Several studies revealed that a small number of glycosylphosphatidylinositol anchored protein-def... more Several studies revealed that a small number of glycosylphosphatidylinositol anchored protein-deficient cells are detectable in peripheral blood of healthy individuals but these PNH-type cells do not persist for a long time because they are originated from committed progenitor cells rather than primitive stem cells with PIG-A gene mutations. We have studied more than 700 patients with AA for the presence of CD55-CD59- granulocytes and red blood cells using highly sensitive flow cytometry and detected 0.003% or more PNH-type cells in about 50% of patients. In patients whose proportions of PNH-type are very low, the appearance of PNH-type cells may also be transient because they are not derived from true PIG-A mutant stem cell clones. In an attempt to characterize hematopoietic clones from which small populations of PNH-type cells are originated, we studied changes in the proportion of PNH-type granulocytes, clinical findings, and PIG-A mutations over 3–7 years on 52 AA patients (18 males and 33 females). The initial examination revealed less than 0.1% (0–0.075%) PNH-type granulocytes in 21 patients (Group A) and more than 0.1% (0.101–36%) PNH-type granulocytes in 31 patients (Group B). In three (14%) patients of Group A, PNH-type granulocytes became undetectable 2.9, 1.3 and 1.6 years after the initial examination. 0.007 % granulocytes became detectable 2.5 years after the first examination which produced a negative result in one patient. Among the other 17 (81%) patients of Group A, proportions of PNH-type granulocytes remained stable at 0.03–0.41% over 3–6 years. By contrast, 5 (16%) patients of Group B showed an apparent increase in the proportion of PNH-type cells (from 1.46%, 1.63%, 3.31%, 23%, and 36% to 79%, 21%, 83%, 55%, and 78%, respectively) 2 to 4 years after the initial examination. Four of the five developed clinical signs of hemolysis. The proportion of PNH-type cells in Group B patients remained stable in 33 (63%) patients and declined in 12 (23%) patients. When we sorted a small (0.04%) population of PNH-type granulocytes from a patients of Group A and analyzed PIG-A gene, only one point mutation at position 479, C to T was revealed in the exon 2. The finding that the proportion of PNH-type cells remained stable over 3 years in most Group A patients suggests that very low proportions of PNH-type cells are derived from primitive hematopoietic stem cell clones with PIG-A mutation. Among AA patients displaying small populations of PNH-type cells, only those whose proportion of PNH-type cells are more than 1% may be at a high risk of developing hemolytic PNH.
Modeling of genomic profiles from the Cancer Genome Atlas (TCGA) by using recently developed math... more Modeling of genomic profiles from the Cancer Genome Atlas (TCGA) by using recently developed mathematical frameworks has associated a genome-wide pattern of DNA copy-number alterations with a shorter, roughly one-year, median survival time in glioblastoma (GBM) patients. Here, to experimentally test this relationship, we whole-genome sequenced DNA from tumor samples of patients. We show that the patients represent the U.S. adult GBM population in terms of most normal and disease phenotypes. Intratumor heterogeneity affects ≈11% and profiling technology and reference human genome specifics affect <1% of the classifications of the tumors by the pattern, where experimental batch effects normally reduce the reproducibility, i.e., precision, of classifications based upon between one to a few hundred genomic loci by >30%. With a 2.25-year Kaplan–Meier median survival difference, a 3.5 univariate Cox hazard ratio, and a 0.78 concordance index, i.e., accuracy, the pattern predicts sur...
