Report on the workshop

Technical solutions for biosecurity in synthetic biology

held on April 03rd, 2008 in Munich

Dr. Hubert Bernauer, Jason Christopher, Dr. Werner Deininger, Markus Fischer, Philip
Habermeier, Dr. Klaus Heumann, Prof. Stephen Maurer, Dr. Heinz Schwer, Peer Stähler,
Tobias Wagner

IASB
Industry Association Synthetic Biology

www.ia-sb.eu
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 2

1 Introduction
Synthetic biology is a rapidly evolving field, which is based on the exciting proposition of
applying our deepening understanding of biological system to technical problems, creating
de novo solutions synthetically. Such solutions can be new features of existing living
systems - mostly bacteria - but also the construction of entirely new organisms, such as the
Mycoplasma bacterium based on a minimal genome created by Craig Venter.1
At the basis of synthetic biology is the ability to create components of biological systems
artificially and in a highly efficient way. This ability has widely expanded in the past ten
years, leading to a vivid industry of service providers who manufacture custom proteins,
DNA fragments and genes on demand. In particular, the field of gene synthesis has seen a
dramatic development from a small niche technology to a widely applied standard technique.
Today synthetic genes can be produced on demand, with virtually no limits in quantity and
length.
In parallel, an exhaustive infrastructure has been created for the collection, storage and
processing of genetic information. In combination with software for the design of new genes,
these resources can be used to rapidly assemble complex genetic networks.
These developments in the field of synthetic biology open up exciting new opportunities for
research and industry. The power of the resulting biotechnological applications has vastly
increased in the past decade. Concerns have been raised that this power may be abused.
In its most recent unclassified report on the future global landscape, the U.S. National
Intelligence Council predicted that a major terrorist attack employing biological agents will
likely occur by 2020. Leading committees and reports on both sides of the Atlantic have
uniformly recommended the implementation of technical measures to screen synthetic
biology projects for biosecurity risks, including the Fink Report2 and the report of the Royal
Academy/Wellcome Trust3. The EU research project synbiosafe4 described in a recent
report on the biosecurity awareness in Europe ongoing public efforts and their reception by
the synthetic biology community5.
In the light of these concerns, the Industry Association Synthetic Biology (IASB) has
organized a workshop on technical solutions for improved biosecurity in synthetic biology.
The workshop took place on April 3rd, 2008 in Munich. The workshop was attended by
leading companies from both sides of the Atlantic as well as representatives of the
International Consortium for Polynucleotide Synthesis trade association. Collectively, the
group provided a broad, representative cross-section of gene synthesis companies
worldwide.
This is a report of the workshop and the resulting action items and agreements. The
intention of the workshop was to promote the development and implementation of technical
measures that address current and future biosecurity threats.
The workshop was borne out of our responsibility for the scientific field to which we provide
services and products. It is our conviction that the still relatively moderate size of the field of
synthetic biology opens up a unique opportunity to develop and implement reasonable, cost-
effective responses to potential biosecurity threats and build a foundation for future
developments.
There is now a clear consensus around several strategies that can and should be part of a
unified strategy towards increased biosecurity in synthetic biology. This basic agreement
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 3

includes a detailed list of projects in which members agreed to take concrete measures to
improve biosecurity over the next year. The resulting Work Packages and other initiatives
can be found in Section 12 of this report.

2 Participants
The workshop was organized by the Industry Association Synthetic Biology (IASB), the
current members of which are (in alphabetical order) ATG:Biosynthetics GmbH, Biomax
Informatics AG, Entelechon GmbH, febit Holding GmbH, MWG Biotech AG, and Sloning
Biotechnology GmbH. In addition to representatives from the IASB members, there were a
number of distinguished representatives from the academic field, the industry and
government-associated organizations present:

First name Last name Organization

Tom Bayer Eurofins MWG
Alexandra Beil Sloning
Hubert Bernauer ATG Biosynthetics
Luis Campos Drew University
Anthony Caruso Febit
Jason Christopher Goldman School of Public Policy
Werner Deininger Entelechon GmbH
Markus Fischer Entelechon GmbH
Sibylle Gaisser TESSY
Marcus Graf GeneArt
Philipp Habermeier Febit
Gudrun Horn Sloning
Robert Jones Craic Computing LLC
Stephanie Kretz Europäische Union
Josef Maier IStLS - Information Services to Life Science
Steve Maurer Goldman School of Public Policy
Kathryn Nixdorff Universität Darmstadt
Catherine Rhodes University of Bradford
Maxim Scheremetjew Universität Halle-Wittenberg
Heinz Schwer Sloning
Peer Stähler Febit
Eva Sterzel Febit
Karoline Stürmer Geneart AG
Terence Taylor International Council for the Life Sciences
Damon Terrill Integrated DNA Technologies, Inc.
Tobias Wagner Eurofins MWG
Anna Zmorzynska Universität Hamburg
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 4

3 The problem of biosecurity in synthetic biology

The assembly of artificial DNA into functional genes and the production of proteins from
such genes is available as a highly standardized commercial service. This international
industry currently fills thousands of orders for whole genes and millions of orders for short
oligonucleotides each day.
.

