Foci of tick-borne diseases in Southwest Germany

Foci of tick-borne diseases in Southwest Germany Rainer Oehme, Kathrin Hartelt, Hannelore Backe, Stefan Brockmann, Peter Kimmig State Health Office Baden-Wuerttemberg, Germany Corresponding author: Rainer Oehme, State Health Office Baden-Wuerttemberg, Wiederholdstr. 15, D-70174 Stuttgart, Germany, Phone: +49-(0)711-1849-285, FAX: +49-(0)711-1849-242, E-mail: [email protected] International Journal of Medical Microbiology (IJMM) 291(33) June 2002 page 22-29 Abstract The presently known tick-borne diseases in Germany include Lyme Borreliosis, tickborne encephalitis (TBE-virus, Central European Type), Q-fever, Babesiosis and presumably Ehrlichiosis. Blood samples of 4.368 forestry workers in the State of Baden-Wuerttemberg (B-W), Southwest Germany, were tested for presence of antibodies against Borrelia burgdorferi sensu lato, TBE-virus and Ehrlichia spp. (genogroup E. phagocytophila). Furthermore 12.327 ticks (Ixodes ricinus) collected in various areas of BW were analyzed by PCR and genotyping for the prevalence of respective pathogen RNA and DNA. The human seroprevalence rates of antibodies to B. burgdorferi sensu lato ranged from 18% to 52%, for TBE-virus from 0% to 43% and for Ehrlichia spp. from 5% to 16% in various counties of the State. The foci of B. burgdorferi and TBE-virus as indicated by antibody prevalence in humans are only partly overlapping with each other partially. The highest rates of TBE-virus antibodies are in concordance with available clinical data. However antibody prevalence up to 27% in areas with no reports of clinical cases were found, suggesting that TBE occurs throughout the State of B-W. The prevalence of Ehrlichia spp. antibodies suggests that Ehrlichiosis could play a further role in German tick-borne diseases, but as long as no clinical data is available, this will remain unclear. Investigations of ticks for TBE-virus (n= 9.189) by nested PCR showed prevalence rates from 0% to 2.3% and for Ehrlichia spp. (n=1.963) from 2.6% to 3.1%. Examination of ticks (n= 3.138) for presence of B. burgdorferi sensu lato DNA was performed by PCR and revealed prevalence rates from 13.9% up to 24%. Furthermore 1.106 samples positive for B. burgdorferi sensu lato were used for genotyping. Borrelia afzelii DNA was found in 407 ticks (36.8%), followed by B. garinii (21.9%), B. valaisiana (13.7%) and B. burgdorferi sensu stricto (9.9%). Double infection was found in 6.4% and triple infection in 0.8% of the ticks. 10.5% of the positive samples could not be classified. Prevention of tick-borne diseases has to focus on behavioral intervention to reduce individual tick exposure by proper behavior in the environment, as a large-scale control of the tick population seems impossible and thus reduction of LymeBorreliosis and TBE through control of this population is unlikely. Vaccination against TBE-virus should not only be recommended for high endemic areas but also for persons with a high individual risk. Key words: Tick-borne encephalitis (TBE) – Lyme Borreliosis – Ehrlichiosis Introduction Among the presently known tick borne diseases which occur in Southwest Germany – Tick borne encephalitis (TBE), Lyme Borreliosis, Q-fever, Ehrlichiosis and Babesiosis – the first three are of major importance. The medical relevance of Ehrlichiosis and Babesiosis remains unclear due to the lack of documented clinical cases. Ixodes ricinus is an important vector for the transmission of bacterial, viral and rickettsial diseases in Germany. Effective transmission of tick-borne diseases occurs only after firm