High altitude is accompanied by hypoxia. Acute and chronic hypoxia induces a number of compensato... more High altitude is accompanied by hypoxia. Acute and chronic hypoxia induces a number of compensatory physiological responses mediated by hypoxia-inducible factors (HIFs) that regulate erythropoiesis, iron and energy metabolism, and other essential organismal responses. Excessive HIF responses occurring at high altitude may be accompanied by morbidity (polycythemia and pulmonary hypertension) or mortality (brain and pulmonary edema). HIFs are down regulated by two principal factors, i.e. prolyl hydroxylases (PHDs) and von Hippel Lindau proteins (VHL). Tibetans have lived at 3,000-5,000 meters for approximately 20,000 years and have acquired a number of beneficial genetic adaptations which appear to prevent negative responses to hypoxia at high-altitude. Deciphering these genetic changes is crucial to improve our understanding of the underlying hypoxia-mediated response mechanisms and to develop targeted therapies. We recently identified the first Tibetan-specific mutation, PHD2D4E, caused by a missense mutation (rs186996510) in EGLN1. PHD2D4E has an allelic frequency of ~85% in Tibetans and a low Km for oxygen, accounting for the protection of Tibetans from high-altitude polycythemia. Other effects of PHD2D4E on HIF-regulated pathophysiology remain to be delineated. A 77% GC-rich area surrounds rs186996510, resulting in a low success rate of detecting the mutation by Sanger sequencing or next-generation sequencing. PHD2D4E was unreported in published whole-genome analyses of Tibetans (Xin Yi et. al. Science 2010). Here we describe a high-resolution melting assay of a small PCR product for targeted genotyping of rs186996510. The single base-pair change (G to C) is visualized by melting small amplicons in the presence of a fluorescent DNA-binding dye. Heterozygotes are differentiated from homozygous genotypes by a pronounced change in the shape of the melting curve caused by the formation of heteroduplexes. However, wild type and homozygous variants are difficult to distinguish by melting alone, and require an additional step of a second melting analysis after mixing with known wild type DNA. Upon melting these mixtures, homozygotes appear as heterozygous melting curves, while wild type genotypes will remain wild type (Figure 1). We developed and validated a high resolution melting assay for rapid genotyping of PHD2D4E suitable for population and disease association studies. In our ongoing analyses, we genotyped DNA from over 300 Tibetans residing at sea level, 1300 meters, 1730-2300 meters and 4320 meters, and are correlating the allelic frequency of PHD2D4E with hematocrit levels. The high resolution melting assay for genotyping PHD2D4E is a simple, accurate, rapid, and inexpensive approach to identify SNP-targeted mutations, especially suitable for a large number of samples such as needed for population studies, without the expense and time required for sequencing studies. Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Disclosures Wittwer: BioFire Diagnostics: Aspects of melting analysis Patents…
A 10-year-old girl with paroxysmal nocturnal hemoglobinuria (PNH) received an infusion of syngene... more A 10-year-old girl with paroxysmal nocturnal hemoglobinuria (PNH) received an infusion of syngeneic bone marrow without preparative marrow ablation or immunosuppression. Following transplant, the patient became asymptomatic in concordance with an increase in the percentage of peripheral blood cells with normal expression of glycosyl phosphatidylinositol-anchored proteins (GPI-AP). However, molecular analysis suggested engraftment of a relatively small number of donor stem cells and persistence of an abnormal stem cell with mutant PIG-A. During 17 months of observation, the percentage of cells with normal GPI-AP expression gradually decreased, while intravascular hemolysis progressively increased. Approximately 16.5 months post-AROXYSMAL NOCTURNAL hemoglobinuria (PNH) P is an acquired disease in which a somatic mutation involving a primitive hematopoietic stem cell occurs.' The gene that is mutated (PIG-A) is located on the X chromosome. PIG-A encodes a protein that is essential for the normal biosynthesis of the glycosyl phosphatidylinositol (GPI) moiety that serves as a membrane anchor for a functionally diverse group of cellular proteins.',? The primary clinical manifestations of PNH are intravascular hemolysis resulting in hemoglobinuria, thrombosis, and abnormal hematopoiesis, which results in pan~ytopenia.~ The natural history varies greatly among patients. Depending on the disease manifestations, therapeutic options include supportive care, glucocorticoids, and antic~agulation.~ With particularly severe disease (eg, bone marrow failure or recurrent, life-threatening thromboembolic events), marrow ablation followed by bone marrow transplantation from an HLA-matched sibling donor should be considered. In this case, the abnormal stem cells are destroyed by the conditioning regimen, and the marrow is repopulated with normal donor cells.' While this approach is potentially curative, the benefits must be weighed against the significant morbidity and mortality associated with allogeneic bone marrow transplantation. In the unusual circumstance in which the patient has a syngeneic twin, bone marrow transplantation is the most
Page 184. High-resolution melting analysis for scanning and genotyping Virginie Dujols, Noriko Ku... more Page 184. High-resolution melting analysis for scanning and genotyping Virginie Dujols, Noriko Kusukawa, Jason T. McKinney, Steven F. Dobrowolsky and Carl T. Wittwer 9.1 Introduction Ever since the introduction of the LightCycler ...
