Mitochondrial DNA analysis of the domestic dogs in Turkey

European Journal of Forensic Sciences www.ejfs.co.uk Original Research DOI: 10.5455/ejfs.230996 Mitochondrial DNA analysis of the domestic dogs in Turkey Itir Erkan1, Kadir Dastan2, Sedat Tanju Karadeniz3, Yemliha Yıldız4, Dilek Alpsar5, Emel Hulya Yukseloglu2 1 Department of Healthcare Management, Faculty of Health Sciences, Istanbul Yeni Yuzyil University, Istanbul, Turkey, 2Department of Sciences, Institute of Forensic Sciences, Istanbul University, Istanbul, Turkey, 3Computational Biology and Bioinformatics Program, Kadir Has University, Istanbul, Turkey, 4Department of Molecular Medicine, Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey, 5Department of Microbiology and Clinical Microbiology, Istanbul University, Istanbul School of Medicine, Istanbul, Turkey ABSTRACT Objective: This study aims to prove that analyzing the hypervariable I (HV-I) and HV-II regions of mitochondrial DNA using 150 blood samples from Canis lupus familiaris would be an important source of evidence in solving an incident. Materials and Methods: The target region was amplified in the first and second polymerase chain reaction step following DNA isolation and the purification process was performed. As for the sequence analysis, it was analyzed in the ABI3130 capillary electrophoresis device. The analysis of raw data was performed. The results obtained were compared with the reference sequence. Results: The results achieved are compatible with those of the previous studies and the polymorphisms in the positions 15,543 (4.03%), 15,640 (3.23%), 15,756 (6.45%), 15,945 (8.87%), 15,951 (%4.03), and 15,960 (3.23%) of the region HV-I and the positions 16,495 (16.94%), 16,585 (7.26%), 16,611 (15.32%), 16,619 (17.74%), 16,624 (12.90%), 16,628 (4.84%), 16,635 (8.06%), 16,637 (11.29%), 16,652 (4.84%), 16,654 (4.03%), 16,658 (13.71%), and 16,676 (4.03%) of the region HV-II were identified for the first time. Conclusions: This study is a first of its kind in the field of forensic science in Turkey; however, the run time and cost were reduced via optimization in a different way as compared to the methods used in international publications. Address for correspondence: Itir Erkan, Faculty of Health Sciences, Istanbul Yeni Yuzyil University, Istanbul, Turkey. E-mail: itir.erkan@yeniyuzyil. edu.t Received: June 02, 2016 Accepted: August 31, 2016 e-Published: April 07, 2017 KEY WORDS: Forensic sciences, forensic genetics, Canis lupus familiaris, crime scene investigation, mitochondrial DNA INTRODUCTION Most of the biological evidence collected in investigating crime in forensic science is related to humans; however, there may also be evidence found at the crime scene which is related to animals. Finding biological materials of an animal at a crime scene aids in identifying the remains of a lost pet, identifying the attacking animal in case of an attack at a person or animal, identifying the animal causing the accident in case of an accident, determining the animal in charge of material damage and throwing light onto the incident in cases such as animal persecution and animal theft [1-5]. Dogs have an important Eur J Forensic Sci ● Apr-Jun 2017 ● Vol 4 ● Issue 2 role in forensic science since they can be domesticated. The biological samples of a dog such as blood, hair, and saliva help in establishing a connection between the crime scene and victim. Once a pet has entered its place of inhabitation, it is impossible for that place not to be contaminated by the hair of the animal. Furthermore, dogs leave more samples than the biological material of their owners since they shed hair wherever they are [6]. While dogs can be the reason for forensic case, they also constitute an important source of evidence in solving forensic cases when the crime scene investigation is done in a comprehensive manner. There are solved forensic cases in that respect [7,8]. 