attachment of the tick in the skin for at least several hours. Lyme disease is a zoonotic spirochetal disease caused by Borrelia burgdorferi sensu lato and is the most common vector-borne disease in Germany. However, as Lyme Borreliosis is not a notefiable disease in Germany, no systematic data about prevalence, incidence or clinical outcome is presently available. Nevertheless the disease is frequently observed by general practitioners and clinicians (Maiwald et al. 1996, Kaiser et al. 1996, Hassler et al. 1992). Tick-borne encephalitis (TBE, Central European Type) is caused by a virus of the family Flaviviridae. It is a relatively rare neurologic disease with about 100 to 200 reported cases in B-W annually. Fatal outcomes are described and therapy is only symptomatic, in contrast to B. burgdorferi sensu lato infections which can be cured by early antibiotic treatment. However, an effective vaccine is available against TBEvirus, but none against B. burgdorferi sensu lato species found in Germany. Granulocytic Ehrlichiae are obligate intracellular bacteria (Ehrlichia spp.) which have been well established as tick-borne pathogens of veterinary importance. Human Granulocytic Ehrlichiosis (HGE) was first reported in 1994 (Bakken et al. 1996, Chen et al. 1994). The etiologic agent of HGE is ascribed to the Ehrlichia phagocytophila group on the basis of 16S rRNA gene sequence comparison (Chen et al. 1994). The medical relevance of Ehrlichiosis in Germany remains ambiguous at the moment, due to the lack of documented clinical cases. Documented cases of HGE were described in Slovenia (Petrovec et al. 1997) and in the Netherlands (van Dobbenburgh et al. 1999). The above mentioned tick-borne diseases and their causative agents are not distributed evenly in Germany, but are restricted to so called natural foci which are based mainly on the presence of an infective cycle of the pathogen between the vector (ticks) and their natural hosts (rodents, deer). The knowledge of the location and intensity of these risk areas is important for the recommendation of prophylactic measures. For the survey of natural foci within a larger area three different methods can be employed: 1. Collecting of the data on and geographical localisation of clinical cases 2. Seroepidemiological investigation of tick exposed persons 3. Examinations of ticks for infective agents. In this report the method 2 and 3 were used to investigate the epidemiological situation of TBE, Lyme Borreliosis and Ehrlichiosis in different counties of the State of B-W. Material and Methods Serum samples A total of 4.368 blood samples from forestry workers in the State of B-W were collected in the years 1997 - 1999 from 133 forest offices. The workers were asked to fill out a questionnaire about their residential district, their place of employment, age, number of tick bites a year, TBE vaccination status and previous clinical symptoms. Serological Tests for TBE, Borreliosis and Ehrlichiosis Commercially available test kits for the measurement of TBE antibodies (TBE-ELISA IgM, IgG, Baxter, Germany), Lyme Borreliosis (ELISA IgM, IgG, Behring, Germany, Lyme Borreliosis recombinant Immunoblot, IgM, IgG, Mikrogen, Germany), and antibodies against HGE (HGE-IFA IgG, MRL Diagnostics, USA) were employed following manufacturer´s instructions for examination of antibody serum reactivity. Sampling of Ticks Ixodes ricinus ticks were collected during the period 1998 to 2000 by blanketdragging in different woodlands in the State of B-W. The ticks were stored at –20°C until the PCR was performed. Extraction of RNA