GNAS mutations in canine cortisol-secreting adrenocortical tumors

J Vet Intern Med 2013;27:1486–1492 Activating Mutations of GNAS in Canine Cortisol-Secreting Adrenocortical Tumors M.M.J. Kool, S. Galac, C.G. Spandauw, H.S. Kooistra, and J.A. Mol Background: Cushing’s syndrome or hypercortisolism is a common endocrinopathy in dogs. In approximately 15% of cases, the disorder is caused by adrenocorticotropin (ACTH)-independent hypersecretion of cortisol by an adrenocortical tumor (AT). Without other explanation, the cortisol hypersecretion has been referred to as autonomous. Objectives: To investigate whether ACTH-independent hypersecretion of cortisol may be associated with aberrant activation of the melanocortin 2 receptor (MC2R)-cyclic AMP (cAMP)-protein kinase A (PKA) pathway. Animals: All analyses were performed on 44 cortisol-secreting ATs (14 adenomas and 30 carcinomas) derived from dogs diagnosed with ACTH-independent hypercortisolism. Methods: Mutation analysis was performed of genes encoding the stimulatory G protein alpha subunit (GNAS), MC2R, and PKA regulatory subunit 1A (PRKAR1A) in all ATs. Results: Approximately one-third of all ATs harbored an activating mutation of GNAS. Missense mutations, known to result in constitutive activation, were present in codon 201 in 11 ATs, in codon 203 (1 AT), and in codon 227 (3 ATs). No functional mutations were found in MC2R and PRKAR1A. Conclusions and Clinical Importance: Activation of cAMP signaling is a frequent event in canine cortisol-secreting ATs and may play a crucial role in both ACTH-independent cortisol production and tumor formation. To the best of our knowledge, this is the first report of potentially causative mutations in canine cortisol-secreting ATs. Key words: Adrenal; Cushing’s syndrome; Dog; Gs alpha. C ushing’s syndrome or hypercortisolism is relatively common in dogs, with an estimated incidence of approximately 1–2 cases per 1000 dogs per year. In approximately 15% of cases, this disorder is due to a cortisol-secreting adrenocortical tumor (AT).1,2 Clinical signs of such a tumor include centripetal obesity, atrophy of muscles and skin, exercise intolerance, polyphagia, polyuria, and polydipsia3,4 and are a consequence of ACTH-independent hypersecretion of cortisol. In the healthy adrenal cortex, cell proliferation and steroidogenesis are regulated by melanocortin 2 receptor (MC2R) signaling. Upon ACTH binding to the MC2R, the stimulatory G protein alpha subunit (Gsalpha) activates adenylyl cyclase, producing cAMP. This, in turn, induces protein kinase A (PKA) activity, which results in activation of transcription factors such as cAMP response elements (CREB) that mediate ACTH effects and induce target gene transcription (Fig 1).5 Aberrant activation of the MC2R-cAMPPKA pathway therefore may be a cause of ACTH-independent hypersecretion of cortisol by ATs. Despite extensive search, no activating mutations of the MC2R have ever been described.6–8 Mutations that constitutively activate cAMP production mimic MC2R From the Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands (Kool, Galac, Spandauw, Kooistra, Mol). Corresponding author: S. Galac, Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, Yalelaan 108, 3584 CM, Utrecht, The Netherlands; e-mail: s.galac @uu.nl. Submitted March 22, 2013; Revised June 13, 2013; Accepted August 8, 2013. Copyright © 2013 by the American College of Veterinary Internal Medicine 10.1111/jvim.12194 Abbreviations: AC AMP AT ATP cAMP CREB FAK GDP GNAS GNASL GNASS Gsa MAPK MAS MC2R NFKB PDE PKA PPNAD PRKAR1A SNP TF UTR adenylate cyclase adenosine monophosphate adrenocortical tumor adenosine triphosphate cyclic adenosine monophosphate cAMP response elements focal adhesion kinase guanidine diphosphate stimulatory G protein alpha subunit gene stimulatory G protein alpha subunit, long variant stimulatory G protein alpha subunit, short variant stimulatory G protein alpha subunit mitogen-activated protein kinase McCune Albright syndrome melanocortin 2 receptor nuclear factor kappa-B phosphodiesterase protein kinase A primary pigmented nodular adrenocortical disease PKA regulatory subunit 1A single