NADPH-Cytochrome P450 Reductase: Molecular Cloning

and Functional Characterization of Two Paralogs from

Withania somnifera (L.) Dunal
Satiander Rana1, Surrinder K. Lattoo1*, Niha Dhar1, Sumeer Razdan1, Wajid Waheed Bhat1,
Rekha S. Dhar1, Ram Vishwakarma2
1 Plant Biotechnology, Indian Institute of Integrative Medicine (CSIR), Canal Road, Jammu Tawi, India, 2 Medicinal Chemistry, Indian Institute of Integrative Medicine (CSIR),
Canal Road, Jammu Tawi, India

Abstract
Withania somnifera (L.) Dunal, a highly reputed medicinal plant, synthesizes a large array of steroidal lactone triterpenoids
called withanolides. Although its chemical profile and pharmacological activities have been studied extensively during the
last two decades, limited attempts have been made to decipher the biosynthetic route and identification of key regulatory
genes involved in withanolide biosynthesis. Cytochrome P450 reductase is the most imperative redox partner of multiple
P450s involved in primary and secondary metabolite biosynthesis. We describe here the cloning and characterization of two
paralogs of cytochrome P450 reductase from W. somnifera. The full length paralogs of WsCPR1 and WsCPR2 have open
reading frames of 2058 and 2142 bp encoding 685 and 713 amino acid residues, respectively. Phylogenetic analysis
demonstrated that grouping of dual CPRs was in accordance with class I and class II of eudicotyledon CPRs. The
corresponding coding sequences were expressed in Escherichia coli as glutathione-S-transferase fusion proteins, purified
and characterized. Recombinant proteins of both the paralogs were purified with their intact membrane anchor regions and
it is hitherto unreported for other CPRs which have been purified from microsomal fraction. Southern blot analysis
suggested that two divergent isoforms of CPR exist independently in Withania genome. Quantitative real-time PCR analysis
indicated that both genes were widely expressed in leaves, stalks, roots, flowers and berries with higher expression level of
WsCPR2 in comparison to WsCPR1. Similar to CPRs of other plant species, WsCPR1 was un-inducible while WsCPR2 transcript
level increased in a time-dependent manner after elicitor treatments. High performance liquid chromatography of
withanolides extracted from elicitor-treated samples showed a significant increase in two of the key withanolides,
withanolide A and withaferin A, possibly indicating the role of WsCPR2 in withanolide biosynthesis. Present investigation so
far is the only report of characterization of CPR paralogs from W. somnifera.

Citation: Rana S, Lattoo SK, Dhar N, Razdan S, Bhat WW, et al. (2013) NADPH-Cytochrome P450 Reductase: Molecular Cloning and Functional Characterization of
Two Paralogs from Withania somnifera (L.) Dunal. PLoS ONE 8(2): e57068. doi:10.1371/journal.pone.0057068
Editor: Turgay Unver, Cankiri Karatekin University, Turkey
Received October 5, 2012; Accepted January 17, 2013; Published February 21, 2013
Copyright: ß 2013 Rana et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The financial grant from Council of Scientific and Industrial Research, Government of India, New Delhi under Network Project NWP 0008. The funders
had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected]

Introduction W. somnifera also known as Indian ginseng is often compared

with Korean ginseng (P. ginseng) for its rejuvenating properties.
Withania somnifera (L.) Dunal commonly known as ashwa- Withanolides are synthesized and accumulated in leaves and
gandha or winter cherry, belongs to family Solanaceae. Its roots of W. somnifera. Chemoprofiling of Withania presents
versatile reproductive strategy of mixed mating and robust several alkaloids, sitoendosides, and more than 40 withanolides
chemotypical variability enables it to thrive under marginal and [6,7]. Substantial pharmacological activities have been accred-
xeric habitats with a wide geographic distribution [1,2]. It is a ited to two main withanolides, withaferin A (WS-3) and
multipurpose medicinal plant, synthesizing large array of bio- withanolide D (WS-D). These compounds have been reported
active secondary metabolites. In recent years there has been a to inhibit angiogenesis, Notch-1, NFkB in cancer cells and
remarkable surge in the pharmacological studies of this plant as
induce apoptosis in breast cancer cells [8,9,10].
it has been shown to possess wide spectrum of therapeutic
Principally, withanolides (C-30) are synthesized via both
properties including antitumor, immuno-modulatory, chemo-
mevalonate (MVA) and non-mevalonate (DOXP) pathways. The
protective, cardio-protective and neuroprotective [3,4,5]. Most
head-to-tail condensation of isopentenyl pyrophosphate (IPP) leads
of the biological activities are attributed to naturally occurring
to formation of farnesyl diphosphate (FPP) which is the main
C-28 steroidal lactone triterpenoids built on an intact or
precursor for triterpenoids [11,12]. A key intermediate compound,
rearranged ergostane framework, in which C-22 and C-28 are
24-methylenecholesterol is an immediate precursor for biosynthe-
oxidised to form a 6-membered lactone ring. These steroidal
triterpenoids known as withanolides have a structural resem- sis of different withanolides (Figure 1). While there is considerable
blance with active constituents of Panax ginseng called gingosides. literature pertaining to the fascinating chemistry and biological

PLOS ONE | www.plosone.org 1 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

PLOS ONE | www.plosone.org 2 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 1. An overview of putative withanolide biosynthesic pathway. DXP: 1-deoxy-D-xylulose 5-phosphate, HMBDP: 1-hydroxy-2-methyl-2-
(E)-butenyl 4-diphosphate, IPP:Isopentylpyrophosphate, DMPP: Dimethylalyl diphosphate, IPP isomerase: Isopentylpyrophosphate isomerase, FPPS:
farnesyldiphosphate synthase, SQS: Squalene synthase, SQE/CPR: Squalene epoxidase/cytochrome P450 reductase, CAS: Cycloartinol synthase, SMT-1:
Sterol methyl transferase/cytochrome P450 reductase, ODM/CPR: Obtusifoliol-14-demethylase/cytochrome P450 reductase. First three highlighted
(yellow) steps indicating involvement of P450 monooxygenases and CPR. Single dark arrows represent one step, two or more dark arrows represent
multiple steps and dashed arrow represents unknown steps. Below the pathway: chemical structure of important withanolides.
doi:10.1371/journal.pone.0057068.g001

