on the ideas in the following publications: Homer N, Merriman B, Nelson SF. BFAST: An alignment tool for large scale genome resequencing. PMID: 19907642 PLoS ONE. 2009 4(11): e7767. http://dx.doi.org/10.1371/journal.pone.0007767 Homer N, Merriman B, Nelson SF. Local alignment of two-base encoded DNA sequence. BMC Bioinformatics. 2009 Jun 9;10(1):175. PMID: 19508732 http://dx.doi.org/10.1186/1471-2105-10-175
Which Reads Are Used in the Alignment Process?
The alignment stage involves aligning reads produced by the pipeline to a reference genome and extracting metrics from those alignments. By default, Torrent Suite aligns all reads to the genome, however there may be situations, particularly with large genomes, where the alignment takes longer than the user is willing to wait. So for such circumstances the Torrent Suite also has the capability to define on a per-reference basis the maximum number of reads that should be aligned from a run. For more detail on how to enable and specify this reference-specific limit see the Adding a Reference Sequence section of Working with Reference Sequences. When the number of reads in a run exceeds a genome-specific maximum, a random sample of reads is taken and results are extrapolated to the full run. By sampling a quickly-aligned subset of reads and extrapolating the values to the full run, the software gives you enough information to be able to judge the quality of the sample, library and sequencing run for quality assessment purposes. The outputs of the alignment process is a BAM file. The BAM file includes an alignment of all reads, including the unmapped, with exactly one mapping per read. When a read maps to multiple locations, the mapping with the best mapping score is used. If more than one such mapping exists, a random mapping is used and given a mapping quality of zero.
Version 3.4.1
Run Report Metrics Before Alignment

Run Report Metrics Before Alignment The Unaligned area in the Run Summary section provides before-alignment metrics. There are three sections in the Unaligned area: ISP Density ISP Summary Read Length
Version 3.4.1
ISP Density
This table describes the Ion Sphere Particle (ISP) density metrics: Metric Total Bases Description Number of filtered and trimmed base pairs reported in the output BAM file. Note: The SFF file format is deprecated. Key Signal Bead Loading Percentage of Live ISPs with a key signal that is identical to the library key signal. Percentage of chip wells that contain a live ISP. (The percentage value considers only potentially addressable wells.)
The ISP Density image is is a pseudo-color image of the Ion Chip showing percent loading across the physical surface. Click on the image to open a larger version:
Version 3.4.1
ISP Summary
Version 3.4.1
In the lower rows, the percentages are relative to the total in the next higher row. The first row gives percentages of loaded wells and empty wells, relative to the number of potentially addressable wells on the chip. This table describes the ISP summary metrics: Metric Total Reads Description Total number of filtered and trimmed reads independent of length reported in the output BAM file. Note: The SFF file format is deprecated. Usable Sequence Number of filtered and trimmed base pairs reported in the output BAM file. (Same as total bases.) Percentage of chip wells that contain a live ISP. (The percentage value considers only potentially addressable wells.) Percentage of chip wells that do not contain an ISP. (The percentage value considers only potentially addressable wells.) (Not calculated) Calculation (Not calculated)
Loading
No. of Loaded ISPs / No. of potentially addressable wells
Empty Wells
(No. of potentially addressable wells minus No. of Loaded ISPs) / No. of potentially addressable wells
Version 3.4.1
Enrichment
Predicted number of Live ISPs that have a key signal identical to the library key signal. The Percent Enrichment value reported is the number of loaded ISPs that are Library ISPs, after taking out Test Fragment ISPs. Percentage of chip wells that do not contain a DNA template.
Library ISPs / (No. of Loaded ISPs minus TF ISPs)
No Template
(No. of Loaded ISPs minus TF ISPs) minus (Library ISPs) / (No. of Loaded ISPs minus TF ISPs) No. of ISPs with single beads / No. of Live Wells
Clonal
Percentage of clonal ISPs (all library and Test Fragment ISPs that are not polyclonal). An ISP is clonal if all of its DNA fragments are cloned from a single original template. All the fragments on such a bead are identical (and they respond in unison as each nucleotide is flowed in turn across the chip).
Polyclonal
Percentage of polyclonal ISPs (ISP s carrying clones from two or more templates). Percentage of reads which pass all filters and which are recorded in the output BAM file. This value may be different from the Total Reads due to technicalities associated with read trimming beyond a minimal requirement resulting in Total Reads being slightly less than Final Library. Percentage of Live ISPs with a key signal that is identical to the test fragment key signal. Percentage of ISPs with an insert length of less than 8 bp. Percentage of ISPs with a low or unrecognizable signal.
Polyclonal ISPs / Live ISPs
Final Library
Final Library / Clonal ISPs
% Test Fragments
Test Fragment ISPs / Clonal ISPs
% Adapter Dimer % Low Quality
Primer dimer ISPs / Clonal ISPs Low quality ISPs / Clonal ISPs
Click the ISP Summary image to open a larger version with also a table of values from the classic run report format:
Version 3.4.1
This table describes the fields in the classic table format: Metric Addressable Wells With ISPs Description Total number of addressable wells. Number (and percentage of addressable wells) of wells that were determined to be "positive" for the presence of an ISP within the well. "Positive" is determined by measuring the diffusion rate of a flow with a different pH. Wells containing ISPs have a delayed pH change due to the presence of an ISP slowing the detection of the pH change from the solution. Number (and percentage of wells with ISPs) of wells that contained an ISP with a signal of sufficient strength and composition to be associated with the library or Test Fragment key. This value is the sum of the following categories: Test Fragment Library Test Fragment Number (and percentage of Live ISPs) of Live ISPs with a key signal that was identical to the Test Fragment key signal. Test Fragment ISPs / Live ISPs Calculation (Not calculated) Wells with ISPs / Total Addressable Wells
Live
Live ISPs / Wells with ISPs
Version 3.4.1
Library
Number (and percentage of Live ISPs) of Live ISPs with a key signal that was identical to the library key signal. Predicted number of Live ISPs that have a key signal identical to the library key signal (the same value as shown in the well information table on the right).
Library ISPs / Live ISPs
Library ISPs
Library ISPs
Filtered: Polyclonal
ISPs carrying clones from two or more templates. Low or unrecognizable signal. Insert length of less than 8 bp. Number (and percentage of Library ISPs) of reads passing all filters, which are recorded in the output BAM file. This value may be different from the Total number of reads located in the Library Summary Section due to technicalities associated with read trimming beyond a minimal requirement resulting in Total number of reads being slightly less than Final Library Reads.
Polyclonal ISPs / Library ISPs
Filtered: Low quality Filtered: Primer dimer Final Library ISPs
Low quality ISPs / Library ISPs Primer dimer ISPs / Library ISPs Final Library / Library ISPs
Version 3.4.1
In the table above, the bottom line (the Final Library ISPs) plus the Filtered fields, add up to the number of Library ISPs. Starting with the Library ISPs, first the polyclonal, then the low quality, and then primer dimer reads are filtered out, leaving the number of Final Library ISPs. The percentages of the filtered categories and the Final Library ISPs add up to 100% (100% of the Library ISPs).
Read Length
This table describes the read length metric:
Version 3.4.1
Metric Mean Read Length
Description Average length, in base pairs, of all filtered and trimmed library reads reported in the output BAM file.
The read length histogram is a histogram of the trimmed lengths of all reads present in the output files. Click on the histogram to open a larger version:
For more information on filtering and trimming, please see Technical Note - Filtering and Trimming.
Version 3.4.1
Run Report Metrics on Aligned Reads

Run Report Metrics on Aligned Reads This section of a run report provides metrics on aligned reads:
Version 3.4.1
The Total Aligned Bases
The following table describes metrics in the Total Aligned bases column. Metric Total Aligned Bases Description Number of filtered and trimmed million base pairs reported in the output BAM file. Percentage of Total Aligned Bases out of all reads. The average of the number of reads that cover each reference position.
% Aligned Bases Average Coverage Depth of Reference
The graph in the Total Aligned reads column plots number of aligned (in blue) and unaligned (in grey) bases by posit ion in an aligned sequence:
Version 3.4.1
For each position in an aligned sequence, the height of the blue area shows the number of aligned bases at that position. The grey area shows the number of unaligned bases at that position. Unaligned bases are not shown by the absolute height on the number of bases axis, but by the difference between the grey height and the blue height.
Raw Accuracy
The following table describes metrics in the Raw Accuracy column. Metric Mean Raw Accuracy 1x Description .
The graph in the Raw Accuracy column plots percent accuracy for each position in an aligned sequence:
Version 3.4.1
Barcode Reports
Barcode Reports
The barcode section of a run report displays the following information per barcode:
Version 3.4.1
Column Barcode Name
Description The individual barcode in the barcode set. The row labeled as No barcode reports on unclassified barcodes, which are reads that could not be classified as matching one of the expected barcodes in the barcode set.
Sample Output % >= Q20
Name of the sample that was sequenced on instrument. Total number of reads. The percentage of reads that have a predicted quality score of Q20 or better. A Q20 score is the predicted quality of a Phred-like score of 20 or better, or one error in 100 bp.
Reads
Total number of filtered and trimmed library reads (independent of length). This number is reported in the barcode BAM file. The average read length, in bp, of all filtered and trimmed library reads reported in the barcode BAM file. A thumbnail histogram of the read lengths for this barcode. Buttons to download the BAM and BAM index file (BAI) for this barcode. The BAM file contains aligned reads sorted by reference location. See also Run Metrics Overview for a description of alignment data.
Mean Read Length
Read Length Histogram
BAM
Version 3.4.1
The number of barcodes shown in the barcode section varies according to the barcode set used in your run and on the barcodes actually present in the sample. Only data for barcodes present in the run are displayed in the run report.
Output Files
Output Files
These links permit you to directly download the data and report files. Some files are compressed, using the .zip for mat, to provide data integrity and to reduce download time.
Version 3.4.1
Click on a file type button to save the file to your local computer. Most output files can be loaded into third-party viewers (such as IGV) for visualization. The barcode row only appears for runs on barcoded data. Files in the barcode row are zips of one file per active barcode. To download only BAM and BAI files for a single barcode, go to the barcode section at the top of the run report (see Barcode Reports).
Column Reads Aligned Reads File type BAM Reads
Description Files with unaligned reads (before alignment) Files with aligned reads Aligned reads Aligned reads sorted by reference location. See Run Metrics Overview for a description of the alignment data included in this BAM file. BAM index file
Unaligned reads in BAM format. In this release, the BAM file contains some flow space information.
BAI The BAM format
Binary Sequence Alignment/Map (BAM), is a compressed, binary form of the SAM format. BAM files can be indexed, using the BAM Index file, for quick access to sequence alignment data. See http://samtools.sourceforge.net for more a more detailed description of the SAM/BAM file format. Many tools are available for working with SAM files. Deprecated file formats The following file formats are deprecated and not produced by the default analysis pipeline. See SFFCreator and FastqCreator Plugins. The SFF and FASTQ files created by these plugins are generated in the plugin directory, not in the main analysis directory . File type Description
Version 3.4.1
SFF
Compressed (.zip) Standard Flowgram Format (SFF) -formatted file that contains "flow space" data. The bases called in a run are stored in two formats: SFF and FASTQ. Both files contain the nucleotide calls and associated quality values, the SFF files, additionally, contain signal values in flow space and a mapping between sequence and flow spaces. The data are organized on a per flow basis, and contain information about nucleotide flows that both did and did not result in base incorporation. (See Technical Note - Filtering and Trimming.) Note: The SFF file format is deprecated and not produced by the default pipeline.
FASTQ
Compressed (.zip) FASTQ-formatted file containing data organized in a per-base basis, including quality scores. The reads contained in the file are unaligned reads. (See Technical Note - Filtering and Trimming.) Note: The FASTQ file format is deprecated and not produced by the default pipeline.
Version 3.4.1
Plugin Summary
Plugin Summary
The Plugin Summary section lists the plugins associated with the analysis, and provides an interface for running and monitoring your plugin(s).
Version 3.4.1
Plugins can have one of the following behaviors: Run without user input. Run with a user interface for getting plugin parameters. Plugins without a user interface display a confirmation message that the plugin has been submitted to run. Plugins requiring input parameters display a user interface dialog and are launched after you click Submit on the plugin user interface.
The Combine Alignment and IonReporterUploader functionality
In previous releases, Combine Alignment was a plugin available through the Select plugins to run button. Combine Alignment is now available in a project result set page, Data > Projects > projectname, with the Combine Selected... button. The result sets to be combined must be members of the same project. The IonReporterUploader plugin is available here to launch manually through the Select plugins to run button and can also be specified in the template and planned run wizard, under the Export chevron, to run automatically (after the plugin is configured). Run a plugin The Plugin Summary list Plugin reports Plugin log files Run a plugin
Version 3.4.1
The following plugins are pre-installed on Torrent Server. See Running the Installed Plugins for a description of these plugins. Alignment Coverage Analysis ERCC_Analysis FastqCreator IonReporterUploader Run RecognitION sampleID SFFCreator Torrent Variant Caller
To manually run a post-analysis plugin on the report data: 1. Click Select Plugins To Run. 2. The Plugin List pops up and displays a list of available plugins:
3. Click the plugin you want to run. If the plugin does not require user input, it begins execution. This displays the user interface for your plugin. In this example, the Alignment plugin is selected, displaying the Alignment plugin dialog (see Run the Installed Plugins for more information about running pre-installed plugins):
Version 3.4.1
4. Select the desired plugin options and click Submit. This runs your plugin, listing the run status in the Plugin Summary panel. 5. For plugins that take a long time to run, click Refresh Plugin Status to update the plugin display status. The Plugin Summary list After a plugin runs, it is listed in the Plugin Summary panel:
Some plugins, such as Alignment, display a preview results window in the Plugin Summary list. Plugin reports Plugin results, results summaries, links to output files, and other information are available in the plugin report pages. See Run the Installed Plugins for a description of report pages for the installed plugins. Click the plugin html link in the Plugin Summary section to open that plugin's report page:
Version 3.4.1
Plugin log files 1. To view the plugin log file, hover your mouse pointer over the log icon to the right of your plugin to display the plugin log file:
2. Click the icon to display the log:
Version 3.4.1
3. Click Close to exit the display.
Version 3.4.1
Run the Installed Plugins

Run the Installed Plugins
You customize your Torrent Suite Software analysis by running one or more plugin applications at the end of each run. Your Torrent Browser includes several of these plugins, such as for variant calling and realignment. The Torrent Browser Plugin Store offers other plugins written by Ion Community members. The Torrent Browser Plugin Store is on the Ion Community (registration required). Available plugins Manually run a plugin Automatically run plugins Available plugins
Version 3.4.1
This table lists the pre-installed and officially supported plugins. Plugin Alignment Plugin Description Performs a new alignment to the reference you specify. Note: Plugins run after the Torrent Suite analysis pipeline. This plugin does not affect the alignment during pipeline analysis. Coverage Analysis Plugin Provides statistics and graphs describing the level of sequence coverage produced for targeted genomic regions. Helps with ERCC RNA Spike-in Controls: enables you to quickly determine whether or not the ERCC results indicate a problem with either the library preparation or the sequencing instrument run. Generates a Fastq format file of the analysis output. Transfers run results files to your organization in Ion Reporter Software (available under a separate license). Please read the Ion Reporter Software release notes for instructions about the Uploader plugin. Run RecognitION Plugin Considers candidate runs for inclusion in Ion Community leaderboards. Within each chip type (Ion 314 chip, Ion 316 chip, and Ion 318 chip), top runs are ranked according the number of AQ20 bases mapped. Uses sample fingerprinting to identify any cross-contamination between samples or between barcodes in a run. Generates an SFF format file of the analysis output. Calls SNP and InDel variants across a reference or within a targeted subset of that reference. With low-frequency variant options, the plugin can call variants down to a 5% level of variant frequency. It can also show which variants coincide with predefined HotSpot positions on the reference sequence.
ERCC Analysis Plugin
FastqCreator IonReporterUploader_V1_2
sampleID Plugin
SFFCreator Torrent Variant Caller Plugin
This table lists plugin functionality that is available in other areas of the Torrent Browser. Previous plugin Description and new location
Version 3.4.1
IonReporterUploader_V1_2
Transfers run results files to Ion Reporter Software (access is available under a separate license). The IonReporterUploader_V1_2 is selected before a sequencing run in the Plan > Templates, Plan > Planne d Run, and wizard pages.
combineAlignment
Combines reads aligned to the specified reference from multiple run reports. Intended for use when multiple runs analyze the same tissue sample, for example when a tissue sample is run on more than one chip. You invoke combineAlignment from the project page (see Projects). The runs you combined must be members of the same project.
Manually run a plugin You manually run a plugin in the run report of a completed analysis run, with the Select plugins to run button. Only enabled plugins are listed. Follow these steps to manually run a plugin: 1. Go to the Data > Completed Runs & Reports tab, then click the link for your completed analysis run. 2. In the run report, scroll down to Plugin Summary tab.
The Plugin Summary also lists any plugins that executed on your run (not shown in this example). 3. Click Select plugins to run to see the list of plugins available on your Torrent Server. See Available Plugins f or the pre-installed plugins. Your server may have additional plugins or other versions installed.
Version 3.4.1
4. Click the desired plugin name to run a plugin. If the plugin does not require user input, it starts immediately, without a confirmation screen. 5. Click Close to close the Plugin List without running a plugin. Automatically run plugins When you design your sequencing protocol in the Plan > Template page, you specify which plugins to execute. You can select any plugin that is installed and configured on your Torrent Server. You are not limited to the pre-installed plugins. See the following for more information on specifying plugins in your templates and planned runs: Plan Tab Templates Planned Runs Template and Planned Run Wizard
The old method to autorun a plugin
Your Torrent Server administrator can set plugins to be executed automatically on every run; however, the preinstalled plugins are not good candidates to be run automatically. For example, the Torrent Variant Caller plugin fails on runs that do not use both the hg19 reference and the Ion AmpliSeq Cancer Panel or custom product data.
Version 3.4.1
The Alignment and RunRecognitION plugins cannot be be executed automatically because they require manual user input before every run. For Ion Reporter users, enabling Autorun with the IonReporterUploader plugin could cause you extra expense, by transferring unnecessary results to the Ion Reporter server. (The Plan tab allows you to turn off the plugin for a template and for a planned run.)
Alignment Plugin
Version 3.4.1

Alignment Plugin The Alignment plugin performs a new alignment to the user-selected reference file. Output files include BAM files of sampled reads. This plugin cannot be auto-run because it requires user input before execution. The new alignment appears in the context of the same run report. The recommend way to do a re-alignment is through the run report under Data > Completed Runs & Reports > run report > gear menu > Reanalyze > Advanced > Start reanalysis from: Alignment. The R eanalyze method generates a new run report and you optionally can run other plugins on the new result set.
Follow these steps to run the plugin and to review the plugin output report. 1. To run this plugin, in the report for your run, scroll down to the Plugin Summary section, and click Select plugins to run.
2. In Select a plugin, select Alignment. The plugin displays the plugin user interface:
Version 3.4.1
3. From the Libraries drop-down list, select the desired library. 4. Select the desired Sampling option. 5. Click the checkbox for each of the desired plugin output formats: .sam and .bam. 6. Click Submit to run the plugin with the specified parameters. The interface provides feedback that the plugin has started:
On completion, the Alignment displays a minimal output preview in the plugin list of the Plugin Summary pa nel:
Version 3.4.1
Click the Alignment.html link to display the full plugin output.
Note: Plugins run after the Torrent Suite analysis pipeline. This plugin does not affect the alignment during pipeline analysis.
Version 3.4.1
Coverage Analysis Plugin

Coverage Analysis Plugin The Coverage Analysis plugin provides statistics and graphs describing the level of sequence coverage produced for targeted genomic regions. You can run the Coverage Analysis plugin automatically or manually. To run the Coverage Analysis plugin automatically, you select Coverage Analysis plugin during template setup. Refer to the Plan Tab and Templates pages section of the Torrent Browser User Interface Guide for information about how to set up a template and create a planned run.
Version 3.4.1
To run the Coverage Analysis plugin manually, perform the following steps: 1. In the Torrent Browser, select a run report by clicking a run link, then clicking a report from the dropdown area. The run report opens. 2. On the run report page, scroll about halfway down the screen to the Plugin Summary area. Click Select plugins to run. The Select a plugin popup appears:
3. Select coverageAnalysis. The Coverage Analysis Plugin interface appears.
Version 3.4.1
4. Select a library type. 5. If you have one and would like to use it, select a targeted regions file. 6. If you would like to pad the target by a number of bases, enter the desired number. If you do not enter a number, the default of 0 is used. 7. If you would like the option to examine unique starts, select the checkbox. 8. When you are satisfied with your selections, click Submit. The analysis runs and a group of output reports is created. The following sections of this document describe the output reports generated by the Coverage Analysis plugin. Coverage Analysis Plugin Output The Coverage Analysis Plugin output is a report called the Coverage Analysis Report. This report includes statistics about all reads, and the following information in graphical form: Target Coverage Binned Target Coverage Target Coverage by Chromosome Individual Target Coverage On/Off Target Read Alignment Normalized Target Coverage In addition, from the bottom of the Coverage Analysis Report, you can download a BAM file or its related BAM index file.
All Reads
The All Reads section of the Coverage Analysis Report provides statistics about all reads. The items in this report are described in the table below.
Version 3.4.1
Statistic Number of mapped reads Number of reads on target
Description Total number of reads mapped to the reference. Total number of reads mapped to any targeted region of the reference. A read is considered to be on target if at least one aligned base overlaps a target region. A read that overlaps a targeted region but where only flanking sequence is aligned, for example, due to poor matching of 5' bases of the read, is not counted. The percentage of reads mapped to any targeted region relative to all reads mapped to the reference. The total number of bases covered by reads aligned to the reference. The total number of target bases covered by any number of aligned reads.
Percent of reads on target
Total aligned base reads
Total base reads on target
Version 3.4.1
Percent base reads on target
The percent of all bases covered by reads aligned to the reference that covered bases in target regions. The total number of bases in all target regions of the reference. The total number of target bases that had at least one read aligned over the proximal sequence. Only the aligned parts of each read are considered. For example, unaligned (soft-cut) bases at the 5' ends of mapped reads are not considered. Covered target reference bases may include sample DNA read base mismatches, but does not include read base deletions in the read, nor insertions between reference bases. The average number of reads of all targeted reference bases... The percentage of all target bases covered by at least 0.2x the average base coverage depth. The maximum number of times any single target base was read. The average number of reads of all targeted reference bases that were read at least once. The standard deviation (root variance) of the read depts of all targeted reference bases that were read at least once. The percentage of target bases covered by at least one read. The percentage of target bases covered by at least ten reads. The percentage of target bases covered by at least 20 reads. The percentage of target bases covered by at least 50 reads. The percentage of target bases covered by at least 100 reads.
Bases in targeted reference
Bases covered (at least 1x)
Average base coverage depth
Uniformity of coverage
Maximum base read depth
Average base read depth
Std.Dev base read depth
Target coverage at 1x
Target Coverage Graph
In the Target Coverage graph, target base coverage is plotted against read depth, where read depth is the number of times a particular base is read and coverage is the number of counts of bases read at that read depth. This plot
Version 3.4.1
includes the number of target bases that were not read (to 0x coverage). The right-hand y-axis shows the cumulative coverage as a percentage of the total number of targe base reads, corresponding to the blue line. This may be used to gauge the target number of bases read to a particular depth.
Binned Target Coverage Graph
In the Binned Target Coverage graph, as in the Target Coverage graph above, target base coverage is plotted against read depth, where read depth is the number of times a particular base is read and coverage is the number of counts of bases read at that read depth. However, in the Binned Target Coverage graph, the read depths are binned to better represent coverage where the maximum read depth is high. The binning size is chosen accordingly. For example, an x-axis value of 20x indicates the sum of coverage for reads from 1 to 20, or 11 to 20 if the preceding bar was labeled 10x, etc. This plot does not include the coverage for non-covered target bases (0x coverage).
Version 3.4.1
Target Coverage by Chromosome Graph
In the Target Coverage by Chromosome graph, the number of reads that align to each chromosome of the reference are plotted as a bar chart. The number of reads that have aligned sequence overlapping any part of the target region are represented by the gray portion of the plot. Those aligned off-target are represented by the white region.
Version 3.4.1
Individual Target Coverage Graph
In the Individual Target Coverage graph, the number of aligned base reads are counted for individual target regions of the reference and normalized by dividing by the length of the target. These valuea are plotted on a bar chart for each chromosome of the reference to a common scale, set by the highest normalized count. Red areas of the bars show the fraction of the target bases uncovered by any read. For example, 20:80 red:gray indicates only 80% of the original target was read. Note that with large numbers of targets, details for individual target regions (bars) may not be visible. Download the data file using the link provided to examine the individual target coverage in full detail.
Version 3.4.1
On/Off Target Read Alignment Graph
In the On/Off Target Read Alignment graph aligned read starts are counted for each 100 bases of the reference and plotted as a bar if the count as at least five. Hence zero- or low-coverage regions, including isolated read mappings, are not represented in these plots. Plot color is alternated to show continuous regions of coverage. Red and blue represent the reads starting in a 100 base region overlapping a target region. Black and gray represent reads starting outside of a target region. Peaks are contiguous and aligned to 100 base counts along the reference but no distance between any two peaks is depicted. Note that with large numbers of targets, peak shape and resolution between on- and off-target peaks may not be discernible. Download the data file using the link provided to examine the coverage in full detail.
Version 3.4.1
Normalized Target Coverage Graph
In the Normalized Target Coverage graph, the fraction of total target bases covered is plotted against normalized coverage, where normalized coverage is the number of times a particular base is read (read depth) divided by the read depth of all target bases. The y-axis is the cumulative read depth divided by the total number of target base reads.
Version 3.4.1
Version 3.4.1

