Mitochondrial DNA variability in Poles and Russians

Ann. Hum. Genet. (2002), 66, 261–283 ' University College London DOI : 10.1017}S0003480002001161 Printed in the United Kingdom 261 Mitochondrial DNA variability in Poles and Russians B. A. MALYARCHUK", T. GRZYBOWSKI#, M. V. DERENKO", J. CZARNY#, M. WOZ; NIAK#  D. MIS; CICKA-S; LIWKA# " Institute of Biological Problems of the North, Russian Academy of Sciences, Portovaya str. 18, 685000 Magadan, Russia # The Ludwik Rydygier University School of Medical Sciences, Forensic Medicine Institute, ul. Sklodowskiej-Curie 9, 85-094 Bydgoszcz, Poland (Received 11.2.02. Accepted 11.4.02)  Mitochondrial DNA (mtDNA) sequence variation was examined in Poles (from the PomeraniaKujawy region ; n ¯ 436) and Russians (from three different regions of the European part of Russia ; n ¯ 201), for which the two hypervariable segments (HVS I and HVS II) and haplogroup-specific coding region sites were analyzed. The use of mtDNA coding region RFLP analysis made it possible to distinguish parallel mutations that occurred at particular sites in the HVS I and II regions during mtDNA evolution. In total, parallel mutations were identified at 73 nucleotide sites in HVS I (17±8 %) and 31 sites in HVS II (7±73 %). The classification of mitochondrial haplotypes revealed the presence of all major European haplogroups, which were characterized by similar patterns of distribution in Poles and Russians. An analysis of the distribution of the control region haplotypes did not reveal any specific combinations of unique mtDNA haplotypes and their subclusters that clearly distinguish both Poles and Russians from the neighbouring European populations. The only exception is a novel subcluster U4a within subhaplogroup U4, defined by a diagnostic mutation at nucleotide position 310 in HVS II. This subcluster was found in common predominantly between Poles and Russians (at a frequency of 2±3 % and 2±0 %, respectively) and may therefore have a central-eastern European origin.  Analysis of mitochondrial DNA (mtDNA) polymorphism has become a useful tool for human population and molecular evolution studies, allowing researchers to infer the pattern of female migrations and peopling of different regions of the world (Wallace, 1995). The use of the phylogeographic approach has allowed refinement of the analysis of maternal mtDNA lineages, suggesting the current model of complex demographic scenarios for European peopling (Richards et al. 2000). Although linguistic, anthropological and archaeological data, as well as classical genetic data, cover most of the Correspondence : Dr Boris A. Malyarchuk, Genetics Laboratory, Institute of Biological Problems of the North, Portovaya str., 18, 685000 Magadan, Russia. Tel}Fax : 7 41322 34463. E-mail : mderenko!mail.ru Slavonic populations living in Europe, there are many unanswered questions about the origin and dispersal of Slavs. Archaeological studies indicate that the Lusatian culture (1300 to 1100 B.C.) emerged in central Europe, and later spread over a region that reached from the central basin of the Oder River and the Bohemian mountain ridge, as far east as the Ukraine, and as far north as the shores of the Baltic Sea (Sedov, 1979 ; SC avli et al. 1996). Despite the divergent views on the ethnic affiliation of the Lusatian culture, it is often considered that this culture constituted the foundation of the historical development of the Proto-Slavs (SC avli et al. 1996). According to linguistic data, the split among Proto-Slavs, the bearers of the Lusatian culture, resulted in the three Slavonic language groups – Western, East- 262 B. A. M   ern and Southern (SC avli et al. 1996). In the north, the Lusatian culture was succeeded by the Pomeranian culture, extending over the coastal region from the mouth of the Oder to the mouth of the Vistula. The Przeworsk group encompassed the southern parts of present-day Poland. In the 2nd and 3rd centuries A.D., this group spread northward into the swampy Pripet and united there with the Zarubincy culture. It has been suggested that out of this culture the Eastern Slavonic language group developed (Rybakov, 1981 ; SC avli et al. 1996). Archaeologists report that the Slavs invaded the Balkan peninsula as early as the 2nd century A.D., and since this settlement movement of the Southern Slavs gradually evolved (Sedov, 1979). All of these ‘ migration ’ hypotheses claim that modern Slavonic groups are the result of an admixture between pre-Slavonic European populations and Slavonic tribes, whose homeland was probably in central Europe (Sedov, 1979 ; Alekseeva & Alekseev, 1989). This theory also predicts that diverse modern Slavonic populations may have certain combinations of genetic markers derived from the gene pool of the assumed ancestral Proto-Slavonic population. A high-resolution analysis of maternal mtDNA lineages appears to be a highly informative approach in the reconstruction of the past demographic events, when large enough samples are available (Helgason et al. 2000). MtDNA sequences can be used to create a detailed pattern of the spatially resolved distribution of maternal lineages in Slavonic populations, and to trace a number of shared maternal lineages unique for Slavonic groups, connecting them among themselves and to other neighbours such as presentday German and Finno-Ugric populations. However, the mtDNA data sets for Slavonic populations living in Southern, Central, and Eastern Europe are either incomplete or virtually non-existent for many regional groups of Slavs, especially for populations inhabiting the East European Plain. Population samples of Slavs have been analyzed in different ways : some covering only HVS I sequences, others also including coding-region RFLPs (Malyarchuk et al. 1995 ; Calafell et al. 1996 ; Orekhov et al. 1999 ; Richards et al. 2000 ; Tolk et al. 2000 ; Malyarchuk & Derenko, 2001). In addition, almost all of these mtDNA studies have not addressed specific questions about the origin and early dispersal of Slavs in Europe. To date, it is known that Slavonic populations sharing the same language group (such as Russians, Ukrainians, Bulgarians) display a large amount of interpopulation genetic variation (Malyarchuk & Derenko, 2001). Moreover, we have not found any specific combinations of unique mtDNA types that clearly distinguish Russians from Germans and the neighboring Eastern European populations. To obtain a better characterization of Slavonic mtDNA variability, we present here mtDNA diversity data in Poles and Russians, based on the HVS I and HVS II sequences typed for the presence of major West Eurasian haplogroupspecific markers.    Population samples A population sample of 436 Poles from the Pomerania-Kujawy region of the northern part of Poland was studied. In addition, three population samples of Russians from the European region of Russia were analysed : 62 unrelated individuals from the south (Stavropol region), 76 from the centre (Orel region) and 63 from the east (Saratov region). MtDNA analysis DNA samples from the blood of individuals studied were used for mtDNA amplification and sequencing. PCR amplification of the entire noncoding region was performed using the primers L15926 and H00580. The temperature profile for 30 cycles of amplification was 94 °C for 20 sec, 50 °C for 30 sec, and 72 °C for 2±5 min (Thermal Cycler 9700 ; Perkin Elmer, USA). The resulting amplification product was diluted 1000fold and 4 µl aliquots were added to an array of second-round, nested PCR reactions (32 cycles) to generate DNA templates for sequencing. The primer sets L15997}M13(®21)H16401 and M13(®21)L15997}H16401 were used to generate Polish and Russian MtDNAs both strands of the hypervariable segment I (HVS I). Similarly, the primer sets L00029}M13(®21)H00408 and H00408}M13(®21)L00029 were used for hypervariable segment II (HVS II). Both primer sequences, and nomenclature, were used according to Sullivan et al. (1992). Negative controls were prepared for both the DNA extraction and the amplification process. PCR products were purified by ultrafiltration (Microcon 100 ; Amicon) and sequenced directly from both strands with the (®21)M13 primer using the BigDye Primer Cycle Sequencing Kit (Perkin Elmer) according to the manufacturer’s protocol. Sequencing products were separated in a 4 % PAGE gel on the ABI PrismTM 377 DNA Sequencer. Data were analyzed using DNA Sequencing Analysis and Sequence Navigator programs (Perkin Elmer). The nucleotide sequences obtained were compared with the Cambridge reference sequence (CRS ; Anderson et al. 1981). To determine the haplogroup status of the control region (CR) sequences, RFLP typing was performed by restriction endonuclease analysis of PCR amplified mtDNA fragments using the same primer pairs and amplification conditions as described by Torroni et al. (1996, 1997), Macaulay et al. (1999), and Finnila$ et al. (2000). The samples were typed for a restricted set of RFLPs that were diagnostic of all major western Eurasian clusters, on the basis of the hierarchical mtDNA RFLP scheme (Macaulay et al. 1999). To determine haplogroup H sequences, all samples were tested for 14766MseI, 10394DdeI, and 7025AluI. Samples lacking these three sites were assigned to cluster H. All non-H samples harboring ®14766MseI and ®10394DdeI were tested for 15904MseI, and samples with ­15904MseI site were classified as cluster pre-V, which is solely defined by the two CR mutations 16298C and 72C (Torroni et al. 2001). All non-H and non-pre-V samples (®14766MseI and ®10394DdeI) were determined as HV*. All non-HV samples were tested for 12308Hinf I. Those with ­12308Hinf I were assigned to clusters U and K, and were further determined as belonging to haplogroup K or to subgroups of the haplogroup U on the basis of 263 the HVS I motif information (Richards et al. 1998 ; Macaulay et al. 1999). The phylogenetic status of subhaplogroup U4 was determined by RFLP screening of the 4643RsaI site (Macaulay et al. 1999). The remaining samples were tested for 13366BamHI, 15606AluI, 15925MspI, and 12629AvaII. Those with ­13366BamHI, ­15606AluI, and ®15925MspI were assigned to cluster T. The haplogroup T sequences lacking the 12629AvaII site were classified as T1, whereas those with ­12629AvaII were declared as T*. The remaining samples were tested for 13704BstOI, and those with ®13704BstOI and ­10394DdeI were classified as J. Further, mtDNAs