nucleotide polymorphism transcription factor untranslated region activation in their effects. The best known example is the gsp-oncogene, which arises from a mutation in the stimulatory G protein alpha subunit gene (GNAS), and leads to activation of Gsalpha.9, 10 Activating GNAS mutations cause McCune-Albright syndrome in humans11 and also occur in various endocrine tumors, for instance growth hormone-secreting pituitary tumors in humans and thyroid tumors in humans and cats.12–1413,14 However, only a few cases of activating GNAS mutations have been described in adrenocortical adenomas of humans,9,15,16 and no activating GNAS mutations have been described in dogs. GNAS Mutations in Canine Adrenocortical Tumors Fig 1. Schematic overview of the MC2R-cAMP-PKA pathway. Binding of ACTH to the MC2R activates adenylate cyclase (AC) through Gsa. AC converts ATP to cAMP, which separates protein kinase A (PKA) from its regulatory subunit PRKAR1A, enabling it to phosphorylate (P) and subsequently activate transcription factors (TF). Phosphodiesterase (PDE) inhibits the pathway by converting the active cAMP to inactive AMP. MC2R, melanocortin 2 receptor; Gsa, stimulatory G protein alpha subunit; ATP, adenosine triphosphate; cAMP, cyclic adenosine monophosphate; AMP, adenosine monophosphate; PRKAR1A, protein kinase A regulatory subunit 1A. Inactivating mutations of the gene encoding PKA regulatory 1 alpha (PRKAR1A) subunit cause increased basal and cAMP-stimulated PKA activity.17,18 Inactivating germ line mutations of this gene are found in approximately two-thirds of people with Carney complex,19 in whom endocrine tumors are common. The most common endocrine gland manifestation in affected people is ACTH-independent hypercortisolism because of primary pigmented nodular adrenocortical disease (PPNAD).19 Inactivating PRKAR1A mutations also are a relatively common finding in sporadic cortisol-secreting adenomas of humans.20 In dogs, 1 case report describes a syndrome similar to human Carney complex, but no mutations in PRKAR1A have ever been detected in dogs.21 Although the knowledge of canine ATs has expanded considerably in recent years, the molecular origin of these adrenocortical neoplasms and the mechanism behind their autonomous cortisol production still are largely unknown, and the role of the MC2RcAMP-PKA signaling pathway has never been addressed. Therefore, we report here the results of mutation analysis of the full cDNA sequences of MC2R, GNAS and PRKAR1A in 44 canine cortisol-secreting ATs. Materials and Methods Animals and Tests The study included 44 canine cortisol-secreting ATs and 2 normal adrenal glands (whole tissue explants). Normal adrenal glands were obtained from healthy Beagle dogs, euthanized for 1487 reasons unrelated to the present study and for which approval was obtained from the Ethical Committee of Utrecht University. All ATs were derived from patients referred to the Department of Clinical Sciences of Companion Animals of the Faculty of Veterinary Medicine in Utrecht between 2001 and 2012. Suspicion of hypercortisolism was based on the history, physical examination findings, and routine laboratory findings. The diagnosis of ACTH-independent hypercortisolism due to an AT was based upon (i) increased urinary cortisol secretion, which was not suppressible with a high dose of dexamethasone; (ii) suppressed or undetectable basal plasma ACTH concentrations2; and (iii) demonstration of an AT by ultrasonography, computed tomography, or both.22 All ATs were removed by unilateral adrenalectomy. The dogs’ ages at the time of surgery ranged from 2 to 13 years (mean, 9 years). Six dogs were mongrels and the others were of 26 different breeds. Twenty-two of the dogs were male (10 castrated) and 22 female (15 spayed). Permission to use AT tissue for this study was obtained from all patient owners, and the study was approved by the Ethical Committee of Utrecht University. Histopathology Histopathological evaluation of ATs was performed on formalin-fixed and paraffin-embedded tissue slides of all samples and used to confirm the diagnosis and to classify the tumors. All histological evaluations were performed