348-356 Al-Talib H.pmd

Tropical Biomedicine 36(2): 348–356 (2019) A quadriplex PCR assay for rapid detection of diarrhoeacausing parasitic protozoa from spiked stool samples Al-Talib, H.1*, Julia Ashazila, M.J.2, Hussaini, J.1,3, Wang, S.M.3,4, Mohd Shah, N.A.1, Al-Khateeb, A.3,4 and Chandrika, M.5 1 Medical Microbiology and Parasitology Department, Faculty of Medicine, Universiti Teknologi MARA (UiTM), Sungai Buloh, Selangor, Malaysia 2Institute of Medical Molecular Biotechnology, Faculty of Medicine, Universiti Teknologi MARA (UiTM), Sungai Buloh, Selangor 47000, Malaysia 3 Institute for Pathology, Laboratory and Forensic Medicine (I-PPerForM), Universiti Teknologi MARA (UiTM), Sungai Buloh Campus, Jalan Hospital, 47000 Sungai Buloh, Selangor, Malaysia 4Faculty of Medicine, Universiti Teknologi MARA (UiTM), Sungai Buloh Campus, Jalan Hospital, 47000 Sungai Buloh, Selangor, Malaysia 5 Department of Biomedical Sciences and Therapeutics, Faculty of Medicine and Health Sciences, University Malaysia Sabah, Sabah, Malaysia *Corresponding author e-mail: [email protected]; [email protected] Received 27 April 2018; received in revised form 2 January 2019; accepted 3 January 2019 Abstract. Diarrhoea is a leading killer of children, accounting for 9% of all deaths among children under age 5 worldwide and 3% in Malaysia in 2015. A large proportion of diarrhoea illnesses among children in developing countries are ascribed to an unknown etiology because microscopic examination was the only available technique which has low detection limits. The proposed study aimed to evaluate a new quadriplex PCR assay to detect parasitic pathogens namely E. histolytica, G. lamblia and C. parvum which considered responsible for the majority of human infections. Three set of specific primer pairs were designed for detection of parasitic pathogens. Quadriplex PCR assay was optimized and an internal amplification control was incorporated to check for PCR inhibitors in samples. The PCR assay was evaluated using spiked stool samples. Specific primer pairs were successfully designed and simultaneously amplified the targeted genes. The analytical sensitivity of the quadriplex PCR at the DNA level was found to be 50 ng DNA. The analytical specificity was evaluated with 11 reference protozoal and bacterial strains and was found to be 100%. We concluded that the developed quadriplex PCR assay was rapid and gave results within 5 hours which is essential for the identification of parasitic pathogen and might be useful as an additional diagnostic tool whenever time is important in the diagnosis of parasite that cause diarrhoea. INTRODUCTION (Ajjampur et al., 2008). Direct observation of protozoa by microscopy is frequently employed as a rapid and simple diagnostic method. However, it has frequently been shown to offer variations in results due to low sensitivity and depend to a great extent upon the skill of the person carrying out the analysis (Ajjampur, Rajendran, 2008, Al-Kubaisy et al., 2014). Although, many commercial kits are available and used as alternative cost-effective diagnostic methods (Goni et al., 2012; Minak et al., In 2015, it was reported that diarrhoea had killed 9% of children under the age of 5 worldwide and 3% in Malaysia, making it the leading cause of death among children. (UNICEF Data, 2018). Since microscopic examination has a low detection limit and it was the only available technique in developing countries, a large proportion of diarrhoea recorded cases among children were ascribed to an unknown etiology 348 2012). However, the specificity and sensitivity of these kits have been reported to be lower than those obtained using the PCR based detection assays. Indeed, molecular detection methods by PCR is simple and can offer a better turnaround time (Al-Talib et al., 2014a; Haque et al., 2007). Although many PCR-based diagnostic assays have been reported, to the best of our knowledge none of these assays have been introduced