for the detection of the Tick Borne Encephalitis Virus (TBEvirus) For the detection of the TBE-virus 10 Nymphs or 5 Adult ticks were pooled in one sample. Viral RNA was isolated following the Silica-extraction method described by Boom et al. 1990. Detection of the TBE-virus RNA For the detection of the TBE-virus RNA a sensitive nested reverse-transcriptase polymerase chain reaction assay (n RT-PCR) as described by Schrader and Suess 1999 was used. The target for the n RT-PCR was the 5´- terminal noncoding region, a highly conserved part of the virus. DNA extraction for the detection of B. burgdorferi and Ehrlichia spp. (genogroup E. phagocytophila) DNA The extraction of DNA from the ticks was performed with the Chelex-based method, which represents a fast DNA extraction procedure (Walsh et al 1991). Single ticks were mechanically crushed with sterile pistils in 40µl 20% Chelex 100 suspension (BioRad Laboratories, Munich, Germany). After thoroughly mixing, the sample was incubated at 56°C for 30 min. Then, the suspension was boiled for 10 min and the debris was removed by centrifugation (16.000 x g for 3 min). The supernatant was either used directly for amplification or stored at –20°C until use. Detection and simultaneous genotyping of B. burgdorferi sensu lato For the detection of B. burgdorferi sensu lato in ticks two different PCR-protocols were employed. For the simple detection of B. burgdorferi the PCR described by Schwartz et al. 1992 was used. The target for the PCR was the 23S rRNA gene of B. burgdorferi sensu lato. For the simultaneous detection and genotyping of four genomic groups of B. burgdorferi sensu lato in ticks we used a reverse line blot hybridization assay with probes which were specific for B. burgdorferi sensu stricto, B. garinii, B. afzelii, and B. valaisiana (Rijpkema et al. 1995). The target for the PCR was the spacer region between the 5S rRNA and 23S rRNA genes of B. burgdorferi sensu lato. Detection of Ehrlichia spp. (genogroup E. phagocytophila) For the detection of Ehrlichia spp. (genogroup E. phagocytophila) a nested PCR was used, based on the 16S rRNA gene from E. phagocytophila as described by Little et al. 1997 For the detection of E. phagocytophila we developed a PCR with the same primersystem described above but with species-specific hybridization probes (EHR FL: 5´CCAAGGCGATGATCTATAGCTGGTC X and EHR LC: 5´- LC Red640- AGAGGATGATCAGCCACACTGGAAC ph) on the LightCycler system (Roche, Boehringer-Mannheim, Germany). Results TBE The prevalence of TBE-virus (Central European type) IgG-antibodies (ELISA) in forestry workers (n=4.368) in various counties in the State of B-W varied from 0 to a maximum of 43%. The highest prevalence rates occurred in the southwest of B-W and corresponded to the number of reported clinical cases. However there were also high prevalence rates of 13% up to 27% in some areas in the north and east of B-W, where clinical cases were not or only rarely reported. Based on seroepidemiologic data a map was designed (Fig. 2). To correlate the clinical data with the infection rate of the vector the prevalence of TBE-vius RNA in a total of 9.189 ticks collected in several counties of B-W was examined by nested PCR. The prevalence of TBE-virus RNA in Ixodes ricinus ranged between 0 and 2.3% (Table 1). The prevalence of infected ticks was paralleled by the clinical data (Fig. 2). Lyme-Borreliosis The prevalence of B. burgdorferi sensu lato IgM and IgG- antibodies was also examined in serum from 4.368 forestry workers. Seroprevalence rates for B. burgdorferi sensu lato antibodies between 18% up to 