by a single pathologist. Classification was based on the criteria described by Labelle et al.23 Classification as a carcinoma was based on histological evidence of vascular invasion, peripheral fibrosis, capsular invasion, trabecular growth, hemorrhage, necrosis, and single cell necrosis. Typical histological characteristics of adenomas were hematopoiesis, fibrin thrombi, and cytoplasmic vacuolization. Based on these criteria, the tumor group consisted of 14 adenomas and 30 carcinomas. Total RNA Extraction and Reverse Transcription Tissue fragments for RNA isolation were snap frozen in liquid nitrogen within 10–20 minutes after surgical removal. Total RNA was isolated from the samples using the RNeasy mini kit,a according to the manufacturer’s protocols. A DNAse step was performed to avoid DNA contamination. RNA concentrations were measured on the NanoDrop ND-1000.b cDNA synthesis was performed using the iScript cDNA synthesis kit,c according to the manufacturer’s protocols. For all samples, 1 cDNA reaction was performed without Reverse Transcriptase (RT ), to check for contamination with genomic DNA. PCR Primers for PCR were designed using Perl-primer v1.1.14 according to the parameters in the Bio-Rad iCycler manual, and ordered from Eurogentech.d Forward primers were located in the 5′ untranslated region (UTR) of the genes of interest, whereas reverse primers were located in the 3′UTR. For the MC2R, the canine UTR sequences were not available, and were predicted based on the human UTR sequences and the canine genomic sequence. Overlapping primer pairs were used when a gene could not be amplified in 1 stretch. For all primer pairs, a PCR temperature gradient was performed to determine the optimal annealing temperature. Formation of the proper PCR products was evaluated by gel electrophoresis, to check for the correct product length. In case of correct product lengths, a sequencing reaction was performed to confirm the identity of the transcript, using the ABI3130XL 1488 Kool et al Genetic analyzere according to the manufacturer’s protocol. After optimization of the protocol, the complete cDNA of all target genes was amplified in all ATs. PCR reactions were performed using Phusion Hot Start Flex DNA Polymerasef on a Dyad Disciple Peltier Thermal Cycler (BioRadc) for PRKAR1A and on a C1000 Touch thermal cycler (BioRadc) for MC2R and GNAS. All PCR primers and their characteristics are listed in Table 1. Sequencing All sequence primers were designed using Perl-primer v1.1.14, and ordered from Eurogentech. Primers were located every 300-500 base pairs along the entire transcript, or closer together when additional primers were needed for complete coverage. All PCR primers also were used as sequence primers. PCR products were amplified for sequencing using the BigDye Terminator version 3.1 Cycle Sequencing Kitg and filtrated using Sephadex G-50 Superfine.h Sequencing reactions were performed on an ABI3130XL Genetic analyzer, according to the manufacturer’s instructions. The obtained sequences were compared to the consensus mRNA sequence using DNAstar Lasergene core suite 9.1 SeqMan software (DNASTAR, Madison, WI). All mutations affecting the amino acid sequence were confirmed by repeat RNA extraction, and sequenced in both sense and antisense directions. All sequence primers and their characteristics are listed in Table 2. transcript. The silent mutation was found in codon 201 (CGT>CGC) and was present in 8 ATs in both hetero- and homozygous form. Missense mutations were present in 14 of the 44 ATs, including 4 of the 14 adenomas and 10 of the 30 carcinomas. All missense mutations were heterozygous. Eleven of the 14 missense mutations were located in codon 201 (Fig 2B). They were present in 8 carcinomas and 3 adenomas and comprised the following substitutions: R201C (59), R201H (49), R201S (19), and R201L (19). A missense mutation in codon 203 (L203P) was present in 1 adenoma (Fig 2C). Missense mutations in codon 227 (Fig 2D) were present in 2 carcinomas (Q227H and Q227R). An overview of the different missense mutations is presented in Table 3. Mutation analysis of PRKAR1A showed the presence of 2 