into the clinical laboratory as routine diagnostic tests. This may be due to several reasons. First, most of these assays rely on multi-step procedures for the protozoal DNA extraction and subsequent PCR amplification (Hawash et al., 2016). Second, most of these assays lack standardization and proper clinical evaluation (McHardy et al., 2014). Finally, for poor countries where parasitic infections predominate, PCR is still considered an expensive technique in comparison to the conventional diagnostic methods (Hawash, Ghonaim, 2016). This study aimed to evaluate a new quadriplex PCR assay to detect parasitic protozoa namely Entamoeba histolyticawhich (E. histolyticawhich), Giardia lamblia (G. lamblia) and Cryptosporidium parvum (C. parvum) which were responsible for the majority of human infections. The study protozoa are globally distributed due to the high infectivity rates and the availability of various modes of transmission (Al-Kubaisy, Al-Talib, 2014). Since early identification of diarrhoea causing pathogens is vital for immediate and prompt treatment, the proposed quadriplex PCR assay includes three primer pairs which make it able to detect any pathogens in a short duration of time and at a lower cost. Various molecular methods have been used to identify faecal parasites however; these methods do not detect all target pathogens simultaneously. Hence, the newly developed PCR assay was a modified and inclusive method which can identify any of these parasites simultaneously. The proposed assay was evaluated by comparing the results with the conventional methods, and an internal amplification control was included to detect the presence of any PCR inhibitors in samples as done in previous study (Al-Talib et al., 2014b). This study helps to incorporate the DNA amplification technology into the diagnostic parasitology laboratory to detect the causative pathogens. MATERIALS AND METHODS Study design and protozoal stock This was a cross-sectional study conducted in Institute of Medical Molecular Biotechnology - Faculty of Medicine – UiTM from October 2016 to June 2017. The Research and Human Ethics Committee, Universiti Teknologi MARA approved the study protocol (REC/62/16). Protozoal strains used in this study for positive and negative control were obtained from American Type Culture Collections. E. histolytica, strain HM 1: IMSS (ATCC 30459), G. lamblia, strain WB, clone 6 (ATCC 30957), and C. parvum, strain Iowa (P102). The stock culture of E. histolytica HM1: IMSS strain was obtained from Pusat Pengajian Sains Kesihatan, Universiti Sains Malaysia. The trophozoite of E. histolytica HM1: IMSS strain were then axenically cultivated in TYI-S-33 medium in culture flasks and incubated anaerobically by using Anaerocult A (Merck) for 48 hours. The culture flasks were placed in ice-cold bath for 5 minutes and trophozoites were centrifuged and re-suspended in phosphate buffered saline pH 7.2 and the parasite number was determined. The stock of G. lamblia, strain WB, clone 6 (ATCC 30957 was axenically grown anaerobically in ATCC® Medium 2155: LYI Giardia Medium in 13 ml glass tubes at 35°C, in a horizontal position at a slight incline and were subcultured at interval of 72 hours. The cells were adhered on the surface of the glass tubes and were dislodged by repeated inversion of the culture tubes after chilling for 10 min in an ice water bath. Cell concentrations were estimated with a Coulter counter. A purified preparation of 1×106 C. parvum oocysts lowa (P102) in 5% formalin in 4 ml was purchased from 349 Dr. Henry Stibbs (Waterborne Inc., New Orleans, LA, USA). Each 1 µL contain about 250 oocysts. Quadriplex Polymerase Chain Reaction The uniplex and multiplex PCR amplifications were carried out with Eppendorf Mastercycler Gradient Thermal Cycler ((Eppendorf AG, Hamburg, Germany). GoTaq® Hot Start Polymerase (Promega) and other PCR reagents were used in amplification reactions with the final concentrations given at