26 Erkan, et al.: mtDNA analysis in dogs To be able to shed light on cases in forensic science, it is necessary to perform a DNA analysis of the trace amount of biological material. However, it is not always possible to achieve adequate amount of genomic DNA with such biological samples. More successful results can be obtained via mitochondrial DNA (mtDNA) analysis on such samples. The region, known as the control region on the mtDNA genome (D-loop or hypervariable I region/[HV-I] and HV-II), has become popular in terms of DNA analyses since it has a high rate of mutation among humans and other mammals. Dog mitochondrial genome is circular, has 16.728 base pairs and it codes 13 proteins, 22 tRNAs and 2 rRNAs [9,10]. This study aims to obtain mtDNA from blood samples of domestic dogs and to perform an analysis of the regions HV-I and HV-II. MATERIALS AND METHODS Samples In this study, blood materials from 150 domestic dogs brought for health check and vaccination to Istanbul University, School of Veterinary Medicine, Research and Practice Hospital were used. Dog breeds and numbers are presented in Table 1. DNA Extraction, Amplification, and Sequencing DNA isolation from blood samples was carried out using the “Invitrogen PureLink™ Genomic DNA” Isolation Kit. The primers specified by Eichmann and Parson to be appropriate for the multiplication of the dog mitochondrial region were selected [11]. Accordingly, two primers, i.e., F15416 (CATCAGCACCCAAAGCTGAGA) and R00056 (GTGCGACTCATCTTGGCATTT), which were synthesized by the company “Invitrogen,” were used. For the first polymerase chain reaction (PCR), the AmpliTaq Gold® PCR Master Table 1: Information of dog breeds and numbers Dog breed N Terrier Golden retriever German shepherd American cocker Sivas Kangal Rottweiler Irish setter English setter Bulldog Beagle Boxer Cocker Siberian husky Pekingese Pointer Doberman German pinscher Yorkshire terrier Saint Bernard puppies Chow Chow 24 19 15 20 12 11 8 8 7 6 5 4 2 2 2 1 1 1 1 27 1 Mix kit was used. As per the procedure, 10 μl PCR Master Mix (×2), 2 μl F15416 primer, 2 μl R00056 primer, 2 μl DNA, and 4 μl dH2O were added into the tube. As for the PCR cycling parameters, the start incubation was identified to be 30 cycles for 5 min at 95°C, 15 s at 95°C, 15 s at 60°C, 60 s at 72°C, and the final extension was identified to be 7 min at 72°C. For the purification of PCR products, an Exo-Sap or ChargeSwitch®-Pro PCR Cleanup Kit was used. The sequencing PCR was performed using a BigDye Terminator v3.1 Cycle Sequencing Kit. To purify the sequencing PCR products, the Sephadex method or an Applied Biosystems BigDye® XTerminator™ Purification Kit was used. The electrophoresis stage was performed using POP7 polymer in an ABI Prism 3130 Genetic Analyzer (Applied Biosystems) device with four capillary arrays and a capillary array length of 36 cm. The raw data were analyzed using the Sequencing Analysis (Applied Biosystems), SeqScape 3.7 (Applied Biosystems), BioEdit and ClustalX programs. Using the “Sequencing Analysis” program, it was identified whether the patterns of the runs were successful or not and the sequences of samples were identified [12,13]. The results were compared with the reference sequence of Canis familiaris published in 1998 by Kim et al. [10], and the profiling step was thus completed. RESULTS Based on the analysis of mtDNA from 150 dogs, 47 polymorphic regions in total were identified with 27 in HV-I and 20 in HV-II [Figure 1]. In a study conducted by Eichmann and Parson, a high degree of polymorphism was identified in the positions 15,627, 15,639, and 15,955 of the region HV-I and in the positions 16,431 and 16,672 of the region HV-II of mtDNA. 14 (44%) polymorphisms the position 15,627, 12 (38%) polymorphisms in the position 15,955, 12 (38%) polymorphisms in the position 16,431, and 16 (50%) polymorphisms in the position 16,672 were identified. Transversion of adenine was seen in 20 (62.5%) out of 28 polymorphisms (87.5%) identified in the position 15,639 and transversion of guanine was seen in 8 (25%) of them [11]. In our study, 27 polymorphisms (21.77%) were identified in the position 15,627, 16 (12.90%) in 15,955, 13 (10.48%) in 16,431, and 22 (17.74%) in 16,672. Among 56 polymorphisms (45.16%) identified in the position 15,639, 40 (32.5%) were seen to have adenine transversion, and 16 (12.66%) were