different silent mutations. A silent mutation in codon 317 (AGA>CGA) was present in 4 carcinomas and a silent mutation in codon 311 (GAG>GAA) was present in 1 adenoma. Mutations that changed the amino acid sequence were not found in any of the ATs. Discussion Results Mutation analysis of MC2R identified 3 different silent point mutations and 1 amino-acid changing (missense) point mutation. The silent mutations or single nucleotide polymorphisms (SNPs) found in codon 38 (GGG>GGA), codon 237 (GCG>GCC), and codon 286 (GCG>GCA) were present in 8, 21, and 21 ATs, respectively, and occurred both in hetero- and homozygous form. The missense mutation, a V291I substitution, was present in 3 of the 44 ATs (2 carcinomas, 1 adenoma) and was present only in heterozygous form (Fig 2A). Mutation analysis of GNAS showed the presence of a splice variant, 1 silent point mutation, and 7 different missense mutations. The splice variant of GNAS, in which exon 3 is missing, is analogous to the human GNAS transcript variant 3 (GenBank: NM_080426.2) or GNAS-short (GNASS). It was present in all ATs and normal adrenal glands, alongside the full length In this study, GNAS mutations were detected in 14 of the 44 cortisol-secreting ATs of dogs, whereas no functional mutations were found in MC2R and PRKAR1A. All GNAS mutations detected in the ATs of these dogs previously have been described in the human literature, and have been found to cause constitutive activation of cAMP signaling.14,24–26 Although additional in vitro assays would be necessary to establish a causal relationship, our results strongly suggest the involvement of increased cAMP signaling, caused by activating GNAS mutations, in the pathogenesis of a subset of cortisol-secreting ATs in dogs. This finding even may provide an explanation for autonomous, ACTH-independent, cortisol secretion in the affected subset of ATs. In cortisol-secreting ATs of humans, activation of the cAMP signaling pathway is a well-known phenomenon; however, activating GNAS mutations in these tumors are extremely rare, and only have been Table 1. PCR primers for the amplification of canine MC2R, GNAS, and PRKAR1A. All positions are based on the mRNA sequence, as published on the NCBI website. PCR Primers MC2R Fw 69 MC2R Rv 743 MC2R Fw 410 MC2R Fw 1190 GNAS Fw 352 GNAS Rv 1708 PRKAR1A Fw 20 PRKAR1A Rv 1355 Sequence (5′-3′) Location CGAGGCAGAGTAACACCT GGAAGCGTCAAGATCTTCC CACAGCGGATGACATTATGG AAGCATGAGCATTTGTTGGT CCATGGGCTGCCTCGGAAACA TTAAGCAAGCGGAAGGGAAGAAA GCTATCGCGGAGTAGAG AGAGGAAGAGAAAGCAGTC 41/ 24 614/632 300/319 1061/1080 352/372 1686/1708 20/36 1337/1355 Annealing Temperature Product Length 55°C 674 55°C 781 56°C 1357 59°C 1336 Accession numbers used were as follows: MC2R: XM_003638756.1, GNAS: NM_001003263.1, PRKAR1A: XM_537577.3. MC2R, melanocortin 2 receptor; GNAS, stimulatory G protein alpha subunit; PRKAR1A, protein kanise A regulatory subunit 1A; Fw, Forward primer; Rv, Reverse primer. GNAS Mutations in Canine Adrenocortical Tumors 1489 Table 2. Sequencing primers for the mutation analysis of canine MC2R, GNAS, and PRKAR1A. All positions are based on the mRNA sequence, as published on the NCBI website. Sequence Primers MC2R Fw 810 MC2R Rv 340 GNAS Fw 777 GNAS Fw 1226 GNAS Rv 845 GNAS Rv 951 GNAS Rv 1504 PRKAR1A Fw 174 PRKAR1A Fw 329 PRKAR1A Fw 575 PRKAR1A Fw 750 PRKAR1A Fw 975 PRKAR1A Rv 452 PRKAR1A Rv 699 PRKAR1A Rv 855 PRKAR1A Rv 975 PRKAR1A Rv 1255 Sequence (5′-3′) Location CCCTTTGTCCTTCATGTTCTG TATACAAGCTGCCCATCATATCAG TCCCTCCTGAGTTCTATGAG AACAAGCAAGACCTGCTC CTCATAGCAGGCACGCACTCC CAGCGAAGCAGATCCTG CTGAATGATGTCACGGCA GGGAATGTGAGCTCTATGTC CTGCAGAAAGCAAGCTCC TTTGATGCCATGTTTCCAG GAACACCTAGAGCAGCCA TGGTACAGGGAGAACCAG CTCCTCCGTGTAGACTTCG CCCATTCGTTGTTGAC GCTTTCTCAGAGTGCTTCC CTGGTTCTCCCTGTACCA AAACTGTTGTACTGCTGGA 700/720 206/229 778/797 1127/1244 825/845 936/952 1488/1505 175/194 330/347 576/594 751/768 976/993 434/452 684/699 837/855 975/993 1237/1255 Accession numbers used: MC2R: XM_003638756, GNAS: NM_001003263, PRKAR1A: XM_537577.3. MC2R, melanocortin 2 receptor; GNAS, stimulatory G protein alpha subunit; PRKAR1A, protein kinase A regulatory subunit 1A; Fw, Forward primer; Rv, Reverse