Many others have contributed to the research culminating in this dissertation. Nancy Walsh, Chris... more Many others have contributed to the research culminating in this dissertation. Nancy Walsh, Chris Young, and Brenda Fekete have been little praised but highly deserving laboratory technicians. Terry Lofthouse, Ron Cook and Bob Wood taught me Fourier transform nmr operation. Allen K. Smith assisted in the development of the pantothenate assay for enzyme activity. Jack Brown helped in the initial planning and beginning synthesis of the pantetheine analogs. Dave Burkhard's assistance in enzyme preparation allowed me to complete its purification. Randy Rasmussen was responsible for much of the carbohydrate analysis. Finally, Kirk Ririe was very helpful in the final synthesis and characterization of the pantetheine analogs.
The use of general descriptive names, registered names, trademarks, etc. in this publication does... more The use of general descriptive names, registered names, trademarks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. Product liability: The publisher cannot guarantee the accuracy of any information about dosage and application thereof contained in this book. In every individual case the user must check such information by consulting the relevant literature.
Genotyping by high-resolution melting analysis of small amplicons is homogeneous and simple. Howe... more Genotyping by high-resolution melting analysis of small amplicons is homogeneous and simple. However, this approach can be limited by physical and chemical components of the system that contribute to intersample melting variation.
Differential amplification of variant and wild-type alleles by PCR is often used for rare allele ... more Differential amplification of variant and wild-type alleles by PCR is often used for rare allele enrichment. We have combined allele-specific PCR, competitive probe blocking, asymmetric PCR, and melting analysis to enhance rare allele detection in a homogeneous system. Unlabeled, dual hybridization or molecular beacon probes were used for competitive blocking of the wild-type allele at a concentration 10 times that of the allele-specific primer. In each case, rare alleles were detected by probe melting analysis at a sensitivity of >0.001% (1 variant copy within 100,000 wildtype copies), providing single copy detection in typical PCRs. Ninety-one thyroid biopsies were tested for the BRAF mutation p.V600E (c.1799 T>A) by both dual hybridization probes without enrichment and an allele-specific, competitive blocking melting analysis with unlabeled probes. Eighty-seven samples were concordant between methods (43 positive, 44 negative), while 4 samples that were negative by direct analysis became positive after enrichment. Probes that both block wild-type amplification and detect rare variants by melting analysis improve the detection sensitivity of allele-specific PCR for rare alleles. In particular, melting analysis using unlabeled probes and amplification by rapid-cycle PCR provides cost-effective and fast enrichment and detection of rare alleles.
This chapter talks about the fundamentals of real-time PCR and melting analysis. It draws an anal... more This chapter talks about the fundamentals of real-time PCR and melting analysis. It draws an analogy between bacterial growth and PCR and then considers the kinetic requirements of PCR. It provides an overview of real-time instrumentation and fluorescent indicators. It considers methods for detection, quantification, and melting analysis, including high-resolution melting analysis. Real-time PCR with melting analysis can integrate the detection, quantification, and analysis of microbes in one rapid assay. In real-time PCR and melting analysis, fluorescence acquisition may extend the time required in instruments with high noise and/or low fluorescence sensitivity. All real-time PCR instruments monitor sample fluorescence during thermal cycling and are available from many manufacturers. A wide variety of different instruments, dyes, and probe designs are available for real-time PCR. The chapter discusses some of the methods commonly used for detection, quantification, and melting analysis. It also focuses on melting-curve analysis. Inspection of continuous plots during real-time PCR suggests that hybridization information can be extracted during temperature cycling when dyes or hybridization probes are used. Continued improvements in speed, integration of high-resolution melting analysis, and adoption of simple hybridization probe techniques like unlabeled probe and snapback primers will expand the reach of this powerful technique in the coming years.