Table 2. For the quadriplex PCR, optimized primers concentration for each protozoa are 0.15 µM for E. histolytica, 0.25 µM for G. lamblia and 0.25 µM for C. parvum genes. The amplification was carried out using an initial denaturing cycle at 95°C for 5 min and the subsequent cycles as follows: denaturation, 30 s at 95°C; annealing, 20 s at 68°C; and extension, 30 s at 72°C. PCR products (6 µl per lane) were electrophoresed using 1% agarose gel containing SYBR® Safe DNA gel stain (Invitrogen, Cergy Pontoise, France). Spiked stool samples Stool samples obtained from healthy donors were collected and confirmed by microscopic examination as negative for any protozoa. About 0.2 g of stool materials was aliquot in microcentrifuge tubes and preserved in 10% formalin and 75% ethanol for further PCR use. Primer design for pentaplex PCR assay The 16S rRNA of E. histolytica, 16S rRNA of G. lamblia and 18S rRNA of C. parvum genes sequence were obtained from GenBank. Primers were designed using the NCBI Primer Blast with the parameters set to create a product of 100-500bp and melting temperature 70°C. The specificity of the designed primers was checked using BLAST, which is available at the GenBank website. The primer sequences for the four genes and expected PCR product sizes are shown in Table 1. Evaluation of quadriplex PCR The analytical sensitivity was evaluated using various concentrations of genomic DNA starting from 50 ng to 600 ng obtained from a reference strain. Analytical specificity was evaluated using DNA lysates prepared from pure strains of E. histolytica, G. lamblia and C. parvum and other 3 related intestinal protozoa and 5 nonprotozoal Gram negative-bacteria (Table 3). E. histolytica, G. lamblia, and C. parvum oocysts were decimally diluted in PBS and seeded into 200 mg of uninfected human stool samples. Genomic DNA were extracted using QIAmp® Stool Mini Kit (Qiagen, UK) following the manufacturer’s DNA extraction All strains were subjected to DNA extraction using QIAmp® Stool Mini Kit (Qiagen, UK) following the manufacturer’s protocol with minor modification. This is needed because the genetic material of protozoa to be isolated is enclosed mainly in oocysts/cysts which possess very robust cell membranes. This includes boiling at 100°C temperature for 10 minutes and proteinase K treatment for 2 hours at 55°C. Table 1. Oligonucleotides (primers) used in the study Primer Region Sequence Product size 18s rRNA 5'-GGTATTGGCCTACCGTGGCAATG-3' 5'-TAATTTGCGCGCCTGCTGCC-3' 112 E. hystolitica 16s like 5'-AGGATGAAACTGCGGACGGCTC-3' 5'-GTAGCCATCTGTAAAGCTCCCTC-3’ 327 G. lamblia 16s like 5'-TACCGGCCGGGGACGGGTGA-3' 5'-GGCCCAGGGCGTCTGAGGGC-3' 524 5'-GCATTGCTCTTCACAGGGCCGT-3' 5'-GGTAATGCCCCCAAACCGGGC-3' 677 C. parvum Internal control 350 Table 2. The final concentration of PCR reaction mix Reagent ddH20 Buffer MgCl2 dNTP DMSO Primer-F Primer-R Taq polymerase DNA template Concentration Final concentration 5× 25 mM 10 mM 100% 10 µM 10 µM 5 U/ul 100 ng 1× 1.5 mM 0.2 mM 5% 0.25 µM 0.25 µM 0.05 U/ul Table 3. Enteric pathogens used in this study and results of multiplex PCR Reference strains 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 18s rRNA 16S rRNA 16S rRNA Internal control – – – – – – – – – – + – – – – – – – – + – – – – – – – – – – – + – + + + + + + + + + + + Salmonella enterica (ATCC 14028) Shigella flexneri (ATCC 12022) Escherichia coli (EHEC) (ATCC 43889) Campylobacter jejuni (ATCC 33559) Klebsiella pneumoniae (ATCC 13883) Cyclospora cayetanensis (ATCC PRA-3000S) Dientamoeba fragilis (ATCC 30948) Blastocystis hominis (ATCC 50177). Entamoeba histolytica (ATCC 30459) Giardia intestinalis (ATCC 30957) Cryptosporidium parvum (ATCC 87667) protocol with minor modification as mention previously. All spiked samples were thoroughly mixed and 1 µl of each aliquot was subjected to amplification by the quadriplex PCR. 1.25 U Taq polymerase and 0.5% DMSO with 68°C annealing temperature (Figure 1). The first sets of