primer. A C B D Fig 2. Representative examples of the mutations found in codon 291 of the MC2R (A) and in codons 201 (B), 203 (C), and 227 (D) of GNAS in canine cortisol secreting ATs. Reference sequences are based on XM_003638756.1 (MC2R) and NM_001003263.1 (GNAS). WT, wild type; MC2R, melanocortin 2 receptor; GNAS, stimulatory G protein alpha subunit. described in benign lesions.9,15,16 Activating GNAS mutations in humans are associated with McCune Albright syndrome, in which they result in macronodular hyperplasia of the adrenal glands and hypercortisolism.11 GNAS mutations also have been detected in pituitary and pancreatic tumors of humans and in 1490 Kool et al Table 3. Overview of all missense mutations of GNAS in 44 canine cortisol secreting ATs. All nucleotide positions are based on the mRNA sequence (NM_001003263.1), as published on the NCBI website. All amino acid positions are based on the protein sequence (NP_001003263.1), as published on the NCBI website. Mutation Arg201Cys Arg201His Arg201Ser Arg201Leu Gln227His Gln227Arg Leu203Pro Nucleotide Codon Basepair Change Amino Acid Change Number of ATs 954 955 954 955 1034 1033 961 201 201 201 201 227 227 203 CGT>TGT CGT>CAT CGT>AGT CGT>CTT CAG>CAT CAG>CGG CTG>CCG Arg>Cys Arg>His Arg>Ser Arg>Leu Gln>His Gln>Arg Leu>Pro 5 4 1 1 1 1 1 GNAS, stimulatory G protein alpha subunit. Bold text denotes the basepair change within the codon. thyroid tumors of humans and cats.12–14 In humans, substitutions of Arg201 are most common, followed by Gln227 substitutions11,13,14 whereas Arg201 and Gln227 also were the affected codons in thyroid tumors of cats.12 Likewise, in our canine cohort most of the mutations were substitutions of Arg201 and Gln.227 Four possible substitutions of Arg201 in GNAS have been described in humans, in decreasing occurrence: R201C, R201H, R201S, and R201L.11,24,26 Of these mutations, only R201C and R201H previously have been reported in the adrenal cortex, including cortisolsecreting ATs.10,15,27 In cats, R201C is the only known mutation affecting Arg201.12 In our canine AT cohort, all 4 known Arg201 mutations were identified, with a higher frequency of R201C and R201H mutations. Five different substitutions have been described at the 2nd hotspot for human GNAS mutations (ie, Gln227) of which Q227H, Q227L and Q227R are most common.14,24 A single report of a Q227H substitution in a cortisol-secreting adrenocortical adenoma in a human has been published.9 In thyroid tumors of cats, both Q227R and Q227L have been reported.12 In our canine AT cohort, both Q227H and Q227R substitutions were detected. The L203P substitution at Leu203 found in 1 AT in a dog has only been described in a thyroid tumor of a human.25 The GNAS splice variant that was present in all samples was analogous to human transcript variant 3.28 This transcript variant corresponds to a shorter Gsalpha protein (GNASS), which was found to be coexpressed with the long variant (GNASL) in nearly all cell types, although the relative amounts vary depending on the tissue type. In the adrenal cortex of humans, GNASL was found to be the predominant isoform.29 Both variants induce cAMP production, and some investigations have indicated differences in their activity, affinity of GDP binding and receptor interaction.30–32 However, whether these differences result in clinically relevant biological effects still is unclear.33 Moreover, the presence of both variants in all ATs and normal adrenal glands in our canine cohort makes a causal role in canine adrenocortical tumorigenesis unlikely. cAMP is the main cellular signal for inducing cortisol secretion.5 Therefore, the activating GNAS mutations in ATs of dogs, resulting in constitutive cAMP production, may explain the ACTH-independent cortisol production for this subgroup. Apart from cortisol production, increased cAMP signaling also is known to play a role in adrenal tumorigenesis.34 Activating mutations in GNAS induce tumor formation in cAMP-sensitive tissue types by increasing cell proliferation. The mutated GNAS thus is referred to as the gsp oncogene.35 GNAS activating mutations have been shown to result in induction of