Retrospective DNA-content analysis was performed by flow cytometry on formalin-fixed, paraffin-em... more Retrospective DNA-content analysis was performed by flow cytometry on formalin-fixed, paraffin-embedded tissue from 36 patients with histiocytosis X (Langerhans cell histiocytosis). Included were 17 patients with solitary bone lesions, 4 patients with multiple bone lesions, 2 patients with solitary extraosseous lesions, 1 patient with congenital self-healing histiocytosis, and 12 patients with disseminated disease. The diagnosis was in each case verified by review of the clinical history and histopathologic material. None of the cases displayed significant cytologic atypia. DNA content analysis failed to reveal additional G0-G1 peaks or "shoulders" suggestive of aneuploid subpopulations in any case. Full-peak coefficients of variation ranged from 3.8 to 8.0. Our data suggest that despite a prior report of a single aneuploid case of histiocytosis X, DNA content analysis may not be useful in predicting clinical stage and outcome in this disease.
Neonatal hemochromatosis is an uncommon disorder, clinicopathologically defined by severe and gen... more Neonatal hemochromatosis is an uncommon disorder, clinicopathologically defined by severe and generally fatal liver disease of intrauterine onset associated with extrahepatic siderosis that spares reticuloendothelial elements (hemochromatotic siderosis). The agent or agents of liver disease in neonatal hemochromatosis are not known. It also is not known if intrauterine liver disease of defined infective etiology can lead to hemochromatotic siderosis. We present two patients with fetal liver disease and hemochromatotic siderosis whose cases help address these points. In the first patient rare hepatobiliary and numerous renal tubular cytomegalovirus (CMV) inclusions were found; CMV infection was confirmed by the polymerase chain reaction. Studies of the mother of the second patient 1, 5, and 9 weeks post-partum showed recent seroconversion against CMV; seroconversion against other infectious agents (toxoplasma, rubella, herpes, parvovirus B19, hepatitis A/B/C) was not present. Histologic, immunohistochemical, in situ hybridization, or polymerase chain reaction evidence of CMV infection was not present in infant tissues, even though peripartum maternal seroconversion against CMV was observed. We conclude that hemochromatotic siderosis may accompany chronic fetal liver disease of defined infective etiology (patient no. 1) and that recent maternal seroconversion against CMV in the presence of severe fetal liver disease does not necessarily mean that transplacentally acquired CMV infection caused the fetal liver disease (patient no. 2). Polymerase chain reaction documentation of infective-agent genomic sequences in fetal or infant tissues permits more accurate interpretation of maternal serologic data.