studies of many withanolides from W. somnifera, but sparse numerous studies related to heterologous cDNA-expression to
information exists regarding their biosynthesis. identify different physiological substrates for proteins in the P450
From biochemical, molecular and pathway engineering per- superfamily. The heterologous expression of P450s is often
spectives, it is imperative to characterize key pathway genes and to constrained because of inadequate interface of endogenous
understand their regulatory role in the biosynthesis of bioactive cytochrome P450 oxido-reductase partners resulting in no or
metabolites. Cytochrome P450 enzymes belong to one of the low activity [31]. We tend to understand the regulatory role by co-
largest and most functionally diverse protein super-families which expression of cloned CPRs with different P450 monooxygenases
is pivotal in various metabolic molecular circuitries. P450s are which have been demonstrated to result in increased utilization of
heme thiolate-proteins, catalyse extremely diverse variety of substrate and found to enhance the production of secondary
reactions like hydroxylations, dealkylations, sulphoxidations, ep- metabolites. Different paralogs of CPR have been implicated to
oxidations, reductive dehalogenations, peroxidations and various possess diverse physiological roles particularly in secondary
types of isomerization for the synthesis of a suite of primary and metabolism, plant adaptation and defence mechanism by main-
secondary metabolites essential for plant growth and development taining electron supply to different P450 monooxygenases [32].
[13,14]. P450 monooxygenases constitute a substrate specific class
of enzymes which are highly regio and stereo-specific. By gene Materials and Methods
annotation approximate 1% of the total genes in the plant’s
genome are found to be cytochrome P450s. Arabidopsis genome Plant Material
contains 244 genes and 28 pseudo-gene representing cytochrome A WS-3 rich genetic stock of W. somnifera designated as WS-Y-
P450s [15]. P450s are located in the endoplasmic reticulum (ER) 08 (described elsewhere [30]) grown at IIIM experimental farm
and their catalytic activities strictly rely on supply of electrons from (Indian Institute of Integrative Medicine, CSIR, Jammu, India,
NADPH:cytochrome P450 reductase (CPR: diflavoenzyme). 32u449N longitude, 74u559E latitude; 305 m in altitude) was used
CPRs (EC 1.6.2.4) are membrane bound proteins localized to as a source material. In vitro raised plants through forced axillary
ER, contain an N-terminal positioned FMN binding domain bud culture of accession WS-Y-08 were used for MeJA and SA
linked to NADPH binding domain via FAD domain. CPR shuttles treatments. Samples were collected, frozen immediately in liquid
electrons derived from NADPH through FAD and FMN domains nitrogen, and stored at 280uC.
into the heme iron-centre of the various P450 enzymes. Genes
encoding CPR from many species of animals, insects and yeast RNA Isolation and cDNA Synthesis
have been isolated and among all only single form is known to Total RNA was extracted using Trizol reagent (Sigma, St.
interact with various P450s [16]. However, in vascular plants Louis, USA) as per manufacturer’s protocol. Concentration of
number of CPR paralogs vary from one to three depending on the isolated RNAs was estimated by measuring the absorbance at
species e.g. Nothapodytes foetida and Hybrid poplar (Populus trichocarpa 260 nm in a spectrophotometer (AstraAuriga, Cambridge, UK).
6 Populus deltoides) [17,18] contain three paralogs while Helianthus Further, quality of RNA was assessed by determining the ratio of
tuberosus, Petroselinum crispum, Arabidopsis thaliana, Centaurium erythrae absorbance at 260 and 280 nm (A260/280) and formaldehyde-
and Gossipium hirusitum have two CPR homologs. [19,20,21,22,23]. denatured agarose gel electrophoresis. Total RNA (5 mg) was
Similarly, single form of CPR has been characterised from some incubated with RNase free DNase (Fermentas, Burlington,
plants like Coleus blumei, Papaver somniferum, Taxus cuspidate, Vigna Canada) at 37uC for 30 min. First strand cDNA synthesized using
radiate [24,25,26,27]. Based on the N- terminal anchoring the RevertAid cDNA synthesis kit (Fermentas, Burlington,
sequences, Ro et al. [18] have classified CPRs into two classes: Canada) in a total volume of 20 ml containing 3 mg total RNA,
Class I and class II. CPR1 belonging to class I is found to express 10 mM dNTPs, 10 mM oligo (dT) primer, 1 ml M-MuLV reverse
constitutively while in class II, CPR2 is transcribed under stress or transcriptase (200 U/ml) and 16 first strand buffer (250 mM Tris-
elicited by wounding or elicitors. Presence of multiple CPRs in HCl, pH 8.3, 250 mM KCl, 20 mM MgCl2, 50 mM DTT). The
plants may reflect the diversity of P450s [28,29] and seem reaction was incubated for 60 min at 42uC followed by 5 min at
primarily to confront the high demand of electron supply during 70uC to inactivate the reverse transcriptase.
biotic and abiotic stress or differential expression at various stages
of plant development [18,21]. Cloning of WsCPR1 and WsCPR2
Biochemical and molecular studies have been recently initiated Degenerate primers (Table 1) based on the conserved regions of
to elucidate biosynthetic pathway for various withanolides in W. CPRs were designed by multiple sequence alignment of different
somnifera [30]. As a part of on-going endeavour to investigate CPR sequences retrieved from the GenBank database at National
various pathway genes in withanolide biosynthesis, we in present Center for Biotechnology Information (NCBI). Optimization of
study report cloning and characterization of two paralogs of CPR reverse transcriptase-polymerase chain reaction (RT-PCR) condi-
(NCBI GenBank Acc No. WsCPR1: HM036710 and WsCPR2: tions allowed amplification of cDNA fragments corresponding to
GU808569). The investigations also include comparative tissue- WsCPR1 and WsCPR2 under following cycling conditions: one
specific expression analysis of WsCPR1 and WsCPR2 and changes cycle of 94uC for 3 min, 35 cycles of 94uC for 30 s, 55uC for 1 min
in three key withanolides namely withanolide A (WS-1), withanone and 72uC for 2 min followed by a final extension of 72uC for
(WS-2) and withaferin A (WS-3) in response to elicitor stimuli 10 min in a thermal cycler (Bio-Rad Laboratories, Hercules, CA,
methyl jasmonate (MeJA) and salicylic acid (SA). There are USA). Amplicons examined by agarose gel electrophoresis were

PLOS ONE | www.plosone.org 3 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Table 1. List of primers used in the study.

Primers Sequence (592

239) Direction

Degenerate
PLCPR -1F GAGCCIACIGATAATGCTGCN(A/C/T/G)A(C)G Forward
PLCPR-1R TTGCY(C/T)GAW(A/T)GGR(A/G)AAM(C/A)CAGCCA Reverse
PLCPR-2F GTCATGGS(G/C)K(T/G)GAATTCCW(A/T)TCAG Forward
PLCPR-2R GGACCY(T/C)GAR(G/A)AAR(G/A)GCWAC Reverse
59 and 39 RACE
59 Adapter* GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA
59 RACE-OUT* GCTGATGGCGATGAATGAACACTG Forward
59 RACE-IN* CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG Forward
59 CPR1-OUT CATCATCGGCAGCATAATCATCCAT Forward
59 CPR1-IN CAACTGCCTTCTCATACCTTGCT Forward
59 CPR2-OUT GCCATCCTAGGAGATGATGAGATA Reverse
59 CPR2-IN ACTGAAGGCTTGGCTGATGGAAAT Reverse
39 Adapter* GCGAGCACAGAATTAATACGACTCACTATAGGT12V(G/A/C)N(A/C/T/G)
39 RACE-OUT* GCGAGCACAGAATTAATACGACT Reverse
39 RACE- IN* CGCGGATCCGAATTAATACGACTCACTATAGG Reverse
39CPR1-OUT GATCAGATACTTAGAGACGAGGATG Forward
39 CPR1-IN TACGGCTGCAATTCCTGAATATCG Forward
39 CPR2-OUT AGCTAGTTGTTGCTTTCTCACGTG Forward
39 CPR2-IN CTAACAAACAATACGTGCAGCATA Forward
Full length
FullCPR1F ATGGAGTTGAGTTCGGAGTTGGTGAG Forward
FullCPR1R TCACCACACATCCCTGAGATATCTTCC Reverse
FullCPR2F ATGGACTCTACATCAGAAAAACTTTCTCC Forward
FullCPR2R TCACCACACATCACGCAGATATCT Reverse
Expression
CPR1BamHIF CGGGATCCATGGAGTTGAGTTCGGAGTTGGTGAG Forward
CPR1XhoIR CCGCTCGAGATCACCACACATCCCTGAGATATCTTCC Reverse
CPR2BamHIF CGGGATCCATGGACTCTACATCAGAAAAACTTTCTCC Forward
CPR2 NotIR ATTTGCGGCCGCTCACCACACATCACGCAGATATCT Reverse
Real-Time analysis
RTCPR1F AGCAAGGTATGAGAAGGCAGTTGT Forward
RTCPR1R CAGCATTATCAGTTGGCTCACCAT Reverse
RTCPR2F AGTGTGGCCTAAATTGGATAAGTTGC Forward
RTCPR2R ACGATAACATGTCCATTTGCATGAC Reverse
RTActinF GAGAGTTTTGATGTCCCTGCCATG Forward
RTActinR CAACGTCGCATTTCATGATGGAGT Reverse

*Primers marked with star were provided with the kits.

doi:10.1371/journal.pone.0057068.t001

cloned into pTZ57R/T vector (Fermentas, Burlington, Canada), (Ambion, Austin, TX, USA). cDNAs obtained were subjected to
and then transformed into E. coli DH5a host strain. Cloned nested PCR using GSPs as listed in the Table 1. Two rounds of
amplicons were sequenced using an automated DNA sequencer PCR were performed, first round with 59 RACE-OUT corre-
(ABI Prism 3130XL; Applied Biosystems, Foster City, CA, USA). sponding to the 59 RACE adapter sequence and 59 CPR1-OUT
The nucleotide sequences obtained were analysed using the and 59 CPR2-OUT as specific outer primers, followed by a second
similarity search BLAST program and subsequently used for round of PCR with 59 RACE-IN and 59 CPR inner GSPs. In both
designing gene specific primers (GSPs). rounds, PCR reactions of 50 ml containing 1.0 ml cDNA as
template (except for second round where amplified products of 1st
59 and 39 RACE round were used as template), 2 ml of 10 mM 59 CPR1-OUT and
To validate prediction of target genes, 59 & 39 rapid 59 CPR2-OUT, 2 ml of 59 RACE outer, 45.0 ml master Mix
amplification of cDNA ends (RACE) were performed using first (34.5 ml PCR-grade water, 10 mM Tris HCl; pH 9.0, 50 mM
choice RLM-RACE kit according to the product manual KCl, 2.5 mM MgCl2, 200 mM dNTPs, 2.5 U Taq DNA

PLOS ONE | www.plosone.org 4 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 2. Multiple sequence alignment of deduced amino acid sequences of WsCPR1 and WsCPR2 with other CPR homologs using
ClustalX. CPRs used for alignment were from Withania somnifera (WsCPR1: HM036710, WsCPR2: GU808569), Petunia hybrida CPR1:DQ099544, CPR2
DQ099545); Petroselinum crispum (CPR1:AF024635, CPR2:AF024634); Gossipium hirsutum (CPR1: FJ719368, CPR2:FJ719369); Populus trichocarpa
(CPR1:XM_002307300, CPR2:XM_002329600, CPR3: AF302498); Arabidopsis thaliana (CPR1:X66016, CPR2: X66017). Typical conserved membrane
anchor, cytochrome P450-, FMN, FAD and NADPH-binding domains characteristic for the CPR are highlighted grey in colour and underlined.
doi:10.1371/journal.pone.0057068.g002