ERCC Analysis Plugin This section describes the ERCC Analysis plugin. This plugin helps with analyses that use ERCC RNA Spike-in Controls. The plugin enables you to quickly determine whether or not the ERCC results indicate a problem with either the library preparation or the sequencing instrument run. Enable the ERCC Analysis plugin Manually run the ERCC Analysis plugin Configure a template to run the ERCC plugin Plugin run times View analysis results Interpret the data
Version 3.4.1
View transcript details Definitions (Optional) Configure the ERCC Analysis plugin View plugin error information ERCC resources
Enable the ERCC Analysis plugin
A plugin must be enabled before it can run. Your Torrent Server administrator may have already enabled ERCC Analysis plugin and then the plugin appears in the run report Plugin Summary Select Plugin to Run list. Follow these steps if you need to enable the plugin: 1. Scroll to the top of the Torrent Browser and click Plugins in the gear menu on the right:
2. If the ERCC_Analysis plugin does not appear on your plugin page, click the Name column to sort by name and scroll to the plugin. In the ERCC_Analysis row, click the Enable column checkbox:
Auto-run is not recommended for the ERCC_Analysis plugin unless most analyses on this Torrent Server use ERCC controls.
Version 3.4.1
Manually run the ERCC Analysis plugin
Follow these steps to manually launch the ERCC_Analysis plugin. You can use the default minimum R-squared value or enter you own value. 1. Open the run report for the analysis. Scroll down to the Plugin Summary section. 2. Click Select plugin to run to open the plugin list:
3. Click ERCC_Analysis. (The version number on your system might be different from the version shown here.) 4. A popup window with a minimum acceptable R-squared value appears. You can use the default value or enter your own value. The value should be in the range from 0 to 1.
5. Click Submit to start the plugin.
Version 3.4.1
Configure a template to run the ERCC plugin
If you configure a template or planned run to execute the ERCC Analysis plugin, and your experiment uses the Ion Total RNA-Seq Kit V2, then on the wizard Kits page, you must make a Barcode Set selection. Select either one of the following in the Barcode Set menu: IonXpressRNA Select this if your experiment uses this kit. RNA_Barcode_None Select this if your experiment does not use a barcode kit. This selection is required for the correct trimming. The following wizard image shows the two barcode kit selections. (Make only one selection per run.)
Plugin run times
For analysis runs with total reads under 1,000,000, the plugin normally takes 2-3 minutes to run (on supported hardware). For larger runs, the plugin takes approximately an additional 1-2 minutes per million total reads. For example, a run with 5 million reads may take 10-15 minutes. These run times are offered only as a guideline. If your Torrent Server is busy with other processing, plugin run times are longer. After the ERCC analysis is completed, you can view the analysis results.
View analysis results
Plugin analysis results appear in the plguin summary area:
Version 3.4.1
After the status of the ERCC plugin has changed to Completed, click the ERCC_Analysis.html link in the Plugin Summary section to open the ERCC Report and view analysis results:
Interpret the data
The ERCC Report screen (shown on page 5) displays the ERCC Dose Response plot. The points are color-coded, based on mapping quality. There is also a trendline, based on the parameters shown in tabular form to the right of the graph. The y-axis of the plot is the log (base 2) of the raw counts found for the transcript in question. The x-axis is also logarithmic, but represents the known relative concentration of the ERCC transcripts. Ideally, the points all fall on a straight line.
Version 3.4.1
More realistically, in the good case, the raw counts and relative concentration should at least correlate with a high R-squared (for example, 0.9 or higher). The table to the right of the plot (shown on page 5) shows the R-squared value found for this plot, as well as the Slope, Y-intercept, and N (number of transcripts found) values. Although there are 92 transcripts in the ERCC mix, it is not expected that all 92 will be detected. The number of transcripts detected depends on the sequencing depth.
View transcript details
If you want to look at the details regarding a particular transcript, there are two methods you can use: Hover your mouse-cursor over a point on the ERCC Dose Response plot to display a popup window that shows details about that transcript (the name, reads, and coverage plots). If several points are very close together on the plot and it is difficult to hover over the point you are interested in, you can zoom in on the plot to more easily distinguish points: Use your mouse to draw a box around the point of interest and magnify it. To zoom out to the full view of the ERCC Dose Response plot, either doubleclick the plot, or click the Reset Zoom button. Scroll to the particular transcript, and click the [+] next to the transcript name. This method shows the same information, plus a few additional pieces. See Definitions if the meaning of any of these pieces is unclear.
Definitions
This section defines terms used in the plugin output. Coverage Depth The minimum and maximum number of reads covering bases in the transcript. If coverage is 100%, the minimum value will be > 0. Coverage The number of base positions covered by at least one read. Start Sites The number of base positions that are the start site for a read. Unique Start Sites The number of start sites that have only one read starting at the site. Coverage CV Coefficient of Variation for coverage = average coverage / stddev coverage for the entire transcript.
(Optional) Configure the ERCC Analysis plugin
You can optionally change the R-squared value to set a default value for the summary report screen: 1. If the window showing the minimum acceptable R-squared value is open, close it. Then scroll to the top of the Torrent Browser and click Plugins in the gear menu on the top right:
Version 3.4.1
2. If the ERCC_Analysis plugin does not appear on your plugin page, click the Name column to sort by name and scroll to the plugin. In the ERCC_Analysis row, click the Manage column gear menu, then select Configur e.
3. The ERCC Plugin Configuration screen opens:
Enter a value between 0 and 1 as your minimum acceptable R-squared value (a lower value is indicated by a red light in the summary report). Then click Submit. The value you enter on the ERCC Plugin Configuration screen is used when the plugin is auto-run and
Version 3.4.1
when a user manually launches the plugin without entering a value. Users can override this value on a per-run basis when they manually launch the plugin.
View plugin error information
If the ERCC_Analysis plugin status changes to Error after you click the ERCC_Analysis.html link, then something went wrong during the running of the plugin. In this case, look at the error log: 1. Return to the Plugin Summary, then click the log file icon to see the error log:
2. Scroll to the bottom of the log to see error messages:
An Error status for the ERCC_Analysis plugin should be a rare event and indicates that the ERCC_Analysis plugin itself failed to run. A plugin error does not indicate that the ERCC_Analysis results are bad.
ERCC resources
The External RNA Controls Consortium (ERCC) is hosted by the U.S. National Institute of Standards and Technology. The ERCC Analysis plugin is for experiments that use ERCC RNA Spike-In Control Mixes, set of RNA controls derived from the ERCC plasmid reference library.
Version 3.4.1
For information on ERCC RNA Spike-In Control Mixes, please refer to the ERCC RNA Spike-In Control Mixes User Guide (Pub no. 4455352). For more information on ERCC analysis, refer to the following resources: Figure 2, Analysis of ERCC read counts, in Sensitivity of RNA-Seq using Ion semiconductor sequencing a comparison to microarrays and qPCR The Ion Torrent white paper Methods, tools, and pipelines for analysis of Ion PGM Sequencer miRNA and gene expression data The information on the ERCC ExFold RNA Spike-In Mix product page.
Run RecognitION Plugin

Version 3.4.1
Run RecognitION Plugin The Run RecognitION plugin allows you to submit your best runs to the Ion Community leaderboards. The leaderboards are available on the Ion Community, and are organized in leagues according to chip type:
Your Torrent Suite software must be at least version 1.5.1 to use this plugin.
Run the RunRecognitION Plugin Follow these steps to run to the RunRecognitION plugin: 1. Go to the report page for your run. Scroll down to the Plugin Summary section, and click Select plugins to run. 2. In Select a plugin, click RunRecognitION:
Version 3.4.1
The leaderboard for your chip type is shown, with a message indicating where your ranks among the leaderboard runs.
Submit your run to the RunRecognitION leaderboard
Follow these steps to submit a candidate run to the leaderboard: 1. Go to the report page for your run. Run the RunRecognitION plugin, as described in Run the RunRecognitION Plugin. The Run RecognitION leaderboard is displayed for your chip type.
Version 3.4.1
2. Scroll to the Ion Community Login section below the leaderboard. If you do not have an Ion Community account, click create an account to register. Enter your community user name and password. 3. Optionally enter the any of this information about your run: Your site name The reference genome used in this run The application type for this run 1. Below the information fields, click Terms and Conditions and carefully read that information. Click the checkbox "I agree to the Terms and Conditions". 2. Click Submit at the bottom of the page. If your run qualifies, it is added to the leaderboard:
Version 3.4.1
What Information About Me Does RunRecognitION Make Public?
If your run is published to the leaderboard, your Ion Community user name and avatar are visible to other members of the community.
Version 3.4.1
Run the IonReporterUploader Plugin

Run the IonReporterUploader_V1_2 plugin The IonReporterUploader_V1_2 plugin transfer results files directly from a Torrent Server analysis to your Ion Reporter Software organization (available under a separate license). You include the Uploader plugin settings in the run plan that you use for your sequencing run. The run plan then launches the plugin automatically when the PGM or Proton sequencer analysis completes. There is a one-time configuration of the plugin in both the Ion Reporter Software UI and the Torrent Browser, before the plugin can be used. The version 1.2 plugin has a limitation with these requirements:
Version 3.4.1
The plugin only works an completed Torrent Suite analyses that have a run plan with the following: IonReporterUploader_V1_2 selected in the run plan wizard Export chevron, The Ion Reporter Software sample name(s), workflow(s), and sample relationships properly defined in the Plan chevron, And, for barcoded runs, the correct barcode kit selected ion the Kits chevron. Manually launches of the plugin (on a completed run report) also depend on the run plan.
Ion Reporter Software 1.2
To transfer to Ion Reporter Software 1.2, you must use the plugin named IonReporterUploader_V1_2. You can download and install the plugin from the Torrent Browser Plugin Store on the Ion Community.
Transfer limitations
The following limitations apply to the Uploader plugin: The Uploader plugin transfers results files for a completed run plan that executed on the Torrent Server where the plugin is configured. (In addition, each run must have the IonReporterUploader plugin enabled and configured in its run plan.) You cannot copy results file from a different Torrent Server and have the plugin transfer those files. Only files appearing in the File Links section of a run report are transferred. You cannot add supplemental files to the results files of a run, in order to have the plugin transfer those files. For barcoded runs: For automatic runs with barcoded data, the Uploader plugin only transfers samples if the barcode kit selection in the run plan wizard is correct. If you correct or add the barcode kit selection on the sequencing instrument, the Uploader plugin still uses the old run plan information and the results file transfer fails. For manual launches of the plugin on barcoded data, the Uploader plugin uses the barcode kit selection that you make on the sequencing instrument.
Add the IonReporterUploader_V1_2 plugin to a run plan
To set a run plan to automatically transfer files (after the completion of the PGM analysis), use the Export and Plan chevrons in the Torrent Browser run plan wizard. For barcoded data, also select the correct barcode kit in the Kits chevron. When you select a barcode kit, the Plan chevron creates a sample name field for each barcode. You define a run pan in the Torrent Browser Plan tab before your sequencing run. The following sections describe how to enable and configure the IonReporterUploader_V1_2 plugin in the run plan wizard.
The Kits chevron
If your sequencing run uses a barcode kit, select that kit in the Kits chevron:
Version 3.4.1
Based on your barcode kit selection, the Plan chevron has a sample field for each barcode.
The wizard Export chevron
In the run plan wizard Export chevron, click the IonReporterUploader_V1_2 plugin checkbox to enable the plugin in this run plan.
Make sure the plugin name is correct: IonReporterUploader_V1_2. If this name does not appear in the Export chevron, either the plugin is not installed, not enabled in the admin Plugin page, or not configured correctly. Important: If the Uploader plugin is not enabled or not set for Autorun, the IonReporterUploader_V1_2 plugin does not appear in in the Export chevron of the run plan wizard.
The wizard Plan chevron
In the run plan wizard Plan chevron, you specify the Ion Reporter Software sample name and workflow. A single-sample example is shown here:
Version 3.4.1
With the settings shown in this example, after your Torrent Suite analysis completes, the run plan launches the Uploader plugin. After the plugin transfers the Torrent Suite analysis results file to Ion Reporter Software, the plugin defines it as a sample named Sample_01 and launches a Whole Genome workflow analysis on Sample_01. The information in the Plan chevron of the run plan wizard is described in the following table: Column Sample Name Workflow Relation Relation Role Set ID Description The sample name to be used in Ion Reporter Software. The Ion Reporter Software workflow, to specify automatic analysis launch in Ion Reporter Software. The type of sample relationship in the Ion Reporter Software analysis: Self, Tumor Normal, or Trio. The role of this sample in the sample relationship: Self, Tumor, Normal, Mother, or Father. Used for the following: To group related samples, for Tumor Normal and Trio sample relationships. To combine multiple data files into one Ion Reporter Software sample. To specify different Ion Reporter Software analyses to be launched (when there are multiple analyses). Each different Set ID involves a separate Ion Reporter Software analysis.
Set ID column
The Set ID column serves two related purposes: After file transfer, in Ion Reporter Software, samples with the same Set ID are launched in the same analysis. Related samples, such as a normal sample and a tumor sample, must have the same Set ID. No other samples can share the same Set ID. The following rules apply to the Set ID column: Never leave the Set ID column blank. Remember to scroll to reveal the entire Set ID column, and to set the Set ID value correctly for each sample. Do not inadvertently give unrelated samples the same Set ID value (even if that value is blank or zero).
Version 3.4.1
Run plan IDs
When you configure a run plan with the IonReporterUploader and your experiment involves multiple samples of nonbarcodeddata, the Torrent Suite Software creates a separate plan run for each sample. This splitting happens because (with non-barcoded data) each sample involves a separate run on the sequencing instrument. In this case, each plan ID includes the sample name. The resulting plans appear in the Plan tab Planned Runs page, and each plan has its own Run Code and run plan name. Warning: Extra care is needed when selecting one of these plan's Run Code on the sequencing instrument. The plan names are similar, and the correct plan must be chosen for each physical sample. Note: This splitting does not happen with barcoded data, because the barcoded data is sequenced in one instrument run (and only requires one run plan).
Related samples
The following example shows how to specify related samples:
This example specifies the following: The Torrent Suite analysis results will be transferred to Ion Reporter Software and defined as two samples. Sample_03 is the tumor sample in a Tumor_Normal relationship and Sample_04 is the related normal sample. Both samples have the same Set ID, which identifies them as related. The sample will be analyzed with the Annotate Variants workflow in Ion Reporter Software. This analysis is launched automatically after the file transfer and sample definition. Related samples must have the same value in the Set ID column.
A sample with multiple data files
To create a single Ion Reporter Software sample that contains multiple results files from your Torrent Server, give each Torrent Suite sample file the same Ion Reporter Software sample name:
Version 3.4.1
This example creates one Ion Reporter Software sample from 3 results files from your Torrent Server. Be sure to give each of these samples the same Set ID value.
Barcode data
To transfer barcode data, you select the barcode kit in the Kits chevron and specify the samples in the Plan chevron.
Barcode kits
When you create a plan run for barcode data, you first select the correct barcode kit in the Kits chevron of the wizard:
Based on your barcode kit selection, the sample fields in the Plan chevron are pre-populated with the kits' barcodes:
Version 3.4.1
Barcoded samples
When you select your barcode kit in the wizard Kits chevron, the barcodes are pre-populated in the Plan chevron, as shown in this example (the sequence column and part of the barcode number column are not shown):
This example specifies the following: The Torrent Suite analysis results will be transferred to Ion Reporter Software and defined as several samples. SampleBC_01 is the normal sample in a Tumor_Normal relationship and SampleBC_02 is the related tumor sample. Both samples have the same Set ID, which identifies them as related. The samples SampleBC_01 and SampleBC_02 will be analyzed with the TargetSeq Somatic workflow in Ion Reporter Software. Sample SampleBC_03 will be analyzed with the Whole Genome workflow (in a separate Ion Reporter Software analysis). SampleBC_04 is the tumor sample in a Tumor_Normal relationship and will be analyzed with the Annotate Variants workflow (in a separate Ion Reporter Software analysis). (The related normal sample is not shown.) Each different Set ID represents a different analysis in Ion Reporter Software. For any barcode that is not used in your Torrent Suite analysis, leave that barcode's row blank in the Plan chevron sample table.
A transfer of multiple unrelated data files
When you transfer multiple unrelated files, each sample is launched in a separate Ion Reporter Software analysis (the barcode sequence column is not shown):
Version 3.4.1
Be sure to give each of these samples a unique Set ID value.

Results files for barcoded PGM and Proton runs
For barcoded runs, all barcoded results files are transferred, except for results files with a file size of zero. The plugin logs warnings for these files: Files with a file size of zero Missing files The plugin log file is found on the Torrent Browser Completed Runs & Reports tab, in the run report for which the plugin was run, in the Plugin Summary section. The Detailed Information link opens the Uploader plugin log. Note: Results files for unused barcodes are transferred, if the results file size is not zero.
A barcode mismatch
A barcode mismatch occurs when the run's results files do not match the Uploader plugin's barcode information. For automatic plugin runs, the plugin reads metadata information only from the run plan. For a manual launch of the plugin, the plugin also reads the barcode selection made on instrument.
Plugin log files
The plugin log files are found on the Torrent Browser Completed Runs & Reports tab Plugin Summary section, in the run report for which the plugin was run. The icon opens the system log for the plugin run. The Detailed Information link opens the Uploader plugin log.
If the Detailed Information link is not present, use this workaround to open the plugin log file: 1. Click on the icon for the IonReporterUploader_V1_2 plugin (or right click to open the log in a new browser tab). The system log file opens in your browser, with a URL that ends in a string such as this:
Version 3.4.1
plugin_out/IonReporterUploader_V1_2_out/drmaa_stdout.txt 2. Change drmaa_stdout.txt to log.txt and click Enter: plugin_out/IonReporterUploader_V1_2_out/log.txt The plugin log file opens in your browser.
Manual launch of the Uploader plugin
In this release, the only supported launch option is Upload and Define Samples. With the Upload and Define Samples option, your results files are transferred to Ion Reporter Software and also defined as samples in Ion Reporter Software. (Before the 1.2.2 release, the Upload Only option did not define the samples after transfer.) Please also note the following: Use only IonReporterUploader_V1_2. Other versions of IonReporterUploader plugins are not compatible with Ion Reporter Software 1.2. If IonReporterUploader_V1_2 does not appear in the Select Plugin to Run list, it is not either enabled or configured on your Torrent Server. The plugin log file (in the Torrent Browser Plugin Summary area) contains information about the location the data files are transferred to in Ion Reporter Software. Only for a manual launch of the plugin, the plugin reads the barcode kit selection made on the sequencing instrument. (All other information is read from the run plan.) For Torrent Suite analyses that do not have the Uploader plugin configured in a run plan, sample file names in Ion Reporter Software are created using the Torrent Suite analysis name. With barcoded runs, the barcode name is also added to the sample name.
Transfer files for a Genetic Disease Screening workflow
In this release, when you transfer files for analysis with a Genetic Disease Screening (GDS) workflow in Ion Reporter Software, the required gender information is not included with the sample metadata. Because the gender of the proband is not known, variants cannot be assigned the categories HasMaleMaternalX and HasUnknownX. As a workaround, after the files are transferred, go to the Sample > Sample Management screen in the Ion Reporter Console and edit each GDS sample to specify the gender attribute. Note: You cannot edit samples that have been launched in an analysis. Instead, define new samples from the raw data files, and add the correct gender metadata to the new samples. Credit balances Each Ion Reporter Software organization has a number of credits. The credit balances for your organization appear in the Home tab Dashboard, in the lower right corner. Credits are deducted when samples are defined in Ion Reporter Software. A sample is defined during these two cases: By the Uploader plugin, after a successful transfer of results files from your Torrent Server By an Ion Reporter Software user in the UI, on the Sample > Define Samples page (when the user clicks S ave)
Version 3.4.1
The number of credits deducted depends on the chip type. Your Ion Reporter Software administrator manages your organization's research credits.
Related topics: Configure the IonReporterUploader Plugin
SFFCreator and FastqCreator Plugins