American Journal of Clinical Pathology, Sep 1, 2005
High-resolution melting analysis (HRMA) was compared with denaturing high-performance liquid chro... more High-resolution melting analysis (HRMA) was compared with denaturing high-performance liquid chromatography (dHPLC) for mutation scanning of common mutations in the cystic fibrosis transmembrane conductance regulator gene. We amplified (polymerase chain reaction under conditions optimized for melting analysis or dHPLC) 26 previously genotyped samples with mutations in exons 3
Several studies revealed that a small number of glycosylphosphatidylinositol anchored protein-def... more Several studies revealed that a small number of glycosylphosphatidylinositol anchored protein-deficient cells are detectable in peripheral blood of healthy individuals but these PNH-type cells do not persist for a long time because they are originated from committed progenitor cells rather than primitive stem cells with PIG-A gene mutations. We have studied more than 700 patients with AA for the presence of CD55-CD59- granulocytes and red blood cells using highly sensitive flow cytometry and detected 0.003% or more PNH-type cells in about 50% of patients. In patients whose proportions of PNH-type are very low, the appearance of PNH-type cells may also be transient because they are not derived from true PIG-A mutant stem cell clones. In an attempt to characterize hematopoietic clones from which small populations of PNH-type cells are originated, we studied changes in the proportion of PNH-type granulocytes, clinical findings, and PIG-A mutations over 3–7 years on 52 AA patients (18 males and 33 females). The initial examination revealed less than 0.1% (0–0.075%) PNH-type granulocytes in 21 patients (Group A) and more than 0.1% (0.101–36%) PNH-type granulocytes in 31 patients (Group B). In three (14%) patients of Group A, PNH-type granulocytes became undetectable 2.9, 1.3 and 1.6 years after the initial examination. 0.007 % granulocytes became detectable 2.5 years after the first examination which produced a negative result in one patient. Among the other 17 (81%) patients of Group A, proportions of PNH-type granulocytes remained stable at 0.03–0.41% over 3–6 years. By contrast, 5 (16%) patients of Group B showed an apparent increase in the proportion of PNH-type cells (from 1.46%, 1.63%, 3.31%, 23%, and 36% to 79%, 21%, 83%, 55%, and 78%, respectively) 2 to 4 years after the initial examination. Four of the five developed clinical signs of hemolysis. The proportion of PNH-type cells in Group B patients remained stable in 33 (63%) patients and declined in 12 (23%) patients. When we sorted a small (0.04%) population of PNH-type granulocytes from a patients of Group A and analyzed PIG-A gene, only one point mutation at position 479, C to T was revealed in the exon 2. The finding that the proportion of PNH-type cells remained stable over 3 years in most Group A patients suggests that very low proportions of PNH-type cells are derived from primitive hematopoietic stem cell clones with PIG-A mutation. Among AA patients displaying small populations of PNH-type cells, only those whose proportion of PNH-type cells are more than 1% may be at a high risk of developing hemolytic PNH.
Modeling of genomic profiles from the Cancer Genome Atlas (TCGA) by using recently developed math... more Modeling of genomic profiles from the Cancer Genome Atlas (TCGA) by using recently developed mathematical frameworks has associated a genome-wide pattern of DNA copy-number alterations with a shorter, roughly one-year, median survival time in glioblastoma (GBM) patients. Here, to experimentally test this relationship, we whole-genome sequenced DNA from tumor samples of patients. We show that the patients represent the U.S. adult GBM population in terms of most normal and disease phenotypes. Intratumor heterogeneity affects ≈11% and profiling technology and reference human genome specifics affect <1% of the classifications of the tumors by the pattern, where experimental batch effects normally reduce the reproducibility, i.e., precision, of classifications based upon between one to a few hundred genomic loci by >30%. With a 2.25-year Kaplan–Meier median survival difference, a 3.5 univariate Cox hazard ratio, and a 0.78 concordance index, i.e., accuracy, the pattern predicts sur...