mitogen-activated protein kinase (MAPK or ERK) and p53 signaling, focal adhesion kinase (FAK) pathways, and nuclear factor kappa-B (NFjB) expression.27 Both P53 and RasRaf-MAPK pathways are well known for their roles in carcinogenesis and have been implicated as factors in adrenal tumorigenesis.36,37 The FAK pathway and NFKB also have been implicated as factors in the pathogenesis of various tumor types.38,39 Therefore, it is likely that the activating GNAS mutations found in ATs of dogs play a role in tumorigenesis. In contrast to the high prevalence of activating GNAS mutations in cortisol-secreting ATs of dogs, no mutations affecting the amino acid sequence were found in PRKAR1A. This contrasts with the important role of PRKAR1A mutations in adrenal pathology in humans and mice. Mutations in PRKAR1A cause Carney complex in humans, with PPNAD as one of the main consequences19 When cAMP-PKA activation is present in ATs of humans, it nearly always originates from PRKAR1A mutations or other PKA signaling abnormalities.34 Likewise, in the mouse, PRKAR1A inactivation and AT formation are closely linked. Transgenic mice lacking PRKAR1A activity in the adrenal cortex develop ACTH-independent Cushing’s syndrome40 and activated PKA signaling because of PRKAR1A loss of function results in a tumor formation syndrome similar to human Carney complex.41,42 In dogs, a single case report describes a syndrome similar to human Carney complex, but in this dog PRKAR1A was not altered.21 The absence of missense PRKAR1A mutations in these canine AT cohort, combined with the fact that no mutations in PRKAR1A have ever been detected in dogs, appear to indicate a difference in the molecular origin of cAMP-PKA activation between adrenal glands of dogs and their human and murine counterparts. The pathways affected by cAMP-PKA activation have been shown to differ GNAS Mutations in Canine Adrenocortical Tumors depending on the molecular origin of the activation. cAMP-PKA activation attributable to PRKAR1A mutations stimulates a different set of cellular pathways and target genes than activation caused by GNAS mutations.27 Both PRKAR1A and GNAS mutations activate MAPK and P53 signaling, whereas the FAK pathway and NFKB specifically are induced by GNAS mutations, and PRKAR1A mutations induce activation of the Wnt-pathway, one of the main cellular pathways implicated in AT pathogenesis in humans.27,43 However, although differences exist between germ line PRKAR1A defects and somatic GNAS mutations, dogs and humans still share common MAPK and p53 signaling pathway activations that might be important targets for treatment in both species. Mutation analysis of the MC2R identified the presence of a V291R missense mutation in 3 ATs, which has not been described previously in the literature. However, this substitution is not likely to have a functional effect on the receptor, because valine and isoleucine are alike in polarity and charge. Moreover, in the human MC2R, isoleucine and not valine is the consensus amino acid. Otherwise, no mutations in the MC2R were found, corresponding to the situation in humans, where activating MC2R mutations have never been identified. In conclusion, this study demonstrates the presence of activating GNAS mutations in a large portion of both benign and malignant cortisol-secreting ATs in dogs. These results strongly suggest increased cAMP signaling as a factor in the pathogenesis of these tumors and may explain the autonomous secretion of cortisol in the affected subset of ATs. This study thus is the first to identify potentially causal mutations in cortisol-secreting ATs of dogs. Footnotes a Qiagen, Hilden, Germany NanoDrop Technologies, Wilmington, DE c Bio-Rad, Hercules, CA d Eurogentec, Maastricht, the Netherlands e AB Applied Biosystems, Carlsbad, CA f New England BioLabs Inc, Ipswich, MA g Applied Biosystems h Amersham, Buckinghamshire, UK b Acknowledgments Funding: This work was supported by a Morris Animal Foundation – Pfizer Animal Health veterinary fellowship for advanced study (grant ID: D09CA-913). The funding sources had no involvement in study design, collection, analysis, and interpretation of data, writing of the report, and the decision to submit the article for publication. Conflict of Interest: Authors disclose no conflict of interest. 