Mammalian genomes
Bacterial genomes
Gene synthesis 2010
Gene synthesis 2008
Oligonucleotide synthesis
Chemical components

1 10 100 1k 10k 100k 1m 10m 100m 1b

Nucleotides

Fig. 1: Scales of naturally occurring nucleic acid species and the

capabilities of current and future synthesis processes

In some instances, these orders comprise DNA sequences derived from pathogenic
organisms, and in rare cases from pathogens with an extremely high mortality rate, such as
the Ebola virus.
So far, none of these orders has been identified as malevolent. Instead, they relate to work
on new vaccines, on basic research to better understand mechanisms of pathogenicity or to
clinical research and drug discovery.
Nevertheless, it is important for gene synthesis companies to detect such orders for genes
of concern effectively and efficiently. To achieve this, almost all gene synthesis houses apply
a screening process in which incoming orders are homology matched against a database.
However, reports persist that a few gene synthesis companies have yet to embrace this
practice and this loophole needs to be closed.6
The reference database usually consists of all known genomic sequences of a list of
pathogenic agents - oftentimes this list is either the list of select agents or the Australia
group list or a combination of both. Unfortunately, this leads to a high number of false
positive hits, since for instance harmless housekeeping genes of a pathogenic organism are
highly homologous to those of a non-pathogenic relative. Fixing this problem could
potentially make screening more affordable for gene synthesis companies that currently do
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 5

not screen and make it feasible for companies that produce shorter, oligonucleotide-length
sequences to develop their own screening programs.
In addition, it is unclear how a gene synthesis house is supposed to respond to a true
positive hit. It is difficult to distinguish between legitimate and malicious use cases,
especially since the interaction between customers and suppliers can be very limited.

4 Bioterrorism
Terrorism is a serious threat to the security of the world. The vulnerability of societies to
terrorist attacks results in part from the great technological achievements of the past
decades resulting in proliferation of chemical, biological, and nuclear weapons of mass
destruction, but is also a consequence of highly efficient transportation systems, cheap
travel and advanced interconnectedness of people around the world. A brief report by the
U.S. Central Intelligence Agency on a workshop on new biosecurity threats states the
inherent risk in new biotechnology developments:

According to experts, the biotechnology underlying the development of

advanced biological agents is likely to advance very rapidly, causing a
diverse and elusive threat spectrum. The resulting diversity of new BW
agents could enable such a broad range of attack scenarios that it would
be virtually impossible to anticipate and defend against, they say. As a
result, there could be a considerable lag time in developing effective
7
biodefense measures.

This report reviews and recommends consensus measures that can materially reduce the
risk of a terrorist attack with biological weapons addressing human and agricultural health
systems.
The most frequently cited lists of biological agents with potential to pose a severe threat to
public health and safety are published by the US Federal Register, FDA, NIAID, CDC, by the
American and European Societies for Microbiology and by the WHO. Bio-terrorism agents
are listed under three priority categories: priorities A and B are distinguished on the basis of
easiness of dissemination and transmission of a pathogen from person to person, the
associated mortality and morbidity rates, social disruption potential, and necessity for
enhanced disease surveillance. Category C or third priority contains emerging pathogens
that could be engineered for mass dissemination in the future. A comprehensive summary of
the different pathogens with some of their most important characteristics is attached at the
end of this executive summary. The following bio-terrorism agents are currently considered
as major threats: Bacillus anthracis (anthrax), Clostridium botulinum toxin, Yersinia pestis
(plague), Francisella tularensis (tularemia), Variola major (smallpox) and viral hemorrhagic
fevers (e.g. Ebola, Marburg, Lassa, Junin, Machupo virus, etc.) From a public health
perspective, Influenza A H1/N1 (Spanish Flu), Influenza A H5/N1 (avian flu) and SARS-CoV
represent an additional category of (naturally-)occurring agents with dangerous outbreak
potential.
The power and versatility of modern biotechnological methods is inherently of „dual use‟, and
thus bears a considerable security risk. In the words of Matthew Meselson, a leading
molecular biologist, at the Symposium on Biological Weapons and Bioterrorism of the
American National Academy of Sciences:
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 6

Every major technology (metallurgy, explosives, internal combustion,

aviation, electronics, nuclear energy) has been intensively exploited, not
only for peaceful purposes but also for hostile ones. Must this also happen
with biotechnology, certain to be a dominant technology of the coming
century? During the century just begun, as our ability to modify
fundamental life processes continues its rapid advance, we will be able not
only to devise additional ways to destroy life but ... also ... to manipulate it
– including the processes of cognition, development, reproduction, and
inheritance. A world in which these capabilities are widely employed for
hostile purposes would be a world in which the very nature of conflict has
radically changed. Therein could lie unprecedented opportunities for
8
violence, coercion, repression, or subjugation.