were classified as follows : ­14465AccI to cluster X ; ®4529HaeII, ­8249AvaII, ­16389BamHI, and ­10032AluI to cluster I ; ­8249 AvaII and ®8994HaeIII to cluster W ; ­10394DdeI and ­10397AluI to cluster M. M-sequences were further classified as belonging to haplogroup C (®13259HincII, ­13262AluI), D (®5176AluI), E (®7598HhaI), or G (­4830HaeII, ­4831HhaI). The remaining control region sequences were assigned to certain haplogroups (such as R*, N1b, N1c, L3, pre-HV) on the basis of the HVS I motifs classification (Macaulay et al. 1999 ; Richards et al. 2000). Sequence classification into subhaplogroups was based on the HVS I motifs and nomenclature of Richards et al. (1998, 2000) and Macaulay et al. (1999). Phylogenetic analysis For phylogenetic analysis, all available published data on HVS I-RFLP mtDNA variability in West Eurasian populations were used (Richards et al. 2000). To classify the Slavonic mtDNA haplotype diversity, a phylogeographic approach, based on the phylogenetic analysis of the spatial distribution of mitochondrial haplotypes and haplogroups determined as a monophyletic clade, was performed (Richards et al. 1998). The phylogenetic relationships between mitochondrial haplotypes comprising various combinations of the HVS I and HVS II sequences and RFLPs were analyzed by the mediannetwork method (Bandelt et al. 1995). To es- 264 B. A. M   timate the diversity of mtDNA haplotypes, the average number of transitions on the reconstructed phylogeny from ancestral type to each sample (ρ) was used, according to the methods of Forster et al. (1996). For the CR sequence sharing analysis, HVS I and HVS II haplotypes of Poles and Russians, as well as other European populations, were compared. Data from the following populations were used : 200 Southern Germans (Lutz et al. 1998) ; 101 Austrians (Parson et al. 1998) ; 150 Western Germans (Baasner et al. 1998 ; Baasner & Madea, 2000) ; 109 North-Western Germans (Pfeiffer et al. 1999) ; and 192 Finns (Finnila$ et al. 2001 b).    Sequence variability in Poles and Russians In the present study, the nucleotide sequences of HVS I from position 15991 to 16400 and HVS II from position 20 to 420 have been determined in 436 Poles and 201 Russians. Comparison to the Cambridge reference sequence (Anderson et al. 1981) showed that 140 nucleotide sites were polymorphic in HVS I (34±2 %) and 79 sites in HVS II (19±7 %). Transitions and transversions were found at 136 nps in HVS I and at 73 nps in HVS II. For each hypervariable region, transitions predominate over transversions, being found with a ratio of 133 : 16 and 73 : 0 in HVS I and HVS II, respectively. Among the transitions, pyrimidine substitutions were observed with significantly higher frequency in HVS I (with a pyrimidine : purine ratio of 92 : 41), whereas in HVS II the pyrimidine : purine ratio was 42 : 31. Among the transversions in HVS I there is no predominating type : C ! A transversions were found at 5 nps, A ! C at 4 nps, C ! G at 3 nps, A U T at 3 nps and G ! C at one nucleotide position. It is interesting that multiple substitutions were found at 9 positions of HVS I – from C to T and A at np 16111 ; from C to T and A at np 16114 ; from G to A and C at np 16129 ; from C to T and G at np 16176 ; from C to T, G and A at np 16188 ; from C to T and G at np 16239 ; from A to G and T at np 16241 ; from A to G and C at np 16258 ; and from A to G, T and C at np 16318. Point deletion and insertion events were observed both in HVS I and HVS II. In HVS I an insertion polymorphism was found at np 16193. The occurrence of such a type of polymorphism is probably due to instability in the homopolymeric tract between nps 16184 and 16193, which can be associated with a transition from T to C at np 16189 (Bendall & Sykes, 1995). Similarly, length polymorphism in the poly-C tract of HVS II at nps 303–315 was found in the majority of the mtDNA samples studied. In this tract, insertions of either one, two (at nps 309 and 315), or three (at np 309) C-residues were identified. In addition, insertions of single nucleotides were observed at nps 42 (­T), 60 (­T), 270 (­A) and 299 (­C). Deletions of nucleotides in the mtDNA control region appear to be rarer events, and they were found at nps 16073 (®C) and 16078 (®A) in HVS I, and at nps 249 (®A) and 315 (®C) in HVS II. Heteroplasmic positions were clearly detected in four instances at nps 16093, 16231, 16325 and 72. The heteroplasmic status of these positions was confirmed several times by sequencing of both mtDNA strands. The use of RFLP analysis for mtDNA coding regions amplified via PCR has allowed us to determine the exact phylogenetic status of HVS I and II sequences and distinguish independent (parallel) mutations occurring at particular sites during the evolution mtDNA lineages (Macaulay et al. 1999 ; Richards et al. 2000 ; Finnila$ et al. 2001 b ; Malyarchuk & Derenko, 2001). As a result, we have identified a total of 73 hypervariable sites in HVS I (17±8 %) and 31 hypervariable sites in HVS II (7±73 %) at which more than one independent mutation is observed (Tables 1 and 2). However, in HVS II the number of parallel mutations is approximately 1±8 times as high as the corresponding HVS I value (279 and 155, respectively). Accordingly, the ratio of the average number of parallel mutations per site in HVS II (5±0) and HVS I (3±82) is 1±31. This estimate ranges from 1±17 in Russians to 1±34 in Poles. Therefore, as was suggested previously (Bandelt et al. 2000), although on average HVS II seems to be less Polish and Russian MtDNAs 265 Table 1. Parallel mutations detected in the mtDNA HVS I in Poles and Russians Position 16051 16069 16071 16086 16092 16093 Nucleotide change A!G C!T C!T T!C T!C T!C Poles H, U2, U5 J W U*, I, X H, J1b, D H, K, U4, U5, J1b, C, G 16126 T!C (J*, T*) 16129 16140 16145 16146 16148 16150 16153 16168 16169 16170 16172 16179 16186 16189 G!A T!C G!A A!G C!T C!T G!A C!T C!T A!G T!C C!T C!T T!C 16192 16193 16213 16218 16221 16222 16223 C!T C!T G!A C!T C!T C!T C!T H, U5, T*, T1, I, W, M* H, U5, T* J1b, J1a, N1b U8 H, M* pre-V H, pre-V H, U3 H, pre-V H, T1 H, K, U5, J1b, T*, I H, U4, U5, U8, R* T1 H, K, U4, U2, U5, J*, J1a, T*, T1, pre-V, X, C, D H, K, U5, T*, W, M* H, J2 16224 16227 16231 16234 16239 16241 16243 16249 16256 16260 16261 16265 16266 16270 16271 16274 16278 16286 16288 16290 16291 16292 16293 16294 16295 16298 16300 16304 16309 T!C A!G T!C C!T C!T A!G T!C T!C C!T C!T C!T A!G C!T C!T T!C G!A C!T C!T T!C C!T C!T C!T A!G C!T C!T T!C A!G T!C A!G H, pre-V H, U4 H, U5, J*, J1b U4, (I, N1b,N1c, W, X, L3, C, D, G, M*, E) K T*, R*, G H, J1a K, U4, U5, T*, C, G H, U* J1a H H, J* H, K, U2, U5 T H, J1a, J1b H, N1c H, U5, X, R*, D H, U5, pre-V H, T* H, K, X, R* H, J2, X, R*, G, E H, U5 U5, C H H, K, U5, pre-V, M* T*, W H, K, I H, U4, U5, T W T*, pre-V, C, M* X H, T* U7, G n 3 1 1 3 3 7 Russians H, U2 K, J R* H, K, J* H, K, U2, U4, U5, J*, X 1 U7, (J*, T*), pre-HV, pre-V, X, D 7 H, U4, U1, I 3 3 U5, J*, J1b 1 T* 2 H, U7 1 U4 2 pre-V 2 2 2 6 J1b, I 5 1 J*, T1 13 H, U1, U2, U5, J*, T1, I, W, X, D 6 H, U5, J1b, W 2 H 0 H, J* 2 2 4 U5, J1b, T* 2 (I, W, X, D, G, M*) 1 3 2 6 2 1 1 2 4 1 3 2 5 3 2 4 6 2 2 1 5 2 3 4 1 4 1 2 2 K, U1 G H HV*, G, M* X T1 H, U1 H, U2, U5 U5 H, J*, J1b H H, U5 T* H H, X, G H, U1 H, J* H, U5 U5, T*, W H, T1 T, I HV*, W pre-V H, X, M* H, U5, T*, I U7 n Total 2 3 2 2 1 2 0 3 3 5 7 10 6 6 4 0 3 1 2 1 1 0 0 0 2 0 2 10 9 3 5 2 3 2 2 2 2 2 6 5 2 16 4 1 2 0 0 3 1 7 2 2 2 2 5 2 2 1 1 3 0 1 1 2 3 1 3 1 0 2 1 1 3 0 2 2 2 3 2 2 2 1 3 4 1 2 3 2 8 2 2 2 3 4 2 4 2 5 3 2 4 6 2 4 2 5 3 4 5 2 4 3 4 2 266 B. A. M   Table 1. (Cont.) Nucleotide change Poles n Russians n Total T!C H, K, U*, U5, J*, 11 H, K, J*, J1a, HV*, I 6 12 T*, R*, HV*, pre-V, I, W 16316 A!G 0 H, M* 2 2 16318 A!G T* 1 H 1 2 16318 A!C H 1 U7 1 2 16319 G!A H, J*, J2, T1 4 H 1 4 16320 C!T U*, U5, T*, W 4 0 4 16324 T!C J*, T* 2 T* 1 2 16325 T!C U5, W 2 H, U3, W 3 4 16342 T!C H, U8 2 0 2 16343 A!G H, U3 2 U3 1 2 16355 C!T T*, HV* 2 R* 1 3 16356 T!C H, U4 2 H, U4 2 2 16360 C!T H 1 D 1 2 16362 T!C H, U2, U5, U7, W, R*, 9 H, U4, U2, U5, J*, T*, 10 14 D, G, E pre-HV, D, G, M* 16390 G!A J*, N1b, X 3 U5 1 4 16391 G!A I 1 H, I 2 2 16399 A!G H, U5, T* 3 H, U5 2 3 Mutations are shown indicating positions relative to the revised CRS (Andrews et al. 1999). Haplogroup name denotes the presence of mutation occurring in the background of this haplogroup. A numeral (n) denotes the number of parallel mutations observed. Haplogroups, which have shared ancestry for a certain nucleotide variant, are shown in parentheses. Position 16311 variable (per position) than HVS I, the homoplasic events are more numerous in HVS II, but concentrated at fewer sites – such as 146, 150, 152 and 195. These sites are at least as variable as the most variable positions (16093, 16189, 16311 and 16362) in HVS I. The HVS I and HVS II regions differ slightly in the number of pyrimidine transitions at hypervariable sites, with a higher pyrimidine : purine ratio being found in HVS I (3±33 in total sample, 3±65 in Poles and 4±8 in Russians) in comparison with values for HVS II (2±52 in total sample, 2±68 in Poles and 2±63 in Russians). The molecular instability of the polypyrimidine tract (C5)-T-(C4) located between nps 16184 and 16193 of the L-strand is one of the most studied manifestations of mtDNA hypervariability. It was found that a transition from T to C at np 16189 results in a continuous poly-C tract which may vary in length from 8 to 14 nucleotides (Bendall & Sykes, 1995 ; Marchington et al. 1996). Table 3 shows examples of variation in the tract length found in Polish and Russian mtDNAs. Another example of a hypervariable polypyrimidine sequence is a (C7)-T-(C5) tract starting at np 303 in HVS II. In comparison with the CRS (Anderson et al. 1981), insertion of an additional C residue at np 315 is common in Poles and Russians as well as in other population groups studied (Budowle et al. 1999). It is well established that both poly-C portions in this tract are very unstable ; the length of the (C7)sequences vary from 7 to 10 nucleotides and (C5)sequences vary from 5 to 7 nucleotides (Torroni et al. 1994 ; Howell & Smejkal, 2001). The longest polypyrimidine tract, which was identified in Poles and Russians, was (C10)-T-(C6). In the present study, however, we have observed a poly-C tract with a total length of 13 C-residues, generated by a transition from T to C at np 310. This (C13)-sequence was observed in different mitochondrial haplogroups – H, U4, T, C and M* (see Appendix). Haplogroup diversity in Poles and Russians and notes to mtDNA classification The analysis of HVS I and II variability, in combination with RFLP typing of the coding region haplogroup-diagnostic sites, in a total sample of 637 Polish and Russian individuals, Polish and Russian MtDNAs 267 Table 2. Parallel mutations detected in the mtDNA HVS II in Poles and Russians Position 64 73 93 143 146 Nucleotide change C!T G!A A!G G!A T!C 150 C!T 151 152 C!T T!C 153 182 189 194 195 A!G C!T A!G C!T T!C Poles H H, HV*, U5, I, N1c H, HV*, pre-V H, U4, W H, K, U4, U5, J*, J1b, T*, W, X H, K, U*, U3, U5, J1a, J2, T*, HV*, W, D H, K, pre-V, L3 H, K, U2, U3, U4, U5, U7, J*, J1a, J2, T*, T1, I, N1b, W, X, L3, C, G X H, X K, pre-V, N1c, W pre-V, W, R* H, K, U4, U3, J1a, T*, T1, pre-V, N1c, W, X, R*, L3 H, X H, T, I, W U5, HV* H, U4, U5, (I, N1c, W) H, T*, (I, N1c, W) J*, N1c H, K, U4, J1a H, U2, U4, J*, pre-V H H, I T K, I n 1 5 3 3 9 Russians pre-HV H, HV*, pre-HV H, pre-V H, K, U7, T*, HV*, R* n 1 3 2 0 6 Total 2 6 3 3 12 11 H, U1, U3, U5, J1a, R* 6 13 4 19 H, U7, pre-HV H, K, U4, U2, U3, U5, U7, T*, T1, pre-HV, R* 3 11 6 21 1 2 4 3 13 X, M* 2 0 2 1 10 2 2 5 3 16 H, W W H, U4, U1, U5, U7, J1a, T1, pre-V, W, X U4, U5, pre-HV T, I, X H H, K, U5, J1a, (I, W), X H, (I, W) 198 C!T 2 3 5 199 T!C 4 3 5 200 A!G 2 1 3 204 T!C 4 6 7 207 G!A 3 2 3 210 A!G 2 0 2 215 A!G 4 U4, W 2 5 228 G!A 5 J*, pre-V 2 5 236 T!C 1 U4 1 2 239 T!C 2 H 1 2 240 A!G 1 H 1 2 250 T!C 2 I 1 2 263 G!A 0 H, T* 2 2 279 T!C H, T* 2 0 2 295 C!T H, J, R* 3 J 1 3 310 T!C U4, T*, C, M* 4 H, U4 2 5 319 T!C H, J1a, T* 3 0 3 385 A!G 0 U1, T1 2 2 Mutations are shown indicating positions relative to the HVS II sequence that differs from the revised CRS at np 73. For further information, see footnote to Table 1. Table 3. Instability of the polypyrimidine tracts in HVS I and II regions in Poles and Russians Nucleotide sequence HVS I, nps 16180-16193 AAAACCCCCTCCCC AAAACCCCCCCCCC AAAACCCCCCCCCCC AAAACCCCCCCCCCCC AAACCCCCCCCCCC AAACCCCCCCCCCCC AACCCCCCCCCCCC AACCCCCCCCCCCCC HVS II, nps 300-315 AAACCCCCCCTCCCCC AAACCCCCCCTCCCCCC AAACCCCCCCCTCCCCCC AAACCCCCCCCCTCCCCCC AAACCCCCCCCCCTCCCCCC AAACCCCCCCTCCCCCCC AAACCCCCCCCCCCCC AAACCCCCCCCCCCC Nucleotide changes Length of polypyrimidine tracts CRS 16189 T ! C 16193­C 16193­2C 16183 A ! C 16183 A ! C, 16193 ­C 16182 A ! C, 16183 A ! C 16182 A ! C, 16183A ! C, 16193­C C5-T-C4 C10 C11 C12 C11 C12 C12 C13 CRS 315­C 309­C, 315 ­C 309­2C, 315­C 309­3C, 315­C 315­2C 310 T ! C 310 T ! C, 315 ®C C7-T-C5 C7-T-C6 C8-T-C6 C9-T-C6 C10-T-C6 C7-T-C7 C13 C12 268 B. A. M   Table 4. Haplogroup distributions (no. of individuals and % values in parentheses) in Poles and Russians Haplogroup H HV* pre-V pre-HV J T* T1 K U1 U2 U3 U4 U5 U7 U8 U* I W X N1b N1c R* L3 M Poles (436) 197 (45±18) 4 (0±92) 21 (4±82) 0 34 (7±80) 41 (9±40) 9 (2±06) 15 (3±44) 0 4 (0±92) 2 (0±46) 22 (5±05) 38 (8±72) 1 (0±23) 2 (0±46) 1 (0±23) 8 (1±83) 16 (3±67) 8 (1±83) 1 (0±23) 1 (0±23) 2 (0±46) 1 (0±23) 8 (1±83) Russians (201) 85 (42±29) 4 (1±99) 11 (5±47) 1 (0±50) 16 (7±96) 18 (8±96) 4 (1±99) 6 (2±99) 2 (1±00) 3 (1±49) 2 (1±00) 7 (3±48) 21 (10±45) 1 (0±50) 0 0 5 (2±49) 4 (1±99) 7 (3±48) 0 0 1 (0±50) 0 3 (1±49) allowed detection of 455 different mitochondrial haplotypes (see Appendix) : 329 haplotypes among 436 Poles and 158 haplotypes among 201 Russians. This high resolution ensured that only 32 shared HVS I and II haplotypes were found between Poles and Russians. In order to determine the phylogenetic status of HVS I and II sequences, restriction analysis of the coding regions was performed. As a result, it was found that mitochondrial haplotypes in Poles and Russians are clustered, according to the mtDNA classification (Macaulay et al. 1999 ; Richards et al. 2000 ; Torroni et al. 2001), into haplogroups H, pre-V, HV*, pre-HV, U, K, J, T, I, X, N, R*, M, L3 and their subgroups (Table 4). The Polish and Russian samples studied are characterized by a similar pattern of mtDNA haplogroup distributions. Comparison between them did not reveal statistical differences (χ# ¯ 23±33, 23 .., p ¯ 0±44). The main mitochondrial haplogroup of the Polish and Russian sequences is group H, which is the most frequent haplogroup in Europe and also common in the Near East (Richards et al. 1998, 2000). Haplogroup H comprises the majority of the Russian (42±3 %) and Polish (45±2 %) samples. This haplogroup has been difficult to subdivide based on HVS I and II variation alone. A number of major clades within haplogroup H were revealed on the basis of highresolution mtDNA analysis and complete or partial mtDNA sequencing (Macaulay et al. 1999 ; Torroni et al. 1999 ; Finnila$ et al. 2001 b). Based on mtDNA HVS I and II sequencing data in Poles and Russians, only three clearly defined Hsubgroups, which are characterized by HVS I and II motifs 16362-239, 16293-16311-195 and 16162-73, respectively, were found. A transition, T ! C at np 239, appears to be a relatively stable marker for H-16362 sequence types, being found only sparsely on the background of haplogroup I (Table 2). Variant 73G is a relatively stable marker for those HVS I types which distinguish themselves from the CRS by a variant 16162G. However, HVS I sequence types determined by motif 16293, 16311 exhibit diagnostic variant 195C in a position that seems to be hypervariable (Table 2). The node designated as HV* (Richards et al. 1998, 2000) is highly important in mtDNA phylogeny because two of the most frequent haplogroups in Europe, H and pre-V, descend from it. The haplogroup HV*, rare in European populations, was identified in Polish and Russian samples with low frequency (1 % and 2 %, respectively). However, these sequences are heterogeneous and belong to various HV*subgroups, determined by variants 16067T, 16311C or 73G. A single sequence type 16126C16362C, which was found among Russians, is a member of cluster pre-HV (Richards et al. 2000). Haplogroup pre-V sequences, defined by the CR motif 16298-72 (Torroni et al. 2001), were present in Poles and Russians at frequencies of 4±8 % and 5±5 %, respectively. All of these samples harbored a full CR motif of haplogroup pre-V, with the exception of three Polish individuals who do not have a marker at np 72, but belong nevertheless to the haplogroup pre-V, being found in association with RFLP variant Polish and Russian MtDNAs ­15904MseI. In addition, the HVS I haplogroup pre-V sequences lacking 16298C variant were found in one Polish and one Russian individual. It may be noted that haplogroup pre-V frequencies in Poles and Russians correspond to those observed in other Western, Central and Northern European populations (Table 1 in Torroni et al. 2001). Phylogenetic studies have shown that haplogroups J and T stem from a common node which is distinguished from the ancestral node R* by polymorphisms at nps 4216, 11251, 15452 and 16126 (Macaulay et al. 1999 ; Finnila$ et al. 2001 b). Both haplogroups are widely distributed in European populations as well as in the Polish and Russian samples presented here. Haplogroup T represents 11±5 % of the Polish and 11 % of the Russian mtDNAs, and includes two distinct subgroups, T* and T1, distributed among Poles and Russians with equal frequencies. On the basis of HVS I motifs, subhaplogroup T* may be further differentiated into several subclusters ; but their phylogenetic reliability appears to be ambiguous due to the influence of several unstable nucleotide positions, such as 16296, 16292 and, possibly, 16304 (Malyarchuk & Derenko, 1999 ; Richards et al. 2000 ; Finnila$ & Majamaa, 2001). Haplogroup J sequences in Poles and Russians are characterized by similar frequencies of 7±8 % and 8 %, respectively. Based on HVS I polymorphisms, this haplogroup can be divided into four subgroups, determined by motifs 1606916126 (J*), 16069-16126-16145-16222-16261 (J1b), 16069-16126-16145-16231-16261 (J1a), and 16069-16126-16278 (J2) (Richards et al. 1998). Based on HVS II mutations, haplogroup J is characterized by marker variant 295T and can be further divided into subgroups, represented by additional motifs 185-228 (for J*), 242 (for J1b), 150-195 (for J1a), and 150 (for J2). Phylogenetic analysis of the complete mtDNA sequences revealed a subdivision of the haplogroup J into two major subclusters. One is determined by polymorphism at np 3010 and combines subgroups J* and J1b. The second subcluster is defined by polymorphisms at nps 7476 and 15257, and consists of J1b and J2 269 (Finnila$ & Majamaa, 2001). Therefore, comparison of the mtDNA coding region with noncoding region variability data suggests that parallel mutations at nps 16145, 16172 and 16261 should be assumed to obtain a concordant network for haplogroup J (Finnila$ & Majamaa, 2001). In addition, np 16222 has undergone two independent mutations, being found in J1b and J* Polish sequences (Table 1). Similarly, identical HVS I sequence types 16069-16126-16311 were observed in Poles and Russians as belonging to two different subgroups, J* and J1a, based on HVS II information. Subgroup J* was found to be predominant among Poles and Russians and was present at population frequencies of 4±6 % and 5±5 %, respectively. The remaining J-subclusters were found with lower frequencies, ranging from 0±9 % for J1a and J2 and 1±4 % for J1b in Poles, and from 0±5 % for J1a and 2 % for J1b in Russians. Haplogroup U and K sequences, which are defined by a variant ­12308HinfI, were found in 19±5 % of the Polish mtDNAs and in 20±0 % of the Russian mtDNAs. Of these, haplogroup K sequences are relatively rare both in Poles and in Russians (3±4 % and 3±0 %, respectively). On the contrary, haplogroup U itself is widely distributed in Slavonic populations and is represented by subgroups U*, U1, U2, U3, U4, U5, U7 and U8. U5, the most frequent and ancient subgroup of haplogroup U in Europe (Torroni et al. 1996 ; Richards et al. 1998, 2000), is represented in Poles and Russians by two main subgroups, U5a and U5b. On the basis of complete mtDNA sequence variation in Finns, Finnila$ et al. (2000) found mutations at np 14793 and at nps 7768 and 14182 were shared, correspondingly, by subgroups U5a (with HVS I motif 16192-1625616270) and U5b (with HVS I motif 16189-1619216270). This subdivision of haplogroup U5 is confirmed by HVS II sequence data, since all of U5b-sequences which were observed