E. histolytica primer which is Forward 5’ATGGCCAATTCA TTCAATGAATTGAG 3’ and Reverse 5’ GCCCTCCAATTGATTTCGTAGGAG 3’ failed to give a specific band when quadriplex PCR were performed even though its showed specificity during BLAST (Figure 2). Other optimizations performed include reduced primer concentration and increased annealing temperature but still failed to get specific band. We speculate that, there is a presence of another binding site of this primer in another species that is not updated in GenBank. The whole operating period from stool extraction till obtaining PCR results is 5 hours which can be considered as fast compared to conventional methods. RESULTS In the present study, the quadriplex PCR was optimized successfully to identify the 16S rRNA of E. histolytica, 16S rRNA of G. lamblia and 18S rRNA of C. parvum genes simultaneously. Throughout the optimization process, no PCR amplification products were obtained using standard protocol. However, when 0.5% of DMSO added to the master mix, we managed to get PCR amplification bands for all protozoa (Figure 1). The quadriplex PCR gave the best results when 1.0 mM MgCl2, 0.2 mM dNTP, 351 Figure 1. Representative SYBR Safe stained 3 % agarose gel picture. (A) PCR amplification products for singleplex PCR. M, GeneRuler™ 100 bp DNA marker; Lane-1, Internal Control; Lane-2, Cryptosporidium; Lane-3, Entamoeba; Lane-4, Giardia; Lane-5, positive control; Lane6, no-template master mix sample (PCR negative control). (B) PCR product for multiplex PCR. M, GeneRuler™ 100 bp DNA marker; Lane-1, Internal Control; Lane-2, multiplex PCR product, Lane-3, no-template master mix sample (PCR negative control). Figure 2. SYBR Safe stained 3 % agarose gel picture showed PCR amplification products for the first sets of E. histolytica primer. M, GeneRuler™ 100 bp DNA marker; Lane 1-5, Optimization using various primer concentrations. 352 The optimization of multiplex PCRs can pose several difficulties, including poor sensitivity or specificity and/or preferential amplification of certain specific targets. The analytical sensitivity of the quadriplex PCR at the DNA level was found to be 50 ng (Figure 3). The analytical specificity of the quadriplex PCR assay found to be positive for the E. histolytica (16S rRNA), G. lamblia (16S rRNA) and C. parvum (18s rRNA). A representative gel picture of quadriplex PCR assay with reference protozoal strains is shown in Figure 1A. However the other 3 related intestinal protozoa and 5 Gram negativebacteria were negative (Table 1). Overall, the analytical specificity of quadriplex PCR was 100% for the detection of study protozoa. Further evaluation of the quadriplex PCR assay was made using ten normal stools to determine specificity of the assay. No amplification bands were detected indicate 100% assay specificity (Figure 4). Figure 3. Representative SYBR Safe stained 3 % agarose gel picture showing PCR amplification products for Limit of detection test from negative stool sample spiked with the three protozoal genomic DNA. M, GeneRuler™ 100 bp DNA marker; Lane-1, Internal Control; Lane-2, 50 ng genomic DNA; Lane-3, 100 ng genomic DNA; Lane-4, 200 ng genomic DNA; Lane-5, 300 ng genomic DNA; Lane-6, 400ng genomic DNA; Lane-7, 500ng genomic DNA; Lane-8, 600 ng genomic DNA, Lane-9, positive control; Lane-10, no-template master mix sample (PCR negative control). Figure 4. Representative SYBR Safe stained 3 % agarose gel picture showing PCR amplification products for specificity test from negative stool samples. M, GeneRuler™ 100 bp DNA marker; Lane 1, Internal Control; Lane 2 to 11, 100 ng negative stool genomic DNA from 10 independent samples, Lane 12, positive control; Lane 13, no-template master mix sample (PCR negative control). 