seen to have guanine transversion. Figure 1: The frequency at which positions with high polymorphism are seen (hypervariable-I [HV-I] region is indicated with blue color and HV-II region with red color) Eur J Forensic Sci ● Apr-Jun 2017 ● Vol 4 ● Issue 2 Erkan, et al.: mtDNA analysis in dogs These results are consistent with our study and the polymorphisms of mtDNA in the positions 15,543 (4.03%), 15,640 (3.23%), 15,756 (6.45%), 15,945 (8.87%), 15,951 (4.03%), and 15,960 (3.23%) of the region HV-I and the positions 16,495 (16.94%), 16,585 (7.26%), 16,611 (15.32%), 16,619 (17.74%), 16,624 (12.90%), 16,628 (4.84%), 16,635 (8.06%), 16,637 (11.29%), 16,652 (4.84%), 16,654 (4.03%), 16,658 (13.71%), and 16,676 (4.03%) of the region HV-II were determined for the first time. The polymorphisms identified in our study as being specific to breeds are consistent with the polymorphisms specified by Bekaert et al. in their published study [14]. The samples number 26, 27, 42, and 58 are from the Beagle breed. In that regard, cytosine-thymine transition in the position 15,595, thymine-cytosine transition in the position 15,612, and thymine-cytosine transition in the position 15800 were observed. Thymine-cytosine transition was identified in the position 15,815, and cytosine-thymine transition was identified in the position 15,955 of the same samples. The samples number 9, 41, 69, 97, and 137 are from the terrier breed, and adenine-guanine transition is seen in the position 15,627. The samples number 3, 33, 98, 99, 132, 141, and 149 are from the Golden retriever breed and thymine-adenine transversion was identified in the position 15639; the samples number 24 and 62 are from the Boxer breed, and thymine-guanine transversion was identified in the same position. The samples number 87, 93, 107, and 129 are from the Rottweiler breed and thyminecytosine transition was identified in the position 16,025. The samples 8, 56, and 95 are from the German shepherd breed, and adenine-guanine transition was identified in the position 16,083. Figure 2a and b show the sequencing analysis results. While there is a thymine base in this position in the reference a b Figure 2: (a) Indication of the position 15,639 in the region hypervariable-I (HV-I) of the breeds Canis lupus familiaris (Y: Cytosine-thymine heterozygosis, R: Guanine-adenine heterozygosis, W: Adenine-thymine heterozygosis, K: Guanine-thymine heterozygosis), (b) ındication of the position 15,639 of the region hypervariable-I of the breeds C. lupus familiaris Eur J Forensic Sci ● Apr-Jun 2017 ● Vol 4 ● Issue 2 28 Erkan, et al.: mtDNA analysis in dogs Table 2: Polymorphisms frequently observed in the regions HV-I and HV-II Position Reference sequence Variant observed 15,483 15,508 15,627 15,632 15,639 15,643 15,650 15,652 15,710 15,800 15,815 15,912 15,955 16,003 16,025 16,083 16,128 16,431 16,439 16,671 16,672 16,705 C C A C T A T G C T T C C A T A G C T T C C T T G T A/G G C A T C C T T G C G A T C C T T HV: Hypervariable sequence, A/G switches are observed in 56 (45.16%) of the samples in the study. In all of the figures, the letters written as “Reference-AA” are the amino-acid equivalents of the codons and the sample numbers are indicated in the lower part of this paper. Table 2 shows the polymorphisms frequently observed in the regions HV-I and HV-II. The acquired results were examined, and 16 haplotypes belonging to the region HV-I were identified; the discriminatory power was found to be 0.98 and genetic diversity 0.96. 12 haplotypes belonging to the region HV-II were found; the discriminatory power was identified as 0.89 and genetic diversity as 0.79. In mtDNA analysis studies, the performance of the purification process in the desired way following PCR analysis constitutes the most important step. Otherwise, phosphate and unbound primers would not be able to be removed; therefore, the marked deoxynucleotide (dNTP) would not completely bind to the desired regions in the second (sequencing) PCR process and impurities in the sequence analysis would emerge. For this purpose, the purification process was carried out in our study following the first PCR step