in Poles and Russians have an additional marker mutation at np 150 (Appendix). Although HVS II site 150 has undergone multiple mutations on the background of different mitochondrial lineages (Table 2), it nonetheless seems to be fixed for subgroup 270 B. A. M   Table 5. U4a sequence types distribution in different populations HVS I sequence HVS II sequence Coding region markers Sample origin CRS 73 195 263 310 4646 12308 Poles" CRS 73 152 195 263 310 4646 12308 Russians" CRS 66 73 195 263 310 315D 4646 12308 Poles" CRS 73 195 263 310 ND Austrians# 16129 16362 73 195 263 310 4646 12308 Russians" 16189 73 195 263 310 4646 12308 Poles" 16294 73 195 263 310 4646 12308 Poles" 16294 ND 12308 Nenets$ 16263 73 195 263 310 4646 12308 Russians" 16356 73 143 195 263 310 4646 12308 Poles" 16356 73 195 263 310 315D ND Germans% 16223 16356 73 195 263 310 4646 12308 Poles", Finns& Data from the following studies were analyzed : " Present study, # Parson et al. 1998, $ Saillard et al. 2000, % Baasner & Madea, 2000, & Finnila$ et al. 2001a. ND, not determined. U5b. The distribution of the subgroup U5a and U5b frequencies in Poles and Russians is approximately equal, with the U5a subgroup prevailing over U5b – 5±3 % and 3±4 % in Poles, and 7±5 % and 3 % in Russians. U4 (with CR motif 16356-195) is the next relatively frequent subgroup in the populations studied, being found at a frequency of 5 % in Poles and 3±5 % in Russians. Phylogeographic studies revealed that two major founder clusters characterize U4, determined by HVS I motifs 16356 and 16134-16356 (Richards et al.1998, 2000) ; it was also suggested that the latter subgroup appears to be specific for Central and Eastern European populations. In this study, 16134-16356 sequences with low frequencies of 1±4 % in Poles and 0±5 % in Russians were observed. Perhaps more importantly, among Poles and Russians 14 HVS I sequences which belong to haplogroup U (­12308HinfI) have been identified, but they do not share any mutations with subgroup-specific polymorphisms within haplogroup U (Table 5). All of these sequence types, as well as some members of subgroup U4, are characterized by HVS II motif 73-310. These samples were tested for the presence of a U4-diagnostic site ­4643RsaI and it was found that all of them belong to the U4subgroup. In accordance with the style of established mtDNA nomenclature (Richards et al. 1998 ; Macaulay et al. 1999) we designated U4sequences with the 310C variant in HVS II as belonging to clade U4a. Analysis of the published HVS I and II data allowed us to reveal U4a sequence types, although at a low frequency, in populations of Finno-Ugric-speaking Finns and Nenets, and German-speaking populations of Austrians and Germans (Table 5). Nevertheless, the current data on population distribution of U4a sequences led us to assume that the majority of them are characteristic for Poles and Russians, where this U4-subcluster was found with a frequency of 2±3 % and 2±0 %, respectively. The geographic picture of the U4a sequence distribution remains unclear, since many published population data on the HVS I and II variability appear to be insufficient to determine an exact phylogenetic status of the CR sequences (such as CRS-73, for instance) without the support of coding-region sites. This study has observed CRS-73 sequences belonging to haplogroups H and HV*. Therefore, additional detailed studies are required to elucidate the origin and diversification of the U4a subcluster in Europe. In addition, phylogenetic relationships between control region sequences belonging to the U4 subgroup remain ambiguous, and therefore, the branching order of these sequence types cannot be resolved (Figure 1). The median network demonstrates that two possible phylogenetic directions are possible. The first scenario suggests that mutation at np 310 appeared later than marker mutation at np 16356, and further diversification of the U4a occurred after back-mutation at np 16356. On the contrary, the second scenario suggests that mutation at np 310 outstripped change at np 16356, and hence, the U4a subcluster may be Polish and Russian MtDNAs 271 Fig. 1. Schematic phylogenetic network of the subhaplogroup U4 sequence types. The node U*, labelled by an asterisk (*), is defined by the RFLP variant ­12308HinfI and 73G variant in the HVS II, in comparison with the revised CRS (Andrews et al. 1999). The deletion event at np 315 was not considered. Any diversity within the node defined by 16356 variant alone is not shown. Reticulation in the network indicates ambiguity in the topology. RFLP variant is shown with the arrow pointing in the direction of a site gain. The nodes in the network represent the haplotypes found in populations (Table 5) as well as hypothetical intermediate haplotypes (empty nodes). Labelled nodes are U4a haplotypes observed in Poles (P), Russians (R), Germans (G), Austrians (A), Finns (F), Nenets (N), or in West Eurasians (WE). considered as an ancestral state for the U4phylogeny. Unfortunately, with the data on nucleotide stability in HVS I and II regions, we were unable to resolve this inconsistency due to an almost equal instability of nps 16356 and 310 (Tables 1 and 2). According to our data, the variant 16356C appeared twice and independently in the background of haplogroups U and H, but the variant 310C occurred independently in the background of haplogroup U, and rarely in association with H, T*, C, M* lineages. In addition, diversity estimates calculated for the two subsets of U4, with and without the 310C variant, gave similar values of ρ ¯ 0±929 for U4a and ρ ¯ 1±083 for the remaining U4-HVS I sequences found in Poles and Russians. Besides subgroups U5 and U4, several minor U-subclusters were found in Polish and Russian mtDNA pools. Subgroup U1 with HVS I motif 16189-16249 (Macaulay et al. 1999), accompanied by variant 285T in HVS II, was present at a frequency of 1±0 % in Russians. Subgroup U2 sequences, characterized by HVS I and II motif 16051-16129C-152-217-340, were observed at low frequencies, both in Poles (0±9 %) and in Russians (1±5 %). U3-sequences with CR motif 16343-150 appear to be rare in Poles and Russians, being found at frequencies of 0±5 % and 1±0 %, re- spectively. Similarly, U7 sequences with CR motif 16309-16318T}C-152 were present in the populations studied at low frequency (less than 1±0 %). The U8-subgroup (Finnila$ et al. 2001 b), which is defined by motif 16342-282, was observed only in Poles at a frequency of 0±5 %. The remaining haplogroups I, W, X, N1b, N1c observed in Poles and Russians belong to the macro-haplogroup N, which also encompasses all aforementioned clusters of haplogroups (HV, JT, UK) as members of the macro-haplogroup R (Macaulay et al. 1999 ; Richards et al. 2000). Haplogroup I, characterized by CR motif 1612916223-16391-199-204-250, occurred in Poles and Russians at a frequency of 1±8 % and 2±5 %, respectively. N1b and N1c sequences are defined by tentative HVS I motifs 16145-16176G-16223 and 16223-16265, correspondingly (Richards et al. 2000), and were found as individual haplotypes in Poles. Haplogroup W sequences (CR motif 16223-16292-189-204-207) were observed in Poles and Russians at frequencies of 3±7 % and 2±0 %. Topology of the phylogenetic network of haplogroups I and W was resolved based on mtDNA variability in the coding region, with the exception of reticulation composed of polymorphisms at nps 1719 and 8251 (Finnila$ et al. 2001 b). According to the phylogeny suggested by 272 B. A. M   Finnila$ et al. (2001 b), variant 204C appears to be ancestral for the IW branch, but various 207A originated twice as a parallel mutation in haplogroups W and I. However, population data on HVS I and II variation presented here demonstrated that combination of the variants 204C-207A is characteristic for mtDNA sequences from haplogroups W, I and N1c, implying that this motif may be considered as ancestral. Haplogroup X was found in Poles and Russians at a frequency of 1±8 % and 3±5 %, respectively. This haplogroup, rare in Europe, is determined by CR motif 16189-16223-16278153-195-225 and further subdivided into two clusters defined by mutations at nps 226 and 227. Interestingly, both in Poles (0±5 %) and in Russians (1±5 %) several sequence types without HVS II diagnostic mutations at nps 153, 195, 225 were observed. Several rare X-HVS I sequences defined by variants 16248T and 16266T-16274A were previously revealed in southern West Eurasian populations (Richards et al. 2000). In addition, X-HVS I sequences determined by variant 16241G, rare in Russians (1 %), were described recently among Gypsies at a frequency of 2±2 % (Gresham et al. 2001). The remaining CR sequences found in Poles and Russians were classified as belonging to the East Eurasian macro-haplogroup M. Both macro-haplogroups M and N coalesce to the African cluster L3, which is considered as the most recent ancestor of all Eurasians (QuintanaMurci et al. 1999 ; Ingman et al. 2000). Mhaplogroups such as C, D, E, G and Z are very rare in western European populations. We have observed members of the haplogroups C, D, E, G and M* in Poles and Russians at a frequency of 1±8 % and 1±5 %, respectively. However, diversity of the M-CR sequence types was high, both in Poles and in Russians. Haplogroup C sequences defined by CR motif 16223-1629816327-249D were present in Poles. Haplogroup C sequences were previously also described at low frequency in Russian populations (Orekhov et al. 1999 ; Malyarchuk et al. 2001). In addition, haplogroup Z sequences were revealed in Russians at a frequency of 1±3 % (Orekhov et al. 1999 ; Malyarchuk & Derenko, 2001). Interestingly, both haplogroup C and Z sequences are characterized by the deletion of an adenine residue at np 249 (variant 249D). According to the phylogenetic data based on variation in the complete mtDNA sequences, both haplogroups C and Z have shared polymorphisms at nps 4715, 7196CA, and 8584 (Finnila$ et al. 2001 b ; Maca-Meyer et al. 2001) and should be considered as sister haplogroups (Kivisild et al. 2001). Haplogroup Z sequences were found in many Siberian}Central Asian populations (Kolman et al. 1996 ; Derenko & Shields, 1997 ; Schurr et al. 1999 ; Derenko et al. 2000) as well as in Saami (Sajantila et al. 1995). The Saami gene pool is also characterized by the presence of the D-lineage with motif 1612616136-16189-16223-16360-16362, found at a low frequency