353 DISCUSSION 2 hours and additional incubation for 10 minutes at 100°C. In this study, we managed to obtain higher DNA yield than non-modified protocols. However, it takes too long for the extraction to be completed and this could be one of the limitations for diagnostic purposes. For the purposes of detection, DNA is performed at the same efficiency from all oocysts / cyst, the lower detection limit of the PCR diagnostic assay is 50ng genomic DNA. Despite this promising result, the methods used for estimating the lower detection limit of the diagnostic assay experienced by one major weakness. The faecal-derived oocysts /cysts suspensions used for the seeding experiments were not entirely purified. As a result, the actual calculation of concentration of DNA is very challenging. The comparison of analytical sensitivities with previous studies will not be precise due to using different methods to evaluate the lower detection limits in addition to using various species-specific primers. Analytical specificity was evaluated using DNA lysates prepared from 10 enteric pathogens including bacteria and protozoa (Table 3). Nevertheless, in this study, PCR amplification was always target-specific when the assays were applied to faecalderived stools that contained DNA from various defined sources. PCR detection of enteric protozoa is largely dependent upon the method used for DNA extraction from the stool specimens. Most of the previously developed PCR assays have reported high levels of sensitivity and specificity using pure genomic DNA samples (Won et al., 2016). This analytical sensitivity is actually estimating the performance of PCR amplification step and not the overall diagnostic process. The current study has limitation due to lack of comparison with other methods such as microscopy and coproantigen assays. This study also needs further evaluation using larger clinical samples size. In this study, a multiplex PCR assay was developed for synchronous detection of three important enteric protozoa which cause human diarrhoea including E. histolytica, G. lamblia and C. parvum. In this study, we design three specific primers sets with additional primer set as internal control. We design our primers to be highly specific to avoid cross-reaction with other organism’s DNA. We considered specific features in designing our primers to achieve successful multiplexing of all primers together. In particular, the narrow primers melting temperatures (Tm) and short lengths targeted DNA sequences which can be differentiated easily by the agarose gel electrophoresis. The used of Go Taq® Hot start polymerase (Promega) to drive the diagnostic multiplex PCR assay has shown to be advantageous in this PCR assay. This includes (1) it is a comparatively inexpensive polymerase compared to commercially available hot start polymerase; (2) it does not require early preliminary heating steps for its activation as required by other hot start polymerases; (3) the green buffer has a tracking dye which helps unload the PCR products directly into the agarose gel which save significant of time. In establishing the multiplex PCR, the ultimate effort is to minimize the preferential amplification of one DNA target over another as reported previously (Shum and Paul, 2009). The correct annealing temperature, final concentration of MgCl2, and careful balancing of the primer concentrations minimized preferential amplification. In addition, inclusion of 0.5% DMSO (Sigma) in the reaction proved to be a very effective step in improving the sensitivity and the specificity of the assay. All primers sets work well at 68°C. The low DNA yield was one of the challenges that encountered during isolation of DNA from stool samples. To improve the DNA yield, few modifications have been used such as increasing the incubation period of proteinase K from 10 minutes to 354 In conclusion the developed singleround quadriplex PCR assay for simultaneous detection of the three important enteric protozoa affecting humans was effective and performed well using extracted DNA from faecal samples. The quadriplex PCR assay was highly sensitive and the results could be obtained in same day. The developed