LSM2102 Lecture schedule LT26 1400-1600h, Tuesdays & Fridays

Lecture 1 Lecture 2 Lecture 3 Lecture 4 Lecture 5 Lecture 6 Tue (01/02/11) Tue (11/02/11) Tue (15/02/11) Fri (18/02/11) Tue (01/03/11) Fri (04/03/11) Gene transfer in bacteria Genetic recombination DNA rearrangements Epigenetics Mutation and DNA repair Transcription & gene regulation in prokaryotes Gene regulation in prokaryotes (contd)

Tutorial

Tue (08/03/11)

Genetic Recombination
Mechanisms of Gene Transfer in Prokaryotes

Gene transfer and recombination

General homologous recombination involves the exchange of genetic material between a pair of DNA double helices which share significant homology The transfer of genetic material between bacteria (haploid organisms) is a mechanism which can create partial diploids (or merodiploids) 3 mechanisms of gene transfer:

Transformation (naked DNA) Conjugation (bacteria-mediated) Transduction (phage-mediated)

Transferred DNA may undergo genetic recombination in recipient cell to produce a new (recombinant) phenotype

recombinant phenotype
4

Types of Genetic Recombination

General homologous recombination

Site-specific recombination
Transpositional Conservative

site-specific recombination

site-specific recombination

A. Gene Transfer by Transformation

Transfer of naked DNA

of chromosomal DNA

Plasmids

Small, extrachromosomal, circular DNA found in many bacteria Autonomous replicons

Plasmid DNA

Genomic DNA

A bacterial cell with many plasmids

Carry few genes (2 30) - often genes conferring drug resistance Some have the ability to move in and out of the bacterial chromosome i.e. mobilizable Plasmids are used as cloning vectors to carry chromosomal DNA
7

Plasmids in E. coli include:

F plasmids ("sex factors") R plasmids (drug/antibiotic resistance).

Curing is a process whereby plasmids are removed from a bacterial strain

plasmidless cell
8

The process of transformation

Isolate DNA (plasmids or fragments of chromosomal DNA) from donor cells

Cell-to-cell contact is not required

Some species of bacteria are naturally competent whereas in others, competence need to be induced

E.g. by treating recipient cells with CaCl2, by heat shock or electroporation

Recombinant chromosome

or
Ca2+, heat or electric shock plasmids

Donor DNA may either remain as an autonomous replicon (if a plasmid) or recombine with the recipient's DNA
10

B. Gene Transfer via Conjugation

unidirectional transfer of genetic information between cells requires cell-to-cell contact

11

E. coli

conjugation is mediated by a fertility factor (F plasmid)

12

+
F+ donor F- recipient F+

+
F+

Recombinants are very rarely produced in F+ x Fcrosses But F factor is transferred frequently F- recipient is converted to F+

13

The F (fertility) plasmid

94.5 kb; carries genes for conjugation + others (cf. with E. coli genome 4600 kb)

tra genes encoding transfer functions (pilus synthesis and assembly, cell pairing, nicking at oriT, etc ) are located in an operon Single copy

(oriT)

14

F+ x
F plasmid

F+
oriT

F-

Leading strand synthesis 3

F+

F+

Leading strand synthesis Rolling circle mechanism Lagging strand synthesis

15

Conjugation

16

Hfr (high-frequency of recombination) strains are formed when F integrates into the bacterial chromosome

F+ Cell

Site-specific recombination

Hfr Cell

Integration of F at different sites (IS sequences) on the host chromosome gives rise to different Hfr strains e.g. HfrC, HfrH, KL98, KL16, etc F contains 3 transposable elements (IS2, IS3 and Tn1000) that allow for integration into host DNA by sitespecific recombination
17

HfrH 80

HfrC

Some sites on the bacterial genome where F may insert to form different Hfr strains Orientation of the arrowhead ( ) indicates direction of transfer. Each E. coli Hfr strain has a name and a unique insertion site for the F plasmid
0

KL99 20 60 KL16 KL98 40

80 20 HfrC 60 KL16

40

18

Examples of E. coli Hfr strains

HfrH

Hfr1

Hfr2

Hfr3

Hfr312

19

Hfr x F

Nick at oriT

In Hfr x F- mating, F- cells almost never acquire an F+ phenotype because only the first part of F is transferred.
20

Gene mapping using Hfrs

Donor and recipient cells are allowed to conjugate for different periods of time Mating stopped by agitation using a blender or by addition of nalidixic acid (stops DNA replication and therefore blocks DNA transfer) Order of genes transferred can be determined

21

Inserted F Interrupted mating Conjugation Hfr Donor F- Recipient

Recombination between homologous regions on donor and recipient DNA

Recipient with new phenotype

Recombinants or "exconjugants" (recipient cells that received donor DNA) are detected using selective and counterselective techniques Lac+ StrS donor strain Lac- StrR recipient strain
Minimal media+ lactose

Minimal media+lactose

donor Counterselected against using antibiotics e.g. streptomycin

Lac+ StrR exconjugants Selected for using antibiotics or ability to utilize a sugar e.g. lactose 23

Prototrophs: wild-type strain that has minimal requirement for nutrient supplements

Auxotrophs: mutant strain that has lost its ability to synthesize a nutrient, e.g amino acids
24

Order of genes transferred is: azi-ton-lac-gal

25

Chromosome map can be determined

Genes nearest oriT have highest frequency of being transferred and vice versa Genes transferred early are more frequently represented in the recombinants than those transferred late The complete E. coli genetic map deduced by this method is about 90 min in length (4600 kb) and the zero point (reference) is the marker thr.

azi10 15 ton 20 lac 30 gal

26

By some clever use of timing experiments, it is possible to generate a genetic map of E.coli without sequencing DNA!