PLOS ONE | www.plosone.org 5 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 3. Phylogenetic analysis of deduced amino acid sequences. Phylogeny of WsCPRs was inferred using the Neighbor-joining method
using MEGA 5 software. A total of 33 protein sequences used for analysis were from following plant species: Withania somnifera (WsCPR1: HM036710,
WsCPR2: GU808569), Petunia hybrida (CPR1: DQ099544, CPR2: DQ099545); Petroselinum crispum (CPR1: AF024635, CPR2: AF024634); Gossipium
hirsutum (CPR1: FJ719368, CPR2: FJ719369); Populus trichocarpa (CPR1: XM_002307300, CPR2: XM_002329600, CPR3: AF302498); Arabidopsis thaliana
(CPR1: X66016, CPR2: X66017); Capsicum annuum (EU616557); Vigna radiata (P37116); Vicia sativa (Z26252); Stevia rebaudiana (DQ269454); Ricinus
communis (XM_002514003); Pisum sativum (AF002698); Picrorhiza kurrooa (JN968968); Artemisia annua (EF104642); Papaver somniferum (U67185);

PLOS ONE | www.plosone.org 6 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Taxus cuspidate (AY571340); Taxus chinensis (AY959320); Perilla frutescens (GQ120439); Ophiorrhiza pumila (AB086169); Medicago truncatula
(XM_003610061); Lotus japonicas (AB433810); Catharanthus roseus (Q05001); Centaurium erythraea (AY596976); Zea mays (CAC83301); Triticum
aestivum (AGC27711) and Eschscholzia californica (U67186). All CPRs were grouped into two clusters where the WsCPR1 and WsCPR2 confined to their
corresponding cluster like other CPRs.
doi:10.1371/journal.pone.0057068.g003

polymerase) were subjected to following cycling conditions: One Sequence Analysis

cycle of 94uC for 3 min and 35 cycles of 94uC for 30 s, 60uC for BLAST (http://www.ncbi.nlm.nih.gov) was used to find
30 s, 72uC for 2 min with a final step at 72uC of 10 min. Similarly similarity of amplified CPRs in Genbank database. Translate tool
for 39 RACE, first strand cDNA was synthesized from total RNA (http://www.expasy.ch/tools/dna.html) was used to predict the
using supplied 39 RACE adapter primer. cDNA was subjected to open reading frame (ORF). The properties of deduced amino acid
nested PCR using outer and inner primers specific to 39 RACE sequences of WsCPR1 and WsCPR2 were estimated by using
adapter along with 39 GSPs with same reaction volume and ProtParam (http://www.expasy.ch/tools/protparam.html),
cycling conditions as described for 59 RACE. All PCR products SPLIT v.4.0 (http://split.pmfst.hr/split/4/) and TMHMM
were gel purified, cloned and sequenced. (http://www.cbs.dtu.dk/services/) programs. Predictions of N-
glycosylation and chloroplast targeting sites in both polypeptides
Full-length Cloning of WsCPR1 and WsCPR2 were computed using NetNGlyc 1.0 Server (http://www.cbs.dtu.
By comparing and aligning the sequences of the core fragments, dk/services/NetNGlyc/) and ChloroP (http://www.cbs.dtu.dk/
59 RACE and 39 RACE products, the full-length cDNAs of services/ChloroP). ClustalX was used for multiple sequence
WsCPR1 and WsCPR2 were generated and subsequently amplified alignment [33]. Protein secondary structures were determined by
with primers FullCPR1F, FullCPR1R and FullCPR2F, SOPMA program [34]. Structurally and functionally important
FullCPR2F (Table 1). A high fidelity proof-reading DNA regions were identified in deduced protein sequence by Conseq
polymerase (New England Biolabs, Herts, UK) was employed services. To assess the evolutionary relationships between the
for amplification under PCR conditions; One cycle of 94uC for WsCPRs and CPR homologs from different plants species,
3 min, 35 cycles of 94uC for 30 s, 60uC for 30 s, 72uC for 2 min. sequences were retrieved using BLASTp searches using WsCPR1
The final extension was at 72uC for 10 min. PCR products were and WsCPR2 as query. Further, sequences were aligned using the
analysed on 1.2% agarose gels and visualized under UV light. The ClustalW (http://www.ebi.ac.uk) and a phylogenetic tree was
resulted amplified products were ligated in pJET vector and sub- constructed by Neighbour-joining method using MEGA 5
cloned into E.coli DH5a.

Figure 4. Three dimensional models and conserved residue prediction for WsCPR1 and WsCPR2. 4A & 4D: Cartoon display of the 3-D
structures of WsCPR1 and WsCPR2 as predicted by Phyre2 using crystal structure of Rattus norvagicus (PDB ID: 1J9Z) as template. 4B & 4E: Predicted
ligand (shown in green) binding sites as predicted by 3DLigandSite Web Server. 4C & 4F: Conserved residue analysis of WsCPR1 and WsCPR2 were
performed using Consurf and Conseq web servers. Residue conservation from variable to conserve is shown in blue (1) to violet (9). The residues
involved in substrate binding and active site are shown in the center core of the structure.
doi:10.1371/journal.pone.0057068.g004

PLOS ONE | www.plosone.org 7 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 5. Sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) of heterologously expressed WsCPR1 and
WsCPR2. 5A: SDS-PAGE (10%) pattern of proteins obtained from E.coli BL21 (DE3) transformed with pGEX-WsCPR1 and pGEX-WsCPR2. Lane 1 & 5;
Standard protein markers. Lane 2 & 7; Whole cell lysate of uninduced WsCPR1 and WsCPR2, Lane 3–6 & 10–13; Cell lysate of WsCPR1 and WsCPR2
induced with 0.8 mM IPTG harvested after 2 h, 4 h, 6 h and 8 h respectively. Lane 7 & 14; Cell lysate of E. coli BL21 (DE3) cells containing the empty
vector pGEX-4T2 obtained at 4 h post-induction with 0.8 mM IPTG. 5B: The SDS-PAGE (10%) profile of optimized WsCPR2 expression at 25uC. In
different lanes the samples were harvested at different time periods as indicated above. The highest expression was observed with 0.8 mM IPTG after
12 h of induction.
doi:10.1371/journal.pone.0057068.g005

software. Bootstrap analysis with 100 replicates was also conducted ampicillin and incubated overnight at 37uC. 1% culture was
in order to obtain confidence levels for the branches. transferred into 100 ml of LB media containing the corresponding
antibiotic and incubated at 37uC, until optical density (A600 nm)
Prediction of Three-dimensional Structures of WsCPR1 reached 0.4–0.5. Protein expression was induced by adding Iso-
and WsCPR2 propyl b-D-1-thiogalactopyranoside (IPTG; Fermentas, Berligton,
Three-dimensional structures of WsCPR1 and WsCPR2 were Canada) into the cultures at the concentration of 0.2 mM to
predicted using Phyre2 [35] with the crystal structure of Rattus 1 mM. The cultures were constantly incubated at 25uC for 8–
norvegicus (PDB ID: 1J9Z) as a template. Ligand binding sites were 12 h. The induced bacterial cells were harvested at an interval of
predicted using 3DLigandSite [36]. Conserved amino acids at the 2 h by centrifugation and resuspended in 6x sodium dodecyl
protein surface were determined using ConSurf (http://consurf. sulphate–polyacrylamide gel electrophoresis sample buffer (SDS-
tau.ac.il/overview.html). PAGE; 0.375 M Tris pH 6.8, 12% SDS, 60% glycerol, 0.6 M
DTT, 0.06% bromophenol blue). The expression of target
Heterologous Expression of Recombinant Proteins proteins was analysed on 10% SDS-PAGE.
Full length coding sequences of WsCPR genes were modified by
adding restriction sites (Table1). Immediately upstream to start Purification of WsCPR1 and WsCPR2
codons, BamHI in both genes and downstream to stop codons, Protein expression was induced by addition of 0.8 mM IPTG
XhoI (WsCPR1) and NotI (WsCPR2) restriction sites were intro- when the optical density at 600 nm reached 0.4. Cells were grown
duced using engineered sense and anti-sense primers (Table 1). for further 8–12 h at 25uC and then harvested by centrifugation
Using directional cloning, ORFs of candidate P450 reductases (6000 g at 4uC for 10 min; Eppendorf, Hamburg, Germany).
were excised from pJET and transferred to pre-digested, purified Pelleted cells were resuspended in the 16 PBS (140 mM NaCl,
pGEX4T-2. The E.coli BL21 (DE3) cells were transformed with 2.7 mM KCl, 10 mM Na2HPO4, 10 mM KH2PO4, pH 7.3) and
pGEX-WsCPR1 and pGEX-WsCPR2 expression cassettes. A single lysed by adding 100 mM DTT followed by lysozyme (100 mg/ml)
colony of each recombinant culture was inoculated separately into for 45 min at 4uC. The lysates were sonicated four times for 30 s
100 ml of Luria–Bertani (LB) broth containing 100 mg/ml of each time (amplitude 1, 20% duty cycle) using a sonicator

PLOS ONE | www.plosone.org 8 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

agarose gel and transferred onto positively charged nylon

membrane (Roche, Manheim, Germany) by capillary blotting
[37]. The probes for southern hybridization were synthesized by
PCR using full length primers that amplified the coding sequence
of WsCPR1 and WsCPR2 respectively. The probes were labelled
with digoxigenin (DIG)-dUTP using the DIG-DNA synthesis Kit
(Roche, Manheim, Germany) according to the manufacturer’s
instructions. The blot was hybridised, blocked and incubated with
antibodies. Further, it was washed and signal generation and
detection were performed according to the manufacture’s manual.