of 4±7 % (Delghandi et al. 1998). In the present study, an identical sequence type was found among Russians. A similar CR sequence type, observed in Poles, belongs to the 16189subcluster of haplogroup D. In addition, both Polish and Russian samples are characterized by the presence of the Saami-specific U5b-motif (16144-16189-16270) found at a frequency of 0±5 % in Poles and 1±5 % in Russians. The presence of the Saami-specific mtDNAs from haplogroups D and U5b, as well as haplogroup Z sequences, in the mitochondrial gene pool of Russians was considered as a consequence of local Finno-Ugric tribe assimilation by Slavs during their movement to the north of Eastern Europe, a trend suggested previously by anthropologists (Alekseeva, 1973). The remaining M-sequences in Poles and Russians were identified as belonging to haplogroups G, E and M*. In the case of haplogroup G, both Russian and Polish sequence types had both G and E specific RFLPs (­4830HaeII} ­4831HhaI for G and ®7598HhaI for E) ; the latter marker originated on the background of haplogroup G due to mutation at np 7600, which gives a similar E-specific RFLP pattern (Kivisild et al. 2001). Therefore, the results of mtDNA variation study demonstrated that all major West Eurasian haplogroups and their subgroups were Polish and Russian MtDNAs 273 Table 6. The frequency of shared haplotypes found in Poles (POL) and in Russians (RUS) in comparison with Germans (GER) and Finns (FIN) HG H H H H H H H H H H H H H H H H HV* K U4 U5 U5 HVS I sequence HVS II sequence POL (436) RUS (201) GER (560) FIN (192) CRS 263 9±4 8±0 8±9 0 CRS 146 195 263 0±2 0±5 0±2 0 CRS 152 263 1±4 1±0 2±7 0 CRS 195 263 0±2 0±5 0±5 0 16093 263 0±5 2±5 0±2 0 16129 263 0±7 1±0 0±2 0 16274 146 263 0±2 0±5 0 0 16304 263 1±6 1±5 1±1 1±0 16051 16162 16259 73 263 0±2 0±5 0 0 16189 16356 263 0±5 0±5 0±4 0 16080 16189 16356 263 0±2 0±5 0 0 16189 16356 16362 263 0±7 0±5 0±4 0 16311 263 0±7 0±5 0±9 1±0 16278 16293 16311 195 263 0±2 2±0 0 0 16354 263 0±5 2±5 0 0 16362 239 263 1±4 2±0 0±5 0 CRS 73 263 0±5 0±5 ? 0 16224 16311 73 146 152 263 0±7 1±5 0±5 2±6 16093 16356 73 195 215 263 0±2 0±5 0 0 16192 16256 16270 73 263 1±0 0±5 0±7 0 16192 16256 16270 73 152 263 0±2 0±5 0 0 16399 U5 16192 16222 16256 73 263 0±2 0±5 0±2 0 16270 16399 U5 16256 16270 16399 73 263 0±2 1±5 0±5 0 U5 16256 16270 16399 73 152 263 0±2 1±0 0 0 J* 16069 16126 73 185 263 295 0±7 0±5 0±2 0 J* 16069 16126 73 185 228 263 295 0±2 0±5 1±1 0 J* 16069 16126 16311 73 185 263 295 0±2 0±5 0 0 J1b 16069 16126 16145 73 242 263 295 0±7 1±5 0±2 0 16172 16222 16261 T* 16126 16294 16296 73 263 0±5 1±0 1±3 0 T* 16126 16294 16296 73 263 1±6 3±0 1±4 0 16304 T1 16126 16163 16186 73 152 195 263 1±2 1±0 0±7 1±6 16189 16294 pre-V 16298 72 263 2±1 1±5 1±3 2±1 I 16129 16172 16223 73 199 203 204 250 263 0±2 0±5 0±4 3±1 16311 16391 X 16189 16223 16255 73 153 195 225 227 263 0±2 0±5 0±2 0±5 16278 HG denotes mitochondrial haplogroup. A question mark (?) denotes that haplogroup affiliation of the CR sequence type cannot be determined without additional coding-region markers. detected in Poles and Russians. It was also found that the East Asian admixture in Poles and Russians appears to be insignificant (less than 2±0 %). MtDNA haplotypes and subclusters shared between Poles and Russians It has been suggested, by means of phylogenetic analysis (Comas et al. 1997 ; Richards et al. 1998 ; Simoni et al. 2000), that European populations demonstrate limited genetic differ- entiation and do not exhibit any obvious geographic patterns. However, the study by Helgason et al. (2000) indicated that European populations contain a large number of closely related mtDNA lineages, many of which have not yet been sampled in the current comparative data set. This means that geographic patterns of mtDNA variation may exist at the level of individual lineages or lineage subclusters. In the present study, a high level of mtDNA diversity in Poles and Russians sharing the same language group has been found. In order to 274 B. A. M   Table 7. The frequency of shared HVS I subclusters found in Poles (POL) and in Russians (RUS) in comparison with Germans (GER) and Finns (FIN) HG HVS I subclusters H 16129, 16129-16316 H 16256, 16256-16352, 16256-16319 H 16291 H 16278-16293-16311 H 16092-16140-16265-16293-16311 H 16192-16304-16311 H 16189-16356 H 16080-16189-16356 H 16189-16356-16362 H 16354 pre-V 16153-16298 J* 16069-16126-16311 U2 16051-16129C-16189-16256 U4 16093-16356 U4a CRS, 16356 U5 16192-16222-16256-16270-16399 U5 16192-16256-16270-16291-16399 W 16223-16292-16325 HG denotes mitochondrial haplogroup. POL (436) 0±7 0±2 0±2 0±7 2±8 0±2 1±6 0±5 1±2 0±7 0±5 0±2 0±5 0±2 2±3 0±2 0±9 0±7 investigate genetic similarity between them at the level of shared mtDNA haplotypes and their subclusters, the total number of CR sequence types has been reduced by means of removing polymorphic variants at unstable sites (such as A ! C transversions at nps 16182 and 16183) and insertions of additional C residues in the HVS I and II poly-C tracts. As a result, out of 297 and 142 CR sequence types observed in Poles and Russians, respectively, 34 are shared between these population samples. Table 6 shows the distribution of shared haplotypes between Poles and Russians in comparison with Germans and Finns. The latter populations were selected in accordance with their geographic proximity and the historical evidence concerning their participation in the formation of modern Poles and Russians. The results of this analysis indicate that only a small fraction of the CR haplotypes (10 out of 34 haplotypes) appear to be actually shared between Poles and Russians, not being found in German and Finnish gene pools. These haplotypes belong to five different haplogroups – H, HV*, U4, U5, and J*. It should be noted, however, that the majority of these haplotypes belong to subclusters which can be found in common among many West Eurasian populations. RUS (201) 2±5 2±5 0±5 1±5 0±5 1±0 0±5 1±0 1±0 4±5 1±0 0±5 0±5 0±5 2±0 1±0 0±5 0±5 GER (560) 0±7 0±4 0±4 0±2 0±2 0±5 0±4 0±2 1±1 0 0±2 0 0±2 0 0±4 0±2 0±5 0 FIN (192) 0±5 0 0 0 0 0 0 0 0 1±0 2±6 1±0 0 0 0±5 0 0 0 In order to identify subclusters of CR haplotypes which are specific mainly for Poles and Russians, the distribution of haplotypes that differ by the fewest number of base substitutions in Poles and Russians and their neighbours, Germans and Finns, were analyzed. Although almost all of the mtDNA subclusters observed in Poles and Russians can be accounted for in many European populations, this analysis allowed us to reveal at least 16 subclusters of relatively rare haplotypes which have a preferential distribution among Poles and Russians (Table 7). In Russians, H-subclusters determined by HVS I motifs 16129 (and 16129-16316), 16256 (and 16256-16352, 16256-16319), and 16354 were found at a relatively high frequency, ranging from 2±5 % to 4±5 %. In Poles, sequence types with motif 16092-16140-16265-16293-16311 occurred at the frequency of 2±8 %. Similar haplotypes, defined by motif 16293-16278-16311, were also common between Russians and Poles (1±5 % and 0±7 %, respectively). However, it is known that the subcluster of H-haplotypes determined by motif 16293-16311 has a pan-European distribution (Richards & Macaulay, 2000). Moreover, the highest frequency (6±1 %) of this Hsubcluster was found in Estonians (Tambets et al. 2000). Another H-subcluster, defined by motif Polish and Russian MtDNAs 16189-16356 and its branches 16080-16189-16356 and 16189-16356-16362, was found frequently in Poles (3±3 %) as well as in Russians (2±5 %) and Germans (1±7 %). A relatively high occurrence of H1-sequences determined by motif 16192-1630416311 is characteristic for Russians in comparison to Poles and Germans, but another H1branch (with motif 16294-16304) is clearly common between Germans and Poles. Taking into account the data presented in Tables 6 and 7, one can conclude that we were not able to find any specific combinations of unique mtDNA haplotypes and their subclusters clearly distinguishing Poles and Russians, as Slavonic-speaking populations, from the neighboring European populations such as Germans and Finns. This trend was also noted in a previous study on the HVS I-RFLP variation in Russians in comparison with Western and Eastern European populations (Malyarchuk & Derenko, 2001). One possible exception is subgroup U4a. This subgroup comprises 10 (2±3 %) out of 436 Poles, 4 (2±0 %) out of 201 Russians, 2 (0±4 %) out of 560 Germans (Parson et al. 1998 ; Baasner & Madea, 2000) and 1 (0±25 %) out of 403 Finns (Finnila$ et al. 2001 a). Given the relatively high frequency and diversity of U4a among Poles and Russians and its low frequency in the neighbouring German and Finnish populations, one can suggest a central-eastern European origin of U4a. It is possible that the subsequent dispersal of this mtDNA subgroup in Eastern European populations was due to Slavonic migrations. Undoubtedly, to elucidate the origin of the U4a subgroup, additional analysis is required followed by a much more extensive sampling of Slavonic and other European populations.  Analysis of mtDNA variation, performed by means of sequencing two hypervariable segments and assaying of haplogroup-diagnostic polymorphisms in the coding region, appears to be an effective genetic tool for inferring the genetic 275 history of populations (Macaulay et al. 1999). In the present study, we have found that Poles and Russians are characterized by the same West Eurasian mtDNA haplogroups which describe at least 95 % of mtDNA variations in Europe and the Near East (Torroni et al. 1996 ; Richards et al. 1998, 2000). Although there is a good correspondence between CR sequences and RFLPs grouping into monophyletic mtDNA clusters, and this looks to be strongest when only HVS I sequences are used in comparison (Bandelt et al. 2000) ; the addition of the HVS II sequences may be extremely useful in the resolution of the phylogenetic relationships among some uncertain mitochondrial lineages. A good example of this is subgroup U4a which does not have a certain HVS I motif, but can be recognized on the basis of HVS II information. Despite the high level of mtDNA variation in Poles and Russians, both populations exhibit a similar pattern of mtDNA haplogroup distribution, which is also typical for many European populations studied. Moreover, the analysis of distribution of CR haplotypes and subclusters shared between Poles and Russians has shown that both Slavonic populations share them mainly with Germans and Finns. These data allow us to suggest that Europeans, despite their linguistic differences, originated in the common genetic substratum which predates the formation of the most modern European populations. It seems that considerable genetic similarity between European populations, which has been revealed by mtDNA variation studies, was further accelerated by a process of gene redistribution between populations due to the multiple migrations occurring in Europe during the past millenia (Sykes, 1999 ; Helgason et al. 2000 ; Richards et al. 2000). As for Slavonicspeaking populations, the evidence from the present study and our previous work (Malyarchuk & Derenko, 2001) suggests that the assumption of a common central European origin of Slavs should be tested with additional studies of mtDNA and Y chromosome variability in Slavonic populations inhabiting different regions of Europe. 