The SFFCreator and FastqCreator Plugins

Version 3.4.1
You can use these plugins to create either SFF and Fastq format output files. These plugins are provided because the Torrent Suite analysis pipeline by default no longer creates these files. There are some differences between the SFF file created by default during previous releases and the SFF file that is created by the SFFCreator plugin. See the Technical Note - Transition from FASTQ/SFF to BAM format. Also, the output files are generated in a plugin directory, not in the main analysis directory.
Run the plugin automatically Run the plugin manually Plugin output
Run the plugins automatically
You set up these plugins to run automatically when you configure your template or run plan. In the Plugin chevron of the template wizard, you select which plugins run automatically on planned runs created from that template. See the Templates page in the Torrent Browser User Interface Guide.
Run the plugins manually
You can launch the plugin manually from a completed run report. Follow these steps to run the plugin manually: 1. Open the run report and scroll down to the Plugin Summary button. Click Select plugins to run.
2.
Version 3.4.1
2. In the Select a plugin list, click FastqCreator or SFFCreator. These plugins do not take user input. The plugin is submitted immediately when you click it in the Select a plugin list.
Plugin output
Links to the plugin output files are shown below. Be sure to right click on the link and select " Save link as ...".
Do not click on the file link. If you do, the file opens in your browser.
Version 3.4.1
The SampleID Plugin

The SampleID Plugin Ion AmpliSeq Sample ID Panel is a human SNP genotyping panel enabling accurate sample verification for increased confidence in sample data management. The plugin is comprised of nine primer pairs that can be combined with any Ion AmpliSeq Ready-to-Use or Custom Panel for the generation of a unique ID during post-sequencing analysis of research samples. The Ion AmpliSeq Sample ID Panel can be used in combination with any Ion AmpliSeq Ready-to-Use or Custom Panel using the Ion AmpliSeq Designer 1.2 or greater. This plugin is compatible with the Ion Xpress barcodes set.
Version 3.4.1
Plugin output Run the SampleID plugin automatically Run the SampleID plugin manually On-target metrics
Plugin output
Example plugin output is shown below:
Use the Sample ID column to verify sample fingerprints. Click on a barcode ID to open the detail report:
With the detail report, you can review the IUPAC SNP calls and click a link in the TaqMan Assay ID column to order the corresponding TaqMan Assay.
Run the SampleID plugin automatically
You set up the plugin to run automatically when you configure your template. In the Plugin chevron of the template wizard, you select which plugins run automatically on planned runs created from that template. See the Templates p age in the Torrent Browser User Interface Guide.
Run the SampleID plugin manually
You can launch the plugin manually from a completed run report. Follow these steps to run the plugin manually: 1. Open the run report and scroll down to the Plugin Summary button. Click Select plugins to run.
Version 3.4.1
2. In the Select a plugin list, click sampleID. The sampleID plugin does not take user input. The plugin executes immediately (depending on server load) when you click it in the Select a plugin list.
On-target metrics
When you use the SampleID Panel, lower-than-expected number of on-target reads may occur. To recover the correct on-target reads metrics, add back the On-Target reads from the Sample ID Panel into the Ion AmpliSeq Ready-to-Use or Custom Panel Coverage Analysis plugin data.
Version 3.4.1
Torrent Variant Caller Plugin

Torrent Browser Analysis Report Guide (v3.x)
Introduction
The Torrent Variant Caller (TVC) plugin calls SNP and indel variants in a sample across a reference or within a targeted subset of that reference. Using the Torrent Variant Caller plugin, you can perform six possible analysis types by selecting one of three library types (Whole Genome, Ion AmpliSeq, Ion TargetSeq) and one of two variant frequencies (Germ-line or Somatic) . In addition, if you have Target Region and/or HotSpot Region files in BED format, you can upload them and select them from the dropdown menu, and they will be applied to your analysis.
Version 3.4.1
If you do not select a Target Regions file or a HotSpot Regions file, the Torrent Variant Caller plugin assumes there are no targeted regions when it runs the analysis.
Variant Caller options

The Trim Reads checkbox only appears if the Ion AmpliSeq library type is selected. When enabled, this option trims reads to amplicon targets. This option helps to avoid having variant sites be covered by residual primers form overlapping amplicons.
The Target Padding checkboxes only appears if the Ion TargetSeq library type is selected. When greater than zero, the Target Padding value extends target regions at both ends by this number of base pairs. The effect is to allow variants to be detected in regions where individual reads overlap the boundaries of targeted regions.
Run the Torrent Variant Caller plugin

There are two ways to run the Torrent Variant Caller plugin: automatically, by preconfiguring the plugin to run as soon as primary analysis has completed, or manually, allowing you to run the plugin at any time from a completed run report. The Torrent Variant Caller takes a significant amount of time to complete. Setting it up to run automatically saves time compared to running it manually.
See also Variant Caller options. Configure the Torrent Variant Caller in a template or run plan When you select the Torrent Variant Caller plugin in the template or run plan wizard, the Variant Caller configuration page opens in the wizard:
Version 3.4.1
If the Advanced Settings + link does not appear, try disabling popup blockers and adblockers on your browser.
1. Select the library type. Some Variant Caller options appear only for specific library types. See also Variant Caller options. 2. Variant Caller plugin parameters are available in the Advanced Settings. Note: Changes to parameters can dramatically affect the behavior and sensitivity of the Variant Caller. Parameter changes are not recommended if you are new to the Variant Caller plugin. 3. Be sure to click the Save Plugin Settings button before you click Next. You can return to the Variant Caller configuration page by clicking the Configure button next to variantCaller in the plugin selection list.
Version 3.4.1
The Variant Caller parameter settings are saved in templates but not in run plans. Parameter changes that you make in a run plan affect only the one run. When you change Variant Caller parameter settings in a template, your changes affect all users who create run plans from that template.
The Torrent Variant Caller plugin is not run if you select Generic Sequencing as the sequencing run type.
Run the Torrent Variant Caller manually
The TVC plugin supports multiple run analysis. The plugin can analyze a BAM file generated from Combine Alignment on multiple reports in a project. Combine Alignment creates a new run report (in the same project). You can open the new combined run report and use the Select plugins to run button to launch the TVC plugin.
To run the Torrent Variant Caller plugin manually, perform the following steps: 1. In the Torrent Browser, select a run report on the Data > Completed Runs & Reports page or on a Data > Projects > projectname page. 2. On the run report page, scroll about halfway down the screen to the Plugin Summary area. Click Select plugins to run. In the list of plugins, click on variantCaller.
3. The Torrent Variant Caller Plugin interface appears.
Version 3.4.1
The first item, Reference Genome, displays the reference used for mapping. The same reference is used for the variant caller run. The reference cannot be changed from within the Torrent Variant Caller Plugin interface. 4. Select a Library Type for your analysis from the dropdown menu. Options include Whole Genome, Ion AmpliSeq, and Ion TargetSeq. The TVC plugin supports the various panels in the Ion AmpliSeq family of sequencing kits: Ion AmpliSeq Cancer Panel Ion AmpliSeq Comprehensive Cancer Panel Ion AmpliSeq Inherited Disease Panel Ion AmpliSeq Custom Panels The TVC plugin can also analyze data generated from the Ion TargetSeq Exome kit. When an Ion AmpliSeq product is selected, a Trim Reads checkbox appears, for which the default setting is checked.This setting trims reads to amplicon targets, primarily to avoid variant sites being covered by residual primers from overlapping amplicons. The Ion TargetSeq option allows you to specify Target Padding and whether to Use Unique Starts. Target Padding allows for calling variants the specified number of bases adjacent to a target region. Checking Unique Starts will perform the variant calling using just one read starting at each reference position for both read orientations. This removes bias due to non-uniform library enrichment but produces a most conservative representation of target coverage. Checking this option can increase specificity and reduce sensitivity. See also Variant Caller options. 5. Select a Variant Frequency for your analysis from the dropdown menu. Options include Germ-line or Somat ic. Select Germ Line unless you are looking for low frequency variants (<20%); in that case, select Somatic.
Version 3.4.1
6. If they are needed for your analysis, select Targeted Regions or Hotspot Regions BED files by doing one of the following: If the Target Regions file and/or Hotspot regions files you want to use already appear in the dropdown menu, select them. If you want to use a Target Regions or Hotspot Regions file that is not already included as an option in the dropdown menu, use the BED file uploader on a reference page to upload the BED file. Once you have uploaded a new BED file, it appears in the dropdown menu, and you can select it for use in your analysis.
If you do not select a Target Regions file or a Hotspot Regions file, the Torrent Variant Caller plugin assumes there are no targeted regions when it runs the analysis.
BED files provided by Life Technologies can be downloaded from the Ion Community. Use the BED file uploader to include these files as options in the dropdown menu. For more information about BED files, see Work with BED Files. 7. When you are satisfied with your selections, click Submit. The analysis runs and a group of output reports is created. Torrent Variant Caller plugin output The Torrent Variant Caller plugin output includes the following details reports: Barcode Coverage and Variants Report Variant Caller Report Variant Calls Summary Variant Calls Allele Coverage for All Bases in HotSpot Regions In addition, there is a File Links section, which is a list of output files generated by the Torrent Variant Caller Plugin. The plugin output files can be loaded into the Broad Institute's IGV or other third-party tools for further visualization or analysis. Variant Caller results for analyses with a very large number of variants (such as exome or genome analyses) are best viewed in Chrome or Firefox rather than Internet Explorer, because Internet Explorer runs Javascript more slowly than other browsers, especially on large datasets. The workaround for using Internet Explorer is to confirm continuing to run the scripts as many times as prompted until the results load.
You can hide report sections by clicking the collapse icon for a section, in hts header bar:
Barcode Coverage and Variants Report
The Barcode Coverage and Variants Report is a table that provides a summary list of reports per barcode. For each barcode, various types of data are displayed that can help you evaluate the quality of your run.
Version 3.4.1
Barcoded samples are represented by different colors. A successful barcode is shown with a clickable hyperlink, a failed barcode is shown with a red term, and non-existent barcode is represented with a gray term.The following table provides descriptions of the Barcode Coverage and Variants Report columns. Column Variant Caller Reports Description Individual reports for each barcode. For a non-barcoded run, this report is not generated. Number of reads that map to the reference genome. Number of reads that overlap the target region. Number of bases that overlap the target region. Average coverage in all targeted regions. (The number of bases in reads that overlap the targeted region, divided by total length of the region.) Percentage of the targeted region that has at least 1x coverage. Percentage of the targeted region that has at least 20x coverage. Percentage of the targeted region that has at least 100x coverage. Number of variants detected in the targeted region.
Mapped Reads Reads On-Target Bases On-Target Read Depth
1x Coverage
20x Coverage
100x Coverage
Variants Detected
Variant Caller Report
Variant Caller Reports are individual reports (per barcode) which can be selected from the Barcode Coverage and Variants Report shown above. While the Barcode Coverage and Variants Report provides a summary of all available barcode reports, the Variant Caller Report provides additional data, such as variant categories and information in HotSpot regions.
Version 3.4.1
The following tables provide descriptions of the Variant Caller report columns. Report Header Column Number of mapped reads Percent reads on target Description Total number of reads mapped to the reference. The percentage of reads mapped to any targeted region relative to all reads mapped to the reference. The total number of target bases covered by any number of aligned reads. The percent of all bases covered by reads aligned to the reference that covered bases in target regions.
Number of mapped bases
Percent bases on target
Report Tables - Target Regions / HotSpot Regions Column Bases in target regions Description The total number of bases in all target regions of the reference.
Version 3.4.1
Average base coverage depth
The average number of reads of all targeted reference bases. This is the total number of base reads on target divided by the number of targeted bases, and therefore includes any bases that had no coverage. The percentage of target bases covered by at least 0.2x the average base coverage depth. The percentage of target bases covered by at least 1 read. The percentage of target bases covered by at least 20 reads. The percentage of target bases covered by at least 100 reads. Number of called heterozygous SNPs in target regions or loci. Number of called homozygous SNPs in target regions or loci. Number of called heterozygous INDELs in target regions or loci. Number of called homozygous INDELs in target regions or loci.
Uniformity of coverage
Coverage at 1x
Coverage at 20x
Coverage at 100x
Heterozygous SNPs
Homozygous SNPs
Heterozygous INDELs
Homozygous INDELs
Heterozygous SNPs and INDELs differ from the reference in only one copy of the chromosome, while homozygous SNPs and INDELs differ from the reference in both copies of the chromosome.
Variant Calls Summary table
The Variant Calls Summary table shows the number of variants per chromosome. In this table, you can select the number of entries to display, filter the table based on search terms, or export the table for use with other third-party data analysis tools. You can use this report monitor the quality of your run on a per-chromosome basis. For example, if one chromosome has an unexpected number of variants, this might indicate an issue with the run.
Version 3.4.1
The following table provides descriptions of the Variant Calls Summary Report columns. Column Chromosome Description The chromosome (or contig) name in the reference genome. The total number of variants called (in the target regions of) the reference. The total number of heterozygous SNPs called (in the target regions of) the reference. The total number of homozygous SNPs called (in the target regions of) the reference. The total number of heterozygous INDELs called (in the target regions of) the reference. The total number of homozygous INDELs called (in the target regions of) the reference. The total number of variants identified with one or more HotSpots.
Variants
Het SNPs
Hom SNPs
Het INDELs
Hom INDELs
HotSpots
Variant Calls table
The Variant Calls table has several interactive features, including the following: Multi-column sorting Table search and filter Paging and re-sizing Column hiding, re-sizing and moving Linking to IGV (Integrative Genomic Viewer) Displaying up to 5 million records Row selection for exporting data
Version 3.4.1
The following table provides descriptions of the Variant Calls report columns. Column View Description Click IGV to open the variant in the Broad Institute's Integrative Genomics Viewer to see all reads covering the variant. The IGV is hosted by the Broad Institute, so internet connectivity is required from the machine running your web browser. Use of the IGV also requires a Java Runtime Environment installed on the desktop.
Chromosome
The chromosome (or contig) name in the reference genome. The one-based position in the reference genome. Gene Symbol for the gene where the variant is located. This value is not available (N/A) if no target regions were defined (full genome was used).
Position Gene Sym
Version 3.4.1
Target ID
Name of the target region where the variant is located. This value is not available (N/A) if no target regions were defined (full genome was used). Type of variation detected: SNP (single nucleotide polymorphism), MNP (multinucleotide polymorphism), IN (insertion), or DEL (deletion). Assigned zygosity of the variation: HOM (homozygous), HET (heterozygous), or NC (no call). The reference base(s). Variant allele base(s). Frequency of the variant allele. Estimated probability that the variant could be produced by chance. (The smaller the p-value, the higher the confidence in the variant call.) The total reads covering the position. The number of reads covering the reference allele. The number of reads covering the variant allele. The HotSpot ID for one or more starting locations matching the identified variant. (Examples: cosmic ID, dbSNP ID.)
Var Type
Zygosity
Ref Variant Var Freq P-value
Coverage Ref Cov Var Cov HotSpot ID
Allele Coverage for all Bases in HotSpot Regions
The Allele Coverage for all Bases in HotSpot Regions report provides allele- and strand-specific coverage information for each location of interest, as defined in a HotSpot BED file. The purpose of this table is to provide investigators with additional information about locations of interest, in the event that a variant wasn't called at the location of interest and wasn't shown in the Variant calls table. The Allele Coverage for all bases in HotSpot regions report has been updated for the Torrent Suite 2.0 release. New columns include: HotSpot ID, Cov (+), and Cov (-).
Version 3.4.1
The following table provides descriptions of the Allele Coverage for All Bases in HotSpot Regions report columns. Column Chromosome Description The chromosome (or contig) name in the reference genome. The one-based position in the reference genome. Name of the target region containing the HotSpot variation site. Name(s) of the HotSpot variant sites overlapping current position. (Examples: cosmic ID, dbSNP ID.) Name(s) marked with a '*' have multiple start positions or start position changed after LeftAlignment. The reference base(s). The total reads covering the position. Number of reads calling A. Number of reads calling C. Number of reads calling G. Number of reads calling T. Number of reads calling either an insertion or deletion at this base location. Number of forward reads aligned over the reference base.
Position Target ID
HotSpot ID
Ref Coverage A C G T INDEL
Cov (+)
Version 3.4.1
Cov (-)
Number of reverse reads aligned over the reference base.
File Links
The File Links section contains links to the plugin results files. The variant calls files (VCF files) are in VCF 4.1 format. The plugin output files can be loaded into the Broad Institute's IGV or other third-party tools for further visualization or analysis. Not all output files are produced on all runs. The target regions and hotspots file links only appear if the analysis uses these files. If your run includes barcoded data, barcode file links also appear in this section.
The following table provides descriptions of the files available in the File Links section. Link Open internal IGV to import genome Variant calls file Description Opens the genome in the IGV browser. Variant calls generated by this plugin, in table format: t extfile.xls Coverage and allele information, in table format: textfil e.xls SNP calls generated by this plugin, in VCF format: bina ryfile.vcf.gz Index of the SNP calls file, generated from the SNP calls file. Format: binaryfile.vcf.gz.tbi
Allele counts file
SNP calls file
SNP calls VCF index file
Version 3.4.1
INDEL calls file
INDEL calls generated by this plugin, in VCF format: bi naryfile.vcf.gz Index of the INDEL calls file, generated from the INDEL calls file. Format: binaryfile.vcf.gz.tbi Target regions file generated by this plugin, in BED format: textfile.bed Target HotSpots file generated by this plugin, in BED format: textfile.bed Mapped reads file generated by this plugin, in BAM format: binaryfile.bam Index of the mapped reads file, generated from the mapped reads file. Format: binaryfile.bai A listing the Torrent Variant Caller parameter settings, in table format: textfile.xls
INDEL calls VCF index file
Target regions file
Target hotspots file
Mapped reads file
Mapped reads index file
Parameter settings file
TaqMan Assay Search

After running the TVC plugin, you can select variants from a report table and submit a search against the TaqMan Assay Search webpage. When the search is submitted, you can choose which TaqMan Assay database to search. A new browser window appears with the search results. If TaqMan assays are available for the selected variant, you can immediately order the assay directly from the landing page. You must be connected to the internet to access this feature. To initiate a search, simply select variants from the TVC plugin report and click on the tool icon. A pop-up window allows you to submit variants for TaqMan assay design.
Version 3.4.1
You are then presented with a list of validation assays that you can order from Life Technologies.
2012 Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners. Taqman is a registered trademark of Roche Molecular Systems, Inc. For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use.
Version 3.4.1
Test Fragment Report

Test Fragment Report
The Test Fragment Summary section of the Analysis Report provides information about the performance of each Test Fragment included in the experiment. Test Fragments are used during analysis to predict the CF/IE/DR values for each Test Fragment, regionally. Analysis results for a Test Fragment are displayed when there are at least 1000 high-quality Test Fragments, where there is an 85% match against the appropriate template in the Test Fragment list. This includes CF/IE/DR estimates and performance calculations.
Version 3.4.1
The number of TFs reported includes lower quality TFs, down to 70% match, to better represent the run quality from all TF's.
Open the test fragment report Open the test fragments report with the Test Fragments button, near the bottom of the run report:
Test fragment metrics
The Test Fragments report displays the following information:
Parameter Test Fragment
Description Test fragment name (defined in the Admin > References tab of Torrent Browser). Number of filtered & trimmed reads identified for this test fragment. The percentage of reads for this test fragment with a minimum of 50 base pairs in length and an error rate of 1 in 50, Phred-like 17, or better. Quality is based on alignment, not predicted quality.
Reads
Percentage 50AQ17
The test fragment sequence is also shown in the read length histogram.
Read length histogram
This is a histogram of read lengths, in bp units, that have a Phred-like score of 17 or better, or one error in 50 bp (the ends only are shown because of width considerations):
Version 3.4.1
Distributions skewed to the right are ideal, showing longer read lengths (test fragments are a discrete length). It is likely that the sequence can extend all the way through the test fragment, if enough flows are run, so the histogram only displays a maximum size based on the length of the test fragment.
Version 3.4.1
Report Information
Report Information
This section describes the following run report buttons: Analysis Details Software Version Support Analysis Details
Version 3.4.1
The Analysis Details report displays the following information:
Parameter Run Name Run Date Run Cycles
Description Name of the run. Date and time the PGM or Proton run was started. Number of PGM or Proton cycles analyzed for this report. Note that this number can differ from the total number of cycles run on the sequencer. Number of PGM or Proton nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the sequencer. Names of the projects the result set is a member of. Name of the sample assigned to the run used to generate this analysis. This is assigned on the PGM or Proton sequencer.
Run Flows
Project Sample
Version 3.4.1
Library
Name of the library assigned to the run used to generate this analysis. This library name is used to specify the reference genome used for alignment. Name of the PGM or Proton sequencer on which the run was performed. This value is typically entered on the sequencer. Flow order selected on PGM or Proton sequencer: Samba = TACGTACGTCTGAGCATCGATCGATGTACAGC [ Default] Regular = TACG The "regular" flow order adds bases most rapidly to sequenced molecules but is vulnerable to phase errors. The Samba flow order consists of a 32-base sequence, repeated. This flow order resists phase errors by providing opportunities for out-of-phase molecules to catch up and is designed to sample all dimer (nucleotide pair) sequences, efficiently. Samba is the default flow order because it improve sequencing accuracy for longer reads by resisting phase errors.
PGM
Flow Order
Library Key
A short known sequence of bases used to distinguish the library fragment from the test fragment. Example: "TCAG" A short known sequence of bases used to distinguish the test fragment. A series of tests on reference wells (about 10% of the chip in non-addressable areas) is performed to ensure that the chip is functioning at a basic level. The value of this field is either Passed or Failed. Type of chip used on the PGM sequencer. Usually, 314, 316, or 318 (for the Ion 314 chip, Ion 316 chip, and Ion 318 chip.) A letter follows the numbers, indicating the chip version. In this release, the value is single, for a forward run. A space for text notes entered during the PGM or Pr oton sequencer run. The name of the barcode set assigned to the run. Blank for non-barcode libraries. Name of the analysis provided in Torrent Browser when the analysis was initiated. If the analysis was scheduled to auto-start, this is the default analysis name.
TF Key Chip Check
Chip Type
Chip Data Notes
Barcode Set
Analysis Name
Version 3.4.1
Analysis Date Analysis Flows
Date the analysis was performed. Number of PGM or Proton nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the PGM or Proton sequencer. The run code that the Torrent Browser assigned to the planned run for this analysis.
runID
Software Version
The Software Version report display includes version information for the Torrent Suite Software and its modules installed on your Torrent Server. The version numbers shown in the example may be different from your current version of the software depending on the age of the analysis. See the About tab in the Torrent Browser for a complete list of modules and version on your server. See the Torrent Suite Release Notes for the package versions in a specific release.
Parameter Torrent Suite
Description Version of Torrent Suite software used to generate the analysis. Version of the Datacollect package. Version of the Graphics package
Datacollect Graphics
Version 3.4.1
LiveView Script host ion-alignment
Version of the LiveView package. Version of the Script package. Host name where the Torrent Server is installed. Version of the Torrent Suite alignment module used for this analysis. Version of the Analysis Pipeline used to generate the analysis. Version of the NVIDIA Tesla GPU driver. Version of the analysis pipeline.
ion-analysis
ion-gpu ion-pipeline
Support The Support button opens links to the following: Download the Customer Support Archive Download a ZIP archive containing the PDF and HTML version of the run report as well as useful logs in case troubleshooting is required. See Customer Support Archive for a description of the archive and its contents. Download the New Customer Support Archive Generate a new customer support archive and download it. View the Report Log View the error log for this run report.
An example report log is shown below (chopped for width considerations):
Version 3.4.1
Version 3.4.1
Pre-3.0 Run Reports