Tissue-specific Expression Analysis

To study tissue-specific expression, total RNA was extracted
from leaves, stalks, roots, flowers and berries respectively. Total
RNA (5 mg) was incubated with RNase free DNase (Fermentas,
Burlington, Canada) at 37uC for 30 min. cDNA was synthesized
from 3 mg of RNA using RevertAid cDNA synthesis kit according
to manufacturer’s instruction. SYBR green PCR amplification was
performed using the StepOne Real-time PCR System (Applied
Biosystems, Foster City, CA, USA). Briefly, for the standard 20 ml
of reaction, included 0.2 mL cDNA template, 200 nM each of the
primers, and 10 mL SYBRPremix Ex (Takara, Otsu, Japan) under
following cycling conditions: one cycle of 94uC for 1 min, 40 cycle
of 94uC for 10 s, 60uC for 20 s and 72uC for 25 s. Two primers,
Actin F and Actin R were used to amplify housekeeping actin gene
as control. All samples were analysed in triplicate and the
specificity of each primer pair was validated by a dissociation
curve (a single peak was observed for each primer pair). Data
obtained were subjected to analysis using StepOne software v 2.0.

Elicitor Treatment
Figure 6. SDS-PAGE profile of purified recombinant proteins. For elicitor treatment the micro-propagated plantlets were pre-
SDS-PAGE (10%) of purified recombinant proteins from E.coli BL-21 cultured in Hoagland’s suspension medium for 2 wk. The plantlets
transformed with pGEX-WsCPR1 and pGEX-WsCPR2. Lane 1; Standard were treated with MeJA (0.1 mM) and SA (0.1 mM) dissolved in
protein markers, Lane 2&3; Cell lysate (CL) of WsCPR1 and WsCPR2
expressing cells remained after incubation with GST-beads, Lane 4; dimethylsulphoxide (DMSO) and untreated kept as control with
Purified recombinant GST-fused WsCPR1, Lane 5; Purified recombinant same amount of DMSO. The tissue from each treated sample was
GST fused WsCPR2, Lane 6; Purified WsCPR1 after removal of GST using harvested after 6, 12, 24 and 48 h for RNA isolation and
thrombin and Lane 7; Purified CPR2 after removal of GST. withanolides extraction. cDNA was obtained from each treated
doi:10.1371/journal.pone.0057068.g006 sample including control, using the same RNA isolation and
cDNA synthesis protocols as described above. Effect of elicitor
(Sartorius, Gottingen, Germany). To the lysates, 10% triton X-100 treatment on expression profile was studied using semi-quantita-
was added and incubated for 30 min at 4uC. Further, soluble and tive PCR. The PCR cycles for each gene were optimized to their
insoluble fractions were separated by centrifugation (14, 5000 g at exponential stage. Actin was used as an internal control. The
4uC for 15 min). The supernatant was incubated overnight with reaction mixture for each sample contained 10 mM Tris HCl
glutathione-sepharose beads (1 ml L21 of culture) (GE Healthcare, pH 9.0, 50 mM KCl, 2.5 mM MgCl2, 200 mM dNTP, 1 mM RT
Little Chalfont, UK) at 20uC. The beads were washed five times primers (Table 1), 0.5 ml of cDNA template, and 0.5 U of Taq
with 10 bead volumes of 16 PBS. To remove the glutathione S- DNA polymerase (Fermentas, Burlington, Canada). The PCR
transferase (GST) moiety, thrombin (4 U/ml of beads) was added conditions were as follows: one cycle 94uC for 1 min, 27 cycles of
to the beads, and cleavage was allowed to proceed for 10–12 h at 94uC for 30 s, 60uC for 20 s and 72uC for 25 s. The samples were
24uC. The beads were pelleted (600 g at 4uC for 5 min), analysed on 1.5% agarose gel and densitometric quantitation of
supernatant containing proteins were incubated overnight further relative band intensities by normalizing with actin was performed
with benzymedene beads to remove the thrombin. The purified using QuantityOne v 3.0 software (Bio-Rad, Laboratory, Phila-
protein samples were denatured and analysed on 10% SDS-PAGE delphia, USA).
and their concentration was directly measured on spectrophotom-
eter. Extraction and Quantification of Withanolides Using
HPLC
Southern Blotting Withanolides were extracted and quantified as described by
The genomic DNA was isolated from mature leaf-tissue using Dhar et al. [38]. Concisely, samples of W. somnifera were powdered
Qiagen DNeasy plant mini kit (Qiagen, Hilden, Germany) and extracted with ethanol-water (50:50; v/v) with magnetic
following manual provided and quantified at A260/280 nm. Aliquots stirring at room temperature (2562uC). Extracts were filtered and
of DNA (30 mg) were digested for 16 h at 37uC with BamHI, NotI the solvent was removed under vacuum. The extracts (20 mg/ml)
and BglII for WsCPR1 and NotI, PvuI and EcoRI for WsCPR2 obtained from each sample of the plant material were prepared in
respectively. Digested products were electrophoresed on 0.8% HPLC-grade methanol-water (50:50; v/v) for quantitative analysis.

PLOS ONE | www.plosone.org 9 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 7. Southern blot analysis of genomic DNA. A&B: Southern blot analysis of total DNA using WsCPR1 and WsCPR2 as a probe. Total DNA
(30 mg) isolated from Withania somnifera was digested with the indicated restriction enzymes, The digested samples were electrophoresed on 0.8%
agarose gel, blotted onto nylon membrane and subjected to hybridisation using DIG-labelled ORF of WsCPR1 and WsCPR2 as probes. First lane
contains molecular markers with indicated molecular weight on the left side.
doi:10.1371/journal.pone.0057068.g007

1.2 mg per 2 ml of the standards of withanolide A (WS-1), (100 mM) with varying concentrations of cytochrome c (10–
withanone (WS-2) and withaferin A (WS-3) were prepared in 250 mM) were used in the reaction mixture. The kinetic constants
HPLC-grade methanol. HPLC analysis was performed with Km and Vmax, were calculated with non-linear regression analysis
Shimadzu HPLC system (Shimadzu, Tokyo, Japan) equipped using GraphPad Prism 5 software.
with 515 quaternary gradient pump, 717 Rheodyne injector,
2996 PDA detector and CLASS-VP software v 6.14. All samples Results and Discussion
were filtered through 0.45 mM filters (Millipore, Bedford, USA).
Extracts of W. somnifera samples were separated on a RP-18e Cloning of Full Length cDNAs Encoding WsCPR1 and
(4.66100 mm, 5 mm) (Merck, Bangalore, India) column. The WsCPR2
mobile phase consisted of methanol-water (60:40; v/v) delivered at Plant P450s catalyse a diverse array of reactions during
a flow rate of 0.5 ml/min. The samples were analyzed at 30uC to secondary metabolite synthesis which require involvement of their
provide efficiency to the peaks. The UV chromatograms were redox partner, NADPH:cytochrome P450 reductase [40]. In this
recorded at 237 nm. investigation, two CPR paralogs from W. somnifera, WsCPR1 and
WsCPR2 were isolated and expressed in E. coli BL21 (DE3) to
NADPH-reductase Assays study their catalytic properties. Gene expression patterns were also
Activities of purified NADPH- reductases were determined by studied in relation to elicitors (MeJA & SA) and corroborated with
the reduction of cytochrome c (20 mM) in presence of NADPH chemo-profiles.
(100 mM). All assays and incubations were carried out in 300 mM Full length cDNAs of WsCPR1 and WsCPR2 genes were
potassium phosphate buffer, containing 0.1 mM EDTA, pH 7.8 at obtained from the leaf tissue of WS-3 rich chemo-variant by
25uC. The rate of reduction was monitored by increase of degenerate PCR and RACE methods (NCBI GenBank Acc No.
absorbance at 550 nm [39]. For calculating the reduction rate of WsCPR1: HM036710 and WsCPR2: GU808569). Degenerate
cytochrome c, a specific molar absorption coefficient primers based on the conserved regions were designed by
(21.1 mM21 cm21) of equine heart cytochrome c was used. employing multiple sequence alignment strategy using ClustalW.
Further, for measurement of kinetic parameters, NADPH A 600 and 450 bp core fragments were obtained from the initial

Table 2. Specific activities and of kinetic constants of WsCPR1 and WsCPR2.