276 B. A. M    mtDNA haplotypes and their distribution in Polish and Russian populations HVS I (minus 16000) HVS II HG POL RUS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS CRS 066 172 218 318AC 328CA 093 093 093 129 316 093 129 189 193±1 316 095 111 189 193±1 114 270 129 129 129 129 210 148 247 168 176 179 183 239CG 209 209 111 209 218 222 231C}T 189 291 235 291 239 244 399 250 256 256 256 352 261 261 265 266 270 274 274 274 278 286 311 304 304 304 304 304 304 093 304 111CA 304 153 304 172 304 213 304 243 304 271 304 092 294 304 294 304 294 304 192 304 192 304 311 167 192 304 311 162 263 309±1 315±1 263 315±1 263 309±1 309±2 315±1 263 309±1 315±1 337 143 228 263 309±1 315±1 146 263 309±1 315±1 146 152 263 309±1 315±1 146 263 309±1 309±2 315±1 146 195 263 309±1 315±1 150 263 315±1 93 152 263 309±1 315±1 152 263 315±1 152 263 309±1 315±1 152 263 309±1 309±2 315±1 152 195 263 309±1 315±1 152 199 263 309±1 309±2 315±1 152 204 309±1 309±2 315±1 186 263 315±1 186 263 309±1 315±1 195 263 315±1 195 263 309±1 309±2 315±1 199 263 309±1 315±1 228 263 309±1 315±1 262 263 309±1 315±1 263 269 315±1 263 315±1 357 73 146 263 309±1 309±2 315±1 73 182 263 309±1 315±1 195 198 263 309±1 309±2 315±1 263 309±1 315±1 263 315±1 73 263 315±1 207 263 309±1 309±2 315±1 93 263 309±1 315±1 152 182 263 309±1 309±2 315±1 146 263 309±1 315±1 263 315±1 263 309±1 315±1 N}A 263 309±1 309±2 315±1 263 315±1 152 263 309±1 315±1 195 263 315±1 263 309±1 315±1 152 263 309±1 315±1 263 315±1 42±1 146 182 215 263 309±1 315±1 263 309±1 315±1 263 315±1 93 263 309±1 315±1 263 309±1 315±1 263 309±1 315±1 263 315±1 207 263 309±1 309±2 315±1 263 309±1 309±2 315±1 200 263 315±1 263 309±1 315±1 263 309±1 315±1 263 309±1 315±1 152 263 309±1 315±1 152 263 309±1 309±2 315±1 152 263 315±1 315±1 146 263 315±1 146 263 309±1 315±1 73 263 315±1 263 309±1 315±1 143 152 263 309±1 315±1 263 309±1 315±1 263 315±1 146 263 309±1 315±1 152 263 309±1 315±1 195 263 315±1 199 263 309±1 309±2 315±1 263 309±1 309±2 315±1 263 309±1 315±1 263 315±1 263 315±1 263 309±1 315±1 263 315±1 263 309±1 309±2 315±1 263 315±1 263 315±1 236 263 315±1 195 240 263 315±1 263 309±1 309±2 315±1 263 309±1 315±1 73 263 309±1 315±1 H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H 12 22 7 1 1 2 8 5 3 1 1 1 1 1 4 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 2 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 4 3 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 Polish and Russian MtDNAs 277  (cont.) HVS I (minus 16000) HVS II HG 162 209 162 258AC 051 162 259 051 162 291 304 188CA 188CG 188 188 188CG 189 189 183C 189 193±1 093C}T 183C 189 193±1 189 193±1 189 193±1 189 193±1 193±2 188 189 356 169 183C 189 356 189 193±1 356 189 193±1 356 080 189 356 080 183C 189 356 080 189 193±1 356 080 189 193±1 193±2 231 356 189 356 183C 189 356 183C 189 356 183C 189 193±1 356 360 093 183C 189 356 360 183C 189 356 362 182C 183C 189 356 362 092 183C 189 193±1 356 362 189 193±1 356 362 189 356 362 189 290 291 311 356 362 189 318 356 311 311 311 311 311 391 093 311 093 311 157 311 221 311 249 249 311 042 288 290 311 319 148 256 319 265 352 278 293 278 293 311 278 293 311 209 278 293 311 319 129 293 170 293 293 311 293 311 293 311 092 092 092 183 293 311 092 140 265 293 311 092 140 265 270 293 311 092 140 265 293 311 092 140 189 193±1 265 293 311 342 070 070 343 304 343 354 354 167 354 193 354 354 399 354 399 399 362 362 362 362 362 182C 183C 189 362 193 219 362 193 219 319 362 300 325C}T 362 137AT 176 256 311 CRS 380 73 199 263 309±1 315±1 73 263 309±1 315±1 73 263 315±1 73 263 315±1 263 315±1 263 315±1 263 315±1 263 309±1 309±2 315±1 263 309±1 309±2 315±1 152 263 309±1 315±1 263 309±1 315±1 263 309±1 309±2 315±1 152 263 309±1 315±1 263 315±1 263 315±1 263 315±1 263 315±1 152 263 315±1 146 263 309±1 309±2 315±1 263 309±1 315±1 151 263 309±1 309±2 315±1 263 309±1 315±1 146 263 309±1 309±2 315±1 263 309±1 309±2 315±1 263 309±1 309±2 315±1 263 315±1 263 315±1 263 315±1 263 315±1 263 315±1 263 315±1 263 309±1 309±2 315±1 263 315±1 64 263 315±1 263 315±1 263 315±1 152 263 315±1 144 195 263 309±1 315±1 195 263 309±1 315±1 263 309±1 309±2 315±1 263 315±1 131 152 263 309±1 315±1 263 309±1 315±1 263 309±1 315±1 152 263 309±1 315±1 263 309±1 315±1 263 309±1 315±1 263 309±1 315±1 146 189 193 263 309±1 309±2 315±1 263 309±1 315±1 195 263 315±1 195 263 309±1 315±1 195 263 315±1 195 215 263 309±1 309±2 315±1 263 315±1 263 315±1 143 195 263 309±1 315±1 195 263 315±1 195 263 309±1 315±1 195 263 309±1 315±1 263 309±1 315±1 195 263 315±1 195 263 315±1 195 263 309±1 315±1 195 204 263 315±1 195 263 315±1 263 309±1 315±1 152 263 315±1 152 263 309±1 309±2 315±1 151 263 279 309±1 309±2 315±1 263 309±1 315±1 263 309±1 309±2 315±1 263 309±1 309±2 315±1 127 152 263 309±1 309±2 315±1 150 263 310 N}A 146 263 309±1 309±2 315±1 239 263 315±1 239 263 309±1 315±1 239 258 263 309±1 309±2 309±3 315±1 319 239 263 309±1 309±2 309±3 315±1 319 239 263 309±1 309±2 315±1 146 239 263 309±1 309±2 309±3 315±1 93 204 239 263 309±1 315±1 204 239 263 315±1 239 263 309±1 315±1 73 152 263 295 309±1 315±1 72 263 309±1 309±2 315±1 72 263 315±1 H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H H pre-V pre-V POL RUS 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 2 1 1 1 1 8 1 1 1 1 2 1 1 1 1 1 4 1 1 1 1 1 1 4 1 1 1 2 2 1 1 1 1 1 1 1 278 B. A. M    (cont.) HVS I (minus 16000) HVS II HG 298 298 298 298 298 298 104CA 298 126 298 150 298 169 298 216 298 218 298 270 298 298 311 153 298 153 298 153 298 153 189 298 291 298 CRS CRS 067 355 295 295 311 234 311 126 362 069 126 069 126 069 126 069 126 069 126 069 126 069 126 069 126 063 069 126 069 078D 126 069 126 189 193±1 069 126 145 183C 189 069 126 213 069 126 222 069 126 230 069 126 249 069 092 126 261 069 093 126 290 069 126 311 069 126 319 069 126 319 069 126 186 362 069 126 324 366 069 126 366 069 126 366 390 069 126 145 172 222 261 069 126 145 172 222 261 069 126 145 172 222 261 069 092 126 145 172 222 261 069 093 126 145 172 222 261 069 126 145 172 192 222 261 069 126 145 231 261 069 126 145 189 193±1 231 261 069 126 311 069 126 241 069 126 193 278 069 126 193 278 069 126 193 278 319 069 126 278 126 294 126 185 294 126 192 292 294 126 146 284 292 294 296 126 294 296 126 294 296 126 209 294 296 126 294 296 301 126 294 296 320 126 171 294 296 324 126 294 296 324 126 294 304 126 294 304 126 294 304 126 294 304 355 126 172 192 294 304 126 172 189 214 294 304 126 222 294 304 126 294 296 304 126 294 296 304 126 294 296 304 126 294 296 304 126 294 296 304 126 294 296 304 72 263 315±1 72C}T 195 263 309±1 315±1 72 195 263 309±1 309±2 315±1 72 263 309±1 315±1 72 263 309±1 309±2 315±1 72 195 228 263 309±1 315±1 72 151 228 263 309±1 315±1 72 263 309±1 315±1 42±1 72 263 309±1 309±2 315±1 72 263 309±1 315±1 263 309±1 309±2 315±1 72 189 194 263 309±1 309±2 315±1 72 263 315±1 195 263 309±1 309±2 315±1 72 93 263 309±1 315±1 72 93 195 263 309±1 315±1 72 93 195 263 315±1 72 93 195 263 309±1 315±1 72 93 195 263 309±1 309±2 315±1 73 263 315±1 73 263 309±1 315±1 150 200 263 309±1 315±1 146 263 315±1 263 309±1 309±2 315±1 93 263 309±1 309±2 315±1 263 315±1 60±1 64 151 152 197 198 263 309±1 309±2 315±1 73 146 185 188 222 228 263 295 315±1 73 185 188 228 263 295 309±1 315±1 73 185 263 295 315±1 73 185 263 295 309±1 315±1 73 185 263 295 309±1 309±2 315±1 73 146 185 188 228 263 295 315±1 73 185 228 263 295 315±1 73 185 210 228 263 295 315±1 73 228 263 295 315±1 73 185 188 228 263 295 315±1 73 185 228 263 295 309±1 315±1 73 185 228 263 295 315±1 73 146 185 188 228 263 295 315±1 73 185 228 263 295 315±1 73 185 228 263 295 315±1 73 185 188 228 263 295 315±1 73 185 228 263 295 315±1 73 185 188 228 263 295 309±1 315±1 73 185 263 295 315±1 73 152 185 228 263 295 315±1 73 185 228 263 295 315±1 73 185 188 228 263 295 309±1 309±2 315±1 73 185 188 228 263 295 309±1 315±1 73 185 188 228 263 295 315±1 73 185 188 263 295 309±1 315±1 73 242 263 295 309±1 315±1 73 242 263 309±1 315±1 73 242 263 295 315±1 73 146 242 263 295 315±1 73 242 263 295 309±1 309±2 315±1 73 242 263 295 315±1 73 150 152 195 215 263 295 309±1 315±1 319 73 150 152 195 215 263 295 309±1 315±1 319 73 150 195 204 263 295 309±1 315±1 150 195 263 295 315±1 73 150 263 295 309±1 315±1 73 150 152 263 295 309±1 315±1 73 150 263 295 309±1 315±1 73 263 315±1 73 152 263 315±1 73 152 263 309±1 315±1 73 146 152 263 279 309±1 315±1 73 263 315±1 73 263 315±1 73 263 309±1 315±1 73 263 315±1 73 263 310 73 263 315±1 73 263 315±1 73 152 263 309±1 315±1 73 263 315±1 73 263 309±1 309±2 315±1 73 263 309±1 315±1 73 152 263 309±1 315±1 73 263 309±1 315±1 73 263 309±1 315±1 73 263 309±1 315±1 73 146 263 309±1 315±1 73 150 263 315±1 73 152 263 315±1 73 263 315±1 73 263 309±1 315±1 73 263 309±1 309±2 315±1 pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V pre-V HV* HV* HV* HV* HV* HV* HV* pre-HV J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J* J1b J1b J1b J1b J1b J1b J1a J1a J1a J1a J2 J2 J2 J2 T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* POL 6 3 RUS 1 1 1 2 1 1 2 1 1 2 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 2 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 1 2 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 2 1 1 3 1 1 1 1 1 2 2 4 1 4 2 Polish and Russian MtDNAs 279  (cont.) HVS I (minus 16000) HVS II HG POL 126 294 296 304 294 296 304 126 129 294 296 304 126 294 296 304 318 126 234 294 296 304 126 172 227 294 296 304 126 271 294 296 304 271 294 304 126 260 294 296 304 126 294 296 304 362 