High altitude is accompanied by hypoxia. Acute and chronic hypoxia induces a number of compensato... more High altitude is accompanied by hypoxia. Acute and chronic hypoxia induces a number of compensatory physiological responses mediated by hypoxia-inducible factors (HIFs) that regulate erythropoiesis, iron and energy metabolism, and other essential organismal responses. Excessive HIF responses occurring at high altitude may be accompanied by morbidity (polycythemia and pulmonary hypertension) or mortality (brain and pulmonary edema). HIFs are down regulated by two principal factors, i.e. prolyl hydroxylases (PHDs) and von Hippel Lindau proteins (VHL). Tibetans have lived at 3,000-5,000 meters for approximately 20,000 years and have acquired a number of beneficial genetic adaptations which appear to prevent negative responses to hypoxia at high-altitude. Deciphering these genetic changes is crucial to improve our understanding of the underlying hypoxia-mediated response mechanisms and to develop targeted therapies. We recently identified the first Tibetan-specific mutation, PHD2D4E, caused by a missense mutation (rs186996510) in EGLN1. PHD2D4E has an allelic frequency of ~85% in Tibetans and a low Km for oxygen, accounting for the protection of Tibetans from high-altitude polycythemia. Other effects of PHD2D4E on HIF-regulated pathophysiology remain to be delineated. A 77% GC-rich area surrounds rs186996510, resulting in a low success rate of detecting the mutation by Sanger sequencing or next-generation sequencing. PHD2D4E was unreported in published whole-genome analyses of Tibetans (Xin Yi et. al. Science 2010). Here we describe a high-resolution melting assay of a small PCR product for targeted genotyping of rs186996510. The single base-pair change (G to C) is visualized by melting small amplicons in the presence of a fluorescent DNA-binding dye. Heterozygotes are differentiated from homozygous genotypes by a pronounced change in the shape of the melting curve caused by the formation of heteroduplexes. However, wild type and homozygous variants are difficult to distinguish by melting alone, and require an additional step of a second melting analysis after mixing with known wild type DNA. Upon melting these mixtures, homozygotes appear as heterozygous melting curves, while wild type genotypes will remain wild type (Figure 1). We developed and validated a high resolution melting assay for rapid genotyping of PHD2D4E suitable for population and disease association studies. In our ongoing analyses, we genotyped DNA from over 300 Tibetans residing at sea level, 1300 meters, 1730-2300 meters and 4320 meters, and are correlating the allelic frequency of PHD2D4E with hematocrit levels. The high resolution melting assay for genotyping PHD2D4E is a simple, accurate, rapid, and inexpensive approach to identify SNP-targeted mutations, especially suitable for a large number of samples such as needed for population studies, without the expense and time required for sequencing studies. Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Figure 1. High resolution melting analysis of rs186996510 using a 48-base a pair PCR product amplified with primers Forward 5Õ AACGCTCTCACGCCGCCATGGCCAATGA 3Õ and Reverse 5Õ GCCGGGCCCGCCGCT 3Õ. Rapid-cycle PCR amplification and melting analysis were performed in a LS32 real-time instrument. Amplicons from homozygous, heterozygous and wild-type genotypes, and a mixture of wild-type and homozygous products were melted in the presence of a saturating DNA dye (LCGreen). High resolution melting curves and derivative plot are shown. Heterozygotes, or mixed wild type and homozygous variant produce a large change in the shape of the melting curve (red) in comparison to wild-type and homozygous variant (black). Disclosures Wittwer: BioFire Diagnostics: Aspects of melting analysis Patents…
A 10-year-old girl with paroxysmal nocturnal hemoglobinuria (PNH) received an infusion of syngene... more A 10-year-old girl with paroxysmal nocturnal hemoglobinuria (PNH) received an infusion of syngeneic bone marrow without preparative marrow ablation or immunosuppression. Following transplant, the patient became asymptomatic in concordance with an increase in the percentage of peripheral blood cells with normal expression of glycosyl phosphatidylinositol-anchored proteins (GPI-AP). However, molecular analysis suggested engraftment of a relatively small number of donor stem cells and persistence of an abnormal stem cell with mutant PIG-A. During 17 months of observation, the percentage of cells with normal GPI-AP expression gradually decreased, while intravascular hemolysis progressively increased. Approximately 16.5 months post-AROXYSMAL NOCTURNAL hemoglobinuria (PNH) P is an acquired disease in which a somatic mutation involving a primitive hematopoietic stem cell occurs.' The gene that is mutated (PIG-A) is located on the X chromosome. PIG-A encodes a protein that is essential for the normal biosynthesis of the glycosyl phosphatidylinositol (GPI) moiety that serves as a membrane anchor for a functionally diverse group of cellular proteins.',? The primary clinical manifestations of PNH are intravascular hemolysis resulting in hemoglobinuria, thrombosis, and abnormal hematopoiesis, which results in pan~ytopenia.~ The natural history varies greatly among patients. Depending on the disease manifestations, therapeutic options include supportive care, glucocorticoids, and antic~agulation.~ With particularly severe disease (eg, bone marrow failure or recurrent, life-threatening thromboembolic events), marrow ablation followed by bone marrow transplantation from an HLA-matched sibling donor should be considered. In this case, the abnormal stem cells are destroyed by the conditioning regimen, and the marrow is repopulated with normal donor cells.' While this approach is potentially curative, the benefits must be weighed against the significant morbidity and mortality associated with allogeneic bone marrow transplantation. In the unusual circumstance in which the patient has a syngeneic twin, bone marrow transplantation is the most
Page 184. High-resolution melting analysis for scanning and genotyping Virginie Dujols, Noriko Ku... more Page 184. High-resolution melting analysis for scanning and genotyping Virginie Dujols, Noriko Kusukawa, Jason T. McKinney, Steven F. Dobrowolsky and Carl T. Wittwer 9.1 Introduction Ever since the introduction of the LightCycler ...