5 National regulation
There exist of course a number of national regulations that deal with biosecurity. Most
countries, including the USA and EU members, have legislation in place for the limitation of
the export of dual use goods. This includes synthetic DNA. In Germany, for instance, the
export is controlled by the BAFA9, and export gene sequences involved in the pathogenicity
mechanism of a range of pathogenic organisms requires an export permit. This permit will
be granted based on an evaluation of the ordered sequence as well as the ordering party.

febit Entelechon
ATG Biosynthetics Geneart
Integrated DNA Technologies
MWG Eurofins
Sloning

Blue Heron
Codon Devices
DNA 2.0

Fig. 2: Place of residence of the IASB and ICPS members who offer
gene synthesis services

The largest part of inquiries for risk-associated gene sequences never surfaces in the public
or at the authorities. There are two reasons for this: First, domestic inquiries10 and orders are
never submitted to authorities. Secondly, since the bureaucratic steps necessary for export
permits are very complicated, customers and suppliers oftentimes discard an order rather
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 7

than going through the paperwork for a permit. Therefore, the relatively strong export
regulations lead to less, not more control of the executive on security-related activities in the
market.
Interestingly enough, legislation for domestic orders is much more relaxed – both in the USA
and the EU. Such legislation is focused much more on biosafety than biosecurity and takes
the view that the shipping of material that is in itself harmless, i.e. does not pose an
immediate biosafety hazard, needs not be restricted nor registered.
Damon Terrill (of IDT) evaluated the significant inter-agency effort now underway in the
U.S. to develop the first generation of federal regulations aimed at reducing the perceived
security risks of synthetic biology. The regulatory principles developed in the U.S. will affect
directly companies and researchers active there, but may also indirectly influence European
and other approaches. Mr. Terrill pointed out that there exists a formal mechanism for the
interaction between the USA and the EU for regulation, which may form the basis of an
emerging regulatory consensus on biosecurity in synthetic biology.
He brought to attention the NSABB (National Science Advisory Board on Biosecurity)
report11 on the question of synthetic biology. This report suggested harmonized guidelines
for the application of the select agent rule, in particular with regard to isolated DNA
sequences as opposed to whole pathogenic organisms. In addition, the report suggested
that US government agencies should implement a requirement for industry suppliers to
screen both their customer contacts and incoming gene sequences. In the long run, the
current Select Agent Rule may be replaced by a tiered system of checks and screens that
accounts for the modular nature of virulence factors and risk-associated genetic elements.
Mr. Terrill pointed out that the current system lacks both in conceptual clarity and in
implementation details. There is currently no permanent reporting mechanism in place which
could be used by industry suppliers to efficiently report suspicious orders. Member
companies of the International Consortium for Polynucleotide Synthesis (ICPS) are currently
working with government agencies – in particular the FBI – to implement a suitable reporting
system as well as adequate response strategies to positive hits.
A Policy Coordinating Committee (PCC) led by staff in the Homeland Security Council has
been established in the US that will address the problem of biosecurity in synthetic biology.
The PCC has issued eight taskings, of which two are currently being pursued actively: the
creation of harmonized guidelines to the Select Agent Rule12; and the engagement of
stakeholders, i.e. industry producers and consumers. The latter has been realized in the
form of the industry / FBI collaboration, in particular. It is clear that US activities in the field of
biosecurity are much more prevalent than those from the EU. Therefore, the IASB will seek
the dialog with EU representatives to address this deficit in EU policy making.
Robert Jones noted that there is strong interest from the US executive branch in promoting
screening practices and creating technical solutions for this purposes. However, there is
currently not yet any funding available from the US government. Therefore, it is important
that industry proceed with developing technical solutions immediately rather than waiting for
government support to materialize.

6 Biosafety considerations
Sibylle Gaisser raised the issue of balancing biosecurity and biosafety. So far very few
concerns have been raised that are specific to synthetic biology. Most biosafety
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 8

considerations for general molecular biology and genetic engineering apply to synthetic
biology as well, and perhaps to a larger extent due to the efficiency and scalability of the
field. However, it is conceivable that new biosafety risks emerge from synthetic biology in
relatively short time. IASB wants to anticipate and address these issues, and it was agreed
that a similar event to this workshop will be organized. As shown in an analysis13 recently
carried out on behalf of the BBSRC in the UK two of the five areas of concern in Synthetic
Biology14 are directly linked to biosafety issues. These are
 uncontrolled environmental release
 creating artificial life
A number of important lessons can be learnt from the history of recombinant DNA, including
that it is essential for the scientific community to play a leadership role in addressing risks
and ethical issues, introducing pre-emptive policy initiatives, applying tight regulation in the
beginning which can be relaxed over the time and stimulating open public debate. The need
for a timely clarification of ethical issues and the development of a coordinated regulation for
biorisks, biosafety and biosecurity was shown in the Roadmap for Synthetic Biology in
Europe which was developed in the European TESSY project15 under the coordination of the
Fraunhofer Institute for Systems and Innovation Research, Karlsruhe, Germany. IASB wants
to anticipate and address these issues, and the IASB aims to organize a workshop
specifically on the topic of biosafety.

7 Current state of screening

Workshop participants uniformly agreed that synthetic biology's principal risk for the
immediate future was that terrorists could use artificial DNA to recreate naturally occuring
pathogens like smallpox or 1918 influenza. This implies that better screening – including
both extending existing methods to the handful of gene synthesis companies that do not use
them and the development of more powerful, second generation technologies – are a
powerful lever for managing this risk.