126 294 296 304 362 126 294 296 304 399 126 147 294 296 297 304 126 147 189 294 296 297 304 126 140 183C 189 193±1 294 296 311 126 182C 183C 189 294 296 298 126 294 296 298 126 129 163 189 243 294 126 163 186 189 294 126 163 186 189 294 126 163 186 189 294 126 163 186 189 294 126 163 170 186 189 294 126 186 189 209 294 126 163 186 189 293 294 126 163 186 189 294 319 224 311 224 311 224 311 224 311 224 311 224 311 093 224 311 093 192 224 311 093 224 256 311 224 274 311 224 291 311 224 293 311 189 192 224 311 093 183C 189 193±1 224 311 224 311 368 069 092 224 311 172 189 234 311 086 239 311 320 129 183C 189 224 249 288 182C 183C 189 249 051 129C 183C 189 193±1 209 362 051 129C 183C 189 193±1 362 051 093 129C 182C 183C 189 193±1 362 051 093 129C 183C 189 362 051 129C 189 256 051 129C 189 209 256 129C 183C 189 256 343 343 168 343 325 343 CRS CRS CRS 129 362 189 263 294 356 223 356 356 356 356 356 093 356 134 134 356 134 150 356 134 221 234 356 134 207 356 179 356 179 356 270 192 256 270 093 189 192 256 270 192 256 270 399 192 256 270 399 192 222 256 270 399 192 222 256 270 390 399 192 256 270 291 399 093 192 256 291 399 172 192 256 270 291 399 192 256 270 304 399 192 256 270 304 399 129 256 270 311 399 73 73 73 73 73 73 73 73 41 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 66 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 73 T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T* T1 T1 T1 T1 T1 T1 T1 T1 T1 K K K K K K K K K K K K K K K K K U* U1 U1 U2 U2 U2 U2 U2 U2 U2 U3 U3 U3 U3 U4a U4a U4a U4a U4a U4a U4a U4a U4a U4* U4* U4* U4* U4* U4* U4* U4* U4* U4* U4* U4* U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a 1 2 1 1 1 1 1 207 263 309±1 309±2 315±1 263 315±1 263 315±1 150 263 309±1 315±1 152 263 315±1 263 315±1 263 315±1 315±1 73 263 309±1 315±1 319 263 315±1 146 199 263 315±1 263 315±1 263 309±1 315±1 240 263 309±1 309±2 315±1 195 263 309±1 315±1 195 263 309±1 309±2 315±1 199 263 309±1 315±1 263 309±1 315±1 385 152 195 263 309±1 315±1 152 195 263 315±1 195 263 315±1 152 195 263 309±1 309±2 315±1 152 195 263 315±1 152 195 263 309±1 315±1 152 195 263 315±1 263 309±1 315±1 204 263 315±1 263 309±1 315±1 195 263 315±1 146 195 263 315±1 146 152 263 315±1 146 152 263 309±1 309±2 315±1 247 250 263 315±1 150 195 263 315±1 263 309±1 315±1 195 263 315±1 263 309±1 309±2 315±1 263 309±1 315±1 195 263 309±1 309±2 315±1 189 195 215 263 315±1 146 152 263 309±1 315±1 146 152 263 315±1 324 151 195 263 315±1 150 263 315±1 150 195 263 285 315±1 385 263 285 309±1 315±1 217 228 263 315±1 318 340 152 217 263 309±1 309±2 315±1 340 152 217 263 309±1 309±2 315±1 340 152 217 263 309±1 315±1 152 217 263 315±1 340 152 217 263 315±1 340 152 217 263 315±1 340 150 152 263 315±1 150 179 195 263 315±1 150 152 263 309±1 315±1 150 263 315±1 195 263 310 152 195 263 310 73 195 263 310 315D 195 263 310 195 263 310 195 263 310 195 263 310 143 195 263 310 195 263 310 146 195 228 263 315±1 146 195 263 309±1 315±1 195 263 309±1 315±1 195 236 263 309±1 315±1 195 215 263 309±1 315±1 152 195 263 296 315±1 152 195 263 309±1 315±1 152 195 198 263 309±1 309±2 315±1 152 195 263 309±1 315±1 152 195 204 263 315±1 195 263 309±1 315±1 195 263 315±1 263 315±1 263 315±1 263 315±1 152 263 315±1 195 198 204 263 315±1 263 309±1 315±1 204 263 309±1 315±1 263 315±1 263 315±1 200 263 315±1 263 315±1 263 309±1 315±1 146 263 299±1 309±1 315±1 RUS 1 1 1 1 1 1 1 1 1 1 3 2 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1 1 1 1 2 1 1 3 1 1 1 1 1 3 1 1 1 1 1 1 1 1 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 280 B. A. M    (cont.) HVS I (minus 16000) HVS II HG POL 192 256 270 286 320 399 076 192 256 270 399 145 189 192 256 270 399 256 270 256 270 256 270 399 256 270 399 256 270 399 051 256 270 399 256 270 362 399 256 260 270 291 399 256 270 291 294 399 114CA 192 256 270 294 114CA 192 256 270 294 189 270 189 270 291 093 189 270 093 189 270 093 189 193±1 270 179 189 193 193±1 270 183C 189 193±1 270 286 093 182C 183C 189 193±1 270 140 174 183C 189 193±1 270 288 311 093 258 270 292 362 189 325 189 217 234 270 398 189 192 270 398 189 270 398 144 189 270 144 189 266 270 144 183C 189 193±1 241AT 270 144 189 193±1 270 309 318AT 362 073D 126 148 309 318AC 146 342 179 342 179 187 227 245 266 274 278 362 071 355 357 311 129 223 391 129 223 391 129 223 391 086 129 223 391 129 223 304 391 129 223 311 129 223 311 391 129 172 223 311 391 129 172 223 311 391 129 172 223 293 311 391 129 172 223 311 391 129 172 189 223 311 391 129 172 223 294 311 391 145 176G 223 390 201 223 265 223 292 223 292 223 292 223 292 223 292 223 292 311 223 292 311 223 292 362 223 292 362 071 129 223 292 178 223 292 223 292 295 192 223 292 325 192 223 292 325 192 223 325 223 292 325 189 223 292 295 223 292 320 223 278 189 223 278 183C 189 223 278 183C 189 223 255 278 183C 189 223 255 278 183C 189 223 255 278 300 086 182C 183C 189 223 255 278 300 108 189 193±1 193±2 223 255 278 183C 189 223 255 278 344 189 223 248 278 126 183C 189 223 241 278 093 189 193±1 223 241 278 183C 189 223 266 274 278 390 183C 189 193±1 223 266 274 278 124 223 093 223 234 288 298 327 093 223 234 288 298 327 189 193±1 223 288 298 327 126 136 182C 183C 189 193±1 223 360 362 73 183 263 315±1 73 263 309±1 315±1 73 195 263 309±1 315±1 73 263 309±1 315±1 73 263 315±1 73 263 315±1 73 263 309±1 315±1 73 152 263 309±1 315±1 73 263 309±1 315±1 73 152 204 263 309±1 315±1 73 263 309±1 315±1 73 263 309±1 315±1 73 263 309±1 315±1 263 309±1 315±1 73 150 263 315±1 73 150 152 263 315±1 73 150 152 263 315±1 73 150 152 263 270±1 315±1 73 150 263 309±1 315±1 73 150 263 315±1 73 150 152 263 315±1 73 150 152 263 315±1 315±2 73 150 263 309±1 315±1 73 150 263 309±1 315±1 73 150 152 263 315±1 73 150 263 315±1 73 150 263 315±1 73 150 263 315±1 73 150 263 315±1 73 150 263 292 315±1 73 150 263 315±1 73 150 152 243 263 315±1 60 73 152 263 315±1 73 146 151 152 195 263 315±1 73 263 282 309±1 315±1 73 263 282 309±1 315±1 73 194 195 246 315±1 73 81 146 150 152 263 283 309±1 315±1 73 263 295 315±1 73 152 199 204 207 250 263 315±1 73 152 199 204 207 239 250 263 309±1 309±2 315±1 73 152 199 204 207 250 263 309±1 309±2 315±1 73 152 199 204 207 239 250 263 315±1 73 199 204 250 263 315±1 199 204 250 263 315±1 73 199 204 250 263 309±1 315±1 73 199 203 204 250 263 315±1 73 199 203 204 250 263 309±1 315±1 73 199 203 204 250 263 309±1 315±1 73 199 204 250 263 315±1 73 199 250 263 309±1 315±1 73 199 203 204 250 263 309±1 315±1 73 152 263 315±1 75 189 195 204 207 210 263 309±1 315±1 73 189 194 195 204 207 263 309±1 315±1 73 189 194 195 199 204 207 263 309±1 315±1 73 146 195 204 207 263 309±1 315±1 73 143 189 194 195 204 207 263 315±1 73 119 189 195 204 207 263 315±1 73 119 152 189 195 204 207 263 315±1 73 189 195 204 207 263 309±1 315±1 73 189 194 195 204 207 263 309±1 315±1 73 189 194 195 207 263 315±1 73 150 189 194 195 199 204 207 263 309±1 315±1 73 189 194 195 204 207 263 315±1 73 119 152 189 195 207 263 315±1 73 189 194 195 204 207 263 309±1 315±1 73 189 194 195 204 207 263 315±1 73 189 194 195 204 207 215 263 309±1 315±1 73 189 194 195 207 263 309±1 315±1 73 189 195 204 207 263 315±1 73 189 195 204 207 263 315±1 73 153 195 225 226 263 309±1 315±1 73 153 195 225 226 263 309±1 315±1 73 146 153 195 198 225 226 309±1 315±1 73 153 195 225 227 263 315±1 73 153 195 225 227 263 309±1 315±1 73 153 195 225 227 263 315±1 73 153 195 225 227 263 315±1 73 153 195 225 263 315±1 73 153 195 225 227 263 309±1 315±1 73 153 195 199 263 309±1 315±1 73 263 315±1 73 195 204 263 315±1 73 146 152 182 195 263 309±1 309±2 315±1 73 146 152 195 263 309±1 315±1 73 151 152 195 263 315±1 73 249D 263 315±1 54 73 249D 263 315±1 73 152 249D 263 310 73 150 263 309±1 309±2 315±1 U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5a U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U5b U7 U7 U8 U8 R* R* R* I I I I I I I I I I I I I N1b N1c W W W W W W W W W W W W W W W W W W X X X X X X X X X X X X X X L3 C C C D 2 RUS 1 1 1 1 1 1 1 1 3 2 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 2 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 2 1 1 1 Polish and Russian MtDNAs 281  (cont.) HVS I (minus 16000) HVS II HG POL 092 223 093 129 223 223 42±1 73 150 263 309±1 309±2 315±1 73 263 309±1 315±1 73 152 263 315±1 73 263 310 73 153 263 315±1 73 260 263 309±1 315±1 D G G M* M* E 1 102 227 209 148 234 278 164 234 223 192 300 362 182C 183C 189 193±1 223 266 362 278 362 227 234 278 309 362 223 291 298 316 362 RUS 1 1 1 1 1 Sample codes : POL, Poles ; RUS, Russians. Mutations are shown indicating positions relative to the CRS (Anderson et al. 1981). The nucleotide positions in HVS I and II sequences correspond to transitions ; transversions are further specified. Haplogroup names (HG) are given in capital letters according to the mtDNA classification (Macaulay et al. 1999 ; Richards et al. 2000). The presence of insertions or deletions is referred by .1, .2 and .3 or D, respectively, following the nucleotide position. We are very grateful to Ewa Lewandowska for her excellent technical assistance. The authors would like to thank two anonymous reviewers for the useful comments. This work was supported by the Russian Foundation for Basic Research (grant 00-06-80448), and the grant from the Ludwik Rydygier Medical University in Bydgoszcz, Poland (BW66}02).  Alekseeva, T. I. (1973). Ethnogenesis of Eastern Slavs. Moscow : Moscow State University (in Russian). Alekseeva, T. I. & Alekseev, V. P. (1989). Anthropological view of the origin of Slavs. Priroda 881, 60–69 (in Russian). Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H. L., Coulson, A. R., Drouin, J., et al. (1981). Sequence and organization of the human mitochondrial genome. Nature 290, 457– 465. Andrews, R. M., Kubacka, I., Chinnery, P. F., Lightowlers, R. N., Turnbull, D. M. & Howell, N. (1999). Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nature Genet. 23, 147. Baasner, A. & Madea, B. (2000). Sequence polymorphisms of the mitochondrial DNA control region in 100 German Caucasians. J. Forensic Sci. 45, 1343–1348. Baasner, A., Scha$ fer, C., Junge, A. & Burkhard, M. (1998). Polymorphic sites in human mitochondrial DNA control region sequences : population data and maternal inheritance. Forensic Sci. Int. 98, 169–178. Bandelt, H.-J., Forster, P., Sykes, B. C. & Richards, M. B. (1995). Mitochondrial portraits of human populations using median networks. Genetics 141, 743–753. Bandelt, H.