Many others have contributed to the research culminating in this dissertation. Nancy Walsh, Chris... more Many others have contributed to the research culminating in this dissertation. Nancy Walsh, Chris Young, and Brenda Fekete have been little praised but highly deserving laboratory technicians. Terry Lofthouse, Ron Cook and Bob Wood taught me Fourier transform nmr operation. Allen K. Smith assisted in the development of the pantothenate assay for enzyme activity. Jack Brown helped in the initial planning and beginning synthesis of the pantetheine analogs. Dave Burkhard's assistance in enzyme preparation allowed me to complete its purification. Randy Rasmussen was responsible for much of the carbohydrate analysis. Finally, Kirk Ririe was very helpful in the final synthesis and characterization of the pantetheine analogs.
The use of general descriptive names, registered names, trademarks, etc. in this publication does... more The use of general descriptive names, registered names, trademarks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. Product liability: The publisher cannot guarantee the accuracy of any information about dosage and application thereof contained in this book. In every individual case the user must check such information by consulting the relevant literature.
Genotyping by high-resolution melting analysis of small amplicons is homogeneous and simple. Howe... more Genotyping by high-resolution melting analysis of small amplicons is homogeneous and simple. However, this approach can be limited by physical and chemical components of the system that contribute to intersample melting variation.
Differential amplification of variant and wild-type alleles by PCR is often used for rare allele ... more Differential amplification of variant and wild-type alleles by PCR is often used for rare allele enrichment. We have combined allele-specific PCR, competitive probe blocking, asymmetric PCR, and melting analysis to enhance rare allele detection in a homogeneous system. Unlabeled, dual hybridization or molecular beacon probes were used for competitive blocking of the wild-type allele at a concentration 10 times that of the allele-specific primer. In each case, rare alleles were detected by probe melting analysis at a sensitivity of >0.001% (1 variant copy within 100,000 wildtype copies), providing single copy detection in typical PCRs. Ninety-one thyroid biopsies were tested for the BRAF mutation p.V600E (c.1799 T>A) by both dual hybridization probes without enrichment and an allele-specific, competitive blocking melting analysis with unlabeled probes. Eighty-seven samples were concordant between methods (43 positive, 44 negative), while 4 samples that were negative by direct analysis became positive after enrichment. Probes that both block wild-type amplification and detect rare variants by melting analysis improve the detection sensitivity of allele-specific PCR for rare alleles. In particular, melting analysis using unlabeled probes and amplification by rapid-cycle PCR provides cost-effective and fast enrichment and detection of rare alleles.