Pre-3.0 Run Reports
This section describes the old style run reports used before release 3.0. The old style run report use an older layout and do not offer 3.x features. To view analysis runs generated with earlier version of the Torrent Suite software, you must either re-analyze the run to create a 3.x-style run report or use the older report format. Some features that previously were available in run reports are moved in 3.x releases. For example, in 3.x, to combine alignments you create a project, use a template that creates run results in that project, and use the Data > Projects > projectname > Combine Selected... button. This button replaces the combinAlignments plugin that was available in previous releases.
Version 3.4.1
Contents Torrent Browser Analysis Report Guide (3.x) Pre-3.0 Run Reports Pre-3.0 Library Summary Overview Pre-3.0 Library Summary Report Pre-3.0 Barcode Reports Pre-3.0 Test Fragment Report Pre-3.0 Ion Sphere Particle Summary Pre-3.0 Report Information Pre-3.0 File Links Pre-3.0 Plugin Summary Pre-3.0 Running the Installed Plugins Alignment Plugin (3.x) Coverage Analysis Plugin (3.x) ERCC Analysis Plugin (3.x) FastqCreator Plugin (3.x) Run RecognitION Plugin (3.x) sampleID Plugin (3.x) SFFCreator Plugin (3.x) Torrent Variant Caller Plugin (3.x)
Pre-3.0 Library Summary

Pre-3.0 Library Summary This section provides Library Summary background information and a detailed description of the report. Library Summary Overview Library Summary Report
Version 3.4.1
Pre-3.0 Library Summary Overview

Pre-3.0 Library Summary Overview
This Library Summary section of the Torrent Browser Analysis Report gives performance metrics for reads whose initial bases match the library key. These reads are generated from the input library, not from the positive control Test Fragments.
Performance is measured based on either predicted quality or quality as measured following alignment. Using Predicted Quality (Q17/Q20) Using Quality Following Alignment (AQ17/AQ20)
Version 3.4.1
Using Predicted Quality (Q17/Q20)
The number of called bases with a predicted quality of Q17 or Q20 is reported. The predicted quality values are reported on the Phred scale, defined as -10log10 (error probability). Q20, therefore, corresponds to a predicted error rate of one percent and Q17 corresponds to a predicted error rate of two percent. Refer to http://en.wikipedia.org/wiki/Phred_quality_score for a more complete description of Phred values.
Using Quality Following Alignment (AQ17/AQ20)
Alignment of reads can be a useful process to assess the quality of the sequencing reaction and the quality of the underlying library where an accurate reference is available. Reads are aligned to a reference genome. Any discrepancy in alignment to a reference (whether biological or technical, meaning a real variant or a sequencing error) is listed as a mismatch. Alignment performance metrics are reported depending on how many misaligned bases are permitted. Torrent Suite reports alignment performance at three quality levels: AQ17 AQ20 Perfect How Is Aligned Read Length Calculated? The aligned length of a read at a given accuracy threshold is defined as the greatest position in the read at which the accuracy in the bases up to and including the position meets the accuracy threshold. So for example the AQ17 length of a read is the greatest length at which the read error rate is 2% or less, and the AQ20 length is the greatest length at which the error rate is 1% or less. The "perfect" length is simply the longest perfectly aligned segment. For all of these calculations the alignment is constrained to start from position 1 in the read - in other words, no 5' clipping is permitted. The underlying assumption is that the reference to which the read is aligned represents the true sequence that should have been seen. Suitable caution should be taken when interpreting AQ17 values in situations where the sample sequenced has substantial differences relative to the reference used, such as working with alignments to a rough draft genome or with samples that are expected to have high mutation rates relative to the reference used. In these situations the AQ17 lengths might be short even when sequencing quality is excellent. Specifically, the AQ20 length is computed as follows: 1. Every base in the read is classified as being correct or incorrect according to the alignment to the reference. 2. At every position in the read the total error rate is computed up to and including that position. 3. The greatest position at which the error rate is one percent or less is identified and that position defines the AQ20 length. For example, if a 100bp read consists of 80 perfect bases followed by 2 errors followed by 18 more perfect bases, the total error rate at position 80 is zero percent. At position 81 the total error rate is 1.2% (1/81), at position 82 the error rate is 2.4%, continuing up to position 100 where it is two percent (2/100). The greatest length at which the error rate is one percent or less is 80 and the greatest length at which the error rate is two percent or less is 100, so the AQ20 and AQ17 lengths are 80 and 100 bases, respectively. How Is Alignment Performed? Within Torrent Browser, the objective is to provide you with a view on alignment that helps determine run and library quality.
Version 3.4.1
There are many alignment algorithms available within the marketplace and you are encouraged to consult with a bioinformatician for the most appropriate alignment algorithm for your downstream analysis needs. Alignment algorithms are also embedded in many of the commercial software tools available within the Ion Torrent Web store. You are also encouraged to experiment with these tools. Alignment within Torrent Browser is performed using TMAP. TMAP is currently an unpublished alignment algorithm, created by the authors of the BFAST algorithm. Please, contact Ion Torrent Technical Support for more information about TMAP. Technical Note - Analysis Pipeline Technical Note - TMAP Alignment Although TMAP is unpublished and a reference is not currently available, the precursor to TMAP, BFAST, is based on the ideas in the following publications: Homer N, Merriman B, Nelson SF. BFAST: An alignment tool for large scale genome resequencing. PMID: 19907642 PLoS ONE. 2009 4(11): e7767. http://dx.doi.org/10.1371/journal.pone.0007767 Homer N, Merriman B, Nelson SF. Local alignment of two-base encoded DNA sequence. BMC Bioinformatics. 2009 Jun 9;10(1):175. PMID: 19508732 http://dx.doi.org/10.1186/1471-2105-10-175 Which Reads Are Used in the Alignment Process? The alignment stage involves aligning reads produced by the pipeline to a reference genome and extracting metrics from those alignments. By default, Torrent Suite aligns all reads to the genome, however there may be situations, particularly with large genomes, where the alignment takes longer than the user is willing to wait. So for such circumstances the Torrent Suite also has the capability to define on a per-reference basis the maximum number of reads that should be aligned from a run. For more detail on how to enable and specify this reference-specific limit see the Adding a Reference Sequence section of Working with Reference Sequences. When the number of reads in a run exceeds a genome-specific maximum, a random sample of reads is taken and results are extrapolated to the full run. By sampling a quickly-aligned subset of reads and extrapolating the values to the full run, the software gives you enough information to be able to judge the quality of the sample, library and sequencing run for quality assessment purposes. The outputs of the alignment process is a BAM file. The BAM file includes an alignment of all reads, including the unmapped, with exactly one mapping per read. When a read maps to multiple locations, the mapping with the best mapping score is used. If more than one such mapping exists, a random mapping is used and given a mapping quality of zero.
Version 3.4.1
Pre-3.0 Library Summary Report

Pre-3.0 Library Summary Report
Performance, based on either predicted quality or quality as measured following alignment, is provided in the Librar y Summary section of the Detailed Report. This section of the report contains the following information:
Based on Predicted Per-Base Quality Scores - Independent of Alignment
The Based on Predicted Per-Base Quality Scores - Independent of Alignment section gives performance measurements based on predicted quality:
Version 3.4.1
Parameter Total Number of Bases [Mbp]
Description Number of filtered and trimmed million base pairs reported in the output files. Number of bases with predicted quality of Q20 or greater. Total number of filtered and trimmed reads independent of length reported in the output files. Average length, in base pairs, of all filtered and trimmed library reads reported in the output files. Maximum length, in base pairs, of all filtered and trimmed library reads reported in the file.
Number of Q20 Bases [Mbp]
Total Number of Reads
Mean Length [bp]
Longest Read [bp]
Read Length Histogram The Read Length Histogram is a histogram of the trimmed lengths of all a reads present in the output BAM file. The following figure illustrates an example graph:
Consensus Key 1-Mer The Consensus Key 1-Mer graph shows the strength of the signal from the first three one-mer bases of the library key. This graph represents the consensus signal measurement of release of H+ during nucleotide incorporation.
Version 3.4.1
The y-axis shows signal strength, measured in Counts, which is an arbitrary but consistent unit of measure. The x-axis shows time as nucleotide Flows over the chip. There is a known key at the beginning of every library read. Typically, three bases are shown of the 4-mer key. Note that the graph is displayed in "flow order" rather than "base order." For example, the four-base library key is typically TCAG for nucleotides one through four and is graphed as TCA, representing the nucleotide flow order. Negative flows are not displayed. Q: If the library key is 4 bases, why are only three bases displayed in the key one-mer graph? A: The next base after the last key base is the first library base. This base varies depending on the library fragment. If the last key base is a G and the first library base is a G, both of these are incorporated in the same flow resulting in a signal roughly 2X of a one-mer. Thus, the last base of the library read is not informative for quality purposes because that flow can contain library information in addition to key information. The one-mer key pass graph only contains n-1 flows for an n-mer library key.
Reference Genome Information
The Library Summary includes the Reference Genome Information:
Parameter Genome Name Genome Size Genome Version Index Version
Description Name of reference genome. Number of bases in the reference genome. Version information for the genome used. Version information for the genome index used.
If an alignment error occurred, a message prompts you to view the report log for information about the error.
Based on Full Library Alignment to Provided Reference
Version 3.4.1
This section of the Library Summary report shows performance as measured following alignment.
Parameter Total Number of Bases [Mbp]
Description Number of million of base pairs that have been aligned to the genome at the specified quality level. Average length, in base pairs, of all library reads that aligned to the genome at Q20 and Perfect (the longest perfectly aligned segment). Maximum length, in base pairs, of all library reads that aligned to the genome at a specific quality level. Average number of times that a base was independently sequenced and aligned to the reference genome. 1X means that every base was sequenced and aligned, on average, once. 2X means that every base was sequenced and aligned, on average, twice. Percentage of the reference genome that is covered at a minimum of 1X by filtered library reads at a specific quality.
Mean Length [bp]
Longest Alignment [bp]
Mean Coverage Depth
Percentage of Library Covered [bp]
Using the TMAP Alignment Algorithm When the reference genome is a large genome, alignment is performed on a random subset of the reads in the unmapped BAM file. You can specify sampling and the number of reads to sample on a per-genome basis. Sampling only occurs if this number is set during reference upload. Otherwise, complete alignment is performed. The values in this table are extrapolated to the full number of reads.
Read Alignment Distribution
Summarizing the alignments produces the following report format:
Version 3.4.1
The number of rows displayed varies depending on the read length.
Each column shows data based on alignment of the sample. Column Read Length [bp] Description The number of bases in each read considered for the row in the table. Number of reads with at least Read Length bases. Number of reads that TMAP could not map. Number of reads mapped but not having 90% accuracy in first 50 bases. Number of reads mapped and with accuracy of greater than 90% in first 50 bases, but with align length less than the Read Length threshold. Number of aligned reads with zero mismatches in the first Read Length bases. Number of aligned reads with one mismatch in the first Read Length bases. Number of aligned reads with two or more mismatches in the first Read Length bases.
Reads Unmapped Excluded
Clipped
Perfect
1 mismatch
2 mismatches
SAM/BAM files for reports with sampled data only include alignment information for the sampled subset.
Version 3.4.1
Pre-3.0 Barcode Reports

Pre-3.0 Barcode Reports The Barcode Reports section displays histograms for the following metrics per barcode:
Chart Total number of reads
Description Total number of filtered and trimmed reads independent of length. This number is reported in the barcode unmapped BAM file. Number of base pairs of sequence from reads with aligned quality score of AQ20 or better.
AQ20 Bases
Version 3.4.1
Mean AQ20 read length
An AQ20 read length is the length, in bp units, that after alignment has a Phred-like score of 20 or better, or one error in 100 bp. This histogram charts the mean of these AQ20 read lengths per barcode. The number of reads with an aligned quality score of AQ20 or better.
AQ20 Reads
Version 3.4.1
The number of barcodes shown in the reports varies according to the barcode set used in your run and on the barcodes actually present in the sample. Only data for barcodes present in the run are displayed in the chart. Each bar is labeled with the barcode ID. Data labeled as barcode ID X reports the number of unclassified barcodes: reads which could not be classified as matching one of the expected barcodes in the barcode set.
Version 3.4.1
Pre-3.0 Test Fragment Report

Pre-3.0 Test Fragment Report The Test Fragment Summary section of the Analysis Report provides information about the performance of each Test Fragment included in the experiment. The report has a heading for each Test Fragment, in the form Test Fragment - <TestFragmentName>. Test Fragments are used during analysis to predict the CF/IE/DR values for each Test Fragment, regionally. Analysis results for a Test Fragment are displayed when there are at least 1000 high-quality Test Fragments, where there is an 85% match against the appropriate template in the Test Fragment list. This includes CF/IE/DR estimates and performance calculations. The number of TFs reported includes lower quality TFs, down to 70% match, to better represent the run quality from all TF's.
Version 3.4.1
Test Fragment Summary
The Test Fragment Summary part of the Test Fragment Report displays the following information:
Test Fragment List
Consensus Key 1-Mer
The Consensus Key 1-Mer graph shows the strength of the signal from the first three one-mer bases of the Test Fragment key. This graph represents the consensus signal measurement of release of H+ during nucleotide incorporation.
The y-axis shows signal strength, measured in Counts, which is an arbitrary but consistent unit of measure. The x-axis shows time as nucleotide Flows over the chip. There is a known key at the beginning of every read. Typically, three bases are shown of the 4-mer key. Note that the graph is displayed in "flow order" rather than "base order." For example, the four-base Test Fragment key is typically ATCG for nucleotides one through four and is graphed as ATC, representing the nucleotide flow order. Negative flows are not displayed.
Quality Metrics
The Quality Metrics part of the Test Fragment Report displays the following information:
Version 3.4.1
Parameter TF Name
Description Test Fragment name, as defined in the Templates tab of Torrent Browser. Test Fragment sequence. Number of filtered & trimmed reads identified for this Test Fragment. Average read length with Q17, or better, for this Test Fragment. Number of reads for this Test Fragment with a minimum of 50 base pairs in length and an error rate of 1 in 50, Phred-like 17, or better. Quality is based on alignment, not predicted quality.
TF Seq Num
Avg Q17 read length
50AQ17
Graphs
The Graphs part of the Test Fragment Report displays the following information:
AQ17 Read Lengths
The AQ17 Read Lengths graph is a histogram of read lengths, in bp units, that have a Phred-like score of 17 or better, or one error in 50 bp. Distributions skewed to the right are ideal, showing longer read lengths (remembering that Test Fragments are a discrete length). It is likely that the sequence can extend all the way through the Test Fragment, if enough flows are run, so the histogram only displays a maximum size based on the length of the Test Fragment.
Version 3.4.1
Average Corrected Ionogram
In the Average Corrected Ionogram graph, the x-axis is in flow space and the y-axis shows the signal intensity. A unit of one indicates that there is only one base. A unit of two indicates that there are two bases of that specific nucleotide incorporated during the single flow event.
Version 3.4.1
Pre-3.0 Ion Sphere Particle Summary

Torrent Browser Analysis Report Guide Pre-3.0 Ion Sphere Particle (ISP) Summary
The Ion Sphere Particle (ISP) Identification Summary section of the Analysis Report gives summary statistics of Ion Sphere Particle performance:
Version 3.4.1
This section of the report is available before the Library Summary or Test Fragment Summary sections, providing a quick determination of whether or not the analysis should be permitted to continue. The report displays:
Well Information
The data generated in this section are created "early" in the analysis process, before base calling, and are intended to be a coarse, initial assessment of run performance. The well data are subject to more stringent filtering in later stages of the analysis.
Parameter Total Addressable Wells
Description Total number of addressable wells.
Percentage Not calculated
Version 3.4.1
Wells with ISPs
Number (and percentage of addressable wells) of wells that were determined to be "positive" for the presence of an ISP within the well. "Positive" is determined by measuring the diffusion rate of a flow with a different pH. Wells containing ISPs have a delayed pH change due to the presence of an ISP slowing the detection of the pH change from the solution. Number (and percentage of wells with ISPs) of wells that contained an ISP with a signal of sufficient strength and composition to be associated with the library or Test Fragment key. This value is the sum of the following categories: Test Fragment Library
Wells with ISPs / Total Addressable Wells
Live ISPs
Live ISPs / Wells with ISPs
Test Fragment ISPs
Number (and percentage of Live ISPs) of Live ISPs with a key signal that was identical to the Test Fragment key signal. Number (and percentage of Live ISPs) of Live ISPs that have a key signal identical to the library key signal. These reads are input into the Library filtering process.
Test Fragment ISPs / Live ISPs
Library ISPs
Library ISPs / Live ISPs
Library ISP Details
The Library ISP Details table is available after basecalling and read filtering are complete. This table provides information on a collection of read filters, which are applied after basecalling to ensure only high-quality reads are written to the final results. The Polyclonal filter removes ISPs carrying clones from two or more templates. The Primer dimer filter removes reads carrying an insert of fewer than 8 bp. The Low quality filter removes reads that fail to attain a high level of accuracy.
Version 3.4.1
Parameter Library ISPs/Percent Enrichment
Description Predicted number of Live ISPs that have a key signal identical to the library key signal (the same value as shown in the Well Information table). The Percent Enrichment value reported is the number of loaded ISPs that are Library ISPs, after taking out Test Fragment ISPs.
Percentage Library ISPs / (No. of Loaded ISPs minus TF ISPs)
Filtered: Polyclonal
ISPs carrying clones from two or more templates. Insert length of less than 8 bp. Low or unrecognizable signal. Number (and percentage of Library ISPs) of reads passing all filters, which are recorded in the unmapped BAM file. This value may be different from the Total number of reads located in the Library Summary Section due to technicalities associated with read trimming beyond a minimal requirement resulting in Total number of reads being slightly less than Final Library Reads.
Polyclonal ISPs / Library ISPs
Filtered: Primer dimer Filtered: Low quality Final Library Reads
Primer dimer ISPs / Library ISPs Low quality ISPs / Library ISPs Final Library / Library ISPs
Chip Loading Image
The Ion Sphere Particle Identification Summary section includes a Chip Loading Image, similar to the image shown in the following figure:
Version 3.4.1
This is a pseudo-color image of the Ion CHIP showing percent loading across the physical surface. The Loading Density percentage is displayed above the image, with the percentage value that considers only potentially addressable wells.
Version 3.4.1
Pre-3.0 Report Information

Pre-3.0 Report Information
Analysis Info
The Analysis Info report displays the following information:
Version 3.4.1
Parameter Run Name
Description Name of the sequencing run entered. This value is typically entered on the PGM or Proton sequencer. Date and time the PGM or Proton run was started. Name of the analysis provided in Torrent Browser when the analysis was initiated. If the analysis was scheduled to auto-start, this is the default analysis name. Date the analysis was performed. Number of cycles analyzed for this report. Note that this number can differ from the total number of cycles run on the sequencer.
Run Date Analysis Name
Analysis Date Analysis Cycles
Version 3.4.1
Analysis Flows
Number of nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the sequencer. Name of the project assigned to the run. This is typically assigned on the PGM or Proton sequence r. Name of the sample assigned to the run used to generate this analysis. This is assigned on the PGM or Proton sequencer. Name of the library assigned to the run used to generate this analysis. This library name is used to specify the reference genome used for alignment. Name of the PGM or Proton sequencer where the run was performed. A series of tests on reference wells (about 10% of the chip in non-addressable areas) is performed to ensure that the chip is functioning at a basic level. The value of this field is either Passed or Failed. Type of chip used on the sequencer. Usually, 314, 316, or 318 (for the Ion 314 chip, Ion 316 chip, and Ion 318 chip.) A letter follows the numbers, indicating the chip version. The name of the barcode set assigned to the run. Blank for non-barcode libraries. A space for text notes entered during the PGM or Proton sequencer run. Flow order selected on PGM or Proton sequencer: Samba = TACGTACGTCTGAGCATCGATCGATGTACAGC [ Default] Regular = TACG The "regular" flow order adds bases most rapidly to sequenced molecules but is vulnerable to phase errors. The Samba flow order consists of a 32-base sequence, repeated. This flow order resists phase errors by providing opportunities for out-of-phase molecules to catch up and is designed to sample all dimer (nucleotide pair) sequences, efficiently. Samba is the default flow order because it improve sequencing accuracy for longer reads by resisting phase errors.
Project
Sample
Library
PGM
Chip Check
Chip Type
Barcode Set
Notes
Flow Order
Version 3.4.1
Library Key
A short known sequence of bases used to distinguish the library fragment from the Test Fragment. Example: "TCAG"
Software Version
The Software Version report display includes version information for the modules installed on your Torrent Server. The version numbers shown in the example may be different from your current version of the software depending on the age of the analysis. See the About tab in the Torrent Browser for a complete list of modules and version on your server. See the Torrent Suite Release Notes for the package versions in a specific release.
Parameter Torrent Suite
Description Version of Torrent Suite software used to generate the analysis. Version of the Datacollect package. Version of the LiveView package. Version of the Script package.
Datacollect LiveView Script
Version 3.4.1
ion-alignment
Version of the Torrent Suite alignment module used for this analysis. Version of the Analysis Pipeline used to generate the analysis. Version of the ion-dbreports package. Version of the NVIDIA Tesla GPU driver. Version of the pre-installed plugins. Version of the TorrentR stats package. Version of the TMAP alignment package.
ion-analysis
ion-dbreports ion-gpu ion-plugins ion-torrentR tmap
Version 3.4.1
Pre-3.0 File Links

Pre-3.0 File Links These links permit you to directly download the data and report files. Some files are compressed, using the .zip for mat, to provide data integrity and to reduce download time. Right-click the wanted file type and follow the Save link as dialog to save the file to your local computer. Most output files can be loaded into third-party viewers (such as IGV) for visualization. The barcode links only appear for runs on barcoded data.
File Type Library Alignments (BAM)
Description Binary Sequence Alignment/Map (BAM), is a compressed, binary form of the SAM file. BAM files can be indexed, using the BAM Index file, for quick access to sequence alignment data. See http://samtools.sourc eforge.net for more a more detailed description of the SAM/BAM file format. Many tools are available for working with SAM files. See Pre-3.0 Library Summary Overview for a description of the alignment data included in the BAM file. The reads in the file are sorted by reference location.
Library Alignments (BAM Index)
Binary Sequence Alignment/Map Index (BAI) -formatted file. A BAM index file speeds up the access time for a coordinate-sorted BAM file, enabling software to more quickly access random parts of the genomic information in a BAM file. Each BAM index file is associated with a BAM file so be careful not to confuse them. They share the same file name but the BAM index file has a .bai extension. To access information in a BAM file, a BAM index file is not required but does improve time-to-access.
Version 3.4.1
Barcode Alignments Summary
A summary file of alignment metrics for barcodes. The metrics include the quality and read lengths at which each barcode aligns to reference. This link appears on barcode runs only. The same format and purpose as the Library Alignments (BAM) and Library Alignments (BAM Index) files, with content for specific barcodes. The BAM and BAM Index files for each barcode are zipped together. This link appears on barcode runs only. Complete detailed Analysis Report in PDF format. ZIP archive containing the PDF and HTML version of the run report as well as useful logs in case troubleshooting is required.
Barcode-specific Library Alignments (BAM and BAM Index)
PDF of this Report Customer Support Archive
The SFF and FASTQ files formats are deprecated. See Technical Note - Transition from SFF to BAM format and SFFCreator and FastqCreator Plugins.
Version 3.4.1
Pre-3.0 Plugin Summary