7.1 Sequence screening

Virtually all gene synthesis providers in Europe and the USA have a screening system and
policy in place. Robert Jones described the current implementation of screening
procedures: The usual setup consists of a BLAST homology search of DNA or protein
sequences of incoming orders / inquiries against a subset database of Genbank. The subset
may vary between companies, but generally consists of all available genetic information for
selected pathogenic organisms (such as all organisms on the Australia Group common
control lists16 or the Select Agent list17).
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 9

Gene synthesis company Government

Select Agent
List
ATGCACAGGACAGATTAGACAC
CAGAGACCAGAGATTGGAGAA
GAGCACC...
Australia Group
List

Requested sequence Internal database

of critical sequences
In-house expert Other custom
(Molecular biologist) precompiled lists

Counter-terrorism
lists

Internal database
Customer In-house expert of restricted users Export control
(Accounting, Export lists
control)

Fig. 3: Schematic of the screening processes implemented at gene

synthesis companies. Both biological sequences and customers
are screened. The screening is done on the basis of databases
that include at least in part government information, such as lists
of pathogenic organisms or counter-terrorism person lists. The
interaction between companies and governments is very poorly
standardized, though, and the details of the implementation as
well as the exact contents of the databases vary between
companies.

Many companies have created their own implementation of screening software. There are
two applications of more general distribution, which are used by a number of companies:
pathoGENEDetective18 by Entelechon and Blackwatch19 by CRAIC Computing.
pathoGENEDetective will be discontinued in favor of Blackwatch, and Entelechon will
contribute to the development of future versions of Blackwatch.
CRAIC has also agreed to make the current, first-generation version of Blackwatch available
as open source to any gene synthesis or oligonucleotide synthesis company that wants it.
This will simultaneously make it easier for those few companies that do not currently screen
to adopt first generation technologies and lay the groundwork for an open source community
of users to maintain and improve the current code base.
Blackwatch and similar implementations perform a BLAST search against such a database
and report a hit if a similarity above a certain threshold is found. Unfortunately this
procedures leads to a high number of false positive hits due to the high number of
conserved genes between pathogenic and non-pathogenic organisms. These include
harmless housekeeping genes, but also genes that are already in Nature being used dually,
in a harmless, non-pathogenic context and as part of a pathogenicity mechanism.
It is noteworthy that false positive hits are not recorded in any central place, and often not
even within a company. This means that there is little accumulation of knowledge within
companies, and even less so between companies. The costs of screening are currently
moderate but increasing. Companies can go some distance toward counter balancing this
trend by sharing the costs of screening open source-style sharing of best practice methods
and, especially, literature searches and other research conducted to investigate false
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 10

positive hits as they arise. Steve Maurer pointed out that encouraging screening employees
to share virulence factors would benefit all companies and that the underlying economic
logic is more or less identical to that which drives corporate involvement in more traditional
open source collaborations like LINUX and APACHE.
True positive hits pose a problem as there are many conceivable legitimate uses for such
sequences, including basic research and vaccine development.
Dr. Jones discussed the problem of false negatives as well. There is a number of ways in
which a sequence may be modified in order to avoid matches in screening databases, such
as the replacement of synonymous codons or the alteration of the amino acid sequence. In
addition, an obvious strategy to evade detection would be to split an order into several
smaller fragments that can easily be assembled afterwards. Therefore, an effective
screening should be able to detect the smallest possible sequence fragments without an
unduly high number of false positive hits.
In order to achieve that, a number of steps are necessary. One is to limit the screening
database to those sequences that actually bear a biosecurity risk. This requires a curated
database that is peer reviewed and accepted by the community and authorities as being
authoritative.

7.2 Customer screening

In addition to sequence screening, most gene synthesis companies perform a background
screen of new customers. Damon Terrill noted that there are several government-maintained
lists for the screening of individuals and corporate customers. There exists advanced and
affordable standard software for the screening of customers against these lists, for example
the Bridger Insight suite.
Customer screening is not well standardized, and government regulations are vague about
the requirement to screen customers (except in cases of export of dual-use goods).
Moreover, watch lists differ widely between nations and watch list screening may interfere
with national privacy laws.
Therefore, this problem would strongly benefit from a closer transnational collaboration of
policy makers and from a more standardized regulation.

7.3 Genes versus Oligonucleotides

There is a vast difference in the screening of short and long DNA fragments. Long DNA
fragments are pieces of at least 200 nt length, which usually represent one or more
functional genes and are delivered as double-stranded, cloned DNA ready for protein
expression. Short DNA fragments are so-called oligonucleotides that are single stranded
DNA molecules of about 15-70 nt length. Oligonucleotides are usually too short to represent
a complete functional gene, but can be used for a large number of purposes, including the
retrieval, amplification and modification of existing DNA from natural sources or the
assembly of complete genes. An additional rich source of oligonucleotides lacking any
attention, regulation or oversight is represented by synthetic DNA microarrays.
Screening of oligonucleotides for pathogenicity is not performed at all at the moment. The
reason is that the number of orders is two magnitudes larger than for genes, and due to the
short length of oligonucleotides it is very difficult to eliminate false positives (or reach a high
enough sensitivity to detect true positives). Nevertheless, a set of well designed
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 11

oligonucleotides can easily be assembled into a full-length functional gene by a moderately

trained molecular biologist.
Robert Jones suggested a mechanism to address this problem: By determining the
homology of each part of a pathogen genome with the genomes of closely related
organisms, it is possible to identify genomic sequence fragments that are diagnostic for the
pathogen. These diagnostic parts can then be used to identify matching sequences
unambiguously, without producing false positive hits. It is planned to incorporate this
strategy into the next version of BlackWatch.