52 % (mean 34.6 %) were found. However, the highly endemic areas of Lyme Borreliosis were only partially identical to those for TBE. In some areas in the northeastern parts of B-W no correlation was detected (Fig. 3). Tick examinations for B. burgdorferi senu lato were made by PCR in the four counties. Here, prevalence rates of 14% up to 24% were found in a total of 3.138 collected ticks (Table 2). The B. burgdorferi sensu lato positive samples were used also for genotyping. A total of 1.106 samples were analyzed. The dominant species found was B. afzelii (36.8%), followed by B. garinii (21.9%), B. valaisiana (13.7%) and B. burgdorferi sensu stricto (9.9%). Double infections were found only in 6.4% of the positive ticks and the presence of three species was found in 7 ticks (0.8%). A total of 116 positive samples (10.5%) could not be classified (Table 3). Ehrlichiosis Prevalence rates of E. phagocytophila antibodies in the same forest workers ranged from 5% to 15% extending in a corridor from the southwest to a main focus in the northeast of the state. In the northeast of B-W areas with high prevalence were partially overlapping those foci of B. burgdorferi (Fig. 4). Ticks (n=898) were collected in three counties and examined by nested PCR for the presence of Ehrlichia DNA. The infection rates found were 3,1%, 2,7% and. 2,6% (Table 4). In about 7 ticks (0.8%) a double infection with B. burgdorferi sensu lato species were found (Table 5). The modified PCR for detection of E. phagocytophila with species-specific hybridization probes revealed two different melting points in the melting curve. The melting points of the positive control from USA and the isolates from Berglen were identical, but the melting point of the Lahr isolates was 10 °C lower. The reason for this differences were a few mutations in the isolates from Lahr, two at the position of the hybridization probes (data not shown). Discussion The incidence of tick-borne diseases in a particular geographic area depends on the population density of the tick, the prevalence of infectious agents in ticks and the frequency of contact between tick and the susceptible population. Actual incidences of Lyme Borreliosis and TBE in Southwest Germany are vage. Several studies suggest that the incidence of Lyme Borreliosis is between 50 and 600 per 100.000 inhabitants (Hassler 1992, Maiwald 1996). During the last decade TBE infections between 100 and 200 cases per year were reported in Southwest Germany. This represents an incidence of 1-2 per 100.000 inhabitants. Mapping of the clinical cases from 1981 to 2000 collected by Roggendorf, Jäger and Kaiser (RKI 2001) shows an evident accumulation of most cases in a few districts of the very south of the State of B-W. (Fig. 1) However the seroprevalence found in our study (Fig. 2 and 3), including data from the entire State suggests for both, Lyme Disease and TBE, a much more wide spread occurrence of these diseases throughout the State than previously assumed. These clinical findings are supported by the prevalence rates found in ticks. The relatively high prevalence rates of TBE-virus in ticks up to 2.3% found, not only in areas where TBE is reported frequently and the prevalence rates of 14 to 25% for B. burgdorferi infections highlights the relevance of this investigation for public health in Southwest Germany. The investigated endemicity of Ehrlichia (genogroup E. phagocytophila) in ticks and seroprevalence in exposed humans suggests that Ehrlichiosis is present in Southwest Germany, despite the lack of documented clinical cases. It should be reminded