Pre-3.0 Plugin Summary
The Plugin Summary lists the plugins associated with the analysis, and provides an interface for running and monitoring your plugin(s).
Plugins can have one of the following behaviors:
Version 3.4.1
Run without user input. Run with a user interface for getting plugin parameters. Plugins without a user interface display a confirmation message that the plugin has been submitted to run. Plugins requiring input parameters display a user interface dialog and are launched after you click Submit.
Running Plugins
The following plugins are pre-installed on Torrent Server. See Pre-3.0 Running the Installed Plugins for a description of these plugins. Alignment Coverage Analysis ERCC Analysis FastqCreator IonReporterUploader Run RecognitION SampleID SFFCreator Torrent Variant Caller
To manually run a post-analysis plugin on the report data: 1. Click Select Plugins To Run. 2. The Plugin List pops up and displays a list of available plugins:
3. Click the plugin you want to run.
Version 3.4.1
3.
If the plugin does not require user input, it begins execution. This displays the user interface for your plugin. In this example, the Alignment plugin is selected, displaying the Alignment plugin dialog (See Pre-3.0 Running the Installed Plugins for more information about running pre-installed plugins.):
4. Select the desired plugin options and click Submit. This runs your plugin, listing the run status in the Plugin Summary panel. 5. For plugins that take a long time to run, click Refresh Plugin Status to update the plugin display status. When your plugin completes, the status is updated to Started.
The Plugin Summary List
After a plugin runs, it is listed in the Plugin Summary panel:
Some plugins, such as Alignment, display a preview results window in the Plugin Summary list.
Plugin Reports
Plugin results, results summaries, links to output files, and other information are available in the plugin report pages. See Pre-3.0 Running the Installed Plugins for a description of report pages for the installed plugins. Click the plugin html link in the Plugin Summary section to open that plugin's report page.
Plugin Log Files
1. To view the plugin log file, hover your mouse pointer over the log icon to the right of your plugin to display the plugin log file:
Version 3.4.1
2. Click the icon to display the log:
3. Click Close to exit the display.
Version 3.4.1
Pre-3.0 Running the Installed Plugins

Pre-3.0 Run the Installed Plugins Available Plugins Manually Run a Plugin Automatically Run Plugins
Available Plugins
This table lists the pre-installed and officially supported plugins. Plugin Alignment Plugin Description Performs a new alignment to the reference you specify. Note: Plugins run after the Torrent Suite analysis pipeline. This plugin does not affect the alignment during pipeline analysis.
Version 3.4.1
Coverage Analysis Plugin
Provides statistics and graphs describing the level of sequence coverage produced for targeted genomic regions. Helps with ERCC RNA Spike-in Controls: enables you to quickly determine whether or not the ERCC results indicate a problem with either the library preparation or the sequencing instrument run. Generates a Fastq format file of the analysis output. Considers candidate runs for inclusion in Ion Community leaderboards. Within each chip type (Ion 314 chip, Ion 316 chip, and Ion 318 chip), top runs are ranked according the number of AQ20 bases mapped. Uses sample fingerprinting to identify any cross-contamination between samples or between barcodes in a run. Generates an SFF format file of the analysis output. Calls SNP and InDel variants across a reference or within a targeted subset of that reference. With low-frequency variant options, the plugin can call variants down to a 5% level of variant frequency. It can also show which variants coincide with predefined HotSpot positions on the reference sequence.
FastqCreator Run RecognitION Plugin
sampleIDPlugin
SFFCreator Torrent Variant Caller Plugin
This table lists functionality that was available as plugins in previous releases. These are now available in other areas of the Torrent Browser. Previous plugin IonReporterUploader Description and new location Transfers run results files to the Ion Reporter Software (access is available under a separate license). The IonReporterUploader is now selected before a run in the Plan > Templates, Plan > Planned Run, and wiza rd pages. After a run, if the results set is a member of a project, you invoke the IonReporterUploader from the project page (see Projects).
Version 3.4.1
combineAlignment
Combines reads aligned to the specified reference from multiple run reports. Intended for use when multiple runs analyze the same tissue sample, for example when a tissue sample is run on more than one chip. You invoke combineAlignment from the project page (see Projects). The runs you combined must be members of the same project.
Manually run a plugin
The Plugin List is the mechanism to manually run plugins. The Plugin List is accessed in the run report of completed analysis runs. Only enabled plugins are listed. Follow these steps to manually run a plugin: 1. Click the Reports tab, then click the link for your completed analysis run. 2. In the run report, scroll down to Plugin Summary section.
The Plugin Summary also lists any plugins that executed on your run (not shown in this example). 3. Click Select Plugins To Run to see the list of available plugins. See Available Plugins for the pre-installed plugins. Your server may have additional plugins installed.
Version 3.4.1
4. Click the desired plugin name to run a plugin. If the plugin does not require user input, it starts immediately, without a confirmation screen. 5. Click Close to close the Plugin List without running a plugin.
Automatically run plugins
When you design your sequencing protocol in the Plan > Template page, you specify which plugins to execute. You can select any plugin that is installed and configured on your Torrent Server. You are not limited to the pre-installed plugins. See the following for more information on specifying plugins in your templates and planned runs: Plan Tab Templates Planned Runs Template and Planned Run Wizard
The old method to autorun a plugin
Your Torrent Server administrator can set plugins to be executed automatically on every run; however, the preinstalled plugins are not good candidates to be run automatically. For example, the Torrent Variant Caller plugin fails on runs that do not use both the hg19 reference and the Ion AmpliSeq Cancer Panel or custom product data.
Version 3.4.1
The Alignment and RunRecognitION plugins cannot be be executed automatically because they require manual user input before every run. For Ion Reporter users, enabling AutoRun with the IonReporterUploader plugin could cause you extra expense, by transferring unnecessary results to the Ion Reporter server. (The Plan tab allows you to turn off the plugin for a template or a planned run.)
Pre-3.0 TBAR Table Of Contents
Version 3.4.1
Pre-3.0 combineAlignments Plugin

Pre-3.0 combineAlignments Plugin The combineAlignment plugin combines reports from multiple runs that analyze the same tissue sample. The plugin is used, for example, when you run a tissue sample on more than one chip. The plugin combines the reports from those runs into one report. You run the plugin from any one of the related reports. All runs must use the same reference. Analyses using barcoded libraries are not supported in this release.
Run the Plugin
You run the plugin from the Report tab run report of one of the runs to be combined:
Version 3.4.1
That report appears in the selected reports section. Click search to find related reports:
Related reports appear in the search section. Your original report has the Add button grayed out:
Click Add for each run to be combined. Additional search results can be seen by clicking the More button on the lower right. When you have all runs selected and appearing in the selected report section (the lower table), select a name for the combined alignments report, and click Submit.
Plugin Notes
the plugin includes these notes in the submission page: This plugin combines reads aligned to the specified reference from multiple run reports. The resulting combined
Version 3.4.1
alignment files may be downloaded from the plugin report page or used as input for other Torrent Browser plugins that support the use of these files, such as the Torrent Variant Caller. Use the filters in the Report Locater to find reports then click the Add button to add them to the Selected Reports table. Initially the list of selected reports will contain the current report name. This report, or any selected report, may be removed from the list by clicking the Remove button. The alignment file from selected reports is combined by this plugin after clicking the Submit button. You may also modify the default name for the combined alignment files generated. Note that the Report Locator will only include reports that are completed and does not support barcoded runs. Also, the Report Locator only lists reports for runs associated with the selected reference.
TBAR Table Of Contents
Version 3.4.1
Version 3.4.1
Use Cases
Use Cases
Introduction
This document describes several common use cases. These include topics whose operation or application: May not be intuitive from the Torrent Browser UI. May cross UI functional boundaries. May have alternative command line interfaces. Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Terminate an Analysis Run Work with Files Work with the Database Contents Introduction Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Determine the Fault Cause Restart a Run Terminate an Analysis Run Work with Files Work with the Database Change the Report Name Change the Sample Name Change the Run Date Add or Change a PGM or Proton Change Your Torrent Browser Password
Terminate an Analysis Run

Use Cases
Terminate an Analysis Run
Version 3.4.1
Use the following procedure to terminate an analysis job for a run that has started but not completed: 1. In the Torrent Browser, near the top right, click the Admin gear menu and click the Services option:
2. Scroll down to the Active Jobs panel. Find the run Name you want to terminate and click the Terminate butt on associated with the job (the Status Message column indicates job is running).
3. In the confirmation dialog, click Terminate to end the run or click Cancel to let the analysis job continue:
4. Refresh your browser to update the information in the Active Jobs section. The run is removed from the Activ e Jobs list, which displays No active jobs if no other runs are active:
Version 3.4.1
On the Data> Completed Runs & Reports list view, the deleted report shows a TERMINATED status:
You can always start a new analysis run. Contents Introduction Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Determine the Fault Cause Restart a Run Terminate an Analysis Run Work with Files Work with the Database Change the Report Name Change the Sample Name Change the Run Date Add or Change a PGM or Proton Change Your Torrent Browser Password
Handle a Failed Analysis Run

Use Cases
Handle a Failed Analysis Run
If an analysis run fails, you need to attempt to determine the cause of the failure an, possibly, restart the run.
Version 3.4.1
Determine the Fault Cause Restart a Run Contents Introduction Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Determine the Fault Cause Restart a Run Terminate an Analysis Run Work with Files Work with the Database Change the Report Name Change the Sample Name Change the Run Date Add or Change a PGM or Proton Change Your Torrent Browser Password
Determine the Fault Cause

Use Cases
Determine the Fault Cause If an analysis run fails, make the following checks: 1. Has the PGM or Proton sequencer completely transferred the data for the run? Go to the sequencer Data Management screen to verify complete data transfer. You can re-transfer the data if you are not sure it was completely transmitted. 2. Go to the Torrent Browser Data > Completed Runs & Reports tab and see that the file transfer was complete. Also, check if there are any error messages, such as User Aborted. Look for a status of Error or Pending. 3. If the report was generated, check if there are any messages on the report itself. 4. Click the Support link towards the bottom of the run report (above the Plugin Summary row of buttons). Click View the Report Log or Download the Customer Support Archive. You can send the customer support archive to your Ion Torrent contact for review. 5. If you cannot determine the cause of the fault, try restarting the run. See Customer Support Archive for a description of the Customer Support Archive.
Version 3.4.1
Contents Introduction Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Determine the Fault Cause Restart a Run Terminate an Analysis Run Work with Files Work with the Database Change the Report Name Change the Sample Name Change the Run Date Add or Change a PGM or Proton Change Your Torrent Browser Password
Restart a Run
Use Cases
Restart a Run Follow these steps to restart an analysis run: 1. Open a run reports listing in the Data > Completed Runs & Reports tab to access run management functions. In the list view, click the Analyze button on the right side of the run listing:
In the table view, click the gear menu on the right side of the run report listing and click the Reanalyze option:
Version 3.4.1
2. The Start Analysis window opens:
Do not modify the Report Name field. To rerun with the same run settings, click Start Analysis. To modify run settings, click the Advanced + button. 3. Modify the advanced options, if needed. See Work with Completed Runs for information on Advanced fields.
Version 3.4.1
4. Click the Start Analysis button. 5. Verify that the run has started by clicking the Admin gear menu Services option to view your job:
Version 3.4.1
Use Cases Table of Contents
Version 3.4.1
Realign Run to Different Reference Genome

Use Cases
Realign Run to Different Reference Genome
This section describes how to rerun an analysis with alignment to a different reference genome. These steps create a new run report. The Alignment plugin also realigns to a different reference genome, but does not generate a new run report.
1. Log in to Torrent Browser and click the Data tab Completed Runs & Reports page. 2. Go to the Data > Completed Runs & Reports tab and find your run name.
Version 3.4.1
In the table view, click the Reanalyze option in the gear menu on the right of the run entry:
The main run analysis dialog opens:
3. Click the Advanced button to display the additional run parameter options:
3.
Version 3.4.1
4. Click the Alignment Reference pull-down menu and select the reference for this run:
This menu shows the references available on your Torrent Server. Your list is different from the list shown
Version 3.4.1
here. 5. (Optional) Change other advanced options if required. (See Work with Completed Runs for a description of the Advanced fields.) 6. Click the Start Analysis button.
Work with Files

Use Cases
Work with Analysis Files
Analysis results file location For a standard Torrent Server configuration, analysis results files are located in the following directories: Type of Data Raw Processed Directory Name /results/<PGM_name>/<Run_name>/ /results/analysis/output/Home/<Report_na me>/
Standard reference file location

Version 3.4.1
Standard reference files are stored in the following location:
/results/referenceLibrary/<index_type>/<genome_shortname>/
Log files in the /results folder Many log files, shown in the following table, are generated for different parts of the Analysis pipeline. Some files only appear when a problem occurs. You do not need to login to see these files. Opening a report and removing the report name gives you a directory listing of all of the files, which you can open directly as text files. Be careful that you do not open a large file using the web browser. Filename version.txt Description Lists the versions of the Ion software packages that were installed at the time the report was generated and the host name of the server. This information is also displayed on the default report. Lists all of the Test Fragment Templates that were used for generating this report. If the file size is zero and there are no data in the file, either no templates are installed or none are flagged isofficial. Analysis only checks against the templates that are marked isofficial, which is set using the Template s tab in the browser. Lists problems uploading data to the database. If analysis results are not being displayed in the browser, check this file. Normal results: Updating Analysis Adding TF Metrics Adding PE Metrics Adding Analysis Metrics Adding Library Metrics Adding Quality Metrics Error examples: Failed addAnalysisMetrics Failed addLibMetrics status.txt Analysis run status. If the analysis completed successfully, the contents of this file are a 1. A value of 0 indicates a failure occurred, requiring that you check other log files to determine the cause. No specific error information is provided in this file.
DefaultTFs.conf
uploadStatus
Version 3.4.1
processParameters.txt
Run events and duration. The command-line passed to the Analysis program is also included, which is useful if you want to re-run the same analysis. These files are in subdirectories named sigproc_results/block_*. Analysis pipeline log files. Always check for errors in these files, especially the first and the last pages. The contents of these log files (without HTML formatting) are available in the Torrent Browser with the run report Support tab View the report log link:
sigproc_results/sigproc.log basecaller_results/basecaller.log alignment.log
drmaa_stdout.txt drmaa_stderr.txt
Post-analysis events. Error messages related to processes called after the primary analysis. This has a value of zero if the analysis completed successfully. Useful troubleshooting information generated during the alignment process. This file is only created when there is a problem. A memory dump listing, usually caused by a critical fault. You should see a related exception or core du mp message in an analysis pipeline log file. Errors related to TMAP. If the file is not present, it is likely that TMAP was not called. These files are in subdirectories named basecaller_results/block _*.
analyzeReads_err.txt
core
alignmentQC_out.txt
Version 3.4.1
Work with the Database

Use Cases
Work with the Database
User configuration information and experiment descriptions can be accessed and modified directly in the database, provided you have administrator privileges.
Warning!
Care must be taken when modifying database items. Setting fields to incorrect values may corrupt the database or produce unpredictable results.
Access the Database For all of the common database operations, you must begin by logging in to the database interface: Making changes to the database requires Torrent Server administrator-level user access.
1. In the Torrent Browser, near the top right, click the Admin gear menu and click the Configure option:
Version 3.4.1
1.
2. In the Admin Configure tab, scroll down to the Database Administration section. Click Admin Interface to access database administration functions:
3. If you are prompted to log in, enter the administrator ( ionadmin) Username and Password, and click Log In:
Common Database Operations Change the Report Name Change the Sample Name Realign Run to Different Reference Genome Change the Run Date Add or Change a PGM or Proton
Version 3.4.1
Change the Report Name

Use Cases
Change the Report Name If you manually started an analysis and realize that you typed the report name incorrectly, you can change the report name using the following procedure. These steps require admin login. It is not safe to change the report name while the report is being processed.
1. Select the Results dialog.
Version 3.4.1
2. On the Select results to change page, click the name of the run you want to change, in the ResultsName c olumn:
Version 3.4.1
3. Enter the new report name in the ResultsName field:
Version 3.4.1
4. Click Save (on the bottom right) to save your change.
Version 3.4.1
Change the Sample Name

Use Cases
Change the Sample Name When you start to process a chip on the PGM or Proton sequencer, one of the things you must enter is a sample name. The sample name can be any text that helps you to remember your data. When the sequencer run completes, the data are transferred to the server for analysis and the sample name is displayed in the Torrent Browser, as shown in this example:
Version 3.4.1
It may sometimes be necessary to change the sample name because of one of the following conditions: The PGM or Proton sequencer user entered the wrong information or a typo. The format for tracking sample names changed. You decided another name is more useful. Use the following procedure to change the sample name: 1. Select the Experiments option.
Version 3.4.1
2. Scroll down the list of experiments and click to select the experiment that has the sample name that you want to change. 3. Scroll to the Sample field for the selected experiment and change the contents of that field, as wanted. Warning Again, do not change any other fields or you risk corrupting the database. If you think you may have accidently modified another field, click Back in your browser and do not press Save.
Version 3.4.1
4. When you are done changing the Sample name, click the Save button in the lower-right corner. 5. Go back to the Data tab run reports listing in the Torrent Browser, and you should immediately see that the sample name is changed.
Version 3.4.1
Change the Run Date

Use Cases
Change the Run Date Occasionally, the PGM or Proton sequencer cannot get a date/time from the internet time server. When this occurs, the sequencer date is set to January 1, 1969. The date of the run is encoded in the folder name, which is parsed and used as the Run Date in the database. This causes the new run to be displayed with the incorrect date. With a date of January 1, 1969, the run is the last item on the last page of run reports listings in the Data tab. Use the following procedure to change the date for this run: 1. In the Torrent Browser Config tab, click Admin Interface and login, if prompted. 2. Click to open the Experiments database item for modification:
Version 3.4.1
3. Find your run in the experiment name list. The list is sorted by date, starting with the newest runs in the database. Because the run from 1969 is at or near the end of the list, it is convenient to re-sort by date, in ascending order (oldest at top). Re-sort by clicking the Date column heading:
Version 3.4.1
4. Click the ExpName for your run to select it and display the following run information:
Version 3.4.1
5. Use one of the following two options to change the date: a) Click the Today and Now buttons to set the Date and Time values to the current date and time in one click.
The automatic method is recommended because it places this run at the top of the run report lists, in both the Data > Completed Runs & Reports tab and the Data > Projects > projectname tabs.
b) Manually edit the date/time strings. 6. Click Save, on the bottom right to save the new date:
Version 3.4.1
7. Return to the Data tab when done. Contents Introduction Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Determine the Fault Cause Restart a Run Terminate an Analysis Run Work with Files Work with the Database Change the Report Name Change the Sample Name Change the Run Date Add or Change a PGM or Proton Change Your Torrent Browser Password
Add or Change a PGM or Proton

Use Cases
Add or Change a PGM or Proton Sequencer Do not add or change a PGM or Proton sequencer through the Site administration Rigs configuration item. During initial setup, Ion sequencers automatically register themselves with the Torrent Browser. Changes to a PGM or Proton sequencer are also communicated directly to the Torrent Browser.
Version 3.4.1
Never delete a Rig using the Site administration Rigs configuration item. That action could corrupt the database.
The Site administration Rigs configuration item is not to be used:
Refer to Manage Sequencer Settings from the Torrent Browser to configure a PGM or Proton sequenc er from Torrent Browser.
Version 3.4.1
Change Your Torrent Browser Password

Use Cases
Change Your Torrent Browser Password It is possible for a user to change the UI password and lock themselves out of the Torrent Browser Admin screen, or locked out of the Torrent Browser UI altogether. The UI password is stored in a database field. When you access to the database, you can change the password.
Method one
The first way to change a username with minimal terminal interaction is to create a new super user account. 1. Run the following commands:
cd /opt/ion/iondb ./manage.py createsuperuser
2. Once the new superuser account has been created, login to the admin page with the newly created username and password. 3. Select the user section under Auth:
Version 3. 3.4.1
The Auth section does not appear if you login with an ionuser account. 4. Select the account you want to change the password for:
5. Click Change password form:
6. Enter the new desired password and click Change Password:
Version 3.4.1
Method two
Step 1: Login to the database
Log into the torrent server and get an interactive postgres database command prompt
ionadmin@my-torrent-server:~$ psql -U ion -d iondb psql (8.4.5) Type "help" for help. iondb=>
Step 2: Display the user list
In our example, the user ionadmin forgot the password, but we know the ionuser password. This command provides a list of users and passwords
iondb=> SELECT username, password from auth_user; username | password ----------+----------------------------------------------------ionuser | sha1$7e254$476582a5fa365cdd6081a80ac161c1904cc9c374 ionadmin | sha1$93099$b7da0df453d8db1c7715cabef9651c73003de849 ion | sha1$7798b$c025c463682f84b66cf3b5168356a04e3ce3b899 (3 rows)
Step 3: Copy the password from another user
The passwords are hashed in the database, so we do not know what the actual password is. But we know the ionu ser password is ionuser, so we can copy that hashed password to ionadmin, and that will change the ionadmi n password to ionuser. WARNING The UPDATE command modifies the database. Do not proceed with this step if you are not comfortable with SQL commands
iondb=> UPDATE auth_user set password='sha1$7e254$476582a5fa365cdd6081a80ac161c1904cc9c374' where username='ionadmin';
Step 4: Check that the password has been changed
Query the database one again to verify that the password has been changed. See that ionadmin and ionuser no w have the same password
Version 3.4.1
iondb=> SELECT username, password from auth_user; username | password ----------+----------------------------------------------------ionuser | sha1$7e254$476582a5fa365cdd6081a80ac161c1904cc9c374 ionadmin | sha1$7e254$476582a5fa365cdd6081a80ac161c1904cc9c374 ion | sha1$7798b$c025c463682f84b66cf3b5168356a04e3ce3b899 (3 rows)
Step 5: Reset the password
Now you can log in via the UI as ionadmin, and reset the password. Remember to change the password via the C hange password form. Contents Introduction Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Determine the Fault Cause Restart a Run Terminate an Analysis Run Work with Files Work with the Database Change the Report Name Change the Sample Name Change the Run Date Add or Change a PGM or Proton Change Your Torrent Browser Password
Use DNA Barcodes with the Ion Sequencers