1491 References 1. Willeberg P, Priester WA. Epidemiological aspects of clinical hyperadrenocorticism in dogs (canine Cushing’s syndrome). J Am Anim Hosp Assoc 1982;18:717–724. 2. Galac S, Reusch CE, Kooistra HS, Rijnberk A. Adrenals. In: Second, revised and extended edition, ed. Clinical Endocrinology of Dogs and Cats. Hannover: Schl€ utersche; 2010:93–154. 3. Feldman EC, Nelson RW. Comparative aspects of Cushing’s syndrome in dogs and cats. Endocrinol Metab Clin North Am 1994;23:671–691. 4. Kooistra HS, Galac S, Buijtels JJ, Meij BP. Endocrine diseases in animals. Horm Res 2009;71(Suppl 1):144–147. 5. Gallo-Payet N, Payet MD. Mechanism of action of ACTH: Beyond cAMP. Microsc Res Tech 2003;61:275–287. 6. Latronico AC, Reincke M, Mendonca BB, et al. No evidence for oncogenic mutations in the adrenocorticotropin receptor gene in human adrenocortical neoplasms. J Clin Endocrinol Metab 1995;80:875–877. 7. Light K, Jenkins PJ, Weber A, et al. Are activating mutations of the adrenocorticotropin receptor involved in adrenal cortical neoplasia? Life Sci 1995;56:1523–1527. 8. Beuschlein F, Fassnacht M, Klink A, et al. ACTH-receptor expression, regulation and role in adrenocortial tumor formation. Eur J Endocrinol 2001;144:199–206. 9. Kobayashi H, Usui T, Fukata J, et al. Mutation analysis of Gsalpha, adrenocorticotropin aeceptor and p53 genes in Japanese patients with adrenocortical neoplasms: Including a case of Gsalpha mutation. Endocr J 2000;47:461–466. 10. Dall’Asta C, Ballare E, Mantovani G, et al. Assessing the presence of abnormal regulation of cortisol secretion by membrane hormone receptors: In vivo and in vitro studies in patients with functioning and non-functioning adrenal adenoma. Horm Metab Res 2004;36:578–583. 11. Lumbroso S, Paris F, Sultan C. European Collaborative Study. Activating Gsalpha mutations: Analysis of 113 patients with signs of McCune-Albright syndrome – a European collaborative study. J Clin Endocrinol Metab 2004;89:2107–2113. 12. Peeters ME, Timmermans-Sprang EP, Mol JA. Feline thyroid adenomas are in part associated with mutations in the G(s Alpha) gene and not with polymorphisms found in the thyrotropin receptor. Thyroid 2002;12:571–575. 13. Hayward BE, Barlier A, Korbonits M, et al. Imprinting of the G(s)Alpha gene GNAS1 in the pathogenesis of acromegaly. J Clin Invest 2001;107:R31–R36. 14. Nishihara E, Amino N, Maekawa K, et al. Prevalence of TSH receptor and Gsalpha mutations in 45 autonomously functioning thyroid nodules in Japan. Endocr J 2009;56:791–798. 15. Mantovani G, Bondioni S, Lania AG, et al. Parental origin of Gsalpha mutations in the McCune-Albright syndrome and in isolated endocrine tumors. J Clin Endocrinol Metab 2004;89:3007–3009. 16. Libe R, Mantovani G, Bondioni S, et al. Mutational analysis of PRKAR1A and Gs(Alpha) in sporadic adrenocortical tumors. Exp Clin Endocrinol Diabetes 2005;113:248–251. 17. Robinson-White A, Meoli E, Stergiopoulos S, et al. PRKAR1A mutations and protein kinase A interactions with other signaling pathways in the adrenal cortex. J Clin Endocrinol Metab 2006;91:2380–2388. 18. Bertherat J, Bertagna X. Pathogenesis of adrenocortical cancer. Best Pract Res Clin Endocrinol Metab 2009;23:261–271. 19. Rothenbuhler A, Stratakis CA. Clinical and molecular genetics of Carney complex. Best Pract Res Clin Endocrinol Metab 2010;24:389–399. 20. Bertherat J, Groussin L, Sandrini F, et al. Molecular and functional analysis of PRKAR1A and its locus (17q22-24) in 1492 Kool et al sporadic adrenocortical tumors: 17q losses, somatic mutations, and protein kinase A expression and activity. Cancer Res 2003;63:5308–5319. 21. Adissu HA, Hayes G, Wood GA, Caswell JL. Cardiac myxosarcoma with adrenal adenoma and pituitary hyperplasia resembling Carney complex in a dog. Vet Pathol 2010;47:354–357. 22. Galac S, Kool MM, Naan EC, et al. Expression of the ACTH receptor, steroidogenic acute regulatory protein, and steroidogenic enzymes in canine cortisol-secreting adrenocortical tumors. Domest Anim Endocrinol 2010;39:259–267. 