that Ehrlichiosis is usually not considered as differential diagnosis in tickborne disease by general practitioners. The risk of tick bites and infection can be reduced by simple procedures, e.g. wearing of long trousers and using of repellents. Checking for ticks in children (by the parents) and self examination of exposed persons is important, because effective transmission of tick-borne diseases occurs only after firm attachment of the tick for at least several hours (with the possible exception of TBE-virus). In conclusion of the relatively high prevalence of TBE-virus in ticks, TBE vaccination should be recommended on the basis of individual exposition rather than on the basis of living in an endemic area. But TBE, Borreliosis and Ehrlichiosis are not the only tick borne diseases in Southwest Germany. Q-Fever is very common in B-W and every year outbreaks occur. Babesiosis in cows is known in some regions of the black forest, but exact epidemiological data are not available at present. Rickettsia helvetica was isolated in Switzerland and in France, and is likely to occur also in Southwest Germany (Parola et al. 1998, Beati et al. 1993). The extent to which this infections occur and their relative contribution to morbidity has to be investigated. Acknowledgements We thank to Christina Schrader and Jochen Suess (BgVV, Berlin Germany) for the Primer-system for TBE-virus, Susan Little for the DNA of E. phagocytophila and Iris Breutner, Ingrid Drescher, Georgia Ehrlich-Nietner, Elke Gutwein, Christine Herrmann, Sieglinde Moll and Roswitha Wiesinger for eminent practical assistance. Special thanks to Luc Haerter for critical review of the manuscript. This study was partially supported by grants of the Grimminger-Stiftung für Zoonosenforschung, the Sozialministerium Baden-Wuerttemberg and Baxter Germany GmbH. Without the helpful cooperation of the Ministerium Laendlicher Raum BadenWuerttemberg the seroepidemiological investigations could not be done. References Bakken, J.S., Dumler, J.S., Chen, S.M., Eckmann, M.R., van Etta, L.L, Walker, D.H.: Human granulocytic ehrlichiosis in the upper Midwest United States: a new species emerging? JAMA 275, 199-205 (1996) Beati L, Peter O, Burgdorfer W, Aeschlimann A, Raoult D. Confirmation that Rickettsia helvetica sp. nov. is a distinct species of the spotted fever group of rickettsiae. Int J Syst Bacteriol. 43(3), 521-526 (1993). Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim-van Dillen, P.M.E., van der Noordaa, J.: Rapid and simple method for purification of nucleic acids. J. Clin. Microbiol. 28, 495-503 (1990). Chen, S.-M., Dumler, J.S., Bakken, J.S., Walker, D.H.: Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 32, 589-595 (1994) Hassler, D., Zoeller, L., Haude, M., Hufnagel, H.D., Sonntag, H.-G.: Lyme-Borreliose in einem europaeischen Endemiegebiet: Antikoerperpraevalenz und klinisches Spektrum. Dtsch. Med. Wschr. 117, 767-774 (1992) Kaiser, R., Kern, A., Fressle, R., Steinbrecher, A., Omran, H., Malzacher, V., Kuegler, D., Kampa, D., Batsford, S.: Zeckenvermittelte Erkrankungen in Baden- Wuerttemberg. Muench. med. Wschr. 138, 647-652 (1996). Little, S.E., Dawson, J.E., Lockhart, J.M., Stallknecht, D.E., Warner, C.K., Davidson, W.R.: Development and use of specific polymerase reaction for the detection of an organism resembling Ehrlichia sp. in white-tailed deer. Journal of Wildlife Diseases 33(2), 246-253 (1997). Maiwald, M., Hassler, D., Zappe, H.A.: Epidemiologie und Prophylaxe zeckenübertragener Krankheiten. Allgemeinarzt 9, 986-993 (1996). Parola P, Beati L, Cambon M, Raoult D. First isolation of Rickettsia helvetica from Ixodes ricinus ticks in France. Eur J Clin Microbiol Infect Dis. 17(2), 95-100 (1998). Petrovec, M., Lotric Furlan, S., Zupanc, T.A., Strle, F., Brouqui, P., Roux, V., Dumler, J.S.: Human disease in Europe caused by a granulocytic Ehrlichia species. J. Clin. Microbiol. 