7.4 Response to hits

One important gap in current screening strategies is the question of what to do when a
positive hit comes up. There are rules under national biosafety laws and under export
regulation laws, with different impact on the question of biosecurity.
In particular, only export regulations address forensic scenarios, whereas national laws for
domestic processes are not concerned with questions of malevolent use. Therefore, there is
a significant number of unregulated cases and loopholes.
In these cases – which might nevertheless be relevant in terms of biosecurity and/or
biosafety – there is not currently a clear line of action to take, nor is there a competent point
of contact in the executive branch of the EU administration (the situation is similar in the US,
but may be changing there due to the activities of the aforementioned PCC).
U.S.-based companies are collaborating with the FBI in a pilot project to establish points of
contact and standard procedures for responses to positive hits. As of now, no such initiative
exists in the EU or in any EU member state, nor – according to the authors‟ knowledge – in
other countries of the world.

8 Trust and customer confidence

All industry representatives agreed that customer confidence is of the utmost importance for
the industry. Since virtually all industrial orders require strict confidentiality and involve trade
secrets of the ordering party (in the form of proprietary DNA and protein sequences), it must
be ensured that no customer data will be shared with a third party.
All biosecurity measures discussed must maintain this very high level of confidentiality.
Virtually all industrial orders require strict confidentiality and involve trade secrets of the
ordering party (in the form of proprietary DNA and protein sequences) and any feasible
biosecurity initiative must respect this. That said, limited disclosures in which data is
presented in ways that conceal customer identities, mask individual orders, and/or occur
after a commercially reasonable delay can often accommodate these legitimate needs and
may be acceptable to customers if they are (correctly) seen as a necessary step towards
improved biosecurity.

9 Current developments
There is a number of efforts for improved biosecurity going on in the synthetic biology
community and industry.
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 12

9.1 Web-based portal for experiments of concern

Stephen Maurer from the Goldman School of Public Policy and Jason Christopher
presented current efforts under their supervision for increased biosecurity in synthetic
biology. These include the development of a web-accessible advice portal for “experiments
of concern” in the life sciences. This portal will address the problem that new experiments
are planned on a daily basis that build upon emerging powerful tools such as high
throughput gene synthesis and that potentially bear security and safety risks. Such risks may
not be obvious to the researcher who plans an experiment, and may require analysis by a
panel of peers in order to fully appreciate the level of risk they bear.
Workshop participants agreed that the Portal could potentially benefit industry by giving
companies a new source of biosecurity advice, as well as providing a place to send
customers whose orders raised security issues. Mr. Maurer pointed out that there were
several informal and inexpensive ways that industry could help support the Portal. These
potentially include (a) inserting web links into IASB, ICPS, and member company web sites,
(b) suggesting that customers consult the Portal when appropriate, and (c) nominating
industry members and contacts willing to serve peer experts for the Portal.
The portal will be used by academic and industrial researchers and hosted by the University
of California at Berkeley. Experiments will be reviewed by peer experts recruited from the
field of the particular experiment that is under review. Readers interested in evaluating beta
site versions of Portal software are encouraged to contact [email protected]. A full-
scale version of the Portal will go on-line on January 2, 2009.
The database project for experiments of concern was discussed with regard to its
implications for synthetic biology. It was acknowledged that the submission of descriptions of
experiments may interfere with the confidentiality of customer data. Jason Christopher
explained that the portal does not aim to be exhaustive in covering all planned experiments
world-wide, but would be a service to concerned scientists and a reference for current trends
in the life sciences which might open up new security and safety risks. Therefore, the system
would be based on an opt-in mechanism, where interested customers could share their non-
confidential data on a voluntary basis, in order to increase the safety and security of their
experiments.

9.2 Virulence factor information repository - VIREP

We have already noted that it makes good economic sense for companies to establish open-
source-style arrangements for preserving and sharing the virulence factor information
generated by their respective screening programs. Such a database would enable the step
from an organism-centric view of biosecurity to a gene-centric view. It would enable
technology providers to screen for risk-associated sequences in a much more efficient way,
avoiding a large number of false positive hits. In the near future a board of scientific experts
should be built to give further guidance and support further diligence and curation.
Initial steps have already been made to create such a database. The Lawrence Livermore
National Laboratories have created a database of virulence factors as part of the BioWatch
project which could be used as an initial basis for a new database with a broader scope and
the ability for user-provided content. Entelechon has created an initial proof of concept
database – which can be used for the refinement of feature lists and specification.
VIREP will serve three purposes: It will be a community resource that company screening
programs can turn to when they encounter unfamiliar gene sequences and, more generally,
discuss whether those sequences are virulent and should be considered a biosecurity risk. It
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 13

will form the underlying data basis for improved, second generation screening technologies.
And it will be a valuable resource of categorized sequence data for the development and
training of machine learning algorithms which can then be used to annotate and improve
virulence factor database – including VIREP itself.

9.3 Biosafety and biosecurity reporting site

The Goldman School of Public Policy is currently in the early stages of constructing a central
reporting site where industry members and researchers could pool information about
emerging biosafety and biosecurity issues as they emerged. Such a site will facilitate the
discussion of experience that could otherwise be overlooked or over sensationalized. It will
turn anecdotes into peer-reviewable and structured information.
Steve Maurer and Jason Christopher made it clear that the public and the industry can
help to shape the results of the ongoing efforts at the University of Berkeley. Since the
described three components – the database of experiments of concern, VIREP, and the
biosafety and biosecurity reporting site – are currently still in development, there is a unique
opportunity for the intended target users (industry and academia) to contribute and to have
an impact on the end result.
It is hoped and anticipated that these projects will translate into community activity not just
once they are finished, but already during their development. Workshop participants agreed
that this sharing could begin by writing a jointly authored review article in which several
leading firms described the history of their respective screening program and what this
experience has taught them about the experiments of concern problem in general (see
Section 12.3).
Workshop participants agreed that all three components would be useful projects. IASB
endorses them and IASB members plan on actively contributing to the design, specification,
implementation and usage of the system. At least for an interim time, IASB is willing to
contribute to the curation of a virulence factor database.