-J., Macaulay, V. & Richards, M. (2000). Median networks : speedy construction and greedy reduction, one simulation and two case studies from human mtDNA. Mol. Phylogenet. Evol. 16, 8–28. Bendall, K. E. & Sykes, B. C. (1995). Length heteroplasmy in the first hypervariable segment of the human mtDNA control region. Am. J. Hum. Genet. 57, 248–256. Budowle, B., Wilson, M. R., DiZinno, J. A., Stauffer, C., Fasano, M. A., Holland, M. M. & Monson, K. L. (1999). Mitochondrial DNA regions HV I and HV II population data. Forensic Sci. Int. 103, 23–35. Calafell, F., Underhill, P., Tolun, A., Angelicheva, D. & Kalaydjieva, L. (1996). From Asia to Europe : mito- chondrial DNA sequence variability in Bulgarians and Turks. Ann. Hum. Genet. 60, 35–49. Comas, D., Calafell, F., Mateu, E., Perez-Lezaun, A., Bosch, E. & Bertranpetit, J. (1997). Mitochondrial DNA variation and the origin of the Europeans. Hum. Genet. 99, 443–449. Delghandi, M., Utsi, E. & Krauss, S. (1998). Saami mitochondrial DNA reveals deep maternal lineage clusters. Hum. Hered. 48, 108–114. Derenko, M. V., Malyarchuk, B. A., Dambueva, I. K., Shaikhaev, G. O., Dorzhu, C. M., Nimaev, D. D. & Zakharov, I. A. (2000). Mitochondrial DNA variation in two South Siberian aboriginal populations : Implications for the genetic history of North Asia. Hum. Biol. 72, 945–973. Derenko, M. V. & Shields, G. F. (1997). Mitochondrial DNA sequence diversity in three North Asian aboriginal population groups. Mol. Biol. (Moscow) 31, 665–669. Finnila$ , S., Hassinen, I. E., Ala-Kokko, L. & Majamaa, K. (2000). Phylogenetic network of the mtDNA haplogroup U in northern Finland based on sequence analysis of the complete coding region by conformation-sensitive gel electrophoresis. Am. J. Hum. Genet. 66, 1017–1026. Finnila$ , S., Hassinen, I. E. & Majamaa, K. (2001 a). Phylogenetic analysis of mitochondrial DNA in patients with an occipital stroke. Evaluation of mutations by using sequence data on the entire coding region. Mutat. Res. Genomics 458, 31–39. Finnila$ , S., Lehtonen, M. S. & Majamaa, K. (2001 b). Phylogenetic network for European mtDNA. Am. J. Hum. Genet. 68, 1475–1484. Finnila$ , S. & Majamaa, K. (2001). Phylogenetic analysis of mtDNA haplogroup TJ in a Finnish population. J. Hum. Genet. 46, 64–69. Forster, P., Harding, R., Torroni, A. & Bandelt, H.-J. (1996). Origin and evolution of Native American mtDNA variation : a reappraisal. Am. J. Hum. Genet. 59, 935–945. Gresham, D., Morar, B., Underhill, P. A., Passarino, G., Lin, A. A., Wise, C., et al. (2001). Origins and divergence of the Roma (Gypsies). Am. J. Hum. Genet. 69, 1314–1331. Helgason, A., Sigurdardo! ttir, S., Gulcher, J. R., Ward, R. & Stefa! nsson, K. (2000). mtDNA and the origin of the Icelanders : Deciphering signals of recent population history. Am. J. Hum. Genet. 66, 999–1016. 282 B. A. M   Howell, N. & Smejkal, C. B. (2000). Persistent heteroplasmy of a mutation in the human mtDNA control region : Hypermutation as an apparent consequence of simple-repeat expansion}contraction. Am. J. Hum. Genet. 66, 1589–1598. Ingman, M., Kaessmann, H., Pa$ a$ bo, S. & Gyllensten, U. (2000). Mitochondrial genome variation and the origin of modern humans. Nature 408, 708–713. Kivisild, T., Bandelt, H.-J., Wang, J., Derenko, M., Malyarchuk, B., Golubenko, M., et al. (2001). Mitochondrial DNA tree for Eastern Asian populations. In : Abstracts of the First workshop on information technologies application to problems of biodiversity and dynamics of ecosystems in North Eurasia (WITA’2001), p. 302. Novosibirsk : Institute of Cytology and Genetics. Kolman, C. J., Sambuughin, N. & Bermingham, E. (1996). Mitochondrial DNA analysis of Mongolian populations and implications for the origin of New World founders. Genetics 142, 1321–1334. Lutz, S., Weisser, H.-J., Heizmann, J. & Pollak, S. (1998). Location and frequency of polymorphic positions in the mtDNA control region of individuals from Germany. Int. J. Legal Med. 111, 67–77. Maca-Meyer, N., Gonzalez, A. M., Larruga, J. M., Flores, C. & Cabrera, V. M. (2001). Major genomic mitochondrial lineages delineate early human expansions. BMC Genetics 2, 13. Macaulay, V., Richards, M., Hickey, E., Vega, E., Cruciani, F., Guida, V., et al. (1999). The emerging tree of West Eurasian mtDNAs : a synthesis of controlregion sequences and RFLPs. Am. J. Hum. Genet. 64, 232–249. Malyarchuk, B. A., Denisova, G. A., Derenko, M. V., Rogaev, E. I., Vlasenko, L. V. & Zhukova, S. G. (2001). Mitochondrial DNA variation in Russian populations of Krasnodar krai, Belgorod, and Nizhnii Novgorod oblast. Russ. J. Genet. 37, 1411–1416. Malyarchuk, B. A. & Derenko, M. V. (1999). Molecular instability of the mitochondrial haplogroup T sequences at nucleotide positions 16292 and 16296. Ann. Hum. Genet. 63, 489–497. Malyarchuk, B. A. & Derenko, M. V. (2001). Mitochondrial DNA variability in Russians and Ukrainians : Implication to the origin of the Eastern Slavs. Ann. Hum. Genet. 65, 63–78. Malyarchuk, B. A., Derenko, M. V. & Solovenchuk, L. L. (1995). Types of mitochondrial DNA control region in the Eastern Slavs. Russ. J. Genet. 31, 723–727. Marchington, D. R., Poulton, J. Sellar, A. & Holt, I. J. (1996). Do sequence variants in the major non-coding region of the mitochondrial genome influence mitochondrial mutations associated with disease ? Hum. Mol. Genet. 5, 473–479. Parson, W., Parsons, T. J., Scheithauer, R. & Holland, M. M. (1998). Population data for 101 Austrian Caucasian mitochondrial DNA d-loop sequences : Application of mtDNA sequence analysis to a forensic case. Int. J. Legal Med. 111, 124–132. Orekhov, V., Poltoraus, A., Zhivotovsky, L. A., Spitsyn, V., Ivanov, P. & Yankovsky, N. (1999). Mitochondrial DNA sequence diversity in Russians. FEBS Letters 445, 197–201. Pfeiffer, H., Brinkmann, B., Hu$ hne, J., Rolf, B., Morris, A. A., Steighner, R., et al. (1999). Expanding the forensic German mitochondrial DNA control region database : genetic diversity as a function of sample size and microgeography. Int. J. Legal Med. 112 : 291–298. Quintana-Murci, L., Semino, O., Bandelt, H.-J., Passarino, G., McElreavey, K. & SantachiaraBenerecetti, A. S. (1999). Genetic evidence for an early exit of Homo sapiens sapiens from Africa through eastern Africa. Nature Genet. 23, 437–441. Richards, M. & Macaulay, V. (2000). Genetic data and the colonization of Europe : genealogies and founders. In : Archaeogenetics : DNA and the population prehistory of Europe (eds. C. Renfrew & K. Boyle), pp. 139–151. Cambridge : McDonald Institute for Archaeological Research. Richards, M. B., Macaulay, V. A., Bandelt, H.-J. & Sykes, B. C. (1998). Phylogeography of mitochondrial DNA in western Europe. Ann. Hum. Genet. 62, 241–260. Richards, M. B., Macaulay, V. A., Hickey, E., Vega, E., Sykes, B., Guida, V., et al. (2000). Tracing European founder lineages in the Near Eastern mtDNA pool. Am. J. Hum. Genet. 67, 1251–1276. Rybakov, B. A. (1981). Paganism of ancient Slavs. Moscow : Nauka (in Russian). Saillard, J., Evseeva, I., Tranebjerg, L. & Norby, S. (2000). Mitochondrial DNA diversity among Nenets. In : Archaeogenetics : DNA and the population prehistory of Europe (eds. C. Renfrew & K. Boyle), pp. 255–258. Cambridge : McDonald Institute for Archaeological Research. Sajantila, A., Lahermo, P., Anttinen, T., Lukka, M., Sistonen, P., Savontaus, M. L., et al. (1995). Genes and languages in Europe – an analysis of mitochondrial lineages. Genome Res. 5, 42–52. SC avli, J., Bor, M. & Tomaz) ic, I. (1996). Veneti. First builders of European community. Tracing the history and language of early ancestors of Slovenes. Wien, Boswell : Editiones Veneti. Schurr, T. G., Sukernik, R. I., Starikovskaya, Y. B. & Wallace, D. C. (1999). Mitochondrial DNA variation in Koryaks and Itel’men : Population replacement in the Okhotsk Sea – Bering Sea region during the Neolithic. Am. J. Phys. Anthropol. 108, 1–39. Sedov, V. V. (1979). Origin and early history of Slavs. Moscow : Nauka (in Russian). Simoni, L., Calafell, F., Pettener, D., Bertranpetit, J. & Barbujani, G. (2000). Geographic patterns of mtDNA diversity in Europe. Am. J. Hum. Genet. 66, 262–278. Sullivan, K. M., Hopgood, R. & Gill, P. (1992). Identification of human remains by amplification and automated sequencing of mitochondrial DNA. Int. J. Legal Med. 105, 83–86. Sykes, B. (1999). The molecular genetics of European ancestry. Phylos. Trans. R. Soc. Lond. B. Biol. Sci. 354, 131–138. Tambets, K., Kivisild, T., Metspalu, E., Parik, J., Kaldma, K., Laos, S., et al. (2000). The topology of the maternal lineages of the Anatolian and Trans-Caucasus populations and the peopling of Europe : some preliminary considerations. In : Archaeogenetics : DNA and the population prehistory of Europe (eds. C. Renfrew & K. Boyle), pp. 219–235. Cambridge : McDonald Institute for Archaeological Research. Tolk, H. V., Pericic, M., Barac, L., Martinovic Klaric, I., Janicijevic, B., Rudan, I., et al. (2000). MtDNA Polish and Russian MtDNAs haplogroups in the populations of Croatian Adriatic Islands. Coll. Anthropol. 2, 267–279. Torroni, A., Bandelt, H.-J., Macaulay, V., Richards, M., Cruciani, F., Rengo, C., et al. (2001). A signal, from human mtDNA, of postglacial recolonization in Europe. Am. J. Hum. Genet. 69, 844–852. Torroni, A., Cruciani, F., Rengo, C., Sellitto, D., Lo! pezBigas, N., Rabionet, R., et al. (1999). The A1555G mutation in the 12S rRNA gene of human mtDNA : recurrent origins and founder events in families affected by sensorineural deafness. Am. J. Hum. Genet. 65, 1349–1358. Torroni, A., Huoponen, K., Francalacci, P., Petrozzi, M., Morelli, L., Scozzari, R., et al. (1996). Classification of European mtDNAs from an analysis of three European populations. Genetics 144, 1835–1850. 283 Torroni, A., Lott, M. T., Cabell, M. F., Chen, Y. S., Lavergne, L. & Wallace, D. C. (1994). mtDNA and the origin of Caucasians : identification of ancient Caucasian-specific haplogroups, one of which is prone to a recurrent somatic duplication in the D-loop region. Am. J. Hum. Genet. 55, 760–776. Torroni, A., Petrozzi, M., D’Urbano, L., Sellitto, D., Zeviani, M., Carrara, F., et al. (1997). Haplotype and phylogenetic analyses suggest that one Europeanspecific mtDNA background plays a role in the expression of Leber hereditary optic neuropathy by increasing the penetrance of primary mutations 11778 and 14484. Am. J. Hum. Genet. 60, 1107–1121. Wallace, D. C. (1995). Mitochondrial DNA variation in human evolution, degenerative disease and aging. Am. J. Hum. Genet. 57, 201–223.