NADPH
21 21
Specific activity mmol min mg ) Vmax (mmol min21 mg21) Km (mM)

WsCPR1 7.5660.06 8.9660.06 5.0660.30

WsCPR2 6.8360.06 10.8660.07 6.4860.33

For measuring specific activities, cytochrome c (20 mM) was reduced in presence NADPH (20 mM) as electron donor. Kinetic parameters for NADPH were studied in
reaction mixture containing different concentrations of cytochrome c (10–250 mM). Values were obtained by non-linear regression of Michaelis-Menten plots and are
presented as mean6SE.
doi:10.1371/journal.pone.0057068.t002

PLOS ONE | www.plosone.org 10 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 8. Tissue-specific real-time expression analysis. Quantitative assessment of the expression of WsCPR1 and WsCPR2 in different tissues
of Withania somnifera. Data were compared and analysed with analysis of variance (ANOVA). Values are means, with standard errors indicated by bars,
representing three independent biological samples, each with three technical replicates. Differences were scored as statistical significance at *p,0.05
and **p,0.01 levels.
doi:10.1371/journal.pone.0057068.g008

RT-PCR reactions. The amplicons were confirmed as segments of [41].The well-known role of CPRs is to ensure the electron supply
two isoforms of CPR by sequencing and similarity searches using to P450 genes involved in metabolic pathways like biosynthesis of
BLAST. Further, extension of both amplified core fragments plant hormones and secondary metabolites such as alkaloids,
toward 59 and 39 ends by using RACE-PCR succeeded in sterols and brassinosteroids [42]. The existence of two divergent
amplification of remaining cDNA portions corresponding to two CPRs may likely impart Withania the capability to adapt their
different isoforms of P450 reductase. Using GSPs designed from metabolic flux and survival in response to different biotic and
start codons and stop codons, 2058 bp and 2142 bp open reading abiotic stress.
frames (ORFs) were amplified from the pool of leaf cDNA
designated as WsCPR1 and WsCPR2 respectively. Both WsCPR1 In silico Characterization of Deduced WsCPR1 and
and WsCPR2 encoded 685 and 713 amino acid residues WsCPR2
respectively. The first methionine as per First-AUG rule was Pairwise alignment of deduced primary structures of WsCPR1
considered as initiator codon. WsCPR1 having upstream untrans- and WsCPR2 showed that they are 63.14% identical at nucleotide
lated region (UTR; 93 bp) contained stop codons. At 39 ends, and 54.02% at amino acid level. WsCPR1 and WsCPR2 have
WsCPR1 has 357 bp non-coding region and poly-A tail while predicted isoelectric points 5.38 and 5.54 and molecular masses of
WsCPR2 cDNA has non-coding region of 154 nucleotide residues. 76.06 and 79.05 kDa respectively. Alignment of deduced amino
Similarity searches showed that both polypeptides share 80–89% acid sequences of WsCPR1 and WsCPR2 with the known CPRs of
identities with CPRs from other plant species. On the basis of N- taxonomically diverse species showed the presence of several
terminal anchoring sequences, WsCPR1 and WSCPR2 conform to conserved regions. At the N-terminal end of each CPR there is a
Ro et al. [18] classification of CPRs: class I and class II. WsCPR1 membrane anchor region which is essential for normal interaction
has short stretch of amino acids and WsCPR2 contained extended between CPR and P450 monooxygenases. Their presence was also
amino acid sequence at N-terminal. Dual CPRs are reported predicted by TMHMM and SPLIT 4.0 bioinformatics programs
earlier in many plant species like P. crispum, A. thaliana, and G. (Figure S1). FMN domain is connected to FAD domain via a
hirusitum [19,21,23]. Recently, in A. thaliana third isoform has also flexible linker region and NADPH binding domain is present near
been cloned and proved to be essential for embryo development C-terminal end (Figure 2). The CPRs are supposed to have

PLOS ONE | www.plosone.org 11 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 9. Time course effect of elicitor treatments on expression profiles of WsCPRs paralogs. 9A: Time courses of WsCPR1 and WsCPR2
expression in micropropagated Withania somnifera induced by methyl jasmonate (MeJA; 0.1 mM) and salicylic acid (SA; 0.1 mM) treatments. The
numbers above indicate the different time points in hours. MeJA and SA were added to the micro-propagated plantlets precultured for 2 wk on
Hoagland’s medium. Total RNA from each sample was used for quantitation. Actin was kept as internal control. 9B: Expression profiles obtained by
densitometric quantification of band intensities. Experiments were performed in triplicate with similar results; error bars indicate 6 standard
deviation of the mean. IOD, integrated optical density; A.U., arbitrary units.
doi:10.1371/journal.pone.0057068.g009

evolved from ancestral fusion of two separate genes as the FMN- extended strands (14.16%; 13.88%), and random coils (38.39%;
containing bacterial flavodoxin (Fld) and a FAD-containing 40.48%). Protein sequences when subjected to analysis for
ferredoxin NADP-reductase (FNR) are found to be existing glycosylation sites were found to have two glycosylation sites for
independently [43,44]. WsCPR1 and WsCPR2 contain conserved WsCPR1 (at 278 and 514 aa residues) and one for WsCPR2 (at
acidic amino acid sequences (WsCPR1: LGDDDQCIEDD, 28 aa residue) respectively. For the prediction of chloroplast
WsCPR2: YGDGEPT) which are proposed to interact with localization, WsCPR amino acid sequences were in silico analysed
cytochrome c and P450s, existing nearby FMN domain [43,45]. with ChloroP program. Scores for potential chloroplast targeting
The linker region which joins the FAD and FMN somehow allows of CPR isoforms were, 0.463 for WsCPR1 and WsCPR2 scored
the conformational changes in the position of FMN domain to 0.513. There was high Ser content at N-terminal in WsCPR2,
interact with various P450s [46]. which is predicted to be required for chloroplast targeting.
To ascertain the degree of evolutionary relatedness, Neighbour- Subcellular localization study of CPR proteins in Hybrid poplar
joining phylogenetic tree was constructed with MEGA 5 software has been experimentally demonstrated that they are confined to
from the ClustalW alignment of the WsCPR1 and WsCPR2 with ER only [18]. However, in silico prediction do not rule out the
number of CPR sequences of different plants retrieved from the possibility of their localization to chloroplast membrane also [17].
NCBI GenBank database. The WsCPR1 and WsCPR2 included Three dimensional structural models on the basis of homology
into separate phylogenetic groups in accordance with the amino based modelling using rat CPR (PDB: IJ9Z) as template were
acid similarity among their proteins (Figure 3). The CPR1 cluster generated by using Phyre2 with .90% accuracy (Figure 4A and
contained sequences from only eudicotyledons, while the CPR2 4D). For modelling WsCPR1 and WsCPR2 proteins, templates
cluster had both monocotyledons and eudicotyledon specific (WsCPR1:1TLL, 1J9Z, 2BPO and WsCPR2; 2IJ2A 1TLL, 1J9Z,
sequences. The presence of CPR1 and CPR2 homologs in 2BPO) were selected based on heuristics to maximise confidence,
eudicotyledons and absence of CPR1 homologs in monocotyledon percentage identity and alignment coverage. 63 residues for
strongly suggests the gene duplication event giving rise to the WsCPR1 and 44 residues for WsCPR2 were modelled by ab initio.
CPR2 cluster [43]. Secondary structure analysis of WsCPR In different crystallographic studies, plausible structural explana-
proteins by SOPMA program revealed that they consist of a- tion for the mechanism of electron transfer and interaction of
helixes (43.36%; 41.23%), b-turns (4.09%; 4.49%) joined by different domains has been elegantly described in a very precise

PLOS ONE | www.plosone.org 12 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