Use Cases
Use DNA Barcodes with the Ion Sequencers

Overview The Torrent Suite supports barcoded runs, which allow you to process multiple barcoded samples in a single run on the Ion PGM or Proton sequencer.
Version 3.4.1
Torrent Server comes pre-installed with several DNA barcode sets, ionSet1, ionXpress, ionXpressRNA, MuSe ek_5prime_tag, and RNA_Barcode_None. These barcode sets are available for use on the Ion PGM and Proto n sequencers. A barcode run on the Ion sequencer requires a sample-prep kit such as the IonSet1 or Ion Xpress barcode adapter kits. You select a DNA barcode adapter kit when you set up your Ion sequencer run. The barcode sequences for the IonSet1, Ion Xpress, and Ion Xpress RNA barcode adapter kits are included with the Torrent Server software. This barcode set information is used during analysis to separate out reads by barcode, to remove the barcode and adapters from the read, and to output reads by barcode into BAM files. Reads are aligned against the reference genome, and the results stored in BAM and BAM index (BAI) files for each barcode. Reads that can not be classified as being one of the barcodes in the designated set are grouped into a "no-match" group, and alignment against the reference also performed on this group. The new barcode results files are availabe in the run report File Links section. Alignment metrics for each barcode are available in the run report page for the given run. You can add additional DNA barcode sets using the Torrent Browser Admin gear menu References option:
See Manage DNA Barcodes and DNA Barcode Sets, which describes how to do the following: View barcode sequences. Add and delete your own DNA barcode set. Add and delete individual barcodes of your DNA barcode sets. Workflow The standard workflow for a barcoded sample is similar to a normal Ion PGM or Proton run and analysis. This section provides an overview of the workflow, with the new steps involved on a barcode run.
Summary of the recommended workflow
Here is an overview of the recommended workflow for a barcode run. Screenshots and more details are provided below. 1. Create a template for your runs in the Plan tab Template page. In the template wizard Kits page, select one of the available barcode sets from the drop-down Barcode Sets menu, and fill out the other run information (the same information as entered on the Ion PGM Run Info screen). Save your template. 2. When you have the actual sample name, click the Plan Run button for your template. Enter you run name
Version 3.4.1
2. and sample name, then click Plan. 3. The Torrent Server assigns a name to your planned run, and generates a retail-style scannable barcode image representing your planned run name. Your run information is stored on the Torrent Server as a planne d run until you are ready to start the run on the Ion PGM sequencer. 4. When you are ready to start the run, on the Ion PGM Run Info screen you select your run from a list of plan ned runs. The Torrent Server populates the Ion PGM Run Info with the information you entered in the Planning tab. (You may optionally change information on the Run Info screen.) 5. You start the Ion PGM run as usual. 6. When the run and report are complete, you can review the performance of the barcoded reads in the default report page. The following additional barcode-specific files are available for download from the File Links download section: A zip of BAM and BAM index (BAI) files for each barcode A csv-style spreadsheet summarizing the barcode performance for each barcode
Set up your barcode run in a Plan tab template
The same steps apply to a planned run (which is created from a template). For information on templates, including application groups and the template wizard, see the following: Introduction Plan Tab Templates Template and Planned Run Wizard Follow these steps to set up your barcoded run information in a template: 1. Click the Plan tab > Template page, click the Add New Template button for the application group appropriate to your experiment. 2. The Template wizard opens:
Version 3.4.1
3. Select the correct application group and click the Next (Kits) button. 4. On the Kits page, click the Barcode Set menu. Select the barcode set that corresponds to your barcode kit.
Version 3.4.1
5. Click the Next button and complete the rest of the wizard. On the last page, click Save. 6. Your new template appears in the Data tab Templates page, in the application group you selected.
7.
Version 3.4.1
7. To run on the Ion sequencing instrument, create a planned run from your new template. Click the Plan Run li nk for the template you just created.
8. The planned run wizard opens, in the wizard Plan page. Enter a descriptive run name and enter the sample name for each barcode you wan to use Click the Plan Run button to save and finish. 9. The Planned Runs page opens with your planned run at (or near) the top of the table:
The Torrent Server assigns a short code name to your planned run. The example short code here is 67HYE.
See the User Interface Guide Plan Tab page for more information about creating templates and planned runs.
Start your planned run on the Ion PGM or Proton sequencer
This section describes how to go from a planned run to an actual run on the Ion PGM or Proton sequencer. You must first create a planned run, as described in Set up your barcode run in a Plan tab template, before using the instructions in this section. 1. Open the Run Info screen on the Ion PGM sequencer. 2. Click on the Browse button (near the middle of the screen, to the right of the Planned Run field).
3. The Planned Run pop-up opens with a list of available planned runs. Your planned run is identified by short code and plan name (as listed under the Plan tab). Select your run and click OK.
Version 3.4.1
Your selection appears in the Planned Run field:
The Ion PGM Sequencer Run Info fields, including your barcode set, are populated with information from your planned run.
Version 3.4.1
If required, you can manually update any Run Info fields now. 4. Click Next --> to start your Ion PGM Sequencer run, as usual. Approve your run on the confirmation screen.
When you accept the confirmation screen, your planned run information is deleted from the Data tab Planned Runs page. If you terminate your Ion PGM Sequencer run and at a later time want to start the run, you must either enter the run information on the Ion PGM S equencer Run Info screen or re-create the planned run again under the Torrent Browser Planning tab. The new planned run has a different short code.
Other methods to import your planned run
This section describes the ways to import your planned run information into the Ion PGM Sequencer Run Info screen. These are all done on the Ion PGM Sequencer Run Info screen, and are all different ways to populate the PGM Sequencer Run Info screen with the run information previously entered in the Planning tab.Choose the method which best fits your work environment.
Planned run Browse button
The planned run Browse button is described in Start your planned run on the Ion PGM or Proton sequencer: click Browse and select your planned run from the pop-up list.
Planned run run code
Version 3.4.1
You can type the run code for your planned run into the Planned Run: text field. An example run code is ITHWQ.
A run code is assigned to your planned run when you enter the run information in the Plan > Template page planned run wizard and is listed in the Plan > Planned Runs page.
Barcode reports and output files
This section describes output and reports for barcode runs. The barcode reports section appears at the top of a run report for a barcode run and shows key performance metrics for each barcode in the run. The category named "No barcode" contains barcodes that could not be matched to known members of the barcode set being used.
The BAM and BAI links in the barcode report download files for only that barcode.
The Output Files section of the Torrent Browser run report includes barcode-related results files available for download. The links in the Barcodes row download zipped files of all barcodes for the run. The data in the Reads column are before alignment.
File Type
Description
Version 3.4.1
Barcode-specific Library Alignments (BAM and BAM Index)
Binary Sequence Alignment/Map (BAM), is a compressed, binary form of the SAM file. The BAM index (BAI) file speeds up the access time for a coordinate-sorted BAM file. The BAM and BAI files for each barcode are zipped together.
The SFF and FASTQ file formats are not produced by the default analysis pipeline. See SFFCreator and FastqCreator Plugins and Technical Note - Transition from SFF to BAM format.
Plugin Support for Barcodes
The following plugins supports barcode libraries. See Run the Installed Plugins for information on these plugins: Coverage Analysis Torrent Variant Caller
The following plugin does not support barcode libraries: Alignment Related Information The following pages also discuss barcode usage, reports, and manipulation: Manage DNA Barcodes and DNA Barcode Sets describes how to manage individual barcodes and barcode sets using the Torrent Browser Admin References tab. The User Interface Guide Plan Tab describes how to create templates and planned runs for your experiments. Run the Installed Plugins includes example barcode output for plugins.
Version 3.4.1
Reanalyze with a Different DNA Barcode Set

Use Cases
Reanalyze with a Different DNA Barcode Set
If you choose the wrong DNA barcode set or forget to select a DNA barcode set during run planning, these instructions help you select the correct barcode set and reanalyze the run. Follow these steps to change the DNA barcode ID: 1. Open a run reports listing in the Data > Completed Runs & Reports tab. 2. In the list view, click the Edit button on the right side of the run listing:
In the table view, click the gear menu on the right side of the run report listing and click the Edit option:
Version 3.4.1
3. The Edit Run window opens:
Click the barcode menu pull-down and choose the correct barcode set. If you have custom barcode sets, your list is different: 4. Click the Save button (in the bottom right corner). You can now reanalyze the run from the Data > Completed Runs & Reports tab.
Version 3.4.1
Scan Your Sequencing Kit
Use Cases
Scan Your Sequencing Kit
Scanning sequencing kits is a part of the Personal Genome Machine (PGM) and Proton instrument setup workflow. The Torrent Browser template wizard (under the Plan tab) also supports specifying the sequencing kit when you create a template or a planned run. Here is an example of the kit scanning page and keyboard during the PGM system setup:
Version 3.4.1
Scanning the sequencing kit is preferred to selecting a checkbox, because scanning provides more detailed kit information that can be used for troubleshooting or other purposes. The choice of sequencing kit affects the nucleotide flows on the Ion sequencer. The template wizard Enter the sequence kit in the Torrent Browser template wizard, under the Kits chevron:
Version 3.4.1
The visual reminder in the planned run helps prevent error on instrument. Contents Introduction Realign Run to Different Reference Genome Reanalyze with a Different DNA Barcode Set Use DNA Barcodes with the Ion Sequencers Scan Your Sequencing Kit Handle a Failed Analysis Run Determine the Fault Cause Restart a Run Terminate an Analysis Run Work with Files Work with the Database Change the Report Name Change the Sample Name Change the Run Date Add or Change a PGM or Proton Change Your Torrent Browser Password
Version 3.4.1
Technical Notes and Whitepapers

Torrent Suite Technical Notes and Whitepapers
Welcome to the Torrent Suite User Documentation Technical Notes and Whitepapers Page. Contents Technical Note - Analysis Pipeline Technical Note - Base Recalibration Technical Note - Filtering and Trimming Technical Note - Quality Score Technical Note - TMAP Alignment Technical Note - Transition from SFF to BAM format White Paper - Torrent Variant Detection Algorithms
Technical Note - Analysis Pipeline

Technical Note
Torrent Server Analysis Pipeline
The Analysis Pipeline is the primary software used to process raw Personal Genome Machine (PGM) and Proton sequencer acquisition data to produce read files containing high quality bases. This document provides an overview of the software modules and concepts applied at various stages of the data processing. Introduction
The Torrent Server Analysis Pipeline, the "Pipeline", processes raw acquisition data from a PGM or Proton seq uencer run, and outputs base calls in unmapped BAM file formats. The Torrent Browser provides a web interface to the process, including many metrics, graphs, and reporting features derived from the Pipeline results. The following figure shows a conceptual overview of the Pipeline:
The following sections provide additional, detailed information about the Analysis Pipeline modules that work together to convert the raw acquisition data into high-quality base calls and reads.
Version 3.4.1
Background
Although the focus of this document is on the analysis pipeline itself, a few concepts are presented here for review. During a PGM or Proton sequencer run, for each nucleotide flow, one acquisition file is generated. Each acquisition file contains the raw signal measurement in each well of the chip for the given nucleotide flow. So each acquisition flow, for an Ion 314 chip, contains roughly 1.5 million separate incorporation events. A series of such acquisition files represents the roughly 1.5 million possible reads. The analysis pipeline converts these raw signal measurements into incorporation measures, and ultimately into base calls for each read. The raw measurements are the conversion of the raw pH value in each well into a voltage converted into a digital representation of that voltage. This measurement over the entire chip occurs many times per second. Analysis Pipeline Modules
The following figure shows the high level modules within the analysis pipeline. Each module accepts specific inputs and produces specific outputs, described in more detail, below.
DAT Processing
The DAT processing module deals directly with raw acquisition files (acq_*.dat). The following figure shows an Ion 314 chip heat map, which indicates percent loading across the physical surface:
Version 3.4.1
DAT processing performs the following functions: Raw acquisition data loading into memory. This includes decompressing the data files. Data is compressed when it is streamed off the PGM or Proton sequencer: An optional dynamic frame rate compression mode whereby various portions of the incorporation event throughout the nucleotide flow duration are captured at different frame rates. The variable frame rate permits biologically specific events to be captured with high resolution while averaging multiple frames where appropriate, giving a reduction in overall file size. A compression approach may use a keyframe/delta compression technique whereby an initial value is stored, followed by the changes in that initial value, rather than storing the actual value each time. This results in a nearly 2x reduction in file size. Raw measurement offset corrections. Raw acquisition data are stored using the values output by the chip. Each well has its own reference value, and to compare well to well, the two wells may use a common reference. The offset correction takes the average of the first few frames within each acquisition file and subtracts that value from each well, thus permitting well measurements to have a common reference value. Pinned well identification. Due to the nature of the chip output voltages, a range of values exists for any given chip. The PGM and Pro ton sequencer calibration code brings the majority of wells within range of the hardware analog to digital converters. The output is a distribution of values centered around the center voltage. Wells that reside outside a selected distribution are considered "pinned" (functional wells outside of the range of the Analog to Digital Converter (ADC)). These pinned wells typically represent fewer than one percent of the total available wells. Excluded Wells. Various flow cell configurations often make tradeoffs on flow velocity profiles and chip coverage areas. For the Ion 314 chip, for example, a percentage of the wells are covered by the flow cell and are not fluidically addressable. A mask is loaded, per chip type, to mark those wells as excluded so they do not complicate down-stream processing of the chip. Default Sequencing Keys and Flow Order The next part of the classification module involves identifying particle wells as test fragments (TF) or library fragments. To understand this part of the algorithm, the concept of "keys" and flow order must first be understood. The following table shows the default library and TF sequencing keys in both base-space and flow-space for the default, TACG, flow order: Base-space Library Key TF Key TCAG ATCG Flow order TACG vector 1010010X 0100101X
Version 3.4.1
The "X" in the vector column indicates that the value is at least a one, but could in fact be higher because the next base after the key could also match, thus creating a longer homopolymer.
Classification
Classification is the process of determining the contents of each well on the chip. The primary purpose of classification is to determine which wells contain particles with template for sequencing and which wells are empty for use in background estimation during signal processing. The figure below illustrates the nested classes of classification.
A well can either be empty, contain a particle or be flagged as an outlier. Wells are flagged as outliers if they do not appear to be responding appropriately to the nucleotide, are not fitting the model well or are wells marked empty that appear to be buffering. For wells containing a particle, the process additionally determines if the particle is: A library particle. A test fragment (control) particle. A dud particle (a particle that does not produce a sufficiently strong sequence signal). It is important to note at this point that classification is not simply processing the entire chip as one group. As is mentioned for other pipeline modules, the chip is processed in smaller regions. An Ion 314 chip, for example, is divided into on the order of 50x50 well regions, resulting in about 625 total regions. This enables processing many small regions in parallel and taking advantage of multi-core/multi-process compute nodes that have such capabilities. More importantly, regions in the chip are processed that contain fluidically similar wells, where smaller regions tend to be relatively homogeneous and facilitate comparing wells to each other within a region. Key Classification Each well is checked to see if it is producing sequence that matches any one of the keys. A model is fit and the key with the best fit is assigned to that well. If no key has a high enough score then the well is not assigned to the live classification and will not be processed downstream. With the default keys and flow order, above, there are two vectors in flow space:
Nuc Flow: TACGTACG Library: 1010010 Test Frag: 0100101
Each key is tested to see if it fits the expected behavior of similar signals in the 1mer flows and no signal in the 0mer
Version 3.4.1
flows. Note, as mentioned above for these keys, the last 'G' flow is not used in the model fitting. There could be another G following in the template sequence which would mean that in some cases the incorporation may be a 2mer, 3mer, etc. and not fit the model. A key must have at least two 1mer flows and two 0mer flows to be valid for sequencing. Mask The output of the classification module is a mask object (and file as bfmask.bin) that contains bit flags for each well, indicating the contents of each well.
Signal Processing
The signal processing module focuses on wells containing particles, which is now using the mask information in addition to the raw acquisition data. The following figure shows a conceptual representation of the signal measured in a well during an incorporation event.
This signal has additional components, referred to as "the background". This background part of the signal is present during each flow and can vary over time, across the chip, and during an acquisition. The signal processing problem can be thought of as having two parts: The first part involves deriving the background signal that would have been measured in a given well, had no incorporation occurred. The second part involves subtracting (or fitting) the background signal and examining (or fitting to) the remaining signal. The output of the incorporation fitting model produces the estimate of the incorporation at each nucleotide flow for each well. At this point, the output from the analysis pipeline is a raw incorporation signal measure per well, per flow, stored as a 1.wells file.
Basecalling
The basecaller module performs phasing parameters estimation, signal normalization, and determination of base calls and quality values for each well. Basecaller is equipped with a generative model of phasing that allows it construct an artificial, expected incorporation signal for any base sequence. The generative model requires knowledge of model parameters that are obtained during the phasing parameter estimation stage preceding basecalling. The goal of basecaller is to determine the most likely base sequence, i.e., the sequence for which the expected incorporation signal best matches the observed incorporation signal stored in 1.wells file. Once the most likely sequence is found, any remaining difference between expected and observed signals influences the assignment of quality values. The results of basecalling, after the additional steps of filtering, trimming, and barcode classification, are stored in unmapped BAM format. Additionally, the basecaller must normalize the observed incorporation signal for best fit to the predicted signal.
Version 3.4.1
Phasing parameters estimation The three parameters controlling the generative signal mode are carry-forward (CF), incomplete extension (IE), and droop (DR). CF and IE control the rate of out-of-phase polymerase buildup, while DR measures DNA polymerase loss rate during a sequencing run. The chip area is divided into 64 regions, each of which receives its own, independent set of estimates. In each region, wells are divided into two groups, "odd-numbered" and "even-numbered". From each of these groups, approximately 5000 training wells are selected, and used to find optimal CF, IE, and DR via Nelder-Mead optimization algorithm. To prevent estimation bias, CF, IE, DR estimates obtained from a sample of "odd-numbered" wells are used to basecall (solve) all "even-numbered" wells in the same regions, and vice versa. Once obtained, all 64 x 2 sets of parameter estimates are passed to the solver. Solver The solver uses the measured incorporation signal, the phase estimates, and the droop estimates to determine the most likely base sequence in the well. The solver achieves this by repeatedly constructing predicted signals for partial base sequences and evaluating their fit to the measured signal. The predicted signals are generated by a highly efficient dynamic programming algorithm. These signals are further used by the solver to perform a branch-and-bound search through the tree of partial base sequences. The solver keeps a list of promising partial sequences. At each step, it selects the most promising sequence and extends it by one base into four new longer partial sequences. These new candidates are checked against a set of fit criteria, and those that pass them are added to the list. The list size is limited and the excess sequences are discarded based on a fit heuristic. When none of the entries on the list yield a better fit than the best sequence examined thus far, the tree search concludes. Normalization The solver expects that in absence of phasing and droop, the measured signal for flows incorporating a 1-mer is very close to 1, and for non-incorporating flows very close to zero. In practice, the measured incorporation signal can deviate from this assumption by an additive offset and a multiplicative scaling that slowly varies with the flow number and is different for each read. This is addressed by normalizing the signal before it is passed to the solver. Before the first execution of the solver, a key normalization preliminarily scales the measurements by a constant factor. The factor is selected to bring the signal of the known expected 1-mers produced by sequencing through the key as close to unity as possible. Once the solver has guessed a sequence, the corresponding predicted signal is leveraged for adaptive normalization. Adaptive normalization compares the predicted signal to the measured incorporation signal to fit the flow-varying additive and multiplicative terms, and subsequently generates an improved normalized signal with the distortion removed (or at least reduced). Adaptive normalization is invoked iteratively with the solver for several rounds, allowing the normalized signal and the predicted signal to converge towards the best solution.
Read Filtering and Trimming
Version 3.4.1
Read filtering involves generation of various quality metrics for each base call, quality metrics for each read, and using those metrics to filter out low quality reads and trim reads back to acceptable quality levels. Additionally, adapter trimming is performed on the ends of each read. See: Technical Note - Filtering and Trimming Technical Note - Quality Score Per-base Quality Scoring Per-base quality scores are assigned to each read, and written to the unmapped BAM file along with the read itself. The per-base quality scores are assigned by calculating various metrics for the read and using those metrics as lookup indexes into a pre-defined quality lookup table established through prior system training. The metrics often involve estimates of accuracy at the current base, flow, and earlier or later bases or flows for each read. Filtering Filtering reads involves calculating an overall quality metric representing the basecaller capability to accurately correct and base call the raw signals. Reads that have calculated low quality are not written to the unmapped BAM file. Low quality reads are typically mixed reads or very low copy-count reads that produce low quality sequence such that they do not fit the expected incorporation model. Quality and Adapter Trimming Using processing algorithms, a read can be trimmed back until an acceptable level of quality persists for the entire read. A read is also examined to determine if the B-Primer adapter sequence or a portion thereof can be identified with high confidence within the read. If a matching sequence is found, the read is trimmed to the base immediately prior to the start of the adapter.
Alignment QC
The alignment QC stage involves alignment of reads produced by the pipeline to a reference genome, and extracting metrics from those alignments. Currently, the TMAP aligner is used to align reads. As inputs to the aligner, some or all of the reads produced in the pipeline are used, along with the reference genome and index files. The output is a BAM file. This output BAM file is processed to extract various quality metrics, including estimates of Q20 bases, estimates of number of reads at or above 100Q20. The results of the Alignment QC module are viewable using the Torrent Browser web interface in the Reports summary page. The key output component is the BAM file. Data Files Produced
See Quickstart On Dataflow for a listing of the files output at each stage or module, along with their expected size for typical runs.
Technical Note - Base Recalibration