35, 1556-1559 (1997) Rijpkema, S.G., Molkenboer M.J., Schouls L.M., Jongejan F., Schellekens J.F.: Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J. Clin. Microbiol. 33, 3091-3095 (1995). Robert Koch Institut: Risikogebiete der Frühsommer-Menigoenzephalitis (FSME). Epidemiologisches Bulletin Nr16, 105-110 (2001) Schrader, C., Suess, J.: A nested RT-PCR for the detection of Tick-borne Encephalitis Virus (TBEV) in ticks in natural foci. Zbl. Bakteriol. 289, 319-328 (1999). Schwartz I., Wormser G.P., Schwartz J.J., Cooper D., Weissensee P., Gazumyan A., Zimmermann E., Goldberg N.S., Bittker S., Campbell G.L.: Diagnosis of early Lyme disease by polymerase chain reaction amplification and culture of skin biopsies from erythema migrans lesions. J. Clin. Microbiol. 30, 3082-3088 (1992). van Dobbenburgh, A., van Dam, A.P., Fikrig, E.: Human granulocytic ehrlichiosis in western Europe. N. Engl. J. Med. 340, 1214-1216 (1999) Walsh, P. S., Metzger D. A., Higuchi, R.: Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques. 10, 506-513 (1991). Legends to illustrations Table 1: Prevalence of TBE-virus (Central European Type) in Ixodes ricinus by nested PCR in various counties of the State of Baden-Wuerttemberg (n=9.189). Table 2: Prevalence of B. burgdorferi sensu lato in Ixodes ricinus by PCR in various counties of the State of Baden-Wuerttemberg (n=3.138). Table 3: Prevalence of the different species of B. burgdorferi sensu lato detected in Ixodes ricinus (n=1.106). Table 4: Prevalence of Ehrlichia spp. (genogroup E. phagocytophila) in Ixodes ricinus by nested PCR in various counties of the State of Baden-Wuerttemberg (n=1.963). Table 5: Prevalence of coinfection of B. burgdorferi sensu lato and Ehrlichia spp. (genogroup E. phagocytophila) in Ixodes ricinus by PCR in various counties of the State of Baden-Wuerttemberg (n=898). Fig. 1: Risk- and high risk areas of TBE in Southwest Germany during 1981 – 2000 mod. from RKI: Epidemiologisches Bulletin 16/2001 Fig. 2: Prevalence of TBE-virus (Central European Type) IgM and IgG-antibodies (ELISA) of unvaccinated forestry workers (n=1.896) in various counties of the State of Baden-Wuerttemberg. Fig. 3: Prevalence of B. burgdorferi sensu lato IgM and IgG- antibodies (ELISA and Immunoblot) of forestry workers (n=4.368) in various counties of the State of BadenWuerttemberg. Fig. 4: Prevalence of Human Granulocytic Ehrlichiosis (HGE) IgG- antibodies (IFA) of forestry workers (n=4332) in various counties of the State of Baden-Wuerttemberg. Tables Table 1 Area County Elztal Emmendingen Kinzigtal Ortenau Simonswald Ticks examined TBE-Virus pos 740 16 (2.2%) 1405 20 (1.4%) BreisgauHochschwarzwald 445 9 (2.0%) Bodmann Bodensee 943 11 (1.2%) Hödinger Tobel Bodensee 1114 26 (2.3%) Enztal Pforzheim 607 0 (0%) Größelberg Pforzheim 447 2 (0.5%) Stuttgart Stuttgart 868 4 (0.5%) Großbottwar Ludwigsburg 1250 10 (0.8%) Bietigheim Ludwigsburg 1370 4 (0.3%) Table 2 Area County Ticks examined B. Burgdorferi s.l. pos. Stuttgart Stuttgart 1556 217 (13.9%) Allensbach Bodensee 684 97 (14.2%) Berglen Rems Murr 452 76 (16.8%) Lahr Ortenau 446 107 (24.0%) Table 3 species No. B. burgdorferi sensu stricto 109 (9.9%) B. afzelii 407 (36.8%) B. garinii 242 (21.9%) B. valaisiana 152 (13.7%) double infections 71 (6.4%) triple