Figure 10. Time course effect of elicitor treatments on withanolides accumulation. 10A: Effect of methyl jasmonate (MeJA) treatment on
withanolides accumulation at different time intervals. HPLC analysis demonstrated the change in three key withanolides of withanolide A (WS-1),
withanone (WS-2) and withaferin A (WS-3) at 6, 12, 24 and 48 h after treatments of micro-shoots with 0.1 mM MeJA. WS-3 was observed to be
enhanced more with respect to WS-1 while WS-2 was detected in sample harvested after 48 h. All values obtained were means of triplicate with
standard errors. Time course accumulation of WS-1 and WS-3 was statistically significant at p,0.01 level. 10B: Effect of salicylic acid (SA) on
withanolide accumulation at different time interval. The WS-3 level was also up-regulated in salicylic acid treated samples but WS-1 was enhanced
more in comparison to methyl jasmonate (MeJA) treated samples. All values obtained were means of triplicate with standard errors. Time course
accumulation of WS-1 and WS-3 was statistically significant at p,0.001 level.
doi:10.1371/journal.pone.0057068.g010

way by some authors [47,48,49]. The amino acid residues and N-terminal GST-tag containing a thrombin recognition site
involved in ligand binding were also predicted using the was intended for expression of both the proteins. The genes of
3DLigandSite tool as depicted in Figure 4B and 4E. Analysis of WsCPR1 and WsCPR2 cleaved from the pJET-WsCPR1 and pJET-
the evolutionary conservation of WsCPR1 and WsCPR2 surface WsCPR2 using BamHI/XhoI and BamHI/NotI were inserted into
amino acids were performed using ConSurf program. Several vector pGEX4T-2. The recombinant expression vectors with the
residues with high scores were found to be functional and inserted WsCPR1 and WsCPR2 were identified by PCR and
structural residues of the proteins by ConSeq servers (Figure 4C digestion with BamHI/XhoI and BamHI/NotI. The highest expres-
and 4F). sion of proteins was observed at 25uC using 0.8 mM ITPG after
8–12 h of induction. The fusion protein having molecular weight
Heterologous Expression in E. coli and Protein of ,105 kDa was expressed by the pGEX-WsCPR1 and detected
Purification by SDS-PAGE analysis. The molecular weight was identical to the
To confirm whether WsCPR1 and WsCPR2 encode for two predicted molecular mass of the recombinant protein composed of
different proteins, both genes were expressed in E.coli BL21 (DE3). GST (26 kDa) and WsCPR1. Similarly, the pGEX-WsCPR2
An IPTG inducible E.coli expression vector having Tac promoter produced a band of fusion protein of ,107 kDa. Furthermore,

PLOS ONE | www.plosone.org 13 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

the PGEX4T-2 vector was also transformed into E.coli BL21 (DE3) c while for WsCPR2 Km value was 6.4860.33 mM. It has been
cells and the GST protein of 26 kDa was expressed successfully shown that addition of FMN to the reaction mixture increases the
(Figure 5A). Time course study revealed that the optimum specific activities of other CPRs which is mainly due to depletion
expression of WsCPR2, as examined from SDS-PAGE profile of FMN domain during the isolation of microsomal fraction
was obtained after 12 h of induction at 25uC (Figure 5B). [23,44]. Contrary to these observations, addition of FMN to
Previously, functional expression of CPR in E.coli has been WsCPR1 and WsCPR2 did not affect the activity as the purified
reported from Musca domestica, human and G. hirusitum [23,50,51]. proteins contained all the domains intact including membrane
The CPR used by Wang el al. [46] for X-ray crystallography was anchor.
also expressed in E.coli in truncated form. Nevertheless, in all
studies, the CPRs have been purified from microsomal fraction Tissue-specific Expression Analysis Using qPCR
because these are localized to membrane. The cloning of WsCPR1 To study the WsCPR1 and WsCPR2 gene expression pattern
and WsCPR2 in pGEX4T-2 having N-terminal GST-tags allowed and levels in different tissues of W. Somnifera, total RNA of leaves,
their expression in soluble fraction along with their membrane stalks, roots, flowers and berries (unripen) from four month old
anchor regions. Based on the principle of affinity chromatography, plant was used as template for quantitative real-time PCR. The
recombinant fusion proteins having GST-tags were purified using results showed that WsCPR1 and WsCPR2 expressed constitutively
glutathione sepharose beads. Initially, their expression was with varying expression levels in different tissues as depicted in
localized to inclusion bodies at 37uC but lowering the temperature Figure 8. WsCPR2 was found to be transcribing more in all tissues
to 25uC allowed protein expression in solubilised form. Protein in comparison to WsCPR1. However, highest expression of CPR1
purity of the two soluble proteins was enriched up to more than was observed in roots among all the tissues. The expression pattern
90% in a single step. The purified fusion protein bands of WsCPR1 of WsCPR2 is in agreement with the higher content of withanolides
at ,105 kDa and WsCPR2 at ,107 kDa in molecular mass were in leaves of W. somnifera as reported earlier [30,38] and probably
observed on SDS-PAGE (Figure 6). The GST-WsCPR1 and GST- indicates their involvement to meet the high reductive demand of
WsCPR2 fusion was cleaved by thrombin protease and purified different P450 monooxygenases for driving the biosynthesis of
which showed intense band of ,77 and ,79 kDa (Figure 6) withanolides. Various steroidal lactone triterpenoids including
respectively. The amount of purified WsCRP1 was 0.30 mg/ml withanolides are synthesized via both MVA and DOXP pathways
while the WsCPR2 was 0.14 mg/ml. involving CPR dependent monooxygenases like squalene epox-
idase and obtusifoliol-14-demethylase [12]. Similarly, the expres-
Southern Blotting sion analysis of obtusifoliol-14-demthylase (CYP51) and sterol
To determine the gene copy number and further validation of methyl transferase (SMT-1) has been preponderant in leaves of W.
two paralogs of CPR in W. somnifera, southern blot analysis was somnifera than in other tissues [52]. mRNA levels of multiple
carried out under high stringency conditions using DIG-labelled orthologs of different plants like P. crispum, A. thaliana and Hybrid
full length probes for WsCPR1 and WsCPR2 [21]. A set of three poplar varied in relation to tissues analysed depending on the
restriction enzymes for each CPR was used in the study. Among species [18,19,21]. However, higher transcript levels of CPR2 in
them two enzymes have no restriction sites in coding sequence of flowers and stems from A. thaliana were apparently matched by
genes and one enzyme has one cutting site for both WsCPR1 and higher expression of P450s. This possibly indicates that multiple
WsCPR2. The digested genomic DNA was transferred to positively paralogs may serve as electron donors to large number of
charged membrane and hybridised to probes. In WsCPR1, one cytochrome P450s involved in the biosynthesis of variety of
band was scored in BamHI and NotI digested DNA and two bands natural products.
were detected with BglII digestion (Figure 7A). Similarly for
WsCPR2 the single bands were scored for DNA digested with NotI, Effect of Elicitors on WsCPRs and Withanolides
PvuI enzymes and two bands for EcoRI (Figure 7B). This indicates In vitro cultures established via micro-propagation were used for
that probes of WsCPR1 and WsCPR2 hybridised to their respective MeJA and SA treatments. Micro-shoots were grown for 2 wk in
genes. The results obtained thus suggest that Withania genome Hoagland suspension medium. Subsequently, established shoot
contains two paralogs of P450 reductase and single allele for both cultures were supplemented with either MJ (0.1 mM) or SA
WsCPR1 and WsCPR2. (1 mM) for 48 h. The untreated were kept as control. Samples
were harvested after 6, 12, 24, and 48 h of interval. Equal
NADPH-reductase Assays amounts of DNase-treated RNA (1 mg) of control and treated
It has been earlier demonstrated that CPR1 and CPR2 from samples were converted into cDNA. The effect of MJ and SA on
different plant species have different specific activities and most of expression profile of WsCPR1 and WsCPR2 was studied using
them have been assayed using microsomal fraction or truncated semi-quantitative PCR and densitometric quantitation of relative
polypeptide (without membrane anchor). In this investigation, we band intensities was normalized to relative optical unit of actin
were able to purify the proteins with membrane anchors. Purified (Figure 9A and 9B). The treatments with MeJA and SA resulted in
WsCPR1 and WsCPR2 used NADPH as electron donor for induction of WsCPR2 while the expression of WsCPR1 remained
reducing its substrate cytochrome c where WsCPR1 was observed unchanged. These observations are in agreement with earlier
to possess higher specific activity of 7.5660.06 mmol min21 mg21 report on C. erythrium where only CPR2 was induced on treatment
while as specific activity of WsCPR2 was 6.8360.06 mmol with MeJA [22]. In A. thaliana and G. hirsutum, CPR1 expresses
min21 mg21 (Table 2). For kinetic studies of WsCPRs, the constitutively while CPR2 was induced by environmental stimuli,
enzyme and NADPH were kept constant whereas the concentra- such as wounding and light treatments [21]. MeJA and SA are
tion of cytochrome c was taken in increasing order. As the generally considered to modulate expression of genes involved in
substrate concentration was increased, the amount of products defence responses, flowering and senescence including the genes
produced also increased. Vmax of each purified protein was also that code for enzymes catalysing the formation of secondary
calculated as shown in Table 2.This was explained by Michaelis- metabolites [53,54]. Treatment of these signalling molecules has
Menten plot (Figure S2). The apparent Km value for WsCPR1 was been reported to enhance the biosynthesis of triterpenes in some
5.0660.30 mM which showed its high affinity towards cytochrome medicinal plants like P. ginseng and Centella asiatica [55,56]. The