9.4 Next version of BlackWatch

CRAIC Computing is currently working on the next version of BlackWatch, under the working
title Safeguard. Safeguard will include a number of improvements, including the sensitivity
analysis of sequence parts for diagnostic specificity and the usage of a curated database of
virulence factors.20
Another step is the analysis of database sequences to detect diagnostic versus non-
diagnostic portions of a gene or genome. When comparing the smallpox viral genome21 to
that of other pox viruses, for instance, it becomes obvious that some sequence parts have a
much lower homology to neighboring genomes than others. These parts – without which the
genome would not be functional – could be used to efficiently detect attempts at
synthesizing smallpox without any false positive hits.
Safeguard will likely incorporate data gathered via VIREP, and will be loosely associated
with a biosecurity portal to be created at the Goldman School of Public Policy.

9.5 Reporting infrastructure

As mentioned, certain U.S. companies are already working on the standardization of
operating procedures for reporting suspicious DNA synthesis orders. In collaboration with
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 14

the FBI, manageable rules and points of contact are established and tested. The two
industry representations could work together to generalize these procedures and make them
applicable in the various national contexts.

10 Technical approaches
Josef Maier suggested replacing or complementing the current homology-based screening
approach with a pattern recognition approach. This would entail the training of a pattern
recognition algorithm with selected DNA sequences that are diagnostic for a certain type of
virulence factor, for a pathogenicity islands or other sequences or motifs of concern.
Such a method would have the benefit of detecting closely related sequences, even if they
were not known at the time of the pattern generation. Therefore, much as a heuristics-based
virus scanner in the IT world, this system would be adaptable and could respond to new
sequences in a meaningful way.
It was agreed that such an approach could have a strong impact on the quality of screening,
but requires a significant amount of software development. Therefore, the implementation
was deferred until more funding is available.
Klaus Heumann suggested a knowledge-based approach to the screening problem, using a
metric that represents the risk associated with each individual sequence. Such a metric
could be derived from parameters collected from various sources, including a knowledge
base. The knowledge base would in turn be maintained by experts from the field, including
those responsible for biosecurity screening at the gene synthesis houses. It was noted that
there could be more than one metric, with different weights or integration methods for the
available parameters, so that the system is adaptable to the requirements of individual
users.

11 Discussion
In the discussion, it became obvious that the industry does not view biosecurity as a field for
competition, but that all industry representatives were very interested in collaboration.
Therefore, a certain degree of sharing of information would be relatively easy to implement.
It was pointed out that confidentiality of information and data integrity are of the utmost
concern of both industry producers and consumers, and there was consensus that all
implementations must ensure the confidential and secure handling of sensitive customer
data.
It was agreed that the IASB and ICPS should promote best practices and codes of conduct,
but that it is outside of their scope to act as standard defining organizations. The
implementation of a code of conduct would raise the question of auditing and generally of
how compliance with such a code would be ensured. It is clear that such an auditing cannot
and should not be organized by the industry associations, but that the formulation of a code
of conduct would be an important first step. Ultimately, the definition of standards and the
enforcement of compliance with these is a government task.
However, since any government decision in this direction can potentially put a strong burden
on customers and suppliers, it is in our best interest to interact with the authorities to
promote standards that are efficient and effective.
In the discussion, it was noted that Blackwatch and Safeguard serve an important role in
driving specifications and viable pathways for technical solutions. Blackwatch is currently
adopted by Blue Heron and Codon Devices as their screening tool of choice. Several IASB
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 15

members contemplate the adoption of Blackwatch, and Entelechon has already committed
to using Blackwatch in the future.
Therefore, there is a significant user basis for Blackwatch present in the current gene
synthesis community, and even companies that do not use Blackwatch acknowledge its
important role as a reference implementation of a screening system. IASB intends to
promote Blackwatch and participate in the development of Safeguard and associated
framework technology.
It was agreed that Blackwatch will aim for a close integration with the virulence factor
database proposed and developed by Steve Maurer and Jason Christopher.
Any biosecurity screening infrastructure that is initially developed with or by the industry
must eventually be put under the control of an independent, international body. It is the
declared goal of the IASB to promote such a transition. In the meantime, it is important to
coordinate today‟s industry-level initiatives across countries. This will make more formal
international bodies much easier to negotiate and implement when the time comes. IASB
and ICPS will work closely together to this end.
Markus Fischer suggested a time line for the implementation of missing functionality:
Development of standards and a code of conduct: 3rd quarter of 2008
Development and implementation of harmonized screening procedures: 1st quarter
of 2009
Basic implementation of a virulence factor database: 1st quarter of 2009
Acquisition of funding: In 2009
Transition to a non-profit organization: Beginning in 2010 or 2011