using the Exo-Sap method. However, it was observed that certain samples could not become adequately purified in this step. For these samples which could not be purified in the desired way, purification was carried out using the ChargeSwitch®-Pro PCR Clean-up Kit. When this method is compared with the Exo-Sap method, it is seen that the Exo-Sap method requiring a PCR step (disintegration of primers and dNTPs that were not bound at 37°C for 90 min, deactivation of enzymes at 80°C for 20 min) constitutes a disadvantage with respect to time. Furthermore, it was observed that purification using the kit proved to be more successful than the Exo-Sap method. For the purification processes performed after the sequencing PCR step, the Sephadex was initially used and then an Applied Biosystems BigDye® XTerminator™ Purification Kit was used. 29 When the two purification methods were compared, it was observed that purification using a kit was not only less timeconsuming but also more successful in comparison with the Sephadex methods. With respect to purification using the Sephadex method, it was observed that fractures developed in some samples in the filler material and these samples were noted down. In this step, the PCR products do not bind to the filler material and rapidly move to the lower surface of the tube. Therefore, the purification process cannot be fully performed. When the purification is carried out using the Sephadex method, caution should be exercised to prevent any potential fracture in the filler material that grows in the tube. Otherwise, the desired purification will not take place and impurities will be observed after sequencing. DISCUSSION For the analysis of the regions HV-I and HV-II of the dog mtDNA, primers at different numbers and orders were used by many researchers. This choice may influence the run time, quality, and cost. Especially the primers used while performing sequencing PCR are important in terms of sequence overlapping, and profiling of the genome as a whole in forward and reverse sequencing processes. When a wrong choice of primer is made, profiling of the desired regions of the genome would be incomplete; hence, polymorphic regions would not be able to be exactly identified, which would result in unreliable analysis results. In a study conducted in the year 2005, 6 primers in total with 3 forward (H15404, H15430, and H15706) and 3 reverse (L16102, L16092, and L15791) were used [15]. In a study conducted by Gundry et al., 8 primers in total with 4 forward (F15412, F15719, F16072, and F16431) and 4 reverse (R15803, R16114, R16527, and R42) were used [16]. In another study conducted in the year 2012, 10 primers with 5 forward (F15412, F15412L, F15719, F16010, and F16431) and 5 reverse (R00042, R00056, R15803, R16114, and R16643) were used [17]. In our study, the primer F15416 (CATCAGCACCCAAAGCTGAGA) was used for the multiplication of the region 15458-16130 HV-I and the primer R00056 (GTGCGACTCATCTTGGCATTT) was used for the multiplication of the region 16429-16727 HV-II. At the same time, these primers were also used during the sequencing PCR. The 1270 bp mtDNA genome could be sequenced using only 2 primers. The reason for this is that the device ABI3130 used in the study is able to sequence samples with the polymer POP7 up to 850 bases. When compared with the other capillary electrophoresis devices, it is possible to perform sequencing up to 450-500 bases with 45 cm capillary arrays, 650 bases with 61 cm capillary arrays using the ABI310 device, and up to 400-450 bases using the ABI373 and ABI377 devices. For these reasons, the region to be sequenced would have to be sequenced individually in much smaller parts if other devices had been used in the study. However, the study we carried out provided a great ease in that respect. Furthermore, the fact that the sample is not subjected to any processes before being placed in the ABI3130 device is another feature of this device that provides ease when compared to other devices. We are convinced that the reason why the processes were conducted with more primers in the other studies published on this topic Eur J Forensic