PLOS ONE | www.plosone.org 14 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

elicitors strongly enhanced the transcript level of WsCPR2 which indicates toward the possible role of CPR in metabolic regulation.
had a positive influence on withanolides accumulation. To The present investigation also suggests that CPRs express
establish a correlation between expression profiles and metabolite constitutively and at least one CPR is inducible. All the inducible
flux, withanolides extracted from the treated samples were CPRs reported so far belong to class II. CPRs are the most
subjected to HPLC analysis (Figure S3). There was increase in important class of enzymes and modulate the fate of various P450
WS-1 and WS-3 over a period of time in response to elicitor involved in primary and secondary metabolite synthesis. For
treatments. In MeJA treated samples there was a significant homologous modulation of withanolide biosynthetic pathway, we
increase in WS-1 (36.66960.592141.53360.42 mg mg21 of dry have established an efficient Agrobacterium transformation system
weight) and WS-3 (396.3760.4422629.39760.41 mg mg21 of dry (unpublished). The Agrobacterium mediated transformation protocol
weight) while as WS-2 accumulated meagrely (13.81860.14 mg for Withania can be deployed to understand the regulatory role of
mg21 of dry weight) after 48 h (Figure 10A). SA treated samples CPRs for enhanced production of withanolides as higher
showed marked increase in both WS-1 transcript levels of key regulatory genes have a cascading influence
(36.66960.592257.54660.29 mg mg21 of dry weight) and WS- on the up-regulation of downstream genes thus increasing the
3(396.3760.4421505.46360.41 mg mg21 of dry weight) with no overall metabolite levels. We have already cloned and character-
traces of WS-2 (Figure 10B). Absence or low production of WS-2 is ized three more withanolide biosynthetic pathway genes which
possibly linked to inherently lower levels of WS-2 accumulation include squalene synthase [30], squalene epoxidase [57], cycloar-
even in cultivated accessions of W. somnifera [38].In one of our tenol synthase (NCBI GenBank Acc. No. GU590576). Character-
previous reports, MeJA and SA up-regulated the expression of ization of W. somnifera NADPH-P450 reductases may further
squalene synthase gene which plays an important regulatory role facilitate elucidation of biosynthetic pathway of different with-
in the phytosterol biosynthetic pathway [30]. These elicitors are anolides.
important components of signal transduction cascades activating
plant’s defence response against pathogen attack and often result
in increased metabolite accumulation.
Supporting Information
Figure S1 Protpram and THMM prediction of WsCPR1
Conclusion and WsCPR2.
Pharmacological studies are positioning withanolides as prom- (TIF)
ising lead molecules for screening against various critical diseases
Figure S2 Kinetic study of WsCPR1 and WsCPR2.
and ailments. Chemically these compounds are well investigated
but there exists sparse information regarding their biosynthesis. (TIF)
Understanding of various enzymatic or regulatory steps involved Figure S3 HPLC chromatograms of elicitor treated
in secondary metabolite biosynthesis is a prerequisite for metabolic samples.
engineering. Pathway intensification leading to enhanced produc- (TIF)
tion of metabolites in host plant or heterologous production in
microbial systems can prove to be important for their scalable Acknowledgments
production. Keeping this perspective in view, we have successfully
cloned and characterized two paralogs of CPR. The fully This manuscript represents institutional communication number IIIM/
functional proteins were purified from bacterial extract and 1500/2012.
enzymatically assayed using cytochrome c as substrate. Further,
validation of CPR isoforms was done using southern blot analysis Author Contributions
which confirmed that two separate genes exist in Withania genome. Conceived and designed the experiments: SKL RV. Performed the
Expression pattern for WsCPR1 and WsCPR2 in different plant experiments: S. Rana ND S. Razdan WWB. Analyzed the data: S. Rana
parts was studied using quantitative real-time PCR. Effect of ND SKL RSD. Contributed reagents/materials/analysis tools: RV SKL
MeJA and SA and their correlation with withanolides production RSD. Wrote the paper: S. Rana SKL.

References
1. Lattoo SK, Dhar RS, Khan S, Bamotra S, Dhar AK (2007) Temporal sexual 8. Hahm ER, Moura MB, Kelley EE, Van Houten B, Shiva S, et al. (2011)
maturation and incremental staminal movement encourages mixed mating in Withaferin A-Induced Apoptosis in Human Breast Cancer Cells Is Mediated by
Withania somnifera - An insurance for reproductive success. Current Science 92: Reactive Oxygen Species. Plos One 6.
1390–1399. 9. Kaileh M, Vanden Berghe W, Heyerick A, Horion J, Piette J, et al. (2007)
2. Rana S, Dhar N, Bhat WW, Razdan S, Khan S, et al. (2012) A 12- Withaferin A strongly elicits I kappa B kinase beta hyperphosphorylation
deoxywithastramonolide-rich somaclonal variant in Withania somnifera (L.) concomitant with potent inhibition of its kinase activity. Journal of Biological
Dunal–molecular cytogenetic analysis and significance as a chemotypic resource. Chemistry 282: 4253–4264.
In Vitro Cellular & Developmental Biology-Plant: 1–9. 10. Koduru S, Kumar R, Srinivasan S, Evers MB, Damodaran C (2010) Notch-1
3. Mishra LC, Singh BB, Dagenais S (2000) Scientific basis for the therapeutic use Inhibition by Withaferin-A: A Therapeutic Target against Colon Carcinogen-
of Withania somnifera (ashwagandha): a review. Alternative medicine esis. Molecular Cancer Therapeutics 9: 202–210.
review: a journal of clinical therapeutic 5: 334–346. 11. Kuzuyama T (2002) Mevalonate and nonmevalonate pathways for the
4. Kulkarni SK, Dhir A (2008) Withania somnifera: An Indian ginseng. Progress in biosynthesis of isoprene units. Bioscience, biotechnology, and biochemistry 66:
Neuro-Psychopharmacology & Biological Psychiatry 32: 1093–1105. 1619–1627.
5. Jayaprakasam B, Padmanabhan K, Nair M (2010) Withanamides in Withania 12. Chaurasiya N, Sangwan N, Sabir F, Misra L, Sangwan R (2012) Withanolide
somnifera Fruit Protect PC-12 Cells from beta-Amyloid Responsible for biosynthesis recruits both mevalonate and DOXP pathways of isoprenogenesis
Alzheimer’s Disease. Phytotherapy Research 24: 859–863. in Ashwagandha Withania somnifera L. (Dunal). Plant Cell Reports 31: 1889–
6. Elsakka M, Grigorescu E, Stanescu U, Dorneanu V (1990) New data referring to 1897.
chemistry of Withania somnifera species. Revista medico-chirurgicala a Societatii 13. Guengerich FP (2001) Common and uncommon cytochrome P450 reactions
de Medici si Naturalisti din Iasi 94: 385–387. related to metabolism and chemical toxicity. Chemical Research in Toxicology
7. Mirjalili MH, Moyano E, Bonfill M, Cusido RM, Palazon J (2009) Steroidal 14: 611–650.
lactones from Withania somnifera, an ancient plant for novel medicine. 14. Hrycay EG, Bandiera SM (2012) The monooxygenase, peroxidase, and
Molecules. Switzerland. 2373–2393. peroxygenase properties of cytochrome P450. Archives of Biochemistry and
Biophysics 522: 71–89.