Concerns were raised that the accumulating information in the database for experiments of
concern and in VIREP is in itself a security risk due to the centralized form in which it is
provided. Therefore, access to these databases must be controlled.
However, at the same time care must be taken to not exclude interested parties from access
to the system. A certain level of openness is important in allowing the engagement of
academics and industry representatives. These two goals – security and openness – must
be balanced carefully. A subscription-based system was proposed where interested parties
would be authenticated through personal interaction with the curating organization, but
where such authentication is not limited a priori to a particular user group. Instead, interested
parties must provide plausible arguments why they want or need access to the system.
It was noted that although there is an added security risk due to the centralized nature of the
provided information, at least in the case of VIREP virtually no information will be in the
system that isn‟t readily available from other sources. The situation thus is similar to the
acquisition of publications on select agents where there had been a debate for a long time
whether access to such publications – for instance in the form of abstracts in PubMed 22 –
should be restricted. In the end, the decision was for open access to this information, since
any access restrictions would impede benevolent users much more than those with
malicious intent. This is in agreement with the Fink Report which clearly advocates open
access to information on pathogenicity.23
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 16

It was clear that at least companies active in the field of synthetic biology as suppliers should
have access to the databases, so that they can implement technical solutions to counteract
malevolent orders.
The workshop acknowledged the increasing complexity of biosecurity risks emerging from
synthetic biology. This includes new and unprecedented experiments, new ways of
interfering with human health (such as the synthesis, modification and application of
bioregulators24), new delivery technologies and vastly increased scales of analytical and
synthetic methods. Therefore, it is clear that no single technical measure will provide a
universal solution to the problem of biosecurity. Instead, it is important to create solid
technical foundations upon which to build, and to promote an enabling environment for the
detection of and response to malevolent behavior. Furthermore, it would be wrong to defer
initiatives simply because they might eventually be revised or supplemented later on. There
is no such thing as a perfect, 100% solution and it is pointless to wait for one. Industry can
and should mount reasonable initiatives to improve biosecurity in the immediate future.

12 Results
The workshop defined three work packages that can be immediately addressed by the IASB
members and/or in a collaboration of the IASB, ICPS member companies, and the academic
participants. In addition, the IASB members resolved to advertise their commitment to
biosecurity screening. Attendees agreed that it would be a useful first step for both IASB and
ICPS to (a) announce on their web sites that all of their members practice responsible
screening, and (b) encourage their members to make similar representations on their
individual company sites. This simple, inexpensive step would empower consumers and
encourage the handful of companies that do not currently screen to reform their practices. It
would also mark a useful first step towards more detailed best practice codes that may be
developed in the future.

12.1 Work package 1: Harmonized screening strategies

IASB and ICPS member companies will share information about the screening strategies
currently implemented at their corporate members. They will create a wiki-style non-public
forum to discuss shortcomings and possible improvements and to share technical resources
on a non-competing basis. In cooperation with CRAIC Computing, the current Blackwatch
software will be set up as a reference implementation for a screening workflow. This
reference implementation will be freely available to other organizations who wish to screen
gene sequences for biosecurity risks.

12.2 Work package 2: Central virulence factor database

IASB will cooperate with the Goldman School of Public Policy in building the infrastructure
for a virulence factor database. This resource, the „Virulence Factor Information Repository -
VIREP‟ will be a web-based, publicly accessible database containing the annotated
genomes of selected viruses, bacteria and possibly eukaryotic pathogens. The database will
provide means to annotate genomic information on the level of genes and genetic elements,
and will include both virulence factors and other, „harmless‟ genes. The purpose of VIREP
will be threefold: First, it will provide the data basis for future screening software
applications. In contrast to current implementations, such software will not screen against all
available genomic information for a set of pathogens, but against selected sequences with
an associated biosecurity or biosafety risk. Second, VIREP will provide an open forum for
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 17

the discussion and definition of virulence factors and mechanisms of pathogenicity. And
third, it will provide reference data for the training and testing of machine learning algorithms
for the (semi-)automated identification of virulence factor sequences.
As Steve Maurer pointed out, a centralized virulence factor database or similar resource
may also facilitate the sharing of information on false positives between gene synthesis
companies. A human screening operator would use VIREP to retrieve information about a
homology hit, including what previous researchers have learned about the sequence's
pathogenicity. This would reduce the cost of screening significantly.

12.3 Work package 3: Publication on status quo of synthetic biology

The workshop participants agreed to write an article describing the synthetic biology
industry; the history of screening and other biosecurity / biosafety programs within their
respective companies; a description of the false positives and other challenges which these
programs typically face; and what these programs have taught them about experiments of
concern and how to move forward. Representatives of Entelechon, febit, CRAIC have
already agreed to participate and the Goldman School's Steve Maurer will serve as lead
author. Companies and individuals who would like to join the project should contact
[email protected].
The project will create a secure website hosted at Berkeley for the collection of data. This
effort will continue after the publication of the article, to create a record of the current state of
synthetic biology.

12.4 Technical biosecurity group

The members of IASB and ICPS will each nominate one technical expert for the assembly of
a „Technical Biosecurity Group‟. This group will regularly hold virtual meetings to discuss
improvements and next steps for biosecurity measures. In particular, this group will work
with CRAIC Computing to define requirements and specifications for the second generation
of screening software and future versions of BlackWatch. These specifications will be made
available to anyone who is interested in creating similar screening software, and will thus
serve as an open resource to facilitate the development of such software.
The technical biosecurity group will support efforts to create international policies, as
recommended by the Fink report:

We recommend that the international policymaking and scientific

communities create an International Forum on Biosecurity to develop and
promote harmonized national, regional, and international measures that will
25
provide a counterpart to the system we recommend for the United States.