Sci ● Apr-Jun 2017 ● Vol 4 ● Issue 2 Erkan, et al.: mtDNA analysis in dogs is attributable to the differences in device and method. It was determined in this study that dogs could be identified in a shorter time and at a lower cost as compared to other studies thanks to the various modifications that we made. CONCLUSION This study is the first study conducted on dog identification for forensic purposes in Turkey, and new polymorphisms were identified using various modifications; also, the run time and cost were reduced. It is thought that this modification that has been made would provide a contribution to any other studies in the field of forensic science. Furthermore, it was emphasized via the sample cases we provided that not only humans, but also animals played a role in resolving incidents with respect to the crime scene. ACKNOWLEDGMENT This study was supported by BAP Project of Istanbul University (Project no.15716). We would like to thank Prof. Dr. Utku Bakirel, Dr. Sinem Ulgen from Istanbul University Faculty of Veterinary Medicine for canine blood samples, and also special thanks MedSanTek for materials and laboratory support. Ethics The study was approved by Istanbul University, Animal Experiments Local Ethics Committee, Ethical approval: 204, 30 December 2010. REFERENCES 1. 2. 3. Ganço L, Carvalho M, Serra A, Balsa F, Bento AM, Anjos MJ, et al. Genetic diversity analysis of 10 STR’s loci used for forensic identification in canine hair samples. Forensic Sci Int Genet Suppl 2009;2:288-9. Menotti-Raymond MA, David VA, O’Brien SJ. Pet cat hair implicates murder suspect. Nature 1997;386:774. Budowle B, Allard MW, Wilson MR, Chakraborty R. Forensics and mitochondrial DNA: Applications, debates, and foundations. Annu Eur J Forensic Sci ● Apr-Jun 2017 ● Vol 4 ● Issue 2 Rev Genomics Hum Genet 2003;4:119-41. Gurney SM, Schneider S, Pflugradt R, Barrett E, Forster AC, Brinkmann B, et al. Developing equine mtDNA profiling for forensic application. Int J Legal Med 2010;124:617-22. 5. Fumagalli L, Cabrita CJ, Castella V. Simultaneous identification of multiple Mammalian species from mixed forensic samples based on mtDNA control region length polymorphism. Forensic Sci Int Genet Suppl 2009;2:302-3. 6. D’Andrea F, Fridez F, Coquoz R. Preliminary experiments on the transfer of animal hair during simulated criminal behavior. J Forensic Sci 1998;43:1257-8. 7. Caniglia R, Fabbri E, Greco C, Galaverni M, Randi E. Forensic DNA against wildlife poaching: Identification of a serial wolf killing in Italy. Forensic Sci Int Genet 2010;4:334-8. 8. Scharnhorst G, Kanthaswamy S. An assessment of scientific and technical aspects of Closed investigations of canine forensics DNA - case series from the University of California, Davis, USA. Croat Med J 2011;52:280-92. 9. Darok M, Gatternig R. Suspected suicide and suicide attempt with mysterious concomitant circumstances. Forensic Sci Int 2005;147 Suppl: S17-9. 10. Kim KS, Lee SE, Jeong HW, Ha JH. The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome. Mol Phylogenet Evol 1998;10:210-20. 11. Eichmann C, Parson W. Molecular characterization of the canine mitochondrial DNA control region for forensic applications. Int J Legal Med 2007;121:411-6. 12. Hall TA. Bioedit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symp 1999;41:95-8. 13. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25:4876-82. 14. Bekaert B, Larmuseau MH, Vanhove MP, Opdekamp A, Decorte R. Automated DNA extraction of single dog hairs without roots for mitochondrial DNA analysis. Forensic Sci Int Genet 2012;6:277-81. 15. Angleby H, Savolainen P. Forensic informativity of domestic dog mtDNA control region sequences. Forensic Sci Int 2005;154:99-110. 16. Gundry RL, Allard MW, Moretti TR, Honeycutt RL, Wilson MR, Monson KL, et al. Mitochondrial DNA analysis of the domestic dog: Control region variation within and among breeds. J Forensic Sci 2007;52:562-72. 17. Desmyter S, Gijsbers L. Belgian canine population and purebred study for forensics by improved mitochondrial DNA sequencing. Forensic Sci Int Genet 2012;6:113-20. 4. Source of Support: Nil, Conflict of Interest: None declared. 30