PLOS ONE | www.plosone.org 15 February 2013 | Volume 8 | Issue 2 | e57068

 NADPH:P450 Reductase Paralogs from W. somnifera

15. Nelson DR, Schuler MA, Paquette SM, Werck-Reichhart D, Bak S (2004) 37. Sambrook J, Russell DW (2001) Molecular Cloning: A Laboratory Manual:
Comparative genomics of rice and Arabidopsis. Analysis of 727 cytochrome Cold Spring Harbor Laboratory Press.
P450 genes and pseudogenes from a monocot and a dicot. Plant Physiology 135: 38. Dhar RS, Verma V, Suri KA, Sangwan RS, Satti NK, et al. (2006)
756–772. Phytochemical and genetic analysis in selected chemotypes of Withania
16. Simmons DL, Lalley PA, Kasper CB (1985) Chromosomal assignments of genes somnifera. Phytochemistry 67: 2269–2276.
coding for components of the mixed-function oxidase system in mice. Genetic 39. Urban P, Mignotte C, Kazmaier M, Delorme F, Pompon D (1997) Cloning,
localization of the cytochrome P-450PCN and P-450PB gene families and the yeast expression, and characterization of the coupling of two distantly related
nadph-cytochrome P-450 oxidoreductase and epoxide hydratase genes. The Arabidopsis thaliana NADPH-cytochrome P450 reductases with P450
Journal of biological chemistry 260: 515–521. CYP73A5. J Biol Chem 272: 19176–19186.
17. Huang FC, Sung PH, Do YY, Huang PL (2012) Differential expression and 40. McLean KJ, Sabri M, Marshall KR, Lawson RJ, Lewis DG, et al. (2005)
functional characterization of the NADPH cytochrome P450 reductase genes Biodiversity of cytochrome P450 redox systems. Biochemical Society Transac-
from Nothapodytes foetida. Plant Sci. Ireland: 2012 Elsevier Ireland Ltd. 16–23. tions 33: 796–801.
18. Ro D, Ehlting J, Douglas C (2002) Cloning, functional expression, and 41. Varadarajan J, Guilleminot J, Saint-Jore-Dupas C, Piegu B, Chaboute M, et al.
subcellular localization of multiple NADPH-cytochrome P450 reductases from (2010) ATR3 encodes a diflavin reductase essential for Arabidopsis embryo
hybrid poplar. Plant Physiology 130: 1837–1851.
development. New Phytologist 187: 67–82.
19. Koopmann E, Hahlbrock K (1997) Differentially regulated NADPH: cyto-
42. Mizutani M, Ohta D (2010) Diversification of P450 genes during land plant
chrome P450 oxidoreductases in parsley. Proceedings of the National Academy
evolution. Annu Rev Plant Biol 61: 291–315.
of Sciences of the United States of America 94: 14954–14959.
20. Benveniste I, Lesot A, Hasenfratz MP, Kochs G, Durst F (1991) Multiple forms 43. Jensen K, Moller B (2010) Plant NADPH-cytochrome P450 oxidoreductases.
of NADPH-cytochrome P450 reductase in higher plants. Biochem Biophys Res Phytochemistry 71: 132–141.
Commun 177: 105–112. 44. Smith G, Tew D, Wolf C (1994) Dissection of NADPH-cytochrome P450
21. Mizutani M, Ohta D (1998) Two isoforms of NADPH: cytochrome P450 oxidoreductase into distinct functional domains. Proceedings of the National
reductase in Arabidopsis thaliana - Gene structure, heterologous expression in Academy of Sciences of the United States of America 91: 8710–8714.
insect cells, and differential regulation. Plant Physiology 116: 357–367. 45. Shen A, Kasper C (1993) Role of Acidic Residues in the Interaction of Nadph-
22. Schwarz H, Liu B, Peters S, Barillas W, Beerhues L (2009) Purification, cDNA Cytochrome-P450 Oxidoreductase with Substrates. Protein Engineering 6: 50–
cloning and functional expression of NADPH-cytochrome P450 reductase from 50.
Centaurium erythraea cell cultures. Plant Biol (Stuttg) 11: 300–306. 46. Wang M, Roberts D, Paschke R, Shea T, Masters B, et al. (1997) Three-
23. Yang CQ, Lu S, Mao YB, Wang LJ, Chen XY (2010) Characterization of two dimensional structure of NADPH-cytochrome P450 reductase: Prototype for
NADPH: Cytochrome P450 reductases from cotton (Gossypium hirsutum). FMN- and FAD-containing enzymes. Proceedings of the National Academy of
Phytochemistry 71: 27–35. Sciences of the United States of America 94: 8411–8416.
24. Eberle D, Ullmann P, Werck-Reichhart D, Petersen M (2009) cDNA cloning 47. Sevrioukova I, Li H, Zhang H, Peterson J, Poulos T (1999) Structure of a
and functional characterisation of CYP98A14 and NADPH:cytochrome P450 cytochrome P450-redox partner electron-transfer complex. Proceedings of the
reductase from Coleus blumei involved in rosmarinic acid biosynthesis. Plant National Academy of Sciences of the United States of America 96: 1863–1868.
Mol Biol 69: 239–253. 48. Hubbard P, Shen A, Paschke R, Kasper C, Kim J (2001) NADPH-cytochrome
25. Shet MS, Sathasivan K, Arlotto MA, Mehdy MC, Estabrook RW (1993) P450 oxidoreductase - Structural basis for hydride and electron transfer. Journal
Purification, characterization, and cDNA cloning of an NADPH-cytochrome of Biological Chemistry 276: 29163–29170.
P450 reductase from mung bean. Proc Natl Acad Sci U S A 90: 2890–2894. 49. Aigrain L, Pompon D, Truan G, Morera S (2009) Cloning, purification,
26. Rosco A, Pauli HH, Priesner W, Kutchan TM (1997) Cloning and heterologous crystallization and preliminary X-ray analysis of a chimeric NADPH-
expression of NADPH-cytochrome P450 reductases from the Papaveraceae. cytochrome P450 reductase. Acta Crystallographica Section F-Structural
Arch Biochem Biophys 348: 369–377. Biology and Crystallization Communications 65: 210–212.
27. Jennewein S, Park H, DeJong JM, Long RM, Bollon AP, et al. (2005) 50. Andersen J, Utermohlen J, Feyereisen R (1994) Expression of house-fly cyp6a1
Coexpression in yeast of Taxus cytochrome P450 reductase with cytochrome and NADPH-cytochrome P450 reductase in Escherichia coli and reconstitution
P450 oxygenases involved in Taxol biosynthesis. Biotechnol Bioeng 89: 588– of an insecticide-metabolizing P450 system. Biochemistry 33: 2171–2177.
598. 51. Pritchard M, Glancey M, Blake J, Gilham D, Burchell B, et al. (1998) Functional
28. Werck-Reichhart D, Hehn A, Didierjean L (2000) Cytochromes P450 for co-expression of CYP2D6 and human NADPH-cytochrome P450 reductase in
engineering herbicide tolerance. Trends Plant Sci 5: 116–123. Escherichia coli. Pharmacogenetics 8: 33–42.
29. Feldmann KA (2001) Cytochrome P450s as genes for crop improvement. Curr
52. Pal S, Singh S, Shukla AK, Gupta MM, Khanuja SPS, et al. (2011) Comparative
Opin Plant Biol 4: 162–167.
withanolide profiles, gene isolation, and differential gene expression in the leaves
30. Bhat WW, Lattoo SK, Razdan S, Dhar N, Rana S, et al. (2012) Molecular
and roots of Withania somnifera. Journal of Horticultural Science &
cloning, bacterial expression and promoter analysis of squalene synthase from
Biotechnology 86: 391–397.
Withania somnifera (L.) Dunal. Gene 499: 25–36.
31. Duan H, Schuler M (2006) Heterologous expression and strategies for 53. Wasternack C, Parthier B (1997) Jasmonate-signalled plant gene expression.
encapsulation of membrane-localized plant P450s. Phytochemistry Reviews 5: Trends in Plant Science 2: 302–307.
507–523. 54. Lamb C, Dixon RA (1997) The oxidative burst in plant disease resistance. Annu
32. Schuler MA, Werck-Reichhart D (2003) Functional genomics of P450s. Annual Rev Plant Physiol Plant Mol Biol 48: 251–275.
Review of Plant Biology 54: 629–667. 55. Lee MH, Jeong JH, Seo JW, Shin CG, Kim YS, et al. (2004) Enhanced
33. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) triterpene and phytosterol biosynthesis in Panax ginseng overexpressing squalene
Clustal W and clustal X version 2.0. Bioinformatics 23: 2947–2948. synthase gene. Plant Cell Physiol. Japan. 976–984.
34. Geourjon C, Deleage G (1995) SOPMA: significant improvements in protein 56. Kim OT, Kim SH, Ohyama K, Muranaka T, Choi YE, et al. (2010)
secondary structure prediction by consensus prediction from multiple align- Upregulation of phytosterol and triterpene biosynthesis in Centella asiatica hairy
ments. Comput Appl Biosci 11: 681–684. roots overexpressed ginseng farnesyl diphosphate synthase. Plant Cell Rep 29:
35. Kelley LA, Sternberg MJE (2009) Protein structure prediction on the Web: a 403–411.
case study using the Phyre server. Nature Protocols 4: 363–371. 57. Razdan S, Bhat W, Rana S, Dhar N, Lattoo S, et al. (2012) Molecular
36. Wass MN, Kelley LA, Sternberg MJE (2010) 3DLigandSite: predicting ligand- characterization and promoter analysis of squalene epoxidase gene from
binding sites using similar structures. Nucleic Acids Research 38: W469–W473. Withania somnifera (L.) Dunal. Molecular Biology Reports: 1–12.

PLOS ONE | www.plosone.org 16 February 2013 | Volume 8 | Issue 2 | e57068