12.5 Commitment to biosecurity screening

The IASB members are committed to biosecurity screening. Each member already screens
incoming gene orders for potential biosafety and biosecurity risks, and each member has
implemented mechanisms to establish and authenticate the identity of customers.
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 18

In order to promote screening, the IASB members will describe and advertise their screening
efforts. This will include public resources on the IASB website26 and an „IASB Biosecurity
Seal‟ on their individual websites.

12.6 Next steps

Apart from the work packages, the next steps will be the approach of government
representatives in Europe and the networking of IASB efforts in biosecurity with other
organizations in the USA and Asia. It was agreed that the IASB should reach out to the
international community and especially the local Asian market players at the Synthetic
Biology 4.0 conference in Hong Kong.27 In addition, IASB plans to hold a similar follow-up
workshop in 2009. The exact place and time is yet to be determined and will be announced
on the IASB website.
Terence Taylor argued that the process of developing standards should be organized as
openly as possible. Kathryn Nixdorff argued for a close collaboration with the Biological
Weapons Convention (BWC). In 2008, the BWC is putting a focus on awareness raising,
which would be an ideal opportunity to initiate a dialog on biosecurity in the commercial
sector.

13 About the Industry Association Synthetic Biology

The Industry Association of Synthetic Biology (IASB) is a consortium of leading companies
in synthetic biology. Founding members include ATG:Biosynthetics GmbH, Biomax
Informatics AG, Entelechon GmbH, febit synbio GmbH, MWG Biotech AG and Sloning
BioTechnology GmbH. The main focus of the association is the advancement and future
development of synthetic biology. For more information on the IASB please visit the IASB
website at www.ia-sb.eu.

1
Glass, John I.; Nacyra Assad-Garcia, Nina Alperovich, Shibu Yooseph, Matthew R. Lewis, Mahir
Maruf, Clyde A. Hutchison, Hamilton O. Smith, J. Craig Venter (2006-01-10). „Essential genes of a
minimal bacterium‟. Proceedings of the National Academy of Sciences 103 (2): 425-430
2
National Research Council of the National Academies, „Biotechnology Research in an Age of
Terrorism‟, 2004, National Academies Press, Washington DC
3
The Royal Society and Wellcome Trust, 07 October 2004, "Do no harm: reducing the potential for
the misuse of life science research", royalsociety.org/displaypagedoc.asp?id=13647
4
www.synbiosafe.eu
5
www.synbiosafe.eu/uploads/pdf/Synbiosafe-Biosecurity_awareness_in_Europe_Kelle.pdf
6
Aldhouse P, New Scientist, November 2004, 'The Bioweapon is in the Post.'
7
Federation of American Scientists, Central Intelligence Agency, Unclassified Report, „The darker
bioweapons future‟, 3 November 2003, www.fas.org/irp/cia/product/bw1103.pdf
8
Meselson, M. 2000. „The Problem of Biological Weapons,‟ remarks at the Symposium on
Biological Weapons and Bioterrorism, National Academy of Sciences, May 2.
9
BAFA- Bundesamt für Ausfuhrkontrolle
10
It is noteworthy that orders from one EU country into another one are considered domestic, i.e.
shipping of goods within EU borders is not considered an export activity
IASB "Workshop Technical solutions for biosecurity in synthetic biology" Page 19

11
National Science Advisory Board for Biosecurity, „Addressing Biosecurity Concerns Related to the
Synthesis of Select Agents‟, December 2006.
www.biosecurityboard.gov/pdf/Final%20NSABB%20Report%20on%20Synthetic%20Genomics.pdf
12
www.cdc.gov/od/sap/final_rule.htm
13
Palmer A, Martin P, Institute for Science and Society, University of Nottingham, May 2008,
'Synthetic Biology – Social and Ethical Challenges'
14
The other three areas are biological weapons, IP, generation of monopolies, and trade and global
justice.
15
www.tessy-europe.eu
16
www.australiagroup.net/en/biological_agents.html
17
www.cdc.gov/od/sap/docs/salist.pdf
18
www.p-detective.org
19
biotech.craic.com/blackwatch/
20
cf. Robert Jones, „Assessment Criteria for Select Agent Sequences‟, CRAIC Computing Tech
Report 2008-01, www.craic.com
21
The smallpox virus genome consists of 197 genes and 186 kbp. It is fully sequenced and publicly
available from Genbank under the accession number X69198.
22
www.ncbi.nlm.nih.gov/pubmed/
23
National Research Council of the National Academies, „Biotechnology Research in an Age of
Terrorism‟, 2004, National Academies Press, Washington DC
24
Kagan E., Clin Lab Med. 2001 Sep;21(3):607-18, „Bioregulators as instruments of terror‟

25
National Research Council of the National Academies, „Biotechnology Research in an Age of
Terrorism‟, 2004, National Academies Press, Washington DC
26
www.ia-sb.eu
27
The Synthetic Biology 4.0 conference is organized by the BioBricks Foundation in partnership with
the Hong Kong University of Science and Technology (HKUST), the University of Hong Kong
(HKU), and the Chinese University of Hong Kong (CUHK). It takes place in Hong Kong on October
10-12, 2008.