4600 kb

27

Gene transfer by F

An F' is formed by the improper excision of F from the bacterial chromosome The F' plasmid can carry as much as 15% of the E. coli genome, thus providing partial diploidy when transferred into a recipient strain e.g. FlacZ This homologous region can recombine with the host chromosome Site-specific integration
precise excision

F+ Cell

imprecise excision

Hfr Cell

F Cell

28

Formation of an FlacZ
Hfr strain

Aberrant excision of chromosomal fragment

Merodiploid (w.r.t. lacZ)

29

C. Transduction
Bacteriophage-mediated gene transfer

30

Serial dilution method for counting phage.

As the phage grow and lyse (burst) the host, holes, or plaques, are formed in the bacterial lawn By counting the number of plaques seen on the lawns the original concentration of phage can be determined
31

Transduction

Bacteriophage-mediated transfer of host DNA from one bacterium to another Highly efficient and does not require cell-to-cell contact Lysogenic bacteriophages are able to transduce fragments of the host DNA

2 types:
Generalized transduction Specialized transduction
32

Phage-mediated gene transfer and recombination

Homologous recombination & possible change in recipients phenotype

33

Generalized transduction

Most of the transducing phage particles carry only bacterial genes (random fragments), not phage genes Homologous recombination may occur in recipient bacteria Amount of bacterial DNA packaged varies from phage to phage
Bacteriophage Bacteriophage

P22 carries ~ 50 E. coli genes P1 carries ~ 100 genes

35

How is the transduced DNA stably inherited?

stable integration into the host genome via general homologous recombination to form a transductant

What are the frequencies at which phage can generate transductants?

1 in 106 phage particles

36

Specialized transduction

Occurs among temperate phages which can form lysogens by integrating into host genome e.g. bacteriophage Phage particles carry both phage DNA and flanking bacterial DNA Only bacterial DNA adjacent to the prophage insertion site is packaged Occurs only when lysogen is induced to go into lytic phase but is infrequently thus termed Low frequency transducing (LFT) lysate
37

Formation of LFT phage

can exist as a prophage via integration at the att site located on the E. coli chromosome. --------gal - attB- bio--------Bacterial DNA

Integration of into the attB site interrupts the gene order as follows:
-----gal - attL - int - N - cI - cos - b2 region - attR bio-------- lysogen DNA

38

Integration and excision of involves site-specific recombination

attP

(Integrase) (Int, IHF) (Xis)

attL
attL
BOP

attR
attR
POB

attB

attP and attB share a common core sequence (O) recognized by Integrase (POP) attP CAGCTTTTTTTATACTAAGTTG GTCGAAAAAAATATGATTCAAC
39

Specialized transducing phages are often defective (d), lacking certain phage genes --gal - attL- int - N - cI - cos - b2 region - attR bio--dgal

carries the gal gene, but missing in genes required for synthesis of the phage head and tail proteins

-dbio

carries the bio gene, but lacks the int and xis genes for integration and excision

Occurs at a frequency of about 1 in 106 - thus, the resulting lysate is also called Low frequency transducing (LFT) lysate
40

[LFT]

Specialized

[HFT]

41

Excision involves very efficient site-specific recombination between these 2 att sites

Once the defective phage has been integrated, all progeny phage particles that are produced during prophage induction will carry the E. coli chromosomal genes thus, such lysates are called High frequency transducing (HFT) lysates, yielding many dgal particles
42

dgal specialized transducing phages mediate general homologous recombination

General homologous recombination at the gal locus

44

Summary

Gene transfer between haploid bacteria creates partial diploids or merodiploids for genetic recombination to occur & to create a novel phenotype Intrachromosomal DNA duplications or repeats are also substrates for general homologous recombination 3 mechanisms of gene transfer:
Transformation Conjugation

(naked DNA)

(bacteria-mediated) (phage-mediated)
45

Transduction

46

Transferred DNA are stabilized by genetic recombination with recipient DNA to produce a new phenotype (recombinant)
Transferred via transformation, conjugation or transduction

Transferred DNA that does not recombine will be lost in the next replication cycle

47

Reading
Gene transfer and mapping in bacteria:
Klug

& Cummings, Genetics 6th ed, Prentice-Hall 2000

p177-194

48

49

Question
A new mutant was isolated that is StrR and unable to use acetate as a carbon source (ace). To determine where the mutation maps, it was mated with the four different StrS ace+ Hfr donor strains shown below. [Arrowheads indicate the location and direction of transfer from each different Hfr.]

50

1. What is the selection for exconjugants in this experiment? 2. What is the counterselection against the donor cells in this experiment?

51

Given the results in the following table, where does the ace mutation map?
(G)

(A)

(F) (B) (E) (C) (D)

Donor strain Hfr 1 Hfr 2 Hfr 3 Hfr 4

Ace+ colonies 1000 5 1000 80

52