quadriplex PCR assay has real potential to replace the conventional routine tests in diagnostic microbiology laboratories, particularly among countries with high prevalence of enteritis. More studies are required to assess the cost-effectiveness of the present test and to contain more pathogens including enteric bacteria in the same test that make this assay more inclusive and valuable. Al-Kubaisy, W., Al-Talib, H., Al-khateeb, A. & Shanshal, M.M. (2014). Intestinal parasitic diarrhea among children in Baghdad Iraq. Tropical Biomedicine 31: 499-506. Al-Talib, H., Latif, B. & Mohd-Zain, Z. (2014a). Pentaplex PCR assay for detection of hemorrhagic bacteria from stool samples. Journal of Clinical Microbiology 52: 3244-3249. Al-Talib, H., Yean, C.Y., Al-Khateeb, A., Hasan, H. & Ravichandran, M. (2014b). Rapid detection of methicillin-resistant Staphylococcus aureus by a newly developed dry reagent-based polymerase chain reaction assay. Journal of Microbiology, Immunology and Infection 47: 484-490. Goni, P., Martin, B., Villacampa, M., Garcia, A., Seral, C., Castillo, F.J. & Clavel, A. (2012). Evaluation of an immunochromatographic dip strip test for simultaneous detection of Cryptosporidium spp., Giardia duodenalis, and Entamoeba histolytica antigens in human faecal samples. European Journal of Clinical Microbiology & Infectious Diseases 31: 2077-2082. Haque, R., Roy, S., Siddique, A., Mondal, U., Rahman, S.M., Mondal, D., Houpt, E. & Petri, W.A., Jr. (2007). Multiplex real-time PCR assay for detection of Entamoeba histolytica, Giardia intestinalis, and Cryptosporidium spp. The American Journal of Tropical Medicine and Hygiene 76: 713-717. Hawash, Y., Ghonaim, M.M. & Al-Shehri, S.S. (2016). An Improved PCR-RFLP Assay for Detection and Genotyping of Asymptomatic Giardia lamblia Infection in a Resource-Poor Setting. The Korean Journal of Parasitology 54: 1-8. McHardy, I.H., Wu, M., Shimizu-Cohen, R., Couturier, M.R. & Humphries, R.M. (2014). Detection of intestinal protozoa in the clinical laboratory. J. Clin. Microbiol. 52: 712-720. Acknowledgements. The authors thank the microbiology staff at Center of Pathology Diagnostics & Research Laboratories (CPDRL) as part of the research work. This work was supported by Universiti Teknologi MARA (UiTM) under the program, Research Entity Initiative (REI) Grant [600-IRMI/ DANA 5/3/REI (0008/2016)]. The authors also would like to acknowledge all highly dedicated research assistances and staffs from Faculty of Medicine, Universiti Teknologi MARA particularly Institute Medical and Molecular Biotechnology (IMMB), Medical Laboratory Technician and Science Officer involved for all their support and assistance. We would like to thank Prof. Lim Boon Huat from Pusat Pengajian Sains Kesihatan, Universiti Sains Malaysia for his kind help in this study. REFERENCES Ajjampur, S.S., Rajendran, P., Ramani, S., Banerjee, I., Monica, B., Sankaran, P., Rosario, V., Arumugam, R., Sarkar, R., Ward, H. & Kang, G. (2008). Closing the diarrhoea diagnostic gap in Indian children by the application of molecular techniques. Journal of Medical Microbiology 57: 1364-1368. 355 Minak, J., Kabir, M., Mahmud, I., Liu, Y., Liu, L., Haque, R. & Petri, W.A., Jr. (2012). Evaluation of rapid antigen point-ofcare tests for detection of Giardia and Cryptosporidium species in human fecal specimens. Journal of Clinical Microbiology 50: 154-156. Shum, J. & Paul, N. (2009). Chemically modified primers for improved multiplex polymerase chain reaction. Analytical Biochemistry 388: 266-272. UNICEF Data. Diarrhoea remains a leading killer of young children, despite the availability of a simple treatment solution. 2018. Won, E.J., Kim, S.H., Kee, S.J., Shin, J.H., Suh, S.P., Chai, J.Y., Ryang, D.W. & Shin, M.G. (2016). Multiplex Real-Time PCR Assay Targeting Eight Parasites Customized to the Korean Population: Potential Use for Detection in Diarrheal Stool Samples from Gastroenteritis Patients. PLoS One 11: e0166957. 356