infections untypeable 9 (0.8%) 116 (10.5%) Table 4 Area County Ticks examined Ehrlichia pos. Berglen Rems Murr 452 14 (3.1%) Lahr Ortenau 446 12 (2.7%) Hödinger Tobel Bodensee 1065 28 (2.6%) Table 5 Area County Ticks examined Ehrlichia and B. burgdorferi s.l. pos. Berglen Rems Murr 452 2 (0.4%) Lahr Ortenau 446 5 (1.1%) Figures LK Main-Tauberkreis LK Neckar-Odenwaldkreis 5 clinical cases within 5 years LK Rhein-Neckar-Kreis LK Karlsruhe 25 clinical cases within 5 years LK Hohenlohekreis LK Heilbronn LK Schwäbisch Hall LK Karlsruhe LK Enzkreis LK Ludwigsburg SK Pforzheim LK Ostalbkreis LK Rems-Murr-Kreis SK Stuttgart LK Rastatt LK Calw LK Göppingen LK Böblingen LK Freudenstadt LK Alb-Donau-Kreis LK Tübingen LK Reutlingen LK Ortenaukreis LK Rottweil SK Ulm LK Zollernalbkreis LK Emmendingen LK Schwarzwald-Baar-Kreis SK Freiburg i. Breisgau LK Tuttlingen LK BreisgauHochschwarzwald LK Konstanz LK Lörrach Fig. 1 LK Biberach LK Sigmaringen LK Ravensburg LK Bodenseekreis LK Waldshut LK Heidenheim LK Esslingen n positive 1896 138 (7,3%) 20 % 10 - 20 % 5 - 10 % 1-5% 0% LK Main-Tauberkreis 5% SK Mannheim 0 LK Neckar-Odenwaldkreis 3% SK Heidelberg 0 LK Rhein-Neckar-Kreis 2% LK Heilbronn 7% SK Heilbronn LK Karlsruhe 6% LK Hohenlohekreis 0 LK Schwäbisch Hall 12% SK Karlsruhe LK Enzkreis 2% SK Pforzheim LK Rastatt 4% LK Ludwigsburg 27% LK Rems-Murr-Kreis SK Stuttgart 27% SK Baden-Baden LK Calw LK Böblingen 3% 13% LK Freudenstadt 2% LK Ortenaukreis 18% LK Ostalbkreis 7% 3% LK Rottweil 7% LK Tübingen 7% LK Esslingen 0 LK Göppingen 0 LK Alb-Donau-Kreis 4% LK Reutlingen 10% SK Ulm 0 LK Zollernalbkreis 3% LK Emmendingen 43% LK Biberach LK Schwarzwald-Baar-Kreis 0 LK Sigmaringen 2% SK Freiburg LK Tuttlingen 9% 29% 2% LK BreisgauHochschwarzwald 10% LK Ravensburg LK Konstanz 6% 15% LK Lörrach LK Bodenseekreis 2% 19% LK Waldshut 8% Fig. 2 LK Heidenheim 3% 4368 LK Neckar-Odenwaldkreis 27% SK Heidelberg 18% positive 40 % 30 - 40 % 20 - 30 % 10 - 20 % LK Main-Tauberkreis 52% SK Mannheim 18% 1511 (34,6%) LK Rhein-Neckar-Kreis 24% LK Heilbronn 46% SK Heilbronn LK Karlsruhe 31% LK Hohenlohekreis 45% LK Schwäbisch Hall 52% SK Karlsruhe LK Enzkreis 32% SK Pforzheim LK Rastatt 46% LK Ludwigsburg 41% LK Rems-Murr-Kreis SK Stuttgart 18% SK Baden-Baden LK Calw 27% LK Böblingen 31% LK Ortenaukreis 42% LK Ostalbkreis 36% 36% LK Freudenstadt 24% LK Rottweil 28% LK Tübingen 33% LK Esslingen 28% LK Göppingen 35% LK Alb-Donau-Kreis 26% LK Reutlingen 23% SK Ulm 27% LK Zollernalbkreis 21% LK Emmendingen 49% LK Biberach LK Schwarzwald-Baar-Kreis 40% LK Sigmaringen 23% SK Freiburg LK Tuttlingen 30% 34% 22% LK BreisgauHochschwarzwald 42% LK Ravensburg LK Konstanz 42% 44% LK Lörrach LK Bodenseekreis 27% 27% LK Waldshut 32% Fig. 3 LK Heidenheim 34% LK Neckar-Odenwaldkreis SK Heidelberg 5% n positive 4332 462 (10,7%) 15 % 10 - 15 % 5 - 10 % 1-5% No data LK Main-Tauberkreis 14% SK Mannheim 5% LK Rhein-Neckar-Kreis 6% LK Heilbronn 8% SK Heilbronn LK Karlsruhe 6% LK Hohenlohekreis 5% LK Schwäbisch Hall 15% SK Karlsruhe LK Enzkreis 6% SK Pforzheim LK Rastatt 16% LK Ludwigsburg 16% LK Rems-Murr-Kreis SK Stuttgart 14% SK Baden-Baden LK Calw 5% LK Böblingen 6% LK Freudenstadt 7% LK Ortenaukreis 9% LK Ostalbkreis 13% 6% LK Rottweil 8% LK Tübingen 7% LK Esslingen 12% LK Göppingen 12% LK Alb-Donau-Kreis 10% LK Reutlingen 14% SK Ulm 6% LK Zollernalbkreis 12% LK Emmendingen 12% LK Biberach LK Schwarzwald-Baar-Kreis 14% LK Sigmaringen 12% SK Freiburg LK Tuttlingen 13% 8% 12% LK BreisgauHochschwarzwald 12% LK Ravensburg LK Konstanz 9% 9% LK Lörrach LK Bodenseekreis 13% 9% LK Waldshut 9% Fig. 4 LK Heidenheim 8%