This chapter talks about the fundamentals of real-time PCR and melting analysis. It draws an anal... more This chapter talks about the fundamentals of real-time PCR and melting analysis. It draws an analogy between bacterial growth and PCR and then considers the kinetic requirements of PCR. It provides an overview of real-time instrumentation and fluorescent indicators. It considers methods for detection, quantification, and melting analysis, including high-resolution melting analysis. Real-time PCR with melting analysis can integrate the detection, quantification, and analysis of microbes in one rapid assay. In real-time PCR and melting analysis, fluorescence acquisition may extend the time required in instruments with high noise and/or low fluorescence sensitivity. All real-time PCR instruments monitor sample fluorescence during thermal cycling and are available from many manufacturers. A wide variety of different instruments, dyes, and probe designs are available for real-time PCR. The chapter discusses some of the methods commonly used for detection, quantification, and melting analysis. It also focuses on melting-curve analysis. Inspection of continuous plots during real-time PCR suggests that hybridization information can be extracted during temperature cycling when dyes or hybridization probes are used. Continued improvements in speed, integration of high-resolution melting analysis, and adoption of simple hybridization probe techniques like unlabeled probe and snapback primers will expand the reach of this powerful technique in the coming years.
Retrospective DNA-content analysis was performed by flow cytometry on formalin-fixed, paraffin-em... more Retrospective DNA-content analysis was performed by flow cytometry on formalin-fixed, paraffin-embedded tissue from 36 patients with histiocytosis X (Langerhans cell histiocytosis). Included were 17 patients with solitary bone lesions, 4 patients with multiple bone lesions, 2 patients with solitary extraosseous lesions, 1 patient with congenital self-healing histiocytosis, and 12 patients with disseminated disease. The diagnosis was in each case verified by review of the clinical history and histopathologic material. None of the cases displayed significant cytologic atypia. DNA content analysis failed to reveal additional G0-G1 peaks or "shoulders" suggestive of aneuploid subpopulations in any case. Full-peak coefficients of variation ranged from 3.8 to 8.0. Our data suggest that despite a prior report of a single aneuploid case of histiocytosis X, DNA content analysis may not be useful in predicting clinical stage and outcome in this disease.
Neonatal hemochromatosis is an uncommon disorder, clinicopathologically defined by severe and gen... more Neonatal hemochromatosis is an uncommon disorder, clinicopathologically defined by severe and generally fatal liver disease of intrauterine onset associated with extrahepatic siderosis that spares reticuloendothelial elements (hemochromatotic siderosis). The agent or agents of liver disease in neonatal hemochromatosis are not known. It also is not known if intrauterine liver disease of defined infective etiology can lead to hemochromatotic siderosis. We present two patients with fetal liver disease and hemochromatotic siderosis whose cases help address these points. In the first patient rare hepatobiliary and numerous renal tubular cytomegalovirus (CMV) inclusions were found; CMV infection was confirmed by the polymerase chain reaction. Studies of the mother of the second patient 1, 5, and 9 weeks post-partum showed recent seroconversion against CMV; seroconversion against other infectious agents (toxoplasma, rubella, herpes, parvovirus B19, hepatitis A/B/C) was not present. Histologic, immunohistochemical, in situ hybridization, or polymerase chain reaction evidence of CMV infection was not present in infant tissues, even though peripartum maternal seroconversion against CMV was observed. We conclude that hemochromatotic siderosis may accompany chronic fetal liver disease of defined infective etiology (patient no. 1) and that recent maternal seroconversion against CMV in the presence of severe fetal liver disease does not necessarily mean that transplacentally acquired CMV infection caused the fetal liver disease (patient no. 2). Polymerase chain reaction documentation of infective-agent genomic sequences in fetal or infant tissues permits more accurate interpretation of maternal serologic data.
American Journal of Clinical Pathology, Sep 1, 2005
High-resolution melting analysis (HRMA) was compared with denaturing high-performance liquid chro... more High-resolution melting analysis (HRMA) was compared with denaturing high-performance liquid chromatography (dHPLC) for mutation scanning of common mutations in the cystic fibrosis transmembrane conductance regulator gene. We amplified (polymerase chain reaction under conditions optimized for melting analysis or dHPLC) 26 previously genotyped samples with mutations in exons 3
Uploads
Papers by Carl Wittwer