Technical Note
Base Recalibration
Version 3.4.1
Base recalibration is a process to improve base calls by relearning the homopolymer flow signal distribution from the alignment of a fraction of library reads. Base recalibration applies the learned rules to make flow signal adjustments and improve subsequent base calls. Learn the homopolymer flow signal distribution After an initial round of regular base calling, a random sample of up to 2 million reads is taken and aligned to the reference genome. The alignments are post-processed to determine the joint distribution of true homopolymer length and observed flow signals for each nucleotide. These distributions are determined separately for four quadrants on the chip, and for two bins of flows (the first half of the flows make up the first bin, the second half makes up the second bin). The frequency table is further processed to generate final flow quality value (QV) table, which is then used for recalibration of all reads produced by BaseCaller. The flow QV table contains observed flow QV and homopolymer length for each flow signal. For a given flow signal, a list of homopolymers are observed with frequencies of Ci, , and Cj, where i and j represent homopolymer lengths. The flow QV is is logarithmically related to the homopolymer-calling error probabilities and is defined as -10 * log10(1- Cn / C), where Cn is the maximum, C i s the total of frequencies, and n is the assigned homopolymer length. This graph shows the flow QV distributions of four nucleotide types.
The flow QV table has 32 sets of QV and homopolymer distributions, corresponding to the 4 nucleotide types, 4 regions out of 2-by-2 chip spatial stratification, and 2 equal partitions of flows. The difference between barcoded and non-barcoded runs is illustrated below:
Version 3.4.1
Read Recalibration In pyrosequencing, basecalling is constructed from homopolymer calls of all nucleotide flows. During the flow signal distribution learning process, it is possible that some population of flow signal might under-call homopolymer and another population of flow signal could over-call homopolymer. Any under-calling or over-calling changes the derived basecalling. In the flow QV table, learned homopolymer lengths might be different from originally-called lengths for a population of flow signal, where new HP length and base calling would be produced. The flow signals and predicted base quality scores need to be modified to satisfy newly-called homopolyers (for example, an original 6 mer T at flow signal 649 is recalibrated as 7 mer T, and it is illegal to have a 7 mer T that has flow signal of 649). The predicted base quality score adjustment is done by simply ensuring production of the same number of quality scores as the number of recalibrated base calls. In the case of a deletion, the first predicted quality score is removed; in the case of an insertion of a longer homopolymer, the last quality score of the homopolymer is copied; and in the case of insertion of a new 1-mer, the flow QV is used. For flow signal adjustment, the flow signal boundary (FSLeft and FSRight) of each homopolymer is identified from flow QV table. The corrected flow signal is defined as 98 * (fs - FSLeft) / (FSRight - FSLeft) + HP * 100 49, where H P is the calibrated homopolymer length and fs is the reported signal. It is possible for recalibration to produce illegal flow sequences where positive flow is called at a later flow, while no other positive flow is called in between (Case 1 in the table below) or same positive flow is called in a row (Case 2). A linear algorithm is developed to identify potential illegal flows due to recalibration and these flows are skipped during recalibration. Case 1 Flow order CGTCTGAG Original flow signal: 0, 100, 0, 0, 49, 0, 100, 0 Calibrated flow signal: 0, 100, 0, 0, 51, 0, 100, 0 Implementation
Case 2 Flow order CGTCTGAG Original flow signal: 0, 100, 100, 0, 49, 0, 100, 0 Calibrated flow signal: 0, 100, 100, 0, 51, 0, 100, 0
Version 3.4.1
Base recalibration is implemented as part of the Base Calling module and is enabled by default if a reference library is associated with the run. For any given run, recalibration can be disabled by unchecking the Enable Base Recalibration box in the advanced section of the analysis launch page:
Performance Because the recalibration involves alignment, the run time is dependent on the complexity of reference library. Performance from runs aligning with hg19 is shown in this table: Chip type Reads count (Million) Reads sampling time (Min) Base alignment time (Min) Flow alignment time (Min) Reads recalibration (Min) Total time (Min) Ion 314TM Chip 0.63 NA Ion 316TM Chip 2.11 NA Ion 318TM Chip 5.73 4.1
5.5 2.5 1.1 9.1
15.2 6.4 3.8 25.4
14.8 6.2 9.8 34.9
Base recalibration significantly improves the accuracy of longer homopolymers, as shown in the following figures: Original, before recalibration:
Version 3.4.1
After recalibration:
The following table shows the improvement of mapping throughput and overall sequencing error of a typical Comprehensive Cancer Panel run on the Ion 318 Series Chip: Original, before recalibr ation AQ17 (MB) Q20 (MB) Q47 (MB) Error rate (%) 539 479 423 1.096 After recalibration Percent change
552 501 447 0.871
2.38 4.61 5.73 -20.5
Version 3.4.1
Summary
Base recalibration remeasures the homopolymer flow signal distribution from a sample of reads. This process adds to the reanalysis runtime (from about 10 to 35 minutes on PGM runs), but improves mapping throughput and the accuracy of long homopolymer calls, while reducing the overall sequencing error rate.
Technical Note - Filtering and Trimming

Technical Note
Trimming and Filtering
The Ion Torrent system applies some quality checks to sequence reads before writing them out. Reads are tested to see if they are possibly the result of mixed DNA templates on an Ion Sphere Particle (ISP) in a given well, or if they are generally of low signal quality. The 3' ends of reads are scanned for matches to the adapter sequence and for regions of trailing low quality. Only the high-quality portions of reads passing through these checks are written out to the unmapped BAM file. Introduction When processing data from the Personal Genome Machine (PGM), the identification and removal of low-quality or uncertain base calls is an important consideration for delivering accurate results. In the Torrent Suite analysis software, low-quality bases are removed from the output by: Trimming low-quality 3' ends of reads. Filtering out entire reads. The operations described in this document are applied as post-processing operations after the initial base calls have been determined. Trimming The goal of read trimming is the removal of undesired base calls at the 3' end of a read. Such undesired base calls come from: High-quality base calls on reads that have read all the way through the library insert into the adapter. Low-quality base calls at the 3' end of the read. Three filters are applied to trim reads, targeted at each of the two categories of undesirable 3' bases. Each filter is applied separately and the read length is taken as the shortest of the three. If the resulting trimmed length is shorter than the minimum read length (four bases), the read is filtered out entirely. Otherwise the read is written to the unmapped BAM file.
Removal of Adapter Sequence
Version 3.4.1
Trailing adapter sequence is trimmed out by searching the read for candidate matches to the known adapter sequence in flow-space. If a read extends into the adapter, the 3' end of this phase-corrected ionogram exhibits a pattern that is characteristic of the adapter sequence. Adapter trimming is accomplished by testing each candidate position in the phase-corrected ionogram to see how well it matches the pattern expected for the adapter. The test computes the Euclidean distance between the phase-corrected ionogram at the tested position and the predicted ionogram for the adapter. If this distance falls below a fixed threshold, the corresponding position (translated from flow-space back to read-space) is recorded as the adapter trim location; otherwise, the read is considered not to have a match to the adapter. The threshold used is a Euclidean distance of 16. The 3' adapter sequence can be selected from a predefined list either during planning (Plan New Run / Kits / Library Kit Type Details / Forward 3' Adapter) or on Edit Run page. The predefined list contains adapter sequences corresponding to standard Ion Torrent library kits. Additional adapter sequences can be added to the list through Django Interface.
Removal of lower-quality 3' Ends with Low Quality Scores
The distribution of quality scores within Ion Torrent reads is such that the highest quality calls tend to occur at the start of the read where phase errors are smallest in magnitude. For reads that run into low-quality bases before reaching the end of the template, it is helpful to trim away the lower-quality calls at the 3' end. The quality trimming is performed using the per-base quality scores (see Technical Note - Quality Score). The approach is to scan along the bases of the read computing a moving average in a fixed-length window, and to set the read trim point to just before the earliest (5'-most) base at which the moving average of the per-base quality scores drops below a fixed threshold. The window size is set to 30 bases, and the threshold below which the trimming occurs is a quality score of nine.
Trimming based on High-Residual Ionogram Values
Phase-corrected ionogram values for 1-mers range from 50-149 and for 2-mers range from 150-249. We define an high-residual 1-mer as one with an intensity value between 50-59 or 140-149 and an high-residual 2-mer as one with an intensity value between 150-59 or 240-249. We require that the fraction of high-residual 1-mers and 2-mers does not exceed 3% within any read saved to the unmapped BAM file. Reads that do not satisfy this quality condition over the entire length, have their bases at the 3 end trimmed away, until the remaining bases satisfy it. If no amount of trimming can reduce the fraction of high-residual 1- and 2-mers below 3%, or the trimmed read is shorter than 4 bases, the read is omitted from unmapped BAM completely. Read Filtering The goal of read filtering is to remove reads that contain insufficient high quality library sequence. The fraction of reads filtered from the final output is reported in the ISP Summary.
Removal of Short Reads
The trimming process described above may potentially leave very few high quality bases in a read. Any read with trimmed insert length less than four base pairs is removed from the final output. All such reads are counted as Low Quality for purposes of the ISP Summary.
Removal of Adapter Dimers
Typically a small number of reads will consist of sequencing adapters with no insert, or with only a very short insert. Any read with an insert of less than four base pairs is labeled as an adapter dimer, and is removed from the final output. The fraction of such reads is typically less than 1%, and is reported as Adapter Dimer in the ISP Summary.
Version 3.4.1
Removal of Reads Lacking Sequencing Key
The first four bases of library reads are always TCAG. The first four bases of test fragment reads are always ATCG. Any read that does not match one of these two keys is removed from the final output. All such reads are counted as Low Quality for purposes of the ISP Summary.
Removal of Reads with Off-Scale Signal
If during any flow, a read records a signal that is off-scale, that read will be removed from the final output. All such reads are counted as Low Quality for purposes of the ISP Summary.
Removal of Polyclonal Reads
An Ion Sphere Particle is clonal if all of its DNA fragments are cloned from a single original template. All the fragments on such a bead are identical, and they respond in unison as each nucleotide is flowed in turn across the chip. Using the standard PGM flow order, about 44% of all nucleotide flows yield a positive signal from the chip. The data from the chip are normalized so that the 1-mers in the key yield a unit signal. 1-mers in the insert also yield a signal value of 1, 2-mers yield a signal of 2, 3-mers 3, and so on. Data for a clonal ISP from a 260 flow PGM run are shown below. Slighly more than half of the flows cluster around zero, and the rest are positive. The positive flows cluster around integer values. This pattern is most clearly seen for the earliest flows, before phase effects cause some templates to respond out of sync with others.
What happens if an ISP carries fragments derived from two distinct templates? The next figure shows data from such a bead. This bead harbors two distinct populations of clones. On some flows, only one of the populations responds with an incorporation. Since only half the templates are incorporating, a 1-mer now yields a signal value of about 0.5 instead of 1.0; a 2-mer yields a signal of 1.0, instead of 2.0. One strand may incorporate a 1-mer, and the other a 2-mer, yielding a signal of 1.5. A signal of 0 is still possible, if both populations fail to incorporate. But such 0-signal flows are less frequent than in the clonal case, accounting for only about 19% of flows. In summary, polycl onal beads exhibit more non-zero flows, and the signals no longer cluster exclusively around integers.
Version 3.4.1
It is also possible for emPCR to generate beads carrying fragments derived from a large number of library templates. Such beads are referred to as super-mixed. The signal from a super-mixed bead is shown in the next figure. Now almost all flows have non-zero signal, and the signal does not cluster around integer values at all.
These kinds of patterns can be used to identify polyclonal beads in software. Torrent Suite does this by computing two scores for each well. The first score is simply the percentage of flows that return a non-zero signal. Because of the possibility of noise in the data, only flows with a signal value greater than 0.25 are counted as positive. This score is computed for each bead for flows 12 through 72, and is referred to as percent positive flows (PPF). The second score captures the degree to which the signal clusters around integer values. For each flow, the difference between the signal and the nearest integer value is computed. This distance is squared, and the squared values are summed over flows 12 through 72. This score is low if the signal clusters around integer values, and higher otherwise. This score is referred to as the sum of squares (SSQ). The next figure shows a scatter plot of PPF vs. SSQ for a sample of 200,000 beads from a PGM run. Three distinct populations are evident in this plot. The high density group below and to the left of the other groups has the lowest values for PPF and SSQ. Analysis of a large number of PGM runs shows that beads from this cluster are typically clonal, and map well to identifiable reference sequence. The more diffuse group at the far right has the highest PPF and SSQ scores. This group includes super-mixed beads, and other beads that fail to produce high quality sequence. The third group has intermediate PPF and high SSQ, and lies between the other two groups. This group is typically composed of mixed-template beads that fail to map to identifiable reference sequence. In this PGM run, about 74% of beads fall in the clonal cluster, 21% in the mixed cluster, and 6% in the super-mixed cluster.
Version 3.4.1
The fraction of beads determined to be polyclonal is recorded in the ISP Summary. Contents Introduction Read Filtering Removal of Mixed-template Reads Removal of Lower Quality Reads Trimming Removal of Adapter Sequence Removal of lower-quality 3' Ends
FTTechNoteTOC
Contents Introduction Read Filtering Removal of Mixed-template Reads Removal of Lower Quality Reads Trimming Removal of Adapter Sequence Removal of lower-quality 3' Ends
Technical Note - Quality Score

Technical Note
The Per-Base Quality Score System
Version 3.4.1
Overview The Ion Torrent per-base quality score system uses a Phred-like method to predict the probability of correct base call. The prediction is based on the quality of the base incorporation signal that was used for generating the base calls. The Personal Genome Machine (PGM) and Ion Proton quality score system uses a set of 6 predictors whose values are correlated with the probability of a base miscall. A Phred lookup table is used for converting the values of predictors to error probabilities. The lookup table is generated by training on a representative data set in customer configuration. The lookup table is re-trained for each software release and is shipped as part of the software package. Quality scores are published in the BAM file. Quality Score Predictors Torrent software uses the following six predictors that are correlated with empirical base call quality: P1 Penalty Residual: A penalty based on the difference between predicted and actual flow values. Computed by the base caller. Local noise: Noise (defined as the maximum absolute difference between the flow value and the nearest integer) in the immediate neighborhood (plus/minus 1 base) of the given base. Beverly Events: Number of high-residual flows in the 20-flow window around the flow containing the base. A flow has high residual when the normalized difference between the observed and model-predicted signal exceeds 0.4 or falls below 0.4. The more high-residual flows in the window, the lower quality the base call. Multiple incorporations: Number of incorporated bases in this flow. Length of the homopolymer. For multiple incorporations of the same nucleotide in one flow, the last base in the incorporation order is assigned a value equivalent to the total number of incorporations. All other bases in the sequence of the multiple incorporations are assigned the value 1. Environment noise: The average signal noise (defined as the absolute difference between the flow value and the nearest integer) in the neighborhood (plus/minus 5 bases) of the given base. State Inphase: Live polymerase in phase.
P2
P3
P4
P5
P6
Ion Torrent does not provide support for customer-generated Phred tables.
Lookup Tables
Version 3.4.1
The six quality predictors are calculated for each base. Other predictors (not described here) are computed from the corrected flow values generated by the base caller. The corresponding per-base quality value is located by finding the first line in the lookup table for which all six calculated predictors are less than or equal to the predictor values in the table. This process occurs automatically as part of the standard analysis. The Phred lookup tables are stored in the /opt/ion/config directory on Torrent Server. The Torrent Server supports separate phred tables for each type of chip (Ion 314 chip, Ion 316 chip, Ion 318 chip, and Ion 900), named phredTable.txt_314, phredTable.txt_316, phredTable.txt_318 and phredTable.txt _900 respectively. Results The per-base quality along with all other read information is written to the unmapped BAM file. The per-base quality scores are reported in the QUAL field. The quality scores are on a phred -10*log_10(error rate) scale. References 1. Brockman et al. (2008): "Quality scores and SNP detection in sequencing-by-synthesis systems." Genome Res. 18: 763-770.References 2. Ewing B, Hillier L, Wendl MC, Green P. (1998): "Base-calling of automated sequencer traces using phred. I. Accuracy assessment." Genome Res. 8(3):175-185. 3. Ewing B, Green P. (1998): "Base-calling of automated sequencer traces using phred. II. Error probabilities." Genome Res. 8(3):186-194.
Technical Note - TMAP Alignment

Technical Note
TMAP: The Torrent Mapping Alignment Program for Ion Torrent
A mapping software program, called Torrent Mapping Alignment Program (TMAP), has been developed to meet Ion Torrent data mapping challenges. Background Sequence alignment is a critical component of any project utilizing next generation sequencing technologies. There are many options for alignment software, each optimized for specific sequencing platforms and downstream applications. The Ion Torrent data have particular qualities requiring special consideration during the alignment process: Reads generated by the PGM Sequencer are variable length and are expected to increase over time. The principal error mode associated with Ion data relates to miscalling homopolymer lengths and results in insertion or deletion errors during alignment and post-processing. TMAP is part of Torrent Suite on Torrent Server and is used for alignment in the primary analysis pipeline. The TMAP source code is available on the Torrent Dev community Web site under the GPLv2 license, and can be compiled on any standard *nix system for use outside the Torrent Server primary analysis pipeline. Implementation TMAP integrates three popular and one novel alignment algorithms: BWA-short (Li and Durbin, 2009)
Version 3.4.1
BWA-long (Li and Durbin, 2010) SSAHA (Ning et al, 2001) Super-maximal Exact Matching (Li 2012) These provide a fast and accurate aligner. The overall alignment strategy identifies a list of Candidate Mapping Locations (CMLs) using a subset of the above algorithms. These CMLs are then aligned using the Smith Waterman algorithm (Smith and Waterman, 1981). The resulting alignments are aggregated to find the best mapping(s), and a user-defined parameter determines if all alignments, a subset of alignments, or a random best alignment is reported. TMAP creates an efficient index using the compressed suffix array to quickly and compactly index and query the genome reference. Index creation occurs for both the forward and reverse references, which benefits some alignment algorithms, resulting in a final index size of 4.7GB for a human hg19 reference and taking less than four hours to create. For these evaluations, a Mac Pro running Mac OS X (10.6.6) with a dual 6-core Intel Xeon Processors (2.66GHz) and 32GB of 1066 MHz DDR RAM was used. Up to 24-threads could be used because of the hyper-threading capability of these processors.
TMAP implements a two-stage mapping approach to maintain sensitivity and specificity while significantly reducing runtime. In two-stage mapping, reads that do not align during the first stage are passed to the second stage with a new set of algorithms and/or parameters. The implementation also supports easy integration of other mapping algorithms that can utilize the TMAP index. Advantages TMAP has key advantages over other alignment tools: The re-implemented versions of BWA-short, BWA-long, and SSAHA are significantly optimized to deal with varied length reads and error profiles specific to Ion Torrent Systems. Therefore, TMAP results are expected to perform significantly better when compared against the original algorithms. When you run TMAP, you can use all the algorithms, a subset, or only one algorithm, for greater flexibility, efficiency, and accuracy. Because TMAP can combine the CMLs for all three methods and identifies the best alignment, the final accuracy and specificity benefit from the advantages of each individual algorithm. Nonetheless, each algorithm is optimized and can be used on its own. TMAP has been optimized for performance and, because the TMAP index is shared between all algorithms, the overall performance (both CPU load and RAM utilization) is comparable to other popular alignment software. The performance when combining multiple algorithms is equal to or better than the total performance of running each algorithm, separately. With a framework that quickly integrates other algorithms, TMAP is a versatile tool for fast and accurate mapping of Ion Torrent data. Best Practices The current algorithm recommended is map4. This algorithm runs quickly while maintaining a high degree of sensitivity and specificity. For maximum sensitivity and specificity at the cost of running time, utilizing all algorithms or a subset is recommended. For maximum speed, it is recommended to use the map4 algorithm with the stage opti on --stage-seed-freq-cutoff=0.1. References
Version 3.4.1
Li, H, Durbin, R (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformati cs, 25, 14:1754-60. Li, H, Durbin, R (2010). Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformati cs, 26, 5:589-95. Ning, Z, Cox, AJ, Mullikin, JC (2001). SSAHA: a fast search method for large DNA databases. Genome Res., 11, 10:1725-9. Smith, T. F. and Waterman, M. S. (1981). Identification of common molecular subsequences. Journal of Molecular Biology, 147(1), 195 197. Li, Heng (2012). Exploring single-sample SNP and INDEL calling with whole-genome de novo assembly. Bioinformatics, 28, 14:1838-1844.
Technical Note - Transition from SFF to BAM format

Transitioning from FASTQ/SFF to unmapped BAM
One of the changes in the update from Torrent Suite 2.x to Torrent Suite 3.0 is a transition from FASTQ and SFF to BAM as the principal format in which primary analysis results are delivered. The new file is sometimes referred to as unmapped BAM to indicate that it can still be produced in the absence of any reference genome. The mapping fields of the BAM are set to the usual defaults for unmapped reads. In the case of a reference genome being available, the mapping information is added to the BAM. In TS 3.0, the unmapped BAM file names have the extension *.basecaller.bam. The FASTQ and SFF formats are still provided in Torrent Suite 3.0 and 3.2. In Torrent Suite 3.4, the FASTQ and SFF files are no longer produced by default, though for backward compatibility both plugins and command-line tools are provided to make it easy to create FASTQ and SFF files on demand. Note, however, that although the SFF file that may be created on demand in Torrent Suite 3.4 has the same usual standard data format, the actual content of one of the data fields in that SFF file is modified as further discussed below. There are multiple reasons motivating the implementation of the previously-announced transition from SFF to BAM: Community-driven standard The BAM format is a community-driven standard that has become the format of choice for representing next-generation sequence data for multiple sequencing technologies. Delivering the data in BAM format will enable greater compatibility with current and future software tools. Native data compression BAM supports native compression of the data, SFF was not designed with compression in mind. An unmapped BAM from Torrent Suite 3.0 is typically less than half the size of the corresponding SFF file, though it contains more information. SFF format constraints The SFF format is rigid, there is no ability for it to adapt to improvements in the underlying sequencing technology that it represents. For example, an SFF file cannot be used for runs that incorporate multiple flow orders or multiple sequencing keys. Extensibility The BAM format is extendable. New kinds of information can be added to it without breaking existing parsers. Having the ability to record in the BAM file new kinds of data derived during primary analysis will enable current and future improvements in the analysis methods used in downstream applications such as variant calling improvements. In Torrent Suite 3.0 and 3.2, the unmapped BAM file is generated directly from the BaseCaller, and the SFF and FASTQ files are then generated from the unmapped BAM. In Torrent Suite 3.4, the SFF and FASTQ generation are removed from the default analysis pipeline, which has undergone significant changes. The BAM and SFF generated by Torrent Suite 3.0 and 3.2 store the same library insert flow values, bases, and quality scores that are available in the SFF from Torrent Suite 2.x, and all three would produce the same FASTQ file. There are some small differences in some of the auxiliary information available relating to 5-clipping and 3-clipping. In Torrent Suite 3.0 and 3.2, the corrected flow signals provided in the SFF and unmapped BAM correspond to previously-made base calls and include residual terms related to the closeness between actual measurements and measurements predicted for the base calls under a predictive model of phasing effects.
Version 3.4.1
In Torrent Suite 3.4, the corrected flow signal is no longer generated by the analysis pipeline. The flow signals formerly stored in the read data section of the SFF and the FZ tag of the unmapped BAM files are replaced by raw normalized signal values, which include phasing effects. The specific contents and relative differences are outlined in the table below. Data Type Flow order Key sequence TS-2.x SFF TS-3.0/3.2 SFF TS-3.0/3.2 unmapped BAM TS-3.4 unmapped BAM
Specified in global header Specified in global header In non-barcoded runs, or in composite SFFs in barcoded runs, key sequence is specified in global header. In per-barcode SFFs, global header contains combined sequences of key + barcode.
Specified in read group header's FO tag In non-barcoded runs, key sequence is specified in read group header's KS tag. In barcoded runs, KS tag contains combined sequences of key + barcode.
Flow values
Specified in read data section
The FZ tag stores the corrected flow signals for all flows, including those clipped away
Instead of storing the corrected flow signals, the new ZM tag stores normalized signals, which include phasing effects. Signal in ZM tag may be 3' clipped, but is guaranteed to include information about all saved bases (see Bases & Qualities below)
Flow index
Specified in read data section
Not directly available, but can be inferred from the flow order plus the ZF tag (which specifies the flow that generated the first base after the 5' clipped region)
Version 3.4.1
Bases & Qualities
Bases and qualities, including 5' and 3' clipped regions, are stored in the read data section
The read data section contains bases and qualities, including 5' clipped region but excluding 3' clipped region. The data for the 3' clipped region is excluded because in Torrent Suite 3.0 the SFF is derived from the unmapped BAM file and the BAM file itself does not contain the 3'-clipped data Base position of key + barcode clipping specified in clip_adapter_left field. Field clip_qual_left is unused and always equals zero. The clip_adapter_right and clip_qual_right fields are set to zero. This is because the 3'-clipped bases are not included in the SFF and specifying positions corresponding to bases that are absent from the SFF causes some downstream utilities to break.
The usual BAM fields specify the base calls and quality value for all bases surviving 5' and 3' clipping. Base calls and quality values for clipped regions are not stored directly. Base calls for clipped regions can be derived from the flow signals and flow order. Quality values for clipped regions are not available. Note: Content of these fields may be changed during alignment processing. If the aligner maps a read to the reverse strand, base sequence in the BAM file is reverse-complemented and qualities are reversed.
5' clipping data
Base position of key clipping is specified in clip_qual_left field. If barcode clipping was performed, its position is stored in clip_adapter_left field. Base position of 3' adapter clipping specified in clip_adapter_right field, base position of 3' quality clipping specified in clip_qual_right field
Not directly available, can be derived from the flow values, flow order, and ZF tag
3' clipping data
ZA tag specifies zero-based flow during which the first base of the adapter would have been incorporated. ZG tag specifies the number of insert bases (insert starts after the key and barcode, and ends before the adapter). For reads where 3' adapter trimming was more restrictive than quality trimming, ZG equals read length. As a result, the base position of 3' quality clipping is equal to the read length when the read length is less than the ZG tag, otherwise the base position of 3' quality clipping is only known to be greater than or equal to the read length. ZF tag specifies the 0-indexed position of the flow generating the first base after the 3' clipped region
Flow corresponding to the first base after the 5' clipped region
Can be inferred from flow index values
Version 3.4.1
Backward compatibility: creating FASTQ and SFF output