23. Labelle P, Kyles AE, Farver TB, De Cock HE. Indicators of malignancy of canine adrenocortical tumors: Histopathology and proliferation index. Vet Pathol 2004;41:490–497. 24. Freda PU, Chung WK, Matsuoka N, et al. Analysis of GNAS mutations in 60 growth hormone secreting pituitary tumors: Correlation with clinical and pathological characteristics and surgical outcome based on highly sensitive GH and IGF-I criteria for remission. Pituitary 2007;10:275–282. 25. Palos-Paz F, Perez-Guerra O, Cameselle-Teijeiro J, et al. Prevalence of mutations in TSHR, GNAS, PRKAR1A and RAS genes in a large series of toxic thyroid adenomas from Galicia, an iodine-deficient area in NW Spain. Eur J Endocrinol 2008;159:623–631. 26. Nault JC, Fabre M, Couchy G, et al. GNAS-activating mutations define a rare subgroup of inflammatory liver tumors characterized by STAT3 activation. J Hepatol 2012;56:184–191. 27. Almeida MQ, Azevedo MF, Xekouki P, et al. Activation of cyclic AMP signaling leads to different pathway alterations in lesions of the adrenal cortex caused by germline PRKAR1A defects versus those due to somatic GNAS mutations. J Clin Endocrinol Metab 2012;97:E687–E693. 28. Bray P, Carter A, Simons C, et al. Human cDNA clones for four species of G Alpha s signal transduction protein. Proc Natl Acad Sci USA 1986;83:8893–8897. 29. Mumby SM, Kahn RA, Manning DR, Gilman AG. Antisera of designed specificity for subunits of guanine nucleotide-binding regulatory proteins. Proc Natl Acad Sci USA 1986;83:265–269. 30. Walseth TF, Zhang HJ, Olson LK, et al. Increase in Gs and cyclic AMP generation in HIT cells. Evidence that the 45-kDa alpha-subunit of Gs has greater functional activity than the 52-kDa alpha-subunit. J Biol Chem 1989;264:21106–21111. 31. Graziano MP, Freissmuth M, Gilman AG. Expression of Gs alpha in Escherichia coli. Purification and properties of two forms of the protein. J Biol Chem 1989;264:409–418. 32. Seifert R, Wenzel-Seifert K, Lee TW, et al. Different effects of Gsalpha splice variants on beta2-adrenoreceptor-mediated signaling. The beta2-adrenoreceptor coupled to the long splice variant of Gsalpha has properties of a constitutively active receptor. J Biol Chem 1998;273:5109–5116. 33. Bastepe M. The GNAS Locus: Quintessential complex gene encoding Gsalpha, XLalphas, and other imprinted transcripts. Curr Genomics 2007;8:398–414. 34. Almeida MQ, Stratakis CA. How does cAMP/protein kinase A signaling lead to tumors in the adrenal cortex and other tissues? Mol Cell Endocrinol 2011;336:162–168. 35. Lyons J, Landis CA, Harsh G, et al. Two G protein oncogenes in human endocrine tumors. Science 1990;249:655– 659. 36. Kotoula V, Sozopoulos E, Litsiou H, et al. Mutational analysis of the BRAF, RAS and EGFR genes in human adrenocortical carcinomas. Endocr Relat Cancer 2009;16:565– 572. 37. Waldmann J, Patsalis N, Fendrich V, et al. Clinical impact of TP53 alterations in adrenocortical carcinomas. Langenbecks Arch Surg 2012;397:209–216. 38. Inoue J, Gohda J, Akiyama T, Semba K. NF-kappaB Activation in development and progression of cancer. Cancer Sci 2007;98:268–274. 39. Golubovskaya VM, Cance W. Focal adhesion kinase and p53 signal transduction pathways in cancer. Front Biosci 2010;15:901–912. 40. Sahut-Barnola I, de Joussineau C, Val P, et al. Cushing’s syndrome and fetal features resurgence in adrenal cortex-specific Prkar1a knockout mice. PLoS Genet 2010;6:e1000980. 41. Griffin KJ, Kirschner LS, Matyakhina L, et al. A transgenic mouse bearing an antisense construct of regulatory subunit type 1A of protein kinase A develops endocrine and other tumours: Comparison with Carney complex and other PRKAR1A induced lesions. J Med Genet 2004;41:923–931. 42. Kirschner LS, Kusewitt DF, Matyakhina L, et al. A mouse model for the Carney complex tumor syndrome develops neoplasia in cyclic AMP-responsive tissues. Cancer Res 2005;65:4506–4514. 43. Gaujoux S, Tissier F, Groussin L, et al. Wnt/beta-catenin and 3′,5′-cyclic adenosine 5′-monophosphate/protein kinase A signaling pathways alterations and somatic beta-catenin gene mutations in the progression of adrenocortical tumors. J Clin Endocrinol Metab 2008;93:4135–4140.