In Torrent Suite 3.4, FASTQ and SFF can be created either on the command-line or with a plugin. See above for some important differences in the interpretation of flow values stored in the SFF introduced in Torrent Suite 3.4.
Using the plugins
There is a plugin named SFFCreator that can be used to make SFF files. Click on the Select plugins to run button in the run report and select the SFFCreator plugin. Upon plugin completion, a download link appears in the plugin results section. There is a plugin named FastqCreator that can be used to make FASTQ files. Click on the Select plugins to run button in the run report and select the FastqCreator plugin. Upon plugin completion, a download link appears in the plugin results section.
Using the command line
SFF and FASTQ can be created directly from Ion Torrent BAM files (either mapped or unmapped) with the following commands, which are the same as those used in the plugin method: SFF can be created with the bam2sff command-line utility that is installed on the Torrent Server. Running the command with no arguments prints the usage information to the screen. Example of a typical call:
bam2sff -o out.sff in.bam

FASTQ can be created with a call to the SamToFastq tool that is part of the Picard package. Example of a typical call using the Picard version installed on a Torrent Server:
java -Xmx8g -jar /opt/picard/picard-tools-current/SamToFastq.jar I=in.bam F=out.fastq

Sample data
There are no significant differences in the headers of the BAM files produced by TS-3.2 and TS-3.4. Find below an example of a single alignment from a mapped BAM file converted into text SAM format, for each of TS-3.2 and TS-3. 4. In this example the two software versions have produced the same base calls, though that will not always be the case. The differences between the two entries are as follows: As usual, the read name differs in the initial 5-character hash, as every analysis run produces a unique base name for reads. The per-base predicted quality scores differ due to ongoing improvements made in the quality score prediction method used As noted in the table above, the corrected flow values provided by the FZ tag in TS-3.2 are replaced by raw normalized values provided by the ZM tag in TS-3.4. The flow values in the ZM tag include phasing effects.
TS-3.2
Version 3.4.1
97X4E:00028:00037 0 Amplicon11 1 92 86M * 0 0 GTTCCTCTGGGATGCAACATGAGAGAGCAGCACACTGAGGCTTTATG GGTTGCCCTGCCACAAGTGAACAGGTCCCAGCATGAAAG GGAGBFFEED?DDDDGAGNIIEDDDGDIDAABDEDBFII@BBF?FFF N?F?A@>5>77-5AA<BBCB@CBB?AAA=ADFFF777*7 XA:Z:map4-1 ZA:i:86 MD:Z:86 ZF:i:25 PG:Z:tmap RG:Z:97X4E.IonXpress_007 ZG:i:183 NM:i:0 AS:i:86 XS:i:-2147483647 FZ:B:S,100,1,95,1,2,96,0,108,205,87,0,100,0,0,0 ,1,113,1,105,106,196,95,96,106,109,96,209,0,202 ,1,0,0,101,0,95,0,98,3,0,315,6,0,2,0,102,1,7,0, 98,0,85,0,0,94,0,209,0,0,1,3,102,102,0,0,98,1,1 ,105,2,99,0,110,1,1,1,0,108,96,0,108,0,0,105,0, 0,100,6,101,0,94,0,0,118,93,0,106,8,96,85,0,106 ,8,7,97,4,0,13,0,96,205,113,2,293,0,10,98,99,0, 299,0,197,88,0,0,280,0,0,3,106,6,0,106,0,1,155, 20,1,0,3,2,97,0,108,191,2,1,101,2,101,9,111,197 ,0,0,0,1,112,108,196,5,99,0,278,0,2,104,7,102,0 ,100,0,5,103,8,10,0,100,6,103,255,11,0,96,97,10 2,4,0,0,111,104,9,178,4,0,10,88,0,110,99,5,92,0 ,0,86,8,0,273,86,107,5,6,107,0,8,90,100,9,93,0, 99,19,7,174,95,106,3,0,92,0,110,18,95,7,0,0,0,1 14,4,93,10,98,0,80,21,0,179,7,183,4,165,0,5,89, 78,16,78,9,83,71,24
TS-3.4
Version 3.4.1
LLPMG:00028:00037 0 Amplicon11 1 92 86M * 0 0 GTTCCTCTGGGATGCAACATGAGAGAGCAGCACACTGAGGCTTTATG GGTTGCCCTGCCACAAGTGAACAGGTCCCAGCATGAAAG CC@C@EBBCB?CDAAE@BCBBB?@BBBDB>@>@???BDC?CCCACDF F?@@;991111-1<<:ACDDBGBBA<<>;=DBBA88819 XA:Z:map4-1 ZA:i:86 ZB:i:30 MD:Z:86 ZF:i:25 PG:Z:tmap RG:Z:LLPMG.IonXpress_007 ZG:i:183 NM:i:0 ZM:B:s,260,2,244,2,2,244,2,270,498,220,2,248,2, 2,2,2,286,6,266,260,470,226,236,262,284,220,462 ,2,470,2,12,2,246,2,218,2,248,10,12,692,66,30,2 4,36,236,2,34,4,246,2,244,2,20,214,4,466,2,4,2, 12,252,266,2,14,222,30,2,230,36,216,2,264,2,2,2 ,2,270,238,2,260,2,2,256,30,2,214,48,216,2,198, 2,2,280,226,42,252,30,238,208,0,212,66,60,200,6 4,0,38,48,240,484,276,10,692,0,50,234,252,2,688 ,2,466,230,0,0,638,0,10,46,276,22,0,270,2,10,36 8,66,14,10,14,10,242,0,274,452,16,16,242,28,240 ,30,270,454,0,16,0,28,282,268,470,12,248,0,646, 16,16,254,48,240,0,226,0,10,258,28,34,0,252,24, 250,614,32,12,238,250,238,18,0,2,272,242,26,404 ,26,0,42,210,0,268,252,32,208,2,2,194,46,0,624, 192,268,16,28 ZP:B:f,0.0047309,0.00782546,0.0023048 AS:i:86 XS:i:-2147483647
White Paper - Torrent Variant Detection Algorithms

White Paper
Torrent Variant Detection Algorithms
This white paper describes algorithms developed by Ion Torrent for the detection of SNPs and small indels on the Ion Torrent Proton and PGM platforms. There are three core algorithms: one for SNP detection, one for detection of insertions and deletions (GATK-based), and one for long indels (assembly).
Version 3.4.1
SNP Detection
The SNP Detection algorithm takes as input a BAM file of aligned reads (for example, a BAM file produced by TMAP, the Torrent aligner), and tiles the genome (or subset of the genome defined by a BED file), evaluating evidence for a variant by looking at a pileup of the reads. Our SNP detection algorithm includes filters by read, base, frequency, and genome position, and it includes statistical modeling of data that passes the filters to evaluate the probability that a SNP exists at a candidate genome position. If the position passes the filters and there is sufficient evidence, it is called as a SNP and assigned a genotype and a p-value. Two methods based on statistical modeling are implemented for base-space SNP prediction: Bayesian and frequentist. The Bayesian method is currently only implemented for germ-line SNP detection and is most useful when coverage is low to medium (between 10-50). The frequentist approach is used for positions with higher coverage and can be used to detect low frequency variants for example, it is used by default for positions with filtered coverage greater than 60x. Some common filtering occurs before the algorithm. Common filters are the following: A read-level filter Removes reads with low mapping QV. A position-level filter Checks each position of the reference to see if there are enough reads mapped to an alternative allele. This filter is controlled by allele frequency (a user-defined parameter). A position-level filter Removes positions where the reads for the variants have significantly more strand bias than the reads covering the position. A base-level filter Removes bases of reads with poor base QV. Extreme strand bias in reads predicting a variant often results in false positive variant calls. To avoid these, we use a method called relative strand bias filtering. For a given genomic position, let Cp and Cm be the numbers of reads in the plus and minus strands that cover this position, and let Vp and Vm be the numbers of reads in plus and minus strands that match the variant. The relative variant strand bias is defined by:
Positions in which a potential variant has a high relative strand bias are filtered out. The relative bias is found by first normalizing strand count for the variant based on the bias of the total set of reads at the position, then calculating the strand bias on the normalized count. Hotspot positions in a sequencing sample are much more likely to have mutations. In human, while the background chance of SNP at any random position is about 1 in 200 or more, a hotspot position can be 10s or even 100s times more likely to have a SNP. Our normal filters and p-value cutoffs for SNP calling are overly conservative for a hotspot position. In order to detect hotspot SNPs, we allow a more aggressive set of filter settings and p-value cutoff for hotspot positions. Once a position with a potential variant passes the filter and reads covering the position are collected, we choose one of the two algorithms to determine the genome type and p-value(s) of prediction.
Version 3.4.1
Bayesian Method When coverage is below a threshold (for example, 60x), we use the Bayesian method. From the set of reads covering the position, we have the number of reads supporting each of the four alleles. We use the most common allele, mca, and second most common allele, sca. The Bayesian algorithm checks three hypotheses: No SNP (ref), homozygous SNP (if mca is not a reference allele), and heterozygous SNP (mca/sca), by calculating P(ref|R), P(Het| R), and P(Hom|R), where R is the set of the reads, and each of the posterior probabilities is calculated using Bayes' theorem: P(H|R)=P(R|H)P(H)/P(R), where P(H) is the prior and P(R) is a constant, and P(R|H) is easily calculated using the base QV to estimate the chance that a base is correct. If P=P(ref|R)+P(Hom|R)+P(Het|R), then the likelihood of each prediction is P(H|R)/P, and the hypothesis with the highest likelihood is called. Frequentist Method
Version 3.4.1
When coverage is high, we can use the frequentist method, which effectively estimates P(ref|R). If the genome position does not have an alternative allele (i.e., it has no SNP), we do this by estimating the expected number of reads matched to an alternative allele. Using the QV of all reads, we estimate the error rate of the bases covering this position. This error rate times the coverage depth is the number of non-reference reads expected. From the set of reads, we know the actual number of reads matching the alternative allele. A Poisson distribution is used to estimate the likelihood of this happening by chance. Low-frequency variants can be detected by this method. The variants are reported in a VCF file. SNPs called near homopolymer (HP) positions tend to be more likely to be false positives because of a higher chance of mismapping, in addition to the higher error rate at these positions. Also, longer HPs are more likely to cause false positives. We model this observation by adding an HP penalty. Formally, for any HP of length L we define a penalty function P(L)=a+bL when L<C and P(L)=a+bL+d otherwise, where a, b, c, d are user-specified parameters. In the frequentist method, the error rate of each base was determined by its base QV, and for any base belong to a HP of length L, we multiply P(L) by the error rate calculated from the base QV. The process is also equivalent to lowering the base QV of HP by a certain amount determined by length.
Indel Detection - GATK

Overall Ion's Unified Genotyper in the current release makes use of not only the flow order and flow intensities, but also Ion's base calls, CIGAR alignment, and base quality calls. The indel caller in the Torrent Variant Caller (TVC) implements four consecutive steps. The first two steps are designed to accurately call short indels of less than 15bp. The third step is designed to reconstruct long indels 1570bp in size. The fourth step filters candidate indels and produces final calls.
First step
In the first step, we traverse all genomic positions limited to the regions provided in the BED file. For each position, we generate a list of observed indels by inspecting a pileup of base-space alignments crossing that position. By default, each indel that is present at a frequency of 10% or higher is included in the set of candidate variants. This step is implemented by calling GATK UnifiedGenotyper in the multi-threaded mode with a certain level of downsampling for speed. The list of candidate indels contains most of the true indels and a large number of false indels caused by misalignments and sequencing errors.
Second step
In general in this step, each candidate indel is rescored using a Bayesian framework that estimates significance of the indel from flow intensities and flow-space alignments across reads that have the indel in their base-space sequence. This step is implemented by calling a modified version of the GATK UnifiedGenotyper that has two major additional functionalities: a. Extracts flow signal from BAM. Realigns flow signal to base calls. Collects flow intensities from reads supporting an indel. Calculates a new Bayesian score (with calls external to GATK). b. Correctly calculates the number of reads on each strand that support the reference allele or indel variant. All the candidate indels identified in step 1 are classified into one of the following three categories: 1. Indels in a homopolymer region (example: 'TTTT' -> 'TTT') 2. Indels within a multi-nucleotide repeat region (MNR), where one or more copies of a series of 2-, 3-, or 4-nucleotide bases are either inserted or deleted (example: 'ATATAT' -> 'ATAT') 3. Other indels of one or more bases that are not in a homopolymer or multi-nucleotide repeat region Previous releases refer to the MNR category as di-nucleotide and tri-nucleotide repeats. 3.x releases also consider 4-nucleotide repeats in this category.
Version 3.4.1
Each candidate category receives a different approach, as described in the following sections.
Indels in a homopolymer region
The candidate indels classified as homopolymer indels are further evaluated using a separate module called Flow Peak Estimator (FPE). FPE develops the distribution of flow signals from all the reads spanning the candidate position and does a flow-space evaluation using the flow signal distribution. The module assigns a score to all candidate indels and filters out all candidates below a score threshold. The FPE module fits the flow signal distribution to a Gaussian model and uses a least-squares min approach to determine the number of peaks in the flow signal distribution. The presence of two signal peaks, one centered around the reference homopolymer length and the other centered around the candidate homopolymer length, is used as evidence for a heterozygous sample. The presence of a single peak centered around candidate homopolymer length is evidence of a homozygous indel. Several quantitative measures are used to identify error modes in the flow signal distribution. Strand-bias is the principal error mode that results in noisy bi-modal flow signal distribution (where only one strand contributes to signal peak around candidate homopolymer length). A k-means clustering approach is used to identify the two clusters (if any) within all the flow signals contributing to the candidate indel position. The strand-bias estimate is calculated from the number of flow signals contributing to the two identified clusters from the postive and negative strands. The strand-bias threshold is controlled by the parameter hp_stb_max_two_peaks_relative_ bias, which is set to default value of 0.8. The minimum coverage required to calculate this flow space based strand-bias estimate is controlled by the parameter hp_stb_fpe_min_coverage and the default value is set to 50. If the coverage at any candidate indel position is below this threshold, then the position is no longer consider as an MNR candidate and is evaluated as a potential indel of one or non-consecutive bases: The indel is scored by the Bayesian framework The strand-bias is calculated using base space (number of reference and candidate alleles from each strand). The standard deviation of the flow signal distribution is used as a measure to identify noisy signals at any given candidate indel position (homozygous variants in particular). The threshold for standard deviation of uni-modal flow signal distributions is controlled jointly by these parameters: hp_max_single_peak_std_23 Signifies the maximum allowed standard deviation for homopolymers of length up to 3 hp_max_single_peak_std_increment Signifies the maximum allowed increment in standard deviation for homopolymers greater than length 3. In the case of homozygous variants, the distribution of flow signals is expected to be uni-modal with the peak ideally centered around the homopolymer length of the variant allele (for example, around 600 for a 6mer homopolymer). The distance (D) between the observed and the expected mean of the flow signal peaks is another good quantitative measure of noise in flow signals and is controlled using the parameter hp-max_peak_deviation. A large D is an indicator of an error prone position and increasing this threshold would lower the specificity of the variants reported. The allele frequencies, in case of heterozygous variants, is estimated using the flow signal distribution by taking the ratio of the areas under the two peaks in a bi-modal distribution (bi-modality is expected in flow signal distributions at heterozygous positions), rather than by simple counting of number reads supporting the each allele in base space. hp_max_length parameter This parameter, new in release 3.2, sets the maximum indel homopolymer length. HP indels longer than this value are not called. The default for this parameter varies by workflow: Ion AmpliSeq workflows 8
Version 3.4.1
Ion TargetSeq workflows 7 Whole Genome workflow 7

Indels in a multi-nucleotide region
Candidate indels classified to be within a multi-nucleotide repeat region are further evaluated in the second step using a separate MNR module. This module again operates within the flow space rather than the base space to evaluate the candidate variants. The observed flow signals within the flow order spanning the candidate indel position is evaluated against the expected flow signals from both the null hypothesis (reference) and the hypothesis that variant is present. The measure of similarity between the observed and expected flow signals is used to generate a quantitative score for each candidate variant which is used in the final step of filter variants.
Other indels
All candidate indels that have not been classified as either of the other two types (in a homopolyer or in a multi-nucleotide repeat region) are further evaluated using a Bayesian framework that estimates significance of the indel from flow intensities and flow-space alignments across reads that have the indel in their base-space sequence.
Second step output
The output of this step is a new VCF file that includes each candidate indel generated in the first step with the addition of the Bayesian score and strand counts in the info field of each variant.
Third step
In the third step, we sequentially traverse all reads in the BAM file and detect genomic regions with a large number of partially aligned reads that have >10bp of soft-clipped (non-aligned) sequence. This signals the possibility of presence of a large indel sequence that does not align to the reference. De novo assembly proceeds with soft-clipped sequences from partially aligned reads in a region and calls an indel if assembled sequence anchors to the reference. This step is designed to call long indels that are missed by the first two steps due to being soft-clipped by the aligner.
Fourth step
The fourth step step merges results from step 2 and 3 and filters them based on score, frequency, and relative strand bias. This step also sorts and produces the final list of variant calls.
Workflows
Version 3.4.1
Torrent Variant Caller Workflow 1. First, in the Plan > Template tab, the user selects or creates a template appropriate to his or her sequencing experiment. (The template contains sequencing instructions, such as the sequencing application (Ion AmpliSeq sequencing, Whole Genome, TargetSeq, etc.), reference, target region BED file (f not using the whole genome application), and other options.) 2. In the template, the user defines one of six workflows consisting of three possible region sizes (Whole Genome, TargetSeq, and Ion AmpliSeq), each of which may be called at two frequencies (germ-line, somatic). 3. Once sequencing is performed, TMAP maps the reads to the reference, followed by a conversion to a flowspace alignment, and barcode splitting. 4. Reads are trimmed of primers for more accurate variant calling (because primers are not from the sample). 5. Summary reports of coverage, variants, chromosomes, and HotSpots are generated. 6. The individual SNP and indel detectors are run, followed by a Bayesian Rescorer, which employs flowspace realignment, and filtering by parameters specific to the application. 7. HotSpot variants are annotated and left-aligned, and a report is generated containing the summary, variant, and HotSpots tables, along with links to files that may be of interest to the user (BAM files, VCF files for SNPs and Indels, target region BED files). The variant calling algorithms are separately optimized for three workflows: Ion AmpliSeq Workflow, which includes the Ion AmpliSeq Cancer Panel and Custom Ion AmpliSeq panels. TargetSeq Workflow, with parameters optimized for hybridization-based target enrichment ("TargetSeq"). Full Genome Workflow, which does not assume enrichment and does not require a target regions file. These methods can be extended to the Ion TargetSeq Workflow and to validation of exome data. Previously we have extensively sequenced the HuRef exome, and reliably know where true positive variants are located.
Version 3.4.1
Ion AmpliSeq Workflow We report only variants within the target region (defined by the target BED file). One specific module for the Ion AmpliSeq workflow is Primer Trimming. For AmpliSeq, we assign each read to the amplicon to which it most likely belongs and trim away any primer sequence, leaving only the insert sequence. This allows us to elegantly manage overlapping amplicons. Several methods are used to validate indels. We obtained and sequenced 15 samples from the HapMap project, for which sequencing and variant data from the 1000 Genomes Project is publicly available. This provides us with, in principal, true positives for comparison, although they are somewhat limited in number per sample. To increase the absolute number of true positives, a dataset of simulated indels was generated by mapping reads from a HapMap sample to a modified hg19 reference. The strength of this method is that there are many true positives that are definitively known; however, simulation of this type is limited to homozygous calls. Early-access customer feedback is also a valuable source of information for validating indels, especially when attempting to discover the reasons behind false positives. In some cases, customers have Sanger sequenced variants, providing us with the ability to examine known false negatives. TargetSeq Workflow We report only variants within the target region (defined by the target BED file). Whole Genome Workflow We report variants across the entire sequenced region.

Ion Torrent TorrentSuite Guide Version 3.4.1

Uploaded by

Copyright:

Available Formats

Ion Torrent TorrentSuite Guide Version 3.4.1

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Ion Torrent TorrentSuite Guide Version 3.4.1

Uploaded by

Copyright:

Available Formats

USER DOCUMENTATION

Torrent Suite 3.4.1

Revision Date December 2012

Torrent Suite User Documentation

Quickstart Introduction On Dataflow

Start a Run View Runs and Reports What Next

Plan > Templates

Plan > Planned Runs

The Data tab

the Torrent Server for analysis and reporting.

Resulting File Type ---bfmask.bin DAT

Ion 318 Chip 520 81% 4994815 25 MB 232 GB

Ion 316 Chip 520 70% 2167130 14 MB 126 GB

Ion 314 Chip 520 71% 660938 2.9 MB 41 GB

Torrent Variant Caller

The Start Analysis dialog opens:

View Runs and Reports

View Runs and Reports

Here is an example of the table view:

Filter displayed runs

The menu changes to the following:

The date filter

The starred runs filter

Click the checkbox next to the search area blue star

When Auto Update is on, the button changes to Stop Updates:

Torrent Browser User Interface Guide

The Plan Tab The Monitor Tab The Data Tab

Example application group

Where are we?

Run Plan Name Barcodes Application

Sample Library Last modified

Example run plan information

Run planning workflow

Template and Planned Run Wizard

Planned run wizard:

Create Multiple Run Plans

Create a Template from AmpliSeq Designer

2. In the Reference Sequences table, click the entry for hg19:

5. Verify that your results file is successfully added:

The Torrent Browser does the rest.

Views Auto Update Review the planned run settings

Example monitoring metrics

When Auto Update is on, the button changes to Stop Updates:

Review the planned run settings

Completed Runs and Reports Tab

Here is an example of the table view:

The menu changes to the following:

The date filter

The starred runs filter

Click the checkbox next to the search area blue star

Failure of an Report Data Management option

The list view has separate buttons to reanalyze or edit a run.

3. In the list of all reports, click the thumbs-up icon

for the report you want to mark as representative.

CSV metrics file

Work with Completed Runs

The main run analysis dialog opens:

Start reanalysis from

Use data from previous report